Science.gov

Sample records for 19-rod clusters r3

  1. Overexpression of M68/DcR3 in human gastrointestinal tract tumors independent of gene amplification and its location in a four-gene cluster

    PubMed Central

    Bai, Chang; Connolly, Brett; Metzker, Michael L.; Hilliard, Catherine A.; Liu, Xiaomei; Sandig, Volker; Soderman, Avery; Galloway, Sheila M.; Liu, Qingyun; Austin, Christopher P.; Caskey, C. Thomas

    2000-01-01

    Fas-mediated apoptosis is an important regulator of cell survival, and abnormalities in this system have been shown to result in a number of human pathological conditions. A secreted member of the tumor necrosis factor receptor superfamily, DcR3, was recently reported to be amplified in human lung and colon cancers as a negative regulator of Fas-mediated apoptosis. We identified this gene, which we call M68. M68 genomic DNA, mRNA, and protein levels were examined in a series of human gastrointestinal tract tumors. Using M68 immunohistochemistry and a scoring system similar to that used for HER-2/neu, we found that M68 protein was overexpressed in 30 of 68 (44%) human adenocarcinomas of the esophagus, stomach, colon, and rectum. Tumors examined by Northern blot revealed M68 mRNA highly elevated in a similar fraction of primary tumors from the same gastrointestinal tract regions, as well as in the colon adenocarcinoma cell lines SW480 and SW1116. Further, we found M68 protein to be overexpressed in a substantial number of tumors in which gene amplification could not be detected by fluorescence in situ hybridization or quantitative genomic PCR, suggesting that overexpression of M68 may precede amplification in tumors. Finally, we find that M68 lies within a four-gene cluster that includes a novel helicase-like gene (NHL) related to RAD3/ERCC2, a plasma membrane Ras-related GTPase and a member of the stathmin family, amplification or overexpression of which may also contribute to cell growth and tumor progression. PMID:10655513

  2. A Gene Cluster for Biosynthesis of Mannosylerythritol Lipids Consisted of 4-O-β-D-Mannopyranosyl-(2R,3S)-Erythritol as the Sugar Moiety in a Basidiomycetous Yeast Pseudozyma tsukubaensis

    PubMed Central

    Saika, Azusa; Koike, Hideaki; Fukuoka, Tokuma; Yamamoto, Shuhei; Kishimoto, Takahide; Morita, Tomotake

    2016-01-01

    Mannosylerythritol lipids (MELs) belong to the glycolipid biosurfactants and are produced by various fungi. The basidiomycetous yeast Pseudozyma tsukubaensis produces diastereomer type of MEL-B, which contains 4-O-β-D-mannopyranosyl-(2R,3S)-erythritol (R-form) as the sugar moiety. In this respect it differs from conventional type of MELs, which contain 4-O-β-D-mannopyranosyl-(2S,3R)-erythritol (S-form) as the sugar moiety. While the biosynthetic gene cluster for conventional type of MELs has been previously identified in Ustilago maydis and Pseudozyma antarctica, the genetic basis for MEL biosynthesis in P. tsukubaensis is unknown. Here, we identified a gene cluster involved in MEL biosynthesis in P. tsukubaensis. Among these genes, PtEMT1, which encodes erythritol/mannose transferase, had greater than 69% identity with homologs from strains in the genera Ustilago, Melanopsichium, Sporisorium and Pseudozyma. However, phylogenetic analysis placed PtEMT1p in a separate clade from the other proteins. To investigate the function of PtEMT1, we introduced the gene into a P. antarctica mutant strain, ΔPaEMT1, which lacks MEL biosynthesis ability owing to the deletion of PaEMT1. Using NMR spectroscopy, we identified the biosynthetic product as MEL-A with altered sugar conformation. These results indicate that PtEMT1p catalyzes the sugar conformation of MELs. This is the first report of a gene cluster for the biosynthesis of diastereomer type of MEL. PMID:27327162

  3. A Gene Cluster for Biosynthesis of Mannosylerythritol Lipids Consisted of 4-O-β-D-Mannopyranosyl-(2R,3S)-Erythritol as the Sugar Moiety in a Basidiomycetous Yeast Pseudozyma tsukubaensis.

    PubMed

    Saika, Azusa; Koike, Hideaki; Fukuoka, Tokuma; Yamamoto, Shuhei; Kishimoto, Takahide; Morita, Tomotake

    2016-01-01

    Mannosylerythritol lipids (MELs) belong to the glycolipid biosurfactants and are produced by various fungi. The basidiomycetous yeast Pseudozyma tsukubaensis produces diastereomer type of MEL-B, which contains 4-O-β-D-mannopyranosyl-(2R,3S)-erythritol (R-form) as the sugar moiety. In this respect it differs from conventional type of MELs, which contain 4-O-β-D-mannopyranosyl-(2S,3R)-erythritol (S-form) as the sugar moiety. While the biosynthetic gene cluster for conventional type of MELs has been previously identified in Ustilago maydis and Pseudozyma antarctica, the genetic basis for MEL biosynthesis in P. tsukubaensis is unknown. Here, we identified a gene cluster involved in MEL biosynthesis in P. tsukubaensis. Among these genes, PtEMT1, which encodes erythritol/mannose transferase, had greater than 69% identity with homologs from strains in the genera Ustilago, Melanopsichium, Sporisorium and Pseudozyma. However, phylogenetic analysis placed PtEMT1p in a separate clade from the other proteins. To investigate the function of PtEMT1, we introduced the gene into a P. antarctica mutant strain, ΔPaEMT1, which lacks MEL biosynthesis ability owing to the deletion of PaEMT1. Using NMR spectroscopy, we identified the biosynthetic product as MEL-A with altered sugar conformation. These results indicate that PtEMT1p catalyzes the sugar conformation of MELs. This is the first report of a gene cluster for the biosynthesis of diastereomer type of MEL. PMID:27327162

  4. Dynamical Cosmological Constant in R 3 Gravity

    NASA Astrophysics Data System (ADS)

    Zare, Nasser; Fathi, Mohsen

    2015-03-01

    In this paper, we go through the famous f( R) theories of gravity, but keeping a peculiar one, namely R 3 modification. Moreover, instead of a coordinate free cosmological parameter, we take it to be a function of time. Having all these stuff, we investigate the notions of standard cosmology model, in the context of R 3 modification to general relativity, and in various regimes, we study the dynamical cosmological constant.

  5. Kinetics, safety and tolerability of (R)-3-hydroxybutyl (R)-3-hydroxybutyrate in healthy adult subjects

    PubMed Central

    Clarke, Kieran; Tchabanenko, Kirill; Pawlosky, Robert; Carter, Emma; King, M. Todd; Musa-Veloso, Kathy; Ho, Manki; Roberts, Ashley; Robertson, Jeremy; VanItallie, Theodore B.; Veech, Richard L.

    2013-01-01

    Induction of mild states of hyperketonemia may improve physical and cognitive performance. In this study, we determined the kinetic parameters, safety and tolerability of (R)-3-hydroxybutyl (R)-3-hydroxybutyrate, a ketone monoester administered in the form of a meal replacement drink to healthy human volunteers. Plasma levels of β-hydroxybutyrate and acetoacetate were elevated following administration of a single dose of the ketone monoester, whether at 140, 357, or 714 mg/kg body weight, while the intact ester was not detected. Maximum plasma levels of ketones were attained within 1–2 h, reaching 3.30 mM and 1.19 mM for β-hydroxybutyrate and acetoacetate, respectively, at the highest dose tested. The elimination half-life ranged from 0.8–3.1 h for β-hydroxybutyrate and 8–14 h for acetoacetate. The ketone monoester was also administered at 140, 357, and 714 mg/kg body weight, three times daily, over 5 days (equivalent to 0.42, 1.07, and 2.14 g/kg/d). The ketone ester was generally well-tolerated, although some gastrointestinal effects were reported, when large volumes of milk-based drink were consumed, at the highest ketone monoester dose. Together, these results suggest ingestion of (R)-3-hydroxybutyl (R)-3-hydroxybutyrate is a safe and simple method to elevate blood ketone levels, compared with the inconvenience of preparing and consuming a ketogenic diet. PMID:22561291

  6. DISINTEGRATING ASTEROID P/2013 R3

    SciTech Connect

    Jewitt, David; Li, Jing; Agarwal, Jessica; Weaver, Harold; Mutchler, Max; Larson, Stephen

    2014-03-20

    Splitting of the nuclei of comets into multiple components has been frequently observed but, to date, no main-belt asteroid has been observed to break up. Using the Hubble Space Telescope, we find that main-belt asteroid P/2013 R3 consists of 10 or more distinct components, the largest up to 200 m in radius (assumed geometric albedo of 0.05) each of which produces a coma and comet-like dust tail. A diffuse debris cloud with total mass ∼2 × 10{sup 8} kg further envelopes the entire system. The velocity dispersion among the components, ΔV ∼ 0.2-0.5 m s{sup –1}, is comparable to the gravitational escape speeds of the largest members, while their extrapolated plane-of-sky motions suggest a break up between 2013 February and September. The broadband optical colors are those of a C-type asteroid. We find no spectral evidence for gaseous emission, placing model-dependent upper limits to the water production rate ≤1 kg s{sup –1}. Breakup may be due to a rotationally induced structural failure of the precursor body.

  7. Creating "SMART" Supply Chain Scenarios Using SAP R/3

    ERIC Educational Resources Information Center

    Ragan, Joseph M.; McGettigan, Patrick J.; Storms, Michael R.; Rizman, Brian

    2004-01-01

    Pedagogical revisions to the undergraduate Haub School of Business curriculum at Saint Joseph's University employing the SAP R/3 system encompass the core accounting courses traversing the sophomore and junior years. The entire accounting curriculum was overhauled in order to integrate SAP R/3. Each course progressively builds upon and expands the…

  8. (2R,3R)-3-O-Benzoyl-N-benzyl­tartramide1

    PubMed Central

    Madura, Izabela D.; Zachara, Janusz; Bernaś, Urszula; Hajmowicz, Halina; Synoradzki, Ludwik

    2012-01-01

    The title compound, C18H17NO6 [systematic name: (2R,3R)-4-benzyl­amino-2-benzo­yloxy-3-hy­droxy-4-oxobutanoic acid], is the first structurally characterized unsymmetrical monoamide–monoacyl tartaric acid derivative. The mol­ecule shows a staggered conformation around the tartramide Csp3—Csp3 bond with trans-oriented carboxyl and amide groups. The mol­ecular conformation is stabilized by an intra­molecular N—H⋯O hydrogen bond. In the crystal, mol­ecules are linked by O—H⋯O hydrogen bonds between the carboxyl and amide carbonyl groups, forming translational chains along [001]. Further O—H⋯O and N—H⋯O hydrogen bonds as well as weaker C—H⋯O and C—H⋯π inter­molecular inter­actions extend the supra­molecular assembly into a double-layer structure parallel to (100). There are no directional inter­actions between the double layers. PMID:22719648

  9. High Performance Analytics with the R3-Cache

    NASA Astrophysics Data System (ADS)

    Eavis, Todd; Sayeed, Ruhan

    Contemporary data warehouses now represent some of the world’s largest databases. As these systems grow in size and complexity, however, it becomes increasingly difficult for brute force query processing approaches to meet the performance demands of end users. Certainly, improved indexing and more selective view materialization are helpful in this regard. Nevertheless, with warehouses moving into the multi-terabyte range, it is clear that the minimization of external memory accesses must be a primary performance objective. In this paper, we describe the R 3-cache, a natively multi-dimensional caching framework designed specifically to support sophisticated warehouse/OLAP environments. R 3-cache is based upon an in-memory version of the R-tree that has been extended to support buffer pages rather than disk blocks. A key strength of the R 3-cache is that it is able to utilize multi-dimensional fragments of previous query results so as to significantly minimize the frequency and scale of disk accesses. Moreover, the new caching model directly accommodates the standard relational storage model and provides mechanisms for pro-active updates that exploit the existence of query “hot spots”. The current prototype has been evaluated as a component of the Sidera DBMS, a “shared nothing” parallel OLAP server designed for multi-terabyte analytics. Experimental results demonstrate significant performance improvements relative to simpler alternatives.

  10. R3D: Reduction Package for Integral Field Spectroscopy

    NASA Astrophysics Data System (ADS)

    Sánchez, Sebastián. F.

    2011-06-01

    R3D was developed to reduce fiber-based integral field spectroscopy (IFS) data. The package comprises a set of command-line routines adapted for each of these steps, suitable for creating pipelines. The routines have been tested against simulations, and against real data from various integral field spectrographs (PMAS, PPAK, GMOS, VIMOS and INTEGRAL). Particular attention is paid to the treatment of cross-talk. R3D unifies the reduction techniques for the different IFS instruments to a single one, in order to allow the general public to reduce different instruments data in an homogeneus, consistent and simple way. Although still in its prototyping phase, it has been proved to be useful to reduce PMAS (both in the Larr and the PPAK modes), VIMOS and INTEGRAL data. The current version has been coded in Perl, using PDL, in order to speed-up the algorithm testing phase. Most of the time critical algorithms have been translated to C[float=][/float], and it is our intention to translate all of them. However, even in this phase R3D is fast enough to produce valuable science frames in reasonable time.

  11. Genome-wide identification of cassava R2R3 MYB family genes related to abscission zone separation after environmental-stress-induced abscission

    PubMed Central

    Liao, Wenbin; Yang, Yiling; Li, Yayun; Wang, Gan; Peng, Ming

    2016-01-01

    Cassava plants (Manihot esculenta Crantz) resist environmental stresses by shedding leaves in leaf pulvinus abscission zones (AZs), thus leading to adaptation to new environmental conditions. Little is known about the roles of cassava R2R3 MYB factors in regulating AZ separation. Herein, 166 cassava R2R3 MYB genes were identified. Evolutionary analysis indicated that the 166 R2R3 MYB genes could be divided into 11 subfamilies. Transcriptome analysis indicated that 26 R2R3 MYB genes were expressed in AZs across six time points during both ethylene- and water-deficit stress-induced leaf abscission. Comparative expression profile analysis of similar SOTA (Self Organizing Tree Algorithm) clusters demonstrated that 10 R2R3 MYB genes had similar expression patterns at six time points in response to both treatments. GO (Gene Ontology) annotation confirmed that all 10 R2R3 MYB genes participated in the responses to stress and ethylene and auxin stimuli. Analysis of the putative 10 R2R3 MYB promoter regions showed that those genes primarily contained ethylene- and stress-related cis-elements. The expression profiles of the genes acting downstream of the selected MYBs were confirmed to be involved in cassava abscission zone separation. All these results indicated that R2R3 MYB plays an important regulatory role in AZ separation. PMID:27573926

  12. Genome-wide identification of cassava R2R3 MYB family genes related to abscission zone separation after environmental-stress-induced abscission.

    PubMed

    Liao, Wenbin; Yang, Yiling; Li, Yayun; Wang, Gan; Peng, Ming

    2016-01-01

    Cassava plants (Manihot esculenta Crantz) resist environmental stresses by shedding leaves in leaf pulvinus abscission zones (AZs), thus leading to adaptation to new environmental conditions. Little is known about the roles of cassava R2R3 MYB factors in regulating AZ separation. Herein, 166 cassava R2R3 MYB genes were identified. Evolutionary analysis indicated that the 166 R2R3 MYB genes could be divided into 11 subfamilies. Transcriptome analysis indicated that 26 R2R3 MYB genes were expressed in AZs across six time points during both ethylene- and water-deficit stress-induced leaf abscission. Comparative expression profile analysis of similar SOTA (Self Organizing Tree Algorithm) clusters demonstrated that 10 R2R3 MYB genes had similar expression patterns at six time points in response to both treatments. GO (Gene Ontology) annotation confirmed that all 10 R2R3 MYB genes participated in the responses to stress and ethylene and auxin stimuli. Analysis of the putative 10 R2R3 MYB promoter regions showed that those genes primarily contained ethylene- and stress-related cis-elements. The expression profiles of the genes acting downstream of the selected MYBs were confirmed to be involved in cassava abscission zone separation. All these results indicated that R2R3 MYB plays an important regulatory role in AZ separation. PMID:27573926

  13. Additive manufacturing of poly[(R)-3-hydroxybutyrate-co-(R)-3-hydroxyhexanoate] scaffolds for engineered bone development.

    PubMed

    Mota, Carlos; Wang, Shen-Yu; Puppi, Dario; Gazzarri, Matteo; Migone, Chiara; Chiellini, Federica; Chen, Guo-Qiang; Chiellini, Emo

    2014-05-30

    A wide range of poly(hydroxyalkanoate)s (PHAs), a class of biodegradable polyesters produced by various bacteria grown under unbalanced conditions, have been proposed for the fabrication of tissue-engineering scaffolds. In this study, the manufacture of poly[(R)-3-hydroxybutyrate-co-(R)-3-hydroxyhexanoate] (or PHBHHx) scaffolds, by means of an additive manufacturing technique based on a computer-controlled wet-spinning system, was investigated. By optimizing the processing parameters, three-dimensional scaffolds with different internal architectures were fabricated, based on a layer-by-layer approach. The resulting scaffolds were characterized by scanning electron microscopy, which showed good control over the fibre alignment and a fully interconnected porous network, with porosity in the range 79-88%, fibre diameter 47-76 µm and pore size 123-789 µm. Moreover, the resulting fibres presented an internal porosity connected to the external fibre surface as a consequence of the phase-inversion process governing the solidification of the polymer solution. Scaffold compressive modulus and yield stress and strain could be varied in a certain range by changing the architectural parameters. Cell-culture experiments employing the MC3T3-E1 murine pre-osteoblast cell line showed good cell proliferation after 21 days of culture. The PHBHHx scaffolds demonstrated promising results in terms of cell differentiation towards an osteoblast phenotype. Copyright © 2014 John Wiley & Sons, Ltd. PMID:24889107

  14. Gold in the layered structures of R3Au7Sn3: From relativity to versatility

    DOE PAGESBeta

    Provino, Alessia; Steinberg, Simon Alexander; Smetana, Volodymyr; Paramanik, Uday; Manfrinetti, Pietro; Dhar, Sudesh Kumar; Mudring, Anja -Verena

    2016-07-11

    A new isotypic series of ternary rare earth element-gold-tetrel intermetallic compounds has been synthesized and their structures and properties have been characterized. R3Au7Sn3 (R = Y, La-Nd, Sm, Gd-Tm, Lu) crystallize with the hexagonal Gd3Au7Sn3 prototype (Pearson symbol hP26; P63/m, a = 8.110-8.372 Å, c = 9.351-9.609 Å, Vcell = 532.7-583.3 Å3, Z = 2), an ordered variant of the Cu10Sn3-type. Their structure is built up by GdPt2Sn-type layers, which feature edge-sharing Sn@Au6 trigonal antiprisms connected by trigonal R3 groups. Additional insertion of gold atoms leads to the formation of new homoatomic Au clusters, Au@Au6; alternatively, the structure can bemore » considered as a superstructural polyhedral packing of the ZrBeSi-type. The magnetization, heat ca-pacity and electrical resistivity have been measured for R3Au7Sn3 (R = Ce, Pr, Nd and Tb). All four compounds order antiferromagnetically with the highest TN of 13 K for Tb3Au7Sn3. In Ce3Au7Sn3, which has a TN of 2.9 K, the heat capacity and electrical resistivity data in zero and applied fields indicate the presence of Kondo interactions. The coefficient of the linear term in the electronic heat capacity, γ, derived from the heat capacity data below 0.5 K is 211 mJ/Ce mol K2 suggesting strong electronic correlations due to the Kondo interaction. The electronic structure calculations based on the projector augmented wave method for particular representatives of the series suggest different tendencies of the localized R-4f AOs to hybridize with the valence states. LMTO-based bonding analysis on the non-magnetic La3Au7Sn3 indicates that the integrated crystal orbital Hamilton popu-lations (COHPs) are dominated by the heteroatomic Au–Sn contacts; however, contributions from La–Au and La–Sn separations are significant, both together exceeding 40 % in the overall bonding. Furthermore, homoatomic Au–Au interactions are evident for the Au@Au6 units but, despite of the high atomic concentration of

  15. (R)-3-oxobutyl 3-hydroxybutanoate (OBHB) induces hyperketonemiain Alzheimer's disease.

    PubMed

    Chu, Chang-Biao; Jiao, Li-Dong

    2015-01-01

    The present study demonstrates the effect of (R)-3-oxobutyl 3-hydroxybutanoate (OBHB) on hyperketonemia in 2 patients with Alzheimer's disease dementia who were performed a mini-mental state examination score of above 11 and 10. The patients were treated with OBHB for 24 months and received usual diet. The patients were administered 15 g of OBHB three times per day for two days. The dosage of OBHB was increased to 30 g three times daily from the day 4. OBHB was always taken after adding with soda-flavoured syrups in order to mask the bitter taste. The measurement of plasma β-hydroxybutyrate (βHB) levels after every week was performed to determine OBHB plasma βHB dose-response relationships. Precision Xtra Glucose and Ketone Monitoring System (Abbott Diabetes Care, Inc., Alameda, CA, USA) was used to measure βHB levels in the blood samples. We did not observe any adverse effects of OBHB in any of the patients and it was well tolerated throughout the 24 months treatment period. Both of the patients showed marked improvement in mood, behaviour, self-care, cognitive and daily activity performance. The results revealed a marked improvement in conversation and interaction after administration of OBHB doses. The biochemical investigation of the blood samples before, during OBHB treatment and after 24 months of the treatment revealed only minor changes in the plasma lipids. There was a decrease in cholesterol level from 251 to 158 and 247 to 152 mg/dL in the two patients respectively after 24 months of the treatment. Similarly the level of high-density lipoprotein cholesterol was found to decrease from 157 to 79 and 149 to 76 mg/dL, respectively in two patients. Thus OBHB can be a promising agent in the treatment of hyperketonemia and can be taken as an oral supplement without changing the habitual diet. PMID:26221318

  16. Production of the Chiral Compound (R)-3-Hydroxybutyrate by a Genetically Engineered Methylotrophic Bacterium▿

    PubMed Central

    Hölscher, Tina; Breuer, Uta; Adrian, Lorenz; Harms, Hauke; Maskow, Thomas

    2010-01-01

    In this study, a methylotrophic bacterium, Methylobacterium rhodesianum MB 126, was used for the production of the chiral compound (R)-3-hydroxybutyrate (R-3HB) from methanol. R-3HB is formed during intracellular degradation of the storage polymer (R)-3-polyhydroxybutyrate (PHB). Since the monomer R-3HB does not accumulate under natural conditions, M. rhodesianum was genetically modified. The gene (hbd) encoding the R-3HB-degrading enzyme, R-3HB dehydrogenase, was inactivated in M. rhodesianum. The resulting hbd mutant still exhibited low growth rates on R-3HB as the sole source of carbon and energy, indicating the presence of alternative pathways for R-3HB utilization. Therefore, transposon mutagenesis was carried out with the hbd mutant, and a double mutant unable to grow on R-3HB was obtained. This mutant was shown to be defective in lipoic acid synthase (LipA), resulting in an incomplete citric acid cycle. Using the hbd lipA mutant, we produced 3.2 to 3.5 mM R-3HB in batch and 27 mM (2,800 mg liter−1) in fed-batch cultures. This was achieved by sequences of cultivation conditions initially favoring growth, then PHB accumulation, and finally PHB degradation. PMID:20581197

  17. Lipase-catalyzed resolution of (2R*,3S*)- and (2R*,3R*)-3-methyl-3-phenyl-2-aziridinemethanol at low temperatures and determination of the absolute configurations of the four stereoisomers.

    PubMed

    Sakai, Takashi; Liu, Yu; Ohta, Hiroshi; Korenaga, Toshinobu; Ema, Tadashi

    2005-02-18

    [reaction: see text] Lipase-catalyzed resolution of (2R*,3S*)-3-methyl-3-phenyl-2-aziridinemethanol, (+/-)-2, at low temperatures gave synthetically useful (2R,3S)-2 and its acetate (2S,3R)-2a with (2S)-selectivity (E = 55 at -40 degrees C), while a similar reaction of (2R*,3R*)-3-methyl-3-phenyl-2-aziridinemethanol, (+/-)-3, gave (2S,3S)-3 and its acetate (2R,3R)-3a with (2R)-selectivity (E = 73 at -20 degrees C). Compound (+/-)-2 was prepared conveniently via diastereoselective addition of MeMgBr to tert-butyl 3-phenyl-2H-azirine-2-carboxylate, (+/-)-1a, which was successfully prepared by the Neber reaction of oxime tosylate of tert-butyl benzoyl acetate 7a. The tert-butyl ester was requisite to promote this reaction. For determination of the absolute configuration of (2S,3R)-2a, enantiopure (2S,3R)-2 was independently prepared in three steps involving diastereoselective methylation of 3-phenyl-2H-azirine-2-methanol, (S)-10, with MeMgBr. The absolute configuration of (2S,3S)-3 was determined by X-ray analysis of the corresponding N-(S)-2-(6-methoxy-2-naphthyl)propanoyl derivative (S,S,S)-13. PMID:15704972

  18. Allelic variation of the Tas1r3 taste receptor gene selectively affects taste responses to sweeteners: evidence from 129.B6-Tas1r3 congenic mice.

    PubMed

    Inoue, Masashi; Glendinning, John I; Theodorides, Maria L; Harkness, Sarah; Li, Xia; Bosak, Natalia; Beauchamp, Gary K; Bachmanov, Alexander A

    2007-12-19

    The Tas1r3 gene encodes the T1R3 receptor protein, which is involved in sweet taste transduction. To characterize ligand specificity of the T1R3 receptor and the genetic architecture of sweet taste responsiveness, we analyzed taste responses of 129.B6-Tas1r3 congenic mice to a variety of chemically diverse sweeteners and glucose polymers with three different measures: consumption in 48-h two-bottle preference tests, initial licking responses, and responses of the chorda tympani nerve. The results were generally consistent across the three measures. Allelic variation of the Tas1r3 gene influenced taste responsiveness to nonnutritive sweeteners (saccharin, acesulfame-K, sucralose, SC-45647), sugars (sucrose, maltose, glucose, fructose), sugar alcohols (erythritol, sorbitol), and some amino acids (D-tryptophan, D-phenylalanine, L-proline). Tas1r3 genotype did not affect taste responses to several sweet-tasting amino acids (L-glutamine, L-threonine, L-alanine, glycine), glucose polymers (Polycose, maltooligosaccharide), and nonsweet NaCl, HCl, quinine, monosodium glutamate, and inosine 5'-monophosphate. Thus Tas1r3 polymorphisms affect taste responses to many nutritive and nonnutritive sweeteners (all of which must interact with a taste receptor involving T1R3), but not to all carbohydrates and amino acids. In addition, we found that the genetic architecture of sweet taste responsiveness changes depending on the measure of taste response and the intensity of the sweet taste stimulus. Variation in the T1R3 receptor influenced peripheral taste responsiveness over a wide range of sweetener concentrations, but behavioral responses to higher concentrations of some sweeteners increasingly depended on mechanisms that could override input from the peripheral taste system. PMID:17911381

  19. Gold-rich R3Au7Sn3: Establishing the interdependence between electronic features and physical properties

    DOE PAGESBeta

    Provino, Alessia; Steinberg, Simon; Smetana, Volodymyr; Kulkarni, Ruta; Dhar, Sudesh K.; Manfrinetti, Pietro; Mudring, Anja -Verena

    2015-05-18

    Two new polar intermetallic compounds Y3Au7Sn3 (I) and Gd3Au7Sn3 (II) have been synthesized and their structures have been determined by single crystal X-ray diffraction (P63/m; Z = 2, a = 8.148(1)/8.185(3), and c = 9.394(2)/9.415(3) for I/II, respectively). They can formally be assigned to the Cu10Sn3 type and consist of parallel slabs of Sn centered, edge-sharing trigonal Au6 antiprisms connected through R3 (R = Y, Gd) triangles. Additional Au atoms reside in the centres of trigonal Au6 prisms forming Au@Au6 clusters with Au–Au distances of 2.906–2.960 Å, while the R–R contacts in the R3 groups are considerably larger than themore » sums of their metallic radii. These exclusive structural arrangements provide alluring systems to study the synergism between strongly correlated systems, particularly, those in the structure of (II), and extensive polar intermetallic contacts, which has been inspected by measurements of the magnetic properties, heat capacities and electrical conductivities of both compounds. Gd3Au7Sn3 shows an antiferromagnetic ordering at 13 K, while Y3Au7Sn3 is a Pauli paramagnet and a downward curvature in its electrical resistivity at about 1.9 K points to a superconducting transition. DFT-based band structure calculations on R3Au7Sn3 (R = Y, Gd) account for the results of the conductivity measurements and different spin ordering models of (II) provide conclusive hints about its magnetic structure. As a result, chemical bonding analyses of both compounds indicate that the vast majority of bonding originates from the heteroatomic Au–Gd and Au–Sn interactions, while homoatomic Au–Au bonding is evident within the Au@Au6 clusters.« less

  20. Impaired Glucose Metabolism in Mice Lacking the Tas1r3 Taste Receptor Gene

    PubMed Central

    2015-01-01

    The G-protein-coupled sweet taste receptor dimer T1R2/T1R3 is expressed in taste bud cells in the oral cavity. In recent years, its involvement in membrane glucose sensing was discovered in endocrine cells regulating glucose homeostasis. We investigated importance of extraorally expressed T1R3 taste receptor protein in age-dependent control of blood glucose homeostasis in vivo, using nonfasted mice with a targeted mutation of the Tas1r3 gene that encodes the T1R3 protein. Glucose and insulin tolerance tests, as well as behavioral tests measuring taste responses to sucrose solutions, were performed with C57BL/6ByJ (Tas1r3+/+) inbred mice bearing the wild-type allele and C57BL/6J-Tas1r3tm1Rfm mice lacking the entire Tas1r3 coding region and devoid of the T1R3 protein (Tas1r3-/-). Compared with Tas1r3+/+ mice, Tas1r3-/- mice lacked attraction to sucrose in brief-access licking tests, had diminished taste preferences for sucrose solutions in the two-bottle tests, and had reduced insulin sensitivity and tolerance to glucose administered intraperitoneally or intragastrically, which suggests that these effects are due to absence of T1R3. Impairment of glucose clearance in Tas1r3-/- mice was exacerbated with age after intraperitoneal but not intragastric administration of glucose, pointing to a compensatory role of extraoral T1R3-dependent mechanisms in offsetting age-dependent decline in regulation of glucose homeostasis. Incretin effects were similar in Tas1r3+/+ and Tas1r3-/- mice, which suggests that control of blood glucose clearance is associated with effects of extraoral T1R3 in tissues other than the gastrointestinal tract. Collectively, the obtained data demonstrate that the T1R3 receptor protein plays an important role in control of glucose homeostasis not only by regulating sugar intake but also via its extraoral function, probably in the pancreas and brain. PMID:26107521

  1. Muscle regulatory factors regulate T1R3 taste receptor expression.

    PubMed

    Kokabu, Shoichiro; Lowery, Jonathan W; Toyono, Takashi; Seta, Yuji; Hitomi, Suzuro; Sato, Tsuyoshi; Enoki, Yuichiro; Okubo, Masahiko; Fukushima, Yosuke; Yoda, Tetsuya

    2015-12-25

    T1R3 is a T1R class of G protein-coupled receptors, composing subunit of the umami taste receptor when complexed with T1R1. T1R3 was originally discovered in gustatory tissue but is now known to be expressed in a wide variety of tissues and cell types such the intestine, pancreatic β-cells, skeletal muscle, and heart. In addition to taste recognition, the T1R1/T1R3 complex functions as an amino acid sensor and has been proposed to be a control mechanism for the secretion of hormones, such as cholecystokinin, insulin, and duodenal HCO3(-) and activates the mammalian rapamycin complex 1 (MTORC1) to inhibit autophagy. T1R3 knockout mice have increased rate of autophagy in the heart, skeletal muscle and liver. Thus, T1R3 has multiple physiological functions and is widely expressed in vivo. However, the exact mechanisms regulating T1R3 expression are largely unknown. Here, we used comparative genomics and functional analyses to characterize the genomic region upstream of the annotated transcriptional start of human T1R3. This revealed that the T1R3 promoter in human and mouse resides in an evolutionary conserved region (ECR). We also identified a repressive element located upstream of the human T1R3 promoter that has relatively high degree of conservation with rhesus macaque. Additionally, the muscle regulatory factors MyoD and Myogenin regulate T1R3 expression and T1R3 expression increases with skeletal muscle differentiation of murine myoblast C2C12 cells. Taken together, our study raises the possibility that MyoD and Myogenin might control skeletal muscle metabolism and homeostasis through the regulation of T1R3 promoter activity. PMID:26545778

  2. New Linear and Star-Shaped Thermogelling Poly([R]-3-hydroxybutyrate) Copolymers.

    PubMed

    Barouti, Ghislaine; Liow, Sing Shy; Dou, Qingqing; Ye, Hongye; Orione, Clément; Guillaume, Sophie M; Loh, Xian Jun

    2016-07-18

    The synthesis of multi-arm poly([R]-3-hydroxybutyrate) (PHB)-based triblock copolymers (poly([R]-3-hydroxybutyrate)-b-poly(N-isopropylacrylamide)-b-[[poly(methyl ether methacrylate)-g-poly(ethylene glycol)]-co-[poly(methacrylate)-g-poly(propylene glycol)

  3. Expansion and diversification of the Populus R2R3-MYB family of transcription factors.

    PubMed

    Wilkins, Olivia; Nahal, Hardeep; Foong, Justin; Provart, Nicholas J; Campbell, Malcolm M

    2009-02-01

    The R2R3-MYB proteins comprise one of the largest families of transcription factors in plants. R2R3-MYB family members regulate plant-specific processes, such as the elaboration of specialized cell types, including xylem, guard cells, trichomes, and root hairs, and the biosynthesis of specialized branches of metabolism, including phenylpropanoid biosynthesis. As such, R2R3-MYB family members are hypothesized to contribute to the emergence of evolutionary innovations that have arisen in specific plant lineages. As a first step in determining the role played by R2R3-MYB family members in the emergence of lineage-specific innovations in the genus Populus, the entire Populus trichocarpa R2R3-MYB family was characterized. The Populus R2R3-MYB complement is much larger than that found in other angiosperms with fully sequenced genomes. Phylogenetic analyses, together with chromosome placement, showed that the expansion of the Populus R2R3-MYB family was not only attributable to whole genome duplication but also involved selective expansion of specific R2R3-MYB clades. Expansion of the Populus R2R3-MYB family prominently involved members with expression patterns that suggested a role in specific components of Populus life history, including wood formation and reproductive development. An expandable compendium of microarray-based expression data (PopGenExpress) and associated Web-based tools were developed to better enable within- and between-species comparisons of Populus R2R3-MYB gene expression. This resource, which includes intuitive graphic visualization of gene expression data across multiple tissues, organs, and treatments, is freely available to, and expandable by, scientists wishing to better understand the genome biology of Populus, an ecologically dominant and economically important forest tree genus. PMID:19091872

  4. Closure report for underground storage tank 141-R3U1 and its associated underground piping

    SciTech Connect

    Mallon, B.J.; Blake, R.G.

    1994-03-01

    Underground storage tank UST 141-R3U1 at Lawrence Livermore National Laboratory (LLNL), was registered with the State Water Resources Control Board on June 27, 1984. This tank system consisted of a concrete tank, lined with polyvinyl chloride, and approximately 100 feet of PVC underground piping. UST 141-R3U1 had a capacity of 450 gallons. The underground piping connected three floor drains and one sink inside Building 141 to UST 141-R3U1. The wastewater collected in UST 141-R3U1 contained organic solvents, metals, and inorganic acids. On November 30, 1987, the 141-R3U1 tank system failed a precision tank test. The 141-R3U1 tank system was subsequently emptied and removed from service pending further precision tests to determine the location of the leak within the tank system. A precision tank test on February 5, 1988, was performed to confirm the November 30, 1987 test. Four additional precision tests were performed on this tank system between February 25, 1988, and March 6, 1988. The leak was located where the inlet piping from Building 141 penetrates the concrete side of UST 141-R3U1. The volume of wastewater that entered the backfill and soil around and/or beneath UST 141-R3U1 is unknown. On December 13, 1989, the LLNL Environmental Restoration Division submitted a plan to close UST 141-R3U1 and its associated piping to the Alameda County Department of Environmental Health. UST 141-R3U1 was closed as an UST, and shall be used instead as additional secondary containment for two aboveground storage tanks.

  5. A regulatory gene network related to the porcine umami taste receptor (TAS1R1/TAS1R3).

    PubMed

    Kim, J M; Ren, D; Reverter, A; Roura, E

    2016-02-01

    Taste perception plays an important role in the mediation of food choices in mammals. The first porcine taste receptor genes identified, sequenced and characterized, TAS1R1 and TAS1R3, were related to the dimeric receptor for umami taste. However, little is known about their regulatory network. The objective of this study was to unfold the genetic network involved in porcine umami taste perception. We performed a meta-analysis of 20 gene expression studies spanning 480 porcine microarray chips and screened 328 taste-related genes by selective mining steps among the available 12,320 genes. A porcine umami taste-specific regulatory network was constructed based on the normalized coexpression data of the 328 genes across 27 tissues. From the network, we revealed the 'taste module' and identified a coexpression cluster for the umami taste according to the first connector with the TAS1R1/TAS1R3 genes. Our findings identify several taste-related regulatory genes and extend previous genetic background of porcine umami taste. PMID:26554867

  6. Online / Offline reconstruction of trigger-less readout in the R3B experiment at FAIR

    NASA Astrophysics Data System (ADS)

    Kresan, Dmytro; Al-Turany, Mohammad; Uhlig, Florian

    2015-12-01

    The R3B (Reactions with Rare Radioactive Beams) experiment is one of the planned experiments at the future FAIR facility at GSI Darmstadt. R3B will cover experimental reaction studies with exotic nuclei far off stability, thus enabling a broad physics program with rare-isotope beams with emphasis on nuclear structure and dynamics. Several different detection subsystems as well as sophisticated DAQ system and data-analysis software are being developed for this purpose. The data analysis software for R3B is based on FairRoot framework and called R3BRoot. R3BRoot is being used for simulation and detector design studies for the last few years. Recently, it was successfully used directly with the data acquisition and for the analysis of the R3B test beam-time in April 2014. For the future beam times the framework has to deal with the free streaming readout of the detectors. The implementation within R3BRoot to fulfil this trigger-less run mode will be discussed in this paper, as well as the set of tools developed for the online reconstruction and quality assurance of the data during the run.

  7. Novel aspects of the Z and R3 antigens of Streptococcus agalactiae revealed by immunological testing.

    PubMed

    Maeland, Johan A; Radtke, Andreas; Lyng, Randi V; Mavenyengwa, Rooyen T

    2013-04-01

    Group B streptococci (GBS) are important human and bovine pathogens which can be classified by a variety of phenotype- and gene-based techniques. The capsular polysaccharide and strain-variable, surface-anchored proteins are particularly important phenotypic markers. In an earlier study, a previously unrecognized protein antigen called Z was described. It was expressed by 27.2% of GBS strains from Zimbabwe, usually in combination with R3 protein expression. In this study, a putative Z-specific antiserum actually contained antibodies against two different antigens named Z1 and Z2; Z1 was >250 kDa in molecular mass. Z1, Z2, and R3 generated multiple stained bands on Western blots and showed similar chromatographic characteristics with respect to molecular mass, aggregate formation, and charge. Of 28 reference and prototype GBS strains examined, 8/28 (28.5%) isolates expressed one, two, or all three of the Z1, Z2, and R3 antigens; 4/28 expressed all three antigens; 2/28 expressed Z2 and R3; 1/28 expressed Z1 only; and 1/28 expressed R3 only. Twenty (71.5%) of the 28 isolates expressed none of the three antigens. Expression of one or more of these antigens was shown by isolates of the capsular polysaccharide types Ia, Ib, V, and IX and NT strains and occurred in combination with expression of various other strain-variable and surface-localized protein antigens. When used as serosubtype markers, Z1, Z2, and R3 affected existing GBS serotype designations for some of the isolates. For instance, the R3 reference strain Prague 10/84 (ATCC 49447) changed serotype markers from V/R3 to V/R3, Z1, and Z2. Other isolates may change correspondingly, implying consequences for GBS serotyping and research. PMID:23408530

  8. Long-time behavior of solution for the compressible nematic liquid crystal flows in R3

    NASA Astrophysics Data System (ADS)

    Gao, Jincheng; Tao, Qiang; Yao, Zheng-an

    2016-08-01

    In this paper, we investigate the global existence and long-time behavior of classical solution for the compressible nematic liquid crystal flows in three-dimensional whole space. First of all, the global existence of classical solution is established under the condition that the initial data are close to the constant equilibrium state in HN (R3) (N ≥ 3)-framework. Then, one establishes algebraic time decay for the classical solution by weighted energy method. Finally, the algebraic decay rate of classical solution in Lp (R3)-norm with 2 ≤ p ≤ ∞ and optimal decay rate of their spatial derivative in L2 (R3)-norm are obtained if the initial perturbation belong to L1 (R3) additionally.

  9. Regulation of Cell Fate Determination by Single-Repeat R3 MYB Transcription Factors in Arabidopsis

    SciTech Connect

    Wang, Shucai; Chen, Jay

    2014-01-01

    MYB transcription factors regulate multiple aspects of plant growth and development. Among the large family of MYB transcription factors, single-repeat R3 MYB are characterized by their short sequence (<120 amino acids) consisting largely of the single MYB DNA-binding repeat. In the model plant Arabidopsis, R3 MYBs mediate lateral inhibition during epidermal patterning and are best characterized for their regulatory roles in trichome and root hair development. R3 MYBs act as negative regulators for trichome formation but as positive regulators for root hair development. In this article, we provide a comprehensive review on the role of R3 MYBs in the regulation of cell type specification in the model plant Arabidopsis.

  10. Genome-Wide Identification and Characterization of R2R3MYB Family in Cucumis sativus

    PubMed Central

    Li, Qiang; Zhang, Cunjia; Li, Jing; Wang, Lina; Ren, Zhonghai

    2012-01-01

    Background The R2R3MYB proteins comprise one of the largest families of transcription factors in plants. Although genome-wide analysis of this family has been carried out in some species, little is known about R2R3MYB genes in cucumber (Cucumis sativus L.). Principal Findings This study has identified 55 R2R3MYB genes in the latest cucumber genome and the CsR2R3MYB family contained the smallest number of identified genes compared to other species that have been studied due to the absence of recent gene duplication events. These results were also supported by genome distribution and gene duplication analysis. Phylogenetic analysis showed that they could be classified into 11 subgroups. The evolutionary relationships and the intron - exon organizations that showed similarities with Arabidopsis, Vitis and Glycine R2R3MYB proteins were also analyzed and suggested strong gene conservation but also the expansions of particular functional genes during the evolution of the plant species. In addition, we found that 8 out of 55 (∼14.54%) cucumber R2R3MYB genes underwent alternative splicing events, producing a variety of transcripts from a single gene, which illustrated the extremely high complexity of transcriptome regulation. Tissue-specific expression profiles showed that 50 cucumber R2R3MYB genes were expressed in at least one of the tissues and the other 5 genes showed very low expression in all tissues tested, which suggested that cucumber R2R3MYB genes took part in many cellular processes. The transcript abundance level analysis during abiotic conditions (NaCl, ABA and low temperature treatments) identified a group of R2R3MYB genes that responded to one or more treatments. Conclusions This study has produced a comparative genomics analysis of the cucumber R2R3MYB gene family and has provided the first steps towards the selection of CsR2R3MYB genes for cloning and functional dissection that can be used in further studies to uncover their roles in cucumber growth and

  11. Molecular field theory analysis of R 3Co 11B 4 compounds

    NASA Astrophysics Data System (ADS)

    Xiang-Mu, Zhang; Rui-Wang, Huang; Zhong-Wu, Zhang

    2002-03-01

    The temperature dependence of magnetization of the R 3Co 11B 4 compounds has been analysed using the two-sublattice molecular field theory. The molecular field coefficients, nCoCo, nRCo, nRR, have been calculated by a numerical fitting process. The analytic form of the exchange field HR( T) varying with temperature for each of the R 3Co 11B 4 compounds is presented, and some results are discussed.

  12. External mitochondrial NADH-dependent reductase of redox cyclers: VDAC1 or Cyb5R3?

    PubMed

    Nikiforova, Anna B; Saris, Nils-Erik L; Kruglov, Alexey G

    2014-09-01

    It was reported that VDAC1 possesses an NADH oxidoreductase activity and plays an important role in the activation of xenobiotics in the outer mitochondrial membrane. In the present work, we evaluated the participation of VDAC1 and Cyb5R3 in the NADH-dependent activation of various redox cyclers in mitochondria. We show that external NADH oxidoreductase caused the redox cycling of menadione ≫ lucigenin>nitrofurantoin. Paraquat was predominantly activated by internal mitochondria oxidoreductases. An increase in the ionic strength stimulated and suppressed the redox cycling of negatively and positively charged acceptors, as was expected for the Cyb5R3-mediated reduction. Antibodies against Cyb5R3 but not VDAC substantially inhibited the NADH-related oxidoreductase activities. The specific VDAC blockers G3139 and erastin, separately or in combination, in concentrations sufficient for the inhibition of substrate transport, exhibited minimal effects on the redox cycler-dependent NADH oxidation, ROS generation, and reduction of exogenous cytochrome c. In contrast, Cyb5R3 inhibitors (6-propyl-2-thiouracil, p-chloromercuriobenzoate, quercetin, mersalyl, and ebselen) showed similar patterns of inhibition of ROS generation and cytochrome c reduction. The analysis of the spectra of the endogenous cytochromes b5 and c in the presence of nitrofurantoin and the inhibitors of VDAC and Cyb5R3 demonstrated that the redox cycler can transfer electrons from Cyb5R3 to endogenous cytochrome c. This caused the oxidation of outer membrane-bound cytochrome b5, which is in redox balance with Cyb5R3. The data obtained argue against VDAC1 and in favor of Cyb5R3 involvement in the activation of redox cyclers in the outer mitochondrial membrane. PMID:24945955

  13. A potent antibrowning agent from pine needles of Cedrus deodara: 2R,3R-dihydromyricetin.

    PubMed

    Liang, Xue; Wu, Yan-Ping; Qiu, Jing-Hong; Zhong, Kai; Gao, Hong

    2014-09-01

    This article focuses on finding the novel antibrowning agents from the pine needles of Cedrus deodara and studying its antibrowning effect. By bioassay guide of tyrosinase inhibitory activity, the main active compound was isolated and purified from 50% methanol extract of pine needles of C. deodara through macroporous resin Diaion HP-20 column chromatography and high-performance liquid chromatography. Based on mass and nuclear magnetic resonance data, the active compound was identified as 2R,3R-dihydromyricetin, which showed the potent monophenolase and diphenolase inhibitory activities. Moreover, 2R,3R-dihydromyricetin exhibited a strong ABTS radical scavenging activity with a dose-dependent manner. The antibrowning efficacy of 2R,3R-dihydromyricetin was evaluated by monitoring the changes of L*, a*, and b* values and total color difference (△E) on fresh-cut apple slices. It was found that 2R,3R-dihydromyricetin was effective in inhibiting the browning of apple slices treated with a concentration as low as 0.05% at 25 °C for 24 h. Its antibrowning effect was significantly better than ascorbic acid (0.5%) alone. Furthermore, 2R,3R-dihydromyricetin showed a good synergistic antibrowning effect with ascorbic acid. This is the first report that 2R,3R-dihydromyricetin from pine needles of C. deodara may be used as a potential antibrowning agent in protecting against food browning. PMID:25163933

  14. Involvement of glucocorticoid in induction of lingual T1R3 in rodents.

    PubMed

    Ogawa, Nobuhumi; Kanki, Keita; Honda, Kotaro; Tomooka, Yasuhiro; Ryoke, Kazuo; Watanabe, Tatsuo

    2015-08-15

    We previously reported that in rats, chronic exposure to stress inhibits the induction of the common receptor (T1R3) for sweet and umami tastes. Here, we investigated whether endogenous glucocorticoids (GCs) might be responsible for this inhibition. In addition, we used mouse taste-bud cells (TB cells) expressing T1R3 to examine the effect of exogenous GC on T1R3 induction. Both adrenal glands were removed from rats [adrenalectomized (ADX) rats] and T1R3 mRNA expression in fungiform papillae was examined by real-time RT-PCR. T1R3 mRNA expression was significantly reduced in the ADX rats (versus sham-ADX rats). The reduced mRNA expression was restored to the level seen in the sham-ADX rats by administration of dexamethasone (DEX) at the smallest dose tested (0.1ng/kg, i.p.). However, with larger doses of DEX (10 and 1000ng/kg, i.p.) there was no such restoration (i.e., the expression level did not differ from that seen in ADX rats). Expression of the mRNA for the GC receptor-α was detected in mouse TB cells by RT-PCR. Significantly reduced T1R3 mRNA expression, as measured by real-time RT-PCR, was observed in TB cells at 24h after application of DEX (0.1, 1.0, or 10μM). These results suggest that in rodents: (a) a low concentration of endogenous GC is necessary and sufficient for induction of T1R3 expression, and that higher concentrations may actually inhibit such induction, and (b) this inhibitory effect may be due, at least in part, to a direct action of GC on taste cells. PMID:26096555

  15. Conformational Analysis of R-(+)-3-METHYLCYCLOPENTANONE by IR Spectroscopy in Para-Hydrogen Crystal

    NASA Astrophysics Data System (ADS)

    Al-Basheer, Watheq; Toh, Shin Yi; Miyazaki, Jun; Momose, Takamasa

    2014-06-01

    Para-hydrogen (pH_2) soft quantum crystal is an ideal isolation matrix due to its impressive intrinsic properties, i.e. its significant lattice constant, large zero-point vibration as well as its ability to repair itself of crystal defects. To investigate molecular conformation of a chiral ketone, IR spectra of R-(+)-3-methylcyclopentanone (R3MCP), hosted in pH_2 crystal, were recorded as a function of sample concentration and host pH_2 crystal temperature over the low deposition range {3.5-6.0K}. IR spectra of R3MCP in pH_2 crystal will be presented and compared against corresponding spectra in Ar matrix as well as IR spectra of the neat crystalline R3MCP at low deposition temperatures. Furthermore, density functional theory calculations of simulated IR spectra for the optimized geometries of R3MCP, equatorial-methyl and axial-methyl conformers are compared against experimental spectra for the purpose of investigating molecular conformation. Upon comparison between theoretical and experimental IR spectra, vibrational modes arising from equatorial and axial conformers have been successfully assigned and related to the individual conformer's structure.

  16. Tau Assembly: The Dominant Role of PHF6 (VQIVYK) in Microtubule Binding Region Repeat R3

    PubMed Central

    Ganguly, Pritam; Do, Thanh D.; Larini, Luca; LaPointe, Nichole E.; Sercel, Alexander J.; Shade, Madeleine F.; Feinstein, Stuart C.; Bowers, Michael T.; Shea, Joan-Emma

    2015-01-01

    Self-aggregation of the microtubule-binding protein Tau reduces its functionality and is tightly associated with Tau-related diseases, termed tauopathies. Tau aggregation is also strongly associated with two nucleating six-residue segments, namely PHF6 (VQIVYK) and PHF6* (VQIINK). In this paper, using experiments and computational modeling, we study the self-assembly of individual and binary mixtures of Tau fragments containing PHF6* (R2/wt; 273GKVQIINKKLDL284) and PHF6 (R3/wt; 306VQIVYKPVDLSK317), and a mutant R2/ΔK280 associated with a neurodegenerative tauopathy. The initial stage of aggregation is probed by ion-mobility mass spectrometry, the kinetics of aggregation monitored with Thioflavin T assays and the morphology of aggregates visualized by transmission electron microscopy. Insights into the structure of early aggregates and the factors stabilizing the aggregates are obtained from replica exchange molecular dynamics simulations. Our data suggest that R3/wt has a much stronger aggregation propensity than either R2/wt or R2/ΔK280. Heterodimers containing R3/wt are less stable than R3/wt homodimers but much more stable than homodimers of R2/wt and R2/ΔK280, suggesting a possible role of PHF6*/PHF6 interactions in initiating the aggregation of full length Tau. Lastly, R2/ΔK280 binds stronger to R3/wt than R2/wt suggesting a possible mechanism for a pathological loss of normal Tau function. PMID:25775228

  17. Hubble Investigation of the First Known, Multi-Fragment Main Belt Comet: P/2013 R3

    NASA Astrophysics Data System (ADS)

    Jewitt, David

    2013-10-01

    Comet-like object P/2013 R3, announced on 2013 Sept 27, is the latest of the newly discovered class of active asteroids {equivalently main-belt comets, MBCs}. Observations with the Keck 10-m telescope on Oct 01 and 02 reveal that P/2013 R3 is a multiple object, with three co-moving components resolved at 1.0 arcsec resolution. Multiplicity has never before been seen in the MBCs and offers the opportunity to study internal dynamics in detail. We request five orbits of DD time to explore P/2013 R3 at resolutions and sensitivities only possible with Hubble, to search for fainter fragments and to determine the dynamics of the components. P/2013 R3 is a leading candidate for a body breaking up under rotational stresses {presumably induced by YORP radiation forces}, and Hubble data will test this hypothesis by pin-pointing the dates of ejection of the fragments, their speeds, and their directions. Our Hubble MBC program has been remarkably successful in probing the activation triggers for this new class of objects, and our proposed program on P/2013 R3 will provide the first opportunity to track fragments associated with the activation event.

  18. Heightened Avidity for Trisodium Pyrophosphate in Mice Lacking Tas1r3

    PubMed Central

    Aleman, Tiffany R.; McCaughey, Stuart A.

    2015-01-01

    Laboratory rats and mice prefer some concentrations of tri- and tetrasodium pyrophosphate (Na3HP2O7 and Na4P2O7) to water, but how they detect pyrophosphates is unknown. Here, we assessed whether T1R3 is involved. We found that relative to wild-type littermate controls, Tas1r3 knockout mice had stronger preferences for 5.6–56mM Na3HP2O7 in 2-bottle choice tests, and they licked more 17.8–56mM Na3HP2O7 in brief-access tests. We hypothesize that pyrophosphate taste in the intact mouse involves 2 receptors: T1R3 to produce a hedonically negative signal and an unknown G protein-coupled receptor to produce a hedonically positive signal; in Tas1r3 knockout mice, the hedonically negative signal produced by T1R3 is absent, leading to a heightened avidity for pyrophosphate. PMID:25452580

  19. Decoy Strategies: The Structure of TL1A:DcR3 Complex

    SciTech Connect

    C Zhan; Y Patskovsky; Q Yan; Z Li; U Ramagopal; H Cheng; M Brenowitz; X Hui; S Nathenson; S Almo

    2011-12-31

    Decoy Receptor 3 (DcR3), a secreted member of the Tumor Necrosis Factor (TNF) receptor superfamily, neutralizes three different TNF ligands: FasL, LIGHT, and TL1A. Each of these ligands engages unique signaling receptors which direct distinct and critical immune responses. We report the crystal structures of the unliganded DcR3 ectodomain and its complex with TL1A, as well as complementary mutagenesis and biochemical studies. These analyses demonstrate that DcR3 interacts with invariant backbone and side-chain atoms in the membrane-proximal half of TL1A which supports recognition of its three distinct TNF ligands. Additional features serve as antideterminants that preclude interaction with other members of the TNF superfamily. This mode of interaction is unique among characterized TNF:TNFR family members and provides a mechanistic basis for the broadened specificity required to support the decoy function of DcR3, as well as for the rational manipulation of specificity and affinity of DcR3 and its ligands.

  20. The chain length of biologically produced (R)-3-hydroxyalkanoic acid affects biological activity and structure of anti-cancer peptides.

    PubMed

    Szwej, Emilia; Devocelle, Marc; Kenny, Shane; Guzik, Maciej; O'Connor, Stephen; Nikodinovic-Runic, Jasmina; Radivojevic, Jelena; Maslak, Veselin; Byrne, Annete T; Gallagher, William M; Zulian, Qun Ren; Zinn, Manfred; O'Connor, Kevin E

    2015-06-20

    Conjugation of DP18L peptide with (R)-3-hydroxydecanoic acid, derived from the biopolymer polyhydroxyalkanoate, enhances its anti-cancer activity (O'Connor et al., 2013. Biomaterials 34, 2710-2718). However, it is unknown if other (R)-3-hydroxyalkanoic acids (R3HAs) can enhance peptide activity, if chain length affects enhancement, and what effect R3HAs have on peptide structure. Here we show that the degree of enhancement of peptide (DP18L) anti-cancer activity by R3HAs is carbon chain length dependent. In all but one example the R3HA conjugated peptides were more active against cancer cells than the unconjugated peptides. However, R3HAs with 9 and 10 carbons were most effective at improving DP18L activity. DP18L peptide variant DP17L, missing a hydrophobic amino acid (leucine residue 4) exhibited lower efficacy against MiaPaCa cells. Circular dichroism analysis showed DP17L had a lower alpha helix content and the conjugation of any R3HA ((R)-3-hydroxyhexanoic acid to (R)-3-hydroxydodecanoic acid) to DP17L returned the helix content back to levels of DP18L. However (R)-3-hydroxyhexanoic did not enhance the anti-cancer activity of DP17L and at least 7 carbons were needed in the R3HA to enhance activity of D17L. DP17L needs a longer chain R3HA to achieve the same activity as DP18L conjugated to an R3HA. As a first step to assess the synthetic potential of polyhydroxyalkanoate derived R3HAs, (R)-3-hydroxydecanoic acid was synthetically converted to (±)3-chlorodecanoic acid, which when conjugated to DP18L improved its antiproliferative activity against MiaPaCa cells. PMID:25820126

  1. Topological aspects of the structure of chaotic attractors in R3

    NASA Astrophysics Data System (ADS)

    Tsankov, Tsvetelin Draganov

    We extend the methods for topological analysis of chaotic dynamical systems in R3 by introducing two new concepts---embedding manifolds and their canonical forms. These are used to specify in topological terms the large scale global structure of chaotic attracting sets. We show how these ideas help us put the finishing touch on the third coarsest level in a classification scheme for strange attractors in R3 , for which the two lower levels have been constructed about a decade ago. In addition we present a guide on how to construct a Poincare surface of section for strange attractors with Lyapunov dimension dL < 3. We show how to extract information about the canonical form from scalar time series. In addition we discuss what possible changes occur to the topological properties of the unstable periodic orbits in the strange attractor, as we use different embedding mappings into R3 .

  2. Matrix embeddings on flat R3 and the geometry of membranes

    NASA Astrophysics Data System (ADS)

    Berenstein, David; Dzienkowski, Eric

    2012-10-01

    We show that given three Hermitian matrices, what one could call a fuzzy representation of a membrane, there is a well-defined procedure to define a set of oriented Riemann surfaces embedded in R3 using an index function defined for points in R3 that is constructed from the three matrices and the point. The set of surfaces is covariant under rotations, dilatations and translation operations on R3; it is additive on direct sums; and the orientation of the surfaces is reversed by complex conjugation of the matrices. The index we build is closely related to the Hanany-Witten effect. We also show that the surfaces carry information of a line bundle with connection on them. We discuss applications of these ideas to the study of holographic matrix models and black hole dynamics.

  3. R3D Align: global pairwise alignment of RNA 3D structures using local superpositions

    PubMed Central

    Rahrig, Ryan R.; Leontis, Neocles B.; Zirbel, Craig L.

    2010-01-01

    Motivation: Comparing 3D structures of homologous RNA molecules yields information about sequence and structural variability. To compare large RNA 3D structures, accurate automatic comparison tools are needed. In this article, we introduce a new algorithm and web server to align large homologous RNA structures nucleotide by nucleotide using local superpositions that accommodate the flexibility of RNA molecules. Local alignments are merged to form a global alignment by employing a maximum clique algorithm on a specially defined graph that we call the ‘local alignment’ graph. Results: The algorithm is implemented in a program suite and web server called ‘R3D Align’. The R3D Align alignment of homologous 3D structures of 5S, 16S and 23S rRNA was compared to a high-quality hand alignment. A full comparison of the 16S alignment with the other state-of-the-art methods is also provided. The R3D Align program suite includes new diagnostic tools for the structural evaluation of RNA alignments. The R3D Align alignments were compared to those produced by other programs and were found to be the most accurate, in comparison with a high quality hand-crafted alignment and in conjunction with a series of other diagnostics presented. The number of aligned base pairs as well as measures of geometric similarity are used to evaluate the accuracy of the alignments. Availability: R3D Align is freely available through a web server http://rna.bgsu.edu/R3DAlign. The MATLAB source code of the program suite is also freely available for download at that location. Supplementary information: Supplementary data are available at Bioinformatics online. Contact: r-rahrig@onu.edu PMID:20929913

  4. Distinct Human and Mouse Membrane Trafficking Systems for Sweet Taste Receptors T1r2 and T1r3

    PubMed Central

    Shimizu, Madoka; Goto, Masao; Kawai, Takayuki; Yamashita, Atsuko; Kusakabe, Yuko

    2014-01-01

    The sweet taste receptors T1r2 and T1r3 are included in the T1r taste receptor family that belongs to class C of the G protein-coupled receptors. Heterodimerization of T1r2 and T1r3 is required for the perception of sweet substances, but little is known about the mechanisms underlying this heterodimerization, including membrane trafficking. We developed tagged mouse T1r2 and T1r3, and human T1R2 and T1R3 and evaluated membrane trafficking in human embryonic kidney 293 (HEK293) cells. We found that human T1R3 surface expression was only observed when human T1R3 was coexpressed with human T1R2, whereas mouse T1r3 was expressed without mouse T1r2 expression. A domain-swapped chimera and truncated human T1R3 mutant showed that the Venus flytrap module and cysteine-rich domain (CRD) of human T1R3 contain a region related to the inhibition of human T1R3 membrane trafficking and coordinated regulation of human T1R3 membrane trafficking. We also found that the Venus flytrap module of both human T1R2 and T1R3 are needed for membrane trafficking, suggesting that the coexpression of human T1R2 and T1R3 is required for this event. These results suggest that the Venus flytrap module and CRD receive taste substances and play roles in membrane trafficking of human T1R2 and T1R3. These features are different from those of mouse receptors, indicating that human T1R2 and T1R3 are likely to have a novel membrane trafficking system. PMID:25029362

  5. Genome Sequencing and Transposon Mutagenesis of Burkholderia seminalis TC3.4.2R3 Identify Genes Contributing to Suppression of Orchid Necrosis Caused by B. gladioli.

    PubMed

    Araújo, Welington L; Creason, Allison L; Mano, Emy T; Camargo-Neves, Aline A; Minami, Sonia N; Chang, Jeff H; Loper, Joyce E

    2016-06-01

    From a screen of 36 plant-associated strains of Burkholderia spp., we identified 24 strains that suppressed leaf and pseudobulb necrosis of orchid caused by B. gladioli. To gain insights into the mechanisms of disease suppression, we generated a draft genome sequence from one suppressive strain, TC3.4.2R3. The genome is an estimated 7.67 megabases in size, with three replicons, two chromosomes, and the plasmid pC3. Using a combination of multilocus sequence analysis and phylogenomics, we identified TC3.4.2R3 as B. seminalis, a species within the Burkholderia cepacia complex that includes opportunistic human pathogens and environmental strains. We generated and screened a library of 3,840 transposon mutants of strain TC3.4.2R3 on orchid leaves to identify genes contributing to plant disease suppression. Twelve mutants deficient in suppression of leaf necrosis were selected and the transposon insertions were mapped to eight loci. One gene is in a wcb cluster that is related to synthesis of extracellular polysaccharide, a key determinant in bacterial-host interactions in other systems, and the other seven are highly conserved among Burkholderia spp. The fundamental information developed in this study will serve as a resource for future research aiming to identify mechanisms contributing to biological control. PMID:26959838

  6. Subspecialization of R2R3-MYB Repressors for Anthocyanin and Proanthocyanidin Regulation in Forage Legumes

    PubMed Central

    Albert, Nick W.

    2015-01-01

    The synthesis of anthocyanin pigments and proanthocyanidins (condensed tannins) is regulated by MYB-bHLH-WDR (MBW) transcription factor complexes in all angiosperms studied to date. Tr-MYB133 and Tr-MYB134 were isolated from Trifolium repens and encode R2R3-MYBs that antagonize the activity of MBW activation complexes. These two genes are conserved in other legume species, and form two sub-clades within the larger anthocyanin/proanthocyanidin clade of MYB repressors. However, unlike petunia and Arabidopsis, these R2R3-MYB repressors do not prevent ectopic accumulation of anthocyanins or proanthocyanidins. Instead, they are expressed when anthocyanins or proanthocyanidins are being synthesized, and provide feedback regulation to MBW complexes. This feedback occurs because Tr-MYB133 and Tr-MYB134 are themselves regulated by MBW complexes. Tr-MYB133 is regulated by MBW complexes containing anthocyanin-related R2R3-MYB proteins (Tr-RED LEAF), while Tr-MYB134 is regulated by complexes containing the proanthocyanidin R2R3-MYBs (Tr-MYB14). Other features of the MBW gene regulation networks are also conserved within legumes, including the ability for the anthocyanin MBW complexes to activate the expression of the AN1/TT8 clade bHLH factor. The regulation of Tr-MYB133 and Tr-MYB134 by distinct, pathway-specific MBW complexes has resulted in subspecialization for controlling anthocyanin or proanthocyanidin synthesis. PMID:26779194

  7. A Neuro-genetic Control Scheme Application for Industrial R 3 Workspaces

    NASA Astrophysics Data System (ADS)

    Irigoyen, E.; Larrea, M.; Valera, J.; Gómez, V.; Artaza, F.

    This work presents a neuro-genetic control scheme for a R 3 workspace application. The solution is based on a Multi Objective Genetic Algorithm reference generator and an Adaptive Predictive Neural Network Controller. Crane position control is presented as an application of the proposed control scheme.

  8. Production of (R)-3-hydroxybutyric acid by Burkholderia cepacia from wood extract hydrolysates

    PubMed Central

    2014-01-01

    (R)-hydroxyalkanoic acids (R-HAs) are valuable building blocks for the synthesis of fine chemicals and biopolymers because of the chiral center and the two active functional groups. Hydroxyalkanoic acids fermentation can revolutionize the polyhydroxyalkanoic acids (PHA) production by increasing efficiency and enhancing product utility. Modifying the fermentation conditions that promotes the in vivo depolymerization and secretion to fermentation broth in wild type bacteria is a novel and promising approach to produce R-HAs. Wood extract hydrolysate (WEH) was found to be a suitable substrate for R-3-hydroxybutyric acid (R-3-HB) production by Burkholderia cepacia. Using Paulownia elongate WEH as a feedstock, the R-3-HB concentration in fermentation broth reached as high as 14.2 g/L after 3 days of batch fermentation and the highest concentration of 16.8 g/L was obtained at day 9. Further investigation indicated that the composition of culture medium contributed to the enhanced R-3-HB production. PMID:24949263

  9. R3D-2-MSA: the RNA 3D structure-to-multiple sequence alignment server.

    PubMed

    Cannone, Jamie J; Sweeney, Blake A; Petrov, Anton I; Gutell, Robin R; Zirbel, Craig L; Leontis, Neocles

    2015-07-01

    The RNA 3D Structure-to-Multiple Sequence Alignment Server (R3D-2-MSA) is a new web service that seamlessly links RNA three-dimensional (3D) structures to high-quality RNA multiple sequence alignments (MSAs) from diverse biological sources. In this first release, R3D-2-MSA provides manual and programmatic access to curated, representative ribosomal RNA sequence alignments from bacterial, archaeal, eukaryal and organellar ribosomes, using nucleotide numbers from representative atomic-resolution 3D structures. A web-based front end is available for manual entry and an Application Program Interface for programmatic access. Users can specify up to five ranges of nucleotides and 50 nucleotide positions per range. The R3D-2-MSA server maps these ranges to the appropriate columns of the corresponding MSA and returns the contents of the columns, either for display in a web browser or in JSON format for subsequent programmatic use. The browser output page provides a 3D interactive display of the query, a full list of sequence variants with taxonomic information and a statistical summary of distinct sequence variants found. The output can be filtered and sorted in the browser. Previous user queries can be viewed at any time by resubmitting the output URL, which encodes the search and re-generates the results. The service is freely available with no login requirement at http://rna.bgsu.edu/r3d-2-msa. PMID:26048960

  10. Genome-wide identification and characterization of R2R3MYB family in Rosaceae.

    PubMed

    González, Máximo; Carrasco, Basilio; Salazar, Erika

    2016-09-01

    Transcription factors R2R3MYB family have been associated with the control of secondary metabolites, development of structures, cold tolerance and response to biotic and abiotic stress, among others. In recent years, genomes of Rosaceae botanical family are available. Although this information has been used to study the karyotype evolution of these species from an ancestral genome, there are no studies that treat the evolution and diversity of gene families present in these species or in the botanical family. Here we present the first comparative study of the R2R3MYB subfamily of transcription factors in three species of Rosaceae family (Malus domestica, Prunus persica and Fragaria vesca). We described 186, 98 and 86 non-redundant gene models for apple, peach and strawberry, respectively. In this research, we analyzed the intron-exon structure and genomic distribution of R2R3MYB families mentioned above. The phylogenetic comparisons revealed putative functions of some R2R3MYB transcription factors. This analysis found 44 functional subgroups, seven of which were unique for Rosaceae. In addition, our results showed a highly collinearity among some genes revealing the existence of conserved gene models between the three species studied. Although some gene models in these species have been validated under several approaches, more research in the Rosaceae family is necessary to determine gene expression patterns in specific tissues and development stages to facilitate understanding of the regulatory and biochemical mechanism in this botanical family. PMID:27408811

  11. Structure of the S1S2 Glutamate Binding Domain of GluR3

    PubMed Central

    Ahmed, Ahmed H.; Wang, Qi; Sondermann, Holger; Oswald, Robert E.

    2009-01-01

    Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system. Determining the structural differences between the binding sites of different subtypes is crucial to our understanding of neuronal circuits and to the development of subtype specific drugs. The structures of the binding domain (S1S2) of the GluR3 (flip) AMPA receptor subunit bound to glutamate and AMPA and the GluR2 (flop) subunit bound to glutamate were determined by X-ray crystallography to 1.9, 2.1, and 1.55 Å, respectively. Overall, the structure of GluR3 (flip) S1S2 is very similar to GluR2 (flop) S1S2 (backbone RMSD of 0.30 ± 0.05 for glutamate-bound and 0.26 ± 0.01 for AMPA-bound). The differences in the flip and flop isoforms are subtle and largely arise from one hydrogen bond across the dimer interface and associated water molecules. Comparison of the binding affinity for various agonists and partial agonists suggest that the S1S2 domains of GluR2 and GluR3 show only small differences in affinity, unlike what is found for the intact receptors (with the exception of one ligand, Cl-HIBO, which has a ten-fold difference in affinity for GluR2 vs GluR3). PMID:19003990

  12. Project R-3, San Jose, Calif: Evaluation of Results and Development of a Cost Model.

    ERIC Educational Resources Information Center

    Rapp, M. L.; And Others

    This report is an evaluation by the Rand Corporation of a project designed to raise reading and arithmetic achievement of disadvantaged junior high school students. The project was prepared by Lockheed Missiles and Space Company for the San Jose Unified School District. Described are both the original R-3 program for a small number of students and…

  13. R3D-2-MSA: the RNA 3D structure-to-multiple sequence alignment server

    PubMed Central

    Cannone, Jamie J.; Sweeney, Blake A.; Petrov, Anton I.; Gutell, Robin R.; Zirbel, Craig L.; Leontis, Neocles

    2015-01-01

    The RNA 3D Structure-to-Multiple Sequence Alignment Server (R3D-2-MSA) is a new web service that seamlessly links RNA three-dimensional (3D) structures to high-quality RNA multiple sequence alignments (MSAs) from diverse biological sources. In this first release, R3D-2-MSA provides manual and programmatic access to curated, representative ribosomal RNA sequence alignments from bacterial, archaeal, eukaryal and organellar ribosomes, using nucleotide numbers from representative atomic-resolution 3D structures. A web-based front end is available for manual entry and an Application Program Interface for programmatic access. Users can specify up to five ranges of nucleotides and 50 nucleotide positions per range. The R3D-2-MSA server maps these ranges to the appropriate columns of the corresponding MSA and returns the contents of the columns, either for display in a web browser or in JSON format for subsequent programmatic use. The browser output page provides a 3D interactive display of the query, a full list of sequence variants with taxonomic information and a statistical summary of distinct sequence variants found. The output can be filtered and sorted in the browser. Previous user queries can be viewed at any time by resubmitting the output URL, which encodes the search and re-generates the results. The service is freely available with no login requirement at http://rna.bgsu.edu/r3d-2-msa. PMID:26048960

  14. Tau assembly: the dominant role of PHF6 (VQIVYK) in microtubule binding region repeat R3.

    PubMed

    Ganguly, Pritam; Do, Thanh D; Larini, Luca; LaPointe, Nichole E; Sercel, Alexander J; Shade, Madeleine F; Feinstein, Stuart C; Bowers, Michael T; Shea, Joan-Emma

    2015-04-01

    Self-aggregation of the microtubule-binding protein Tau reduces its functionality and is tightly associated with Tau-related diseases, termed tauopathies. Tau aggregation is also strongly associated with two nucleating six-residue segments, namely PHF6 (VQIVYK) and PHF6* (VQIINK). In this paper, using experiments and computational modeling, we study the self-assembly of individual and binary mixtures of Tau fragments containing PHF6* (R2/wt; (273)GKVQIINKKLDL(284)) and PHF6 (R3/wt; (306)VQIVYKPVDLSK(317)) and a mutant R2/ΔK280 associated with a neurodegenerative tauopathy. The initial stage of aggregation is probed by ion-mobility mass spectrometry, the kinetics of aggregation monitored with Thioflavin T assays, and the morphology of aggregates visualized by transmission electron microscopy. Insights into the structure of early aggregates and the factors stabilizing the aggregates are obtained from replica exchange molecular dynamics simulations. Our data suggest that R3/wt has a much stronger aggregation propensity than either R2/wt or R2/ΔK280. Heterodimers containing R3/wt are less stable than R3/wt homodimers but much more stable than homodimers of R2/wt and R2/ΔK280, suggesting a possible role of PHF6*-PHF6 interactions in initiating the aggregation of full-length Tau. Lastly, R2/ΔK280 binds more strongly to R3/wt than R2/wt, suggesting a possible mechanism for a pathological loss of normal Tau function. PMID:25775228

  15. A MarR Family Transcriptional Regulator, DptR3, Activates Daptomycin Biosynthesis and Morphological Differentiation in Streptomyces roseosporus

    PubMed Central

    Zhang, Qinling; Chen, Qiong; Zhuang, Shuai; Chen, Zhi; Li, Jilun

    2015-01-01

    Daptomycin produced by Streptomyces roseosporus is an important lipopeptide antibiotic used to treat human infections caused by Gram-positive pathogenic bacteria, including drug-resistant strains. The genetic basis for regulatory mechanisms of daptomycin production is poorly known. Here, we characterized the dptR3 gene, which encodes a MarR family transcriptional regulator located adjacent to the known daptomycin biosynthetic (dpt) genes. Deletion of dptR3 reduced daptomycin production significantly and delayed aerial mycelium formation and sporulation on solid media. Dissection of the mechanism underlying the function of DptR3 in daptomycin production revealed that it stimulates daptomycin production indirectly by altering the transcription of dpt structural genes. DptR3 directly activated the transcription of its own gene, dptR3, but repressed the transcription of the adjacent, divergent gene orf16 (which encodes a putative ABC transporter ATP-binding protein). A 66-nucleotide DptR3-binding site in the intergenic region of dptR3-orf16 was determined by DNase I footprinting, and the palindromic sequence TCATTGTTACCTATGCTCACAATGA (underlining indicates inverted repeats) in the protected region was found to be essential for DptR3 binding. orf16, the major target gene of DptR3, exerted a positive effect on daptomycin biosynthesis. Our findings indicate that DptR3 functions as a global regulator that positively controls daptomycin production and morphological development in S. roseosporus. PMID:25819953

  16. CLUSTER CHEMISTRY

    SciTech Connect

    Muetterties, Earl L.

    1980-05-01

    Metal cluster chemistry is one of the most rapidly developing areas of inorganic and organometallic chemistry. Prior to 1960 only a few metal clusters were well characterized. However, shortly after the early development of boron cluster chemistry, the field of metal cluster chemistry began to grow at a very rapid rate and a structural and a qualitative theoretical understanding of clusters came quickly. Analyzed here is the chemistry and the general significance of clusters with particular emphasis on the cluster research within my group. The importance of coordinately unsaturated, very reactive metal clusters is the major subject of discussion.

  17. (2R,3S,2'' R,3''R)-manniflavanone, a new gastrointestinal smooth muscle L-type calcium channel inhibitor, which underlies the spasmolytic properties of Garcinia buchananii stem bark extract.

    PubMed

    Balemba, Onesmo B; Stark, Timo D; Lösch, Sofie; Patterson, Savannah; McMillan, John S; Mawe, Gary M; Hofmann, Thomas

    2014-01-01

    Garcinia buchananii Baker stem bark extract (GBB) is a traditional medication of diarrhea and dysentery in sub-Saharan Africa. It is believed that GBB causes gastrointestinal smooth muscle relaxation. The aim of this study was to determine whether GBB has spasmolytic actions and identify compounds underlying these actions. Calcium (Ca(2+)) imaging was used to analyze the effect of GBB on Ca(2+) flashes and Ca(2+) waves in guinea pig gallbladder and distal colon smooth muscle. Intracellular microelectrode recording was used to determine the effect of GBB, six fractions of GBB, M1-5 and M7, and (2R,3S,2'' R,3''R)-manniflavanone, a compound isolated from M3 on action potentials in gallbladder smooth muscle. The technique was also used to analyze the effect of GBB, M3, and (2R,3S,2'' R,3''R)-manniflavanone on action potentials in the circular muscle of mouse and guinea pig distal colons, and the effect of GBB and (2R,3S,2''R,3'' R)-manniflavanone on slow waves in porcine ileum. GBB inhibited Ca(2+) flashes and Ca(2+) waves. GBB, M3 and (2R,3 S,2''R,3''R)-manniflavanone inhibited action potentials. L-type Ca(2+) channel activator Bay K 8644 increased the discharge of action potentials in mouse colon but did not trigger or increase action potentials in the presence of GBB and (2R,3S,2''R,3'' R)-manniflavanone. GBB and (2R,3S,2'' R,3''R)-manniflavanone inhibited action potentials in the presence of Bay K 8644. GBB and (2R,3 S,2''R,3''R)-manniflavanone reduced the amplitude but did not alter the frequency of slow waves in the porcine ileum. In conclusion, GBB and (2R,3S,2'' R,3''R)-manniflavanone relax smooth muscle by inhibiting L-type Ca(2+) channels, thus have potential for use as therapies of gastrointestinal smooth muscle spasms, and arrhythmias. PMID:26081368

  18. (2R,3S,2”R,3”R)-manniflavanone, a new gastrointestinal smooth muscle L-type calcium channel inhibitor, which underlies the spasmolytic properties of Garcinia buchananii stem bark extract

    PubMed Central

    Balemba, Onesmo B.; Lösch, Sofie; Patterson, Savannah; McMillan, John S.; Hofmann, Thomas; Mawe, Gary M.; Stark, Timo D.

    2016-01-01

    Garcinia buchananii Baker stem bark extract (GBB) is a traditional medication of diarrhea and dysentery in sub-Saharan Africa. It is believed that GBB causes gastrointestinal smooth muscle relaxation. The aim of this study was to determine whether GBB has spasmolytic actions and identify compounds underlying these actions. Calcium (Ca2+) imaging was used to analyze the effect of GBB on Ca2+ flashes and Ca2+ waves in guinea pig gallbladder and distal colon smooth muscle. Intracellular microelectrode recording was used to determine the effect of GBB, six fractions of GBB, M1–5 and M7, and (2R,3S,2”R,3”R)-manniflavanone, a compound isolated from M3 on action potentials in gallbladder smooth muscle. The technique was also used to analyze the effect of GBB, M3, and (2R,3S,2”R,3”R)-manniflavanone on action potentials in the circular muscle of mouse and guinea pig distal colons, and the effect of GBB and (2R,3S,2”R,3”R)-manniflavanone on slow waves in porcine ileum. GBB inhibited Ca2+ flashes and Ca2+ waves. GBB, M3 and (2R,3S,2”R,3”R)-manniflavanone inhibited action potentials. L-type Ca2+ channel activator Bay K 8644 increased the discharge of action potentials in mouse colon but did not trigger or increase action potentials in the presence of GBB and (2R,3S,2”R,3”R)-manniflavanone. GBB and (2R,3S,2”R,3”R)-manniflavanone inhibited action potentials in the presence of Bay K 8644. GBB and (2R,3S,2”R,3”R)-manniflavanone reduced the amplitude but did not alter the frequency of slow waves in the porcine ileum. In conclusion, GBB and (2R,3S,2”R,3”R)-manniflavanone relax smooth muscle by inhibiting L-type Ca2+ channels, thus have potential for use as therapies of gastrointestinal smooth muscle spasms, and arrhythmias. PMID:26081368

  19. Chiral crystal-structure transformation of R3Co4Sn13 (R =La and Ce )

    NASA Astrophysics Data System (ADS)

    Otomo, Yuka; Iwasa, Kazuaki; Suyama, Kazuya; Tomiyasu, Keisuke; Sagayama, Hajime; Sagayama, Ryoko; Nakao, Hironori; Kumai, Reiji; Murakami, Youichi

    2016-08-01

    The compounds designated as R3T4Sn13 (R = rare earth and T = transition metal) are hypothesized to be strongly correlated electron systems. Some of these compounds exhibit structural phase transitions with speculated charge-density-wave (CDW) formations. We carried out x-ray diffraction measurements in order to investigate the second-order phase transition of R3Co4Sn13 (R =La and Ce ) by using single-crystalline samples synthesized by the molten Sn-flux method. Both compounds exhibit the structural superlattice transformations characterized by the wave vector q =(1 /2 ,1 /2 ,0 ) below TD≃160 K, which originate from electronic states owing to the common Co and Sn. The space group of the low-temperature phase is evidenced as a chiral cubic I 213 . The magnetic-susceptibility enhancement and the Co-ion valence shift below TD are signatures of a phase transition not fully attributed to the conventional CDW formation.

  20. Existence and multiplicity of solutions for Kirchhoff-type equation with radial potentials in {R3}

    NASA Astrophysics Data System (ADS)

    Li, Anran; Su, Jiabao

    2015-12-01

    In this paper, we deal with the Kirchhoff-type equation -[1+intlimits_{{{R}}^3} (|nabla u|^2+V(x)u^2)dx ][Δ u+V(x)u] = λ Q(x) f(u), quad xin {{R}}^3, quad quad quad {(P)_λ} u(x)→ 0, quad as |x|→ ∞ , where {λ > 0}, V and Q are radial functions, which can be vanishing or coercive at infinity. With assumptions on f just in a neighborhood of the origin, existence and multiplicity of nontrivial radial solutions are obtained via variational methods. In particular, if f is sublinear and odd near the origin, we obtain infinitely many solutions of {(P)_λ} for any {λ > 0}.

  1. Effects of Nitrogen Resources on Fermentative Biohydrogen Production of Biohydrogenbacterium R3 sp.nov.

    NASA Astrophysics Data System (ADS)

    Chen, Hong; Han, Wei; Yue, Li-ran; Li, Yong-feng; Liu, Kun; Yang, Chuan-ping

    2010-11-01

    This study discussed the effects of nitrogen resources (include organic nitrogen resources and inorganic nitrogen resources) on hydrogen production bacterium (HPB) Biohydrogenbacterium R3 sp.nov. The performance of organic nitrogen resource to Biohydrogenbacterium R3 sp.nov. was better than that of inorganic nitrogen resource on cell growth and hydrogen production. Yeast powder was most beneficial to promote cell growth and hydrogen production among all those nitrogen resources with the maximum of hydrogen production yield, hydrogen production ration and specific hydrogen produce ration were 1529.69 ml H2/L, 16.94 mmol H2/g CDW•h and 1.33 mol H2/mol glucose, respectively.

  2. Stereoselective Synthesis of (R)-3-Methylthalidomide by Piperidin-2-one Ring Assembly Approach.

    PubMed

    Yadav, Shyam Raj; Tiwari, Vinay Shankar; Haq, Wahajul

    2015-09-01

    A simple and stereoselective synthesis of 3-methylthalidomide, a configurationally stable thalidomide analog, is presented. Herein we describe the synthesis of (R)-3-methylthalidomide starting from (S)-alanine by piperidin-2-one ring assembly approach in high yield and enantiomeric purity without using a chiral auxiliary or reagent. Starting from (R)-alanine, the corresponding (S)-3-methylthalidomide can be prepared using the same methodology. PMID:26079113

  3. Comprehensive behavioral study of mGluR3 knockout mice: implication in schizophrenia related endophenotypes

    PubMed Central

    2014-01-01

    Background We previously performed systematic association studies of glutamate receptor gene family members with schizophrenia, and found positive associations of polymorphisms in the GRM3 (a gene of metabotropic glutamate receptor 3: mGluR3) with the disorder. Physiological roles of GRM3 in brain functions and its functional roles in the pathogenesis of schizophrenia remain to be resolved. Results We generated mGluR3 knockout (KO) mice and conducted comprehensive behavioral analyses. KO mice showed hyperactivity in the open field, light/dark transition, and 24-hour home cage monitoring tests, impaired reference memory for stressful events in the Porsolt forced swim test, impaired contextual memory in cued and contextual fear conditioning test, and impaired working memory in the T-Maze forced alternation task test. Hyperactivity and impaired working memory are known as endophenotypes of schizophrenia. We examined long-term synaptic plasticity by assessing long-term potentiation (LTP) in the CA1 region in the hippocampi of KO and wild-type (WT) mice. We observed no differences in the amplitude of LTP between the two genotypes, suggesting that mGluR3 is not essential for LTP in the CA1 region of the mouse hippocampus. As hyperactivity is typically associated with increased dopaminergic transmission, we performed in vivo microdialysis measurements of extracellular dopamine in the nucleus accumbens of KO and WT mice. We observed enhancements in the methamphetamine (MAP)-induced release of dopamine in KO mice. Conclusions These results demonstrate that a disturbance in the glutamate-dopamine interaction may be involved in the pathophysiology of schizophrenia-like behavior, such as hyperactivity in mGluR3 KO mice. PMID:24758191

  4. Metabolism of (Z)-(1R,3R)-Profluthrin in Rats.

    PubMed

    Abe, Jun; Nagahori, Hirohisa; Omori, Rie; Mikata, Kazuki; Kurosawa, Motohiro; Tomigahara, Yoshitaka; Isobe, Naohiko

    2015-10-01

    When [benzyl-α-(14)C]-labeled (Z)-(1R,3R)-profluthrin (2,3,5,6-tetrafluoro-4-methylbenzyl (Z)-(1R,3R)-2,2-dimethyl-3-(prop-1-enyl) cyclopropanecarboxylate, a newly developed pyrethroid) was administered orally to rats at 1 mg/kg, around 70% was absorbed, metabolized, and mainly excreted into urine within 48 h. Radioactivity in plasma reached Cmax at 6-8 h, and decreased (half-life; 37-52 h). A similar tendency was observed also in tissues. Absorption rate was slightly lower at high dose, while kinetics and distribution did not change. Eight metabolites were detected in urine and one in feces. Most of the (14)C in feces was unabsorbed (Z)-(1R,3R)-profluthrin. The main metabolic reactions were ester cleavage, hydroxylation of the methyl group on the C4-position of the benzene ring, and its glucuronidation or oxidation to carboxylic acid. Oxidation of the geminal dimethyl on the cyclopropane-C2 to carboxylic acid, oxidation followed by hydration of the propenyl double bond, and ω-oxidation to carboxylic acid and mercapturic acid conjugation of the benzyl alcohol were observed as minor reactions. PMID:26357989

  5. The cysteine-rich region of T1R3 determines responses to intensely sweet proteins.

    PubMed

    Jiang, Peihua; Ji, Qingzhou; Liu, Zhan; Snyder, Lenore A; Benard, Lumie M J; Margolskee, Robert F; Max, Marianna

    2004-10-22

    A wide variety of chemically diverse compounds taste sweet, including natural sugars such as glucose, fructose, sucrose, and sugar alcohols, small molecule artificial sweeteners such as saccharin and acesulfame K, and proteins such as monellin and thaumatin. Brazzein, like monellin and thaumatin, is a naturally occurring plant protein that humans, apes, and Old World monkeys perceive as tasting sweet but that is not perceived as sweet by other species including New World monkeys, mouse, and rat. It has been shown that heterologous expression of T1R2 plus T1R3 together yields a receptor responsive to many of the above-mentioned sweet tasting ligands. We have determined that the molecular basis for species-specific sensitivity to brazzein sweetness depends on a site within the cysteine-rich region of human T1R3. Other mutations in this region of T1R3 affected receptor activity toward monellin, and in some cases, overall efficacy to multiple sweet compounds, implicating this region as a previously unrecognized important determinant of sweet receptor function. PMID:15299024

  6. Enzyme-catalyzed synthesis of poly[(R)-(-)-3-hydroxybutyrate]: Formation of macroscopic granules in vitro

    SciTech Connect

    Gerngross, T.U.; Martin, D.P.

    1995-07-03

    A combined chemical and enzymatic procedure has been developed to synthesize macroscopic poly[(R)-(-)-3-hydroxybutyrate] (PHB) granules in vitro. The granules form in a matter of minutes when purified polyhydroxyalkanoate (PHA) synthase from Alcaligenes eutrophus is exposed to synthetically prepared (R)-3-hydroxybutyryl coenzyme A, thereby establishing the minimal requirements for PHB granule formation. The artificial granules are spherical with diameters of up to 3 {mu}m and significantly larger than their native counterparts (0.5 {mu}m). The isolated PHB was characterized by {sup 1}H and {sup 13}C NMR, gel-permeation chromatography, and chemical analysis. The in vitro polymerization system yields PHB with a molecular mass > 10 x 10{sup 6} Da, exceeding by an order of magnitude the mass of PHAs typically extracted from microorganisms. We also demonstrate that the molecular mass of the polymer can be controlled by the initial PHA synthase concentration. Preliminary kinetic analysis of de novo granule formation confirms earlier findings of a lag time for the enzyme but suggests the involvement of an additional granule assembly step. Minimal requirements for substrate recognition were investigated. Since substrate analogs lacking the adenosine 3{prime}, 5{prime}-bisphosphate moiety of (R)-3-hydroxybutyryl coenzyme A were not accepted by the PHA synthase, we provide evidence that this structural element of the substrate is essential for catalysis. PHAs provide a range of natural, renewable, biodegradable thermoplastics with a broad range of useful material properties. 33 refs., 6 figs., 1 tab.

  7. Antiausterity activity of arctigenin enantiomers: importance of (2R,3R)-absolute configuration.

    PubMed

    Awale, Suresh; Kato, Mamoru; Dibwe, Dya Fita; Li, Feng; Miyoshi, Chika; Esumi, Hiroyasu; Kadota, Shigetoshi; Tezuka, Yasuhiro

    2014-01-01

    From a MeOH extract of powdered roots of Wikstroemia indica, six dibenzyl-gamma-butyrolactone-type lignans with (2S,3S)-absolute configuration [(+)-arctigenin (1), (+)-matairesinol (2), (+)-trachelogenin (3), (+)-nortrachelogenin (4), (+)-hinokinin (5), and (+)-kusunokinin (6)] were isolated, whereas three dibenzyl-gamma-butyrolactone-type lignans with (2R,3R)-absolute configuration [(-)-arctigenin (1*), (-)-matairesinol (2*), (-)-trachelogenin (3*)] were isolated from Trachelospermum asiaticum. The in vitro preferential cytotoxic activity of the nine compounds was evaluated against human pancreatic PANC-1 cancer cells in nutrient-deprived medium (NDM), but none of the six lignans (1-6) with (2S,3S)-absolute configuration showed preferential cytotoxicity. On the other hand, three lignans (1*-3*) with (2R,3R)-absolute configuration exhibited preferential cytotoxicity in a concentration-dependent manner with PC50 values of 0.54, 6.82, and 5.85 microM, respectively. Furthermore, the effect of (-)- and (+)-arctigenin was evaluated against the activation of Akt, which is a key process in the tolerance to nutrition starvation. Interestingly, only (-)-arctigenin (1*) strongly suppressed the activation of Akt. These results indicate that the (2R,3R)-absolute configuration of (-)-enantiomers should be required for the preferential cytotoxicity through the inhibition of Akt activation. PMID:24660468

  8. A R2R3-MYB Transcription Factor from Epimedium sagittatum Regulates the Flavonoid Biosynthetic Pathway

    PubMed Central

    Lv, Haiyan; Luo, Ming; Zeng, Shaohua; Pattanaik, Sitakanta; Yuan, Ling; Wang, Ying

    2013-01-01

    Herba epimedii (Epimedium), a traditional Chinese medicine, has been widely used as a kidney tonic and antirheumatic medicine for thousands of years. The bioactive components in herba epimedii are mainly prenylated flavonol glycosides, end-products of the flavonoid pathway. Epimedium species are also used as garden plants due to the colorful flowers and leaves. Many R2R3-MYB transcription factors (TFs) have been identified to regulate the flavonoid and anthocyanin biosynthetic pathways. However, little is known about the R2R3-MYB TFs involved in regulation of the flavonoid pathway in Epimedium. Here, we reported the isolation and functional characterization of the first R2R3-MYB TF (EsMYBA1) from Epimedium sagittatum (Sieb. Et Zucc.) Maxim. Conserved domains and phylogenetic analysis showed that EsMYBA1 belonged to the subgroup 6 clade (anthocyanin-related MYB clade) of R2R3-MYB family, which includes Arabidopsis AtPAP1, apple MdMYB10 and legume MtLAP1. EsMYBA1 was preferentially expressed in leaves, especially in red leaves that contain higher content of anthocyanin. Alternative splicing of EsMYBA1 resulted in three transcripts and two of them encoded a MYB-related protein. Yeast two-hybrid and transient luciferase expression assay showed that EsMYBA1 can interact with several bHLH regulators of the flavonoid pathway and activate the promoters of dihydroflavonol 4-reductase (DFR) and anthocyanidin synthase (ANS). In both transgenic tobacco and Arabidopsis, overexpression of EsMYBA1 induced strong anthocyanin accumulation in reproductive and/or vegetative tissues via up-regulation of the main flavonoid-related genes. Furthermore, transient expression of EsMYBA1 in E. sagittatum leaves by Agrobacterium infiltration also induced anthocyanin accumulation in the wounded area. This first functional characterization of R2R3-MYB TFs in Epimedium species will promote further studies of the flavonoid biosynthesis and regulation in medicinal plants. PMID:23936468

  9. The R2R3-Myb transcription fators of cotton: SNP characterization, chromosomal assignment, and phylogenetic analysis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The R2R3-Myb transcription factors are involved in many plant physiological and biochemical processes including regulation of trichome length and density in Arabidopsis. In cotton, Gossypium spp.,the developmental regulation of some R2R3-Myb transcription factors are related to fiber differentiatio...

  10. Coulomb excitation of exotic nuclei at the R3B-LAND setup

    NASA Astrophysics Data System (ADS)

    Rossi, D. M.; Adrich, P.; Aksouh, F.; Alvarez-Pol, H.; Aumann, T.; Benlliure, J.; Böhmer, M.; Boretzky, K.; Casarejos, E.; Chartier, M.; Chatillon, A.; Cortina-Gil, D.; Datta Pramanik, U.; Emling, H.; Ershova, O.; Fernandez-Dominguez, B.; Geissel, H.; Gorska, M.; Heil, M.; Johansson, H.; Junghans, A.; Kiselev, O.; Klimkiewicz, A.; Kratz, J. V.; Kurz, N.; Labiche, M.; Le Bleis, T.; Lemmon, R.; Litvinov, Yu A.; Mahata, K.; Maierbeck, P.; Movsesyan, A.; Nilsson, T.; Nociforo, C.; Palit, R.; Paschalis, S.; Plag, R.; Reifarth, R.; Simon, H.; Sümmerer, K.; Wagner, A.; Walus, W.; Weick, H.; Winkler, M.

    2013-03-01

    Exotic Ni isotopes have been measured at the R3B-LAND setup at GSI in Darmstadt, using Coulomb excitation in inverse kinematics at beam energies around 500 MeV/u. As the experimental setup allows kinematically complete measurements, the excitation energy was reconstructed using the invariant mass method. The GDR and additional low-lying strength have been observed in 68Ni, the latter exhausting 4.1(1.9)% of the E1 energy-weighted sum rule. Also, the branching ratio for the non-statistical decay of the excited 68Ni nuclei was measured and amounts to 24(4)%.

  11. Solitary solutions for a class of Schrödinger equations in R^3

    NASA Astrophysics Data System (ADS)

    Wang, Youjun

    2016-08-01

    In this paper, we consider a model problem arising from a classical planar Heisenberg ferromagnetic spin chain -Δ u + (λ + ɛ') u ∓ Δ √{1-u2}u/√{1- u2} - ɛ'u/√{1 - u2} = 0, x in R3, where {λ} and {ɛ'}are real constants. By variational methods and perturbation arguments, we study the existence of positive classical solutions. Our results generalize the previous results in one-dimensional space given by Brüll et al. [4].

  12. HOTAIR Promotes Proliferation, Migration, and Invasion of Ovarian Cancer SKOV3 Cells Through Regulating PIK3R3

    PubMed Central

    Dong, Lijun; Hu, Lina

    2016-01-01

    Background The aim of this study was to determine the effect on proliferation, migration, and invasion after silencing HOTAIR in ovarian cancer SKOV3 cells, and to elucidate the potential mechanism. Material/Methods We analyzed the mRNA expression level of HOTAIR and PIK3R3 in ovarian cancer SKOV3, OVCAR3, and A2780 cell lines. We analyzed the mRNA expression level of HOTAIR and PIK3R3 in ovarian SKOV3 after transection with miR-214 or miR-217. We analyzed the mRNA and protein expression level of PIK3R3 when silencing HOTAIR. We analyzed the expression of HOTAIR when silencing PIK3R3. We analyzed the proliferation, migration and invasion in ovarian cancer SKOV3 after silencing HOTAIR or PIK3R3. Results The expression of HOTAIR and PIK3R3 in ovarian SKOV3 and OVCAR3 was increased compared with A2780 cells (P<0.05). The mRNA level of HOTAIR and PIK3R3 in ovarian cancer SKOV3 cells was decreased when transected with miR-214 or miR-217 compared to negative control (p<0.05). The mRNA and protein level of PIK3R3 was decreased when HOTAIR was silenced and the mRNA level of HOTAIR was decreased when PIK3R3 was silenced (p<0.05). The proliferation, migration and invasion was decreased in ovarian SKOV3 when HOTAIR or PIK3R3 was silenced (p<0.05). Conclusions HOTAIR can promote proliferation, migration, and invasion in ovarian SKOV3 cells as a competing endogenous RNA. PMID:26826873

  13. The Scutellaria baicalensis R2R3-MYB Transcription Factors Modulates Flavonoid Biosynthesis by Regulating GA Metabolism in Transgenic Tobacco Plants

    PubMed Central

    Liu, Yunjun; Yang, Jian; Huang, Luqi

    2013-01-01

    R2R3-MYB proteins play role in plant development, response to biotic and abiotic stress, and regulation of primary and secondary metabolism. Little is known about the R2R3-MYB proteins in Scutellaria baicalensis which is an important Chinese medical plant. In this paper, nineteen putative SbMYB genes were identified from a S. baicalensis cDNA library, and eleven R2R3-MYBs were clustered into 5 subgroups according to phylogenetic reconstruction. In the S. baicalensis leaves which were sprayed with GA3, SbMYB2 and SbMYB7 had similar expression pattern with SbPALs, indicating that SbMYB2 and SbMYB7 might be involved in the flavonoid metabolism. Transactivation assay results showed that SbMYB2 and SbMYB7 can function as transcriptional activator. The expression of several flavonoid biosynthesis-related genes were induced or suppressed by overexpression of SbMYB2 or SbMYB7 in transgenic tobacco plants. Consistent with the change of the expression of NtDH29 and NtCHI, the contents of dicaffeoylspermidine and quercetin-3,7-O-diglucoside in SbMYB2-overexpressing or SbMYB7-overexpressing transgenic tobacco plants were decreased. The transcriptional level of NtUFGT in transgenic tobacco overexpressing SbMYB7 and the transcriptional level of NtHCT in SbMYB2-overexpressing tobacco plants were increased; however the application of GA3 inhibited the transcriptional level of these two genes. These results suggest that SbMYB2 and SbMYB7 might regulate the flavonoid biosynthesis through GA metabolism. PMID:24143216

  14. Reliability and validity of the tritrac-R3D accelerometer during backpacking: a case study.

    PubMed

    DeVoe, D; Dalleck, L

    2001-08-01

    This study investigated the utility of the Tritrac-R3D accelerometer as a reliable and valid instrument in the quantification of physical activity while backpacking in the field and to evaluate heart-rate responses and oxygen consumption to assess the feasibility of using the Tritrac-R3D to estimate caloric expenditure. Two 7-day backpacking expeditions were conducted in two consecutive years by a single subject at Grand Canyon National Park, Arizona. The average hiking heart rate ranged front 60% to 77% HRmax during the expeditions. The average rate of estimated caloric cost ranged from 6.8 to 11.7 kcals x min.(-1) (equivalent to 408 to 702 kcals x hr.(-1)), indicating a relatively moderate to high level of exertion. The Tritrac had adequate consistency and reliability in the field between the two expeditions in recorded activity counts. The Tritrac underestimated caloric expenditure during backpacking with changes in terrain, and hiking speed contributed to even greater disparity in accuracy. PMID:11693704

  15. pipsqueak encodes a novel nuclear protein required downstream of seven-up for the development of photoreceptors R3 and R4.

    PubMed Central

    Weber, U; Siegel, V; Mlodzik, M

    1995-01-01

    Photoreceptor induction in the Drosophila eye is mediated by activation of the Ras signal transduction cascade. Although this process is well understood, little is known about how the diversity of photoreceptor subtypes is generated. The pipsqueak (psq) gene is expressed at high levels in the R3/R4 precursors during eye development and this expression depends on seven-up (svp) gene function. Moreover, strong psq alleles are dominant suppressors of a svp-induced cone cell transformation phenotype. Although the gene was previously identified and described as a member of the maternal posterior group of genes, the strong semilethal alleles isolated here demonstrate a specific requirement for psq function downstream of svp for the development of photoreceptors R3/R4. The gene has three independent 5' ends and codes for several nuclear protein isoforms, some containing the POZ domain which has been implicated in protein-protein interactions. Interestingly, all viable alleles with a maternal posterior group phenotype cluster around one specific 5' exon, while all semilethal alleles have lesions which map to a different alternative 5' exon. Images PMID:8557044

  16. Effect of IP3R3 and NPY on age-related declines in olfactory stem cell proliferation.

    PubMed

    Jia, Cuihong; Hegg, Colleen C

    2015-02-01

    Losing the sense of smell because of aging compromises health and quality of life. In the mouse olfactory epithelium, aging reduces the capacity for tissue homeostasis and regeneration. The microvillous cell subtype that expresses both inositol trisphosphate receptor type 3 (IP3R3) and the neuroproliferative factor neuropeptide Y (NPY) is critical for regulation of homeostasis, yet its role in aging is undefined. We hypothesized that an age-related decline in IP3R3 expression and NPY signaling underlie age-related homeostatic changes and olfactory dysfunction. We found a decrease in IP3R3(+) and NPY(+) microvillous cell numbers and NPY protein and a reduced sensitivity to NPY-mediated proliferation over 24 months. However, in IP3R3-deficient mice, there was no further age-related reduction in cell numbers, proliferation, or olfactory function compared with wild type. The proliferative response was impaired in aged IP3R3-deficient mice when injury was caused by satratoxin G, which induces IP3R3-mediated NPY release, but not by bulbectomy, which does not evoke NPY release. These data identify IP3R3 and NPY signaling as targets for improving recovery following olfactotoxicant exposure. PMID:25482245

  17. Effect of IP3R3 and NPY on age-related declines in olfactory stem cell proliferation

    PubMed Central

    Jia, Cuihong; Hegg, Colleen C.

    2014-01-01

    Losing the sense of smell due to aging compromises health and quality of life. In the mouse olfactory epithelium (OE) aging reduces the capacity for tissue homeostasis and regeneration. The microvillous cell subtype that expresses both inositol trisphosphate receptor type 3 (IP3R3) and the neuroproliferative factor neuropeptide Y (NPY) is critical for regulation of homeostasis, yet its role in aging is undefined. We hypothesized that an age-related decline in IP3R3 expression and NPY signaling underlie age-related homeostatic changes and olfactory dysfunction. We found a decrease in IP3R3+ and NPY+ microvillous cell numbers and NPY protein, and a reduced sensitivity to NPY-mediated proliferation over 24 months. However, in IP3R3-deficient mice, there was no further age-related reduction in cell numbers, proliferation, or olfactory function compared to wild-type. The proliferative response was impaired in aged IP3R3-deficient mice when injury was caused by satratoxin-G, which induces IP3R3-mediated NPY release, but not by bulbectomy, which does not evoke NPY release. These data identify IP3R3 and NPY signaling as targets for improving recovery following olfactotoxicant exposure. PMID:25482245

  18. Meaningful Clusters

    SciTech Connect

    Sanfilippo, Antonio P.; Calapristi, Augustin J.; Crow, Vernon L.; Hetzler, Elizabeth G.; Turner, Alan E.

    2004-05-26

    We present an approach to the disambiguation of cluster labels that capitalizes on the notion of semantic similarity to assign WordNet senses to cluster labels. The approach provides interesting insights on how document clustering can provide the basis for developing a novel approach to word sense disambiguation.

  19. Glucose-Sensing Receptor T1R3: A New Signaling Receptor Activated by Glucose in Pancreatic β-Cells.

    PubMed

    Kojima, Itaru; Nakagawa, Yuko; Hamano, Kunihisa; Medina, Johan; Li, Longfei; Nagasawa, Masahiro

    2015-01-01

    Subunits of the sweet taste receptors T1R2 and T1R3 are expressed in pancreatic β-cells. Compared with T1R3, mRNA expression of T1R2 is considerably lower. At the protein level, expression of T1R2 is undetectable in β-cells. Accordingly, a major component of the sweet taste-sensing receptor in β-cells may be a homodimer of T1R3 rather than a heterodimer of T1R2/T1R3. Inhibition of this receptor by gurmarin or deletion of the T1R3 gene attenuates glucose-induced insulin secretion from β-cells. Hence the T1R3 homodimer functions as a glucose-sensing receptor (GSR) in pancreatic β-cells. When GSR is activated by the T1R3 agonist sucralose, elevation of intracellular ATP concentration ([ATP]i) is observed. Sucralose increases [ATP]i even in the absence of ambient glucose, indicating that sucralose increases [ATP]i not simply by activating glucokinase, a rate-limiting enzyme in the glycolytic pathway. In addition, sucralose augments elevation of [ATP]i induced by methylsuccinate, suggesting that sucralose activates mitochondrial metabolism. Nonmetabolizable 3-O-methylglucose also increases [ATP]i and knockdown of T1R3 attenuates elevation of [ATP]i induced by high concentration of glucose. Collectively, these results indicate that the T1R3 homodimer functions as a GSR; this receptor is involved in glucose-induced insulin secretion by activating glucose metabolism probably in mitochondria. PMID:25947913

  20. Gut T1R3 sweet taste receptors do not mediate sucrose-conditioned flavor preferences in mice.

    PubMed

    Sclafani, Anthony; Glass, Damien S; Margolskee, Robert F; Glendinning, John I

    2010-12-01

    Most mammals prefer the sweet taste of sugars, which is mediated by the heterodimeric T1R2+T1R3 taste receptor. Sugar appetite is also enhanced by the post-oral reinforcing actions of the nutrient in the gut. Here, we examined the contribution of gut T1R3 (either alone or as part of the T1R3+T1R3 receptor) to post-oral sugar reinforcement using a flavor-conditioning paradigm. We trained mice to associate consumption of a flavored solution (CS+) with intragastric (IG) infusions of a sweetener, and a different flavored solution (CS-) with IG infusions of water (23 h/day); then, we measured preference in a CS+ vs. CS- choice test. In experiment 1, we predicted that if activation of gut T1R3 mediates sugar reinforcement, then IG infusions of a nutritive (sucrose) or nonnutritive (sucralose) ligand for this receptor should condition a preference for the CS+ in B6 wild-type (WT) mice. While the mice that received IG sucrose infusions developed a strong preference for the CS+, those that received IG sucralose infusions developed a weak avoidance of the CS+. In experiment 2, we used T1R3 knockout (KO) mice to examine the necessity of gut T1R2+T1R3 receptors for conditioned flavor preferences. If intact gut T1R3 (or T1R2+T1R3) receptors are necessary for flavor-sugar conditioning, then T1R3 KO mice should not develop a sugar-conditioned flavor preference. We found that T1R3 KO mice, like WT mice, acquired a strong preference for the CS+ paired with IG sucrose infusions. The KO mice were also like WT mice in avoiding a CS+ flavor paired with IG sucralose infusions These findings provide clear evidence that gut T1R3 receptors are not necessary for sugar-conditioned flavor preferences or sucralose-induced flavor avoidance in mice. PMID:20926763

  1. CYB5R3: a key player in aerobic metabolism and aging?

    PubMed

    de Cabo, Rafael; Siendones, Emilio; Minor, Robin; Navas, Plácido

    2010-01-01

    Aging results from a complex and not completely understood chain of processes that are associated with various negative metabolic consequences and ultimately leads to senescence and death. The intracellular ratio of pyridine nucleotides (NAD(+)/NADH), has been proposed to be at the center stage of age-related biochemical changes in organisms, and may help to explain the observed influence of calorie restriction and energy-sensitive proteins on lifespan in model organisms. Indeed, the NAD(+)/NADH ratios affect the activity of a number of proteins, including sirtuins, which have gained prominence in the aging field as potential mediators of the beneficial effects of calorie restriction and mediating lifespan. Here we review the activities of a redox enzyme (NQR1 in yeast and CYB5R3 in mammals) that also influences the NAD(+)/NADH ratio and may play a regulatory role that connects aerobic metabolism with aging. PMID:20228936

  2. Classification of robust heteroclinic cycles for vector fields in {\\protect\\bb R}^3 with symmetry

    NASA Astrophysics Data System (ADS)

    Hawker, David; Ashwin, Peter

    2005-09-01

    We consider a classification of robust heteroclinic cycles in the positive octant of {\\bb R}^3 under the action of the symmetry group {{\\bb Z}_2}^3 . We introduce a coding system to represent different classes up to a topological equivalence, and produce a characterization of all types of robust heteroclinic cycle that can arise in this situation. These cycles may or may not contain the origin within the cycle. We proceed to find a connection between our problem and meandric numbers. We find a direct correlation between the number of classes of robust heteroclinic cycle that do not include the origin and the 'Mercedes-Benz' sequence of integers characterizing meanders through a 'Y-shaped' configuration. We investigate upper and lower bounds for the number of classes possible for robust cycles between n equilibria, one of which may be the origin.

  3. Performance analysis for the CALIFA Barrel calorimeter of the R3B experiment

    NASA Astrophysics Data System (ADS)

    Alvarez-Pol, H.; Ashwood, N.; Aumann, T.; Bertini, D.; Cabanelas, P.; Casarejos, E.; Cederkall, J.; Cortina-Gil, D.; Díaz Fernández, P.; Duran, I.; Fiori, E.; Galaviz, D.; Labiche, M.; Nacher, E.; Pietras, B.; Savran, D.; Tengblad, O.; Teubig, P.

    2014-12-01

    The CALIFA calorimeter is an advanced detector for gamma rays and light charged particles, accordingly optimized for the demanding requirements of the physics programme proposed for the R3B facility at FAIR. The multipurpose character of CALIFA is required to fulfil challenging demands in energy resolution (5-6% at 1 MeV for gamma rays) and efficiency. Charged particles, e.g. protons of energies up to 320 MeV in the Barrel section, should also be identified with an energy resolution better to 1%. CALIFA is divided into two well-separated sections: a "Forward EndCap" and a cylindrical "Barrel" covering an angular range from 43.2° to 140.3°. The Barrel section, based on long CsI(Tl) pyramidal frustum crystals coupled to large area avalanche photodiodes (LAAPDs), attains the requested high efficiency for calorimetric purposes. The construction of the CALIFA Demonstrator, comprising 20% of the total detector, has already been initiated, and commissioning experiments are expected for 2014. The assessment of the capabilities and expected performance of the detector elements is a crucial step in their design, along with the prototypes evaluation. For this purpose, the Barrel geometry has been carefully implemented in the simulation package R3BRoot, including easily variable thicknesses of crystal wrapping and carbon fibre supports. A complete characterization of the calorimeter response (including efficiency, resolution, evaluation of energy and reconstruction losses) under different working conditions, with several physics cases selected to probe the detector performance over a wide range of applications, has been undertaken. Prototypes of different sections of the CALIFA Barrel have been modeled and their responses have been evaluated and compared with the experimental results. The present paper summarizes the outcome of the simulation campaign for the entire Barrel section and for the corresponding prototypes tested at different European installations.

  4. Model-independent constraints on r-3 extra-interactions from orbital motions

    NASA Astrophysics Data System (ADS)

    Iorio, L.

    2012-07-01

    Constraints on long-range power-law modifications Upert ≈ r-3 of the usual Newtonian gravitational potential UN ≈ r-1 are inferred from orbital motions of well known artificial and natural bodies. They can be interpreted in terms of a characteristic length ℓ which may be identified with, e.g., the antide Sitter (AdS) radius of curvature ℓ in the Randall-Sundrum (RS) braneworld model, although this not a mandatory choice. Our bounds, complementary to those from tabletop laboratory experiments, do not rely upon more or less speculative and untested theoretical assumptions, contrary to other longrange RS tests proposed in astrophysical scenarios in which many of the phenomena adopted may depend on the system's composition, formation and dynamical history as well. Independently of the interpretation of ℓ the perihelion precession of Mercury and its radiotechnical ranging from the Earth yield ℓ ≲ 10-50 km. Tighter bounds come from the perigee precession of the Moon, from which it can be inferred ℓ ≲ 500-700m. The best constraints (ℓ ≲ 5m) come from the Satellite-to-Satellite Tracking (SST) range of the GRACE A/B spacecrafts orbiting the Earth: proposed follow-on of such a mission, implying a sub-nm s-1 range-rate accuracy,may constrain ℓ at ∼ 10 cm level. Weaker constraints come from the double pulsar system (ℓ ≲ 80-100 km) and fromthe main sequence star S2 orbiting the compact object in Sgr A* (ℓ ≲ 6.2-8.8 AU). Such bounds on the length ℓ, which must not necessarily be identified with the AdS radius of curvature of the RS model, naturally translate into constraints on an, e.g., universal coupling parameter K of the extra r-3 interaction. GRACE yields K ≤ 1×1016 m5 s-2.

  5. The R3-MYB Gene GhCPC Negatively Regulates Cotton Fiber Elongation

    PubMed Central

    Liu, Bingliang; Zhu, Yichao; Zhang, Tianzhen

    2015-01-01

    Cotton (Gossypium spp.) fibers are single-cell trichomes that arise from the outer epidermal layer of seed coat. Here, we isolated a R3-MYB gene GhCPC, identified by cDNA microarray analysis. The only conserved R3 motif and different expression between TM-1 and fuzzless-lintless mutants suggested that it might be a negative regulator in fiber development. Transgenic evidence showed that GhCPC overexpression not only delayed fiber initiation but also led to significant decreases in fiber length. Interestingly, Yeast two-hybrid analysis revealed an interaction complex, in which GhCPC and GhTTG1/4 separately interacted with GhMYC1. In transgenic plants, Q-PCR analysis showed that GhHOX3 (GL2) and GhRDL1 were significantly down regulated in −1–5 DPA ovules and fibers. In addition, Yeast one-hybrid analysis demonstrated that GhMYC1 could bind to the E-box cis-elements and the promoter of GhHOX3. These results suggested that GhHOX3 (GL2) might be downstream gene of the regulatory complex. Also, overexpression of GhCPC in tobacco led to differential loss of pigmentation. Taken together, the results suggested that GhCPC might negatively regulate cotton fiber initiation and early elongation by a potential CPC-MYC1-TTG1/4 complex. Although the fibers were shorter in transgenic cotton lines than in the wild type, no significant difference was detected in stem or leaf trichomes, even in cotton mutants (five naked seed or fuzzless), suggesting that fiber and trichome development might be regulated by two sets of genes sharing a similar model. PMID:25646816

  6. An R2R3-MYB Transcription Factor Regulates Eugenol Production in Ripe Strawberry Fruit Receptacles.

    PubMed

    Medina-Puche, Laura; Molina-Hidalgo, Francisco Javier; Boersma, Maaike; Schuurink, Robert C; López-Vidriero, Irene; Solano, Roberto; Franco-Zorrilla, José-Manuel; Caballero, José Luis; Blanco-Portales, Rosario; Muñoz-Blanco, Juan

    2015-06-01

    Eugenol is a volatile phenylpropanoid that contributes to flower and ripe fruit scent. In ripe strawberry (Fragaria × ananassa) fruit receptacles, eugenol is biosynthesized by eugenol synthase (FaEGS2). However, the transcriptional regulation of this process is still unknown. We have identified and functionally characterized an R2R3 MYB transcription factor (emission of benzenoid II [FaEOBII]) that seems to be the orthologous gene of PhEOBII from Petunia hybrida, which contributes to the regulation of eugenol biosynthesis in petals. The expression of FaEOBII was ripening related and fruit receptacle specific, although high expression values were also found in petals. This expression pattern of FaEOBII correlated with eugenol content in both fruit receptacle and petals. The expression of FaEOBII was repressed by auxins and activated by abscisic acid, in parallel to the ripening process. In ripe strawberry receptacles, where the expression of FaEOBII was silenced, the expression of cinnamyl alcohol dehydrogenase1 and FaEGS2, two structural genes involved in eugenol production, was down-regulated. A subsequent decrease in eugenol content in ripe receptacles was also observed, confirming the involvement of FaEOBII in eugenol metabolism. Additionally, the expression of FaEOBII was under the control of FaMYB10, another R2R3 MYB transcription factor that regulates the early and late biosynthetic genes from the flavonoid/phenylpropanoid pathway. In parallel, the amount of eugenol in FaMYB10-silenced receptacles was also diminished. Taken together, these data indicate that FaEOBII plays a regulating role in the volatile phenylpropanoid pathway gene expression that gives rise to eugenol production in ripe strawberry receptacles. PMID:25931522

  7. Expression and clinicopathological implication of DcR3 in lung cancer tissues: a tissue microarray study with 365 cases

    PubMed Central

    Zhang, Yu; Luo, Jie; He, Rongquan; Huang, Wenting; Li, Zuyun; Li, Ping; Dang, Yiwu; Chen, Gang; Li, Shikang

    2016-01-01

    Background Decoy receptor 3 (DcR3) has been reported to be involved in different cancers. However, few related researches have been accomplished on the role of DcR3 in lung cancer. Objective To explore the expression level and clinicopathological implication of DcR3 protein in lung cancer tissues. Materials and methods Immunohistochemistry was used to examine DcR3 protein expression in lung cancer (n=365) and normal lung tissues (n=26). The relationships between DcR3 expression and clinical parameters were further investigated. Furthermore, the diagnostic and clinicopathological value of DcR3 mRNA was analyzed based on The Cancer Genome Atlas database in lung cancer patients. Results Compared to normal lung tissues, DcR3 expression was significantly higher in lung cancer (P=0.007) tissues, including small-cell lung cancer (P=0.001) and non-small-cell lung cancer (P=0.008). In addition, DcR3 expression was related to tumor-node-metastasis (TNM) stage (P<0.001), tumor diameter (P=0.007), distant metastasis (P<0.001), and lymph node metastasis (P<0.001) in lung cancers. When concerning non-small-cell lung cancer, consistent correlations between DcR3 expression and TNM stage (P<0.001), tumor diameter (P=0.019), distant metastasis (P<0.001), and lymph node metastasis (P<0.001) were found. Simultaneously, in small-cell lung cancer, TNM stage (P=0.004) and lymph node metastasis (P=0.005) were also associated with DcR3 expression. Additionally, receiver operator characteristic curve revealed that the area under curve (AUC) of DcR3 was 0.637 (95% confidence interval [CI] 0.531–0.742) for lung cancer. Furthermore, DcR3 was overexpressed in both adenocarcinoma and squamous cell carcinoma tissues than in noncancerous lung tissues (all P<0.0001) based on the data from The Cancer Genome Atlas. AUC of DcR3 was 0.726 (95% CI 0.644–0.788) for lung adenocarcinoma patients and 0.647 (95% CI 0.566–0.728) for squamous cell carcinoma patients. DcR3 expression was also related to

  8. Design, Synthesis, and Antiplasmodial Activity of Hybrid Compounds Based on (2R,3S)-N-Benzoyl-3-phenylisoserine

    PubMed Central

    2013-01-01

    A series of hybrid compounds based on (2R,3S)-N-benzoyl-3-phenylisoserine, artemisinin, and quinoline moieties was synthesized and tested for in vitro antiplasmodial activity against erythrocytic stages of K1 and W2 strains of Plasmodium falciparum. Two hybrid compounds incorporating (2R,3S)-N-benzoyl-3-phenylisoserine and artemisinin scaffolds were 3- to 4-fold more active than dihydroartemisinin, with nanomolar IC50 values against Plasmodium falciparum K1 strain. PMID:24900723

  9. R3D Align web server for global nucleotide to nucleotide alignments of RNA 3D structures.

    PubMed

    Rahrig, Ryan R; Petrov, Anton I; Leontis, Neocles B; Zirbel, Craig L

    2013-07-01

    The R3D Align web server provides online access to 'RNA 3D Align' (R3D Align), a method for producing accurate nucleotide-level structural alignments of RNA 3D structures. The web server provides a streamlined and intuitive interface, input data validation and output that is more extensive and easier to read and interpret than related servers. The R3D Align web server offers a unique Gallery of Featured Alignments, providing immediate access to pre-computed alignments of large RNA 3D structures, including all ribosomal RNAs, as well as guidance on effective use of the server and interpretation of the output. By accessing the non-redundant lists of RNA 3D structures provided by the Bowling Green State University RNA group, R3D Align connects users to structure files in the same equivalence class and the best-modeled representative structure from each group. The R3D Align web server is freely accessible at http://rna.bgsu.edu/r3dalign/. PMID:23716643

  10. R3D Align web server for global nucleotide to nucleotide alignments of RNA 3D structures

    PubMed Central

    Rahrig, Ryan R.; Petrov, Anton I.; Leontis, Neocles B.; Zirbel, Craig L.

    2013-01-01

    The R3D Align web server provides online access to ‘RNA 3D Align’ (R3D Align), a method for producing accurate nucleotide-level structural alignments of RNA 3D structures. The web server provides a streamlined and intuitive interface, input data validation and output that is more extensive and easier to read and interpret than related servers. The R3D Align web server offers a unique Gallery of Featured Alignments, providing immediate access to pre-computed alignments of large RNA 3D structures, including all ribosomal RNAs, as well as guidance on effective use of the server and interpretation of the output. By accessing the non-redundant lists of RNA 3D structures provided by the Bowling Green State University RNA group, R3D Align connects users to structure files in the same equivalence class and the best-modeled representative structure from each group. The R3D Align web server is freely accessible at http://rna.bgsu.edu/r3dalign/. PMID:23716643

  11. Co-Dopant Influence on the Persistent Luminescence of BaAl2O4:Eu2+,R3+

    NASA Astrophysics Data System (ADS)

    Rodrigues, Lucas C. V.; Hölsä, Jorma; Carvalho, José M.; Pedroso, Cássio C. S.; Lastusaari, Mika; Felinto, Maria C. F. C.; Watanabe, Shigeo; Brito, Hermi F.

    2014-04-01

    The R3+ (rare earth) co-dopants may have a surprisingly important role in persistent luminescence - enhancement of up to 1-3 orders of magnitude may be obtained in the performance of these phosphor materials - depending strongly on the R3+ ion, of course. In this work, the effects of the R3+ co-dopants in the BaAl2O4:Eu2+,R3+ materials were studied using mainly thermoluminescence (TL) and synchrotron radiation XANES methods. In BaAl2O4, the conventional and persistent luminescence both arise from the 4f7→4f65d1 transition of Eu2+, yielding blue-green emission color. The former, in the presence of humidity, turns to more bluish because of creation of an additional Eu2+ luminescence centre which is not, however, visible in persistent luminescence. The trap structure in the non-co-doped BaAl2O4:Eu2+ is rather complex with 4-5 TL bands above room temperature. With R3+ co-doping, this basic structure is modified though no drastic change can be observed. This underlines the fact that even very small changes in the trap depths can produce significant modifications in the persistent luminescence efficiency. It should be remembered that basically the persistent luminescence performance is controlled by the Boltzmann population law depending exponentially on both the temperature and trap depth. Some mechanisms for persistent luminescence have suggested the presence of either divalent R2+ or tetravalent RIV during the charging of the Eu2+ doped materials. The present XANES measurements on BaAl2O4:Eu2+,R3+ confirmed the presence of only the trivalent form of the R3+ co-dopants excluding both of these pathways. It must thus be concluded, that the energy is stored in intrinsic and extrinsic defects created by the synthesis conditions and charge compensation due to R3+ co-doping. Even though the effect of the R3+ co-dopants was carefully exploited and characterized, the differences in the effect of different R3+ ions with very similar chemical and spectroscopic properties could

  12. T1r3 taste receptor involvement in gustatory neural responses to ethanol and oral ethanol preference

    PubMed Central

    Norman, Meghan B.; Lemon, Christian H.

    2010-01-01

    Elevated alcohol consumption is associated with enhanced preference for sweet substances across species and may be mediated by oral alcohol-induced activation of neurobiological substrates for sweet taste. Here, we directly examined the contribution of the T1r3 receptor protein, important for sweet taste detection in mammals, to ethanol intake and preference and the neural processing of ethanol taste by measuring behavioral and central neurophysiological responses to oral alcohol in T1r3 receptor-deficient mice and their C57BL/6J background strain. T1r3 knockout and wild-type mice were tested in behavioral preference assays for long-term voluntary intake of a broad concentration range of ethanol, sucrose, and quinine. For neurophysiological experiments, separate groups of mice of each genotype were anesthetized, and taste responses to ethanol and stimuli of different taste qualities were electrophysiologically recorded from gustatory neurons in the nucleus of the solitary tract. Mice lacking the T1r3 receptor were behaviorally indifferent to alcohol (i.e., ∼50% preference values) at concentrations typically preferred by wild-type mice (5–15%). Central neural taste responses to ethanol in T1r3-deficient mice were significantly lower compared with C57BL/6J controls, a strain for which oral ethanol stimulation produced a concentration-dependent activation of sweet-responsive NTS gustatory neurons. An attenuated difference in ethanol preference between knockouts and controls at concentrations >15% indicated that other sensory and/or postingestive effects of ethanol compete with sweet taste input at high concentrations. As expected, T1r3 knockouts exhibited strongly suppressed behavioral and neural taste responses to sweeteners but did not differ from wild-type mice in responses to prototypic salt, acid, or bitter stimuli. These data implicate the T1r3 receptor in the sensory detection and transduction of ethanol taste. PMID:20145204

  13. Contribution of the T1r3 taste receptor to the response properties of central gustatory neurons.

    PubMed

    Lemon, Christian H; Margolskee, Robert F

    2009-05-01

    T1r3 is a critical subunit of T1r sweet taste receptors. Here we studied how the absence of T1r3 impacts responses to sweet stimuli by taste neurons in the nucleus tractus solitarius (NTS) of the mouse. The consequences bear on the multiplicity of sweet taste receptors and how T1r3 influences the distribution of central gustatory neurons. Taste responses to glycine, sucrose, NaCl, HCl, and quinine were electrophysiologically recorded from single NTS neurons in anesthetized T1r3 knockout (KO) and wild-type (WT) C57BL/6 mice. Other stimuli included l-proline, d-fructose, d-glucose, d-sorbitol, Na-saccharin, acesulfame-K, monosodium glutamate, NaNO(3), Na-acetate, citric acid, KCl, denatonium, and papaverine. Forty-one WT and 41 KO neurons were recorded. Relative to WT, KO responses to all sweet stimuli were significantly lower, although the degree of attenuation differed among stimuli, with near zero responses to sugars but salient residual activity to artificial sweeteners and glycine. Residual KO across-neuron responses to sweet stimuli were variably similar to nonsweet responses, as indexed by multivariate and correlation analyses. In some cases, this suggested that residual KO activity to "sweet" stimuli could be mediated by nonsweet taste receptors, implicating T1r3 receptors as primary contributors to NTS sweet processing. The influence of T1r3 on the distribution of NTS neurons was evaluated by comparing neuron types that emerged between WT and KO cells. Neurons tuned toward sweet stimuli composed 34% of the WT sample but did not appear among KO cells. Input from T1r3-containing receptors critically guides the normal development of NTS neurons oriented toward sweet tastants. PMID:19279151

  14. Regulating the production of (R)-3-hydroxybutyrate in Escherichia coli by N or P limitation.

    PubMed

    Guevara-Martínez, Mónica; Sjöberg Gällnö, Karin; Sjöberg, Gustav; Jarmander, Johan; Perez-Zabaleta, Mariel; Quillaguamán, Jorge; Larsson, Gen

    2015-01-01

    The chiral compound (R)-3-hydroxybutyrate (3HB) is naturally produced by many wild type organisms as the monomer for polyhydroxybutyrate (PHB). Both compounds are commercially valuable and co-polymeric polyhydroxyalkanoates have been used e.g., in medical applications for skin grafting and as components in pharmaceuticals. In this paper we investigate cultivation strategies for production of 3HB in the previously described E. coli strain AF1000 pJBGT3RX. This strain produces extracellular 3HB by expression of two genes from the PHB pathway of Halomonas boliviensis. H. boliviensis is a newly isolated halophile that forms PHB as a storage compound during carbon excess and simultaneous limitation of another nutrient like nitrogen and phosphorous. We hypothesize that a similar approach can be used to control the flux from acetyl-CoA to 3HB also in E. coli; decreasing the flux to biomass and favoring the pathway to the product. We employed ammonium- or phosphate-limited fed-batch processes for comparison of the productivity at different nutrient limitation or starvation conditions. The feed rate was shown to affect the rate of glucose consumption, respiration, 3HB, and acetic acid production, although the proportions between them were more difficult to affect. The highest 3HB volumetric productivity, 1.5 g L(-1) h(-1), was seen for phosphate-limitation. PMID:26347729

  15. The oil palm VIRESCENS gene controls fruit colour and encodes a R2R3-MYB

    PubMed Central

    Singh, Rajinder; Low, Eng-Ti Leslie; Ooi, Leslie Cheng-Li; Ong-Abdullah, Meilina; Nookiah, Rajanaidu; Ting, Ngoot-Chin; Marjuni, Marhalil; Chan, Pek-Lan; Ithnin, Maizura; Manaf, Mohd Arif Abdul; Nagappan, Jayanthi; Chan, Kuang-Lim; Rosli, Rozana; Halim, Mohd Amin; Azizi, Norazah; Budiman, Muhammad A.; Lakey, Nathan; Bacher, Blaire; Van Brunt, Andrew; Wang, Chunyan; Hogan, Michael; He, Dong; MacDonald, Jill D.; Smith, Steven W.; Ordway, Jared M.; Martienssen, Robert A.; Sambanthamurthi, Ravigadevi

    2014-01-01

    Oil palm, a plantation crop of major economic importance in Southeast Asia, is the predominant source of edible oil worldwide. We report the identification of the VIRESCENS (VIR) gene, which controls fruit exocarp colour and is an indicator of ripeness. VIR is a R2R3-MYB transcription factor with homology to Lilium LhMYB12 and similarity to Arabidopsis PRODUCTION OF ANTHOCYANIN PIGMENT1 (PAP1). We identify five independent mutant alleles of VIR in over 400 accessions from sub-Saharan Africa that account for the dominant-negative virescens phenotype. Each mutation results in premature termination of the carboxy-terminal domain of VIR, resembling McClintock’s C1-I allele in maize. The abundance of alleles likely reflects cultural practices, by which fruits were venerated for magical and medicinal properties. The identification of VIR will allow selection of the trait at the seed or early-nursery stage, 3-6 years before fruits are produced, greatly advancing introgression into elite breeding material. PMID:24978855

  16. An R2R3-MYB transcription factor regulates carotenoid pigmentation in Mimulus lewisii flowers.

    PubMed

    Sagawa, Janelle M; Stanley, Lauren E; LaFountain, Amy M; Frank, Harry A; Liu, Chang; Yuan, Yao-Wu

    2016-02-01

    Carotenoids are yellow, orange, and red pigments that contribute to the beautiful colors and nutritive value of many flowers and fruits. The structural genes in the highly conserved carotenoid biosynthetic pathway have been well characterized in multiple plant systems, but little is known about the transcription factors that control the expression of these structural genes. By analyzing a chemically induced mutant of Mimulus lewisii through bulk segregant analysis and transgenic experiments, we have identified an R2R3-MYB, Reduced Carotenoid Pigmentation 1 (RCP1), as the first transcription factor that positively regulates carotenoid biosynthesis during flower development. Loss-of-function mutations in RCP1 lead to down-regulation of all carotenoid biosynthetic genes and reduced carotenoid content in M. lewisii flowers, a phenotype recapitulated by RNA interference in the wild-type background. Overexpression of this gene in the rcp1 mutant background restores carotenoid production and, unexpectedly, results in simultaneous decrease of anthocyanin production in some transgenic lines by down-regulating the expression of an activator of anthocyanin biosynthesis. Identification of transcriptional regulators of carotenoid biosynthesis provides the 'toolbox' genes for understanding the molecular basis of flower color diversification in nature and for potential enhancement of carotenoid production in crop plants via genetic engineering. PMID:26377817

  17. Development of MMRPC prototype for the NeuLAND detector of the R3B collaboration

    NASA Astrophysics Data System (ADS)

    Pramanik, U. Datta; Chakraborty, S.; Basu, P.; Basu, J.; Banerjee, P.; Bemmerer, D.; Bose, S.; Chatterjee, S.; Elekes, Z.; Kempe, M.; Leifels, Y.; Panja, J.; Mukherjee, A.; Rahaman, A.; Roy, S.; Simon, H.; Sobiella, M.; Stach, D.; Wagner, A.; Yakorev, D.

    2012-01-01

    A prototype of Multi-strip Multi-gap Resistive Plate chamber (MMRPC) with active area 40cm×20cm has been developed at SINP, Kolkata as a new Time-Of-Flight (TOF) system with timing resolution σt<120ps and position resolution σx˜0.58cm. The intention is to use multilayers of this type together with converter materials as a high energy neutron (1GeV>En>200MeV) TOF system for the R3B collaboration at the FAIR facility. The design of the detector elements is as follows: a double stack MMRPC with float glass plates and two gas gaps of 0.3 mm per stack. The response of this MMRPC has been studied with cosmic muons and γ-rays from a standard radioactive source (60Co) in coincidence with fast inorganic scintillators at SINP laboratory. Recently, response of developed MMRPC has been studied using pulsed electron beam at ELBE, FZD. The details of the MMRPC construction , experimental set-up for investigation of its response and first results are presented.

  18. Poly[(R)-3-hydroxybutyrate] production under different salinity conditions by a novel Bacillus megaterium strain.

    PubMed

    Rodríguez-Contreras, Alejandra; Koller, Martin; Braunegg, Gerhart; Marqués-Calvo, María Soledad

    2016-01-25

    Bacillus megaterium uyuni S29, isolated from the Bolivian salt lake Uyuni, displays a high capability to produce poly[(R)-3-hydroxybutyrate] (PHB) in industrial culture media. In order to analyze the influence of salt on biomass formation and PHB production, cultivations at different NaCl concentrations were carried out according to the salinity conditions of the habitats of the strain's original isolation. In this preliminary report, the strain showed considerable adaptability to media of different salinity, obtaining the best results for both cellular growth and PHB production in media containing 45 g/L NaCl. The strain grew at 100 g/L NaCl and PHB production was observed even at high salt levels of 250 g/L without unwanted concurrent spore formation. Its tolerance to high salt concentrations together with auspicious PHB productivity makes this strain appealing not only for PHB production, but also for other biotechnological applications such as the treatment of salty wastewater; additional studies will be needed to further increase PHB productivity. PMID:26344348

  19. Regulating the production of (R)-3-hydroxybutyrate in Escherichia coli by N or P limitation

    PubMed Central

    Guevara-Martínez, Mónica; Sjöberg Gällnö, Karin; Sjöberg, Gustav; Jarmander, Johan; Perez-Zabaleta, Mariel; Quillaguamán, Jorge; Larsson, Gen

    2015-01-01

    The chiral compound (R)-3-hydroxybutyrate (3HB) is naturally produced by many wild type organisms as the monomer for polyhydroxybutyrate (PHB). Both compounds are commercially valuable and co-polymeric polyhydroxyalkanoates have been used e.g., in medical applications for skin grafting and as components in pharmaceuticals. In this paper we investigate cultivation strategies for production of 3HB in the previously described E. coli strain AF1000 pJBGT3RX. This strain produces extracellular 3HB by expression of two genes from the PHB pathway of Halomonas boliviensis. H. boliviensis is a newly isolated halophile that forms PHB as a storage compound during carbon excess and simultaneous limitation of another nutrient like nitrogen and phosphorous. We hypothesize that a similar approach can be used to control the flux from acetyl-CoA to 3HB also in E. coli; decreasing the flux to biomass and favoring the pathway to the product. We employed ammonium- or phosphate-limited fed-batch processes for comparison of the productivity at different nutrient limitation or starvation conditions. The feed rate was shown to affect the rate of glucose consumption, respiration, 3HB, and acetic acid production, although the proportions between them were more difficult to affect. The highest 3HB volumetric productivity, 1.5 g L−1 h−1, was seen for phosphate-limitation. PMID:26347729

  20. 3D hexagonal (R-3m) mesostructured nanocrystalline titania thin films : synthesis and characterization.

    SciTech Connect

    Choi, S. Y.; Lee, B.; Carew, D. B.; Mamak, M; Peiris, F. C.; Speakman, S.; Chopra, N.; Ozin, G. A.; X-Ray Science Division; Univ. of Toronto; ORNL; Xerox Research Centre of Canada

    2006-01-01

    A straightforward and reproducible synthesis of crack-free large-area thin films of 3D hexagonal (R-3m) mesostructured nanocrystalline titania (meso-nc-TiO{sub 2}) using a Pluronic triblock copolymer (P123)/1-butanol templating system is described. The characterization of the films is achieved using a combination of electron microscopy (high-resolution scanning electron microscopy and scanning transmission electron microscopy), grazing-incidence small-angle X-ray scattering, in situ high-temperature X-ray diffraction, and variable-angle spectroscopic ellipsometry. The mesostructure of the obtained films is found to be based upon a 3D periodic array of large elliptically shaped cages with diameters around 20 nm interconnected by windows of about 5 nm in size. The mesopores of the film calcined at 300 C are very highly ordered, and the titania framework of the film has a crystallinity of 40 % being composed of 5.8 nm sized anatase crystallites. The film displays high thermal stability in that the collapse of the pore architecture is incomplete even at 600 C. The accessible surface area of 3D hexagonal meso-nc-TiO{sub 2} estimated by the absorption of methylene blue is nearly twice as large as that of 2D hexagonal meso-nc-TiO{sub 2} at the same annealing temperature.

  1. 3D HEXAGONAL (R-3M) MESOSTRUCTURED NANOCRYSTALLINE TITANIA THIN FILMS: SYNTHESIS AND CHARACTERIZATION

    SciTech Connect

    Choi, S Y; Lee, B; Carew, D B; Peiris, F C; Mamak, M; Speakman, Scott A; Chopra, N; Ozin, G A

    2006-01-01

    A straightforward and reproducible synthesis of crack-free large-area thin films of 3D hexagonal (R-3m) mesostructured nanocrystalline titania (meso-nc-TiO{sub 2}) using a Pluronic triblock copolymer (P123)/1-butanol templating system is described. The characterization of the films is achieved using a combination of electron microscopy (high-resolution scanning electron microscopy and scanning transmission electron microscopy), grazing-incidence small-angle X-ray scattering, in situ high-temperature X-ray diffraction, and variable-angle spectroscopic ellipsometry. The mesostructure of the obtained films is found to be based upon a 3D periodic array of large elliptically shaped cages with diameters around 20 nm interconnected by windows of about 5 nm in size. The mesopores of the film calcined at 300 C are very highly ordered, and the titania framework of the film has a crystallinity of 40 % being composed of 5.8 nm sized anatase crystallites. The film displays high thermal stability in that the collapse of the pore architecture is incomplete even at 600 C. The accessible surface area of 3D hexagonal meso-nc-TiO{sub 2} estimated by the absorption of methylene blue is nearly twice as large as that of 2D hexagonal meso-nc-TiO{sub 2} at the same annealing temperature.

  2. Expression and Purification of Functional Ligand-binding Domains of T1R3 Taste Receptors

    SciTech Connect

    Nie,Y.; Hobbs, J.; Vigues, S.; Olson, W.; Conn, G.; Munger, S.

    2006-01-01

    Chemosensory receptors, including odor, taste, and vomeronasal receptors, comprise the largest group of G protein-coupled receptors (GPCRs) in the mammalian genome. However, little is known about the molecular determinants that are critical for the detection and discrimination of ligands by most of these receptors. This dearth of understanding is due in part to difficulties in preparing functional receptors suitable for biochemical and biophysical analyses. Here we describe in detail two strategies for the expression and purification of the ligand-binding domain of T1R taste receptors, which are constituents of the sweet and umami taste receptors. These class C GPCRs contain a large extracellular N-terminal domain (NTD) that is the site of interaction with most ligands and that is amenable to expression as a separate polypeptide in heterologous cells. The NTD of mouse T1R3 was expressed as two distinct fusion proteins in Escherichia coli and purified by column chromatography. Spectroscopic analysis of the purified NTD proteins shows them to be properly folded and capable of binding ligands. This methodology should not only facilitate the characterization of T1R ligand interactions but may also be useful for dissecting the function of other class C GPCRs such as the large family of orphan V2R vomeronasal receptors.

  3. The oil palm VIRESCENS gene controls fruit colour and encodes a R2R3-MYB.

    PubMed

    Singh, Rajinder; Low, Eng-Ti Leslie; Ooi, Leslie Cheng-Li; Ong-Abdullah, Meilina; Nookiah, Rajanaidu; Ting, Ngoot-Chin; Marjuni, Marhalil; Chan, Pek-Lan; Ithnin, Maizura; Manaf, Mohd Arif Abdul; Nagappan, Jayanthi; Chan, Kuang-Lim; Rosli, Rozana; Halim, Mohd Amin; Azizi, Norazah; Budiman, Muhammad A; Lakey, Nathan; Bacher, Blaire; Van Brunt, Andrew; Wang, Chunyan; Hogan, Michael; He, Dong; MacDonald, Jill D; Smith, Steven W; Ordway, Jared M; Martienssen, Robert A; Sambanthamurthi, Ravigadevi

    2014-01-01

    Oil palm, a plantation crop of major economic importance in Southeast Asia, is the predominant source of edible oil worldwide. We report the identification of the virescens (VIR) gene, which controls fruit exocarp colour and is an indicator of ripeness. VIR is a R2R3-MYB transcription factor with homology to Lilium LhMYB12 and similarity to Arabidopsis production of anthocyanin pigment1 (PAP1). We identify five independent mutant alleles of VIR in over 400 accessions from sub-Saharan Africa that account for the dominant-negative virescens phenotype. Each mutation results in premature termination of the carboxy-terminal domain of VIR, resembling McClintock's C1-I allele in maize. The abundance of alleles likely reflects cultural practices, by which fruits were venerated for magical and medicinal properties. The identification of VIR will allow selection of the trait at the seed or early-nursery stage, 3-6 years before fruits are produced, greatly advancing introgression into elite breeding material. PMID:24978855

  4. AlgR3, a protein resembling eukaryotic histone H1, regulates alginate synthesis in Pseudomonas aeruginosa.

    PubMed Central

    Kato, J; Misra, T K; Chakrabarty, A M

    1990-01-01

    A regulatory mutation (alg52) in a Pseudomonas aeruginosa alginate-negative mutant (strain 8882) is complemented efficiently by the gene algR2 and somewhat inefficiently by a second gene termed algR3. algR3 and algR2 are located on a 4.4-kilobase-pair HindIII-BamHI fragment, which has been completely sequenced. algR2 has previously been characterized. Introduction of kanamycin-resistance cassettes and deletion-subcloning experiments involving various open reading frames in the HindIII-BamHI fragment have localized the algR3 gene, which encodes a 340-amino acid polypeptide. This highly basic regulatory protein contains 17% lysine and 36% alanine. The predicted amino acid sequence shows no significant similarity with any bacterial proteins and yet is highly similar to the sea urchin Lytechinus pictus histone H1 subtype of protein. Promoter localization by reverse transcriptase mapping of the algR3 gene shows the presence of Escherichia coli sigma 70 recognition sequences, and coupled transcription/translation experiments in E. coli demonstrate the presence of a 39-kDa polypeptide encoded by the cloned algR3 gene. Images PMID:2109318

  5. Genome-Wide Identification of R2R3-MYB Genes and Expression Analyses During Abiotic Stress in Gossypium raimondii

    PubMed Central

    He, Qiuling; Jones, Don C.; Li, Wei; Xie, Fuliang; Ma, Jun; Sun, Runrun; Wang, Qinglian; Zhu, Shuijin; Zhang, Baohong

    2016-01-01

    The R2R3-MYB is one of the largest families of transcription factors, which have been implicated in multiple biological processes. There is great diversity in the number of R2R3-MYB genes in different plants. However, there is no report on genome-wide characterization of this gene family in cotton. In the present study, a total of 205 putative R2R3-MYB genes were identified in cotton D genome (Gossypium raimondii), that are much larger than that found in other cash crops with fully sequenced genomes. These GrMYBs were classified into 13 groups with the R2R3-MYB genes from Arabidopsis and rice. The amino acid motifs and phylogenetic tree were predicted and analyzed. The sequences of GrMYBs were distributed across 13 chromosomes at various densities. The results showed that the expansion of the G. Raimondii R2R3-MYB family was mainly attributable to whole genome duplication and segmental duplication. Moreover, the expression pattern of 52 selected GrMYBs and 46 GaMYBs were tested in roots and leaves under different abiotic stress conditions. The results revealed that the MYB genes in cotton were differentially expressed under salt and drought stress treatment. Our results will be useful for determining the precise role of the MYB genes during stress responses with crop improvement. PMID:27009386

  6. Analysis of the grape MYB R2R3 subfamily reveals expanded wine quality-related clades and conserved gene structure organization across Vitis and Arabidopsis genomes

    PubMed Central

    Matus, José Tomás; Aquea, Felipe; Arce-Johnson, Patricio

    2008-01-01

    Background The MYB superfamily constitutes the most abundant group of transcription factors described in plants. Members control processes such as epidermal cell differentiation, stomatal aperture, flavonoid synthesis, cold and drought tolerance and pathogen resistance. No genome-wide characterization of this family has been conducted in a woody species such as grapevine. In addition, previous analysis of the recently released grape genome sequence suggested expansion events of several gene families involved in wine quality. Results We describe and classify 108 members of the grape R2R3 MYB gene subfamily in terms of their genomic gene structures and similarity to their putative Arabidopsis thaliana orthologues. Seven gene models were derived and analyzed in terms of gene expression and their DNA binding domain structures. Despite low overall sequence homology in the C-terminus of all proteins, even in those with similar functions across Arabidopsis and Vitis, highly conserved motif sequences and exon lengths were found. The grape epidermal cell fate clade is expanded when compared with the Arabidopsis and rice MYB subfamilies. Two anthocyanin MYBA related clusters were identified in chromosomes 2 and 14, one of which includes the previously described grape colour locus. Tannin related loci were also detected with eight candidate homologues in chromosomes 4, 9 and 11. Conclusion This genome wide transcription factor analysis in Vitis suggests that clade-specific grape R2R3 MYB genes are expanded while other MYB genes could be well conserved compared to Arabidopsis. MYB gene abundance, homology and orientation within particular loci also suggests that expanded MYB clades conferring quality attributes of grapes and wines, such as colour and astringency, could possess redundant, overlapping and cooperative functions. PMID:18647406

  7. Optimal Decay Rate of the Compressible Navier-Stokes-Poisson System in {mathbb {R}^3}

    NASA Astrophysics Data System (ADS)

    Li, Hai-Liang; Matsumura, Akitaka; Zhang, Guojing

    2010-05-01

    The compressible Navier-Stokes-Poisson (NSP) system is considered in {mathbb {R}^3} in the present paper, and the influences of the electric field of the internal electrostatic potential force governed by the self-consistent Poisson equation on the qualitative behaviors of solutions is analyzed. It is observed that the rotating effect of electric field affects the dispersion of fluids and reduces the time decay rate of solutions. Indeed, we show that the density of the NSP system converges to its equilibrium state at the same L 2-rate {(1+t)^{-frac {3}{4}}} or L ∞-rate (1 + t)-3/2 respectively as the compressible Navier-Stokes system, but the momentum of the NSP system decays at the L 2-rate {(1+t)^{-frac {1}{4}}} or L ∞-rate (1 + t)-1 respectively, which is slower than the L 2-rate {(1+t)^{-frac {3}{4}}} or L ∞-rate (1 + t)-3/2 for compressible Navier-Stokes system [Duan et al., in Math Models Methods Appl Sci 17:737-758, 2007; Liu and Wang, in Comm Math Phys 196:145-173, 1998; Matsumura and Nishida, in J Math Kyoto Univ 20:67-104, 1980] and the L ∞-rate (1 + t)- p with {p in (1, 3/2)} for irrotational Euler-Poisson system [Guo, in Comm Math Phys 195:249-265, 1998]. These convergence rates are shown to be optimal for the compressible NSP system.

  8. Three R2R3-MYB transcription factors regulate distinct floral pigmentation patterning in Phalaenopsis spp.

    PubMed

    Hsu, Chia-Chi; Chen, You-Yi; Tsai, Wen-Chieh; Chen, Wen-Huei; Chen, Hong-Hwa

    2015-05-01

    Orchidaceae are well known for their fascinating floral morphologic features, specialized pollination, and distinctive ecological strategies. With their long-lasting flowers of various colors and pigmentation patterning, Phalaenopsis spp. have become important ornamental plants worldwide. In this study, we identified three R2R3-MYB transcription factors PeMYB2, PeMYB11, and PeMYB12. Their expression profiles were concomitant with red color formation in Phalaenopsis spp. flowers. Transient assay of overexpression of three PeMYBs verified that PeMYB2 resulted in anthocyanin accumulation, and these PeMYBs could activate the expression of three downstream structural genes Phalaenopsis spp. Flavanone 3-hydroxylase5, Phalaenopsis spp. Dihydroflavonol 4-reductase1, and Phalaenopsis spp. Anthocyanidin synthase3. In addition, these three PeMYBs participated in the distinct pigmentation patterning in a single flower, which was revealed by virus-induced gene silencing. In the sepals/petals, silencing of PeMYB2, PeMYB11, and PeMYB12 resulted in the loss of the full-red pigmentation, red spots, and venation patterns, respectively. Moreover, different pigmentation patterning was regulated by PeMYBs in the sepals/petals and lip. PeMYB11 was responsive to the red spots in the callus of the lip, and PeMYB12 participated in the full pigmentation in the central lobe of the lip. The differential pigmentation patterning was validated by RNA in situ hybridization. Additional assessment was performed in six Phalaenopsis spp. cultivars with different color patterns. The combined expression of these three PeMYBs in different ratios leads to a wealth of complicated floral pigmentation patterning in Phalaenopsis spp. PMID:25739699

  9. L-Theanine elicits umami taste via the T1R1 + T1R3 umami taste receptor.

    PubMed

    Narukawa, Masataka; Toda, Yasuka; Nakagita, Tomoya; Hayashi, Yukako; Misaka, Takumi

    2014-06-01

    L-Theanine is a unique amino acid present in green tea. It elicits umami taste and has a considerable effect on tea taste and quality. We investigated L-theanine activity on the T1R1 + T1R3 umami taste receptor. L-Theanine activated T1R1 + T1R3-expressing cells and showed a synergistic response with inosine 5'-monophosphate. The site-directed mutagenesis analysis revealed that L-theanine binds to L-amino acid binding site in the Venus flytrap domain of T1R1. This study shows that L-theanine elicits an umami taste via T1R1 + T1R3. PMID:24633359

  10. The Role of Short-Chain Conjugated Poly-(R)-3-Hydroxybutyrate (cPHB) in Protein Folding

    PubMed Central

    Reusch, Rosetta N.

    2013-01-01

    Poly-(R)-3-hydroxybutyrate (PHB), a linear polymer of R-3-hydroxybutyrate (R-3HB), is a fundamental constituent of biological cells. Certain prokaryotes accumulate PHB of very high molecular weight (10,000 to >1,000,000 residues), which is segregated within granular deposits in the cytoplasm; however, all prokaryotes and all eukaryotes synthesize PHB of medium-chain length (~100–200 residues) which resides within lipid bilayers or lipid vesicles, and PHB of short-chain length (<12 residues) which is conjugated to proteins (cPHB), primarily proteins in membranes and organelles. The physical properties of cPHB indicate it plays important roles in the targeting and folding of cPHB-proteins. Here we review the occurrence, physical properties and molecular characteristics of cPHB, and discuss its influence on the folding and structure of outer membrane protein A (OmpA) of Escherichia coli. PMID:23702844

  11. Quintuplet Cluster

    NASA Technical Reports Server (NTRS)

    1999-01-01

    Penetrating 25,000 light-years of obscuring dust and myriad stars, NASA's Hubble Space Telescope has provided the clearest view yet of one of the largest young clusters of stars inside our Milky Way galaxy, located less than 100 light-years from the very center of the Galaxy. Having the equivalent mass greater than 10,000 stars like our sun, the monster cluster is ten times larger than typical young star clusters scattered throughout our Milky Way. It is destined to be ripped apart in just a few million years by gravitational tidal forces in the galaxy's core. But in its brief lifetime it shines more brightly than any other star cluster in the Galaxy. Quintuplet Cluster is 4 million years old. It has stars on the verge of blowing up as supernovae. It is the home of the brightest star seen in the galaxy, called the Pistol star. This image was taken in infrared light by Hubble's NICMOS camera in September 1997. The false colors correspond to infrared wavelengths. The galactic center stars are white, the red stars are enshrouded in dust or behind dust, and the blue stars are foreground stars between us and the Milky Way's center. The cluster is hidden from direct view behind black dust clouds in the constellation Sagittarius. If the cluster could be seen from earth it would appear to the naked eye as a 3rd magnitude star, 1/6th of a full moon's diameter apart.

  12. Polymorphisms in the taste receptor gene (Tas1r3) region are associated with saccharin preference in 30 mouse strains.

    PubMed

    Reed, D R; Li, S; Li, X; Huang, L; Tordoff, M G; Starling-Roney, R; Taniguchi, K; West, D B; Ohmen, J D; Beauchamp, G K; Bachmanov, A A

    2004-01-28

    The results of recent studies suggest that the mouse Sac (saccharin preference) locus is identical to the Tas1r3 (taste receptor) gene. The goal of this study was to identify Tas1r3 sequence variants associated with saccharin preference in a large number of inbred mouse strains. Initially, we sequenced approximately 6.7 kb of the Tas1r3 gene and its flanking regions from six inbred mouse strains with high and low saccharin preference, including the strains in which the Sac alleles were described originally (C57BL/6J, Sac(b); DBA/2J, Sac(d)). Of the 89 sequence variants detected among these six strains, eight polymorphic sites were significantly associated with preferences for 1.6 mm saccharin. Next, each of these eight variant sites were genotyped in 24 additional mouse strains. Analysis of the genotype-phenotype associations in all 30 strains showed the strongest association with saccharin preference at three sites: nucleotide (nt) -791 (3 bp insertion/deletion), nt +135 (Ser45Ser), and nt +179 (Ile60Thr). We measured Tas1r3 gene expression, transcript size, and T1R3 immunoreactivity in the taste tissue of two inbred mouse strains with different Tas1r3 haplotypes and saccharin preferences. The results of these experiments suggest that the polymorphisms associated with saccharin preference do not act by blocking gene expression, changing alternative splicing, or interfering with protein translation in taste tissue. The amino acid substitution (Ile60Thr) may influence the ability of the protein to form dimers or bind sweeteners. Here, we present data for future studies directed to experimentally confirm the function of these polymorphisms and highlight some of the difficulties of identifying specific DNA sequence variants that underlie quantitative trait loci. PMID:14749438

  13. Galaxy Clusters

    NASA Astrophysics Data System (ADS)

    Miller, Christopher J. Miller

    2012-03-01

    There are many examples of clustering in astronomy. Stars in our own galaxy are often seen as being gravitationally bound into tight globular or open clusters. The Solar System's Trojan asteroids cluster at the gravitational Langrangian in front of Jupiter’s orbit. On the largest of scales, we find gravitationally bound clusters of galaxies, the Virgo cluster (in the constellation of Virgo at a distance of ˜50 million light years) being a prime nearby example. The Virgo cluster subtends an angle of nearly 8◦ on the sky and is known to contain over a thousand member galaxies. Galaxy clusters play an important role in our understanding of theUniverse. Clusters exist at peaks in the three-dimensional large-scale matter density field. Their sky (2D) locations are easy to detect in astronomical imaging data and their mean galaxy redshifts (redshift is related to the third spatial dimension: distance) are often better (spectroscopically) and cheaper (photometrically) when compared with the entire galaxy population in large sky surveys. Photometric redshift (z) [Photometric techniques use the broad band filter magnitudes of a galaxy to estimate the redshift. Spectroscopic techniques use the galaxy spectra and emission/absorption line features to measure the redshift] determinations of galaxies within clusters are accurate to better than delta_z = 0.05 [7] and when studied as a cluster population, the central galaxies form a line in color-magnitude space (called the the E/S0 ridgeline and visible in Figure 16.3) that contains galaxies with similar stellar populations [15]. The shape of this E/S0 ridgeline enables astronomers to measure the cluster redshift to within delta_z = 0.01 [23]. The most accurate cluster redshift determinations come from spectroscopy of the member galaxies, where only a fraction of the members need to be spectroscopically observed [25,42] to get an accurate redshift to the whole system. If light traces mass in the Universe, then the locations

  14. Occupational Clusters.

    ERIC Educational Resources Information Center

    Pottawattamie County School System, Council Bluffs, IA.

    The 15 occupational clusters (transportation, fine arts and humanities, communications and media, personal service occupations, construction, hospitality and recreation, health occupations, marine science occupations, consumer and homemaking-related occupations, agribusiness and natural resources, environment, public service, business and office…

  15. Data Clustering

    NASA Astrophysics Data System (ADS)

    Wagstaff, Kiri L.

    2012-03-01

    On obtaining a new data set, the researcher is immediately faced with the challenge of obtaining a high-level understanding from the observations. What does a typical item look like? What are the dominant trends? How many distinct groups are included in the data set, and how is each one characterized? Which observable values are common, and which rarely occur? Which items stand out as anomalies or outliers from the rest of the data? This challenge is exacerbated by the steady growth in data set size [11] as new instruments push into new frontiers of parameter space, via improvements in temporal, spatial, and spectral resolution, or by the desire to "fuse" observations from different modalities and instruments into a larger-picture understanding of the same underlying phenomenon. Data clustering algorithms provide a variety of solutions for this task. They can generate summaries, locate outliers, compress data, identify dense or sparse regions of feature space, and build data models. It is useful to note up front that "clusters" in this context refer to groups of items within some descriptive feature space, not (necessarily) to "galaxy clusters" which are dense regions in physical space. The goal of this chapter is to survey a variety of data clustering methods, with an eye toward their applicability to astronomical data analysis. In addition to improving the individual researcher’s understanding of a given data set, clustering has led directly to scientific advances, such as the discovery of new subclasses of stars [14] and gamma-ray bursts (GRBs) [38]. All clustering algorithms seek to identify groups within a data set that reflect some observed, quantifiable structure. Clustering is traditionally an unsupervised approach to data analysis, in the sense that it operates without any direct guidance about which items should be assigned to which clusters. There has been a recent trend in the clustering literature toward supporting semisupervised or constrained

  16. Cluster generator

    DOEpatents

    Donchev, Todor I.; Petrov, Ivan G.

    2011-05-31

    Described herein is an apparatus and a method for producing atom clusters based on a gas discharge within a hollow cathode. The hollow cathode includes one or more walls. The one or more walls define a sputtering chamber within the hollow cathode and include a material to be sputtered. A hollow anode is positioned at an end of the sputtering chamber, and atom clusters are formed when a gas discharge is generated between the hollow anode and the hollow cathode.

  17. AGE-R3/galectin-3 expression in osteoblast-like cells: regulation by AGEs.

    PubMed

    Mercer, Natalia; Ahmed, Hafiz; McCarthy, Antonio D; Etcheverry, Susana B; Vasta, Gerardo R; Cortizo, Ana M

    2004-11-01

    The accumulation of irreversible advanced glycation endproducts (AGEs) on long-lived proteins, and the interaction of AGEs with cellular receptors such as AGE-R3/galectin-3 and RAGE, are considered to be key events in the development of long-term complications of diabetes mellitus, Alzheimer's disease, uremia and ageing. The aim of this study was to investigate the expression and sub-cellular distribution of galectin-3, as well as its possible modulation by AGEs, in MC3T3E1 mouse calvaria-derived osteoblasts and in UMR 106 rat osteosarcoma cells. Both osteoblastic lines were cultured either with control bovine serum albumin (BSA) or with AGEs-BSA for 48 h. Cells were evaluated for galectin-3 expression by fixing and immunofluorescent microscopic analysis; or Western blot analysis of whole cell extracts, sub-cellular fractions and culture media. Both cell lines express 30 kDa (monomeric) galectin-3, although expression was about 15-fold lower in the UMR106 osteosarcoma cells. Dimeric (70 kDa) galectin-3 was additionally observed in the UMR106 cells. Immunofluorescent analysis of galectin-3 distribution showed a diffuse cytoplasmic and strong nuclear pattern in MC3T3E1 osteoblasts, and a patchy cytoplasmic pattern in UMR106 cells. Western blot analysis for both cell lines showed that galectin-3 was mainly found in the cytoplasm and in minor amounts in the microsomal fraction, while considerable amounts were secreted into the culture media. Exposure to 100-200 microg/mL AGEs-BSA increased the cellular content of 30 kDa galectin-3 (20-25% for MC3T3E1 and 35-70% for UMR106 versus control BSA, p < 0.05), and decreased the culture media levels of galectin-3 (10-20% for MC3T3E1 and for UMR106 versus control BSA, p < 0.05). These results confirm the expression of galectin-3 in osteoblastic cells, and suggest different levels and sub-cellular distribution of this protein in transformed versus non-transformed osteoblasts. Osteoblastic exposure to AGEs alters their expression

  18. Effect of selective thiol-group derivatization on enzyme kinetics of (R)-3-hydroxybutyrate dehydrogenase.

    PubMed Central

    Dalton, L A; McIntyre, J O; Fleischer, S

    1993-01-01

    (R)-3-Hydroxybutyrate dehydrogenase (BDH) is a phosphatidylcholine-requiring tetrameric enzyme with two thiol groups (SH-1 and SH-2) per protomer. By first protecting the more rapidly reacting thiol group (SH-1) with diamide [1,1'-azobis-(NN'-dimethylformamide), DM] to form DM(SH-1)BDH, SH-2 can be selectively derivatized by reaction with maleimide reagents such as 4-maleimido-2,2,6,6-tetramethyl-piperidine-N-oxyl (MSL), which gives DM(SH-1)MSL(SH-2)BDH. Reduction with dithiothreitol (DTT) regenerates SH-1, yielding MAL(SH-2)BDH (where MAL is the diamagnetic reduction product of MSL-BDH and DTT). The enzymic activity of DM(SH-1)BDH is decreased to approx. 4% relative to the native purified enzyme, and the apparent Km for substrate, KmBOH, is increased approx. 100-fold. Reduction of DM(SH-1)BDH with DTT regenerates SH-1 and restores normal enzymic function. Modification of SH-2 with piperidinylmaleimide [MAL(SH-2)BDH] diminishes enzymic activity to approx. 35% of its original value, but has no significant effect on apparent KmBOH. The doubly derivatized enzyme, DM(SH-1)MSL(SH-2)BDH, has lower enzymic activity [about half that for DM(SH-2)BDH] and a yet higher apparent KmBOH than DM(SH-1)BDH. Derivatization of SH-2 with different maleimide reagents results in diminished activity approximately proportional to the size of the maleimide substituent, suggesting that this inhibition is steric. Whereas modification of SH-1 results in marked changes in kinetic parameters (increased apparent Km and reduced apparent Vmax), derivatization of SH-2 has a lesser effect on enzymic function. Thus SH-1 is postulated to be closer to the active centre than is SH-2, although neither is involved in catalysis, since: (1) the activity of the derivatized enzyme is not abolished; and (2) activity can be enhanced by increasing substrate (and cofactor) concentrations. PMID:8280053

  19. Evaluation of Radial Flow Fluidized Filter (R3F) Followed by Microfiltration and Ultrafiltration Systems in Calimesa, California

    EPA Science Inventory

    U.S. EPA coordinated a field study with South Mesa Water Utility to look for treatment alternatives for California State Project Water in the small community of Calimesa, California. EPA evaluated the performance of a system comprised of Radial Flow Fluidized Filtration (R3f) fo...

  20. Cloning, expression and structural stability of a cold-adapted ß-Galactosidase from Rahnella sp.R3

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A novel gene was isolated for the first time from a psychrophilic gram-negative bacterium Rahnella sp.R3. It encoded a cold-adapted ß-galactosidase (R-ß-Gal). Recombinant R-ß-Gal was expressed in Escherichia coli BL21 (DE3), purified, and characterized. R-ß-Gal belongs to the glycosyl hydrolase fami...

  1. R3-R4 deletion in the PRNP gene is associated with Creutzfeldt-Jakob disease (CJD)

    SciTech Connect

    Cervenakova, L.; Brown, P.; Nagle, J.

    1994-09-01

    There are conflicting reports on the association of deletions in the PRNP gene on chromosome 20 with CJD, a rapidly progressive fatal spongiform encephalopathy. We accumulated data suggesting that a deletion of R3-R4 type (parts of the third and fourth repeats are deleted from the area of four repeating 24 bp sequences in the 5{prime} region of the gene) is causing CJD. Screening of 129 unaffected control individuals demonstrated presence of a deletion of R2 type in four (1.55% of the studied chromosomes), but none of them had the R3-R4 type. Of 181 screened patients with spongiform encephalopathies, two had a deletion of R3-R4 type with no other mutations in the coding sequence. Both patients had a classical rapidly progressive dementing disease and diffuse spongiform degeneration, and both cases were apparently sporadic. The same R3-R4 type of deletion was detected in three additional neuropathologically confirmed spongiform encephalopathy patients, of which two had other known pathogenic mutations in the PRNP gene: at codon 178 on the methionine allele exhibiting the phenotype of fatal familial insomnia, and codon 200 causing CJD with severe dementia; the third was a patient with iatrogenic CJD who developed the disease after treatment with growth hormone extracted from cadaveric human pituitary glands. In all cases the deletion coincided with a variant sequence at position 129 coding for methionine.

  2. Crystal structure analysis of a glycosides hydrolase family 42 cold-adapted ß-galactosidase from Rahnella sp. R3

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The ß-galactosidase isolated from a psychrotrophic bacterium, Rahnella sp. R3 (R-ß-Gal), exhibits high activity at low temperature. R-ß-Gal is a member of the glycoside hydrolases family 42 (GH42), and forms a 225 kDa trimeric structure in solution. The X-ray crystal structure of R-ß-Gal was determi...

  3. 76 FR 71044 - International Conference on Harmonisation; E2B(R3) Electronic Transmission of Individual Case...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-11-16

    ... (76 FR 65199). The document announced the availability of a draft guidance entitled ``E2B(R3... 20993-0002, (301) 796-3601. SUPPLEMENTARY INFORMATION: In FR Doc. 2011-27147, appearing on page 65199...) Electronic Transmission of Individual Case Safety Reports; Draft Guidance on Implementation; Data...

  4. 76 FR 65199 - International Conference on Harmonisation; E2B(R3) Electronic Transmission of Individual Case...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-10-20

    ...) Electronic Transmission of Individual Case Safety Reports; Draft Guidance on Implementation; Data Elements... Safety Reports (ICSRs): Implementation Guide--Data Elements and Message Specification'' (the draft E2B(R3... BFC appendix describes the relationship between data elements from the 2001 ICH E2B guidance and...

  5. Characterization of a citrus R2R3-MYB transcription factor that regulates the flavonol and hydroxycinnamic acid biosynthesis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Flavonols and hydroxycinnamic acids are important phenylpropanoid metabolites in plants. In this study, we isolated and characterized a citrus R2R3-MYB transcription factor CsMYBF1, encoding a protein belonging to the flavonol-specific MYB subgroup. Ectopic expression of CsMYBF1 in tomato led to an ...

  6. Two Distinct Determinants of Ligand Specificity in T1R1/T1R3 (the Umami Taste Receptor)*

    PubMed Central

    Toda, Yasuka; Nakagita, Tomoya; Hayakawa, Takashi; Okada, Shinji; Narukawa, Masataka; Imai, Hiroo; Ishimaru, Yoshiro; Misaka, Takumi

    2013-01-01

    Umami taste perception in mammals is mediated by a heteromeric complex of two G-protein-coupled receptors, T1R1 and T1R3. T1R1/T1R3 exhibits species-dependent differences in ligand specificity; human T1R1/T1R3 specifically responds to l-Glu, whereas mouse T1R1/T1R3 responds more strongly to other l-amino acids than to l-Glu. The mechanism underlying this species difference remains unknown. In this study we analyzed chimeric human-mouse receptors and point mutants of T1R1/T1R3 and identified 12 key residues that modulate amino acid recognition in the human- and mouse-type responses in the extracellular Venus flytrap domain of T1R1. Molecular modeling revealed that the residues critical for human-type acidic amino acid recognition were located at the orthosteric ligand binding site. In contrast, all of the key residues for the mouse-type broad response were located at regions outside of both the orthosteric ligand binding site and the allosteric binding site for inosine-5′-monophosphate (IMP), a known natural umami taste enhancer. Site-directed mutagenesis demonstrated that the newly identified key residues for the mouse-type responses modulated receptor activity in a manner distinct from that of the allosteric modulation via IMP. Analyses of multiple point mutants suggested that the combination of two distinct determinants, amino acid selectivity at the orthosteric site and receptor activity modulation at the non-orthosteric sites, may mediate the ligand specificity of T1R1/T1R3. This hypothesis was supported by the results of studies using nonhuman primate T1R1 receptors. A complex molecular mechanism involving changes in the properties of both the orthosteric and non-orthosteric sites of T1R1 underlies the determination of ligand specificity in mammalian T1R1/T1R3. PMID:24214976

  7. The Rapid Response Radiation Survey (R3S) Mission Using the HiSat Conformal Satellite Architecture

    NASA Technical Reports Server (NTRS)

    Miller, Nathanael A.; Norman, Ryan B.; Soto, Hector L.; Stewart, Victor A.; Jones, Mark L.; Kowalski, Matthew C.; Ben Shabat, Adam; Gough, Kerry M.; Stavely, Rebecca L.; Shim, Alex C.; Jaeger, Gene T. K.

    2015-01-01

    The Rapid Response Radiation Survey (R3S) experiment, designed as a quick turnaround mission to make radiation measurements in Low Earth Orbit (LEO), will fly as a hosted payload in partnership with NovaWurks using their Hyper-integrated Satlet (HISat) architecture. The need for the mission arises as the Nowcast of Atmospheric Ionization Radiation for Aviation Safety (NAIRAS) model moves from a research effort into an operational radiation assessment tool. Currently, airline professionals are the second largest demographic of radiation workers and to date their radiation exposure is undocumented in the USA. The NAIRAS model seeks to fill this information gap. The data collected by R3S, in addition to the complementary data from a NASA Langley Research Center (LaRC) atmospheric balloon mission entitled Radiation Dosimetry Experiment (RaD-X), will validate exposure prediction capabilities of NAIRAS. The R3S mission collects total dose and radiation spectrum measurements using a Teledyne µDosimeter and a Liulin-6SA2 LED spectrometer. These two radiation sensors provide a cross correlated radiometric measurement in combination with the Honeywell HMR2300 Smart Digital Magnetometer. The magnetometer assesses the Earth's magnetic field in the LEO environment and allows radiation dose to be mapped as a function of the Earth's magnetic shielding. R3S is also unique in that the radiation sensors will be exposed on the outer surface of the spacecraft, possibly making this the first measurements of the LEO radiation environment with bare sensors. Viability of R3S as an extremely fast turnaround mission is due, in part, to the nature of the robust, well-defined interfaces of the conformal satellite HiSat Architecture. The HiSat architecture, which was developed with the support of the Defense Advanced Research Projects Agency's (DARPA's) Phoenix Program, enabled the R3S system to advance from the first concept to delivery of preliminary design review (PDR) level documents in

  8. [Involvement of Tas1r3 receptor protein in control of the metabolism of glucose at different levels of glycemia in mice].

    PubMed

    Murovets, V O; Bachmanov, A A; Travnikov, S V; Tchurikova, A A; Zolotarev, V A

    2014-01-01

    The heterodimeric protein T1R2/T1R3 is a chemoreceptor mediating taste perception of sugars, several amino acids, and non-caloric sweeteners in humans and many other vertebrate species. The T1R2 and T1R3 proteins are expressed not only in the oral cavity, but also in the intestine, pancreas, liver, adipose, tissue, and in structures of the central nervous system, which suggests their involvement in functions other than gustatory perception. In this study, we analyzed the role of the T1R3 protein in regulation of glucose metabolism in experiments with the gene-knockout mouse strain C57BL6J-Tas1r3(tm1Rfm) (Tas1r3-/-), with a deletion of the Tas1r3 gene encoding T1R3, and the control strain C57BL/6ByJ with the intact gene. Glucose tolerance was measured in euglycemic or food-deprived mice after intraperitoneal to disappearance glucose administration. We have shown that in the Tas1r3-/- strain, in addition to disappearance of taste preference for sucrose, glucose tolerance is also substantially reduced, and insulin resistance is observed. The effect of the Tas1r3 gene knockout on glucose utilization was more pronounced in the euglycemic state than after food deprivation. The baseline glucose level after food deprivation was lower in the Tas1r3-/- strain than in the control strain, which suggested that the T1R3 is involved in regulation of endogenous glucose production. These data suggest that the T1R3-mediated glucoreception interacts with the K(ATP)-dependent mechanisms of regulation of the glucose metabolism, and that the main role is likely played by T1R3 expressed in the pancreas and possibly in the central nervous system, but not in the intestinal mucosa, as it was suggested earlier. PMID:25775865

  9. The Involvement of the T1R3 Receptor Protein in the Control of Glucose Metabolism in Mice at Different Levels of Glycemia

    PubMed Central

    Murovets, V. O.; Bachmanov, A. A.; Travnikov, S. V.; Churikova, A. A.; Zolotarev, V. A.

    2015-01-01

    The heterodimeric protein T1R2/T1R3 is a chemoreceptor mediating taste perception of sugars, several amino acids, and non-caloric sweeteners in humans and many other vertebrate species. The T1R2 and T1R3 proteins are expressed not only in the oral cavity, but also in the intestine, pancreas, liver, adipose tissue, and in structures of the central nervous system, which suggests their involvement in functions other than gustatory perception. In this study, we analyzed the role of the T1R3 protein in regulation of glucose metabolism in experiments with the gene-knockout mouse strain C57BL/6J–Tas1r3tm1Rfm (Tas1r3−/−), with a deletion of the Tas1r3 gene encoding T1R3, and the control strain C57BL/6ByJ with the intact gene. Glucose tolerance was measured in euglycemic or food-deprived mice after intraperitoneal or intragastric glucose administration. We have shown that in the Tas1r3−/− strain, in addition to the disappearance of taste preference for sucrose, glucose tolerance is also substantially reduced, and insulin resistance is observed. The effect of the Tas1r3 gene knockout on glucose utilization was more pronounced in the euglycemic state than after food deprivation. The baseline glucose level after food deprivation was lower in the Tas1r3−/− strain than in the control strain, which suggests that T1R3 is involved in regulation of endogenous glucose production. These data suggest that the T1R3-mediated glucoreception interacts with the KATP-dependent mechanisms of regulation of the glucose metabolism, and that the main role is likely played by T1R3 expressed in the pancreas and possibly in the central nervous system, but not in the intestinal mucosa, as it was suggested earlier. PMID:25983343

  10. Response of isolated ruminant mammary arteries to the long R3 analogue of insulin-like growth factor I.

    PubMed

    Gow, I F

    2000-05-01

    Isolated mammary arteries from ruminants were used in a conventional organ bath system. Acetylcholine relaxed bovine but not ovine mammary arteries; both types responded to sodium nitroprusside. Noradrenaline (NA) caused a dose-dependent increase in generated tension. An analogue of insulin-like growth factor I (long R3-IGF-I) caused a rightward shift in the NA response curve in bovine vessels with intact endothelium (P < 0.02), and also in sheep arteries (P < 0.01). In bovine vessels, this effect was abolished when the endothelium was removed. The effect of long R3-IGF-I in bovine vessels was abolished by N -nitro-L-arginine methyl ester (L-NAME) an inhibitor of nitric oxide synthase, suggesting the effect of IGF-I on mammary arteries in vitro requires NO generation. PMID:10825414

  11. SVM clustering

    PubMed Central

    Winters-Hilt, Stephen; Merat, Sam

    2007-01-01

    Background Support Vector Machines (SVMs) provide a powerful method for classification (supervised learning). Use of SVMs for clustering (unsupervised learning) is now being considered in a number of different ways. Results An SVM-based clustering algorithm is introduced that clusters data with no a priori knowledge of input classes. The algorithm initializes by first running a binary SVM classifier against a data set with each vector in the set randomly labelled, this is repeated until an initial convergence occurs. Once this initialization step is complete, the SVM confidence parameters for classification on each of the training instances can be accessed. The lowest confidence data (e.g., the worst of the mislabelled data) then has its' labels switched to the other class label. The SVM is then re-run on the data set (with partly re-labelled data) and is guaranteed to converge in this situation since it converged previously, and now it has fewer data points to carry with mislabelling penalties. This approach appears to limit exposure to the local minima traps that can occur with other approaches. Thus, the algorithm then improves on its weakly convergent result by SVM re-training after each re-labeling on the worst of the misclassified vectors – i.e., those feature vectors with confidence factor values beyond some threshold. The repetition of the above process improves the accuracy, here a measure of separability, until there are no misclassifications. Variations on this type of clustering approach are shown. Conclusion Non-parametric SVM-based clustering methods may allow for much improved performance over parametric approaches, particularly if they can be designed to inherit the strengths of their supervised SVM counterparts. PMID:18047717

  12. The optical counterpart of the supersoft X-ray source r3-8 in M31

    NASA Astrophysics Data System (ADS)

    Orio, M.; Luna, G. J. M.; Kotulla, R.; Gallagher, J. S. G.

    2015-10-01

    On behalf of a larger collaboration we announce that we have obtained spectra of the M31 supersoft X-ray source defined as r3-8 in the Chandra catalogs (see Chiosi et al. 2014, MNRAS 443, 1821, and references therein) using GMOS and the B600 grating at Gemini North, in the 4150-7100 Angstrom range, on 2015/9/9.

  13. Absolute quantification of DcR3 and GDF15 from human serum by LC-ESI MS

    PubMed Central

    Lancrajan, Ioana; Schneider-Stock, Regine; Naschberger, Elisabeth; Schellerer, Vera S; Stürzl, Michael; Enz, Ralf

    2015-01-01

    Biomarkers are widely used in clinical diagnosis, prognosis and therapy monitoring. Here, we developed a protocol for the efficient and selective enrichment of small and low concentrated biomarkers from human serum, involving a 95% effective depletion of high-abundant serum proteins by partial denaturation and enrichment of low-abundant biomarkers by size exclusion chromatography. The recovery of low-abundance biomarkers was above 97%. Using this protocol, we quantified the tumour markers DcR3 and growth/differentiation factor (GDF)15 from 100 μl human serum by isotope dilution mass spectrometry, using 15N metabolically labelled and concatamerized fingerprint peptides for the both proteins. Analysis of three different fingerprint peptides for each protein by liquid chromatography electrospray ionization mass spectrometry resulted in comparable concentrations in three healthy human serum samples (DcR3: 27.23 ± 2.49 fmol/ml; GDF15: 98.11 ± 0.49 fmol/ml). In contrast, serum levels were significantly elevated in tumour patients for DcR3 (116.94 ± 57.37 fmol/ml) and GDF15 (164.44 ± 79.31 fmol/ml). Obtained data were in good agreement with ELISA and qPCR measurements, as well as with literature data. In summary, our protocol allows the reliable quantification of biomarkers, shows a higher resolution at low biomarker concentrations than antibody-based strategies, and offers the possibility of multiplexing. Our proof-of-principle studies in patient sera encourage the future analysis of the prognostic value of DcR3 and GDF15 for colon cancer patients in larger patient cohorts. PMID:25823874

  14. Stereospecific enzymatic transformation of alpha-ketoglutarate to (2S,3R)-3-methyl glutamate during acidic lipopeptide biosynthesis.

    PubMed

    Mahlert, Christoph; Kopp, Florian; Thirlway, Jenny; Micklefield, Jason; Marahiel, Mohamed A

    2007-10-01

    The acidic lipopeptides, including the calcium-dependent antibiotics (CDA), daptomycin, and A54145, are important macrocyclic peptide natural products produced by Streptomyces species. All three compounds contain a 3-methyl glutamate (3-MeGlu) as the penultimate C-terminal residue, which is important for bioactivity. Here, biochemical in vitro reconstitution of the 3-MeGlu biosynthetic pathway is presented, using exclusively enzymes from the CDA producer Streptomyces coelicolor. It is shown that the predicted 3-MeGlu methyltransferase GlmT and its homologues DptI from the daptomycin producer Streptomyces roseosporus and LptI from the A54145 producer Streptomyces fradiae do not methylate free glutamic acid, PCP-bound glutamate, or Glu-containing CDA in vitro. Instead, GlmT, DptI, and LptI are S-adenosyl methionine (SAM)-dependent alpha-ketoglutarate methyltransferases that catalyze the stereospecific methylation of alpha-ketoglutarate (alphaKG) leading to (3R)-3-methyl-2-oxoglutarate. Subsequent enzyme screening identified the branched chain amino acid transaminase IlvE (SCO5523) as an efficient catalyst for the transformation of (3R)-3-methyl-2-oxoglutarate into (2S,3R)-3-MeGlu. Comparison of reversed-phase HPLC retention time of dabsylated 3-MeGlu generated by the coupled enzymatic reaction with dabsylated synthetic standards confirmed complete stereocontrol during enzymatic catalysis. This stereospecific two-step conversion of alphaKG to (2S,3R)-3-MeGlu completes our understanding of the biosynthesis and incorporation of beta-methylated amino acids into the nonribosomal lipopeptides. Finally, understanding this pathway may provide new possibilities for the production of modified peptides in engineered microbes. PMID:17784761

  15. Action of long(R3)-insulin-like growth factor-1 on protein metabolism in beef heifers.

    PubMed

    Hill, R A; Hunter, R A; Lindsay, D B; Owens, P C

    1999-05-01

    Insulin-like growth factor-1 (IGF-1) is perhaps the most important endogenous factor controlling growth. Most studies to date in livestock have shown that IGF-1 has greatest efficacy when animals are in a catabolic state. We have determined the effects of an i.v. infusion of the IGF-1 analog Long(R3)-IGF-1 on protein metabolism in beef heifers that were slowly losing liveweight because of restricted feeding. There was a tendency for both whole-body protein and skeletal muscle protein to be conserved in Long(R3)-IGF-1-treated heifers. Long(R3)-IGF-1 administration markedly reduced the plasma concentrations of all amino acids measured and glucose. There was a significant change in the profile differences of endogenous plasma IGF-1 concentrations during the 8-hr infusion period, with plasma IGF-1 decreasing sharply in the test group. There was a significant difference in mean profiles for plasma IGF-2 between the test and control groups. Overall, plasma IGF-2 for the control group decreased only slightly over time (about 40 ng/ml), whereas the test group decreased dramatically (by about 140 ng/ml). Increased plasma concentrations of a 31-32-kDa IGF-binding protein (possibly IGF-binding protein-1) in the treated group was detected by radioligand blot. We found that Long(R3)-IGF-1 infusion tended to preserve whole-body and muscle protein in beef heifers on a low-quality diet, and suggest that further investigation of this treatment may provide an alternative approach to reducing weight loss during the dry season. PMID:10370861

  16. Ground state sign-changing solutions for a class of Schrödinger-Poisson type problems in R3

    NASA Astrophysics Data System (ADS)

    Chen, Sitong; Tang, Xianhua

    2016-08-01

    This paper is dedicated to studying the following Schrödinger-Poisson system -triangle u+V(x)u+λφ u=K(x)f(u),& quad xin R3,-triangleφ= u^2,quad xin R3, where V, K are positive continuous potentials, f is a continuous function and {λ} is a positive parameter. We develop a direct approach to establish the existence of one ground state sign-changing solution {u_λ} with precisely two nodal domains, by introducing a weaker condition that there exists {θ_0in (0,1)} such that K(x)[f(τ)/τ^3-f(tτ)/(tτ)^3 ]sign(1-t)+θ_0V(x)|1-t^2|/(tτ)^2 ≥ 0, quad forall x in R^3, t > 0, τ≠ 0 than the usual increasing condition on {f(t)/|t|^3}. Under the above condition, we also prove that the energy of any sign-changing solution is strictly larger than two times the least energy, and give a convergence property of {u_λ} as {λsearrow 0}.

  17. Mediation of Autophagic Cell Death by Type 3 Ryanodine Receptor (RyR3) in Adult Hippocampal Neural Stem Cells

    PubMed Central

    Chung, Kyung Min; Jeong, Eun-Ji; Park, Hyunhee; An, Hyun-Kyu; Yu, Seong-Woon

    2016-01-01

    Cytoplasmic Ca2+ actively engages in diverse intracellular processes from protein synthesis, folding and trafficking to cell survival and death. Dysregulation of intracellular Ca2+ levels is observed in various neuropathological states including Alzheimer’s and Parkinson’s diseases. Ryanodine receptors (RyRs) and inositol 1,4,5-triphosphate receptors (IP3Rs), the main Ca2+ release channels located in endoplasmic reticulum (ER) membranes, are known to direct various cellular events such as autophagy and apoptosis. Here we investigated the intracellular Ca2+-mediated regulation of survival and death of adult hippocampal neural stem (HCN) cells utilizing an insulin withdrawal model of autophagic cell death (ACD). Despite comparable expression levels of RyR and IP3R transcripts in HCN cells at normal state, the expression levels of RyRs—especially RyR3—were markedly upregulated upon insulin withdrawal. While treatment with the RyR agonist caffeine significantly promoted the autophagic death of insulin-deficient HCN cells, treatment with its inhibitor dantrolene prevented the induction of autophagy following insulin withdrawal. Furthermore, CRISPR/Cas9-mediated knockout of the RyR3 gene abolished ACD of HCN cells. This study delineates a distinct, RyR3-mediated ER Ca2+ regulation of autophagy and programmed cell death in neural stem cells. Our findings provide novel insights into the critical, yet understudied mechanisms underlying the regulatory function of ER Ca2+ in neural stem cell biology. PMID:27199668

  18. Impact of T1r3 and Trpm5 on carbohydrate preference and acceptance in C57BL/6 mice.

    PubMed

    Zukerman, Steven; Glendinning, John I; Margolskee, Robert F; Sclafani, Anthony

    2013-06-01

    Knockout (KO) mice missing the sweet taste receptor subunit T1r3 or the signaling protein Trpm5 have greatly attenuated sweetener preferences but learn to prefer sucrose in 24-h tests. Here, we examined 24-h preferences of T1r3 KO, Trpm5 KO, and C57BL/6J wild-type (WT) mice for glucose, fructose, galactose, and corn starch. Unlike glucose, fructose has little postoral reward effect in WT mice, whereas conflicting data have been obtained with galactose. Naïve KO mice were initially indifferent to dilute glucose solutions (0.5-4%) but exhibited strong preferences for 8-32% concentrations. In a second test, they strongly preferred (~90%) all glucose concentrations although they drank less sugar than WT mice. Naïve KO mice were indifferent to 0.5-8% fructose and avoided 16-32% fructose. However, the glucose-experienced KO mice displayed significant preferences for all fructose solutions. Naïve KO mice preferred only 8% galactose, whereas WT mice preferred 4-16% galactose, and all mice avoided 32% galactose. Galactose experience enhanced the preference for this sugar in KO and WT mice. Naïve T1r3 KO and WT mice displayed similar preferences for 0.5-32% corn starch, which were enhanced by starch experience. Naïve Trpm5 KO mice did not prefer starch but did so after 1-bottle starch experience. The results confirm the sweet taste deficits of T1r3 KO and Trpm5 KO mice but demonstrate their ability to develop strong glucose and milder galactose preferences attributed to the postoral actions of these sugars. The acquired preference for the non-sweet flavor properties of glucose generalized to those of fructose. The findings further demonstrate that although Trpm5 (but not T1r3) signaling is essential for starch preference, Trpm5 KO mice can learn to prefer starch based on its postoral effects. PMID:23547138

  19. The receptor-like kinase SOBIR1 interacts with Brassica napus LepR3 and is required for Leptosphaeria maculans AvrLm1-triggered immunity.

    PubMed

    Ma, Lisong; Borhan, M Hossein

    2015-01-01

    The fungus Leptosphaeria maculans (L. maculans) is the causal agent of blackleg disease of canola/oilseed rape (Brassica napus) worldwide. We previously reported cloning of the B. napus blackleg resistance gene, LepR3, which encodes a receptor-like protein. LepR3 triggers localized cell death upon recognition of its cognate Avr protein, AvrLm1. Here, we exploited the Nicotiana benthamiana model plant to investigate the recognition mechanism of AvrLm1 by LepR3. Co-expression of the LepR3/AvrLm1 gene pair in N. benthamiana resulted in development of a hypersensitive response (HR). However, a truncated AvrLm1 lacking its indigenous signal peptide was compromised in its ability to induce LepR3-mediated HR, indicating that AvrLm1 is perceived by LepR3 extracellularly. Structure-function analysis of the AvrLm1 protein revealed that the C-terminal region of AvrLm1 was required for LepR3-mediated HR in N. benthamiana and for resistance to L. maculans in B. napus. LepR3 was shown to be physically interacting with the B. napus receptor like kinase, SOBIR1 (BnSOBIR1). Silencing of NbSOBIR1 or NbSERK3 (BAK1) compromised LepR3-AvrLm1-dependent HR in N. benthamiana, suggesting that LepR3-mediated resistance to L. maculans in B. napus requires SOBIR1 and BAK1/SERK3. Using this model system, we determined that BnSOBIR1 and SERK3/BAK1 are essential partners in the LepR3 signaling complex and were able to define the AvrLm1 effector domain. PMID:26579176

  20. Return of the glucoreceptor: Glucose activates the glucose-sensing receptor T1R3 and facilitates metabolism in pancreatic β-cells

    PubMed Central

    Kojima, Itaru; Nakagawa, Yuko; Ohtsu, Yoshiaki; Hamano, Kunihisa; Medina, Johan; Nagasawa, Masahiro

    2015-01-01

    Subunits of the sweet taste receptor, namely T1R2 and T1R3, are expressed in mouse pancreatic islets. Quantitatively, the expression of messenger ribonucleic acid for T1R2 is much lower than that of T1R3, and immunoreactive T1R2 is in fact undetectable. Presumably, a homodimer of T1R3 could function as a signaling receptor. Activation of this receptor by adding an artificial sweetener, sucralose, leads to an increase in intracellular adenosine triphosphate ([ATP]c). This increase in [ATP]c is observed in the absence of ambient glucose. Sucralose also augments elevation of [ATP]c induced by methylsuccinate, a substrate for mitochondria. Consequently, activation of T1R3 promotes metabolism in mitochondria and increases [ATP]c. 3-O-Methylglucose, a non-metabolizable analog of glucose, also increases [ATP]c. Conversely, knockdown of T1R3 attenuates elevation of [ATP]c induced by glucose. Hence, glucose promotes its own metabolism by activating T1R3 and augmenting ATP production. Collectively, a homodimer of T1R3 functions as a cell surface glucose-sensing receptor and participates in the action of glucose on insulin secretion. The glucose-sensing receptor T1R3 might be the putative glucoreceptor proposed decades ago by Niki et al. The glucose-sensing receptor is involved in the action of glucose and modulates glucose metabolism in pancreatic β-cells. PMID:25969708

  1. Return of the glucoreceptor: Glucose activates the glucose-sensing receptor T1R3 and facilitates metabolism in pancreatic β-cells.

    PubMed

    Kojima, Itaru; Nakagawa, Yuko; Ohtsu, Yoshiaki; Hamano, Kunihisa; Medina, Johan; Nagasawa, Masahiro

    2015-05-01

    Subunits of the sweet taste receptor, namely T1R2 and T1R3, are expressed in mouse pancreatic islets. Quantitatively, the expression of messenger ribonucleic acid for T1R2 is much lower than that of T1R3, and immunoreactive T1R2 is in fact undetectable. Presumably, a homodimer of T1R3 could function as a signaling receptor. Activation of this receptor by adding an artificial sweetener, sucralose, leads to an increase in intracellular adenosine triphosphate ([ATP]c). This increase in [ATP]c is observed in the absence of ambient glucose. Sucralose also augments elevation of [ATP]c induced by methylsuccinate, a substrate for mitochondria. Consequently, activation of T1R3 promotes metabolism in mitochondria and increases [ATP]c. 3-O-Methylglucose, a non-metabolizable analog of glucose, also increases [ATP]c. Conversely, knockdown of T1R3 attenuates elevation of [ATP]c induced by glucose. Hence, glucose promotes its own metabolism by activating T1R3 and augmenting ATP production. Collectively, a homodimer of T1R3 functions as a cell surface glucose-sensing receptor and participates in the action of glucose on insulin secretion. The glucose-sensing receptor T1R3 might be the putative glucoreceptor proposed decades ago by Niki et al. The glucose-sensing receptor is involved in the action of glucose and modulates glucose metabolism in pancreatic β-cells. PMID:25969708

  2. Ectopic expression of R3 MYB transcription factor gene OsTCL1 in Arabidopsis, but not rice, affects trichome and root hair formation

    PubMed Central

    Zheng, Kaijie; Tian, Hainan; Hu, Qingnan; Guo, Hongyan; Yang, Li; Cai, Ling; Wang, Xutong; Liu, Bao; Wang, Shucai

    2016-01-01

    In Arabidopsis, a MYB-bHLH-WD40 (MBW) transcriptional activator complex activates the homeodomain protein gene GLABRA2 (GL2), leading to the promotion of trichome formation and inhibition of root hair formation. The same MBW complex also activates single-repeat R3 MYB genes. R3 MYBs in turn, play a negative feedback role by competing with R2R3 MYB proteins for binding bHLH proteins, thus blocking the formation of the MBW complex. By BLASTing the rice (Oryza sativa) protein database using the entire amino acid sequence of Arabidopsis R3 MYB transcription factor TRICHOMELESS1 (TCL1), we found that there are two genes in rice genome encoding R3 MYB transcription factors, namely Oryza sativa TRICHOMELESS1 (OsTCL1) and OsTCL2. Expressing OsTCL1 in Arabidopsis inhibited trichome formation and promoted root hair formation, and OsTCL1 interacted with GL3 when tested in Arabidopsis protoplasts. Consistent with these observations, expression levels of GL2, R2R3 MYB transcription factor gene GLABRA1 (GL1) and several R3 MYB genes were greatly reduced, indicating that OsTCL1 is functional R3 MYB. However, trichome and root hair formation in transgenic rice plants overexpressing OsTCL1 remained largely unchanged, and elevated expression of OsGL2 was observed in the transgenic rice plants, indicating that rice may use different mechanisms to regulate trichome formation. PMID:26758286

  3. Synthesis of (2R, 3R)-epigallocatechin-3-O-(4-hydroxybenzoate), a novel catechin from Cistus salvifolius, and evaluation of its proteasome inhibitory activities.

    PubMed

    Osanai, Kumi; Huo, Congde; Landis-Piwowar, Kristin R; Dou, Q Ping; Chan, Tak Hang

    2007-08-01

    The total and semi syntheses of (2R, 3R)-epigallocatechin-3-O-(4-hydroxybenzoate), a novel catechin from Cistus salvifolius, was accomplished. The proteasome inhibition and cytotoxic activities of the synthetic compound and its acetyl derivative were studied and compared with (2R, 3R)-epigallocatechin-3-gallate (EGCG), the active component from green tea. PMID:21152270

  4. Ectopic expression of R3 MYB transcription factor gene OsTCL1 in Arabidopsis, but not rice, affects trichome and root hair formation.

    PubMed

    Zheng, Kaijie; Tian, Hainan; Hu, Qingnan; Guo, Hongyan; Yang, Li; Cai, Ling; Wang, Xutong; Liu, Bao; Wang, Shucai

    2016-01-01

    In Arabidopsis, a MYB-bHLH-WD40 (MBW) transcriptional activator complex activates the homeodomain protein gene GLABRA2 (GL2), leading to the promotion of trichome formation and inhibition of root hair formation. The same MBW complex also activates single-repeat R3 MYB genes. R3 MYBs in turn, play a negative feedback role by competing with R2R3 MYB proteins for binding bHLH proteins, thus blocking the formation of the MBW complex. By BLASTing the rice (Oryza sativa) protein database using the entire amino acid sequence of Arabidopsis R3 MYB transcription factor TRICHOMELESS1 (TCL1), we found that there are two genes in rice genome encoding R3 MYB transcription factors, namely Oryza sativa TRICHOMELESS1 (OsTCL1) and OsTCL2. Expressing OsTCL1 in Arabidopsis inhibited trichome formation and promoted root hair formation, and OsTCL1 interacted with GL3 when tested in Arabidopsis protoplasts. Consistent with these observations, expression levels of GL2, R2R3 MYB transcription factor gene GLABRA1 (GL1) and several R3 MYB genes were greatly reduced, indicating that OsTCL1 is functional R3 MYB. However, trichome and root hair formation in transgenic rice plants overexpressing OsTCL1 remained largely unchanged, and elevated expression of OsGL2 was observed in the transgenic rice plants, indicating that rice may use different mechanisms to regulate trichome formation. PMID:26758286

  5. The impact of Ghana’s R3M programme on the provision of safe abortions and postabortion care

    PubMed Central

    Sundaram, Aparna; Juarez, Fatima; Ahiadeke, Clement; Bankole, Akinrinola; Blades, Nakeisha

    2015-01-01

    In 2006, in response to the high maternal mortality, driven largely by unsafe abortions, the government of Ghana, in partnership with other organizations, launched the reducing maternal mortality and morbidity (R3M) programme in seven districts in Greater Accra, Ashanti and Eastern, to improve comprehensive abortion care services. This article examines whether this intervention made a difference to the provision of safe abortion services and postabortion care (PAC). We also examine the role played by provider attitudes and knowledge of the abortion law, on providers with clinical training in service provision. Primary data on health care providers in Ghana, collected using a quasi-experimental design, were analysed using propensity score weighting. Apart from the treatment group, the sample included two controls: (1) Districts in Accra, Ashanti and Eastern, not exposed to the treatment; and (2) Districts from distant Brong Ahafo, also not exposed to the treatment. The findings show that providers in the treatment group are nearly 16 times as likely to provide safe abortions compared with their peers in Brong Ahafo, and ∼2.5 times as likely compared with providers in the other control group. R3M providers were also different from their peers in providing PAC. Associations between provider attitudes and knowledge of the law on both outcomes were either non-significant or inconsistent including for providers with clinical knowledge of abortion provision. Provider confidence however is strongly associated with service provision. We conclude that the R3M programme is helping safe abortion provision, with the differences being greater with control groups that are geographically distant, perhaps owing to lower contamination from movement of providers between facilities. Increasing provider confidence is key to improving both safe abortion provision and PAC. PMID:25261230

  6. Lactisole inhibits the glucose-sensing receptor T1R3 expressed in mouse pancreatic β-cells.

    PubMed

    Hamano, Kunihisa; Nakagawa, Yuko; Ohtsu, Yoshiaki; Li, Longfei; Medina, Johan; Tanaka, Yuji; Masuda, Katsuyoshi; Komatsu, Mitsuhisa; Kojima, Itaru

    2015-07-01

    Glucose activates the glucose-sensing receptor T1R3 and facilitates its own metabolism in pancreatic β-cells. An inhibitor of this receptor would be helpful in elucidating the physiological function of the glucose-sensing receptor. The present study was conducted to examine whether or not lactisole can be used as an inhibitor of the glucose-sensing receptor. In MIN6 cells, in a dose-dependent manner, lactisole inhibited insulin secretion induced by sweeteners, acesulfame-K, sucralose and glycyrrhizin. The IC50 was ∼4 mmol/l. Lactisole attenuated the elevation of cytoplasmic Ca2+ concentration ([Ca2+]c) evoked by sucralose and acesulfame-K but did not affect the elevation of intracellular cAMP concentration ([cAMP]c) induced by these sweeteners. Lactisole also inhibited the action of glucose in MIN6 cells. Thus, lactisole significantly reduced elevations of intracellular [NADH] and intracellular [ATP] induced by glucose, and also inhibited glucose-induced insulin secretion. To further examine the effect of lactisole on T1R3, we prepared HEK293 cells stably expressing mouse T1R3. In these cells, sucralose elevated both [Ca2+]c and [cAMP]c. Lactisole attenuated the sucralose-induced increase in [Ca2+]c but did not affect the elevation of [cAMP]c. Finally, lactisole inhibited insulin secretion induced by a high concentration of glucose in mouse islets. These results indicate that the mouse glucose-sensing receptor was inhibited by lactisole. Lactisole may be useful in assessing the role of the glucose-sensing receptor in mouse pancreatic β-cells. PMID:25994004

  7. Biosurfactins production by Bacillus amyloliquefaciens R3 and their antibacterial activity against multi-drug resistant pathogenic E. coli.

    PubMed

    Chi, Zhe; Rong, Yan-Jun; Li, Yang; Tang, Mei-Juan; Chi, Zhen-Ming

    2015-05-01

    In this work, the anti-Escherichia coli activity of the bioactive substances produced by Bacillus amyloliquefaciens R3 was examined. A new and cheap medium for production of the anti-E. coli substances which contained 20.0 g L(-1) soybean powder, 20.0 g L(-1) wheat flour, pH 6.0 was developed. A crude surfactant concentration of 0.48 mg mL(-1) was obtained after 27 h of 10-L fermentation, and the diameter of the clear zone on the plate seeded with the pathogenic E. coli 2# was 23.3 mm. A preliminary characterization suggested that the anti-E. coli substances produced by B. amyloliquefaciens R3 were the biosurfactins (F1, F2, F3, F4, and F5) with amino acids (GLLVDLL) and hydroxy fatty acids (of 12-15 carbons in length). It was found that all the strains of the pathogenic E. coli showed resistance to several different antibiotics, suggesting that they were the multi-drug resistance and all the strains of the pathogenic E. coli were sensitive to the biosurfactins, indicating that the biosurfactins produced by B. amyloliquefaciens R3 had a broad spectrum of antibacterial activity against the pathogenic E. coli with multi-drug resistant profiles. After the treatment with the purified biosurfactin (F1), the cell membrane of both the whole cells and protoplasts of the E. coli 2# was damaged and the whole cells of the bacterium were broken. PMID:25407729

  8. Membrane-Bound CYB5R3 Is a Common Effector of Nutritional and Oxidative Stress Response Through FOXO3a and Nrf2

    PubMed Central

    Siendones, Emilio; SantaCruz-Calvo, Sara; Martín-Montalvo, Alejandro; Cascajo, María V.; Ariza, Julia; López-Lluch, Guillermo; Villalba, José M.; Acquaviva-Bourdain, Cécile; Roze, Emmanuel; Bernier, Michel; de Cabo, Rafael

    2014-01-01

    Abstract Aims: Membrane-bound CYB5R3 deficiency in humans causes recessive hereditary methaemoglobinaemia (RHM), an incurable disease that is characterized by severe neurological disorders. CYB5R3 encodes for NADH-dependent redox enzyme that contributes to metabolic homeostasis and stress protection; however, how it is involved in the neurological pathology of RHM remains unknown. Here, the role and transcriptional regulation of CYB5R3 was studied under nutritional and oxidative stress. Results: CYB5R3-deficient cells exhibited a decrease of the NAD+/NADH ratio, mitochondrial respiration rate, ATP production, and mitochondrial electron transport chain activities, which were associated with higher sensitivity to oxidative stress, and an increase in senescence-associated β-galactosidase activity. Overexpression of either forkhead box class O 3a (FOXO3a) or nuclear factor (erythroid-derived 2)-like2 (Nrf2) was associated with increased CYB5R3 levels, and genetic ablation of Nrf2 resulted in lower CYB5R3 expression. The presence of two antioxidant response element sequences in the CYB5R3 promoter led to chromatin immunoprecipitation studies, which showed that cellular stressors enhanced the binding of Nrf2 and FOXO3a to the CYB5R3 promoter. Innovation: Our findings demonstrate that CYB5R3 contributes to regulate redox homeostasis, aerobic metabolism, and cellular senescence, suggesting that CYB5R3 might be a key effector of oxidative and nutritional stress pathways. The expression of CYB5R3 is regulated by the cooperation of Nrf2 and FOXO3a. Conclusion: CYB5R3 is an essential gene that appears as a final effector for both nutritional and oxidative stress responses through FOXO3a and Nrf2, respectively, and their interaction promotes CYB5R3 expression. These results unveil a potential mechanism of action by which CYB5R3 deficiency contributes to the pathophysiological underpinnings of neurological disorders in RHM patients. Antioxid. Redox Signal. 21, 1708–1725. PMID

  9. The mechanical design of the BARREL section of the detector CALIFA for R3B-FAIR.

    NASA Astrophysics Data System (ADS)

    Casarejos, E.; Alvarez-Pol, H.; Cortina-Gil, D.; Durán, I.; Izquierdo, P.; Yañez, P.; Vilán, J. A.

    2014-03-01

    In this work we present the mechanical concept proposed for one of the sections of the detector CALIFA of the R3B experiment for FAIR. The use of an alveolar structure made of carbon-fiber composites allows for a light and robust solution to hold the active elements with an extreme mass ratio below 0.7%. The active core is supported by structural elements designed to make a fully operational assembly, taking care of different configurations and functionality. All the design has been developed using intensive calculation based in finite elements models and physical simulations.

  10. [USAGE OF FUMARATE BY SULPHATE-REDUCING BACTERIA DESULFOMICROBIUM SP. CrR3 AND DESULFOTOMACULUM SP].

    PubMed

    Sholiak, K V; Peretyatko, T B; Gudz, S P; Hnatush, S O; Verkholyak, N S; Halushka, A A

    2015-01-01

    Sulphate-reducing bacteria Desulfomicrobium sp. CrR3 and Desulfotomaculum. sp. are able to use fumarate as electron donor and acceptor. When they use fumarate as an electron acceptor succinate accumulates in the medium. If fumarate serves as electron donor, minor amounts of citrate, isocitrate and acetate are detected except succinate. In the case of simultaneous introduction of fumarate, SO4(2-) and Cr2O7(2-), the last inhibits usage of fumarate and SO4(2-). PMID:26638481

  11. Investigation of the Dipole Response in Exotic Nuclei --- Experiments at the LAND-R^3B Setup

    NASA Astrophysics Data System (ADS)

    Rossi, D.; Adrich, P.; Aksouh, F.; Alvarez-Pol, H.; Aumann, T.; Benlliure, J.; Böhmer, M.; Boretzky, K.; Casarejos, E.; Chartier, M.; Chatillon, A.; Cortina-Gil, D.; Pramanik, U. D.; Emling, H.; Ershova, O.; Fernando-Dominguez, B.; Geissel, H.; Gorska, M.; Heil, M.; Johansson, H. k.; Junghans, A.; Kiselev, O.; Klimkiewicz, A.; Kratz, J.; Kurz, N.; Labiche, M.; Bleis, T. L.; Lemmon, R.; Litvinov, Y.; Mahata, K.; Maierbeck, P.; Movsesyan, A.; Nilsson, T.; Nociforo, C.; Palit, R.; Paschalis, S.; Plag, R.; Reifarth, R.; Simon, H.; Sümmerer, K.; Wagner, A.; Walus, W.; Weick, H.; Winkler, M.

    We present experimental results on the electromagneticexcitation of neutron-rich nickel isotopes, making use of the R^{3}B-LAND setup at GSI. Exotic beams were produced at approximately 500 MeV/u and their reactions were studied in inverse kinematics. Integral cross sections for ^{58}Ni are discussed and compared to previous data, providing a validation of our experimental method. The E1 excitation-energy distribution of the unstable ^{68}Ni is presented as well, showing an excess in cross section in the 1n decay channel when compared only with a typical Giant Dipole Resonance.

  12. Genetic Variation in CYB5R3 is Associated with Methemoglobin Levels in Preterm Infants Receiving Nitric Oxide Therapy

    PubMed Central

    Fuller, Tyson D; Spracklen, Cassandra N; Ryckman, Kelli K; Knake, Lindsey A; Busch, Tamara D; Momany, Allison M; Murray, Jeffrey C; Dagle, John M

    2015-01-01

    Background In recent years, increasing numbers of preterm infants have been exposed to inhaled nitric oxide (iNO). This population has decreased methemoglobin (MetHb) reductase activity in their erythrocytes, which may increase the risk of MetHb toxicity. We sought to determine if genetic factors are associated with the observed variance in MetHb levels. Methods A population of 127 preterm infants was genotyped for five single-nucleotide polymorphisms (SNPs) in the CYB5A and CYB5R3 genes. iNO dose and levels of MetHb were obtained by chart abstraction. Analysis of variance was performed to identify genetic associations with MetHb levels. Results An association was found between the heterozygous genotype (GA) of rs916321 in the CYB5R3 gene and the mean of the first recorded MetHb levels in Caucasian infants (p=0.01). This result remained significant after adjustment for the iNO dose (p=0.009), gender (p=0.03), multiple gestation (p=0.03), birth weight (p=0.02), and gestational age (p=0.02). No significant associations were found with the other SNPs. Conclusion We demonstrate a novel genetic association with neonatal MetHb levels. Identification of genetic risk factors may be useful in determining which preterm infants are most at risk of developing MetHb toxicity with the use of iNO. PMID:25521918

  13. Characterization of two tartary buckwheat R2R3-MYB transcription factors and their regulation of proanthocyanidin biosynthesis.

    PubMed

    Bai, Yue-Chen; Li, Cheng-Lei; Zhang, Jin-Wen; Li, Shuang-Jiang; Luo, Xiao-Peng; Yao, Hui-Peng; Chen, Hui; Zhao, Hai-Xia; Park, Sang-Un; Wu, Qi

    2014-11-01

    Tartary buckwheat (Fagopyrum tataricum Gaertn.) contains high concentrations of flavonoids. The flavonoids are mainly represented by rutin, anthocyanins and proanthocyanins in tartary buckwheat. R2R3-type MYB transcription factors (TFs) play key roles in the transcriptional regulation of the flavonoid biosynthetic pathway. In this study, two TF genes, FtMYB1 and FtMYB2, were isolated from F. tataricum and characterized. The results of bioinformatic analysis indicated that the putative FtMYB1 and FtMYB2 proteins belonged to the R2R3-MYB family and displayed a high degree of similarity with TaMYB14 and AtMYB123/TT2. In vitro and in vivo evidence both showed the two proteins were located in the nucleus and exhibited transcriptional activation activities. During florescence, both FtMYB1 and FtMYB2 were more highly expressed in the flowers than any other organ. The overexpression of FtMYB1 and FtMYB2 significantly enhanced the accumulation of proanthocyanidins (PAs) and showed a strong effect on the target genes' expression in Nicotiana tabacum. The expression of dihydroflavonol-4-reductase (DFR) was upregulated to 5.6-fold higher than that of control, and the expression level was lower for flavonol synthase (FLS). To our knowledge, this is the first functional characterization of two MYB TFs from F. tataricum that control the PA pathway. PMID:24730512

  14. CONSTRAINTS ON THE PHYSICAL PROPERTIES OF MAIN BELT COMET P/2013 R3 FROM ITS BREAKUP EVENT

    SciTech Connect

    Hirabayashi, Masatoshi; Sánchez, Diego Paul; Gabriel, Travis; Scheeres, Daniel J.

    2014-07-01

    Jewitt et al. recently reported that main belt comet P/2013 R3 experienced a breakup, probably due to rotational disruption, with its components separating on mutually hyperbolic orbits. We propose a technique for constraining physical properties of the proto-body, especially the initial spin period and cohesive strength, as a function of the body's estimated size and density. The breakup conditions are developed by combining mutual orbit dynamics of the smaller components and the failure condition of the proto-body. Given a proto-body with a bulk density ranging from 1000 kg m{sup –3} to 1500 kg m{sup –3} (a typical range of the bulk density of C-type asteroids), we obtain possible values of the cohesive strength (40-210 Pa) and the initial spin state (0.48-1.9 hr). From this result, we conclude that although the proto-body could have been a rubble pile, it was likely spinning beyond its gravitational binding limit and would have needed cohesive strength to hold itself together. Additional observations of P/2013 R3 will enable stronger constraints on this event, and the present technique will be able to give more precise estimates of its internal structure.

  15. Production of Chiral (R)-3-Hydroxyoctanoic Acid Monomers, Catalyzed by Pseudomonas fluorescens GK13 Poly(3-Hydroxyoctanoic Acid) Depolymerase▿

    PubMed Central

    Gangoiti, Joana; Santos, Marta; Llama, María J.; Serra, Juan L.

    2010-01-01

    The extracellular medium-chain-length polyhydroxyalkanoate (MCL-PHA) depolymerase of Pseudomonas fluorescens GK13 catalyzes the hydrolysis of poly(3-hydroxyoctanoic acid) [P(3HO)]. Based on the strong tendency of the enzyme to interact with hydrophobic materials, a low-cost method which allows the rapid and easy purification and immobilization of the enzyme has been developed. Thus, the extracellular P(3HO) depolymerase present in the culture broth of cells of P. fluorescens GK13 grown on mineral medium supplemented with P(3HO) as the sole carbon and energy source has been tightly adsorbed onto a commercially available polypropylene support (Accurel MP-1000) with high yield and specificity. The activity of the pure enzyme was enhanced by the presence of detergents and organic solvents, and it was retained after treatment with an SDS-denaturing cocktail under both reducing and nonreducing conditions. The time course of the P(3HO) hydrolysis catalyzed by the soluble and immobilized enzyme has been assessed, and the resulting products have been identified. After 24 h of hydrolysis, the dimeric ester of 3-HO [(R)-3-HO-HO] was obtained as the main product of the soluble enzyme. However, the immobilized enzyme catalyzes almost the complete hydrolysis of P(3HO) polymer to (R)-3-HO monomers under the same conditions. PMID:20400568

  16. CARTILAGE CELL CLUSTERS

    PubMed Central

    Lotz, Martin K.; Otsuki, Shuhei; Grogan, Shawn P.; Sah, Robert; Terkeltaub, Robert; D’Lima, Darryl

    2010-01-01

    The formation of new cell clusters is a histological hallmark of arthritic cartilage but the biology of clusters and their role in disease are poorly understood. This is the first comprehensive review of clinical and experimental conditions associated with cluster formation. Genes and proteins that are expressed in cluster cells, the cellular origin of the clusters, mechanisms that lead to cluster formation and the role of cluster cells in pathogenesis are discussed. PMID:20506158

  17. Efficient secretion of (R)-3-hydroxybutyric acid from Halomonas sp. KM-1 by nitrate fed-batch cultivation with glucose under microaerobic conditions.

    PubMed

    Kawata, Yoshikazu; Ando, Hitoshi; Matsushita, Isao; Tsubota, Jun

    2014-03-01

    To establish a sustainable society, commodity chemicals need to be developed from biomass resources. Recently, (R)-3-hydroxybutyric acid ((R)-3-HB), a monomer of bioplastic poly-(R)-3-hydroxybutyric acid (PHB), has attracted attention for its possible use in the chemical industry. Halophilic bacteria have been considered for bioprocess applications due to certain characteristics such as the ability to grow in media containing high levels of the starting carbon source and the ability to be rarely contaminated. A halophilic bacterium Halomonas sp. KM-1 stores PHB intracellularly under aerobic conditions and secretes (R)-3-HB under microaerobic conditions. In this study, we optimized culture conditions to maximize (R)-3-HB secretion by KM-1 cells. By a simple nitrate fed-batch cultivation, Halomonas sp. KM-1 secreted 40.3g/L (R)-3-HB with a productivity of 0.48g L(-1)h(-1) with 20% (w/v) glucose. This level is one of the highest recorded productivity of (R)-3-HB to date. PMID:24503050

  18. Multiflavor QCD∗ on R3 ×S1: Studying transition from Abelian to non-Abelian confinement

    NASA Astrophysics Data System (ADS)

    Shifman, M.; Ünsal, M.

    2009-11-01

    The center-stabilized multiflavor QCD∗ theories formulated on R3 ×S1 exhibit both Abelian and non-Abelian confinement as a function of the S1 radius, similar to the Seiberg-Witten theory as a function of the mass deformation parameter. For sufficiently small number of flavors and small r (S1), we show occurrence of a mass gap in gauge fluctuations, and linear confinement. This is a regime of confinement without continuous chiral symmetry breaking (χSB). Unlike one-flavor theories where there is no phase transition in r (S1), the multiflavor theories possess a single phase transition associated with breaking of the continuous χS. We conjecture that the scale of the χSB is parametrically tied up with the scale of Abelian to non-Abelian confinement transition.

  19. On the stability of triangular points in the relativistic R3BP with oblate primaries and bigger radiating

    NASA Astrophysics Data System (ADS)

    Bello, Nakone; Singh, Jagadish

    2016-01-01

    We consider a version of the relativistic R3BP which includes the effects of oblateness of the primaries and radiation of the bigger primary as well on the stability of triangular points. We observe that the positions of the triangular points and their stability are affected by the relativistic effect apart from the radiation and oblateness of the primaries. It is further seen for these points that the range of stability region increases or decreases according as the part of the critical mass value, depending upon relativistic terms, radiation and oblateness coefficients, is positive or negative. A numerical exploration shows that in the Sun-Saturn, Sun-Uranus, Sun-Neptune systems, the oblateness has no influence on their positions and range of stability region; whereas it has a little influence on the Sun-Mars, Sun-Jupiter systems. On the other hand, we found that radiation pressure has an observable effect on the solar system.

  20. An R2R3 MYB transcription factor associated with regulation of the anthocyanin biosynthetic pathway in Rosaceae

    PubMed Central

    2010-01-01

    Background The control of plant anthocyanin accumulation is via transcriptional regulation of the genes encoding the biosynthetic enzymes. A key activator appears to be an R2R3 MYB transcription factor. In apple fruit, skin anthocyanin levels are controlled by a gene called MYBA or MYB1, while the gene determining fruit flesh and foliage anthocyanin has been termed MYB10. In order to further understand tissue-specific anthocyanin regulation we have isolated orthologous MYB genes from all the commercially important rosaceous species. Results We use gene specific primers to show that the three MYB activators of apple anthocyanin (MYB10/MYB1/MYBA) are likely alleles of each other. MYB transcription factors, with high sequence identity to the apple gene were isolated from across the rosaceous family (e.g. apples, pears, plums, cherries, peaches, raspberries, rose, strawberry). Key identifying amino acid residues were found in both the DNA-binding and C-terminal domains of these MYBs. The expression of these MYB10 genes correlates with fruit and flower anthocyanin levels. Their function was tested in tobacco and strawberry. In tobacco, these MYBs were shown to induce the anthocyanin pathway when co-expressed with bHLHs, while over-expression of strawberry and apple genes in the crop of origin elevates anthocyanins. Conclusions This family-wide study of rosaceous R2R3 MYBs provides insight into the evolution of this plant trait. It has implications for the development of new coloured fruit and flowers, as well as aiding the understanding of temporal-spatial colour change. PMID:20302676

  1. A single-repeat R3-MYB transcription factor MYBC1 negatively regulates freezing tolerance in Arabidopsis

    SciTech Connect

    Zhai, Hong; Bai, Xi; Zhu, Yanming; Li, Yong; Cai, Hua; Ji, Wei; Ji, Zuojun; Liu, Xiaofei; Liu, Xin; Li, Jing

    2010-04-16

    We had previously identified the MYBC1 gene, which encodes a single-repeat R3-MYB protein, as a putative osmotic responding gene; however, no R3-MYB transcription factor has been reported to regulate osmotic stress tolerance. Thus, we sought to elucidate the function of MYBC1 in response to osmotic stresses. Real-time RT-PCR analysis indicated that MYBC1 expression responded to cold, dehydration, salinity and exogenous ABA at the transcript level. mybc1 mutants exhibited an increased tolerance to freezing stress, whereas 35S::MYBC1 transgenic plants exhibited decreased cold tolerance. Transcript levels of some cold-responsive genes, including CBF/DREB genes, KIN1, ADC1, ADC2 and ZAT12, though, were not altered in the mybc1 mutants or the 35S::MYBC1 transgenic plants in response to cold stress, as compared to the wild type. Microarray analysis results that are publically available were investigated and found transcript level of MYBC1 was not altered by overexpression of CBF1, CBF2, and CBF3, suggesting that MYBC1 is not down regulated by these CBF family members. Together, these results suggested that MYBC1is capable of negatively regulating the freezing tolerance of Arabidopsis in the CBF-independent pathway. In transgenic Arabidopsis carrying an MYBC1 promoter driven {beta}-glucuronidase (GUS) construct, GUS activity was observed in all tissues and was relatively stronger in the vascular tissues. Fused MYBC1 and GFP protein revealed that MYBC1 was localized exclusively in the nuclear compartment.

  2. An R2R3-MYB Transcription Factor Regulates Eugenol Production in Ripe Strawberry Fruit Receptacles1

    PubMed Central

    Medina-Puche, Laura; Molina-Hidalgo, Francisco Javier; Boersma, Maaike; Schuurink, Robert C.; López-Vidriero, Irene; Solano, Roberto; Franco-Zorrilla, José-Manuel; Caballero, José Luis; Blanco-Portales, Rosario; Muñoz-Blanco, Juan

    2015-01-01

    Eugenol is a volatile phenylpropanoid that contributes to flower and ripe fruit scent. In ripe strawberry (Fragaria × ananassa) fruit receptacles, eugenol is biosynthesized by eugenol synthase (FaEGS2). However, the transcriptional regulation of this process is still unknown. We have identified and functionally characterized an R2R3 MYB transcription factor (EMISSION OF BENZENOID II [FaEOBII]) that seems to be the orthologous gene of PhEOBII from Petunia hybrida, which contributes to the regulation of eugenol biosynthesis in petals. The expression of FaEOBII was ripening related and fruit receptacle specific, although high expression values were also found in petals. This expression pattern of FaEOBII correlated with eugenol content in both fruit receptacle and petals. The expression of FaEOBII was repressed by auxins and activated by abscisic acid, in parallel to the ripening process. In ripe strawberry receptacles, where the expression of FaEOBII was silenced, the expression of CINNAMYL ALCOHOL DEHYDROGENASE1 and FaEGS2, two structural genes involved in eugenol production, was down-regulated. A subsequent decrease in eugenol content in ripe receptacles was also observed, confirming the involvement of FaEOBII in eugenol metabolism. Additionally, the expression of FaEOBII was under the control of FaMYB10, another R2R3 MYB transcription factor that regulates the early and late biosynthetic genes from the flavonoid/phenylpropanoid pathway. In parallel, the amount of eugenol in FaMYB10-silenced receptacles was also diminished. Taken together, these data indicate that FaEOBII plays a regulating role in the volatile phenylpropanoid pathway gene expression that gives rise to eugenol production in ripe strawberry receptacles. PMID:25931522

  3. Comparison of the RT3 Research Tracker and Tritrac R3D accelerometers during a backpacking expedition by a single subject.

    PubMed

    DeVoe, Dale

    2004-10-01

    This study compared the RT3 Research Tracker accelerometer and the Tritrac R3D accelerometer in a field setting. A six-day backpacking expedition (122.4 km in length) was completed by a single subject in the Grand Canyon National Park, Arizona. The overall correlation between the counts of vector magnitude activity for the RT3 and R3D was moderate (r =.75, p<.001), with the overall calculated bias [mean difference (RT3 minus R3D) and standard deviation of the differences] across all six days estimated at 235+/-436 vector magnitude activity counts. However, agreement between the instruments is problematic; the RT3 might be 201 activity counts below or 671 activity counts above the R3D in assessing physical activity during backpacking. PMID:15560342

  4. Development of a Functionally Minimized Mutant of the R3C Ligase Ribozyme Offers Insight into the Plausibility of the RNA World Hypothesis

    PubMed Central

    Kurihara, Eri; Uchida, Sayuri; Umehara, Takuya; Tamura, Koji

    2014-01-01

    The R3C ligase ribozyme is an artificial ligase ribozyme produced by modification of the ribozyme that lacks cytidine. Here, we attempted to modify the original R3C ribozyme (73 nucleotides) by reducing the number of nucleotides while maintaining the maximum possible catalytic efficiency. By partially deleting both the “grip” (P4 + P5) and “hammer” (P3) stem-loops, we found the critical border to retain activity comparable to that of full-length R3C. The three-way junction structure was necessary to maintain enzymatic function and the stability of the “grip” (P4 + P5) stem had a large influence on the catalytic activity of R3C. The final minimized ribozyme we obtained comprised ~50 nucleotides, comparable to the estimated length of prebiotically synthesized RNA. Our findings suggest that the autocatalytic function in ribozymes is indeed possible to obtain using sequence lengths achievable with prebiotic synthesis. PMID:25256424

  5. A phase I study of 99mTc-hR3 (DiaCIM), a humanized immunoconjugate directed towards the epidermal growth factor receptor.

    PubMed

    Vallis, K A; Reilly, R M; Chen, P; Oza, A; Hendler, A; Cameron, R; Hershkop, M; Iznaga-Escobar, N; Ramos-Suzarte, M; Keane, P

    2002-12-01

    A phase I trial was conducted to evaluate the safety, tumour and normal tissue localization, pharmacokinetics and radiation dosimetry of Tc-hR3, a humanized monoclonal antibody directed towards the epidermal growth factor receptor, in 12 patients with recurrent or metastatic epithelial malignancies. Patients were injected intravenously with 3.0 mg or 6.0 mg (1010 MBq) of Tc-hR3. Blood and plasma concentrations of radioactivity were measured and a complete 24 h urine collection was obtained. Whole-body images were acquired up to 24 h post-injection and normal organ uptake quantified. Radiation dosimetry was estimated using MIRDose. Safety was evaluated by clinical observation, biochemical/haematological testing and by measuring immune response to Tc-hR3. There were no adverse effects, no changes in biochemical/haematological indices and no immune response to Tc-hR3. Tc-hR3 was rapidly cleared from the blood with a distribution half-life of 10.8+/-3.8 min. The volume of distribution, and clearance, were 180+/-37 ml.kg and 14+/-3 ml.kg.min, respectively. The elimination phase could not be discerned due to increasing blood radioactivity at later times. About 19-24% was excreted in the urine. Normal tissue uptake was mainly in the liver (44-50%), spleen (3-4%) and kidneys (3%). Imaging was positive in one patient with squamous cell carcinoma of the mouth and an involved cervical lymph node. The whole-body radiation dose from Tc-hR3 was 1.34+/-0.02x10 mSv.Bq. We conclude that Tc-hR3 exhibited an excellent safety profile. Future studies to determine the sensitivity and specificity of imaging with Tc-hR3 in a larger group of patients with pre-selection for epidermal growth factor receptor positivity are planned. PMID:12464779

  6. Cluster-impact fusion

    SciTech Connect

    Echenique, P.M.; Manson, J.R.; Ritchie, R.H. )

    1990-03-19

    We present a model for the cluster-impact-fusion experiments of Buehler, Friedlander, and Friedman, Calculated fusion rates as a function of bombarding energy for constant cluster size agree well with experiment. The dependence of the fusion rate on cluster size at fixed bombarding energy is explained qualitatively. The role of correlated, coherent collisions in enhanced energy loss by clusters is emphasized.

  7. Foodservice Occupations Cluster Guide.

    ERIC Educational Resources Information Center

    Oregon State Dept. of Education, Salem.

    Intended to assist vocational teachers in developing and implementing a cluster program in food service occupations, this guide contains sections on cluster organization and implementation and instructional emphasis areas. The cluster organization and implementation section covers goal-based planning and includes a proposed cluster curriculum, a…

  8. Genome-Wide Analysis of Citrus R2R3MYB Genes and Their Spatiotemporal Expression under Stresses and Hormone Treatments

    PubMed Central

    He, Shaolan; Zheng, Yongqiang; Yi, Shilai; Lv, Qiang; Deng, Lie

    2014-01-01

    The R2R3MYB proteins represent one of the largest families of transcription factors, which play important roles in plant growth and development. Although genome-wide analysis of this family has been conducted in many species, little is known about R2R3MYB genes in citrus, In this study, 101 R2R3MYB genes has been identified in the citrus (Citrus sinesis and Citrus clementina) genomes, which are almost equal to the number of rice. Phylogenetic analysis revealed that they could be subdivided into 21 subgroups. The evolutionary relationships and the intro-exon organizations were also analyzed, revealing strong gene conservation but also the expansions of particular functional genes during the plant evolution. Tissue-specific expression profiles showed that 95 citrus R2R3MYB genes were expressed in at least one tissue and the other 6 genes showed very low expression in all tissues tested, suggesting that citrus R2R3MYB genes play important roles in the development of all citrus organs. The transcript abundance level analysis during abiotic conditions (NaCl, abscisic acid, jasmonic acid, drought and low temperature) identified a group of R2R3MYB genes that responded to one or multiple treatments, which showed a promising for improving citrus adaptation to stresses. Our results provided an essential foundation for the future selection of the citrus R2R3MYB genes for cloning and functional dissection with an aim of uncovering their roles in citrus growth and development. PMID:25473954

  9. Decoy Receptor 3 (DcR3) as a Biomarker of Tumor Deterioration in Female Reproductive Cancers: A Meta-Analysis.

    PubMed

    Jiang, Mengtong; Lin, Xiaomiao; He, Rongquan; Lin, Xinggu; Liang, Lu; Tang, Ruixue; Xiong, Dandan; Wei, Kanglai; Dang, Yiwu; Feng, Zhenbo; Chen, Gang

    2016-01-01

    BACKGROUND DcR3 (decoy receptor 3) has been proposed be involved in development and prognosis of female reproductive cancers, including cervical cancer, ovarian cancer, and breast cancer. The purpose of this meta-analysis was to explore the evidence for the correlation between DcR3 and the clinicopathological characteristics, as well as the overall survival time, in female reproductive cancers. MATERIAL AND METHODS Relevant studies were searched for in PubMed, Wiley Online Library, Web of Science, Science Direct, Cochrane Central Register of Controlled Trials, Google Scholar, EMBASE, Ovid, LILACS, Chinese CNKI, Chong Qing VIP, Wan Fang, and China Biology Medicine disc up to 30 September 2015. Data on the relationship between DcR3 expression and TNM stage, differentiation, lymph node metastasis, age, and overall survival time were extracted. Pooled odds ratios (ORs) and 95% CIs (confidence intervals) were estimated by forest plot. RESULTS Twelve studies with 1127 patients met the inclusion criteria for this meta-analysis. Overexpression of DcR3 was significantly related to the risk of female reproductive cancers (OR=10.69, 95% CI: 6.33-18.05), TNM stage (OR=5.51, 95% CI: 2.83-10.71), differentiation (OR=4.16, 95% CI: 2.28-7.60), lymph node metastasis (OR=5.89, 95% CI: 3.16-10.9), age (OR=0.85, 95% CI: 0.51-1.44), and overall survival time (OR=1.84, 95% CI: 0.58-5.83). Subgroup analyses showed that overexpression of DcR3 in cervical, ovarian, and breast cancer all had similar relationships with these clinicopathological parameters. CONCLUSIONS Our meta-analysis suggests that overexpression of DcR3 may play vital roles in the tumorigenesis and deterioration of female reproductive cancers. However, the relationship between DcR3 expression and prognosis needs further investigation. PMID:27246752

  10. Expression of tumor necrosis factor-α-induced protein 8 in stage III gastric cancer and the correlation with DcR3 and ERK1/2

    PubMed Central

    HU, RUYI; LIU, WENMING; QIU, XINGFENG; LIN, ZHENGHE; XIE, YAN; HONG, XINGYA; PAERHATI, REYILA; QI, ZHONGQUAN; ZHUANG, GUOHONG; LIU, ZHONGCHEN

    2016-01-01

    Tumor necrosis factor (TNF)-α-induced protein 8 (TIPE) is a recently identified protein that is considered to be associated with various malignancies, including esophageal, breast and pancreatic cancer; however, the importance of TIPE in gastric cancer (GC) remains unknown. Decoy receptor 3 (DcR3) is a member of the tumor necrosis factor receptor superfamily that is expressed in digestive system neoplasms. The expression of DcR3 is regulated by the mitogen-activated protein kinase (MAPK)/MAPK kinase/extracellular signal-regulated kinase (ERK) signaling pathway. Reverse transcription-polymerase chain reaction was performed to detect the expression of TIPE, ERK and DcR3 in the pathological and tumor-adjacent normal gastric tissues of 30 patients that demonstrated stage III gastric adenocarcinoma. The expression and distribution of the TIPE protein was examined using immunohistochemistry, and the clinical significance and expression levels of DcR3 and ERK1/2 were evaluated. The expression of TIPE, ERK1/2 and DcR3 in the tumor tissues of GC was significantly increased compared with paracarcinoma tissues (P<0.05). In addition, TIPE expression positively correlated with DcR3 and ERK1 levels (r=0.538 and r=0.462, respectively; P<0.05). There was no statistical difference between tumor tissues from patients with varying age, gender, differentiation or lymph node metastasis (P>0.05). TIPE may be vital in the progression of GC. TIPE may be associated with the expression of DcR3 and ERK1/2, which may be involved in the cell apoptosis of GC. The present study elucidates the potential function of TIPE as a novel marker and therapeutic target for GC. PMID:26998086

  11. Genome-wide analysis of citrus R2R3MYB genes and their spatiotemporal expression under stresses and hormone treatments.

    PubMed

    Xie, Rangjin; Li, Yongjie; He, Shaolan; Zheng, Yongqiang; Yi, Shilai; Lv, Qiang; Deng, Lie

    2014-01-01

    The R2R3MYB proteins represent one of the largest families of transcription factors, which play important roles in plant growth and development. Although genome-wide analysis of this family has been conducted in many species, little is known about R2R3MYB genes in citrus, In this study, 101 R2R3MYB genes has been identified in the citrus (Citrus sinesis and Citrus clementina) genomes, which are almost equal to the number of rice. Phylogenetic analysis revealed that they could be subdivided into 21 subgroups. The evolutionary relationships and the intro-exon organizations were also analyzed, revealing strong gene conservation but also the expansions of particular functional genes during the plant evolution. Tissue-specific expression profiles showed that 95 citrus R2R3MYB genes were expressed in at least one tissue and the other 6 genes showed very low expression in all tissues tested, suggesting that citrus R2R3MYB genes play important roles in the development of all citrus organs. The transcript abundance level analysis during abiotic conditions (NaCl, abscisic acid, jasmonic acid, drought and low temperature) identified a group of R2R3MYB genes that responded to one or multiple treatments, which showed a promising for improving citrus adaptation to stresses. Our results provided an essential foundation for the future selection of the citrus R2R3MYB genes for cloning and functional dissection with an aim of uncovering their roles in citrus growth and development. PMID:25473954

  12. Antibodies targeting human IL1RAP (IL1R3) show therapeutic effects in xenograft models of acute myeloid leukemia

    PubMed Central

    Ågerstam, Helena; Karlsson, Christine; Hansen, Nils; Sandén, Carl; Askmyr, Maria; von Palffy, Sofia; Högberg, Carl; Rissler, Marianne; Wunderlich, Mark; Juliusson, Gunnar; Richter, Johan; Sjöström, Kjell; Bhatia, Ravi; Mulloy, James C.; Järås, Marcus; Fioretos, Thoas

    2015-01-01

    Acute myeloid leukemia (AML) is associated with a poor survival rate, and there is an urgent need for novel and more efficient therapies, ideally targeting AML stem cells that are essential for maintaining the disease. The interleukin 1 receptor accessory protein (IL1RAP; IL1R3) is expressed on candidate leukemic stem cells in the majority of AML patients, but not on normal hematopoietic stem cells. We show here that monoclonal antibodies targeting IL1RAP have strong antileukemic effects in xenograft models of human AML. We demonstrate that effector-cell–mediated killing is essential for the observed therapeutic effects and that natural killer cells constitute a critical human effector cell type. Because IL-1 signaling is important for the growth of AML cells, we generated an IL1RAP-targeting antibody capable of blocking IL-1 signaling and show that this antibody suppresses the proliferation of primary human AML cells. Hence, IL1RAP can be efficiently targeted with an anti-IL1RAP antibody capable of both achieving antibody-dependent cellular cytotoxicity and blocking of IL-1 signaling as modes of action. Collectively, these results provide important evidence in support of IL1RAP as a target for antibody-based treatment of AML. PMID:26261316

  13. MULTIPASS, a rice R2R3-type MYB transcription factor, regulates adaptive growth by integrating multiple hormonal pathways.

    PubMed

    Schmidt, Romy; Schippers, Jos H M; Mieulet, Delphine; Obata, Toshihiro; Fernie, Alisdair R; Guiderdoni, Emmanuel; Mueller-Roeber, Bernd

    2013-10-01

    Growth regulation is an important aspect of plant adaptation during environmental perturbations. Here, the role of MULTIPASS (OsMPS), an R2R3-type MYB transcription factor of rice, was explored. OsMPS is induced by salt stress and expressed in vegetative and reproductive tissues. Over-expression of OsMPS reduces growth under non-stress conditions, while knockdown plants display increased biomass. OsMPS expression is induced by abscisic acid and cytokinin, but is repressed by auxin, gibberellin and brassinolide. Growth retardation caused by OsMPS over-expression is partially restored by auxin application. Expression profiling revealed that OsMPS negatively regulates the expression of EXPANSIN (EXP) and cell-wall biosynthesis as well as phytohormone signaling genes. Furthermore, the expression of OsMPS-dependent genes is regulated by auxin, cytokinin and abscisic acid. Moreover, we show that OsMPS is a direct upstream regulator of OsEXPA4, OsEXPA8, OsEXPB2, OsEXPB3, OsEXPB6 and the endoglucanase genes OsGLU5 and OsGLU14. The multiple responses of OsMPS and its target genes to various hormones suggest an integrative function of OsMPS in the cross-talk between phytohormones and the environment to regulate adaptive growth. PMID:23855375

  14. The Evolutionary History of R2R3-MYB Proteins Across 50 Eukaryotes: New Insights Into Subfamily Classification and Expansion.

    PubMed

    Du, Hai; Liang, Zhe; Zhao, Sen; Nan, Ming-Ge; Tran, Lam-Son Phan; Lu, Kun; Huang, Yu-Bi; Li, Jia-Na

    2015-01-01

    R2R3-MYB proteins (2R-MYBs) are one of the main transcription factor families in higher plants. Since the evolutionary history of this gene family across the eukaryotic kingdom remains unknown, we performed a comparative analysis of 2R-MYBs from 50 major eukaryotic lineages, with particular emphasis on land plants. A total of 1548 candidates were identified among diverse taxonomic groups, which allowed for an updated classification of 73 highly conserved subfamilies, including many newly identified subfamilies. Our results revealed that the protein architectures, intron patterns, and sequence characteristics were remarkably conserved in each subfamily. At least four subfamilies were derived from early land plants, 10 evolved from spermatophytes, and 19 from angiosperms, demonstrating the diversity and preferential expansion of this gene family in land plants. Moreover, we determined that their remarkable expansion was mainly attributed to whole genome and segmental duplication, where duplicates were preferentially retained within certain subfamilies that shared three homologous intron patterns (a, b, and c) even though up to 12 types of patterns existed. Through our integrated distributions, sequence characteristics, and phylogenetic tree analyses, we confirm that 2R-MYBs are old and postulate that 3R-MYBs may be evolutionarily derived from 2R-MYBs via intragenic domain duplication. PMID:26047035

  15. Characterization, biodegradability and blood compatibility of poly[(R)-3-hydroxybutyrate] based poly(ester-urethane)s.

    PubMed

    Liu, Qiaoyan; Cheng, Shaoting; Li, Zibiao; Xu, Kaitian; Chen, Guo-Qiang

    2009-09-15

    Poly(ester-urethane)s (PUs) were synthesized using hexamethylene diisocyanate (HDI) or toluene diisocyanate (TDI) to join short chains (M(n) = 2000) of poly(R-3-hydroxybutyrate) (PHB) diols and poly(epsilon-caprolactone) (PCL) diols with different feed ratios under different reaction conditions. The multiblock copolymers were characterized by nuclear magnetic resonance spectrometer (NMR), gel permeation chromatography (GPC), differential scanning calorimetry (DSC), thermogravimetric analyses (TGA), X-ray diffraction (XRD), and scanning electron microscope (SEM). XRD spectra and second DSC heat thermograms of the multiblock copolymers revealed that the crystallization of both PHB and PCL segments was mutually restricted, and, especially, the PCL segment limited the cold crystallization of the PHB segment. The SEM of platelet adhesion experiments showed that the hemocompatibility was affected to some extent by the chain flexibility of the polymers. Hydrolysis studies demonstrated that the hydrolytic degradation of PUs was generated from the scission of their ester bonds or/and urethane bonds. Simultaneously, the rate of ester bond scission was determined to some extent by the crystallization degree, which was further affected by the configuration of polymer chains. These highly elastic multiblock copolymers combining hemocompatibility and biodegradability may be developed into blood contact implant materials for biomedical applications. PMID:18671259

  16. The simultaneous production of sphingan Ss and poly(R-3-hydroxybutyrate) in Sphingomonas sanxanigenens NX02.

    PubMed

    Wu, Mengmeng; Li, Guoqiang; Huang, Haidong; Chen, Sibin; Luo, Ying; Zhang, Wenwen; Li, Keran; Zhou, Jiefang; Ma, Ting

    2016-01-01

    Sphingans and poly(R-3-hydroxybutyrate) (PHB) are both widely used biopolymers produced by bacteria. In the batch fermentation of Sphingomonas sanxanigenens NX02 in a 5L fermenter using glucose as carbon source, ivory colored sphingan Ss production was a growth-associated process with a maximum purified production of 14.88 ± 0.83 g/L, while 6.08 ± 0.23 g/L PHB was simultaneously produced. Sphingan Ss and PHB were separated by a simple dilution, heating and centrifugation or filtration process, and sphingan Ss can be cost-effectively extracted using a small amount of acid rather than multi-fold volumes of alcohols. From ultrathin sections of S. sanxanigenens NX02, we found that the interior space of the cells was filled with PHB granules, and the outside was surrounded by abundant Ss. The purified sphingan Ss can be used as an excellent gelling and emulsifying agent in biotechnology applications such as food, personal care and production processes. Proposed pathways of Ss and PHB biosynthesis from glucose are also presented. PMID:26434528

  17. Characterization of a Citrus R2R3-MYB Transcription Factor that Regulates the Flavonol and Hydroxycinnamic Acid Biosynthesis.

    PubMed

    Liu, Chaoyang; Long, Jianmei; Zhu, Kaijie; Liu, Linlin; Yang, Wei; Zhang, Hongyan; Li, Li; Xu, Qiang; Deng, Xiuxin

    2016-01-01

    Flavonols and hydroxycinnamic acids are important phenylpropanoid metabolites in plants. In this study, we isolated and characterized a citrus R2R3-MYB transcription factor CsMYBF1, encoding a protein belonging to the flavonol-specific MYB subgroup. Ectopic expression of CsMYBF1 in tomato led to an up-regulation of a series of genes involved in primary metabolism and the phenylpropanoid pathway, and induced a strong accumulation of hydroxycinnamic acid compounds but not the flavonols. The RNAi suppression of CsMYBF1 in citrus callus caused a down-regulation of many phenylpropanoid pathway genes and reduced the contents of hydroxycinnamic acids and flavonols. Transactivation assays indicated that CsMYBF1 activated several promoters of phenylpropanoid pathway genes in tomato and citrus. Interestingly, CsMYBF1 could activate the CHS gene promoter in citrus, but not in tomato. Further examinations revealed that the MYBPLANT cis-elements were essential for CsMYBF1 in activating phenylpropanoid pathway genes. In summary, our data indicated that CsMYBF1 possessed the function in controlling the flavonol and hydroxycinnamic acid biosynthesis, and the regulatory differences in the target metabolite accumulation between two species may be due to the differential activation of CHS promoters by CsMYBF1. Therefore, CsMYBF1 constitutes an important gene source for the engineering of specific phenylpropanoid components. PMID:27162196

  18. The soybean R2R3 MYB transcription factor GmMYB100 negatively regulates plant flavonoid biosynthesis.

    PubMed

    Yan, Junhui; Wang, Biao; Zhong, Yunpeng; Yao, Luming; Cheng, Linjing; Wu, Tianlong

    2015-09-01

    Soybean flavonoids, a group of important signaling molecules in plant-environment interaction, ubiquitously exist in soybean and are tightly regulated by many genes. Here we reported that GmMYB100, a gene encoding a R2R3 MYB transcription factor, is involved in soybean flavonoid biosynthesis. GmMYB100 is mainly expressed in flowers, leaves and immature embryo, and its level is decreased after pod ripening. Subcellular localization assay indicates that GmMYB100 is a nuclear protein. GmMYB100 has transactivation ability revealed by a yeast functional assay; whereas bioinformatic analysis suggests that GmMYB100 has a negative function in flavonoid biosynthesis. GmMYB100-overexpression represses the transcript levels of flavonoid-related genes in transgenic soybean hairy roots and Arabidopsis, and inhibits isoflavonoid (soybean) and flavonol (Arabidopsis) production in transgenic plants. Furthermore, the transcript levels of six flavonoid-related genes and flavonoid (isoflavonoid and flavone aglycones) accumulation are elevated in the GmMYB100-RNAi transgenic hairy roots. We also demonstrate that GmMYB100 protein depresses the promoter activities of soybean chalcone synthase and chalcone isomerase. These findings indicate that GmMYB100 is a negative regulator in soybean flavonoid biosynthesis pathway. PMID:26231207

  19. A chimeric repressor of petunia PH4 R2R3-MYB family transcription factor generates margined flowers in torenia.

    PubMed

    Kasajima, Ichiro; Sasaki, Katsutomo

    2016-05-01

    The development of new phenotypes is key to the commercial development of the main floricultural species and cultivars. Important new phenotypes include features such as multiple-flowers, color variations, increased flower size, new petal shapes, variegation and distinctive petal margin colourations. Although their commercial use is not yet common, the transgenic technologies provide a potentially rapid means of generating interesting new phenotypes. In this report, we construct 5 vectors which we expected to change the color of the flower anthocyanins, from purple to blue, regulating vacuolar pH. When these constructs were transformed into purple torenia, we unexpectedly recovered some genotypes having slightly margined petals. These transgenic lines expressed a chimeric repressor of the petunia PhPH4 gene under the control of Cauliflower mosaic virus 35 S RNA promoter. PhPH4 is an R2R3-type MYB transcription factor. The transgenic lines lacked pigmentation in the petal margin cells both on the adaxial and abaxial surfaces. Expressions of Flavanone 3-hydroxylase (F3H), Flavonoid 3'-hydroxylase (F3'H) and Flavonoid 3'5'-hydroxylase (F3'5'H) genes were reduced in the margins of these transgenic lines, suggesting an inhibitory effect of PhPH4 repressor on anthocyanin synthesis. PMID:27089475

  20. The Evolutionary History of R2R3-MYB Proteins Across 50 Eukaryotes: New Insights Into Subfamily Classification and Expansion

    PubMed Central

    Du, Hai; Liang, Zhe; Zhao, Sen; Nan, Ming-Ge; Phan Tran, Lam-Son; Lu, Kun; Huang, Yu-Bi; Li, Jia-Na

    2015-01-01

    R2R3-MYB proteins (2R-MYBs) are one of the main transcription factor families in higher plants. Since the evolutionary history of this gene family across the eukaryotic kingdom remains unknown, we performed a comparative analysis of 2R-MYBs from 50 major eukaryotic lineages, with particular emphasis on land plants. A total of 1548 candidates were identified among diverse taxonomic groups, which allowed for an updated classification of 73 highly conserved subfamilies, including many newly identified subfamilies. Our results revealed that the protein architectures, intron patterns, and sequence characteristics were remarkably conserved in each subfamily. At least four subfamilies were derived from early land plants, 10 evolved from spermatophytes, and 19 from angiosperms, demonstrating the diversity and preferential expansion of this gene family in land plants. Moreover, we determined that their remarkable expansion was mainly attributed to whole genome and segmental duplication, where duplicates were preferentially retained within certain subfamilies that shared three homologous intron patterns (a, b, and c) even though up to 12 types of patterns existed. Through our integrated distributions, sequence characteristics, and phylogenetic tree analyses, we confirm that 2R-MYBs are old and postulate that 3R-MYBs may be evolutionarily derived from 2R-MYBs via intragenic domain duplication. PMID:26047035

  1. Circular Dichroism in Mass Spectrometry: Quantum Chemical Investigations for the Differences between (R)-3-Methylcyclopentanone and Its Cation.

    PubMed

    Kröner, Dominik; Gaebel, Tina

    2015-08-27

    In mass spectrometry enantiomers can be distinguished by multiphoton ionization employing circular polarized laser pulses. The circular dichroism (CD) is detected from the normalized difference in the ion yield after excitation with light of opposite handedness. While there are cases in which fragment and parent ions exhibit the same sign of the CD in the ion yield, several experiments show that they might also differ in sign and magnitude. Supported by experimental observations it has been proposed that the parent ion, once it has been formed, is further excited by the laser, which may result in a change of the CD in the ion yield of the formed fragments compared to the parent ion. To gain a deeper insight in possible excitation pathways we calculated and compared the electronic CD absorption spectra of neutral and cationic (R)-3-methylcyclopentanone, applying density functional theory. In addition, electron wavepacket dynamics were used to compare the CD of one- and two-photon transitions. Our results support the proposed subsequent excitation of the parent ion as a possible origin of the difference of the CD in the ion yield between parent ion and fragments. PMID:26214257

  2. The R2R3-MYB transcription factors MYB14 and MYB15 regulate stilbene biosynthesis in Vitis vinifera.

    PubMed

    Höll, Janine; Vannozzi, Alessandro; Czemmel, Stefan; D'Onofrio, Claudio; Walker, Amanda R; Rausch, Thomas; Lucchin, Margherita; Boss, Paul K; Dry, Ian B; Bogs, Jochen

    2013-10-01

    Plant stilbenes are phytoalexins that accumulate in a small number of plant species, including grapevine (Vitis vinifera), in response to biotic and abiotic stresses and have been implicated in many beneficial effects on human health. In particular, resveratrol, the basic unit of all other complex stilbenes, has received widespread attention because of its cardio-protective, anticarcinogenic, and antioxidant properties. Although stilbene synthases (STSs), the key enzymes responsible for resveratrol biosynthesis, have been isolated and characterized from several plant species, the transcriptional regulation underlying stilbene biosynthesis is unknown. Here, we report the identification and functional characterization of two R2R3-MYB-type transcription factors (TFs) from grapevine, which regulate the stilbene biosynthetic pathway. These TFs, designated MYB14 and MYB15, strongly coexpress with STS genes, both in leaf tissues under biotic and abiotic stress and in the skin and seed of healthy developing berries during maturation. In transient gene reporter assays, MYB14 and MYB15 were demonstrated to specifically activate the promoters of STS genes, and the ectopic expression of MYB15 in grapevine hairy roots resulted in increased STS expression and in the accumulation of glycosylated stilbenes in planta. These results demonstrate the involvement of MYB14 and MYB15 in the transcriptional regulation of stilbene biosynthesis in grapevine. PMID:24151295

  3. Time Profile of Cosmic Radiation Exposure During the EXPOSE-E Mission: The R3DE Instrument

    PubMed Central

    Horneck, Gerda; Häder, Donat-Peter; Schuster, Martin; Richter, Peter; Lebert, Michael; Demets, Rene

    2012-01-01

    Abstract The aim of this paper is to present the time profile of cosmic radiation exposure obtained by the Radiation Risk Radiometer-Dosimeter during the EXPOSE-E mission in the European Technology Exposure Facility on the International Space Station's Columbus module. Another aim is to make the obtained results available to other EXPOSE-E teams for use in their data analysis. Radiation Risk Radiometer-Dosimeter is a low-mass and small-dimension automatic device that measures solar radiation in four channels and cosmic ionizing radiation as well. The main results of the present study include the following: (1) three different radiation sources were detected and quantified—galactic cosmic rays (GCR), energetic protons from the South Atlantic Anomaly (SAA) region of the inner radiation belt, and energetic electrons from the outer radiation belt (ORB); (2) the highest daily averaged absorbed dose rate of 426 μGy d−1 came from SAA protons; (3) GCR delivered a much smaller daily absorbed dose rate of 91.1 μGy d−1, and the ORB source delivered only 8.6 μGy d−1. The analysis of the UV and temperature data is a subject of another article (Schuster et al., 2012). Key Words: Ionizing radiation—R3D—ISS. Astrobiology 12, 403–411. PMID:22680687

  4. Characterization of a Citrus R2R3-MYB Transcription Factor that Regulates the Flavonol and Hydroxycinnamic Acid Biosynthesis

    PubMed Central

    Liu, Chaoyang; Long, Jianmei; Zhu, Kaijie; Liu, Linlin; Yang, Wei; Zhang, Hongyan; Li, Li; Xu, Qiang; Deng, Xiuxin

    2016-01-01

    Flavonols and hydroxycinnamic acids are important phenylpropanoid metabolites in plants. In this study, we isolated and characterized a citrus R2R3-MYB transcription factor CsMYBF1, encoding a protein belonging to the flavonol-specific MYB subgroup. Ectopic expression of CsMYBF1 in tomato led to an up-regulation of a series of genes involved in primary metabolism and the phenylpropanoid pathway, and induced a strong accumulation of hydroxycinnamic acid compounds but not the flavonols. The RNAi suppression of CsMYBF1 in citrus callus caused a down-regulation of many phenylpropanoid pathway genes and reduced the contents of hydroxycinnamic acids and flavonols. Transactivation assays indicated that CsMYBF1 activated several promoters of phenylpropanoid pathway genes in tomato and citrus. Interestingly, CsMYBF1 could activate the CHS gene promoter in citrus, but not in tomato. Further examinations revealed that the MYBPLANT cis-elements were essential for CsMYBF1 in activating phenylpropanoid pathway genes. In summary, our data indicated that CsMYBF1 possessed the function in controlling the flavonol and hydroxycinnamic acid biosynthesis, and the regulatory differences in the target metabolite accumulation between two species may be due to the differential activation of CHS promoters by CsMYBF1. Therefore, CsMYBF1 constitutes an important gene source for the engineering of specific phenylpropanoid components. PMID:27162196

  5. Endocrine and metabolic changes in neonatal calves in response to growth hormone and long-R3-insulin-like growth factor-I administration.

    PubMed

    Hammon, H; Blum, J W

    1998-01-01

    Postnatal growth is primarily controlled by growth hormone (GH) and insulin-like growth factor-I (IGF-I). We have studied effects of recombinant bovine GH (rbGH) and Long-R3-insulin-like growth factor-I (Long-R3-IGF-I) on metabolic and endocrine characteristics of neonatal calves. Group GrC (control) was fed colostrum as first meal and then milk replacer up to day 7. Groups GrIGFf, GrIGFi and GrGH were fed as GrC. In group GrIGFf, Long-R3-IGF-I (50 micrograms/[kg x day], twice daily for 7 days) was fed together with colostrum or milk replacer and in group GrIGFi, Long-R3-IGF-I (50 micrograms/[kg x day], twice daily for 7 days) was injected subcutaneously at times of feeding. Calves of group GrGH were injected rbGH (1 mg/[kg x day, s.c.], twice daily for 7 days) at times of feeding. While orally administered Long-R3-IGF-I had no effects, subcutaneously administered Long-R3-IGF-I lowered plasma glucose and insulin concentrations (p < 0.05). In group GrGH, day-2 postprandial plasma insulin concentrations were increased more than in Long-R3-IGF-I-treated groups (p < 0.05) and day-2 postprandial prolactin responses were greater in group GrGH than in controls (p < 0.05). Other traits (lactic acid, nonesterified fatty acids, glucagon, cortisol, thyroxine and 3.5.3'-triiodothyronine) exhibited age-dependent changes, but were not significantly affected by rbGH or Long-R3-IGF-I. The study shows, that parenteral, but not oral, Long-R3-IGF-I affects plasma glucose and insulin concentrations, and that rbGH transiently influences plasma prolactin concentrations in neonatal calves. PMID:9483305

  6. Monitoring and kinetic analysis of the molecular interactions by which a repressor protein, PhaR, binds to target DNAs and poly[(R)-3-hydroxybutyrate

    PubMed Central

    2013-01-01

    The repressor protein PhaR, which is a component of poly[(R)-3-hydroxybutyrate] granules, functions as a repressor of the gene expression of the phasin PhaP and of PhaR itself. We used a quartz crystal microbalance to investigate the binding behavior by which PhaR in Ralstonia eutropha H16 targets DNAs and amorphous poly[(R)-3-hydroxybutyrate] thin films. Binding rate constants, dissociation rate constants, and dissociation constants of the binding of PhaR to DNA and to amorphous poly[(R)-3-hydroxybutyrate] suggested that PhaR bind to both in a similar manner. On the basis of the binding rate constant values, we proposed that the phaP gene would be derepressed in harmony with the ratio of the concentration of the target DNA to the concentration of amorphous poly[(R)-3-hydroxybutyrate] at the start of poly[(R)-3-hydroxybutyrate] synthesis in R. eutropha H16. PMID:23351303

  7. Three R2R3-MYB Transcription Factors Regulate Distinct Floral Pigmentation Patterning in Phalaenopsis spp.1[OPEN

    PubMed Central

    Hsu, Chia-Chi; Chen, You-Yi; Tsai, Wen-Chieh; Chen, Wen-Huei; Chen, Hong-Hwa

    2015-01-01

    Orchidaceae are well known for their fascinating floral morphologic features, specialized pollination, and distinctive ecological strategies. With their long-lasting flowers of various colors and pigmentation patterning, Phalaenopsis spp. have become important ornamental plants worldwide. In this study, we identified three R2R3-MYB transcription factors PeMYB2, PeMYB11, and PeMYB12. Their expression profiles were concomitant with red color formation in Phalaenopsis spp. flowers. Transient assay of overexpression of three PeMYBs verified that PeMYB2 resulted in anthocyanin accumulation, and these PeMYBs could activate the expression of three downstream structural genes Phalaenopsis spp. Flavanone 3-hydroxylase5, Phalaenopsis spp. Dihydroflavonol 4-reductase1, and Phalaenopsis spp. Anthocyanidin synthase3. In addition, these three PeMYBs participated in the distinct pigmentation patterning in a single flower, which was revealed by virus-induced gene silencing. In the sepals/petals, silencing of PeMYB2, PeMYB11, and PeMYB12 resulted in the loss of the full-red pigmentation, red spots, and venation patterns, respectively. Moreover, different pigmentation patterning was regulated by PeMYBs in the sepals/petals and lip. PeMYB11 was responsive to the red spots in the callus of the lip, and PeMYB12 participated in the full pigmentation in the central lobe of the lip. The differential pigmentation patterning was validated by RNA in situ hybridization. Additional assessment was performed in six Phalaenopsis spp. cultivars with different color patterns. The combined expression of these three PeMYBs in different ratios leads to a wealth of complicated floral pigmentation patterning in Phalaenopsis spp. PMID:25739699

  8. Triangular libration points in the R3BP under combined effects of oblateness, radiation and power-law profile

    NASA Astrophysics Data System (ADS)

    Falaye, B. J.; Dong, Shi-Hai; Oyewumi, K. J.; Falaiye, O. A.; Joshua, E. S.; Omojola, J.; Abimbola, O. J.; Kalu, O.; Ikhdair, S. M.

    2016-01-01

    We study the effects of oblateness up to J4 of the primaries and power-law density profile (PDP) on the linear stability of libration location of an infinitesimal mass within the framework of restricted three body problem (R3BP), by using a more realistic model in which a disc with PDP is rotating around the common center of the system mass with perturbed mean motion. The existence and stability of triangular equilibrium points have been explored. It has been shown that triangular equilibrium points are stable for 0 < μ <μc and unstable for μc ⩽ μ≤ 1 / 2 , where μc denotes the critical mass parameter. We find that, the oblateness up to J2 of the primaries and the radiation reduces the stability range while the oblateness up to J4 of the primaries increases the size of stability both in the context where PDP is considered and ignored. The PDP has an effect of about ≈ 0.01 reduction on the application of μc to Earth-Moon and Jupiter-Moons systems. We find that the comprehensive effects of the perturbations have a stabilizing proclivity. However, the oblateness up to J2 of the primaries and the radiation of the primaries have tendency for instability, while coefficients up to J4 of the primaries have stability predisposition. In the limiting case c = 0 , and also by setting appropriate parameter(s) to zero, our results are in excellent agreement with the ones obtained previously. Libration points play a very important role in space mission and as a consequence, our results have a practical application in space dynamics and related areas. The model may be applied to study the navigation and stationkeeping operations of spacecraft (infinitesimal mass) around the Jupiter (more massive) -Callisto (less massive) system, where PDP accounts for the circumsolar ring of asteroidal dust, which has a cloud of dust permanently in its wake.

  9. Survey on granularity clustering.

    PubMed

    Ding, Shifei; Du, Mingjing; Zhu, Hong

    2015-12-01

    With the rapid development of uncertain artificial intelligent and the arrival of big data era, conventional clustering analysis and granular computing fail to satisfy the requirements of intelligent information processing in this new case. There is the essential relationship between granular computing and clustering analysis, so some researchers try to combine granular computing with clustering analysis. In the idea of granularity, the researchers expand the researches in clustering analysis and look for the best clustering results with the help of the basic theories and methods of granular computing. Granularity clustering method which is proposed and studied has attracted more and more attention. This paper firstly summarizes the background of granularity clustering and the intrinsic connection between granular computing and clustering analysis, and then mainly reviews the research status and various methods of granularity clustering. Finally, we analyze existing problem and propose further research. PMID:26557926

  10. A convenient method for europium-labeling of a recombinant chimeric relaxin family peptide R3/I5 for receptor-binding assays.

    PubMed

    Zhang, Wei-Jie; Jiang, Qian; Wang, Xin-Yi; Song, Ge; Shao, Xiao-Xia; Guo, Zhan-Yun

    2013-06-01

    Relaxin family peptides have important biological functions, and so far, four G-protein-coupled receptors have been identified as their receptors (RXFP1-4). A chimeric relaxin family peptide R3/I5, containing the B-chain of relaxin-3 and the A-chain of INSL5, is a selective agonist for both RXFP3 and RXFP4. In a previous study, europium-labeled R3/I5, as a nonradioactive and low-background receptor-binding tracer, was prepared through a chemical synthesis approach. In the present study, we established a convenient alternative approach for preparing the europium-labeled R3/I5 tracer based on a recombinant R3/I5 designed to carry a solubilizing tag at the A-chain N-terminus and a pyroglutamate residue at the B-chain N-terminus. Because of the presence of a single primary amine moiety, the recombinant R3/I5 peptide was site-specifically mono-labeled at the A-chain N-terminus by a diethylenetriaminepentaacetic acid/europium moiety through a convenient one-step procedure. The diethylenetriaminepentaacetic acid/Eu3+-labeled R3/I5 bound both receptors RXFP3 and RXFP4 with high binding affinities and low nonspecific binding. Thus, we have presented a valuable nonradioactive tracer for future interaction studies on RXFP3 and RXFP4 with various natural or designed ligands. The present approach could also be adapted for preparing and labeling of other chimeric relaxin family peptides. PMID:23526726

  11. The somatotropic axis in neonatal calves can be modulated by nutrition, growth hormone, and Long-R3-IGF-I.

    PubMed

    Hammon, H; Blum, J W

    1997-07-01

    Effects on the somatotropic axis [plasma levels of insulin-like growth factors (IGFs) I and II, IGF-binding proteins (IGFBPs), and growth hormone (GH)] of feeding different amounts of colostrum or milk replacer, of Long-R3-IGF-I (administered subcutaneously or orally; 50 micrograms.kg body wt-1.day-1 for 7 days), and of subcutaneously injected recombinant bovine GH (rbGH; 1 mg.kg body wt-1.day-1 for 7 days) were evaluated in calves during the 1st wk of life. Plasma Long-R3-IGF-I increased after subcutaneous application but not with the oral dose. Endogenous IGF-I was higher in calves fed colostrum six times compared with those fed only milk replacer. Native IGF-I was highest in rbGH-injected calves but was lowered by the subcutaneous injection of Long-R3-IGF-I. IGF-II concentrations were not modified by any of the treatments. IGFBP-2 increased in calves fed only milk replacer and those receiving subcutaneous Long-R3-IGF-I. GH was not modulated by differences in nutrition but increased after rbGH administration and similarly in all groups after intravenous injection of GH-releasing factor analog GRF-(1-29). Parenteral administration of Long-R3-IGF-I decreased GH concentration but did not affect the secretory pattern. The data demonstrate that the somatotrophic axis is basically functioning in neonatal calves and is influenced by nutrition, GH, and Long-R3-IGF-I. PMID:9252489

  12. Opposite action of R2R3-MYBs from different subgroups on key genes of the shikimate and monolignol pathways in spruce.

    PubMed

    Bomal, Claude; Duval, Isabelle; Giguère, Isabelle; Fortin, Élise; Caron, Sébastien; Stewart, Don; Boyle, Brian; Séguin, Armand; MacKay, John J

    2014-02-01

    Redundancy and competition between R2R3-MYB activators and repressors on common target genes has been proposed as a fine-tuning mechanism for the regulation of plant secondary metabolism. This hypothesis was tested in white spruce [Picea glauca (Moench) Voss] by investigating the effects of R2R3-MYBs from different subgroups on common targets from distinct metabolic pathways. Comparative analysis of transcript profiling data in spruces overexpressing R2R3-MYBs from loblolly pine (Pinus taeda L.), PtMYB1, PtMYB8, and PtMYB14, defined a set of common genes that display opposite regulation effects. The relationship between the closest MYB homologues and 33 putative target genes was explored by quantitative PCR expression profiling in wild-type P. glauca plants during the diurnal cycle. Significant Spearman's correlation estimates were consistent with the proposed opposite effect of different R2R3-MYBs on several putative target genes in a time-related and tissue-preferential manner. Expression of sequences coding for 4CL, DHS2, COMT1, SHM4, and a lipase thio/esterase positively correlated with that of PgMYB1 and PgMYB8, but negatively with that of PgMYB14 and PgMYB15. Complementary electrophoretic mobility shift assay (EMSA) and transactivation assay provided experimental evidence that these different R2R3-MYBs are able to bind similar AC cis-elements in the promoter region of Pg4CL and PgDHS2 genes but have opposite effects on their expression. Competitive binding EMSA experiments showed that PgMYB8 competes more strongly than PgMYB15 for the AC-I MYB binding site in the Pg4CL promoter. Together, the results bring a new perspective to the action of R2R3-MYB proteins in the regulation of distinct but interconnecting metabolism pathways. PMID:24336492

  13. Relativistic electron fluxes and dose rate variations during April-May 2010 geomagnetic disturbances in the R3DR data on ISS

    NASA Astrophysics Data System (ADS)

    Dachev, Ts. P.; Tomov, B. T.; Matviichuk, Yu. N.; Dimitrov, Pl. G.; Bankov, N. G.; Reitz, G.; Horneck, G.; Häder, D.-P.; Lebert, M.; Schuster, M.

    2012-07-01

    Space radiation has been monitored successfully using the Radiation Risks Radiometer-Dosimeter (R3D) installed at the ESA EXPOSE-R (R3DR) facility outside of the Russian Zvezda module of the International Space Station (ISS) between March 2009 and January 2011. R3DR is a Liulin type spectrometer-dosimeter with a single Si PIN detector 2 cm2 of area and 0.3 mm thick. The R3DR instrument accumulated about 2 million measurements of the absorbed dose rate and flux of 10 s resolution. The total external and internal shielding before the detector of R3DR device is 0.41 g cm-2. The calculated stopping energy of normally incident particles to the detector is 0.78 MeV for electrons and 15.8 MeV for protons. After the Coronal Mass Ejection (CME) at 09:54 UTC on 3 April 2010, a shock was observed at the ACE spacecraft at 0756 UTC on 5 April, which led to a sudden impulse on Earth at 08:26 UTC. Nevertheless, while the magnetic substorms on 5 and 6 of April were moderate; the second largest in history of GOES fluence of electrons with energy >2 MeV was measured. The R3DR data show a relatively small amount of relativistic electrons on 5 April. The maximum dose rate of 2323 μGy day-1 was reached on 7 April; by 9 April, a dose of 6600 μGy was accumulated. By the end of the period on 7 May 2010 a total dose of 11,587 μGy was absorbed. Our data were compared with AE-8 MIN, CRESS and ESA-SEE1 models using SPENVIS and with similar observations on American, Japanese and Russian satellites.

  14. Cluster Morphology Analysis

    PubMed Central

    Jacquez, Geoffrey M.

    2009-01-01

    Most disease clustering methods assume specific shapes and do not evaluate statistical power using the applicable geography, at-risk population, and covariates. Cluster Morphology Analysis (CMA) conducts power analyses of alternative techniques assuming clusters of different relative risks and shapes. Results are ranked by statistical power and false positives, under the rationale that surveillance should (1) find true clusters while (2) avoiding false clusters. CMA then synthesizes results of the most powerful methods. CMA was evaluated in simulation studies and applied to pancreatic cancer mortality in Michigan, and finds clusters of flexible shape while routinely evaluating statistical power. PMID:20234799

  15. Comparative genomic analysis of the R2R3 MYB secondary cell wall regulators of Arabidopsis, poplar, rice, maize, and switchgrass

    PubMed Central

    2014-01-01

    Background R2R3 MYB proteins constitute one of the largest plant transcription factor clades and regulate diverse plant-specific processes. Several R2R3 MYB proteins act as regulators of secondary cell wall (SCW) biosynthesis in Arabidopsis thaliana (At), a dicotyledenous plant. Relatively few studies have examined SCW R2R3 MYB function in grasses, which may have diverged from dicots in terms of SCW regulatory mechanisms, as they have in cell wall composition and patterning. Understanding cell wall regulation is especially important for improving lignocellulosic bioenergy crops, such as switchgrass. Results Here, we describe the results of applying phylogenic, OrthoMCL, and sequence identity analyses to classify the R2R3 MYB family proteins from the annotated proteomes of Arabidposis, poplar, rice, maize and the initial genome (v0.0) and translated transcriptome of switchgrass (Panicum virgatum). We find that the R2R3 MYB proteins of the five species fall into 48 subgroups, including three dicot-specific, six grass-specific, and two panicoid grass-expanded subgroups. We observe four classes of phylogenetic relationships within the subgroups of known SCW-regulating MYB proteins between Arabidopsis and rice, ranging from likely one-to-one orthology (for AtMYB26, AtMYB103, AtMYB69) to no homologs identifiable (for AtMYB75). Microarray data for putative switchgrass SCW MYBs indicate that many maintain similar expression patterns with the Arabidopsis SCW regulators. However, some of the switchgrass-expanded candidate SCW MYBs exhibit differences in gene expression patterns among paralogs, consistent with subfunctionalization. Furthermore, some switchgrass representatives of grass-expanded clades have gene expression patterns consistent with regulating SCW development. Conclusions Our analysis suggests that no single comparative genomics tool is able to provide a complete picture of the R2R3 MYB protein family without leaving ambiguities, and establishing likely false

  16. Universal Cluster Deposition System

    NASA Astrophysics Data System (ADS)

    Qiang, You; Sun, Zhiguang; Sellmyer, David J.

    2001-03-01

    We have developed a universal cluster deposition system (UCDS), which combines a new kind of sputtering-gas-aggregation (SGA) cluster beam source with two atom beams from magnetron sputtering. A highly intense, very stable beam of nanoclusters (like Co, Fe, Ni, Si, CoSm or CoPt) are produced. A quadrupole and/or a new high transmission infinite range mass selector have been designed for the cluster beam. The size distribution (Δd/d) is between 0.05+/-0.10, measured in situ by TOF. A range of mean cluster size is 2 to 10 nm. Usually the deposition rate is about 5 deg/s. The cluster concentration in the film is adjusted through the ratio of cluster and atomic beam deposition rates, as measured in situ with a rotatable quartz microbalance. The UCDS can be used to prepare coated clusters. After exiting from the cluster source, the clusters can be coated first with an atomic or molecular species in an evaporation chamber, and deposited alone or co-deposited with another material. This system is used to deposit simultaneously or alternately mesoscopic thin films or multilayers, and offers the possibility to control independently the incident cluster size and concentration, and thereby the interaction between clusters and cluster-matrix material which is of interest for fundamental research and industry applications. Magnetic properties of Co cluster-assembled materials will be discussed. * Research supported by NSF, DARPA through ARO, and CMRA

  17. Effect of DcR3-specific siRNA on cell growth suppression and apoptosis induction in glioma cells via affecting ERK and AKT

    PubMed Central

    Zhang, Yu; Huang, Suning; Leng, Yuhua; Chen, Xin; Liu, Tiantian; Wang, Hanlin; Wei, Fanglin; Luo, Dianzhong; Chen, Gang; Wei, Zhuxin

    2016-01-01

    Background Previously, we found that the expression of decoy receptor 3 (DcR3) in gliomas was significantly upregulated compared to normal brain tissues. However, the effect of DcR3-specific small interfering RNA (siRNA) on cell biological function of glioma cells remains incompletely understood. Objective The aim of this study was to explore the effect of DcR3 siRNA on cell growth and apoptosis of glioma cells and to investigate the potential downstream pathways affected by DcR3. Methods DcR3-specific siRNA was transfected into three glioma cell lines (U251MG, LN-308, and U87MG) using combiMAGnetofection method. MTS tetrazolium assay and fluorimetric resorufin viability assay were used to assess the growth of glioma cells. Then, apoptosis was examined using the Hoechst 33342/propidium iodide double-staining assay and fluorescent caspase-3/7 assay. Meanwhile, Western blot was performed to explore the probable pathway by which DcR3-specific siRNA acts in glioma cells. Also, microarray dataset analysis was applied to analyze the potential function of DcR3 in glioma. Results The DcR3-specific siRNA had a potent effect on cell growth and apoptosis of all three glioma cells tested, and the effects were time dependent. Among these three glioma cell lines, U251MG had the most significant effect with regard to growth inhibition and apoptosis induction. MTS assay showed that the proliferation rate at 72 and 96 hours after the transfection was 76.333%±5.131% (t=7.611, P=0.002) and 64.333%±5.859% (t=10.983, P<0.001), respectively. The viability rate of U251MG cells was 80.667%±2.309% (t=12.302, P<0.001) and 62.333%±2.082% (t=21.213, P<0.001) at 72 and 96 hours posttreatment, respectively. The caspase-3/7 activity of U251MG cells was 2.76 (t=−6.601, P=0.003) and 4.75 (t=−9.189, P=0.001) folds that of the mock control at 72 and 96 hours, respectively. The apoptosis rate was increased to 1.85 (t=−2.496, P=0.067) and 3.93 (t=−12.587, P<0.001) folds at 72 and 96 hours

  18. EINSTEIN Cluster Alignments Revisited

    NASA Astrophysics Data System (ADS)

    Chambers, S. W.; Melott, A. L.; Miller, C. J.

    2000-12-01

    We have examined whether the major axes of rich galaxy clusters tend to point (in projection) toward their nearest neighboring cluster. We used the data of Ulmer, McMillan and Kowalski, who used x-ray morphology to define position angles. Our cluster samples, with well measured redshifts and updated positions, were taken from the MX Northern Abell Cluster Survey. The usual Kolmogorov-Smirnov test shows no significant alignment signal for nonrandom angles for all separations less than 100 Mpc/h. Refining the null hypothesis, however, with the Wilcoxon rank-sum test, reveals a high confidence signal for alignment. This confidence is highest when we restrict our sample to small nearest neighbor separations. We conclude that we have identified a more powerful tool for testing cluster-cluster alignments. Moreover, there is a strong signal in the data for alignment, consistent with a picture of hierarchical cluster formation in which matter falls into clusters along large scale filamentary structures.

  19. Matlab Cluster Ensemble Toolbox

    SciTech Connect

    Sapio, Vincent De; Kegelmeyer, Philip

    2009-04-27

    This is a Matlab toolbox for investigating the application of cluster ensembles to data classification, with the objective of improving the accuracy and/or speed of clustering. The toolbox divides the cluster ensemble problem into four areas, providing functionality for each. These include, (1) synthetic data generation, (2) clustering to generate individual data partitions and similarity matrices, (3) consensus function generation and final clustering to generate ensemble data partitioning, and (4) implementation of accuracy metrics. With regard to data generation, Gaussian data of arbitrary dimension can be generated. The kcenters algorithm can then be used to generate individual data partitions by either, (a) subsampling the data and clustering each subsample, or by (b) randomly initializing the algorithm and generating a clustering for each initialization. In either case an overall similarity matrix can be computed using a consensus function operating on the individual similarity matrices. A final clustering can be performed and performance metrics are provided for evaluation purposes.

  20. [Pathophysiology of cluster headache].

    PubMed

    Donnet, Anne

    2015-11-01

    The aetiology of cluster headache is partially unknown. Three areas are involved in the pathogenesis of cluster headache: the trigeminal nociceptive pathways, the autonomic system and the hypothalamus. The cluster headache attack involves activation of the trigeminal autonomic reflex. A dysfunction located in posterior hypothalamic gray matter is probably pivotal in the process. There is a probable association between smoke exposure, a possible genetic predisposition and the development of cluster headache. PMID:26470883

  1. CLUSTERING OF RARE EVENTS

    EPA Science Inventory

    The clustering of cases of a rare disease is considered. The number of events observed for each unit is assumed to have a Poisson distribution, the mean of which depends upon the population size and the cluster membership of that unit. Here a cluster consists of those units that ...

  2. Crystal structure of methyl (2R,3S)-3-[(tert-butyl­sulfin­yl)amino]-2-fluoro-3-phenyl­propano­ate

    PubMed Central

    Zhao, Zhiwei; Fan, Wenqiang; Zhang, Yixiang; Li, Ya

    2015-01-01

    The title compound, C14H20FNO3S, contains two chiral carbon centres and the absolute configuration has been confirmed as (2R,3S). In the crystal, adjacent mol­ecules are linked by weak C—H⋯O hydrogen bonds, generating zigzag chains along the a-axis direction. PMID:26870495

  3. Protection against glucose-induced neuronal death by NAAG and GCP II inhibition is regulated by mGluR3.

    PubMed

    Berent-Spillson, Alison; Robinson, Amanda M; Golovoy, David; Slusher, Barbara; Rojas, Camilo; Russell, James W

    2004-04-01

    Glutamate carboxypeptidase II (GCP II) inhibition has previously been shown to be protective against long-term neuropathy in diabetic animals. In the current study, we have determined that the GCP II inhibitor 2-(phosphonomethyl) pentanedioic acid (2-PMPA) is protective against glucose-induced programmed cell death (PCD) and neurite degeneration in dorsal root ganglion (DRG) neurons in a cell culture model of diabetic neuropathy. In this model, inhibition of caspase activation is mediated through the group II metabotropic glutamate receptor, mGluR3. 2-PMPA neuroprotection is completely reversed by the mGluR3 antagonist (S)-alpha-ethylglutamic acid (EGLU). In contrast, group I and III mGluR inhibitors have no effect on 2-PMPA neuroprotection. Furthermore, we show that two mGluR3 agonists, the direct agonist (2R,4R)-4-aminopyrrolidine-2, 4-dicarboxylate (APDC) and N-acetyl-aspartyl-glutamate (NAAG) provide protection to neurons exposed to high glucose conditions, consistent with the concept that 2-PMPA neuroprotection is mediated by increased NAAG activity. Inhibition of GCP II or mGluR3 may represent a novel mechanism to treat neuronal degeneration under high-glucose conditions. PMID:15030392

  4. Evaluation of Polymorphisms in the Sulfonamide Detoxification Genes CYB5A and CYB5R3 in Dogs with Sulfonamide Hypersensitivity

    PubMed Central

    Funk-Keenan, J.; Sacco, J.; (Amos) Wong, Y. Y.; Rasmussen, S.; Motsinger-Reif, A.; Trepanier, L. A.

    2015-01-01

    Background Delayed hypersensitivity (HS) reactions to potentiated sulfonamide antimicrobials occur in both dogs and humans, and involve an intermediate hydroxylamine metabolite that is detoxified by cytochrome b5 and NADH cytochrome b5 reductase. Hypothesis/Objectives We hypothesized that polymorphisms in the genes (CYB5A and CYB5R3) encoding these 2 enzymes would be associated with risk of sulfonamide HS in dogs. Animals A total of 18 dogs with delayed HS to potentiated sulfonamide antimicrobials and 16 dogs that tolerated (TOL) a therapeutic course of these drugs without adverse effect. Methods CYB5A and CYB5R3 were sequenced from canine liver, and the promoter, exons, and 3′ untranslated regions of both genes were resequenced from genomic DNA obtained from all dogs. Results Multiple polymorphisms were found in both genes. When controlled for multiple comparisons, the 729GG variant in CYB5R3 was significantly overrepresented in dogs with sulfonamide HS (78% of dogs), compared to TOL dogs (31%; P = .003). Conclusions and Clinical Importance The CYB5R3 729GG variant may contribute to the risk of sulfonamide HS in dogs. Functional characterization of this polymorphism, as well as genotyping in a larger number of HS and TOL dogs, is warranted. PMID:22816446

  5. Positive selection and functional divergence of R2R3-MYB paralogous genes expressed in inflorescence buds of Scutellaria species (Labiatae).

    PubMed

    Huang, Bing-Hong; Pang, Erli; Chen, Yi-Wen; Cao, Huifen; Ruan, Yu; Liao, Pei-Chun

    2015-01-01

    Anthocyanin is the main pigment forming floral diversity. Several transcription factors that regulate the expression of anthocyanin biosynthetic genes belong to the R2R3-MYB family. Here we examined the transcriptomes of inflorescence buds of Scutellaria species (skullcaps), identified the expression R2R3-MYBs, and detected the genetic signatures of positive selection for adaptive divergence across the rapidly evolving skullcaps. In the inflorescence buds, seven R2R3-MYBs were identified. MYB11 and MYB16 were detected to be positively selected. The signature of positive selection on MYB genes indicated that species diversification could be affected by transcriptional regulation, rather than at the translational level. When comparing among the background lineages of Arabidopsis, tomato, rice, and Amborella, heterogeneous evolutionary rates were detected among MYB paralogs, especially between MYB13 and MYB19. Significantly different evolutionary rates were also evidenced by type-I functional divergence between MYB13 and MYB19, and the accelerated evolutionary rates in MYB19, implied the acquisition of novel functions. Another paralogous pair, MYB2/7 and MYB11, revealed significant radical amino acid changes, indicating divergence in the regulation of different anthocyanin-biosynthetic enzymes. Our findings not only showed that Scutellaria R2R3-MYBs are functionally divergent and positively selected, but also indicated the adaptive relevance of regulatory genes in floral diversification. PMID:25782156

  6. Poly(3-hydroxybutyrate-co-R-3-hydroxyhexanoate) nanoparticles with polyethylenimine coat as simple, safe, and versatile vehicles for cell targeting: population characteristics, cell uptake, and intracellular trafficking.

    PubMed

    Wu, Lin-Ping; Wang, Danyang; Parhamifar, Ladan; Hall, Arnaldur; Chen, Guo-Qiang; Moghimi, Seyed M

    2014-06-01

    A simple and highly safe poly(3-hydroxybutyrate-co-R-3-hydroxyhexanoate) nanoparticulate delivery system that targets different cell types is developed. A sub-cytotoxic level of polyethylenimine coat mediates universal cell targeting. Internalized nanoparticles traffic along endolysosomal compartments, endoplasmic reticulum and the Golgi complex. Nanoparticles have no detrimental effects on cell morphology and respiration. PMID:24408356

  7. Positive Selection and Functional Divergence of R2R3-MYB Paralogous Genes Expressed in Inflorescence Buds of Scutellaria Species (Labiatae)

    PubMed Central

    Huang, Bing-Hong; Pang, Erli; Chen, Yi-Wen; Cao, Huifen; Ruan, Yu; Liao, Pei-Chun

    2015-01-01

    Anthocyanin is the main pigment forming floral diversity. Several transcription factors that regulate the expression of anthocyanin biosynthetic genes belong to the R2R3-MYB family. Here we examined the transcriptomes of inflorescence buds of Scutellaria species (skullcaps), identified the expression R2R3-MYBs, and detected the genetic signatures of positive selection for adaptive divergence across the rapidly evolving skullcaps. In the inflorescence buds, seven R2R3-MYBs were identified. MYB11 and MYB16 were detected to be positively selected. The signature of positive selection on MYB genes indicated that species diversification could be affected by transcriptional regulation, rather than at the translational level. When comparing among the background lineages of Arabidopsis, tomato, rice, and Amborella, heterogeneous evolutionary rates were detected among MYB paralogs, especially between MYB13 and MYB19. Significantly different evolutionary rates were also evidenced by type-I functional divergence between MYB13 and MYB19, and the accelerated evolutionary rates in MYB19, implied the acquisition of novel functions. Another paralogous pair, MYB2/7 and MYB11, revealed significant radical amino acid changes, indicating divergence in the regulation of different anthocyanin-biosynthetic enzymes. Our findings not only showed that Scutellaria R2R3-MYBs are functionally divergent and positively selected, but also indicated the adaptive relevance of regulatory genes in floral diversification. PMID:25782156

  8. PRMT5-mediated methylation of histone H4R3 recruits DNMT3A, coupling histone and DNA methylation in gene silencing.

    PubMed

    Zhao, Quan; Rank, Gerhard; Tan, Yuen T; Li, Haitao; Moritz, Robert L; Simpson, Richard J; Cerruti, Loretta; Curtis, David J; Patel, Dinshaw J; Allis, C David; Cunningham, John M; Jane, Stephen M

    2009-03-01

    Mammalian gene silencing is established through methylation of histones and DNA, although the order in which these modifications occur remains contentious. Using the human beta-globin locus as a model, we demonstrate that symmetric methylation of histone H4 arginine 3 (H4R3me2s) by the protein arginine methyltransferase PRMT5 is required for subsequent DNA methylation. H4R3me2s serves as a direct binding target for the DNA methyltransferase DNMT3A, which interacts through the ADD domain containing the PHD motif. Loss of the H4R3me2s mark through short hairpin RNA-mediated knockdown of PRMT5 leads to reduced DNMT3A binding, loss of DNA methylation and gene activation. In primary erythroid progenitors from adult bone marrow, H4R3me2s marks the inactive methylated globin genes coincident with localization of PRMT5. Our findings define DNMT3A as both a reader and a writer of repressive epigenetic marks, thereby directly linking histone and DNA methylation in gene silencing. PMID:19234465

  9. Project R-3; A Motivational Program Emphasizing Student Readiness, Subject Relevance, and Learning Reinforcement Through Individualized Instruction, Intensive Involvement, and Gaming/Simulation.

    ERIC Educational Resources Information Center

    San Jose Unified School District, CA.

    A course intended to upgrade essential reading and mathematics skills in students who show poor performance or negative attitudes towards school has been developed at A. Lincoln High School in San Jose, California. Called Project R-3, it seeks to motivate students by emphasizing student readiness, subject relevance, and learning reinforcement…

  10. Cotton (Gossypium spp.) R2R3-MYB transcription factors SNP identification, phylo-genomic characterization, chromosome localization and linkage mapping

    Technology Transfer Automated Retrieval System (TEKTRAN)

    R2R3-MYB transcription factors of plants are involved in the regulation of trichome length and density. Several of them are differentially expressed with initiation and expansion of cotton fibers. We report sequence phylo-genomic characterization of the six MYB genes, their chromosomal localizatio...

  11. Existence and asymptotic behavior of sign-changing solutions for the nonlinear Schrödinger-Poisson system in {R^3}

    NASA Astrophysics Data System (ADS)

    Shuai, Wei; Wang, Qingfang

    2015-12-01

    We are interested in the existence and asymptotic behavior of sign-changing solutions to the following nonlinear Schrödinger-Poisson system -Δ u+V(x)u+λ φ(x)u =f(u), \\quad x in {R}^3, -Δ φ=u^2, \\quad x in {R}^3, where V( x) is a smooth function and λ is a positive parameter. Because the so-called nonlocal term {λ φ_u(x)u} is involving in the equation, the variational functional of the equation has totally different properties from the case of {λ=0}. Under suitable conditions, combining constraint variational method and quantitative deformation lemma, we prove that the problem possesses one sign-changing solution {u_λ}. Moreover, we show that any sign-changing solution of the problem has an energy exceeding twice the least energy, and for any sequence {{λ_n} → 0^+(n → ∞)}, there is a subsequence {λ_{n_k}}, such that {u_{λ_{n_k}}} converges in {H^1({R}^3)} to {u_0} as {k→ ∞}, where {u_0} is a sign-changing solution of the following equation -Δ u+V(x)u=f(u),quad x in R^3.

  12. Requirement of IP3 receptor 3 (IP3R3) in nitric oxide induced cardiomyocyte differentiation of mouse embryonic stem cells.

    PubMed

    Wei, Wenjie; Huang, Wei; Yue, Jianbo

    2016-08-01

    Nitric oxide (NO) markedly induces cardiomyocyte (CM) differentiation of embryonic stem (ES) cells. Here we examined the role of the Ca(2+) signaling in the NO-induced CM differentiation of mouse ES cells. We found that NO induced intracellular Ca(2+) increases in ES cells in a dose-dependent manner, and application of IP3 pathway antagonists not only significantly inhibited this induced Ca(2+) increase but also abolished NO-induced CM differentiation of ES cells. Subsequently, all 3 types of inositol 1, 4, 5-trisphosphate (IP3) receptors (IP3Rs) in mouse ES cells were individually or triply knocked down. Interestingly, only knockdown of type 3 IP3R (IP3R3) or triple-knockdown of three types of IP3Rs significantly inhibited the NO-induced Ca(2+) increases. Consistently, IP3R3 knockdown blocked the NO-induced CM differentiation of ES cells. CMs derived from IP3R3 knockdown ES cells also showed both structural and functional defects. In summary, our results indicate that the IP3R3-Ca(2+) pathway is required for NO-induced CM differentiation of ES cells. PMID:27349290

  13. Polymorphisms in the carcinogen detoxification genes CYB5A and CYB5R3 and breast cancer risk in African American women

    PubMed Central

    Blanke, Kristina L.; Sacco, James C.; Millikan, Robert C.; Olshan, Andrew F.; Luo, Jingchun; Trepanier, Lauren A.

    2014-01-01

    Purpose Cytochrome b5 (encoded by CYB5A) and NADH cytochrome b5 reductase (encoded by CYB5R3) detoxify aromatic and heterocyclic amine mammary carcinogens found in cigarette smoke. We hypothesized that CYB5A and CYB5R3 polymorphisms would be associated with breast cancer risk in women. Methods We characterized the prevalence of 18 CYB5A and CYB5R3 variants in genomic DNA from African American (AfrAm) and Caucasian (Cauc) women from the Carolina Breast Cancer Study population (1946 cases and 1747 controls), and determined their associations with breast cancer risk, with effect modification by smoking. Results A CYB5R3 variant, I1M+6T (rs8190370) was significantly more common in breast cancer cases (MAF 0.0238) compared to controls (0.0169, P =0.039); this was attributable to a higher MAF in AfrAm cases (0.0611) compared to AfrAm controls (0.0441, P=0.046; adjusted OR 1.41, CI 0.98-2.04; P=0.062). When smoking was considered, I1M+6T was more strongly associated with breast cancer risk in AfrAm smokers (adjusted OR 2.10, 1.08-4.07; P=0.028) compared to never-smokers (OR=1.21; 0.77-1.88; P for interaction=0.176). I1M+6T and three additional CYB5R3 variants, -251T, I8-1676C, and *392C, as well as two CYB5A variants, 13G and I2-992T, were significantly more common in AfrAms compared to Caucs. Conclusions CYB5R3 I1M+6 C>T should be considered in future molecular epidemiologic studies of breast cancer risk in AfrAms. Further, variants in CYB5A and CYB5R3 should be considered in the evaluation of other tumors in AfrAms that are associated with aromatic and heterocyclic amine exposures, to include prostate, bladder, and colon cancers. PMID:25225034

  14. Decoy Receptor 3 (DcR3) as a Biomarker of Tumor Deterioration in Female Reproductive Cancers: A Meta-Analysis

    PubMed Central

    Jiang, Mengtong; Lin, Xiaomiao; He, Rongquan; Lin, Xinggu; Liang, Lu; Tang, Ruixue; Xiong, Dandan; Wei, Kanglai; Dang, Yiwu; Feng, Zhenbo; Chen, Gang

    2016-01-01

    Background DcR3 (decoy receptor 3) has been proposed be involved in development and prognosis of female reproductive cancers, including cervical cancer, ovarian cancer, and breast cancer. The purpose of this meta-analysis was to explore the evidence for the correlation between DcR3 and the clinicopathological characteristics, as well as the overall survival time, in female reproductive cancers. Material/Methods Relevant studies were searched for in PubMed, Wiley Online Library, Web of Science, Science Direct, Cochrane Central Register of Controlled Trials, Google Scholar, EMBASE, Ovid, LILACS, Chinese CNKI, Chong Qing VIP, Wan Fang, and China Biology Medicine disc up to 30 September 2015. Data on the relationship between DcR3 expression and TNM stage, differentiation, lymph node metastasis, age, and overall survival time were extracted. Pooled odds ratios (ORs) and 95% CIs (confidence intervals) were estimated by forest plot. Results Twelve studies with 1127 patients met the inclusion criteria for this meta-analysis. Overexpression of DcR3 was significantly related to the risk of female reproductive cancers (OR=10.69, 95% CI: 6.33–18.05), TNM stage (OR=5.51, 95% CI: 2.83–10.71), differentiation (OR=4.16, 95% CI: 2.28–7.60), lymph node metastasis (OR=5.89, 95% CI: 3.16–10.9), age (OR=0.85, 95% CI: 0.51–1.44), and overall survival time (OR=1.84, 95% CI: 0.58–5.83). Subgroup analyses showed that overexpression of DcR3 in cervical, ovarian, and breast cancer all had similar relationships with these clinicopathological parameters. Conclusions Our meta-analysis suggests that overexpression of DcR3 may play vital roles in the tumorigenesis and deterioration of female reproductive cancers. However, the relationship between DcR3 expression and prognosis needs further investigation. PMID:27246752

  15. TCP3 interacts with R2R3-MYB proteins, promotes flavonoid biosynthesis and negatively regulates the auxin response in Arabidopsis thaliana.

    PubMed

    Li, Shutian; Zachgo, Sabine

    2013-12-01

    TCP proteins belong to the plant-specific bHLH transcription factor family, and function as key regulators of diverse developmental processes. Functional redundancy amongst family members and post-transcriptional down-regulation by miRJAW of several TCP genes complicate their functional characterization. Here, we explore the role of TCP3 by analyzing transgenic plants expressing miRJAW-resistant mTCP3 and dominant-negative TCP3SRDX. Seedlings and seeds of mTCP3 plants were found to hyper-accumulate flavonols, anthocyanins and proanthocyanidins, whereas levels of proanthocyanidins were slightly reduced in TCP3SRDX plants. R2R3-MYB proteins control not only early flavonoid biosynthetic steps but also activate late flavonoid biosynthetic genes by forming ternary R2R3-MYB/bHLH/WD40 (MBW) complexes. TCP3 interacted in yeast with R2R3-MYB proteins, which was further confirmed in planta using BiFC experiments. Yeast three-hybrid assays revealed that TCP3 significantly strengthened the transcriptional activation capacity of R2R3-MYBs bound by the bHLH protein TT8. Transcriptome analysis of mTCP3 and TCP3SRDX plants supported a role for TCP3 in enhancing flavonoid biosynthesis. Moreover, several auxin-related developmental abnormalities were observed in mTCP3 plants. Transcriptome data coupled with studies of an auxin response reporter and auxin efflux carriers showed that TCP3 negatively modulates the auxin response, probably by compromising auxin transport capacity. Genetic experiments revealed that the chalcone synthase mutant tt4-11 lacking flavonoid biosynthesis abrogated the auxin-related defects caused by mTCP3. Together, these data suggest that TCP3 interactions with R2R3-MYBs lead to enhanced flavonoid production, which further negatively modulates the auxin response. PMID:24118612

  16. Analysis of the DNA-Binding Activities of the Arabidopsis R2R3-MYB Transcription Factor Family by One-Hybrid Experiments in Yeast

    PubMed Central

    Kelemen, Zsolt; Sebastian, Alvaro; Xu, Wenjia; Grain, Damaris; Salsac, Fabien; Avon, Alexandra; Berger, Nathalie; Tran, Joseph; Dubreucq, Bertrand; Lurin, Claire; Lepiniec, Loïc; Contreras-Moreira, Bruno; Dubos, Christian

    2015-01-01

    The control of growth and development of all living organisms is a complex and dynamic process that requires the harmonious expression of numerous genes. Gene expression is mainly controlled by the activity of sequence-specific DNA binding proteins called transcription factors (TFs). Amongst the various classes of eukaryotic TFs, the MYB superfamily is one of the largest and most diverse, and it has considerably expanded in the plant kingdom. R2R3-MYBs have been extensively studied over the last 15 years. However, DNA-binding specificity has been characterized for only a small subset of these proteins. Therefore, one of the remaining challenges is the exhaustive characterization of the DNA-binding specificity of all R2R3-MYB proteins. In this study, we have developed a library of Arabidopsis thaliana R2R3-MYB open reading frames, whose DNA-binding activities were assayed in vivo (yeast one-hybrid experiments) with a pool of selected cis-regulatory elements. Altogether 1904 interactions were assayed leading to the discovery of specific patterns of interactions between the various R2R3-MYB subgroups and their DNA target sequences and to the identification of key features that govern these interactions. The present work provides a comprehensive in vivo analysis of R2R3-MYB binding activities that should help in predicting new DNA motifs and identifying new putative target genes for each member of this very large family of TFs. In a broader perspective, the generated data will help to better understand how TF interact with their target DNA sequences. PMID:26484765

  17. mGluR3 promotes proliferation of human embryonic cortical neural progenitor cells by activating ERK1/2 and JNK2 signaling pathway in vitro.

    PubMed

    Guo, J; Zhou, X; Chen, Y; Bai, M; Yang, X; Zhao, K; Hao, W; Wei, W; Zhang, Y

    2014-01-01

    Metabotropic glutamate receptors (mGluRs) regulate the proliferation and differentiation of neural progenitor cells (NPCs) in brain; however, the mechanisms remain unknown. In this study, we investigated the effect of mGluR3 on the proliferation of human embryonic neural progenitor cells (NPCs), the expression of cyclin D1 and the activation of signaling pathways of mitogen-activated protein kinases (MAPKs). The results showed that mGluR3 agonist N-Acetylaspartylglutamate (NAAG) increased the proliferation of NPCs by increasing cell activity, diameter of neurospheres and cell division. In addition, mGluR3 siRNA decreased the NPC proliferation. The protein expressions of cyclin D1 increased with NAAG treatment and decreased after siRNA treatment. It was also found that activation of extracellular signal-regulated protein kinase (ERK) and c-Jun N-terminal protein kinase (JNK) signaling pathways were involved in the proliferation of NPCs. NAAG increased phosphorylation of ERK1/2 and JNK2 levels, and meanwhile p-p38 level decreased; but p-ERK1/2 and p-JNK2 levels decreased after siRNA treatment, and p-p38 level increased. ERK1/2 inhibitor U0126 and JNK2 inhibitor SP600125 attenuated the increase of proliferation induced by NAAG. These findings demonstrated that mGluR3 promoted the proliferation of human embryonic cortical NPCs and increased cyclin D1 expression by activating ERK1/2 and JNK2 signaling pathways in vitro, suggesting that mGluR3 may be a target molecule for regulating NPC proliferation in brain development. PMID:25198581

  18. Sugar-induced cephalic-phase insulin release is mediated by a T1r2+T1r3-independent taste transduction pathway in mice

    PubMed Central

    Stano, Sarah; Holter, Marlena; Azenkot, Tali; Goldman, Olivia; Margolskee, Robert F.; Vasselli, Joseph R.; Sclafani, Anthony

    2015-01-01

    Sensory stimulation from foods elicits cephalic phase responses, which facilitate digestion and nutrient assimilation. One such response, cephalic-phase insulin release (CPIR), enhances glucose tolerance. Little is known about the chemosensory mechanisms that activate CPIR. We studied the contribution of the sweet taste receptor (T1r2+T1r3) to sugar-induced CPIR in C57BL/6 (B6) and T1r3 knockout (KO) mice. First, we measured insulin release and glucose tolerance following oral (i.e., normal ingestion) or intragastric (IG) administration of 2.8 M glucose. Both groups of mice exhibited a CPIR following oral but not IG administration, and this CPIR improved glucose tolerance. Second, we examined the specificity of CPIR. Both mouse groups exhibited a CPIR following oral administration of 1 M glucose and 1 M sucrose but not 1 M fructose or water alone. Third, we studied behavioral attraction to the same three sugar solutions in short-term acceptability tests. B6 mice licked more avidly for the sugar solutions than for water, whereas T1r3 KO mice licked no more for the sugar solutions than for water. Finally, we examined chorda tympani (CT) nerve responses to each of the sugars. Both mouse groups exhibited CT nerve responses to the sugars, although those of B6 mice were stronger. We propose that mice possess two taste transduction pathways for sugars. One mediates behavioral attraction to sugars and requires an intact T1r2+T1r3. The other mediates CPIR but does not require an intact T1r2+T1r3. If the latter taste transduction pathway exists in humans, it should provide opportunities for the development of new treatments for controlling blood sugar. PMID:26157055

  19. Design and characterisation of long-R3-insulin-like growth factor-I muteins which show resistance to pepsin digestion.

    PubMed

    Bryant, K J; Read, L C; Forsberg, G; Wallace, J C

    1996-01-01

    Site-directed mutagenesis was used to construct pepsin-resistant, single-point mutations of the N-terminal extended IGF-I analogue, long-R3-IGF-I. In order to identify the most susceptible sites, the kinetics of long-R3-IGF-I digestion by purified porcine pepsin were determined. Pepsin initially cleaved the Leu10-Phe11 bond in the N-terminal extension peptide to generate FVN-R3-IGF-I, followed in rapid succession by cleavage at Gln15-Phe16, Tyr24-Phe25, Leu10-Val11 and Met59-Tyr60 in the IGF-I moiety. Single-point mutations at these sites were designed on the basis of the preferred cleavage bonds for pepsin, as well as amino acid substitutions less likely to disturb protein structure. These included Leu10Val, Phe16Ala, Phe25Leu, Asp53Glu and Met59Gln. All five muteins retained growth-promoting activity equivalent to or higher than that of IGF-I. In terms of pepsin susceptibility, Leu10Val and Asp53Glu were degraded as rapidly as the parent long-R3-IGF-I, Met59Gln and Phe25Leu were partially stabilised, and Phe16Ala showed a marked improvement in stability over a wide range of pepsin:substrate ratios. Accordingly, the Phe16Ala mutein, long-R3A16-IGF-I, has potential for oral applications to enhance gastric growth and repair. PMID:8919033

  20. Sugar-induced cephalic-phase insulin release is mediated by a T1r2+T1r3-independent taste transduction pathway in mice.

    PubMed

    Glendinning, John I; Stano, Sarah; Holter, Marlena; Azenkot, Tali; Goldman, Olivia; Margolskee, Robert F; Vasselli, Joseph R; Sclafani, Anthony

    2015-09-01

    Sensory stimulation from foods elicits cephalic phase responses, which facilitate digestion and nutrient assimilation. One such response, cephalic-phase insulin release (CPIR), enhances glucose tolerance. Little is known about the chemosensory mechanisms that activate CPIR. We studied the contribution of the sweet taste receptor (T1r2+T1r3) to sugar-induced CPIR in C57BL/6 (B6) and T1r3 knockout (KO) mice. First, we measured insulin release and glucose tolerance following oral (i.e., normal ingestion) or intragastric (IG) administration of 2.8 M glucose. Both groups of mice exhibited a CPIR following oral but not IG administration, and this CPIR improved glucose tolerance. Second, we examined the specificity of CPIR. Both mouse groups exhibited a CPIR following oral administration of 1 M glucose and 1 M sucrose but not 1 M fructose or water alone. Third, we studied behavioral attraction to the same three sugar solutions in short-term acceptability tests. B6 mice licked more avidly for the sugar solutions than for water, whereas T1r3 KO mice licked no more for the sugar solutions than for water. Finally, we examined chorda tympani (CT) nerve responses to each of the sugars. Both mouse groups exhibited CT nerve responses to the sugars, although those of B6 mice were stronger. We propose that mice possess two taste transduction pathways for sugars. One mediates behavioral attraction to sugars and requires an intact T1r2+T1r3. The other mediates CPIR but does not require an intact T1r2+T1r3. If the latter taste transduction pathway exists in humans, it should provide opportunities for the development of new treatments for controlling blood sugar. PMID:26157055

  1. Sensing of amino acids by the gut-expressed taste receptor T1R1-T1R3 stimulates CCK secretion.

    PubMed

    Daly, Kristian; Al-Rammahi, Miran; Moran, Andrew; Marcello, Marco; Ninomiya, Yuzo; Shirazi-Beechey, Soraya P

    2013-02-01

    CCK is secreted by endocrine cells of the proximal intestine in response to dietary components, including amino acids. CCK plays a variety of roles in digestive processes, including inhibition of food intake, consistent with a role in satiety. In the lingual epithelium, the sensing of a broad spectrum of L-amino acids is accomplished by the heteromeric amino acid (umami) taste receptor (T1R1-T1R3). T1R1 and T1R3 subunits are also expressed in the intestine. A defining characteristic of umami sensing by T1R1-T1R3 is its potentiation by IMP or GMP. Furthermore, T1R1-T1R3 is not activated by Trp. We show here that, in response to L-amino acids (Phe, Leu, Glu, and Trp), but not D-amino acids, STC-1 enteroendocrine cells and mouse proximal small intestinal tissue explants secrete CCK and that IMP enhances Phe-, Leu-, and Glu-induced, but not Trp-induced, CCK secretion. Furthermore, small interfering RNA inhibition of T1R1 expression in STC-1 cells results in significant diminution of Phe-, Leu-, and Glu-stimulated, but not Trp-stimulated, CCK release. In STC-1 cells and mouse intestine, gurmarin inhibits Phe-, Leu-, and Glu-induced, but not Trp-stimulated, CCK secretion. In contrast, the Ca(2+)-sensing receptor antagonist NPS2143 inhibits Phe-stimulated CCK release partially and Trp-induced CCK secretion totally in mouse intestine. However, NPS2143 has no effect on Leu- or Glu-induced CCK secretion. Collectively, our data demonstrate that functional characteristics and cellular location of the gut-expressed T1R1-T1R3 support its role as a luminal sensor for Phe-, Leu-, and Glu-induced CCK secretion. PMID:23203156

  2. Activation of the umami taste receptor (T1R1/T1R3) initiates the peristaltic reflex and pellet propulsion in the distal colon

    PubMed Central

    Kendig, Derek M.; Hurst, Norman R.; Bradley, Zachary L.; Mahavadi, Sunila; Kuemmerle, John F.; Lyall, Vijay; DeSimone, John; Murthy, Karnam S.

    2014-01-01

    Intraluminal nutrients in the gut affect the peristaltic reflex, although the mechanism is not well defined. Recent evidence supports the presence of taste receptors and their signaling components in enteroendocrine cells, although their function is unclear. This study aimed to determine if nutrients modify colonic motility through activation of taste receptors. Colonic sections were immunostained for the umami taste receptor T1R1/T1R3, which mediates the response to umami ligands, such as monosodium glutamate (MSG), in taste cells. Ascending contraction, descending relaxation, and calcitonin gene-related peptide release were measured in three-chamber flat-sheet preparations of rat colon in response to MSG alone or with inosine 5′-monophosphate (IMP). Velocity of artificial fecal pellet propulsion was measured by video recording in guinea pig distal colon. T1R1/T1R3 receptors were present in enteroendocrine cells of colonic sections from human, rat, mouse, and guinea pig. MSG initiated ascending contraction and descending relaxation components of the peristaltic reflex and calcitonin gene-related peptide release in flat-sheet preparations. IMP augmented the MSG-induced effects, suggesting activation of T1R1/T1R3 receptors. In T1R1−/− mice, mucosal stroking, but not MSG, elicited a peristaltic reflex. Intraluminal perfusion of MSG enhanced the velocity of artificial fecal pellet propulsion, which was also augmented by IMP. Propulsion was also increased by l-cysteine, but not l-tryptophan, supporting a role of T1R1/T1R3 receptors. We conclude that T1R1/T1R3 activation by luminal MSG or l-cysteine elicits a peristaltic reflex and CGRP release and increases the velocity of pellet propulsion in distal colon. This mechanism may explain how nutrients regulate colonic propulsion. PMID:25324508

  3. Activation of the umami taste receptor (T1R1/T1R3) initiates the peristaltic reflex and pellet propulsion in the distal colon.

    PubMed

    Kendig, Derek M; Hurst, Norman R; Bradley, Zachary L; Mahavadi, Sunila; Kuemmerle, John F; Lyall, Vijay; DeSimone, John; Murthy, Karnam S; Grider, John R

    2014-12-01

    Intraluminal nutrients in the gut affect the peristaltic reflex, although the mechanism is not well defined. Recent evidence supports the presence of taste receptors and their signaling components in enteroendocrine cells, although their function is unclear. This study aimed to determine if nutrients modify colonic motility through activation of taste receptors. Colonic sections were immunostained for the umami taste receptor T1R1/T1R3, which mediates the response to umami ligands, such as monosodium glutamate (MSG), in taste cells. Ascending contraction, descending relaxation, and calcitonin gene-related peptide release were measured in three-chamber flat-sheet preparations of rat colon in response to MSG alone or with inosine 5'-monophosphate (IMP). Velocity of artificial fecal pellet propulsion was measured by video recording in guinea pig distal colon. T1R1/T1R3 receptors were present in enteroendocrine cells of colonic sections from human, rat, mouse, and guinea pig. MSG initiated ascending contraction and descending relaxation components of the peristaltic reflex and calcitonin gene-related peptide release in flat-sheet preparations. IMP augmented the MSG-induced effects, suggesting activation of T1R1/T1R3 receptors. In T1R1(-/-) mice, mucosal stroking, but not MSG, elicited a peristaltic reflex. Intraluminal perfusion of MSG enhanced the velocity of artificial fecal pellet propulsion, which was also augmented by IMP. Propulsion was also increased by l-cysteine, but not l-tryptophan, supporting a role of T1R1/T1R3 receptors. We conclude that T1R1/T1R3 activation by luminal MSG or l-cysteine elicits a peristaltic reflex and CGRP release and increases the velocity of pellet propulsion in distal colon. This mechanism may explain how nutrients regulate colonic propulsion. PMID:25324508

  4. A new clustering strategy

    NASA Astrophysics Data System (ADS)

    Feng, Jian-xin; Tang, Jia-fu; Wang, Guang-xing

    2007-04-01

    On the basis of the analysis of clustering algorithm that had been proposed for MANET, a novel clustering strategy was proposed in this paper. With the trust defined by statistical hypothesis in probability theory and the cluster head selected by node trust and node mobility, this strategy can realize the function of the malicious nodes detection which was neglected by other clustering algorithms and overcome the deficiency of being incapable of implementing the relative mobility metric of corresponding nodes in the MOBIC algorithm caused by the fact that the receiving power of two consecutive HELLO packet cannot be measured. It's an effective solution to cluster MANET securely.

  5. Unconventional methods for clustering

    NASA Astrophysics Data System (ADS)

    Kotyrba, Martin

    2016-06-01

    Cluster analysis or clustering is a task of grouping a set of objects in such a way that objects in the same group (called a cluster) are more similar (in some sense or another) to each other than to those in other groups (clusters). It is the main task of exploratory data mining and a common technique for statistical data analysis used in many fields, including machine learning, pattern recognition, image analysis, information retrieval, and bioinformatics. The topic of this paper is one of the modern methods of clustering namely SOM (Self Organising Map). The paper describes the theory needed to understand the principle of clustering and descriptions of algorithm used with clustering in our experiments.

  6. Modeling Clustered Data with Very Few Clusters.

    PubMed

    McNeish, Daniel; Stapleton, Laura M

    2016-01-01

    Small-sample inference with clustered data has received increased attention recently in the methodological literature, with several simulation studies being presented on the small-sample behavior of many methods. However, nearly all previous studies focus on a single class of methods (e.g., only multilevel models, only corrections to sandwich estimators), and the differential performance of various methods that can be implemented to accommodate clustered data with very few clusters is largely unknown, potentially due to the rigid disciplinary preferences. Furthermore, a majority of these studies focus on scenarios with 15 or more clusters and feature unrealistically simple data-generation models with very few predictors. This article, motivated by an applied educational psychology cluster randomized trial, presents a simulation study that simultaneously addresses the extreme small sample and differential performance (estimation bias, Type I error rates, and relative power) of 12 methods to account for clustered data with a model that features a more realistic number of predictors. The motivating data are then modeled with each method, and results are compared. Results show that generalized estimating equations perform poorly; the choice of Bayesian prior distributions affects performance; and fixed effect models perform quite well. Limitations and implications for applications are also discussed. PMID:27269278

  7. [Clustering of simple obesity].

    PubMed

    Yoshida, K; Matsuda, H; Kurita, M; Umetada, Y

    1988-05-01

    An attempt was made to classify persons with simple obesity from the viewpoint of health education. Subjects of the study were 1,278 male workers in a financing company who underwent health examination. At the time of health examinations, questionnaire survey concerning their life styles was carried out on all the subjects. The obese group consisted of 127 subjects whose obesity indices were over 15% and the control group consisted of 342 subjects whose obesity indices ranged from -5 to 5%. Subjects in the obese group were classified into four clusters based on cluster analysis using five life-style parameters; that is, frequency of taking breakfast, frequency of taking staple food, drinking habits, smoking habits, and frequency of exercise. The first cluster (N = 10) included inactive persons, the second cluster (N = 46) non smokers, the third cluster (N = 39) smokers and heavy drinkers, and the fourth cluster (N = 32) smokers and non-drinkers. Comparison of the four clusters of obese persons with the control group revealed the following findings: 1) All the four clusters had significantly high frequencies of abnormal values of triglyceride (TG) and fasting blood sugar (FBS). 2) The first cluster had significantly high frequencies of abnormal values of glutamic oxalacetic transaminase (GOT) and glutamic pyruvic transaminase (GPT). 3) The second cluster had significantly high frequencies of abnormal values of systolic and diastolic blood pressure, total cholesterol, TG, FBS, uric acid, GOT, GPT and gamma glutamyl transferase (GGT).(ABSTRACT TRUNCATED AT 250 WORDS) PMID:3172544

  8. [Population frequency and age of c.806C > T mutation in CYB5R3 gene as cause of recessive congenital methemoglobinemia in Yakutia].

    PubMed

    Galeeva, N M; Voevoda, M I; Spiridonova, M G; Stepanov, V A; Poliakov, A V

    2013-04-01

    Type-1recessive congenital methemoglobinemia (RCM) is a rare autosomal disease characterized by a deficiency of the soluble form of nicotineamide adenine dinucleotide (NADH)-cytochrome b5 reductase (b5R) and clinically manifests as cyanosis of skin and mucous membranes. In the Russian Federation, type-I RCM is widely disturbed in Yakutia due to the local founder effect. The molecular genetics cause of type-I RCM in Yakutia is mutation c.806C > T in the CYB5R3 gene. In this work we used 13 polymorphic markers, which flanking the CYB5R3 gene to establish the founder haplotype. The age of the mutation was estimated as about 285 +/- 135 years. In this work, we have evaluated the frequency of the c.806 C > T mutation in Yakutia, which averaged 55 : 1000 Yakuts. The calculated frequency of disease was 1: 1250 Yakuts. PMID:23866629

  9. BaCO3: High-Temperature crystal Structures and the Pmcn → R3m Phase Transition at 811 Celius

    SciTech Connect

    Antao,S.; Hassan, I.

    2007-01-01

    The temperature (T) evolution of the barium carbonate (BaCO3) structure was studied using Rietveld structure refinements based on synchrotron X-ray diffraction and a powdered synthetic sample. BaCO3 transforms from an orthorhombic, Pmcn, a phase to a trigonal, R3m, {beta} phase at 811 C. The orthorhombic BaCO3 structure is isotypic with aragonite, CaCO3. In trigonal R3m BaCO3, the CO3 group occupies one orientation and shows no rotational disorder. The average distances increase while the distances decrease linearly with T in the orthorhombic phase. After the 811 C phase transition, the distances increase while C-O distances decrease. There is also a significant volume change of 2.8% at the phase transition.

  10. Electron: Cluster interactions

    SciTech Connect

    Scheidemann, A.A.; Kresin, V.V.; Knight, W.D.

    1994-02-01

    Beam depletion spectroscopy has been used to measure absolute total inelastic electron-sodium cluster collision cross sections in the energy range from E {approximately} 0.1 to E {approximately} 6 eV. The investigation focused on the closed shell clusters Na{sub 8}, Na{sub 20}, Na{sub 40}. The measured cross sections show an increase for the lowest collision energies where electron attachment is the primary scattering channel. The electron attachment cross section can be understood in terms of Langevin scattering, connecting this measurement with the polarizability of the cluster. For energies above the dissociation energy the measured electron-cluster cross section is energy independent, thus defining an electron-cluster interaction range. This interaction range increases with the cluster size.

  11. Information-based clustering

    PubMed Central

    Slonim, Noam; Atwal, Gurinder Singh; Tkačik, Gašper; Bialek, William

    2005-01-01

    In an age of increasingly large data sets, investigators in many different disciplines have turned to clustering as a tool for data analysis and exploration. Existing clustering methods, however, typically depend on several nontrivial assumptions about the structure of data. Here, we reformulate the clustering problem from an information theoretic perspective that avoids many of these assumptions. In particular, our formulation obviates the need for defining a cluster “prototype,” does not require an a priori similarity metric, is invariant to changes in the representation of the data, and naturally captures nonlinear relations. We apply this approach to different domains and find that it consistently produces clusters that are more coherent than those extracted by existing algorithms. Finally, our approach provides a way of clustering based on collective notions of similarity rather than the traditional pairwise measures. PMID:16352721

  12. T1R2 and T1R3 subunits are individually unnecessary for normal affective licking responses to Polycose: implications for saccharide taste receptors in mice.

    PubMed

    Treesukosol, Yada; Blonde, Ginger D; Spector, Alan C

    2009-04-01

    The T1R2 and T1R3 proteins are expressed in taste receptor cells and form a heterodimer binding with compounds described as sweet by humans. We examined whether Polycose taste might be mediated through this heterodimer by testing T1R2 knockout (KO) and T1R3 KO mice and their wild-type (WT) littermate controls in a series of brief-access taste tests (25-min sessions with 5-s trials). Sucrose, Na-saccharin, and Polycose were each tested for three consecutive sessions with order of presentation varied among subgroups in a Latin-Square manner. Both KO groups displayed blunted licking responses and initiated significantly fewer trials of sucrose and Na-saccharin across a range of concentrations. KO mice tested after Polycose exposure demonstrated some degree of concentration-dependent licking of sucrose, likely attributable to learning related to prior postingestive experience. These results are consistent with prior findings in the literature, implicating the T1R2+3 heterodimer as the principal taste receptor for sweet-tasting ligands, and also provide support for the potential of postingestive experience to influence responding in the KO mice. In contrast, T1R2 KO and T1R3 KO mice displayed concentration-dependent licking responses to Polycose that tracked those of their WT controls and in some cases licked midrange concentrations more; the number of Polycose trials initiated overall did not differ between KO and WT mice. Thus, the T1R2 and T1R3 proteins are individually unnecessary for normal concentration-dependent licking of Polycose to be expressed in a brief-access test. Whether at least one of these T1R protein subunits is necessary for normal Polycose responsiveness remains untested. Alternatively, there may be a novel taste receptor(s) that mediates polysaccharide taste. PMID:19158407

  13. Evaluation of polymorphisms in the sulfonamide detoxification genes NAT2, CYB5A, and CYB5R3 in patients with sulfonamide hypersensitivity

    PubMed Central

    Sacco, James; Abouraya, Mahmoud; Motsinger-Reif, Alison; Yale, Steven; McCarty, Catherine; Trepanier, Lauren

    2013-01-01

    Objective To determine whether polymorphisms in the sulfonamide detoxification genes, CYB5A (encoding cytochrome b5), CYB5R3 (encoding cytochrome b5 reductase), or NAT2 (encoding N-acetyltransferase 2) were over-represented in patients with delayed sulfonamide drug hypersensitivity, compared to control patients that tolerated a therapeutic course of trimethoprim-sulfamethoxazole without adverse event. Methods DNA from 99 non-immunocompromised patients with sulfonamide hypersensitivity that were identified from the Personalized Medicine Research Project at the Marshfield Clinic, and from 99 age-, race-, and gender-matched drug-tolerant controls, were genotyped for four CYB5A and five CYB5R3 polymorphisms, and for all coding NAT2 SNPs. Results CYB5A and CYB5R3 SNPs were found at low allele frequencies (less than 3–4%), which did not differ between hypersensitive and tolerant patients. NAT2 allele and haplotype frequencies, as well as inferred NAT2 phenotypes, also did not differ between groups (60% vs. 59% slow acetylators). Finally, no difference in NAT2 status was found in a subset of patients with more severe hypersensitivity signs (drug reaction with eosinophilia and systemic symptoms; DRESS) compared to tolerant patients. Conclusions We found no evidence for a substantial involvement of these 9 CYB5A or CYB5R3 polymorphisms in sulfonamide HS risk, although minor effects cannot be completely ruled out. Despite careful medical record review and full re-sequencing of the NAT2 coding region, we found no association of NAT2 coding alleles with sulfonamide hypersensitivity (predominantly cutaneous eruptions) in this adult Caucasian population. PMID:22850190

  14. Effect of recombinant porcine IGFBP-3 on IGF-I and long-R3-IGF-I-stimulated proliferation and differentiation of L6 myogenic cells.

    PubMed

    Xi, G; Kamanga-Sollo, E; Pampusch, M S; White, M E; Hathaway, M R; Dayton, William R

    2004-09-01

    Insulin-like growth factor (IGF)-I stimulates both proliferation and differentiation of myogenic precursor cells. In vivo, IGFs are bound to one of the members of a family of six high-affinity IGF binding proteins (IGFBP 1-6) that regulate their biological activity. One of these binding proteins, IGFBP-3, affects cell proliferation via both IGF-dependent and IGF-independent mechanisms and it has generally been shown to suppress proliferation of cultured cells; however, it also may stimulate proliferation depending upon the cell type and the assay conditions. Cultured porcine embryonic myogenic cells (PEMCs) produce IGFBP-3 and its level drops significantly immediately prior to differentiation. Additionally, IGFBP-3 suppresses both IGF-I and Long-R3-IGF-I-stimulated proliferation of embryonic porcine myogenic cells. In this study, we have examined the effects of recombinant porcine IGFBP-3 (rpIGFBP-3) on IGF-I- and Long-R3-IGF-I-stimulated proliferation and differentiation of the L6 myogenic cell line. L6 cells potentially provide a good model for studying the actions of IGFBP-3 on muscle because they contain no non-muscle cells and they do not produce detectable levels of IGFBP-3. RpIGFBP-3 suppresses both IGF-I and Long-R3-IGF-I-stimulated proliferation of L6 cells, indicating that it suppresses proliferation via both IGF-dependent and IGF-independent mechanisms. Our data also show that rpIGFBP-3 causes IGF-independent suppression of proliferation without increasing the level of phosphosmad-2 in L6 cultures. Additionally, rpIGFBP-3 suppresses IGF-I-stimulated differentiation of L6 cells. In contrast, however, rpIGFBP-3 does not suppress Long-R3-IGF-I-stimulated differentiation. This suggests that rpIGFBP-3 does not have IGF-independent effects on L6 cell differentiation. PMID:15254966

  15. R3P-Loc: a compact multi-label predictor using ridge regression and random projection for protein subcellular localization.

    PubMed

    Wan, Shibiao; Mak, Man-Wai; Kung, Sun-Yuan

    2014-11-01

    Locating proteins within cellular contexts is of paramount significance in elucidating their biological functions. Computational methods based on knowledge databases (such as gene ontology annotation (GOA) database) are known to be more efficient than sequence-based methods. However, the predominant scenarios of knowledge-based methods are that (1) knowledge databases typically have enormous size and are growing exponentially, (2) knowledge databases contain redundant information, and (3) the number of extracted features from knowledge databases is much larger than the number of data samples with ground-truth labels. These properties render the extracted features liable to redundant or irrelevant information, causing the prediction systems suffer from overfitting. To address these problems, this paper proposes an efficient multi-label predictor, namely R3P-Loc, which uses two compact databases for feature extraction and applies random projection (RP) to reduce the feature dimensions of an ensemble ridge regression (RR) classifier. Two new compact databases are created from Swiss-Prot and GOA databases. These databases possess almost the same amount of information as their full-size counterparts but with much smaller size. Experimental results on two recent datasets (eukaryote and plant) suggest that R3P-Loc can reduce the dimensions by seven-folds and significantly outperforms state-of-the-art predictors. This paper also demonstrates that the compact databases reduce the memory consumption by 39 times without causing degradation in prediction accuracy. For readers׳ convenience, the R3P-Loc server is available online at url:http://bioinfo.eie.polyu.edu.hk/R3PLocServer/. PMID:24997236

  16. Stereoselective chemo-enzymatic oxidation routes for (1R,3E,7E,11S,12S)-3,7,18-dolabellatriene

    PubMed Central

    Görner, Christian; Hirte, Max; Huber, Stephanie; Schrepfer, Patrick; Brück, Thomas

    2015-01-01

    The diterpene (1R,3E,7E,11S,12S)-3,7,18-dolabellatriene from the marine brown alga Dilophus spiralis belongs to the dolabellanes natural product family and has antimicrobial activity against multi-drug resistant Staphylococcus aureus. Recently, we generated a CotB2 diterpene synthase mutant (W288G), which instead of its native product cyclooctat-9-en-7-ol, generates (1R,3E,7E,11S,12S)-3,7,18-dolabellatriene. In vivo CotB2 W288G reconstitution in an Escherichia coli based terpene production system, allowed efficient production of this olefinic macrocycle. To diversify the 3,7,18-dolabellatriene bioactivity we evaluated chemical and enzymatic methods for selective oxidation. Epoxidation by acetic peracid, which was formed in situ by a lipase catalyzed reaction of acetic acid with H2O2, provided efficient access to two monooxidized dolabellanes and to a novel di-epoxidated dolabellane species. These compounds could act as synthons en-route to new dolabellanes with diversified bioactivities. Furthermore, we demonstrate the almost quantitative 3,7,18-dolabellatriene conversion into the new, non-natural compound (1R,3E,7E,11S,12S,18R)-dolabella-3,7-diene-20-ol by hydroboration–oxidation with an enantiomeric excess of 94%, for the first time. PMID:26528263

  17. Metabolism of myo-[2-3H]Inositol and scyllo-[R-3H]Inositol in Ripening Wheat Kernels 1

    PubMed Central

    Sasaki, Ken; Loewus, Frank A.

    1980-01-01

    Injection of myo-[2-3H]inositol or scyllo-[R-3H]inositol into the peduncular cavity of wheat stalks about 2 to 4 weeks postanthesis led to rapid translocation into the spike and accumulation of label in developing kernels, especially the bran fraction. With myo-[2-3H]inositol, about 50 to 60% of the label was incorporated into high molecular weight cell wall substance in the region of the injection. That portion translocated to the kernels was utilized primarily for cell wall polysaccharide formation and phytate biosynthesis. A small amount was recovered as free myo-inositol and galactinol. When scyllo-[R-3H]inositol was supplied, most of the label was translocated into the developing kernels where it accumulated as free scyllo-inositol and O-α-d-galactopyranosyl-scyllo-inositol in approximately equal amount. None of the label from scyllo-[R-3H]inositol was utilized for either phytate biosynthesis or cell wall polysaccharide formation. PMID:16661513

  18. Function search in a large transcription factor gene family in Arabidopsis: assessing the potential of reverse genetics to identify insertional mutations in R2R3 MYB genes.

    PubMed Central

    Meissner, R C; Jin, H; Cominelli, E; Denekamp, M; Fuertes, A; Greco, R; Kranz, H D; Penfield, S; Petroni, K; Urzainqui, A; Martin, C; Paz-Ares, J; Smeekens, S; Tonelli, C; Weisshaar, B; Baumann, E; Klimyuk, V; Marillonnet, S; Patel, K; Speulman, E; Tissier, A F; Bouchez, D; Jones, J J; Pereira, A; Wisman, E

    1999-01-01

    More than 92 genes encoding MYB transcription factors of the R2R3 class have been described in Arabidopsis. The functions of a few members of this large gene family have been described, indicating important roles for R2R3 MYB transcription factors in the regulation of secondary metabolism, cell shape, and disease resistance, and in responses to growth regulators and stresses. For the majority of the genes in this family, however, little functional information is available. As the first step to characterizing these genes functionally, the sequences of >90 family members, and the map positions and expression profiles of >60 members, have been determined previously. An important second step in the functional analysis of the MYB family, through a process of reverse genetics that entails the isolation of insertion mutants, is described here. For this purpose, a variety of gene disruption resources has been used, including T-DNA-insertion populations and three distinct populations that harbor transposon insertions. We report the isolation of 47 insertions into 36 distinct MYB genes by screening a total of 73 genes. These defined insertion lines will provide the foundation for subsequent detailed functional analyses for the assignment of specific functions to individual members of the R2R3 MYB gene family. PMID:10521515

  19. Reversal of multidrug resistance in breast cancer MCF-7/ADR cells by h-R3-siMDR1-PAMAM complexes.

    PubMed

    Li, Jun; Liu, Jing; Guo, Nana; Zhang, Xiaoning

    2016-09-10

    Multidrug resistance (MDR) among breast cancer cells is the paramount obstacle for the successful chemotherapy. In this study, anti-EGFR antibody h-R3 was designed to self-assembled h-R3-siRNA-PAMAM-complexes (HSPCs) via electrostatic interactions for siRNA delivery. The physicochemical characterization, cell uptake, MDR1 silencing efficiency, cell migration, cell growth and cell apoptosis were investigated. The HSPCs presented lower cytotoxicity, higher cellular uptake and enhanced endosomal escape ability. Also, HSPCs encapsulating siMDR1 knockdowned 99.4% MDR1 gene with up to ∼6 times of enhancement compared to naked siMDR1, increased the doxorubicin accumulation, down-regulated P-glycoprotein (P-gp) expression and suppressed cellular migration in breast cancer MCF-7/ADR cells. Moreover, the combination of anticancer drug paclitaxel (PTX) and siMDR1 loaded HSPCs showed synergistic effect on overcoming MDR, which inhibited cell growth and induced cell apoptosis. This h-R3-mediated siMDR1 delivery system could be a promising vector for effective siRNA therapy of drug resistant breast cancer. PMID:27444552

  20. Members of an R2R3-MYB transcription factor family in Petunia are developmentally and environmentally regulated to control complex floral and vegetative pigmentation patterning.

    PubMed

    Albert, Nick W; Lewis, David H; Zhang, Huaibi; Schwinn, Kathy E; Jameson, Paula E; Davies, Kevin M

    2011-03-01

    We present an investigation of anthocyanin regulation over the entire petunia plant, determining the mechanisms governing complex floral pigmentation patterning and environmentally induced vegetative anthocyanin synthesis. DEEP PURPLE (DPL) and PURPLE HAZE (PHZ) encode members of the R2R3-MYB transcription factor family that regulate anthocyanin synthesis in petunia, and control anthocyanin production in vegetative tissues and contribute to floral pigmentation. In addition to these two MYB factors, the basic helix-loop-helix (bHLH) factor ANTHOCYANIN1 (AN1) and WD-repeat protein AN11, are also essential for vegetative pigmentation. The induction of anthocyanins in vegetative tissues by high light was tightly correlated to the induction of transcripts for PHZ and AN1. Interestingly, transcripts for PhMYB27, a putative R2R3-MYB active repressor, were highly expressed during non-inductive shade conditions and repressed during high light. The competitive inhibitor PhMYBx (R3-MYB) was expressed under high light, which may provide feedback repression. In floral tissues DPL regulates vein-associated anthocyanin pigmentation in the flower tube, while PHZ determines light-induced anthocyanin accumulation on exposed petal surfaces (bud-blush). A model is presented suggesting how complex floral and vegetative pigmentation patterns are derived in petunia in terms of MYB, bHLH and WDR co-regulators. PMID:21235651

  1. Management of cluster headache.

    PubMed

    Tfelt-Hansen, Peer C; Jensen, Rigmor H

    2012-07-01

    The prevalence of cluster headache is 0.1% and cluster headache is often not diagnosed or misdiagnosed as migraine or sinusitis. In cluster headache there is often a considerable diagnostic delay - an average of 7 years in a population-based survey. Cluster headache is characterized by very severe or severe orbital or periorbital pain with a duration of 15-180 minutes. The cluster headache attacks are accompanied by characteristic associated unilateral symptoms such as tearing, nasal congestion and/or rhinorrhoea, eyelid oedema, miosis and/or ptosis. In addition, there is a sense of restlessness and agitation. Patients may have up to eight attacks per day. Episodic cluster headache (ECH) occurs in clusters of weeks to months duration, whereas chronic cluster headache (CCH) attacks occur for more than 1 year without remissions. Management of cluster headache is divided into acute attack treatment and prophylactic treatment. In ECH and CCH the attacks can be treated with oxygen (12 L/min) or subcutaneous sumatriptan 6 mg. For both oxygen and sumatriptan there are two randomized, placebo-controlled trials demonstrating efficacy. In both ECH and CCH, verapamil is the prophylactic drug of choice. Verapamil 360 mg/day was found to be superior to placebo in one clinical trial. In clinical practice, daily doses of 480-720 mg are mostly used. Thus, the dose of verapamil used in cluster headache treatment may be double the dose used in cardiology, and with the higher doses the PR interval should be checked with an ECG. At the start of a cluster, transitional preventive treatment such as corticosteroids or greater occipital nerve blockade can be given. In CCH and in long-standing clusters of ECH, lithium, methysergide, topiramate, valproic acid and ergotamine tartrate can be used as add-on prophylactic treatment. In drug-resistant CCH, neuromodulation with either occipital nerve stimulation or deep brain stimulation of the hypothalamus is an alternative treatment strategy

  2. Mini-clusters

    NASA Technical Reports Server (NTRS)

    Chinellato, J. A.; Dobrigkeit, C.; Bellandifilho, J.; Lattes, C. M. G.; Menon, M. J.; Navia, C. E.; Pamilaju, A.; Sawayanagi, K.; Shibuya, E. H.; Turtelli, A., Jr.

    1985-01-01

    Experimental results of mini-clusters observed in Chacaltaya emulsion chamber no.19 are summarized. The study was made on 54 single core shower upper and 91 shower clusters of E(gamma) 10 TeV from 30 families which are visible energy greater than 80 TeV and penetrate through both upper and lower detectors of the two-story chamber. The association of hadrons in mini-cluster is made clear from their penetrative nature and microscopic observation of shower continuation in lower chamber. Small P sub t (gamma) of hadrons in mini-clusters remained in puzzle.

  3. The youngest globular clusters

    NASA Astrophysics Data System (ADS)

    Beck, Sara

    2015-11-01

    It is likely that all stars are born in clusters, but most clusters are not bound and disperse. None of the many protoclusters in our Galaxy are likely to develop into long-lived bound clusters. The super star clusters (SSCs) seen in starburst galaxies are more massive and compact and have better chances of survival. The birth and early development of SSCs takes place deep in molecular clouds, and during this crucial stage the embedded clusters are invisible to optical or UV observations but are studied via the radio-infrared supernebulae (RISN) they excite. We review observations of embedded clusters and identify RISN within 10 Mpc whose exciting clusters have ≈ 106 M⊙ or more in volumes of a few pc3 and which are likely to not only survive as bound clusters, but to evolve into objects as massive and compact as Galactic globulars. These clusters are distinguished by very high star formation efficiency η, at least a factor of 10 higher than the few percent seen in the Galaxy, probably due to the violent disturbances their host galaxies have undergone. We review recent observations of the kinematics of the ionized gas in RISN showing outflows through low-density channels in the ambient molecular cloud; this may protect the cloud from feedback by the embedded H II region.

  4. Clustering versus non-clustering phase synchronizations.

    PubMed

    Liu, Shuai; Zhan, Meng

    2014-03-01

    Clustering phase synchronization (CPS) is a common scenario to the global phase synchronization of coupled dynamical systems. In this work, a novel scenario, the non-clustering phase synchronization (NPS), is reported. It is found that coupled systems do not transit to the global synchronization until a certain sufficiently large coupling is attained, and there is no clustering prior to the global synchronization. To reveal the relationship between CPS and NPS, we further analyze the noise effect on coupled phase oscillators and find that the coupled oscillator system can change from CPS to NPS with the increase of noise intensity or system disorder. These findings are expected to shed light on the mechanism of various intriguing self-organized behaviors in coupled systems. PMID:24697366

  5. Clustering versus non-clustering phase synchronizations

    SciTech Connect

    Liu, Shuai; Zhan, Meng

    2014-03-15

    Clustering phase synchronization (CPS) is a common scenario to the global phase synchronization of coupled dynamical systems. In this work, a novel scenario, the non-clustering phase synchronization (NPS), is reported. It is found that coupled systems do not transit to the global synchronization until a certain sufficiently large coupling is attained, and there is no clustering prior to the global synchronization. To reveal the relationship between CPS and NPS, we further analyze the noise effect on coupled phase oscillators and find that the coupled oscillator system can change from CPS to NPS with the increase of noise intensity or system disorder. These findings are expected to shed light on the mechanism of various intriguing self-organized behaviors in coupled systems.

  6. A nonparametric clustering technique which estimates the number of clusters

    NASA Technical Reports Server (NTRS)

    Ramey, D. B.

    1983-01-01

    In applications of cluster analysis, one usually needs to determine the number of clusters, K, and the assignment of observations to each cluster. A clustering technique based on recursive application of a multivariate test of bimodality which automatically estimates both K and the cluster assignments is presented.

  7. Reactive accelerated cluster erosion (RACE) by ionized cluster beams

    NASA Astrophysics Data System (ADS)

    Gspann, Jürgen

    1996-05-01

    Beams of ionized clusters accelerated up to about 120 keV kinetic energy per cluster are used for cluster impact lithography. Chemical reactions of clusters of CO 2, or of SF 6, respectively, are found to assist the physical erosion by hypervelocity cluster impacts in yielding volatile products. Natural diamond, silicon and Pyrex glass have been microstructured showing very smooth eroded surfaces.

  8. Illinois' Career Cluster Model

    ERIC Educational Resources Information Center

    Jankowski, Natasha A.; Kirby, Catherine L.; Bragg, Debra D.; Taylor, Jason L.; Oertle, Kathleen M.

    2009-01-01

    This booklet provides information to multiple stakeholders on the implementation of career clusters in Illinois. The booklet is an extension of the previous edition titled "An Introduction to Illinois CTE Programs of Study" (2008), and provides a resource for partners to understand Illinois' Career Cluster Model as its own adaptation of the…

  9. Matlab Cluster Ensemble Toolbox

    Energy Science and Technology Software Center (ESTSC)

    2009-04-27

    This is a Matlab toolbox for investigating the application of cluster ensembles to data classification, with the objective of improving the accuracy and/or speed of clustering. The toolbox divides the cluster ensemble problem into four areas, providing functionality for each. These include, (1) synthetic data generation, (2) clustering to generate individual data partitions and similarity matrices, (3) consensus function generation and final clustering to generate ensemble data partitioning, and (4) implementation of accuracy metrics. Withmore » regard to data generation, Gaussian data of arbitrary dimension can be generated. The kcenters algorithm can then be used to generate individual data partitions by either, (a) subsampling the data and clustering each subsample, or by (b) randomly initializing the algorithm and generating a clustering for each initialization. In either case an overall similarity matrix can be computed using a consensus function operating on the individual similarity matrices. A final clustering can be performed and performance metrics are provided for evaluation purposes.« less

  10. Mixed-Initiative Clustering

    ERIC Educational Resources Information Center

    Huang, Yifen

    2010-01-01

    Mixed-initiative clustering is a task where a user and a machine work collaboratively to analyze a large set of documents. We hypothesize that a user and a machine can both learn better clustering models through enriched communication and interactive learning from each other. The first contribution or this thesis is providing a framework of…