Science.gov

Sample records for 18s small-subunit ribosomal

  1. Phylogeny and systematics of demospongiae in light of new small-subunit ribosomal DNA (18S) sequences.

    PubMed

    Redmond, N E; Morrow, C C; Thacker, R W; Diaz, M C; Boury-Esnault, N; Cárdenas, P; Hajdu, E; Lôbo-Hajdu, G; Picton, B E; Pomponi, S A; Kayal, E; Collins, A G

    2013-09-01

    The most diverse and species-rich class of the phylum Porifera is Demospongiae. In recent years, the systematics of this clade, which contains more than 7000 species, has developed rapidly in light of new studies combining molecular and morphological observations. We add more than 500 new, nearly complete 18S sequences (an increase of more than 200%) in an attempt to further enhance understanding of the phylogeny of Demospongiae. Our study specifically targets representation of type species and genera that have never been sampled for any molecular data in an effort to accelerate progress in classifying this diverse lineage. Our analyses recover four highly supported subclasses of Demospongiae: Keratosa, Myxospongiae, Haploscleromorpha, and Heteroscleromorpha. Within Keratosa, neither Dendroceratida, nor its two families, Darwinellidae and Dictyodendrillidae, are monophyletic and Dictyoceratida is divided into two lineages, one predominantly composed of Dysideidae and the second containing the remaining families (Irciniidae, Spongiidae, Thorectidae, and Verticillitidae). Within Myxospongiae, we find Chondrosida to be paraphyletic with respect to the Verongida. We amend the latter to include species of the genus Chondrosia and erect a new order Chondrillida to contain remaining taxa from Chondrosida, which we now discard. Even with increased taxon sampling of Haploscleromorpha, our analyses are consistent with previous studies; however, Haliclona species are interspersed in even more clades. Haploscleromorpha contains five highly supported clades, each more diverse than previously recognized, and current families are mostly polyphyletic. In addition, we reassign Janulum spinispiculum to Haploscleromorpha and resurrect Reniera filholi as Janulum filholi comb. nov. Within the large clade Heteroscleromorpha, we confirmed 12 recently identified clades based on alternative data, as well as a sister-group relationship between the freshwater Spongillida and the family

  2. Assessing the odd secondary structural properties of nuclear small subunit ribosomal RNA sequences (18S) of the twisted-wing parasites (Insecta: Strepsiptera).

    PubMed

    Gillespie, J J; McKenna, C H; Yoder, M J; Gutell, R R; Johnston, J S; Kathirithamby, J; Cognato, A I

    2005-12-01

    We report the entire sequence (2864 nts) and secondary structure of the nuclear small subunit ribosomal RNA (SSU rRNA) gene (18S) from the twisted-wing parasite Caenocholax fenyesi texensis Kathirithamby & Johnston (Strepsiptera: Myrmecolacidae). The majority of the base pairings in this structural model map on to the SSU rRNA secondary and tertiary helices that were previously predicted with comparative analysis. These regions of the core rRNA were unambiguously aligned across all Arthropoda. In contrast, many of the variable regions, as previously characterized in other insect taxa, had very large insertions in C. f. texensis. The helical base pairs in these regions were predicted with a comparative analysis of a multiple sequence alignment (that contains C. f. texensis and 174 published arthropod 18S rRNA sequences, including eleven strepsipterans) and thermodynamic-based algorithms. Analysis of our structural alignment revealed four unusual insertions in the core rRNA structure that are unique to animal 18S rRNA and in general agreement with previously proposed insertion sites for strepsipterans. One curious result is the presence of a large insertion within a hairpin loop of a highly conserved pseudoknot helix in variable region 4. Despite the extraordinary variability in sequence length and composition, this insertion contains the conserved sequences 5'-AUUGGCUUAAA-3' and 5'-GAC-3' that immediately flank a putative helix at the 5'- and 3'-ends, respectively. The longer sequence has the potential to form a nine base pair helix with a sequence in the variable region 2, consistent with a recent study proposing this tertiary interaction. Our analysis of a larger set of arthropod 18S rRNA sequences has revealed possible errors in some of the previously published strepsipteran 18S rRNA sequences. Thus we find no support for the previously recovered heterogeneity in the 18S molecules of strepsipterans. Our findings lend insight to the evolution of RNA structure and

  3. Prevalence, Genetic Characterization, and 18S Small Subunit Ribosomal RNA Diversity of Trypanosoma rangeli in Triatomine and Mammal Hosts in Endemic Areas for Chagas Disease in Ecuador.

    PubMed

    Ocaña-Mayorga, Sofia; Aguirre-Villacis, Fernanda; Pinto, C Miguel; Vallejo, Gustavo A; Grijalva, Mario J

    2015-12-01

    Trypanosoma rangeli is a nonpathogenic parasite for humans; however, its medical importance relies in its similarity and overlapping distribution with Trypanosoma cruzi, causal agent of Chagas disease in the Americas. The genetic diversity of T. rangeli and its association with host species (triatomines and mammals) has been identified along Central and the South America; however, it has not included data of isolates from Ecuador. This study reports infection with T. rangeli in 18 genera of mammal hosts and five species of triatomines in three environments (domestic, peridomestic, and sylvatic). Higher infection rates were found in the sylvatic environment, in close association with Rhodnius ecuadoriensis. The results of this study extend the range of hosts infected with this parasite and the geographic range of the T. rangeli genotype KP1(-)/lineage C in South America. It was not possible to detect variation on T. rangeli from the central coastal region and southern Ecuador with the analysis of the small subunit ribosomal RNA (SSU-rRNA) gene, even though these areas are ecologically different and a phenotypic subdivision of R. ecuadoriensis has been found. R. ecuadoriensis is considered one of the most important vectors for Chagas disease transmission in Ecuador due to its wide distribution and adaptability to diverse environments. An extensive knowledge of the trypanosomes circulating in this species of triatomine, and associated mammal hosts, is important for delineating transmission dynamics and preventive measures in the endemic areas of Ecuador and Northern Peru. PMID:26645579

  4. Morphology and Small-Subunit Ribosomal DNA Sequence of Henneguya Adiposa (Myxosporea) From Ictalurus punctatus (Siluriformes)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The original description of Henneguya adiposa, a myxozoan parasitizing channel catfish Ictalurus punctatus, is supplemented with new data on spore morphology, including photomicrographs and line drawings, as well as 18S small-subunit (SSU) ribosomal DNA (rDNA) sequence. Elongate, translucent, linear...

  5. Ribosomal small subunit domains radiate from a central core.

    PubMed

    Gulen, Burak; Petrov, Anton S; Okafor, C Denise; Vander Wood, Drew; O'Neill, Eric B; Hud, Nicholas V; Williams, Loren Dean

    2016-01-01

    The domain architecture of a large RNA can help explain and/or predict folding, function, biogenesis and evolution. We offer a formal and general definition of an RNA domain and use that definition to experimentally characterize the rRNA of the ribosomal small subunit. Here the rRNA comprising a domain is compact, with a self-contained system of molecular interactions. A given rRNA helix or stem-loop must be allocated uniquely to a single domain. Local changes such as mutations can give domain-wide effects. Helices within a domain have interdependent orientations, stabilities and interactions. With these criteria we identify a core domain (domain A) of small subunit rRNA. Domain A acts as a hub, linking the four peripheral domains and imposing orientational and positional restraints on the other domains. Experimental characterization of isolated domain A, and mutations and truncations of it, by methods including selective 2'OH acylation analyzed by primer extension and circular dichroism spectroscopy are consistent with our architectural model. The results support the utility of the concept of an RNA domain. Domain A, which exhibits structural similarity to tRNA, appears to be an essential core of the small ribosomal subunit. PMID:26876483

  6. Ribosomal small subunit domains radiate from a central core

    NASA Astrophysics Data System (ADS)

    Gulen, Burak; Petrov, Anton S.; Okafor, C. Denise; Vander Wood, Drew; O'Neill, Eric B.; Hud, Nicholas V.; Williams, Loren Dean

    2016-02-01

    The domain architecture of a large RNA can help explain and/or predict folding, function, biogenesis and evolution. We offer a formal and general definition of an RNA domain and use that definition to experimentally characterize the rRNA of the ribosomal small subunit. Here the rRNA comprising a domain is compact, with a self-contained system of molecular interactions. A given rRNA helix or stem-loop must be allocated uniquely to a single domain. Local changes such as mutations can give domain-wide effects. Helices within a domain have interdependent orientations, stabilities and interactions. With these criteria we identify a core domain (domain A) of small subunit rRNA. Domain A acts as a hub, linking the four peripheral domains and imposing orientational and positional restraints on the other domains. Experimental characterization of isolated domain A, and mutations and truncations of it, by methods including selective 2‧OH acylation analyzed by primer extension and circular dichroism spectroscopy are consistent with our architectural model. The results support the utility of the concept of an RNA domain. Domain A, which exhibits structural similarity to tRNA, appears to be an essential core of the small ribosomal subunit.

  7. Ribosomal small subunit domains radiate from a central core

    PubMed Central

    Gulen, Burak; Petrov, Anton S.; Okafor, C. Denise; Vander Wood, Drew; O’Neill, Eric B.; Hud, Nicholas V.; Williams, Loren Dean

    2016-01-01

    The domain architecture of a large RNA can help explain and/or predict folding, function, biogenesis and evolution. We offer a formal and general definition of an RNA domain and use that definition to experimentally characterize the rRNA of the ribosomal small subunit. Here the rRNA comprising a domain is compact, with a self-contained system of molecular interactions. A given rRNA helix or stem-loop must be allocated uniquely to a single domain. Local changes such as mutations can give domain-wide effects. Helices within a domain have interdependent orientations, stabilities and interactions. With these criteria we identify a core domain (domain A) of small subunit rRNA. Domain A acts as a hub, linking the four peripheral domains and imposing orientational and positional restraints on the other domains. Experimental characterization of isolated domain A, and mutations and truncations of it, by methods including selective 2′OH acylation analyzed by primer extension and circular dichroism spectroscopy are consistent with our architectural model. The results support the utility of the concept of an RNA domain. Domain A, which exhibits structural similarity to tRNA, appears to be an essential core of the small ribosomal subunit. PMID:26876483

  8. Megraft: A software package to graft ribosomal small subunit (16S/18S) fragments onto full-length sequences for accurate species richness and sequencing depth analysis in pyrosequencing-length metagenomes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Metagenomic libraries represent subsamples of the total DNA found at a study site and offer unprecedented opportunities to study ecological and functional aspects of microbial communities. To examine the depth of the sequencing effort, rarefaction analysis of the ribosomal small sub-unit (SSU/16S/18...

  9. Substitution rate calibration of small subunit ribosomal RNA identifies chlorarachniophyte endosymbionts as remnants of green algae.

    PubMed Central

    Van de Peer, Y; Rensing, S A; Maier, U G; De Wachter, R

    1996-01-01

    Chlorarachniophytes are amoeboid algae with chlorophyll a and b containing plastids that are surrounded by four membranes instead of two as in plants and green algae. These extra membranes form important support for the hypothesis that chlorarachniophytes have acquired their plastids by the ingestion of another eukaryotic plastid-containing alga. Chlorarachniophytes also contain a small nucleus-like structure called the nucleomorph situated between the two inner and the two outer membranes surrounding the plastid. This nucleomorph is a remnant of the endosymbiont's nucleus and encodes, among other molecules, small subunit ribosomal RNA. Previous phylogenetic analyses on the basis of this molecule provided unexpected and contradictory evidence for the origin of the chlorarachniophyte endosymbiont. We developed a new method for measuring the substitution rates of the individual nucleotides of small subunit ribosomal RNA. From the resulting substitution rate distribution, we derived an equation that gives a more realistic relationship between sequence dissimilarity and evolutionary distance than equations previously available. Phylogenetic trees constructed on the basis of evolutionary distances computed by this new method clearly situate the chlorarachniophyte nucleomorphs among the green algae. Moreover, this relationship is confirmed by transversion analysis of the Chlorarachnion plastid small subunit ribosomal RNA. PMID:8755544

  10. Mammalian mitochondrial ribosomal small subunit (MRPS) genes: A putative role in human disease.

    PubMed

    Gopisetty, Gopal; Thangarajan, Rajkumar

    2016-09-01

    Mitochondria are prominently understood as power houses producing ATP the primary energy currency of the cell. However, mitochondria are also known to play an important role in apoptosis and autophagy, and mitochondrial dysregulation can lead to pathological outcomes. Mitochondria are known to contain 1500 proteins of which only 13 are coded by mitochondrial DNA and the rest are coded by nuclear genes. Protein synthesis in mitochondria involves mitochondrial ribosomes which are 55-60S particles and are composed of small 28S and large 39S subunits. A feature of mammalian mitoribosome which differentiate it from bacterial ribosomes is the increased protein content. The human mitochondrial ribosomal protein (MRP) gene family comprises of 30 genes which code for mitochondrial ribosomal small subunit and 50 genes for the large subunit. The present review focuses on the mitochondrial ribosomal small subunit genes (MRPS), presents an overview of the literature and data gleaned from publicly available gene and protein expression databases. The survey revealed aberrations in MRPS gene expression patterns in varied human diseases indicating a putative role in their etiology. PMID:27170550

  11. Phylogenetic position of Cryothecomonas inferred from nuclear-encoded small subunit ribosomal RNA.

    PubMed

    Kühn, S; Lange, M; Medlin, L K

    2000-12-01

    The systematic position of the genus Cryothecomonas has been determined from an analysis of the nuclear-encoded small subunit ribosomal RNA gene of Cryothecomonas longipes and two strains of Cryothecomonas aestivalis. Our phylogenetic trees inferred from maximum likelihood, distance and maximum parsimony methods robustly show that the genus Cryothecomonas clusters within the phylum Cercozoa, and is related to the sarcomonad flagellate Heteromita globosa. Morphological data supporting the taxonomic placement of Cryothecomonas near the sarcomonad flagellates has been compiled from the literature. The high number of nucleotide substitutions found between two morphologically indistinguishable strains of Cryothecomonas aestivalis suggests the possibility of cryptic species within Cryothecomonas aestivalis. PMID:11212894

  12. Prevalent Ciliate Symbiosis on Copepods: High Genetic Diversity and Wide Distribution Detected Using Small Subunit Ribosomal RNA Gene

    PubMed Central

    Guo, Zhiling; Liu, Sheng; Hu, Simin; Li, Tao; Huang, Yousong; Liu, Guangxing; Zhang, Huan; Lin, Senjie

    2012-01-01

    Toward understanding the genetic diversity and distribution of copepod-associated symbiotic ciliates and the evolutionary relationships with their hosts in the marine environment, we developed a small subunit ribosomal RNA gene (18S rDNA)-based molecular method and investigated the genetic diversity and genotype distribution of the symbiotic ciliates on copepods. Of the 10 copepod species representing six families collected from six locations of Pacific and Atlantic Oceans, 9 were found to harbor ciliate symbionts. Phylogenetic analysis of the 391 ciliate 18S rDNA sequences obtained revealed seven groups (ribogroups), six (containing 99% of all the sequences) belonging to subclass Apostomatida, the other clustered with peritrich ciliate Vorticella gracilis. Among the Apostomatida groups, Group III were essentially identical to Vampyrophrya pelagica, and the other five groups represented the undocumented ciliates that were close to Vampyrophrya/Gymnodinioides/Hyalophysa. Group VI ciliates were found in all copepod species but one (Calanus sinicus), and were most abundant among all ciliate sequences obtained, indicating that they are the dominant symbiotic ciliates universally associated with copepods. In contrast, some ciliate sequences were found only in some of the copepods examined, suggesting the host selectivity and geographic differentiation of ciliates, which requires further verification by more extensive sampling. Our results reveal the wide occurrence and high genetic diversity of symbiotic ciliates on marine copepods and highlight the need to systematically investigate the host- and geography-based genetic differentiation and ecological roles of these ciliates globally. PMID:23024768

  13. An overview of the secondary structure of the V4 region of eukaryotic small-subunit ribosomal RNA.

    PubMed Central

    Nickrent, D L; Sargent, M L

    1991-01-01

    The V4 region of the small subunit (18S) ribosomal RNA was examined in 72 different sequences representing a broad sample eukaryotic diversity. This domain is the most variable region of the 18S rRNA molecule and ranges in length from ca. 230 to over 500 bases. Based upon comparative analysis, secondary structural models were constructed for all sequences and the resulting generalized model shows that most organisms possess seven helices for this region. The protists and two insects show from one to as many as four helices in addition to the above seven. In this report, we summarize secondary structure information presented elsewhere for the V4 region, describe the general features for helical and apical regions, and identify signature sequences useful in helix identification. Our model generally agrees with other current concepts; however, we propose modifications or alternative structures for the start of the V4 region, the large protist inserts, and the sector that may possibly contain a pseudoknot. PMID:2014163

  14. Small-subunit ribosomal RNA gene sequences of Phaeodarea challenge the monophyly of Haeckel's Radiolaria.

    PubMed

    Polet, Stephane; Berney, Cédric; Fahrni, José; Pawlowski, Jan

    2004-03-01

    In his grand monograph of Radiolaria, Ernst Haeckel originally included Phaeodarea together with Acantharea and Polycystinea, all three taxa characterized by the presence of a central capsule and the possession of axopodia. Cytological and ultrastructural studies, however, questioned the monophyly of Radiolaria, suggesting an independent evolutionary origin of the three taxa, and the first molecular data on Acantharea and Polycystinea brought controversial results. To test further the monophyly of Radiolaria, we sequenced the complete small subunit ribosomal RNA gene of three phaeodarians and three polycystines. Our analyses reveal that phaeodarians clearly branch among the recently described phylum Cercozoa, separately from Acantharea and Polycystinea. This result enhances the morphological variability within the phylum Cercozoa, which already contains very heterogeneous groups of protists. Our study also confirms the common origin of Acantharea and Polycystinea, which form a sister-group to the Cercozoa, and allows a phylogenetic reinterpretation of the morphological features of the three radiolarian groups. PMID:15144058

  15. Phylogenetic relationships of the green alga Volvox carteri deduced from small-subunit ribosomal RNA comparisons.

    PubMed

    Rausch, H; Larsen, N; Schmitt, R

    1989-09-01

    The 1788-nucleotide sequence of the small-subunit ribosomal RNA (srRNA) coding region from the chlorophyte Volvox carteri was determined. The secondary structure bears features typical of the universal model of srRNA, including about 40 helices and a division into four domains. Phylogenetic relationships to 17 other eukaryotes, including two other chlorophytes, were explored by comparing srRNA sequences. Similarity values and the inspection of phylogenetic trees derived by distance matrix methods revealed a close relationship between V. carteri and Chlamydomonas reinhardtii. The results are consistent with the view that these Volvocales, and the third green alga, Nanochlorum eucaryotum, are more closely related to higher plants than to any other major eukaryotic group, but constitute a distinct lineage that has long been separated from the line leading to the higher plants. PMID:2506359

  16. Stage-specific assembly events of the 6-MDa small-subunit processome initiate eukaryotic ribosome biogenesis.

    PubMed

    Chaker-Margot, Malik; Hunziker, Mirjam; Barandun, Jonas; Dill, Brian D; Klinge, Sebastian

    2015-11-01

    Eukaryotic ribosome biogenesis involves a plethora of ribosome-assembly factors, and their temporal order of association with preribosomal RNA is largely unknown. By using Saccharomyces cerevisiae as a model organism, we developed a system that recapitulates and arrests ribosome assembly at early stages, thus providing in vivo snapshots of nascent preribosomal particles. Here we report the stage-specific order in which 70 ribosome-assembly factors associate with preribosomal RNA domains, thereby forming the 6-MDa small-subunit processome. PMID:26479197

  17. Recognition of chimeric small-subunit ribosomal DNAs composed of genes from uncultivated microorganisms

    NASA Technical Reports Server (NTRS)

    Kopczynski, E. D.; Bateson, M. M.; Ward, D. M.

    1994-01-01

    When PCR was used to recover small-subunit (SSU) rRNA genes from a hot spring cyanobacterial mat community, chimeric SSU rRNA sequences which exhibited little or no secondary structural abnormality were recovered. They were revealed as chimeras of SSU rRNA genes of uncultivated species through separate phylogenetic analysis of short sequence domains.

  18. Late-assembly of human ribosomal protein S20 in the cytoplasm is essential for the functioning of the small subunit ribosome

    SciTech Connect

    Tai, Lin-Ru; Chou, Chang-Wei; Wu, Jing-Ying; Kirby, Ralph; Lin, Alan

    2013-11-15

    Using immuno-fluorescent probing and Western blotting analysis, we reveal the exclusive cytoplasm nature of the small subunit ribosomal protein S20. To illustrate the importance of the cellular compartmentation of S20 to the function of small subunit 40S, we created a nuclear resident S20{sub NLS} mutant gene and examined polysome profile of cells that had been transfected with the S20{sub NLS} gene. As a result, we observed the formation of recombinant 40S carried S20{sub NLS} but this recombinant 40S was never found in the polysome, suggesting such a recombinant 40S was translation incompetent. Moreover, by the tactic of the energy depletion and restoration, we were able to restrain the nuclear-resided S20{sub NLS} in the cytoplasm. Yet, along a progressive energy restoration, we observed the presence of recombinant 40S subunits carrying the S20{sub NLS} in the polysome. This proves that S20 needs to be cytoplasmic in order to make a functional 40S subunit. Furthermore, it also implies that the assembly order of ribosomal protein in eukaryote is orderly regulated. - Highlights: • The step of S20 assembled on 40S is happened in the cytoplasm. • A small subunit assembled with a nuclear S20{sub NLS} is translational incompetence. • Using energy depletion and recovery to manipulate the cellular compartment of S20{sub NLS}. • Cytoplasm-retained S20{sub NLS} is crucial for creating a functional small subunit.

  19. Proteomic analysis of the mammalian mitochondrial ribosome. Identification of protein components in the 28 S small subunit.

    PubMed

    Suzuki, T; Terasaki, M; Takemoto-Hori, C; Hanada, T; Ueda, T; Wada, A; Watanabe, K

    2001-08-31

    The mammalian mitochondrial ribosome (mitoribosome) has a highly protein-rich composition with a small sedimentation coefficient of 55 S, consisting of 39 S large and 28 S small subunits. In the previous study, we analyzed 39 S large subunit proteins from bovine mitoribosome (Suzuki, T., Terasaki, M., Takemoto-Hori, C., Hanada, T., Ueda, T., Wada, A., and Watanabe, K. (2001) J. Biol. Chem. 276, 21724-21736). The results suggested structural compensation for the rRNA deficit through proteins of increased molecular mass in the mitoribosome. We report here the identification of 28 S small subunit proteins. Each protein was separated by radical-free high-reducing two-dimensional polyacrylamide gel electrophoresis and analyzed by liquid chromatography/mass spectrometry/mass spectrometry using electrospray ionization/ion trap mass spectrometer to identify cDNA sequence by expressed sequence tag data base searches in silico. Twenty one proteins from the small subunit were identified, including 11 new proteins along with their complete cDNA sequences from human and mouse. In addition to these proteins, three new proteins were also identified in the 55 S mitoribosome. We have clearly identified a mitochondrial homologue of S12, which is a key regulatory protein of translation fidelity and a candidate for the autosomal dominant deafness gene, DFNA4. The apoptosis-related protein DAP3 was found to be a component of the small subunit, indicating a new function for the mitoribosome in programmed cell death. In summary, we have mapped a total of 55 proteins from the 55 S mitoribosome on the two-dimensional polyacrylamide gels. PMID:11402041

  20. Systematics of Chaetognatha under the light of molecular data, using duplicated ribosomal 18S DNA sequences.

    PubMed

    Papillon, Daniel; Perez, Yvan; Caubit, Xavier; Le Parco, Yannick

    2006-03-01

    While the phylogenetic position of Chaetognatha has became central to the question of early bilaterian evolution, the internal systematics of the phylum are still not clear. The phylogenetic relationships of the chaetognaths were investigated using newly obtained small subunit ribosomal RNA nuclear 18S (SSU rRNA) sequences from 16 species together with 3 sequences available in GenBank. As previously shown with the large subunit ribosomal RNA 28S gene, two classes of Chaetognatha SSU rRNA gene can be identified, suggesting a duplication of the whole ribosomal cluster; allowing the rooting of one class of genes by another in phylogenetic analyses. Maximum Parsimony, Maximum Likelihood and Bayesian analyses of the molecular data, and statistical tests showed (1) that there are three main monophyletic groups: Sagittidae/Krohnittidae, Spadellidae/Pterosagittidae, and Eukrohniidae/Heterokrohniidae, (2) that the group of Aphragmophora without Pterosagittidae (Sagittidae/Krohnittidae) is monophyletic, (3) the Spadellidae/Pterosagittidae and Eukrohniidae/Heterokrohniidae families are very likely clustered, (4) the Krohnittidae and Pterosagittidae groups should no longer be considered as families as they are included in other groups designated as families, (5) suborder Ctenodontina is not monophyletic and the Flabellodontina should no longer be considered as a suborder, and (6) the Syngonata/Chorismogonata and the Monophragmophora/Biphragmophora hypotheses are rejected. Such conclusions are considered in the light of morphological characters, several of which are shown to be prone to homoplasy. PMID:16434216

  1. Phylogenetic position of the genus Perkinsus (Protista, Apicomplexa) based on small subunit ribosomal RNA.

    PubMed

    Goggin, C L; Barker, S C

    1993-07-01

    Parasites of the genus Perkinsus destroy marine molluscs worldwide. Their phylogenetic position within the kingdom Protista is controversial. Nucleotide sequence data (1792 bp) from the small subunit rRNA gene of Perkinsus sp. from Anadara trapezia (Mollusca: Bivalvia) from Moreton Bay, Queensland, was used to examine the phylogenetic affinities of this enigmatic genus. These data were aligned with nucleotide sequences from 6 apicomplexans, 3 ciliates, 3 flagellates, a dinoflagellate, 3 fungi, maize and human. Phylogenetic trees were constructed after analysis with maximum parsimony and distance matrix methods. Our analyses indicate that Perkinsus is phylogenetically closer to dinoflagellates and to coccidean and piroplasm apicomplexans than to fungi or flagellates. PMID:8366895

  2. Eukaryote-specific extensions in ribosomal proteins of the small subunit: Structure and function.

    PubMed

    Ghosh, Arnab; Komar, Anton A

    2015-01-01

    High-resolution structures of yeast ribosomes have improved our understanding of the architecture and organization of eukaryotic rRNA and proteins, as well as eukaryote-specific extensions present in some conserved ribosomal proteins. Despite this progress, assignment of specific functions to individual proteins and/or eukaryote-specific protein extensions remains challenging. It has been suggested that eukaryote-specific extensions of conserved proteins from the small ribosomal subunit may facilitate eukaryote-specific reactions in the initiation phase of protein synthesis. This review summarizes emerging data describing the structural and functional significance of eukaryote-specific extensions of conserved small ribosomal subunit proteins, particularly their possible roles in recruitment and spatial organization of eukaryote-specific initiation factors. PMID:26779416

  3. Cryo-EM structure of the small subunit of the mammalian mitochondrial ribosome.

    PubMed

    Kaushal, Prem S; Sharma, Manjuli R; Booth, Timothy M; Haque, Emdadul M; Tung, Chang-Shung; Sanbonmatsu, Karissa Y; Spremulli, Linda L; Agrawal, Rajendra K

    2014-05-20

    The mammalian mitochondrial ribosomes (mitoribosomes) are responsible for synthesizing 13 membrane proteins that form essential components of the complexes involved in oxidative phosphorylation or ATP generation for the eukaryotic cell. The mammalian 55S mitoribosome contains significantly smaller rRNAs and a large mass of mitochondrial ribosomal proteins (MRPs), including large mito-specific amino acid extensions and insertions in MRPs that are homologous to bacterial ribosomal proteins and an additional 35 mito-specific MRPs. Here we present the cryo-EM structure analysis of the small (28S) subunit (SSU) of the 55S mitoribosome. We find that the mito-specific extensions in homologous MRPs generally are involved in inter-MRP contacts and in contacts with mito-specific MRPs, suggesting a stepwise evolution of the current architecture of the mitoribosome. Although most of the mito-specific MRPs and extensions of homologous MRPs are situated on the peripheral regions, they also contribute significantly to the formation of linings of the mRNA and tRNA paths, suggesting a tailor-made structural organization of the mito-SSU for the recruitment of mito-specific mRNAs, most of which do not possess a 5' leader sequence. In addition, docking of previously published coordinates of the large (39S) subunit (LSU) into the cryo-EM map of the 55S mitoribosome reveals that mito-specific MRPs of both the SSU and LSU are involved directly in the formation of six of the 15 intersubunit bridges. PMID:24799711

  4. Cryo-EM structure of the small subunit of the mammalian mitochondrial ribosome

    PubMed Central

    Kaushal, Prem S.; Sharma, Manjuli R.; Booth, Timothy M.; Haque, Emdadul M.; Tung, Chang-Shung; Sanbonmatsu, Karissa Y.; Spremulli, Linda L.; Agrawal, Rajendra K.

    2014-01-01

    The mammalian mitochondrial ribosomes (mitoribosomes) are responsible for synthesizing 13 membrane proteins that form essential components of the complexes involved in oxidative phosphorylation or ATP generation for the eukaryotic cell. The mammalian 55S mitoribosome contains significantly smaller rRNAs and a large mass of mitochondrial ribosomal proteins (MRPs), including large mito-specific amino acid extensions and insertions in MRPs that are homologous to bacterial ribosomal proteins and an additional 35 mito-specific MRPs. Here we present the cryo-EM structure analysis of the small (28S) subunit (SSU) of the 55S mitoribosome. We find that the mito-specific extensions in homologous MRPs generally are involved in inter-MRP contacts and in contacts with mito-specific MRPs, suggesting a stepwise evolution of the current architecture of the mitoribosome. Although most of the mito-specific MRPs and extensions of homologous MRPs are situated on the peripheral regions, they also contribute significantly to the formation of linings of the mRNA and tRNA paths, suggesting a tailor-made structural organization of the mito-SSU for the recruitment of mito-specific mRNAs, most of which do not possess a 5′ leader sequence. In addition, docking of previously published coordinates of the large (39S) subunit (LSU) into the cryo-EM map of the 55S mitoribosome reveals that mito-specific MRPs of both the SSU and LSU are involved directly in the formation of six of the 15 intersubunit bridges. PMID:24799711

  5. One step engineering of the small-subunit ribosomal RNA using CRISPR/Cas9.

    PubMed

    Kannan, Krishna; Tsvetanova, Billyana; Chuang, Ray-Yuan; Noskov, Vladimir N; Assad-Garcia, Nacyra; Ma, Li; Hutchison Iii, Clyde A; Smith, Hamilton O; Glass, John I; Merryman, Chuck; Venter, J Craig; Gibson, Daniel G

    2016-01-01

    Bacteria are indispensable for the study of fundamental molecular biology processes due to their relatively simple gene and genome architecture. The ability to engineer bacterial chromosomes is quintessential for understanding gene functions. Here we demonstrate the engineering of the small-ribosomal subunit (16S) RNA of Mycoplasma mycoides, by combining the CRISPR/Cas9 system and the yeast recombination machinery. We cloned the entire genome of M. mycoides in yeast and used constitutively expressed Cas9 together with in vitro transcribed guide-RNAs to introduce engineered 16S rRNA genes. By testing the function of the engineered 16S rRNA genes through genome transplantation, we observed surprising resilience of this gene to addition of genetic elements or helix substitutions with phylogenetically-distant bacteria. While this system could be further used to study the function of the 16S rRNA, one could envision the "simple" M. mycoides genome being used in this setting to study other genetic structures and functions to answer fundamental questions of life. PMID:27489041

  6. One step engineering of the small-subunit ribosomal RNA using CRISPR/Cas9

    PubMed Central

    Kannan, Krishna; Tsvetanova, Billyana; Chuang, Ray-Yuan; Noskov, Vladimir N.; Assad-Garcia, Nacyra; Ma, Li; Hutchison III, Clyde A.; Smith, Hamilton O.; Glass, John I.; Merryman, Chuck; Venter, J. Craig; Gibson, Daniel G.

    2016-01-01

    Bacteria are indispensable for the study of fundamental molecular biology processes due to their relatively simple gene and genome architecture. The ability to engineer bacterial chromosomes is quintessential for understanding gene functions. Here we demonstrate the engineering of the small-ribosomal subunit (16S) RNA of Mycoplasma mycoides, by combining the CRISPR/Cas9 system and the yeast recombination machinery. We cloned the entire genome of M. mycoides in yeast and used constitutively expressed Cas9 together with in vitro transcribed guide-RNAs to introduce engineered 16S rRNA genes. By testing the function of the engineered 16S rRNA genes through genome transplantation, we observed surprising resilience of this gene to addition of genetic elements or helix substitutions with phylogenetically-distant bacteria. While this system could be further used to study the function of the 16S rRNA, one could envision the “simple” M. mycoides genome being used in this setting to study other genetic structures and functions to answer fundamental questions of life. PMID:27489041

  7. Phylogenetics of Bonamia parasites based on small subunit and internal transcribed spacer region ribosomal DNA sequence data.

    PubMed

    Hill, Kristina M; Stokes, Nancy A; Webb, Stephen C; Hine, P Mike; Kroeck, Marina A; Moore, James D; Morley, Margaret S; Reece, Kimberly S; Burreson, Eugene M; Carnegie, Ryan B

    2014-07-24

    The genus Bonamia (Haplosporidia) includes economically significant oyster parasites. Described species were thought to have fairly circumscribed host and geographic ranges: B. ostreae infecting Ostrea edulis in Europe and North America, B. exitiosa infecting O. chilensis in New Zealand, and B. roughleyi infecting Saccostrea glomerata in Australia. The discovery of B. exitiosa-like parasites in new locations and the observation of a novel species, B. perspora, in non-commercial O. stentina altered this perception and prompted our wider evaluation of the global diversity of Bonamia parasites. Samples of 13 oyster species from 21 locations were screened for Bonamia spp. by PCR, and small subunit and internal transcribed spacer regions of Bonamia sp. ribosomal DNA were sequenced from PCR-positive individuals. Infections were confirmed histologically. Phylogenetic analyses using parsimony and Bayesian methods revealed one species, B. exitiosa, to be widely distributed, infecting 7 oyster species from Australia, New Zealand, Argentina, eastern and western USA, and Tunisia. More limited host and geographic distributions of B. ostreae and B. perspora were confirmed, but nothing genetically identifiable as B. roughleyi was found in Australia or elsewhere. Newly discovered diversity included a Bonamia sp. in Dendostrea sandvicensis from Hawaii, USA, that is basal to the other Bonamia species and a Bonamia sp. in O. edulis from Tomales Bay, California, USA, that is closely related to both B. exitiosa and the previously observed Bonamia sp. from O. chilensis in Chile. PMID:25060496

  8. A definition of the domains Archaea, Bacteria and Eucarya in terms of small subunit ribosomal RNA characteristics

    NASA Technical Reports Server (NTRS)

    Winker, S.; Woese, C. R.

    1991-01-01

    The number of small subunit rRNA sequences is now great enough that the three domains Archaea, Bacteria and Eucarya (Woese et al., 1990) can be reliably defined in terms of their sequence "signatures". Approximately 50 homologous positions (or nucleotide pairs) in the small subunit rRNA characterize and distinguish among the three. In addition, the three can be recognized by a variety of nonhomologous rRNA characters, either individual positions and/or higher-order structural features. The Crenarchaeota and the Euryarchaeota, the two archaeal kingdoms, can also be defined and distinguished by their characteristic compositions at approximately fifteen positions in the small subunit rRNA molecule.

  9. Natural-abundance stable carbon isotopes of small-subunit ribosomal RNA (SSU rRNA) from Guaymas Basin (Mexico)

    NASA Astrophysics Data System (ADS)

    MacGregor, B. J.; Mendlovitz, H.; Albert, D.; Teske, A. P.

    2012-12-01

    Small-subunit ribosomal RNA (SSU rRNA) is a phylogenetically informative molecule found in all species. Because it is poorly preserved in most environments, it is a useful marker for active microbial populations. We are using the natural-abundance stable carbon isotopic composition of specific microbial groups to help identify the carbon substrates contributing to microbial biomass in a variety of marine environments. At Guaymas Basin, hydrothermal fluids interact with abundant sedimentary organic carbon to produce natural gas and petroleum. Where this reaches the sediment surface, it can support dense patches of seafloor life, including Beggiatoa mats. We report here on the stable carbon isotopic composition of SSU rRNA from a Beggiatoa mat transect, a cold background site, a warm site with high oil concentration, and a second Beggiatoa mat. The central part of the transect mat overlay the steepest temperature gradient, and was visually dominated by orange Beggiatoa. This was fringed by white Beggiatoa mat and bare, but still warm, sediment. Methane concentrations were saturating beneath the orange and white mats and at the oily site, lower beneath bare sediment, and below detection at the background site. Our initial hypotheses were that rRNA isotopic composition would be strongly influenced by methane supply, and that archaeal rRNA might be lighter than bacterial due to contributions from methanogens and anaerobic methane oxidizers. We used biotin-labeled oligonucleotides to capture Bacterial and Archaeal SSU rRNA for isotopic determination. Background-site rRNA was isotopically heaviest, and bacterial RNA from below 2 cm at the oily site was lightest, consistent with control by methane. Within the transect mat, however, the pattern was more complicated; at some sediment depths, rRNA from the mat periphery was isotopically lightest. Part of this may be due to the spatially and temporally variable paths followed by hydrothermal fluid, which can include horizontal

  10. Redescription of Rhizodomus tagatzi (Ciliophora: Spirotrichea: Tintinnida), based on morphology and small subunit ribosomal RNA gene sequence.

    PubMed

    Saccà, Alessandro; Strüder-Kypke, Michaela C; Lynn, Denis H

    2012-01-01

    Herein, we redescribe a tintinnid ciliate that is most commonly known as Tintinnopsis corniger Hada, 1964; but it has been described several times with different names, specifically Tintinnopsis nudicauda Paulmier, 1997 and Rhizodomus tagatzi Strelkow & Wirketis, 1950. Neotype material was collected from the water column of the coastal saline Lake Faro, a meromictic basin connected to the Straits of Messina, Central Mediterranean. The Lake Faro population is characterized by a hyaline or sparsely agglomerated lorica, which made it possible to observe in detail the basal layer structure, usually concealed by abundant incrusting particles. Along with an improved description of the lorica, we provide novel information, such as the general zooid morphology, the ciliary pattern, and the small subunit rRNA (SSU rRNA) gene sequence. Our phylogenetic analysis, based on the SSU rRNA, groups this species with Tintinnopsis radix, while the first taxonomic study designated it as R. tagatzi, introducing a new genus due to peculiarities in lorica morphology. We conclude that the species should be known as R. tagatzi, the senior synonym for the species. However, we do not transfer any other species to this genus, despite strong molecular similarities. Although it is obvious that the genus Tintinnopsis is in need of a thorough revision, current molecular and cytological information for this genus is too sparse, and the type species has not yet been redescribed with modern methods. PMID:22452414

  11. Ribosomal 18S rRNA base pairs with mRNA during eukaryotic translation initiation

    PubMed Central

    Martin, Franck; Ménétret, Jean-François; Simonetti, Angelita; Myasnikov, Alexander G.; Vicens, Quentin; Prongidi-Fix, Lydia; Natchiar, S. Kundhavai; Klaholz, Bruno P.; Eriani, Gilbert

    2016-01-01

    Eukaryotic mRNAs often contain a Kozak sequence that helps tether the ribosome to the AUG start codon. The mRNA of histone H4 (h4) does not undergo classical ribosome scanning but has evolved a specific tethering mechanism. The cryo-EM structure of the rabbit ribosome complex with mouse h4 shows that the mRNA forms a folded, repressive structure at the mRNA entry site on the 40S subunit next to the tip of helix 16 of 18S ribosomal RNA (rRNA). Toe-printing and mutational assays reveal that an interaction exists between a purine-rich sequence in h4 mRNA and a complementary UUUC sequence of helix h16. Together the present data establish that the h4 mRNA harbours a sequence complementary to an 18S rRNA sequence which tethers the mRNA to the ribosome to promote proper start codon positioning, complementing the interactions of the 40S subunit with the Kozak sequence that flanks the AUG start codon. PMID:27554013

  12. Ribosomal 18S rRNA base pairs with mRNA during eukaryotic translation initiation.

    PubMed

    Martin, Franck; Ménétret, Jean-François; Simonetti, Angelita; Myasnikov, Alexander G; Vicens, Quentin; Prongidi-Fix, Lydia; Natchiar, S Kundhavai; Klaholz, Bruno P; Eriani, Gilbert

    2016-01-01

    Eukaryotic mRNAs often contain a Kozak sequence that helps tether the ribosome to the AUG start codon. The mRNA of histone H4 (h4) does not undergo classical ribosome scanning but has evolved a specific tethering mechanism. The cryo-EM structure of the rabbit ribosome complex with mouse h4 shows that the mRNA forms a folded, repressive structure at the mRNA entry site on the 40S subunit next to the tip of helix 16 of 18S ribosomal RNA (rRNA). Toe-printing and mutational assays reveal that an interaction exists between a purine-rich sequence in h4 mRNA and a complementary UUUC sequence of helix h16. Together the present data establish that the h4 mRNA harbours a sequence complementary to an 18S rRNA sequence which tethers the mRNA to the ribosome to promote proper start codon positioning, complementing the interactions of the 40S subunit with the Kozak sequence that flanks the AUG start codon. PMID:27554013

  13. PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences

    PubMed Central

    Machida, Ryuji J.; Knowlton, Nancy

    2012-01-01

    Background Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. Methodology/Principal Findings Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. Conclusions/Significance The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S) and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other marker regions as targets

  14. RNA Cytidine Acetyltransferase of Small-Subunit Ribosomal RNA: Identification of Acetylation Sites and the Responsible Acetyltransferase in Fission Yeast, Schizosaccharomyces pombe

    PubMed Central

    Taoka, Masato; Ishikawa, Daisuke; Nobe, Yuko; Ishikawa, Hideaki; Yamauchi, Yoshio; Terukina, Goro; Nakayama, Hiroshi; Hirota, Kouji; Takahashi, Nobuhiro; Isobe, Toshiaki

    2014-01-01

    The eukaryotic small-subunit (SSU) ribosomal RNA (rRNA) has two evolutionarily conserved acetylcytidines. However, the acetylation sites and the acetyltransferase responsible for the acetylation have not been identified. We performed a comprehensive MS-based analysis covering the entire sequence of the fission yeast, Schizosaccharomyces pombe, SSU rRNA and identified two acetylcytidines at positions 1297 and 1815 in the 3′ half of the rRNA. To identify the enzyme responsible for the cytidine acetylation, we searched for an S. pombe gene homologous to TmcA, a bacterial tRNA N-acetyltransferase, and found one potential candidate, Nat10. A temperature-sensitive strain of Nat10 with a mutation in the Walker A type ATP-binding motif abolished the cytidine acetylation in SSU rRNA, and the wild-type Nat10 supplemented to this strain recovered the acetylation, providing evidence that Nat10 is necessary for acetylation of SSU rRNA. The Nat10 mutant strain showed a slow-growth phenotype and was defective in forming the SSU rRNA from the precursor RNA, suggesting that cytidine acetylation is necessary for ribosome assembly. PMID:25402480

  15. Phylogenetic Analysis of Myobia musculi (Schranck, 1781) by Using the 18S Small Ribosomal Subunit Sequence

    PubMed Central

    Feldman, Sanford H; Ntenda, Abraham M

    2011-01-01

    We used high-fidelity PCR to amplify 2 overlapping regions of the ribosomal gene complex from the rodent fur mite Myobia musculi. The amplicons encompassed a large portion of the mite's ribosomal gene complex spanning 3128 nucleotides containing the entire 18S rRNA, internal transcribed spacer (ITS) 1, 5.8S rRNA, ITS2, and a portion of the 5′-end of the 28S rRNA. M. musculi’s 179-nucleotide 5.8S rRNA nucleotide sequence was not conserved, so this region was identified by conservation of rRNA secondary structure. Maximum likelihood and Bayesian inference phylogenetic analyses were performed by using multiple sequence alignment consisting of 1524 nucleotides of M. musculi 18S rRNA and homologous sequences from 42 prostigmatid mites and the tick Dermacentor andersoni. The phylograms produced by both methods were in agreement regarding terminal, secondary, and some tertiary phylogenetic relationships among mites. Bayesian inference discriminated most infraordinal relationships between Eleutherengona and Parasitengona mites in the suborder Anystina. Basal relationships between suborders Anystina and Eupodina historically determined by comparing differences in anatomic characteristics were less well-supported by our molecular analysis. Our results recapitulated similar 18S rRNA sequence analyses recently reported. Our study supports M. musculi as belonging to the suborder Anystina, infraorder Eleutherenona, and superfamily Cheyletoidea. PMID:22330574

  16. A Method for Studying Protistan Diversity Using Massively Parallel Sequencing of V9 Hypervariable Regions of Small-Subunit Ribosomal RNA Genes

    PubMed Central

    Amaral-Zettler, Linda A.; McCliment, Elizabeth A.; Ducklow, Hugh W.; Huse, Susan M.

    2009-01-01

    Background Massively parallel pyrosequencing of amplicons from the V6 hypervariable regions of small-subunit (SSU) ribosomal RNA (rRNA) genes is commonly used to assess diversity and richness in bacterial and archaeal populations. Recent advances in pyrosequencing technology provide read lengths of up to 240 nucleotides. Amplicon pyrosequencing can now be applied to longer variable regions of the SSU rRNA gene including the V9 region in eukaryotes. Methodology/Principal Findings We present a protocol for the amplicon pyrosequencing of V9 regions for eukaryotic environmental samples for biodiversity inventories and species richness estimation. The International Census of Marine Microbes (ICoMM) and the Microbial Inventory Research Across Diverse Aquatic Long Term Ecological Research Sites (MIRADA-LTERs) projects are already employing this protocol for tag sequencing of eukaryotic samples in a wide diversity of both marine and freshwater environments. Conclusions/Significance Massively parallel pyrosequencing of eukaryotic V9 hypervariable regions of SSU rRNA genes provides a means of estimating species richness from deeply-sampled populations and for discovering novel species from the environment. PMID:19633714

  17. Ultrastructural characteristics and small subunit ribosomal DNA sequence of Vairimorpha cheracis sp. nov., (Microspora: Burenellidae), a parasite of the Australian yabby, Cherax destructor (Decapoda: Parastacidae).

    PubMed

    Moodie, Elizabeth G; Le Jambre, Leo F; Katz, Margaret E

    2003-11-01

    This is the first record of a species of Vairimorpha infecting a crustacean host. Vairimorpha cheracis sp. nov. was found in a highland population of the Australian freshwater crayfish, Cherax destructor. The majority of spores and earlier developmental stages of V. cheracis sp. nov. were found within striated muscle cells of the thorax, abdomen, and appendages of the crayfish. Only octosporoblastic sporogony within sporophorous vesicles (SPVs) was observed. Diplokaryotic sporonts separated into two uninucleate daughter cells, each of which gave rise to four sporoblasts in a rosette-shaped plasmodium, so that eight uninucleate spores were produced within the persistent ovoid SPV. Ultrastructural features of stages in the octosporoblastic sequence were similar to those described for Vairimorpha necatrix, the type species. Mature spores were pyriform in shape and averaged 3.4x1.9 microm in dimensions. The anterior polaroplast was lamellar in structure, and the posterior polaroplast vesicular. The polar filament was coiled 10-12 times, lateral to the posterior vacuole. The small subunit ribosomal DNA (SSU rDNA) of V. cheracis sp. nov. was sequenced and compared with other microsporidia. V. cheracis sp. nov. showed over 97% sequence identity with Vairimorpha imperfecta and five species of Nosema, and only 86% sequence identity with V. necatrix. The need for a taxonomic revision of the Nosema/Vairimorpha group of species is discussed. PMID:14726242

  18. The Large Ribosomal Subunit Protein L9 Enables the Growth of EF-P Deficient Cells and Enhances Small Subunit Maturation

    PubMed Central

    Naganathan, Anusha; Wood, Matthew P.; Moore, Sean D.

    2015-01-01

    The loss of the large ribosomal protein L9 causes a reduction in translation fidelity by an unknown mechanism. To identify pathways affected by L9, we identified mutants of E. coli that require L9 for fitness. In a prior study, we characterized L9-dependent mutations in the essential GTPase Der (EngA). Here, we describe a second class of L9-dependent mutations that either compromise or inactivate elongation factor P (EF-P, eIF5A in eukaryotes). Without L9, Δefp cells are practically inviable. Cell fractionation studies revealed that, in both the Der and EF-P mutant cases, L9's activity reduces immature 16S rRNA in 30S particles and partially restores the abundance of monosomes. Inspired by these findings, we discovered that L9 also enhances 16S maturation in wild-type cells. Surprisingly, although the amount of immature 16S in 30S particles was found to be elevated in ΔrplI cells, the amount in polysomes was low and inversely correlated with the immature 16S abundance. These findings provide an explanation for the observed fitness increases afforded by L9 in these mutants and reveal particular physiological conditions in which L9 becomes critical. Additionally, L9 may affect the partitioning of small subunits containing immature 16S rRNA. PMID:25879934

  19. Sequence variation in nuclear ribosomal small subunit, internal transcribed spacer and large subunit regions of Rhizophagus irregularis and Gigaspora margarita is high and isolate-dependent.

    PubMed

    Thiéry, Odile; Vasar, Martti; Jairus, Teele; Davison, John; Roux, Christophe; Kivistik, Paula-Ann; Metspalu, Andres; Milani, Lili; Saks, Ülle; Moora, Mari; Zobel, Martin; Öpik, Maarja

    2016-06-01

    Arbuscular mycorrhizal (AM) fungi are known to exhibit high intra-organism genetic variation. However, information about intra- vs. interspecific variation among the genes commonly used in diversity surveys is limited. Here, the nuclear small subunit (SSU) rRNA gene, internal transcribed spacer (ITS) region and large subunit (LSU) rRNA gene portions were sequenced from 3 to 5 individual spores from each of two isolates of Rhizophagus irregularis and Gigaspora margarita. A total of 1482 Sanger sequences (0.5 Mb) from 239 clones were obtained, spanning ~4370 bp of the ribosomal operon when concatenated. Intrasporal and intra-isolate sequence variation was high for all three regions even though variant numbers were not exhausted by sequencing 12-40 clones per isolate. Intra-isolate nucleotide variation levels followed the expected order of ITS > LSU > SSU, but the values were strongly dependent on isolate identity. Single nucleotide polymorphism (SNP) densities over 4 SNP/kb in the ribosomal operon were detected in all four isolates. Automated operational taxonomic unit picking within the sequence set of known identity overestimated species richness with almost all cut-off levels, markers and isolates. Average intraspecific sequence similarity values were 99%, 96% and 94% for amplicons in SSU, LSU and ITS, respectively. The suitability of the central part of the SSU as a marker for AM fungal community surveys was further supported by its level of nucleotide variation, which is similar to that of the ITS region; its alignability across the entire phylum; its appropriate length for next-generation sequencing; and its ease of amplification in single-step PCR. PMID:27092961

  20. Phylogeny of chloromonas (chlorophyceae): A study of 18S ribosomal RNA gene sequences

    SciTech Connect

    Buchheim, M.A.; Buchheim, J.A.; Chapman, R.L.

    1997-04-01

    The unicellular, biflagellate genus Chloromonas differs from its ally, Chlamydomonas, primarily by the absence of pyrenoids in the vegetative stage of the former. As with most green flagellate genera, little is known about phylogenetic affinities within and among Chloromonas species. Phylogenetic analyses of nuclear-encoded small-subunit ribosomal RNA gene sequences demonstrate that a sampling of five Chloromonas taxa, obtained from major culture collections, do not form a monophyletic group. However, only three of these isolates, Chloromonas clathrata, Chloromonas serbinowi, and Chloromonas rosae, are diagnosable morphologically as Chloromonas species by the absence of a pyrenoid in the vegetative stage. The three diagnosable Chloromonas taxa form an alliance with two pyrenoid-bearing chlamydomonads, Chlamydomonas augustae and Chlamydomonas macrostellata. With the exception of Chloromonas serbinowi, which represents the basal lineage within the clade, each of the diagnosable Chloromonas taxa and their pyrenoid-bearing Chlamydomonas allies were isolated originally from mountain soils, snow, or cold peat. These observations suggest that hibitat, independent of pyrenoid status, may be most closely linked to the natural history of this clade of chlamydomonad flagellates. 51 refs., 3 figs., 3 tabs.

  1. Optimal Eukaryotic 18S and Universal 16S/18S Ribosomal RNA Primers and Their Application in a Study of Symbiosis

    PubMed Central

    Wang, Yong; Tian, Ren Mao; Gao, Zhao Ming; Bougouffa, Salim; Qian, Pei-Yuan

    2014-01-01

    Eukaryotic 18S ribosomal RNA (rRNA) gene primers that feature a wide coverage are critical in detecting the composition of eukaryotic microscopic organisms in ecosystems. Here, we predicted 18S rRNA primers based on consecutive conserved sites and evaluated their coverage efficiency and scope of application to different eukaryotic groups. After evaluation, eight of them were considered as qualified 18S primers based on coverage rate. Next, we examined common conserved regions in prokaryotic 16S and eukaryotic 18S rRNA sequences to design 16S/18S universal primers. Three 16S/18S candidate primers, U515, U1390 and U1492, were then considered to be suitable for simultaneous amplification of the rRNA sequences in three domains. Eukaryotic 18S and prokaryotic 16S rRNA genes in a sponge were amplified simultaneously using universal primers U515 and U1390, and the subsequent sorting of pyrosequenced reads revealed some distinctive communities in different parts of the sample. The real difference in biodiversity between prokaryotic and eukaryotic symbionts could be discerned as the dissimilarity between OTUs was increased from 0.005 to 0.1. A network of the communities in external and internal parts of the sponge illustrated the co-variation of some unique microbes in certain parts of the sponge, suggesting that the universal primers are useful in simultaneous detection of prokaryotic and eukaryotic microbial communities. PMID:24594623

  2. Using Small Subunit Ribosomal RNA to Follow Dark Incorporation of 14C-bicarbonate by Bacteria and Archaea in Sandy Sediment

    NASA Astrophysics Data System (ADS)

    MacGregor, B. J.; Musat, N.; Kuypers, M. M.

    2007-12-01

    Small subunit ribosomal RNA (SSU rRNA) and the genes encoding it have become the basis of modern microbial phylogeny, and of numerous methods for characterizing the composition of bacterial, archaeal, and even eukaryotic communities as they occur in nature. A limitation of this approach has been that phylogeny alone is not a reliable guide to physiology, particularly for groups with no close relatives in culture. We have been developing ways of using the SSU rRNA molecule itself to identify and (eventually) quantify the carbon sources incorporated by particular phylogenetic groups. This can be done by taking advantage of natural variations in carbon isotopic composition among growth substrates, or by following incorporation of 13C- or 14C-labeled compounds. 14C has the advantage that natural background levels are negligible. In the present study, our goal is to identify species responsible for non-photosynthetic CO2 incorporation in sandy sediments of the German Wadden Sea. Sediment cores collected from the Janssand sand flats were percolated with 14C-bicarbonate at in situ temperature for 36-38h in the dark, total RNA isolated, and domain-specific oligonucleotide probes used to capture bacterial and archaeal SSU rRNA. Total and/or captured RNA was separated by denaturing polyacrylamide gel electrophoresis, and 14C detected by phosphor imager, autoradiography, or beta imager. Detection was fastest and most sensitive with the beta imager. Both Bacteria and Archaea had incorporated label, suggesting both groups may harbor non-photosynthetic autotrophs. The next step will be to use more specific capture probes. We are currently working to separate the captured domain-specific SSU rRNA on non-denaturing gels, with detection by the high-resolution mode of the beta imager, so that individual species incorporating label can be identified by RT-PCR and sequencing of labeled bands.

  3. Molecular phylogeny of labyrinthulids and thraustochytrids based on the sequencing of 18S ribosomal RNA gene.

    PubMed

    Honda, D; Yokochi, T; Nakahara, T; Raghukumar, S; Nakagiri, A; Schaumann, K; Higashihara, T

    1999-01-01

    Labyrinthulids and thraustochytrids are unicellular heterotrophs, formerly considered as fungi, but presently are recognized as members in the stramenopiles of the kingdom Protista sensu lato. We determined the 18S ribosomal RNA gene sequences of 14 strains from different species of the six genera and analyzed the molecular phylogenetic relationships. The results conflict with the current classification based on morphology, at the genus and species levels. These organisms are separated, based on signature sequences and unique inserted sequences, into two major groups, which were named the labyrinthulid phylogenetic group and the thraustochytrid phylogenetic group. Although these groupings are in disagreement with many conventional taxonomic characters, they correlated better with the sugar composition of the cell wall. Thus, the currently used taxonomic criteria need serious reconsideration. PMID:10568038

  4. A variant of Plasmodium ovale; analysis of its 18S ribosomal RNA gene sequence.

    PubMed

    Miyake, H; Suwa, S; Kimura, M; Wataya, Y

    1997-01-01

    We report here a new variant of human malaria parasite found by comparison of diagnostic results obtained from a new DNA diagnostic method named microtiter plate-hybridization (MPH) and traditional microscopic method. Total five cases of malaria were diagnosed as microscopy-positive but MPH-negative; one case was found in epidemiological research in Vietnam and four cases were obtained from imported malaria in Japan. Although they were quite similar to typical P. ovale morphologically in microscopy, sequence analysis of PCR-amplified DNA fragment revealed that their 18S ribosomal RNA gene sequence was different from published sequence of P. ovale. Combination of MPH and microscopic examination provides us a new method for detection of a new type of malaria parasite which is difficult to distinguish morphologically. PMID:9586115

  5. Depletion of U3 small nucleolar RNA inhibits cleavage in the 5' external transcribed spacer of yeast pre-ribosomal RNA and impairs formation of 18S ribosomal RNA.

    PubMed Central

    Hughes, J M; Ares, M

    1991-01-01

    Multiple processing events are required to convert a single eukaryotic pre-ribosomal RNA (pre-rRNA) into mature 18S (small subunit), 5.8S and 25-28S (large subunit) rRNAs. We have asked whether U3 small nucleolar RNA is required for pre-rRNA processing in vivo by depleting Saccharomyces cerevisiae of U3 by conditional repression of U3 synthesis. The resulting pattern of accumulation and depletion of specific pre-rRNAs indicates that U3 is required for multiple events leading to the maturation of 18S rRNA. These include an initial cleavage within the 5' external transcribed spacer, resembling the U3 dependent initial processing event of mammalian pre-rRNA. Formation of large subunit rRNAs is unaffected by U3 depletion. The similarity between the effects of U3 depletion and depletion of U14 small nucleolar RNA and the nucleolar protein fibrillarin (NOP1) suggests that these could be components of a single highly conserved processing complex. Images PMID:1756730

  6. Ribosome biogenesis factor Tsr3 is the aminocarboxypropyl transferase responsible for 18S rRNA hypermodification in yeast and humans

    PubMed Central

    Meyer, Britta; Wurm, Jan Philip; Sharma, Sunny; Immer, Carina; Pogoryelov, Denys; Kötter, Peter; Lafontaine, Denis L. J.; Wöhnert, Jens; Entian, Karl-Dieter

    2016-01-01

    The chemically most complex modification in eukaryotic rRNA is the conserved hypermodified nucleotide N1-methyl-N3-aminocarboxypropyl-pseudouridine (m1acp3Ψ) located next to the P-site tRNA on the small subunit 18S rRNA. While S-adenosylmethionine was identified as the source of the aminocarboxypropyl (acp) group more than 40 years ago the enzyme catalyzing the acp transfer remained elusive. Here we identify the cytoplasmic ribosome biogenesis protein Tsr3 as the responsible enzyme in yeast and human cells. In functionally impaired Tsr3-mutants, a reduced level of acp modification directly correlates with increased 20S pre-rRNA accumulation. The crystal structure of archaeal Tsr3 homologs revealed the same fold as in SPOUT-class RNA-methyltransferases but a distinct SAM binding mode. This unique SAM binding mode explains why Tsr3 transfers the acp and not the methyl group of SAM to its substrate. Structurally, Tsr3 therefore represents a novel class of acp transferase enzymes. PMID:27084949

  7. Ribosome biogenesis factor Tsr3 is the aminocarboxypropyl transferase responsible for 18S rRNA hypermodification in yeast and humans.

    PubMed

    Meyer, Britta; Wurm, Jan Philip; Sharma, Sunny; Immer, Carina; Pogoryelov, Denys; Kötter, Peter; Lafontaine, Denis L J; Wöhnert, Jens; Entian, Karl-Dieter

    2016-05-19

    The chemically most complex modification in eukaryotic rRNA is the conserved hypermodified nucleotide N1-methyl-N3-aminocarboxypropyl-pseudouridine (m(1)acp(3)Ψ) located next to the P-site tRNA on the small subunit 18S rRNA. While S-adenosylmethionine was identified as the source of the aminocarboxypropyl (acp) group more than 40 years ago the enzyme catalyzing the acp transfer remained elusive. Here we identify the cytoplasmic ribosome biogenesis protein Tsr3 as the responsible enzyme in yeast and human cells. In functionally impaired Tsr3-mutants, a reduced level of acp modification directly correlates with increased 20S pre-rRNA accumulation. The crystal structure of archaeal Tsr3 homologs revealed the same fold as in SPOUT-class RNA-methyltransferases but a distinct SAM binding mode. This unique SAM binding mode explains why Tsr3 transfers the acp and not the methyl group of SAM to its substrate. Structurally, Tsr3 therefore represents a novel class of acp transferase enzymes. PMID:27084949

  8. Molecular Identification of Ptychodera flava (Hemichordata: Enteropneusta): Reconsideration in Light of Nucleotide Polymorphism in the 18S Ribosomal RNA Gene.

    PubMed

    Urata, Makoto

    2015-06-01

    Seven nuclear and mitochondrial DNA markers were examined in 12 specimens of Ptychodera flava, a model acorn worm used in molecular biology, collected in Japan from three local populations with different modes of living. A comparison of intraspecific results did not show genetically isolated populations despite the species' enclave habitats and asexual reproduction. Moreover, both the nuclear 18S ribosomal RNA gene and mitochondrial 16S ribosomal RNA gene sequences were identical to those from Moorea in French Polynesia, nearly 10,000 kilometers away from Japan. I also provide the first definitive information regarding polymorphisms in 18S ribosomal RNA gene, the external transcribed spacer (ETS), internal transcribed spacers (ITS), and mitochondrial cytochrome c oxidase subunit 1 (mtCO1) sequence in hemichordates using newly designed primer sets, and I show both high larval vagility and certain criteria for the molecular identification of this species. PMID:26003987

  9. A phylogenetic study on galactose-containing Candida species based on 18S ribosomal DNA sequences.

    PubMed

    Suzuki, Motofumi; Suh, Sung-Oui; Sugita, Takashi; Nakase, Takashi

    1999-10-01

    Phylogenetic relationships of 33 Candida species containing galactose in the cells were investigated by using 18S ribosomal DNA sequence analysis. Galactose-containing Candida species and galactose-containing species from nine ascomycetous genera were a heterogeneous assemblage. They were divided into three clusters (II, III, and IV) which were phylogenetically distant from cluster I, comprising 9 galactose-lacking Candida species, C. glabrata, C. holmii, C. krusei, C. tropicalis (the type species of Candida), C. albicans, C. viswanathii, C. maltosa, C. parapsilosis, C. guilliermondii, and C. lusitaniae, and 17 related ascomycetous yeasts. These three clusters were also phylogenetically distant from Schizosaccharomyces pombe, which contains galactomannan in its cell wall. Cluster II comprised C. magnoliae, C. vaccinii, C. apis, C. gropengiesseri, C. etchellsii, C. floricola, C. lactiscondensi, Wickerhamiella domercqiae, C. versatilis, C. azyma, C. vanderwaltii, C. pararugosa, C. sorbophila, C. spandovensis, C. galacta, C. ingens, C. incommunis, Yarrowia lipolytica, Galactomyces geotrichum, and Dipodascus albidus. Cluster III comprised C. tepae, C. antillancae and its synonym C. bondarzewiae, C. ancudensis, C. petrohuensis, C. santjacobensis, C. ciferrii (anamorph of Stephanoascus ciferrii), Arxula terrestris, C. castrensis, C. valdiviana, C. paludigena, C. blankii, C. salmanticensis, C. auringiensis, C. bertae, and its synonym C. bertae var. chiloensis, C. edax (anamorph of Stephanoascus smithiae), Arxula adeninivorans, and C. steatolytica (synonym of Zygoascus hellenicus). Cluster IV comprised C. cantarellii, C. vinaria, Dipodascopsis uninucleata, and Lipomyces lipofer. Two galactose-lacking and Q-8-forming species, C. stellata and Pichia pastoris, and 5 galactose-lacking and Q-9-forming species, C. apicola, C. bombi, C. bombicola, C. geochares, and C. insectalens, were included in Cluster II. Two galactose-lacking and Q-9-forming species, C. drimydis and C

  10. Chromosome Mapping of 18S Ribosomal RNA Genes in Eleven Hypostomus Species (Siluriformes, Loricariidae): Diversity Analysis of the Sites.

    PubMed

    Rubert, Marceléia; da Rosa, Renata; Zawadzki, Claudio H; Mariotto, Sandra; Moreira-Filho, Orlando; Giuliano-Caetano, Lucia

    2016-08-01

    We investigated the chromosomal distribution of 18S ribosomal DNA (rDNA) in different populations of 11 species of Hypostomus collected in important Brazilian basins, namely South Atlantic, Upper Paraná, and Paraguay applying the fluorescence in situ hybridization (FISH). Hypostomus cochliodon, Hypostomus commersoni, Hypostomus hermanni, Hypostomus regani, Hypostomus albopunctatus, Hypostomus paulinus, Hypostomus aff. paulinus, Hypostomus iheringii, and Hypostomus mutucae presented multiple 18S rDNA sites while Hypostomus strigaticeps and Hypostomus nigromaculatus exhibited a single pair of chromosomes with 18S rDNA sites. The studied species presented variations in the number and position of these sites. The results accomplished were similar to those obtained by the analysis of AgNORs, revealing the same interspecific variability. Each species exhibited distinctive patterns of AgNOR and 18S rDNA distribution, which can be considered cytogenetic markers in each species of the genus and help improve the discussions on the phylogeny of the group. PMID:27192329

  11. Structural and functional studies of Bud23–Trm112 reveal 18S rRNA N7-G1575 methylation occurs on late 40S precursor ribosomes

    PubMed Central

    Létoquart, Juliette; Huvelle, Emmeline; Wacheul, Ludivine; Bourgeois, Gabrielle; Zorbas, Christiane; Graille, Marc; Heurgué-Hamard, Valérie; Lafontaine, Denis L. J.

    2014-01-01

    The eukaryotic small ribosomal subunit carries only four ribosomal (r) RNA methylated bases, all close to important functional sites. N7-methylguanosine (m7G) introduced at position 1575 on 18S rRNA by Bud23–Trm112 is at a ridge forming a steric block between P- and E-site tRNAs. Here we report atomic resolution structures of Bud23–Trm112 in the apo and S-adenosyl-l-methionine (SAM)-bound forms. Bud23 and Trm112 interact through formation of a β-zipper involving main-chain atoms, burying an important hydrophobic surface and stabilizing the complex. The structures revealed that the coactivator Trm112 undergoes an induced fit to accommodate its methyltransferase (MTase) partner. We report important structural similarity between the active sites of Bud23 and Coffea canephora xanthosine MTase, leading us to propose and validate experimentally a model for G1575 coordination. We identify Bud23 residues important for Bud23–Trm112 complex formation and recruitment to pre-ribosomes. We report that though Bud23–Trm112 binds precursor ribosomes at an early nucleolar stage, m7G methylation occurs at a late step of small subunit biogenesis, implying specifically delayed catalytic activation. Finally, we show that Bud23–Trm112 interacts directly with the box C/D snoRNA U3-associated DEAH RNA helicase Dhr1 supposedly involved in central pseudoknot formation; this suggests that Bud23–Trm112 might also contribute to controlling formation of this irreversible and dramatic structural reorganization essential to overall folding of small subunit rRNA. Our study contributes important new elements to our understanding of key molecular aspects of human ribosomopathy syndromes associated with WBSCR22 (human Bud23) malfunction. PMID:25489090

  12. Modified nucleotides in T1 RNase oligonucleotides of 18S ribosomal RNA of the Novikoff hepatoma.

    PubMed

    Choi, Y C; Busch, H

    1978-06-27

    The primary structure of 18S rRNA of the Novikoff hepatoma cells was investigated. Regardless of whether the primary sequence of 18S rRNA is finally determined by RNA sequencing methods or DNA sequencing methods, it is important to identify numbers and types of the modified nucleotides and accordingly the present study was designed to localize the modified regions in T1 RNase derived oligonucleotide. Modified nucleotides found in 66 different oligonucleotide sequences included 2 m62A, 1 m6A, 1 m7G, 1m1cap3psi, 7 Cm, 13 Am, 9 Gm, 11 Um, and 38 psi residues. A number of these modified nucleotides are now placed in defined sequences of T1 RNase oligonucleotides which are now being searched for in larger fragments derived from partial T1 RNase digests of 18S rRNA. Improved homochromatography fingerprinting (Choi et al. (1976) Cancer Res. 36, 4301) of T1 RNase derived oligonucleotides provided a distinctive pattern for 18S rRNA of Novikoff hepatoma ascites cells. The 116 spots obtained by homochromatography contain 176 oligonucleotide sequences. PMID:209819

  13. New Hosts of Simplicimonas similis and Trichomitus batrachorum Identified by 18S Ribosomal RNA Gene Sequences

    PubMed Central

    Dimasuay, Kris Genelyn B.; Lavilla, Orlie John Y.; Rivera, Windell L.

    2013-01-01

    Trichomonads are obligate anaerobes generally found in the digestive and genitourinary tract of domestic animals. In this study, four trichomonad isolates were obtained from carabao, dog, and pig hosts using rectal swab. Genomic DNA was extracted using Chelex method and the 18S rRNA gene was successfully amplified through novel sets of primers and undergone DNA sequencing. Aligned isolate sequences together with retrieved 18S rRNA gene sequences of known trichomonads were utilized to generate phylogenetic trees using maximum likelihood and neighbor-joining analyses. Two isolates from carabao were identified as Simplicimonas similis while each isolate from dog and pig was identified as Pentatrichomonas hominis and Trichomitus batrachorum, respectively. This is the first report of S. similis in carabao and the identification of T. batrachorum in pig using 18S rRNA gene sequence analysis. The generated phylogenetic tree yielded three distinct groups mostly with relatively moderate to high bootstrap support and in agreement with the most recent classification. Pathogenic potential of the trichomonads in these hosts still needs further investigation. PMID:23936631

  14. Analysis of environmental 18S ribosomal RNA sequences reveals unknown diversity of the cosmopolitan phylum Telonemia.

    PubMed

    Shalchian-Tabrizi, Kamran; Kauserud, Håvard; Massana, Ramon; Klaveness, Dag; Jakobsen, Kjetill S

    2007-04-01

    Telonemia has recently been described as a new eukaryotic phylum with uncertain evolutionary origin. So far, only two Telonemia species, Telonema subtilis and Telonema antarcticum, have been described, but there are substantial variations in size and morphology among Telonema isolates and field observations, indicating a hidden diversity of Telonemia-like species and populations. In this study, we investigated the diversity and the global distribution of this group by analyzing 18S rDNA sequences from marine environmental clone libraries published in GenBank as well as several unpublished sequences from the Indian Ocean. Phylogenetic analyses of the identified sequences suggest that the Telonemia phylum includes several undescribed 18S rDNA phylotypes, probably corresponding to a number of different species and/or populations. The Telonemia phylotypes form two main groups, here referred to as Telonemia Groups 1 and 2. Some of the closely related sequences originate from separate oceans, indicating worldwide distributions of various Telonemia phylotypes, while other phylotypes seem to have limited geographical distribution. Further investigations of the evolutionary relationships within Telonemia should be conducted on isolated cultures of Telonema-like strains using multi-locus sequencing and morphological data. PMID:17196879

  15. The phylogenetic position of Rhopalura ophiocomae (Orthonectida) based on 18S ribosomal DNA sequence analysis.

    PubMed

    Hanelt, B; Van Schyndel, D; Adema, C M; Lewis, L A; Loker, E S

    1996-11-01

    The Orthonectida is a small, poorly known phylum of parasites of marine invertebrates. Their phylogenetic placement is obscure; they have been considered to be multicellular protozoans, primitive animals at a "mesozoan" grade of organization, or secondarily simplified flatworm-like organisms. The best known species in the phylum, Rhopalura ophiocomae, was collected on San Juan Island, Wash. and a complete 18S rDNA sequence was obtained. Using the models of minimum evolution and parsimony, phylogenetic analyses were undertaken and the results lend support to the following hypotheses about orthonectids: (1) orthonectids are more closely aligned with triploblastic metazoan taxa than with the protist or diploblastic metazoan taxa considered in this analysis; (2) orthonectids are not derived members of the phylum Platyhelminthes; and (3) orthonectids and rhombozoans are not each other's closest relatives, thus casting further doubt on the validity of the phylum Mesozoa previously used to encompass both groups. PMID:8896370

  16. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae)

    PubMed Central

    Gomez-Rodriguez, Victor Manuel; Rodriguez-Garay, Benjamin; Palomino, Guadalupe; Martínez, Javier; Barba-Gonzalez, Rodrigo

    2013-01-01

    Abstract Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country’s economy. Cytogenetic analysis was carried out in Agave tequilana Weber, 1902 ‘Azul’, Agave cupreata Trelease et Berger, 1915 and Agave angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH) was used for physical mapping of 5S and 18S ribosomal DNA (rDNA). All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies. PMID:24260700

  17. A Single Acetylation of 18 S rRNA Is Essential for Biogenesis of the Small Ribosomal Subunit in Saccharomyces cerevisiae*

    PubMed Central

    Ito, Satoshi; Akamatsu, Yu; Noma, Akiko; Kimura, Satoshi; Miyauchi, Kenjyo; Ikeuchi, Yoshiho; Suzuki, Takeo; Suzuki, Tsutomu

    2014-01-01

    Biogenesis of eukaryotic ribosome is a complex event involving a number of non-ribosomal factors. During assembly of the ribosome, rRNAs are post-transcriptionally modified by 2′-O-methylation, pseudouridylation, and several base-specific modifications, which are collectively involved in fine-tuning translational fidelity and/or modulating ribosome assembly. By mass-spectrometric analysis, we demonstrated that N4-acetylcytidine (ac4C) is present at position 1773 in the 18 S rRNA of Saccharomyces cerevisiae. In addition, we found an essential gene, KRE33 (human homolog, NAT10), that we renamed RRA1 (ribosomal RNA cytidine acetyltransferase 1) encoding an RNA acetyltransferase responsible for ac4C1773 formation. Using recombinant Rra1p, we could successfully reconstitute ac4C1773 in a model rRNA fragment in the presence of both acetyl-CoA and ATP as substrates. Upon depletion of Rra1p, the 23 S precursor of 18 S rRNA was accumulated significantly, which resulted in complete loss of 18 S rRNA and small ribosomal subunit (40 S), suggesting that ac4C1773 formation catalyzed by Rra1p plays a critical role in processing of the 23 S precursor to yield 18 S rRNA. When nuclear acetyl-CoA was depleted by inactivation of acetyl-CoA synthetase 2 (ACS2), we observed temporal accumulation of the 23 S precursor, indicating that Rra1p modulates biogenesis of 40 S subunit by sensing nuclear acetyl-CoA concentration. PMID:25086048

  18. The human 18S rRNA base methyltransferases DIMT1L and WBSCR22-TRMT112 but not rRNA modification are required for ribosome biogenesis

    PubMed Central

    Zorbas, Christiane; Nicolas, Emilien; Wacheul, Ludivine; Huvelle, Emmeline; Heurgué-Hamard, Valérie; Lafontaine, Denis L. J.

    2015-01-01

    At the heart of the ribosome lie rRNAs, whose catalytic function in translation is subtly modulated by posttranscriptional modifications. In the small ribosomal subunit of budding yeast, on the 18S rRNA, two adjacent adenosines (A1781/A1782) are N6-dimethylated by Dim1 near the decoding site, and one guanosine (G1575) is N7-methylated by Bud23-Trm112 at a ridge between the P- and E-site tRNAs. Here we establish human DIMT1L and WBSCR22-TRMT112 as the functional homologues of yeast Dim1 and Bud23-Trm112. We report that these enzymes are required for distinct pre-rRNA processing reactions leading to synthesis of 18S rRNA, and we demonstrate that in human cells, as in budding yeast, ribosome biogenesis requires the presence of the modification enzyme rather than its RNA-modifying catalytic activity. We conclude that a quality control mechanism has been conserved from yeast to human by which binding of a methyltransferase to nascent pre-rRNAs is a prerequisite to processing, so that all cleaved RNAs are committed to faithful modification. We further report that 18S rRNA dimethylation is nuclear in human cells, in contrast to yeast, where it is cytoplasmic. Yeast and human ribosome biogenesis thus have both conserved and distinctive features. PMID:25851604

  19. HCV IRES interacts with the 18S rRNA to activate the 40S ribosome for subsequent steps of translation initiation

    PubMed Central

    Malygin, Alexey A.; Kossinova, Olga A.; Shatsky, Ivan N.; Karpova, Galina G.

    2013-01-01

    Previous analyses of complexes of 40S ribosomal subunits with the hepatitis C virus (HCV) internal ribosome entry site (IRES) have revealed contacts made by the IRES with ribosomal proteins. Here, using chemical probing, we show that the HCV IRES also contacts the backbone and bases of the CCC triplet in the 18S ribosomal RNA (rRNA) expansion segment 7. These contacts presumably provide interplay between IRES domain II and the AUG codon close to ribosomal protein S5, which causes a rearrangement of 18S rRNA structure in the vicinity of the universally conserved nucleotide G1639. As a result, G1639 becomes exposed and the corresponding site of the 40S subunit implicated in transfer RNA discrimination can select . These data are the first demonstration at nucleotide resolution of direct IRES–rRNA interactions and how they induce conformational transition in the 40S subunit allowing the HCV IRES to function without AUG recognition initiation factors. PMID:23873958

  20. Ribosomal RNA sequence suggest microsporidia are extremely ancient eukaryotes

    NASA Technical Reports Server (NTRS)

    Vossbrinck, C. R.; Maddox, J. V.; Friedman, S.; Debrunner-Vossbrinck, B. A.; Woese, C. R.

    1987-01-01

    A comparative sequence analysis of the 18S small subunit ribosomal RNA (rRNA) of the microsporidium Vairimorpha necatrix is presented. The results show that this rRNA sequence is more unlike those of other eukaryotes than any known eukaryote rRNA sequence. It is concluded that the lineage leading to microsporidia branched very early from that leading to other eukaryotes.

  1. gar2 is a nucleolar protein from Schizosaccharomyces pombe required for 18S rRNA and 40S ribosomal subunit accumulation.

    PubMed Central

    Gulli, M P; Girard, J P; Zabetakis, D; Lapeyre, B; Melese, T; Caizergues-Ferrer, M

    1995-01-01

    Several nucleolar proteins, such as nucleolin, NOP1/fibrillarin, SSB1, NSR1 and GAR1 share a common glycine and arginine rich structural motif called the GAR domain. To identify novel nucleolar proteins from fission yeast we screened Schizosaccharomyces pombe genomic DNA libraries with a probe encompassing the GAR structural motif. Here we report the identification and characterization of a S.pombe gene coding for a novel nucleolar protein, designated gar2. The structure of the fission yeast gar2 is reminiscent of that of nucleolin from vertebrates and NSR1 from Saccharomyces cerevisiae. In addition, like these proteins, gar2 has a nucleolar localisation. The disruption of the gar2+ gene affects normal cell growth, leads to an accumulation of 35S pre-rRNA and a decrease of mature 18S rRNA steady state levels. Moreover, ribosomal profiles of the mutant show an increase of free 60S ribosomal subunits and an absence of free 40S ribosomal subunits. gar2 is able to rescue a S.cerevisiae mutant lacking NSR1, thus establishing gar2 as a functional homolog of NSR1. We propose that gar2 helps the assembly of pre-ribosomal particles containing 18S rRNA. Images PMID:7596817

  2. Molecular Phylogenetic Analysis of Enterobius vermicularis and Development of an 18S Ribosomal DNA-Targeted Diagnostic PCR▿

    PubMed Central

    Zelck, Ulrike E.; Bialek, Ralf; Weiß, Michael

    2011-01-01

    We genetically characterized pinworms obtained from 37 children from different regions of Germany and established new species-specific molecular diagnostic tools. No ribosomal DNA diversity was found; the phylogenetic position of Enterobius vermicularis within the Oxyurida order and its close relationship to the Ascaridida and Spirurida orders was confirmed. PMID:21248085

  3. Human NAT10 Is an ATP-dependent RNA Acetyltransferase Responsible for N4-Acetylcytidine Formation in 18 S Ribosomal RNA (rRNA)*

    PubMed Central

    Ito, Satoshi; Horikawa, Sayuri; Suzuki, Tateki; Kawauchi, Hiroki; Tanaka, Yoshikazu; Suzuki, Takeo; Suzuki, Tsutomu

    2014-01-01

    Human N-acetyltransferase 10 (NAT10) is known to be a lysine acetyltransferase that targets microtubules and histones and plays an important role in cell division. NAT10 is highly expressed in malignant tumors, and is also a promising target for therapies against laminopathies and premature aging. Here we report that NAT10 is an ATP-dependent RNA acetyltransferase responsible for formation of N4-acetylcytidine (ac4C) at position 1842 in the terminal helix of mammalian 18 S rRNA. RNAi-mediated knockdown of NAT10 resulted in growth retardation of human cells, and this was accompanied by high-level accumulation of the 30 S precursor of 18 S rRNA, suggesting that ac4C1842 formation catalyzed by NAT10 is involved in rRNA processing and ribosome biogenesis. PMID:25411247

  4. Variation in the number of nucleoli and incomplete homogenization of 18S ribosomal DNA sequences in leaf cells of the cultivated Oriental ginseng (Panax ginseng Meyer)

    PubMed Central

    Chelomina, Galina N.; Rozhkovan, Konstantin V.; Voronova, Anastasia N.; Burundukova, Olga L.; Muzarok, Tamara I.; Zhuravlev, Yuri N.

    2015-01-01

    Background Wild ginseng, Panax ginseng Meyer, is an endangered species of medicinal plants. In the present study, we analyzed variations within the ribosomal DNA (rDNA) cluster to gain insight into the genetic diversity of the Oriental ginseng, P. ginseng, at artificial plant cultivation. Methods The roots of wild P. ginseng plants were sampled from a nonprotected natural population of the Russian Far East. The slides were prepared from leaf tissues using the squash technique for cytogenetic analysis. The 18S rDNA sequences were cloned and sequenced. The distribution of nucleotide diversity, recombination events, and interspecific phylogenies for the total 18S rDNA sequence data set was also examined. Results In mesophyll cells, mononucleolar nuclei were estimated to be dominant (75.7%), while the remaining nuclei contained two to four nucleoli. Among the analyzed 18S rDNA clones, 20% were identical to the 18S rDNA sequence of P. ginseng from Japan, and other clones differed in one to six substitutions. The nucleotide polymorphism was more expressed at the positions 440–640 bp, and distributed in variable regions, expansion segments, and conservative elements of core structure. The phylogenetic analysis confirmed conspecificity of ginseng plants cultivated in different regions, with two fixed mutations between P. ginseng and other species. Conclusion This study identified the evidences of the intragenomic nucleotide polymorphism in the 18S rDNA sequences of P. ginseng. These data suggest that, in cultivated plants, the observed genome instability may influence the synthesis of biologically active compounds, which are widely used in traditional medicine. PMID:27158239

  5. Phylogeny of the sundews, Drosera (Droseraceae), based on chloroplast rbcL and nuclear 18S ribosomal DNA Sequences.

    PubMed

    Rivadavia, Fernando; Kondo, Katsuhiko; Kato, Masahiro; Hasebe, Mitsuyasu

    2003-01-01

    The sundew genus Drosera consists of carnivorous plants with active flypaper traps and includes nearly 150 species distributed mainly in Australia, Africa, and South America, with some Northern Hemisphere species. In addition to confused intrageneric classification of Drosera, the intergeneric relationships among the Drosera and two other genera in the Droseraceae with snap traps, Dionaea and Aldrovanda, are problematic. We conducted phylogenetic analyses of DNA sequences of the chloroplast rbcL gene for 59 species of Drosera, covering all sections except one. These analyses revealed that five of 11 sections, including three monotypic sections, are polyphyletic. Combined rbcL and 18S rDNA sequence data were used to infer phylogenetic relationships among Drosera, Dionaea, and Aldrovanda. This analysis revealed that all Drosera species form a clade sister to a clade including Dionaea and Aldrovanda, suggesting that the snap traps of Aldrovanda and Dionaea are homologous despite their morphological differences. MacClade reconstructions indicated that multiple episodes of aneuploidy occurred in a clade that includes mainly Australian species, while the chromosome numbers in the other clades are not as variable. Drosera regia, which is native to South Africa, and most species native to Australia, were clustered basally, suggesting that Drosera originated in Africa or Australia. The rbcL tree indicates that Australian species expanded their distribution to South America and then to Africa. Expansion of distribution to the Northern Hemisphere from the Southern Hemispere occurred in a few different lineages. PMID:21659087

  6. The Strepsiptera problem: phylogeny of the holometabolous insect orders inferred from 18S and 28S ribosomal DNA sequences and morphology.

    PubMed

    Whiting, M F; Carpenter, J C; Wheeler, Q D; Wheeler, W C

    1997-03-01

    Phylogenetic relationships among the holometabolous insect orders were inferred from cladistic analysis of nucleotide sequences of 18S ribosomal DNA (rDNA) (85 exemplars) and 28S rDNA (52 exemplars) and morphological characters. Exemplar outgroup taxa were Collembola (1 sequence), Archaeognatha (1), Ephemerida (1), Odonata (2), Plecoptera (2), Blattodea (1), Mantodea (1), Dermaptera (1), Orthoptera (1), Phasmatodea (1), Embioptera (1), Psocoptera (1), Phthiraptera (1), Hemiptera (4), and Thysanoptera (1). Exemplar ingroup taxa were Coleoptera: Archostemata (1), Adephaga (2), and Polyphaga (7); Megaloptera (1); Raphidioptera (1); Neuroptera (sensu stricto = Planipennia): Mantispoidea (2), Hemerobioidea (2), and Myrmeleontoidea (2); Hymenoptera: Symphyta (4) and Apocrita (19); Trichoptera: Hydropsychoidea (1) and Limnephiloidea (2); Lepidoptera: Ditrysia (3); Siphonaptera: Pulicoidea (1) and Ceratophylloidea (2); Mecoptera: Meropeidae (1), Boreidae (1), Panorpidae (1), and Bittacidae (2); Diptera: Nematocera (1), Brachycera (2), and Cyclorrhapha (1); and Strepsiptera: Corioxenidae (1), Myrmecolacidae (1), Elenchidae (1), and Stylopidae (3). We analyzed approximately 1 kilobase of 18S rDNA, starting 398 nucleotides downstream of the 5' end, and approximately 400 bp of 28S rDNA in expansion segment D3. Multiple alignment of the 18S and 28S sequences resulted in 1,116 nucleotide positions with 24 insert regions and 398 positions with 14 insert regions, respectively. All Strepsiptera and Neuroptera have large insert regions in 18S and 28S. The secondary structure of 18S insert 23 is composed of long stems that are GC rich in the basal Strepsiptera and AT rich in the more derived Strepsiptera. A matrix of 176 morphological characters was analyzed for holometabolous orders. Incongruence length difference tests indicate that the 28S + morphological data sets are incongruent but that 28S + 18S, 18S + morphology, and 28S + 18S + morphology fail to reject the hypothesis of

  7. Ribosomal Protein S14 of Saccharomyces cerevisiae Regulates Its Expression by Binding to RPS14B Pre-mRNA and to 18S rRNA

    PubMed Central

    Fewell, Sheara W.; Woolford, John L.

    1999-01-01

    Production of ribosomal protein S14 in Saccharomyces cerevisiae is coordinated with the rate of ribosome assembly by a feedback mechanism that represses expression of RPS14B. Three-hybrid assays in vivo and filter binding assays in vitro demonstrate that rpS14 directly binds to an RNA stem-loop structure in RPS14B pre-mRNA that is necessary for RPS14B regulation. Moreover, rpS14 binds to a conserved helix in 18S rRNA with approximately five- to sixfold-greater affinity. These results support the model that RPS14B regulation is mediated by direct binding of rpS14 either to its pre-mRNA or to rRNA. Investigation of these interactions with the three-hybrid system reveals two regions of rpS14 that are involved in RNA recognition. D52G and E55G mutations in rpS14 alter the specificity of rpS14 for RNA, as indicated by increased affinity for RPS14B RNA but reduced affinity for the rRNA target. Deletion of the C terminus of rpS14, where multiple antibiotic resistance mutations map, prevents binding of rpS14 to RNA and production of functional 40S subunits. The emetine-resistant protein, rpS14-EmRR, which contains two mutations near the C terminus of rpS14, does not bind either RNA target in the three-hybrid or in vitro assays. This is the first direct demonstration that an antibiotic resistance mutation alters binding of an r protein to rRNA and is consistent with the hypothesis that antibiotic resistance mutations can result from local alterations in rRNA structure. PMID:9858605

  8. PFR²: a curated database of planktonic foraminifera 18S ribosomal DNA as a resource for studies of plankton ecology, biogeography and evolution.

    PubMed

    Morard, Raphaël; Darling, Kate F; Mahé, Frédéric; Audic, Stéphane; Ujiié, Yurika; Weiner, Agnes K M; André, Aurore; Seears, Heidi A; Wade, Christopher M; Quillévéré, Frédéric; Douady, Christophe J; Escarguel, Gilles; de Garidel-Thoron, Thibault; Siccha, Michael; Kucera, Michal; de Vargas, Colomban

    2015-11-01

    Planktonic foraminifera (Rhizaria) are ubiquitous marine pelagic protists producing calcareous shells with conspicuous morphology. They play an important role in the marine carbon cycle, and their exceptional fossil record serves as the basis for biochronostratigraphy and past climate reconstructions. A major worldwide sampling effort over the last two decades has resulted in the establishment of multiple large collections of cryopreserved individual planktonic foraminifera samples. Thousands of 18S rDNA partial sequences have been generated, representing all major known morphological taxa across their worldwide oceanic range. This comprehensive data coverage provides an opportunity to assess patterns of molecular ecology and evolution in a holistic way for an entire group of planktonic protists. We combined all available published and unpublished genetic data to build PFR(2), the Planktonic foraminifera Ribosomal Reference database. The first version of the database includes 3322 reference 18S rDNA sequences belonging to 32 of the 47 known morphospecies of extant planktonic foraminifera, collected from 460 oceanic stations. All sequences have been rigorously taxonomically curated using a six-rank annotation system fully resolved to the morphological species level and linked to a series of metadata. The PFR(2) website, available at http://pfr2.sb-roscoff.fr, allows downloading the entire database or specific sections, as well as the identification of new planktonic foraminiferal sequences. Its novel, fully documented curation process integrates advances in morphological and molecular taxonomy. It allows for an increase in its taxonomic resolution and assures that integrity is maintained by including a complete contingency tracking of annotations and assuring that the annotations remain internally consistent. PMID:25828689

  9. An 18S ribosomal DNA barcode for the study of Isomermis lairdi, a parasite of the blackfly Simulium damnosum s.l.

    PubMed

    Crainey, J L; Wilson, M D; Post, R J

    2009-09-01

    The mermithid parasite, Isomermis lairdi Mondet, Poinar & Bernadou (Nematoda: Mermithidae), is known to have a major impact on populations of Simulium damnosum s.l. Theobald (Diptera: Simuliidae) and on their efficiency as vectors of Onchocerca volvulus (Leuckart) (Nematoda: Filarioidea). However, the value of I. lairdi and other mermithid parasites as potential means of integrated vector control has not been fully realized. This is partly because traditional taxonomic approaches have been insufficient for describing and analysing important aspects of their biology and host range. In total, rDNA barcode sequences have been obtained from over 70 I. lairdi mermithids found parasitizing S. damnosum s.l. larvae in three different rivers. No two sequences were found to vary by more than 0.5%, and cytospecies identification of mermithid hosts revealed that I. lairdi with identical rDNA barcodes can parasitize multiple cytoforms of the S. damnosum complex, including S. squamosum (Enderlein). Phylogenetic analysis using a partial sequence from the 18S ribosomal DNA barcode, grouped I. lairdi in a monophyletic group with Gastromermis viridis Welch (Nematoda: Mermithidae) and Isomermis wisconsinensis Welch (Nematoda: Mermithidae). PMID:19712154

  10. Optimization of PCR—RFLP Directly from the Skin and Nails in Cases of Dermatophytosis, Targeting the ITS and the 18S Ribosomal DNA Regions

    PubMed Central

    Elavarashi, Elangovan; Kindo, Anupma Jyoti; Kalyani, Jagannathan

    2013-01-01

    Purpose: A pan fungal primer targeting the Internal Transcribed Spacer (ITS) region and optimization of PCR-RFLP using a dermatophyte specific primer targeted the 18S ribosomal DNA (rDNA) region were performed for the identification of dermatophyte species and strains directly from clinical specimens. Materials and Methods: One hundred and thirty eight specimens (129 skin scrapings and 9 nail clippings) from clinically suspected cases of dermatophytosis were collected and subjected to direct microscopy and culture. Among them, 66 skin scrapings and 3 nail clippings were processed for genotyping by PCR-RFLP analysis using the Mva I, Hae III and the Dde I restriction enzymes. Results: Of the 138 specimens, 81 specimens were positive for dermatophytosis, the most common one being Trichophyton rubrum (47), followed by Trichophyton mentagrophytes (25) and Epidermophyton floccosum (9). Of the 47 T. rubrum isolates, 10 were T. rubrum var. raubitschekii which were identified phenotypically as urease positive and by DNA sequencing. Since they exhibited minor morphological and physiological features, they have currently been synonymized with T. rubrum. Of the 25 T. mentagrophytes isolates, three were Trichophyton interdigitale, which were identified by DNA sequencing. Among the 66 skin specimens smear, culture and PCR showed the presence of dermatophytes in 36 (54.54%), 42 (63.63%) and 47 (71.21%) cases respectively. Among the three nail specimens, only one was found to be positive for dermatophytosis by smear, culture and PCR. Conclusion: Amplification of the dermatophyte specific primer is appropriate in the identification of dermatophytes directly from the clinical material. PCR targeting the ITS region by using the Mva I and the Dde I enzymes was equally good for the RFLP analysis. However, by using the above three restriction enzymes, no strain variations were detected among the T. rubrum and the T. mentagrophytes strains. PMID:23730638

  11. WBSCR22/Merm1 is required for late nuclear pre-ribosomal RNA processing and mediates N7-methylation of G1639 in human 18S rRNA

    PubMed Central

    Haag, Sara; Kretschmer, Jens

    2015-01-01

    Ribosomal (r)RNAs are extensively modified during ribosome synthesis and their modification is required for the fidelity and efficiency of translation. Besides numerous small nucleolar RNA-guided 2′-O methylations and pseudouridinylations, a number of individual RNA methyltransferases are involved in rRNA modification. WBSCR22/Merm1, which is affected in Williams–Beuren syndrome and has been implicated in tumorigenesis and metastasis formation, was recently shown to be involved in ribosome synthesis, but its molecular functions have remained elusive. Here we show that depletion of WBSCR22 leads to nuclear accumulation of 3′-extended 18SE pre-rRNA intermediates resulting in impaired 18S rRNA maturation. We map the 3′ ends of the 18SE pre-rRNA intermediates accumulating after depletion of WBSCR22 and in control cells using 3′-RACE and deep sequencing. Furthermore, we demonstrate that WBSCR22 is required for N7-methylation of G1639 in human 18S rRNA in vivo. Interestingly, the catalytic activity of WBSCR22 is not required for 18S pre-rRNA processing, suggesting that the key role of WBSCR22 in 40S subunit biogenesis is independent of its function as an RNA methyltransferase. PMID:25525153

  12. Characterization of three different clusters of 18S-26S ribosomal DNA genes in the sea urchin P. lividus: Genetic and epigenetic regulation synchronous to 5S rDNA.

    PubMed

    Bellavia, Daniele; Dimarco, Eufrosina; Caradonna, Fabio

    2016-04-15

    We previously reported the characterization 5S ribosomal DNA (rDNA) clusters in the common sea urchin Paracentrotus lividus and demonstrated the presence of DNA methylation-dependent silencing of embryo specific 5S rDNA cluster in adult tissue. In this work, we show genetic and epigenetic characterization of 18S-26S rDNA clusters in this specie. The results indicate the presence of three different 18S-26S rDNA clusters with different Non-Transcribed Spacer (NTS) regions that have different chromosomal localizations. Moreover, we show that the two largest clusters are hyper-methylated in the promoter-containing NTS regions in adult tissues, as in the 5S rDNA. These findings demonstrate an analogous epigenetic regulation in small and large rDNA clusters and support the logical synchronism in building ribosomes. In fact, all the ribosomal RNA genes must be synchronously and equally transcribed to perform their unique final product. PMID:26789074

  13. PCR amplification of a multi-copy mitochondrial gene (cox3) improves detection of Cytauxzoon felis infection as compared to a ribosomal gene (18S).

    PubMed

    Schreeg, Megan E; Marr, Henry S; Griffith, Emily H; Tarigo, Jaime L; Bird, David M; Reichard, Mason V; Cohn, Leah A; Levy, Michael G; Birkenheuer, Adam J

    2016-07-30

    Cytauxzoon felis is a tick-transmitted protozoan parasite that infects felids. Clinical disease caused by acute C. felis infection rapidly progresses in domestic cats, leading to high morbidity and mortality. Accurately diagnosing cytauxzoonosis as soon as possible during acute infection would allow for earlier initiation of antiprotozoal therapy which could lead to higher survival rates. Molecular detection of parasite rRNA genes (18S) by PCR has previously been shown to be a sensitive method of diagnosing C. felis infections. Based on evidence from related apicomplexan species, we hypothesized that C. felis mitochondrial genes would exist at higher copy numbers than 18S and would be a more sensitive diagnostic target. In this study we have designed a PCR assay targeting the C. felis mitochondrial gene cytochrome c oxidase subunit III (cox3). Herein we demonstrate that (1) the cox3 PCR can detect as low as 1 copy of DNA target and can detect C. felis in samples with known mitochondrial sequence heterogeneity, (2) cox3 copy number is increased relative to 18S in blood and tissue samples from acutely infected cats, and (3) the cox3 PCR is more sensitive than 18S PCR for detection of C. felis during early infections. PMID:27369587

  14. Both the Exact Target Site Sequence and a Long Poly(A) Tail Are Required for Precise Insertion of the 18S Ribosomal DNA-Specific Non-Long Terminal Repeat Retrotransposon R7Ag.

    PubMed

    Nichuguti, Narisu; Hayase, Mayumi; Fujiwara, Haruhiko

    2016-05-15

    Ribosomal elements (R elements) are site-specific non-long terminal repeat (LTR) retrotransposons that target ribosomal DNA (rDNA). To elucidate how R elements specifically access their target sites, we isolated and characterized the 18S rDNA-specific R element R7Ag from Anopheles gambiae Using an in vivo and ex vivo recombinant baculovirus retrotransposition system, we found that the exact host 18S rDNA sequence at the target site is essential for the precise insertion of R7Ag. In addition, a long poly(A) tail is necessary for the accurate initiation of R7Ag reverse transcription, a novel mechanism found in non-LTR elements. We further compared the subcellular localizations of proteins in R7Ag as well as R1Bm, another R element that targets 28S rDNA. Although the open reading frame 1 proteins (ORF1ps) of both R7Ag and R1Bm localized predominantly in the cytoplasm, ORF2 proteins (ORF2ps) colocalized in the nucleus with the nucleolar marker fibrillarin. The ORF1ps and ORF2ps of both R elements colocalized largely in the nuclear periphery and to a lesser extent within the nucleus. These results suggest that R7Ag and R1Bm proteins may access nucleolar rDNA targets in an ORF2p-dependent manner. PMID:26976636

  15. Fungal community analysis in the deep-sea sediments of the Pacific Ocean assessed by comparison of ITS, 18S and 28S ribosomal DNA regions

    NASA Astrophysics Data System (ADS)

    Xu, Wei; Luo, Zhu-Hua; Guo, Shuangshuang; Pang, Ka-Lai

    2016-03-01

    We investigated the diversity of fungal communities in 6 different deep-sea sediment samples of the Pacific Ocean based on three different types of clone libraries, including internal transcribed spacer (ITS), 18S rDNA, and 28S rDNA regions. A total of 1978 clones were generated from 18 environmental clone libraries, resulting in 140 fungal operational taxonomic units (OTUs), including 18 OTUs from ITS, 44 OTUs from 18S rDNA, and 78 OTUs from 28S rDNA gene primer sets. The majority of the recovered sequences belonged to diverse phylotypes of the Ascomycota and Basidiomycota. Additionally, our study revealed a total of 46 novel fungal phylotypes, which showed low similarities (<97%) with available fungal sequences in the GenBank, including a novel Zygomycete lineage, suggesting possible new fungal taxa occurring in the deep-sea sediments. The results suggested that 28S rDNA is an efficient target gene to describe fungal community in deep-sea environment.

  16. Phylogenetic position of the yeast-like symbiotes of Tagosodes orizicolus (Homoptera: Delphacidae) based on 18S ribosomal DNA partial sequences.

    PubMed

    Xet-Mull, Ana M; Quesada, Tania; Espinoza, Ana M

    2004-09-01

    Tagosodes orizicolus Muir (Homoptera: Delphacidae), the endemic delphacid species of tropical America carries yeast-like symbiotes (YLS) in the abdominal fat bodies and the ovarial tissues, like other rice planthoppers of Asia. These YLS are obligate symbiotes, which are transmitted transovarially, and maintain a mutualistic relationship with the insect host. This characteristic has made in vitro culture and classification of YLS rather difficult using conventional methods. Nevertheless, microorganisms of similar characteristics have been successfully classified by using molecular taxonomy. In the present work, the YLS of Tagosodes orizicolus (YLSTo) were purified on Percoll gradients, and specific segments of 18S rDNA were amplified by PCR, cloned and sequenced. Sequences were aligned by means of the CLUSTAL V (DNASTAR) program; phylogenetic trees were constructed with the Phylogeny Inference Package (PHYLIP), showing that YLSTo belong to the fungi class Pyrenomycetes, phylum Ascomycota. Similarities between 98% and 100% were observed among YLS of the rice delphacids Tagosodes orizicolus, Nilaparvata lugens, Laodelphax striatellus and Sogatella fur cifera, and between 89.8% and 90.8% when comparing the above to YLS of the aphid Hamiltonaphis styraci. These comparisons revealed that delphacid YLS are a highly conserved monophyletic group within the Pyrenomycetes and are closely related to Hypomyces chrysospermus. PMID:17361570

  17. Wide genetic variations at 18S ribosomal RNA locus of Cyclospora cayetanensis isolated from Egyptian patients using high resolution melting curve.

    PubMed

    Hussein, Eman M; El-Moamly, Amal A; Mahmoud, Moushira A; Ateek, Nayera S

    2016-07-01

    A variable clinical picture of cyclosporiasis including gastrointestinal tract (GIT) symptomatic or asymptomatic beside extraintestinal consequences suggests a possibility of heterogenicity of Cyclospora cayetanensis. The present work aimed to explore the possibility of genetic variation of C. cayetanensis using high-resolution melting (HRM) curve of polymerase chain reaction (PCR) amplified 18S rRNA genes. DNAs extracted from the stool samples of 70 cyclosporiasis patients were amplified and scanned by PCR/HRM curve. The results showed that there are four different genotypic profiles of C. cayetanensis with presence of mixed ones. Although Tm of all profiles was within the same range, they were discerned by plotting of the temperature-shifted florescence difference between normalized melting curves (dF/dT). Genotypic profile I was found alone in 40 % of patients and mixed with genotypic profile II and/or III in 25.7 % of patients, followed by genotypic profile II in 14.3 % then genotypic profile III and IV (10 % each). A significant relation was found between genotypic profiles and GIT symptomatic status as profile I and profile II were mostly detected in patients with acute GIT symptoms without or with chronic illness, respectively, while profile IV cases only were GIT asymptomatic. Statistical significance relations between genotypic profiles and age, gender, residence and oocyst shape index were determined. In conclusion, PCR/HRM proved a wide variation on C. cayetanensis genes that could be reflected on its pathogenic effects and explaining the variability of the clinical manifestations presented by cyclosporiasis patients. PMID:27041342

  18. Intragenomic sequence variation at the ITS1 - ITS2 region and at the 18S and 28S nuclear ribosomal DNA genes of the New Zealand mud snail, Potamopyrgus antipodarum (Hydrobiidae: mollusca)

    USGS Publications Warehouse

    Hoy, Marshal S.; Rodriguez, Rusty J.

    2013-01-01

    Molecular genetic analysis was conducted on two populations of the invasive non-native New Zealand mud snail (Potamopyrgus antipodarum), one from a freshwater ecosystem in Devil's Lake (Oregon, USA) and the other from an ecosystem of higher salinity in the Columbia River estuary (Hammond Harbor, Oregon, USA). To elucidate potential genetic differences between the two populations, three segments of nuclear ribosomal DNA (rDNA), the ITS1-ITS2 regions and the 18S and 28S rDNA genes were cloned and sequenced. Variant sequences within each individual were found in all three rDNA segments. Folding models were utilized for secondary structure analysis and results indicated that there were many sequences which contained structure-altering polymorphisms, which suggests they could be nonfunctional pseudogenes. In addition, analysis of molecular variance (AMOVA) was used for hierarchical analysis of genetic variance to estimate variation within and among populations and within individuals. AMOVA revealed significant variation in the ITS region between the populations and among clones within individuals, while in the 5.8S rDNA significant variation was revealed among individuals within the two populations. High levels of intragenomic variation were found in the ITS regions, which are known to be highly variable in many organisms. More interestingly, intragenomic variation was also found in the 18S and 28S rDNA, which has rarely been observed in animals and is so far unreported in Mollusca. We postulate that in these P. antipodarum populations the effects of concerted evolution are diminished due to the fact that not all of the rDNA genes in their polyploid genome should be essential for sustaining cellular function. This could lead to a lessening of selection pressures, allowing mutations to accumulate in some copies, changing them into variant sequences.                   

  19. Three Group-I introns in 18S rDNA of Endosymbiotic Algae of Paramecium bursaria from Japan

    NASA Astrophysics Data System (ADS)

    Hoshina, Ryo; Kamako, Shin-ichiro; Imamura, Nobutaka

    2004-08-01

    In the nuclear encoded small subunit ribosomal DNA (18S rDNA) of symbiotic alga of Paramecium bursaria (F36 collected in Japan) possesses three intron-like insertions (Hoshina et al., unpubl. data, 2003). The present study confirmed these exact lengths and insertion sites by reverse transcription-PCR. Two of them were inserted at Escherichia coli 16S rRNA genic position 943 and 1512 that are frequent intron insertion positions, but another insertion position (nearly 1370) was the first finding. Their secondary structures suggested they belong to Group-I intron; one belongs to subgroup IE, others belong to subgroup IC1. Similarity search indicated these introns are ancestral ones.

  20. Dasytricha dominance in Surti buffalo rumen revealed by 18S rRNA sequences and real-time PCR assay.

    PubMed

    Singh, K M; Tripathi, A K; Pandya, P R; Rank, D N; Kothari, R K; Joshi, C G

    2011-09-01

    The genetic diversity of protozoa in Surti buffalo rumen was studied by amplified ribosomal DNA restriction analysis, 18S rDNA sequence homology and phylogenetic and Real-time PCR analysis methods. Three animals were fed diet comprised green fodder Napier bajra 21 (Pennisetum purpureum), mature pasture grass (Dicanthium annulatum) and concentrate mixture (20% crude protein, 65% total digestible nutrients). A protozoa-specific primer (P-SSU-342f) and a eukarya-specific primer (Medlin B) were used to amplify a 1,360 bp fragment of DNA encoding protozoal small subunit (SSU) ribosomal RNA from rumen fluid. A total of 91 clones were examined and identified 14 different 18S RNA sequences based on PCR-RFLP pattern. These 14 phylotypes were distributed into four genera-based 18S rDNA database sequences and identified as Dasytricha (57 clones), Isotricha (14 clones), Ostracodinium (11 clones) and Polyplastron (9 clones). Phylogenetic analyses were also used to infer the makeup of protozoa communities in the rumen of Surti buffalo. Out of 14 sequences, 8 sequences (69 clones) clustered with the Dasytricha ruminantium-like clone and 4 sequences (13 clones) were also phylogenetically placed with the Isotricha prostoma-like clone. Moreover, 2 phylotypes (9 clones) were related to Polyplastron multivesiculatum-like clone. In addition, the number of 18S rDNA gene copies of Dasytricha ruminantium (0.05% to ciliate protozoa) was higher than Entodinium sp. (2.0 × 10(5) vs. 1.3 × 10(4)) in per ml ruminal fluid. PMID:21744288

  1. Paradigms of ribosome synthesis: Lessons learned from ribosomal proteins

    PubMed Central

    Gamalinda, Michael; Woolford, John L

    2015-01-01

    The proteome in all cells is manufactured via the intricate process of translation by multimolecular factories called ribosomes. Nevertheless, these ribonucleoprotein particles, the largest of their kind, also have an elaborate assembly line of their own. Groundbreaking discoveries that bacterial ribosomal subunits can be self-assembled in vitro jumpstarted studies on how ribosomes are constructed. Until recently, ribosome assembly has been investigated almost entirely in vitro with bacterial small subunits under equilibrium conditions. In light of high-resolution ribosome structures and a more sophisticated toolkit, the past decade has been defined by a burst of kinetic studies in vitro and, importantly, also a shift to examining ribosome maturation in living cells, especially in eukaryotes. In this review, we summarize the principles governing ribosome assembly that emerged from studies focusing on ribosomal proteins and their interactions with rRNA. Understanding these paradigms has taken center stage, given the linkage between anomalous ribosome biogenesis and proliferative disorders. PMID:26779413

  2. A tRNA methyltransferase paralog is important for ribosome stability and cell division in Trypanosoma brucei.

    PubMed

    Fleming, Ian M C; Paris, Zdeněk; Gaston, Kirk W; Balakrishnan, R; Fredrick, Kurt; Rubio, Mary Anne T; Alfonzo, Juan D

    2016-01-01

    Most eukaryotic ribosomes contain 26/28S, 5S, and 5.8S large subunit ribosomal RNAs (LSU rRNAs) in addition to the 18S rRNA of the small subunit (SSU rRNA). However, in kinetoplastids, a group of organisms that include medically important members of the genus Trypanosoma and Leishmania, the 26/28S large subunit ribosomal RNA is uniquely composed of 6 rRNA fragments. In addition, recent studies have shown the presence of expansion segments in the large ribosomal subunit (60S) of Trypanosoma brucei. Given these differences in structure, processing and assembly, T. brucei ribosomes may require biogenesis factors not found in other organisms. Here, we show that one of two putative 3-methylcytidine methyltransferases, TbMTase37 (a homolog of human methyltransferase-like 6, METTL6), is important for ribosome stability in T. brucei. TbMTase37 localizes to the nucleolus and depletion of the protein results in accumulation of ribosomal particles lacking srRNA 4 and reduced levels of polysome associated ribosomes. We also find that TbMTase37 plays a role in cytokinesis, as loss of the protein leads to multi-flagellated and multi-nucleated cells. PMID:26888608

  3. A tRNA methyltransferase paralog is important for ribosome stability and cell division in Trypanosoma brucei

    PubMed Central

    Fleming, Ian M. C.; Paris, Zdeněk; Gaston, Kirk W.; Balakrishnan, R.; Fredrick, Kurt; Rubio, Mary Anne T.; Alfonzo, Juan D.

    2016-01-01

    Most eukaryotic ribosomes contain 26/28S, 5S, and 5.8S large subunit ribosomal RNAs (LSU rRNAs) in addition to the 18S rRNA of the small subunit (SSU rRNA). However, in kinetoplastids, a group of organisms that include medically important members of the genus Trypanosoma and Leishmania, the 26/28S large subunit ribosomal RNA is uniquely composed of 6 rRNA fragments. In addition, recent studies have shown the presence of expansion segments in the large ribosomal subunit (60S) of Trypanosoma brucei. Given these differences in structure, processing and assembly, T. brucei ribosomes may require biogenesis factors not found in other organisms. Here, we show that one of two putative 3-methylcytidine methyltransferases, TbMTase37 (a homolog of human methyltransferase-like 6, METTL6), is important for ribosome stability in T. brucei. TbMTase37 localizes to the nucleolus and depletion of the protein results in accumulation of ribosomal particles lacking srRNA 4 and reduced levels of polysome associated ribosomes. We also find that TbMTase37 plays a role in cytokinesis, as loss of the protein leads to multi-flagellated and multi-nucleated cells. PMID:26888608

  4. UtpA and UtpB chaperone nascent pre-ribosomal RNA and U3 snoRNA to initiate eukaryotic ribosome assembly

    PubMed Central

    Hunziker, Mirjam; Barandun, Jonas; Petfalski, Elisabeth; Tan, Dongyan; Delan-Forino, Clémentine; Molloy, Kelly R.; Kim, Kelly H.; Dunn-Davies, Hywel; Shi, Yi; Chaker-Margot, Malik; Chait, Brian T.; Walz, Thomas; Tollervey, David; Klinge, Sebastian

    2016-01-01

    Early eukaryotic ribosome biogenesis involves large multi-protein complexes, which co-transcriptionally associate with pre-ribosomal RNA to form the small subunit processome. The precise mechanisms by which two of the largest multi-protein complexes—UtpA and UtpB—interact with nascent pre-ribosomal RNA are poorly understood. Here, we combined biochemical and structural biology approaches with ensembles of RNA–protein cross-linking data to elucidate the essential functions of both complexes. We show that UtpA contains a large composite RNA-binding site and captures the 5′ end of pre-ribosomal RNA. UtpB forms an extended structure that binds early pre-ribosomal intermediates in close proximity to architectural sites such as an RNA duplex formed by the 5′ ETS and U3 snoRNA as well as the 3′ boundary of the 18S rRNA. Both complexes therefore act as vital RNA chaperones to initiate eukaryotic ribosome assembly. PMID:27354316

  5. UtpA and UtpB chaperone nascent pre-ribosomal RNA and U3 snoRNA to initiate eukaryotic ribosome assembly

    NASA Astrophysics Data System (ADS)

    Hunziker, Mirjam; Barandun, Jonas; Petfalski, Elisabeth; Tan, Dongyan; Delan-Forino, Clémentine; Molloy, Kelly R.; Kim, Kelly H.; Dunn-Davies, Hywel; Shi, Yi; Chaker-Margot, Malik; Chait, Brian T.; Walz, Thomas; Tollervey, David; Klinge, Sebastian

    2016-06-01

    Early eukaryotic ribosome biogenesis involves large multi-protein complexes, which co-transcriptionally associate with pre-ribosomal RNA to form the small subunit processome. The precise mechanisms by which two of the largest multi-protein complexes--UtpA and UtpB--interact with nascent pre-ribosomal RNA are poorly understood. Here, we combined biochemical and structural biology approaches with ensembles of RNA-protein cross-linking data to elucidate the essential functions of both complexes. We show that UtpA contains a large composite RNA-binding site and captures the 5' end of pre-ribosomal RNA. UtpB forms an extended structure that binds early pre-ribosomal intermediates in close proximity to architectural sites such as an RNA duplex formed by the 5' ETS and U3 snoRNA as well as the 3' boundary of the 18S rRNA. Both complexes therefore act as vital RNA chaperones to initiate eukaryotic ribosome assembly.

  6. Molecular phylogenetic analysis among bryophytes and tracheophytes based on combined data of plastid coded genes and the 18S rRNA gene.

    PubMed

    Nishiyama, T; Kato, M

    1999-08-01

    The basal relationship of bryophytes and tracheophytes is problematic in land plant phylogeny. In addition to cladistic analyses of morphological data, molecular phylogenetic analyses of the nuclear small-subunit ribosomal RNA gene and the plastic gene rbcL have been performed, but no confident conclusions have been reached. Using the maximum-likelihood (ML) method, we analyzed 4,563 bp of aligned sequences from plastid protein-coding genes and 1,680 bp from the nuclear 18S rRNA gene. In the ML tree of deduced amino acid sequences of the plastid genes, hornworts were basal among the land plants, while mosses and liverworts each formed a clade and were sister to each other. Total-evidence evaluation of rRNA data and plastid protein-coding genes by TOTALML had an almost identical result. PMID:10474899

  7. Yeast Kre33 and human NAT10 are conserved 18S rRNA cytosine acetyltransferases that modify tRNAs assisted by the adaptor Tan1/THUMPD1

    PubMed Central

    Sharma, Sunny; Langhendries, Jean-Louis; Watzinger, Peter; Kötter, Peter; Entian, Karl-Dieter; Lafontaine, Denis L.J.

    2015-01-01

    The function of RNA is subtly modulated by post-transcriptional modifications. Here, we report an important crosstalk in the covalent modification of two classes of RNAs. We demonstrate that yeast Kre33 and human NAT10 are RNA cytosine acetyltransferases with, surprisingly, specificity toward both 18S rRNA and tRNAs. tRNA acetylation requires the intervention of a specific and conserved adaptor: yeast Tan1/human THUMPD1. In budding and fission yeasts, and in human cells, we found two acetylated cytosines on 18S rRNA, one in helix 34 important for translation accuracy and another in helix 45 near the decoding site. Efficient 18S rRNA acetylation in helix 45 involves, in human cells, the vertebrate-specific box C/D snoRNA U13, which, we suggest, exposes the substrate cytosine to modification through Watson–Crick base pairing with 18S rRNA precursors during small subunit biogenesis. Finally, while Kre33 and NAT10 are essential for pre-rRNA processing reactions leading to 18S rRNA synthesis, we demonstrate that rRNA acetylation is dispensable to yeast cells growth. The inactivation of NAT10 was suggested to suppress nuclear morphological defects observed in laminopathic patient cells through loss of microtubules modification and cytoskeleton reorganization. We rather propose the effects of NAT10 on laminopathic cells are due to reduced ribosome biogenesis or function. PMID:25653167

  8. Yeast Kre33 and human NAT10 are conserved 18S rRNA cytosine acetyltransferases that modify tRNAs assisted by the adaptor Tan1/THUMPD1.

    PubMed

    Sharma, Sunny; Langhendries, Jean-Louis; Watzinger, Peter; Kötter, Peter; Entian, Karl-Dieter; Lafontaine, Denis L J

    2015-02-27

    The function of RNA is subtly modulated by post-transcriptional modifications. Here, we report an important crosstalk in the covalent modification of two classes of RNAs. We demonstrate that yeast Kre33 and human NAT10 are RNA cytosine acetyltransferases with, surprisingly, specificity toward both 18S rRNA and tRNAs. tRNA acetylation requires the intervention of a specific and conserved adaptor: yeast Tan1/human THUMPD1. In budding and fission yeasts, and in human cells, we found two acetylated cytosines on 18S rRNA, one in helix 34 important for translation accuracy and another in helix 45 near the decoding site. Efficient 18S rRNA acetylation in helix 45 involves, in human cells, the vertebrate-specific box C/D snoRNA U13, which, we suggest, exposes the substrate cytosine to modification through Watson-Crick base pairing with 18S rRNA precursors during small subunit biogenesis. Finally, while Kre33 and NAT10 are essential for pre-rRNA processing reactions leading to 18S rRNA synthesis, we demonstrate that rRNA acetylation is dispensable to yeast cells growth. The inactivation of NAT10 was suggested to suppress nuclear morphological defects observed in laminopathic patient cells through loss of microtubules modification and cytoskeleton reorganization. We rather propose the effects of NAT10 on laminopathic cells are due to reduced ribosome biogenesis or function. PMID:25653167

  9. Phylogenetic relationships of land plants using mitochondrial small-subunit rDNA sequences.

    PubMed

    Duff, R J; Nickrent, D L

    1999-03-01

    Phylogenetic relationships among embryophytes (tracheophytes, mosses, liverworts, and hornworts) were examined using 21 newly generated mitochondrial small-subunit (19S) rDNA sequences. The "core" 19S rDNA contained more phylogenetically informative sites and lower homoplasy than either nuclear 18S or plastid 16S rDNA. Results of phylogenetic analyses using parsimony (MP) and likelihood (ML) were generally congruent. Using MP, two trees were obtained that resolved either liverworts or hornworts as the basal land plant clade. The optimal ML tree showed hornworts as basal. That topology was not statistically different from the two MP trees, thus both appear to be equally viable evolutionary hypotheses. High bootstrap support was obtained for the majority of higher level embryophyte clades named in a recent morphologically based classification, e.g., Tracheophyta, Euphyllophytina, Lycophytina, and Spermatophytata. Strong support was also obtained for the following monophyletic groups: hornworts, liverworts, mosses, lycopsids, leptosporangiate and eusporangiate ferns, gymnosperms and angiosperms. This molecular analysis supported a sister relationship between Equisetum and leptosporangiate ferns and a monophyletic gymnosperms sister to angiosperms. The topologies of deeper clades were affected by taxon inclusion (particularly hornworts) as demonstrated by jackknife analyses. This study represents the first use of mitochondrial 19S rDNA for phylogenetic purposes and it appears well-suited for examining intermediate to deep evolutionary relationships among embryophytes. PMID:10077500

  10. The phylogenetic relationships of Rhodosporidium dacryoidum Fell, Hunter et Tallman based on the partial sequences of 18S and 26S ribosomal RNAs: the proposal of Sakaguchia gen. nov., a heterobasidiomycetous yeast genus.

    PubMed

    Yamada, Y; Maeda, K; Mikata, K

    1994-01-01

    The partial base sequences of 18S and 26S rRNAs of Rhodosporidium fluviale, R. lusitaniae, and Erythrobasidium hasegawianum were analyzed. In the 26S rRNA partial base sequencings, R. fluviale CBS 6568 and R. lusitaniae IGC 4599 and IGC 4641 had 81-82 and 77 percent similarities compared with R. toruloides (type species of genus Rhodosporidium) IFO 0559 and IFO 0880. Erythrobasidium hasegawianum IFO 1058 showed 69-71, 59, 63, and 61 percent similarities with R. toruloides IFO 0559 and IFO 0880, L. scottii (type species of genus Leucosporidium) IFO 1923, R. dacryoidum IFO 1930 and IFO 1931, and Kondoa malvinella IFO 1936, respectively. In the 18S rRNA partial base sequencings, R. fluviale CBS 6568 and R. lusitaniae IGC 4599 and IGC 4641 had zero and two base differences with R. toruloides. Erythrobasidium hasegawianum IFO 1058 showed ten, sixteen, three, and twenty base differences with R. toruloides IFO 0559 and IFO 0880, L. scottii IFO 1923, R. dacryoidum IFO 1930 and IFO 1931, and K. malvinella IFO 1936, respectively. Based on the sequence data obtained, a new genus, Sakaguchia was proposed for R. dacryoidum with a new combination, Sakaguchia dacryoides. PMID:7765151

  11. Plasmids containing small subunit ribosomal RNA gene fragments from Babesia bovis and Babesia bigemina

    Technology Transfer Automated Retrieval System (TEKTRAN)

    BEI Resources was developed by NIAID as a centralized biological resource center for research reagents to the scientific community (http://www.beiresources.org/). They have a considerable amount of reagents and isolates for parasitologists working with Entamoeba histolytica, Giardia, Toxoplasma, and...

  12. Collection of small subunit (16S- and 16S-like) ribosomal RNA structures: 1994.

    PubMed Central

    Gutell, R R

    1994-01-01

    A collection of diverse 16S and 16S-like rRNA secondary structure diagrams are available. This set of rRNAs contains representative structures from all of the major phylogenetic groupings--Archaea, (eu)Bacteria, and the nucleus, mitochondrion, and chloroplast of Eucarya. Within this broad phylogenetic sampling are examples of the major forms of structural diversity currently known for this class of rRNAs. These structure diagrams are available online through our computer-network WWW server and anonymous ftp, as well as from the author in hardcopy format. PMID:7524024

  13. PHYLOGENETIC ANALYSIS OF CRYPTOSPORIDIUM PARASITES BASED ON THE SMALL SUBUNIT RIBOSOMAL RNA GENE LOCUS

    EPA Science Inventory

    ABSTRACT
    Biologic data support the presence of multiple species in the genus Cryptosporidium, but
    a recent analysis of the available genetic data has suggested that there is insufficient evidence for species differentiation. In order to resolve the controversy in the taxono...

  14. Soybean ribulose bisphosphate carboxylase small subunit: Mechanisms and determinants on RNA turnover: Progress report, May 1988--December 1988

    SciTech Connect

    Meagher, R.

    1989-01-01

    The goal of this work is to elucidate the mechanisms and determinants behind the light induced turnover and general chemical instability of Rubisco small subunit (SSU) RNA. Three approaches are being used: (A) to use molecular physiology to help define the phenomena and identify the possible cellular machinery involved in these processes; (B) SSU RNA stability will be assayed in transgenic plants; and (C) in vivo RNA structure is being examined via chemical modification of RNA. The tremendous success we have had with assaying in vivo RNA structure by DMS modification and a need to validate this technique with sufficient controls has resulted in our adding an additional goal to the project: to develop a DMS modification map of 18S rRNA and portions of Rubisco SSU RNA and predict a potential secondary structures.

  15. Autophagy induction is a Tor- and Tp53-independent cell survival response in a zebrafish model of disrupted ribosome biogenesis.

    PubMed

    Boglev, Yeliz; Badrock, Andrew P; Trotter, Andrew J; Du, Qian; Richardson, Elsbeth J; Parslow, Adam C; Markmiller, Sebastian J; Hall, Nathan E; de Jong-Curtain, Tanya A; Ng, Annie Y; Verkade, Heather; Ober, Elke A; Field, Holly A; Shin, Donghun; Shin, Chong H; Hannan, Katherine M; Hannan, Ross D; Pearson, Richard B; Kim, Seok-Hyung; Ess, Kevin C; Lieschke, Graham J; Stainier, Didier Y R; Heath, Joan K

    2013-01-01

    Ribosome biogenesis underpins cell growth and division. Disruptions in ribosome biogenesis and translation initiation are deleterious to development and underlie a spectrum of diseases known collectively as ribosomopathies. Here, we describe a novel zebrafish mutant, titania (tti(s450)), which harbours a recessive lethal mutation in pwp2h, a gene encoding a protein component of the small subunit processome. The biochemical impacts of this lesion are decreased production of mature 18S rRNA molecules, activation of Tp53, and impaired ribosome biogenesis. In tti(s450), the growth of the endodermal organs, eyes, brain, and craniofacial structures is severely arrested and autophagy is up-regulated, allowing intestinal epithelial cells to evade cell death. Inhibiting autophagy in tti(s450) larvae markedly reduces their lifespan. Somewhat surprisingly, autophagy induction in tti(s450) larvae is independent of the state of the Tor pathway and proceeds unabated in Tp53-mutant larvae. These data demonstrate that autophagy is a survival mechanism invoked in response to ribosomal stress. This response may be of relevance to therapeutic strategies aimed at killing cancer cells by targeting ribosome biogenesis. In certain contexts, these treatments may promote autophagy and contribute to cancer cells evading cell death. PMID:23408911

  16. The utility of diversity profiling using Illumina 18S rRNA gene amplicon deep sequencing to detect and discriminate Toxoplasma gondii among the cyst-forming coccidia.

    PubMed

    Cooper, Madalyn K; Phalen, David N; Donahoe, Shannon L; Rose, Karrie; Šlapeta, Jan

    2016-01-30

    Next-generation sequencing (NGS) has the capacity to screen a single DNA sample and detect pathogen DNA from thousands of host DNA sequence reads, making it a versatile and informative tool for investigation of pathogens in diseased animals. The technique is effective and labor saving in the initial identification of pathogens, and will complement conventional diagnostic tests to associate the candidate pathogen with a disease process. In this report, we investigated the utility of the diversity profiling NGS approach using Illumina small subunit ribosomal RNA (18S rRNA) gene amplicon deep sequencing to detect Toxoplasma gondii in previously confirmed cases of toxoplasmosis. We then tested the diagnostic approach with species-specific PCR genotyping, histopathology and immunohistochemistry of toxoplasmosis in a Risso's dolphin (Grampus griseus) to systematically characterise the disease and associate causality. We show that the Euk7A/Euk570R primer set targeting the V1-V3 hypervariable region of the 18S rRNA gene can be used as a species-specific assay for cyst-forming coccidia and discriminate T. gondii. Overall, the approach is cost-effective and improves diagnostic decision support by narrowing the differential diagnosis list with more certainty than was previously possible. Furthermore, it supplements the limitations of cryptic protozoan morphology and surpasses the need for species-specific PCR primer combinations. PMID:26801593

  17. Structure of Csm2 elucidates the relationship between small subunits of CRISPR-Cas effector complexes.

    PubMed

    Venclovas, Česlovas

    2016-05-01

    Type I and type III CRISPR-Cas effector complexes share similar architecture and have homologous key subunits. However, the relationship between the so-called small subunits of these complexes remains a contentious issue. Here, it is shown that the recently solved structure of Thermotoga maritima Csm2 represents a dimer with the extensive structure swapping between monomers. Unswapping the structure generates a compact globular monomer which shares similar structure and surface properties with Cmr5, the small subunit of a related Cmr complex. Detailed analysis of available structures of small subunits reveals that they all have a common fold suggesting their common origin. PMID:27091242

  18. Functional Role of Ribosomal Signatures

    PubMed Central

    Chen, Ke; Eargle, John; Sarkar, Krishnarjun; Gruebele, Martin; Luthey-Schulten, Zaida

    2010-01-01

    Although structure and sequence signatures in ribosomal RNA and proteins are defining characteristics of the three domains of life and instrumental in constructing the modern phylogeny, little is known about their functional roles in the ribosome. In this work, the largest coevolving RNA/protein signatures in the bacterial 30S ribosome are investigated both experimentally and computationally through all-atom molecular-dynamics simulations. The complex includes the N-terminal fragment of the ribosomal protein S4, which is a primary binding protein that initiates 30S small subunit assembly from the 5′ domain, and helix 16 (h16), which is part of the five-way junction in 16S rRNA. Our results show that the S4 N-terminus signature is intrinsically disordered in solution, whereas h16 is relatively stable by itself. The dynamic disordered property of the protein is exploited to couple the folding and binding process to the five-way junction, and the results provide insight into the mechanism for the early and fast binding of S4 in the assembly of the ribosomal small subunit. PMID:21156135

  19. Evaluation of nearest-neighbor methods for detection of chimeric small-subunit rRNA sequences

    NASA Technical Reports Server (NTRS)

    Robison-Cox, J. F.; Bateson, M. M.; Ward, D. M.

    1995-01-01

    Detection of chimeric artifacts formed when PCR is used to retrieve naturally occurring small-subunit (SSU) rRNA sequences may rely on demonstrating that different sequence domains have different phylogenetic affiliations. We evaluated the CHECK_CHIMERA method of the Ribosomal Database Project and another method which we developed, both based on determining nearest neighbors of different sequence domains, for their ability to discern artificially generated SSU rRNA chimeras from authentic Ribosomal Database Project sequences. The reliability of both methods decreases when the parental sequences which contribute to chimera formation are more than 82 to 84% similar. Detection is also complicated by the occurrence of authentic SSU rRNA sequences that behave like chimeras. We developed a naive statistical test based on CHECK_CHIMERA output and used it to evaluate previously reported SSU rRNA chimeras. Application of this test also suggests that chimeras might be formed by retrieving SSU rRNAs as cDNA. The amount of uncertainty associated with nearest-neighbor analyses indicates that such tests alone are insufficient and that better methods are needed.

  20. Transcriptional regulation of a gene encoding the small subunit of ribulose-1,5-bisphosphate carboxylase in soybean tissue is linked to the phytochrome response.

    PubMed Central

    Berry-Lowe, S L; Meagher, R B

    1985-01-01

    The effects of white light, far-red light, and darkness on the transcription of a soybean ribulose-1,5-biphosphate carboxylase small subunit gene, SRS1, were investigated. RNA was labeled with [alpha-32P]UTP in nuclei isolated from plants grown under different conditions of light and darkness and used to probe Southern blots and dot blots. The levels of small subunit mRNA synthesis were normalized to ribosomal RNA synthesis. We demonstrate that the SRS1 gene is transcribed at a rate 16- to 32-fold higher in plants grown in the light than in those grown in darkness. Transcription of the small subunit increased dramatically when plants grown in darkness were given 30 min to 6 h of light and then leveled off after 24 to 48 h of exposure. When light-grown seedlings were exposed to greater than 2 h of darkness, a gradual decrease in transcription was detected. This decrease in transcription reached basal dark-grown levels after 48 h of exposure to darkness. The increase in transcription in etiolated seedlings treated with white light for 15 min could be reduced to basal levels if the treatment was followed by treatment with far-red light for 15 min. In addition, transcription in ligh-grown seedlings was reduced to basal levels when plants were exposed to far-red light for 15 min. The transcription of this ribulose-1,5-biphosphate carboxylase small subunit gene is strongly positively regulated by white light, is negatively regulated by far-red light, and exhibits a classic phytochrome-linked response. Images PMID:3837851

  1. Ribosomal Database Project II

    DOE Data Explorer

    The Ribosomal Database Project (RDP) provides ribosome related data and services to the scientific community, including online data analysis and aligned and annotated Bacterial small-subunit 16S rRNA sequences. As of March 2008, RDP Release 10 is available and currently (August 2009) contains 1,074,075 aligned 16S rRNA sequences. Data that can be downloaded include zipped GenBank and FASTA alignment files, a histogram (in Excel) of the number of RDP sequences spanning each base position, data in the Functional Gene Pipeline Repository, and various user submitted data. The RDP-II website also provides numerous analysis tools.[From the RDP-II home page at http://rdp.cme.msu.edu/index.jsp

  2. Stepwise and dynamic assembly of the earliest precursors of small ribosomal subunits in yeast.

    PubMed

    Zhang, Liman; Wu, Chen; Cai, Gaihong; Chen, She; Ye, Keqiong

    2016-03-15

    The eukaryotic ribosomal RNA (rRNA) is associated cotranscriptionally with numerous factors into an enormous 90S preribosomal particle that conducts early processing of small ribosomal subunits. The assembly pathway and structure of the 90S particle is poorly understood. Here, we affinity-purified and analyzed the constituents of yeast 90S particles that were assembled on a series of plasmid-encoded 3'-truncated pre-18S RNAs. We determined the assembly point of 65 proteins and the U3, U14, and snR30 small nucleolar RNAs (snoRNAs), revealing a stepwise and dynamic assembly map. The 5' external transcribed spacer (ETS) alone can nucleate a large complex. When the 18S rRNA is nearly complete, the 90S structure undergoes a dramatic reorganization, releasing U14, snR30, and 14 protein factors that bind earlier. We also identified a reference state of 90S that is fully assembled yet has not undergone 5'ETS processing. The assembly map present here provides a new framework to understand small subunit biogenesis. PMID:26980190

  3. Essential ribosome assembly factor Fap7 regulates a hierarchy of RNA-protein interactions during small ribosomal subunit biogenesis.

    PubMed

    Hellmich, Ute A; Weis, Benjamin L; Lioutikov, Anatoli; Wurm, Jan Philip; Kaiser, Marco; Christ, Nina A; Hantke, Katharina; Kötter, Peter; Entian, Karl-Dieter; Schleiff, Enrico; Wöhnert, Jens

    2013-09-17

    Factor activating Pos9 (Fap7) is an essential ribosome biogenesis factor important for the assembly of the small ribosomal subunit with an uncommon dual ATPase and adenylate kinase activity. Depletion of Fap7 or mutations in its ATPase motifs lead to defects in small ribosomal subunit rRNA maturation, the absence of ribosomal protein Rps14 from the assembled subunit, and retention of the nascent small subunit in a quality control complex with the large ribosomal subunit. The molecular basis for the role of Fap7 in ribosome biogenesis is, however, not yet understood. Here we show that Fap7 regulates multiple interactions between the precursor rRNA, ribosomal proteins, and ribosome assembly factors in a hierarchical manner. Fap7 binds to Rps14 with a very high affinity. Fap7 binding blocks both rRNA-binding elements of Rps14, suggesting that Fap7 inhibits premature interactions of Rps14 with RNA. The Fap7/Rps14 interaction is modulated by nucleotide binding to Fap7. Rps14 strongly activates the ATPase activity but not the adenylate kinase activity of Fap7, identifying Rps14 as an example of a ribosomal protein functioning as an ATPase-activating factor. In addition, Fap7 inhibits the RNA cleavage activity of Nob1, the endonuclease responsible for the final maturation step of the small subunit rRNA, in a nucleotide independent manner. Thus, Fap7 may regulate small subunit biogenesis at multiple stages. PMID:24003121

  4. Crystallography of ribosomal particles

    NASA Astrophysics Data System (ADS)

    Yonath, A.; Frolow, F.; Shoham, M.; Müssig, J.; Makowski, I.; Glotz, C.; Jahn, W.; Weinstein, S.; Wittmann, H. G.

    1988-07-01

    Several forms of three-dimensional crystals and two-dimensional sheets of intact ribosomes and their subunits have been obtained as a result of: (a) an extensive systematic investigation of the parameters involved in crystallization, (b) a development of an experimental procedure for controlling the volumes of the crystallization droplets, (c) a study of the nucleation process, and (d) introducing a delicate seeding procedure coupled with variations in the ratios of mono- and divalent ions in the crystallization medium. In all cases only biologically active particles could be crystallized, and the crystalline material retains its integrity and activity. Crystallographic data have been collected from crystals of 50S ribosomal subunits, using synchrotron radiation at temperatures between + 19 and - 180°C. Although at 4°C the higher resolution reflections decay within minutes in the synchrotron beam, at cryo-temperature there was hardly any radiation damage, and a complete set of data to about 6Åresolution could be collected from a single crystal. Heavy-atom clusters were used for soaking as well as for specific binding to the surface of the ribosomal subunits prior to crystallization. The 50S ribosomal subunits from a mutant of B. stearothermophilus which lacks the ribosomal protein BL11 crystallize isomorphously with in the native ones. Models, aimed to be used for low resolution phasing, have been reconstructed from two-dimensional sheets of 70S ribosomes and 50S subunits at 47 and 30Å, respectively. These models show the overall structure of these particles, the contact areas between the large and small subunits, the space where protein synthesis might take place and a tunnel which may provide the path for the nascent protein chain.

  5. Evaluating hypotheses of basal animal phylogeny using complete sequences of large and small subunit rRNA

    PubMed Central

    Medina, Mónica; Collins, Allen G.; Silberman, Jeffrey D.; Sogin, Mitchell L.

    2001-01-01

    We studied the evolutionary relationships among basal metazoan lineages by using complete large subunit (LSU) and small subunit (SSU) ribosomal RNA sequences for 23 taxa. After identifying competing hypotheses, we performed maximum likelihood searches for trees conforming to each hypothesis. Kishino–Hasegawa tests were used to determine whether the data (LSU, SSU, and combined) reject any of the competing hypotheses. We also conducted unconstrained tree searches, compared the resulting topologies, and calculated bootstrap indices. Shimodaira–Hasegawa tests were applied to determine whether the data reject any of the topologies resulting from the constrained and unconstrained tree searches. LSU, SSU, and the combined data strongly contradict two assertions pertaining to sponge phylogeny. Hexactinellid sponges are not likely to be the basal lineage of a monophyletic Porifera or the sister group to all other animals. Instead, Hexactinellida and Demospongia form a well-supported clade of siliceous sponges, Silicea. It remains unclear, on the basis of these data alone, whether the calcarean sponges are more closely related to Silicea or to nonsponge animals. The SSU and combined data reject the hypothesis that Bilateria is more closely related to Ctenophora than it is to Cnidaria, whereas LSU data alone do not refute either hypothesis. LSU and SSU data agree in supporting the monophyly of Bilateria, Cnidaria, Ctenophora, and Metazoa. LSU sequence data reveal phylogenetic structure in a data set with limited taxon sampling. Continued accumulation of LSU sequences should increase our understanding of animal phylogeny. PMID:11504944

  6. Evaluating hypotheses of basal animal phylogeny using complete sequences of large and small subunit rRNA

    SciTech Connect

    Medina, Monica; Collins, Allen G.; Silberman, Jeffrey; Sogin, Mitchell L.

    2001-06-21

    We studied the evolutionary relationships among basal metazoan lineages by using complete large subunit (LSU) and small subunit (SSU) ribosomal RNA sequences for 23 taxa. After identifying competing hypotheses, we performed maximum likelihood searches for trees conforming to each hypothesis. Kishino-Hasegawa tests were used to determine whether the data (LSU, SSU, and combined) reject any of the competing hypotheses. We also conducted unconstrained tree searches, compared the resulting topologies, and calculated bootstrap indices. Shimodaira-Hasegawa tests were applied to determine whether the data reject any of the topologies resulting from the constrained and unconstrained tree searches. LSU, SSU, and the combined data strongly contradict two assertions pertaining to sponge phylogeny. Hexactinellid sponges are not likely to be the basal lineage of amonophyletic Porifera or the sister group to all other animals. Instead, Hexactinellida and Demospongia form a well-supported clade of siliceous sponges, Silicea. It remains unclear, on the basis of these data alone, whether the calcarean sponges are more closely related to Silicea or to nonsponge animals. The SSU and combined data reject the hypothesis that Bilateria is more closely related to Ctenophora than it is to Cnidaria, whereas LSU data alone do not refute either hypothesis. LSU and SSU data agree in supporting the monophyly of Bilateria, Cnidaria, Ctenophora, and Metazoa. LSU sequence data reveal phylogenetic structure in a data set with limited taxon sampling. Continued accumulation of LSU sequences should increase our understanding of animal phylogeny.

  7. Structural Insights Into Ribosome Recycling Factor Interactions with the 70S Ribosome

    PubMed Central

    Pai, Raj D.; Zhang, Wen; Schuwirth, Barbara S.; Hirokawa, Go; Kaji, Hideko; Kaji, Akira; Cate, Jamie H.D.

    2009-01-01

    SUMMARY At the end of translation in bacteria, ribosome recycling factor (RRF) is used together with Elongation Factor G (EF-G) to recycle the 30S and 50S ribosomal subunits for the next round of translation. In x-ray crystal structures of RRF with the Escherichia coli 70S ribosome, RRF binds to the large ribosomal subunit in the cleft that contains the peptidyl transferase center (PTC). Upon binding of either E. coli or T. thermophilus RRF to the E. coli ribosome, the tip of ribosomal RNA helix H69 in the large subunit moves away from the small subunit toward RRF by 8 Å, thereby disrupting a key contact between the small and large ribosomal subunits, termed bridge B2a. In the ribosome crystals, the ability of RRF to destabilize bridge B2a is influenced by crystal packing forces. Movement of H69 involves an ordered to disordered transition upon binding of RRF to the ribosome. The disruption of bridge B2a upon RRF binding to the ribosome seen in the present structures reveals one of the key roles that RRF plays in ribosome recycling, the dissociation of 70S ribosomes into subunits. The structures also reveal contacts between Domain II of RRF and protein S12 in the 30S subunit that may also play a role in ribosome recycling. PMID:18234219

  8. Expression of a foreign Rubisco small subunit in tobacco with reduced levels of the native protein

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The cDNA, ArRbcS3, for the small subunit of Rubisco from Amaranthus retroflexus (pigweed) was expressed in tobacco (Nicotiana tabacum) under the control of a strong leaf-specific Lhcb promoter. The coding region of the ArRbcS3 was fused to the plastid targeting sequence of the native tobacco rbcS to...

  9. RNA chaperones stimulate formation and yield of the U3 snoRNA-pre-rRNA duplexes needed for eukaryotic ribosome biogenesis

    PubMed Central

    Gérczei, Tímea; Shah, Binal N.; Manzo, Anthony J.; Walter, Nils G.; Correll, Carl C.

    2010-01-01

    To satisfy the high demand for ribosome synthesis in rapidly growing eukaryotic cells, short duplexes between the U3 small nucleolar RNA (snoRNA) and the precursor ribosomal RNA (pre-rRNA) must form quickly and with high yield. These interactions, designated the U3-ETS and U3-18S duplexes, are essential to initiate the processing of small subunit rRNA. Previously, we showed in vitro that duplexes corresponding to those in Saccharomyces cerevisiae are only observed after addition of one of two proteins: Imp3p or Imp4p. Here, we used fluorescence-based and other in vitro assays to determine whether these proteins possess RNA chaperone activities and to assess whether these activities are sufficient to satisfy the duplex yield and rate requirements expected in vivo. Assembly of both proteins with the U3 snoRNA into a chaperone complex destabilizes a U3-stem structure, apparently to expose its 18S base-pairing site. As a result, the chaperone complex accelerates formation of the U3-18S duplex from an undetectable rate to one comparable to the intrinsic rate observed for hybridizing short duplexes. The chaperone complex also stabilizes the U3-ETS duplex by 2.7 kcal/mol. These chaperone activities provide high U3-ETS duplex yield and rapid U3-18S duplex formation over a broad concentration range to help ensure that the U3-pre-rRNA interactions limit neither ribosome biogenesis nor rapid cell growth. The thermodynamic and kinetic framework used is general and thus suitable to investigate the mechanism of action of other RNA chaperones. PMID:19482034

  10. Ribosomal History Reveals Origins of Modern Protein Synthesis

    PubMed Central

    Harish, Ajith; Caetano-Anollés, Gustavo

    2012-01-01

    The origin and evolution of the ribosome is central to our understanding of the cellular world. Most hypotheses posit that the ribosome originated in the peptidyl transferase center of the large ribosomal subunit. However, these proposals do not link protein synthesis to RNA recognition and do not use a phylogenetic comparative framework to study ribosomal evolution. Here we infer evolution of the structural components of the ribosome. Phylogenetic methods widely used in morphometrics are applied directly to RNA structures of thousands of molecules and to a census of protein structures in hundreds of genomes. We find that components of the small subunit involved in ribosomal processivity evolved earlier than the catalytic peptidyl transferase center responsible for protein synthesis. Remarkably, subunit RNA and proteins coevolved, starting with interactions between the oldest proteins (S12 and S17) and the oldest substructure (the ribosomal ratchet) in the small subunit and ending with the rise of a modern multi-subunit ribosome. Ancestral ribonucleoprotein components show similarities to in vitro evolved RNA replicase ribozymes and protein structures in extant replication machinery. Our study therefore provides important clues about the chicken-or-egg dilemma associated with the central dogma of molecular biology by showing that ribosomal history is driven by the gradual structural accretion of protein and RNA structures. Most importantly, results suggest that functionally important and conserved regions of the ribosome were recruited and could be relics of an ancient ribonucleoprotein world. PMID:22427882

  11. Morphology and 18S rDNA of Henneguya gurlei (Myxosporea) from Ameiurus nebulosus (Siluriformes) in North Carolina

    USGS Publications Warehouse

    Iwanowicz, L.R.; Iwanowicz, D.D.; Pote, L.M.; Blazer, V.S.; Schill, W.B.

    2008-01-01

    Henneguya gurlei was isolated from Ameiurus nebulosus captured in North Carolina and redescribed using critical morphological features and 18S small-subunit ribosomal RNA (SSU rDNA) gene sequence. Plasmodia are white, spherical, or subspherical, occur in clusters, measure up to 1.8 mm in length, and are located on the dorsal, pectoral, and anal fins. Histologically, plasmodia are located in the dermis and subdermally, and the larger cysts disrupt the melanocyte pigment layer. The spore body is lanceolate, 18.2 ?? 0.3 ??m (range 15.7-20.3) in length, and 5.4 ?? 0.1 ??m (range 3.8-6.1) in width in valvular view. The caudal appendages are 41.1 ?? 1.1 ??m (range 34.0-49.7) in length. Polar capsules are pyriform and of unequal size. The longer polar capsule measures 6.2 ?? 0.1 ??m (range 5.48-7.06), while the shorter is 5.7 ?? 0.1 ??m (range 4.8-6.4) in length. Polar capsule width is 1.2 ?? 0.03 ??m (range 1.0-1.54). The total length of the spore is 60.9 ?? 1.2 ??m (range 48.7-68.5). Morphologically, this species is similar to other species of Henneguya that are known to infect ictalurids. Based on SSU rDNA sequences, this species is most closely related to H. exilis and H. ictaluri, which infect Ictalurus punctatus. ?? American Society of Parasitologists 2008.

  12. Phylogenetic position of the Phacotaceae within the Chlamydophyceaeas revealed by analysis of 18S rDNA and rbcL sequences.

    PubMed

    Hepperle, D; Nozaki, H; Hohenberger, S; Huss, V A; Morita, E; Krienitz, L

    1998-10-01

    Four genera of the Phacotaceae (Phacotus, Pteromonas, Wislouchiella, Dysmorphococcus), a family of loricated green algal flagellates within the Volvocales, were investigated by means of transmission electron microscopy and analysis of the nuclear encoded small-subunit ribosomal RNA (18S rRNA) genes and the plastid-encoded rbcL genes. Additionally, the 18S rDNA of Haematococcus pluvialis and the rbcL sequences of Chlorogonium elongatum, C. euchlorum, Dunaliella parva, Chloromonas serbinowii, Chlamydomonas radiata, and C. tetragama were determined. Analysis of ultrastructural data justified the separation of the Phacotaceae into two groups. Phacotus, Pteromonas, and Wislouchiella generally shared the following characters: egg-shaped protoplasts, a single pyrenoid with planar thylakoid double-lamellae, three-layered lorica, flagellar channels as part of the central lorica layer, mitochondria located in the central cytoplasm, lorica development that occurs in mucilaginous zoosporangia that are to be lysed, and no acid-resistant cell walls. Dysmorphococcus was clearly different in each of the characters mentioned. Direct comparison of sequences of Phacotus lenticularis, Pteromonas sp., Pteromonas protracta, and Wislouchiella planctonica revealed DNA sequence homologies of >/=98. 0% within the 18S gene and 93.9% within the rbcL gene. D. globosus was quite different from these species, with a maximum of 92.9% homology in the 18S rRNA and 18S rDNA of Dunaliella salina, with 95.3%, and to the rbcL sequence of Chlamydomonas tetragama, with 90.3% sequence homology. Additionally, the Phacotaceae sensu stricto exclusively shared 10 (rbcL: 4) characters which were present neither in other Chlamydomonadales nor in Dysmorphococcus globosus. Different phylogenetic analysis methods confirmed the hypothesis that the Phacotaceae are polyphyletic. The Phacotaceae sensu stricto form a stable cluster with affinities to the

  13. A polymorphic motif in the small subunit of ADP-glucose pyrophosphorylase modulates interactions between the small and large subunits.

    PubMed

    Cross, Joanna M; Clancy, Maureen; Shaw, Janine R; Boehlein, Susan K; Greene, Thomas W; Schmidt, Robert R; Okita, Thomas W; Hannah, L Curtis

    2005-02-01

    The heterotetrameric, allosterically regulated enzyme, adenosine-5'-diphosphoglucose pyrophosphorylase (AGPase) catalyzes the rate-limiting step in starch synthesis. Despite vast differences in allosteric properties and a long evolutionary separation, heterotetramers of potato small subunit and maize large subunit have activity comparable to either parent in an Escherichia coli expression system. In contrast, co-expression of maize small subunit with the potato large subunit produces little activity as judged by in vivo activity stain. To pinpoint the region responsible for differential activity, we expressed chimeric maize/potato small subunits in E. coli. This identified a 55-amino acid motif of the potato small subunit that is critical for glycogen production when expressed with the potato large subunit. Potato and maize small subunit sequences differ at five amino acids in this motif. Replacement experiments revealed that at least four amino acids of maize origin were required to reduce staining. An AGPase composed of a chimeric potato small subunit containing the 55-amino acid maize motif with the potato large subunit exhibited substantially less affinity for the substrates, glucose-1-phosphate and ATP and an increased Ka for the activator, 3-phosphoglyceric acid. Placement of the potato motif into the maize small subunit restored glycogen synthesis with the potato large subunit. Hence, a small polymorphic motif within the small subunit influences both catalytic and allosteric properties by modulating subunit interactions. PMID:15686515

  14. Structures of the ribosome in intermediate states of ratcheting

    PubMed Central

    Zhang, Wen; Dunkle, Jack; Cate, Jamie H. D.

    2010-01-01

    Summary Structures of the E. coli 70S ribosome show how the large and small subunits rotate to facilitate protein synthesis. Protein biosynthesis on the ribosome requires repeated cycles of ratcheting, which couples rotation of the two ribosomal subunits with respect to each other and swiveling of the head domain of the small subunit. However, the molecular basis for how the two ribosomal subunits rearrange contacts with each other during ratcheting while remaining stably associated is not known. Here we describe x-ray crystal structures of the intact Escherichia coli ribosome, either in the apo form (3.5 Å resolution) or with one (4.0 Å res) or two (4.0 Å res) anticodon stem-loop tRNA mimics bound, that reveal intermediate states of intersubunit rotation. In the structures, the interface between the small and large ribosomal subunits rearranges in discrete steps along the ratcheting pathway. Positioning of the head domain of the small subunit is controlled by interactions with the large subunit and with the tRNA bound in the peptidyl-tRNA site. The intermediates observed here provide insight into how tRNAs move into the hybrid state of binding that precedes the final steps of mRNA and tRNA translocation. PMID:19696352

  15. Ribosome engineering to promote new crystal forms

    SciTech Connect

    Selmer, Maria; Gao, Yong-Gui; Weixlbaumer, Albert; Ramakrishnan, V.

    2012-05-01

    Truncation of ribosomal protein L9 in T. thermophilus allows the generation of new crystal forms and the crystallization of ribosome–GTPase complexes. Crystallographic studies of the ribosome have provided molecular details of protein synthesis. However, the crystallization of functional complexes of ribosomes with GTPase translation factors proved to be elusive for a decade after the first ribosome structures were determined. Analysis of the packing in different 70S ribosome crystal forms revealed that regardless of the species or space group, a contact between ribosomal protein L9 from the large subunit and 16S rRNA in the shoulder of a neighbouring small subunit in the crystal lattice competes with the binding of GTPase elongation factors to this region of 16S rRNA. To prevent the formation of this preferred crystal contact, a mutant strain of Thermus thermophilus, HB8-MRCMSAW1, in which the ribosomal protein L9 gene has been truncated was constructed by homologous recombination. Mutant 70S ribosomes were used to crystallize and solve the structure of the ribosome with EF-G, GDP and fusidic acid in a previously unobserved crystal form. Subsequent work has shown the usefulness of this strain for crystallization of the ribosome with other GTPase factors.

  16. Morphology and small subunit rRNA gene sequence of Uronemita parabinucleata n. sp. (Ciliophora, Uronematidae), with an improved generic diagnosis.

    PubMed

    Liu, Mingjian; Gao, Feng; Al-Farraj, Saleh A; Hu, Xiaozhong

    2016-06-01

    The morphology and infraciliature of a new species, Uronemita parabinucleata n. sp., isolated from intertidal sediments in a coastal region in northern China, were investigated using live observation and silver impregnation methods. The new species is characterized by an in vivo body size of about 20-50×10-25μm, 22 or 23 somatic kineties, two macronuclear nodules, and one caudal cilium. Its small subunit ribosomal RNA gene (SSU rDNA) was sequenced and compared with those of other Uronemita species to reveal nucleotide differences. Phylogenetic analyses indicated that Uronemita is monophyletic and that the new species clusters with its congener Uronemita filificum, with full support provided by both Bayesian inference and maximum likelihood algorithms. Based on previous studies and the present study, an improved diagnosis of the genus Uronemita is supplied, which has been absent since the establishment of this genus. A key to the Uronemita species is also provided. PMID:26999559

  17. Discovery of a free-living chlorophyll d-producing cyanobacterium with a hybrid proteobacterial/cyanobacterial small-subunit rRNA gene

    PubMed Central

    Miller, Scott R.; Augustine, Sunny; Olson, Tien Le; Blankenship, Robert E.; Selker, Jeanne; Wood, A. Michelle

    2005-01-01

    Chlorophyll d-producing cyanobacteria are a recently described group of phototrophic bacteria that is a major focus of photosynthesis research, previously known only from marine environments in symbiosis with eukaryotes. We have discovered a free-living member of this group from a eutrophic hypersaline lake. Phylogenetic analyses indicated these strains are closely related to each other but not to prochlorophyte cyanobacteria that also use an alternative form of chlorophyll as the major light-harvesting pigment. We have also demonstrated that these bacteria acquired a fragment of the small-subunit rRNA gene encoding a conserved hairpin in the bacterial ribosome from a proteobacterial donor at least 10 million years before the present. Thus, our most widely used phylogenetic marker can be a mosaic of sequence fragments with widely divergent evolutionary histories. PMID:15637160

  18. The Splicing Factor U2AF Small Subunit Is Functionally Conserved between Fission Yeast and Humans

    PubMed Central

    Webb, Christopher J.; Wise, Jo Ann

    2004-01-01

    The small subunit of U2AF, which functions in 3′ splice site recognition, is more highly conserved than its heterodimeric partner yet is less thoroughly investigated. Remarkably, we find that the small subunit of Schizosaccharomyces pombe U2AF (U2AFSM) can be replaced in vivo by its human counterpart, demonstrating that the conservation extends to function. Precursor mRNAs accumulate in S. pombe following U2AFSM depletion in a time frame consistent with a role in splicing. A comprehensive mutational analysis reveals that all three conserved domains are required for viability. Notably, however, a tryptophan in the pseudo-RNA recognition motif implicated in a key contact with the large subunit by crystallographic data is dispensable whereas amino acids implicated in RNA recognition are critical. Mutagenesis of the two zinc-binding domains demonstrates that they are neither equivalent nor redundant. Finally, two- and three-hybrid analyses indicate that mutations with effects on large-subunit interactions are rare whereas virtually all alleles tested diminished RNA binding by the heterodimer. In addition to demonstrating extraordinary conservation of U2AF small-subunit function, these results provide new insights into the roles of individual domains and residues. PMID:15121844

  19. Role of the Rubisco small subunit. Final report for period May 1, 1997--April 30,2000

    SciTech Connect

    Spreitzer, Robert J.

    2000-10-04

    CO{sub 2} and O{sub 2} are mutually competitive at the active site of ribulose-1,5-biphosphate (RuBP) carboxylase/oxygenase (Rubisco). Rubisco contains two subunits, each present in eight copies. The 15-kD small subunit is coded by a family of nuclear RbcS genes. Until now, the role of the small subunit in Rubisco structure or catalytic efficiency is not known. Because of other work in eliminating the two RbcS genes in the green algo Chlamydomonas reinhardtii, it is now possible to address questions about the structure-function relationships of the eukaryotic small subunit. There are three specific aims in this project: (1) Alanine scanning mutagenesis is being used to dissect the importance of the {beta}A/{beta}B loop, a feature unique to the eukaryotic small subunit. (2) Random mutagenesis is being used to identify additional residues or regions of the small subunit that are important for holoenzyme assembly and function. (3) Attempts are being made to express foreign small subunits in Chlamydomonas to examine the contribution of small subunits to holoenzyme assembly, catalytic efficiency, and CO{sub 2}/O{sub 2} specificity.

  20. Identification of Cryptosporidium isolates from cockatiels by direct sequencing of the PCR-amplified small subunit ribosomal RNA gene.

    PubMed

    Abe, Niichiro; Iseki, Motohiro

    2004-04-01

    Cryptosporidium is a significant pathogen in humans and animals. Cases of infection by C. meleagridis or C. baileyi with zoonotic potential have also been reported in domestic birds; and recent studies indicate the presence of new host-adapted species or genotype in birds. Therefore, accurately identifying isolates is important for understanding the epizootiology of Cryptosporidium infection in birds and for the control of human cryptosporidiosis. Cryptosporidium has been detected in cockatiels, but the species or genotype of isolates remains unclear because identification was performed using conventional microscopy. We report herein the species or genotype of isolates from two cockatiels distinguished by a PCR-based diagnostic method. The isolates were found to be C. meleagridis and C. baileyi, respectively. This study documents the first discovery of C. meleagridis and C. baileyi in cockatiels and suggests that pet birds may play an important role in the epidemiology of cryptosporidiosis. PMID:14999470

  1. Molecular phylogeny of brachiopods and phoronids based on nuclear-encoded small subunit ribosomal RNA gene sequences

    PubMed Central

    L.Cohen, B.

    1998-01-01

    Brachiopod and phoronid phylogeny is inferred from SSU rDNA sequences of 28 articulate and nine inarticulate brachiopods, three phoronids, two ectoprocts and various outgroups, using gene trees reconstructed by weighted parsimony, distance and maximum likelihood methods. Of these sequences, 33 from brachiopods, two from phoronids and one each from an ectoproct and a priapulan are newly determined. The brachiopod sequences belong to 31 different genera and thus survey about 10% of extant genus-level diversity. Sequences determined in different laboratories and those from closely related taxa agree well, but evidence is presented suggesting that one published phoronid sequence (GenBank accession UO12648) is a brachiopod-phoronid chimaera, and this sequence is excluded from the analyses. The chiton, Acanthopleura, is identified as the phenetically proximal outgroup; other selected outgroups were chosen to allow comparison with recent, non-molecular analyses of brachiopod phylogeny. The different outgroups and methods of phylogenetic reconstruction lead to similar results, with differences mainly in the resolution of weakly supported ancient and recent nodes, including the divergence of inarticulate brachiopod sub-phyla, the position of the rhynchonellids in relation to long- and short-looped articulate brachiopod clades and the relationships of some articulate brachiopod genera and species. Attention is drawn to the problem presented by nodes that are strongly supported by non-molecular evidence but receive only low bootstrap resampling support. Overall, the gene trees agree with morphology-based brachiopod taxonomy, but novel relationships are tentatively suggested for thecideidine and megathyrid brachiopods. Articulate brachiopods are found to be monophyletic in all reconstructions, but monophyly of inarticulate brachiopods and the possible inclusion of phoronids in the inarticulate brachiopod clade are less strongly established. Phoronids are clearly excluded from a sister-group relationship with articulate brachiopods, this proposed relationship being due to the rejected, chimaeric sequence (GenBank UO12648). Lineage relative rate tests show no heterogeneity of evolutionary rate among articulate brachiopod sequences, but indicate that inarticulate brachiopod plus phoronid sequences evolve somewhat more slowly. Both brachiopods and phoronids evolve slowly by comparison with other invertebrates. A number of palaeontologically dated times of earliest appearance are used to make upper and lower estimates of the global rate of brachiopod SSU rDNA evolution, and these estimates are used to infer the likely divergence times of other nodes in the gene tree. There is reasonable agreement between most inferred molecular and palaeontological ages. The estimated rates of SSU rDNA sequence evolution suggest that the last common ancestor of brachiopods, chitons and other protostome invertebrates (Lophotrochozoa and Ecdysozoa) lived deep in Precambrian time. Results of this first DNA-based, taxonomically representative analysis of brachiopod phylogeny are in broad agreement with current morphology-based classification and systematics and are largely consistent with the hypothesis that brachiopod shell ontogeny and morphology are a good guide to phylogeny.

  2. Synthesis of the small subunit of ribulose-bisphosphate carboxylase from genes cloned into plasmids containing the SP6 promoter.

    PubMed Central

    Anderson, S; Smith, S M

    1986-01-01

    DNA sequences encoding ribulose 1,5-bisphosphate carboxylase small subunit precursor from Pisum sativum L. have been transcribed from plasmids containing the SP6 promoter, and translated in a wheat germ cell-free system. The small subunit precursor polypeptide, its N-terminal leader sequence (transit peptide) and the mature small subunit have each been synthesized independently from three different plasmid constructs. The precursor polypeptide is imported into isolated pea chloroplasts and processed to the mature small subunit by a stromal proteinase. The mature polypeptide is neither imported, nor subject to proteolysis by stromal extracts. The transit peptide alone is very rapidly degraded by a stromal proteinase activity which can be inhibited by EDTA or 1,10-phenanthroline. The use of these gene constructs helps to establish the crucial role of the transit peptide in protein import into the chloroplast. Images Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:3827863

  3. Ribosome dynamics and the evolutionary history of ribosomes

    NASA Astrophysics Data System (ADS)

    Fox, George E.; Paci, Maxim; Tran, Quyen; Petrov, Anton S.; Williams, Loren D.

    2015-09-01

    The ribosome is a dynamic nanomachine responsible for coded protein synthesis. Its major subsystems were essentially in place at the time of the last universal common ancestor (LUCA). Ribosome evolutionary history thus potentially provides a window into the pre- LUCA world. This history begins with the origins of the peptidyl transferase center where the actual peptide is synthesized and then continues over an extended timeframe as additional functional centers including the GTPase center are added. The large ribosomal RNAs (rRNAs) have grown over time by an accretion process and a model exists that proposes a relative age of each accreted element. We have compared atomic resolution ribosome structures before and after EF-G bound GTP hydrolysis and thereby identified the location of 23 pivot points in the large rRNAs that facilitate ribosome dynamics. Pivots in small subunit helices h28 and h44 appear to be especially central to the process and according to the accretion model significantly older than the other helices containing pivots. Overall, the results suggest that ribosomal dynamics occurred in two phases. In the first phase, an inherently mobile h28/h44 combination provided the flexibility needed to create a dynamic ribosome that was essentially a Brownian machine. This addition likely made coded peptide synthesis possible by facilitating movement of a primitive mRNA. During the second phase, addition of pivoting elements and the creation of a factor binding site allowed the regulation of the inherent motion created by h28/h44. All of these events likely occurred before LUCA.

  4. Large and small subunits of the Aujeszky's disease virus ribonucleotide reductase: nucleotide sequence and putative structure.

    PubMed

    Kaliman, A V; Boldogköi, Z; Fodor, I

    1994-09-13

    We determined the entire DNA sequence of two adjacent open reading frames of Aujeszky's disease virus encoding ribonucleotide reductase genes with the intergenic sequence of 9 bp. From the sequence analysis we deduce that ORFs encode large and small subunits, with sizes of 835 and 303 amino acids, respectively. Amino acid sequence comparison of ADV RR2 with that of equine herpesvirus type 1, bovine herpesvirus type 1, HSV-1 and varicella zoster virus revealed that 48% of amino acids represent clusters of residues conserved in all compared sequences. In the N-terminal part ADV RR1 shows low homology to the RR1 of other herpesviruses. Rest of the RR1 protein contains highly conserved amino acid sequences divided by blocks of low homology. PMID:8086454

  5. Substrate specificity determinants of the methanogen homoaconitase enzyme: structure and function of small subunit residues

    SciTech Connect

    Jeyakanthan, Jeyaraman; Drevland, Randy; Gayathri, Dasara; Velmurugan, Devadasan; Shinkai, Akeo; Graham, David E

    2010-01-01

    The aconitase family of hydro-lyase enzymes includes three classes of proteins that catalyze the isomerization of -hydroxyacids to -hydroxyacids. Besides aconitase, isopropylmalate isomerase (IPMI) proteins specifically catalyze the isomerization of , -dicarboxylates with hydrophobic -chain groups, and homoaconitase (HACN) proteins catalyze the isomerization of tricarboxylates with variable chain length -carboxylate groups. These enzymes stereospecific hydro-lyase activities make them attractive catalysts to produce diastereomers from unsaturated precursors. However, sequence similarity and convergent evolution among these proteins leads to widespread misannotation and uncertainty about gene function. To find the substrate specificity determinants of homologous IPMI and HACN proteins from Methanocaldococcus jannaschii, the small-subunit HACN protein (MJ1271) was crystallized for X-ray diffraction. The structural model showed characteristic residues in a flexible loop region between 2 and 3 that distinguish HACN from IPMI and aconitase proteins. Site-directed mutagenesis of MJ1271 produced loop-region variant proteins that were reconstituted with wild-type MJ1003 large-subunit protein. The heteromers formed promiscuous hydro-lyases with reduced activity but broader substrate specificity. Both R26K and R26V variants formed relatively efficient IPMI enzymes, while the T27A variant had uniformly lower specificity constants for both IPMI and HACN substrates. The R26V T27Y variant resembles the MJ1277 IPMI small subunit in its flexible loop sequence, but demonstrated the broad substrate specificity of the R26V variant. These mutations may reverse the evolution of HACN activity from an ancestral IPMI gene, demonstrating the evolutionary potential for promiscuity in hydro-lyase enzymes. Understanding these specificity determinants enables the functional reannotation of paralogous HACN and IPMI genes in numerous genome sequences. These structural and kinetic results will

  6. Development and application of small-subunit rRNA probes for assessment of selected Thiobacillus species and members of the genus Acidiphilium.

    PubMed

    Peccia, J; Marchand, E A; Silverstein, J; Hernandez, M

    2000-07-01

    Culture-dependent studies have implicated sulfur-oxidizing bacteria as the causative agents of acid mine drainage and concrete corrosion in sewers. Thiobacillus species are considered the major representatives of the acid-producing bacteria in these environments. Small-subunit rRNA genes from all of the Thiobacillus and Acidiphilium species catalogued by the Ribosomal Database Project were identified and used to design oligonucleotide DNA probes. Two oligonucleotide probes were synthesized to complement variable regions of 16S rRNA in the following acidophilic bacteria: Thiobacillus ferrooxidans and T. thiooxidans (probe Thio820) and members of the genus Acidiphilium (probe Acdp821). Using (32)P radiolabels, probe specificity was characterized by hybridization dissociation temperature (T(d)) with membrane-immobilized RNA extracted from a suite of 21 strains representing three groups of bacteria. Fluorochrome-conjugated probes were evaluated for use with fluorescent in situ hybridization (FISH) at the experimentally determined T(d)s. FISH was used to identify and enumerate bacteria in laboratory reactors and environmental samples. Probing of laboratory reactors inoculated with a mixed culture of acidophilic bacteria validated the ability of the oligonucleotide probes to track specific cell numbers with time. Additionally, probing of sediments from an active acid mine drainage site in Colorado demonstrated the ability to identify numbers of active bacteria in natural environments that contain high concentrations of metals, associated precipitates, and other mineral debris. PMID:10877807

  7. Further consideration of the phylogeny of some "traditional" heterotrichs (Protista, Ciliophora) of uncertain affinities, based on new sequences of the small subunit rRNA gene.

    PubMed

    Miao, Miao; Song, Weibo; Clamp, John C; Al-Rasheid, Khaled A S; Al-Khedhairy, Abdulaziz A; Al-Arifi, Saud

    2009-01-01

    The systematic relationships and taxonomic positions of the traditional heterotrich genera Condylostentor, Climacostomum, Fabrea, Folliculina, Peritromus, and Condylostoma, as well as the licnophorid genus Licnophora, were re-examined using new data from sequences of the gene coding for small subunit ribosomal RNA. Trees constructed using distance-matrix, Bayesian inference, and maximum-parsimony methods all showed the following relationships: (1) the "traditional" heterotrichs consist of several paraphyletic groups, including the current classes Heterotrichea, Armophorea and part of the Spirotrichea; (2) the class Heterotrichea was confirmed as a monophyletic assemblage based on our analyses of 31 taxa, and the genus Peritromus was demonstrated to be a peripheral group; (3) the genus Licnophora occupied an isolated branch on one side of the deepest divergence in the subphylum Intramacronucleata and was closely affiliated with spirotrichs, armophoreans, and clevelandellids; (4) Condylostentor, a recently defined genus with several truly unique morphological features, is more closely related to Condylostoma than to Stentor; (5) Folliculina, Eufolliculina, and Maristentor always clustered together with high bootstrap support; and (6) Climacostomum occupied a paraphyletic position distant from Fabrea, showing a close relationship with Condylostomatidae and Chattonidiidae despite of modest support. PMID:19527351

  8. A genetic link between epigenetic repressor AS1-AS2 and a putative small subunit processome in leaf polarity establishment of Arabidopsis.

    PubMed

    Matsumura, Yoko; Ohbayashi, Iwai; Takahashi, Hiro; Kojima, Shoko; Ishibashi, Nanako; Keta, Sumie; Nakagawa, Ayami; Hayashi, Rika; Saéz-Vásquez, Julio; Echeverria, Manuel; Sugiyama, Munetaka; Nakamura, Kenzo; Machida, Chiyoko; Machida, Yasunori

    2016-01-01

    Although the DEAD-box RNA helicase family is ubiquitous in eukaryotes, its developmental role remains unelucidated. Here, we report that cooperative action between the Arabidopsis nucleolar protein RH10, an ortholog of human DEAD-box RNA helicase DDX47, and the epigenetic repressor complex of ASYMMETRIC-LEAVES1 (AS1) and AS2 (AS1-AS2) is critical to repress abaxial (ventral) genes ETT/ARF3 and ARF4, which leads to adaxial (dorsal) development in leaf primordia at shoot apices. Double mutations of rh10-1 and as2 (or as1) synergistically up-regulated the abaxial genes, which generated abaxialized filamentous leaves with loss of the adaxial domain. DDX47 is part of the small subunit processome (SSUP) that mediates rRNA biogenesis. In rh10-1 we found various defects in SSUP-related events, such as: accumulation of 35S/33S rRNA precursors; reduction in the 18S/25S ratio; and nucleolar hypertrophy. Double mutants of as2 with mutations of genes that encode other candidate SSUP-related components such as nucleolin and putative rRNA methyltransferase exhibited similar synergistic defects caused by up-regulation of ETT/ARF3 and ARF4 These results suggest a tight link between putative SSUP and AS1-AS2 in repression of the abaxial-determining genes for cell fate decisions for adaxial development. PMID:27334696

  9. A genetic link between epigenetic repressor AS1-AS2 and a putative small subunit processome in leaf polarity establishment of Arabidopsis

    PubMed Central

    Matsumura, Yoko; Ohbayashi, Iwai; Takahashi, Hiro; Kojima, Shoko; Ishibashi, Nanako; Keta, Sumie; Nakagawa, Ayami; Hayashi, Rika; Saéz-Vásquez, Julio; Echeverria, Manuel; Sugiyama, Munetaka; Nakamura, Kenzo; Machida, Chiyoko

    2016-01-01

    ABSTRACT Although the DEAD-box RNA helicase family is ubiquitous in eukaryotes, its developmental role remains unelucidated. Here, we report that cooperative action between the Arabidopsis nucleolar protein RH10, an ortholog of human DEAD-box RNA helicase DDX47, and the epigenetic repressor complex of ASYMMETRIC-LEAVES1 (AS1) and AS2 (AS1-AS2) is critical to repress abaxial (ventral) genes ETT/ARF3 and ARF4, which leads to adaxial (dorsal) development in leaf primordia at shoot apices. Double mutations of rh10-1 and as2 (or as1) synergistically up-regulated the abaxial genes, which generated abaxialized filamentous leaves with loss of the adaxial domain. DDX47 is part of the small subunit processome (SSUP) that mediates rRNA biogenesis. In rh10-1 we found various defects in SSUP-related events, such as: accumulation of 35S/33S rRNA precursors; reduction in the 18S/25S ratio; and nucleolar hypertrophy. Double mutants of as2 with mutations of genes that encode other candidate SSUP-related components such as nucleolin and putative rRNA methyltransferase exhibited similar synergistic defects caused by up-regulation of ETT/ARF3 and ARF4. These results suggest a tight link between putative SSUP and AS1-AS2 in repression of the abaxial-determining genes for cell fate decisions for adaxial development. PMID:27334696

  10. Two Chlamydomonas OPR proteins stabilize chloroplast mRNAs encoding small subunits of photosystem II and cytochrome b6 f.

    PubMed

    Wang, Fei; Johnson, Xenie; Cavaiuolo, Marina; Bohne, Alexandra-Viola; Nickelsen, Joerg; Vallon, Olivier

    2015-06-01

    In plants and algae, chloroplast gene expression is controlled by nucleus-encoded proteins that bind to mRNAs in a specific manner, stabilizing mRNAs or promoting their splicing, editing, or translation. Here, we present the characterization of two mRNA stabilization factors of the green alga Chlamydomonas reinhardtii, which both belong to the OctotricoPeptide Repeat (OPR) family. MCG1 is necessary to stabilize the petG mRNA, encoding a small subunit of the cytochrome b6 f complex, while MBI1 stabilizes the psbI mRNA, coding for a small subunit of photosystem II. In the mcg1 mutant, the small RNA footprint corresponding to the 5'-end of the petG transcript is reduced in abundance. In both cases, the absence of the small subunit perturbs assembly of the cognate complex. Whereas PetG is essential for formation of a functional cytochrome b6 f dimer, PsbI appears partly dispensable as a low level of PSII activity can still be measured in its absence. Thus, nuclear control of chloroplast gene expression is not only exerted on the major core subunits of the complexes, but also on small subunits with a single transmembrane helix. While OPR proteins have thus far been involved in translation or trans-splicing of plastid mRNAs, our results expand the potential roles of this repeat family to their stabilization. PMID:25898982

  11. A novel 3′ splice site recognition by the two zinc fingers in the U2AF small subunit

    PubMed Central

    Yoshida, Hisashi; Park, Sam-Yong; Oda, Takashi; Akiyoshi, Taeko; Sato, Mamoru; Shirouzu, Mikako; Tsuda, Kengo; Kuwasako, Kanako; Unzai, Satoru; Muto, Yutaka; Urano, Takeshi; Obayashi, Eiji

    2015-01-01

    The pre-mRNA splicing reaction of eukaryotic cells has to be carried out extremely accurately, as failure to recognize the splice sites correctly causes serious disease. The small subunit of the U2AF heterodimer is essential for the determination of 3′ splice sites in pre-mRNA splicing, and several single-residue mutations of the U2AF small subunit cause severe disorders such as myelodysplastic syndromes. However, the mechanism of RNA recognition is poorly understood. Here we solved the crystal structure of the U2AF small subunit (U2AF23) from fission yeast, consisting of an RNA recognition motif (RRM) domain flanked by two conserved CCCH-type zinc fingers (ZFs). The two ZFs are positioned side by side on the β sheet of the RRM domain. Further mutational analysis revealed that the ZFs bind cooperatively to the target RNA sequence, but the RRM domain acts simply as a scaffold to organize the ZFs and does not itself contact the RNA directly. This completely novel and unexpected mode of RNA-binding mechanism by the U2AF small subunit sheds light on splicing errors caused by mutations of this highly conserved protein. PMID:26215567

  12. Characterization of an ADP-glucose Pyrophosphorylase Small Subunit Gene Expressed in Developing Cotton (Gossypium hirsutum) Fibers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    ADP-glucose pyrophosphorylase (ADPGp) plays a rate limiting role in the biosynthesis of starch and has been shown to be involved in cell expansion of tobacco sepals. A cotton gene encoding ADPGp small subunit was isolated and sequenced. The gene contains 8 introns similar to other ADPGp genes. The o...

  13. Investigation of the interaction between the large and small subunits of potato ADP-glucose pyrophosphorylase.

    PubMed

    Baris, Ibrahim; Tuncel, Aytug; Ozber, Natali; Keskin, Ozlem; Kavakli, Ibrahim Halil

    2009-10-01

    ADP-glucose pyrophosphorylase (AGPase), a key allosteric enzyme involved in higher plant starch biosynthesis, is composed of pairs of large (LS) and small subunits (SS). Current evidence indicates that the two subunit types play distinct roles in enzyme function. Recently the heterotetrameric structure of potato AGPase has been modeled. In the current study, we have applied the molecular mechanics generalized born surface area (MM-GBSA) method and identified critical amino acids of the potato AGPase LS and SS subunits that interact with each other during the native heterotetrameric structure formation. We have further shown the role of the LS amino acids in subunit-subunit interaction by yeast two-hybrid, bacterial complementation assay and native gel. Comparison of the computational results with the experiments has indicated that the backbone energy contribution (rather than the side chain energies) of the interface residues is more important in identifying critical residues. We have found that lateral interaction of the LS-SS is much stronger than the longitudinal one, and it is mainly mediated by hydrophobic interactions. This study will not only enhance our understanding of the interaction between the SS and the LS of AGPase, but will also enable us to engineer proteins to obtain better assembled variants of AGPase which can be used for the improvement of plant yield. PMID:19876371

  14. Rubisco small-subunit α-helices control pyrenoid formation in Chlamydomonas

    PubMed Central

    Meyer, Moritz T.; Genkov, Todor; Skepper, Jeremy N.; Jouhet, Juliette; Mitchell, Madeline C.; Spreitzer, Robert J.; Griffiths, Howard

    2012-01-01

    The pyrenoid is a subcellular microcompartment in which algae sequester the primary carboxylase, ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco). The pyrenoid is associated with a CO2-concentrating mechanism (CCM), which improves the operating efficiency of carbon assimilation and overcomes diffusive limitations in aquatic photosynthesis. Using the model alga Chlamydomonas reinhardtii, we show that pyrenoid formation, Rubisco aggregation, and CCM activity relate to discrete regions of the Rubisco small subunit (SSU). Specifically, pyrenoid occurrence was shown to be conditioned by the amino acid composition of two surface-exposed α-helices of the SSU: higher plant-like helices knock out the pyrenoid, whereas native algal helices establish a pyrenoid. We have also established that pyrenoid integrity was essential for the operation of an active CCM. With the algal CCM being functionally analogous to the terrestrial C4 pathway in higher plants, such insights may offer a route toward transforming algal and higher plant productivity for the future. PMID:23112177

  15. Soybean ribulose bisphosphate carboxylase small subunit: Mechanisms and determinants of RNA turnover. Annual progress report

    SciTech Connect

    Meagher, R.B.

    1993-12-31

    An in vitro degradation system has been developed from petunia and soybean polysomes in order to investigate the mechanisms and determinants controlling RNA turnover in higher plants. This system faithfully degrades soybean ribulose-1,5-bisphosphate carboxylase small subunit (rbcS) mRNA into the same products observed in total RNA preparations. In previous years it was shown that the most stable products represent a nested constellation of fragments, which are shortened from their 3{prime} ends, and have intact 5{prime} ends. Exogenous rbcS RNA tagged with novel 5{prime} sequence 15 or 56 bp long were synthesized in vitro as Sp6 and T7 runoff transcripts, respectively. When added to the system they were degraded faithfully into constellation of products which were 15 or 56 bp longer than the endogenous products, respectively. Detailed kinetics on the appearance of these exogenous products confirmed degradation proceeds in an overall 3{prime} to 5{prime} direction but suggested that there are multiple pathways through which the RNA may be degraded. To further demonstrate a precursor product relationships, in vitro synthesized transcripts truncated at their 3{prime} ends were shown to degrade into the expected smaller fragments previously mapped in the 5{prime} portion of the rbcS RNA.

  16. Differential distribution of calpain small subunit 1 and 2 in rat brain.

    PubMed

    Friedrich, Peter; Papp, Henrietta; Halasy, Katalin; Farkas, Attila; Farkas, Bence; Tompa, Peter; Kása, Peter

    2004-04-01

    Calpains, the Ca(2+)-dependent thiol proteases, are abundant in the nervous tissue. The ubiquitous enzyme forms in mammals are heterodimers consisting of a specific, micro or m, large (catalytic) subunit and, apparently, a common small (regulatory) subunit (CSS1). Recently, however, we described a second form of small subunit (CSS2), which is of restricted occurrence [Schád, E., Farkas, A., Jékely, G., Tompa, P. & Friedrich, P. (2002) Biochem. J., 362, 383-388]. Here we analysed the distribution of immunoreactivity in various parts of rat brain against two anti-CSS1 and two anti-CSS2 antibodies by correlated light and electron microscopy. Remarkably, the antibodies showed differential distribution in various parts of rat cortex: anti-CSS1 reacted mainly with perikarya and dendrites, whereas anti-CSS2 was more prominent in axons. In serial sections CSS2 and synaptophysin gave very similar patterns, i.e. these epitopes seem to colocalize. Electron microscopy confirmed that CSS1 was mainly localized postsynaptically in dendrites and somata, whereas CSS2 was found presynaptically. The hypothesis is advanced that these distinct distributions of calpain subunits may be related to the transport of these enzymes in nerve cells. PMID:15078555

  17. Incorporation of single dinitrophenyl-modified proteins in to the 30S subunit of Escherichia coli ribosomes by total reconstitution for localization by immune electron microscopy

    SciTech Connect

    Olah, T.V.

    1989-01-01

    The ribosome is a structurally defined organelle whose function is central to the existence of all organisms. It is the unique site of protein biosynthesis in all cells. A detailed understanding of ribosome structure is essential in understanding the process of translation. This thesis represents a new approach to the systematic localization of individual proteins contained in the small subunit of Escherichia coli ribosomes using immunoelectron microscopy. All 30S proteins were purified using high performance liquid chromatography (HPLC) and eight isolated proteins (S12,S21,S14,S19,S18,S17,S16 and S13) were derivatized with 2,4-(3,5-{sup 3}H)dinitrofluorobenzene (DNFB). The extent of modification of these proteins was estimated by both radioactivity and integrated peak areas, using dual wavelength monitoring at 214nm to detect protein and 360nm (to detect dinitrophenyl groups). Each dinitrophenylated protein was introduced in place of the corresponding unmodified protein into totally reconstituted 30S subunits. Antibodies raised against the DNP-hapten bound effectively to such reconstituted subunits and did not cause dissociation of the modified protein from the subunit. Electron microscopy of the immune complexes was used to localize the modified protein on the subunit surface. Incorporation of any of the DNP-modified proteins, with the exception of DNP-S18, does not interfere with the functionality of the ribosome as measure by the binding of Phe-tRNA{sup Phe} or the synthesis of poly(Phe) in a poly(U)-dependent manner. Results show that unmodified protein competes with DNP-protein and that DNP-protein can function, as its native counterpart, in stimulating uptake of specific proteins during reconstitution. This data provides evidence that each DNP-protein occupies the same position in 30S subunits as does the corresponding unmodified protein.

  18. Structures of the Ribosome in Intermediate States of Ratcheting

    SciTech Connect

    Zhang, Wen; Dunkle, Jack A.; Cate, Jamie H.D.

    2009-10-21

    Protein biosynthesis on the ribosome requires repeated cycles of ratcheting, which couples rotation of the two ribosomal subunits with respect to each other, and swiveling of the head domain of the small subunit. However, the molecular basis for how the two ribosomal subunits rearrange contacts with each other during ratcheting while remaining stably associated is not known. Here, we describe x-ray crystal structures of the intact Escherichia coli ribosome, either in the apo-form (3.5 angstrom resolution) or with one (4.0 angstrom resolution) or two (4.0 angstrom resolution) anticodon stem-loop tRNA mimics bound, that reveal intermediate states of intersubunit rotation. In the structures, the interface between the small and large ribosomal subunits rearranges in discrete steps along the ratcheting pathway. Positioning of the head domain of the small subunit is controlled by interactions with the large subunit and with the tRNA bound in the peptidyl-tRNA site. The intermediates observed here provide insight into how tRNAs move into the hybrid state of binding that precedes the final steps of mRNA and tRNA translocation.

  19. Energy landscape of the ribosomal decoding center.

    PubMed

    Sanbonmatsu, K Y

    2006-08-01

    The ribosome decodes the genetic information that resides in nucleic acids. A key component of the decoding mechanism is a conformational switch in the decoding center of the small ribosomal subunit discovered in high-resolution X-ray crystallography studies. It is known that small subunit nucleotides A1492 and A1493 flip out of helix 44 upon transfer RNA (tRNA) binding; however, the operation principles of this switch remain unknown. Replica molecular dynamics simulations reveal a low free energy barrier between flipped-out and flipped-in states, consistent with a switch that can be controlled by shifting the equilibrium between states. The barrier determined by the simulations is sufficiently small for the binding of ligands, such as tRNAs or aminoglycoside antibiotics, to shift the equilibrium. PMID:16905237

  20. Metabolism of 18S rRNA in rat liver cells in different functional states of protein-synthesizing apparatus

    SciTech Connect

    Chirkov, G.P.; Druzhinina, M.K.; Todorov, I.N.

    1986-04-10

    The ratio of the absolute radioactivities of 28S and 18S RNAs in the fractions of membrane-bound and free polysomes and the fraction of free rat liver ribosomes was studied under conditions of inhibition of translation by cycloheximide, insulin, and cAMP. It was found that insulin and cAMP, in contrast to cycloheximide, do not induce selective degradation of 18S rRNA. The results are discussed from the standpoint of the possible role of the phosphorylation of protein S6 in the degradation of the 40S ribosomal subunit.

  1. Role of Small Subunit in Mediating Assembly of Red-type Form I Rubisco

    PubMed Central

    Joshi, Jidnyasa; Mueller-Cajar, Oliver; Tsai, Yi-Chin C.; Hartl, F. Ulrich; Hayer-Hartl, Manajit

    2015-01-01

    Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) is the key enzyme involved in photosynthetic carbon fixation, converting atmospheric CO2 to organic compounds. Form I Rubisco is a cylindrical complex composed of eight large (RbcL) subunits that are capped by four small subunits (RbcS) at the top and four at the bottom. Form I Rubiscos are phylogenetically divided into green- and red-type. Some red-type enzymes have catalytically superior properties. Thus, understanding their folding and assembly is of considerable biotechnological interest. Folding of the green-type RbcL subunits in cyanobacteria is mediated by the GroEL/ES chaperonin system, and assembly to holoenzyme requires specialized chaperones such as RbcX and RAF1. Here, we show that the red-type RbcL subunits in the proteobacterium Rhodobacter sphaeroides also fold with GroEL/ES. However, assembly proceeds in a chaperone-independent manner. We find that the C-terminal β-hairpin extension of red-type RbcS, which is absent in green-type RbcS, is critical for efficient assembly. The β-hairpins of four RbcS subunits form an eight-stranded β-barrel that protrudes into the central solvent channel of the RbcL core complex. The two β-barrels stabilize the complex through multiple interactions with the RbcL subunits. A chimeric green-type RbcS carrying the C-terminal β-hairpin renders the assembly of a cyanobacterial Rubisco independent of RbcX. Our results may facilitate the engineering of crop plants with improved growth properties expressing red-type Rubisco. PMID:25371207

  2. Isolation and Characterization of the Small Subunit of the Uptake Hydrogenase from the Cyanobacterium Nostoc punctiforme*

    PubMed Central

    Raleiras, Patrícia; Kellers, Petra; Lindblad, Peter; Styring, Stenbjörn; Magnuson, Ann

    2013-01-01

    In nitrogen-fixing cyanobacteria, hydrogen evolution is associated with hydrogenases and nitrogenase, making these enzymes interesting targets for genetic engineering aimed at increased hydrogen production. Nostoc punctiforme ATCC 29133 is a filamentous cyanobacterium that expresses the uptake hydrogenase HupSL in heterocysts under nitrogen-fixing conditions. Little is known about the structural and biophysical properties of HupSL. The small subunit, HupS, has been postulated to contain three iron-sulfur clusters, but the details regarding their nature have been unclear due to unusual cluster binding motifs in the amino acid sequence. We now report the cloning and heterologous expression of Nostoc punctiforme HupS as a fusion protein, f-HupS. We have characterized the anaerobically purified protein by UV-visible and EPR spectroscopies. Our results show that f-HupS contains three iron-sulfur clusters. UV-visible absorption of f-HupS has bands ∼340 and 420 nm, typical for iron-sulfur clusters. The EPR spectrum of the oxidized f-HupS shows a narrow g = 2.023 resonance, characteristic of a low-spin (S = ½) [3Fe-4S] cluster. The reduced f-HupS presents complex EPR spectra with overlapping resonances centered on g = 1.94, g = 1.91, and g = 1.88, typical of low-spin (S = ½) [4Fe-4S] clusters. Analysis of the spectroscopic data allowed us to distinguish between two species attributable to two distinct [4Fe-4S] clusters, in addition to the [3Fe-4S] cluster. This indicates that f-HupS binds [4Fe-4S] clusters despite the presence of unusual coordinating amino acids. Furthermore, our expression and purification of what seems to be an intact HupS protein allows future studies on the significance of ligand nature on redox properties of the iron-sulfur clusters of HupS. PMID:23649626

  3. Regulation of the mammalian elongation cycle by subunit rolling: a eukaryotic-specific ribosome rearrangement.

    PubMed

    Budkevich, Tatyana V; Giesebrecht, Jan; Behrmann, Elmar; Loerke, Justus; Ramrath, David J F; Mielke, Thorsten; Ismer, Jochen; Hildebrand, Peter W; Tung, Chang-Shung; Nierhaus, Knud H; Sanbonmatsu, Karissa Y; Spahn, Christian M T

    2014-07-01

    The extent to which bacterial ribosomes and the significantly larger eukaryotic ribosomes share the same mechanisms of ribosomal elongation is unknown. Here, we present subnanometer resolution cryoelectron microscopy maps of the mammalian 80S ribosome in the posttranslocational state and in complex with the eukaryotic eEF1A⋅Val-tRNA⋅GMPPNP ternary complex, revealing significant differences in the elongation mechanism between bacteria and mammals. Surprisingly, and in contrast to bacterial ribosomes, a rotation of the small subunit around its long axis and orthogonal to the well-known intersubunit rotation distinguishes the posttranslocational state from the classical pretranslocational state ribosome. We term this motion "subunit rolling." Correspondingly, a mammalian decoding complex visualized in substates before and after codon recognition reveals structural distinctions from the bacterial system. These findings suggest how codon recognition leads to GTPase activation in the mammalian system and demonstrate that in mammalia subunit rolling occurs during tRNA selection. PMID:24995983

  4. Characterization and phylogenetic relationships among microsporidia infecting silkworm, Bombyx mori, using inter simple sequence repeat (ISSR) and small subunit rRNA (SSU-rRNA) sequence analysis.

    PubMed

    Rao, S Nageswara; Nath, B Surendra; Saratchandra, B

    2005-06-01

    This study is the first report on the genetic characterization and relationships among different microsporidia infecting the silkworm, Bombyx mori, using inter simple sequence repeat PCR (ISSR-PCR) analysis. Six different microsporidians were distinguished through molecular DNA typing using ISSR-PCR. Thus, ISSR-PCR analysis can be a powerful tool to detect polymorphisms and identify microsporidians, which are difficult to study with microscopy because of their extremely small size. Of the 100 ISSR primers tested, only 28 primers had reproducibility and high polymorphism (93%). A total of 24 ISSR primers produced 55 unique genetic markers, which could be used to differentiate the microsporidians from each other. Among the 28 SSRs tested, the most abundant were (CA)n, (GA)n, and (GT)n repeats. The degree of band sharing was used to evaluate genetic similarity between different microsporidian isolates and to construct a phylogenetic tree using Jaccard's similarity coefficient. The results indicate that the DNA profiles based on ISSR markers can be used as diagnostic tools to identify different microsporidia with considerable accuracy. In addition, the small subunit ribosomal RNA (SSU-rRNA) sequence gene was amplified, cloned, and sequenced from each of the 6 microsporidian isolates. These sequences were compared with 20 other microsporidian SSU-rRNA sequences to develop a phylogenetic tree for the microsporidia isolated from the silkworms. This method was found to be useful in establishing the phylogenetic relationships among the different microsporidians isolated from silkworms. Of the 6 microsporidian isolates, NIK-1s revealed an SSU-rRNA gene sequence similar to Nosema bombycis, indicating that NIK-1s is similar to N. bombycis; the remaining 5 isolates, which differed from each other and from N. bombycis, were considered to be different variants belonging to the species N. bombycis. PMID:16121233

  5. Ribosomal proteins: functions beyond the ribosome

    PubMed Central

    Zhou, Xiang; Liao, Wen-Juan; Liao, Jun-Ming; Liao, Peng; Lu, Hua

    2015-01-01

    Although ribosomal proteins are known for playing an essential role in ribosome assembly and protein translation, their ribosome-independent functions have also been greatly appreciated. Over the past decade, more than a dozen of ribosomal proteins have been found to activate the tumor suppressor p53 pathway in response to ribosomal stress. In addition, these ribosomal proteins are involved in various physiological and pathological processes. This review is composed to overview the current understanding of how ribosomal stress provokes the accumulation of ribosome-free ribosomal proteins, as well as the ribosome-independent functions of ribosomal proteins in tumorigenesis, immune signaling, and development. We also propose the potential of applying these pieces of knowledge to the development of ribosomal stress-based cancer therapeutics. PMID:25735597

  6. Mitomycin C Inhibits Ribosomal RNA

    PubMed Central

    Snodgrass, Ryan G.; Collier, Abby C.; Coon, Amy E.; Pritsos, Chris A.

    2010-01-01

    Mitomycin C (MMC) is a commonly used and extensively studied chemotherapeutic agent requiring biological reduction for activity. Damage to nuclear DNA is thought to be its primary mechanism of cell death. Due to a lack of evidence for significant MMC activation in the nucleus and for in vivo studies demonstrating the formation of MMC-DNA adducts, we chose to investigate alternative nucleic acid targets. Real-time reverse transcription-PCR was used to determine changes in mitochondrial gene expression induced by MMC treatment. Although no consistent effects on mitochondrial mRNA expression were observed, complementary results from reverse transcription-PCR experiments and gel-shift and binding assays demonstrated that MMC rapidly decreased the transcript levels of 18S ribosomal RNA in a concentration-dependent manner. Under hypoxic conditions, transcript levels of 18S rRNA decreased by 1.5-fold compared with untreated controls within 30 min. Recovery to base line required several hours, indicating that de novo synthesis of 18S was necessary. Addition of MMC to an in vitro translation reaction significantly decreased protein production in the cell-free system. Functional assays performed using a luciferase reporter construct in vivo determined that protein translation was inhibited, further confirming this mechanism of toxicity. The interaction of MMC with ribosomal RNA and subsequent inhibition of protein translation is consistent with mechanisms proposed for other natural compounds. PMID:20418373

  7. Residues in three conserved regions of the small subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase are required for quaternary structure

    SciTech Connect

    Fitchen, J.H.; McIntosh, L. ); Knight, S.; Andersson, I.; Branden, C.I. )

    1990-08-01

    To explore the role of individual residues in the small subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase, small subunits with single amino acid substitutions in three regions of relative sequence conservation were produced by directed mutagenesis of the rbcS gene from Anabaena 7120. These altered small subunits were cosythesized with large subunits (from an expressed Anabaena rbcL gene) in Escherichia coli. Mutants were analyzed for effects on quaternary structure and catalytic activity. Changing Glu-13S (numbering used is that of the spinach enzyme) to Val, Trp-67S to Arg, Pro-73S to His, or Tyr-98S to Asn prevented accumulation of stable holoenzyme. Interpretation of these results using a model for the three-dimensional structure of the spinach enzyme based on x-ray crystallographic data suggests that our small subunit mutants containing substitutions at positions 13S and 67S probably do not assemble because of mispairing or nonpairing of charged residues on the interfacing surfaces of the large and small subunits. The failure of small subunits substituted at positions 73S or 98S to assemble correctly may result from disruption of intersubunit or intrasubunit hydrophobic pockets, respectively.

  8. MPV17L2 is required for ribosome assembly in mitochondria

    PubMed Central

    Dalla Rosa, Ilaria; Durigon, Romina; Pearce, Sarah F.; Rorbach, Joanna; Hirst, Elizabeth M.A.; Vidoni, Sara; Reyes, Aurelio; Brea-Calvo, Gloria; Minczuk, Michal; Woellhaf, Michael W.; Herrmann, Johannes M.; Huynen, Martijn A.; Holt, Ian J.; Spinazzola, Antonella

    2014-01-01

    MPV17 is a mitochondrial protein of unknown function, and mutations in MPV17 are associated with mitochondrial deoxyribonucleic acid (DNA) maintenance disorders. Here we investigated its most similar relative, MPV17L2, which is also annotated as a mitochondrial protein. Mitochondrial fractionation analyses demonstrate MPV17L2 is an integral inner membrane protein, like MPV17. However, unlike MPV17, MPV17L2 is dependent on mitochondrial DNA, as it is absent from ρ0 cells, and co-sediments on sucrose gradients with the large subunit of the mitochondrial ribosome and the monosome. Gene silencing of MPV17L2 results in marked decreases in the monosome and both subunits of the mitochondrial ribosome, leading to impaired protein synthesis in the mitochondria. Depletion of MPV17L2 also induces mitochondrial DNA aggregation. The DNA and ribosome phenotypes are linked, as in the absence of MPV17L2 proteins of the small subunit of the mitochondrial ribosome are trapped in the enlarged nucleoids, in contrast to a component of the large subunit. These findings suggest MPV17L2 contributes to the biogenesis of the mitochondrial ribosome, uniting the two subunits to create the translationally competent monosome, and provide evidence that assembly of the small subunit of the mitochondrial ribosome occurs at the nucleoid. PMID:24948607

  9. Elevation of 20-carbon long chain bases due to a mutation in serine palmitoyltransferase small subunit b results in neurodegeneration

    PubMed Central

    Zhao, Lihong; Spassieva, Stefka; Gable, Kenneth; Gupta, Sita D.; Shi, Lan-Ying; Wang, Jieping; Bielawski, Jacek; Hicks, Wanda L.; Krebs, Mark P.; Naggert, Juergen; Hannun, Yusuf A.; Dunn, Teresa M.; Nishina, Patsy M.

    2015-01-01

    Sphingolipids typically have an 18-carbon (C18) sphingoid long chain base (LCB) backbone. Although sphingolipids with LCBs of other chain lengths have been identified, the functional significance of these low-abundance sphingolipids is unknown. The LCB chain length is determined by serine palmitoyltransferase (SPT) isoenzymes, which are trimeric proteins composed of two large subunits (SPTLC1 and SPTLC2 or SPTLC3) and a small subunit (SPTssa or SPTssb). Here we report the identification of an Sptssb mutation, Stellar (Stl), which increased the SPT affinity toward the C18 fatty acyl-CoA substrate by twofold and significantly elevated 20-carbon (C20) LCB production in the mutant mouse brain and eye, resulting in surprising neurodegenerative effects including aberrant membrane structures, accumulation of ubiquitinated proteins on membranes, and axon degeneration. Our work demonstrates that SPT small subunits play a major role in controlling SPT activity and substrate affinity, and in specifying sphingolipid LCB chain length in vivo. Moreover, our studies also suggest that excessive C20 LCBs or C20 LCB-containing sphingolipids impair protein homeostasis and neural functions. PMID:26438849

  10. Structural Comparison, Substrate Specificity, and Inhibitor Binding of AGPase Small Subunit from Monocot and Dicot: Present Insight and Future Potential

    PubMed Central

    Choudhury, Manabendra D.; Modi, Mahendra K.

    2014-01-01

    ADP-glucose pyrophosphorylase (AGPase) is the first rate limiting enzyme of starch biosynthesis pathway and has been exploited as the target for greater starch yield in several plants. The structure-function analysis and substrate binding specificity of AGPase have provided enormous potential for understanding the role of specific amino acid or motifs responsible for allosteric regulation and catalytic mechanisms, which facilitate the engineering of AGPases. We report the three-dimensional structure, substrate, and inhibitor binding specificity of AGPase small subunit from different monocot and dicot crop plants. Both monocot and dicot subunits were found to exploit similar interactions with the substrate and inhibitor molecule as in the case of their closest homologue potato tuber AGPase small subunit. Comparative sequence and structural analysis followed by molecular docking and electrostatic surface potential analysis reveal that rearrangements of secondary structure elements, substrate, and inhibitor binding residues are strongly conserved and follow common folding pattern and orientation within monocot and dicot displaying a similar mode of allosteric regulation and catalytic mechanism. The results from this study along with site-directed mutagenesis complemented by molecular dynamics simulation will shed more light on increasing the starch content of crop plants to ensure the food security worldwide. PMID:25276800

  11. Phylogenetic relationships of Cryptosporidium determined by ribosomal RNA sequence comparison.

    PubMed

    Johnson, A M; Fielke, R; Lumb, R; Baverstock, P R

    1990-04-01

    Reverse transcription of total cellular RNA was used to obtain a partial sequence of the small subunit ribosomal RNA of Cryptosporidium, a protist currently placed in the phylum Apicomplexa. The semi-conserved regions were aligned with homologous sequences in a range of other eukaryotes, and the evolutionary relationships of Cryptosporidium were determined by two different methods of phylogenetic analysis. The prokaryotes Escherichia coli and Halobacterium cuti were included as outgroups. The results do not show an especially close relationship of Cryptosporidium to other members of the phylum Apicomplexa. PMID:2332273

  12. Identification of new 18S rRNA strains of Babesia canis isolated from dogs with subclinical babesiosis.

    PubMed

    Łyp, P; Adaszek, Ł; Furmaga, B; Winiarczyk, S

    2015-01-01

    In this study, we used PCR to detect and characterize B. canis from naturally infected dogs in Poland with subclinical babesiosis by amplifying and sequencing a portion of the 18S ribosomal RNA (rRNA) gene. Venous blood samples were collected from ten dogs with subclinical babesiosis. A 559-bp fragment of the B. canis 18S rRNA gene was amplified by PCR. Sequencing of the PCR products led to the identification of a new variant of Babesia canis, differing from the previously detected protozoa genotypes (18S rRNA-A and 18S rRNA-B) with nucleotide substitutions in positions 150 and 151 of the tested gene fragment. The results indicate the emergence within the Polish territory of a new, previously unencountered Babesia canis genotype responsible for the development of subclinical babesiosis. PMID:26618590

  13. Comprehensive analysis of phosphorylated proteins of Escherichia coli ribosomes.

    PubMed

    Soung, George Y; Miller, Jennifer L; Koc, Hasan; Koc, Emine C

    2009-07-01

    Phosphorylation of bacterial ribosomal proteins has been known for decades; however, there is still very limited information available on specific locations of the phosphorylation sites in ribosomal proteins and the role they might play in protein synthesis. In this study, we have mapped the specific phosphorylation sites in 24 Escherichia coli ribosomal proteins by tandem mass spectrometry. Detection of phosphorylation was achieved by either phosphorylation specific visualization techniques, ProQ staining, and antibodies for phospho-Ser, Thr, and Tyr; or by mass spectrometry equipped with a capability to detect addition and loss of the phosphate moiety. Enrichment by immobilized metal affinity and/or strong cation exchange chromatography was used to improve the success of detection of the low abundance phosphopeptides. We found the small subunit (30S) proteins S3, S4, S5, S7, S11, S12, S13, S18, and S21 and the large subunit (50S) proteins L1, L2, L3, L5, L6, L7/L12, L13, L14, L16, L18, L19, L21, L22, L28, and L31 to be phosphorylated at one or more residues. Potential roles for each specific site in ribosome function were deduced through careful evaluation of the given phosphorylation sites in 3D-crystal structure models of ribosomes and the previous mutational studies of E. coli ribosomal proteins. PMID:19469554

  14. Genetic polymorphisms of loci D18S53, D18S59, and D18S488 in fetuses from a Chinese Tianjin Han population.

    PubMed

    Li, X Z; Liu, J; Shi, Y F; Ju, D; Zhang, Y; Yue, T F

    2016-01-01

    We investigated the genetic polymorphisms of three short tandem repeat (STR) loci, D18S53, D18S59, and D18S488, on chromosome 18 in fetuses from a Chinese Tianjin Han population. Sixty-four villus samples and 374 amniotic fluid samples were collected from fetuses. Quantitative fluorescence polymerase chain reaction was performed to amplify the STR loci, followed by scanned electrophoresis and quantitative analysis of the fluorescence signals. Hardy-Weinberg equilibrium (HWE) analysis was performed based on the genotype distributions of the STR loci to obtain the following population genetic data: genotype frequency, heterozygosity of observation (HO), polymorphism information content (PIC), probability of discrimination power (PD), and probability of exclusion (PE). We detected 15, 13, and 15 alleles of D18S53, D18S59, and D18S488, respectively. The genotype frequencies were found to be in line with HWE. The HO values of the three loci, D18S53, D18S59, and D18S488, were 0.797, 0.847, and 0.792; the PIC values were 0.81, 0.75, and 0.73; the PD values were 0.944, 0.901, and 0.881; and the PE values were 0.593, 0.689, and 0.585, respectively. D18S53, D18S59, and D18S488 loci are good genetic markers of chromosome 18, and show potential for use in the prenatal genetic diagnosis of Edwards' syndrome. PMID:27323182

  15. Cloning of the cDNAs for the small subunits of bovine and human DNA polymerase {delta} and chromosomal location of the human gene (POLD2)

    SciTech Connect

    Zhang, Jian; Tan, Cheng-Keat; Downey, K.M.

    1995-09-01

    cDNAs encoding the small subunit of bovine and human DNA polymerase {delta} have been cloned and sequenced. The predicted polypeptides, 50,885 and 51,289 Daltons, respectively, are 94% identical, similar to the catalytic subunits. The high degree of conservation of the polypeptides suggests an essential function for the small subunit in the heterodimeric core enzyme. Although the catalytic subunit of DNA polymerase 5 shares significant homology with those of the herpes virus family of DNA polymerases, the small subunit of mammalian DNA polymerase 6 is not homologous to the small subunit of either herpes simplex virus type 1 DNA polymerase (UL42 protein) or the Epstein-Barr virus DNA polymerase (BMRF1 protein). Searches of the protein databases failed to detect significant homology with any protein sequenced thus far. PCR analysis of DNA from a panel of human-hamster hybrid cell lines localized the gene (POLD2) for the small subunit of DNA polymerase 5 to human chromosome 7. 45 refs., 2 figs., 2 tabs.

  16. Morphology, ultrastructure, and small subunit rDNA phylogeny of the marine heterotrophic flagellate Goniomonas aff. amphinema.

    PubMed

    Martin-Cereceda, Mercedes; Roberts, Emily C; Wootton, Emma C; Bonaccorso, Elisa; Dyal, Patricia; Guinea, Almudena; Rogers, Dale; Wright, Chris J; Novarino, Gianfranco

    2010-01-01

    Marine goniomonads have a worldwide distribution but ultrastructural information has not been available so far. An isolate of the heterotrophic marine nanoflagellate Goniomonas (G. aff. amphinema) from North Wales (UK) has been studied, providing information on its morphology and cellular structure using video, electron, laser scanning confocal microscopy (LSCM), and atomic force microscopy. Here, we describe a new feature, a granular area, potentially involved in particle capture and feeding. The binding of the lectin wheat germ agglutinin to the granular area of cells with discharged ejectisomes indicates the adhesive nature of this novel feature. The presence of a microtubular intracellular cytopharynx, apparently also used for feeding, has been revealed by LSCM. The small subunit rRNA gene of the isolate has been sequenced (1,788 bp). Phylogenetic results corroborate significant genetic divergence within the marine members of Goniomonas. This work highlights the need for integrated morphological, ultrastructural, and molecular investigation when describing and studying heterotrophic nanoflagellates. PMID:20015186

  17. Group-specific small-subunit rRNA hybridization probes to characterize filamentous foaming in activated sludge systems.

    PubMed Central

    de los Reyes, F L; Ritter, W; Raskin, L

    1997-01-01

    Foaming in activated sludge systems is characterized by the formation of a thick, chocolate brown-colored scum that floats on the surface of aeration basins and secondary clarifiers. These viscous foams have been associated with the presence of filamentous mycolic acid-containing actinomycetes. To aid in evaluating the microbial representation in foam, we developed and characterized group-, genus-, and species-specific oligonucleotide probes targeting the small subunit rRNA of the Mycobacterium complex, Gordona spp., and Gordona (Nocardia) amarae, respectively. The use of a universal base analog, 5-nitroindole, in oligonucleotide probe design was evaluated by comparing the characteristics of two different versions of the Mycobacterium complex probe. The temperature of dissociation of each probe was determined. Probe specificity studies with a diverse collection of 67 target and nontarget rRNAs demonstrated the specificity of the probes to the target groups. Whole-cell hybridizations with fluorescein- and rhodamine-labeled probes were performed with pure cultures of various members of the Mycobacterium complex as well as with environmental samples from a full-scale activated sludge plant which experienced foaming. Quantitative membrane hybridizations with activated sludge and anaerobic digester foam showed that 15.0 to 18.3% of the total small-subunit rRNAs could be attributed to members of the Mycobacterium complex, of which a vast majority consisted of Gordona rRNA. Several G. amarae strains made up only a very small percentage of the Gordona strains present. We demonstrated that group-specific rRNA probes are useful tools for the in situ monitoring and identification of filamentous bacteria in activated sludge systems. PMID:9055425

  18. Group-specific small-subunit rRNA hybridization probes to characterize filamentous foaming in activated sludge systems.

    PubMed

    de los Reyes, F L; Ritter, W; Raskin, L

    1997-03-01

    Foaming in activated sludge systems is characterized by the formation of a thick, chocolate brown-colored scum that floats on the surface of aeration basins and secondary clarifiers. These viscous foams have been associated with the presence of filamentous mycolic acid-containing actinomycetes. To aid in evaluating the microbial representation in foam, we developed and characterized group-, genus-, and species-specific oligonucleotide probes targeting the small subunit rRNA of the Mycobacterium complex, Gordona spp., and Gordona (Nocardia) amarae, respectively. The use of a universal base analog, 5-nitroindole, in oligonucleotide probe design was evaluated by comparing the characteristics of two different versions of the Mycobacterium complex probe. The temperature of dissociation of each probe was determined. Probe specificity studies with a diverse collection of 67 target and nontarget rRNAs demonstrated the specificity of the probes to the target groups. Whole-cell hybridizations with fluorescein- and rhodamine-labeled probes were performed with pure cultures of various members of the Mycobacterium complex as well as with environmental samples from a full-scale activated sludge plant which experienced foaming. Quantitative membrane hybridizations with activated sludge and anaerobic digester foam showed that 15.0 to 18.3% of the total small-subunit rRNAs could be attributed to members of the Mycobacterium complex, of which a vast majority consisted of Gordona rRNA. Several G. amarae strains made up only a very small percentage of the Gordona strains present. We demonstrated that group-specific rRNA probes are useful tools for the in situ monitoring and identification of filamentous bacteria in activated sludge systems. PMID:9055425

  19. Characterization of GE82832, a peptide inhibitor of translocation interacting with bacterial 30S ribosomal subunits

    PubMed Central

    Brandi, Letizia; Fabbretti, Attilio; Stefano, Michele Di; Lazzarini, Ameriga; Abbondi, Monica; Gualerzi, Claudio O.

    2006-01-01

    GE82832, a secondary metabolite produced by Streptosporangium cinnabarinum (strain GE82832), has been identified as a translational inhibitor by in vitro screening of a library of natural products. Secondary functional tests specific for individual steps of the translational pathway demonstrated that translocation is the specific target of GE82832. Chemical probing in situ demonstrated that this antibiotic protects bases A1324 and A1333 and exposes C1336 of 16S rRNA, thereby indicating that its binding site is located on the head of the 30S ribosomal subunit. The ribosomal location of GE82832, near ribosomal protein S13 and G1338, two elements of the small subunit that are part of or close to the B1a intrasubunit bridge, suggests that translocation inhibition results from an altered dynamics of 30S–50S ribosomal subunit interaction. PMID:16699167

  20. Choreography of molecular movements during ribosome progression along mRNA.

    PubMed

    Belardinelli, Riccardo; Sharma, Heena; Caliskan, Neva; Cunha, Carlos E; Peske, Frank; Wintermeyer, Wolfgang; Rodnina, Marina V

    2016-04-01

    During translation elongation, ribosome translocation along an mRNA entails rotations of the ribosomal subunits, swiveling motions of the small subunit (SSU) head and stepwise movements of the tRNAs together with the mRNA. Here, we reconstructed the choreography of the collective motions of the Escherichia coli ribosome during translocation promoted by elongation factor EF-G, by recording the fluorescence signatures of nine different reporters placed on both ribosomal subunits, tRNA and mRNA. We captured an early forward swiveling of the SSU head taking place while the SSU body rotates in the opposite, clockwise direction. Backward swiveling of the SSU head starts upon tRNA translocation and continues until the post-translocation state is reached. This work places structures of translocation intermediates along a time axis and unravels principles of the motions of macromolecular machines. PMID:26999556

  1. Multiperspective smFRET reveals rate-determining late intermediates of ribosomal translocation.

    PubMed

    Wasserman, Michael R; Alejo, Jose L; Altman, Roger B; Blanchard, Scott C

    2016-04-01

    Directional translocation of the ribosome through the mRNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of tRNA and mRNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations revealed direct evidence of structurally and kinetically distinct late intermediates during substrate movement, whose resolution determines the rate of translocation. These steps involve intramolecular events within the EF-G-GDP-bound ribosome, including exaggerated, reversible fluctuations of the small-subunit head domain, which ultimately facilitate peptidyl-tRNA's movement into its final post-translocation position. PMID:26926435

  2. Gene cloning of the 18S rRNA of an ancient viable moss from the permafrost of northeastern Siberia

    NASA Astrophysics Data System (ADS)

    Marsic, Damien; Hoover, Richard B.; Gilichinsky, David A.; Ng, Joseph D.

    1999-12-01

    A moss plant dating as much as 40,000 years old was collected from the permafrost of the Kolyma Lowlands of Northeastern Siberia. The plant tissue was revived and cultured for the extraction of its genomic DNA. Using the polymerase chain reaction technique, the 18S ribosomal RNA gene was cloned and its sequence studied. Comparative sequence analysis of the cloned ribosomal DNA to other known 18S RNA showed very high sequence identity and was revealed to be closest to the moss specie, Aulacomnium turgidum. The results of this study also show the ability of biological organisms to rest dormant in deep frozen environments where they can be revived and cultured under favorable conditions. This is significant in the notion that celestial icy bodies can be media to preserve biological function and genetic material during long term storage or transport.

  3. E2F1 promote the aggressiveness of human colorectal cancer by activating the ribonucleotide reductase small subunit M2

    SciTech Connect

    Fang, Zejun; Gong, Chaoju; Liu, Hong; Zhang, Xiaomin; Mei, Lingming; Song, Mintao; Qiu, Lanlan; Luo, Shuchai; Zhu, Zhihua; Zhang, Ronghui; Gu, Hongqian; Chen, Xiang

    2015-08-21

    As the ribonucleotide reductase small subunit, the high expression of ribonucleotide reductase small subunit M2 (RRM2) induces cancer and contributes to tumor growth and invasion. In several colorectal cancer (CRC) cell lines, we found that the expression levels of RRM2 were closely related to the transcription factor E2F1. Mechanistic studies were conducted to determine the molecular basis. Ectopic overexpression of E2F1 promoted RRM2 transactivation while knockdown of E2F1 reduced the levels of RRM2 mRNA and protein. To further investigate the roles of RRM2 which was activated by E2F1 in CRC, CCK-8 assay and EdU incorporation assay were performed. Overexpression of E2F1 promoted cell proliferation in CRC cells, which was blocked by RRM2 knockdown attenuation. In the migration and invasion tests, overexpression of E2F1 enhanced the migration and invasion of CRC cells which was abrogated by silencing RRM2. Besides, overexpression of RRM2 reversed the effects of E2F1 knockdown partially in CRC cells. Examination of clinical CRC specimens demonstrated that both RRM2 and E2F1 were elevated in most cancer tissues compared to the paired normal tissues. Further analysis showed that the protein expression levels of E2F1 and RRM2 were parallel with each other and positively correlated with lymph node metastasis (LNM), TNM stage and distant metastasis. Consistently, the patients with low E2F1 and RRM2 levels have a better prognosis than those with high levels. Therefore, we suggest that E2F1 can promote CRC proliferation, migration, invasion and metastasis by regulating RRM2 transactivation. Understanding the role of E2F1 in activating RRM2 transcription will help to explain the relationship between E2F1 and RRM2 in CRC and provide a novel predictive marker for diagnosis and prognosis of the disease. - Highlights: • E2F1 promotes RRM2 transactivation in CRC cells. • E2F1 promotes the proliferation of CRC cells by activating RRM2. • E2F1 promotes the migration and

  4. The ATPase hCINAP regulates 18S rRNA processing and is essential for embryogenesis and tumour growth

    PubMed Central

    Bai, Dongmei; Zhang, Jinfang; Li, Tingting; Hang, Runlai; Liu, Yong; Tian, Yonglu; Huang, Dadu; Qu, Linglong; Cao, Xiaofeng; Ji, Jiafu; Zheng, Xiaofeng

    2016-01-01

    Dysfunctions in ribosome biogenesis cause developmental defects and increased cancer susceptibility; however, the connection between ribosome assembly and tumorigenesis remains unestablished. Here we show that hCINAP (also named AK6) is required for human 18S rRNA processing and 40S subunit assembly. Homozygous CINAP−/− mice show embryonic lethality. The heterozygotes are viable and show defects in 18S rRNA processing, whereas no delayed cell growth is observed. However, during rapid growth, CINAP haploinsufficiency impairs protein synthesis. Consistently, hCINAP depletion in fast-growing cancer cells inhibits ribosome assembly and abolishes tumorigenesis. These data demonstrate that hCINAP reduction is a specific rate-limiting controller during rapid growth. Notably, hCINAP is highly expressed in cancers and correlated with a worse prognosis. Genome-wide polysome profiling shows that hCINAP selectively modulates cancer-associated translatome to promote malignancy. Our results connect the role of hCINAP in ribosome assembly with tumorigenesis. Modulation of hCINAP expression may be a promising target for cancer therapy. PMID:27477389

  5. Identification of bovine Neospora parasites by PCR amplification and specific small-subunit rRNA sequence probe hybridization.

    PubMed

    Ho, M S; Barr, B C; Marsh, A E; Anderson, M L; Rowe, J D; Tarantal, A F; Hendrickx, A G; Sverlow, K; Dubey, J P; Conrad, P A

    1996-05-01

    Neospora is a newly recognized genus of pathogenic coccidia, closely related to Toxoplasma gondii, that can cause abortion or congenital disease in a variety of domestic animal hosts. On the basis of the small-subunit rRNA gene sequences of Neospora spp. and other apicomplexa coccidia, oligonucleotide primers COC-1 and COC-2 were used for PCR amplification of conserved sequences of approximately 300 bp in size. A Neospora-specific chemiluminescent probe hybridized to Southern blots of amplification products from Neospora DNA but not to Southern blots with amplified DNA from the other coccidian parasites tested. A Toxoplasma-specific probe whose sequence differed from that of the probe for Neospora spp. by a single base pair was used to distinguish these parasites by specific Southern blot hybridization. The PCR system detected as few as one Neospora tachyzoite in the culture medium or five tachyzoites in samples of whole blood or amniotic fluid spiked with Neospora parasites. In addition, Neospora PCR products were successfully amplified from whole blood and amniotic fluid samples of experimentally infected bovine and rhesus macaque fetuses. These results indicate that this PCR and probe hybridization system could be a valuable adjunct to serology and immunohistochemistry for the diagnosis of Neospora infections in bovine or primate fetuses. PMID:8727903

  6. Establishment of a continuous culture system for Entamoeba muris and analysis of the small subunit rRNA gene.

    PubMed

    Kobayashi, S; Suzuki, J; Takeuchi, T

    2009-06-01

    We established a culture system for Entamoeba muris (MG-EM-01 strain isolated from a Mongolian gerbil) using a modified Balamuth's egg yolk infusion medium supplemented with 4% adult bovine serum and Bacteroides fragilis cocultured with Escherichia coli. Further, encystation was observed in the culture medium. The morphological characteristics of E. muris are similar to those of Entamoeba coli (E. coli); moreover, the malic isoenzyme electrophoretic band, which shows species-specific electrophoretic mobility, of E. muris had almost the same mobility as that observed with the malic isoenzyme electrophorectic band of E. coli (UZG-EC-01 strain isolated from a gorilla). We determined the small subunit rRNA (SSU-rRNA) gene sequence of the MG-EM-01 strain, and this sequence was observed to show 82.7% homology with that of the UZG-EC-01 strain. Further, the resultant phylogenetic tree for molecular taxonomy based on the SSU-rRNA genes of the 21 strains of the intestinal parasitic amoeba species indicated that the MG-EM-01 strain was most closely related to E. coli. PMID:19585892

  7. Novel Eukaryotic Lineages Inferred from Small-Subunit rRNA Analyses of Oxygen-Depleted Marine Environments†

    PubMed Central

    Stoeck, Thorsten; Epstein, Slava

    2003-01-01

    Microeukaryotes in oxygen-depleted environments are among the most diverse, as well as the least studied, organisms. We conducted a cultivation-independent, small-subunit (SSU) rRNA-based survey of microeukaryotes in suboxic waters and anoxic sediments in the great Sippewisset salt marsh, Cape Cod, Mass. We generated two clone libraries and analyzed approximately 300 clones, which contained a large diversity of microeukaryotic SSU rRNA signatures. Only a few of these signatures were closely related (sequence similarity of >97%) to the sequences reported earlier. The bulk of our sequences represented deep novel branches within green algae, fungi, cercozoa, stramenopiles, alveolates, euglenozoa and unclassified flagellates. In addition, a significant number of detected rRNA sequences exhibited no affiliation to known organisms and sequences and thus represent novel lineages of the highest taxonomical order, most of them branching off the base of the global phylogenetic tree. This suggests that oxygen-depleted environments harbor diverse communities of novel organisms, which may provide an interesting window into the early evolution of eukaryotes. PMID:12732534

  8. Identification of a potential fungal species by 18S rDNA for ligninases production.

    PubMed

    Ferhan, M; Santos, S N; Melo, I S; Yan, N; Sain, M

    2013-12-01

    Fungal species for ligninases production was investigated by 18S ribosomal DNA sequence analysis. Two primer sets were chosen to amplify a major part of the 18S rDNA, which resulted in intense PCR product of approximately 550-820 bp in size per sample. The results suggest that the 18S rDNA-based approach is a useful tool for identification of unknown potential fungal species for ligninases production. The isolated fungal species produces mainly manganese peroxidase (MnP). The enzyme oxidized a variety of the usual MnP substrates, including lignin related polyphenols. Time course studies showed that maximum production of ligninolytic enzymes MnP (64 IU L⁻¹), lignin peroxidase (26.35 IU L⁻¹), and laccase (5.44 IU L⁻¹), respectively, were achieved after 10 days of cultivation under optimum conditions. Furthermore, the biological decolorization of Remazol Brilliant Blue R dye following 10 days of cultivation was 94 %. NCBI BLAST was used to search for closest matched sequences in the GenBank database and based on sequence homology the first BLAST hit was Dothioraceae sp. LM572 with accession number EF060858.1. PMID:23744034

  9. Mutational analysis of S12 protein and implications for the accuracy of decoding by the ribosome

    PubMed Central

    Sharma, Divya; Cukras, Anthony R.; Rogers, Elizabeth J.; Southworth, Daniel R.; Green, Rachel

    2007-01-01

    The fidelity of aminoacyl-tRNA selection by the ribosome depends on a conformational switch in the decoding center of the small ribosomal subunit induced by cognate but not by near-cognate aminoacyl tRNA. The aminoglycosides paromomycin and streptomycin bind to the decoding center and induce related structural rearrangements that explain their observed effects on miscoding. Structural and biochemical studies have identified ribosomal protein S12 (as well as specific nucleotides in 16S rRNA) as a critical molecular contributor in distinguishing between cognate and near-cognate tRNA species as well as in promoting more global rearrangements in the small subunit referred to as “closure”. Here we use a mutational approach to define contributions made by two highly conserved loops in S12 to the process of tRNA selection. Most S12 variant ribosomes tested display increased levels of fidelity (a “restrictive” phenotype). Interestingly, several variants, K42A and R53A, were substantially resistant to the miscoding effects of paromomycin. Further characterization of the compromised paromomycin response identified a probable second, fidelity modulating binding site for paromomycin in the 16S rRNA that facilitates closure of the small subunit and compensates for defects associated with the S12 mutations. PMID:17967466

  10. Key intermolecular interactions in the E. coli 70S ribosome revealed by coarse-grained analysis.

    PubMed

    Zhang, Zhiyong; Sanbonmatsu, Karissa Y; Voth, Gregory A

    2011-10-26

    The ribosome is a very large complex that consists of many RNA and protein molecules and plays a central role in protein biosynthesis in all organisms. Extensive interactions between different molecules are critical to ribosomal functional dynamics. In this work, intermolecular interactions in the Escherichia coli 70S ribosome are investigated by coarse-grained (CG) analysis. CG models are defined to preserve dynamic domains in RNAs and proteins and to capture functional motions in the ribosome, and then the CG sites are connected by harmonic springs, and spring constants are obtained by matching the computed fluctuations to those of an all-atom molecular dynamics (MD) simulation. Those spring constants indicate how strong the interactions are between the ribosomal components, and they are in good agreement with various experimental data. Nearly all the bridges between the small and large ribosomal subunits are indicated by CG interactions with large spring constants. The head of the small subunit is very mobile because it has minimal CG interactions with the rest of the subunit; however, a large number of small subunit proteins bind to maintain the internal structure of the head. The results show a clear connection between the intermolecular interactions and the structural and functional properties of the ribosome because of the reduced complexity in domain-based CG models. The present approach also provides a useful strategy to map interactions between molecules within large biomolecular complexes since it is not straightforward to investigate these by either atomistic MD simulations or residue-based elastic network models. PMID:21910449

  11. Complete sequence and gene organization of the Nosema heliothidis ribosomal RNA gene region.

    PubMed

    Dong, Shinan; Shen, Zhongyuan; Zhu, Feng; Tang, Xudong; Xu, Li

    2011-01-01

    By sequencing the entire ribosomal RNA (rRNA) gene region of Nosema heliothidis isolated from cotton bollworm (Helicoverpa armigera), we showed that its gene organization is similar to the type species, Nosema bombycis: the 5'-large subunit rRNA (2,490 bp)-internal transcribed spacer (192 bp)-small subunit rRNA (1,232 bp)-intergenic spacer (274 bp)-5S rRNA (115 bp)-3'. We constructed two phylogenetic trees, analyzed phylogenetic relationships, examined rRNA organization of microsporidia, and compared the secondary structure of small subunit rRNA with closely related microsporidia. The latter two features may provide important information for the classification and phylogenetic analysis of microsporidia. PMID:21895841

  12. Affinity labeling of the ribosomal P site in Drosophila melanogaster

    SciTech Connect

    North, D.

    1987-01-01

    Several recent studies have probed the peptidyl transferase region of the Drosophila ribosome via the use of reactive site specific analogues (affinity labels). P site proteins adjacent to the 3' end of the amino acid bearing tRNA strand were labeled with modified tRNA fragments. Drugs affecting the binding of these agents were used to further clarify the nature of the region. The nascent peptide region of the P site was not labeled in previous experiments. To label that region radioactive Bromoacetylphenylalanyl-tRNA (BrAcphe-tRNA) was synthesized. The alpha-bromoacetyl group of this analogue is potentially reactive with nucleophiles present in either proteins or RNAs. Charged tRNAs and tRNA analogues bearing a peptide bond on the N-terminus of their amino acid are recognized as having affinity for the ribosomal P site. Specific labeling of the P site by BrAcphe-tRNA was confirmed by its ability to radioactively label proteins indirectly. As many as 8 ribosomal proteins may be labeled under these conditions, however, the majority of the bound label is associated with 3 large subunit proteins and 2 small subunit proteins. Overlaps between the proteins labeled by BrAcphe-tRNA and those labeled by other affinity labels are examined and a model of the peptidyl transferase region of Drosophila ribosomes is presented.

  13. Ribosomal protein uS19 mutants reveal its role in coordinating ribosome structure and function

    PubMed Central

    Bowen, Alicia M; Musalgaonkar, Sharmishtha; Moomau, Christine A; Gulay, Suna P; Mirvis, Mary; Dinman, Jonathan D

    2015-01-01

    Prior studies identified allosteric information pathways connecting functional centers in the large ribosomal subunit to the decoding center in the small subunit through the B1a and B1b/c intersubunit bridges in yeast. In prokaryotes a single SSU protein, uS13, partners with H38 (the A-site finger) and uL5 to form the B1a and B1b/c bridges respectively. In eukaryotes, the SSU component was split into 2 separate proteins during the course of evolution. One, also known as uS13, participates in B1b/c bridge with uL5 in eukaryotes. The other, called uS19 is the SSU partner in the B1a bridge with H38. Here, polyalanine mutants of uS19 involved in the uS19/uS13 and the uS19/H38 interfaces were used to elucidate the important amino acid residues involved in these intersubunit communication pathways. Two key clusters of amino acids were identified: one located at the junction between uS19 and uS13, and a second that appears to interact with the distal tip of H38. Biochemical analyses reveal that these mutations shift the ribosomal rotational equilibrium toward the unrotated state, increasing ribosomal affinity for tRNAs in the P-site and for ternary complex in the A-site, and inhibit binding of the translocase, eEF2. These defects in turn affect specific aspects of translational fidelity. These findings suggest that uS19 plays a critical role as a conduit of information exchange between the large and small ribosomal subunits directly through the B1a, and indirectly through the B1b/c bridges. PMID:26824029

  14. Ribosomal protein uS19 mutants reveal its role in coordinating ribosome structure and function.

    PubMed

    Bowen, Alicia M; Musalgaonkar, Sharmishtha; Moomau, Christine A; Gulay, Suna P; Mirvis, Mary; Dinman, Jonathan D

    2015-01-01

    Prior studies identified allosteric information pathways connecting functional centers in the large ribosomal subunit to the decoding center in the small subunit through the B1a and B1b/c intersubunit bridges in yeast. In prokaryotes a single SSU protein, uS13, partners with H38 (the A-site finger) and uL5 to form the B1a and B1b/c bridges respectively. In eukaryotes, the SSU component was split into 2 separate proteins during the course of evolution. One, also known as uS13, participates in B1b/c bridge with uL5 in eukaryotes. The other, called uS19 is the SSU partner in the B1a bridge with H38. Here, polyalanine mutants of uS19 involved in the uS19/uS13 and the uS19/H38 interfaces were used to elucidate the important amino acid residues involved in these intersubunit communication pathways. Two key clusters of amino acids were identified: one located at the junction between uS19 and uS13, and a second that appears to interact with the distal tip of H38. Biochemical analyses reveal that these mutations shift the ribosomal rotational equilibrium toward the unrotated state, increasing ribosomal affinity for tRNAs in the P-site and for ternary complex in the A-site, and inhibit binding of the translocase, eEF2. These defects in turn affect specific aspects of translational fidelity. These findings suggest that uS19 plays a critical role as a conduit of information exchange between the large and small ribosomal subunits directly through the B1a, and indirectly through the B1b/c bridges. PMID:26824029

  15. Nuclear localization of the Saccharomyces cerevisiae ribonucleotide reductase small subunit requires a karyopherin and a WD40 repeat protein

    PubMed Central

    Zhang, Zhen; An, Xiuxiang; Yang, Kui; Perlstein, Deborah L.; Hicks, Leslie; Kelleher, Neil; Stubbe, JoAnne; Huang, Mingxia

    2006-01-01

    Ribonucleotide reductase (RNR) catalyzes the reduction of ribonucleotides to the corresponding deoxyribonucleotides and is an essential enzyme for DNA replication and repair. Cells have evolved intricate mechanisms to regulate RNR activity to ensure high fidelity of DNA replication during normal cell-cycle progression and of DNA repair upon genotoxic stress. The RNR holoenzyme is composed of a large subunit R1 (α, oligomeric state unknown) and a small subunit R2 (β2). R1 binds substrates and allosteric effectors; R2 contains a diferric-tyrosyl radical [(Fe)2-Y·] cofactor that is required for catalysis. In Saccharomyces cerevisiae, R1 is predominantly localized in the cytoplasm, whereas R2, which is a heterodimer (ββ′), is predominantly in the nucleus. When cells encounter DNA damage or stress during replication, ββ′ is redistributed from the nucleus to the cytoplasm in a checkpoint-dependent manner, resulting in the colocalization of R1 and R2. We have identified two proteins that have an important role in ββ′ nuclear localization: the importin β homolog Kap122 and the WD40 repeat protein Wtm1. Deletion of either WTM1 or KAP122 leads to loss of ββ′ nuclear localization. Wtm1 and its paralog Wtm2 are both nuclear proteins that are in the same protein complex with ββ′. Wtm1 also interacts with Kap122 in vivo and requires Kap122 for its nuclear localization. Our results suggest that Wtm1 acts either as an adaptor to facilitate nuclear import of ββ′ by Kap122 or as an anchor to retain ββ′ in the nucleus. PMID:16432237

  16. Regulation of Plasmodium yoelii Oocyst Development by Strain- and Stage-Specific Small-Subunit rRNA

    PubMed Central

    Qi, Yanwei; Zhu, Feng; Eastman, Richard T.; Fu, Young; Zilversmit, Martine; Pattaradilokrat, Sittiporn; Hong, Lingxian; Liu, Shengfa; McCutchan, Thomas F.; Pan, Weiqing; Xu, Wenyue

    2015-01-01

    ABSTRACT One unique feature of malaria parasites is the differential transcription of structurally distinct rRNA (rRNA) genes at different developmental stages: the A-type genes are transcribed mainly in asexual stages, whereas the S-type genes are expressed mostly in sexual or mosquito stages. Conclusive functional evidence of different rRNAs in regulating stage-specific parasite development, however, is still absent. Here we performed genetic crosses of Plasmodium yoelii parasites with one parent having an oocyst development defect (ODD) phenotype and another producing normal oocysts to identify the gene(s) contributing to the ODD. The parent with ODD—characterized as having small oocysts and lacking infective sporozoites—was obtained after introduction of a plasmid with a green fluorescent protein gene into the parasite genome and subsequent passages in mice. Quantitative trait locus analysis of genome-wide microsatellite genotypes of 48 progeny from the crosses linked an ~200-kb segment on chromosome 6 containing one of the S-type genes (D-type small subunit rRNA gene [D-ssu]) to the ODD. Fine mapping of the plasmid integration site, gene expression pattern, and gene knockout experiments demonstrated that disruption of the D-ssu gene caused the ODD phenotype. Interestingly, introduction of the D-ssu gene into the same parasite strain (self), but not into a different subspecies, significantly affected or completely ablated oocyst development, suggesting a stage- and subspecies (strain)-specific regulation of oocyst development by D-ssu. This study demonstrates that P. yoelii D-ssu is essential for normal oocyst and sporozoite development and that variation in the D-ssu sequence can have dramatic effects on parasite development. PMID:25759501

  17. Molecular microbial diversity of an anaerobic digestor as determined by small-subunit rDNA sequence analysis.

    PubMed Central

    Godon, J J; Zumstein, E; Dabert, P; Habouzit, F; Moletta, R

    1997-01-01

    The bacterial community structure of a fluidized-bed reactor fed by vinasses (wine distillation waste) was analyzed. After PCR amplification, four small-subunit (SSU) rDNA clone libraries of Bacteria, Archaea, Procarya, and Eucarya populations were established. The community structure was determined by operational taxonomic unit (OTU) phylogenetic analyses of 579 partial rDNA sequences (about 500 bp long). A total of 146 OTUs were found, comprising 133, 6, and 7 from the Bacteria, Archaea, and Eucarya domains, respectively. A total of 117 bacterial OTU were affiliated with major phyla: low-G+C gram-positive bacteria, Cytophaga-Flexibacter-Bacteroides, Proteobacteria, high-G+C gram-positive bacteria, and Spirochaetes, where the clone distribution was 34, 26, 17, 6, and 4%, respectively. The other 16 bacterial OTUs represent 13% of the clones. They were either affiliated with narrow phyla such as Planctomyces-Chlamydia, green nonsulfur bacteria, or Synergistes, or deeply branched on the phylogenetic tree. A large number of bacterial OTUs are not closely related to any other hitherto determined sequences. The most frequent bacterial OTUs represents less than 5% of the total bacterial SSU rDNA sequences. However, the 20 more frequent bacterial OTUs describe at least 50% of these sequences. Three of the six Archaea OTUs correspond to 95% of the Archaea population and are very similar to already known methanogenic species: Methanosarcina barkeri, Methanosarcina frisius, and Methanobacterium formicicum. In contrast, the three other Archaea OTUs are unusual and are related to thermophilic microorganisms such as Crenarchaea or Thermoplasma spp. Five percent of the sequences analyzed were chimeras and were removed from the analysis. PMID:9212428

  18. The ribosome filter redux.

    PubMed

    Mauro, Vincent P; Edelman, Gerald M

    2007-09-15

    The ribosome filter hypothesis postulates that ribosomes are not simply translation machines but also function as regulatory elements that differentially affect or filter the translation of particular mRNAs. On the basis of new information, we take the opportunity here to review the ribosome filter hypothesis, suggest specific mechanisms of action, and discuss recent examples from the literature that support it. PMID:17890902

  19. Inferring the Ancient History of the Translation Machinery and Genetic Code via Recapitulation of Ribosomal Subunit Assembly Orders

    PubMed Central

    Fournier, Gregory P.; Neumann, Justin E.; Gogarten, J. Peter

    2010-01-01

    Universally conserved positions in ribosomal proteins have significant biases in amino acid usage, likely indicating the expansion of the genetic code at the time leading up to the most recent common ancestor(s) (MRCA). Here, we apply this principle to the evolutionary history of the ribosome before the MRCA. It has been proposed that the experimentally determined order of assembly for ribosomal subunits recapitulates their evolutionary chronology. Given this model, we produce a probabilistic evolutionary ordering of the universally conserved small subunit (SSU) and large subunit (LSU) ribosomal proteins. Optimizing the relative ordering of SSU and LSU evolutionary chronologies with respect to minimizing differences in amino acid usage bias, we find strong compositional evidence for a more ancient origin for early LSU proteins. Furthermore, we find that this ordering produces several trends in specific amino acid usages compatible with models of genetic code evolution. PMID:20208990

  20. E. coli metabolic protein aldehyde-alcohol dehydrogenase-E binds to the ribosome: a unique moonlighting action revealed.

    PubMed

    Shasmal, Manidip; Dey, Sandip; Shaikh, Tanvir R; Bhakta, Sayan; Sengupta, Jayati

    2016-01-01

    It is becoming increasingly evident that a high degree of regulation is involved in the protein synthesis machinery entailing more interacting regulatory factors. A multitude of proteins have been identified recently which show regulatory function upon binding to the ribosome. Here, we identify tight association of a metabolic protein aldehyde-alcohol dehydrogenase E (AdhE) with the E. coli 70S ribosome isolated from cell extract under low salt wash conditions. Cryo-EM reconstruction of the ribosome sample allows us to localize its position on the head of the small subunit, near the mRNA entrance. Our study demonstrates substantial RNA unwinding activity of AdhE which can account for the ability of ribosome to translate through downstream of at least certain mRNA helices. Thus far, in E. coli, no ribosome-associated factor has been identified that shows downstream mRNA helicase activity. Additionally, the cryo-EM map reveals interaction of another extracellular protein, outer membrane protein C (OmpC), with the ribosome at the peripheral solvent side of the 50S subunit. Our result also provides important insight into plausible functional role of OmpC upon ribosome binding. Visualization of the ribosome purified directly from the cell lysate unveils for the first time interactions of additional regulatory proteins with the ribosome. PMID:26822933

  1. E. coli metabolic protein aldehyde-alcohol dehydrogenase-E binds to the ribosome: a unique moonlighting action revealed

    PubMed Central

    Shasmal, Manidip; Dey, Sandip; Shaikh, Tanvir R.; Bhakta, Sayan; Sengupta, Jayati

    2016-01-01

    It is becoming increasingly evident that a high degree of regulation is involved in the protein synthesis machinery entailing more interacting regulatory factors. A multitude of proteins have been identified recently which show regulatory function upon binding to the ribosome. Here, we identify tight association of a metabolic protein aldehyde-alcohol dehydrogenase E (AdhE) with the E. coli 70S ribosome isolated from cell extract under low salt wash conditions. Cryo-EM reconstruction of the ribosome sample allows us to localize its position on the head of the small subunit, near the mRNA entrance. Our study demonstrates substantial RNA unwinding activity of AdhE which can account for the ability of ribosome to translate through downstream of at least certain mRNA helices. Thus far, in E. coli, no ribosome-associated factor has been identified that shows downstream mRNA helicase activity. Additionally, the cryo-EM map reveals interaction of another extracellular protein, outer membrane protein C (OmpC), with the ribosome at the peripheral solvent side of the 50S subunit. Our result also provides important insight into plausible functional role of OmpC upon ribosome binding. Visualization of the ribosome purified directly from the cell lysate unveils for the first time interactions of additional regulatory proteins with the ribosome. PMID:26822933

  2. Deconstructing ribosome construction

    PubMed Central

    Connolly, Keith; Culver, Gloria

    2013-01-01

    The ribosome is an essential ribonucleoprotein enzyme, and its biogenesis is a fundamental process in all living cells. Recent X-ray crystal structures of the bacterial ribosome and new technologies have allowed a greater interrogation of in vitro ribosome assembly; however, substantially less is known about ribosome biogenesis in vivo. Ongoing investigations are focused on elucidating the cellular processes that facilitate biogenesis of the ribosomal subunits, and many extraribosomal factors, including modification enzymes, remodeling enzymes and GTPases, are being uncovered. Moreover, specific roles for ribosome biogenesis factors in subunit maturation are now being elaborated. Ultimately, such studies will reveal a more complete understanding of processes at work in in vivo ribosome biogenesis. PMID:19376708

  3. Crystallization and preliminary X-ray crystallographic analysis of the small subunit of the heterodimeric laccase POXA3b from Pleurotus ostreatus

    PubMed Central

    Ferraroni, Marta; Scozzafava, Andrea; Ullah, Sana; Tron, Thierry; Piscitelli, Alessandra; Sannia, Giovanni

    2014-01-01

    Laccases are multicopper oxidases of great biotechnological potential. While laccases are generally monomeric glycoproteins, the white-rot fungus Pleurotus ostreatus produces two closely related heterodimeric isoenzymes composed of a large subunit, homologous to the other fungal laccases, and a small subunit. The sequence of the small subunit does not show significant homology to any other protein or domain of known function and consequently its function is unknown. The highest similarity to proteins of known structure is to a putative enoyl-CoA hydratase/isomerase from Acinetobacter baumannii, which shows an identity of 27.8%. Diffraction-quality crystals of the small subunit of the heterodimeric laccase POXA3b (sPOXA3b) from P. ostreatus were obtained using the sitting-drop vapour-diffusion method at 294 K from a solution consisting of 1.8 M sodium formate, 0.1 M Tris–HCl pH 8.5. The crystals belonged to the tetragonal space group P41212 or P43212, with unit-cell parameters a = 126.6, c = 53.9 Å. The asymmetric unit contains two molecules related by a noncrystallographic twofold axis. A complete data set extending to a maximum resolution of 2.5 Å was collected at 100 K using a wavelength of 1.140 Å. PMID:24419623

  4. Major centers of motion in the large ribosomal RNAs

    PubMed Central

    Paci, Maxim; Fox, George E.

    2015-01-01

    Major centers of motion in the rRNAs of Thermus thermophilus are identified by alignment of crystal structures of EF-G bound and EF-G unbound ribosomal subunits. Small rigid helices upstream of these ‘pivots’ are aligned, thereby decoupling their motion from global rearrangements. Of the 21 pivots found, six are observed in the large subunit rRNA and 15 in the small subunit rRNA. Although the magnitudes of motion differ, with only minor exceptions equivalent pivots are seen in comparisons of Escherichia coli structures and one Saccharomyces cerevisiae structure pair. The pivoting positions are typically associated with structurally weak motifs such as non-canonical, primarily U-G pairs, bulge loops and three-way junctions. Each pivot is typically in direct physical contact with at least one other in the set and often several others. Moving helixes include rRNA segments in contact with the tRNA, intersubunit bridges and helices 28, 32 and 34 of the small subunit. These helices are envisioned to form a network. EF-G rearrangement would then provide directional control of this network propagating motion from the tRNA to the intersubunit bridges to the head swivel or along the same path backward. PMID:25870411

  5. ITS-2 and 18S rRNA gene phylogeny of Aplysinidae (Verongida, Demospongiae).

    PubMed

    Schmitt, Susanne; Hentschel, Ute; Zea, Sven; Dandekar, Thomas; Wolf, Matthias

    2005-03-01

    18S ribosomal DNA and internal transcribed spacer 2 (ITS-2) full-length sequences, each of which was sequenced three times, were used to construct phylogenetic trees with alignments based on secondary structures, in order to elucidate genealogical relationships within the Aplysinidae (Verongida). The first poriferan ITS-2 secondary structures are reported. Altogether 11 Aplysina sponges and 3 additional sponges (Verongula gigantea, Aiolochroia crassa, Smenospongia aurea) from tropical and subtropical oceans were analyzed. Based on these molecular studies, S. aurea, which is currently affiliated with the Dictyoceratida, should be reclassified to the Verongida. Aplysina appears as monophyletic. A soft form of Aplysina lacunosa was separated from other Aplysina and stands at a basal position in both 18S and ITS-2 trees. Based on ITS-2 sequence information, the Aplysina sponges could be distinguished into a single Caribbean-Eastern Pacific cluster and a Mediterranean cluster. The species concept for Aplysina sponges as well as a phylogenetic history with a possibly Tethyan origin is discussed. PMID:15871043

  6. Visualization of the hybrid state of tRNA binding promoted by spontaneous ratcheting of the ribosome.

    PubMed

    Agirrezabala, Xabier; Lei, Jianlin; Brunelle, Julie L; Ortiz-Meoz, Rodrigo F; Green, Rachel; Frank, Joachim

    2008-10-24

    A crucial step in translation is the translocation of tRNAs through the ribosome. In the transition from one canonical site to the other, the tRNAs acquire intermediate configurations, so-called hybrid states. At this stage, the small subunit is rotated with respect to the large subunit, and the anticodon stem loops reside in the A and P sites of the small subunit, while the acceptor ends interact with the P and E sites of the large subunit. In this work, by means of cryo-EM and particle classification procedures, we visualize the hybrid state of both A/P and P/E tRNAs in an authentic factor-free ribosome complex during translocation. In addition, we show how the repositioning of the tRNAs goes hand in hand with the change in the interplay between S13, L1 stalk, L5, H68, H69, and H38 that is caused by the ratcheting of the small subunit. PMID:18951087

  7. VISUALIZATION OF THE HYBRID STATE OF tRNA BINDING PROMOTED BY SPONTANEOUS RATCHETING OF THE RIBOSOME

    PubMed Central

    Agirrezabala, Xabier; Lei, Jianlin; Brunelle, Julie L.; Ortiz-Meoz, Rodrigo F.; Green, Rachel; Frank, Joachim

    2008-01-01

    SUMMARY A crucial step in protein translation is the translocation of tRNAs through the ribosome. In the transition from one canonical site to the other, the tRNAs acquire intermediate configurations, so-called hybrid states. At this stage, the small subunits is rotated with respect to the large subunit, and the anticodon stem loops reside in the A and P sites of the small subunit, while the acceptor ends interact with the P and E sites of the large subunit. In this work, by means of cryo-EM and particle classification procedures, we visualize for the first time the hybrid state of both A/P and P/E tRNAs in an authentic factor-free ribosome complex during translocation. In addition, we show how the repositioning of the tRNAs goes hand in hand with the change in the interplay between S13, L1 stalk, L5, H68, H69 and H38 that is caused by the ratcheting of the small subunit. PMID:18951087

  8. A new version of the RDP (Ribosomal Database Project)

    NASA Technical Reports Server (NTRS)

    Maidak, B. L.; Cole, J. R.; Parker, C. T. Jr; Garrity, G. M.; Larsen, N.; Li, B.; Lilburn, T. G.; McCaughey, M. J.; Olsen, G. J.; Overbeek, R.; Pramanik, S.; Schmidt, T. M.; Tiedje, J. M.; Woese, C. R.

    1999-01-01

    The Ribosomal Database Project (RDP-II), previously described by Maidak et al. [ Nucleic Acids Res. (1997), 25, 109-111], is now hosted by the Center for Microbial Ecology at Michigan State University. RDP-II is a curated database that offers ribosomal RNA (rRNA) nucleotide sequence data in aligned and unaligned forms, analysis services, and associated computer programs. During the past two years, data alignments have been updated and now include >9700 small subunit rRNA sequences. The recent development of an ObjectStore database will provide more rapid updating of data, better data accuracy and increased user access. RDP-II includes phylogenetically ordered alignments of rRNA sequences, derived phylogenetic trees, rRNA secondary structure diagrams, and various software programs for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (ftp.cme.msu. edu) and WWW (http://www.cme.msu.edu/RDP). The WWW server provides ribosomal probe checking, approximate phylogenetic placement of user-submitted sequences, screening for possible chimeric rRNA sequences, automated alignment, and a suggested placement of an unknown sequence on an existing phylogenetic tree. Additional utilities also exist at RDP-II, including distance matrix, T-RFLP, and a Java-based viewer of the phylogenetic trees that can be used to create subtrees.

  9. The ribosomal database project.

    PubMed Central

    Larsen, N; Olsen, G J; Maidak, B L; McCaughey, M J; Overbeek, R; Macke, T J; Marsh, T L; Woese, C R

    1993-01-01

    The Ribosomal Database Project (RDP) is a curated database that offers ribosome data along with related programs and services. The offerings include phylogenetically ordered alignments of ribosomal RNA (rRNA) sequences, derived phylogenetic trees, rRNA secondary structure diagrams and various software packages for handling, analyzing and displaying alignments and trees. The data are available via ftp and electronic mail. Certain analytic services are also provided by the electronic mail server. PMID:8332524

  10. Intrageneric relationships of Enterococci as determined by reverse transcriptase sequencing of small-subunit rRNA.

    PubMed

    Williams, A M; Rodrigues, U M; Collins, M D

    1991-01-01

    The 16S ribosomal ribonucleic acid (rRNA) sequences of eleven Enterococcus species were determined by reverse transcription in an attempt to clarify their intrageneric relationships. Comparative analysis of the sequence data revealed the presence of several species groups within the genus. The species E. avium, E. malodoratus, E. pseudoavium and E. raffinosus formed a distinct group as did E. durans, E. faecium, E. hirae and E. mundtii and the pair of species E. casseliflavus and E. gallinarum. Of the remaining species, E. cecorum, E. columbae, E. faecalis and E. saccharolyticus formed distinct lines of descent within the genus, whereas E. solitarius displayed a closer affinity with Tetragenococcus halophilus than with other enterococcal species. PMID:1712504

  11. The Ribosomal Database Project.

    PubMed Central

    Maidak, B L; Larsen, N; McCaughey, M J; Overbeek, R; Olsen, G J; Fogel, K; Blandy, J; Woese, C R

    1994-01-01

    The Ribosomal Database Project (RDP) is a curated database that offers ribosome-related data, analysis services, and associated computer programs. The offerings include phylogenetically ordered alignments of ribosomal RNA (rRNA) sequences, derived phylogenetic trees, rRNA secondary structure diagrams, and various software for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (rdp.life.uiuc.edu), electronic mail (server/rdp.life.uiuc.edu) and gopher (rdpgopher.life.uiuc.edu). The electronic mail server also provides ribosomal probe checking, approximate phylogenetic placement of user-submitted sequences, screening for chimeric nature of newly sequenced rRNAs, and automated alignment. PMID:7524021

  12. Regulation of the mammalian elongation cycle by subunit rolling: a eukaryotic-specific ribosome rearrangement

    PubMed Central

    Budkevich, Tatyana V.; Giesebrecht, Jan; Behrmann, Elmar; Loerke, Justus; Ramrath, David J.F.; Mielke, Thorsten; Ismer, Jochen; Hildebrand, Peter W.; Tung, Chang-Shung; Nierhaus, Knud H.; Sanbonmatsu, Karissa Y.; Spahn, Christian M.T.

    2014-01-01

    SUMMARY The extent to which bacterial ribosomes and the significantly larger eukaryotic ribosomes share the same mechanisms of ribosomal elongation is unknown. Here, we present sub-nanometer resolution cryo-electron microscopy maps of the mammalian 80S ribosome in the post-translocational state and in complex with the eukaryotic eEF1A•Val-tRNA•GMPPNP ternary complex, revealing significant differences in the elongation mechanism between bacteria and mammals. Surprisingly, and in contrast to bacterial ribosomes, a rotation of the small subunit around its long axis and orthogonal to the well-known intersubunit rotation distinguishes the post-translocational state from the classical pre-translocational state ribosome. We term this motion “subunit rolling”. Correspondingly, a mammalian decoding complex visualized in sub-states before and after codon recognition reveals structural distinctions from the bacterial system. These findings suggest how codon recognition leads to GTPase activation in the mammalian system and demonstrate that in mammalia subunit rolling occurs during tRNA selection. PMID:24995983

  13. Karyotypic Variability in Ribosomal DNA Subchromosome Size among Colpodid Ciliates, a Possible Tool To Differentiate Colpodid Species

    PubMed Central

    Martin, A.; Palacios, G.; Olmo, A.; Martin-Gonzalez, A.; Ruiz-Perez, L. M.; Gutierrez, J. C.

    1997-01-01

    Pulsed-field gel electrophoresis has been applied to analyze the karyotypic variability among colpodid ciliates. The 18S ribosomal gene was found at different locations in the electrophoretic pattern, and these size variations in the ribosomal DNA subchromosomal molecule seem to be species specific. This could potentially be a useful new tool with which to differentiate colpodid ciliates. PMID:16535582

  14. Key Inter-molecular Interactions in the E. Coli 70S Ribosome Revealed by Coarse-Grained Analysis

    PubMed Central

    Zhang, Zhiyong; Sanbonmatsu, Karissa Y.; Voth, Gregory A.

    2011-01-01

    The ribosome is a very large complex, which consists of many RNA and protein molecules and plays a central role in protein biosynthesis in all organisms. Extensive interactions between different molecules are critical to ribosomal functional dynamics. In this work, inter-molecular interactions in the E. coli 70S ribosome are investigated by coarse-grained (CG) analysis. CG models are defined to preserve dynamic domains in RNAs and proteins, and capture functional motions in the ribosome, then the CG sites are connected by harmonic springs and spring constants are obtained by matching the computed fluctuations to those of an all-atom molecular dynamics (MD) simulation. Those spring constants indicate how strong the interactions are between the ribosomal components, which are in good agreement with various experimental data. Nearly all of bridges between the small and large ribosomal subunits are indicated by CG interactions with large spring constants. The head of the small subunit is very mobile because it has the minimal CG interactions with the rest of the subunit; However, a large number of small subunit proteins bind to maintain the internal structure of the head. The results show a clear connection between the inter-molecular interactions and the structural and functional properties of the ribosome because of the reduced complexity in domain-based CG models. The present approach also provides a useful strategy to map interactions between molecules within large biomolecular complexes since it is not straightforward to investigate these by either atomistic MD simulations or residue-based elastic network models. PMID:21910449

  15. Identification of Species and Sources of Cryptosporidium Oocysts in Storm Waters with a Small-Subunit rRNA-Based Diagnostic and Genotyping Tool

    PubMed Central

    Xiao, Lihua; Alderisio, Kerri; Limor, Josef; Royer, Michael; Lal, Altaf A.

    2000-01-01

    The identification of Cryptosporidium oocysts in environmental samples is largely made by the use of an immunofluorescent assay. In this study, we have used a small-subunit rRNA-based PCR-restriction fragment length polymorphism technique to identify species and sources of Cryptosporidium oocysts present in 29 storm water samples collected from a stream in New York. A total of 12 genotypes were found in 27 positive samples; for 4 the species and probable origins were identified by sequence analysis, whereas the rest represent new genotypes from wildlife. Thus, this technique provides an alternative method for the detection and differentiation of Cryptosporidium parasites in environmental samples. PMID:11097935

  16. Functional interaction of yeast elongation factor 3 with yeast ribosomes.

    PubMed

    Chakraburtty, K

    1999-01-01

    Elongation factor 3 (EF-3) is a unique and essential requirement of the fungal translational apparatus. EF-3 is a monomeric protein with a molecular mass of 116,000. EF-3 is required by yeast ribosomes for in vitro translation and for in vivo growth. The protein stimulates the binding of EF-1 alpha :GTP:aa-tRNA ternary complex to the ribosomal A-site by facilitating release of deacylated-tRNA from the E-site. The reaction requires ATP hydrolysis. EF-3 contains two ATP-binding sequence motifs (NBS). NBSI is sufficient for the intrinsic ATPase function. NBSII is essential for ribosome-stimulated activity. By limited proteolysis, EF-3 was divided into two distinct functional domains. The N-terminal domain lacking the highly charged lysine blocks failed to bind ribosomes and was inactive in the ribosome-stimulated ATPase activity. The C-terminally derived lysine-rich fragment showed strong binding to yeast ribosomes. The purported S5 homology region of EF-3 at the N-terminal end has been reported to interact with 18S ribosomal RNA. We postulate that EF-3 contacts rRNA and/or protein(s) through the C-terminal end. Removal of these residues severely weakens its interaction mediated possibly through the N-terminal domain of the protein. PMID:10216951

  17. The Ribosomal Database Project

    PubMed Central

    Olsen, Gary J.; Overbeek, Ross; Larsen, Niels; Marsh, Terry L.; McCaughey, Michael J.; Maciukenas, Michael A.; Kuan, Wen-Min; Macke, Thomas J.; Xing, Yuqing; Woese, Carl R.

    1992-01-01

    The Ribosomal Database Project (RDP) compiles ribosomal sequences and related data, and redistributes them in aligned and phylogenetically ordered form to its user community. It also offers various software packages for handling, analyzing and displaying sequences. In addition, the RDP offers (or will offer) certain analytic services. At present the project is in an intermediate stage of development. PMID:1598241

  18. Structure of psoralen-crosslinked ribosomal RNA from Drosophila melanogaster.

    PubMed Central

    Wollenzien, P L; Youvan, D C; Hearst, J E

    1978-01-01

    Ribosomal RNA from Drosophila melanogaster photoreacted with hydroxymethyltrioxsalen has been examined by electron microscopy. Reproducible patterns of hairpins were found in both the 26S and 18S RNA. The frequency of these hairpins and the amount of incorporated drug were dependent upon the conditions under which the crosslinking was performed. A prominent central hairpin occurs in the 26S RNA and the break that interrupts the continuity of the RNA chain is located within it. In addition to several small hairpins, the crosslinked 18S RNA contains a large open loop. Images PMID:417342

  19. Retroposons do jump: a B2 element recently integrated in an 18S rDNA gene.

    PubMed Central

    Oberbäumer, I

    1992-01-01

    Several cDNA clones were isolated from cDNA libraries constructed with mRNA longer than 28S RNA from the murine cell line PYS-2/12. The plasmids have inserts containing 1-1.2 kb of the ribosomal 5' external transcribed spacer followed by nearly 700 nt of sequence for 18S rRNA and ending with a B2 element (retroposon). The cloned sequence differed in a few positions from published ribosomal sequences. The 3' adjacent genomic sequence was obtained by polymerase chain reaction (PCR) and showed that the B2 element has a poly(A) tail of about 50 nt and is surrounded by perfect direct repeats of 15 nt. Analysis of genomic DNA from several murine cell lines revealed that PYS cells contain at least one copy of 18S RNA with the B2 element which is not present in the genome of other murine cell lines derived from the same teratocarcinoma. Similarly, rRNA transcripts containing the B2 element were only detected in PYS cells. According to the publication dates of the different cell lines, the B2 element must have been integrated into an rRNA transcription unit during the years 1970 through 1974 thus proving that retroposons (SINEs) can still be inserted into the genome in our times. Images PMID:1311830

  20. Distinct 18S rRNA precursors are targets of the exosome complex, the exoribonuclease RRP6L2 and the terminal nucleotidyltransferase TRL in Arabidopsis thaliana.

    PubMed

    Sikorski, Pawel J; Zuber, Hélène; Philippe, Lucas; Sement, François M; Canaday, Jean; Kufel, Joanna; Gagliardi, Dominique; Lange, Heike

    2015-09-01

    The biosynthesis of ribosomal RNA and its incorporation into functional ribosomes is an essential and intricate process that includes production of mature ribosomal RNA from large precursors. Here, we analyse the contribution of the plant exosome and its co-factors to processing and degradation of 18S pre-RNAs in Arabidopsis thaliana. Our data show that, unlike in yeast and humans, an RRP6 homologue, the nucleolar exoribonuclease RRP6L2, and the exosome complex, together with RRP44, function in two distinct steps of pre-18S rRNA processing or degradation in Arabidopsis. In addition, we identify TRL (TRF4/5-like) as the terminal nucleotidyltransferase that is mainly responsible for oligoadenylation of rRNA precursors in Arabidopsis. We show that TRL is required for efficient elimination of the excised 5' external transcribed spacer and of 18S maturation intermediates that escaped 5' processing. Our data also suggest involvement of additional nucleotidyltransferases, including terminal uridylyltransferase(s), in modifying rRNA processing intermediates in plants. PMID:26216451

  1. Mapping of a conformational epitope on the cashew allergen Ana o 2: a discontinuous large subunit epitope dependent upon homologous or heterologous small subunit association.

    PubMed

    Xia, Lixin; Willison, LeAnna N; Porter, Lauren; Robotham, Jason M; Teuber, Suzanne S; Sathe, Shridhar K; Roux, Kenneth H

    2010-05-01

    The 11S globulins are members of the cupin protein superfamily and represent an important class of tree nut allergens for which a number of linear epitopes have been mapped. However, specific conformational epitopes for these allergens have yet to be described. We have recently reported a cashew Ana o 2 conformational epitope defined by murine mAb 2B5 and competitively inhibited by a subset of patient IgE antibodies. The 2B5 epitope appears to reside on the large (acidic) subunit, is dependent upon small (basic) subunit association for expression, and is highly susceptible to denaturation. Here we fine map the epitope using a combination of recombinant chimeric cashew Ana o 2-soybean Gly m 6 chimeras, deletion and point mutations, molecular modeling, and electron microscopy of 2B5-Ana o 2 immune complexes. Key residues appear confined to a 24 amino acid segment near the N-terminus of the large subunit peptide, a portion of which makes direct contact with the small subunit. These data provide an explanation for both the small subunit dependence and the structurally labile nature of the epitope. PMID:20362338

  2. Heat stability of maize endosperm ADP-glucose pyrophosphorylase is enhanced by insertion of a cysteine in the N terminus of the small subunit.

    PubMed

    Linebarger, Carla R Lyerly; Boehlein, Susan K; Sewell, Aileen K; Shaw, Janine; Hannah, L Curtis

    2005-12-01

    ADP-glucose pyrophosphorylase (AGPase) is a key regulatory enzyme in starch biosynthesis. However, plant AGPases differ in several parameters, including spatial and temporal expression, allosteric regulation, and heat stability. AGPases of cereal endosperms are heat labile, while those in other tissues, such as the potato (Solanum tuberosum) tuber, are heat stable. Sequence comparisons of heat-stable and heat-labile AGPases identified an N-terminal motif unique to heat-stable enzymes. Insertion of this motif into recombinant maize (Zea mays) endosperm AGPase increased the half-life at 58 degrees C more than 70-fold. Km values for physiological substrates were unaffected, although Kcat was doubled. A cysteine within the inserted motif gives rise to small subunit homodimers not found in the wild-type maize enzyme. Placement of this N-terminal motif into a mosaic small subunit containing the N terminus from maize endosperm and the C terminus from potato tuber AGPase increases heat stability more than 300-fold. PMID:16299180

  3. Phytoplankton distribution patterns in the northwestern Sargasso Sea revealed by small subunit rRNA genes from plastids.

    PubMed

    Treusch, Alexander H; Demir-Hilton, Elif; Vergin, Kevin L; Worden, Alexandra Z; Carlson, Craig A; Donatz, Michael G; Burton, Robert M; Giovannoni, Stephen J

    2012-03-01

    Phytoplankton species vary in their physiological properties, and are expected to respond differently to seasonal changes in water column conditions. To assess these varying distribution patterns, we used 412 samples collected monthly over 12 years (1991-2004) at the Bermuda Atlantic Time-Series Study site, located in the northwestern Sargasso Sea. We measured plastid 16S ribosomal RNA gene abundances with a terminal restriction fragment length polymorphism approach and identified distribution patterns for members of the Prymnesiophyceae, Pelagophyceae, Chrysophyceae, Cryptophyceae, Bacillariophyceae and Prasinophyceae. The analysis revealed dynamic bloom patterns by these phytoplankton taxa that begin early in the year, when the mixed layer is deep. Previously, unreported open-ocean prasinophyte blooms dominated the plastid gene signal during convective mixing events. Quantitative PCR confirmed the blooms and transitions of Bathycoccus, Micromonas and Ostreococcus populations. In contrast, taxa belonging to the pelagophytes and chrysophytes, as well as cryptophytes, reached annual peaks during mixed layer shoaling, while Bacillariophyceae (diatoms) were observed only episodically in the 12-year record. Prymnesiophytes dominated the integrated plastid gene signal. They were abundant throughout the water column before mixing events, but persisted in the deep chlorophyll maximum during stratified conditions. Various models have been used to describe mechanisms that drive vernal phytoplankton blooms in temperate seas. The range of taxon-specific bloom patterns observed here indicates that different 'spring bloom' models can aptly describe the behavior of different phytoplankton taxa at a single geographical location. These findings provide insight into the subdivision of niche space by phytoplankton and may lead to improved predictions of phytoplankton responses to changes in ocean conditions. PMID:21955994

  4. When ribosomes go bad: diseases of ribosome biogenesis

    PubMed Central

    Freed, Emily F.; Bleichert, Franziska; Dutca, Laura M.; Baserga, Susan J.

    2010-01-01

    Ribosomes are vital for cell growth and survival. Until recently, it was believed that mutations in ribosomes or ribosome biogenesis factors would be lethal, due to the essential nature of these complexes. However, in the last few decades, a number of diseases of ribosome biogenesis have been discovered. It remains a challenge in the field to elucidate the molecular mechanisms underlying them. PMID:20174677

  5. Ribosomal RNA analysis in the diagnosis of Diamond-Blackfan Anaemia.

    PubMed

    Quarello, Paola; Garelli, Emanuela; Carando, Adriana; Mancini, Cecilia; Foglia, Luiselda; Botto, Carlotta; Farruggia, Piero; De Keersmaecker, Kim; Aspesi, Anna; Ellis, Steve R; Dianzani, Irma; Ramenghi, Ugo

    2016-03-01

    Diamond-Blackfan anaemia (DBA) is an inherited disease characterized by pure erythroid aplasia that has been tagged as a 'ribosomopathy'. We report a multi-centre study focused on the analysis of rRNA processing of 53 Italian DBA patients using capillary electrophoresis analysis of rRNA maturation of the 40S and 60S ribosomal subunits. The ratio of 28S/18S rRNA was higher in patients with mutated ribosomal proteins (RPs) of the small ribosomal subunit. In contrast, patients with mutated RPs of the large ribosomal subunit (RPLs) had a lower 28S/18S ratio. The assay reported here would be amenable for development as a diagnostic tool. PMID:26763766

  6. Physical mapping of 5S and 18S-5.8S-26S RNA gene families in polyploid series of Cenchrus ciliaris Linnaeus, 1771 (Poaceae)

    PubMed Central

    Kharrat-Souissi, Amina; Siljak-Yakovlev, Sonja; Pustahija, Fatima; Chaieb, Mohamed

    2012-01-01

    Abstract The Buffelgrass (Cenchrus ciliaris L., Poaceae) is one of the most important pasturage grasses due to its high productivity and good forage qualities. This species possess a high adaptability to bioclimatic constraints of arid zones and may be used for the restoration of degraded arid ecosystems. Tunisian populations present three ploidy levels (4x, 5x and 6x) with a basic chromosome number x=9. This study reported for the first time the distribution of the ribosomal genes (rRNA) for pentaploid and hexaploid cytotypes of Cenchrus ciliaris. Molecular cytogenetic study using double fluorescence in situ hybridization has shown that the two rDNA families, 5S and 18S-5.8S-26S (18S), displayed intraspecific variation in number of loci among different ploidy levels. Each ploidy level was characterized by specific number of both 5S and 18S rDNA loci (two loci in tetraploid, five in pentaploid and six in hexaploid level). For three studied cytotypes (4x, 5x and 6x) all 5S rDNA loci were localized on the subcentromeric region of chromosomes, while 18S loci were situated on the telomeric region of short chromosome arms. Data of the FISH experiments show proportional increase of ribosomal loci number during polyploidization processes. PMID:24260668

  7. The ribosomal subunit assembly line

    PubMed Central

    Dlakić, Mensur

    2005-01-01

    Recent proteomic studies in Saccharomyces cerevisiae have identified nearly 200 proteins, other than the structural ribosomal proteins, that participate in the assembly of ribosomal subunits and their transport from the nucleus. In a separate line of research, proteomic studies of mature plant ribosomes have revealed considerable variability in the protein composition of individual ribosomes. PMID:16207363

  8. An updated 18S rRNA phylogeny of tunicates based on mixture and secondary structure models

    PubMed Central

    Tsagkogeorga, Georgia; Turon, Xavier; Hopcroft, Russell R; Tilak, Marie-Ka; Feldstein, Tamar; Shenkar, Noa; Loya, Yossi; Huchon, Dorothée; Douzery, Emmanuel JP; Delsuc, Frédéric

    2009-01-01

    Background Tunicates have been recently revealed to be the closest living relatives of vertebrates. Yet, with more than 2500 described species, details of their evolutionary history are still obscure. From a molecular point of view, tunicate phylogenetic relationships have been mostly studied based on analyses of 18S rRNA sequences, which indicate several major clades at odds with the traditional class-level arrangements. Nonetheless, substantial uncertainty remains about the phylogenetic relationships and taxonomic status of key groups such as the Aplousobranchia, Appendicularia, and Thaliacea. Results Thirty new complete 18S rRNA sequences were acquired from previously unsampled tunicate species, with special focus on groups presenting high evolutionary rate. The updated 18S rRNA dataset has been aligned with respect to the constraint on homology imposed by the rRNA secondary structure. A probabilistic framework of phylogenetic reconstruction was adopted to accommodate the particular evolutionary dynamics of this ribosomal marker. Detailed Bayesian analyses were conducted under the non-parametric CAT mixture model accounting for site-specific heterogeneity of the evolutionary process, and under RNA-specific doublet models accommodating the occurrence of compensatory substitutions in stem regions. Our results support the division of tunicates into three major clades: 1) Phlebobranchia + Thaliacea + Aplousobranchia, 2) Appendicularia, and 3) Stolidobranchia, but the position of Appendicularia could not be firmly resolved. Our study additionally reveals that most Aplousobranchia evolve at extremely high rates involving changes in secondary structure of their 18S rRNA, with the exception of the family Clavelinidae, which appears to be slowly evolving. This extreme rate heterogeneity precluded resolving with certainty the exact phylogenetic placement of Aplousobranchia. Finally, the best fitting secondary-structure and CAT-mixture models suggest a sister

  9. The ribosome returned

    PubMed Central

    Moore, Peter B

    2009-01-01

    Since the mid-1990s, insights obtained from electron microscopy and X-ray crystallography have transformed our understanding of how the most important ribozyme in the cell, the ribosome, catalyzes protein synthesis. This review provides a brief account of how this structural revolution came to pass, and the impact it has had on our understanding of how the ribosome decodes messenger RNAs. PMID:19222865

  10. Ribosome-omics of the human ribosome

    PubMed Central

    Gupta, Varun; Warner, Jonathan R.

    2014-01-01

    The torrent of RNA-seq data becoming available not only furnishes an overview of the entire transcriptome but also provides tools to focus on specific areas of interest. Our focus on the synthesis of ribosomes asked whether the abundance of mRNAs encoding ribosomal proteins (RPs) matched the equimolar need for the RPs in the assembly of ribosomes. We were at first surprised to find, in the mapping data of ENCODE and other sources, that there were nearly 100-fold differences in the level of the mRNAs encoding the different RPs. However, after correcting for the mapping ambiguities introduced by the presence of more than 2000 pseudogenes derived from RP mRNAs, we show that for 80%–90% of the RP genes, the molar ratio of mRNAs varies less than threefold, with little tissue specificity. Nevertheless, since the RPs are needed in equimolar amounts, there must be sluggish or regulated translation of the more abundant RP mRNAs and/or substantial turnover of unused RPs. In addition, seven of the RPs have subsidiary genes, three of which are pseudogenes that have been “rescued” by the introduction of promoters and/or upstream introns. Several of these are transcribed in a tissue-specific manner, e.g., RPL10L in testis and RPL3L in muscle, leading to potential variation in ribosome structure from one tissue to another. Of the 376 introns in the RP genes, a single one is alternatively spliced in a tissue-specific manner. PMID:24860015

  11. Sequence Variation in the Small-Subunit rRNA Gene of Plasmodium malariae and Prevalence of Isolates with the Variant Sequence in Sichuan, China

    PubMed Central

    Liu, Qing; Zhu, Shenghua; Mizuno, Sahoko; Kimura, Masatsugu; Liu, Peina; Isomura, Shin; Wang, Xingzhen; Kawamoto, Fumihiko

    1998-01-01

    By two PCR-based diagnostic methods, Plasmodium malariae infections have been rediscovered at two foci in the Sichuan province of China, a region where no cases of P. malariae have been officially reported for the last 2 decades. In addition, a variant form of P. malariae which has a deletion of 19 bp and seven substitutions of base pairs in the target sequence of the small-subunit (SSU) rRNA gene was detected with high frequency. Alignment analysis of Plasmodium sp. SSU rRNA gene sequences revealed that the 5′ region of the variant sequence is identical to that of P. vivax or P. knowlesi and its 3′ region is identical to that of P. malariae. The same sequence variations were also found in P. malariae isolates collected along the Thai-Myanmar border, suggesting a wide distribution of this variant form from southern China to Southeast Asia. PMID:9774600

  12. Redescriptions of three trachelocercid ciliates (Protista, Ciliophora, Karyorelictea), with notes on their phylogeny based on small subunit rRNA gene sequences.

    PubMed

    Yan, Ying; Xu, Yuan; Yi, Zhenzhen; Warren, Alan

    2013-09-01

    Three trachelocercid ciliates, Kovalevaia sulcata (Kovaleva, 1966) Foissner, 1997, Trachelocerca sagitta (Müller, 1786) Ehrenberg, 1840 and Trachelocerca ditis (Wright, 1982) Foissner, 1996, isolated from two coastal habitats at Qingdao, China, were investigated using live observation and silver impregnation methods. Data on their infraciliature and morphology are supplied. The small subunit rRNA (SSU rRNA) genes of K. sulcata and Trachelocerca sagitta were sequenced for the first time. Phylogenetic analyses based on SSU rRNA gene sequence data indicate that both organisms, and the previously sequenced Trachelocerca ditis, are located within the trachelocercid assemblage and that K. sulcata is sister to an unidentified taxon forming a clade that is basal to the core trachelocercids. PMID:23847285

  13. Cloning and characterization of ribulose-1,5-bisphosphate carboxylase/oxygenase small subunit (RbcS) cDNA from green microalga Ankistrodesmus convolutus.

    PubMed

    Thanh, Tran; Chi, Vu Thi Quynh; Abdullah, Mohd Puad; Omar, Hishamuddin; Noroozi, Mostafa; Napis, Suhaimi

    2011-11-01

    An initial study on gene cloning and characterization of unicellular green microalga Ankistrodesmus convolutus was carried out to isolate and characterize the full-length cDNA of ribulose-1,5-bisphosphate carboxylase/oxygenase small subunit (RbcS) as a first step towards elucidating the structure of A. convolutus RbcS gene. The full-length of A. convolutus RbcS cDNA (AcRbcS) contained 28 bp of 5' untranslated region (UTR), 225 bp of 3' non-coding region, and an open reading frame of 165 amino acids consisting of a chloroplast transit peptide with 24 amino acids and a mature protein of 141 amino acids. The amino acid sequence has high identity to those of other green algae RbcS genes. The AcRbcS contained a few conserved domains including protein kinase C phosphorylation site, tyrosine kinase phosphorylation site and N-myristoylation sites. The AcRbcS was successfully expressed in Escherichia coli and a ~21 kDa of anticipated protein band was observed on SDS-PAGE. From the phylogenetic analysis of RbcS protein sequences, it was found that the RbcS of A. convolutus has closer genetic relationship with green microalgae species compared to those of green seaweed and green macroalgae species. Southern hybridization analysis revealed that the AcRbcS is a member of a small multigene family comprising of two to six members in A. convolutus genome. Under different illumination conditions, RT-PCR analysis showed that AcRbcS transcription was reduced in the dark, and drastically recovered in the light condition. Results presented in this paper established a good foundation for further study on the photosynthetic process of A. convolutus and other green algae species where little information is known on Rubisco small subunit. PMID:21287365

  14. Chromosomal location of 18S and 5S rDNA sites in Triportheus fish species (Characiformes, Characidae)

    PubMed Central

    2009-01-01

    The location of 18S and 5S rDNA sites was determined in eight species and populations of the fish genus Triportheus by using fluorescent in situ hybridization (FISH). The males and females of all species had 2n = 52 chromosomes and a ZZ/ZW sex chromosome system. A single 18S rDNA site that was roughly equivalent to an Ag-NOR was detected on the short arms of a submetacentric pair in nearly all species, and up to two additional sites were also observed in some species. In addition, another 18S rDNA cluster was identified in a distal region on the long arms of the W chromosome; this finding corroborated previous evidence that this cluster would be a shared feature amongst Triportheus species. In T. angulatus, a heterozygotic paracentric inversion involving the short arms of one homolog of a metacentric pair was associated with NORs. The 5S rDNA sites were located on the short arms of a single submetacentric chromosomal pair, close to the centromeres, except in T. auritus, which had up to ten 5S rDNA sites. The 18S and 5S rDNA sites were co-localized and adjacent on the short arms of a chromosomal pair in two populations of T. nematurus. Although all Triportheus species have a similar karyotypic macrostructure, the results of this work show that in some species ribosomal genes may serve as species-specific markers when used in conjunction with other putatively synapomorphic features. PMID:21637644

  15. The Ribosome Comes Alive

    PubMed Central

    2010-01-01

    This essay is a reflection on the ways the X-ray structures of the ribosome are helping in the interpretation of cryogenic electron microscopy (cryo-EM) density maps showing the translating ribosome in motion. Through advances in classification methods, cryo-EM and single-particle reconstruction methods have recently evolved to the point where they can yield an array of structures from a single sample (“story in a sample”), providing snapshots of an entire subprocess of translation, such as translocation or decoding. PMID:21072331

  16. The Ribosome Comes Alive.

    PubMed

    Frank, Joachim

    2010-06-18

    This essay is a reflection on the ways the X-ray structures of the ribosome are helping in the interpretation of cryogenic electron microscopy (cryo-EM) density maps showing the translating ribosome in motion. Through advances in classification methods, cryo-EM and single-particle reconstruction methods have recently evolved to the point where they can yield an array of structures from a single sample ("story in a sample"), providing snapshots of an entire subprocess of translation, such as translocation or decoding. PMID:21072331

  17. Analysis of interactions between ribosomal proteins and RNA structural motifs

    PubMed Central

    2010-01-01

    Background One important goal of structural bioinformatics is to recognize and predict the interactions between protein binding sites and RNA. Recently, a comprehensive analysis of ribosomal proteins and their interactions with rRNA has been done. Interesting results emerged from the comparison of r-proteins within the small subunit in T. thermophilus and E. coli, supporting the idea of a core made by both RNA and proteins, conserved by evolution. Recent work showed also that ribosomal RNA is modularly composed. Motifs are generally single-stranded sequences of consecutive nucleotides (ssRNA) with characteristic folding. The role of these motifs in protein-RNA interactions has been so far only sparsely investigated. Results This work explores the role of RNA structural motifs in the interaction of proteins with ribosomal RNA (rRNA). We analyze composition, local geometries and conformation of interface regions involving motifs such as tetraloops, kink turns and single extruded nucleotides. We construct an interaction map of protein binding sites that allows us to identify the common types of shared 3-D physicochemical binding patterns for tetraloops. Furthermore, we investigate the protein binding pockets that accommodate single extruded nucleotides either involved in kink-turns or in arbitrary RNA strands. This analysis reveals a new structural motif, called tripod. It corresponds to small pockets consisting of three aminoacids arranged at the vertices of an almost equilateral triangle. We developed a search procedure for the recognition of tripods, based on an empirical tripod fingerprint. Conclusion A comparative analysis with the overall RNA surface and interfaces shows that contact surfaces involving RNA motifs have distinctive features that may be useful for the recognition and prediction of interactions. PMID:20122215

  18. Sequence of steps in ribosome recycling as defined by kinetic analysis.

    PubMed

    Peske, Frank; Rodnina, Marina V; Wintermeyer, Wolfgang

    2005-05-13

    After termination of protein synthesis in bacteria, ribosomes are recycled from posttermination complexes by the combined action of elongation factor G (EF-G), ribosome recycling factor (RRF), and initiation factor 3 (IF3). The functions of the factors and the sequence in which ribosomal subunits, tRNA, and mRNA are released from posttermination complexes are unclear and, in part, controversial. Here, we study the reaction by rapid kinetics monitoring fluorescence. We show that RRF and EF-G with GTP, but not with GDPNP, promote the dissociation of 50S subunits from the posttermination complex without involving translocation or a translocation-like event. IF3 does not affect subunit dissociation but prevents reassociation, thereby masking the dissociating effect of EF-G-RRF under certain experimental conditions. IF3 is required for the subsequent ejection of tRNA and mRNA from the small subunit. The latter step is slower than subunit dissociation and constitutes the rate-limiting step of ribosome recycling. PMID:15893724

  19. The linkage between ribosomal crystallography, metal ions, heteropolytungstates and functional flexibility

    NASA Astrophysics Data System (ADS)

    Bashan, Anat; Yonath, Ada

    2008-11-01

    Crystallography of ribosomes, the universal cell nucleoprotein assemblies facilitating the translation of the genetic-code into proteins, met with severe problems owing to the large size, complex structure, inherent flexibility and high conformational variability of the ribosome. For the case of the small ribosomal subunit, which caused extreme difficulties, post-crystallization treatment by minute amounts of a heteropolytungstate cluster allowed structure determination at atomic resolution. This cluster played a dual role: providing anomalous phasing power and dramatically increased the resolution, by stabilization of a selected functional conformation. Thus, four out of the fourteen clusters that bind to each of the crystallized small subunits are attached to a specific ribosomal protein in a fashion that may control a significant component of the subunit internal flexibility, by "gluing" symmetrical related subunits. Here, we highlight basic issues in the relationship between metal ions and macromolecules and present common traits controlling in the interactions between polymetalates and various macromolecules, which may be extended towards the exploitation of polymetalates for therapeutical treatment.

  20. An unexpected type of ribosomes induced by kasugamycin: A look into ancestral times of protein synthesis?

    PubMed Central

    Kaberdina, Anna Chao; Szaflarski, Witold; Nierhaus, Knud H.; Moll, Isabella

    2010-01-01

    SUMMARY Translation of leaderless mRNAs, lacking ribosomal recruitment signals other than the 5′-terminal AUG-initiating codon, occurs in all three domains of life. Contemporary leaderless mRNAs may therefore be viewed as molecular fossils resembling ancestral mRNAs. Here, we analyzed the phenomenon of sustained translation of a leaderless mRNA in the presence of the antibiotic kasugamycin. Unexpected from the known in vitro effects of the drug, kasugamycin induced the formation of stable ~61S ribosomes in vivo, which were proficient in selectively translating leaderless mRNA. 61S particles are devoid of more than six proteins of the small subunit including the functionally important proteins S1 and S12. The lack of these proteins could be reconciled with structural changes in the 16S rRNA. These studies provide in vivo evidence for the functionality of ribosomes devoid of multiple proteins, and shed light on the evolutionary history of ribosomes. PMID:19187763

  1. Ribosome-inactivating proteins

    PubMed Central

    Walsh, Matthew J; Dodd, Jennifer E; Hautbergue, Guillaume M

    2013-01-01

    Ribosome-inactivating proteins (RIPs) were first isolated over a century ago and have been shown to be catalytic toxins that irreversibly inactivate protein synthesis. Elucidation of atomic structures and molecular mechanism has revealed these proteins to be a diverse group subdivided into two classes. RIPs have been shown to exhibit RNA N-glycosidase activity and depurinate the 28S rRNA of the eukaryotic 60S ribosomal subunit. In this review, we compare archetypal RIP family members with other potent toxins that abolish protein synthesis: the fungal ribotoxins which directly cleave the 28S rRNA and the newly discovered Burkholderia lethal factor 1 (BLF1). BLF1 presents additional challenges to the current classification system since, like the ribotoxins, it does not possess RNA N-glycosidase activity but does irreversibly inactivate ribosomes. We further discuss whether the RIP classification should be broadened to include toxins achieving irreversible ribosome inactivation with similar turnovers to RIPs, but through different enzymatic mechanisms. PMID:24071927

  2. Architecture of the 90S Pre-ribosome: A Structural View on the Birth of the Eukaryotic Ribosome.

    PubMed

    Kornprobst, Markus; Turk, Martin; Kellner, Nikola; Cheng, Jingdong; Flemming, Dirk; Koš-Braun, Isabelle; Koš, Martin; Thoms, Matthias; Berninghausen, Otto; Beckmann, Roland; Hurt, Ed

    2016-07-14

    The 90S pre-ribosome is an early biogenesis intermediate formed during co-transcriptional ribosome formation, composed of ∼70 assembly factors and several small nucleolar RNAs (snoRNAs) that associate with nascent pre-rRNA. We report the cryo-EM structure of the Chaetomium thermophilum 90S pre-ribosome, revealing how a network of biogenesis factors including 19 β-propellers and large α-solenoid proteins engulfs the pre-rRNA. Within the 90S pre-ribosome, we identify the UTP-A, UTP-B, Mpp10-Imp3-Imp4, Bms1-Rcl1, and U3 snoRNP modules, which are organized around 5'-ETS and partially folded 18S rRNA. The U3 snoRNP is strategically positioned at the center of the 90S particle to perform its multiple tasks during pre-rRNA folding and processing. The architecture of the elusive 90S pre-ribosome gives unprecedented structural insight into the early steps of pre-rRNA maturation. Nascent rRNA that is co-transcriptionally folded and given a particular shape by encapsulation within a dedicated mold-like structure is reminiscent of how polypeptides use chaperone chambers for their protein folding. PMID:27419870

  3. Mechanisms underlying the evolution and maintenance of functionally heterogeneous 18S rRNA genes in Apicomplexans.

    PubMed

    Rooney, Alejandro P

    2004-09-01

    In many species of the protist phylum Apicomplexa, ribosomal RNA (rRNA) gene copies are structurally and functionally heterogeneous, owing to distinct requirements for rRNA-expression patterns at different developmental stages. The genomic mechanisms underlying the maintenance of this system over long-term evolutionary history are unclear. Therefore, the aim of this study was to investigate what processes underlie the long-term evolution of apicomplexan 18S genes in representative species. The results show that these genes evolve according to a birth-and-death model under strong purifying selection, thereby explaining how divergent 18S genes are generated over time while continuing to maintain their ability to produce fully functional rRNAs. In addition, it was found that Cryptosporidium parvum undergoes a rapid form of birth-and-death evolution that may facilitate host-specific adaptation, including that of type I and II strains found in humans. This represents the first case in which an rRNA gene family has been found to evolve under the birth-and-death model. PMID:15175411

  4. Phylogenetic relationships of Trypanosoma chelodina and Trypanosoma binneyi from Australian tortoises and platypuses inferred from small subunit rRNA analyses.

    PubMed

    Jakes, K A; O'Donoghue, P J; Adlard, R D

    2001-11-01

    Trypanosome infections are often difficult to detect by conventional microscopy and their pleomorphy often confounds differential diagnosis. Molecular techniques are now being used to diagnose infections and to determine phylogenetic relationships between species. Complete small subunit rRNA gene sequences were determined for isolates of Trypanosoma chelodina from the Brisbane River tortoise (Emydura signata), the saw-shelled tortoise (Elseya latisternum), and the eastern snake-necked tortoise (Chelodina longicollis) from southeast Queensland, Australia. Partial sequence data were also obtained for T. binneyi from a platypus (Ornithorhynchus anatinus) from Tasmania. Phylogenetic relationships between T. chelodina, T. binneyi and other species were examined by maximum parsimony and likelihood methods. The Australian tortoise and platypus trypanosomes did not exhibit any close phylogenetic relationships with those of mammals, reptiles or amphibians, but were closely related to each other, and to fish trypanosomes. This contra-indicates their co-evolution with their vertebrate hosts but does not exclude co-evolution with different groups of invertebrate vectors, notably insects and leeches. PMID:11719959

  5. Morphology and Small Subunit rDNA Phylogeny of Two New Marine Urostylid Ciliates, Caudiholosticha marina sp. nov. and Nothoholosticha flava sp. nov. (Ciliophora, Hypotrichia).

    PubMed

    Li, Ju; Chen, Xumiao; Xu, Kuidong

    2016-07-01

    Two marine urostylid ciliates, Caudiholosticha marina sp. nov. and Nothoholosticha flava sp. nov., isolated from intertidal sediment in the Yellow Sea, are investigated using morphological and small subunit rDNA phylogenetic analyses. Caudiholosticha marina is 210-310 μm × 40-55 μm in vivo, and has 10-20 macronuclear nodules, 23-37 midventral cirral pairs extending to 5-8 transverse cirri, and two caudal cirri. It differs from congeners by its marine habitat, larger size, macronuclear arrangement pattern and high number of midventral pairs. Molecular phylogenetic analyses indicate a polyphyly of Caudiholosticha. Nothoholosticha flava is yellow to brownish and 240-320 μm × 40-60 μm sized, and has a bipartite adoral zone, six frontal cirri in atypical bicorona, usually four frontoterminal, one buccal and 5-7 transverse cirri and 28-54 midventral pairs. Phylogenetic analyses allocate N. flava as sister of N. fasciola, type of the genus. The two Nothoholosticha species differ distinctly by the presence/absence of frontoterminal cirri, a feature often used to define genera in the Hypotrichia. However, the SSU rDNA sequence similarity between these two species is 99.3%, which weakens the justification for separating the new isolate at genus level. The taxonomic significance of frontoterminal cirri is discussed based on morphological and molecular data. PMID:26663360

  6. Isolation and characterization of cDNAs and genomic DNAs encoding ADP-glucose pyrophosphorylase large and small subunits from sweet potato.

    PubMed

    Zhou, Yu-Xi; Chen, Yu-Xiang; Tao, Xiang; Cheng, Xiao-Jie; Wang, Hai-Yan

    2016-04-01

    Sweet potato [Ipomoea batatas (L.) Lam.], the world's seventh most important food crop, is also a major industrial raw material for starch and ethanol production. In the plant starch biosynthesis pathway, ADP-glucose pyrophosphorylase (AGPase) catalyzes the first, rate-limiting step and plays a pivotal role in regulating this process. In spite of the importance of sweet potato as a starch source, only a few studies have focused on the molecular aspects of starch biosynthesis in sweet potato and almost no intensive research has been carried out on the AGPase gene family in this species. In this study, cDNAs encoding two small subunits (SSs) and four large subunits (LSs) of AGPase isoforms were cloned from sweet potato and the genomic organizations of the corresponding AGPase genes were elucidated. Expression pattern analysis revealed that the two SSs were constitutively expressed, whereas the four LSs displayed differential expression patterns in various tissues and at different developmental stages. Co-expression of SSs with different LSs in Escherichia coli yielded eight heterotetramers showing different catalytic activities. Interactions between different SSs and LSs were confirmed by a yeast two-hybrid experiment. Our findings provide comprehensive information about AGPase gene sequences, structures, expression profiles, and subunit interactions in sweet potato. The results can serve as a foundation for elucidation of molecular mechanisms of starch synthesis in tuberous roots, and should contribute to future regulation of starch biosynthesis to improve sweet potato starch yield. PMID:26499957

  7. Molecular evolution inferred from small subunit rRNA sequences: what does it tell us about phylogenetic relationships and taxonomy of the parabasalids?

    NASA Technical Reports Server (NTRS)

    Viscogliosi, E.; Edgcomb, V. P.; Gerbod, D.; Noel, C.; Delgado-Viscogliosi, P.; Sogin, M. L. (Principal Investigator)

    1999-01-01

    The Parabasala are a primitive group of protists divided into two classes: the trichomonads and the hypermastigids. Until recently, phylogeny and taxonomy of parabasalids were mainly based on the comparative analysis of morphological characters primarily linked to the development of their cytoskeleton. Recent use of molecular markers, such as small subunit (SSU) rRNA has led to now insights into the systematics of the Parabasala and other groups of prolists. An updated phylogeny based on SSU rRNA is provided and compared to that inferred from ultrastructural data. The SSU rRNA phylogeny contradicts the dogma equating simple characters with pumitive characters. Hypermastigids, possessing a hyperdeveloped cytoskeleton, exhibit the most basal emergence in the parabasalid lineage. Other observations emerge from the SSU rRNA analysis, such as the secondary loss of some cytoskeleton structures in all representatives of the Monocercomonadidae, the existence of secondarily free living taxa (reversibility of parasitism) and the evidence against the co-evolution of the endobiotic parabasalids and their animal hosts. According to phylogenies based on SSU rRNA, all the trichomonad families are not monophyletic groups, putting into question the validity of current taxonomic assignments. The precise branching order of some taxa remains unclear, but this issue can possibly be addressed by the molecular analysis of additional parabasalids. The goal of such additional analyses would be to propose, in a near future, a revision of the taxonomy of this group of protists that takes into account both molecular and morphological data.

  8. Cryptic diversity of free-living parabasalids, Pseudotrichomonas keilini and Lacusteria cypriaca n. g., n. sp., as inferred from small subunit rDNA sequences.

    PubMed

    Yubuki, Naoji; Céza, Vít; Cepicka, Ivan; Yabuki, Akinori; Inagaki, Yuji; Nakayama, Takeshi; Inouye, Isao; Leander, Brian S

    2010-01-01

    Ultrastructural and molecular phylogenetic evidence indicate that the Parabasalia consists of seven main subgroups: the Trichomonadida, Honigbergiellida, Hypotrichomonadida, Tritrichomonadida, Cristamonadida, Spirotrichonymphida, and Trichonymphida. Only five species of free-living parabasalids are known: Monotrichomonas carabina, Ditrichomonas honigbergii, Honigbergiella sp., Tetratrichomonas undula, and Pseudotrichomonas keilini. Phylogenetic analyses show that free-living species do not form a clade and instead branch in several different positions within the context of their parasitic relatives. Because the diversity of free-living parabasalids is poorly understood, the systematics of these lineages is in a significant state of disarray. In order to better understand the phylogenetic distribution of free-living parabasalids, we sequenced the small subunit rDNA from three different strains reminiscent of P. keilini; the strains were isolated from different geographical locations: (1) mangrove sediments in Japan and (2) sediments in Cyprus. These data demonstrated that the free-living parabasalids P. keilini and Lacusteria cypriaca n. g., n. sp., form a paraphyletic assemblage near the origin of a clade consisting mostly of parasitic trichomonadids (e.g. Trichomonas vaginalis). This paraphyletic distribution of similar morphotypes indicates that free-living trichomonadids represent a compelling example of morphostasis that provides insight into the suite of features present in the most recent free-living ancestor of their parasitic relatives. PMID:20880033

  9. The small subunit rRNA gene sequence of the chonotrich Chilodochona carcini Jankowski, 1973 confirms chonotrichs as a dysteriid-derived clade (Phyllopharyngea, Ciliophora).

    PubMed

    Lynn, Denis H

    2016-08-01

    The chonotrichs are sessile ciliated protozoa that are ectosymbiotic on the body parts of a variety of crustaceans. They have long been considered a separate group because their sessile habit has resulted in the evolution of a very divergent body form and reproductive strategy compared to free-living ciliates. In the mid-20th Century, the free-living dysteriid cyrtophorian ciliates were proposed as a potential sister clade because the chonotrich bud or daughter cell showed similarities during division morphogenesis (i.e. ontogeny) to these free-living dysteriids. A single small subunit (SSU) rRNA gene sequence is available for the chonotrich Isochona sp. However, its authenticity has recently been questioned, and the placement of this sequence within the dysteriid clade has added to this controversy. In this report, the SSUrRNA gene sequence of the chonotrich Chilodochona carcini, ectosymbiotic on the green crab Carcinus maenas, is provided. Topology testing of the SSUrRNA gene phylogeny, constructed by Bayesian Inference, robustly supports the sister-group relationship of Isochona sp. and Chilodochona carcini, the monophyly of these two chonotrichs, and the divergence of the chonotrich clade within the dysteriid clade. PMID:27151876

  10. Ribosome Assembly as Antimicrobial Target

    PubMed Central

    Nikolay, Rainer; Schmidt, Sabine; Schlömer, Renate; Deuerling, Elke; Nierhaus, Knud H.

    2016-01-01

    Many antibiotics target the ribosome and interfere with its translation cycle. Since translation is the source of all cellular proteins including ribosomal proteins, protein synthesis and ribosome assembly are interdependent. As a consequence, the activity of translation inhibitors might indirectly cause defective ribosome assembly. Due to the difficulty in distinguishing between direct and indirect effects, and because assembly is probably a target in its own right, concepts are needed to identify small molecules that directly inhibit ribosome assembly. Here, we summarize the basic facts of ribosome targeting antibiotics. Furthermore, we present an in vivo screening strategy that focuses on ribosome assembly by a direct fluorescence based read-out that aims to identify and characterize small molecules acting as primary assembly inhibitors. PMID:27240412

  11. Ribosome Assembly as Antimicrobial Target.

    PubMed

    Nikolay, Rainer; Schmidt, Sabine; Schlömer, Renate; Deuerling, Elke; Nierhaus, Knud H

    2016-01-01

    Many antibiotics target the ribosome and interfere with its translation cycle. Since translation is the source of all cellular proteins including ribosomal proteins, protein synthesis and ribosome assembly are interdependent. As a consequence, the activity of translation inhibitors might indirectly cause defective ribosome assembly. Due to the difficulty in distinguishing between direct and indirect effects, and because assembly is probably a target in its own right, concepts are needed to identify small molecules that directly inhibit ribosome assembly. Here, we summarize the basic facts of ribosome targeting antibiotics. Furthermore, we present an in vivo screening strategy that focuses on ribosome assembly by a direct fluorescence based read-out that aims to identify and characterize small molecules acting as primary assembly inhibitors. PMID:27240412

  12. Structural insights into ribosome translocation.

    PubMed

    Ling, Clarence; Ermolenko, Dmitri N

    2016-09-01

    During protein synthesis, tRNA and mRNA are translocated from the A to P to E sites of the ribosome thus enabling the ribosome to translate one codon of mRNA after the other. Ribosome translocation along mRNA is induced by the universally conserved ribosome GTPase, elongation factor G (EF-G) in bacteria and elongation factor 2 (EF-2) in eukaryotes. Recent structural and single-molecule studies revealed that tRNA and mRNA translocation within the ribosome is accompanied by cyclic forward and reverse rotations between the large and small ribosomal subunits parallel to the plane of the intersubunit interface. In addition, during ribosome translocation, the 'head' domain of small ribosomal subunit undergoes forward- and back-swiveling motions relative to the rest of the small ribosomal subunit around the axis that is orthogonal to the axis of intersubunit rotation. tRNA/mRNA translocation is also coupled to the docking of domain IV of EF-G into the A site of the small ribosomal subunit that converts the thermally driven motions of the ribosome and tRNA into the forward translocation of tRNA/mRNA inside the ribosome. Despite recent and enormous progress made in the understanding of the molecular mechanism of ribosome translocation, the sequence of structural rearrangements of the ribosome, EF-G and tRNA during translocation is still not fully established and awaits further investigation. WIREs RNA 2016, 7:620-636. doi: 10.1002/wrna.1354 For further resources related to this article, please visit the WIREs website. PMID:27117863

  13. Polymorphisms in the 18S rDNA gene of Cystoisospora belli and clinical features of cystoisosporosis in HIV-infected patients.

    PubMed

    Resende, Deisy V; Pedrosa, André L; Correia, Dalmo; Cabrine-Santos, Marlene; Lages-Silva, Eliane; Meira, Wendell S F; Oliveira-Silva, Márcia B

    2011-03-01

    Intraspecific variability among Cystoisospora belli isolates and its clinical implications in human cystoisosporosis have not been established. In this study, the restriction fragment length polymorphisms in a 1.8-kb amplicon of the small subunit ribosomal DNA (SSU rDNA) of the parasite was investigated in 20 C. belli-positive stool samples obtained from 15 HIV-infected patients. Diarrheic syndrome was observed in all patients with cystoisosporosis and the number of diarrheic episodes per patient during hospitalization ranged from 1 to 26 (mean of 9.64 ± 9.30), with a mean duration of 2 to 12 days (mean of 5.90 ± 3 days). Three restriction profiles (RF) were generated with MboII digestion, which were named RFI, RFII, and RFIII. Two isolates obtained from a patient with extraintestinal cystoisosporosis showed distinct restriction profiles with MboII. This study demonstrates that patients can be infected with different C. belli genotypes, and this information may be useful for identifying new C. belli genotypes infecting humans. PMID:20967461

  14. Distribution of Mosquitoes in the South East of Argentina and First Report on the Analysis Based on 18S rDNA and COI Sequences

    PubMed Central

    Díaz-Nieto, Leonardo M.; Maciá, Arnaldo; Parisi, Gustavo; Farina, Juan L.; Vidal-Domínguez, María E.; Perotti, M. Alejandra; Berón, Corina M.

    2013-01-01

    Although Mar del Plata is the most important city on the Atlantic coast of Argentina, mosquitoes inhabiting such area are almost uncharacterized. To increase our knowledge in their distribution, we sampled specimens of natural populations. After the morphological identification based on taxonomic keys, sequences of DNA from small ribosomal subunit (18S rDNA) and cytochrome c oxidase I (COI) genes were obtained from native species and the phylogenetic analysis of these sequences were done. Fourteen species from the genera Uranotaenia, Culex, Ochlerotatus and Psorophora were found and identified. Our 18S rDNA and COI-based analysis indicates the relationships among groups at the supra-species level in concordance with mosquito taxonomy. The introduction and spread of vectors and diseases carried by them are not known in Mar del Plata, but some of the species found in this study were reported as pathogen vectors. PMID:24098700

  15. Ribosome recycling induces optimal translation rate at low ribosomal availability.

    PubMed

    Marshall, E; Stansfield, I; Romano, M C

    2014-09-01

    During eukaryotic cellular protein synthesis, ribosomal translation is made more efficient through interaction between the two ends of the messenger RNA (mRNA). Ribosomes reaching the 3' end of the mRNA can thus recycle and begin translation again on the same mRNA, the so-called 'closed-loop' model. Using a driven diffusion lattice model of translation, we study the effects of ribosome recycling on the dynamics of ribosome flow and density on the mRNA. We show that ribosome recycling induces a substantial increase in ribosome current. Furthermore, for sufficiently large values of the recycling rate, the lattice does not transition directly from low to high ribosome density, as seen in lattice models without recycling. Instead, a maximal current phase becomes accessible for much lower values of the initiation rate, and multiple phase transitions occur over a wide region of the phase plane. Crucially, we show that in the presence of ribosome recycling, mRNAs can exhibit a peak in protein production at low values of the initiation rate, beyond which translation rate decreases. This has important implications for translation of certain mRNAs, suggesting that there is an optimal concentration of ribosomes at which protein synthesis is maximal, and beyond which translational efficiency is impaired. PMID:25008084

  16. Ribosome recycling induces optimal translation rate at low ribosomal availability

    PubMed Central

    Marshall, E.; Stansfield, I.; Romano, M. C.

    2014-01-01

    During eukaryotic cellular protein synthesis, ribosomal translation is made more efficient through interaction between the two ends of the messenger RNA (mRNA). Ribosomes reaching the 3′ end of the mRNA can thus recycle and begin translation again on the same mRNA, the so-called ‘closed-loop’ model. Using a driven diffusion lattice model of translation, we study the effects of ribosome recycling on the dynamics of ribosome flow and density on the mRNA. We show that ribosome recycling induces a substantial increase in ribosome current. Furthermore, for sufficiently large values of the recycling rate, the lattice does not transition directly from low to high ribosome density, as seen in lattice models without recycling. Instead, a maximal current phase becomes accessible for much lower values of the initiation rate, and multiple phase transitions occur over a wide region of the phase plane. Crucially, we show that in the presence of ribosome recycling, mRNAs can exhibit a peak in protein production at low values of the initiation rate, beyond which translation rate decreases. This has important implications for translation of certain mRNAs, suggesting that there is an optimal concentration of ribosomes at which protein synthesis is maximal, and beyond which translational efficiency is impaired. PMID:25008084

  17. The SILVA ribosomal RNA gene database project: improved data processing and web-based tools

    PubMed Central

    Quast, Christian; Pruesse, Elmar; Yilmaz, Pelin; Gerken, Jan; Schweer, Timmy; Yarza, Pablo; Peplies, Jörg; Glöckner, Frank Oliver

    2013-01-01

    SILVA (from Latin silva, forest, http://www.arb-silva.de) is a comprehensive web resource for up to date, quality-controlled databases of aligned ribosomal RNA (rRNA) gene sequences from the Bacteria, Archaea and Eukaryota domains and supplementary online services. The referred database release 111 (July 2012) contains 3 194 778 small subunit and 288 717 large subunit rRNA gene sequences. Since the initial description of the project, substantial new features have been introduced, including advanced quality control procedures, an improved rRNA gene aligner, online tools for probe and primer evaluation and optimized browsing, searching and downloading on the website. Furthermore, the extensively curated SILVA taxonomy and the new non-redundant SILVA datasets provide an ideal reference for high-throughput classification of data from next-generation sequencing approaches. PMID:23193283

  18. Molecular characterization and phylogenetic relationships among microsporidian isolates infecting silkworm, Bombyx mori using small subunit rRNA (SSU-rRNA) gene sequence analysis.

    PubMed

    Nath, B Surendra; Gupta, S K; Bajpai, A K

    2012-12-01

    The life cycle, spore morphology, pathogenicity, tissue specificity, mode of transmission and small subunit rRNA (SSU-rRNA) gene sequence analysis of the five new microsporidian isolates viz., NIWB-11bp, NIWB-12n, NIWB-13md, NIWB-14b and NIWB-15mb identified from the silkworm, Bombyx mori have been studied along with type species, NIK-1s_mys. The life cycle of the microsporidians identified exhibited the sequential developmental cycles that are similar to the general developmental cycle of the genus, Nosema. The spores showed considerable variations in their shape, length and width. The pathogenicity observed was dose-dependent and differed from each of the microsporidian isolates; the NIWB-15mb was found to be more virulent than other isolates. All of the microsporidians were found to infect most of the tissues examined and showed gonadal infection and transovarial transmission in the infected silkworms. SSU-rRNA sequence based phylogenetic tree placed NIWB-14b, NIWB-12n and NIWB-11bp in a separate branch along with other Nosema species and Nosema bombycis; while NIWB-15mb and NIWB-13md together formed another cluster along with other Nosema species. NIK-1s_mys revealed a signature sequence similar to standard type species, N. bombycis, indicating that NIK-1s_mys is similar to N. bombycis. Based on phylogenetic relationships, branch length information based on genetic distance and nucleotide differences, we conclude that the microsporidian isolates identified are distinctly different from the other known species and belonging to the genus, Nosema. This SSU-rRNA gene sequence analysis method is found to be more useful approach in detecting different and closely related microsporidians of this economically important domestic insect. PMID:23129193

  19. The Conserved Lys-95 Charged Residue Cluster Is Critical for the Homodimerization and Enzyme Activity of Human Ribonucleotide Reductase Small Subunit M2*

    PubMed Central

    Chen, Xinhuan; Xu, Zhijian; Zhang, Lingna; Liu, Hongchuan; Liu, Xia; Lou, Meng; Zhu, Lijun; Huang, Bingding; Yang, Cai-Guang; Zhu, Weiliang; Shao, Jimin

    2014-01-01

    Ribonucleotide reductase (RR) catalyzes the reduction of ribonucleotides to deoxyribonucleotides for DNA synthesis. Human RR small subunit M2 exists in a homodimer form. However, the importance of the dimer form to the enzyme and the related mechanism remain unclear. In this study, we tried to identify the interfacial residues that may mediate the assembly of M2 homodimer by computational alanine scanning based on the x-ray crystal structure. Co-immunoprecipitation, size exclusion chromatography, and RR activity assays showed that the K95E mutation in M2 resulted in dimer disassembly and enzyme activity inhibition. In comparison, the charge-exchanging double mutation of K95E and E98K recovered the dimerization and activity. Structural comparisons suggested that a conserved cluster of charged residues, including Lys-95, Glu-98, Glu-105, and Glu-174, at the interface may function as an ionic lock for M2 homodimer. Although the measurements of the radical and iron contents showed that the monomer (the K95E mutant) was capable of generating the diiron and tyrosyl radical cofactor, co-immunoprecipitation and competitive enzyme inhibition assays indicated that the disassembly of M2 dimer reduced its interaction with the large subunit M1. In addition, the immunofluorescent and fusion protein-fluorescent imaging analyses showed that the dissociation of M2 dimer altered its subcellular localization. Finally, the transfection of the wild-type M2 but not the K95E mutant rescued the G1/S phase cell cycle arrest and cell growth inhibition caused by the siRNA knockdown of M2. Thus, the conserved Lys-95 charged residue cluster is critical for human RR M2 homodimerization, which is indispensable to constitute an active holoenzyme and function in cells. PMID:24253041

  20. Small subunit of a cold-resistant plant, Timothy, does not significantly alter the catalytic properties of Rubisco in transgenic rice.

    PubMed

    Fukayama, Hiroshi; Koga, Atsushi; Hatanaka, Tomoko; Misoo, Shuji

    2015-04-01

    Effects of overexpression of high activity-type Rubisco small subunit (RbcS) from a cold-resistant plant, timothy (Phleum pratense), on kinetic properties of Rubisco were studied in rice (Oryza sativa). The full-length mRNA sequence of timothy RbcS (PpRbcS1) was determined by 5'RACE and 3'RACE. The coding sequence of PpRbcS1 was fused to the chlorophyll a/b-binding protein promoter and introduced into rice. PpRbcS was highly expressed in leaf blade and accounted for approximately 30 % of total RbcS in homozygous transgenic lines. However, the catalytic turnover rate and K m for CO2 of Rubisco did not significantly change in these transgenic lines compared to non-transgenic rice, suggesting that PpRbcS1 is not effective for improvement of catalytic efficiency of rice Rubisco. The photosynthetic rate and growth were essentially unchanged, whereas the photosynthetic rate at low CO2 condition was marginally increased in transgenic lines. Rubisco content was significantly increased, whereas soluble protein, nitrogen, and chlorophyll contents were unchanged in transgenic lines compared to non-transgenic rice. Because the kinetic properties were similar, observed slight increase in photosynthetic rate at low CO2 is considered to be large due to increase in Rubisco content in transgenic lines. Introduction of foreign RbcS is an effective approach for the improvement of Rubisco kinetics and photosynthesis. However, in this study, it was suggested that RbcS of high activity-type Rubisco, even showing higher amino acid identity with rice RbcS, did not always enhance the catalytic turnover rate of Rubisco in rice. Thus, we should carefully select RbcS to be overexpressed before introduction. PMID:25595546

  1. Evaluation of phylogenetic relationships in Lemnaceae using nuclear ribosomal data.

    PubMed

    Tippery, N P; Les, D H; Crawford, D J

    2015-01-01

    Nuclear DNA sequence data are essential for obtaining a complete understanding of plant species relationships, yet these data have been conspicuously absent from phylogenetic analyses of Lemnaceae (duckweeds). Using a modified Sanger sequencing protocol, we obtained DNA sequences of duckweed nuclear ribosomal regions, including 18S and 26S rDNA genes, the external transcribed spacer (ETS) and the frequently used internal transcribed spacer (ITS). After obtaining sequence data for all Lemnaceae species, we ascertained that prior difficulty in sequencing the ITS regions likely resulted from extremely rigid secondary structures, precipitated by a high proportion of G/C nucleotides. In phylogenetic analyses, nuclear ribosomal data largely supported relationships that had been inferred using chloroplast DNA sequence data. PMID:24942778

  2. Complete nuclear ribosomal DNA sequence amplification and molecular analyses of Bangia (Bangiales, Rhodophyta) from China

    NASA Astrophysics Data System (ADS)

    Xu, Jiajie; Jiang, Bo; Chai, Sanming; He, Yuan; Zhu, Jianyi; Shen, Zonggen; Shen, Songdong

    2016-01-01

    Filamentous Bangia, which are distributed extensively throughout the world, have simple and similar morphological characteristics. Scientists can classify these organisms using molecular markers in combination with morphology. We successfully sequenced the complete nuclear ribosomal DNA, approximately 13 kb in length, from a marine Bangia population. We further analyzed the small subunit ribosomal DNA gene (nrSSU) and the internal transcribed spacer (ITS) sequence regions along with nine other marine, and two freshwater Bangia samples from China. Pairwise distances of the nrSSU and 5.8S ribosomal DNA gene sequences show the marine samples grouping together with low divergences (00.003; 0-0.006, respectively) from each other, but high divergences (0.123-0.126; 0.198, respectively) from freshwater samples. An exception is the marine sample collected from Weihai, which shows high divergence from both other marine samples (0.063-0.065; 0.129, respectively) and the freshwater samples (0.097; 0.120, respectively). A maximum likelihood phylogenetic tree based on a combined SSU-ITS dataset with maximum likelihood method shows the samples divided into three clades, with the two marine sample clades containing Bangia spp. from North America, Europe, Asia, and Australia; and one freshwater clade, containing Bangia atropurpurea from North America and China.

  3. Complete nuclear ribosomal DNA sequence amplification and molecular analyses of Bangia (Bangiales, Rhodophyta) from China

    NASA Astrophysics Data System (ADS)

    Xu, Jiajie; Jiang, Bo; Chai, Sanming; He, Yuan; Zhu, Jianyi; Shen, Zonggen; Shen, Songdong

    2016-09-01

    Filamentous Bangia, which are distributed extensively throughout the world, have simple and similar morphological characteristics. Scientists can classify these organisms using molecular markers in combination with morphology. We successfully sequenced the complete nuclear ribosomal DNA, approximately 13 kb in length, from a marine Bangia population. We further analyzed the small subunit ribosomal DNA gene (nrSSU) and the internal transcribed spacer (ITS) sequence regions along with nine other marine, and two freshwater Bangia samples from China. Pairwise distances of the nrSSU and 5.8S ribosomal DNA gene sequences show the marine samples grouping together with low divergences (00.003; 0-0.006, respectively) from each other, but high divergences (0.123-0.126; 0.198, respectively) from freshwater samples. An exception is the marine sample collected from Weihai, which shows high divergence from both other marine samples (0.063-0.065; 0.129, respectively) and the freshwater samples (0.097; 0.120, respectively). A maximum likelihood phylogenetic tree based on a combined SSU-ITS dataset with maximum likelihood method shows the samples divided into three clades, with the two marine sample clades containing Bangia spp. from North America, Europe, Asia, and Australia; and one freshwater clade, containing Bangia atropurpurea from North America and China.

  4. Accommodation of tmRNA-SmpB into stalled ribosomes: a cryo-EM study.

    PubMed

    Weis, Felix; Bron, Patrick; Rolland, Jean-Paul; Thomas, Daniel; Felden, Brice; Gillet, Reynald

    2010-02-01

    In eubacteria, translation of defective messenger RNAs (mRNAs) produces truncated polypeptides that stall on the ribosome. A quality control mechanism referred to as trans-translation is performed by transfer-messenger RNA (tmRNA), a specialized RNA acting as both a tRNA and an mRNA, associated with small protein B (SmpB). So far, a clear view of the structural movements of both the protein and RNA necessary to perform accommodation is still lacking. By using a construct containing the tRNA-like domain as well as the extended helix H2 of tmRNA, we present a cryo-electron microscopy study of the process of accommodation. The structure suggests how tmRNA and SmpB move into the ribosome decoding site after the release of EF-Tu.GDP. While two SmpB molecules are bound per ribosome in a preaccommodated state, our results show that during accommodation the SmpB protein interacting with the small subunit decoding site stays in place while the one interacting with the large subunit moves away. Relative to canonical translation, an additional movement is observed due to the rotation of H2. This suggests that the larger movement required to resume translation on a tmRNA internal open reading frame starts during accommodation. PMID:20038631

  5. The Fragmented Mitochondrial Ribosomal RNAs of Plasmodium falciparum

    PubMed Central

    Feagin, Jean E.; Harrell, Maria Isabel; Lee, Jung C.; Coe, Kevin J.; Sands, Bryan H.; Cannone, Jamie J.; Tami, Germaine; Schnare, Murray N.; Gutell, Robin R.

    2012-01-01

    Background The mitochondrial genome in the human malaria parasite Plasmodium falciparum is most unusual. Over half the genome is composed of the genes for three classic mitochondrial proteins: cytochrome oxidase subunits I and III and apocytochrome b. The remainder encodes numerous small RNAs, ranging in size from 23 to 190 nt. Previous analysis revealed that some of these transcripts have significant sequence identity with highly conserved regions of large and small subunit rRNAs, and can form the expected secondary structures. However, these rRNA fragments are not encoded in linear order; instead, they are intermixed with one another and the protein coding genes, and are coded on both strands of the genome. This unorthodox arrangement hindered the identification of transcripts corresponding to other regions of rRNA that are highly conserved and/or are known to participate directly in protein synthesis. Principal Findings The identification of 14 additional small mitochondrial transcripts from P. falcipaurm and the assignment of 27 small RNAs (12 SSU RNAs totaling 804 nt, 15 LSU RNAs totaling 1233 nt) to specific regions of rRNA are supported by multiple lines of evidence. The regions now represented are highly similar to those of the small but contiguous mitochondrial rRNAs of Caenorhabditis elegans. The P. falciparum rRNA fragments cluster on the interfaces of the two ribosomal subunits in the three-dimensional structure of the ribosome. Significance All of the rRNA fragments are now presumed to have been identified with experimental methods, and nearly all of these have been mapped onto the SSU and LSU rRNAs. Conversely, all regions of the rRNAs that are known to be directly associated with protein synthesis have been identified in the P. falciparum mitochondrial genome and RNA transcripts. The fragmentation of the rRNA in the P. falciparum mitochondrion is the most extreme example of any rRNA fragmentation discovered. PMID:22761677

  6. Cryo-EM structure of the tetracycline resistance protein TetM in complex with a translating ribosome at 3.9-Å resolution.

    PubMed

    Arenz, Stefan; Nguyen, Fabian; Beckmann, Roland; Wilson, Daniel N

    2015-04-28

    Ribosome protection proteins (RPPs) confer resistance to tetracycline by binding to the ribosome and chasing the drug from its binding site. Current models for RPP action are derived from 7.2- to 16-Å resolution structures of RPPs bound to vacant or nontranslating ribosomes. Here we present a cryo-electron microscopy reconstruction of the RPP TetM in complex with a translating ribosome at 3.9-Å resolution. The structure reveals the contacts of TetM with the ribosome, including interaction between the conserved and functionally critical C-terminal extension of TetM with a unique splayed conformation of nucleotides A1492 and A1493 at the decoding center of the small subunit. The resolution enables us to unambiguously model the side chains of the amino acid residues comprising loop III in domain IV of TetM, revealing that the tyrosine residues Y506 and Y507 are not responsible for drug-release as suggested previously but rather for intrafactor contacts that appear to stabilize the conformation of loop III. Instead, Pro509 at the tip of loop III is located directly within the tetracycline binding site where it interacts with nucleotide C1054 of the 16S rRNA, such that RPP action uses Pro509, rather than Y506/Y507, to directly dislodge and release tetracycline from the ribosome. PMID:25870267

  7. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi.

    PubMed

    Schoch, Conrad L; Seifert, Keith A; Huhndorf, Sabine; Robert, Vincent; Spouge, John L; Levesque, C André; Chen, Wen

    2012-04-17

    Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative protein-coding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter- and intraspecific variation. The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. The nuclear ribosomal small subunit has poor species-level resolution in fungi. ITS will be formally proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life, with the possibility that supplementary barcodes may be developed for particular narrowly circumscribed taxonomic groups. PMID:22454494

  8. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi

    PubMed Central

    Schoch, Conrad L.; Seifert, Keith A.; Huhndorf, Sabine; Robert, Vincent; Spouge, John L.; Levesque, C. André; Chen, Wen; Bolchacova, Elena; Voigt, Kerstin; Crous, Pedro W.; Miller, Andrew N.; Wingfield, Michael J.; Aime, M. Catherine; An, Kwang-Deuk; Bai, Feng-Yan; Barreto, Robert W.; Begerow, Dominik; Bergeron, Marie-Josée; Blackwell, Meredith; Boekhout, Teun; Bogale, Mesfin; Boonyuen, Nattawut; Burgaz, Ana R.; Buyck, Bart; Cai, Lei; Cai, Qing; Cardinali, G.; Chaverri, Priscila; Coppins, Brian J.; Crespo, Ana; Cubas, Paloma; Cummings, Craig; Damm, Ulrike; de Beer, Z. Wilhelm; de Hoog, G. Sybren; Del-Prado, Ruth; Dentinger, Bryn; Diéguez-Uribeondo, Javier; Divakar, Pradeep K.; Douglas, Brian; Dueñas, Margarita; Duong, Tuan A.; Eberhardt, Ursula; Edwards, Joan E.; Elshahed, Mostafa S.; Fliegerova, Katerina; Furtado, Manohar; García, Miguel A.; Ge, Zai-Wei; Griffith, Gareth W.; Griffiths, K.; Groenewald, Johannes Z.; Groenewald, Marizeth; Grube, Martin; Gryzenhout, Marieka; Guo, Liang-Dong; Hagen, Ferry; Hambleton, Sarah; Hamelin, Richard C.; Hansen, Karen; Harrold, Paul; Heller, Gregory; Herrera, Cesar; Hirayama, Kazuyuki; Hirooka, Yuuri; Ho, Hsiao-Man; Hoffmann, Kerstin; Hofstetter, Valérie; Högnabba, Filip; Hollingsworth, Peter M.; Hong, Seung-Beom; Hosaka, Kentaro; Houbraken, Jos; Hughes, Karen; Huhtinen, Seppo; Hyde, Kevin D.; James, Timothy; Johnson, Eric M.; Johnson, Joan E.; Johnston, Peter R.; Jones, E.B. Gareth; Kelly, Laura J.; Kirk, Paul M.; Knapp, Dániel G.; Kõljalg, Urmas; Kovács, Gábor M.; Kurtzman, Cletus P.; Landvik, Sara; Leavitt, Steven D.; Liggenstoffer, Audra S.; Liimatainen, Kare; Lombard, Lorenzo; Luangsa-ard, J. Jennifer; Lumbsch, H. Thorsten; Maganti, Harinad; Maharachchikumbura, Sajeewa S. N.; Martin, María P.; May, Tom W.; McTaggart, Alistair R.; Methven, Andrew S.; Meyer, Wieland; Moncalvo, Jean-Marc; Mongkolsamrit, Suchada; Nagy, László G.; Nilsson, R. Henrik; Niskanen, Tuula; Nyilasi, Ildikó; Okada, Gen; Okane, Izumi; Olariaga, Ibai; Otte, Jürgen; Papp, Tamás; Park, Duckchul; Petkovits, Tamás; Pino-Bodas, Raquel; Quaedvlieg, William; Raja, Huzefa A.; Redecker, Dirk; Rintoul, Tara L.; Ruibal, Constantino; Sarmiento-Ramírez, Jullie M.; Schmitt, Imke; Schüßler, Arthur; Shearer, Carol; Sotome, Kozue; Stefani, Franck O.P.; Stenroos, Soili; Stielow, Benjamin; Stockinger, Herbert; Suetrong, Satinee; Suh, Sung-Oui; Sung, Gi-Ho; Suzuki, Motofumi; Tanaka, Kazuaki; Tedersoo, Leho; Telleria, M. Teresa; Tretter, Eric; Untereiner, Wendy A.; Urbina, Hector; Vágvölgyi, Csaba; Vialle, Agathe; Vu, Thuy Duong; Walther, Grit; Wang, Qi-Ming; Wang, Yan; Weir, Bevan S.; Weiß, Michael; White, Merlin M.; Xu, Jianping; Yahr, Rebecca; Yang, Zhu L.; Yurkov, Andrey; Zamora, Juan-Carlos; Zhang, Ning; Zhuang, Wen-Ying; Schindel, David

    2012-01-01

    Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative protein-coding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter- and intraspecific variation. The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. The nuclear ribosomal small subunit has poor species-level resolution in fungi. ITS will be formally proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life, with the possibility that supplementary barcodes may be developed for particular narrowly circumscribed taxonomic groups. PMID:22454494

  9. Ribosomes in a Stacked Array

    PubMed Central

    Yamashita, Yui; Kadokura, Yoshitomo; Sotta, Naoyuki; Fujiwara, Toru; Takigawa, Ichigaku; Satake, Akiko; Onouchi, Hitoshi; Naito, Satoshi

    2014-01-01

    Expression of CGS1, which codes for an enzyme of methionine biosynthesis, is feedback-regulated by mRNA degradation in response to S-adenosyl-l-methionine (AdoMet). In vitro studies revealed that AdoMet induces translation arrest at Ser-94, upon which several ribosomes stack behind the arrested one, and mRNA degradation occurs at multiple sites that presumably correspond to individual ribosomes in a stacked array. Despite the significant contribution of stacked ribosomes to inducing mRNA degradation, little is known about the ribosomes in the stacked array. Here, we assigned the peptidyl-tRNA species of the stacked second and third ribosomes to their respective codons and showed that they are arranged at nine-codon intervals behind the Ser-94 codon, indicating tight stacking. Puromycin reacts with peptidyl-tRNA in the P-site, releasing the nascent peptide as peptidyl-puromycin. This reaction is used to monitor the activity of the peptidyltransferase center (PTC) in arrested ribosomes. Puromycin reaction of peptidyl-tRNA on the AdoMet-arrested ribosome, which is stalled at the pre-translocation step, was slow. This limited reactivity can be attributed to the peptidyl-tRNA occupying the A-site at this step rather than to suppression of PTC activity. In contrast, puromycin reactions of peptidyl-tRNA with the stacked second and third ribosomes were slow but were not as slow as pre-translocation step ribosomes. We propose that the anticodon end of peptidyl-tRNA resides in the A-site of the stacked ribosomes and that the stacked ribosomes are stalled at an early step of translocation, possibly at the P/E hybrid state. PMID:24652291

  10. Exploring Ribosome Positioning on Translating Transcripts with Ribosome Profiling.

    PubMed

    Spealman, Pieter; Wang, Hao; May, Gemma; Kingsford, Carl; McManus, C Joel

    2016-01-01

    Recent technological advances (e.g., microarrays and massively parallel sequencing) have facilitated genome-wide measurement of many aspects of gene regulation. Ribosome profiling is a high-throughput sequencing method used to measure gene expression at the level of translation. This is accomplished by quantifying both the number of translating ribosomes and their locations on mRNA transcripts. The inventors of this approach have published several methods papers detailing its implementation and addressing the basics of ribosome profiling data analysis. Here we describe our lab's procedure, which differs in some respects from those published previously. In addition, we describe a data analysis pipeline, Ribomap, for ribosome profiling data. Ribomap allocates sequence reads to alternative mRNA isoforms, normalizes sequencing bias along transcripts using RNA-seq data, and outputs count vectors of per-codon ribosome occupancy for each transcript. PMID:26463378

  11. Mutations in Nu1, the gene encoding the small subunit of bacteriophage lambda terminase, suppress the postcleavage DNA packaging defect of cosB mutations.

    PubMed Central

    Cai, Z H; Hwang, Y; Cue, D; Catalano, C; Feiss, M

    1997-01-01

    The linear double-stranded DNA molecules in lambda virions are generated by nicking of concatemeric intracellular DNA by terminase, the lambda DNA packaging enzyme. Staggered nicks are introduced at cosN to generate the cohesive ends of virion DNA. After nicking, the cohesive ends are separated by terminase; terminase bound to the left end of the DNA to be packaged then binds the empty protein shell, i.e., the prohead, and translocation of DNA into the prohead occurs. cosB, a site adjacent to cosN, is a terminase binding site. cosB facilitates the rate and fidelity of the cosN cleavage reaction by serving as an anchoring point for gpNu1, the small subunit of terminase. cosB is also crucial for the formation of a stable terminase-DNA complex, called complex I, formed after cosN cleavage. The role of complex I is to bind the prohead. Mutations in cosB affect both cosB functions, causing mild defects in cosN cleavage and severe packaging defects. The lethal cosB R3- R2- R1- mutation contains a transition mutation in each of the three gpNu1 binding sites of cosB. Pseudorevertants of lambda cosB R3- R2- R1- DNA contain suppressor mutations affecting gpNu1. Results of experiments that show that two such suppressors, Nu1ms1 and Nu1ms3, do not suppress the mild cosN cleavage defect caused by the cosB R3- R2- R1- mutation but strongly suppress the DNA packaging defect are presented. It is proposed that the suppressing terminases, unlike the wild-type enzyme, are able to assemble a stable complex I with cosB R3- R2- R1- DNA. Observations on the adenosine triphosphatase activities and protease susceptibilities of gpNu1 of the Nu1ms1 and Nu1ms3 terminases indicate that the conformation of gpNu1 is altered in the suppressing terminases. PMID:9098042

  12. Proteomics and Electron Microscopic Characterization of the Unusual Mitochondrial Ribosome-Related 45S Complex in Leishmania Tarentolae

    PubMed Central

    Maslov, Dmitri A.; Spremulli, Linda L.; Sharma, Manjuli R.; Bhargava, Kalpana; Grasso, Domenick; Falick, Arnold M.; Agrawal, Rajendra K.; Parker, Carol E.; Simpson, Larry

    2007-01-01

    A novel type of ribonucleoprotein (RNP) complex has been described from the kinetoplast-mitochondria of Leishmania tarentolae. The complex, termed the 45S SSU*, contains the 9S small subunit rRNA but does not contain the 12S large subunit rRNA. This complex is the most stable and abundant mitochondrial RNP complex present in Leishmania. As shown by tandem mass spectrometry, the complex contains at least 39 polypeptides with a combined molecular mass of almost 2.1 MDa. These components include several homologs of small subunit ribosomal proteins (S5, S6, S8 S9, S11, S15, S16, S17, S18, MRPS29); however, most of the polypeptides present are unique. Only a few of them show recognizable motifs, such as protein-protein (coiled-coil, Rhodanese) or protein-RNA (pentatricopeptide repeat) interaction domains. A cryo-electron microscopy examination of the 45S SSU* fraction reveals that 27% of particles represent SSU homodimers arranged in a head-to-tail orientation, while the majority of particles are clearly different and show an asymmetric bilobed morphology. Multiple classes of two-dimensional averages were derived for the asymmetrical particles, probably reflecting random orientations of the particles and difficulties in correlating these views with the known projections of ribosomal complexes. One class of the two-dimensional averages shows an SSU moiety attached to a protein mass or masses in a monosome-like appearance. The combined mass spectrometry and electron microscopy data thus indicate that the majority 45S SSU* particles represents a heterodimeric complex in which the SSU of the Leishmania mitochondrial ribosome is associated with an additional protein mass. The biological role of these particles is not known. PMID:17292489

  13. Phylogenetic classification of the frog pathogen Amphibiothecum (Dermosporidium) penneri based on small ribosomal subunit sequencing

    USGS Publications Warehouse

    Feldman, S.H.; Wimsatt, J.H.; Green, D.E.

    2005-01-01

    We determined 1,600 base pairs of DNA sequence in the 18S small ribosomal subunit from two geographically distinct isolates of Dermosporidium penneri. Maximum likelihood and parsimony analysis of these sequences place D. penneri in the order Dermocystida of the class Mesomycetozoea. The 18S rRNA sequences from these two isolates only differ within a single region of 16 contiguous nucleotides. Based on the distant phylogenetic relationship of these organisms to Amphibiocystidium ranae and similarity to Sphaerothecum destruens we propose the organism be renamed Amphibiothecum penneri.

  14. Creation of a data base for sequences of ribosomal nucleic acids and detection of conserved restriction endonucleases sites through computerized processing.

    PubMed Central

    Patarca, R; Dorta, B; Ramirez, J L

    1982-01-01

    As part of a project pertaining the organization of ribosomal genes in Kinetoplastidae, we have created a data base for published sequences of ribosomal nucleic acids, with information in Spanish. As a first step in their processing, we have written a computer program which introduces the new feature of determining the length of the fragments produced after single or multiple digestion with any of the known restriction enzymes. With this information we have detected conserved SAU 3A sites: (i) at the 5' end of the 5.8S rRNA and at the 3' end of the small subunit rRNA, both included in similar larger sequences; (ii) in the 5.8S rRNA of vertebrates (a second one), which is not present in lower eukaryotes, showing a clear evolutive divergence; and, (iii) at the 5' terminal of the small subunit rRNA, included in a larger conserved sequence. The possible biological importance of these sequences is discussed. PMID:6278402

  15. Physical mapping of 18S and 5S genes in pelagic species of the genera Caranx and Carangoides (Carangidae).

    PubMed

    Jacobina, U P; Bertollo, L A C; Bello Cioffi, M; Molina, W F

    2014-01-01

    In Carangidae, Caranx is taxonomically controversial because of slight morphological differences among species, as well as because of its relationship with the genus Carangoides. Cytogenetic data has contributed to taxonomic and phylogenetic classification for some groups of fish. In this study, we examined the chromosomes of Caranx latus, Caranx lugubris, and Carangoides bartholomaei using classical methods, including conventional staining, C-banding, silver staining for nuclear organizer regions, base-specific fluorochrome, and 18S and 5S ribosomal sequence mapping using in situ hybridization. These 3 species showed chromosome numbers of 2n = 48, simple nuclear organizer regions (pair 1), and mainly centromeric heterochomatin. However, C. latus (NF = 50) and C. bartholomaei (NF = 50) showed a structurally conserved karyotype compared with C. lugubris (NF = 54), with a larger number of 2-armed chromosomes. The richness of GC-positive heterochromatic segments and sites in 5S rDNA in specific locations compared to the other 2 species reinforce the higher evolutionary dynamism in C. lugubris. Cytogenetic aspects shared between C. latus and C. bartholomaei confirm the remarkable phylogenetic proximity between these genera. PMID:25501173

  16. The mechanics of ribosomal translocation.

    PubMed

    Achenbach, John; Nierhaus, Knud H

    2015-07-01

    The ribosome translates the sequence of codons of an mRNA into the corresponding sequence of amino acids as it moves along the mRNA with a codon-step width of about 10 Å. The movement of the million-dalton complex ribosome is triggered by the universal elongation factor G (EF2 in archaea and eukaryotes) and is termed translocation. Unraveling the molecular details of translocation is one of the most challenging tasks of current ribosome research. In the last two years, enormous progress has been obtained by highly-resolved X-ray and cryo-electron microscopic structures as well as by sophisticated biochemical approaches concerning the trigger and control of the movement of the tRNA2·mRNA complex inside the ribosome during translocation. This review inspects and surveys these achievements. PMID:25514765

  17. The Ribosomal Database Project (RDP).

    PubMed Central

    Maidak, B L; Olsen, G J; Larsen, N; Overbeek, R; McCaughey, M J; Woese, C R

    1996-01-01

    The Ribosomal Database Project (RDP) is a curated database that offers ribosome-related data, analysis services and associated computer programs. The offerings include phylogenetically ordered alignments of ribosomal RNA (rRNA) sequences, derived phylogenetic trees, rRNA secondary structure diagrams and various software for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (rdp.life.uiuc.edu), electronic mail (server@rdp.life.uiuc.edu), gopher (rdpgopher.life.uiuc.edu) and World Wide Web (WWW)(http://rdpwww.life.uiuc.edu/). The electronic mail and WWW servers provide ribosomal probe checking, screening for possible chimeric rRNA sequences, automated alignment and approximate phylogenetic placement of user-submitted sequences on an existing phylogenetic tree. PMID:8594608

  18. Comparison of potential diatom 'barcode' genes (the 18S rRNA gene and ITS, COI, rbcL) and their effectiveness in discriminating and determining species taxonomy in the Bacillariophyta.

    PubMed

    Guo, Liliang; Sui, Zhenghong; Zhang, Shu; Ren, Yuanyuan; Liu, Yuan

    2015-04-01

    Diatoms form an enormous group of photoautotrophic micro-eukaryotes and play a crucial role in marine ecology. In this study, we evaluated typical genes to determine whether they were effective at different levels of diatom clustering analysis to assess the potential of these regions for barcoding taxa. Our test genes included nuclear rRNA genes (the nuclear small-subunit rRNA gene and the 5.8S rRNA gene+ITS-2), a mitochondrial gene (cytochrome c-oxidase subunit 1, COI), a chloroplast gene [ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL)] and the universal plastid amplicon (UPA). Calculated genetic divergence was highest for the internal transcribed spacer (ITS; 5.8S+ITS-2) (p-distance of 1.569, 85.84% parsimony-informative sites) and COI (6.084, 82.14%), followed by the 18S rRNA gene (0.139, 57.69%), rbcL (0.120, 42.01%) and UPA (0.050, 14.97%), which indicated that ITS and COI were highly divergent compared with the other tested genes, and that their nucleotide compositions were variable within the whole group of diatoms. Bayesian inference (BI) analysis showed that the phylogenetic trees generated from each gene clustered diatoms at different phylogenetic levels. The 18S rRNA gene was better than the other genes in clustering higher diatom taxa, and both the 18S rRNA gene and rbcL performed well in clustering some lower taxa. The COI region was able to barcode species of some genera within the Bacillariophyceae. ITS was a potential marker for DNA based-taxonomy and DNA barcoding of Thalassiosirales, while species of Cyclotella, Skeletonema and Stephanodiscus gathered in separate clades, and were paraphyletic with those of Thalassiosira. Finally, UPA was too conserved to serve as a diatom barcode. PMID:25604341

  19. IRESPred: Web Server for Prediction of Cellular and Viral Internal Ribosome Entry Site (IRES)

    PubMed Central

    Kolekar, Pandurang; Pataskar, Abhijeet; Kulkarni-Kale, Urmila; Pal, Jayanta; Kulkarni, Abhijeet

    2016-01-01

    Cellular mRNAs are predominantly translated in a cap-dependent manner. However, some viral and a subset of cellular mRNAs initiate their translation in a cap-independent manner. This requires presence of a structured RNA element, known as, Internal Ribosome Entry Site (IRES) in their 5′ untranslated regions (UTRs). Experimental demonstration of IRES in UTR remains a challenging task. Computational prediction of IRES merely based on sequence and structure conservation is also difficult, particularly for cellular IRES. A web server, IRESPred is developed for prediction of both viral and cellular IRES using Support Vector Machine (SVM). The predictive model was built using 35 features that are based on sequence and structural properties of UTRs and the probabilities of interactions between UTR and small subunit ribosomal proteins (SSRPs). The model was found to have 75.51% accuracy, 75.75% sensitivity, 75.25% specificity, 75.75% precision and Matthews Correlation Coefficient (MCC) of 0.51 in blind testing. IRESPred was found to perform better than the only available viral IRES prediction server, VIPS. The IRESPred server is freely available at http://bioinfo.net.in/IRESPred/. PMID:27264539

  20. IRESPred: Web Server for Prediction of Cellular and Viral Internal Ribosome Entry Site (IRES).

    PubMed

    Kolekar, Pandurang; Pataskar, Abhijeet; Kulkarni-Kale, Urmila; Pal, Jayanta; Kulkarni, Abhijeet

    2016-01-01

    Cellular mRNAs are predominantly translated in a cap-dependent manner. However, some viral and a subset of cellular mRNAs initiate their translation in a cap-independent manner. This requires presence of a structured RNA element, known as, Internal Ribosome Entry Site (IRES) in their 5' untranslated regions (UTRs). Experimental demonstration of IRES in UTR remains a challenging task. Computational prediction of IRES merely based on sequence and structure conservation is also difficult, particularly for cellular IRES. A web server, IRESPred is developed for prediction of both viral and cellular IRES using Support Vector Machine (SVM). The predictive model was built using 35 features that are based on sequence and structural properties of UTRs and the probabilities of interactions between UTR and small subunit ribosomal proteins (SSRPs). The model was found to have 75.51% accuracy, 75.75% sensitivity, 75.25% specificity, 75.75% precision and Matthews Correlation Coefficient (MCC) of 0.51 in blind testing. IRESPred was found to perform better than the only available viral IRES prediction server, VIPS. The IRESPred server is freely available at http://bioinfo.net.in/IRESPred/. PMID:27264539

  1. The methyltransferase adaptor protein Trm112 is involved in biogenesis of both ribosomal subunits

    PubMed Central

    Sardana, Richa; Johnson, Arlen W.

    2012-01-01

    We previously identified Bud23 as the methyltransferase that methylates G1575 of rRNA in the P-site of the small (40S) ribosomal subunit. In this paper, we show that Bud23 requires the methyltransferase adaptor protein Trm112 for stability in vivo. Deletion of Trm112 results in a bud23Δ-like mutant phenotype. Thus Trm112 is required for efficient small-subunit biogenesis. Genetic analysis suggests the slow growth of a trm112Δ mutant is due primarily to the loss of Bud23. Surprisingly, suppression of the bud23Δ-dependent 40S defect revealed a large (60S) biogenesis defect in a trm112Δ mutant. Using sucrose gradient sedimentation analysis and coimmunoprecipitation, we show that Trm112 is also involved in 60S subunit biogenesis. The 60S defect may be dependent on Nop2 and Rcm1, two additional Trm112 interactors that we identify. Our work extends the known range of Trm112 function from modification of tRNAs and translation factors to both ribosomal subunits, showing that its effects span all aspects of the translation machinery. Although Trm112 is required for Bud23 stability, our results suggest that Trm112 is not maintained in a stable complex with Bud23. We suggest that Trm112 stabilizes its free methyltransferase partners not engaged with substrate and/or helps to deliver its methyltransferase partners to their substrates. PMID:22956767

  2. [Ribosomal RNA Evolution

    NASA Technical Reports Server (NTRS)

    1997-01-01

    It is generally believed that an RNA World existed at an early stage in the history of life. During this early period, RNA molecules are seen to be potentially involved in both catalysis and the storage of genetic information. Translation presents several interrelated themes of inquiry for exobiology. First, it is essential, for understanding the very origin of life, how peptides and eventually proteins might have come to be made on the early Earth in a template directed manner. Second, it is necessary to understand how a machinery of similar complexity to that found in the ribosomes of modern organisms came to exist by the time of the last common ancestor (as detected by 16S rRNA sequence studies). Third, the ribosomal RNAs themselves likely had a very early origin and studies of their history may be very informative about the nature of the RNA World. Moreover, studies of these RNAs will contribute to a better understanding of the potential roles of RNA in early evolution.During the past year we have ave conducted a comparative study of four completely sequenced bacterial genoames. We have focused initially on conservation of gene order. The second component of the project continues to build on the model system for studying the validity of variant 5S rRNA sequences in the vicinity of the modern Vibrio proteolyticus 5S rRNA that we established earlier. This system has made it possible to conduct a detailed and extensive analysis of a local portion of the sequence space. These core methods have been used to construct numerous mutants during the last several years. Although it has been a secondary focus, this work has continued over the last year such that we now have in excess of 125 V. proteolyticus derived constructs which have been made and characterized. We have also continued high resolution NMR work on RNA oligomers originally initiated by G. Kenneth Smith who was funded by a NASA Graduate Student Researcher's Fellowship Award until May of 1996. Mr. Smith

  3. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome.

    PubMed

    Poirot, Olivier; Timsit, Youri

    2016-01-01

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through "molecular synapses", ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the "sensory-proteins" innervate the functional ribosomal sites, while the "inter-proteins" interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing. PMID:27225526

  4. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome

    PubMed Central

    Poirot, Olivier; Timsit, Youri

    2016-01-01

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through “molecular synapses”, ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the “sensory-proteins” innervate the functional ribosomal sites, while the “inter-proteins” interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing. PMID:27225526

  5. Rmt1 catalyzes zinc-finger independent arginine methylation of ribosomal protein Rps2 in Saccharomyces cerevisiae

    SciTech Connect

    Lipson, Rebecca S.; Webb, Kristofor J.; Clarke, Steven G.

    2010-01-22

    Rps2/rpS2 is a well conserved protein of the eukaryotic ribosomal small subunit. Rps2 has previously been shown to contain asymmetric dimethylarginine residues, the addition of which is catalyzed by zinc-finger-containing arginine methyltransferase 3 (Rmt3) in the fission yeast Schizosaccharomyces pombe and protein arginine methyltransferase 3 (PRMT3) in mammalian cells. Here, we demonstrate that despite the lack of a zinc-finger-containing homolog of Rmt3/PRMT3 in the budding yeast Saccharomyces cerevisiae, Rps2 is partially modified to generate asymmetric dimethylarginine and monomethylarginine residues. We find that this modification of Rps2 is dependent upon the major arginine methyltransferase 1 (Rmt1) in S. cerevisiae. These results are suggestive of a role for Rmt1 in modifying the function of Rps2 in a manner distinct from that occurring in S. pombe and mammalian cells.

  6. Chloroplast ribosomes and protein synthesis.

    PubMed Central

    Harris, E H; Boynton, J E; Gillham, N W

    1994-01-01

    Consistent with their postulated origin from endosymbiotic cyanobacteria, chloroplasts of plants and algae have ribosomes whose component RNAs and proteins are strikingly similar to those of eubacteria. Comparison of the secondary structures of 16S rRNAs of chloroplasts and bacteria has been particularly useful in identifying highly conserved regions likely to have essential functions. Comparative analysis of ribosomal protein sequences may likewise prove valuable in determining their roles in protein synthesis. This review is concerned primarily with the RNAs and proteins that constitute the chloroplast ribosome, the genes that encode these components, and their expression. It begins with an overview of chloroplast genome structure in land plants and algae and then presents a brief comparison of chloroplast and prokaryotic protein-synthesizing systems and a more detailed analysis of chloroplast rRNAs and ribosomal proteins. A description of the synthesis and assembly of chloroplast ribosomes follows. The review concludes with discussion of whether chloroplast protein synthesis is essential for cell survival. PMID:7854253

  7. Comparison of phosphorylation of ribosomal proteins from HeLa and Krebs II ascites-tumour cells by cyclic AMP-dependent and cyclic GMP-dependent protein kinases.

    PubMed Central

    Issinger, O G; Beier, H; Speichermann, N; Flokerzi, V; Hofmann, F

    1980-01-01

    Phosphorylation of eukaryotic ribosomal proteins in vitro by essentially homogeneous preparations of cyclic AMP-dependent protein kinase catalytic subunit and cyclic GMP-dependent protein kinase was compared. Each protein kinase was added at a concentration of 30nM. Ribosomal proteins were identified by two-dimensional gel electrophoresis. Almost identical results were obtained when ribosomal subunits from HeLa or ascites-tumour cells were used. About 50-60% of the total radioactive phosphate incorporated into small-subunit ribosomal proteins by either kinase was associated with protein S6. In 90 min between 0.7 and 1.0 mol of phosphate/mol of protein S6 was incorporated by the catalytic subunit of cyclic AMP-dependent protein kinase. Of the other proteins, S3 and S7 from the small subunit and proteins L6, L18, L19 and L35 from the large subunit were predominantly phosphorylated by the cyclic AMP-dependent enzyme. Between 0.1 and 0.2 mol of phosphate was incorporated/mol of these phosphorylated proteins. With the exception of protein S7, the same proteins were also major substrates for the cyclic GMP-dependent protein kinase. Time courses of the phosphorylation of individual proteins from the small and large ribosomal subunits in the presence of either protein kinase suggested four types of phosphorylation reactions: (1) proteins S2, S10 and L5 were preferably phosphorylated by the cyclic GMP-dependent protein kinase; (2) proteins S3 and L6 were phosphorylated at very similar rates by either kinase; (3) proteins S7 and L29 were almost exclusively phosphorylated by the cyclic AMP-dependent protein kinase; (4) protein S6 and most of the other proteins were phosphorylated about two or three times faster by the cyclic AMP-dependent than by the cyclic GMP-dependent enzyme. Images Fig. 1. Fig. 2. PMID:6246882

  8. Comparison of bacterial communities in the Solimões and Negro River tributaries of the Amazon River based on small subunit rRNA gene sequences.

    PubMed

    Peixoto, J C C; Leomil, L; Souza, J V; Peixoto, F B S; Astolfi-Filho, S

    2011-01-01

    The microbiota of the Amazon River basin has been little studied. We compared the structure of bacterial communities of the Solimões and Negro Rivers, the main Amazon River tributaries, based on analysis of 16S rRNA gene sequences. Water was sampled with a 3-L Van Dorn collection bottle; samples were collected at nine different points/depths totaling 27 L of water from each river. Total DNA was extracted from biomass retained by a 0.22-μm filter after sequential filtration of the water through 0.8- and 0.22-μm filters. The 16S rRNA gene was amplified by PCR, cloned and sequenced, and the sequences were analyzed with the PHYLIP and DOTUR programs to obtain the operational taxonomic units (OTUs) and to calculate the diversity and richness indices using the SPADE program. Taxonomic affiliation was determined using the naive Bayesian rRNA Classifier of the RDP II (Ribosomal Database Project). We recovered 158 sequences from the Solimões River grouped into 103 OTUs, and 197 sequences from the Negro River library grouped into 90 OTUs by the DOTUR program. The Solimões River was found to have a greater diversity of bacterial genera, and greater estimated richness of 446 OTUs, compared with 242 OTUs from the Negro River, as calculated by ACE estimator. The Negro River has less bacterial diversity, but more 16S rRNA gene sequences belonging to the bacterial genus Polynucleobacter were detected; 56 sequences from this genus were found (about 30% of the total sequences). We suggest that a more in-depth investigation be made to elucidate the role played by these bacteria in the river environment. These differences in bacterial diversity between Solimões and Negro Rivers could be explained by differences in organic matter content and pH of the rivers. PMID:22183948

  9. Profiling of Mycoplasma gallisepticum Ribosomes.

    PubMed

    Fisunov, G Y; Evsyutina, D V; Arzamasov, A A; Butenko, I O; Govorun, V M

    2015-01-01

    The development of high-throughput technologies is increasingly resulting in identification of numerous cases of low correlation between mRNA and the protein level in cells. These controversial observations were made on various bacteria, such as E. coli, Desulfovibrio vulgaris, and Lactococcus lactis. Thus, it is important to develop technologies, including high-throughput techniques, aimed at studying gene expression regulation at the level of translation. In the current study, we performed proteomic profiling of M. gallisepticum ribosomes and identified high abundant noncanonical proteins. We found that binding of mRNAs to ribosomes is mainly determined by two parameters: (1) abundance of mRNA itself and (2) complimentary interactions between the 3' end of 16S rRNA and the ribosome binding site in the 5'-untranslated region of mRNA. PMID:26798497

  10. Profiling of Mycoplasma gallisepticum Ribosomes

    PubMed Central

    Fisunov, G. Y.; Evsyutina, D. V.; Arzamasov, A. A.; Butenko, I. O.; Govorun, V. M.

    2015-01-01

    The development of high-throughput technologies is increasingly resulting in identification of numerous cases of low correlation between mRNA and the protein level in cells. These controversial observations were made on various bacteria, such as E. coli, Desulfovibrio vulgaris, and Lactococcus lactis. Thus, it is important to develop technologies, including high-throughput techniques, aimed at studying gene expression regulation at the level of translation. In the current study, we performed proteomic profiling of M. gallisepticum ribosomes and identified high abundant noncanonical proteins. We found that binding of mRNAs to ribosomes is mainly determined by two parameters: (1) abundance of mRNA itself and (2) complimentary interactions between the 3’ end of 16S rRNA and the ribosome binding site in the 5’-untranslated region of mRNA. PMID:26798497

  11. Comprehensive Molecular Structure of the Eukaryotic Ribosome

    PubMed Central

    Taylor, Derek J.; Devkota, Batsal; Huang, Andrew D.; Topf, Maya; Narayanan, Eswar; Sali, Andrej; Harvey, Stephen C.; Frank, Joachim

    2009-01-01

    Despite the emergence of a large number of X-ray crystallographic models of the bacterial 70S ribosome over the past decade, an accurate atomic model of the eukaryotic 80S ribosome is still not available. Eukaryotic ribosomes possess more ribosomal proteins and ribosomal RNA than bacterial ribosomes, which are implicated in extra-ribosomal functions in the eukaryotic cells. By combining cryo-EM with RNA and protein homology modeling, we obtained an atomic model of the yeast 80S ribosome complete with all ribosomal RNA expansion segments and all ribosomal proteins for which a structural homolog can be identified. Mutation or deletion of 80S ribosomal proteins can abrogate maturation of the ribosome, leading to several human diseases. We have localized one such protein unique to eukaryotes, rpS19e, whose mutations are associated with Diamond-Blackfan anemia in humans. Additionally, we characterize crucial and novel interactions between the dynamic stalk base of the ribosome with eukaryotic elongation factor 2. PMID:20004163

  12. New ribosomes for new memories?

    PubMed Central

    Hernández, A Iván; Alarcon, Juan M; Allen, Kim D

    2015-01-01

    Widely thought to be a housekeeping process, the regulation and synthesis of rRNA emerges as a potentially central mechanism for the maintenance of synaptic plasticity and memory. We have recently shown that an essential component of late-phase synaptic plasticity is rRNA biosynthesis — the rate-limiting step in the production of new ribosomes. We hypothesize that a particular population of ribosomes is generated upon learning-associated neural activity to alter the rate of synthesis of plasticity factors at tagged synapses that will support the maintenance of synaptic plasticity and memory. PMID:26479998

  13. Decrease in Ribosomal RNA in Candida albicans Induced by Serum Exposure

    PubMed Central

    Fleischmann, Jacob; Rocha, Miguel A.

    2015-01-01

    Candida albicans is an important polymorphic human pathogen. It can switch from a unicellular yeast form to germinating hypha, which may play a role in making it the successful pathogen it is. This hyphal transformation can be triggered by various extracellular stimuli, the most potent one being serum from any source. We have previously reported that Candida albicans transiently polyadenylates portions of both the large and small subunits of ribosomal RNA, shortly after serum exposure. Northern blots at the same time suggested that serum might induce a decrease in total ribosomal RNA. We have carried out a number of experiments to carefully assess this possibility and now report that serum significantly reduces ribosomal RNA in Candida albicans. Fluorometric measurements, Northern blotting and quantitative RT-PCR, have all confirmed this decrease. Timed experiments show that serum induces this decrease rapidly, as it was seen in as early as five minutes. Cell mass is not decreased as total cellular protein content remains the same and metabolic activity does not appear to slow, as assessed by XTT assay, and by the observation that cells form hyphal structures robustly. Another hyphal inducer, N-acetylglucosamine, also caused RNA decrease, but to a lesser extent. We also observed it in non-germinating yeast, such as Candida glabrata. The reason for this decrease is unknown and overall our data suggests that decrease in rRNA does not play a causal role in hyphal transformation. Rapid and significant decrease in a molecule so central to the yeast’s biology is of some importance, and further studies, such as its effect on protein metabolism, will be required to better understand its purpose. PMID:25946110

  14. Free-Energy Landscape of Reverse tRNA Translocation through the Ribosome Analyzed by Electron Microscopy Density Maps and Molecular Dynamics Simulations

    PubMed Central

    Ishida, Hisashi; Matsumoto, Atsushi

    2014-01-01

    To understand the mechanism of reverse tRNA translocation in the ribosome, all-atom molecular dynamics simulations of the ribosome-tRNAs-mRNA-EFG complex were performed. The complex at the post-translocational state was directed towards the translocational and pre-translocational states by fitting the complex into cryo-EM density maps. Between a series of the fitting simulations, umbrella sampling simulations were performed to obtain the free-energy landscape. Multistep structural changes, such as a ratchet-like motion and rotation of the head of the small subunit were observed. The free-energy landscape showed that there were two main free-energy barriers: one between the post-translocational and intermediate states, and the other between the pre-translocational and intermediate states. The former corresponded to a clockwise rotation, which was coupled to the movement of P-tRNA over the P/E-gate made of G1338, A1339 and A790 in the small subunit. The latter corresponded to an anticlockwise rotation of the head, which was coupled to the location of the two tRNAs in the hybrid state. This indicates that the coupled motion of the head rotation and tRNA translocation plays an important role in opening and closing of the P/E-gate during the ratchet-like movement in the ribosome. Conformational change of EF-G was interpreted to be the result of the combination of the external motion by L12 around an axis passing near the sarcin-ricin loop, and internal hinge-bending motion. These motions contributed to the movement of domain IV of EF-G to maintain its interaction with A/P-tRNA. PMID:24999999

  15. Chromatographic Purification of Highly Active Yeast Ribosomes

    PubMed Central

    Meskauskas, Arturas; Leshin, Jonathan A.; Dinman, Jonathan D.

    2011-01-01

    Eukaryotic ribosomes are much more labile as compared to their eubacterial and archael counterparts, thus posing a significant challenge to researchers. Particularly troublesome is the fact that lysis of cells releases a large number of proteases and nucleases which can degrade ribosomes. Thus, it is important to separate ribosomes from these enzymes as quickly as possible. Unfortunately, conventional differential ultracentrifugation methods leaves ribosomes exposed to these enzymes for unacceptably long periods of time, impacting their structural integrity and functionality. To address this problem, we utilize a chromatographic method using a cysteine charged Sulfolink resin. This simple and rapid application significantly reduces co-purifying proteolytic and nucleolytic activities, producing high yields of intact, highly biochemically active yeast ribosomes. We suggest that this method should also be applicable to mammalian ribosomes. The simplicity of the method, and the enhanced purity and activity of chromatographically purified ribosome represents a significant technical advancement for the study of eukaryotic ribosomes. PMID:22042245

  16. AMPLIFICATION OF RIBOSOMAL RNA SEQUENCES

    EPA Science Inventory

    This book chapter offers an overview of the use of ribosomal RNA sequences. A history of the technology traces the evolution of techniques to measure bacterial phylogenetic relationships and recent advances in obtaining rRNA sequence information. The manual also describes procedu...

  17. Studies on Pea Ribosomal Proteins

    PubMed Central

    Lin, Chu-Yung; Chia, Subrina Li-Li; Travis, Robert L.; Key, Joe L.

    1975-01-01

    Ribosomal subunits prepared by NH4Cl dissociation (0.5 m) of the monomeric ribosomes were much less active in in vitro protein synthesis than those prepared by KCl dissociation. The decrease in activity correlated with a detachment of some proteins (L2 and L9 as shown by gel electrophoresis) within the 60S ribosomal subunits. Subunits prepared with 0.3 m NH4Cl retained L2 and L9, but the activity remained low. Incubation of these 60S subunits in TKM buffer (50 mm tris [pH 7.5], 20 mm KCl, and 5 mm MgCl2) for 20 min at 37 C restored the activity almost to the level of those obtained by KCl dissociation. Treatment of the 0.3 m NH4Cl-derived 60S subunits with a protein reagent, Procion brilliant blue, prior to extraction of the ribosomal proteins resulted in the loss of L2 and L9, showing that these proteins were made accessible for dye binding. These observations suggest that a considerable degree of unfolding of the 60S subunit occurs at 0.3 m NH4Cl (this apparently leads to a preferential detachment of L2 and L9 at 0.5 m NH4Cl) and that the activity of the purified subunits depends not only on the presence of L2 and L9 but also on the organization of these proteins within the 60S subunits. Images PMID:16659254

  18. Assessment of Helminth Biodiversity in Wild Rats Using 18S rDNA Based Metagenomics

    PubMed Central

    Tsai, Isheng J.; Palomares-Rius, Juan Emilio; Yoshida, Ayako; Ogura, Yoshitoshi; Hayashi, Tetsuya; Maruyama, Haruhiko; Kikuchi, Taisei

    2014-01-01

    Parasite diversity has important implications in several research fields including ecology, evolutionary biology and epidemiology. Wide-ranging analysis has been restricted because of the difficult, highly specialised and time-consuming processes involved in parasite identification. In this study, we assessed parasite diversity in wild rats using 18S rDNA-based metagenomics. 18S rDNA PCR products were sequenced using an Illumina MiSeq sequencer and the analysis of the sequences using the QIIME software successfully classified them into several parasite groups. The comparison of the results with those obtained using standard methods including microscopic observation of helminth parasites in the rat intestines and PCR amplification/sequencing of 18S rDNA from isolated single worms suggests that this new technique is reliable and useful to investigate parasite diversity. PMID:25340824

  19. Magic wavelengths for the 5 s - 18 s transition in rubidium

    NASA Astrophysics Data System (ADS)

    Goldschmidt, Elizabeth; Norris, David; Koller, Silvio; Wyllie, Robert; Brown, Roger; Porto, Trey; Safronova, Ulyana; Safronova, Marianna

    2015-05-01

    Magic wavelengths, for which there is no differential ac Stark shift for the ground and excited state of the atom, allow trapping of excited Rydberg atoms without broadening the optical transition. This is an important tool for implementing quantum gates and other quantum information protocols with Rydberg atoms, and reliable theoretical methods to find such magic wavelengths are thus extremely useful. We use a high-precision all-order method to calculate magic wavelengths for the 5 s - 18 s transition of rubidium near the 18 s - 6 p resonances. We compare the calculation to experiment by measuring the light shift for atoms held in a crossed optical dipole trap with wavelength tuned around the 18 s - 6p3 / 2 resonance at the experimentally convenient wavelength of 1064 nm.

  20. Taxonomic Resolutions Based on 18S rRNA Genes: A Case Study of Subclass Copepoda

    PubMed Central

    Wu, Shu; Xiong, Jie; Yu, Yuhe

    2015-01-01

    Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1–9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy. PMID:26107258

  1. Dynamics of ribosome scanning and recycling revealed by translation complex profiling.

    PubMed

    Archer, Stuart K; Shirokikh, Nikolay E; Beilharz, Traude H; Preiss, Thomas

    2016-07-28

    Regulation of messenger RNA translation is central to eukaryotic gene expression control. Regulatory inputs are specified by them RNA untranslated regions (UTRs) and often target translation initiation. Initiation involves binding of the 40S ribosomal small subunit (SSU) and associated eukaryotic initiation factors (eIFs)near the mRNA 5′ cap; the SSU then scans in the 3′ direction until it detects the start codon and is joined by the 60S ribosomal large subunit (LSU) to form the 80S ribosome. Scanning and other dynamic aspects of the initiation model have remained as conjectures because methods to trap early intermediates were lacking. Here we uncover the dynamics of the complete translation cycle in live yeast cells using translation complex profile sequencing (TCP-seq), a method developed from the ribosome profiling approach. We document scanning by observing SSU footprints along 5′ UTRs. Scanning SSU have 5′-extended footprints (up to~75 nucleotides), indicative of additional interactions with mRNA emerging from the exit channel, promoting forward movement. We visualized changes in initiation complex conformation as SSU footprints coalesced into three major sizes at start codons (19, 29 and 37 nucleotides). These share the same 5′ start site but differ at the 3′ end, reflecting successive changes at the entry channel from an open to a closed state following start codon recognition. We also observe SSU 'lingering' at stop codons after LSU departure. Our results underpin mechanistic models of translation initiation and termination, built on decades of biochemical and structural investigation, with direct genome-wide in vivo evidence. Our approach captures ribosomal complexes at all phases of translation and will aid in studying translation dynamics in diverse cellular contexts. Dysregulation of translation is common in disease and, for example, SSU scanning is a target of anti-cancer drug development. TCP-seq will prove useful in discerning differences

  2. Phylogeny of protostome worms derived from 18S rRNA sequences.

    PubMed

    Winnepenninckx, B; Backeljau, T; De Wachter, R

    1995-07-01

    The phylogenetic relationships of protostome worms were studied by comparing new complete 18S rRNA sequences of Vestimentifera, Pogonophora, Sipuncula, Echiura, Nemertea, and Annelida with existing 18S rRNA sequences of Mollusca, Arthropoda, Chordata, and Platyhelminthes. Phylogenetic trees were inferred via neighbor-joining and maximum parsimony analyses. These suggest that (1) Sipuncula and Echiura are not sister groups; (2) Nemertea are protostomes; (3) Vestimentifera and Pogonophora are protostomes that have a common ancestor with Echiura; and (4) Vestimentifera and Pogonophora are a monophyletic clade. PMID:7659019

  3. Characterizing inactive ribosomes in translational profiling.

    PubMed

    Liu, Botao; Qian, Shu-Bing

    2016-01-01

    The broad impact of translational regulation has emerged explosively in the last few years in part due to the technological advance in genome-wide interrogation of gene expression. During mRNA translation, the majority of actively translating ribosomes exist as polysomes in cells with multiple ribosomes loaded on a single transcript. The importance of the monosome, however, has been less appreciated in translational profiling analysis. Here we report that the monosome fraction isolated by sucrose sedimentation contains a large quantity of inactive ribosomes that do not engage on mRNAs to direct translation. We found that the elongation factor eEF2, but not eEF1A, stably resides in these non-translating ribosomes. This unique feature permits direct evaluation of ribosome status under various stress conditions and in the presence of translation inhibitors. Ribosome profiling reveals that the monosome has a similar but not identical pattern of ribosome footprints compared to the polysome. We show that the association of free ribosomal subunits minimally contributes to ribosome occupancy outside of the coding region. Our results not only offer a quantitative method to monitor ribosome availability, but also uncover additional layers of ribosome status needed to be considered in translational profiling analysis. PMID:27335722

  4. Alcoholic Liver Disease and the Mitochondrial Ribosome

    PubMed Central

    Cahill, Alan; Sykora, Peter

    2009-01-01

    Summary Chronic alcohol consumption has been shown to severely compromise mitochondrial protein synthesis. Hepatic mitochondria isolated from alcoholic animals contain decreased levels of respiratory complexes and display depressed respiration rates when compared to pair-fed controls. One underlying mechanism for this involves ethanol-elicited alterations in the structural and functional integrity of the mitochondrial ribosome. Ethanol feeding results in ribosomal changes that include decreased sedimentation rates, larger hydrodynamic volumes, increased levels of unassociated subunits and changes in the levels of specific ribosomal proteins. The methods presented in this chapter detail how to isolate mitochondrial ribosomes, determine ribosomal activity, separate ribosomes into nucleic acid and protein, and perform two-dimensional nonequilibrium pH gradient electrophoretic polyacrylamide gel electrophoresis to separate and subsequently identify mitochondrial ribosomal proteins. PMID:18369931

  5. [About the ribosomal biogenesis in human].

    PubMed

    Tafforeau, Lionel

    2015-01-01

    Ribosomes are cellular ribonucleoprotein particles required for a fundamental mechanism, translation of the genetic information into proteins. Ribosome biogenesis is a highly complex pathway involving many maturation steps: ribosomal RNA (rRNA) synthesis, rRNA processing, pre-rRNA modifications, its assembly with ribosomal proteins in the nuceolus, export of the subunit precursors to the nucleoplasm and the cytoplasm. Ribosome biogenesis has mainly being investigated in yeast during these last 25 years. However, recent works have shown that, despite many similarities between yeast and human ribosome structure and biogenesis, human pre-rRNA processing is far more complex than in yeast. In order to better understand diseases related to a malfunction in ribosome synthesis, the ribosomopathies, research should be conducted directly in human cells and animal models. PMID:26152166

  6. Intersubunit movement is required for ribosomal translocation

    PubMed Central

    Horan, Lucas H.; Noller, Harry F.

    2007-01-01

    Translocation of tRNA and mRNA during protein synthesis is believed to be coupled to structural changes in the ribosome. The “ratchet model,” based on cryo-EM reconstructions of ribosome complexes, invokes relative movement of the 30S and 50S ribosomal subunits in this process; however, evidence that directly demonstrates a requirement for intersubunit movement during translocation is lacking. To address this problem, we created an intersubunit disulfide cross-link to restrict potential movement. The cross-linked ribosomes were unable to carry out polypeptide synthesis; this inhibition was completely reversed upon reduction of the disulfide bridge. In vitro assays showed that the cross-linked ribosomes were specifically blocked in elongation factor G-dependent translocation. These findings show that intersubunit movement is required for ribosomal translocation, accounting for the universal two-subunit architecture of ribosomes. PMID:17360328

  7. Identification of Methylated Proteins in the Yeast Small Ribosomal Subunit: A Role for SPOUT Methyltransferases in Protein Arginine Methylation†

    PubMed Central

    Young, Brian D.; Weiss, David I.; Zurita-Lopez, Cecilia I.; Webb, Kristofor J.; Clarke, Steven G.; McBride, Anne E.

    2012-01-01

    We have characterized the posttranslational methylation of Rps2, Rps3, and Rps27a, three small ribosomal subunit proteins in the yeast Saccharomyces cerevisiae, using mass spectrometry and amino acid analysis. We found that Rps2 is substoichiometrically modified at arginine-10 by the Rmt1 methyltransferase. We demonstrated that Rps3 is stoichiometrically modified by ω-monomethylation at arginine-146 by mass spectrometric and site-directed mutagenic analyses. Substitution of alanine for arginine at position 146 is associated with slow cell growth, suggesting that the amino acid identity at this site may influence ribosomal function and/or biogenesis. Analysis of the three-dimensional structure of Rps3 in S. cerevisiae shows that arginine-146 makes contacts with the small subunit rRNA. Screening of deletion mutants encoding potential yeast methyltransferases revealed that the loss of the YOR021C gene results in the absence of methylation on Rps3. We demonstrated that recombinant Yor021c catalyzes ω-monomethylarginine formation when incubated with S-adenosylmethionine and hypomethylated ribosomes prepared from a YOR021C deletion strain. Interestingly, Yor021c belongs to the family of SPOUT methyltransferases that, to date, have only been shown to modify RNA substrates. Our findings suggest a wider role for SPOUT methyltransferases in nature. Finally, we have demonstrated the presence of a stoichiometrically methylated cysteine residue at position 39 of Rps27a in a zinc-cysteine cluster. The discovery of these three novel sites of protein modification within the small ribosomal subunit will now allow for an analysis of their functional roles in translation and possibly other cellular processes. PMID:22650761

  8. The Hymenopteran Tree of Life: Evidence from Protein-Coding Genes and Objectively Aligned Ribosomal Data

    PubMed Central

    Klopfstein, Seraina; Vilhelmsen, Lars; Heraty, John M.; Sharkey, Michael; Ronquist, Fredrik

    2013-01-01

    Previous molecular analyses of higher hymenopteran relationships have largely been based on subjectively aligned ribosomal sequences (18S and 28S). Here, we reanalyze the 18S and 28S data (unaligned about 4.4 kb) using an objective and a semi-objective alignment approach, based on MAFFT and BAli-Phy, respectively. Furthermore, we present the first analyses of a substantial protein-coding data set (4.6 kb from one mitochondrial and four nuclear genes). Our results indicate that previous studies may have suffered from inflated support values due to subjective alignment of the ribosomal sequences, but apparently not from significant biases. The protein data provide independent confirmation of several earlier results, including the monophyly of non-xyelid hymenopterans, Pamphilioidea + Unicalcarida, Unicalcarida, Vespina, Apocrita, Proctotrupomorpha and core Proctotrupomorpha. The protein data confirm that Aculeata are nested within a paraphyletic Evaniomorpha, but cast doubt on the monophyly of Evanioidea. Combining the available morphological, ribosomal and protein-coding data, we examine the total-evidence signal as well as congruence and conflict among the three data sources. Despite an emerging consensus on many higher-level hymenopteran relationships, several problems remain unresolved or contentious, including rooting of the hymenopteran tree, relationships of the woodwasps, placement of Stephanoidea and Ceraphronoidea, and the sister group of Aculeata. PMID:23936325

  9. Mitomycin C inhibits ribosomal RNA: a novel cytotoxic mechanism for bioreductive drugs.

    PubMed

    Snodgrass, Ryan G; Collier, Abby C; Coon, Amy E; Pritsos, Chris A

    2010-06-18

    Mitomycin C (MMC) is a commonly used and extensively studied chemotherapeutic agent requiring biological reduction for activity. Damage to nuclear DNA is thought to be its primary mechanism of cell death. Due to a lack of evidence for significant MMC activation in the nucleus and for in vivo studies demonstrating the formation of MMC-DNA adducts, we chose to investigate alternative nucleic acid targets. Real-time reverse transcription-PCR was used to determine changes in mitochondrial gene expression induced by MMC treatment. Although no consistent effects on mitochondrial mRNA expression were observed, complementary results from reverse transcription-PCR experiments and gel-shift and binding assays demonstrated that MMC rapidly decreased the transcript levels of 18S ribosomal RNA in a concentration-dependent manner. Under hypoxic conditions, transcript levels of 18S rRNA decreased by 1.5-fold compared with untreated controls within 30 min. Recovery to base line required several hours, indicating that de novo synthesis of 18S was necessary. Addition of MMC to an in vitro translation reaction significantly decreased protein production in the cell-free system. Functional assays performed using a luciferase reporter construct in vivo determined that protein translation was inhibited, further confirming this mechanism of toxicity. The interaction of MMC with ribosomal RNA and subsequent inhibition of protein translation is consistent with mechanisms proposed for other natural compounds. PMID:20418373

  10. 18S rRNA gene sequencing identifies a novel species of Henneguya parasitizing the gills of the channel catfish (Ictaluridae).

    PubMed

    Rosser, Thomas G; Griffin, Matt J; Quiniou, Sylvie M A; Khoo, Lester H; Pote, Linda M

    2014-12-01

    In the southeastern USA, the channel catfish Ictalurus punctatus is a host to at least eight different species of myxozoan parasites belonging to the genus Henneguya, four of which have been characterized molecularly using sequencing of the small subunit ribosomal RNA (SSU rRNA) gene. However, only two of these have confirmed life cycles that involve the oligochaete Dero digitata as the definitive host. During a health screening of farm-raised channel catfish, several fish presented with deformed primary lamellae. Lamellae harbored large, nodular, white pseudocysts 1.25 mm in diameter, and upon rupturing, these pseudocysts released Henneguya myxospores, with a typical lanceolate-shaped spore body, measuring 17.1 ± 1.0 μm (mean ± SD; range = 15.0-19.3 μm) in length and 4.8 ± 0.4 μm (3.7-5.6 μm) in width. Pyriform-shaped polar capsules were 5.8 ± 0.3 μm in length (5.1-6.4 μm) and 1.7 ± 0.1 μm (1.4-1.9 μm) in width. The two caudal processes were 40.0 ± 5.1 μm in length (29.5-50.0 μm) with a spore length of 57.2 ± 4.7 (46.8-66.8 μm). The contiguous SSU rRNA gene sequence obtained from myxospores of five excised cysts did not match any Henneguya sp. in GenBank. The greatest sequence homology (91% over 1,900 bp) was with Henneguya pellis, associated with blister-like lesions on the skin of blue catfish Ictalurus furcatus. Based on the unique combination of pseudocyst and myxospore morphology, tissue location, host, and SSU rRNA gene sequence data, we report this isolate to be a previously unreported species, Henneguya bulbosus sp. nov. PMID:25270236

  11. Molecular characterization of Stenocarpella maydis based on nuclear ribosomal Internal Transcribed Spacer regions between the 18S and 28S nuclear rRNA gene sequences

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Diplodia ear rot of maize is caused by the fungus Stenocarpella maydis (syn. Diplodia maydis). Although considered a minor pathogen in the later 1900's, with the increased emphasis on conservation tillage, S. maydis has reestablished itself as an important ear and stalk rot pathogen. While S. maydis...

  12. Neutron scattering in the ribosome structure

    NASA Astrophysics Data System (ADS)

    Serdyuk, Igor N.

    1997-02-01

    Thermal neutron scattering has become a powerful instrument for studying the ribosome and its components. The application of neutron scattering allowed to establish some principal features of the ribosome structure: non-homogeneous distribution of the RNA and protein within ribosomal particles, the RNA role as a framework in the arrangement and maintenance of the structure of ribosomal particles, and the globular character of ribosomal proteins. The use of selective deuteration of separate ribosomal proteins in combination with the triangulation method revealed mutual spatial arrangement (the 3D-map) of all the ribosomal proteins within the small particle and in the most part of the large ribosomal particle. An essential impact has been made in the structural studies of ribosomes with the development of novel experimental approaches: triple isotopic substitution and spin contrast variation. These approaches with direct interpretation of spherical harmonics provide new possibilities for constructing models of ribosomal particles, opening principally new perspectives for joint use of X-ray synchrotron diffraction in crystals and small-angle neutron scattering in solution.

  13. Identification and characterization of CHCHD1, AURKAIP1, and CRIF1 as new members of the mammalian mitochondrial ribosome

    PubMed Central

    Koc, Emine C.; Cimen, Huseyin; Kumcuoglu, Beril; Abu, Nadiah; Akpinar, Gurler; Haque, Md. Emdadul; Spremulli, Linda L.; Koc, Hasan

    2013-01-01

    Defects in mitochondrial ribosomal proteins (MRPs) cause various diseases in humans. Because of the essential role of MRPs in synthesizing the essential subunits of oxidative phosphorylation (OXPHOS) complexes, identifying all of the protein components involved in the mitochondrial translational machinery is critical. Initially, we identified 79 MRPs; however, identifying MRPs with no clear homologs in bacteria and yeast mitochondria was challenging, due to limited availability of expressed sequence tags (ESTs) in the databases available at that time. With the improvement in genome sequencing and increased sensitivity of mass spectrometry (MS)-based technologies, we have established four previously known proteins as MRPs and have confirmed the identification of ICT1 (MRP58) as a ribosomal protein. The newly identified MRPs are MRPS37 (Coiled-coil-helix-coiled-coil-helix domain containing protein 1-CHCHD1), MRPS38 (Aurora kinase A interacting protein1, AURKAIP1), MRPS39 (Pentatricopeptide repeat-containing protein 3, PTCD3), in the small subunit and MRPL59 (CR-6 interacting factor 1, CRIF1) in the large subunit. Furthermore, we have demonstrated the essential roles of CHCHD1, AURKAIP1, and CRIF1in mitochondrial protein synthesis by siRNA knock-down studies, which had significant effects on the expression of mitochondrially encoded proteins. PMID:23908630

  14. New Data on Henneguya pellis (Myxozoa: Myxobolidae), A Parasite of Blue Catfish Ictalurus furcatus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The original description of Henneguya pellis, a myxozoan parasitizing blue catfish Ictalurus furcatus, is supplemented with new data on histopathology, spore morphology, and 18S small-subunit (SSU) ribosomal DNA (rDNA) sequence. Plasmodia presented as both internal and external, raised, cyst-like le...

  15. Synthesis of ribosomes in Saccharomyces cerevisiae.

    PubMed Central

    Warner, J R

    1989-01-01

    The assembly of a eucaryotic ribosome requires the synthesis of four ribosomal ribonucleic acid (RNA) molecules and more than 75 ribosomal proteins. It utilizes all three RNA polymerases; it requires the cooperation of the nucleus and the cytoplasm, the processing of RNA, and the specific interaction of RNA and protein molecules. It is carried out efficiently and is exquisitely sensitive to the needs of the cell. Our current understanding of this process in the genetically tractable yeast Saccharomyces cerevisiae is reviewed. The ribosomal RNA genes are arranged in a tandem array of 100 to 200 copies. This tandem array has led to unique ways of carrying out a number of functions. Replication is asymmetric and does not initiate from every autonomously replicating sequence. Recombination is suppressed. Transcription of the major ribosomal RNA appears to involve coupling between adjacent transcription units, which are separated by the 5S RNA transcription unit. Genes for many ribosomal proteins have been cloned and sequenced. Few are linked; most are duplicated; most have an intron. There is extensive homology between yeast ribosomal proteins and those of other species. Most, but not all, of the ribosomal protein genes have one or two sites that are essential for their transcription and that bind a common transcription factor. This factor binds also to many other places in the genome, including the telomeres. There is coordinated transcription of the ribosomal protein genes under a variety of conditions. However, the cell seems to possess no mechanism for regulating the transcription of individual ribosomal protein genes in response either to a deficiency or an excess of a particular ribosomal protein. A deficiency causes slow growth. Any excess ribosomal protein is degraded very rapidly, with a half-life of 1 to 5 min. Unlike most types of cells, yeast cells appear not to regulate the translation of ribosomal proteins. However, in the case of ribosomal protein L32

  16. Control of ribosome formation in rat heart

    SciTech Connect

    Russo, L.A.

    1987-01-01

    Diabetes of 9 days duration produced a 17% diminution in the rate of total protein synthesis in rat hearts perfused as Langendorff preparations supplied with glucose, plasma levels of amino acids, and 400 ..mu..U/ml insulin. This reduction was attributable to a decrease in efficiency of protein synthesis and total RNA content. Total messenger RNA content decreased in diabetic hearts in proportion to the reduction in total RNA. Diabetes also resulted in diminished ribosome content as reflected by the induction in total RNA. Ribosome production was investigated by monitoring incorporation of (/sup 3/H)phenylalanine into the proteins of cytoplasmic ribosomes. Rates of ribosome formation in diabetic hearts were as fast as control rates in the presence of insulin, and were faster than control rates in the absence of the hormone. These results indicated that ribosome content fell in diabetic hearts despite unchanged or faster rates of ribosome formation.

  17. Analyses of the ribosomal DNA region in Nosema bombycis NIS 001.

    PubMed

    Iiyama, Kazuhiro; Chieda, Yuuka; Yasunaga-Aoki, Chisa; Hayasaka, Shoji; Shimizu, Susumu

    2004-01-01

    Ribosomal DNA (rDNA) containing small subunit (SSU) rDNA and both flanking regions in the entomopathogenic microsporidian Nosema bombycis NIS 001 was amplified from genomic DNA with a primer set based on the sequence of an inverse polymerase chain reaction (PCR)-derived fragment. In this fragment, SSU rDNA was divided by a 618-bp insert at nt 599, and 5S rDNA was located downstream of the SSU rDNA, fragmented by 284-bp intergenic spacer. In addition, the 48-bp 3'-end of large subunit (LSU) rDNA was located 118 bp upstream of the fragmented SSU rDNA. In the amplicon, the region upstream of the LSU rDNA was a homologue of the C-terminal CHARLIE8 transposon-like element of human GTF2IRD2. In this organism, another fragmented SSU rDNA, which was divided by a 231-bp insert at nt 50, was also detected. Both the intact (insertless) and fragmented SSU rDNAs clustered with LSU rDNA and 5S rDNA and the intergenic sequences between SSU rDNA and 5S rDNA were divergent in an organism. Reverse transcription (RT)-PCR assay indicated that not only the intact SSU rDNA but also the fragmened SSU rDNA were transcribed in N. bombycis. PMID:15666716

  18. The novel organization and complete sequence of the ribosomal RNA gene of Nosema bombycis.

    PubMed

    Huang, Wei-Fone; Tsai, Shu-Jen; Lo, Chu-Fang; Soichi, Yamane; Wang, Chung-Hsiung

    2004-05-01

    We present here for the first time the complete DNA sequence data (4301bp) of the ribosomal RNA (rRNA) gene of the microsporidian type species, Nosema bombycis. Sequences for the large subunit gene (LSUrRNA: 2497bp, GenBank Accession No. ), the internal transcribed spacer (ITS: 179bp, GenBank Accession No. ), the small subunit gene (SSUrRNA: 1232bp), intergenic spacer (IGS: 279bp), and 5S region (114bp) are also given, and the secondary structure of the large subunit is discussed. The organization of the N. bombycis rRNA gene is LSUrRNA-ITS-SSUrRNA-IGS-5S. This novel arrangement, in which the LSU is 5' of the SSU, is the reverse of the organizational sequence (i.e., SSU-ITS-LSU) found in all previously reported microsporidian rRNAs, including Nosema apis. This unique character in the type species may have taxonomic implications for the members of the genus Nosema. PMID:15050536

  19. Evidence That Antibiotics Bind to Human Mitochondrial Ribosomal RNA Has Implications for Aminoglycoside Toxicity.

    PubMed

    Hong, Seoyeon; Harris, Kimberly A; Fanning, Kathryn D; Sarachan, Kathryn L; Frohlich, Kyla M; Agris, Paul F

    2015-07-31

    Aminoglycosides are a well known antibiotic family used to treat bacterial infections in humans and animals, but which can be toxic. By binding to the decoding site of helix44 of the small subunit RNA of the bacterial ribosome, the aminoglycoside antibiotics inhibit protein synthesis, cause misreading, or obstruct peptidyl-tRNA translocation. Although aminoglycosides bind helix69 of the bacterial large subunit RNA as well, little is known about their interaction with the homologous human helix69. To probe the role this binding event plays in toxicity, changes to thermal stability, base stacking, and conformation upon aminoglycoside binding to the human cytoplasmic helix69 were compared with those of the human mitochondrial and Escherichia coli helix69. Surprisingly, binding of gentamicin and kanamycin A to the chemically synthesized terminal hairpins of the human cytoplasmic, human mitochondrial, and E. coli helix69 revealed similar dissociation constants (1.3-1.7 and 4.0-5.4 μM, respectively). In addition, aminoglycoside binding enhanced conformational stability of the human mitochondrial helix69 by increasing base stacking. Proton one-dimensional and two-dimensional NMR suggested significant and specific conformational changes of human mitochondrial and E. coli helix69 upon aminoglycoside binding, as compared with human cytoplasmic helix69. The conformational changes and similar aminoglycoside binding affinities observed for human mitochondrial helix69 and E. coli helix69, as well as the increase in structural stability shown for the former, suggest that this binding event is important to understanding aminoglycoside toxicity. PMID:26060252

  20. Ribosomal Database Project: data and tools for high throughput rRNA analysis

    PubMed Central

    Cole, James R.; Wang, Qiong; Fish, Jordan A.; Chai, Benli; McGarrell, Donna M.; Sun, Yanni; Brown, C. Titus; Porras-Alfaro, Andrea; Kuske, Cheryl R.; Tiedje, James M.

    2014-01-01

    Ribosomal Database Project (RDP; http://rdp.cme.msu.edu/) provides the research community with aligned and annotated rRNA gene sequence data, along with tools to allow researchers to analyze their own rRNA gene sequences in the RDP framework. RDP data and tools are utilized in fields as diverse as human health, microbial ecology, environmental microbiology, nucleic acid chemistry, taxonomy and phylogenetics. In addition to aligned and annotated collections of bacterial and archaeal small subunit rRNA genes, RDP now includes a collection of fungal large subunit rRNA genes. RDP tools, including Classifier and Aligner, have been updated to work with this new fungal collection. The use of high-throughput sequencing to characterize environmental microbial populations has exploded in the past several years, and as sequence technologies have improved, the sizes of environmental datasets have increased. With release 11, RDP is providing an expanded set of tools to facilitate analysis of high-throughput data, including both single-stranded and paired-end reads. In addition, most tools are now available as open source packages for download and local use by researchers with high-volume needs or who would like to develop custom analysis pipelines. PMID:24288368

  1. Combined heat shock protein 90 and ribosomal RNA sequence phylogeny supports multiple replacements of dinoflagellate plastids.

    PubMed

    Shalchian-Tabrizi, Kamran; Minge, Marianne A; Cavalier-Smith, Tom; Nedreklepp, Joachim M; Klaveness, Dag; Jakobsen, Kjetill S

    2006-01-01

    Dinoflagellates harbour diverse plastids obtained from several algal groups, including haptophytes, diatoms, cryptophytes, and prasinophytes. Their major plastid type with the accessory pigment peridinin is found in the vast majority of photosynthetic species. Some species of dinoflagellates have other aberrantly pigmented plastids. We sequenced the nuclear small subunit (SSU) ribosomal RNA (rRNA) gene of the "green" dinoflagellate Gymnodinium chlorophorum and show that it is sister to Lepidodinium viride, indicating that their common ancestor obtained the prasinophyte (or other green alga) plastid in one event. As the placement of dinoflagellate species that acquired green algal or haptophyte plastids is unclear from small and large subunit (LSU) rRNA trees, we tested the usefulness of the heat shock protein (Hsp) 90 gene for dinoflagellate phylogeny by sequencing it from four species with aberrant plastids (G. chlorophorum, Karlodinium micrum, Karenia brevis, and Karenia mikimotoi) plus Alexandrium tamarense, and constructing phylogenetic trees for Hsp90 and rRNAs, separately and together. Analyses of the Hsp90 and concatenated data suggest an ancestral origin of the peridinin-containing plastid, and two independent replacements of the peridinin plastid soon after the early radiation of the dinoflagellates. Thus, the Hsp90 gene seems to be a promising phylogenetic marker for dinoflagellate phylogeny. PMID:16677346

  2. Human C4orf14 interacts with the mitochondrial nucleoid and is involved in the biogenesis of the small mitochondrial ribosomal subunit

    PubMed Central

    He, J.; Cooper, H. M.; Reyes, A.; Di Re, M.; Kazak, L.; Wood, S. R.; Mao, C. C.; Fearnley, I. M.; Walker, J. E.; Holt, I. J.

    2012-01-01

    The bacterial homologue of C4orf14, YqeH, has been linked to assembly of the small ribosomal subunit. Here, recombinant C4orf14 isolated from human cells, co-purified with the small, 28S subunit of the mitochondrial ribosome and the endogenous protein co-fractionated with the 28S subunit in sucrose gradients. Gene silencing of C4orf14 specifically affected components of the small subunit, leading to decreased protein synthesis in the organelle. The GTPase of C4orf14 was critical to its interaction with the 28S subunit, as was GTP. Therefore, we propose that C4orf14, with bound GTP, binds to components of the 28S subunit facilitating its assembly, and GTP hydrolysis acts as the release mechanism. C4orf14 was also found to be associated with human mitochondrial nucleoids, and C4orf14 gene silencing caused mitochondrial DNA depletion. In vitro C4orf14 is capable of binding to DNA. The association of C4orf14 with mitochondrial translation factors and the mitochondrial nucleoid suggests that the 28S subunit is assembled at the mitochondrial nucleoid, enabling the direct transfer of messenger RNA from the nucleoid to the ribosome in the organelle. PMID:22447445

  3. Seeing is Believing in Ribosome Assembly.

    PubMed

    Warner, Jonathan R

    2016-07-14

    Many proteins have been implicated genetically and biochemically in the assembly of eukaryotic ribosomes. Now, Kornprobst et al. show us how they are put together with a cryoEM structure of the 90S processome that initiates ribosome assembly, revealing the arrangement of U3 RNA and the several UTP complexes that form a chaperone-like structure around and within the developing 40S ribosomal subunit. PMID:27419867

  4. Identification of a new ribose methylation in the 18S rRNA of S. cerevisiae

    PubMed Central

    Yang, Jun; Sharma, Sunny; Kötter, Peter; Entian, Karl-Dieter

    2015-01-01

    Methylation of ribose sugars at the 2′-OH group is one of the major chemical modifications in rRNA, and is catalyzed by snoRNA directed C/D box snoRNPs. Previous biochemical and computational analyses of the C/D box snoRNAs have identified and mapped a large number of 2′-OH ribose methylations in rRNAs. In the present study, we systematically analyzed ribose methylations of 18S rRNA in Saccharomyces cerevisiae, using mung bean nuclease protection assay and RP-HPLC. Unexpectedly, we identified a hitherto unknown ribose methylation at position G562 in the helix 18 of 5′ central domain of yeast 18S rRNA. Furthermore, we identified snR40 as being responsible to guide snoRNP complex to catalyze G562 ribose methylation, which makes it only second snoRNA known so far to target three ribose methylation sites: Gm562, Gm1271 in 18S rRNA, and Um898 in 25S rRNA. Our sequence and mutational analysis of snR40 revealed that snR40 uses the same D′ box and methylation guide sequence for both Gm562 and Gm1271 methylation. With the identification of Gm562 and its corresponding snoRNA, complete set of ribose methylations of 18S rRNA and their corresponding snoRNAs have finally been established opening great prospects to understand the physiological function of these modifications. PMID:25653162

  5. Identification of a new ribose methylation in the 18S rRNA of S. cerevisiae.

    PubMed

    Yang, Jun; Sharma, Sunny; Kötter, Peter; Entian, Karl-Dieter

    2015-02-27

    Methylation of ribose sugars at the 2'-OH group is one of the major chemical modifications in rRNA, and is catalyzed by snoRNA directed C/D box snoRNPs. Previous biochemical and computational analyses of the C/D box snoRNAs have identified and mapped a large number of 2'-OH ribose methylations in rRNAs. In the present study, we systematically analyzed ribose methylations of 18S rRNA in Saccharomyces cerevisiae, using mung bean nuclease protection assay and RP-HPLC. Unexpectedly, we identified a hitherto unknown ribose methylation at position G562 in the helix 18 of 5' central domain of yeast 18S rRNA. Furthermore, we identified snR40 as being responsible to guide snoRNP complex to catalyze G562 ribose methylation, which makes it only second snoRNA known so far to target three ribose methylation sites: Gm562, Gm1271 in 18S rRNA, and Um898 in 25S rRNA. Our sequence and mutational analysis of snR40 revealed that snR40 uses the same D' box and methylation guide sequence for both Gm562 and Gm1271 methylation. With the identification of Gm562 and its corresponding snoRNA, complete set of ribose methylations of 18S rRNA and their corresponding snoRNAs have finally been established opening great prospects to understand the physiological function of these modifications. PMID:25653162

  6. Ribosomal and mitochondrial DNA analysis of Trichuridae nematodes of carnivores and small mammals.

    PubMed

    Guardone, Lisa; Deplazes, Peter; Macchioni, Fabio; Magi, Marta; Mathis, Alexander

    2013-10-18

    Several species of Trichuridae nematodes can infect dogs, cats and wild mammals. The diagnosis of these infections relies on the microscopic identification of eggs which are characterized by a similar "lemon" shape and polar plugs in all Trichuridae. Thus, morphological diagnosis to species level is challenging. The use of biomolecular diagnostic methods is desirable but very little genetic data are known from Trichuridae of carnivores and small mammals. The aim of this work was to genetically characterize several species of Trichuridae that can affect dogs, cats and wild mammals, as a basis to develop molecular diagnostic tests. Specimens (adult worms or eggs) of Eucoleus aerophilus (syn. Capillaria aerophila), Eucoleus boehmi (syn. Capillaria boehmi), Pearsonema plica (syn. Capillaria plica), Aonchotheca putorii (syn. Capillaria putorii), Calodium hepaticum (syn. Capillaria hepatica), Calodium splenaecum (syn. Capillaria splenaeca) and Trichuris vulpis were obtained from carcasses of red foxes, feces of dogs, the liver of a vole and from the spleen of Crocidura sp. Parts of the small subunit rRNA (18S rRNA) gene and of the mitochondrial cytochrome c oxidase subunit I (cox 1 mtDNA) gene were amplified from the above mentioned nematodes, yielding the first 18S rRNA gene sequences of all the capillariid nematodes and the first cox 1 mtDNA sequences of E. boehmi, P. plica, C. hepaticum, A. putorii and T. vulpis. The 18S rRNA gene is highly conserved among the different species and not suitable as a target for specific diagnostic oligonucleotides. However, these sequences contribute to a better understanding of the complex taxonomic relations among Trichuridae. Indeed, a dendrogram based on the 18S rRNA gene locus supports the latest taxonomic revision. Interspecies divergence was much higher at the cox 1 mtDNA gene locus, rendering it suitable for DNA barcoding and particularly valuable in resolving closely related species. Furthermore, the mitochondrial genetic

  7. Ribosome biogenesis in the yeast Saccharomyces cerevisiae.

    PubMed

    Woolford, John L; Baserga, Susan J

    2013-11-01

    Ribosomes are highly conserved ribonucleoprotein nanomachines that translate information in the genome to create the proteome in all cells. In yeast these complex particles contain four RNAs (>5400 nucleotides) and 79 different proteins. During the past 25 years, studies in yeast have led the way to understanding how these molecules are assembled into ribosomes in vivo. Assembly begins with transcription of ribosomal RNA in the nucleolus, where the RNA then undergoes complex pathways of folding, coupled with nucleotide modification, removal of spacer sequences, and binding to ribosomal proteins. More than 200 assembly factors and 76 small nucleolar RNAs transiently associate with assembling ribosomes, to enable their accurate and efficient construction. Following export of preribosomes from the nucleus to the cytoplasm, they undergo final stages of maturation before entering the pool of functioning ribosomes. Elaborate mechanisms exist to monitor the formation of correct structural and functional neighborhoods within ribosomes and to destroy preribosomes that fail to assemble properly. Studies of yeast ribosome biogenesis provide useful models for ribosomopathies, diseases in humans that result from failure to properly assemble ribosomes. PMID:24190922

  8. Tricks an IRES uses to enslave ribosomes

    PubMed Central

    2012-01-01

    In eukaryotes, mRNAs are primarily translated through a cap-dependent mechanism whereby initiation factors recruit the 40S ribosomal subunit to a cap structure at the 5’ end of the mRNA. However, some viral and cellular messages initiate protein synthesis without a cap. They use a structured RNA element termed an internal ribosome entry site (IRES) to recruit the 40S ribosomal subunit. IRESs were discovered over 20 years ago but only recently have studies using a model IRES from dicistroviruses expanded our understanding of how a three dimensional RNA structure can capture and manipulate the ribosome to initiate translation. PMID:22944245

  9. Scattering studies on ribosomes in solution

    NASA Astrophysics Data System (ADS)

    Ramakrishnan, V.

    1986-02-01

    Ribosomes are organelles that play a central role in protein synthesis. They are complexes of protein and nucleic acid, and can be analysed as two-component systems by neutron scattering. Moreover, ribosomes can be biochemically prepared that have specific proteins deuterated. Both these properties have been exploited to study the structure of the ribosome by neutron scattering. This article reviews the studies carried out on the small ribosomal subunit, and describes a recent study that has resolved a conflict between the results of two classes of experiments.

  10. Details of gastropod phylogeny inferred from 18S rRNA sequences.

    PubMed

    Winnepenninckx, B; Steiner, G; Backeljau, T; De Wachter, R

    1998-02-01

    Some generally accepted viewpoints on the phylogenetic relationships within the molluscan class Gastropoda are reassessed by comparing complete 18S rRNA sequences. Phylogenetic analyses were performed using the neighbor-joining and maximum parsimony methods. The previously suggested basal position of Archaeogastropoda, including Neritimorpha and Vetigastropoda, in the gastropod clade is confirmed. The present study also provides new molecular evidence for the monophyly of both Caenogastropoda and Euthyneura (Pulmonata and Opisthobranchia), making Prosobranchia paraphyletic. The relationships within Caenogastropoda and Euthyneura data turn out to be very unstable on the basis of the present 18S rRNA sequences. The present 18S rRNA data question, but are insufficient to decide on, muricacean (Neogastropoda), neotaenioglossan, pulmonate, or stylommatophoran monophyly. The analyses also focus on two systellommatophoran families, namely, Veronicellidae and Onchidiidae. It is suggested that Systellommatophora are not a monophyletic unit but, due to the lack of stability in the euthyneuran clade, their affinity to either Opisthobranchia or Pulmonata could not be determined. PMID:9479694

  11. Molecular systematics of Volvocales (Chlorophyceae, Chlorophyta) based on exhaustive 18S rRNA phylogenetic analyses.

    PubMed

    Nakada, Takashi; Misawa, Kazuharu; Nozaki, Hisayoshi

    2008-07-01

    The taxonomy of Volvocales (Chlorophyceae, Chlorophyta) was traditionally based solely on morphological characteristics. However, because recent molecular phylogeny largely contradicts the traditional subordinal and familial classifications, no classification system has yet been established that describes the subdivision of Volvocales in a manner consistent with the phylogenetic relationships. Towards development of a natural classification system at and above the generic level, identification and sorting of hundreds of sequences based on subjective phylogenetic definitions is a significant step. We constructed an 18S rRNA gene phylogeny based on 449 volvocalean sequences collected using exhaustive BLAST searches of the GenBank database. Many chimeric sequences, which can cause fallacious phylogenetic trees, were detected and excluded during data collection. The results revealed 21 strongly supported primary clades within phylogenetically redefined Volvocales. Phylogenetic classification following PhyloCode was proposed based on the presented 18S rRNA gene phylogeny along with the results of previous combined 18S and 26S rRNA and chloroplast multigene analyses. PMID:18430591

  12. Phylogeny of the Eustigmatophyceae Based upon 18S rDNA, with Emphasis on Nannochloropsis.

    PubMed

    Andersen, R A; Brett, R W; Potter, D; Sexton, J P

    1998-02-01

    Complete 18S rDNA sequences were determined for 25 strains representing five genera of the Eustigmatophyceae, including re-examination of three strains with previously published sequences. Parsimony analysis of these and 44 published sequences for other heterokont chromophytes (unalignable sites removed) revealed that the Eustigmatophyceae were a monophyletic group. Analysis of eustigmatophyte taxa only (complete gene analyzed) supported the current familial classification scheme. Twenty one strains of Nannochloropsis were also examined using light microscopy. Gross morphology of cells was variable and overlapped among the strains; cell size was consistent within strains but sometimes varied considerably among strains of a species. The 18S rDNA of N. gaditana, N. oculata and N. salina was re-sequenced for strains used in previous publications and one or more nucleotide differences were found. Nucleotide sequences for Nannochloropsis species varied by up to 32 nucleotides. Identical sequences were found for six strains of N. salina, five strains of N. gadifana, four strains of N. granulata, and two strains of N. oculata, respectively. Four strains could not be assigned to described species and may represent two new species. The unique 18S rDNA sequences for each sibling species of Nannochloropsis demonstrates the presence of considerable genetic diversity despite the extremely simple morphology in this genus. PMID:23196114

  13. Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation.

    PubMed

    Al-Hadid, Qais; White, Jonelle; Clarke, Steven

    2016-02-12

    A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. PMID:26801560

  14. Triploblastic relationships with emphasis on the acoelomates and the position of Gnathostomulida, Cycliophora, Plathelminthes, and Chaetognatha: a combined approach of 18S rDNA sequences and morphology.

    PubMed

    Giribet, G; Distel, D L; Polz, M; Sterrer, W; Wheeler, W C

    2000-09-01

    Triploblastic relationships were examined in the light of molecular and morphological evidence. Representatives for all triploblastic "phyla" (except Loricifera) were represented by both sources of phylogenetic data. The 18S ribosomal (rDNA) sequence data for 145 terminal taxa and 276 morphological characters coded for 36 supraspecific taxa were combined in a total evidence regime to determine the most consistent picture of triploblastic relationships for these data. Only triploblastic taxa are used to avoid rooting with distant outgroups, which seems to happen because of the extreme distance that separates diploblastic from triploblastic taxa according to the 18S rDNA data. Multiple phylogenetic analyses performed with variable analysis parameters yield largely inconsistent results for certain groups such as Chaetognatha, Acoela, and Nemertodermatida. A normalized incongruence length metric is used to assay the relative merit of the multiple analyses. The combined analysis having the least character incongruence yields the following scheme of relationships of four main clades: (1) Deuterostomia [((Echinodermata + Enteropneusta) (Cephalochordata (Urochordata + Vertebrata)))]; (2) Ecdysozoa [(((Priapulida + Kinorhyncha) (Nematoda + Nematomorpha)) ((Onychophora + Tardigrada) Arthropoda))]; (3) Trochozoa [((Phoronida + Brachiopoda) (Entoprocta (Nemertea (Sipuncula (Mollusca (Pogonophora (Echiura + Annelida)))))))]; and (4) Platyzoa [((Gnathostomulida (Cycliophora + Syndermata)) (Gastrotricha + Plathelminthes))]. Chaetognatha, Nemertodermatida, and Bryozoa cannot be assigned to any one of these four groups. For the first time, a data analysis recognizes a clade of acoelomates, the Platyzoa (sensu Cavalier-Smith, Biol. Rev. 73:203-266, 1998). Other relationships that corroborate some morphological analyses are the existence of a clade that groups Gnathostomulida + Syndermata (= Gnathifera), which is expanded to include the enigmatic phylum Cycliophora, as sister group

  15. Ribosome Mechanics Informs about Mechanism.

    PubMed

    Zimmermann, Michael T; Jia, Kejue; Jernigan, Robert L

    2016-02-27

    The essential aspects of the ribosome's mechanism can be extracted from coarse-grained simulations, including the ratchet motion, the movement together of critical bases at the decoding center, and movements of the peptide tunnel lining that assist in the expulsion of the synthesized peptide. Because of its large size, coarse graining helps to simplify and to aid in the understanding of its mechanism. Results presented here utilize coarse-grained elastic network modeling to extract the dynamics, and both RNAs and proteins are coarse grained. We review our previous results, showing the well-known ratchet motions and the motions in the peptide tunnel and in the mRNA tunnel. The motions of the lining of the peptide tunnel appear to assist in the expulsion of the growing peptide chain, and clamps at the ends of the mRNA tunnel with three proteins ensure that the mRNA is held tightly during decoding and essential for the helicase activity at the entrance. The entry clamp may also assist in base recognition to ensure proper selection of the incoming tRNA. The overall precision of the ribosome machine-like motions is remarkable. PMID:26687034

  16. Description of Eurystomatella sinica n. gen., n. sp., with establishment of a new family Eurystomatellidae n. fam. (Protista, Ciliophora, Scuticociliatia) and analyses of its phylogeny inferred from sequences of the small-subunit rRNA gene.

    PubMed

    Miao, Miao; Wang, Yangang; Song, Weibo; Clamp, John C; Al-Rasheid, Khaled A S

    2010-02-01

    Recently, an undescribed marine ciliate was isolated from China. Investigation of its morphology and infraciliature revealed it as an undescribed species representing a new genus, Eurystomatella n. gen., the type of the new family Eurystomatellidae n. fam. The new family is defined by close-set, apically positioned oral membranelles and a dominant buccal field that is surrounded by an almost completely circular paroral membrane. The new genus is defined by having a small oral membranelle 1 (M1), bipartite M2 and well-developed M3, a body surface faintly sculptured with a silverline system in a quadrangular, reticulate pattern and a cytostome located at the anterior third of a large buccal field. The type species of the new genus, Eurystomatella sinica n. sp., is a morphologically unique form that is defined mainly by the combination of a conspicuously flattened body, several caudal cilia, extremely long cilia associated with the buccal apparatus and a contractile vacuole located subcaudally. According to phylogenetic analyses of small-subunit (SSU) rRNA gene sequences, Eurystomatella clusters with the genus Cyclidium, as a sister group to the family Pleuronematidae. The great divergence in both buccal and somatic ciliature between Eurystomatella and all other known scuticociliates supports the establishment of a new family for Eurystomatella. PMID:19651734

  17. Biochemical characterization of three mycobacterial ribosomal fractions.

    PubMed

    Portelance, V; Beaudet, R

    1983-02-01

    The induction of antituberculous immunity by crude ribosomal fractions isolated from Mycobacterium tuberculosis strain H37Ra, M. bovis strain BCG, and M. smegmatis was studied in CF-1 mice. Levels of antituberculous immunity similar to that induced by live BCG were induced by the BCG and H37Ra ribosomal fractions whereas that isolated from M. smegmatis was found to be inactive. Electrophoresis of the three ribosomal fractions in sodium dodecyl sulfate - polyacylamide gels followed by differential staining showed the two active ribosomal fractions to be similar in their proteins, carbohydrate-containing substances, and lipid profiles. The inactive smegmatis ribosomal fraction differed mainly from the active ones on the basis of its carbohydrate-containing substances profile and by the absence of lipids. The polysaccharides and the ribosomes present in the H37Ra ribosomal fractions were purified by affinity chromatography on concanavalin A - Sepharose 4B. Each purified preparation showed no or only low antituberculous activity when injected separately, but when mixed together a high protection was observed. The formation of complexes between the ribosomes and the polysaccharide fraction was suggested and appears to be necessary for the induction of antituberculous immunity. PMID:6189570

  18. Ribosome flow model with positive feedback

    PubMed Central

    Margaliot, Michael; Tuller, Tamir

    2013-01-01

    Eukaryotic mRNAs usually form a circular structure; thus, ribosomes that terminatae translation at the 3′ end can diffuse with increased probability to the 5′ end of the transcript, initiating another cycle of translation. This phenomenon describes ribosomal flow with positive feedback—an increase in the flow of ribosomes terminating translating the open reading frame increases the ribosomal initiation rate. The aim of this paper is to model and rigorously analyse translation with feedback. We suggest a modified version of the ribosome flow model, called the ribosome flow model with input and output. In this model, the input is the initiation rate and the output is the translation rate. We analyse this model after closing the loop with a positive linear feedback. We show that the closed-loop system admits a unique globally asymptotically stable equilibrium point. From a biophysical point of view, this means that there exists a unique steady state of ribosome distributions along the mRNA, and thus a unique steady-state translation rate. The solution from any initial distribution will converge to this steady state. The steady-state distribution demonstrates a decrease in ribosome density along the coding sequence. For the case of constant elongation rates, we obtain expressions relating the model parameters to the equilibrium point. These results may perhaps be used to re-engineer the biological system in order to obtain a desired translation rate. PMID:23720534

  19. Evolution of the ribosome at atomic resolution

    PubMed Central

    Petrov, Anton S.; Bernier, Chad R.; Hsiao, Chiaolong; Norris, Ashlyn M.; Kovacs, Nicholas A.; Waterbury, Chris C.; Stepanov, Victor G.; Harvey, Stephen C.; Fox, George E.; Wartell, Roger M.; Hud, Nicholas V.; Williams, Loren Dean

    2014-01-01

    The origins and evolution of the ribosome, 3–4 billion years ago, remain imprinted in the biochemistry of extant life and in the structure of the ribosome. Processes of ribosomal RNA (rRNA) expansion can be “observed” by comparing 3D rRNA structures of bacteria (small), yeast (medium), and metazoans (large). rRNA size correlates well with species complexity. Differences in ribosomes across species reveal that rRNA expansion segments have been added to rRNAs without perturbing the preexisting core. Here we show that rRNA growth occurs by a limited number of processes that include inserting a branch helix onto a preexisting trunk helix and elongation of a helix. rRNA expansions can leave distinctive atomic resolution fingerprints, which we call “insertion fingerprints.” Observation of insertion fingerprints in the ribosomal common core allows identification of probable ancestral expansion segments. Conceptually reversing these expansions allows extrapolation backward in time to generate models of primordial ribosomes. The approach presented here provides insight to the structure of pre-last universal common ancestor rRNAs and the subsequent expansions that shaped the peptidyl transferase center and the conserved core. We infer distinct phases of ribosomal evolution through which ribosomal particles evolve, acquiring coding and translocation, and extending and elaborating the exit tunnel. PMID:24982194

  20. Complementary roles of initiation factor 1 and ribosome recycling factor in 70S ribosome splitting

    PubMed Central

    Pavlov, Michael Y; Antoun, Ayman; Lovmar, Martin; Ehrenberg, Måns

    2008-01-01

    We demonstrate that ribosomes containing a messenger RNA (mRNA) with a strong Shine–Dalgarno sequence are rapidly split into subunits by initiation factors 1 (IF1) and 3 (IF3), but slowly split by ribosome recycling factor (RRF) and elongation factor G (EF-G). Post-termination-like (PTL) ribosomes containing mRNA and a P-site-bound deacylated transfer RNA (tRNA) are split very rapidly by RRF and EF-G, but extremely slowly by IF1 and IF3. Vacant ribosomes are split by RRF/EF-G much more slowly than PTL ribosomes and by IF1/IF3 much more slowly than mRNA-containing ribosomes. These observations reveal complementary splitting of different ribosomal complexes by IF1/IF3 and RRF/EF-G, and suggest the existence of two major pathways for ribosome splitting into subunits in the living cell. We show that the identity of the deacylated tRNA in the PTL ribosome strongly affects the rate by which it is split by RRF/EF-G and that IF3 is involved in the mechanism of ribosome splitting by IF1/IF3 but not by RRF/EF-G. With support from our experimental data, we discuss the principally different mechanisms of ribosome splitting by IF1/IF3 and by RRF/EF-G. PMID:18497739

  1. Viral IRES RNA structures and ribosome interactions.

    PubMed

    Kieft, Jeffrey S

    2008-06-01

    In eukaryotes, protein synthesis initiates primarily by a mechanism that requires a modified nucleotide 'cap' on the mRNA and also proteins that recruit and position the ribosome. Many pathogenic viruses use an alternative, cap-independent mechanism that substitutes RNA structure for the cap and many proteins. The RNAs driving this process are called internal ribosome-entry sites (IRESs) and some are able to bind the ribosome directly using a specific 3D RNA structure. Recent structures of IRES RNAs and IRES-ribosome complexes are revealing the structural basis of viral IRES' 'hijacking' of the protein-making machinery. It now seems that there are fundamental differences in the 3D structures used by different IRESs, although there are some common features in how they interact with ribosomes. PMID:18468443

  2. Differential Stoichiometry among Core Ribosomal Proteins

    PubMed Central

    Slavov, Nikolai; Semrau, Stefan; Airoldi, Edoardo; Budnik, Bogdan; van Oudenaarden, Alexander

    2015-01-01

    Summary Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs), some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC) and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function. PMID:26565899

  3. Ribosome defects in disorders of erythropoiesis.

    PubMed

    Narla, Anupama; Hurst, Slater N; Ebert, Benjamin L

    2011-02-01

    Over the past decade, genetic lesions that cause ribosome dysfunction have been identified in both congenital and acquired human disorders. These discoveries have established a new category of disorders, known as ribosomopathies, in which the primary pathophysiology is related to impaired ribosome function. The protoptypical disorders are Diamond-Blackfan anemia, a congenital bone marrow failure syndrome, and the 5q- syndrome, a subtype of myelodysplastic syndrome. In both of these disorders, impaired ribosome function causes a severe macrocytic anemia. In this review, we will discuss the evidence that defects in ribosomal biogenesis cause the hematologic phenotype of Diamond-Blackfan anemia and the 5q- syndrome. We will also explore the potential mechanisms by which a ribosomal defect, which would be expected to have widespread consequences, may lead to specific defects in erythropoiesis. PMID:21279816

  4. Viral IRES RNA structures and ribosome interactions

    PubMed Central

    Kieft, Jeffrey S.

    2009-01-01

    In eukaryotes, protein synthesis initiates primarily by a mechanism that requires a modified nucleotide ‘cap’ on the mRNA and also proteins that recruit and position the ribosome. Many pathogenic viruses use an alternative, cap-independent mechanism that substitutes RNA structure for the cap and many proteins. The RNAs driving this process are called internal ribosome-entry sites (IRESs) and some are able to bind the ribosome directly using a specific 3D RNA structure. Recent structures of IRES RNAs and IRES–ribosome complexes are revealing the structural basis of viral IRES’ ‘hijacking’ of the protein-making machinery. It now seems that there are fundamental differences in the 3D structures used by different IRESs, although there are some common features in how they interact with ribosomes. PMID:18468443

  5. Interaction of Chloramphenicol Tripeptide Analogs with Ribosomes.

    PubMed

    Tereshchenkov, A G; Shishkina, A V; Tashlitsky, V N; Korshunova, G A; Bogdanov, A A; Sumbatyan, N V

    2016-04-01

    Chloramphenicol amine peptide derivatives containing tripeptide fragments of regulatory "stop peptides" - MRL, IRA, IWP - were synthesized. The ability of the compounds to form ribosomal complexes was studied by displacement of the fluorescent erythromycin analog from its complex with E. coli ribosomes. It was found that peptide chloramphenicol analogs are able to bind to bacterial ribosomes. The dissociation constants were 4.3-10 µM, which is 100-fold lower than the corresponding values for chloramphenicol amine-ribosome complex. Interaction of the chloramphenicol peptide analogs with ribosomes was simulated by molecular docking, and the most probable contacts of "stop peptide" motifs with the elements of nascent peptide exit tunnel were identified. PMID:27293096

  6. Differential Stoichiometry among Core Ribosomal Proteins.

    PubMed

    Slavov, Nikolai; Semrau, Stefan; Airoldi, Edoardo; Budnik, Bogdan; van Oudenaarden, Alexander

    2015-11-01

    Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs), some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC) and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function. PMID:26565899

  7. Magic wavelengths for the 5 s -18 s transition in rubidium

    NASA Astrophysics Data System (ADS)

    Goldschmidt, E. A.; Norris, D. G.; Koller, S. B.; Wyllie, R.; Brown, R. C.; Porto, J. V.; Safronova, U. I.; Safronova, M. S.

    2015-03-01

    Magic wavelengths, for which there is no differential ac Stark shift for the ground and excited state of the atom, allow trapping of excited Rydberg atoms without broadening the optical transition. This is an important tool for implementing quantum gates and other quantum information protocols with Rydberg atoms, and reliable theoretical methods to find such magic wavelengths are thus extremely useful. We use a high-precision all-order method to calculate magic wavelengths for the 5 s -18 s transition of rubidium, and compare the calculation to experiment by measuring the light shift for atoms held in an optical dipole trap at a range of wavelengths near a calculated magic value.

  8. Phylogenetic relationships among higher Nemertean (Nemertea) Taxa inferred from 18S rDNA sequences.

    PubMed

    Sundberg, P; Turbeville, J M; Lindh, S

    2001-09-01

    We estimated the phylogenetic relationships of 15 nemertean (phylum Nemertea) species from the four subclasses Hoplo-, Hetero-, Palaeo-, and Bdellonemertea with 18S rDNA sequence data. Three outgroup taxa were used for rooting: Annelida, Platyhelminthes, and Mollusca. Parsimony and maximum-likelihood analyses supported the monophyletic status of the Heteronemertea and a taxon consisting of hoplonemerteans and Bdellonemertea, while indicating that Palaeonemertea is paraphyletic. The monophyletic status of the two nemertean classes Anopla and Enopla is not supported by the data. The unambiguous clades are well supported, as assessed by a randomization test (bootstrapping) and branch support values. PMID:11527461

  9. Mechanisms for ribotoxin-induced ribosomal RNA cleavage

    SciTech Connect

    He, Kaiyu; Zhou, Hui-Ren; Pestka, James J.

    2012-11-15

    The Type B trichothecene deoxynivalenol (DON), a ribotoxic mycotoxin known to contaminate cereal-based foods, induces ribosomal RNA (rRNA) cleavage in the macrophage via p38-directed activation of caspases. Here we employed the RAW 264.7 murine macrophage model to test the hypothesis that this rRNA cleavage pathway is similarly induced by other ribotoxins. Capillary electrophoresis confirmed that the antibiotic anisomycin (≥ 25 ng/ml), the macrocylic trichothecene satratoxin G (SG) (≥ 10 ng/ml) and ribosome-inactivating protein ricin (≥ 300 ng/ml) induced 18s and 28s rRNA fragmentation patterns identical to that observed for DON. Also, as found for DON, inhibition of p38, double-stranded RNA-activated kinase (PKR) and hematopoietic cell kinase (Hck) suppressed MAPK anisomycin-induced rRNA cleavage, while, in contrast, their inhibition did not affect SG- and ricin-induced rRNA fragmentation. The p53 inhibitor pifithrin-μ and pan caspase inhibitor Z-VAD-FMK suppressed rRNA cleavage induced by anisomycin, SG and ricin, indicating that these ribotoxins shared with DON a conserved downstream pathway. Activation of caspases 8, 9 and 3 concurrently with apoptosis further suggested that rRNA cleavage occurred in parallel with both extrinsic and intrinsic pathways of programmed cell death. When specific inhibitors of cathepsins L and B (lysosomal cysteine cathepsins active at cytosolic neutral pH) were tested, only the former impaired anisomycin-, SG-, ricin- and DON-induced rRNA cleavage. Taken together, the data suggest that (1) all four ribotoxins induced p53-dependent rRNA cleavage via activation of cathepsin L and caspase 3, and (2) activation of p53 by DON and anisomycin involved p38 whereas SG and ricin activated p53 by an alternative mechanism. Highlights: ► Deoxynivalenol (DON) anisomycin, satratoxin G (SG) and ricin are ribotoxins. ► Ribotoxins induce 18s and 28s rRNA cleavage in the RAW 264.7 macrophage model. ► Ribotoxins induce rRNA cleavage via

  10. Intra-Genomic Variation in the Ribosomal Repeats of Nematodes

    PubMed Central

    Bik, Holly M.; Fournier, David; Sung, Way; Bergeron, R. Daniel; Thomas, W. Kelley

    2013-01-01

    Ribosomal loci represent a major tool for investigating environmental diversity and community structure via high-throughput marker gene studies of eukaryotes (e.g. 18S rRNA). Since the estimation of species’ abundance is a major goal of environmental studies (by counting numbers of sequences), understanding the patterns of rRNA copy number across species will be critical for informing such high-throughput approaches. Such knowledge is critical, given that ribosomal RNA genes exist within multi-copy repeated arrays in a genome. Here we measured the repeat copy number for six nematode species by mapping the sequences from whole genome shotgun libraries against reference sequences for their rRNA repeat. This revealed a 6-fold variation in repeat copy number amongst taxa investigated, with levels of intragenomic variation ranging from 56 to 323 copies of the rRNA array. By applying the same approach to four C. elegans mutation accumulation lines propagated by repeated bottlenecking for an average of ~400 generations, we find on average a 2-fold increase in repeat copy number (rate of increase in rRNA estimated at 0.0285-0.3414 copies per generation), suggesting that rRNA repeat copy number is subject to selection. Within each Caenorhabditis species, the majority of intragenomic variation found across the rRNA repeat was observed within gene regions (18S, 28S, 5.8S), suggesting that such intragenomic variation is not a product of selection for rRNA coding function. We find that the dramatic variation in repeat copy number among these six nematode genomes would limit the use of rRNA in estimates of organismal abundance. In addition, the unique pattern of variation within a single genome was uncorrelated with patterns of divergence between species, reflecting a strong signature of natural selection for rRNA function. A better understanding of the factors that control or affect copy number in these arrays, as well as their rates and patterns of evolution, will be

  11. Mechanisms for ribotoxin-induced ribosomal RNA cleavage.

    PubMed

    He, Kaiyu; Zhou, Hui-Ren; Pestka, James J

    2012-11-15

    The Type B trichothecene deoxynivalenol (DON), a ribotoxic mycotoxin known to contaminate cereal-based foods, induces ribosomal RNA (rRNA) cleavage in the macrophage via p38-directed activation of caspases. Here we employed the RAW 264.7 murine macrophage model to test the hypothesis that this rRNA cleavage pathway is similarly induced by other ribotoxins. Capillary electrophoresis confirmed that the antibiotic anisomycin (≥25ng/ml), the macrocylic trichothecene satratoxin G (SG) (≥10ng/ml) and ribosome-inactivating protein ricin (≥300ng/ml) induced 18s and 28s rRNA fragmentation patterns identical to that observed for DON. Also, as found for DON, inhibition of p38, double-stranded RNA-activated kinase (PKR) and hematopoietic cell kinase (Hck) suppressed MAPK anisomycin-induced rRNA cleavage, while, in contrast, their inhibition did not affect SG- and ricin-induced rRNA fragmentation. The p53 inhibitor pifithrin-μ and pan caspase inhibitor Z-VAD-FMK suppressed rRNA cleavage induced by anisomycin, SG and ricin, indicating that these ribotoxins shared with DON a conserved downstream pathway. Activation of caspases 8, 9 and 3 concurrently with apoptosis further suggested that rRNA cleavage occurred in parallel with both extrinsic and intrinsic pathways of programmed cell death. When specific inhibitors of cathepsins L and B (lysosomal cysteine cathepsins active at cytosolic neutral pH) were tested, only the former impaired anisomycin-, SG-, ricin- and DON-induced rRNA cleavage. Taken together, the data suggest that (1) all four ribotoxins induced p53-dependent rRNA cleavage via activation of cathepsin L and caspase 3, and (2) activation of p53 by DON and anisomycin involved p38 whereas SG and ricin activated p53 by an alternative mechanism. PMID:23022514

  12. Mechanisms for Ribotoxin-induced Ribosomal RNA Cleavage

    PubMed Central

    He, Kaiyu; Zhou, Hui-Ren; Pestka, James J.

    2012-01-01

    The Type B trichothecene deoxynivalenol (DON), a ribotoxic mycotoxin known to contaminate cereal-based foods, induces ribosomal RNA (rRNA) cleavage in the macrophage via p38-directed activation of caspases. Here we employed the RAW 264.7 murine macrophage model to test the hypothesis that this rRNA cleavage pathway is similarly induced by other ribotoxins. Capillary electrophoresis confirmed that the antibiotic anisomycin (≥25 ng/ml), the macrocylic trichothecene satratoxin G (SG) (≥10 ng/ml) and ribosome-inactivating protein ricin (≥300 ng/ml) induced 18s and 28s rRNA fragmentation patterns identical to that observed for DON. Also, as found for DON, inhibition of p38, double-stranded RNA-activated kinase (PKR) and hematopoietic cell kinase (Hck) suppressed MAPK anisomycin-induced rRNA cleavage, while, in contrast, their inhibition did not affect SG- and ricin-induced rRNA fragmentation. The p53 inhibitor pifithrin-μ and pan caspase inhibitor Z-VAD-FMK suppressed rRNA cleavage induced by anisomycin, SG and ricin, indicating that these ribotoxins shared with DON a conserved downstream pathway. Activation of caspase 8, 9 and 3 concurrently with apoptosis further suggested rRNA cleavage occurred in parallel with both extrinsic and intrinsic pathways of programmed cell death. When specific inhibitors cathepsin L and B (lysosomal cysteine cathepsins active at cytosolic neutral pH) were tested, only the former impaired anisomycin-, SG-, ricin- and DON-induced rRNA cleavage. Taken together, the data suggest that (1) all four ribotoxins induced p53-dependent rRNA cleavage via activation of cathepsin L and caspase 3, and (2) activation of p53 by DON and anisomycin involved p38 whereas SG and ricin activated p53 by an alternative mechanism. PMID:23022514

  13. The Functional Role of eL19 and eB12 Intersubunit Bridge in the Eukaryotic Ribosome.

    PubMed

    Kisly, Ivan; Gulay, Suna P; Mäeorg, Uno; Dinman, Jonathan D; Remme, Jaanus; Tamm, Tiina

    2016-05-22

    During translation, the two eukaryotic ribosomal subunits remain associated through 17 intersubunit bridges, five of which are eukaryote specific. These are mainly localized to the peripheral regions and are believed to stabilize the structure of the ribosome. The functional importance of these bridges remains largely unknown. Here, the essentiality of the eukaryote-specific bridge eB12 has been investigated. The main component of this bridge is ribosomal protein eL19 that is composed of an N-terminal globular domain, a middle region, and a long C-terminal α-helix. The analysis of deletion mutants demonstrated that the globular domain and middle region of eL19 are essential for cell viability, most likely functioning in ribosome assembly. The eB12 bridge, formed by contacts between the C-terminal α-helix of eL19 and 18S rRNA in concert with additional stabilizing interactions involving either eS7 or uS17, is dispensable for viability. Nevertheless, eL19 mutants impaired in eB12 bridge formation displayed slow growth phenotypes, altered sensitivity/resistance to translational inhibitors, and enhanced hyperosmotic stress tolerance. Biochemical analyses determined that the eB12 bridge contributes to the stability of ribosome subunit interactions in vitro. 60S subunits containing eL19 variants defective in eB12 bridge formation failed to form 80S ribosomes regardless of Mg(2+) concentration. The reassociation of 40S and mutant 60S subunits was markedly improved in the presence of deacetylated tRNA, emphasizing the importance of tRNAs during the subunit association. We propose that the eB12 bridge plays an important role in subunit joining and in optimizing ribosome functionality. PMID:27038511

  14. Decreased activity of Blastocladiella emersonii zoospore ribosomes: correlation with developmental changes in ribosome-associated proteins.

    PubMed

    Jaworski, A J; Wilson, J B

    1989-10-01

    Ribosomal proteins isolated from dormant zoospores were compared to the ribosomal proteins found in the active growth phase by two-dimensional polyacrylamide gel electrophoresis. Zoospore ribosomes were found to contain a set of five proteins, designated Z1 to Z5, which were not present in growth phase ribosomes. The Z1-Z5 proteins were not removed by high-salt washes using either 1 M KCl or 1 M NH4 Cl. The Z1 protein is found associated with zoospore 60 S subunits while Z2-Z5 are bound to 40 S subunits. Zoospore monoribosomes and polyribosomes contain comparable levels of each of the five proteins. Approximately 60 min. after sporulation is induced, the Z1-Z5 proteins begin to accumulate on the ribosomes with the highest levels of these proteins found associated with ribosomes at the zoospore stage. During germination, the proteins gradually disappear and are not detectable on the ribosomes after 4 hr of germination. The presence of the Z1-Z5 proteins correlates with a decrease in in vitro protein synthetic activity of the fungal ribosomes. The data are consistent with the hypothesis that the proteins regulate translation by completely blocking protein synthesis on a subset of ribosomes while the remainder of the ribosomes function at normal rates. PMID:2776972

  15. Ribosomopathies: human disorders of ribosome dysfunction.

    PubMed

    Narla, Anupama; Ebert, Benjamin L

    2010-04-22

    Ribosomopathies compose a collection of disorders in which genetic abnormalities cause impaired ribosome biogenesis and function, resulting in specific clinical phenotypes. Congenital mutations in RPS19 and other genes encoding ribosomal proteins cause Diamond-Blackfan anemia, a disorder characterized by hypoplastic, macrocytic anemia. Mutations in other genes required for normal ribosome biogenesis have been implicated in other rare congenital syndromes, Schwachman-Diamond syndrome, dyskeratosis congenita, cartilage hair hypoplasia, and Treacher Collins syndrome. In addition, the 5q- syndrome, a subtype of myelodysplastic syndrome, is caused by a somatically acquired deletion of chromosome 5q, which leads to haploinsufficiency of the ribosomal protein RPS14 and an erythroid phenotype highly similar to Diamond-Blackfan anemia. Acquired abnormalities in ribosome function have been implicated more broadly in human malignancies. The p53 pathway provides a surveillance mechanism for protein translation as well as genome integrity and is activated by defects in ribosome biogenesis; this pathway appears to be a critical mediator of many of the clinical features of ribosomopathies. Elucidation of the mechanisms whereby selective abnormalities in ribosome biogenesis cause specific clinical syndromes will hopefully lead to novel therapeutic strategies for these diseases. PMID:20194897

  16. Ribonucleic acid and ribosomes of Bacillus stearothermophilus.

    PubMed

    Saunders, G F; Campbell, L L

    1966-01-01

    Saunders, Grady F. (University of Illinois, Urbana), and L. Leon Campbell. Ribonucleic acid and ribosomes of Bacillus stearothermophilus. J. Bacteriol. 91:332-339. 1966.-The ability of some thermophilic bacteria to grow at temperatures as high as 76 C emphasizes the remarkable thermal stability of their crucial macromolecules. An investigation of the ribonucleic acid (RNA) and ribosomes of Bacillus stearothermophilus was conducted. Washed log-phase cells were disrupted either by sonic treatment or by alumina grinding in 10(-2)m MgCl(2)-10(-2)m tris-(hydroxymethyl)aminomethane buffer, pH 7.4 (TM buffer). Ultracentrifugal analysis revealed peaks at 72.5S, 101S, and 135S, with the 101S peak being the most prominent. By lowering the Mg(++) concentration to 10(-3)m, the ribosome preparation was dissociated to give 40S, 31S, and 54S peaks. These in turn were reassociated in the presence of 10(-2)m Mg(++) to give the larger 73S and 135S particles. When heated in TM buffer, Escherichia coli ribosomes began a gradual dissociation at 58 C, and at 70 C underwent a large hyperchromic shift with a T(m) at 72.8 C. In contrast, B. stearothermophilus ribosomes did not show a hyperchromic shift below 70 C; they had a T(m) of 77.9 C. The thermal denaturation curves of the 4S, 16S, and 23S RNA from both organisms were virtually identical. The gross amino acid composition of B. stearothermophilus ribosomes showed no marked differences from that reported for E. coli ribosomes. These data suggest that the unusual thermal stability of B. stearothermophilus ribosomes may reflect either an unusual packing arrangement of the protein to the RNA or differences in the primary structure of the ribosomal proteins. PMID:5903099

  17. A new system for naming ribosomal proteins

    PubMed Central

    Ban, Nenad; Beckmann, Roland; Cate, Jamie HD; Dinman, Jonathan D; Dragon, François; Ellis, Steven R; Lafontaine, Denis LJ; Lindahl, Lasse; Liljas, Anders; Lipton, Jeffrey M; McAlear, Michael A; Moore, Peter B; Noller, Harry F; Ortega, Joaquin; Panse, Vikram Govind; Ramakrishnan, V; Spahn, Christian MT; Steitz, Thomas A; Tchorzewski, Marek; Tollervey, David; Warren, Alan J; Williamson, James R; Wilson, Daniel; Yonath, Ada; Yusupov, Marat

    2015-01-01

    A system for naming ribosomal proteins is described that the authors intend to use in the future. They urge others to adopt it. The objective is to eliminate the confusion caused by the assignment of identical names to ribosomal proteins from different species that are unrelated in structure and function. In the system proposed here, homologous ribosomal proteins are assigned the same name, regardless of species. It is designed so that new names are similar enough to old names to be easily recognized, but are written in a format that unambiguously identifies them as ‘new system’ names. PMID:24524803

  18. The economics of ribosome biosynthesis in yeast.

    PubMed

    Warner, J R

    1999-11-01

    In a rapidly growing yeast cell, 60% of total transcription is devoted to ribosomal RNA, and 50% of RNA polymerase II transcription and 90% of mRNA splicing are devoted to ribosomal proteins (RPs). Coordinate regulation of the approximately 150 rRNA genes and 137 RP genes that make such prodigious use of resources is essential for the economy of the cell. This is entrusted to a number of signal transduction pathways that can abruptly induce or silence the ribosomal genes, leading to major implications for the expression of other genes as well. PMID:10542411

  19. Computational studies of molecular machines: the ribosome.

    PubMed

    Sanbonmatsu, Karissa Y

    2012-04-01

    The past decade has produced an avalanche of experimental data on the structure and dynamics of the ribosome. Groundbreaking studies in structural biology and kinetics have placed important constraints on ribosome structural dynamics. However, a gulf remains between static structures and time dependent data. In particular, X-ray crystallography and cryo-EM studies produce static models of the ribosome in various states, but lack dynamic information. Single molecule studies produce information on the rates of transitions between these states but do not have high-resolution spatial information. Computational studies have aided in bridging this gap by providing atomic resolution simulations of structural fluctuations and transitions between configurations. PMID:22336622

  20. Computational studies of molecular machines: the ribosome

    PubMed Central

    Sanbonmatsu, Karissa Y.

    2013-01-01

    The past decade has produced an avalanche of experimental data on the structure and dynamics of the ribosome. Groundbreaking studies in structural biology and kinetics have placed important constraints on ribosome structural dynamics. However, a gulf remains between static structures and time dependent data. In particular, x-ray crystallography and cryo-EM studies produce static models of the ribosome in various states, but lack dynamic information. Single molecule studies produce information on the rates of transitions between these states but do not have high-resolution spatial information. Computational studies have aided in bridging this gap by providing atomic resolution simulations of structural fluctuations and transitions between configurations. PMID:22336622

  1. Morphology and small-subunit rRNA gene sequences of two novel marine ciliates, Metanophrys orientalis spec. nov. and Uronemella sinensis spec. nov. (Protista, Ciliophora, Scuticociliatia), with an improved diagnosis of the genus Uronemella.

    PubMed

    Pan, Xuming; Zhu, Mingzhuang; Ma, Honggang; Al-Rasheid, Khaled A S; Hu, Xiaozhong

    2013-09-01

    The morphology and infraciliature of two novel marine scuticociliates, Metanophrys orientalis spec. nov. and Uronemella sinensis spec. nov., collected from sandy beaches at Qingdao, China, were investigated using live observation and protargol-staining methods. Metanophrys orientalis spec. nov. is distinguished by the following characteristics: marine habitat and a slender to elongate oval body with pointed anterior end and rounded caudal end, in vivo about 25-50 µm long; buccal field about a quarter to a third of body length; nine or ten somatic kineties with dikinetids approximately in anterior half of body, monokinetids in posterior half; membranelles 1 and 2 almost equal in length and composed of two and three longitudinal rows of kinetids respectively; paroral membrane with zigzag structure extending anteriorly to middle portion of membranelle 2; contractile vacuole pore located at posterior end of somatic kinety 1. The genus Uronemella is redefined as follows: marine form with an elongate-elliptical or inverted pear-shaped body; apical plate conspicuous; buccal field about two-thirds of body length, cytostome subequatorially located; oral apparatus Uronema-like; somatic kineties comprising a mixture of dikinetids and monokinetids. Uronemella sinensis spec. nov. is recognized by having an elongate-elliptical body with truncated apical frontal plate, size in vivo about 25-35 × 15-20 µm, nine or ten somatic kineties, membranelle 1 consisting of two or three basal bodies, contractile vacuole pore at posterior end of somatic kinety 1. This study also compared the small-subunit rRNA gene sequences of these two species with other closely related species to show the sequence divergence, which ranged from 3.53 to 9.60%. Phylogenetic analyses support the contention that the genus Uronemella is monophyletic, while Metanophrys is non-monophyletic. PMID:23859947

  2. Caryotricha minuta (Xu et al., 2008) nov. comb., a unique marine ciliate (Protista, Ciliophora, Spirotrichea), with phylogenetic analysis of the ambiguous genus Caryotricha inferred from the small-subunit rRNA gene sequence.

    PubMed

    Miao, Miao; Shao, Chen; Jiang, Jiamei; Li, Liqiong; Stoeck, Thorsten; Song, Weibo

    2009-02-01

    A population of Kiitricha minuta Xu et al., 2008, a small kiitrichid ciliate, was isolated from a brackish water sample in Jiaozhou Bay, Qingdao, northern China. After comparison of its morphology and infraciliature, it is believed that this morphotype should be assigned to the genus Caryotricha; hence, a new combination is suggested, Caryotricha minuta (Xu et al., 2008) nov. comb. The small-subunit (SSU) rRNA gene sequence was determined in order to elucidate the phylogenetic position of this poorly known, ambiguous genus. The organism can be clearly separated from its congener, Caryotricha convexa Kahl, 1932, by the extremely shortened ventral cirral rows in the posterior ends. Based on the data available, an improved diagnosis is given for the genus: marine Kiitrichidae with prominent buccal field; two highly developed undulating membranes; non-grouped, uniform cirral rows on both ventral and dorsal sides; enlarged transverse cirri present, which are the only differentiated cirri; marginal cirri not present; one short migratory row located posterior to buccal field; structure of dorsal kineties generally in Kiitricha pattern. The sequence of the SSU rRNA gene of C. minuta differs by 13 % from that of Kiitricha marina. Molecular phylogenetic analyses (Bayesian inference, least squares, neighbour joining, maximum parsimony) indicate that Caryotricha, together with Kiitricha, diverges at a deep level from all other spirotrichs. Its branching position is between Phacodiniidia and Licnophoridia. The results strongly support the distinct separation of the Kiitricha-Caryotricha clade, which always branches basal to the Stichotrichia-Hypotrichia-Oligotrichia-Choreotrichia assemblage. These results also confirm the previous hypothesis that the Kiitricha-Caryotricha group, long assumed to be a close relation to the euplotids, represents a taxon at subclass level within the spirotrichs. PMID:19196791

  3. Reconsideration of systematic relationships within the order Euplotida (Protista, Ciliophora) using new sequences of the gene coding for small-subunit rRNA and testing the use of combined data sets to construct phylogenies of the Diophrys-complex.

    PubMed

    Yi, Zhenzhen; Song, Weibo; Clamp, John C; Chen, Zigui; Gao, Shan; Zhang, Qianqian

    2009-03-01

    Comprehensive molecular analyses of phylogenetic relationships within euplotid ciliates are relatively rare, and the relationships among some families remain questionable. We performed phylogenetic analyses of the order Euplotida based on new sequences of the gene coding for small-subunit RNA (SSrRNA) from a variety of taxa across the entire order as well as sequences from some of these taxa of other genes (ITS1-5.8S-ITS2 region and histone H4) that have not been included in previous analyses. Phylogenetic trees based on SSrRNA gene sequences constructed with four different methods had a consistent branching pattern that included the following features: (1) the "typical" euplotids comprised a paraphyletic assemblage composed of two divergent clades (family Uronychiidae and families Euplotidae-Certesiidae-Aspidiscidae-Gastrocirrhidae), (2) in the family Uronychiidae, the genera Uronychia and Paradiophrys formed a clearly outlined, well-supported clade that seemed to be rather divergent from Diophrys and Diophryopsis, suggesting that the Diophrys-complex may have had a longer and more separate evolutionary history than previously supposed, (3) inclusion of 12 new SSrRNA sequences in analyses of Euplotidae revealed two new clades of species within the family and cast additional doubt on the present classification of genera within the family, and (4) the intraspecific divergence among five species of Aspidisca was far greater than those of closely related genera. The ITS1-5.8S-ITS2 coding regions and partial histone H4 genes of six morphospecies in the Diophrys-complex were sequenced along with their SSrRNA genes and used to compare phylogenies constructed from single data sets to those constructed from combined sets. Results indicated that combined analyses could be used to construct more reliable, less ambiguous phylogenies of complex groups like the order Euplotida, because they provide a greater amount and diversity of information. PMID:19121402

  4. Introns regulate the production of ribosomal proteins by modulating splicing of duplicated ribosomal protein genes.

    PubMed

    Petibon, Cyrielle; Parenteau, Julie; Catala, Mathieu; Elela, Sherif Abou

    2016-05-01

    Most budding yeast introns exist in the many duplicated ribosomal protein genes (RPGs) and it has been posited that they remain there to modulate the expression of RPGs and cell growth in response to stress. However, the mechanism by which introns regulate the expression of RPGs and their impact on the synthesis of ribosomal proteins remain unclear. In this study, we show that introns determine the ratio of ribosomal protein isoforms through asymmetric paralog-specific regulation of splicing. Exchanging the introns and 3' untranslated regions of the duplicated RPS9 genes altered the splicing efficiency and changed the ratio of the ribosomal protein isoforms. Mutational analysis of the RPS9 genes indicated that splicing is regulated by variations in the intron structure and the 3' untranslated region. Together these data suggest that preferential splicing of duplicated RPGs provides a means for adjusting the ratio of different ribosomal protein isoforms, while maintaining the overall expression level of each ribosomal protein. PMID:26945043

  5. The tails of ubiquitin precursors are ribosomal proteins whose fusion to ubiquitin facilitates ribosome biogenesis

    NASA Astrophysics Data System (ADS)

    Finley, Daniel; Bartel, Bonnie; Varshavsky, Alexander

    1989-03-01

    Three of the four yeast ubiquitin genes encode hybrid proteins which are cleaved to yield ubiquitin and previously unidentified ribosomal proteins. The transient association between ubiquitin and these proteins promotes their incorporation into nascent ribosomes and is required for efficient ribosome biogenesis. These results suggest a novel 'chaperone' function for ubiquitin, in which its covalent association with other proteins promotes the formation of specific cellular structures.

  6. 18S rDNA dataset profiling microeukaryotic populations within Chicago area nearshore waters

    PubMed Central

    Searle, Daniel; Sible, Emily; Cooper, Alexandria; Putonti, Catherine

    2016-01-01

    Despite their critical role in the aquatic food web and nutrient cycling, microeukaryotes within freshwater environments are under-studied. Herein we present the first high-throughput molecular survey of microeukaryotes within Lake Michigan. Every two weeks from May 13 to August 5, 2014, we collected surface water samples from the nearshore waters of four Chicago area beaches: Gillson Park, Montrose Beach, 57th Street Beach, and Calumet Beach. Four biological replicates were collected for each sampling date and location, resulting in 112 samples. Eighty-nine of these samples were surveyed through targeted sequencing of the V7 and V8 regions of the 18S rDNA gene. Both technical and biological replicates were sequenced and are included in this dataset. Raw sequence data is available via NCBI’s SRA database (BioProject PRJNA294919). PMID:26904716

  7. Novelty in phylogeny of gastrotricha: evidence from 18S rRNA gene.

    PubMed

    Wirz, A; Pucciarelli, S; Miceli, C; Tongiorgi, P; Balsamo, M

    1999-11-01

    Gastrotricha form a phylum which is crucial for defining the origin of pseudocoelomates, in that they share a number of characters with Rotifera and Nematoda but also with acoelomates, and even the evolutionary relationships within the phylum are anything but defined. For this reason the first extensive molecular data on Gastrotricha from the 18S rRNA sequences of both orders have been obtained and analyzed. Sequence analyses show that the phylum Gastrotricha is strictly monophyletic along an evolutionary line quite distinct from that of both Rotifera and Nematoda. A new view of the evolutionary history of the phylum Gastrotricha is put forward, in which Chaetonotida, and not Macrodasyida, are the most primitive forms of the group, contrary to the commonly held view. A polyphyletic origin of aschelminthes is supported, and the misleading term pseudocoelomates should be discarded. PMID:10603259

  8. 18S rDNA polymerase chain reaction and sequencing in onychomycosis diagnostics.

    PubMed

    Walberg, Mette; Mørk, Cato; Sandven, Per; Jorde, Anne Tomine; Bjørås, Magnar; Gaustad, Peter

    2006-01-01

    Diagnostic approaches to onychomycosis have traditionally been based on a combination of culture and microscopy. In the present study clinical specimens from 346 patients with suspected onychomycosis were analysed by 18S polymerase chain reaction (detection) followed by sequencing and subsequent database search (identification) in parallel with routine culture on agar (detection and identification). In 49 samples Trichophyton rubrum was identified by culture and sequencing. In 67 additional culture negative samples, a positive dermatophyte sequence was obtained (T. rubrum in 54, T. mentagrophytes in 5, and T. species in 8 samples). Fifteen samples cultured positive while no sequence was obtained. Two hundred and seven samples were negative by culture as well as by sequencing. Nails from 10 healthy controls were negative by culture and sequencing. In conclusion, the number of specimens that were positive by polymerase chain reaction was more than double the number that were positive by culture alone. PMID:16710579

  9. 18S rDNA dataset profiling microeukaryotic populations within Chicago area nearshore waters.

    PubMed

    Searle, Daniel; Sible, Emily; Cooper, Alexandria; Putonti, Catherine

    2016-03-01

    Despite their critical role in the aquatic food web and nutrient cycling, microeukaryotes within freshwater environments are under-studied. Herein we present the first high-throughput molecular survey of microeukaryotes within Lake Michigan. Every two weeks from May 13 to August 5, 2014, we collected surface water samples from the nearshore waters of four Chicago area beaches: Gillson Park, Montrose Beach, 57th Street Beach, and Calumet Beach. Four biological replicates were collected for each sampling date and location, resulting in 112 samples. Eighty-nine of these samples were surveyed through targeted sequencing of the V7 and V8 regions of the 18S rDNA gene. Both technical and biological replicates were sequenced and are included in this dataset. Raw sequence data is available via NCBI's SRA database (BioProject PRJNA294919). PMID:26904716

  10. Molecular phylogenetic relationships between prostanoid-containing Okinawan soft coral ( Clavularia viridis) and nonprostanoid-containing Clavularia species based on ribosomal ITS sequence.

    PubMed

    Fujiwara, Shoko; Yasui, Kazuyuki; Watanabe, Kinzo; Wakabayashi, Takako; Tsuzuki, Mikio; Iguchi, Kazuo

    2003-01-01

    To study phylogenetic relationships among Okinawan soft corals of the genus Clavularia, the ribosomal internal transcribed spacer sequences of host corals and the 18S rDNA sequences of symbiotic algae were analyzed. The molecular phylogenetic trees of hosts showed that a prostanoid-containing species, Clavularia viridis, is deeply diverged from other species of Clavularia which do not biosynthesize the prostanoids as the main secondary metabolites. Comparison of their trees suggested poor phylogenetic concordance between hosts and symbionts. PMID:14719169

  11. Characterization of the 18S rRNA Gene for Designing Universal Eukaryote Specific Primers

    PubMed Central

    Hadziavdic, Kenan; Lekang, Katrine; Lanzen, Anders; Jonassen, Inge; Thompson, Eric M.; Troedsson, Christofer

    2014-01-01

    High throughput sequencing technology has great promise for biodiversity studies. However, an underlying assumption is that the primers used in these studies are universal for the prokaryotic or eukaryotic groups of interest. Full primer universality is difficult or impossible to achieve and studies using different primer sets make biodiversity comparisons problematic. The aim of this study was to design and optimize universal eukaryotic primers that could be used as a standard in future biodiversity studies. Using the alignment of all eukaryotic sequences from the publicly available SILVA database, we generated a full characterization of variable versus conserved regions in the 18S rRNA gene. All variable regions within this gene were analyzed and our results suggested that the V2, V4 and V9 regions were best suited for biodiversity assessments. Previously published universal eukaryotic primers as well as a number of self-designed primers were mapped to the alignment. Primer selection will depend on sequencing technology used, and this study focused on the 454 pyrosequencing GS FLX Titanium platform. The results generated a primer pair yielding theoretical matches to 80% of the eukaryotic and 0% of the prokaryotic sequences in the SILVA database. An empirical test of marine sediments using the AmpliconNoise pipeline for analysis of the high throughput sequencing data yielded amplification of sequences for 71% of all eukaryotic phyla with no isolation of prokaryotic sequences. To our knowledge this is the first characterization of the complete 18S rRNA gene using all eukaryotes present in the SILVA database, providing a robust test for universal eukaryotic primers. Since both in silico and empirical tests using high throughput sequencing retained high inclusion of eukaryotic phyla and exclusion of prokaryotes, we conclude that these primers are well suited for assessing eukaryote diversity, and can be used as a standard in biodiversity studies. PMID:24516555

  12. Marrow failure: a window into ribosome biology.

    PubMed

    Ruggero, Davide; Shimamura, Akiko

    2014-10-30

    Diamond-Blackfan anemia, Shwachman-Diamond syndrome, and dyskeratosis congenita are inherited syndromes characterized by marrow failure, congenital anomalies, and cancer predisposition. Genetic and molecular studies have uncovered distinct abnormalities in ribosome biogenesis underlying each of these 3 disorders. How defects in ribosomes, the essential organelles required for protein biosynthesis in all cells, cause tissue-specific abnormalities in human disease remains a question of fundamental scientific and medical importance. Here we review the overlapping and distinct clinical features of these 3 syndromes and discuss current knowledge regarding the ribosomal pathways disrupted in each of these disorders. We also explore the increasing complexity of ribosome biology and how this informs our understanding of developmental biology and human disease. PMID:25237201

  13. Marrow failure: a window into ribosome biology

    PubMed Central

    Ruggero, Davide

    2014-01-01

    Diamond-Blackfan anemia, Shwachman-Diamond syndrome, and dyskeratosis congenita are inherited syndromes characterized by marrow failure, congenital anomalies, and cancer predisposition. Genetic and molecular studies have uncovered distinct abnormalities in ribosome biogenesis underlying each of these 3 disorders. How defects in ribosomes, the essential organelles required for protein biosynthesis in all cells, cause tissue-specific abnormalities in human disease remains a question of fundamental scientific and medical importance. Here we review the overlapping and distinct clinical features of these 3 syndromes and discuss current knowledge regarding the ribosomal pathways disrupted in each of these disorders. We also explore the increasing complexity of ribosome biology and how this informs our understanding of developmental biology and human disease. PMID:25237201

  14. The immunological properties of Brucella ribosomal preparations.

    PubMed

    Corbel, M J

    1976-01-01

    Ribosomes were isolated from Brucella abortus strains 19 and 45/20 by disruption of the cells followed by differential ultracentrifugation. The ribosome preparations contained 2-3 components reacting in immunodiffusion tests but were free of detectable lipopolysaccharide-protein agglutinogen. They crossreacted with antisera to Br. abortus, Br. melitensis, Br. suis and Br. ovis and elicited intradermal delayed hypersensitivity reactions in animals infected with Br. abortus, Br. melitensis or Br. suis. The ribosomes were antigenic in rabbits, guinea pigs and mice. Those from Br. abortus S19 induced agglutinins reaction with smooth brucella strains whereas those from Br. abortus 45/20 induced agglutinins reacting with rough brucella strains. Cattle vaccinated with S19 or 45/20 vaccines or infected with Br. abortus developed pricipitins to ribosomal components at an early stage in the immune response. PMID:816681

  15. Illuminating Parasite Protein Production by Ribosome Profiling.

    PubMed

    Parsons, Marilyn; Myler, Peter J

    2016-06-01

    While technologies for global enumeration of transcript abundance are well-developed, those that assess protein abundance require tailoring to penetrate to low-abundance proteins. Ribosome profiling circumvents this challenge by measuring global protein production via sequencing small mRNA fragments protected by the assembled ribosome. This powerful approach is now being applied to protozoan parasites including trypanosomes and Plasmodium. It has been used to identify new protein-coding sequences (CDSs) and clarify the boundaries of previously annotated CDSs in Trypanosoma brucei. Ribosome profiling has demonstrated that translation efficiencies vary widely between genes and, for trypanosomes at least, for the same gene across stages. The ribosomal proteins are themselves subjected to translational control, suggesting a means of reinforcing global translational regulation. PMID:27061497

  16. Ribosome Inactivating Proteins from Rosaceae.

    PubMed

    Shang, Chenjing; Rougé, Pierre; Van Damme, Els J M

    2016-01-01

    Ribosome-inactivating proteins (RIPs) are widespread among higher plants of different taxonomic orders. In this study, we report on the RIP sequences found in the genome/transcriptome of several important Rosaceae species, including many economically important edible fruits such as apple, pear, peach, apricot, and strawberry. All RIP domains from Rosaceae share high sequence similarity with conserved residues in the catalytic site and the carbohydrate binding sites. The genomes of Malus domestica and Pyrus communis contain both type 1 and type 2 RIP sequences, whereas for Prunus mume, Prunus persica, Pyrus bretschneideri, and Pyrus communis a complex set of type 1 RIP sequences was retrieved. Heterologous expression and purification of the type 1 as well as the type 2 RIP from apple allowed to characterize the biological activity of the proteins. Both RIPs from Malus domestica can inhibit protein synthesis. Furthermore, molecular modelling suggests that RIPs from Rosaceae possess three-dimensional structures that are highly similar to the model proteins and can bind to RIP substrates. Screening of the recombinant type 2 RIP from apple on a glycan array revealed that this type 2 RIP interacts with terminal sialic acid residues. Our data suggest that the RIPs from Rosaceae are biologically active proteins. PMID:27556443

  17. Chromosome mapping of ribosomal genes and histone H4 in the genus Radacridium (Romaleidae)

    PubMed Central

    Anjos, Allison; Loreto, Vilma; de Souza, Maria José

    2013-01-01

    In this study, two species of Romaleidae grasshoppers, Radacridium mariajoseae and R.nordestinum, were analyzed after CMA3/DA/DAPI sequential staining and fluorescence in situ hybridization (FISH) to determine the location of the 18S and 5S rDNA and histone H4 genes. Both species presented karyotypes composed of 2n = 23, X0 with exclusively acrocentric chromosomes. CMA3+ blocks were detected after CMA3/DA/DAPI staining in only one medium size autosome bivalent and in the X chromosome in R. mariajoseae. On the other hand, all chromosomes, except the L1 bivalent, of R. nordestinum presented CMA3+ blocks. FISH analysis showed that the 18S genes are restricted to the X chromosome in R. mariajoseae, whereas these genes were located in the L2, S9 and S10 autosomes in R. nordestinum. In R. mariajoseae, the 5S rDNA sites were localized in the in L1 and L2 bivalents and in the X chromosome. In R. nordestinum, the 5S genes were located in the L2, L3, M4 and M5 pairs. In both species the histone H4 genes were present in a medium size bivalent. Together, these data evidence a great variability of chromosome markers and show that the 18S and 5S ribosomal genes are dispersed in the Radacridium genome without a significant correlation. PMID:24130439

  18. Silencing of RNA helicase II/Gualpha inhibits mammalian ribosomal RNA production.

    PubMed

    Henning, Dale; So, Rolando B; Jin, Runyan; Lau, Lester F; Valdez, Benigno C

    2003-12-26

    The intricate production of ribosomal RNA is well defined in yeast, but its complexity in higher organisms is barely understood. We recently showed that down-regulation of nucleolar protein RNA helicase II/Gualpha (RH-II/Gualpha or DDX21) in Xenopus oocytes inhibited processing of 20 S rRNA to 18 S and contributed to degradation of 28 S rRNA (Yang, H., Zhou, J., Ochs, R. L., Henning, D., Jin, R., and Valdez, B. C. (2003) J. Biol. Chem. 278, 38847-38859). Since no nucleolar RNA helicase has been functionally characterized in mammalian cells, we used short interfering RNA to search for functions for RH-II/Gualpha and its paralogue RH-II/Gubeta in rRNA production. Silencing of RH-II/Gualpha by more than 80% in HeLa cells resulted in an almost 80% inhibition of 18 and 28 S rRNA production. This inhibition could be reversed by exogenous expression of wild type RH-II/Gualpha. A helicase-deficient mutant form having ATPase activity was able to rescue the production of 28 S but not 18 S rRNA. A phenotype exhibiting inhibition of 18 S and 28 S rRNA production was also observed when the paralogue RH-II/Gubeta was overexpressed. Both down-regulation of RH-II/Gualpha and overexpression of RH-II/Gubeta slowed cell proliferation. The opposite effects of the two paralogues suggest antagonistic functions. PMID:14559904

  19. Pro-resolving actions and stereoselective biosynthesis of 18S E-series resolvins in human leukocytes and murine inflammation

    PubMed Central

    Oh, Sungwhan F.; Pillai, Padmini S.; Recchiuti, Antonio; Yang, Rong; Serhan, Charles N.

    2011-01-01

    E-series resolvins are antiinflammatory and pro-resolving lipid mediators derived from the ω-3 polyunsaturated fatty acid eicosapentaenoic acid (EPA) that actively clear inflammation to promote tissue homeostasis. Aspirin, in addition to exerting antithrombotic actions, also triggers the biosynthesis of these specialized pro-resolving mediators. Here, we used metabolomic profiling to investigate the biosynthesis of E-series resolvins with specific chiral chemistry in serum from human subjects and present evidence for new 18S series resolvins. Aspirin increased endogenous formation of 18S-hydroxyeicosapentaenoate (18S-HEPE) compared with 18R-HEPE, a known resolvin precursor. Human recombinant 5-lipoxygenase used both enantiomers as substrates, and recombinant LTA4 hydrolase (LTA4H) converted chiral 5S(6)-epoxide–containing intermediates to resolvin E1 and 18S-resolvin E1 (RvE1 and 18S-RvE1, respectively). 18S-RvE1 bound to the leukocyte GPCRs ChemR23 and BLT1 with increased affinity and potency compared with the R-epimer, but was more rapidly inactivated than RvE1 by dehydrogenase. Like RvE1, 18S-RvE1 enhanced macrophage phagocytosis of zymosan, E. coli, and apoptotic neutrophils and reduced both neutrophil infiltration and proinflammatory cytokines in murine peritonitis. These results demonstrate two parallel stereospecific pathways in the biosynthesis of E-series resolvins, 18R- and 18S-, which are antiinflammatory, pro-resolving, and non-phlogistic and may contribute to the beneficial actions of aspirin and ω-3 polyunsaturated fatty acids. PMID:21206090

  20. Frozen spin targets in ribosomal structure research.

    PubMed

    Stuhrmann, H B

    1991-01-01

    Polarized neutron scattering strongly depends on nuclear spin polarisation, particularly on proton spin polarisation. A single proton in a deuterated environment then is as efficient as 10 electrons in X-ray anomalous diffraction. Neutron scattering from the nuclear spin label is controlled by the polarisation of neutron spins and nuclear spins. Pure deuteron spin labels and proton spin labels are created by NMR saturation. We report on results obtained from the large subunit of E. coli ribosomes which have been obtained at the research reactor of GKSS using the polarized target facility developed by CERN. The nuclear spins were oriented with respect to an external field by dynamic nuclear polarisation. Proton spin polarisations of more than 80% were obtained in ribosomes at temperatures below 0.5 K. At T = 130 mK the relaxation time of the polarized target is one month (frozen spin target). Polarized small-angle neutron scattering of the in situ structure of rRNA and the total ribosomal protein (TP) has been determined from the frozen spin targets of the large ribosomal subunit, which has been deuterated in the TP and rRNA respectively. The results agree with those from neutron scattering in H2O/D2O mixtures obtained at room temperature. This is a necessary prerequisite for the planned determination of the in situ structure of individual ribosomal proteins and especially of that of ribosome bound mRNA and tRNAs. PMID:1720669

  1. Molecular organization of the 25S-18S rDNA IGS of Fagus sylvatica and Quercus suber: a comparative analysis.

    PubMed

    Inácio, Vera; Rocheta, Margarida; Morais-Cecílio, Leonor

    2014-01-01

    The 35S ribosomal DNA (rDNA) units, repeated in tandem at one or more chromosomal loci, are separated by an intergenic spacer (IGS) containing functional elements involved in the regulation of transcription of downstream rRNA genes. In the present work, we have compared the IGS molecular organizations in two divergent species of Fagaceae, Fagus sylvatica and Quercus suber, aiming to comprehend the evolution of the IGS sequences within the family. Self- and cross-hybridization FISH was done on representative species of the Fagaceae. The IGS length variability and the methylation level of 18 and 25S rRNA genes were assessed in representatives of three genera of this family: Fagus, Quercus and Castanea. The intergenic spacers in Beech and Cork Oak showed similar overall organizations comprising putative functional elements needed for rRNA gene activity and containing a non-transcribed spacer (NTS), a promoter region, and a 5'-external transcribed spacer. In the NTS: the sub-repeats structure in Beech is more organized than in Cork Oak, sharing some short motifs which results in the lowest sequence similarity of the entire IGS; the AT-rich region differed in both spacers by a GC-rich block inserted in Cork Oak. The 5'-ETS is the region with the higher similarity, having nonetheless different lengths. FISH with the NTS-5'-ETS revealed fainter signals in cross-hybridization in agreement with the divergence between genera. The diversity of IGS lengths revealed variants from ∼ 2 kb in Fagus, and Quercus up to 5.3 kb in Castanea, and a lack of correlation between the number of variants and the number of rDNA loci in several species. Methylation of 25S Bam HI site was confirmed in all species and detected for the first time in the 18S of Q. suber and Q. faginea. These results provide important clues for the evolutionary trends of the rDNA 25S-18S IGS in the Fagaceae family. PMID:24893289

  2. SILVA: a comprehensive online resource for quality checked and aligned ribosomal RNA sequence data compatible with ARB

    PubMed Central

    Pruesse, Elmar; Quast, Christian; Knittel, Katrin; Fuchs, Bernhard M.; Ludwig, Wolfgang; Peplies, Jörg; Glöckner, Frank Oliver

    2007-01-01

    Sequencing ribosomal RNA (rRNA) genes is currently the method of choice for phylogenetic reconstruction, nucleic acid based detection and quantification of microbial diversity. The ARB software suite with its corresponding rRNA datasets has been accepted by researchers worldwide as a standard tool for large scale rRNA analysis. However, the rapid increase of publicly available rRNA sequence data has recently hampered the maintenance of comprehensive and curated rRNA knowledge databases. A new system, SILVA (from Latin silva, forest), was implemented to provide a central comprehensive web resource for up to date, quality controlled databases of aligned rRNA sequences from the Bacteria, Archaea and Eukarya domains. All sequences are checked for anomalies, carry a rich set of sequence associated contextual information, have multiple taxonomic classifications, and the latest validly described nomenclature. Furthermore, two precompiled sequence datasets compatible with ARB are offered for download on the SILVA website: (i) the reference (Ref) datasets, comprising only high quality, nearly full length sequences suitable for in-depth phylogenetic analysis and probe design and (ii) the comprehensive Parc datasets with all publicly available rRNA sequences longer than 300 nucleotides suitable for biodiversity analyses. The latest publicly available database release 91 (August 2007) hosts 547 521 sequences split into 461 823 small subunit and 85 689 large subunit rRNAs. PMID:17947321

  3. The structure of ribosome-lankacidin complex reveals ribosomal sites for synergistic antibiotics

    SciTech Connect

    Auerbach, Tamar; Mermershtain, Inbal; Davidovich, Chen; Bashan, Anat; Belousoff, Matthew; Wekselman, Itai; Zimmerman, Ella; Xiong, Liqun; Klepacki, Dorota; Arakawa, Kenji; Kinashi, Haruyasu; Mankin, Alexander S.; Yonath, Ada

    2010-04-26

    Crystallographic analysis revealed that the 17-member polyketide antibiotic lankacidin produced by Streptomyces rochei binds at the peptidyl transferase center of the eubacterial large ribosomal subunit. Biochemical and functional studies verified this finding and showed interference with peptide bond formation. Chemical probing indicated that the macrolide lankamycin, a second antibiotic produced by the same species, binds at a neighboring site, at the ribosome exit tunnel. These two antibiotics can bind to the ribosome simultaneously and display synergy in inhibiting bacterial growth. The binding site of lankacidin and lankamycin partially overlap with the binding site of another pair of synergistic antibiotics, the streptogramins. Thus, at least two pairs of structurally dissimilar compounds have been selected in the course of evolution to act synergistically by targeting neighboring sites in the ribosome. These results underscore the importance of the corresponding ribosomal sites for development of clinically relevant synergistic antibiotics and demonstrate the utility of structural analysis for providing new directions for drug discovery.

  4. Cryo-EM structure of Hepatitis C virus IRES bound to the human ribosome at 3.9-Å resolution

    NASA Astrophysics Data System (ADS)

    Quade, Nick; Boehringer, Daniel; Leibundgut, Marc; van den Heuvel, Joop; Ban, Nenad

    2015-07-01

    Hepatitis C virus (HCV), a widespread human pathogen, is dependent on a highly structured 5'-untranslated region of its mRNA, referred to as internal ribosome entry site (IRES), for the translation of all of its proteins. The HCV IRES initiates translation by directly binding to the small ribosomal subunit (40S), circumventing the need for many eukaryotic translation initiation factors required for mRNA scanning. Here we present the cryo-EM structure of the human 40S ribosomal subunit in complex with the HCV IRES at 3.9 Å resolution, determined by focused refinement of an 80S ribosome-HCV IRES complex. The structure reveals the molecular details of the interactions between the IRES and the 40S, showing that expansion segment 7 (ES7) of the 18S rRNA acts as a central anchor point for the HCV IRES. The structural data rationalizes previous biochemical and genetic evidence regarding the initiation mechanism of the HCV and other related IRESs.

  5. Requirement for SAPK-JNK signaling in the induction of apoptosis by ribosomal stress in REH lymphoid leukemia cells.

    PubMed

    Johnson, C R; Jiffar, T; Fischer, U M; Ruvolo, P P; Jarvis, W D

    2003-11-01

    The present studies examined performance of SAPK cascades and apoptotic commitment following ribosomal trauma in REH lymphoid leukemia cells. Ribostatic insults included disruption of ribosomal activity by mechanistically dissimilar agents such as blasticidin-S (BCS) (which binds 28S-rRNA to block peptidyl bond formation), kasugamycin (KSM) (which binds 18S-rRNA to prevent translational initiation), and cycloheximide (CHX) (which blocks A-site to P-site translocation of peptidyl-tRNA). Exposure of REH cells to BCS elicited DNA degradation and apoptotic cytolysis. BCS stimulated JNK1/JNK2 and p38, and their shared targets c-Jun and ATF2. Inhibition of JNK1/JNK2 (but not of p38) antagonized blasticidin-induced apoptosis, whereas targeting alternative ribosomal sites with KSM or CHX limited translation, but failed to activate the SAPK cascade or initiate apoptosis. Our findings indicate that interference with 28S-rRNA by BCS initiates apoptosis in REH cells through recruitment of SAPK-JNK signaling. Disparities between the lethal actions of BCS, KSM, and CHX appear to reflect established differences in the subribosomal targets of these agents. We propose that the SAPK cascade comprises an essential mechanism for the transduction of specific lethal stress signals emanating from active ribosomes, and that interference with the 28S-rRNA, rather than the peptidyl transfer center of the large subunit, is critical to apoptotic commitment. PMID:12970763

  6. Cryo-EM structure of Hepatitis C virus IRES bound to the human ribosome at 3.9-Å resolution.

    PubMed

    Quade, Nick; Boehringer, Daniel; Leibundgut, Marc; van den Heuvel, Joop; Ban, Nenad

    2015-01-01

    Hepatitis C virus (HCV), a widespread human pathogen, is dependent on a highly structured 5'-untranslated region of its mRNA, referred to as internal ribosome entry site (IRES), for the translation of all of its proteins. The HCV IRES initiates translation by directly binding to the small ribosomal subunit (40S), circumventing the need for many eukaryotic translation initiation factors required for mRNA scanning. Here we present the cryo-EM structure of the human 40S ribosomal subunit in complex with the HCV IRES at 3.9 Å resolution, determined by focused refinement of an 80S ribosome-HCV IRES complex. The structure reveals the molecular details of the interactions between the IRES and the 40S, showing that expansion segment 7 (ES7) of the 18S rRNA acts as a central anchor point for the HCV IRES. The structural data rationalizes previous biochemical and genetic evidence regarding the initiation mechanism of the HCV and other related IRESs. PMID:26155016

  7. Phylogenetic study of Class Armophorea (Alveolata, Ciliophora) based on 18S-rDNA data

    PubMed Central

    da Silva Paiva, Thiago; do Nascimento Borges, Bárbara; da Silva-Neto, Inácio Domingos

    2013-01-01

    The 18S rDNA phylogeny of Class Armophorea, a group of anaerobic ciliates, is proposed based on an analysis of 44 sequences (out of 195) retrieved from the NCBI/GenBank database. Emphasis was placed on the use of two nucleotide alignment criteria that involved variation in the gap-opening and gap-extension parameters and the use of rRNA secondary structure to orientate multiple-alignment. A sensitivity analysis of 76 data sets was run to assess the effect of variations in indel parameters on tree topologies. Bayesian inference, maximum likelihood and maximum parsimony phylogenetic analyses were used to explore how different analytic frameworks influenced the resulting hypotheses. A sensitivity analysis revealed that the relationships among higher taxa of the Intramacronucleata were dependent upon how indels were determined during multiple-alignment of nucleotides. The phylogenetic analyses rejected the monophyly of the Armophorea most of the time and consistently indicated that the Metopidae and Nyctotheridae were related to the Litostomatea. There was no consensus on the placement of the Caenomorphidae, which could be a sister group of the Metopidae + Nyctorheridae, or could have diverged at the base of the Spirotrichea branch or the Intramacronucleata tree. PMID:24385862

  8. High-resolution structure of the Escherichia coli ribosome

    PubMed Central

    Noeske, Jonas; Wasserman, Michael R.; Terry, Daniel S.; Altman, Roger B.; Blanchard, Scott C.; Cate, Jamie H. D.

    2015-01-01

    Protein synthesis by the ribosome is highly dependent on the ionic conditions in the cellular environment, but the roles of ribosome solvation remain poorly understood. Moreover, the function of modifications to ribosomal RNA and ribosomal proteins are unclear. Here we present the structure of the Escherichia coli 70S ribosome to 2.4 Å resolution. The structure reveals details of the ribosomal subunit interface that are conserved in all domains of life, and suggest how solvation contributes to ribosome integrity and function. The structure also suggests how the conformation of ribosomal protein uS12 likely impacts its contribution to messenger RNA decoding. This structure helps to explain the phylogenetic conservation of key elements of the ribosome, including posttranscriptional and posttranslational modifications and should serve as a basis for future antibiotic development. PMID:25775265

  9. Highly divergent 18S rRNA gene paralogs in a Cryptosporidium genotype from eastern chipmunks (Tamias striatus)1

    PubMed Central

    Stenger, Brianna L.S.; Clark, Mark E.; Kváč, Martin; Khan, Eakalak; Giddings, Catherine W.; Dyer, Neil W.; Schultz, Jessie L.; McEvoy, John M.

    2015-01-01

    Cryptosporidium is an apicomplexan parasite that causes the disease cryptosporidiosis in humans, livestock, and other vertebrates. Much of the knowledge on Cryptosporidium diversity is derived from 18S rRNA gene (18S rDNA) phylogenies. Eukaryote genomes generally have multiple 18S rDNA copies that evolve in concert, which is necessary for the accurate inference of phylogenetic relationships. However, 18S rDNA copies in some genomes evolve by a birth-and-death process that can result in sequence divergence among copies. Most notably, divergent 18S rDNA paralogs in the apicomplexan Plasmodium share only 89–95% sequence similarity, encode structurally distinct rRNA molecules, and are expressed at different life cycle stages. In the present study, Cryptosporidium 18S rDNA was amplified from 28/72 (38.9%) eastern chipmunks (Tamias striatus). Phylogenetic analyses showed the co-occurrence of two 18S rDNA types, Type A and Type B, in 26 chipmunks, and Type B clustered with a sequence previously identified as Cryptosporidium chipmunk genotype II. Types A and B had a sister group relationship but shared less than 93% sequence similarity. In contrast, actin and heat shock protein 70 gene sequences were homogeneous in samples with both Types A and B present. It was therefore concluded that Types A and B are divergent 18S rDNA paralogs in Cryptosporidium chipmunk genotype II. Substitution patterns in Types A and B were consistent with functionally constrained evolution; however, Type B evolved more rapidly than Type A and had a higher G+C content (46.3% versus 41.0%). Oocysts of Cryptosporidium chipmunk genotype II measured 4.17 μm (3.73–5.04 μm) × 3.94 μm (3.50–4.98 μm) with a length-to-width ratio of 1.06 ± 0.06 μm, and infection occurred naturally in the jejunum, cecum, and colon of eastern chipmunks. The findings of this study have implications for the use of 18S rDNA sequences to infer phylogenetic relationships. PMID:25772204

  10. Highly divergent 18S rRNA gene paralogs in a Cryptosporidium genotype from eastern chipmunks (Tamias striatus).

    PubMed

    Stenger, Brianna L S; Clark, Mark E; Kváč, Martin; Khan, Eakalak; Giddings, Catherine W; Dyer, Neil W; Schultz, Jessie L; McEvoy, John M

    2015-06-01

    Cryptosporidium is an apicomplexan parasite that causes the disease cryptosporidiosis in humans, livestock, and other vertebrates. Much of the knowledge on Cryptosporidium diversity is derived from 18S rRNA gene (18S rDNA) phylogenies. Eukaryote genomes generally have multiple 18S rDNA copies that evolve in concert, which is necessary for the accurate inference of phylogenetic relationships. However, 18S rDNA copies in some genomes evolve by a birth-and-death process that can result in sequence divergence among copies. Most notably, divergent 18S rDNA paralogs in the apicomplexan Plasmodium share only 89-95% sequence similarity, encode structurally distinct rRNA molecules, and are expressed at different life cycle stages. In the present study, Cryptosporidium 18S rDNA was amplified from 28/72 (38.9%) eastern chipmunks (Tamias striatus). Phylogenetic analyses showed the co-occurrence of two 18S rDNA types, Type A and Type B, in 26 chipmunks, and Type B clustered with a sequence previously identified as Cryptosporidium chipmunk genotype II. Types A and B had a sister group relationship but shared less than 93% sequence similarity. In contrast, actin and heat shock protein 70 gene sequences were homogeneous in samples with both Types A and B present. It was therefore concluded that Types A and B are divergent 18S rDNA paralogs in Cryptosporidium chipmunk genotype II. Substitution patterns in Types A and B were consistent with functionally constrained evolution; however, Type B evolved more rapidly than Type A and had a higher G+C content (46.3% versus 41.0%). Oocysts of Cryptosporidium chipmunk genotype II measured 4.17 μm (3.73-5.04 μm) × 3.94 μm (3.50-4.98 μm) with a length-to-width ratio of 1.06 ± 0.06 μm, and infection occurred naturally in the jejunum, cecum, and colon of eastern chipmunks. The findings of this study have implications for the use of 18S rDNA sequences to infer phylogenetic relationships. PMID:25772204

  11. Mitochondrial ribosomal proteins (MRPs) of yeast.

    PubMed Central

    Graack, H R; Wittmann-Liebold, B

    1998-01-01

    Mitochondrial ribosomal proteins (MRPs) are the counterparts in that organelle of the cytoplasmic ribosomal proteins in the host. Although the MRPs fulfil similar functions in protein biosynthesis, they are distinct in number, features and primary structures from the latter. Most progress in the eludication of the properties of individual MRPs, and in the characterization of the corresponding genes, has been made in baker's yeast (Saccharomyces cerevisiae). To date, 50 different MRPs have been determined, although biochemical data and mutational analysis propose a total number which is substantially higher. Surprisingly, only a minority of the MRPs that have been characterized show significant sequence similarities to known ribosomal proteins from other sources, thus limiting the deduction of their functions by simple comparison of amino acid sequences. Further, individual MRPs have been characterized functionally by mutational studies, and the regulation of expression of MRP genes has been described. The interaction of the mitochondrial ribosomes with transcription factors specific for individual mitochondrial mRNAs, and the communication between mitochondria and the nucleus for the co-ordinated expression of ribosomal constituents, are other aspects of current MRP research. Although the mitochondrial translational system is still far from being described completely, the yeast MRP system serves as a model for other organisms, including that of humans. PMID:9445368

  12. Identification of Habitat-Specific Biomes of Aquatic Fungal Communities Using a Comprehensive Nearly Full-Length 18S rRNA Dataset Enriched with Contextual Data.

    PubMed

    Panzer, Katrin; Yilmaz, Pelin; Weiß, Michael; Reich, Lothar; Richter, Michael; Wiese, Jutta; Schmaljohann, Rolf; Labes, Antje; Imhoff, Johannes F; Glöckner, Frank Oliver; Reich, Marlis

    2015-01-01

    Molecular diversity surveys have demonstrated that aquatic fungi are highly diverse, and that they play fundamental ecological roles in aquatic systems. Unfortunately, comparative studies of aquatic fungal communities are few and far between, due to the scarcity of adequate datasets. We combined all publicly available fungal 18S ribosomal RNA (rRNA) gene sequences with new sequence data from a marine fungi culture collection. We further enriched this dataset by adding validated contextual data. Specifically, we included data on the habitat type of the samples assigning fungal taxa to ten different habitat categories. This dataset has been created with the intention to serve as a valuable reference dataset for aquatic fungi including a phylogenetic reference tree. The combined data enabled us to infer fungal community patterns in aquatic systems. Pairwise habitat comparisons showed significant phylogenetic differences, indicating that habitat strongly affects fungal community structure. Fungal taxonomic composition differed considerably even on phylum and class level. Freshwater fungal assemblage was most different from all other habitat types and was dominated by basal fungal lineages. For most communities, phylogenetic signals indicated clustering of sequences suggesting that environmental factors were the main drivers of fungal community structure, rather than species competition. Thus, the diversification process of aquatic fungi must be highly clade specific in some cases.The combined data enabled us to infer fungal community patterns in aquatic systems. Pairwise habitat comparisons showed significant phylogenetic differences, indicating that habitat strongly affects fungal community structure. Fungal taxonomic composition differed considerably even on phylum and class level. Freshwater fungal assemblage was most different from all other habitat types and was dominated by basal fungal lineages. For most communities, phylogenetic signals indicated clustering of

  13. Identification of Habitat-Specific Biomes of Aquatic Fungal Communities Using a Comprehensive Nearly Full-Length 18S rRNA Dataset Enriched with Contextual Data

    PubMed Central

    Panzer, Katrin; Yilmaz, Pelin; Weiß, Michael; Reich, Lothar; Richter, Michael; Wiese, Jutta; Schmaljohann, Rolf; Labes, Antje; Imhoff, Johannes F.; Glöckner, Frank Oliver; Reich, Marlis

    2015-01-01

    Molecular diversity surveys have demonstrated that aquatic fungi are highly diverse, and that they play fundamental ecological roles in aquatic systems. Unfortunately, comparative studies of aquatic fungal communities are few and far between, due to the scarcity of adequate datasets. We combined all publicly available fungal 18S ribosomal RNA (rRNA) gene sequences with new sequence data from a marine fungi culture collection. We further enriched this dataset by adding validated contextual data. Specifically, we included data on the habitat type of the samples assigning fungal taxa to ten different habitat categories. This dataset has been created with the intention to serve as a valuable reference dataset for aquatic fungi including a phylogenetic reference tree. The combined data enabled us to infer fungal community patterns in aquatic systems. Pairwise habitat comparisons showed significant phylogenetic differences, indicating that habitat strongly affects fungal community structure. Fungal taxonomic composition differed considerably even on phylum and class level. Freshwater fungal assemblage was most different from all other habitat types and was dominated by basal fungal lineages. For most communities, phylogenetic signals indicated clustering of sequences suggesting that environmental factors were the main drivers of fungal community structure, rather than species competition. Thus, the diversification process of aquatic fungi must be highly clade specific in some cases.The combined data enabled us to infer fungal community patterns in aquatic systems. Pairwise habitat comparisons showed significant phylogenetic differences, indicating that habitat strongly affects fungal community structure. Fungal taxonomic composition differed considerably even on phylum and class level. Freshwater fungal assemblage was most different from all other habitat types and was dominated by basal fungal lineages. For most communities, phylogenetic signals indicated clustering of

  14. Sequence requirements for maturation of the 5' terminus of human 18 S rRNA in vitro.

    PubMed

    Yu, Y T; Nilsen, T W

    1992-05-01

    Creation of the mature 5' terminus of human 18 S rRNA in vitro occurs via a two-step processing reaction. In the first step, an endonucleolytic activity found in HeLa cell nucleolar extract cleaves an rRNA precursor spanning the external transcribed spacer-18 S boundary at a position 3 bases upstream from the mature 18 S terminus leaving 2',3'-cyclic phosphate, 5' hydroxyl termini. In the second step, a nucleolytic activity(s) found in HeLa cell cytoplasmic extract removes the 3 extra bases and creates the authentic 5'-phosphorylated terminus of 18 S rRNA. Here we have examined the sequence requirements for the trimming reaction. The trimming activity(s), in addition to requiring a 5' hydroxyl terminus, prefers the naturally occurring adenosine as the 5'-terminal base. By a combination of deletion, site-directed mutagenesis, and chemical modification interference approaches we have also identified a region of 18 S rRNA spanning bases +6 to +25 (with respect to the mature 5' end) which comprises a critical recognition sequence for the trimming activity(s). PMID:1577760

  15. The spc ribosomal protein operon of Escherichia coli: sequence and cotranscription of the ribosomal protein genes and a protein export gene.

    PubMed

    Cerretti, D P; Dean, D; Davis, G R; Bedwell, D M; Nomura, M

    1983-05-11

    The genes encoding the 52 ribosomal proteins (r-proteins) of Escherichia coli are organized into approximately 19 operons scattered throughout the chromosome. One of these, the spc operon, contains the genes for ten ribosomal proteins: L14, L24, L5, S14, S8, L6, L18, S5, L30 and L15 (rp1N, rp1X, rp1E, rpsN, rpsH, rp1F, rp1R, rpsE, rpmD, and rp1O). We now report the entire 5.9 kb nucleotide sequence of the spc operon. DNA sequence analysis has confirmed the genetic organization and refined the amino acid sequence of the ten r-proteins in this operon. It has also revealed the presence of two open reading frames past the last known gene (L15) of the spc operon. One of these corresponds to a gene (pr1A or secY) which recently has been shown by others to be involved in protein export. In addition, S1 mapping experiments indicate that a significant proportion of transcription initiated from the spc operon continues not only into the two putative genes, but also without termination into the downstream alpha r-protein operon. PMID:6222285

  16. Large-scale isolation of mitochondrial ribosomes from mammalian tissues.

    PubMed

    Spremulli, Linda L

    2007-01-01

    The preparation of mammalian mitochondrial ribosomes in sufficient quantities for biochemical studies is best done beginning with whole tissue rather than from cells in culture. This issue arises because of the low abundance of these ribosomes in cells, making their isolation a challenge. Crude mitochondrial preparations are made by differential centrifugation and are treated with digitonin to remove the outer membrane. This treatment also effectively removes most contamination by cytoplasmic ribosomes. Purification of mammalian mitochondrial ribosomes requires treatment with detergents to release the ribosomes from their association with the membrane. Sucrose density gradient centrifugation is used to separate the ribosomes from other large oligomeric complexes from this organelle. PMID:18314732

  17. Single-Molecule Observations of Ribosome Function

    PubMed Central

    Blanchard, Scott C.

    2009-01-01

    Summary of Recent Advances Single-molecule investigations promise to greatly advance our understanding of basic and regulated ribosome functions during the process of translation. Here, recent progress towards directly imaging the elemental translation elongation steps using fluorescence resonance energy transfer (FRET)-based imaging methods is discussed, which provide striking evidence of the highly dynamic nature of the ribosome. In this view, global rates and fidelities of protein synthesis reactions may be regulated by interactions of the ribosome with mRNA, tRNA, translation factors, and potentially many other cellular ligands, that modify intrinsic conformational equilibria in the translating particle. Future investigations probing this model must aim to visualize translation processes from multiple structural and kinetic perspectives simultaneously, to provide direct correlations between factor binding and conformational events. PMID:19223173

  18. Genome Mining for Ribosomally Synthesized Natural Products

    PubMed Central

    Velásquez, Juan E.; van der Donk, Wilfred

    2011-01-01

    In recent years, the number of known peptide natural products that are synthesized via the ribosomal pathway has rapidly grown. Taking advantage of sequence homology among genes encoding precursor peptides or biosynthetic proteins, in silico mining of genomes combined with molecular biology approaches has guided the discovery of a large number of new ribosomal natural products, including lantipeptides, cyanobactins, linear thiazole/oxazole-containing peptides, microviridins, lasso peptides, amatoxins, cyclotides, and conopeptides. In this review, we describe the strategies used for the identification of these ribosomally-synthesized and posttranslationally modified peptides (RiPPs) and the structures of newly identified compounds. The increasing number of chemical entities and their remarkable structural and functional diversity may lead to novel pharmaceutical applications. PMID:21095156

  19. Initial results on the molecular phylogeny of the Nudibranchia (Gastropoda, Opisthobranchia) based on 18S rDNA data.

    PubMed

    Wollscheid, E; Wägele, H

    1999-11-01

    This study investigated nudibranch phylogeny on the basis of 18S rDNA sequence data. 18S rDNA sequence data of 19 taxa representing the major living orders and families of the Nudibranchia were analyzed. Representatives of the Cephalaspidea, Anaspidea, Gymnomorpha, Prosobranchia, and Pulmonata were also sequenced and used as outgroups. An additional 28 gastropod sequences taken from GenBank were also included in our analyses. Phylogenetic analyses of these more than 50 gastropod taxa provide strong evidence for support of the monophyly of the Nudibranchia. The monophyly of the Doridoidea, Cladobranchia, and Aeolidoidea within the Nudibranchia are also strongly supported. Phylogenetic utility and information content of the 18S rDNA sequences for Nudibranchia, and Opisthobranchia in general, are examined using the program SplitsTree as well as phylogenetic reconstructions using distance and parsimony approaches. 0Results based on these molecular data are compared with hypotheses about nudibranch phylogeny inferred from morphological data. PMID:10603252

  20. 18S rDNA Sequences from Microeukaryotes Reveal Oil Indicators in Mangrove Sediment

    PubMed Central

    Santos, Henrique F.; Cury, Juliano C.; Carmo, Flavia L.; Rosado, Alexandre S.; Peixoto, Raquel S.

    2010-01-01

    Background Microeukaryotes are an effective indicator of the presence of environmental contaminants. However, the characterisation of these organisms by conventional tools is often inefficient, and recent molecular studies have revealed a great diversity of microeukaryotes. The full extent of this diversity is unknown, and therefore, the distribution, ecological role and responses to anthropogenic effects of microeukaryotes are rather obscure. The majority of oil from oceanic oil spills (e.g., the May 2010 accident in the Gulf of Mexico) converges on coastal ecosystems such as mangroves, which are threatened with worldwide disappearance, highlighting the need for efficient tools to indicate the presence of oil in these environments. However, no studies have used molecular methods to assess the effects of oil contamination in mangrove sediment on microeukaryotes as a group. Methodology/Principal Findings We evaluated the population dynamics and the prevailing 18S rDNA phylotypes of microeukaryotes in mangrove sediment microcosms with and without oil contamination, using PCR/DGGE and clone libraries. We found that microeukaryotes are useful for monitoring oil contamination in mangroves. Our clone library analysis revealed a decrease in both diversity and species richness after contamination. The phylogenetic group that showed the greatest sensitivity to oil was the Nematoda. After contamination, a large increase in the abundance of the groups Bacillariophyta (diatoms) and Biosoecida was detected. The oil-contaminated samples were almost entirely dominated by organisms related to Bacillariophyta sp. and Cafeteria minima, which indicates that these groups are possible targets for biomonitoring oil in mangroves. The DGGE fingerprints also indicated shifts in microeukaryote profiles; specific band sequencing indicated the appearance of Bacillariophyta sp. only in contaminated samples and Nematoda only in non-contaminated sediment. Conclusions/Significance We believe that

  1. Ribosome-dependent activation of stringent control.

    PubMed

    Brown, Alan; Fernández, Israel S; Gordiyenko, Yuliya; Ramakrishnan, V

    2016-06-01

    In order to survive, bacteria continually sense, and respond to, environmental fluctuations. Stringent control represents a key bacterial stress response to nutrient starvation that leads to rapid and comprehensive reprogramming of metabolic and transcriptional patterns. In general, transcription of genes for growth and proliferation is downregulated, while those important for survival and virulence are upregulated. Amino acid starvation is sensed by depletion of the aminoacylated tRNA pools, and this results in accumulation of ribosomes stalled with non-aminoacylated (uncharged) tRNA in the ribosomal A site. RelA is recruited to stalled ribosomes and activated to synthesize a hyperphosphorylated guanosine analogue, (p)ppGpp, which acts as a pleiotropic secondary messenger. However, structural information about how RelA recognizes stalled ribosomes and discriminates against aminoacylated tRNAs is missing. Here we present the cryo-electron microscopy structure of RelA bound to the bacterial ribosome stalled with uncharged tRNA. The structure reveals that RelA utilizes a distinct binding site compared to the translational factors, with a multi-domain architecture that wraps around a highly distorted A-site tRNA. The TGS (ThrRS, GTPase and SpoT) domain of RelA binds the CCA tail to orient the free 3' hydroxyl group of the terminal adenosine towards a β-strand, such that an aminoacylated tRNA at this position would be sterically precluded. The structure supports a model in which association of RelA with the ribosome suppresses auto-inhibition to activate synthesis of (p)ppGpp and initiate the stringent response. Since stringent control is responsible for the survival of pathogenic bacteria under stress conditions, and contributes to chronic infections and antibiotic tolerance, RelA represents a good target for the development of novel antibacterial therapeutics. PMID:27279228

  2. Functions of ribosomal proteins in assembly of eukaryotic ribosomes in vivo.

    PubMed

    de la Cruz, Jesús; Karbstein, Katrin; Woolford, John L

    2015-01-01

    The proteome of cells is synthesized by ribosomes, complex ribonucleoproteins that in eukaryotes contain 79-80 proteins and four ribosomal RNAs (rRNAs) more than 5,400 nucleotides long. How these molecules assemble together and how their assembly is regulated in concert with the growth and proliferation of cells remain important unanswered questions. Here, we review recently emerging principles to understand how eukaryotic ribosomal proteins drive ribosome assembly in vivo. Most ribosomal proteins assemble with rRNA cotranscriptionally; their association with nascent particles is strengthened as assembly proceeds. Each subunit is assembled hierarchically by sequential stabilization of their subdomains. The active sites of both subunits are constructed last, perhaps to prevent premature engagement of immature ribosomes with active subunits. Late-assembly intermediates undergo quality-control checks for proper function. Mutations in ribosomal proteins that affect mostly late steps lead to ribosomopathies, diseases that include a spectrum of cell type-specific disorders that often transition from hypoproliferative to hyperproliferative growth. PMID:25706898

  3. Functions of Ribosomal Proteins in Assembly of Eukaryotic Ribosomes In Vivo

    PubMed Central

    2016-01-01

    The proteome of cells is synthesized by ribosomes, complex ribonucleoproteins that in eukaryotes contain 79–80 proteins and four ribosomal RNAs (rRNAs) more than 5,400 nucleotides long. How these molecules assemble together and how their assembly is regulated in concert with the growth and proliferation of cells remain important unanswered questions. Here, we review recently emerging principles to understand how eukaryotic ribosomal proteins drive ribosome assembly in vivo. Most ribosomal proteins assemble with rRNA cotranscriptionally; their association with nascent particles is strengthened as assembly proceeds. Each subunit is assembled hierarchically by sequential stabilization of their subdomains. The active sites of both subunits are constructed last, perhaps to prevent premature engagement of immature ribosomes with active subunits. Late-assembly intermediates undergo quality-control checks for proper function. Mutations in ribosomal proteins that affect mostly late steps lead to ribosomopathies, diseases that include a spectrum of cell type–specific disorders that often transition from hypoproliferative to hyperproliferative growth. PMID:25706898

  4. Pharmacological inhibition of PAR2 with the pepducin P2pal-18S protects mice against acute experimental biliary pancreatitis.

    PubMed

    Michael, E S; Kuliopulos, A; Covic, L; Steer, M L; Perides, G

    2013-03-01

    Pancreatic acinar cells express proteinase-activated receptor-2 (PAR2) that is activated by trypsin-like serine proteases and has been shown to exert model-specific effects on the severity of experimental pancreatitis, i.e., PAR2(-/-) mice are protected from experimental acute biliary pancreatitis but develop more severe secretagogue-induced pancreatitis. P2pal-18S is a novel pepducin lipopeptide that targets and inhibits PAR2. In studies monitoring PAR2-stimulated intracellular Ca(2+) concentration changes, we show that P2pal-18S is a full PAR2 inhibitor in acinar cells. Our in vivo studies show that P2pal-18S significantly reduces the severity of experimental biliary pancreatitis induced by retrograde intraductal bile acid infusion, which mimics injury induced by endoscopic retrograde cholangiopancreatography (ERCP). This reduction in pancreatitis severity is observed when the pepducin is given before or 2 h after bile acid infusion but not when it is given 5 h after bile acid infusion. Conversely, P2pal-18S increases the severity of secretagogue-induced pancreatitis. In vitro studies indicate that P2pal-18S protects acinar cells against bile acid-induced injury/death, but it does not alter bile acid-induced intracellular zymogen activation. These studies are the first to report the effects of an effective PAR2 pharmacological inhibitor on pancreatic acinar cells and on the severity of experimental pancreatitis. They raise the possibility that a pepducin such as P2pal-18S might prove useful in the clinical management of patients at risk for developing severe biliary pancreatitis such as occurs following ERCP. PMID:23275617

  5. Modular domains of the Dicistroviridae intergenic internal ribosome entry site

    PubMed Central

    Jang, Christopher J.; Jan, Eric

    2010-01-01

    The intergenic region internal ribosome entry site (IGR IRES) of the Dicistroviridae viral family can directly assemble 80S ribosomes and initiate translation at a non-AUG codon from the ribosomal A-site. These functions are directed by two independently folded domains of the IGR IRES. One domain, composed of overlapping pseudoknots II and III (PKII/III), mediates ribosome recruitment. The second domain, composed of PKI, mimics a tRNA anticodon–codon interaction to position the ribosome at the ribosomal A-site. Although adopting a common secondary structure, the dicistrovirus IGR IRESs can be grouped into two classes based on distinct features within each domain. In this study, we report on the modularity of the IGR IRESs and show that the ribosome-binding domain and the tRNA anticodon mimicry domain are functionally interchangeable between the Type I and the Type II IGR IRESs. Using structural probing, ribosome-binding assays, and ribosome positioning analysis by toeprinting assays, we show that the chimeric IRESs fold properly, assemble 80S ribosomes, and can mediate IRES translation in rabbit reticulocyte lysates. We also demonstrate that the chimeric IRESs can stimulate the ribosome-dependent GTPase activity of eEF2, which suggests that the ribosome is primed for a step downstream from IRES binding. Overall, the results demonstrate that the dicistrovirus IGR IRESs are composed of two modular domains that work in concert to manipulate the ribosome and direct translation initiation. PMID:20423979

  6. Structures of the human and Drosophila 80S ribosome.

    PubMed

    Anger, Andreas M; Armache, Jean-Paul; Berninghausen, Otto; Habeck, Michael; Subklewe, Marion; Wilson, Daniel N; Beckmann, Roland

    2013-05-01

    Protein synthesis in all cells is carried out by macromolecular machines called ribosomes. Although the structures of prokaryotic, yeast and protist ribosomes have been determined, the more complex molecular architecture of metazoan 80S ribosomes has so far remained elusive. Here we present structures of Drosophila melanogaster and Homo sapiens 80S ribosomes in complex with the translation factor eEF2, E-site transfer RNA and Stm1-like proteins, based on high-resolution cryo-electron-microscopy density maps. These structures not only illustrate the co-evolution of metazoan-specific ribosomal RNA with ribosomal proteins but also reveal the presence of two additional structural layers in metazoan ribosomes, a well-ordered inner layer covered by a flexible RNA outer layer. The human and Drosophila ribosome structures will provide the basis for more detailed structural, biochemical and genetic experiments. PMID:23636399

  7. “Invisible” silver and gold in supergene digenite (Cu1.8S)

    NASA Astrophysics Data System (ADS)

    Reich, Martin; Chryssoulis, Stephen L.; Deditius, Artur; Palacios, Carlos; Zúñiga, Alejandro; Weldt, Magdalena; Alvear, Macarena

    2010-11-01

    Despite its potential economic and environmental importance, the study of trace metals in supergene (secondary) Cu-sulfides has been seriously overlooked in the past decades. In this study, the concentration and mineralogical form of "invisible" precious metals (Ag, Au) and metalloids (As, Sb, Se, Te) in supergene digenite (Cu 1.8S) from various Cu deposits in the Atacama Desert of northern Chile, the world's premier Cu province, were determined in detail using a combination of microanalytical techniques. Secondary ion mass spectrometry (SIMS) and electron microprobe analyzer (EMPA) measurements reveal that, apart from hosting up to ˜11,000 ppm Ag, supergene digenite can incorporate up to part-per-million contents of Au (˜6 ppm) and associated metalloids such as As (˜300 ppm), Sb (˜60 ppm), Se (˜96 ppm) and Te (˜18 ppm). SIMS analyses of trace metals show that Ag and Au concentrations strongly correlate with As in supergene digenite, defining wedge-shaped zones in Ag-As and Au-As log-log spaces. SIMS depth profiling and high-resolution transmission electron microscopy (HRTEM) observations reveal that samples with anomalously high Ag/As (>˜30) and Au/As (>˜0.03) ratios plot above the wedge zones and contain nanoparticles of metallic Ag and Au, while samples with lower ratios contain Ag and Au that is structurally bound to the Cu-sulfide matrix. The Ag-Au-As relations reported in this study strongly suggest that the incorporation of precious metals in Cu-sulfides formed under supergene, low-temperature conditions respond to the incorporation of a minor component, in this case As. Therefore, As might play a significant role by increasing the solubility of Ag and Au in supergene digenite and controlling the formation and occurrence of Ag and Au nanoparticles. Considering the fact that processes of supergene enrichment in Cu deposits can be active from tens of millions of years (e.g. Atacama Desert), we conclude that supergene digenite may play a previously unforeseen role in scavenging precious metals from undersaturated (or locally slightly supersaturated) solutions in near-surface environments.

  8. Ribosomal DNA haplotype distribution of Bursaphelenchus xylophilus in Kyushu and Okinawa islands, Japan.

    PubMed

    Nose, Mine; Shiraishi, Susumu; Miyahara, Fumihiko; Ohira, Mineko; Matsunaga, Koji; Tobase, Masashi; Koyama, Takao; Yoshimoto, Kikuo

    2009-09-01

    Ribosomal DNA region sequences (partial 18S, 28S and complete ITS1, 5.8S, and ITS2) of the pinewood nematode (Bursaphelenchus xylophilus) were obtained from DNA extracted directly from wood pieces collected from wilted pine trees throughout the Kyushu and Okinawa islands, Japan. Either a 2569bp or 2573bp sequence was obtained from 88 of 143 samples. Together with the 45 rDNA sequences of pinewood nematode isolates previously reported, there were eight single nucleotide polymorphisms and two indels of two bases. Based on these mutations, nine haplotypes were estimated. The haplotype frequencies differed among regions in Kyushu island (northwest, northeast and center, southeast, and southwest), and the distribution was consistent with the invasion and spreading routes of the pinewood nematode previously estimated from past records of pine wilt and wood importation. There was no significant difference in haplotype frequencies among the collection sites on Okinawa island. PMID:22736814

  9. Intraspecific Variation in Ribosomal DNA in Populations of the Potato Cyst Nematode Globodera pallida.

    PubMed

    Blok, V C; Malloch, G; Harrower, B; Phillips, M S; Vrain, T C

    1998-06-01

    The relationships among a number of populations of Globodera pallida from Britian, the Netherlands, Germany, Switzerland, and South America were examined using PCR amplification of the ribosomal cistron between the 18S and 28S genes that include the two intergenic spacer regions (ITS1 and ITS2) and the 5.8S gene. Amplifications produced a similar-sized product of 1150 bp from all populations. Digestion of the amplified fragment with a number of restriction enzymes showed differences among the populations. The restriction enzyme RsaI distinguished the most populations. The RFLP patterns revealed by this enzyme were complex and could have arisen from heterogeneity between individuals within populations and from differences between the repeats of an individual. Sequence analysis from six of the populations, together with RFLP analysis of PCR products, shows that there is intraspecific variation in the rDNA of G. pallida. PMID:19274220

  10. Intraspecific Variation in Ribosomal DNA in Populations of the Potato Cyst Nematode Globodera pallida

    PubMed Central

    Blok, V. C.; Malloch, G.; Harrower, B.; Phillips, M. S.; Vrain, T. C.

    1998-01-01

    The relationships among a number of populations of Globodera pallida from Britian, the Netherlands, Germany, Switzerland, and South America were examined using PCR amplification of the ribosomal cistron between the 18S and 28S genes that include the two intergenic spacer regions (ITS1 and ITS2) and the 5.8S gene. Amplifications produced a similar-sized product of 1150 bp from all populations. Digestion of the amplified fragment with a number of restriction enzymes showed differences among the populations. The restriction enzyme RsaI distinguished the most populations. The RFLP patterns revealed by this enzyme were complex and could have arisen from heterogeneity between individuals within populations and from differences between the repeats of an individual. Sequence analysis from six of the populations, together with RFLP analysis of PCR products, shows that there is intraspecific variation in the rDNA of G. pallida. PMID:19274220

  11. Two thraustochytrid 5S ribosomal RNAs.

    PubMed Central

    MacKay, R M; Doolittle, W F

    1982-01-01

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  12. Two thraustochytrid 5S ribosomal RNAs.

    PubMed

    MacKay, R M; Doolittle, W F

    1982-12-20

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  13. Release of Nonstop Ribosomes Is Essential

    PubMed Central

    Feaga, Heather A.; Viollier, Patrick H.

    2014-01-01

    ABSTRACT Bacterial ribosomes frequently translate to the 3′ end of an mRNA without terminating at a stop codon. Almost all bacteria use the transfer-messenger RNA (tmRNA)-based trans-translation pathway to release these “nonstop” ribosomes and maintain protein synthesis capacity. trans-translation is essential in some species, but in others, such as Caulobacter crescentus, trans-translation can be inactivated. To determine why trans-translation is dispensable in C. crescentus, a Tn-seq screen was used to identify genes that specifically alter growth in cells lacking ssrA, the gene encoding tmRNA. One of these genes, CC1214, was essential in ΔssrA cells. Purified CC1214 protein could release nonstop ribosomes in vitro. CC1214 is a homolog of the Escherichia coli ArfB protein, and using the CC1214 sequence, ArfB homologs were identified in the majority of bacterial phyla. Most species in which ssrA has been deleted contain an ArfB homolog, suggesting that release of nonstop ribosomes may be essential in most or all bacteria. PMID:25389176

  14. Modeling Interactions of Erythromycin Derivatives with Ribosomes.

    PubMed

    Shishkina, A V; Makarova, T M; Tereshchenkov, A G; Makarov, G I; Korshunova, G A; Bogdanov, A A

    2015-11-01

    Using a method of static simulation, a series of erythromycin A analogs was designed with aldehyde functions introduced instead of one of the methyl substituents in the 3'-N-position of the antibiotic that was potentially capable of forming a covalent bond with an amino group of one of the nucleotide residues of the 23S rRNA in the ribosomal exit tunnel. Similar interaction is observed for antibiotics of the tylosin series, which bind tightly to the large ribosomal subunit and demonstrate high antibacterial activity. Binding of novel erythromycin derivatives with the bacterial ribosome was investigated with the method of fluorescence polarization. It was found that the erythromycin analog containing a 1-methyl-3-oxopropyl group in the 3'-N-position demonstrates the best binding. Based on the ability to inhibit protein biosynthesis, it is on the same level as erythromycin, and it is significantly better than desmethyl-erythromycin. Molecular dynamic modeling of complexes of the derivatives with ribosomes was conducted to explain the observed effects. PMID:26615442

  15. 18S rRNA V9 metabarcoding for diet characterization: a critical evaluation with two sympatric zooplanktivorous fish species.

    PubMed

    Albaina, Aitor; Aguirre, Mikel; Abad, David; Santos, María; Estonba, Andone

    2016-03-01

    The potential of the 18S rRNA V9 metabarcoding approach for diet assessment was explored using MiSeq paired-end (PE; 2 × 150 bp) technology. To critically evaluate the method's performance with degraded/digested DNA, the diets of two zooplanktivorous fish species from the Bay of Biscay, European sardine (Sardina pilchardus) and European sprat (Sprattus sprattus), were analysed. The taxonomic resolution and quantitative potential of the 18S V9 metabarcoding was first assessed both in silico and with mock and field plankton samples. Our method was capable of discriminating species within the reference database in a reliable way providing there was at least one variable position in the 18S V9 region. Furthermore, it successfully discriminated diet between both fish species, including habitat and diel differences among sardines, overcoming some of the limitations of traditional visual-based diet analysis methods. The high sensitivity and semi-quantitative nature of the 18S V9 metabarcoding approach was supported by both visual microscopy and qPCR-based results. This molecular approach provides an alternative cost and time effective tool for food-web analysis. PMID:27087935

  16. Sequencing and characterization of full-length sequence of 18S rRNA gene from the reniform nematode

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The 18S rRNA gene is fundamental to cellular and organismal protein synthesis and because of its stable persistence through generations it is also used in phylogenetic analysis among taxa. Variation within this gene is rare but it has been observed in few metazoan species. For the first time, we h...

  17. Eukaryotic diversity in premise drinking water using 18S rDNA sequencing: implications for health risks

    EPA Science Inventory

    The goal of this study was to characterize microbial eukaryotes over a 12 month period, so as to provide insight into the occurrence of potentially important predators and bacterial hosts in hot and cold premise plumbing. Nearly 6,300 partial (600 bp) 18S rRNA gene sequences from...

  18. Promoter architectures in the yeast ribosomal expression program

    PubMed Central

    Bosio, Maria Cristina; Negri, Rodolfo

    2011-01-01

    Ribosome biogenesis begins with the orchestrated expression of hundreds of genes, including the three large classes of ribosomal protein, ribosome biogenesis and snoRNA genes. Current knowledge about the corresponding promoters suggests the existence of novel class-specific transcriptional strategies and crosstalk between telomere length and cell growth control. PMID:21468232

  19. An RNA trapping mechanism in Alphavirus mRNA promotes ribosome stalling and translation initiation

    PubMed Central

    Toribio, René; Díaz-López, Irene; Boskovic, Jasminka; Ventoso, Iván

    2016-01-01

    During translation initiation, eukaryotic initiation factor 2 (eIF2) delivers the Met-tRNA to the 40S ribosomal subunit to locate the initiation codon (AUGi) of mRNA during the scanning process. Stress-induced eIF2 phosphorylation leads to a general blockade of translation initiation and represents a key antiviral pathway in mammals. However, some viral mRNAs can initiate translation in the presence of phosphorylated eIF2 via stable RNA stem-loop structures (DLP; Downstream LooP) located in their coding sequence (CDS), which promote 43S preinitiation complex stalling on the initiation codon. We show here that during the scanning process, DLPs of Alphavirus mRNA become trapped in ES6S region (680–914 nt) of 18S rRNA that are projected from the solvent side of 40S subunit. This trapping can lock the progress of the 40S subunit on the mRNA in a way that places the upstream initiator AUGi on the P site of 40S subunit, obviating the participation of eIF2. Notably, the DLP structure is released from 18S rRNA upon 60S ribosomal subunit joining, suggesting conformational changes in ES6Ss during the initiation process. These novel findings illustrate how viral mRNA is threaded into the 40S subunit during the scanning process, exploiting the topology of the 40S subunit solvent side to enhance its translation in vertebrate hosts. PMID:26984530

  20. Targets and Intracellular Signaling Mechanisms for Deoxynivalenol-Induced Ribosomal RNA Cleavage

    PubMed Central

    He, Kaiyu; Zhou, Hui-Ren; Pestka, James J.

    2012-01-01

    The trichothecene mycotoxin deoxynivalenol (DON), a known translational inhibitor, induces ribosomal RNA (rRNA) cleavage. Here, we characterized this process relative to (1) specific 18S and 28S ribosomal RNA cleavage sites and (2) identity of specific upstream signaling elements in this pathway. Capillary electrophoresis indicated that DON at concentrations as low as 200 ng/ml evoked selective rRNA cleavage after 6 h and that 1000 ng/ml caused cleavage within 2 h. Northern blot analysis revealed that DON exposure induced six rRNA cleavage fragments from 28S rRNA and five fragments from 18S rRNA. When selective kinase inhibitors were used to identify potential upstream signals, RNA-activated protein kinase (PKR), hematopoietic cell kinase (Hck), and p38 were found to be required for rRNA cleavage, whereas c-Jun N-terminal kinase and extracellular signal-regulated kinase were not. Furthermore, rRNA fragmentation was suppressed by the p53 inhibitors pifithrin-α and pifithrin-μ as well as the pan caspase inhibitor Z-VAD-FMK. Concurrent apoptosis was confirmed by acridine orange/ethidium bromide staining and flow cytometry. DON activated caspases 3, 8, and 9, thus suggesting the possible coinvolvement of both extrinsic and intrinsic apoptotic pathways in rRNA cleavage. Satratoxin G (SG), anisomycin, and ricin also induced specific rRNA cleavage profiles identical to those of DON, suggesting that ribotoxins might share a conserved rRNA cleavage mechanism. Taken together, DON-induced rRNA cleavage is likely to be closely linked to apoptosis activation and appears to involve the sequential activation of PKR/Hck →p38→p53→caspase 8/9→caspase 3. PMID:22491426

  1. Targets and intracellular signaling mechanisms for deoxynivalenol-induced ribosomal RNA cleavage.

    PubMed

    He, Kaiyu; Zhou, Hui-Ren; Pestka, James J

    2012-06-01

    The trichothecene mycotoxin deoxynivalenol (DON), a known translational inhibitor, induces ribosomal RNA (rRNA) cleavage. Here, we characterized this process relative to (1) specific 18S and 28S ribosomal RNA cleavage sites and (2) identity of specific upstream signaling elements in this pathway. Capillary electrophoresis indicated that DON at concentrations as low as 200 ng/ml evoked selective rRNA cleavage after 6 h and that 1000 ng/ml caused cleavage within 2 h. Northern blot analysis revealed that DON exposure induced six rRNA cleavage fragments from 28S rRNA and five fragments from 18S rRNA. When selective kinase inhibitors were used to identify potential upstream signals, RNA-activated protein kinase (PKR), hematopoietic cell kinase (Hck), and p38 were found to be required for rRNA cleavage, whereas c-Jun N-terminal kinase and extracellular signal-regulated kinase were not. Furthermore, rRNA fragmentation was suppressed by the p53 inhibitors pifithrin-α and pifithrin-μ as well as the pan caspase inhibitor Z-VAD-FMK. Concurrent apoptosis was confirmed by acridine orange/ethidium bromide staining and flow cytometry. DON activated caspases 3, 8, and 9, thus suggesting the possible coinvolvement of both extrinsic and intrinsic apoptotic pathways in rRNA cleavage. Satratoxin G (SG), anisomycin, and ricin also induced specific rRNA cleavage profiles identical to those of DON, suggesting that ribotoxins might share a conserved rRNA cleavage mechanism. Taken together, DON-induced rRNA cleavage is likely to be closely linked to apoptosis activation and appears to involve the sequential activation of PKR/Hck →p38→p53→caspase 8/9→caspase 3. PMID:22491426

  2. An RNA trapping mechanism in Alphavirus mRNA promotes ribosome stalling and translation initiation.

    PubMed

    Toribio, René; Díaz-López, Irene; Boskovic, Jasminka; Ventoso, Iván

    2016-05-19

    During translation initiation, eukaryotic initiation factor 2 (eIF2) delivers the Met-tRNA to the 40S ribosomal subunit to locate the initiation codon (AUGi) of mRNA during the scanning process. Stress-induced eIF2 phosphorylation leads to a general blockade of translation initiation and represents a key antiviral pathway in mammals. However, some viral mRNAs can initiate translation in the presence of phosphorylated eIF2 via stable RNA stem-loop structures (DLP; Downstream LooP) located in their coding sequence (CDS), which promote 43S preinitiation complex stalling on the initiation codon. We show here that during the scanning process, DLPs of Alphavirus mRNA become trapped in ES6S region (680-914 nt) of 18S rRNA that are projected from the solvent side of 40S subunit. This trapping can lock the progress of the 40S subunit on the mRNA in a way that places the upstream initiator AUGi on the P site of 40S subunit, obviating the participation of eIF2. Notably, the DLP structure is released from 18S rRNA upon 60S ribosomal subunit joining, suggesting conformational changes in ES6Ss during the initiation process. These novel findings illustrate how viral mRNA is threaded into the 40S subunit during the scanning process, exploiting the topology of the 40S subunit solvent side to enhance its translation in vertebrate hosts. PMID:26984530

  3. Introns regulate the production of ribosomal proteins by modulating splicing of duplicated ribosomal protein genes

    PubMed Central

    Petibon, Cyrielle; Parenteau, Julie; Catala, Mathieu; Elela, Sherif Abou

    2016-01-01

    Most budding yeast introns exist in the many duplicated ribosomal protein genes (RPGs) and it has been posited that they remain there to modulate the expression of RPGs and cell growth in response to stress. However, the mechanism by which introns regulate the expression of RPGs and their impact on the synthesis of ribosomal proteins remain unclear. In this study, we show that introns determine the ratio of ribosomal protein isoforms through asymmetric paralog-specific regulation of splicing. Exchanging the introns and 3′ untranslated regions of the duplicated RPS9 genes altered the splicing efficiency and changed the ratio of the ribosomal protein isoforms. Mutational analysis of the RPS9 genes indicated that splicing is regulated by variations in the intron structure and the 3′ untranslated region. Together these data suggest that preferential splicing of duplicated RPGs provides a means for adjusting the ratio of different ribosomal protein isoforms, while maintaining the overall expression level of each ribosomal protein. PMID:26945043

  4. A RanGTP-independent mechanism allows ribosomal protein nuclear import for ribosome assembly.

    PubMed

    Schütz, Sabina; Fischer, Ute; Altvater, Martin; Nerurkar, Purnima; Peña, Cohue; Gerber, Michaela; Chang, Yiming; Caesar, Stefanie; Schubert, Olga T; Schlenstedt, Gabriel; Panse, Vikram G

    2014-01-01

    Within a single generation time a growing yeast cell imports ∼14 million ribosomal proteins (r-proteins) into the nucleus for ribosome production. After import, it is unclear how these intrinsically unstable and aggregation-prone proteins are targeted to the ribosome assembly site in the nucleolus. Here, we report the discovery of a conserved nuclear carrier Tsr2 that coordinates transfer of the r-protein eS26 to the earliest assembling pre-ribosome, the 90S. In vitro studies revealed that Tsr2 efficiently dissociates importin:eS26 complexes via an atypical RanGTP-independent mechanism that terminates the import process. Subsequently, Tsr2 binds the released eS26, shields it from proteolysis, and ensures its safe delivery to the 90S pre-ribosome. We anticipate similar carriers-termed here escortins-to securely connect the nuclear import machinery with pathways that deposit r-proteins onto developing pre-ribosomal particles. PMID:25144938

  5. A RanGTP-independent mechanism allows ribosomal protein nuclear import for ribosome assembly

    PubMed Central

    Schütz, Sabina; Fischer, Ute; Altvater, Martin; Nerurkar, Purnima; Peña, Cohue; Gerber, Michaela; Chang, Yiming; Caesar, Stefanie; Schubert, Olga T; Schlenstedt, Gabriel; Panse, Vikram G

    2014-01-01

    Within a single generation time a growing yeast cell imports ∼14 million ribosomal proteins (r-proteins) into the nucleus for ribosome production. After import, it is unclear how these intrinsically unstable and aggregation-prone proteins are targeted to the ribosome assembly site in the nucleolus. Here, we report the discovery of a conserved nuclear carrier Tsr2 that coordinates transfer of the r-protein eS26 to the earliest assembling pre-ribosome, the 90S. In vitro studies revealed that Tsr2 efficiently dissociates importin:eS26 complexes via an atypical RanGTP-independent mechanism that terminates the import process. Subsequently, Tsr2 binds the released eS26, shields it from proteolysis, and ensures its safe delivery to the 90S pre-ribosome. We anticipate similar carriers—termed here escortins—to securely connect the nuclear import machinery with pathways that deposit r-proteins onto developing pre-ribosomal particles. DOI: http://dx.doi.org/10.7554/eLife.03473.001 PMID:25144938

  6. Arabidopsis protein arginine methyltransferase 3 is required for ribosome biogenesis by affecting precursor ribosomal RNA processing

    PubMed Central

    Hang, Runlai; Liu, Chunyan; Ahmad, Ayaz; Zhang, Yong; Lu, Falong; Cao, Xiaofeng

    2014-01-01

    Ribosome biogenesis is a fundamental and tightly regulated cellular process, including synthesis, processing, and assembly of rRNAs with ribosomal proteins. Protein arginine methyltransferases (PRMTs) have been implicated in many important biological processes, such as ribosome biogenesis. Two alternative precursor rRNA (pre-rRNA) processing pathways coexist in yeast and mammals; however, how PRMT affects ribosome biogenesis remains largely unknown. Here we show that Arabidopsis PRMT3 (AtPRMT3) is required for ribosome biogenesis by affecting pre-rRNA processing. Disruption of AtPRMT3 results in pleiotropic developmental defects, imbalanced polyribosome profiles, and aberrant pre-rRNA processing. We further identify an alternative pre-rRNA processing pathway in Arabidopsis and demonstrate that AtPRMT3 is required for the balance of these two pathways to promote normal growth and development. Our work uncovers a previously unidentified function of PRMT in posttranscriptional regulation of rRNA, revealing an extra layer of complexity in the regulation of ribosome biogenesis. PMID:25352672

  7. Ribosomal DNA clusters and telomeric (TTAGG)n repeats in blue butterflies (Lepidoptera, Lycaenidae) with low and high chromosome numbers

    PubMed Central

    Vershinina, Alisa O.; Anokhin, Boris A.; Lukhtanov, Vladimir A.

    2015-01-01

    Abstract Ribosomal DNA clusters and telomeric repeats are important parts of eukaryotic genome. However, little is known about their organization and localization in karyotypes of organisms with holocentric chromosomes. Here we present first cytogenetic study of these molecular structures in seven blue butterflies of the genus Polyommatus Latreille, 1804 with low and high chromosome numbers (from n=10 to n=ca.108) using fluorescence in situ hybridization (FISH) with 18S rDNA and (TTAGG)n telomeric probes. FISH with the 18S rDNA probe showed the presence of two different variants of the location of major rDNA clusters in Polyommatus species: with one or two rDNA-carrying chromosomes in haploid karyotype. We discuss evolutionary trends and possible mechanisms of changes in the number of ribosomal clusters. We also demonstrate that Polyommatus species have the classical insect (TTAGG)n telomere organization. This chromosome end protection mechanism probably originated de novo in small chromosomes that evolved via fragmentations. PMID:26140159

  8. BUD22 Affects Ty1 Retrotransposition and Ribosome Biogenesis in Saccharomyces cerevisiae

    PubMed Central

    Dakshinamurthy, Arun; Nyswaner, Katherine M.; Farabaugh, Philip J.; Garfinkel, David J.

    2010-01-01

    A variety of cellular factors affect the movement of the retrovirus-like transposon Ty1. To identify genes involved in Ty1 virus-like particle (VLP) function, the level of the major capsid protein (Gag-p45) and its proteolytic precursor (Gag-p49p) was monitored in a subset of Ty1 cofactor mutants. Twenty-nine of 87 mutants contained alterations in the level of Gag; however, only bud22Δ showed a striking defect in Gag processing. BUD22 affected the +1 translational frameshifting event required to express the Pol proteins protease, integrase, and reverse transcriptase. Therefore, it is possible that the bud22Δ mutant may not produce enough functional Ty1 protease to completely process Gag-p49 to p45. Furthermore, BUD22 is required for 18S rRNA processing and 40S subunit biogenesis and influences polysome density. Together our results suggest that BUD22 is involved in a step in ribosome biogenesis that not only affects general translation, but also may alter the frameshifting efficiency of ribosomes, an event central to Ty1 retrotransposition. PMID:20498295

  9. Lophotrochozoa internal phylogeny: new insights from an up-to-date analysis of nuclear ribosomal genes

    PubMed Central

    Paps, Jordi; Baguñà, Jaume; Riutort, Marta

    2009-01-01

    Resolving the relationships among animal phyla is a key biological problem that remains to be solved. Morphology is unable to determine the relationships among most phyla and although molecular data have unveiled a new evolutionary scenario, they have their own limitations. Nuclear ribosomal genes (18S and 28S rDNA) have been used effectively for many years. However, they are considered of limited use for resolving deep divergences such as the origin of the bilaterians, due to certain drawbacks such as the long-branch attraction (LBA) problem. Here, we attempt to overcome these pitfalls by combining several methods suggested in previous studies and routinely used in contemporary standard phylogenetic analyses but that have not yet been applied to any bilaterian phylogeny based on these genes. The methods used include maximum likelihood and Bayesian inference, the application of models with rate heterogeneity across sites, wide taxon sampling and compartmentalized analyses for each problematic clade. The results obtained show that the combination of the above-mentioned methodologies minimizes the LBA effect, and a new Lophotrochozoa phylogeny emerges. Also, the Acoela and Nemertodermatida are confirmed with maximum support as the first branching bilaterians. Ribosomal RNA genes are thus a reliable source for the study of deep divergences in the metazoan tree, provided that the data are treated carefully. PMID:19129141

  10. Relationship between organization and function of ribosomal genes in Drosophila melanogaster

    SciTech Connect

    Karpen, G.H.

    1987-01-01

    In most eukaryotic organisms, the genes that encode the 18S and 28S ribosomal RNAs (rDNA genes) are tandemly repeated, and are located in constitutive heterochromatin and/or centromeric or telomeric regions. P-element mediated transformation was used to investigate the relationship between rDNA organization and function in Drosophila melanogaster. Tritiated-uridine incorporation under heat shock conditions and in situ hybridization to rRNA were used to demonstrate that a single rDNA gene inserted into euchromatin can be transcribed at a high rate, in polytene nuclei. P-element-mediated transformation of a single Drosophila rDNA gene was also utilized to investigate the ability of ribosomal DNA to organize a nucleolus. Cytological approaches demonstrated that structures resembling the endogenous nucleoli were preferentially associated with four different sites of rDNA insertion, in polytene nuclei. These mini-nucleoli also contained components specific to the nucleolus, as shown by in situ hybridization to rRNA and indirect immunofluorescence with an antibody that binds to Drosophila nucleoli. The transformed genes were able to partially rescue mutant phenotypes due to a deficiency of rDNA, indicating that the mini-nucleoli were functional.

  11. Phylogenetic Information Content of Copepoda Ribosomal DNA Repeat Units: ITS1 and ITS2 Impact

    PubMed Central

    Zagoskin, Maxim V.; Lazareva, Valentina I.; Grishanin, Andrey K.; Mukha, Dmitry V.

    2014-01-01

    The utility of various regions of the ribosomal repeat unit for phylogenetic analysis was examined in 16 species representing four families, nine genera, and two orders of the subclass Copepoda (Crustacea). Fragments approximately 2000 bp in length containing the ribosomal DNA (rDNA) 18S and 28S gene fragments, the 5.8S gene, and the internal transcribed spacer regions I and II (ITS1 and ITS2) were amplified and analyzed. The DAMBE (Data Analysis in Molecular Biology and Evolution) software was used to analyze the saturation of nucleotide substitutions; this test revealed the suitability of both the 28S gene fragment and the ITS1/ITS2 rDNA regions for the reconstruction of phylogenetic trees. Distance (minimum evolution) and probabilistic (maximum likelihood, Bayesian) analyses of the data revealed that the 28S rDNA and the ITS1 and ITS2 regions are informative markers for inferring phylogenetic relationships among families of copepods and within the Cyclopidae family and associated genera. Split-graph analysis of concatenated ITS1/ITS2 rDNA regions of cyclopoid copepods suggested that the Mesocyclops, Thermocyclops, and Macrocyclops genera share complex evolutionary relationships. This study revealed that the ITS1 and ITS2 regions potentially represent different phylogenetic signals. PMID:25215300

  12. RNA Mimicry by the Fap7 Adenylate Kinase in Ribosome Biogenesis

    PubMed Central

    Réty, Stéphane; Lebaron, Simon; Deschamps, Patrick; Bareille, Joseph; Jombart, Julie; Robert-Paganin, Julien; Delbos, Lila; Chardon, Florian; Zhang, Elodie; Charenton, Clément; Tollervey, David; Leulliot, Nicolas

    2014-01-01

    During biogenesis of the 40S and 60S ribosomal subunits, the pre-40S particles are exported to the cytoplasm prior to final cleavage of the 20S pre-rRNA to mature 18S rRNA. Amongst the factors involved in this maturation step, Fap7 is unusual, as it both interacts with ribosomal protein Rps14 and harbors adenylate kinase activity, a function not usually associated with ribonucleoprotein assembly. Human hFap7 also regulates Cajal body assembly and cell cycle progression via the p53–MDM2 pathway. This work presents the functional and structural characterization of the Fap7–Rps14 complex. We report that Fap7 association blocks the RNA binding surface of Rps14 and, conversely, Rps14 binding inhibits adenylate kinase activity of Fap7. In addition, the affinity of Fap7 for Rps14 is higher with bound ADP, whereas ATP hydrolysis dissociates the complex. These results suggest that Fap7 chaperones Rps14 assembly into pre-40S particles via RNA mimicry in an ATP-dependent manner. Incorporation of Rps14 by Fap7 leads to a structural rearrangement of the platform domain necessary for the pre-rRNA to acquire a cleavage competent conformation. PMID:24823650

  13. History of the ribosome and the origin of translation

    PubMed Central

    Petrov, Anton S.; Gulen, Burak; Norris, Ashlyn M.; Kovacs, Nicholas A.; Lanier, Kathryn A.; Fox, George E.; Harvey, Stephen C.; Wartell, Roger M.; Hud, Nicholas V.; Williams, Loren Dean

    2015-01-01

    We present a molecular-level model for the origin and evolution of the translation system, using a 3D comparative method. In this model, the ribosome evolved by accretion, recursively adding expansion segments, iteratively growing, subsuming, and freezing the rRNA. Functions of expansion segments in the ancestral ribosome are assigned by correspondence with their functions in the extant ribosome. The model explains the evolution of the large ribosomal subunit, the small ribosomal subunit, tRNA, and mRNA. Prokaryotic ribosomes evolved in six phases, sequentially acquiring capabilities for RNA folding, catalysis, subunit association, correlated evolution, decoding, energy-driven translocation, and surface proteinization. Two additional phases exclusive to eukaryotes led to tentacle-like rRNA expansions. In this model, ribosomal proteinization was a driving force for the broad adoption of proteins in other biological processes. The exit tunnel was clearly a central theme of all phases of ribosomal evolution and was continuously extended and rigidified. In the primitive noncoding ribosome, proto-mRNA and the small ribosomal subunit acted as cofactors, positioning the activated ends of tRNAs within the peptidyl transferase center. This association linked the evolution of the large and small ribosomal subunits, proto-mRNA, and tRNA. PMID:26621738

  14. History of the ribosome and the origin of translation.

    PubMed

    Petrov, Anton S; Gulen, Burak; Norris, Ashlyn M; Kovacs, Nicholas A; Bernier, Chad R; Lanier, Kathryn A; Fox, George E; Harvey, Stephen C; Wartell, Roger M; Hud, Nicholas V; Williams, Loren Dean

    2015-12-15

    We present a molecular-level model for the origin and evolution of the translation system, using a 3D comparative method. In this model, the ribosome evolved by accretion, recursively adding expansion segments, iteratively growing, subsuming, and freezing the rRNA. Functions of expansion segments in the ancestral ribosome are assigned by correspondence with their functions in the extant ribosome. The model explains the evolution of the large ribosomal subunit, the small ribosomal subunit, tRNA, and mRNA. Prokaryotic ribosomes evolved in six phases, sequentially acquiring capabilities for RNA folding, catalysis, subunit association, correlated evolution, decoding, energy-driven translocation, and surface proteinization. Two additional phases exclusive to eukaryotes led to tentacle-like rRNA expansions. In this model, ribosomal proteinization was a driving force for the broad adoption of proteins in other biological processes. The exit tunnel was clearly a central theme of all phases of ribosomal evolution and was continuously extended and rigidified. In the primitive noncoding ribosome, proto-mRNA and the small ribosomal subunit acted as cofactors, positioning the activated ends of tRNAs within the peptidyl transferase center. This association linked the evolution of the large and small ribosomal subunits, proto-mRNA, and tRNA. PMID:26621738

  15. Phylogenetic comparison of local length plasticity of the small subunit of nuclear rDNAs among all Hexapoda orders and the impact of hyper-length-variation on alignment.

    PubMed

    Xie, Qiang; Tian, Xiaoxuan; Qin, Yan; Bu, Wenjun

    2009-02-01

    The SSU nrDNA (18S), is one of the most frequently sequenced molecular markers in phylogenetic studies. However, the length-hyper-variation at multiple positions of this gene can affect the accuracy of alignment greatly and this length variation makes alignment across arthropod orders a serious problem. The analyses of Hexapoda phylogeny is such a case. A more clear recognition of the distribution of the length-variable-regions is needed. In this study, the secondary structure of some length-variable-regions in the SSU nrRNA of Arthropoda was adjusted by the principle of co-variation. It is found that the extent of plasticity of some length-variable-region can extraordinarily be higher than 600 bases in hexapods. And the numbers of hyper length-variable-regions are largest in Strepsiptera and Sternorrhyncha (Hemiptera). Our study shows that some length-variable-regions can serve as synapomorphies for some groups. The phylogenetic comparison also suggested that the expansion of a lateral bulge could be the origin of a helix. PMID:19027081

  16. The Genes for Cytoplasmic Ribosomal Ribonucleic Acid in Higher Plants

    PubMed Central

    Scott, N. Steele; Ingle, J.

    1973-01-01

    The genes for cytoplasmic ribosomal RNA are partially resolved from the bulk of the DNA by CsCl equilibrium centrifugation. Although in some plants the buoyant density of the ribosomal RNA genes is as expected from the base composition of ribosomal RNA, others show a large discrepancy which cannot be due to the presence of low G-C spacer-DNA. The cross-hybridization observed with 1.3 and 0.7 × 106 molecular weight ribosomal RNAs and DNA, which varies greatly with different plant species, is not due to contamination of the ribosomal RNAs, and is specific for the ribosomal DNA of each species, probably largely restricted to those sequences coding for the two stable ribosomal RNAs. The double reciprocal plot may be used for the extrapolation of saturation values only with caution, because in these cases such plots are not linear over the whole of the hybridization reaction. PMID:16658392

  17. Phylogenetic Analysis of the Spider Mite Sub-Family Tetranychinae (Acari: Tetranychidae) Based on the Mitochondrial COI Gene and the 18S and the 5′ End of the 28S rRNA Genes Indicates That Several Genera Are Polyphyletic

    PubMed Central

    Matsuda, Tomoko; Morishita, Maiko; Hinomoto, Norihide; Gotoh, Tetsuo

    2014-01-01

    The spider mite sub-family Tetranychinae includes many agricultural pests. The internal transcribed spacer (ITS) region of nuclear ribosomal RNA genes and the cytochrome c oxidase subunit I (COI) gene of mitochondrial DNA have been used for species identification and phylogenetic reconstruction within the sub-family Tetranychinae, although they have not always been successful. The 18S and 28S rRNA genes should be more suitable for resolving higher levels of phylogeny, such as tribes or genera of Tetranychinae because these genes evolve more slowly and are made up of conserved regions and divergent domains. Therefore, we used both the 18S (1,825–1,901 bp) and 28S (the 5′ end of 646–743 bp) rRNA genes to infer phylogenetic relationships within the sub-family Tetranychinae with a focus on the tribe Tetranychini. Then, we compared the phylogenetic tree of the 18S and 28S genes with that of the mitochondrial COI gene (618 bp). As observed in previous studies, our phylogeny based on the COI gene was not resolved because of the low bootstrap values for most nodes of the tree. On the other hand, our phylogenetic tree of the 18S and 28S genes revealed several well-supported clades within the sub-family Tetranychinae. The 18S and 28S phylogenetic trees suggest that the tribes Bryobiini, Petrobiini and Eurytetranychini are monophyletic and that the tribe Tetranychini is polyphyletic. At the genus level, six genera for which more than two species were sampled appear to be monophyletic, while four genera (Oligonychus, Tetranychus, Schizotetranychus and Eotetranychus) appear to be polyphyletic. The topology presented here does not fully agree with the current morphology-based taxonomy, so that the diagnostic morphological characters of Tetranychinae need to be reconsidered. PMID:25289639

  18. Unusual dispersion of histone repeats on the whole chromosomal complement and their colocalization with ribosomal genes in Rachycentron canadum (Rachycentridae, Perciformes).

    PubMed

    Costa, Gideão W W F; Cioffi, Marcelo B; Bertollo, Luiz A C; Molina, Wagner F

    2014-01-01

    Rachycentron canadum, the only representative of the family Rachycentridae, has been the focus of biotechnological interest due to its significant potential in marine fish farming. The chromosome set of this species has been widely investigated with respect to the location of genes and multigene families. A FISH analysis was performed using 4 multigene families as probes, represented by 5S and 18S ribosomal genes and histones H2B-H2A and H3. Earlier data suggested that differential replication of heterochromatin could be partially associated with functional genes. Indeed, our results showed that the DNA contained in heterochromatic regions of R. canadum contains 5S and 18S ribosomal genes as well as the gene sequences of histones H2B-H2A and H3, which were colocalized. The distribution of H3 sequences in all heterochromatic regions, except in 13q, could indicate an important evolutionary role for this class of repetitive sequences. Besides, the presence of chromosome regions bearing multifunctional repetitive sequences formed by H2B-H2A/H3/18S rDNA and H2B-H2A/H3/5S rDNA clusters was demonstrated for the first time in fishes. The implications of differential histone gene extension and its functionality in the karyotype of R. canadum remain unknown. PMID:25341625

  19. Ribosomal Mutations in Streptococcus pneumoniae Clinical Isolates

    PubMed Central

    Pihlajamäki, Marja; Kataja, Janne; Seppälä, Helena; Elliot, John; Leinonen, Maija; Huovinen, Pentti; Jalava, Jari

    2002-01-01

    Eleven clinical isolates of Streptococcus pneumoniae, isolated in Finland during 1996 to 2000, had an unusual macrolide resistance phenotype. They were resistant to macrolides and streptogramin B but susceptible, intermediate, or low-level resistant to lincosamides. No acquired macrolide resistance genes were detected from the strains. The isolates were found to have mutations in domain V of the 23S rRNA or ribosomal protein L4. Seven isolates had an A2059C mutation in two to four out of the four alleles encoding the 23S rRNA, two isolates had an A2059G mutation in two alleles, one isolate had a C2611G mutation in all four alleles, and one isolate had a 69GTG71-to-69TPS71 substitution in ribosomal protein L4. PMID:11850244

  20. Navigating the ribosome's metastable energy landscape.

    PubMed

    Munro, James B; Sanbonmatsu, Kevin Y; Spahn, Christian M T; Blanchard, Scott C

    2009-08-01

    The molecular mechanisms by which tRNA molecules enter and transit the ribosome during mRNA translation remains elusive. However, recent genetic, biochemical and structural studies offer important new findings into the ordered sequence of events underpinning the translocation process that help place the molecular mechanism within reach. In particular, new structural and kinetic insights have been obtained regarding tRNA movements through 'hybrid state' configurations. These dynamic views reveal that the macromolecular ribosome particle, like many smaller proteins, has an intrinsic capacity to reversibly sample an ensemble of similarly stable native states. Such perspectives suggest that substrates, factors and environmental cues contribute to translation regulation by helping the dynamic system navigate through a highly complex and metastable energy landscape. PMID:19647434

  1. Disassembly of yeast 80S ribosomes into subunits is a concerted action of ribosome-assisted folding of denatured protein.

    PubMed

    Chakraborty, Biprashekhar; Bhakta, Sayan; Sengupta, Jayati

    2016-01-22

    It has been shown by several groups that ribosome can assist folding of denatured protein in vitro and the process is conserved across the species. Domain V of large ribosomal rRNA which occupies the intersubunit side of the large subunit was identified as the key player responsible for chaperoning the folding process. Thus, it is conceivable that denatured protein needs to access the intersubunit space of the ribosome in order to get folded. In this study, we have investigated the mechanism of release of the protein from the eukaryotic ribosome following reactivation. We have observed significant splitting of yeast 80S ribosome when incubated with the denatured BCAII protein. Energy-free disassembly mechanism functions in low Mg(+2) ion concentration for prokaryotic ribosomes. Eukaryotic ribosomes do not show significant splitting even at low Mg(+2) ion concentration. In this respect, denatured protein-induced disassembly of eukaryotic ribosome without the involvement of any external energy source is intriguing. For prokaryotic ribosomes, it was reported that the denatured protein induces ribosome splitting into subunits in order to access domain V-rRNA. In contrast, our results suggest an alternative mechanism for eukaryotic ribosomal rRNA-mediated protein folding and subsequent separation of the subunits by which release of the activated-protein occurs. PMID:26723252

  2. Structure and Function of the Mitochondrial Ribosome.

    PubMed

    Greber, Basil J; Ban, Nenad

    2016-06-01

    Mitochondrial ribosomes (mitoribosomes) perform protein synthesis inside mitochondria, the organelles responsible for energy conversion and adenosine triphosphate production in eukaryotic cells. Throughout evolution, mitoribosomes have become functionally specialized for synthesizing mitochondrial membrane proteins, and this has been accompanied by large changes to their structure and composition. We review recent high-resolution structural data that have provided unprecedented insight into the structure and function of mitoribosomes in mammals and fungi. PMID:27023846

  3. Typification of virulent and low virulence Babesia bigemina clones by 18S rRNA and rap-1c.

    PubMed

    Thompson, C; Baravalle, M E; Valentini, B; Mangold, A; Torioni de Echaide, S; Ruybal, P; Farber, M; Echaide, I

    2014-06-01

    The population structure of original Babesia bigemina isolates and reference strains with a defined phenotypic profile was assessed using 18S rRNA and rap-1c genes. Two reference strains, BbiS2P-c (virulent) and BbiS1A-c (low virulence), were biologically cloned in vitro. The virulence profile of the strains and clones was assessed in vivo. One fully virulent and one low-virulence clone were mixed in identical proportions to evaluate their growth efficiency in vitro. Each clone was differentiated by two microsatellites and the gene gp45. The 18S rRNA and rap-1c genes sequences from B. bigemina biological clones and their parental strains, multiplied exclusively in vivo or in vitro, were compared with strain JG-29. The virulence of clones derived from the BbiS2P-c strain was variable. Virulent clone Bbi9P1 grew more efficiently in vitro than did the low-virulence clone Bbi2A1. The haplotypes generated by the nucleotide polymorphism, localized in the V4 region of the 18S rRNA, allowed the identification of three genotypes. The rap-1c haplotypes allowed defining four genotypes. Parental and original strains were defined by multiple haplotypes identified in both genes. The rap-1c gene, analyzed by high-resolution melting (HRM), allowed discrimination between two genotypes according to their phenotype, and both were different from JG-29. B. bigemina biological clones made it possible to define the population structure of isolates and strains. The polymorphic regions of the 18S rRNA and rap-1c genes allowed the identification of different subpopulations within original B. bigemina isolates by the definition of several haplotypes and the differentiation of fully virulent from low virulence clones. PMID:24681200

  4. Cryo-EM structure of Hepatitis C virus IRES bound to the human ribosome at 3.9-Å resolution

    PubMed Central

    Quade, Nick; Boehringer, Daniel; Leibundgut, Marc; van den Heuvel, Joop; Ban, Nenad

    2015-01-01

    Hepatitis C virus (HCV), a widespread human pathogen, is dependent on a highly structured 5′-untranslated region of its mRNA, referred to as internal ribosome entry site (IRES), for the translation of all of its proteins. The HCV IRES initiates translation by directly binding to the small ribosomal subunit (40S), circumventing the need for many eukaryotic translation initiation factors required for mRNA scanning. Here we present the cryo-EM structure of the human 40S ribosomal subunit in complex with the HCV IRES at 3.9 Å resolution, determined by focused refinement of an 80S ribosome–HCV IRES complex. The structure reveals the molecular details of the interactions between the IRES and the 40S, showing that expansion segment 7 (ES7) of the 18S rRNA acts as a central anchor point for the HCV IRES. The structural data rationalizes previous biochemical and genetic evidence regarding the initiation mechanism of the HCV and other related IRESs. PMID:26155016

  5. Comparison of Sequences from the Ribosomal DNA Intergenic Region of Meloidogyne mayaguensis and Other Major Tropical Root-Knot Nematodes

    PubMed Central

    Blok, V. C.; Phillips, M. S.; Fargette, M.

    1997-01-01

    The unusual arrangement of the 5S ribosomal gene within the intergenic sequence (IGS) of the ribosomal cistron, previously reported for Meloidogyne arenaria, was also found in the ribosomal DNA of two other economically important species of tropical root-knot nematodes, M, incognita and M. javanica. This arrangement also was found in M. hapla, which is important in temperate regions, and M. mayaguensis, a virulent species of concern in West Africa. Amplification of the region between the 5S and 18S genes by PCR yielded products of three different sizes such that M. mayaguensis could be readily differentiated from the other species in this study. This product can be amplified from single juveniles, females, or egg masses. The sequences obtained in this region for one line of each of M. incognita, M. arenaria, and M. javanica were very similar, reflecting the close relationships of these lineages. The M. mayaguensis sequence for this region had a number of small deletions and insertions of various sizes, including possible sequence duplications. PMID:19274129

  6. Time-series of water column alkenones and 18S rRNA confirm that Uk'37 is a viable SST proxy in Narragansett Bay, RI

    NASA Astrophysics Data System (ADS)

    Salacup, J.; Theroux, S.; Herbert, T.; Prell, W. L.

    2011-12-01

    Alkenones, produced in the sunlit mixed layer by specific Haptophyte algae, are a well-established and widely-applied proxy for sea surface temperature (SST) in the world's open-oceans. However, the proxy's utility in estuarine environments remains largely untested. A reliable SST proxy is needed to identify the estuary's sensitivity and response to past and present global change because SST can exert strong control on stratification and circulation patterns, and thus oxygenation and ecosystem health, in these shallow basins. Knowing the estuaries response should help local managers and policy-makers plan mitigation and adaptation strategies. Additionally, the rapid deposition of both marine and terrestrial organic and inorganic material in estuarine systems makes them potential archives of high-resolution paleo-environmental information. A previous investigation of estuarine alkenones suggested that the Uk'37 proxy may be sensitive to the composition of the alkenone-producing Haptophyte population, which may be affected by local nutrient and fresh water fluxes. In particular, low-salinity coastal Haptophytes such as Isochrysis galbana may have a different relationship to SST than higher-salinity open-ocean Haptophytes and their presence may complicate interpretations of the Uk'37 proxy in estuaries. To better understand how the alkenone-based Uk'37 SST proxy is produced in estuarine systems, we present a two-year time-series (monthly-to-thrice-weekly resolution) of alkenone concentrations in particulate organic matter from Narragansett Bay. Alkenone concentrations are coupled with 18S ribosomal RNA (rRNA) measurements to identify the alkenone-producing population. Highest concentrations of alkenones are detected at different times in the upper and lower Bay such that the highest alkenone concentrations occur in the winter-spring (upper Bay) and summer/fall (lower Bay). This result is consistent with the established seasonal blooms and seasonal changes in nutrient

  7. Structural snapshots of actively translating human ribosomes.

    PubMed

    Behrmann, Elmar; Loerke, Justus; Budkevich, Tatyana V; Yamamoto, Kaori; Schmidt, Andrea; Penczek, Pawel A; Vos, Matthijn R; Bürger, Jörg; Mielke, Thorsten; Scheerer, Patrick; Spahn, Christian M T

    2015-05-01

    Macromolecular machines, such as the ribosome, undergo large-scale conformational changes during their functional cycles. Although their mode of action is often compared to that of mechanical machines, a crucial difference is that, at the molecular dimension, thermodynamic effects dominate functional cycles, with proteins fluctuating stochastically between functional states defined by energetic minima on an energy landscape. Here, we have used cryo-electron microscopy to image ex-vivo-derived human polysomes as a source of actively translating ribosomes. Multiparticle refinement and 3D variability analysis allowed us to visualize a variety of native translation intermediates. Significantly populated states include not only elongation cycle intermediates in pre- and post-translocational states, but also eEF1A-containing decoding and termination/recycling complexes. Focusing on the post-translocational state, we extended this assessment to the single-residue level, uncovering striking details of ribosome-ligand interactions and identifying both static and functionally important dynamic elements. PMID:25957688

  8. Structural snapshots of actively translating human ribosomes

    PubMed Central

    Behrmann, Elmar; Loerke, Justus; Budkevich, Tatyana V.; Yamamoto, Kaori; Schmidt, Andrea; Penczek, Pawel A.; Vos, Matthijn R.; Bürger, Jörg; Mielke, Thorsten; Scheerer, Patrick; Spahn, Christian M.T.

    2015-01-01

    Summary Macromolecular machines, such as the ribosome, undergo large-scale conformational changes during their functional cycles. While their mode of action is often compared to that of mechanical machines, a crucial difference is that at the molecular dimension, thermodynamic effects dominate functional cycles, with proteins fluctuating stochastically between functional states defined by energetic minima on an energy landscape. Here, we have used cryo-electron microscopy to image ex vivo-derived human polysomes as a source of actively translating ribosomes. Multiparticle refinement and three-dimensional variability analysis allowed us to visualize a variety of native translation intermediates. Significantly populated states include not only elongation cycle intermediates in pre- and post-translocational states, but also eEF1A-containing decoding and termination/recycling complexes. Focusing on the post-translocational state, we extended this assessment to the single-residue level, uncovering striking details of ribosome-ligand interactions and identifying both static and functionally important dynamic elements. PMID:25957688

  9. Stochastic gating and drug-ribosome interactions.

    PubMed

    Vaiana, Andrea C; Sanbonmatsu, Kevin Y

    2009-02-27

    Gentamicin is a potent antibiotic that is used in combination therapy for inhalation anthrax disease. The drug is also often used in therapy for methicillin-resistant Staphylococcusaureus. Gentamicin works by flipping a conformational switch on the ribosome, disrupting the reading head (i.e., 16S ribosomal decoding bases 1492-1493) used for decoding messenger RNA. We use explicit solvent all-atom molecular simulation to study the thermodynamics of the ribosomal decoding site and its interaction with gentamicin. The replica exchange molecular dynamics simulations used an aggregate sampling of 15 mus when summed over all replicas, allowing us to explicitly calculate the free-energy landscape, including a rigorous treatment of enthalpic and entropic effects. Here, we show that the decoding bases flip on a timescale faster than that of gentamicin binding, supporting a stochastic gating mechanism for antibiotic binding, rather than an induced-fit model where the bases only flip in the presence of a ligand. The study also allows us to explore the nonspecific binding landscape near the binding site and reveals that, rather than a two-state bound/unbound scenario, drug dissociation entails shuttling between many metastable local minima in the free-energy landscape. Special care is dedicated to validation of the obtained results, both by direct comparison to experiment and by estimation of simulation convergence. PMID:19146858

  10. Mitochondrial ribosome assembly in health and disease

    PubMed Central

    De Silva, Dasmanthie; Tu, Ya-Ting; Amunts, Alexey; Fontanesi, Flavia; Barrientos, Antoni

    2015-01-01

    The ribosome is a structurally and functionally conserved macromolecular machine universally responsible for catalyzing protein synthesis. Within eukaryotic cells, mitochondria contain their own ribosomes (mitoribosomes), which synthesize a handful of proteins, all essential for the biogenesis of the oxidative phosphorylation system. High-resolution cryo-EM structures of the yeast, porcine and human mitoribosomal subunits and of the entire human mitoribosome have uncovered a wealth of new information to illustrate their evolutionary divergence from their bacterial ancestors and their adaptation to synthesis of highly hydrophobic membrane proteins. With such structural data becoming available, one of the most important remaining questions is that of the mitoribosome assembly pathway and factors involved. The regulation of mitoribosome biogenesis is paramount to mitochondrial respiration, and thus to cell viability, growth and differentiation. Moreover, mutations affecting the rRNA and protein components produce severe human mitochondrial disorders. Despite its biological and biomedical significance, knowledge on mitoribosome biogenesis and its deviations from the much-studied bacterial ribosome assembly processes is scarce, especially the order of rRNA processing and assembly events and the regulatory factors required to achieve fully functional particles. This article focuses on summarizing the current available information on mitoribosome assembly pathway, factors that form the mitoribosome assembly machinery, and the effect of defective mitoribosome assembly on human health. PMID:26030272

  11. The PIN domain endonuclease Utp24 cleaves pre-ribosomal RNA at two coupled sites in yeast and humans.

    PubMed

    Wells, Graeme R; Weichmann, Franziska; Colvin, David; Sloan, Katherine E; Kudla, Grzegorz; Tollervey, David; Watkins, Nicholas J; Schneider, Claudia

    2016-06-20

    During ribosomal RNA (rRNA) maturation, cleavages at defined sites separate the mature rRNAs from spacer regions, but the identities of several enzymes required for 18S rRNA release remain unknown. PilT N-terminus (PIN) domain proteins are frequently endonucleases and the PIN domain protein Utp24 is essential for early cleavages at three pre-rRNA sites in yeast (A0, A1 and A2) and humans (A0, 1 and 2a). In yeast, A1 is cleaved prior to A2 and both cleavages require base-pairing by the U3 snoRNA to the central pseudoknot elements of the 18S rRNA. We found that yeast Utp24 UV-crosslinked in vivo to U3 and the pseudoknot, placing Utp24 close to cleavage at site A1. Yeast and human Utp24 proteins exhibited in vitro endonuclease activity on an RNA substrate containing yeast site A2. Moreover, an intact PIN domain in human UTP24 was required for accurate cleavages at sites 1 and 2a in vivo, whereas mutation of another potential site 2a endonuclease, RCL1, did not affect 18S production. We propose that Utp24 cleaves sites A1/1 and A2/2a in yeast and human cells. PMID:27034467

  12. The PIN domain endonuclease Utp24 cleaves pre-ribosomal RNA at two coupled sites in yeast and humans

    PubMed Central

    Wells, Graeme R.; Weichmann, Franziska; Colvin, David; Sloan, Katherine E.; Kudla, Grzegorz; Tollervey, David; Watkins, Nicholas J.; Schneider, Claudia

    2016-01-01

    During ribosomal RNA (rRNA) maturation, cleavages at defined sites separate the mature rRNAs from spacer regions, but the identities of several enzymes required for 18S rRNA release remain unknown. PilT N-terminus (PIN) domain proteins are frequently endonucleases and the PIN domain protein Utp24 is essential for early cleavages at three pre-rRNA sites in yeast (A0, A1 and A2) and humans (A0, 1 and 2a). In yeast, A1 is cleaved prior to A2 and both cleavages require base-pairing by the U3 snoRNA to the central pseudoknot elements of the 18S rRNA. We found that yeast Utp24 UV-crosslinked in vivo to U3 and the pseudoknot, placing Utp24 close to cleavage at site A1. Yeast and human Utp24 proteins exhibited in vitro endonuclease activity on an RNA substrate containing yeast site A2. Moreover, an intact PIN domain in human UTP24 was required for accurate cleavages at sites 1 and 2a in vivo, whereas mutation of another potential site 2a endonuclease, RCL1, did not affect 18S production. We propose that Utp24 cleaves sites A1/1 and A2/2a in yeast and human cells. PMID:27034467

  13. Cellular identification of a novel uncultured marine stramenopile (MAST-12 Clade) small-subunit rRNA gene sequence from a norwegian estuary by use of fluorescence in situ hybridization-scanning electron microscopy.

    PubMed

    Kolodziej, Karolina; Stoeck, Thorsten

    2007-04-01

    Revealing the cellular identity of organisms behind environmental eukaryote rRNA gene sequences is a major objective in microbial diversity research. We sampled an estuarine oxygen-depleted microbial mat in southwestern Norway and retrieved an 18S rRNA gene signature that branches in the MAST-12 clade, an environmental marine stramenopile clade. Detailed phylogenetic analyses revealed that MAST-12 branches among the heterotrophic stramenopiles as a sister of the free-living Bicosoecida and the parasitic genus Blastocystis. Specific sequence signatures confirmed a relationship to these two groups while excluding direct assignment. We designed a specific oligonucleotide probe for the target sequence and detected the corresponding organism in incubation samples using fluorescence in situ hybridization (FISH). Using the combined FISH-scanning electron microscopy approach (T. Stoeck, W. H. Fowle, and S. S. Epstein, Appl. Environ. Microbiol. 69:6856-6863, 2003), we determined the morphotype of the target organism among the very diverse possible morphologies of the heterotrophic stramenopiles. The unpigmented cell is spherical and about 5 mum in diameter and possesses a short flagellum and a long flagellum, both emanating anteriorly. The long flagellum bears mastigonemes in a characteristic arrangement, and its length (30 mum) distinguishes the target organism from other recognized heterotrophic stramenopiles. The short flagellum is naked and often directed posteriorly. The organism possesses neither a lorica nor a stalk. The morphological characteristics that we discovered should help isolate a representative of a novel stramenopile group, possibly at a high taxonomic level, in order to study its ultrastructure, physiological capabilities, and ecological role in the environment. PMID:17293516

  14. Polar bears, antibiotics, and the evolving ribosome (Nobel Lecture).

    PubMed

    Yonath, Ada

    2010-06-14

    High-resolution structures of ribosomes, the cellular machines that translate the genetic code into proteins, revealed the decoding mechanism, detected the mRNA path, identified the sites of the tRNA molecules in the ribosome, elucidated the position and the nature of the nascent proteins exit tunnel, illuminated the interactions of the ribosome with non-ribosomal factors, such as the initiation, release and recycling factors, and provided valuable information on ribosomal antibiotics, their binding sites, modes of action, principles of selectivity and the mechanisms leading to their resistance. Notably, these structures proved that the ribosome is a ribozyme whose active site, namely where the peptide bonds are being formed, is situated within a universal symmetrical region that is embedded in the otherwise asymmetric ribosome structure. As this symmetrical region is highly conserved and provides the machinery required for peptide bond formation and for ribosome polymerase activity, it may be the remnant of the proto-ribosome, a dimeric prebiotic machine that formed peptide bonds and non-coded polypeptide chains. Structures of complexes of ribosomes with antibiotics targeting them revealed the principles allowing for their clinical use, identified resistance mechanisms and showed the structural bases for discriminating pathogenic bacteria from hosts, hence providing valuable structural information for antibiotics improvement and for the design of novel compounds that can serve as antibiotics. PMID:20535730

  15. An overview of pre-ribosomal RNA processing in eukaryotes

    PubMed Central

    Henras, Anthony K; Plisson-Chastang, Célia; O'Donohue, Marie-Françoise; Chakraborty, Anirban; Gleizes, Pierre-Emmanuel

    2015-01-01

    Ribosomal RNAs are the most abundant and universal noncoding RNAs in living organisms. In eukaryotes, three of the four ribosomal RNAs forming the 40S and 60S subunits are borne by a long polycistronic pre-ribosomal RNA. A complex sequence of processing steps is required to gradually release the mature RNAs from this precursor, concomitant with the assembly of the 79 ribosomal proteins. A large set of trans-acting factors chaperone this process, including small nucleolar ribonucleoparticles. While yeast has been the gold standard for studying the molecular basis of this process, recent technical advances have allowed to further define the mechanisms of ribosome biogenesis in animals and plants. This renewed interest for a long-lasting question has been fueled by the association of several genetic diseases with mutations in genes encoding both ribosomal proteins and ribosome biogenesis factors, and by the perspective of new anticancer treatments targeting the mechanisms of ribosome synthesis. A consensus scheme of pre-ribosomal RNA maturation is emerging from studies in various kinds of eukaryotic organisms. However, major differences between mammalian and yeast pre-ribosomal RNA processing have recently come to light. WIREs RNA 2015, 6:225–242. doi: 10.1002/wrna.1269 PMID:25346433

  16. Structure of a mitochondrial ribosome with minimal RNA.

    PubMed

    Sharma, Manjuli R; Booth, Timothy M; Simpson, Larry; Maslov, Dmitri A; Agrawal, Rajendra K

    2009-06-16

    The Leishmania tarentolae mitochondrial ribosome (Lmr) is a minimal ribosomal RNA (rRNA)-containing ribosome. We have obtained a cryo-EM map of the Lmr. The map reveals several features that have not been seen in previously-determined structures of eubacterial or eukaryotic (cytoplasmic or organellar) ribosomes to our knowledge. Comparisons of the Lmr map with X-ray crystallographic and cryo-EM maps of the eubacterial ribosomes and a cryo-EM map of the mammalian mitochondrial ribosome show that (i) the overall structure of the Lmr is considerably more porous, (ii) the topology of the intersubunit space is significantly different, with fewer intersubunit bridges, but more tunnels, and (iii) several of the functionally-important rRNA regions, including the alpha-sarcin-ricin loop, have different relative positions within the structure. Furthermore, the major portions of the mRNA channel, the tRNA passage, and the nascent polypeptide exit tunnel contain Lmr-specific proteins, suggesting that the mechanisms for mRNA recruitment, tRNA interaction, and exiting of the nascent polypeptide in Lmr must differ markedly from the mechanisms deduced for ribosomes in other organisms. Our study identifies certain structural features that are characteristic solely of mitochondrial ribosomes and other features that are characteristic of both mitochondrial and chloroplast ribosomes (i.e., organellar ribosomes). PMID:19497863

  17. Modification of ribosomal RNA by ribosome-inactivating proteins from plants.

    PubMed Central

    Stirpe, F; Bailey, S; Miller, S P; Bodley, J W

    1988-01-01

    We have surveyed 14 different toxic and nontoxic ribosome-inactivating proteins from plants for the ability to act on the RNA of the eucaryotic 60 S ribosomal subunit. All of these proteins act to introduce a specific modification into 26-28 S RNA which renders the RNA sensitive to cleavage by aniline. Sequence analysis of the 5'-termini of the fragments produced by ricin and saporin following aniline cleavage indicate that both proteins possess identical specificity. Our observations support the conclusion of Endo and Tsurugi (J. Biol. Chem. 262, 8128-8130, 1987) that ricin is a specific N-glycosidase and we have located the site of this cleavage by direct sequence analysis. Our results further suggest that all plant ribosome-inactivating proteins function as specific N-glycosidases with the same specificity. Images PMID:3347493

  18. Chemical modulators of ribosome biogenesis as biological probes.

    PubMed

    Stokes, Jonathan M; Brown, Eric D

    2015-12-01

    Small-molecule inhibitors of protein biosynthesis have been instrumental in the dissection of the complexities of ribosome structure and function. Ribosome biogenesis, on the other hand, is a complex and largely enigmatic process for which there is a paucity of chemical probes. Indeed, ribosome biogenesis has been studied almost exclusively using genetic and biochemical approaches without the benefit of small-molecule inhibitors of this process. Here, we provide a perspective on the promise of chemical inhibitors of ribosome assembly for future research. We explore key obstacles that complicate the interpretation of studies aimed at perturbing ribosome biogenesis in vivo using genetic methods, and we argue that chemical inhibitors are especially powerful because they can be used to induce perturbations in a manner that obviates these difficulties. Thus, in combination with leading-edge biochemical and structural methods, chemical probes offer unique advantages toward elucidating the molecular events that define the assembly of ribosomes. PMID:26575239

  19. Phylogeny of organisms investigated by the base-pair changes in the stem regions of small and large ribosomal subunit RNAs.

    PubMed

    Otsuka, J; Terai, G; Nakano, T

    1999-02-01

    In order to obtain the evolutionary distance data that are as purely additive as possible, we have developed a novel method for evaluating the evolutionary distances from the base-pair changes in stem regions of ribosomal RNAs (rRNAs). The application of this method to small-subunit (SSU) and large-subunit (LSU) rRNAs provides the distance data, with which both the unweighted pair group method of analysis and the neighbor-joining method give almost the same tree topology of most organisms except for some Protoctista, thermophilic bacteria, parasitic organisms, and endosymbionts. Although the evolutionary distances calculated with LSU rRNAs are somewhat longer than those with SSU rRNAs, the difference, probably due to a slight difference in functional constraint, is substantially decreased when the distances are converted into the divergence times of organisms by the measure of the time scale estimated in each type of rRNAs. The divergence times of main branches agree fairly well with the geological record of organisms, at least after the appearance of oxygen-releasing photosynthesis, although the divergence times of Eukaryota, Archaebacteria, and Eubacteria are somewhat overestimated in comparison with the geological record of Earth formation. This result is explained by considering that the mutation rate is determined by the accumulation of misrepairs for DNA damage caused by radiation and that the effect of radiation had been stronger before the oxygen molecules became abundant in the atmosphere of the Earth. PMID:9929391

  20. New Degenerate Cytophaga-Flexibacter-Bacteroides-Specific 16S Ribosomal DNA-Targeted Oligonucleotide Probes Reveal High Bacterial Diversity in River Taff Epilithon

    PubMed Central

    O’Sullivan, Louise A.; Weightman, Andrew J.; Fry, John C.

    2002-01-01

    River microbial communities play an important role in global nutrient cycles, and aggregated bacteria such as those in epilithic biofilms may be major contributors. In this study the bacterial diversity of River Taff epilithon in South Wales was investigated. A 16S ribosomal DNA (rDNA) clone library was constructed and analyzed by partial sequencing of 76 of 347 clones and hybridization with taxon-specific probes. The epilithon was found to be very diverse, with an estimated 59.6% of the bacterial populations not accounted for by these clones. Members of the Cytophaga-Flexibacter-Bacteroides division (CFBs) were most abundant in the library, representing 25% of clones, followed by members of the α subdivision of the division Proteobacteria (α-Proteobacteria), γ-Proteobacteria, gram-positive bacteria, Cyanobacteria, β-Proteobacteria, δ-Proteobacteria, and the Prosthecobacter group. This study concentrated on the epilithic CFB populations, and a new set of degenerate 16S rDNA probes was developed to enhance their detection, namely, CFB560, CFB562, and CFB376. The commonly used probe CF319a/b may frequently lead to the underestimation of CFB populations in environmental studies, because it does not fully detect members of the division. CFB560 had exact matches to 95.6% of CFBs listed in the Ribosomal Database Project (release 8.0) small-subunit phylogenetic trees, compared to 60% for CF319a/b. The CFB probes detected 66 of 347 epilithon TAF clones, and 60 of these were partially sequenced. They affiliated with the RDP-designated groups Cytophaga, Sphingobacterium, Lewinella, and Cytophaga aurantiaca. CFB560 and CF319a/b detected 94% (62 of 66) and 48.5% (32 of 66) of clones, respectively, and therefore CFB560 is recommended for future use. Probe design in this study illustrated that multiple degenerate positions can greatly increase target range without adversely effecting specificity or experimental performance. PMID:11772628

  1. Direct Activation of Ribosome-Associated Double-Stranded RNA-Dependent Protein Kinase (PKR) by Deoxynivalenol, Anisomycin and Ricin: A New Model for Ribotoxic Stress Response Induction

    PubMed Central

    Zhou, Hui-Ren; He, Kaiyu; Landgraf, Jeff; Pan, Xiao; Pestka, James J.

    2014-01-01

    Double-stranded RNA (dsRNA)-activated protein kinase (PKR) is a critical upstream mediator of the ribotoxic stress response (RSR) to the trichothecene deoxynivalenol (DON) and other translational inhibitors. Here, we employed HeLa cell lysates to: (1) characterize PKR’s interactions with the ribosome and ribosomal RNA (rRNA); (2) demonstrate cell-free activation of ribosomal-associated PKR and (3) integrate these findings in a unified model for RSR. Robust PKR-dependent RSR was initially confirmed in intact cells. PKR basally associated with 40S, 60S, 80S and polysome fractions at molar ratios of 7, 2, 23 and 3, respectively. Treatment of ATP-containing HeLa lysates with DON or the ribotoxins anisomycin and ricin concentration-dependently elicited phosphorylation of PKR and its substrate eIF2α. These phosphorylations could be blocked by PKR inhibitors. rRNA immunoprecipitation (RNA-IP) of HeLa lysates with PKR-specific antibody and sequencing revealed that in the presence of DON or not, the kinase associated with numerous discrete sites on both the 18S and 28S rRNA molecules, a number of which contained double-stranded hairpins. These findings are consistent with a sentinel model whereby multiple PKR molecules basally associate with the ribosome positioning them to respond to ribotoxin-induced alterations in rRNA structure by dimerizing, autoactivating and, ultimately, evoking RSR. PMID:25521494

  2. Features of 80S mammalian ribosome and its subunits

    PubMed Central

    Budkevich, Tatyana V.; El'skaya, Anna V.; Nierhaus, Knud H.

    2008-01-01

    It is generally believed that basic features of ribosomal functions are universally valid, but a systematic test still stands out for higher eukaryotic 80S ribosomes. Here we report: (i) differences in tRNA and mRNA binding capabilities of eukaryotic and bacterial ribosomes and their subunits. Eukaryotic 40S subunits bind mRNA exclusively in the presence of cognate tRNA, whereas bacterial 30S do bind mRNA already in the absence of tRNA. 80S ribosomes bind mRNA efficiently in the absence of tRNA. In contrast, bacterial 70S interact with mRNA more productively in the presence rather than in the absence of tRNA. (ii) States of initiation (Pi), pre-translocation (PRE) and post-translocation (POST) of the ribosome were checked and no significant functional differences to the prokaryotic counterpart were observed including the reciprocal linkage between A and E sites. (iii) Eukaryotic ribosomes bind tetracycline with an affinity 15 times lower than that of bacterial ribosomes (Kd 30 μM and 1–2 μM, respectively). The drug does not effect enzymatic A-site occupation of 80S ribosomes in contrast to non-enzymatic tRNA binding to the A-site. Both observations explain the relative resistance of eukaryotic ribosomes to this antibiotic. PMID:18632761

  3. Alterations in the ribosomal machinery in cancer and hematologic disorders

    PubMed Central

    2012-01-01

    Ribosomes are essential components of the protein translation machinery and are composed of more than 80 unique large and small ribosomal proteins. Recent studies show that in addition to their roles in protein translation, ribosomal proteins are also involved in extra-ribosomal functions of DNA repair, apoptosis and cellular homeostasis. Consequently, alterations in the synthesis or functioning of ribosomal proteins can lead to various hematologic disorders. These include congenital anemias such as Diamond Blackfan anemia and Shwachman Diamond syndrome; both of which are associated with mutations in various ribosomal genes. Acquired uniallelic deletion of RPS14 gene has also been shown to lead to the 5q syndrome, a distinct subset of MDS associated with macrocytic anemia. Recent evidence shows that specific ribosomal proteins are overexpressed in liver, colon, prostate and other tumors. Ribosomal protein overexpression can promote tumorigenesis by interactions with the p53 tumor suppressor pathway and also by direct effects on various oncogenes. These data point to a broad role of ribosome protein alterations in hematologic and oncologic diseases. PMID:22709827

  4. Dynamic Behavior of Trigger Factor on the Ribosome.

    PubMed

    Deeng, J; Chan, K Y; van der Sluis, E O; Berninghausen, O; Han, W; Gumbart, J; Schulten, K; Beatrix, B; Beckmann, R

    2016-09-11

    Trigger factor (TF) is the only ribosome-associated chaperone in bacteria. It interacts with hydrophobic segments in nascent chain (NCs) as they emerge from the ribosome. TF binds via its N-terminal ribosome-binding domain (RBD) mainly to ribosomal protein uL23 at the tunnel exit on the large ribosomal subunit. Whereas earlier structural data suggested that TF binds as a rigid molecule to the ribosome, recent comparisons of structural data on substrate-bound, ribosome-bound, and TF in solution from different species suggest that this chaperone is a rather flexible molecule. Here, we present two cryo-electron microscopy structures of TF bound to ribosomes translating an mRNA coding for a known TF substrate from Escherichia coli of a different length. The structures reveal distinct degrees of flexibility for the different TF domains, a conformational rearrangement of the RBD upon ribosome binding, and an increase in rigidity within TF when the NC is extended. Molecular dynamics simulations agree with these data and offer a molecular basis for these observations. PMID:27320387

  5. -1 Programmed Ribosomal Frameshifting as a Force-Dependent Process.

    PubMed

    Visscher, Koen

    2016-01-01

    -1 Programmed ribosomal frameshifting is a translational recoding event in which ribosomes slip backward along messenger RNA presumably due to increased tension disrupting the codon-anticodon interaction at the ribosome's coding site. Single-molecule physical methods and recent experiments characterizing the physical properties of mRNA's slippery sequence as well as the mechanical stability of downstream mRNA structure motifs that give rise to frameshifting are discussed. Progress in technology, experimental assays, and data analysis methods hold promise for accurate physical modeling and quantitative understanding of -1 programmed ribosomal frameshifting. PMID:26970190

  6. Dissociability of free and peptidyl-tRNA bound ribosomes.

    PubMed

    Surguchov, A P; Fominykch, E S; Lyzlova, L V

    1978-06-16

    The influence of peptidyl-tRNA on the dissociation of yeast 80 S ribosomes into subunits was studied. For this purpose temperature-sensitive (ts) suppressor strain of yeast Saccharomyces cervisiae carrying a defect in peptide chain termination was used. It was found that peptidyl-tRNA did not influence the dissociation of ribosomes either at high salt concentration or in the presence of dissociation factor (DF) from yeast. After dissociation of yeast ribosomes in 0.5 M KCl, peptidyl-tRNA remains bound to the 60 S subunit. Some characteristics of the termination process and release of nascent polypeptides from yeast ribosomes are discussed. PMID:355860

  7. Ribosome hibernation factor promotes Staphylococcal survival and differentially represses translation.

    PubMed

    Basu, Arnab; Yap, Mee-Ngan F

    2016-06-01

    In opportunistic Gram-positive Staphylococcus aureus, a small protein called hibernation-promoting factor (HPFSa) is sufficient to dimerize 2.5-MDa 70S ribosomes into a translationally inactive 100S complex. Although the 100S dimer is observed in only the stationary phase in Gram-negative gammaproteobacteria, it is ubiquitous throughout all growth phases in S. aureus The biological significance of the 100S ribosome is poorly understood. Here, we reveal an important role of HPFSa in preserving ribosome integrity and poising cells for translational restart, a process that has significant clinical implications for relapsed staphylococcal infections. We found that the hpf null strain is severely impaired in long-term viability concomitant with a dramatic loss of intact ribosomes. Genome-wide ribosome profiling shows that eliminating HPFSa drastically increased ribosome occupancy at the 5' end of specific mRNAs under nutrient-limited conditions, suggesting that HPFSa may suppress translation initiation. The protective function of HPFSa on ribosomes resides at the N-terminal conserved basic residues and the extended C-terminal segment, which are critical for dimerization and ribosome binding, respectively. These data provide significant insight into the functional consequences of 100S ribosome loss for protein synthesis and stress adaptation. PMID:27001516

  8. Ribosome hibernation factor promotes Staphylococcal survival and differentially represses translation

    PubMed Central

    Basu, Arnab; Yap, Mee-Ngan F.

    2016-01-01

    In opportunistic Gram-positive Staphylococcus aureus, a small protein called hibernation-promoting factor (HPFSa) is sufficient to dimerize 2.5-MDa 70S ribosomes into a translationally inactive 100S complex. Although the 100S dimer is observed in only the stationary phase in Gram-negative gammaproteobacteria, it is ubiquitous throughout all growth phases in S. aureus. The biological significance of the 100S ribosome is poorly understood. Here, we reveal an important role of HPFSa in preserving ribosome integrity and poising cells for translational restart, a process that has significant clinical implications for relapsed staphylococcal infections. We found that the hpf null strain is severely impaired in long-term viability concomitant with a dramatic loss of intact ribosomes. Genome-wide ribosome profiling shows that eliminating HPFSa drastically increased ribosome occupancy at the 5′ end of specific mRNAs under nutrient-limited conditions, suggesting that HPFSa may suppress translation initiation. The protective function of HPFSa on ribosomes resides at the N-terminal conserved basic residues and the extended C-terminal segment, which are critical for dimerization and ribosome binding, respectively. These data provide significant insight into the functional consequences of 100S ribosome loss for protein synthesis and stress adaptation. PMID:27001516

  9. Commandeering the Ribosome: Lessons Learned from Dicistroviruses about Translation.

    PubMed

    Kerr, Craig H; Jan, Eric

    2016-06-15

    To replicate, all viruses depend entirely on the enslavement of host cell ribosomes for their own advantage. To this end, viruses have evolved a multitude of translational strategies to usurp the ribosome. RNA-based structures known as internal ribosome entry sites (IRESs) are among the most notable mechanisms employed by viruses to seize host ribosomes. In this article, we spotlight the intergenic region IRES from the Dicistroviridae family of viruses and its importance as a model for IRES-dependent translation and in understanding fundamental properties of translation. PMID:27053555

  10. Replication of ribosomal DNA in Xenopus laevis.

    PubMed

    Bozzoni, I; Baldari, C T; Amaldi, F; Buongiorno-Nardelli, M

    1981-09-01

    The study of the localization of the replication origins of rDNA in Xenopus laevis has been approached by two different methods. 1. The DNA of X. laevis larvae was fractionated by CsCl gradient centrifugation in bulk and ribosomal DNA and examined in the electron microscope. In bulk DNA, clusters of microbubbles, which are related with the origins of replication, appear to be spaced along the DNA molecules at intervals comparable with the size of the 'average' replicon of X. laevis. In ribosomal DNA, the distance between adjacent clusters is much shorter and corresponds to the size of the rDNA repeating unit. When ribosomal DNA was submitted to digestion with restriction enzymes (Eco RI and HindIII) the microbubbles are observed in the non-transcribed spacer-containing fragment. 2. Cultured cells of X. laevis were synchronized by mitotic selection and incubated with 5-fluoro-2-deoxyuridine for a time longer than the G1 phase. This treatment synchronizes the replicons and allows them to start replicating very slowly. It was thus possible to obtain a preferential labelling of the regions containing the origins. The analysis by gel electrophoresis of the Eco Ri-digested rDNA showed that the radioactivity was preferentially incorporated in the fragments which contain the non-transcribed spacer. The results of these two approaches indicate that the rRNA gene cluster consists of multiple units of replication, possibly one per gene unit. Furthermore they show that the origins of replication are localized into the non-transcribed spacer. PMID:7297565

  11. Homoiterons and expansion in ribosomal RNAs.

    PubMed

    Parker, Michael S; Sallee, Floyd R; Park, Edwards A; Parker, Steven L

    2015-01-01

    Ribosomal RNAs in both prokaryotes and eukaryotes feature numerous repeats of three or more nucleotides with the same nucleobase (homoiterons). In prokaryotes these repeats are much more frequent in thermophile compared to mesophile or psychrophile species, and have similar frequency in both large RNAs. These features point to use of prokaryotic homoiterons in stabilization of both ribosomal subunits. The two large RNAs of eukaryotic cytoplasmic ribosomes have expanded to a different degree across the evolutionary ladder. The big RNA of the larger subunit (60S LSU) evolved expansion segments of up to 2400 nucleotides, and the smaller subunit (40S SSU) RNA acquired expansion segments of not more than 700 nucleotides. In the examined eukaryotes abundance of rRNA homoiterons generally follows size and nucleotide bias of the expansion segments, and increases with GC content and especially with phylogenetic rank. Both the nucleotide bias and frequency of homoiterons are much larger in metazoan and angiosperm LSU compared to the respective SSU RNAs. This is especially pronounced in the tetrapod vertebrates and seems to culminate in the hominid mammals. The stability of secondary structure in polyribonucleotides would significantly connect to GC content, and should also relate to G and C homoiteron content. RNA modeling points to considerable presence of homoiteron-rich double-stranded segments especially in vertebrate LSU RNAs, and homoiterons with four or more nucleotides in the vertebrate and angiosperm LSU RNAs are largely confined to the expansion segments. These features could mainly relate to protein export function and attachment of LSU to endoplasmic reticulum and other subcellular networks. PMID:26636029

  12. Homoiterons and expansion in ribosomal RNAs

    PubMed Central

    Parker, Michael S.; Sallee, Floyd R.; Park, Edwards A.; Parker, Steven L.

    2015-01-01

    Ribosomal RNAs in both prokaryotes and eukaryotes feature numerous repeats of three or more nucleotides with the same nucleobase (homoiterons). In prokaryotes these repeats are much more frequent in thermophile compared to mesophile or psychrophile species, and have similar frequency in both large RNAs. These features point to use of prokaryotic homoiterons in stabilization of both ribosomal subunits. The two large RNAs of eukaryotic cytoplasmic ribosomes have expanded to a different degree across the evolutionary ladder. The big RNA of the larger subunit (60S LSU) evolved expansion segments of up to 2400 nucleotides, and the smaller subunit (40S SSU) RNA acquired expansion segments of not more than 700 nucleotides. In the examined eukaryotes abundance of rRNA homoiterons generally follows size and nucleotide bias of the expansion segments, and increases with GC content and especially with phylogenetic rank. Both the nucleotide bias and frequency of homoiterons are much larger in metazoan and angiosperm LSU compared to the respective SSU RNAs. This is especially pronounced in the tetrapod vertebrates and seems to culminate in the hominid mammals. The stability of secondary structure in polyribonucleotides would significantly connect to GC content, and should also relate to G and C homoiteron content. RNA modeling points to considerable presence of homoiteron-rich double-stranded segments especially in vertebrate LSU RNAs, and homoiterons with four or more nucleotides in the vertebrate and angiosperm LSU RNAs are largely confined to the expansion segments. These features could mainly relate to protein export function and attachment of LSU to endoplasmic reticulum and other subcellular networks. PMID:26636029

  13. Cytogenetic Analysis and Chromosomal Characteristics of the Polymorphic 18S rDNA of Haliotis discus hannai from Fujian, China

    PubMed Central

    Wang, Haishan; Luo, Xuan; You, Weiwei; Dong, Yunwei; Ke, Caihuan

    2015-01-01

    We report on novel chromosomal characteristics of Haliotis discus hannai from a breeding population at Fujian, China. The karyotypes of H. discus hannai we obtained from an abalone farm include a common type 2n = 36 = 10M + 8SM (82%) and two rare types 2n = 36 = 11M + 7SM (14%) and 2n = 36 = 10M + 7SM + 1ST (4%). The results of silver staining showed that the NORs of H. discus hannai were usually located terminally on the long arms of chromosome pairs 14 and 17, NORs were also sometimes located terminally on the short arms of other chromosomes, either metacentric or submetacentric pairs. The number of Ag-nucleoli ranged from 2 to 8, and the mean number was 3.61 ± 0.93. Among the scored interphase cells, 41% had 3 detectable nucleoli and 37% had 4 nucleoli. The 18S rDNA FISH result is the first report of the location of 18S rDNA genes in H. discus hannai. The 18S rDNA locations were highly polymorphic in this species. Copies of the gene were observed in the terminal of long or/and short arms of submetacentric or/and metacentric chromosomes. Using FISH with probe for vertebrate-like telomeric sequences (CCCTAA)3 displayed positive green FITC signals at telomere regions of all analyzed chromosome types. We found about 7% of chromosomes had breaks in prophase. A special form of nucleolus not previously described from H. discus hannai was observed in some interphase cells. It consists of many small silver-stained nucleoli gathered together to form a larger nucleolus and may correspond to prenucleolar bodies. PMID:25699679

  14. Towards a classification of E. coli ribosomal proteins: A hypothetical `small ribosome' as a primitive protein-synthesizing apparatus

    NASA Astrophysics Data System (ADS)

    Ohnishi, Koji

    1984-12-01

    Homologies were searched among the published primary sequences of 51 E. coli ribosomal proteins, partly by ‘eye’ and partly by computer-assisted methods. By employing Moore and Goodman's alignment statistics for evaluating homology levels, 33 out of these 51 ribosomal proteins has been classified into 9 homology groups, some of which being yet tentative and remaining to be further analyzed. Taking it into consideration that most ribosomal protein genes are clustered at str- stc region, rif region and several other regions, these results strongly suggest that most or all of the contemporary ribosomal proteins must have evolved by repeated gene duplications of very few (or only one) primitive ancestral ribosomal protein gene(s). Thus it is most reasonable to propose that a ‘ small ribosome’ consisting of very few (or only one) ribosomal protein(s) must have existed as a primitive protein-synthesizing apparatus.

  15. Primers to block the amplification of symbiotic apostome ciliate 18S rRNA gene in a PCR-based copepod diet study

    NASA Astrophysics Data System (ADS)

    Yi, Xiaoyan; Zhang, Huan; Liu, Guangxing

    2014-05-01

    Pelagic copepods play an important role in the marine food web. However, a full understanding of the ecological status of this zooplankton group depends on the careful study of their natural diets. In previous PCR-based copepod diet studies, we found many apostome ciliates that live symbiotically under the exoskeleton of the copepods, and their sequences were often over-represented in the 18S rRNA gene (18S rDNA) libraries. As a first step to address this issue, we designed three apostome ciliate 18S rDNA blocking primers, and tested their blocking efficiency against apostome ciliate 18s rDNA under various PCR conditions. Using a semi-quantitative PCR method, we optimized the conditions to efficiently amplify the 18S rDNA of the prey while simultaneously excluding the symbiotic apostome ciliates. This technique will facilitate PCR-based diet studies of copepods and other zooplankton in their natural environments.

  16. Ribosomal RNA: a key to phylogeny

    NASA Technical Reports Server (NTRS)

    Olsen, G. J.; Woese, C. R.

    1993-01-01

    As molecular phylogeny increasingly shapes our understanding of organismal relationships, no molecule has been applied to more questions than have ribosomal RNAs. We review this role of the rRNAs and some of the insights that have been gained from them. We also offer some of the practical considerations in extracting the phylogenetic information from the sequences. Finally, we stress the importance of comparing results from multiple molecules, both as a method for testing the overall reliability of the organismal phylogeny and as a method for more broadly exploring the history of the genome.

  17. Effect of condensed tannins on bovine rumen protist diversity based on 18S rRNA gene sequences.

    PubMed

    Tan, Hui Yin; Sieo, Chin Chin; Abdullah, Norhani; Liang, Juan Boo; Huang, Xiao Dan; Ho, Yin Wan

    2013-01-01

    Molecular diversity of protists from bovine rumen fluid incubated with condensed tannins of Leucaena leucocephala hybrid-Rendang at 20 mg/500 mg dry matter (treatment) or without condensed tannins (control) was investigated using 18S rRNA gene library. Clones from the control library were distributed within nine genera, but clones from the condensed tannin treatment clone library were related to only six genera. Diversity estimators such as abundance-based coverage estimation and Chao1 showed significant differences between the two libraries, although no differences were found based on Shannon-Weaver index and Libshuff. PMID:23205499

  18. Molecular architecture of the ribosome-bound Hepatitis C Virus internal ribosomal entry site RNA.

    PubMed

    Yamamoto, Hiroshi; Collier, Marianne; Loerke, Justus; Ismer, Jochen; Schmidt, Andrea; Hilal, Tarek; Sprink, Thiemo; Yamamoto, Kaori; Mielke, Thorsten; Bürger, Jörg; Shaikh, Tanvir R; Dabrowski, Marylena; Hildebrand, Peter W; Scheerer, Patrick; Spahn, Christian M T

    2015-12-14

    Internal ribosomal entry sites (IRESs) are structured cis-acting RNAs that drive an alternative, cap-independent translation initiation pathway. They are used by many viruses to hijack the translational machinery of the host cell. IRESs facilitate translation initiation by recruiting and actively manipulating the eukaryotic ribosome using only a subset of canonical initiation factor and IRES transacting factors. Here we present cryo-EM reconstructions of the ribosome 80S- and 40S-bound Hepatitis C Virus (HCV) IRES. The presence of four subpopulations for the 80S•HCV IRES complex reveals dynamic conformational modes of the complex. At a global resolution of 3.9 Å for the most stable complex, a derived atomic model reveals a complex fold of the IRES RNA and molecular details of its interaction with the ribosome. The comparison of obtained structures explains how a modular architecture facilitates mRNA loading and tRNA binding to the P-site. This information provides the structural foundation for understanding the mechanism of HCV IRES RNA-driven translation initiation. PMID:26604301

  19. The effect of trichloroethylene and acrylonitrile on RNA and ribosome synthesis and ribosome content in Saccharomyces cells.

    PubMed

    Lochmann, E R; Ehrlich, W; Mangir, M

    1984-04-01

    The effects of trichloroethylene (TCE) and acrylonitrile (ACN) on growth, RNA synthesis, ribosome synthesis, and ribosome content were tested in yeast cells. TCE causes a delay of the growth of a cell culture (prolongation of the lag phase), but does not cause inhibition. Cells exposed to increasing concentrations of ACN show increasing damage, so that, at a certain point of the growth curve, cell division stops altogether. Similar results were obtained when RNA synthesis was investigated: After treatment with TCE, the maximum RNA synthesis of the cell culture was retarded, but subsequently reached the same level as the untreated control cells. In the presence of ACN, however, the rate of RNA synthesis was lowered with increasing ACN concentrations. The same effect was observed upon investigation of ribosome synthesis: Whereas TCE produces only a slight effect, treatment with increasing concentrations of ACN leads to a substantial decrease in ribosome synthesis, and finally to total inhibition. Parallel to this, the content of free and membrane-bound ribosomes is diminished. Obviously, the decrease in ribosome content is caused not only by an inhibition of ribosome synthesis, but also by a degradation of existing ribosomes, as well as by induction of a ribosome-associated RNase. PMID:6714140

  20. Studies on membrane proteins involved in ribosome binding on the rough endoplasmic reticulum. Ribophorins have no ribosome-binding activity.

    PubMed Central

    Yoshida, H; Tondokoro, N; Asano, Y; Mizusawa, K; Yamagishi, R; Horigome, T; Sugano, H

    1987-01-01

    A membrane protein fraction showing affinity for ribosomes was isolated from rat liver microsomes (microsomal fractions) in association with ribosomes by treatment of the microsomes with Emulgen 913 and then solubilized from the ribosomes with sodium deoxycholate. This protein fraction was separated into two fractions, glycoproteins, including ribophorins I and II, and non-glycoproteins, virtually free from ribophorins I and II, on concanavalin A-Sepharose columns. The two fractions were each reconstituted into liposomes to determine their ribosome-binding activities. The specific binding activity of the non-glycoprotein fraction was approx. 2.3-fold higher than that of the glycoprotein fraction. The recovery of ribosome-binding capacity of the two fractions was about 85% of the total binding capacity of the material applied to a concanavalin A-Sepharose column, and about 90% of it was found in the non-glycoprotein fraction. The affinity constants of the ribosomes for the reconstituted liposomes were somewhat higher than those for stripped rough microsomes. The mode of ribosome binding to the reconstituted liposomes was very similar to that to the stripped rough microsomes, in its sensitivity to proteolytic enzymes and its strong inhibition by increasing KCl concentration. These results support the idea that ribosome binding to rat liver microsomes is not directly mediated by ribophorins I and II, but that another unidentified membrane protein(s) plays a role in ribosome binding. Images Fig. 1. Fig. 3. Fig. 5. PMID:3663192

  1. The B chromosomes of the African cichlid fish Haplochromis obliquidens harbour 18S rRNA gene copies

    PubMed Central

    2010-01-01

    Background Diverse plant and animal species have B chromosomes, also known as accessory, extra or supernumerary chromosomes. Despite being widely distributed among different taxa, the genomic nature and genetic behavior of B chromosomes are still poorly understood. Results In this study we describe the occurrence of B chromosomes in the African cichlid fish Haplochromis obliquidens. One or two large B chromosome(s) occurring in 39.6% of the analyzed individuals (both male and female) were identified. To better characterize the karyotype and assess the nature of the B chromosomes, fluorescence in situ hybridization (FISH) was performed using probes for telomeric DNA repeats, 18S and 5S rRNA genes, SATA centromeric satellites, and bacterial artificial chromosomes (BACs) enriched in repeated DNA sequences. The B chromosomes are enriched in repeated DNAs, especially non-active 18S rRNA gene-like sequences. Conclusion Our results suggest that the B chromosome could have originated from rDNA bearing subtelo/acrocentric A chromosomes through formation of an isochromosome, or by accumulation of repeated DNAs and rRNA gene-like sequences in a small proto-B chromosome derived from the A complement. PMID:20051104

  2. Optical and electrical stability of viral-templated copper sulfide (Cu{sub 1.8}S) films

    SciTech Connect

    Shahriar Zaman, Mohammed; Bernard Grajeda, Gabriel; Haberer, Elaine D.

    2014-04-14

    The optical and electrical stabilities of viral-templated non-stoichiometric copper sulfide, digenite (Cu{sub 1.8}S) films were investigated. The films were composed of large agglomerates of randomly aligned Cu{sub 1.8}S-coated M13 filamentous phage. Free carrier optical absorption associated with localized surface plasmon resonance (LSPR) was observed in the near infrared spectral region, and the films were electrically active, displaying a linear current-voltage relationship. Under ambient conditions, the magnitude of the LSPR absorption increased, following a power law relationship with time, and the electrical resistance of viral-templated films decreased significantly. In contrast, the resistance of films stored under low oxygen, low humidity conditions experienced a smaller reduction in electrical resistance. Changes in optical and electrical film properties under ambient conditions were associated with an increase in free carrier concentration within the copper chalcogenide material due to oxygen exposure. X-ray photoelectron spectroscopy was used to relate this increase in free carrier concentration to compositional changes on the viral-templated material surface.

  3. Identification of cephalopod species from the North and Baltic Seas using morphology, COI and 18S rDNA sequences

    NASA Astrophysics Data System (ADS)

    Gebhardt, Katharina; Knebelsberger, Thomas

    2015-09-01

    We morphologically analyzed 79 cephalopod specimens from the North and Baltic Seas belonging to 13 separate species. Another 29 specimens showed morphological features of either Alloteuthis mediaor Alloteuthis subulata or were found to be in between. Reliable identification features to distinguish between A. media and A. subulata are currently not available. The analysis of the DNA barcoding region of the COI gene revealed intraspecific distances (uncorrected p) ranging from 0 to 2.13 % (average 0.1 %) and interspecific distances between 3.31 and 22 % (average 15.52 %). All species formed monophyletic clusters in a neighbor-joining analysis and were supported by bootstrap values of ≥99 %. All COI haplotypes belonging to the 29 Alloteuthis specimens were grouped in one cluster. Neither COI nor 18S rDNA sequences helped to distinguish between the different Alloteuthis morphotypes. For species identification purposes, we recommend the use of COI, as it showed higher bootstrap support of species clusters and less amplification and sequencing failure compared to 18S. Our data strongly support the assumption that the genus Alloteuthis is only represented by a single species, at least in the North Sea. It remained unclear whether this species is A. subulata or A. media. All COI sequences including important metadata were uploaded to the Barcode of Life Data Systems and can be used as reference library for the molecular identification of more than 50 % of the cephalopod fauna known from the North and Baltic Seas.

  4. Evaluating multiple alternative hypotheses for the origin of Bilateria: An analysis of 18S rRNA molecular evidence

    PubMed Central

    Collins, Allen G.

    1998-01-01

    Six alternative hypotheses for the phylogenetic origin of Bilateria are evaluated by using complete 18S rRNA gene sequences for 52 taxa. These data suggest that there is little support for three of these hypotheses. Bilateria is not likely to be the sister group of Radiata or Ctenophora, nor is it likely that Bilateria gave rise to Cnidaria or Ctenophora. Instead, these data reveal a close relationship between bilaterians, placozoans, and cnidarians. From this, several inferences can be drawn. Morphological features that previously have been identified as synapomorphies of Bilateria and Ctenophora, e.g., mesoderm, more likely evolved independently in each clade. The endomesodermal muscles of bilaterians may be homologous to the endodermal muscles of cnidarians, implying that the original bilaterian mesodermal muscles were myoepithelial. Placozoans should have a gastrulation stage during development. Of the three hypotheses that cannot be falsified with the 18S rRNA data, one is most strongly supported. This hypothesis states that Bilateria and Placozoa share a more recent common ancestor than either does to Cnidaria. If true, the simplicity of placozoan body architecture is secondarily derived from a more complex ancestor. This simplification may have occurred in association with a planula-type larva becoming reproductive before metamorphosis. If this simplification took place during the common history that placozoans share with bilaterians, then placozoan genes that contain a homeobox, such as Trox2, should be explored, for they may include the gene or genes most closely related to Hox genes of bilaterians. PMID:9860990

  5. Genetic diversity of Cryptosporidium in fish at the 18S and actin loci and high levels of mixed infections.

    PubMed

    Yang, Rongchang; Palermo, Cindy; Chen, Linda; Edwards, Amanda; Paparini, Andrea; Tong, Kaising; Gibson-Kueh, Susan; Lymbery, Alan; Ryan, Una

    2015-12-15

    Cryptosporidium is an enteric parasite that infects humans and a wide range of animals. Relatively little is known about the epidemiology and taxonomy of Cryptosporidium in fish. In the present study, a total of 775 fish, belonging to 46 species and comprising ornamental fish, marine fish and freshwater fish were screened for the prevalence of Cryptosporidium by PCR. The overall prevalence of Cryptosporidium in fish was 5.3% (41/775), with prevalences ranging from 1.5 to 100% within individual host species. Phylogenetic analysis of these Cryptosporidium isolates as well as 14 isolates from previous studies indicated extensive genetic diversity as well as evidence for mixed infections. At the 18S locus the following species were identified; Cryptosporidium molnari-like genotype (n=14), Cryptosporidium huwi (n=8), piscine genotype 2 (n=4), piscine genotype 3-like (n=1), piscine genotype 4 (n=2), piscine genotype 5 (n=13), piscine genotype 5-like (n=1) and five novel genotypes (n=5). At the actin locus, species identification agreed with the 18S locus for only 52.3% of isolates sequenced, indicating high levels of mixed infections. Future studies will need to employ both morphological characterization and deep sequencing amplicon-based technologies to better understand the epidemiological and phylogenetic relationships of piscine-derived Cryptosporidium species and genotypes, particularly when mixed infections are detected. PMID:26527238

  6. Distribution of 18S rDNA sites and absence of the canonical TTAGG insect telomeric repeat in parasitoid Hymenoptera.

    PubMed

    Gokhman, Vladimir E; Anokhin, Boris A; Kuznetsova, Valentina G

    2014-08-01

    Karyotypes of six species belonging to three main clades of parasitoid Hymenoptera, the superfamilies Ichneumonoidea (Ichneumonidae: Ichneumon amphibolus), Cynipoidea (Cynipidae: Diplolepis rosae) and Chalcidoidea (Eurytomidae: Eurytoma robusta, Eu. serratulae and Eu. compressa, and Torymidae: Torymus bedeguaris) were studied using FISH with 18S rDNA and telomeric (TTAGG)n probes. Haploid karyotypes of D. rosae, Eu. robusta and Eu. serratulae carried the only 18S rDNA hybridization signal, whereas those of I. amphibolus and Eu. compressa carried three and two rDNA clusters respectively. In addition, three rDNA sites were visualized in the aneuploid female of T. bedeguaris. The number of rDNA clusters in parasitoid Hymenoptera generally correlates to the chromosome number. Apart from the overwhelming majority of the studied species of aculeate Hymenoptera, no hybridization signals were obtained from FISH with the telomeric (TTAGG)n probe in the examined parasitoid species. These data suggest absence of the canonical (TTAGG)n insect telomeric motif in the Ichneumonoidea, Cynipoidea and Chalcidoidea, and perhaps in parasitoid Hymenoptera in general. PMID:24992984

  7. Telonemia-specific environmental 18S rDNA PCR reveals unknown diversity and multiple marine-freshwater colonizations

    PubMed Central

    2010-01-01

    Background Recent surveys of eukaryote 18S rDNA diversity in marine habitats have uncovered worldwide distribution of the heterotrophic eukaryote phylum Telonemia. Here we investigate the diversity and geographic distribution of Telonemia sequences by in-depth sequencing of several new 18S rDNA clone libraries from both marine and freshwater sites by using a Telonemia-specific PCR strategy. Results In contrast to earlier studies that have employed eukaryote-wide PCR design, we identified a large and unknown diversity of phylotypes and the first rigorous evidence for several freshwater species, altogether comprising 91 unique sequences. Phylogenies of these and publicly available sequences showed 20 statistically supported sub-clades as well as several solitary phylotypes with no clear phylogenetic affiliation. Most of these sub-clades were composed of phylotypes from different geographic regions. Conclusions By using specific PCR primers we reveal a much larger diversity of Telonemia from environmental samples than previously uncovered by eukaryote-wide primers. The new data substantially diminish the geographic structuring of clades identified in earlier studies. Nevertheless, since these clades comprise several distinct phylotypes we cannot exclude endemicity at species level. We identified two freshwater clades and a few solitary phylotypes, implying that Telonemia have colonized freshwater habitats and adapted to the different environmental and ecological conditions at independent occasions. PMID:20534135

  8. The Small Ribosomal Subunit RNA Isoforms in Plasmodium Cynomolgi

    PubMed Central

    Corredor, V.; Enea, V.

    1994-01-01

    We report the isolation, characterization and analysis of the small subunit rRNA genes in Plasmodium cynomolgi (Ceylon). As in other Plasmodium species, these genes are present in low copy number, are unlinked and form two types that are distinct in sequence and are expressed stage specifically. The asexually expressed (type A) genes are present in four copies in the Ceylon(-) and in five copies in the Berok(-) strain. Surprisingly, the sexually expressed (type B) gene is present in a single copy. The vast majority of the differences between gene types is confined to the variable regions. The pattern of divergence is different from that observed in Plasmodium berghei or in Plasmodium falciparum. Analysis of the small subunit rRNA sequences of P. cynomolgi, P. berghei and P. falciparum, indicates that the two gene types do not evolve independently but rather interact (through gene conversion or some form of recombination) to such an extent as to erase whatever stage-specific sequence signatures they may have had in the last common ancestor. PMID:8005440

  9. Role of ribosomal protein mutations in tumor development (Review).

    PubMed

    Goudarzi, Kaveh M; Lindström, Mikael S

    2016-04-01

    Ribosomes are cellular machines essential for protein synthesis. The biogenesis of ribosomes is a highly complex and energy consuming process that initiates in the nucleolus. Recently, a series of studies applying whole-exome or whole-genome sequencing techniques have led to the discovery of ribosomal protein gene mutations in different cancer types. Mutations in ribosomal protein genes have for example been found in endometrial cancer (RPL22), T-cell acute lymphoblastic leukemia (RPL10, RPL5 and RPL11), chronic lymphocytic leukemia (RPS15), colorectal cancer (RPS20), and glioma (RPL5). Moreover, patients suffering from Diamond-Blackfan anemia, a bone marrow failure syndrome caused by mutant ribosomal proteins are also at higher risk for developing leukemia, or solid tumors. Different experimental models indicate potential mechanisms whereby ribosomal proteins may initiate cancer development. In particular, deregulation of the p53 tumor suppressor network and altered mRNA translation are mechanisms likely to be involved. We envisage that changes in expression and the occurrence of ribosomal protein gene mutations play important roles in cancer development. Ribosome biology constitutes a re-emerging vital area of basic and translational cancer research. PMID:26892688

  10. Role of ribosomal protein mutations in tumor development (Review)

    PubMed Central

    GOUDARZI, KAVEH M.; LINDSTRÖM, MIKAEL S.

    2016-01-01

    Ribosomes are cellular machines essential for protein synthesis. The biogenesis of ribosomes is a highly complex and energy consuming process that initiates in the nucleolus. Recently, a series of studies applying whole-exome or whole-genome sequencing techniques have led to the discovery of ribosomal protein gene mutations in different cancer types. Mutations in ribosomal protein genes have for example been found in endometrial cancer (RPL22), T-cell acute lymphoblastic leukemia (RPL10, RPL5 and RPL11), chronic lymphocytic leukemia (RPS15), colorectal cancer (RPS20), and glioma (RPL5). Moreover, patients suffering from Diamond-Blackfan anemia, a bone marrow failure syndrome caused by mutant ribosomal proteins are also at higher risk for developing leukemia, or solid tumors. Different experimental models indicate potential mechanisms whereby ribosomal proteins may initiate cancer development. In particular, deregulation of the p53 tumor suppressor network and altered mRNA translation are mechanisms likely to be involved. We envisage that changes in expression and the occurrence of ribosomal protein gene mutations play important roles in cancer development. Ribosome biology constitutes a re-emerging vital area of basic and translational cancer research. PMID:26892688

  11. Motion of individual ribosomes along mRNA

    NASA Astrophysics Data System (ADS)

    Visscher, Koen

    2004-11-01

    Ribosomes move along messenger RNA to translate a sequence of ribonucleotides into a corresponding sequence of amino acids that make up a protein. Efficient motion of ribosomes along the mRNA requires hydrolysis of GTP, converting chemical energy into mechanical work, like better known molecular motors such as kinesin. However, motion is just one of the many tasks of the ribosome, whereas for kinesin, motion itself is the main goal. In keeping with these functional differences, the ribosome is also much larger consisting of more than 50 proteins and with half of its mass made up of ribosomal RNA. Such structural complexity enables indirect ways of coupling GTP hydrolysis to directed motion. In order to elucidate the mechanochemical coupling in ribosomes we have developed a single-molecule assay based on using optical tweezers to record the motion of individual ribosomes along mRNA. Translation rates of 2-4 codons/s have been observed. However, when increasing the force opposing motion, we observe backward slippage of ribosomes along homopolymeric poly(U) messages. Currently, it is not clear if the motor operates in reverse or if backward motion has become completely uncoupled from GTP hydrolysis. Interestingly, force-induced backward motion is of biological relevance because of its possible role in -1 frameshifting, a mechanism used by viruses to regulate gene expression at the level of translation.

  12. Proteopedia Entry: The Large Ribosomal Subunit of "Haloarcula Marismortui"

    ERIC Educational Resources Information Center

    Decatur, Wayne A.

    2010-01-01

    This article presents a "Proteopedia" page that shows the refined version of the structure of the "Haloarcula" large ribosomal subunit as solved by the laboratories of Thomas Steitz and Peter Moore. The landmark structure is of great impact as it is the first atomic-resolution structure of the highly conserved ribosomal subunit which harbors…

  13. Kinetics of paused ribosome recycling in Escherichia coli

    PubMed Central

    Janssen, Brian D.; Hayes, Christopher S.

    2009-01-01

    Summary The bacterial tmRNA•SmpB system recycles stalled translation complexes in a process termed ‘ribosome rescue’. tmRNA•SmpB specifically recognizes ribosomes that are paused at or near the 3′ end of truncated mRNA, and therefore nucleolytic mRNA processing is required before paused ribosomes can be rescued from full-length transcripts. Here, we examine the recycling of ribosomes paused on both full-length and truncated mRNAs. Peptidyl-tRNAs corresponding to each paused translation complex were identified, and their turnover kinetics used to estimate the half-lives of paused ribosomes in vivo. Ribosomes were paused at stop codons on full-length mRNA using a nascent peptide motif that interferes with translation termination and elicits tmRNA•SmpB activity. Peptidyl-tRNA turnover from these termination-paused ribosomes was slightly more rapid in tmRNA+ cells (T1/2 = 22 ± 2.2 s), compared to ΔtmRNA cells (T1/2 = 32 ± 1.6 s). Overexpression of release factor-1 (RF-1) greatly accelerated peptidyl-tRNA turnover from termination-paused ribosomes in both tmRNA+ and ΔtmRNA cells, whereas other termination factors had little or no effect on recycling. In contrast to inefficient translation termination, ribosome recycling from truncated transcripts lacking in-frame stop codons was dramatically accelerated by tmRNA•SmpB. However, peptidyl-tRNA still turned over from nonstop-paused ribosomes at a significant rate (t1/2 = 61 ± 7.3 s) in ΔtmRNA cells. Overexpression of RF-1, RF-3, and ribosome recycling factor (RRF) in ΔtmRNA cells failed to accelerate ribosome recycling from nonstop mRNA. These results indicate that tmRNA•SmpB activity is rate-limited by mRNA cleavage, and that RF-3 and RRF do not constitute a tmRNA-independent rescue pathway as previously suggested. Peptidyl-tRNA turnover from nonstop-paused ribosomes in ΔtmRNA cells suggests the existence of another uncharacterized ribosome rescue pathway. PMID:19761774

  14. Probing the mechanisms underlying human diseases in making ribosomes.

    PubMed

    Farley, Katherine I; Baserga, Susan J

    2016-08-15

    Ribosomes are essential, highly complex machines responsible for protein synthesis in all growing cells. Because of their importance, the process of building these machines is intricately regulated. Although the proteins involved in regulating ribosome biogenesis are just beginning to be understood, especially in human cells, the consequences for dysregulating this process have been even less studied. Such interruptions in ribosome synthesis result in a collection of human disorders known as ribosomopathies. Ribosomopathies, which occur due to mutations in proteins involved in the global process of ribosome biogenesis, result in tissue-specific defects. The questions posed by this dichotomy and the steps taken to address these questions are therefore the focus of this review: How can tissue-specific disorders result from alterations in global processes? Could ribosome specialization account for this difference? PMID:27528749

  15. DExD/H-box RNA helicases in ribosome biogenesis

    PubMed Central

    Martin, Roman; Straub, Annika U.; Doebele, Carmen; Bohnsack, Markus T.

    2013-01-01

    Ribosome synthesis requires a multitude of cofactors, among them DExD/H-box RNA helicases. Bacterial RNA helicases involved in ribosome assembly are not essential, while eukaryotes strictly require multiple DExD/H-box proteins that are involved in the much more complex ribosome biogenesis pathway. Here, RNA helicases are thought to act in structural remodeling of the RNPs including the modulation of protein binding, and they are required for allowing access or the release of specific snoRNPs from pre-ribosomes. Interestingly, helicase action is modulated by specific cofactors that can regulate recruitment and enzymatic activity. This review summarizes the current knowledge and focuses on recent findings and open questions on RNA helicase function and regulation in ribosome synthesis. PMID:22922795

  16. Prediction of ribosome footprint profile shapes from transcript sequences

    PubMed Central

    Liu, Tzu-Yu; Song, Yun S.

    2016-01-01

    Motivation: Ribosome profiling is a useful technique for studying translational dynamics and quantifying protein synthesis. Applications of this technique have shown that ribosomes are not uniformly distributed along mRNA transcripts. Understanding how each transcript-specific distribution arises is important for unraveling the translation mechanism. Results: Here, we apply kernel smoothing to construct predictive features and build a sparse model to predict the shape of ribosome footprint profiles from transcript sequences alone. Our results on Saccharomyces cerevisiae data show that the marginal ribosome densities can be predicted with high accuracy. The proposed novel method has a wide range of applications, including inferring isoform-specific ribosome footprints, designing transcripts with fast translation speeds and discovering unknown modulation during translation. Availability and implementation: A software package called riboShape is freely available at https://sourceforge.net/projects/riboshape Contact: yss@berkeley.edu PMID:27307616

  17. Structures of Eukaryotic Ribosomal Stalk Proteins and Its Complex with Trichosanthin, and Their Implications in Recruiting Ribosome-Inactivating Proteins to the Ribosomes

    PubMed Central

    Choi, Andrew K. H.; Wong, Eddie C. K.; Lee, Ka-Ming; Wong, Kam-Bo

    2015-01-01

    Ribosome-inactivating proteins (RIP) are RNA N-glycosidases that inactivate ribosomes by specifically depurinating a conserved adenine residue at the α-sarcin/ricin loop of 28S rRNA. Recent studies have pointed to the involvement of the C-terminal domain of the eukaryotic stalk proteins in facilitating the toxic action of RIPs. This review highlights how structural studies of eukaryotic stalk proteins provide insights into the recruitment of RIPs to the ribosomes. Since the C-terminal domain of eukaryotic stalk proteins is involved in specific recognition of elongation factors and some eukaryote-specific RIPs (e.g., trichosanthin and ricin), we postulate that these RIPs may have evolved to hijack the translation-factor-recruiting function of ribosomal stalk in reaching their target site of rRNA. PMID:25723321

  18. Regulation of ribosomal DNA amplification by the TOR pathway

    PubMed Central

    Jack, Carmen V.; Cruz, Cristina; Hull, Ryan M.; Keller, Markus A.; Ralser, Markus; Houseley, Jonathan

    2015-01-01

    Repeated regions are widespread in eukaryotic genomes, and key functional elements such as the ribosomal DNA tend to be formed of high copy repeated sequences organized in tandem arrays. In general, high copy repeats are remarkably stable, but a number of organisms display rapid ribosomal DNA amplification at specific times or under specific conditions. Here we demonstrate that target of rapamycin (TOR) signaling stimulates ribosomal DNA amplification in budding yeast, linking external nutrient availability to ribosomal DNA copy number. We show that ribosomal DNA amplification is regulated by three histone deacetylases: Sir2, Hst3, and Hst4. These enzymes control homologous recombination-dependent and nonhomologous recombination-dependent amplification pathways that act in concert to mediate rapid, directional ribosomal DNA copy number change. Amplification is completely repressed by rapamycin, an inhibitor of the nutrient-responsive TOR pathway; this effect is separable from growth rate and is mediated directly through Sir2, Hst3, and Hst4. Caloric restriction is known to up-regulate expression of nicotinamidase Pnc1, an enzyme that enhances Sir2, Hst3, and Hst4 activity. In contrast, normal glucose concentrations stretch the ribosome synthesis capacity of cells with low ribosomal DNA copy number, and we find that these cells show a previously unrecognized transcriptional response to caloric excess by reducing PNC1 expression. PNC1 down-regulation forms a key element in the control of ribosomal DNA amplification as overexpression of PNC1 substantially reduces ribosomal DNA amplification rate. Our results reveal how a signaling pathway can orchestrate specific genome changes and demonstrate that the copy number of repetitive DNA can be altered to suit environmental conditions. PMID:26195783

  19. Regulation of ribosome biogenesis in maize embryonic axes during germination.

    PubMed

    Villa-Hernández, J M; Dinkova, T D; Aguilar-Caballero, R; Rivera-Cabrera, F; Sánchez de Jiménez, E; Pérez-Flores, L J

    2013-10-01

    Ribosome biogenesis is a pre-requisite for cell growth and proliferation; it is however, a highly regulated process that consumes a great quantity of energy. It requires the coordinated production of rRNA, ribosomal proteins and non-ribosomal factors which participate in the processing and mobilization of the new ribosomes. Ribosome biogenesis has been studied in yeast and animals; however, there is little information about this process in plants. The objective of the present work was to study ribosome biogenesis in maize seeds during germination, a stage characterized for its fast growth, and the effect of insulin in this process. Insulin has been reported to accelerate germination and to induce seedling growth. It was observed that among the first events reactivated just after 3 h of imbibition are the rDNA transcription and the pre-rRNA processing and that insulin stimulates both of them (40-230%). The transcript of nucleolin, a protein which regulates rDNA transcription and pre-rRNA processing, is among the messages stored in quiescent dry seeds and it is mobilized into the polysomal fraction during the first hours of imbibition (6 h). In contrast, de novo ribosomal protein synthesis was low during the first hours of imbibition (3 and 6 h) increasing by 60 times in later stages (24 h). Insulin increased this synthesis (75%) at 24 h of imbibition; however, not all ribosomal proteins were similarly regulated. In this regard, an increase in RPS6 and RPL7 protein levels was observed, whereas RPL3 protein levels did not change even though its transcription was induced. Results show that ribosome biogenesis in the first stages of imbibition is carried out with newly synthesized rRNA and ribosomal proteins translated from stored mRNA. PMID:23806421

  20. Crystal Structures of the uL3 Mutant Ribosome: Illustration of the Importance of Ribosomal Proteins for Translation Efficiency.

    PubMed

    Mailliot, Justine; Garreau de Loubresse, Nicolas; Yusupova, Gulnara; Meskauskas, Arturas; Dinman, Jonathan D; Yusupov, Marat

    2016-05-22

    The ribosome has been described as a ribozyme in which ribosomal RNA is responsible for peptidyl-transferase reaction catalysis. The W255C mutation of the universally conserved ribosomal protein uL3 has diverse effects on ribosome function (e.g., increased affinities for transfer RNAs, decreased rates of peptidyl-transfer), and cells harboring this mutation are resistant to peptidyl-transferase inhibitors (e.g., anisomycin). These observations beg the question of how a single amino acid mutation may have such wide ranging consequences. Here, we report the structure of the vacant yeast uL3 W255C mutant ribosome by X-ray crystallography, showing a disruption of the A-site side of the peptidyl-transferase center (PTC). An additional X-ray crystallographic structure of the anisomycin-containing mutant ribosome shows that high concentrations of this inhibitor restore a "WT-like" configuration to this region of the PTC, providing insight into the resistance mechanism of the mutant. Globally, our data demonstrate that ribosomal protein uL3 is structurally essential to ensure an optimal and catalytically efficient organization of the PTC, highlighting the importance of proteins in the RNA-centered ribosome. PMID:26906928

  1. rRNA Suppressor of a Eukaryotic Translation Initiation Factor 5B/Initiation Factor 2 Mutant Reveals a Binding Site for Translational GTPases on the Small Ribosomal Subunit▿

    PubMed Central

    Shin, Byung-Sik; Kim, Joo-Ran; Acker, Michael G.; Maher, Kathryn N.; Lorsch, Jon R.; Dever, Thomas E.

    2009-01-01

    The translational GTPases promote initiation, elongation, and termination of protein synthesis by interacting with the ribosome. Mutations that impair GTP hydrolysis by eukaryotic translation initiation factor 5B/initiation factor 2 (eIF5B/IF2) impair yeast cell growth due to failure to dissociate from the ribosome following subunit joining. A mutation in helix h5 of the 18S rRNA in the 40S ribosomal subunit and intragenic mutations in domain II of eIF5B suppress the toxic effects associated with expression of the eIF5B-H480I GTPase-deficient mutant in yeast by lowering the ribosome binding affinity of eIF5B. Hydroxyl radical mapping experiments reveal that the domain II suppressors interface with the body of the 40S subunit in the vicinity of helix h5. As the helix h5 mutation also impairs elongation factor function, the rRNA and eIF5B suppressor mutations provide in vivo evidence supporting a functionally important docking of domain II of the translational GTPases on the body of the small ribosomal subunit. PMID:19029250

  2. Details of the evolutionary history from invertebrates to vertebrates, as deduced from the sequences of 18S rDNA.

    PubMed Central

    Wada, H; Satoh, N

    1994-01-01

    Almost the entire sequences of 18S rDNA were determined for two chaetognaths, five echinoderms, a hemichordate, and two urochordates (a larvacean and a salp). Phylogenetic comparisons of the sequences, together with those of other deuterostomes (an ascidian, a cephalochordate, and vertebrates) and protostomes (an arthropod and a mollusc), suggest the monophyly of the deuterostomes, with the exception of the chaetognaths. Chaetognaths may not be a group of deuterostomes. The deuterostome group closest to vertebrates was the group of cephalochordates. Ascidians, larvaceans, and salps seem to form a discrete group (urochordates), in which the early divergence of larvaceans is evident. These results support the hypothesis that chordates evolved from free-living ancestors. PMID:8127885

  3. Analysis of 18S rRNA gene sequences suggests significant molecular differences between Macrodasyida and Chaetonotida (Gastrotricha).

    PubMed

    Manylov, Oleg G; Vladychenskaya, Natalia S; Milyutina, Irina A; Kedrova, Olga S; Korokhov, Nikolai P; Dvoryanchikov, Gennady A; Aleshin, Vladimir V; Petrov, Nikolai B

    2004-03-01

    Partial 18S rRNA gene sequences of four macrodasyid and one chaetonotid gastrotrichs were obtained and compared with the available sequences of other gastrotrich species and representatives of various metazoan phyla. Contrary to the earlier molecular data, the gastrotrich sequences did not comprise a monophyletic group but formed two distinct clades, corresponding to the Macrodasyida and Chaetonotida, with the basal position occupied by the sequences of Tetranchyroderma sp. and Xenotrichula sp., respectively. Depending on the taxon sampling and methods of analysis, the two clades were separated by various combinations of clades Rotifera, Gnathostomulida, and Platyhelminthes, and never formed a clade with Nematoda. Thus, monophyly of the Gastrotricha is not confirmed by analysis of the presently available molecular data. PMID:15012964

  4. Molecular Diversity of Eukaryotes in Municipal Wastewater Treatment Processes as Revealed by 18S rRNA Gene Analysis

    PubMed Central

    Matsunaga, Kengo; Kubota, Kengo; Harada, Hideki

    2014-01-01

    Eukaryotic communities involved in sewage treatment processes have been investigated by morphological identification, but have not yet been well-characterized using molecular approaches. In the present study, eukaryotic communities were characterized by constructing 18S rRNA gene clone libraries. The phylogenetic affiliations of a total of 843 clones were Alveolata, Fungi, Rhizaria, Euglenozoa, Stramenopiles, Amoebozoa, and Viridiplantae as protozoans and Rotifera, Gastrotricha, and Nematoda as metazoans. Sixty percent of the clones had <97% sequence identity to described eukaryotes, indicating the greater diversity of eukaryotes than previously recognized. A core OTU closely related to Epistylis chrysemydis was identified, and several OTUs were shared by 4–8 libraries. Members of the uncultured lineage LKM11 in Cryptomycota were predominant fungi in sewage treatment processes. This comparative study represents an initial step in furthering understanding of the diversity and role of eukaryotes in sewage treatment processes. PMID:25491751

  5. Molecular diversity of eukaryotes in municipal wastewater treatment processes as revealed by 18S rRNA gene analysis.

    PubMed

    Matsunaga, Kengo; Kubota, Kengo; Harada, Hideki

    2014-01-01

    Eukaryotic communities involved in sewage treatment processes have been investigated by morphological identification, but have not yet been well-characterized using molecular approaches. In the present study, eukaryotic communities were characterized by constructing 18S rRNA gene clone libraries. The phylogenetic affiliations of a total of 843 clones were Alveolata, Fungi, Rhizaria, Euglenozoa, Stramenopiles, Amoebozoa, and Viridiplantae as protozoans and Rotifera, Gastrotricha, and Nematoda as metazoans. Sixty percent of the clones had <97% sequence identity to described eukaryotes, indicating the greater diversity of eukaryotes than previously recognized. A core OTU closely related to Epistylis chrysemydis was identified, and several OTUs were shared by 4-8 libraries. Members of the uncultured lineage LKM11 in Cryptomycota were predominant fungi in sewage treatment processes. This comparative study represents an initial step in furthering understanding of the diversity and role of eukaryotes in sewage treatment processes. PMID:25491751

  6. Short communication: Genetic variants of Sarcocystis cruzi in infected Malaysian cattle based on 18S rDNA.

    PubMed

    Ng, Yit Han; Fong, Mun Yik; Subramaniam, Vellayan; Shahari, Shahhaziq; Lau, Yee Ling

    2015-12-01

    Sarcocystis species are pathogenic parasites that infect a wide range of animals, including cattle. A high prevalence of cattle sarcocystosis has been reported worldwide, but its status is unknown in Malaysia. This study focused on utilizing 18S rDNA to identify Sarcocystis species in Malaysian cattle and to determine their genetic variants. In this study, only Sarcocystis cruzi was detected in Malaysian cattle. The intra-species S. cruzi phylogenetic tree analysis and principal coordinate analysis (PCoA), respectively displayed two minor groups among the parasite isolates. This finding was supported by high Wright FST value (FST=0.647). The definitive hosts (dogs) may play a fundamental role in the development of S. cruzi genetic variants. Additionally, the existence of microheterogeneity within the S. cruzi merozoites and/or distinct genetic variants arisen from independent merozoites in mature sarcocysts, possibly contributed to the existence of intra-species variations within the population. PMID:26679818

  7. Modifying the maker: Oxygenases target ribosome biology.

    PubMed

    Zhuang, Qinqin; Feng, Tianshu; Coleman, Mathew L

    2015-01-01

    The complexity of the eukaryotic protein synthesis machinery is partly driven by extensive and diverse modifications to associated proteins and RNAs. These modifications can have important roles in regulating translation factor activity and ribosome biogenesis and function. Further investigation of 'translational modifications' is warranted considering the growing evidence implicating protein synthesis as a critical point of gene expression control that is commonly deregulated in disease. New evidence suggests that translation is a major new target for oxidative modifications, specifically hydroxylations and demethylations, which generally are catalyzed by a family of emerging oxygenase enzymes that act at the interface of nutrient availability and metabolism. This review summarizes what is currently known about the role or these enzymes in targeting rRNA synthesis, protein translation and associated cellular processes. PMID:26779412

  8. Compilation of small ribosomal subunit RNA structures.

    PubMed Central

    Neefs, J M; Van de Peer, Y; De Rijk, P; Chapelle, S; De Wachter, R

    1993-01-01

    The database on small ribosomal subunit RNA structure contained 1804 nucleotide sequences on April 23, 1993. This number comprises 365 eukaryotic, 65 archaeal, 1260 bacterial, 30 plastidial, and 84 mitochondrial sequences. These are stored in the form of an alignment in order to facilitate the use of the database as input for comparative studies on higher-order structure and for reconstruction of phylogenetic trees. The elements of the postulated secondary structure for each molecule are indicated by special symbols. The database is available on-line directly from the authors by ftp and can also be obtained from the EMBL nucleotide sequence library by electronic mail, ftp, and on CD ROM disk. PMID:8332525

  9. Ribosome-Inactivating and Related Proteins

    PubMed Central

    Schrot, Joachim; Weng, Alexander; Melzig, Matthias F.

    2015-01-01

    Ribosome-inactivating proteins (RIPs) are toxins that act as N-glycosidases (EC 3.2.2.22). They are mainly produced by plants and classified as type 1 RIPs and type 2 RIPs. There are also RIPs and RIP related proteins that cannot be grouped into the classical type 1 and type 2 RIPs because of their different sizes, structures or functions. In addition, there is still not a uniform nomenclature or classification existing for RIPs. In this review, we give the current status of all known plant RIPs and we make a suggestion about how to unify those RIPs and RIP related proteins that cannot be classified as type 1 or type 2 RIPs. PMID:26008228

  10. Modifying the maker: Oxygenases target ribosome biology

    PubMed Central

    Zhuang, Qinqin; Feng, Tianshu; Coleman, Mathew L

    2015-01-01

    The complexity of the eukaryotic protein synthesis machinery is partly driven by extensive and diverse modifications to associated proteins and RNAs. These modifications can have important roles in regulating translation factor activity and ribosome biogenesis and function. Further investigation of ‘translational modifications’ is warranted considering the growing evidence implicating protein synthesis as a critical point of gene expression control that is commonly deregulated in disease. New evidence suggests that translation is a major new target for oxidative modifications, specifically hydroxylations and demethylations, which generally are catalyzed by a family of emerging oxygenase enzymes that act at the interface of nutrient availability and metabolism. This review summarizes what is currently known about the role or these enzymes in targeting rRNA synthesis, protein translation and associated cellular processes. PMID:26779412

  11. Specific primers for PCR amplification of the ITS1 (ribosomal DNA) of Trypanosoma lewisi.

    PubMed

    Desquesnes, Marc; Marc, Desquesnes; Kamyingkird, Ketsarin; Ketsarin, Kamyingkird; Yangtara, Sarawut; Sarawut, Yangtara; Milocco, Cristina; Cristina, Milocco; Ravel, Sophie; Sophie, Ravel; Wang, Ming-Hui; Ming-Hui, Wang; Lun, Zhao-Rong; Zhao-Rong, Lun; Morand, Serge; Serge, Morand; Jittapalapong, Sathaporn; Sathaporn, Jittapalapong

    2011-08-01

    Trypanosoma lewisi is a mild or non-pathogenic parasite of the sub-genus Herpetosoma transmitted by fleas to rats. In a previous study we described pan-trypanosome specific primers TRYP1 which amplify the ITS1 of ribosomal DNA by hybridizing in highly conserved regions of 18S and 5.8S genes. These primers proved to be useful for detecting T. lewisi DNA in laboratory rats, but a recent large scale survey in wild rodents demonstrated a lack of specificity. In the present study, we designed and evaluated mono-specific primers LEW1S and LEW1R, for the detection and identification of T. lewisi by a single-step PCR. These primers were designed inside the highly variable region of the ITS1 sequence of T. lewisi ribosomal DNA. The product size of 220 bp is specific to T. lewisi. The sensitivity limit was estimated between 0.055 and 0.55 pg of DNA per reaction, equivalent to 1-10 organisms per reaction. All the PCR products obtained from 6 different T. lewisi isolates were more than 98% similar with each other and similar to the sequences of T. lewisi already published in Genbank. All DNA of 7 T. lewisi stocks from China gave the specific 220 bp product. We showed that LEW1S and LEW1R primers enabled sensitive detection and identification of T. lewisi infection in laboratory and wild rats. This assay is recommended for monitoring T. lewisi infections in rat colonies or for studying infections in the wild fauna. An absence of cross reaction with human DNA means that these primers can be used to investigate atypical trypanosome infections in humans. Given the risk of T. lewisi infection in human, we believe that these primers will be beneficial for public health diagnosis and rodents investigation programmes. PMID:21570489

  12. Altering the ribosomal subunit ratio in yeast maximizes recombinant protein yield

    PubMed Central

    Bonander, Nicklas; Darby, Richard AJ; Grgic, Ljuban; Bora, Nagamani; Wen, Jikai; Brogna, Saverio; Poyner, David R; O'Neill, Michael AA; Bill, Roslyn M

    2009-01-01

    Background The production of high yields of recombinant proteins is an enduring bottleneck in the post-genomic sciences that has yet to be addressed in a truly rational manner. Typically eukaryotic protein production experiments have relied on varying expression construct cassettes such as promoters and tags, or culture process parameters such as pH, temperature and aeration to enhance yields. These approaches require repeated rounds of trial-and-error optimization and cannot provide a mechanistic insight into the biology of recombinant protein production. We published an early transcriptome analysis that identified genes implicated in successful membrane protein production experiments in yeast. While there has been a subsequent explosion in such analyses in a range of production organisms, no one has yet exploited the genes identified. The aim of this study was to use the results of our previous comparative transcriptome analysis to engineer improved yeast strains and thereby gain an understanding of the mechanisms involved in high-yielding protein production hosts. Results We show that tuning BMS1 transcript levels in a doxycycline-dependent manner resulted in optimized yields of functional membrane and soluble protein targets. Online flow microcalorimetry demonstrated that there had been a substantial metabolic change to cells cultured under high-yielding conditions, and in particular that high yielding cells were more metabolically efficient. Polysome profiling showed that the key molecular event contributing to this metabolically efficient, high-yielding phenotype is a perturbation of the ratio of 60S to 40S ribosomal subunits from approximately 1:1 to 2:1, and correspondingly of 25S:18S ratios from 2:1 to 3:1. This result is consistent with the role of the gene product of BMS1 in ribosome biogenesis. Conclusion This work demonstrates the power of a rational approach to recombinant protein production by using the results of transcriptome analysis to engineer

  13. Sequence heterogeneity in the 18S rRNA gene in Theileria equi from horses presented in Switzerland.

    PubMed

    Liu, Qin; Meli, Marina L; Zhang, Yi; Meili, Theres; Stirn, Martina; Riond, Barbara; Weibel, Beatrice; Hofmann-Lehmann, Regina

    2016-05-15

    A reverse line blot (RLB) hybridization assay was adapted and applied for equine blood samples collected at the animal hospital of the University of Zurich to determine the presence of piroplasms in horses in Switzerland. A total of 100 equine blood samples were included in the study. The V4 hypervariable region of the 18S rRNA gene was amplified by polymerase chain reaction and analyzed using the RLB assay. Samples from seven horses hybridized to a Theileria/Babesia genus-specific and a Theileria genus-specific probe. Of these, two hybridized also to the Theileria equi-specific probe. The other five positive samples did not hybridize to any of the species-specific probes, suggesting the presence of unrecognized Theileria variants or genotypes. The 18S rRNA gene of the latter five samples were sequenced and found to be closely related to T. equi isolated from horses in Spain (AY534822) and China (KF559357) (≥98.4% identity). Four of the seven horses that tested positive had a documented travel history (France, Italy, and Spain) or lived abroad (Hungary). The present study adds new insight into the presence and sequence heterogeneity of T. equi in Switzerland. The results prompt that species-specific probes must be designed in regions of the gene unique to T. equi. Of note, none of the seven positive horses were suspected of having Theileria infection at the time of presentation to the clinic. Clinicians should be aware of the possibility of equine piroplasma infections outside of endemic areas and in horses without signs of piroplasmosis. PMID:27084467

  14. Differential Expression of Ribosomal Genes in Brain and Blood of Alzheimer's Disease Patients.

    PubMed

    Rasmussen, Lucas; de Labio, Roger W; Viani, Gustavo A; Chen, Elizabeth; Villares, Joao; Bertolucci, Paulo-Henrique; Minett, Thais S; Turecki, Gustavo; Cecyre, Danielle; Drigo, Sandra A; Smith, Marilia C; Payao, Spencer L M

    2015-01-01

    Changes in rRNA and rDNA expression have been associated with cellular and organism aging and have been linked to Alz