Science.gov

Sample records for 19-rod clusters r3

  1. Overexpression of M68/DcR3 in human gastrointestinal tract tumors independent of gene amplification and its location in a four-gene cluster

    PubMed Central

    Bai, Chang; Connolly, Brett; Metzker, Michael L.; Hilliard, Catherine A.; Liu, Xiaomei; Sandig, Volker; Soderman, Avery; Galloway, Sheila M.; Liu, Qingyun; Austin, Christopher P.; Caskey, C. Thomas

    2000-01-01

    Fas-mediated apoptosis is an important regulator of cell survival, and abnormalities in this system have been shown to result in a number of human pathological conditions. A secreted member of the tumor necrosis factor receptor superfamily, DcR3, was recently reported to be amplified in human lung and colon cancers as a negative regulator of Fas-mediated apoptosis. We identified this gene, which we call M68. M68 genomic DNA, mRNA, and protein levels were examined in a series of human gastrointestinal tract tumors. Using M68 immunohistochemistry and a scoring system similar to that used for HER-2/neu, we found that M68 protein was overexpressed in 30 of 68 (44%) human adenocarcinomas of the esophagus, stomach, colon, and rectum. Tumors examined by Northern blot revealed M68 mRNA highly elevated in a similar fraction of primary tumors from the same gastrointestinal tract regions, as well as in the colon adenocarcinoma cell lines SW480 and SW1116. Further, we found M68 protein to be overexpressed in a substantial number of tumors in which gene amplification could not be detected by fluorescence in situ hybridization or quantitative genomic PCR, suggesting that overexpression of M68 may precede amplification in tumors. Finally, we find that M68 lies within a four-gene cluster that includes a novel helicase-like gene (NHL) related to RAD3/ERCC2, a plasma membrane Ras-related GTPase and a member of the stathmin family, amplification or overexpression of which may also contribute to cell growth and tumor progression. PMID:10655513

  2. A Gene Cluster for Biosynthesis of Mannosylerythritol Lipids Consisted of 4-O-β-D-Mannopyranosyl-(2R,3S)-Erythritol as the Sugar Moiety in a Basidiomycetous Yeast Pseudozyma tsukubaensis

    PubMed Central

    Saika, Azusa; Koike, Hideaki; Fukuoka, Tokuma; Yamamoto, Shuhei; Kishimoto, Takahide; Morita, Tomotake

    2016-01-01

    Mannosylerythritol lipids (MELs) belong to the glycolipid biosurfactants and are produced by various fungi. The basidiomycetous yeast Pseudozyma tsukubaensis produces diastereomer type of MEL-B, which contains 4-O-β-D-mannopyranosyl-(2R,3S)-erythritol (R-form) as the sugar moiety. In this respect it differs from conventional type of MELs, which contain 4-O-β-D-mannopyranosyl-(2S,3R)-erythritol (S-form) as the sugar moiety. While the biosynthetic gene cluster for conventional type of MELs has been previously identified in Ustilago maydis and Pseudozyma antarctica, the genetic basis for MEL biosynthesis in P. tsukubaensis is unknown. Here, we identified a gene cluster involved in MEL biosynthesis in P. tsukubaensis. Among these genes, PtEMT1, which encodes erythritol/mannose transferase, had greater than 69% identity with homologs from strains in the genera Ustilago, Melanopsichium, Sporisorium and Pseudozyma. However, phylogenetic analysis placed PtEMT1p in a separate clade from the other proteins. To investigate the function of PtEMT1, we introduced the gene into a P. antarctica mutant strain, ΔPaEMT1, which lacks MEL biosynthesis ability owing to the deletion of PaEMT1. Using NMR spectroscopy, we identified the biosynthetic product as MEL-A with altered sugar conformation. These results indicate that PtEMT1p catalyzes the sugar conformation of MELs. This is the first report of a gene cluster for the biosynthesis of diastereomer type of MEL. PMID:27327162

  3. A Gene Cluster for Biosynthesis of Mannosylerythritol Lipids Consisted of 4-O-β-D-Mannopyranosyl-(2R,3S)-Erythritol as the Sugar Moiety in a Basidiomycetous Yeast Pseudozyma tsukubaensis.

    PubMed

    Saika, Azusa; Koike, Hideaki; Fukuoka, Tokuma; Yamamoto, Shuhei; Kishimoto, Takahide; Morita, Tomotake

    2016-01-01

    Mannosylerythritol lipids (MELs) belong to the glycolipid biosurfactants and are produced by various fungi. The basidiomycetous yeast Pseudozyma tsukubaensis produces diastereomer type of MEL-B, which contains 4-O-β-D-mannopyranosyl-(2R,3S)-erythritol (R-form) as the sugar moiety. In this respect it differs from conventional type of MELs, which contain 4-O-β-D-mannopyranosyl-(2S,3R)-erythritol (S-form) as the sugar moiety. While the biosynthetic gene cluster for conventional type of MELs has been previously identified in Ustilago maydis and Pseudozyma antarctica, the genetic basis for MEL biosynthesis in P. tsukubaensis is unknown. Here, we identified a gene cluster involved in MEL biosynthesis in P. tsukubaensis. Among these genes, PtEMT1, which encodes erythritol/mannose transferase, had greater than 69% identity with homologs from strains in the genera Ustilago, Melanopsichium, Sporisorium and Pseudozyma. However, phylogenetic analysis placed PtEMT1p in a separate clade from the other proteins. To investigate the function of PtEMT1, we introduced the gene into a P. antarctica mutant strain, ΔPaEMT1, which lacks MEL biosynthesis ability owing to the deletion of PaEMT1. Using NMR spectroscopy, we identified the biosynthetic product as MEL-A with altered sugar conformation. These results indicate that PtEMT1p catalyzes the sugar conformation of MELs. This is the first report of a gene cluster for the biosynthesis of diastereomer type of MEL. PMID:27327162

  4. Dynamical Cosmological Constant in R 3 Gravity

    NASA Astrophysics Data System (ADS)

    Zare, Nasser; Fathi, Mohsen

    2015-03-01

    In this paper, we go through the famous f( R) theories of gravity, but keeping a peculiar one, namely R 3 modification. Moreover, instead of a coordinate free cosmological parameter, we take it to be a function of time. Having all these stuff, we investigate the notions of standard cosmology model, in the context of R 3 modification to general relativity, and in various regimes, we study the dynamical cosmological constant.

  5. Kinetics, safety and tolerability of (R)-3-hydroxybutyl (R)-3-hydroxybutyrate in healthy adult subjects

    PubMed Central

    Clarke, Kieran; Tchabanenko, Kirill; Pawlosky, Robert; Carter, Emma; King, M. Todd; Musa-Veloso, Kathy; Ho, Manki; Roberts, Ashley; Robertson, Jeremy; VanItallie, Theodore B.; Veech, Richard L.

    2013-01-01

    Induction of mild states of hyperketonemia may improve physical and cognitive performance. In this study, we determined the kinetic parameters, safety and tolerability of (R)-3-hydroxybutyl (R)-3-hydroxybutyrate, a ketone monoester administered in the form of a meal replacement drink to healthy human volunteers. Plasma levels of β-hydroxybutyrate and acetoacetate were elevated following administration of a single dose of the ketone monoester, whether at 140, 357, or 714 mg/kg body weight, while the intact ester was not detected. Maximum plasma levels of ketones were attained within 1–2 h, reaching 3.30 mM and 1.19 mM for β-hydroxybutyrate and acetoacetate, respectively, at the highest dose tested. The elimination half-life ranged from 0.8–3.1 h for β-hydroxybutyrate and 8–14 h for acetoacetate. The ketone monoester was also administered at 140, 357, and 714 mg/kg body weight, three times daily, over 5 days (equivalent to 0.42, 1.07, and 2.14 g/kg/d). The ketone ester was generally well-tolerated, although some gastrointestinal effects were reported, when large volumes of milk-based drink were consumed, at the highest ketone monoester dose. Together, these results suggest ingestion of (R)-3-hydroxybutyl (R)-3-hydroxybutyrate is a safe and simple method to elevate blood ketone levels, compared with the inconvenience of preparing and consuming a ketogenic diet. PMID:22561291

  6. DISINTEGRATING ASTEROID P/2013 R3

    SciTech Connect

    Jewitt, David; Li, Jing; Agarwal, Jessica; Weaver, Harold; Mutchler, Max; Larson, Stephen

    2014-03-20

    Splitting of the nuclei of comets into multiple components has been frequently observed but, to date, no main-belt asteroid has been observed to break up. Using the Hubble Space Telescope, we find that main-belt asteroid P/2013 R3 consists of 10 or more distinct components, the largest up to 200 m in radius (assumed geometric albedo of 0.05) each of which produces a coma and comet-like dust tail. A diffuse debris cloud with total mass ∼2 × 10{sup 8} kg further envelopes the entire system. The velocity dispersion among the components, ΔV ∼ 0.2-0.5 m s{sup –1}, is comparable to the gravitational escape speeds of the largest members, while their extrapolated plane-of-sky motions suggest a break up between 2013 February and September. The broadband optical colors are those of a C-type asteroid. We find no spectral evidence for gaseous emission, placing model-dependent upper limits to the water production rate ≤1 kg s{sup –1}. Breakup may be due to a rotationally induced structural failure of the precursor body.

  7. Creating "SMART" Supply Chain Scenarios Using SAP R/3

    ERIC Educational Resources Information Center

    Ragan, Joseph M.; McGettigan, Patrick J.; Storms, Michael R.; Rizman, Brian

    2004-01-01

    Pedagogical revisions to the undergraduate Haub School of Business curriculum at Saint Joseph's University employing the SAP R/3 system encompass the core accounting courses traversing the sophomore and junior years. The entire accounting curriculum was overhauled in order to integrate SAP R/3. Each course progressively builds upon and expands the…

  8. (2R,3R)-3-O-Benzoyl-N-benzyl­tartramide1

    PubMed Central

    Madura, Izabela D.; Zachara, Janusz; Bernaś, Urszula; Hajmowicz, Halina; Synoradzki, Ludwik

    2012-01-01

    The title compound, C18H17NO6 [systematic name: (2R,3R)-4-benzyl­amino-2-benzo­yloxy-3-hy­droxy-4-oxobutanoic acid], is the first structurally characterized unsymmetrical monoamide–monoacyl tartaric acid derivative. The mol­ecule shows a staggered conformation around the tartramide Csp3—Csp3 bond with trans-oriented carboxyl and amide groups. The mol­ecular conformation is stabilized by an intra­molecular N—H⋯O hydrogen bond. In the crystal, mol­ecules are linked by O—H⋯O hydrogen bonds between the carboxyl and amide carbonyl groups, forming translational chains along [001]. Further O—H⋯O and N—H⋯O hydrogen bonds as well as weaker C—H⋯O and C—H⋯π inter­molecular inter­actions extend the supra­molecular assembly into a double-layer structure parallel to (100). There are no directional inter­actions between the double layers. PMID:22719648

  9. R3D: Reduction Package for Integral Field Spectroscopy

    NASA Astrophysics Data System (ADS)

    Sánchez, Sebastián. F.

    2011-06-01

    R3D was developed to reduce fiber-based integral field spectroscopy (IFS) data. The package comprises a set of command-line routines adapted for each of these steps, suitable for creating pipelines. The routines have been tested against simulations, and against real data from various integral field spectrographs (PMAS, PPAK, GMOS, VIMOS and INTEGRAL). Particular attention is paid to the treatment of cross-talk. R3D unifies the reduction techniques for the different IFS instruments to a single one, in order to allow the general public to reduce different instruments data in an homogeneus, consistent and simple way. Although still in its prototyping phase, it has been proved to be useful to reduce PMAS (both in the Larr and the PPAK modes), VIMOS and INTEGRAL data. The current version has been coded in Perl, using PDL, in order to speed-up the algorithm testing phase. Most of the time critical algorithms have been translated to C[float=][/float], and it is our intention to translate all of them. However, even in this phase R3D is fast enough to produce valuable science frames in reasonable time.

  10. High Performance Analytics with the R3-Cache

    NASA Astrophysics Data System (ADS)

    Eavis, Todd; Sayeed, Ruhan

    Contemporary data warehouses now represent some of the world’s largest databases. As these systems grow in size and complexity, however, it becomes increasingly difficult for brute force query processing approaches to meet the performance demands of end users. Certainly, improved indexing and more selective view materialization are helpful in this regard. Nevertheless, with warehouses moving into the multi-terabyte range, it is clear that the minimization of external memory accesses must be a primary performance objective. In this paper, we describe the R 3-cache, a natively multi-dimensional caching framework designed specifically to support sophisticated warehouse/OLAP environments. R 3-cache is based upon an in-memory version of the R-tree that has been extended to support buffer pages rather than disk blocks. A key strength of the R 3-cache is that it is able to utilize multi-dimensional fragments of previous query results so as to significantly minimize the frequency and scale of disk accesses. Moreover, the new caching model directly accommodates the standard relational storage model and provides mechanisms for pro-active updates that exploit the existence of query “hot spots”. The current prototype has been evaluated as a component of the Sidera DBMS, a “shared nothing” parallel OLAP server designed for multi-terabyte analytics. Experimental results demonstrate significant performance improvements relative to simpler alternatives.

  11. Genome-wide identification of cassava R2R3 MYB family genes related to abscission zone separation after environmental-stress-induced abscission

    PubMed Central

    Liao, Wenbin; Yang, Yiling; Li, Yayun; Wang, Gan; Peng, Ming

    2016-01-01

    Cassava plants (Manihot esculenta Crantz) resist environmental stresses by shedding leaves in leaf pulvinus abscission zones (AZs), thus leading to adaptation to new environmental conditions. Little is known about the roles of cassava R2R3 MYB factors in regulating AZ separation. Herein, 166 cassava R2R3 MYB genes were identified. Evolutionary analysis indicated that the 166 R2R3 MYB genes could be divided into 11 subfamilies. Transcriptome analysis indicated that 26 R2R3 MYB genes were expressed in AZs across six time points during both ethylene- and water-deficit stress-induced leaf abscission. Comparative expression profile analysis of similar SOTA (Self Organizing Tree Algorithm) clusters demonstrated that 10 R2R3 MYB genes had similar expression patterns at six time points in response to both treatments. GO (Gene Ontology) annotation confirmed that all 10 R2R3 MYB genes participated in the responses to stress and ethylene and auxin stimuli. Analysis of the putative 10 R2R3 MYB promoter regions showed that those genes primarily contained ethylene- and stress-related cis-elements. The expression profiles of the genes acting downstream of the selected MYBs were confirmed to be involved in cassava abscission zone separation. All these results indicated that R2R3 MYB plays an important regulatory role in AZ separation. PMID:27573926

  12. Genome-wide identification of cassava R2R3 MYB family genes related to abscission zone separation after environmental-stress-induced abscission.

    PubMed

    Liao, Wenbin; Yang, Yiling; Li, Yayun; Wang, Gan; Peng, Ming

    2016-01-01

    Cassava plants (Manihot esculenta Crantz) resist environmental stresses by shedding leaves in leaf pulvinus abscission zones (AZs), thus leading to adaptation to new environmental conditions. Little is known about the roles of cassava R2R3 MYB factors in regulating AZ separation. Herein, 166 cassava R2R3 MYB genes were identified. Evolutionary analysis indicated that the 166 R2R3 MYB genes could be divided into 11 subfamilies. Transcriptome analysis indicated that 26 R2R3 MYB genes were expressed in AZs across six time points during both ethylene- and water-deficit stress-induced leaf abscission. Comparative expression profile analysis of similar SOTA (Self Organizing Tree Algorithm) clusters demonstrated that 10 R2R3 MYB genes had similar expression patterns at six time points in response to both treatments. GO (Gene Ontology) annotation confirmed that all 10 R2R3 MYB genes participated in the responses to stress and ethylene and auxin stimuli. Analysis of the putative 10 R2R3 MYB promoter regions showed that those genes primarily contained ethylene- and stress-related cis-elements. The expression profiles of the genes acting downstream of the selected MYBs were confirmed to be involved in cassava abscission zone separation. All these results indicated that R2R3 MYB plays an important regulatory role in AZ separation. PMID:27573926

  13. Additive manufacturing of poly[(R)-3-hydroxybutyrate-co-(R)-3-hydroxyhexanoate] scaffolds for engineered bone development.

    PubMed

    Mota, Carlos; Wang, Shen-Yu; Puppi, Dario; Gazzarri, Matteo; Migone, Chiara; Chiellini, Federica; Chen, Guo-Qiang; Chiellini, Emo

    2014-05-30

    A wide range of poly(hydroxyalkanoate)s (PHAs), a class of biodegradable polyesters produced by various bacteria grown under unbalanced conditions, have been proposed for the fabrication of tissue-engineering scaffolds. In this study, the manufacture of poly[(R)-3-hydroxybutyrate-co-(R)-3-hydroxyhexanoate] (or PHBHHx) scaffolds, by means of an additive manufacturing technique based on a computer-controlled wet-spinning system, was investigated. By optimizing the processing parameters, three-dimensional scaffolds with different internal architectures were fabricated, based on a layer-by-layer approach. The resulting scaffolds were characterized by scanning electron microscopy, which showed good control over the fibre alignment and a fully interconnected porous network, with porosity in the range 79-88%, fibre diameter 47-76 µm and pore size 123-789 µm. Moreover, the resulting fibres presented an internal porosity connected to the external fibre surface as a consequence of the phase-inversion process governing the solidification of the polymer solution. Scaffold compressive modulus and yield stress and strain could be varied in a certain range by changing the architectural parameters. Cell-culture experiments employing the MC3T3-E1 murine pre-osteoblast cell line showed good cell proliferation after 21 days of culture. The PHBHHx scaffolds demonstrated promising results in terms of cell differentiation towards an osteoblast phenotype. Copyright © 2014 John Wiley & Sons, Ltd. PMID:24889107

  14. Gold in the layered structures of R3Au7Sn3: From relativity to versatility

    DOE PAGESBeta

    Provino, Alessia; Steinberg, Simon Alexander; Smetana, Volodymyr; Paramanik, Uday; Manfrinetti, Pietro; Dhar, Sudesh Kumar; Mudring, Anja -Verena

    2016-07-11

    A new isotypic series of ternary rare earth element-gold-tetrel intermetallic compounds has been synthesized and their structures and properties have been characterized. R3Au7Sn3 (R = Y, La-Nd, Sm, Gd-Tm, Lu) crystallize with the hexagonal Gd3Au7Sn3 prototype (Pearson symbol hP26; P63/m, a = 8.110-8.372 Å, c = 9.351-9.609 Å, Vcell = 532.7-583.3 Å3, Z = 2), an ordered variant of the Cu10Sn3-type. Their structure is built up by GdPt2Sn-type layers, which feature edge-sharing Sn@Au6 trigonal antiprisms connected by trigonal R3 groups. Additional insertion of gold atoms leads to the formation of new homoatomic Au clusters, Au@Au6; alternatively, the structure can bemore » considered as a superstructural polyhedral packing of the ZrBeSi-type. The magnetization, heat ca-pacity and electrical resistivity have been measured for R3Au7Sn3 (R = Ce, Pr, Nd and Tb). All four compounds order antiferromagnetically with the highest TN of 13 K for Tb3Au7Sn3. In Ce3Au7Sn3, which has a TN of 2.9 K, the heat capacity and electrical resistivity data in zero and applied fields indicate the presence of Kondo interactions. The coefficient of the linear term in the electronic heat capacity, γ, derived from the heat capacity data below 0.5 K is 211 mJ/Ce mol K2 suggesting strong electronic correlations due to the Kondo interaction. The electronic structure calculations based on the projector augmented wave method for particular representatives of the series suggest different tendencies of the localized R-4f AOs to hybridize with the valence states. LMTO-based bonding analysis on the non-magnetic La3Au7Sn3 indicates that the integrated crystal orbital Hamilton popu-lations (COHPs) are dominated by the heteroatomic Au–Sn contacts; however, contributions from La–Au and La–Sn separations are significant, both together exceeding 40 % in the overall bonding. Furthermore, homoatomic Au–Au interactions are evident for the Au@Au6 units but, despite of the high atomic concentration of

  15. (R)-3-oxobutyl 3-hydroxybutanoate (OBHB) induces hyperketonemiain Alzheimer's disease.

    PubMed

    Chu, Chang-Biao; Jiao, Li-Dong

    2015-01-01

    The present study demonstrates the effect of (R)-3-oxobutyl 3-hydroxybutanoate (OBHB) on hyperketonemia in 2 patients with Alzheimer's disease dementia who were performed a mini-mental state examination score of above 11 and 10. The patients were treated with OBHB for 24 months and received usual diet. The patients were administered 15 g of OBHB three times per day for two days. The dosage of OBHB was increased to 30 g three times daily from the day 4. OBHB was always taken after adding with soda-flavoured syrups in order to mask the bitter taste. The measurement of plasma β-hydroxybutyrate (βHB) levels after every week was performed to determine OBHB plasma βHB dose-response relationships. Precision Xtra Glucose and Ketone Monitoring System (Abbott Diabetes Care, Inc., Alameda, CA, USA) was used to measure βHB levels in the blood samples. We did not observe any adverse effects of OBHB in any of the patients and it was well tolerated throughout the 24 months treatment period. Both of the patients showed marked improvement in mood, behaviour, self-care, cognitive and daily activity performance. The results revealed a marked improvement in conversation and interaction after administration of OBHB doses. The biochemical investigation of the blood samples before, during OBHB treatment and after 24 months of the treatment revealed only minor changes in the plasma lipids. There was a decrease in cholesterol level from 251 to 158 and 247 to 152 mg/dL in the two patients respectively after 24 months of the treatment. Similarly the level of high-density lipoprotein cholesterol was found to decrease from 157 to 79 and 149 to 76 mg/dL, respectively in two patients. Thus OBHB can be a promising agent in the treatment of hyperketonemia and can be taken as an oral supplement without changing the habitual diet. PMID:26221318

  16. Production of the Chiral Compound (R)-3-Hydroxybutyrate by a Genetically Engineered Methylotrophic Bacterium▿

    PubMed Central

    Hölscher, Tina; Breuer, Uta; Adrian, Lorenz; Harms, Hauke; Maskow, Thomas

    2010-01-01

    In this study, a methylotrophic bacterium, Methylobacterium rhodesianum MB 126, was used for the production of the chiral compound (R)-3-hydroxybutyrate (R-3HB) from methanol. R-3HB is formed during intracellular degradation of the storage polymer (R)-3-polyhydroxybutyrate (PHB). Since the monomer R-3HB does not accumulate under natural conditions, M. rhodesianum was genetically modified. The gene (hbd) encoding the R-3HB-degrading enzyme, R-3HB dehydrogenase, was inactivated in M. rhodesianum. The resulting hbd mutant still exhibited low growth rates on R-3HB as the sole source of carbon and energy, indicating the presence of alternative pathways for R-3HB utilization. Therefore, transposon mutagenesis was carried out with the hbd mutant, and a double mutant unable to grow on R-3HB was obtained. This mutant was shown to be defective in lipoic acid synthase (LipA), resulting in an incomplete citric acid cycle. Using the hbd lipA mutant, we produced 3.2 to 3.5 mM R-3HB in batch and 27 mM (2,800 mg liter−1) in fed-batch cultures. This was achieved by sequences of cultivation conditions initially favoring growth, then PHB accumulation, and finally PHB degradation. PMID:20581197

  17. Lipase-catalyzed resolution of (2R*,3S*)- and (2R*,3R*)-3-methyl-3-phenyl-2-aziridinemethanol at low temperatures and determination of the absolute configurations of the four stereoisomers.

    PubMed

    Sakai, Takashi; Liu, Yu; Ohta, Hiroshi; Korenaga, Toshinobu; Ema, Tadashi

    2005-02-18

    [reaction: see text] Lipase-catalyzed resolution of (2R*,3S*)-3-methyl-3-phenyl-2-aziridinemethanol, (+/-)-2, at low temperatures gave synthetically useful (2R,3S)-2 and its acetate (2S,3R)-2a with (2S)-selectivity (E = 55 at -40 degrees C), while a similar reaction of (2R*,3R*)-3-methyl-3-phenyl-2-aziridinemethanol, (+/-)-3, gave (2S,3S)-3 and its acetate (2R,3R)-3a with (2R)-selectivity (E = 73 at -20 degrees C). Compound (+/-)-2 was prepared conveniently via diastereoselective addition of MeMgBr to tert-butyl 3-phenyl-2H-azirine-2-carboxylate, (+/-)-1a, which was successfully prepared by the Neber reaction of oxime tosylate of tert-butyl benzoyl acetate 7a. The tert-butyl ester was requisite to promote this reaction. For determination of the absolute configuration of (2S,3R)-2a, enantiopure (2S,3R)-2 was independently prepared in three steps involving diastereoselective methylation of 3-phenyl-2H-azirine-2-methanol, (S)-10, with MeMgBr. The absolute configuration of (2S,3S)-3 was determined by X-ray analysis of the corresponding N-(S)-2-(6-methoxy-2-naphthyl)propanoyl derivative (S,S,S)-13. PMID:15704972

  18. Allelic variation of the Tas1r3 taste receptor gene selectively affects taste responses to sweeteners: evidence from 129.B6-Tas1r3 congenic mice.

    PubMed

    Inoue, Masashi; Glendinning, John I; Theodorides, Maria L; Harkness, Sarah; Li, Xia; Bosak, Natalia; Beauchamp, Gary K; Bachmanov, Alexander A

    2007-12-19

    The Tas1r3 gene encodes the T1R3 receptor protein, which is involved in sweet taste transduction. To characterize ligand specificity of the T1R3 receptor and the genetic architecture of sweet taste responsiveness, we analyzed taste responses of 129.B6-Tas1r3 congenic mice to a variety of chemically diverse sweeteners and glucose polymers with three different measures: consumption in 48-h two-bottle preference tests, initial licking responses, and responses of the chorda tympani nerve. The results were generally consistent across the three measures. Allelic variation of the Tas1r3 gene influenced taste responsiveness to nonnutritive sweeteners (saccharin, acesulfame-K, sucralose, SC-45647), sugars (sucrose, maltose, glucose, fructose), sugar alcohols (erythritol, sorbitol), and some amino acids (D-tryptophan, D-phenylalanine, L-proline). Tas1r3 genotype did not affect taste responses to several sweet-tasting amino acids (L-glutamine, L-threonine, L-alanine, glycine), glucose polymers (Polycose, maltooligosaccharide), and nonsweet NaCl, HCl, quinine, monosodium glutamate, and inosine 5'-monophosphate. Thus Tas1r3 polymorphisms affect taste responses to many nutritive and nonnutritive sweeteners (all of which must interact with a taste receptor involving T1R3), but not to all carbohydrates and amino acids. In addition, we found that the genetic architecture of sweet taste responsiveness changes depending on the measure of taste response and the intensity of the sweet taste stimulus. Variation in the T1R3 receptor influenced peripheral taste responsiveness over a wide range of sweetener concentrations, but behavioral responses to higher concentrations of some sweeteners increasingly depended on mechanisms that could override input from the peripheral taste system. PMID:17911381

  19. Gold-rich R3Au7Sn3: Establishing the interdependence between electronic features and physical properties

    DOE PAGESBeta

    Provino, Alessia; Steinberg, Simon; Smetana, Volodymyr; Kulkarni, Ruta; Dhar, Sudesh K.; Manfrinetti, Pietro; Mudring, Anja -Verena

    2015-05-18

    Two new polar intermetallic compounds Y3Au7Sn3 (I) and Gd3Au7Sn3 (II) have been synthesized and their structures have been determined by single crystal X-ray diffraction (P63/m; Z = 2, a = 8.148(1)/8.185(3), and c = 9.394(2)/9.415(3) for I/II, respectively). They can formally be assigned to the Cu10Sn3 type and consist of parallel slabs of Sn centered, edge-sharing trigonal Au6 antiprisms connected through R3 (R = Y, Gd) triangles. Additional Au atoms reside in the centres of trigonal Au6 prisms forming Au@Au6 clusters with Au–Au distances of 2.906–2.960 Å, while the R–R contacts in the R3 groups are considerably larger than themore » sums of their metallic radii. These exclusive structural arrangements provide alluring systems to study the synergism between strongly correlated systems, particularly, those in the structure of (II), and extensive polar intermetallic contacts, which has been inspected by measurements of the magnetic properties, heat capacities and electrical conductivities of both compounds. Gd3Au7Sn3 shows an antiferromagnetic ordering at 13 K, while Y3Au7Sn3 is a Pauli paramagnet and a downward curvature in its electrical resistivity at about 1.9 K points to a superconducting transition. DFT-based band structure calculations on R3Au7Sn3 (R = Y, Gd) account for the results of the conductivity measurements and different spin ordering models of (II) provide conclusive hints about its magnetic structure. As a result, chemical bonding analyses of both compounds indicate that the vast majority of bonding originates from the heteroatomic Au–Gd and Au–Sn interactions, while homoatomic Au–Au bonding is evident within the Au@Au6 clusters.« less

  20. Impaired Glucose Metabolism in Mice Lacking the Tas1r3 Taste Receptor Gene

    PubMed Central

    2015-01-01

    The G-protein-coupled sweet taste receptor dimer T1R2/T1R3 is expressed in taste bud cells in the oral cavity. In recent years, its involvement in membrane glucose sensing was discovered in endocrine cells regulating glucose homeostasis. We investigated importance of extraorally expressed T1R3 taste receptor protein in age-dependent control of blood glucose homeostasis in vivo, using nonfasted mice with a targeted mutation of the Tas1r3 gene that encodes the T1R3 protein. Glucose and insulin tolerance tests, as well as behavioral tests measuring taste responses to sucrose solutions, were performed with C57BL/6ByJ (Tas1r3+/+) inbred mice bearing the wild-type allele and C57BL/6J-Tas1r3tm1Rfm mice lacking the entire Tas1r3 coding region and devoid of the T1R3 protein (Tas1r3-/-). Compared with Tas1r3+/+ mice, Tas1r3-/- mice lacked attraction to sucrose in brief-access licking tests, had diminished taste preferences for sucrose solutions in the two-bottle tests, and had reduced insulin sensitivity and tolerance to glucose administered intraperitoneally or intragastrically, which suggests that these effects are due to absence of T1R3. Impairment of glucose clearance in Tas1r3-/- mice was exacerbated with age after intraperitoneal but not intragastric administration of glucose, pointing to a compensatory role of extraoral T1R3-dependent mechanisms in offsetting age-dependent decline in regulation of glucose homeostasis. Incretin effects were similar in Tas1r3+/+ and Tas1r3-/- mice, which suggests that control of blood glucose clearance is associated with effects of extraoral T1R3 in tissues other than the gastrointestinal tract. Collectively, the obtained data demonstrate that the T1R3 receptor protein plays an important role in control of glucose homeostasis not only by regulating sugar intake but also via its extraoral function, probably in the pancreas and brain. PMID:26107521

  1. Muscle regulatory factors regulate T1R3 taste receptor expression.

    PubMed

    Kokabu, Shoichiro; Lowery, Jonathan W; Toyono, Takashi; Seta, Yuji; Hitomi, Suzuro; Sato, Tsuyoshi; Enoki, Yuichiro; Okubo, Masahiko; Fukushima, Yosuke; Yoda, Tetsuya

    2015-12-25

    T1R3 is a T1R class of G protein-coupled receptors, composing subunit of the umami taste receptor when complexed with T1R1. T1R3 was originally discovered in gustatory tissue but is now known to be expressed in a wide variety of tissues and cell types such the intestine, pancreatic β-cells, skeletal muscle, and heart. In addition to taste recognition, the T1R1/T1R3 complex functions as an amino acid sensor and has been proposed to be a control mechanism for the secretion of hormones, such as cholecystokinin, insulin, and duodenal HCO3(-) and activates the mammalian rapamycin complex 1 (MTORC1) to inhibit autophagy. T1R3 knockout mice have increased rate of autophagy in the heart, skeletal muscle and liver. Thus, T1R3 has multiple physiological functions and is widely expressed in vivo. However, the exact mechanisms regulating T1R3 expression are largely unknown. Here, we used comparative genomics and functional analyses to characterize the genomic region upstream of the annotated transcriptional start of human T1R3. This revealed that the T1R3 promoter in human and mouse resides in an evolutionary conserved region (ECR). We also identified a repressive element located upstream of the human T1R3 promoter that has relatively high degree of conservation with rhesus macaque. Additionally, the muscle regulatory factors MyoD and Myogenin regulate T1R3 expression and T1R3 expression increases with skeletal muscle differentiation of murine myoblast C2C12 cells. Taken together, our study raises the possibility that MyoD and Myogenin might control skeletal muscle metabolism and homeostasis through the regulation of T1R3 promoter activity. PMID:26545778

  2. New Linear and Star-Shaped Thermogelling Poly([R]-3-hydroxybutyrate) Copolymers.

    PubMed

    Barouti, Ghislaine; Liow, Sing Shy; Dou, Qingqing; Ye, Hongye; Orione, Clément; Guillaume, Sophie M; Loh, Xian Jun

    2016-07-18

    The synthesis of multi-arm poly([R]-3-hydroxybutyrate) (PHB)-based triblock copolymers (poly([R]-3-hydroxybutyrate)-b-poly(N-isopropylacrylamide)-b-[[poly(methyl ether methacrylate)-g-poly(ethylene glycol)]-co-[poly(methacrylate)-g-poly(propylene glycol)

  3. Expansion and diversification of the Populus R2R3-MYB family of transcription factors.

    PubMed

    Wilkins, Olivia; Nahal, Hardeep; Foong, Justin; Provart, Nicholas J; Campbell, Malcolm M

    2009-02-01

    The R2R3-MYB proteins comprise one of the largest families of transcription factors in plants. R2R3-MYB family members regulate plant-specific processes, such as the elaboration of specialized cell types, including xylem, guard cells, trichomes, and root hairs, and the biosynthesis of specialized branches of metabolism, including phenylpropanoid biosynthesis. As such, R2R3-MYB family members are hypothesized to contribute to the emergence of evolutionary innovations that have arisen in specific plant lineages. As a first step in determining the role played by R2R3-MYB family members in the emergence of lineage-specific innovations in the genus Populus, the entire Populus trichocarpa R2R3-MYB family was characterized. The Populus R2R3-MYB complement is much larger than that found in other angiosperms with fully sequenced genomes. Phylogenetic analyses, together with chromosome placement, showed that the expansion of the Populus R2R3-MYB family was not only attributable to whole genome duplication but also involved selective expansion of specific R2R3-MYB clades. Expansion of the Populus R2R3-MYB family prominently involved members with expression patterns that suggested a role in specific components of Populus life history, including wood formation and reproductive development. An expandable compendium of microarray-based expression data (PopGenExpress) and associated Web-based tools were developed to better enable within- and between-species comparisons of Populus R2R3-MYB gene expression. This resource, which includes intuitive graphic visualization of gene expression data across multiple tissues, organs, and treatments, is freely available to, and expandable by, scientists wishing to better understand the genome biology of Populus, an ecologically dominant and economically important forest tree genus. PMID:19091872

  4. Closure report for underground storage tank 141-R3U1 and its associated underground piping

    SciTech Connect

    Mallon, B.J.; Blake, R.G.

    1994-03-01

    Underground storage tank UST 141-R3U1 at Lawrence Livermore National Laboratory (LLNL), was registered with the State Water Resources Control Board on June 27, 1984. This tank system consisted of a concrete tank, lined with polyvinyl chloride, and approximately 100 feet of PVC underground piping. UST 141-R3U1 had a capacity of 450 gallons. The underground piping connected three floor drains and one sink inside Building 141 to UST 141-R3U1. The wastewater collected in UST 141-R3U1 contained organic solvents, metals, and inorganic acids. On November 30, 1987, the 141-R3U1 tank system failed a precision tank test. The 141-R3U1 tank system was subsequently emptied and removed from service pending further precision tests to determine the location of the leak within the tank system. A precision tank test on February 5, 1988, was performed to confirm the November 30, 1987 test. Four additional precision tests were performed on this tank system between February 25, 1988, and March 6, 1988. The leak was located where the inlet piping from Building 141 penetrates the concrete side of UST 141-R3U1. The volume of wastewater that entered the backfill and soil around and/or beneath UST 141-R3U1 is unknown. On December 13, 1989, the LLNL Environmental Restoration Division submitted a plan to close UST 141-R3U1 and its associated piping to the Alameda County Department of Environmental Health. UST 141-R3U1 was closed as an UST, and shall be used instead as additional secondary containment for two aboveground storage tanks.

  5. A regulatory gene network related to the porcine umami taste receptor (TAS1R1/TAS1R3).

    PubMed

    Kim, J M; Ren, D; Reverter, A; Roura, E

    2016-02-01

    Taste perception plays an important role in the mediation of food choices in mammals. The first porcine taste receptor genes identified, sequenced and characterized, TAS1R1 and TAS1R3, were related to the dimeric receptor for umami taste. However, little is known about their regulatory network. The objective of this study was to unfold the genetic network involved in porcine umami taste perception. We performed a meta-analysis of 20 gene expression studies spanning 480 porcine microarray chips and screened 328 taste-related genes by selective mining steps among the available 12,320 genes. A porcine umami taste-specific regulatory network was constructed based on the normalized coexpression data of the 328 genes across 27 tissues. From the network, we revealed the 'taste module' and identified a coexpression cluster for the umami taste according to the first connector with the TAS1R1/TAS1R3 genes. Our findings identify several taste-related regulatory genes and extend previous genetic background of porcine umami taste. PMID:26554867

  6. Online / Offline reconstruction of trigger-less readout in the R3B experiment at FAIR

    NASA Astrophysics Data System (ADS)

    Kresan, Dmytro; Al-Turany, Mohammad; Uhlig, Florian

    2015-12-01

    The R3B (Reactions with Rare Radioactive Beams) experiment is one of the planned experiments at the future FAIR facility at GSI Darmstadt. R3B will cover experimental reaction studies with exotic nuclei far off stability, thus enabling a broad physics program with rare-isotope beams with emphasis on nuclear structure and dynamics. Several different detection subsystems as well as sophisticated DAQ system and data-analysis software are being developed for this purpose. The data analysis software for R3B is based on FairRoot framework and called R3BRoot. R3BRoot is being used for simulation and detector design studies for the last few years. Recently, it was successfully used directly with the data acquisition and for the analysis of the R3B test beam-time in April 2014. For the future beam times the framework has to deal with the free streaming readout of the detectors. The implementation within R3BRoot to fulfil this trigger-less run mode will be discussed in this paper, as well as the set of tools developed for the online reconstruction and quality assurance of the data during the run.

  7. Novel aspects of the Z and R3 antigens of Streptococcus agalactiae revealed by immunological testing.

    PubMed

    Maeland, Johan A; Radtke, Andreas; Lyng, Randi V; Mavenyengwa, Rooyen T

    2013-04-01

    Group B streptococci (GBS) are important human and bovine pathogens which can be classified by a variety of phenotype- and gene-based techniques. The capsular polysaccharide and strain-variable, surface-anchored proteins are particularly important phenotypic markers. In an earlier study, a previously unrecognized protein antigen called Z was described. It was expressed by 27.2% of GBS strains from Zimbabwe, usually in combination with R3 protein expression. In this study, a putative Z-specific antiserum actually contained antibodies against two different antigens named Z1 and Z2; Z1 was >250 kDa in molecular mass. Z1, Z2, and R3 generated multiple stained bands on Western blots and showed similar chromatographic characteristics with respect to molecular mass, aggregate formation, and charge. Of 28 reference and prototype GBS strains examined, 8/28 (28.5%) isolates expressed one, two, or all three of the Z1, Z2, and R3 antigens; 4/28 expressed all three antigens; 2/28 expressed Z2 and R3; 1/28 expressed Z1 only; and 1/28 expressed R3 only. Twenty (71.5%) of the 28 isolates expressed none of the three antigens. Expression of one or more of these antigens was shown by isolates of the capsular polysaccharide types Ia, Ib, V, and IX and NT strains and occurred in combination with expression of various other strain-variable and surface-localized protein antigens. When used as serosubtype markers, Z1, Z2, and R3 affected existing GBS serotype designations for some of the isolates. For instance, the R3 reference strain Prague 10/84 (ATCC 49447) changed serotype markers from V/R3 to V/R3, Z1, and Z2. Other isolates may change correspondingly, implying consequences for GBS serotyping and research. PMID:23408530

  8. Long-time behavior of solution for the compressible nematic liquid crystal flows in R3

    NASA Astrophysics Data System (ADS)

    Gao, Jincheng; Tao, Qiang; Yao, Zheng-an

    2016-08-01

    In this paper, we investigate the global existence and long-time behavior of classical solution for the compressible nematic liquid crystal flows in three-dimensional whole space. First of all, the global existence of classical solution is established under the condition that the initial data are close to the constant equilibrium state in HN (R3) (N ≥ 3)-framework. Then, one establishes algebraic time decay for the classical solution by weighted energy method. Finally, the algebraic decay rate of classical solution in Lp (R3)-norm with 2 ≤ p ≤ ∞ and optimal decay rate of their spatial derivative in L2 (R3)-norm are obtained if the initial perturbation belong to L1 (R3) additionally.

  9. Regulation of Cell Fate Determination by Single-Repeat R3 MYB Transcription Factors in Arabidopsis

    SciTech Connect

    Wang, Shucai; Chen, Jay

    2014-01-01

    MYB transcription factors regulate multiple aspects of plant growth and development. Among the large family of MYB transcription factors, single-repeat R3 MYB are characterized by their short sequence (<120 amino acids) consisting largely of the single MYB DNA-binding repeat. In the model plant Arabidopsis, R3 MYBs mediate lateral inhibition during epidermal patterning and are best characterized for their regulatory roles in trichome and root hair development. R3 MYBs act as negative regulators for trichome formation but as positive regulators for root hair development. In this article, we provide a comprehensive review on the role of R3 MYBs in the regulation of cell type specification in the model plant Arabidopsis.

  10. Genome-Wide Identification and Characterization of R2R3MYB Family in Cucumis sativus

    PubMed Central

    Li, Qiang; Zhang, Cunjia; Li, Jing; Wang, Lina; Ren, Zhonghai

    2012-01-01

    Background The R2R3MYB proteins comprise one of the largest families of transcription factors in plants. Although genome-wide analysis of this family has been carried out in some species, little is known about R2R3MYB genes in cucumber (Cucumis sativus L.). Principal Findings This study has identified 55 R2R3MYB genes in the latest cucumber genome and the CsR2R3MYB family contained the smallest number of identified genes compared to other species that have been studied due to the absence of recent gene duplication events. These results were also supported by genome distribution and gene duplication analysis. Phylogenetic analysis showed that they could be classified into 11 subgroups. The evolutionary relationships and the intron - exon organizations that showed similarities with Arabidopsis, Vitis and Glycine R2R3MYB proteins were also analyzed and suggested strong gene conservation but also the expansions of particular functional genes during the evolution of the plant species. In addition, we found that 8 out of 55 (∼14.54%) cucumber R2R3MYB genes underwent alternative splicing events, producing a variety of transcripts from a single gene, which illustrated the extremely high complexity of transcriptome regulation. Tissue-specific expression profiles showed that 50 cucumber R2R3MYB genes were expressed in at least one of the tissues and the other 5 genes showed very low expression in all tissues tested, which suggested that cucumber R2R3MYB genes took part in many cellular processes. The transcript abundance level analysis during abiotic conditions (NaCl, ABA and low temperature treatments) identified a group of R2R3MYB genes that responded to one or more treatments. Conclusions This study has produced a comparative genomics analysis of the cucumber R2R3MYB gene family and has provided the first steps towards the selection of CsR2R3MYB genes for cloning and functional dissection that can be used in further studies to uncover their roles in cucumber growth and

  11. Molecular field theory analysis of R 3Co 11B 4 compounds

    NASA Astrophysics Data System (ADS)

    Xiang-Mu, Zhang; Rui-Wang, Huang; Zhong-Wu, Zhang

    2002-03-01

    The temperature dependence of magnetization of the R 3Co 11B 4 compounds has been analysed using the two-sublattice molecular field theory. The molecular field coefficients, nCoCo, nRCo, nRR, have been calculated by a numerical fitting process. The analytic form of the exchange field HR( T) varying with temperature for each of the R 3Co 11B 4 compounds is presented, and some results are discussed.

  12. External mitochondrial NADH-dependent reductase of redox cyclers: VDAC1 or Cyb5R3?

    PubMed

    Nikiforova, Anna B; Saris, Nils-Erik L; Kruglov, Alexey G

    2014-09-01

    It was reported that VDAC1 possesses an NADH oxidoreductase activity and plays an important role in the activation of xenobiotics in the outer mitochondrial membrane. In the present work, we evaluated the participation of VDAC1 and Cyb5R3 in the NADH-dependent activation of various redox cyclers in mitochondria. We show that external NADH oxidoreductase caused the redox cycling of menadione ≫ lucigenin>nitrofurantoin. Paraquat was predominantly activated by internal mitochondria oxidoreductases. An increase in the ionic strength stimulated and suppressed the redox cycling of negatively and positively charged acceptors, as was expected for the Cyb5R3-mediated reduction. Antibodies against Cyb5R3 but not VDAC substantially inhibited the NADH-related oxidoreductase activities. The specific VDAC blockers G3139 and erastin, separately or in combination, in concentrations sufficient for the inhibition of substrate transport, exhibited minimal effects on the redox cycler-dependent NADH oxidation, ROS generation, and reduction of exogenous cytochrome c. In contrast, Cyb5R3 inhibitors (6-propyl-2-thiouracil, p-chloromercuriobenzoate, quercetin, mersalyl, and ebselen) showed similar patterns of inhibition of ROS generation and cytochrome c reduction. The analysis of the spectra of the endogenous cytochromes b5 and c in the presence of nitrofurantoin and the inhibitors of VDAC and Cyb5R3 demonstrated that the redox cycler can transfer electrons from Cyb5R3 to endogenous cytochrome c. This caused the oxidation of outer membrane-bound cytochrome b5, which is in redox balance with Cyb5R3. The data obtained argue against VDAC1 and in favor of Cyb5R3 involvement in the activation of redox cyclers in the outer mitochondrial membrane. PMID:24945955

  13. A potent antibrowning agent from pine needles of Cedrus deodara: 2R,3R-dihydromyricetin.

    PubMed

    Liang, Xue; Wu, Yan-Ping; Qiu, Jing-Hong; Zhong, Kai; Gao, Hong

    2014-09-01

    This article focuses on finding the novel antibrowning agents from the pine needles of Cedrus deodara and studying its antibrowning effect. By bioassay guide of tyrosinase inhibitory activity, the main active compound was isolated and purified from 50% methanol extract of pine needles of C. deodara through macroporous resin Diaion HP-20 column chromatography and high-performance liquid chromatography. Based on mass and nuclear magnetic resonance data, the active compound was identified as 2R,3R-dihydromyricetin, which showed the potent monophenolase and diphenolase inhibitory activities. Moreover, 2R,3R-dihydromyricetin exhibited a strong ABTS radical scavenging activity with a dose-dependent manner. The antibrowning efficacy of 2R,3R-dihydromyricetin was evaluated by monitoring the changes of L*, a*, and b* values and total color difference (△E) on fresh-cut apple slices. It was found that 2R,3R-dihydromyricetin was effective in inhibiting the browning of apple slices treated with a concentration as low as 0.05% at 25 °C for 24 h. Its antibrowning effect was significantly better than ascorbic acid (0.5%) alone. Furthermore, 2R,3R-dihydromyricetin showed a good synergistic antibrowning effect with ascorbic acid. This is the first report that 2R,3R-dihydromyricetin from pine needles of C. deodara may be used as a potential antibrowning agent in protecting against food browning. PMID:25163933

  14. Involvement of glucocorticoid in induction of lingual T1R3 in rodents.

    PubMed

    Ogawa, Nobuhumi; Kanki, Keita; Honda, Kotaro; Tomooka, Yasuhiro; Ryoke, Kazuo; Watanabe, Tatsuo

    2015-08-15

    We previously reported that in rats, chronic exposure to stress inhibits the induction of the common receptor (T1R3) for sweet and umami tastes. Here, we investigated whether endogenous glucocorticoids (GCs) might be responsible for this inhibition. In addition, we used mouse taste-bud cells (TB cells) expressing T1R3 to examine the effect of exogenous GC on T1R3 induction. Both adrenal glands were removed from rats [adrenalectomized (ADX) rats] and T1R3 mRNA expression in fungiform papillae was examined by real-time RT-PCR. T1R3 mRNA expression was significantly reduced in the ADX rats (versus sham-ADX rats). The reduced mRNA expression was restored to the level seen in the sham-ADX rats by administration of dexamethasone (DEX) at the smallest dose tested (0.1ng/kg, i.p.). However, with larger doses of DEX (10 and 1000ng/kg, i.p.) there was no such restoration (i.e., the expression level did not differ from that seen in ADX rats). Expression of the mRNA for the GC receptor-α was detected in mouse TB cells by RT-PCR. Significantly reduced T1R3 mRNA expression, as measured by real-time RT-PCR, was observed in TB cells at 24h after application of DEX (0.1, 1.0, or 10μM). These results suggest that in rodents: (a) a low concentration of endogenous GC is necessary and sufficient for induction of T1R3 expression, and that higher concentrations may actually inhibit such induction, and (b) this inhibitory effect may be due, at least in part, to a direct action of GC on taste cells. PMID:26096555

  15. Hubble Investigation of the First Known, Multi-Fragment Main Belt Comet: P/2013 R3

    NASA Astrophysics Data System (ADS)

    Jewitt, David

    2013-10-01

    Comet-like object P/2013 R3, announced on 2013 Sept 27, is the latest of the newly discovered class of active asteroids {equivalently main-belt comets, MBCs}. Observations with the Keck 10-m telescope on Oct 01 and 02 reveal that P/2013 R3 is a multiple object, with three co-moving components resolved at 1.0 arcsec resolution. Multiplicity has never before been seen in the MBCs and offers the opportunity to study internal dynamics in detail. We request five orbits of DD time to explore P/2013 R3 at resolutions and sensitivities only possible with Hubble, to search for fainter fragments and to determine the dynamics of the components. P/2013 R3 is a leading candidate for a body breaking up under rotational stresses {presumably induced by YORP radiation forces}, and Hubble data will test this hypothesis by pin-pointing the dates of ejection of the fragments, their speeds, and their directions. Our Hubble MBC program has been remarkably successful in probing the activation triggers for this new class of objects, and our proposed program on P/2013 R3 will provide the first opportunity to track fragments associated with the activation event.

  16. Heightened Avidity for Trisodium Pyrophosphate in Mice Lacking Tas1r3

    PubMed Central

    Aleman, Tiffany R.; McCaughey, Stuart A.

    2015-01-01

    Laboratory rats and mice prefer some concentrations of tri- and tetrasodium pyrophosphate (Na3HP2O7 and Na4P2O7) to water, but how they detect pyrophosphates is unknown. Here, we assessed whether T1R3 is involved. We found that relative to wild-type littermate controls, Tas1r3 knockout mice had stronger preferences for 5.6–56mM Na3HP2O7 in 2-bottle choice tests, and they licked more 17.8–56mM Na3HP2O7 in brief-access tests. We hypothesize that pyrophosphate taste in the intact mouse involves 2 receptors: T1R3 to produce a hedonically negative signal and an unknown G protein-coupled receptor to produce a hedonically positive signal; in Tas1r3 knockout mice, the hedonically negative signal produced by T1R3 is absent, leading to a heightened avidity for pyrophosphate. PMID:25452580

  17. Decoy Strategies: The Structure of TL1A:DcR3 Complex

    SciTech Connect

    C Zhan; Y Patskovsky; Q Yan; Z Li; U Ramagopal; H Cheng; M Brenowitz; X Hui; S Nathenson; S Almo

    2011-12-31

    Decoy Receptor 3 (DcR3), a secreted member of the Tumor Necrosis Factor (TNF) receptor superfamily, neutralizes three different TNF ligands: FasL, LIGHT, and TL1A. Each of these ligands engages unique signaling receptors which direct distinct and critical immune responses. We report the crystal structures of the unliganded DcR3 ectodomain and its complex with TL1A, as well as complementary mutagenesis and biochemical studies. These analyses demonstrate that DcR3 interacts with invariant backbone and side-chain atoms in the membrane-proximal half of TL1A which supports recognition of its three distinct TNF ligands. Additional features serve as antideterminants that preclude interaction with other members of the TNF superfamily. This mode of interaction is unique among characterized TNF:TNFR family members and provides a mechanistic basis for the broadened specificity required to support the decoy function of DcR3, as well as for the rational manipulation of specificity and affinity of DcR3 and its ligands.

  18. Conformational Analysis of R-(+)-3-METHYLCYCLOPENTANONE by IR Spectroscopy in Para-Hydrogen Crystal

    NASA Astrophysics Data System (ADS)

    Al-Basheer, Watheq; Toh, Shin Yi; Miyazaki, Jun; Momose, Takamasa

    2014-06-01

    Para-hydrogen (pH_2) soft quantum crystal is an ideal isolation matrix due to its impressive intrinsic properties, i.e. its significant lattice constant, large zero-point vibration as well as its ability to repair itself of crystal defects. To investigate molecular conformation of a chiral ketone, IR spectra of R-(+)-3-methylcyclopentanone (R3MCP), hosted in pH_2 crystal, were recorded as a function of sample concentration and host pH_2 crystal temperature over the low deposition range {3.5-6.0K}. IR spectra of R3MCP in pH_2 crystal will be presented and compared against corresponding spectra in Ar matrix as well as IR spectra of the neat crystalline R3MCP at low deposition temperatures. Furthermore, density functional theory calculations of simulated IR spectra for the optimized geometries of R3MCP, equatorial-methyl and axial-methyl conformers are compared against experimental spectra for the purpose of investigating molecular conformation. Upon comparison between theoretical and experimental IR spectra, vibrational modes arising from equatorial and axial conformers have been successfully assigned and related to the individual conformer's structure.

  19. Tau Assembly: The Dominant Role of PHF6 (VQIVYK) in Microtubule Binding Region Repeat R3

    PubMed Central

    Ganguly, Pritam; Do, Thanh D.; Larini, Luca; LaPointe, Nichole E.; Sercel, Alexander J.; Shade, Madeleine F.; Feinstein, Stuart C.; Bowers, Michael T.; Shea, Joan-Emma

    2015-01-01

    Self-aggregation of the microtubule-binding protein Tau reduces its functionality and is tightly associated with Tau-related diseases, termed tauopathies. Tau aggregation is also strongly associated with two nucleating six-residue segments, namely PHF6 (VQIVYK) and PHF6* (VQIINK). In this paper, using experiments and computational modeling, we study the self-assembly of individual and binary mixtures of Tau fragments containing PHF6* (R2/wt; 273GKVQIINKKLDL284) and PHF6 (R3/wt; 306VQIVYKPVDLSK317), and a mutant R2/ΔK280 associated with a neurodegenerative tauopathy. The initial stage of aggregation is probed by ion-mobility mass spectrometry, the kinetics of aggregation monitored with Thioflavin T assays and the morphology of aggregates visualized by transmission electron microscopy. Insights into the structure of early aggregates and the factors stabilizing the aggregates are obtained from replica exchange molecular dynamics simulations. Our data suggest that R3/wt has a much stronger aggregation propensity than either R2/wt or R2/ΔK280. Heterodimers containing R3/wt are less stable than R3/wt homodimers but much more stable than homodimers of R2/wt and R2/ΔK280, suggesting a possible role of PHF6*/PHF6 interactions in initiating the aggregation of full length Tau. Lastly, R2/ΔK280 binds stronger to R3/wt than R2/wt suggesting a possible mechanism for a pathological loss of normal Tau function. PMID:25775228

  20. The chain length of biologically produced (R)-3-hydroxyalkanoic acid affects biological activity and structure of anti-cancer peptides.

    PubMed

    Szwej, Emilia; Devocelle, Marc; Kenny, Shane; Guzik, Maciej; O'Connor, Stephen; Nikodinovic-Runic, Jasmina; Radivojevic, Jelena; Maslak, Veselin; Byrne, Annete T; Gallagher, William M; Zulian, Qun Ren; Zinn, Manfred; O'Connor, Kevin E

    2015-06-20

    Conjugation of DP18L peptide with (R)-3-hydroxydecanoic acid, derived from the biopolymer polyhydroxyalkanoate, enhances its anti-cancer activity (O'Connor et al., 2013. Biomaterials 34, 2710-2718). However, it is unknown if other (R)-3-hydroxyalkanoic acids (R3HAs) can enhance peptide activity, if chain length affects enhancement, and what effect R3HAs have on peptide structure. Here we show that the degree of enhancement of peptide (DP18L) anti-cancer activity by R3HAs is carbon chain length dependent. In all but one example the R3HA conjugated peptides were more active against cancer cells than the unconjugated peptides. However, R3HAs with 9 and 10 carbons were most effective at improving DP18L activity. DP18L peptide variant DP17L, missing a hydrophobic amino acid (leucine residue 4) exhibited lower efficacy against MiaPaCa cells. Circular dichroism analysis showed DP17L had a lower alpha helix content and the conjugation of any R3HA ((R)-3-hydroxyhexanoic acid to (R)-3-hydroxydodecanoic acid) to DP17L returned the helix content back to levels of DP18L. However (R)-3-hydroxyhexanoic did not enhance the anti-cancer activity of DP17L and at least 7 carbons were needed in the R3HA to enhance activity of D17L. DP17L needs a longer chain R3HA to achieve the same activity as DP18L conjugated to an R3HA. As a first step to assess the synthetic potential of polyhydroxyalkanoate derived R3HAs, (R)-3-hydroxydecanoic acid was synthetically converted to (±)3-chlorodecanoic acid, which when conjugated to DP18L improved its antiproliferative activity against MiaPaCa cells. PMID:25820126

  1. Matrix embeddings on flat R3 and the geometry of membranes

    NASA Astrophysics Data System (ADS)

    Berenstein, David; Dzienkowski, Eric

    2012-10-01

    We show that given three Hermitian matrices, what one could call a fuzzy representation of a membrane, there is a well-defined procedure to define a set of oriented Riemann surfaces embedded in R3 using an index function defined for points in R3 that is constructed from the three matrices and the point. The set of surfaces is covariant under rotations, dilatations and translation operations on R3; it is additive on direct sums; and the orientation of the surfaces is reversed by complex conjugation of the matrices. The index we build is closely related to the Hanany-Witten effect. We also show that the surfaces carry information of a line bundle with connection on them. We discuss applications of these ideas to the study of holographic matrix models and black hole dynamics.

  2. Topological aspects of the structure of chaotic attractors in R3

    NASA Astrophysics Data System (ADS)

    Tsankov, Tsvetelin Draganov

    We extend the methods for topological analysis of chaotic dynamical systems in R3 by introducing two new concepts---embedding manifolds and their canonical forms. These are used to specify in topological terms the large scale global structure of chaotic attracting sets. We show how these ideas help us put the finishing touch on the third coarsest level in a classification scheme for strange attractors in R3 , for which the two lower levels have been constructed about a decade ago. In addition we present a guide on how to construct a Poincare surface of section for strange attractors with Lyapunov dimension dL < 3. We show how to extract information about the canonical form from scalar time series. In addition we discuss what possible changes occur to the topological properties of the unstable periodic orbits in the strange attractor, as we use different embedding mappings into R3 .

  3. R3D Align: global pairwise alignment of RNA 3D structures using local superpositions

    PubMed Central

    Rahrig, Ryan R.; Leontis, Neocles B.; Zirbel, Craig L.

    2010-01-01

    Motivation: Comparing 3D structures of homologous RNA molecules yields information about sequence and structural variability. To compare large RNA 3D structures, accurate automatic comparison tools are needed. In this article, we introduce a new algorithm and web server to align large homologous RNA structures nucleotide by nucleotide using local superpositions that accommodate the flexibility of RNA molecules. Local alignments are merged to form a global alignment by employing a maximum clique algorithm on a specially defined graph that we call the ‘local alignment’ graph. Results: The algorithm is implemented in a program suite and web server called ‘R3D Align’. The R3D Align alignment of homologous 3D structures of 5S, 16S and 23S rRNA was compared to a high-quality hand alignment. A full comparison of the 16S alignment with the other state-of-the-art methods is also provided. The R3D Align program suite includes new diagnostic tools for the structural evaluation of RNA alignments. The R3D Align alignments were compared to those produced by other programs and were found to be the most accurate, in comparison with a high quality hand-crafted alignment and in conjunction with a series of other diagnostics presented. The number of aligned base pairs as well as measures of geometric similarity are used to evaluate the accuracy of the alignments. Availability: R3D Align is freely available through a web server http://rna.bgsu.edu/R3DAlign. The MATLAB source code of the program suite is also freely available for download at that location. Supplementary information: Supplementary data are available at Bioinformatics online. Contact: r-rahrig@onu.edu PMID:20929913

  4. Distinct Human and Mouse Membrane Trafficking Systems for Sweet Taste Receptors T1r2 and T1r3

    PubMed Central

    Shimizu, Madoka; Goto, Masao; Kawai, Takayuki; Yamashita, Atsuko; Kusakabe, Yuko

    2014-01-01

    The sweet taste receptors T1r2 and T1r3 are included in the T1r taste receptor family that belongs to class C of the G protein-coupled receptors. Heterodimerization of T1r2 and T1r3 is required for the perception of sweet substances, but little is known about the mechanisms underlying this heterodimerization, including membrane trafficking. We developed tagged mouse T1r2 and T1r3, and human T1R2 and T1R3 and evaluated membrane trafficking in human embryonic kidney 293 (HEK293) cells. We found that human T1R3 surface expression was only observed when human T1R3 was coexpressed with human T1R2, whereas mouse T1r3 was expressed without mouse T1r2 expression. A domain-swapped chimera and truncated human T1R3 mutant showed that the Venus flytrap module and cysteine-rich domain (CRD) of human T1R3 contain a region related to the inhibition of human T1R3 membrane trafficking and coordinated regulation of human T1R3 membrane trafficking. We also found that the Venus flytrap module of both human T1R2 and T1R3 are needed for membrane trafficking, suggesting that the coexpression of human T1R2 and T1R3 is required for this event. These results suggest that the Venus flytrap module and CRD receive taste substances and play roles in membrane trafficking of human T1R2 and T1R3. These features are different from those of mouse receptors, indicating that human T1R2 and T1R3 are likely to have a novel membrane trafficking system. PMID:25029362

  5. Genome Sequencing and Transposon Mutagenesis of Burkholderia seminalis TC3.4.2R3 Identify Genes Contributing to Suppression of Orchid Necrosis Caused by B. gladioli.

    PubMed

    Araújo, Welington L; Creason, Allison L; Mano, Emy T; Camargo-Neves, Aline A; Minami, Sonia N; Chang, Jeff H; Loper, Joyce E

    2016-06-01

    From a screen of 36 plant-associated strains of Burkholderia spp., we identified 24 strains that suppressed leaf and pseudobulb necrosis of orchid caused by B. gladioli. To gain insights into the mechanisms of disease suppression, we generated a draft genome sequence from one suppressive strain, TC3.4.2R3. The genome is an estimated 7.67 megabases in size, with three replicons, two chromosomes, and the plasmid pC3. Using a combination of multilocus sequence analysis and phylogenomics, we identified TC3.4.2R3 as B. seminalis, a species within the Burkholderia cepacia complex that includes opportunistic human pathogens and environmental strains. We generated and screened a library of 3,840 transposon mutants of strain TC3.4.2R3 on orchid leaves to identify genes contributing to plant disease suppression. Twelve mutants deficient in suppression of leaf necrosis were selected and the transposon insertions were mapped to eight loci. One gene is in a wcb cluster that is related to synthesis of extracellular polysaccharide, a key determinant in bacterial-host interactions in other systems, and the other seven are highly conserved among Burkholderia spp. The fundamental information developed in this study will serve as a resource for future research aiming to identify mechanisms contributing to biological control. PMID:26959838

  6. R3D-2-MSA: the RNA 3D structure-to-multiple sequence alignment server.

    PubMed

    Cannone, Jamie J; Sweeney, Blake A; Petrov, Anton I; Gutell, Robin R; Zirbel, Craig L; Leontis, Neocles

    2015-07-01

    The RNA 3D Structure-to-Multiple Sequence Alignment Server (R3D-2-MSA) is a new web service that seamlessly links RNA three-dimensional (3D) structures to high-quality RNA multiple sequence alignments (MSAs) from diverse biological sources. In this first release, R3D-2-MSA provides manual and programmatic access to curated, representative ribosomal RNA sequence alignments from bacterial, archaeal, eukaryal and organellar ribosomes, using nucleotide numbers from representative atomic-resolution 3D structures. A web-based front end is available for manual entry and an Application Program Interface for programmatic access. Users can specify up to five ranges of nucleotides and 50 nucleotide positions per range. The R3D-2-MSA server maps these ranges to the appropriate columns of the corresponding MSA and returns the contents of the columns, either for display in a web browser or in JSON format for subsequent programmatic use. The browser output page provides a 3D interactive display of the query, a full list of sequence variants with taxonomic information and a statistical summary of distinct sequence variants found. The output can be filtered and sorted in the browser. Previous user queries can be viewed at any time by resubmitting the output URL, which encodes the search and re-generates the results. The service is freely available with no login requirement at http://rna.bgsu.edu/r3d-2-msa. PMID:26048960

  7. A Neuro-genetic Control Scheme Application for Industrial R 3 Workspaces

    NASA Astrophysics Data System (ADS)

    Irigoyen, E.; Larrea, M.; Valera, J.; Gómez, V.; Artaza, F.

    This work presents a neuro-genetic control scheme for a R 3 workspace application. The solution is based on a Multi Objective Genetic Algorithm reference generator and an Adaptive Predictive Neural Network Controller. Crane position control is presented as an application of the proposed control scheme.

  8. Project R-3, San Jose, Calif: Evaluation of Results and Development of a Cost Model.

    ERIC Educational Resources Information Center

    Rapp, M. L.; And Others

    This report is an evaluation by the Rand Corporation of a project designed to raise reading and arithmetic achievement of disadvantaged junior high school students. The project was prepared by Lockheed Missiles and Space Company for the San Jose Unified School District. Described are both the original R-3 program for a small number of students and…

  9. R3D-2-MSA: the RNA 3D structure-to-multiple sequence alignment server

    PubMed Central

    Cannone, Jamie J.; Sweeney, Blake A.; Petrov, Anton I.; Gutell, Robin R.; Zirbel, Craig L.; Leontis, Neocles

    2015-01-01

    The RNA 3D Structure-to-Multiple Sequence Alignment Server (R3D-2-MSA) is a new web service that seamlessly links RNA three-dimensional (3D) structures to high-quality RNA multiple sequence alignments (MSAs) from diverse biological sources. In this first release, R3D-2-MSA provides manual and programmatic access to curated, representative ribosomal RNA sequence alignments from bacterial, archaeal, eukaryal and organellar ribosomes, using nucleotide numbers from representative atomic-resolution 3D structures. A web-based front end is available for manual entry and an Application Program Interface for programmatic access. Users can specify up to five ranges of nucleotides and 50 nucleotide positions per range. The R3D-2-MSA server maps these ranges to the appropriate columns of the corresponding MSA and returns the contents of the columns, either for display in a web browser or in JSON format for subsequent programmatic use. The browser output page provides a 3D interactive display of the query, a full list of sequence variants with taxonomic information and a statistical summary of distinct sequence variants found. The output can be filtered and sorted in the browser. Previous user queries can be viewed at any time by resubmitting the output URL, which encodes the search and re-generates the results. The service is freely available with no login requirement at http://rna.bgsu.edu/r3d-2-msa. PMID:26048960

  10. Subspecialization of R2R3-MYB Repressors for Anthocyanin and Proanthocyanidin Regulation in Forage Legumes

    PubMed Central

    Albert, Nick W.

    2015-01-01

    The synthesis of anthocyanin pigments and proanthocyanidins (condensed tannins) is regulated by MYB-bHLH-WDR (MBW) transcription factor complexes in all angiosperms studied to date. Tr-MYB133 and Tr-MYB134 were isolated from Trifolium repens and encode R2R3-MYBs that antagonize the activity of MBW activation complexes. These two genes are conserved in other legume species, and form two sub-clades within the larger anthocyanin/proanthocyanidin clade of MYB repressors. However, unlike petunia and Arabidopsis, these R2R3-MYB repressors do not prevent ectopic accumulation of anthocyanins or proanthocyanidins. Instead, they are expressed when anthocyanins or proanthocyanidins are being synthesized, and provide feedback regulation to MBW complexes. This feedback occurs because Tr-MYB133 and Tr-MYB134 are themselves regulated by MBW complexes. Tr-MYB133 is regulated by MBW complexes containing anthocyanin-related R2R3-MYB proteins (Tr-RED LEAF), while Tr-MYB134 is regulated by complexes containing the proanthocyanidin R2R3-MYBs (Tr-MYB14). Other features of the MBW gene regulation networks are also conserved within legumes, including the ability for the anthocyanin MBW complexes to activate the expression of the AN1/TT8 clade bHLH factor. The regulation of Tr-MYB133 and Tr-MYB134 by distinct, pathway-specific MBW complexes has resulted in subspecialization for controlling anthocyanin or proanthocyanidin synthesis. PMID:26779194

  11. Structure of the S1S2 Glutamate Binding Domain of GluR3

    PubMed Central

    Ahmed, Ahmed H.; Wang, Qi; Sondermann, Holger; Oswald, Robert E.

    2009-01-01

    Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system. Determining the structural differences between the binding sites of different subtypes is crucial to our understanding of neuronal circuits and to the development of subtype specific drugs. The structures of the binding domain (S1S2) of the GluR3 (flip) AMPA receptor subunit bound to glutamate and AMPA and the GluR2 (flop) subunit bound to glutamate were determined by X-ray crystallography to 1.9, 2.1, and 1.55 Å, respectively. Overall, the structure of GluR3 (flip) S1S2 is very similar to GluR2 (flop) S1S2 (backbone RMSD of 0.30 ± 0.05 for glutamate-bound and 0.26 ± 0.01 for AMPA-bound). The differences in the flip and flop isoforms are subtle and largely arise from one hydrogen bond across the dimer interface and associated water molecules. Comparison of the binding affinity for various agonists and partial agonists suggest that the S1S2 domains of GluR2 and GluR3 show only small differences in affinity, unlike what is found for the intact receptors (with the exception of one ligand, Cl-HIBO, which has a ten-fold difference in affinity for GluR2 vs GluR3). PMID:19003990

  12. Production of (R)-3-hydroxybutyric acid by Burkholderia cepacia from wood extract hydrolysates

    PubMed Central

    2014-01-01

    (R)-hydroxyalkanoic acids (R-HAs) are valuable building blocks for the synthesis of fine chemicals and biopolymers because of the chiral center and the two active functional groups. Hydroxyalkanoic acids fermentation can revolutionize the polyhydroxyalkanoic acids (PHA) production by increasing efficiency and enhancing product utility. Modifying the fermentation conditions that promotes the in vivo depolymerization and secretion to fermentation broth in wild type bacteria is a novel and promising approach to produce R-HAs. Wood extract hydrolysate (WEH) was found to be a suitable substrate for R-3-hydroxybutyric acid (R-3-HB) production by Burkholderia cepacia. Using Paulownia elongate WEH as a feedstock, the R-3-HB concentration in fermentation broth reached as high as 14.2 g/L after 3 days of batch fermentation and the highest concentration of 16.8 g/L was obtained at day 9. Further investigation indicated that the composition of culture medium contributed to the enhanced R-3-HB production. PMID:24949263

  13. Genome-wide identification and characterization of R2R3MYB family in Rosaceae.

    PubMed

    González, Máximo; Carrasco, Basilio; Salazar, Erika

    2016-09-01

    Transcription factors R2R3MYB family have been associated with the control of secondary metabolites, development of structures, cold tolerance and response to biotic and abiotic stress, among others. In recent years, genomes of Rosaceae botanical family are available. Although this information has been used to study the karyotype evolution of these species from an ancestral genome, there are no studies that treat the evolution and diversity of gene families present in these species or in the botanical family. Here we present the first comparative study of the R2R3MYB subfamily of transcription factors in three species of Rosaceae family (Malus domestica, Prunus persica and Fragaria vesca). We described 186, 98 and 86 non-redundant gene models for apple, peach and strawberry, respectively. In this research, we analyzed the intron-exon structure and genomic distribution of R2R3MYB families mentioned above. The phylogenetic comparisons revealed putative functions of some R2R3MYB transcription factors. This analysis found 44 functional subgroups, seven of which were unique for Rosaceae. In addition, our results showed a highly collinearity among some genes revealing the existence of conserved gene models between the three species studied. Although some gene models in these species have been validated under several approaches, more research in the Rosaceae family is necessary to determine gene expression patterns in specific tissues and development stages to facilitate understanding of the regulatory and biochemical mechanism in this botanical family. PMID:27408811

  14. Tau assembly: the dominant role of PHF6 (VQIVYK) in microtubule binding region repeat R3.

    PubMed

    Ganguly, Pritam; Do, Thanh D; Larini, Luca; LaPointe, Nichole E; Sercel, Alexander J; Shade, Madeleine F; Feinstein, Stuart C; Bowers, Michael T; Shea, Joan-Emma

    2015-04-01

    Self-aggregation of the microtubule-binding protein Tau reduces its functionality and is tightly associated with Tau-related diseases, termed tauopathies. Tau aggregation is also strongly associated with two nucleating six-residue segments, namely PHF6 (VQIVYK) and PHF6* (VQIINK). In this paper, using experiments and computational modeling, we study the self-assembly of individual and binary mixtures of Tau fragments containing PHF6* (R2/wt; (273)GKVQIINKKLDL(284)) and PHF6 (R3/wt; (306)VQIVYKPVDLSK(317)) and a mutant R2/ΔK280 associated with a neurodegenerative tauopathy. The initial stage of aggregation is probed by ion-mobility mass spectrometry, the kinetics of aggregation monitored with Thioflavin T assays, and the morphology of aggregates visualized by transmission electron microscopy. Insights into the structure of early aggregates and the factors stabilizing the aggregates are obtained from replica exchange molecular dynamics simulations. Our data suggest that R3/wt has a much stronger aggregation propensity than either R2/wt or R2/ΔK280. Heterodimers containing R3/wt are less stable than R3/wt homodimers but much more stable than homodimers of R2/wt and R2/ΔK280, suggesting a possible role of PHF6*-PHF6 interactions in initiating the aggregation of full-length Tau. Lastly, R2/ΔK280 binds more strongly to R3/wt than R2/wt, suggesting a possible mechanism for a pathological loss of normal Tau function. PMID:25775228

  15. A MarR Family Transcriptional Regulator, DptR3, Activates Daptomycin Biosynthesis and Morphological Differentiation in Streptomyces roseosporus

    PubMed Central

    Zhang, Qinling; Chen, Qiong; Zhuang, Shuai; Chen, Zhi; Li, Jilun

    2015-01-01

    Daptomycin produced by Streptomyces roseosporus is an important lipopeptide antibiotic used to treat human infections caused by Gram-positive pathogenic bacteria, including drug-resistant strains. The genetic basis for regulatory mechanisms of daptomycin production is poorly known. Here, we characterized the dptR3 gene, which encodes a MarR family transcriptional regulator located adjacent to the known daptomycin biosynthetic (dpt) genes. Deletion of dptR3 reduced daptomycin production significantly and delayed aerial mycelium formation and sporulation on solid media. Dissection of the mechanism underlying the function of DptR3 in daptomycin production revealed that it stimulates daptomycin production indirectly by altering the transcription of dpt structural genes. DptR3 directly activated the transcription of its own gene, dptR3, but repressed the transcription of the adjacent, divergent gene orf16 (which encodes a putative ABC transporter ATP-binding protein). A 66-nucleotide DptR3-binding site in the intergenic region of dptR3-orf16 was determined by DNase I footprinting, and the palindromic sequence TCATTGTTACCTATGCTCACAATGA (underlining indicates inverted repeats) in the protected region was found to be essential for DptR3 binding. orf16, the major target gene of DptR3, exerted a positive effect on daptomycin biosynthesis. Our findings indicate that DptR3 functions as a global regulator that positively controls daptomycin production and morphological development in S. roseosporus. PMID:25819953

  16. (2R,3S,2”R,3”R)-manniflavanone, a new gastrointestinal smooth muscle L-type calcium channel inhibitor, which underlies the spasmolytic properties of Garcinia buchananii stem bark extract

    PubMed Central

    Balemba, Onesmo B.; Lösch, Sofie; Patterson, Savannah; McMillan, John S.; Hofmann, Thomas; Mawe, Gary M.; Stark, Timo D.

    2016-01-01

    Garcinia buchananii Baker stem bark extract (GBB) is a traditional medication of diarrhea and dysentery in sub-Saharan Africa. It is believed that GBB causes gastrointestinal smooth muscle relaxation. The aim of this study was to determine whether GBB has spasmolytic actions and identify compounds underlying these actions. Calcium (Ca2+) imaging was used to analyze the effect of GBB on Ca2+ flashes and Ca2+ waves in guinea pig gallbladder and distal colon smooth muscle. Intracellular microelectrode recording was used to determine the effect of GBB, six fractions of GBB, M1–5 and M7, and (2R,3S,2”R,3”R)-manniflavanone, a compound isolated from M3 on action potentials in gallbladder smooth muscle. The technique was also used to analyze the effect of GBB, M3, and (2R,3S,2”R,3”R)-manniflavanone on action potentials in the circular muscle of mouse and guinea pig distal colons, and the effect of GBB and (2R,3S,2”R,3”R)-manniflavanone on slow waves in porcine ileum. GBB inhibited Ca2+ flashes and Ca2+ waves. GBB, M3 and (2R,3S,2”R,3”R)-manniflavanone inhibited action potentials. L-type Ca2+ channel activator Bay K 8644 increased the discharge of action potentials in mouse colon but did not trigger or increase action potentials in the presence of GBB and (2R,3S,2”R,3”R)-manniflavanone. GBB and (2R,3S,2”R,3”R)-manniflavanone inhibited action potentials in the presence of Bay K 8644. GBB and (2R,3S,2”R,3”R)-manniflavanone reduced the amplitude but did not alter the frequency of slow waves in the porcine ileum. In conclusion, GBB and (2R,3S,2”R,3”R)-manniflavanone relax smooth muscle by inhibiting L-type Ca2+ channels, thus have potential for use as therapies of gastrointestinal smooth muscle spasms, and arrhythmias. PMID:26081368

  17. (2R,3S,2'' R,3''R)-manniflavanone, a new gastrointestinal smooth muscle L-type calcium channel inhibitor, which underlies the spasmolytic properties of Garcinia buchananii stem bark extract.

    PubMed

    Balemba, Onesmo B; Stark, Timo D; Lösch, Sofie; Patterson, Savannah; McMillan, John S; Mawe, Gary M; Hofmann, Thomas

    2014-01-01

    Garcinia buchananii Baker stem bark extract (GBB) is a traditional medication of diarrhea and dysentery in sub-Saharan Africa. It is believed that GBB causes gastrointestinal smooth muscle relaxation. The aim of this study was to determine whether GBB has spasmolytic actions and identify compounds underlying these actions. Calcium (Ca(2+)) imaging was used to analyze the effect of GBB on Ca(2+) flashes and Ca(2+) waves in guinea pig gallbladder and distal colon smooth muscle. Intracellular microelectrode recording was used to determine the effect of GBB, six fractions of GBB, M1-5 and M7, and (2R,3S,2'' R,3''R)-manniflavanone, a compound isolated from M3 on action potentials in gallbladder smooth muscle. The technique was also used to analyze the effect of GBB, M3, and (2R,3S,2'' R,3''R)-manniflavanone on action potentials in the circular muscle of mouse and guinea pig distal colons, and the effect of GBB and (2R,3S,2''R,3'' R)-manniflavanone on slow waves in porcine ileum. GBB inhibited Ca(2+) flashes and Ca(2+) waves. GBB, M3 and (2R,3 S,2''R,3''R)-manniflavanone inhibited action potentials. L-type Ca(2+) channel activator Bay K 8644 increased the discharge of action potentials in mouse colon but did not trigger or increase action potentials in the presence of GBB and (2R,3S,2''R,3'' R)-manniflavanone. GBB and (2R,3S,2'' R,3''R)-manniflavanone inhibited action potentials in the presence of Bay K 8644. GBB and (2R,3 S,2''R,3''R)-manniflavanone reduced the amplitude but did not alter the frequency of slow waves in the porcine ileum. In conclusion, GBB and (2R,3S,2'' R,3''R)-manniflavanone relax smooth muscle by inhibiting L-type Ca(2+) channels, thus have potential for use as therapies of gastrointestinal smooth muscle spasms, and arrhythmias. PMID:26081368

  18. CLUSTER CHEMISTRY

    SciTech Connect

    Muetterties, Earl L.

    1980-05-01

    Metal cluster chemistry is one of the most rapidly developing areas of inorganic and organometallic chemistry. Prior to 1960 only a few metal clusters were well characterized. However, shortly after the early development of boron cluster chemistry, the field of metal cluster chemistry began to grow at a very rapid rate and a structural and a qualitative theoretical understanding of clusters came quickly. Analyzed here is the chemistry and the general significance of clusters with particular emphasis on the cluster research within my group. The importance of coordinately unsaturated, very reactive metal clusters is the major subject of discussion.

  19. Existence and multiplicity of solutions for Kirchhoff-type equation with radial potentials in {R3}

    NASA Astrophysics Data System (ADS)

    Li, Anran; Su, Jiabao

    2015-12-01

    In this paper, we deal with the Kirchhoff-type equation -[1+intlimits_{{{R}}^3} (|nabla u|^2+V(x)u^2)dx ][Δ u+V(x)u] = λ Q(x) f(u), quad xin {{R}}^3, quad quad quad {(P)_λ} u(x)→ 0, quad as |x|→ ∞ , where {λ > 0}, V and Q are radial functions, which can be vanishing or coercive at infinity. With assumptions on f just in a neighborhood of the origin, existence and multiplicity of nontrivial radial solutions are obtained via variational methods. In particular, if f is sublinear and odd near the origin, we obtain infinitely many solutions of {(P)_λ} for any {λ > 0}.

  20. Chiral crystal-structure transformation of R3Co4Sn13 (R =La and Ce )

    NASA Astrophysics Data System (ADS)

    Otomo, Yuka; Iwasa, Kazuaki; Suyama, Kazuya; Tomiyasu, Keisuke; Sagayama, Hajime; Sagayama, Ryoko; Nakao, Hironori; Kumai, Reiji; Murakami, Youichi

    2016-08-01

    The compounds designated as R3T4Sn13 (R = rare earth and T = transition metal) are hypothesized to be strongly correlated electron systems. Some of these compounds exhibit structural phase transitions with speculated charge-density-wave (CDW) formations. We carried out x-ray diffraction measurements in order to investigate the second-order phase transition of R3Co4Sn13 (R =La and Ce ) by using single-crystalline samples synthesized by the molten Sn-flux method. Both compounds exhibit the structural superlattice transformations characterized by the wave vector q =(1 /2 ,1 /2 ,0 ) below TD≃160 K, which originate from electronic states owing to the common Co and Sn. The space group of the low-temperature phase is evidenced as a chiral cubic I 213 . The magnetic-susceptibility enhancement and the Co-ion valence shift below TD are signatures of a phase transition not fully attributed to the conventional CDW formation.

  1. Effects of Nitrogen Resources on Fermentative Biohydrogen Production of Biohydrogenbacterium R3 sp.nov.

    NASA Astrophysics Data System (ADS)

    Chen, Hong; Han, Wei; Yue, Li-ran; Li, Yong-feng; Liu, Kun; Yang, Chuan-ping

    2010-11-01

    This study discussed the effects of nitrogen resources (include organic nitrogen resources and inorganic nitrogen resources) on hydrogen production bacterium (HPB) Biohydrogenbacterium R3 sp.nov. The performance of organic nitrogen resource to Biohydrogenbacterium R3 sp.nov. was better than that of inorganic nitrogen resource on cell growth and hydrogen production. Yeast powder was most beneficial to promote cell growth and hydrogen production among all those nitrogen resources with the maximum of hydrogen production yield, hydrogen production ration and specific hydrogen produce ration were 1529.69 ml H2/L, 16.94 mmol H2/g CDW•h and 1.33 mol H2/mol glucose, respectively.

  2. Comprehensive behavioral study of mGluR3 knockout mice: implication in schizophrenia related endophenotypes

    PubMed Central

    2014-01-01

    Background We previously performed systematic association studies of glutamate receptor gene family members with schizophrenia, and found positive associations of polymorphisms in the GRM3 (a gene of metabotropic glutamate receptor 3: mGluR3) with the disorder. Physiological roles of GRM3 in brain functions and its functional roles in the pathogenesis of schizophrenia remain to be resolved. Results We generated mGluR3 knockout (KO) mice and conducted comprehensive behavioral analyses. KO mice showed hyperactivity in the open field, light/dark transition, and 24-hour home cage monitoring tests, impaired reference memory for stressful events in the Porsolt forced swim test, impaired contextual memory in cued and contextual fear conditioning test, and impaired working memory in the T-Maze forced alternation task test. Hyperactivity and impaired working memory are known as endophenotypes of schizophrenia. We examined long-term synaptic plasticity by assessing long-term potentiation (LTP) in the CA1 region in the hippocampi of KO and wild-type (WT) mice. We observed no differences in the amplitude of LTP between the two genotypes, suggesting that mGluR3 is not essential for LTP in the CA1 region of the mouse hippocampus. As hyperactivity is typically associated with increased dopaminergic transmission, we performed in vivo microdialysis measurements of extracellular dopamine in the nucleus accumbens of KO and WT mice. We observed enhancements in the methamphetamine (MAP)-induced release of dopamine in KO mice. Conclusions These results demonstrate that a disturbance in the glutamate-dopamine interaction may be involved in the pathophysiology of schizophrenia-like behavior, such as hyperactivity in mGluR3 KO mice. PMID:24758191

  3. Stereoselective Synthesis of (R)-3-Methylthalidomide by Piperidin-2-one Ring Assembly Approach.

    PubMed

    Yadav, Shyam Raj; Tiwari, Vinay Shankar; Haq, Wahajul

    2015-09-01

    A simple and stereoselective synthesis of 3-methylthalidomide, a configurationally stable thalidomide analog, is presented. Herein we describe the synthesis of (R)-3-methylthalidomide starting from (S)-alanine by piperidin-2-one ring assembly approach in high yield and enantiomeric purity without using a chiral auxiliary or reagent. Starting from (R)-alanine, the corresponding (S)-3-methylthalidomide can be prepared using the same methodology. PMID:26079113

  4. Antiausterity activity of arctigenin enantiomers: importance of (2R,3R)-absolute configuration.

    PubMed

    Awale, Suresh; Kato, Mamoru; Dibwe, Dya Fita; Li, Feng; Miyoshi, Chika; Esumi, Hiroyasu; Kadota, Shigetoshi; Tezuka, Yasuhiro

    2014-01-01

    From a MeOH extract of powdered roots of Wikstroemia indica, six dibenzyl-gamma-butyrolactone-type lignans with (2S,3S)-absolute configuration [(+)-arctigenin (1), (+)-matairesinol (2), (+)-trachelogenin (3), (+)-nortrachelogenin (4), (+)-hinokinin (5), and (+)-kusunokinin (6)] were isolated, whereas three dibenzyl-gamma-butyrolactone-type lignans with (2R,3R)-absolute configuration [(-)-arctigenin (1*), (-)-matairesinol (2*), (-)-trachelogenin (3*)] were isolated from Trachelospermum asiaticum. The in vitro preferential cytotoxic activity of the nine compounds was evaluated against human pancreatic PANC-1 cancer cells in nutrient-deprived medium (NDM), but none of the six lignans (1-6) with (2S,3S)-absolute configuration showed preferential cytotoxicity. On the other hand, three lignans (1*-3*) with (2R,3R)-absolute configuration exhibited preferential cytotoxicity in a concentration-dependent manner with PC50 values of 0.54, 6.82, and 5.85 microM, respectively. Furthermore, the effect of (-)- and (+)-arctigenin was evaluated against the activation of Akt, which is a key process in the tolerance to nutrition starvation. Interestingly, only (-)-arctigenin (1*) strongly suppressed the activation of Akt. These results indicate that the (2R,3R)-absolute configuration of (-)-enantiomers should be required for the preferential cytotoxicity through the inhibition of Akt activation. PMID:24660468

  5. Metabolism of (Z)-(1R,3R)-Profluthrin in Rats.

    PubMed

    Abe, Jun; Nagahori, Hirohisa; Omori, Rie; Mikata, Kazuki; Kurosawa, Motohiro; Tomigahara, Yoshitaka; Isobe, Naohiko

    2015-10-01

    When [benzyl-α-(14)C]-labeled (Z)-(1R,3R)-profluthrin (2,3,5,6-tetrafluoro-4-methylbenzyl (Z)-(1R,3R)-2,2-dimethyl-3-(prop-1-enyl) cyclopropanecarboxylate, a newly developed pyrethroid) was administered orally to rats at 1 mg/kg, around 70% was absorbed, metabolized, and mainly excreted into urine within 48 h. Radioactivity in plasma reached Cmax at 6-8 h, and decreased (half-life; 37-52 h). A similar tendency was observed also in tissues. Absorption rate was slightly lower at high dose, while kinetics and distribution did not change. Eight metabolites were detected in urine and one in feces. Most of the (14)C in feces was unabsorbed (Z)-(1R,3R)-profluthrin. The main metabolic reactions were ester cleavage, hydroxylation of the methyl group on the C4-position of the benzene ring, and its glucuronidation or oxidation to carboxylic acid. Oxidation of the geminal dimethyl on the cyclopropane-C2 to carboxylic acid, oxidation followed by hydration of the propenyl double bond, and ω-oxidation to carboxylic acid and mercapturic acid conjugation of the benzyl alcohol were observed as minor reactions. PMID:26357989

  6. The cysteine-rich region of T1R3 determines responses to intensely sweet proteins.

    PubMed

    Jiang, Peihua; Ji, Qingzhou; Liu, Zhan; Snyder, Lenore A; Benard, Lumie M J; Margolskee, Robert F; Max, Marianna

    2004-10-22

    A wide variety of chemically diverse compounds taste sweet, including natural sugars such as glucose, fructose, sucrose, and sugar alcohols, small molecule artificial sweeteners such as saccharin and acesulfame K, and proteins such as monellin and thaumatin. Brazzein, like monellin and thaumatin, is a naturally occurring plant protein that humans, apes, and Old World monkeys perceive as tasting sweet but that is not perceived as sweet by other species including New World monkeys, mouse, and rat. It has been shown that heterologous expression of T1R2 plus T1R3 together yields a receptor responsive to many of the above-mentioned sweet tasting ligands. We have determined that the molecular basis for species-specific sensitivity to brazzein sweetness depends on a site within the cysteine-rich region of human T1R3. Other mutations in this region of T1R3 affected receptor activity toward monellin, and in some cases, overall efficacy to multiple sweet compounds, implicating this region as a previously unrecognized important determinant of sweet receptor function. PMID:15299024

  7. Enzyme-catalyzed synthesis of poly[(R)-(-)-3-hydroxybutyrate]: Formation of macroscopic granules in vitro

    SciTech Connect

    Gerngross, T.U.; Martin, D.P.

    1995-07-03

    A combined chemical and enzymatic procedure has been developed to synthesize macroscopic poly[(R)-(-)-3-hydroxybutyrate] (PHB) granules in vitro. The granules form in a matter of minutes when purified polyhydroxyalkanoate (PHA) synthase from Alcaligenes eutrophus is exposed to synthetically prepared (R)-3-hydroxybutyryl coenzyme A, thereby establishing the minimal requirements for PHB granule formation. The artificial granules are spherical with diameters of up to 3 {mu}m and significantly larger than their native counterparts (0.5 {mu}m). The isolated PHB was characterized by {sup 1}H and {sup 13}C NMR, gel-permeation chromatography, and chemical analysis. The in vitro polymerization system yields PHB with a molecular mass > 10 x 10{sup 6} Da, exceeding by an order of magnitude the mass of PHAs typically extracted from microorganisms. We also demonstrate that the molecular mass of the polymer can be controlled by the initial PHA synthase concentration. Preliminary kinetic analysis of de novo granule formation confirms earlier findings of a lag time for the enzyme but suggests the involvement of an additional granule assembly step. Minimal requirements for substrate recognition were investigated. Since substrate analogs lacking the adenosine 3{prime}, 5{prime}-bisphosphate moiety of (R)-3-hydroxybutyryl coenzyme A were not accepted by the PHA synthase, we provide evidence that this structural element of the substrate is essential for catalysis. PHAs provide a range of natural, renewable, biodegradable thermoplastics with a broad range of useful material properties. 33 refs., 6 figs., 1 tab.

  8. A R2R3-MYB Transcription Factor from Epimedium sagittatum Regulates the Flavonoid Biosynthetic Pathway

    PubMed Central

    Lv, Haiyan; Luo, Ming; Zeng, Shaohua; Pattanaik, Sitakanta; Yuan, Ling; Wang, Ying

    2013-01-01

    Herba epimedii (Epimedium), a traditional Chinese medicine, has been widely used as a kidney tonic and antirheumatic medicine for thousands of years. The bioactive components in herba epimedii are mainly prenylated flavonol glycosides, end-products of the flavonoid pathway. Epimedium species are also used as garden plants due to the colorful flowers and leaves. Many R2R3-MYB transcription factors (TFs) have been identified to regulate the flavonoid and anthocyanin biosynthetic pathways. However, little is known about the R2R3-MYB TFs involved in regulation of the flavonoid pathway in Epimedium. Here, we reported the isolation and functional characterization of the first R2R3-MYB TF (EsMYBA1) from Epimedium sagittatum (Sieb. Et Zucc.) Maxim. Conserved domains and phylogenetic analysis showed that EsMYBA1 belonged to the subgroup 6 clade (anthocyanin-related MYB clade) of R2R3-MYB family, which includes Arabidopsis AtPAP1, apple MdMYB10 and legume MtLAP1. EsMYBA1 was preferentially expressed in leaves, especially in red leaves that contain higher content of anthocyanin. Alternative splicing of EsMYBA1 resulted in three transcripts and two of them encoded a MYB-related protein. Yeast two-hybrid and transient luciferase expression assay showed that EsMYBA1 can interact with several bHLH regulators of the flavonoid pathway and activate the promoters of dihydroflavonol 4-reductase (DFR) and anthocyanidin synthase (ANS). In both transgenic tobacco and Arabidopsis, overexpression of EsMYBA1 induced strong anthocyanin accumulation in reproductive and/or vegetative tissues via up-regulation of the main flavonoid-related genes. Furthermore, transient expression of EsMYBA1 in E. sagittatum leaves by Agrobacterium infiltration also induced anthocyanin accumulation in the wounded area. This first functional characterization of R2R3-MYB TFs in Epimedium species will promote further studies of the flavonoid biosynthesis and regulation in medicinal plants. PMID:23936468

  9. The R2R3-Myb transcription fators of cotton: SNP characterization, chromosomal assignment, and phylogenetic analysis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The R2R3-Myb transcription factors are involved in many plant physiological and biochemical processes including regulation of trichome length and density in Arabidopsis. In cotton, Gossypium spp.,the developmental regulation of some R2R3-Myb transcription factors are related to fiber differentiatio...

  10. Coulomb excitation of exotic nuclei at the R3B-LAND setup

    NASA Astrophysics Data System (ADS)

    Rossi, D. M.; Adrich, P.; Aksouh, F.; Alvarez-Pol, H.; Aumann, T.; Benlliure, J.; Böhmer, M.; Boretzky, K.; Casarejos, E.; Chartier, M.; Chatillon, A.; Cortina-Gil, D.; Datta Pramanik, U.; Emling, H.; Ershova, O.; Fernandez-Dominguez, B.; Geissel, H.; Gorska, M.; Heil, M.; Johansson, H.; Junghans, A.; Kiselev, O.; Klimkiewicz, A.; Kratz, J. V.; Kurz, N.; Labiche, M.; Le Bleis, T.; Lemmon, R.; Litvinov, Yu A.; Mahata, K.; Maierbeck, P.; Movsesyan, A.; Nilsson, T.; Nociforo, C.; Palit, R.; Paschalis, S.; Plag, R.; Reifarth, R.; Simon, H.; Sümmerer, K.; Wagner, A.; Walus, W.; Weick, H.; Winkler, M.

    2013-03-01

    Exotic Ni isotopes have been measured at the R3B-LAND setup at GSI in Darmstadt, using Coulomb excitation in inverse kinematics at beam energies around 500 MeV/u. As the experimental setup allows kinematically complete measurements, the excitation energy was reconstructed using the invariant mass method. The GDR and additional low-lying strength have been observed in 68Ni, the latter exhausting 4.1(1.9)% of the E1 energy-weighted sum rule. Also, the branching ratio for the non-statistical decay of the excited 68Ni nuclei was measured and amounts to 24(4)%.

  11. Solitary solutions for a class of Schrödinger equations in R^3

    NASA Astrophysics Data System (ADS)

    Wang, Youjun

    2016-08-01

    In this paper, we consider a model problem arising from a classical planar Heisenberg ferromagnetic spin chain -Δ u + (λ + ɛ') u ∓ Δ √{1-u2}u/√{1- u2} - ɛ'u/√{1 - u2} = 0, x in R3, where {λ} and {ɛ'}are real constants. By variational methods and perturbation arguments, we study the existence of positive classical solutions. Our results generalize the previous results in one-dimensional space given by Brüll et al. [4].

  12. HOTAIR Promotes Proliferation, Migration, and Invasion of Ovarian Cancer SKOV3 Cells Through Regulating PIK3R3

    PubMed Central

    Dong, Lijun; Hu, Lina

    2016-01-01

    Background The aim of this study was to determine the effect on proliferation, migration, and invasion after silencing HOTAIR in ovarian cancer SKOV3 cells, and to elucidate the potential mechanism. Material/Methods We analyzed the mRNA expression level of HOTAIR and PIK3R3 in ovarian cancer SKOV3, OVCAR3, and A2780 cell lines. We analyzed the mRNA expression level of HOTAIR and PIK3R3 in ovarian SKOV3 after transection with miR-214 or miR-217. We analyzed the mRNA and protein expression level of PIK3R3 when silencing HOTAIR. We analyzed the expression of HOTAIR when silencing PIK3R3. We analyzed the proliferation, migration and invasion in ovarian cancer SKOV3 after silencing HOTAIR or PIK3R3. Results The expression of HOTAIR and PIK3R3 in ovarian SKOV3 and OVCAR3 was increased compared with A2780 cells (P<0.05). The mRNA level of HOTAIR and PIK3R3 in ovarian cancer SKOV3 cells was decreased when transected with miR-214 or miR-217 compared to negative control (p<0.05). The mRNA and protein level of PIK3R3 was decreased when HOTAIR was silenced and the mRNA level of HOTAIR was decreased when PIK3R3 was silenced (p<0.05). The proliferation, migration and invasion was decreased in ovarian SKOV3 when HOTAIR or PIK3R3 was silenced (p<0.05). Conclusions HOTAIR can promote proliferation, migration, and invasion in ovarian SKOV3 cells as a competing endogenous RNA. PMID:26826873

  13. The Scutellaria baicalensis R2R3-MYB Transcription Factors Modulates Flavonoid Biosynthesis by Regulating GA Metabolism in Transgenic Tobacco Plants

    PubMed Central

    Liu, Yunjun; Yang, Jian; Huang, Luqi

    2013-01-01

    R2R3-MYB proteins play role in plant development, response to biotic and abiotic stress, and regulation of primary and secondary metabolism. Little is known about the R2R3-MYB proteins in Scutellaria baicalensis which is an important Chinese medical plant. In this paper, nineteen putative SbMYB genes were identified from a S. baicalensis cDNA library, and eleven R2R3-MYBs were clustered into 5 subgroups according to phylogenetic reconstruction. In the S. baicalensis leaves which were sprayed with GA3, SbMYB2 and SbMYB7 had similar expression pattern with SbPALs, indicating that SbMYB2 and SbMYB7 might be involved in the flavonoid metabolism. Transactivation assay results showed that SbMYB2 and SbMYB7 can function as transcriptional activator. The expression of several flavonoid biosynthesis-related genes were induced or suppressed by overexpression of SbMYB2 or SbMYB7 in transgenic tobacco plants. Consistent with the change of the expression of NtDH29 and NtCHI, the contents of dicaffeoylspermidine and quercetin-3,7-O-diglucoside in SbMYB2-overexpressing or SbMYB7-overexpressing transgenic tobacco plants were decreased. The transcriptional level of NtUFGT in transgenic tobacco overexpressing SbMYB7 and the transcriptional level of NtHCT in SbMYB2-overexpressing tobacco plants were increased; however the application of GA3 inhibited the transcriptional level of these two genes. These results suggest that SbMYB2 and SbMYB7 might regulate the flavonoid biosynthesis through GA metabolism. PMID:24143216

  14. Reliability and validity of the tritrac-R3D accelerometer during backpacking: a case study.

    PubMed

    DeVoe, D; Dalleck, L

    2001-08-01

    This study investigated the utility of the Tritrac-R3D accelerometer as a reliable and valid instrument in the quantification of physical activity while backpacking in the field and to evaluate heart-rate responses and oxygen consumption to assess the feasibility of using the Tritrac-R3D to estimate caloric expenditure. Two 7-day backpacking expeditions were conducted in two consecutive years by a single subject at Grand Canyon National Park, Arizona. The average hiking heart rate ranged front 60% to 77% HRmax during the expeditions. The average rate of estimated caloric cost ranged from 6.8 to 11.7 kcals x min.(-1) (equivalent to 408 to 702 kcals x hr.(-1)), indicating a relatively moderate to high level of exertion. The Tritrac had adequate consistency and reliability in the field between the two expeditions in recorded activity counts. The Tritrac underestimated caloric expenditure during backpacking with changes in terrain, and hiking speed contributed to even greater disparity in accuracy. PMID:11693704

  15. pipsqueak encodes a novel nuclear protein required downstream of seven-up for the development of photoreceptors R3 and R4.

    PubMed Central

    Weber, U; Siegel, V; Mlodzik, M

    1995-01-01

    Photoreceptor induction in the Drosophila eye is mediated by activation of the Ras signal transduction cascade. Although this process is well understood, little is known about how the diversity of photoreceptor subtypes is generated. The pipsqueak (psq) gene is expressed at high levels in the R3/R4 precursors during eye development and this expression depends on seven-up (svp) gene function. Moreover, strong psq alleles are dominant suppressors of a svp-induced cone cell transformation phenotype. Although the gene was previously identified and described as a member of the maternal posterior group of genes, the strong semilethal alleles isolated here demonstrate a specific requirement for psq function downstream of svp for the development of photoreceptors R3/R4. The gene has three independent 5' ends and codes for several nuclear protein isoforms, some containing the POZ domain which has been implicated in protein-protein interactions. Interestingly, all viable alleles with a maternal posterior group phenotype cluster around one specific 5' exon, while all semilethal alleles have lesions which map to a different alternative 5' exon. Images PMID:8557044

  16. Effect of IP3R3 and NPY on age-related declines in olfactory stem cell proliferation

    PubMed Central

    Jia, Cuihong; Hegg, Colleen C.

    2014-01-01

    Losing the sense of smell due to aging compromises health and quality of life. In the mouse olfactory epithelium (OE) aging reduces the capacity for tissue homeostasis and regeneration. The microvillous cell subtype that expresses both inositol trisphosphate receptor type 3 (IP3R3) and the neuroproliferative factor neuropeptide Y (NPY) is critical for regulation of homeostasis, yet its role in aging is undefined. We hypothesized that an age-related decline in IP3R3 expression and NPY signaling underlie age-related homeostatic changes and olfactory dysfunction. We found a decrease in IP3R3+ and NPY+ microvillous cell numbers and NPY protein, and a reduced sensitivity to NPY-mediated proliferation over 24 months. However, in IP3R3-deficient mice, there was no further age-related reduction in cell numbers, proliferation, or olfactory function compared to wild-type. The proliferative response was impaired in aged IP3R3-deficient mice when injury was caused by satratoxin-G, which induces IP3R3-mediated NPY release, but not by bulbectomy, which does not evoke NPY release. These data identify IP3R3 and NPY signaling as targets for improving recovery following olfactotoxicant exposure. PMID:25482245

  17. Effect of IP3R3 and NPY on age-related declines in olfactory stem cell proliferation.

    PubMed

    Jia, Cuihong; Hegg, Colleen C

    2015-02-01

    Losing the sense of smell because of aging compromises health and quality of life. In the mouse olfactory epithelium, aging reduces the capacity for tissue homeostasis and regeneration. The microvillous cell subtype that expresses both inositol trisphosphate receptor type 3 (IP3R3) and the neuroproliferative factor neuropeptide Y (NPY) is critical for regulation of homeostasis, yet its role in aging is undefined. We hypothesized that an age-related decline in IP3R3 expression and NPY signaling underlie age-related homeostatic changes and olfactory dysfunction. We found a decrease in IP3R3(+) and NPY(+) microvillous cell numbers and NPY protein and a reduced sensitivity to NPY-mediated proliferation over 24 months. However, in IP3R3-deficient mice, there was no further age-related reduction in cell numbers, proliferation, or olfactory function compared with wild type. The proliferative response was impaired in aged IP3R3-deficient mice when injury was caused by satratoxin G, which induces IP3R3-mediated NPY release, but not by bulbectomy, which does not evoke NPY release. These data identify IP3R3 and NPY signaling as targets for improving recovery following olfactotoxicant exposure. PMID:25482245

  18. Glucose-Sensing Receptor T1R3: A New Signaling Receptor Activated by Glucose in Pancreatic β-Cells.

    PubMed

    Kojima, Itaru; Nakagawa, Yuko; Hamano, Kunihisa; Medina, Johan; Li, Longfei; Nagasawa, Masahiro

    2015-01-01

    Subunits of the sweet taste receptors T1R2 and T1R3 are expressed in pancreatic β-cells. Compared with T1R3, mRNA expression of T1R2 is considerably lower. At the protein level, expression of T1R2 is undetectable in β-cells. Accordingly, a major component of the sweet taste-sensing receptor in β-cells may be a homodimer of T1R3 rather than a heterodimer of T1R2/T1R3. Inhibition of this receptor by gurmarin or deletion of the T1R3 gene attenuates glucose-induced insulin secretion from β-cells. Hence the T1R3 homodimer functions as a glucose-sensing receptor (GSR) in pancreatic β-cells. When GSR is activated by the T1R3 agonist sucralose, elevation of intracellular ATP concentration ([ATP]i) is observed. Sucralose increases [ATP]i even in the absence of ambient glucose, indicating that sucralose increases [ATP]i not simply by activating glucokinase, a rate-limiting enzyme in the glycolytic pathway. In addition, sucralose augments elevation of [ATP]i induced by methylsuccinate, suggesting that sucralose activates mitochondrial metabolism. Nonmetabolizable 3-O-methylglucose also increases [ATP]i and knockdown of T1R3 attenuates elevation of [ATP]i induced by high concentration of glucose. Collectively, these results indicate that the T1R3 homodimer functions as a GSR; this receptor is involved in glucose-induced insulin secretion by activating glucose metabolism probably in mitochondria. PMID:25947913

  19. Meaningful Clusters

    SciTech Connect

    Sanfilippo, Antonio P.; Calapristi, Augustin J.; Crow, Vernon L.; Hetzler, Elizabeth G.; Turner, Alan E.

    2004-05-26

    We present an approach to the disambiguation of cluster labels that capitalizes on the notion of semantic similarity to assign WordNet senses to cluster labels. The approach provides interesting insights on how document clustering can provide the basis for developing a novel approach to word sense disambiguation.

  20. Gut T1R3 sweet taste receptors do not mediate sucrose-conditioned flavor preferences in mice.

    PubMed

    Sclafani, Anthony; Glass, Damien S; Margolskee, Robert F; Glendinning, John I

    2010-12-01

    Most mammals prefer the sweet taste of sugars, which is mediated by the heterodimeric T1R2+T1R3 taste receptor. Sugar appetite is also enhanced by the post-oral reinforcing actions of the nutrient in the gut. Here, we examined the contribution of gut T1R3 (either alone or as part of the T1R3+T1R3 receptor) to post-oral sugar reinforcement using a flavor-conditioning paradigm. We trained mice to associate consumption of a flavored solution (CS+) with intragastric (IG) infusions of a sweetener, and a different flavored solution (CS-) with IG infusions of water (23 h/day); then, we measured preference in a CS+ vs. CS- choice test. In experiment 1, we predicted that if activation of gut T1R3 mediates sugar reinforcement, then IG infusions of a nutritive (sucrose) or nonnutritive (sucralose) ligand for this receptor should condition a preference for the CS+ in B6 wild-type (WT) mice. While the mice that received IG sucrose infusions developed a strong preference for the CS+, those that received IG sucralose infusions developed a weak avoidance of the CS+. In experiment 2, we used T1R3 knockout (KO) mice to examine the necessity of gut T1R2+T1R3 receptors for conditioned flavor preferences. If intact gut T1R3 (or T1R2+T1R3) receptors are necessary for flavor-sugar conditioning, then T1R3 KO mice should not develop a sugar-conditioned flavor preference. We found that T1R3 KO mice, like WT mice, acquired a strong preference for the CS+ paired with IG sucrose infusions. The KO mice were also like WT mice in avoiding a CS+ flavor paired with IG sucralose infusions These findings provide clear evidence that gut T1R3 receptors are not necessary for sugar-conditioned flavor preferences or sucralose-induced flavor avoidance in mice. PMID:20926763

  1. Classification of robust heteroclinic cycles for vector fields in {\\protect\\bb R}^3 with symmetry

    NASA Astrophysics Data System (ADS)

    Hawker, David; Ashwin, Peter

    2005-09-01

    We consider a classification of robust heteroclinic cycles in the positive octant of {\\bb R}^3 under the action of the symmetry group {{\\bb Z}_2}^3 . We introduce a coding system to represent different classes up to a topological equivalence, and produce a characterization of all types of robust heteroclinic cycle that can arise in this situation. These cycles may or may not contain the origin within the cycle. We proceed to find a connection between our problem and meandric numbers. We find a direct correlation between the number of classes of robust heteroclinic cycle that do not include the origin and the 'Mercedes-Benz' sequence of integers characterizing meanders through a 'Y-shaped' configuration. We investigate upper and lower bounds for the number of classes possible for robust cycles between n equilibria, one of which may be the origin.

  2. CYB5R3: a key player in aerobic metabolism and aging?

    PubMed

    de Cabo, Rafael; Siendones, Emilio; Minor, Robin; Navas, Plácido

    2010-01-01

    Aging results from a complex and not completely understood chain of processes that are associated with various negative metabolic consequences and ultimately leads to senescence and death. The intracellular ratio of pyridine nucleotides (NAD(+)/NADH), has been proposed to be at the center stage of age-related biochemical changes in organisms, and may help to explain the observed influence of calorie restriction and energy-sensitive proteins on lifespan in model organisms. Indeed, the NAD(+)/NADH ratios affect the activity of a number of proteins, including sirtuins, which have gained prominence in the aging field as potential mediators of the beneficial effects of calorie restriction and mediating lifespan. Here we review the activities of a redox enzyme (NQR1 in yeast and CYB5R3 in mammals) that also influences the NAD(+)/NADH ratio and may play a regulatory role that connects aerobic metabolism with aging. PMID:20228936

  3. Model-independent constraints on r-3 extra-interactions from orbital motions

    NASA Astrophysics Data System (ADS)

    Iorio, L.

    2012-07-01

    Constraints on long-range power-law modifications Upert ≈ r-3 of the usual Newtonian gravitational potential UN ≈ r-1 are inferred from orbital motions of well known artificial and natural bodies. They can be interpreted in terms of a characteristic length ℓ which may be identified with, e.g., the antide Sitter (AdS) radius of curvature ℓ in the Randall-Sundrum (RS) braneworld model, although this not a mandatory choice. Our bounds, complementary to those from tabletop laboratory experiments, do not rely upon more or less speculative and untested theoretical assumptions, contrary to other longrange RS tests proposed in astrophysical scenarios in which many of the phenomena adopted may depend on the system's composition, formation and dynamical history as well. Independently of the interpretation of ℓ the perihelion precession of Mercury and its radiotechnical ranging from the Earth yield ℓ ≲ 10-50 km. Tighter bounds come from the perigee precession of the Moon, from which it can be inferred ℓ ≲ 500-700m. The best constraints (ℓ ≲ 5m) come from the Satellite-to-Satellite Tracking (SST) range of the GRACE A/B spacecrafts orbiting the Earth: proposed follow-on of such a mission, implying a sub-nm s-1 range-rate accuracy,may constrain ℓ at ∼ 10 cm level. Weaker constraints come from the double pulsar system (ℓ ≲ 80-100 km) and fromthe main sequence star S2 orbiting the compact object in Sgr A* (ℓ ≲ 6.2-8.8 AU). Such bounds on the length ℓ, which must not necessarily be identified with the AdS radius of curvature of the RS model, naturally translate into constraints on an, e.g., universal coupling parameter K of the extra r-3 interaction. GRACE yields K ≤ 1×1016 m5 s-2.

  4. The R3-MYB Gene GhCPC Negatively Regulates Cotton Fiber Elongation

    PubMed Central

    Liu, Bingliang; Zhu, Yichao; Zhang, Tianzhen

    2015-01-01

    Cotton (Gossypium spp.) fibers are single-cell trichomes that arise from the outer epidermal layer of seed coat. Here, we isolated a R3-MYB gene GhCPC, identified by cDNA microarray analysis. The only conserved R3 motif and different expression between TM-1 and fuzzless-lintless mutants suggested that it might be a negative regulator in fiber development. Transgenic evidence showed that GhCPC overexpression not only delayed fiber initiation but also led to significant decreases in fiber length. Interestingly, Yeast two-hybrid analysis revealed an interaction complex, in which GhCPC and GhTTG1/4 separately interacted with GhMYC1. In transgenic plants, Q-PCR analysis showed that GhHOX3 (GL2) and GhRDL1 were significantly down regulated in −1–5 DPA ovules and fibers. In addition, Yeast one-hybrid analysis demonstrated that GhMYC1 could bind to the E-box cis-elements and the promoter of GhHOX3. These results suggested that GhHOX3 (GL2) might be downstream gene of the regulatory complex. Also, overexpression of GhCPC in tobacco led to differential loss of pigmentation. Taken together, the results suggested that GhCPC might negatively regulate cotton fiber initiation and early elongation by a potential CPC-MYC1-TTG1/4 complex. Although the fibers were shorter in transgenic cotton lines than in the wild type, no significant difference was detected in stem or leaf trichomes, even in cotton mutants (five naked seed or fuzzless), suggesting that fiber and trichome development might be regulated by two sets of genes sharing a similar model. PMID:25646816

  5. An R2R3-MYB Transcription Factor Regulates Eugenol Production in Ripe Strawberry Fruit Receptacles.

    PubMed

    Medina-Puche, Laura; Molina-Hidalgo, Francisco Javier; Boersma, Maaike; Schuurink, Robert C; López-Vidriero, Irene; Solano, Roberto; Franco-Zorrilla, José-Manuel; Caballero, José Luis; Blanco-Portales, Rosario; Muñoz-Blanco, Juan

    2015-06-01

    Eugenol is a volatile phenylpropanoid that contributes to flower and ripe fruit scent. In ripe strawberry (Fragaria × ananassa) fruit receptacles, eugenol is biosynthesized by eugenol synthase (FaEGS2). However, the transcriptional regulation of this process is still unknown. We have identified and functionally characterized an R2R3 MYB transcription factor (emission of benzenoid II [FaEOBII]) that seems to be the orthologous gene of PhEOBII from Petunia hybrida, which contributes to the regulation of eugenol biosynthesis in petals. The expression of FaEOBII was ripening related and fruit receptacle specific, although high expression values were also found in petals. This expression pattern of FaEOBII correlated with eugenol content in both fruit receptacle and petals. The expression of FaEOBII was repressed by auxins and activated by abscisic acid, in parallel to the ripening process. In ripe strawberry receptacles, where the expression of FaEOBII was silenced, the expression of cinnamyl alcohol dehydrogenase1 and FaEGS2, two structural genes involved in eugenol production, was down-regulated. A subsequent decrease in eugenol content in ripe receptacles was also observed, confirming the involvement of FaEOBII in eugenol metabolism. Additionally, the expression of FaEOBII was under the control of FaMYB10, another R2R3 MYB transcription factor that regulates the early and late biosynthetic genes from the flavonoid/phenylpropanoid pathway. In parallel, the amount of eugenol in FaMYB10-silenced receptacles was also diminished. Taken together, these data indicate that FaEOBII plays a regulating role in the volatile phenylpropanoid pathway gene expression that gives rise to eugenol production in ripe strawberry receptacles. PMID:25931522

  6. Performance analysis for the CALIFA Barrel calorimeter of the R3B experiment

    NASA Astrophysics Data System (ADS)

    Alvarez-Pol, H.; Ashwood, N.; Aumann, T.; Bertini, D.; Cabanelas, P.; Casarejos, E.; Cederkall, J.; Cortina-Gil, D.; Díaz Fernández, P.; Duran, I.; Fiori, E.; Galaviz, D.; Labiche, M.; Nacher, E.; Pietras, B.; Savran, D.; Tengblad, O.; Teubig, P.

    2014-12-01

    The CALIFA calorimeter is an advanced detector for gamma rays and light charged particles, accordingly optimized for the demanding requirements of the physics programme proposed for the R3B facility at FAIR. The multipurpose character of CALIFA is required to fulfil challenging demands in energy resolution (5-6% at 1 MeV for gamma rays) and efficiency. Charged particles, e.g. protons of energies up to 320 MeV in the Barrel section, should also be identified with an energy resolution better to 1%. CALIFA is divided into two well-separated sections: a "Forward EndCap" and a cylindrical "Barrel" covering an angular range from 43.2° to 140.3°. The Barrel section, based on long CsI(Tl) pyramidal frustum crystals coupled to large area avalanche photodiodes (LAAPDs), attains the requested high efficiency for calorimetric purposes. The construction of the CALIFA Demonstrator, comprising 20% of the total detector, has already been initiated, and commissioning experiments are expected for 2014. The assessment of the capabilities and expected performance of the detector elements is a crucial step in their design, along with the prototypes evaluation. For this purpose, the Barrel geometry has been carefully implemented in the simulation package R3BRoot, including easily variable thicknesses of crystal wrapping and carbon fibre supports. A complete characterization of the calorimeter response (including efficiency, resolution, evaluation of energy and reconstruction losses) under different working conditions, with several physics cases selected to probe the detector performance over a wide range of applications, has been undertaken. Prototypes of different sections of the CALIFA Barrel have been modeled and their responses have been evaluated and compared with the experimental results. The present paper summarizes the outcome of the simulation campaign for the entire Barrel section and for the corresponding prototypes tested at different European installations.

  7. Expression and clinicopathological implication of DcR3 in lung cancer tissues: a tissue microarray study with 365 cases

    PubMed Central

    Zhang, Yu; Luo, Jie; He, Rongquan; Huang, Wenting; Li, Zuyun; Li, Ping; Dang, Yiwu; Chen, Gang; Li, Shikang

    2016-01-01

    Background Decoy receptor 3 (DcR3) has been reported to be involved in different cancers. However, few related researches have been accomplished on the role of DcR3 in lung cancer. Objective To explore the expression level and clinicopathological implication of DcR3 protein in lung cancer tissues. Materials and methods Immunohistochemistry was used to examine DcR3 protein expression in lung cancer (n=365) and normal lung tissues (n=26). The relationships between DcR3 expression and clinical parameters were further investigated. Furthermore, the diagnostic and clinicopathological value of DcR3 mRNA was analyzed based on The Cancer Genome Atlas database in lung cancer patients. Results Compared to normal lung tissues, DcR3 expression was significantly higher in lung cancer (P=0.007) tissues, including small-cell lung cancer (P=0.001) and non-small-cell lung cancer (P=0.008). In addition, DcR3 expression was related to tumor-node-metastasis (TNM) stage (P<0.001), tumor diameter (P=0.007), distant metastasis (P<0.001), and lymph node metastasis (P<0.001) in lung cancers. When concerning non-small-cell lung cancer, consistent correlations between DcR3 expression and TNM stage (P<0.001), tumor diameter (P=0.019), distant metastasis (P<0.001), and lymph node metastasis (P<0.001) were found. Simultaneously, in small-cell lung cancer, TNM stage (P=0.004) and lymph node metastasis (P=0.005) were also associated with DcR3 expression. Additionally, receiver operator characteristic curve revealed that the area under curve (AUC) of DcR3 was 0.637 (95% confidence interval [CI] 0.531–0.742) for lung cancer. Furthermore, DcR3 was overexpressed in both adenocarcinoma and squamous cell carcinoma tissues than in noncancerous lung tissues (all P<0.0001) based on the data from The Cancer Genome Atlas. AUC of DcR3 was 0.726 (95% CI 0.644–0.788) for lung adenocarcinoma patients and 0.647 (95% CI 0.566–0.728) for squamous cell carcinoma patients. DcR3 expression was also related to

  8. Design, Synthesis, and Antiplasmodial Activity of Hybrid Compounds Based on (2R,3S)-N-Benzoyl-3-phenylisoserine

    PubMed Central

    2013-01-01

    A series of hybrid compounds based on (2R,3S)-N-benzoyl-3-phenylisoserine, artemisinin, and quinoline moieties was synthesized and tested for in vitro antiplasmodial activity against erythrocytic stages of K1 and W2 strains of Plasmodium falciparum. Two hybrid compounds incorporating (2R,3S)-N-benzoyl-3-phenylisoserine and artemisinin scaffolds were 3- to 4-fold more active than dihydroartemisinin, with nanomolar IC50 values against Plasmodium falciparum K1 strain. PMID:24900723

  9. R3D Align web server for global nucleotide to nucleotide alignments of RNA 3D structures.

    PubMed

    Rahrig, Ryan R; Petrov, Anton I; Leontis, Neocles B; Zirbel, Craig L

    2013-07-01

    The R3D Align web server provides online access to 'RNA 3D Align' (R3D Align), a method for producing accurate nucleotide-level structural alignments of RNA 3D structures. The web server provides a streamlined and intuitive interface, input data validation and output that is more extensive and easier to read and interpret than related servers. The R3D Align web server offers a unique Gallery of Featured Alignments, providing immediate access to pre-computed alignments of large RNA 3D structures, including all ribosomal RNAs, as well as guidance on effective use of the server and interpretation of the output. By accessing the non-redundant lists of RNA 3D structures provided by the Bowling Green State University RNA group, R3D Align connects users to structure files in the same equivalence class and the best-modeled representative structure from each group. The R3D Align web server is freely accessible at http://rna.bgsu.edu/r3dalign/. PMID:23716643

  10. R3D Align web server for global nucleotide to nucleotide alignments of RNA 3D structures

    PubMed Central

    Rahrig, Ryan R.; Petrov, Anton I.; Leontis, Neocles B.; Zirbel, Craig L.

    2013-01-01

    The R3D Align web server provides online access to ‘RNA 3D Align’ (R3D Align), a method for producing accurate nucleotide-level structural alignments of RNA 3D structures. The web server provides a streamlined and intuitive interface, input data validation and output that is more extensive and easier to read and interpret than related servers. The R3D Align web server offers a unique Gallery of Featured Alignments, providing immediate access to pre-computed alignments of large RNA 3D structures, including all ribosomal RNAs, as well as guidance on effective use of the server and interpretation of the output. By accessing the non-redundant lists of RNA 3D structures provided by the Bowling Green State University RNA group, R3D Align connects users to structure files in the same equivalence class and the best-modeled representative structure from each group. The R3D Align web server is freely accessible at http://rna.bgsu.edu/r3dalign/. PMID:23716643

  11. Co-Dopant Influence on the Persistent Luminescence of BaAl2O4:Eu2+,R3+

    NASA Astrophysics Data System (ADS)

    Rodrigues, Lucas C. V.; Hölsä, Jorma; Carvalho, José M.; Pedroso, Cássio C. S.; Lastusaari, Mika; Felinto, Maria C. F. C.; Watanabe, Shigeo; Brito, Hermi F.

    2014-04-01

    The R3+ (rare earth) co-dopants may have a surprisingly important role in persistent luminescence - enhancement of up to 1-3 orders of magnitude may be obtained in the performance of these phosphor materials - depending strongly on the R3+ ion, of course. In this work, the effects of the R3+ co-dopants in the BaAl2O4:Eu2+,R3+ materials were studied using mainly thermoluminescence (TL) and synchrotron radiation XANES methods. In BaAl2O4, the conventional and persistent luminescence both arise from the 4f7→4f65d1 transition of Eu2+, yielding blue-green emission color. The former, in the presence of humidity, turns to more bluish because of creation of an additional Eu2+ luminescence centre which is not, however, visible in persistent luminescence. The trap structure in the non-co-doped BaAl2O4:Eu2+ is rather complex with 4-5 TL bands above room temperature. With R3+ co-doping, this basic structure is modified though no drastic change can be observed. This underlines the fact that even very small changes in the trap depths can produce significant modifications in the persistent luminescence efficiency. It should be remembered that basically the persistent luminescence performance is controlled by the Boltzmann population law depending exponentially on both the temperature and trap depth. Some mechanisms for persistent luminescence have suggested the presence of either divalent R2+ or tetravalent RIV during the charging of the Eu2+ doped materials. The present XANES measurements on BaAl2O4:Eu2+,R3+ confirmed the presence of only the trivalent form of the R3+ co-dopants excluding both of these pathways. It must thus be concluded, that the energy is stored in intrinsic and extrinsic defects created by the synthesis conditions and charge compensation due to R3+ co-doping. Even though the effect of the R3+ co-dopants was carefully exploited and characterized, the differences in the effect of different R3+ ions with very similar chemical and spectroscopic properties could

  12. T1r3 taste receptor involvement in gustatory neural responses to ethanol and oral ethanol preference

    PubMed Central

    Norman, Meghan B.; Lemon, Christian H.

    2010-01-01

    Elevated alcohol consumption is associated with enhanced preference for sweet substances across species and may be mediated by oral alcohol-induced activation of neurobiological substrates for sweet taste. Here, we directly examined the contribution of the T1r3 receptor protein, important for sweet taste detection in mammals, to ethanol intake and preference and the neural processing of ethanol taste by measuring behavioral and central neurophysiological responses to oral alcohol in T1r3 receptor-deficient mice and their C57BL/6J background strain. T1r3 knockout and wild-type mice were tested in behavioral preference assays for long-term voluntary intake of a broad concentration range of ethanol, sucrose, and quinine. For neurophysiological experiments, separate groups of mice of each genotype were anesthetized, and taste responses to ethanol and stimuli of different taste qualities were electrophysiologically recorded from gustatory neurons in the nucleus of the solitary tract. Mice lacking the T1r3 receptor were behaviorally indifferent to alcohol (i.e., ∼50% preference values) at concentrations typically preferred by wild-type mice (5–15%). Central neural taste responses to ethanol in T1r3-deficient mice were significantly lower compared with C57BL/6J controls, a strain for which oral ethanol stimulation produced a concentration-dependent activation of sweet-responsive NTS gustatory neurons. An attenuated difference in ethanol preference between knockouts and controls at concentrations >15% indicated that other sensory and/or postingestive effects of ethanol compete with sweet taste input at high concentrations. As expected, T1r3 knockouts exhibited strongly suppressed behavioral and neural taste responses to sweeteners but did not differ from wild-type mice in responses to prototypic salt, acid, or bitter stimuli. These data implicate the T1r3 receptor in the sensory detection and transduction of ethanol taste. PMID:20145204

  13. Contribution of the T1r3 taste receptor to the response properties of central gustatory neurons.

    PubMed

    Lemon, Christian H; Margolskee, Robert F

    2009-05-01

    T1r3 is a critical subunit of T1r sweet taste receptors. Here we studied how the absence of T1r3 impacts responses to sweet stimuli by taste neurons in the nucleus tractus solitarius (NTS) of the mouse. The consequences bear on the multiplicity of sweet taste receptors and how T1r3 influences the distribution of central gustatory neurons. Taste responses to glycine, sucrose, NaCl, HCl, and quinine were electrophysiologically recorded from single NTS neurons in anesthetized T1r3 knockout (KO) and wild-type (WT) C57BL/6 mice. Other stimuli included l-proline, d-fructose, d-glucose, d-sorbitol, Na-saccharin, acesulfame-K, monosodium glutamate, NaNO(3), Na-acetate, citric acid, KCl, denatonium, and papaverine. Forty-one WT and 41 KO neurons were recorded. Relative to WT, KO responses to all sweet stimuli were significantly lower, although the degree of attenuation differed among stimuli, with near zero responses to sugars but salient residual activity to artificial sweeteners and glycine. Residual KO across-neuron responses to sweet stimuli were variably similar to nonsweet responses, as indexed by multivariate and correlation analyses. In some cases, this suggested that residual KO activity to "sweet" stimuli could be mediated by nonsweet taste receptors, implicating T1r3 receptors as primary contributors to NTS sweet processing. The influence of T1r3 on the distribution of NTS neurons was evaluated by comparing neuron types that emerged between WT and KO cells. Neurons tuned toward sweet stimuli composed 34% of the WT sample but did not appear among KO cells. Input from T1r3-containing receptors critically guides the normal development of NTS neurons oriented toward sweet tastants. PMID:19279151

  14. 3D hexagonal (R-3m) mesostructured nanocrystalline titania thin films : synthesis and characterization.

    SciTech Connect

    Choi, S. Y.; Lee, B.; Carew, D. B.; Mamak, M; Peiris, F. C.; Speakman, S.; Chopra, N.; Ozin, G. A.; X-Ray Science Division; Univ. of Toronto; ORNL; Xerox Research Centre of Canada

    2006-01-01

    A straightforward and reproducible synthesis of crack-free large-area thin films of 3D hexagonal (R-3m) mesostructured nanocrystalline titania (meso-nc-TiO{sub 2}) using a Pluronic triblock copolymer (P123)/1-butanol templating system is described. The characterization of the films is achieved using a combination of electron microscopy (high-resolution scanning electron microscopy and scanning transmission electron microscopy), grazing-incidence small-angle X-ray scattering, in situ high-temperature X-ray diffraction, and variable-angle spectroscopic ellipsometry. The mesostructure of the obtained films is found to be based upon a 3D periodic array of large elliptically shaped cages with diameters around 20 nm interconnected by windows of about 5 nm in size. The mesopores of the film calcined at 300 C are very highly ordered, and the titania framework of the film has a crystallinity of 40 % being composed of 5.8 nm sized anatase crystallites. The film displays high thermal stability in that the collapse of the pore architecture is incomplete even at 600 C. The accessible surface area of 3D hexagonal meso-nc-TiO{sub 2} estimated by the absorption of methylene blue is nearly twice as large as that of 2D hexagonal meso-nc-TiO{sub 2} at the same annealing temperature.

  15. 3D HEXAGONAL (R-3M) MESOSTRUCTURED NANOCRYSTALLINE TITANIA THIN FILMS: SYNTHESIS AND CHARACTERIZATION

    SciTech Connect

    Choi, S Y; Lee, B; Carew, D B; Peiris, F C; Mamak, M; Speakman, Scott A; Chopra, N; Ozin, G A

    2006-01-01

    A straightforward and reproducible synthesis of crack-free large-area thin films of 3D hexagonal (R-3m) mesostructured nanocrystalline titania (meso-nc-TiO{sub 2}) using a Pluronic triblock copolymer (P123)/1-butanol templating system is described. The characterization of the films is achieved using a combination of electron microscopy (high-resolution scanning electron microscopy and scanning transmission electron microscopy), grazing-incidence small-angle X-ray scattering, in situ high-temperature X-ray diffraction, and variable-angle spectroscopic ellipsometry. The mesostructure of the obtained films is found to be based upon a 3D periodic array of large elliptically shaped cages with diameters around 20 nm interconnected by windows of about 5 nm in size. The mesopores of the film calcined at 300 C are very highly ordered, and the titania framework of the film has a crystallinity of 40 % being composed of 5.8 nm sized anatase crystallites. The film displays high thermal stability in that the collapse of the pore architecture is incomplete even at 600 C. The accessible surface area of 3D hexagonal meso-nc-TiO{sub 2} estimated by the absorption of methylene blue is nearly twice as large as that of 2D hexagonal meso-nc-TiO{sub 2} at the same annealing temperature.

  16. Regulating the production of (R)-3-hydroxybutyrate in Escherichia coli by N or P limitation.

    PubMed

    Guevara-Martínez, Mónica; Sjöberg Gällnö, Karin; Sjöberg, Gustav; Jarmander, Johan; Perez-Zabaleta, Mariel; Quillaguamán, Jorge; Larsson, Gen

    2015-01-01

    The chiral compound (R)-3-hydroxybutyrate (3HB) is naturally produced by many wild type organisms as the monomer for polyhydroxybutyrate (PHB). Both compounds are commercially valuable and co-polymeric polyhydroxyalkanoates have been used e.g., in medical applications for skin grafting and as components in pharmaceuticals. In this paper we investigate cultivation strategies for production of 3HB in the previously described E. coli strain AF1000 pJBGT3RX. This strain produces extracellular 3HB by expression of two genes from the PHB pathway of Halomonas boliviensis. H. boliviensis is a newly isolated halophile that forms PHB as a storage compound during carbon excess and simultaneous limitation of another nutrient like nitrogen and phosphorous. We hypothesize that a similar approach can be used to control the flux from acetyl-CoA to 3HB also in E. coli; decreasing the flux to biomass and favoring the pathway to the product. We employed ammonium- or phosphate-limited fed-batch processes for comparison of the productivity at different nutrient limitation or starvation conditions. The feed rate was shown to affect the rate of glucose consumption, respiration, 3HB, and acetic acid production, although the proportions between them were more difficult to affect. The highest 3HB volumetric productivity, 1.5 g L(-1) h(-1), was seen for phosphate-limitation. PMID:26347729

  17. The oil palm VIRESCENS gene controls fruit colour and encodes a R2R3-MYB

    PubMed Central

    Singh, Rajinder; Low, Eng-Ti Leslie; Ooi, Leslie Cheng-Li; Ong-Abdullah, Meilina; Nookiah, Rajanaidu; Ting, Ngoot-Chin; Marjuni, Marhalil; Chan, Pek-Lan; Ithnin, Maizura; Manaf, Mohd Arif Abdul; Nagappan, Jayanthi; Chan, Kuang-Lim; Rosli, Rozana; Halim, Mohd Amin; Azizi, Norazah; Budiman, Muhammad A.; Lakey, Nathan; Bacher, Blaire; Van Brunt, Andrew; Wang, Chunyan; Hogan, Michael; He, Dong; MacDonald, Jill D.; Smith, Steven W.; Ordway, Jared M.; Martienssen, Robert A.; Sambanthamurthi, Ravigadevi

    2014-01-01

    Oil palm, a plantation crop of major economic importance in Southeast Asia, is the predominant source of edible oil worldwide. We report the identification of the VIRESCENS (VIR) gene, which controls fruit exocarp colour and is an indicator of ripeness. VIR is a R2R3-MYB transcription factor with homology to Lilium LhMYB12 and similarity to Arabidopsis PRODUCTION OF ANTHOCYANIN PIGMENT1 (PAP1). We identify five independent mutant alleles of VIR in over 400 accessions from sub-Saharan Africa that account for the dominant-negative virescens phenotype. Each mutation results in premature termination of the carboxy-terminal domain of VIR, resembling McClintock’s C1-I allele in maize. The abundance of alleles likely reflects cultural practices, by which fruits were venerated for magical and medicinal properties. The identification of VIR will allow selection of the trait at the seed or early-nursery stage, 3-6 years before fruits are produced, greatly advancing introgression into elite breeding material. PMID:24978855

  18. An R2R3-MYB transcription factor regulates carotenoid pigmentation in Mimulus lewisii flowers.

    PubMed

    Sagawa, Janelle M; Stanley, Lauren E; LaFountain, Amy M; Frank, Harry A; Liu, Chang; Yuan, Yao-Wu

    2016-02-01

    Carotenoids are yellow, orange, and red pigments that contribute to the beautiful colors and nutritive value of many flowers and fruits. The structural genes in the highly conserved carotenoid biosynthetic pathway have been well characterized in multiple plant systems, but little is known about the transcription factors that control the expression of these structural genes. By analyzing a chemically induced mutant of Mimulus lewisii through bulk segregant analysis and transgenic experiments, we have identified an R2R3-MYB, Reduced Carotenoid Pigmentation 1 (RCP1), as the first transcription factor that positively regulates carotenoid biosynthesis during flower development. Loss-of-function mutations in RCP1 lead to down-regulation of all carotenoid biosynthetic genes and reduced carotenoid content in M. lewisii flowers, a phenotype recapitulated by RNA interference in the wild-type background. Overexpression of this gene in the rcp1 mutant background restores carotenoid production and, unexpectedly, results in simultaneous decrease of anthocyanin production in some transgenic lines by down-regulating the expression of an activator of anthocyanin biosynthesis. Identification of transcriptional regulators of carotenoid biosynthesis provides the 'toolbox' genes for understanding the molecular basis of flower color diversification in nature and for potential enhancement of carotenoid production in crop plants via genetic engineering. PMID:26377817

  19. Development of MMRPC prototype for the NeuLAND detector of the R3B collaboration

    NASA Astrophysics Data System (ADS)

    Pramanik, U. Datta; Chakraborty, S.; Basu, P.; Basu, J.; Banerjee, P.; Bemmerer, D.; Bose, S.; Chatterjee, S.; Elekes, Z.; Kempe, M.; Leifels, Y.; Panja, J.; Mukherjee, A.; Rahaman, A.; Roy, S.; Simon, H.; Sobiella, M.; Stach, D.; Wagner, A.; Yakorev, D.

    2012-01-01

    A prototype of Multi-strip Multi-gap Resistive Plate chamber (MMRPC) with active area 40cm×20cm has been developed at SINP, Kolkata as a new Time-Of-Flight (TOF) system with timing resolution σt<120ps and position resolution σx˜0.58cm. The intention is to use multilayers of this type together with converter materials as a high energy neutron (1GeV>En>200MeV) TOF system for the R3B collaboration at the FAIR facility. The design of the detector elements is as follows: a double stack MMRPC with float glass plates and two gas gaps of 0.3 mm per stack. The response of this MMRPC has been studied with cosmic muons and γ-rays from a standard radioactive source (60Co) in coincidence with fast inorganic scintillators at SINP laboratory. Recently, response of developed MMRPC has been studied using pulsed electron beam at ELBE, FZD. The details of the MMRPC construction , experimental set-up for investigation of its response and first results are presented.

  20. The oil palm VIRESCENS gene controls fruit colour and encodes a R2R3-MYB.

    PubMed

    Singh, Rajinder; Low, Eng-Ti Leslie; Ooi, Leslie Cheng-Li; Ong-Abdullah, Meilina; Nookiah, Rajanaidu; Ting, Ngoot-Chin; Marjuni, Marhalil; Chan, Pek-Lan; Ithnin, Maizura; Manaf, Mohd Arif Abdul; Nagappan, Jayanthi; Chan, Kuang-Lim; Rosli, Rozana; Halim, Mohd Amin; Azizi, Norazah; Budiman, Muhammad A; Lakey, Nathan; Bacher, Blaire; Van Brunt, Andrew; Wang, Chunyan; Hogan, Michael; He, Dong; MacDonald, Jill D; Smith, Steven W; Ordway, Jared M; Martienssen, Robert A; Sambanthamurthi, Ravigadevi

    2014-01-01

    Oil palm, a plantation crop of major economic importance in Southeast Asia, is the predominant source of edible oil worldwide. We report the identification of the virescens (VIR) gene, which controls fruit exocarp colour and is an indicator of ripeness. VIR is a R2R3-MYB transcription factor with homology to Lilium LhMYB12 and similarity to Arabidopsis production of anthocyanin pigment1 (PAP1). We identify five independent mutant alleles of VIR in over 400 accessions from sub-Saharan Africa that account for the dominant-negative virescens phenotype. Each mutation results in premature termination of the carboxy-terminal domain of VIR, resembling McClintock's C1-I allele in maize. The abundance of alleles likely reflects cultural practices, by which fruits were venerated for magical and medicinal properties. The identification of VIR will allow selection of the trait at the seed or early-nursery stage, 3-6 years before fruits are produced, greatly advancing introgression into elite breeding material. PMID:24978855

  1. Expression and Purification of Functional Ligand-binding Domains of T1R3 Taste Receptors

    SciTech Connect

    Nie,Y.; Hobbs, J.; Vigues, S.; Olson, W.; Conn, G.; Munger, S.

    2006-01-01

    Chemosensory receptors, including odor, taste, and vomeronasal receptors, comprise the largest group of G protein-coupled receptors (GPCRs) in the mammalian genome. However, little is known about the molecular determinants that are critical for the detection and discrimination of ligands by most of these receptors. This dearth of understanding is due in part to difficulties in preparing functional receptors suitable for biochemical and biophysical analyses. Here we describe in detail two strategies for the expression and purification of the ligand-binding domain of T1R taste receptors, which are constituents of the sweet and umami taste receptors. These class C GPCRs contain a large extracellular N-terminal domain (NTD) that is the site of interaction with most ligands and that is amenable to expression as a separate polypeptide in heterologous cells. The NTD of mouse T1R3 was expressed as two distinct fusion proteins in Escherichia coli and purified by column chromatography. Spectroscopic analysis of the purified NTD proteins shows them to be properly folded and capable of binding ligands. This methodology should not only facilitate the characterization of T1R ligand interactions but may also be useful for dissecting the function of other class C GPCRs such as the large family of orphan V2R vomeronasal receptors.

  2. Poly[(R)-3-hydroxybutyrate] production under different salinity conditions by a novel Bacillus megaterium strain.

    PubMed

    Rodríguez-Contreras, Alejandra; Koller, Martin; Braunegg, Gerhart; Marqués-Calvo, María Soledad

    2016-01-25

    Bacillus megaterium uyuni S29, isolated from the Bolivian salt lake Uyuni, displays a high capability to produce poly[(R)-3-hydroxybutyrate] (PHB) in industrial culture media. In order to analyze the influence of salt on biomass formation and PHB production, cultivations at different NaCl concentrations were carried out according to the salinity conditions of the habitats of the strain's original isolation. In this preliminary report, the strain showed considerable adaptability to media of different salinity, obtaining the best results for both cellular growth and PHB production in media containing 45 g/L NaCl. The strain grew at 100 g/L NaCl and PHB production was observed even at high salt levels of 250 g/L without unwanted concurrent spore formation. Its tolerance to high salt concentrations together with auspicious PHB productivity makes this strain appealing not only for PHB production, but also for other biotechnological applications such as the treatment of salty wastewater; additional studies will be needed to further increase PHB productivity. PMID:26344348

  3. Regulating the production of (R)-3-hydroxybutyrate in Escherichia coli by N or P limitation

    PubMed Central

    Guevara-Martínez, Mónica; Sjöberg Gällnö, Karin; Sjöberg, Gustav; Jarmander, Johan; Perez-Zabaleta, Mariel; Quillaguamán, Jorge; Larsson, Gen

    2015-01-01

    The chiral compound (R)-3-hydroxybutyrate (3HB) is naturally produced by many wild type organisms as the monomer for polyhydroxybutyrate (PHB). Both compounds are commercially valuable and co-polymeric polyhydroxyalkanoates have been used e.g., in medical applications for skin grafting and as components in pharmaceuticals. In this paper we investigate cultivation strategies for production of 3HB in the previously described E. coli strain AF1000 pJBGT3RX. This strain produces extracellular 3HB by expression of two genes from the PHB pathway of Halomonas boliviensis. H. boliviensis is a newly isolated halophile that forms PHB as a storage compound during carbon excess and simultaneous limitation of another nutrient like nitrogen and phosphorous. We hypothesize that a similar approach can be used to control the flux from acetyl-CoA to 3HB also in E. coli; decreasing the flux to biomass and favoring the pathway to the product. We employed ammonium- or phosphate-limited fed-batch processes for comparison of the productivity at different nutrient limitation or starvation conditions. The feed rate was shown to affect the rate of glucose consumption, respiration, 3HB, and acetic acid production, although the proportions between them were more difficult to affect. The highest 3HB volumetric productivity, 1.5 g L−1 h−1, was seen for phosphate-limitation. PMID:26347729

  4. AlgR3, a protein resembling eukaryotic histone H1, regulates alginate synthesis in Pseudomonas aeruginosa.

    PubMed Central

    Kato, J; Misra, T K; Chakrabarty, A M

    1990-01-01

    A regulatory mutation (alg52) in a Pseudomonas aeruginosa alginate-negative mutant (strain 8882) is complemented efficiently by the gene algR2 and somewhat inefficiently by a second gene termed algR3. algR3 and algR2 are located on a 4.4-kilobase-pair HindIII-BamHI fragment, which has been completely sequenced. algR2 has previously been characterized. Introduction of kanamycin-resistance cassettes and deletion-subcloning experiments involving various open reading frames in the HindIII-BamHI fragment have localized the algR3 gene, which encodes a 340-amino acid polypeptide. This highly basic regulatory protein contains 17% lysine and 36% alanine. The predicted amino acid sequence shows no significant similarity with any bacterial proteins and yet is highly similar to the sea urchin Lytechinus pictus histone H1 subtype of protein. Promoter localization by reverse transcriptase mapping of the algR3 gene shows the presence of Escherichia coli sigma 70 recognition sequences, and coupled transcription/translation experiments in E. coli demonstrate the presence of a 39-kDa polypeptide encoded by the cloned algR3 gene. Images PMID:2109318

  5. Genome-Wide Identification of R2R3-MYB Genes and Expression Analyses During Abiotic Stress in Gossypium raimondii

    PubMed Central

    He, Qiuling; Jones, Don C.; Li, Wei; Xie, Fuliang; Ma, Jun; Sun, Runrun; Wang, Qinglian; Zhu, Shuijin; Zhang, Baohong

    2016-01-01

    The R2R3-MYB is one of the largest families of transcription factors, which have been implicated in multiple biological processes. There is great diversity in the number of R2R3-MYB genes in different plants. However, there is no report on genome-wide characterization of this gene family in cotton. In the present study, a total of 205 putative R2R3-MYB genes were identified in cotton D genome (Gossypium raimondii), that are much larger than that found in other cash crops with fully sequenced genomes. These GrMYBs were classified into 13 groups with the R2R3-MYB genes from Arabidopsis and rice. The amino acid motifs and phylogenetic tree were predicted and analyzed. The sequences of GrMYBs were distributed across 13 chromosomes at various densities. The results showed that the expansion of the G. Raimondii R2R3-MYB family was mainly attributable to whole genome duplication and segmental duplication. Moreover, the expression pattern of 52 selected GrMYBs and 46 GaMYBs were tested in roots and leaves under different abiotic stress conditions. The results revealed that the MYB genes in cotton were differentially expressed under salt and drought stress treatment. Our results will be useful for determining the precise role of the MYB genes during stress responses with crop improvement. PMID:27009386

  6. Analysis of the grape MYB R2R3 subfamily reveals expanded wine quality-related clades and conserved gene structure organization across Vitis and Arabidopsis genomes

    PubMed Central

    Matus, José Tomás; Aquea, Felipe; Arce-Johnson, Patricio

    2008-01-01

    Background The MYB superfamily constitutes the most abundant group of transcription factors described in plants. Members control processes such as epidermal cell differentiation, stomatal aperture, flavonoid synthesis, cold and drought tolerance and pathogen resistance. No genome-wide characterization of this family has been conducted in a woody species such as grapevine. In addition, previous analysis of the recently released grape genome sequence suggested expansion events of several gene families involved in wine quality. Results We describe and classify 108 members of the grape R2R3 MYB gene subfamily in terms of their genomic gene structures and similarity to their putative Arabidopsis thaliana orthologues. Seven gene models were derived and analyzed in terms of gene expression and their DNA binding domain structures. Despite low overall sequence homology in the C-terminus of all proteins, even in those with similar functions across Arabidopsis and Vitis, highly conserved motif sequences and exon lengths were found. The grape epidermal cell fate clade is expanded when compared with the Arabidopsis and rice MYB subfamilies. Two anthocyanin MYBA related clusters were identified in chromosomes 2 and 14, one of which includes the previously described grape colour locus. Tannin related loci were also detected with eight candidate homologues in chromosomes 4, 9 and 11. Conclusion This genome wide transcription factor analysis in Vitis suggests that clade-specific grape R2R3 MYB genes are expanded while other MYB genes could be well conserved compared to Arabidopsis. MYB gene abundance, homology and orientation within particular loci also suggests that expanded MYB clades conferring quality attributes of grapes and wines, such as colour and astringency, could possess redundant, overlapping and cooperative functions. PMID:18647406

  7. Optimal Decay Rate of the Compressible Navier-Stokes-Poisson System in {mathbb {R}^3}

    NASA Astrophysics Data System (ADS)

    Li, Hai-Liang; Matsumura, Akitaka; Zhang, Guojing

    2010-05-01

    The compressible Navier-Stokes-Poisson (NSP) system is considered in {mathbb {R}^3} in the present paper, and the influences of the electric field of the internal electrostatic potential force governed by the self-consistent Poisson equation on the qualitative behaviors of solutions is analyzed. It is observed that the rotating effect of electric field affects the dispersion of fluids and reduces the time decay rate of solutions. Indeed, we show that the density of the NSP system converges to its equilibrium state at the same L 2-rate {(1+t)^{-frac {3}{4}}} or L ∞-rate (1 + t)-3/2 respectively as the compressible Navier-Stokes system, but the momentum of the NSP system decays at the L 2-rate {(1+t)^{-frac {1}{4}}} or L ∞-rate (1 + t)-1 respectively, which is slower than the L 2-rate {(1+t)^{-frac {3}{4}}} or L ∞-rate (1 + t)-3/2 for compressible Navier-Stokes system [Duan et al., in Math Models Methods Appl Sci 17:737-758, 2007; Liu and Wang, in Comm Math Phys 196:145-173, 1998; Matsumura and Nishida, in J Math Kyoto Univ 20:67-104, 1980] and the L ∞-rate (1 + t)- p with {p in (1, 3/2)} for irrotational Euler-Poisson system [Guo, in Comm Math Phys 195:249-265, 1998]. These convergence rates are shown to be optimal for the compressible NSP system.

  8. Three R2R3-MYB transcription factors regulate distinct floral pigmentation patterning in Phalaenopsis spp.

    PubMed

    Hsu, Chia-Chi; Chen, You-Yi; Tsai, Wen-Chieh; Chen, Wen-Huei; Chen, Hong-Hwa

    2015-05-01

    Orchidaceae are well known for their fascinating floral morphologic features, specialized pollination, and distinctive ecological strategies. With their long-lasting flowers of various colors and pigmentation patterning, Phalaenopsis spp. have become important ornamental plants worldwide. In this study, we identified three R2R3-MYB transcription factors PeMYB2, PeMYB11, and PeMYB12. Their expression profiles were concomitant with red color formation in Phalaenopsis spp. flowers. Transient assay of overexpression of three PeMYBs verified that PeMYB2 resulted in anthocyanin accumulation, and these PeMYBs could activate the expression of three downstream structural genes Phalaenopsis spp. Flavanone 3-hydroxylase5, Phalaenopsis spp. Dihydroflavonol 4-reductase1, and Phalaenopsis spp. Anthocyanidin synthase3. In addition, these three PeMYBs participated in the distinct pigmentation patterning in a single flower, which was revealed by virus-induced gene silencing. In the sepals/petals, silencing of PeMYB2, PeMYB11, and PeMYB12 resulted in the loss of the full-red pigmentation, red spots, and venation patterns, respectively. Moreover, different pigmentation patterning was regulated by PeMYBs in the sepals/petals and lip. PeMYB11 was responsive to the red spots in the callus of the lip, and PeMYB12 participated in the full pigmentation in the central lobe of the lip. The differential pigmentation patterning was validated by RNA in situ hybridization. Additional assessment was performed in six Phalaenopsis spp. cultivars with different color patterns. The combined expression of these three PeMYBs in different ratios leads to a wealth of complicated floral pigmentation patterning in Phalaenopsis spp. PMID:25739699

  9. L-Theanine elicits umami taste via the T1R1 + T1R3 umami taste receptor.

    PubMed

    Narukawa, Masataka; Toda, Yasuka; Nakagita, Tomoya; Hayashi, Yukako; Misaka, Takumi

    2014-06-01

    L-Theanine is a unique amino acid present in green tea. It elicits umami taste and has a considerable effect on tea taste and quality. We investigated L-theanine activity on the T1R1 + T1R3 umami taste receptor. L-Theanine activated T1R1 + T1R3-expressing cells and showed a synergistic response with inosine 5'-monophosphate. The site-directed mutagenesis analysis revealed that L-theanine binds to L-amino acid binding site in the Venus flytrap domain of T1R1. This study shows that L-theanine elicits an umami taste via T1R1 + T1R3. PMID:24633359

  10. The Role of Short-Chain Conjugated Poly-(R)-3-Hydroxybutyrate (cPHB) in Protein Folding

    PubMed Central

    Reusch, Rosetta N.

    2013-01-01

    Poly-(R)-3-hydroxybutyrate (PHB), a linear polymer of R-3-hydroxybutyrate (R-3HB), is a fundamental constituent of biological cells. Certain prokaryotes accumulate PHB of very high molecular weight (10,000 to >1,000,000 residues), which is segregated within granular deposits in the cytoplasm; however, all prokaryotes and all eukaryotes synthesize PHB of medium-chain length (~100–200 residues) which resides within lipid bilayers or lipid vesicles, and PHB of short-chain length (<12 residues) which is conjugated to proteins (cPHB), primarily proteins in membranes and organelles. The physical properties of cPHB indicate it plays important roles in the targeting and folding of cPHB-proteins. Here we review the occurrence, physical properties and molecular characteristics of cPHB, and discuss its influence on the folding and structure of outer membrane protein A (OmpA) of Escherichia coli. PMID:23702844

  11. Polymorphisms in the taste receptor gene (Tas1r3) region are associated with saccharin preference in 30 mouse strains.

    PubMed

    Reed, D R; Li, S; Li, X; Huang, L; Tordoff, M G; Starling-Roney, R; Taniguchi, K; West, D B; Ohmen, J D; Beauchamp, G K; Bachmanov, A A

    2004-01-28

    The results of recent studies suggest that the mouse Sac (saccharin preference) locus is identical to the Tas1r3 (taste receptor) gene. The goal of this study was to identify Tas1r3 sequence variants associated with saccharin preference in a large number of inbred mouse strains. Initially, we sequenced approximately 6.7 kb of the Tas1r3 gene and its flanking regions from six inbred mouse strains with high and low saccharin preference, including the strains in which the Sac alleles were described originally (C57BL/6J, Sac(b); DBA/2J, Sac(d)). Of the 89 sequence variants detected among these six strains, eight polymorphic sites were significantly associated with preferences for 1.6 mm saccharin. Next, each of these eight variant sites were genotyped in 24 additional mouse strains. Analysis of the genotype-phenotype associations in all 30 strains showed the strongest association with saccharin preference at three sites: nucleotide (nt) -791 (3 bp insertion/deletion), nt +135 (Ser45Ser), and nt +179 (Ile60Thr). We measured Tas1r3 gene expression, transcript size, and T1R3 immunoreactivity in the taste tissue of two inbred mouse strains with different Tas1r3 haplotypes and saccharin preferences. The results of these experiments suggest that the polymorphisms associated with saccharin preference do not act by blocking gene expression, changing alternative splicing, or interfering with protein translation in taste tissue. The amino acid substitution (Ile60Thr) may influence the ability of the protein to form dimers or bind sweeteners. Here, we present data for future studies directed to experimentally confirm the function of these polymorphisms and highlight some of the difficulties of identifying specific DNA sequence variants that underlie quantitative trait loci. PMID:14749438

  12. Quintuplet Cluster

    NASA Technical Reports Server (NTRS)

    1999-01-01

    Penetrating 25,000 light-years of obscuring dust and myriad stars, NASA's Hubble Space Telescope has provided the clearest view yet of one of the largest young clusters of stars inside our Milky Way galaxy, located less than 100 light-years from the very center of the Galaxy. Having the equivalent mass greater than 10,000 stars like our sun, the monster cluster is ten times larger than typical young star clusters scattered throughout our Milky Way. It is destined to be ripped apart in just a few million years by gravitational tidal forces in the galaxy's core. But in its brief lifetime it shines more brightly than any other star cluster in the Galaxy. Quintuplet Cluster is 4 million years old. It has stars on the verge of blowing up as supernovae. It is the home of the brightest star seen in the galaxy, called the Pistol star. This image was taken in infrared light by Hubble's NICMOS camera in September 1997. The false colors correspond to infrared wavelengths. The galactic center stars are white, the red stars are enshrouded in dust or behind dust, and the blue stars are foreground stars between us and the Milky Way's center. The cluster is hidden from direct view behind black dust clouds in the constellation Sagittarius. If the cluster could be seen from earth it would appear to the naked eye as a 3rd magnitude star, 1/6th of a full moon's diameter apart.

  13. Galaxy Clusters

    NASA Astrophysics Data System (ADS)

    Miller, Christopher J. Miller

    2012-03-01

    There are many examples of clustering in astronomy. Stars in our own galaxy are often seen as being gravitationally bound into tight globular or open clusters. The Solar System's Trojan asteroids cluster at the gravitational Langrangian in front of Jupiter’s orbit. On the largest of scales, we find gravitationally bound clusters of galaxies, the Virgo cluster (in the constellation of Virgo at a distance of ˜50 million light years) being a prime nearby example. The Virgo cluster subtends an angle of nearly 8◦ on the sky and is known to contain over a thousand member galaxies. Galaxy clusters play an important role in our understanding of theUniverse. Clusters exist at peaks in the three-dimensional large-scale matter density field. Their sky (2D) locations are easy to detect in astronomical imaging data and their mean galaxy redshifts (redshift is related to the third spatial dimension: distance) are often better (spectroscopically) and cheaper (photometrically) when compared with the entire galaxy population in large sky surveys. Photometric redshift (z) [Photometric techniques use the broad band filter magnitudes of a galaxy to estimate the redshift. Spectroscopic techniques use the galaxy spectra and emission/absorption line features to measure the redshift] determinations of galaxies within clusters are accurate to better than delta_z = 0.05 [7] and when studied as a cluster population, the central galaxies form a line in color-magnitude space (called the the E/S0 ridgeline and visible in Figure 16.3) that contains galaxies with similar stellar populations [15]. The shape of this E/S0 ridgeline enables astronomers to measure the cluster redshift to within delta_z = 0.01 [23]. The most accurate cluster redshift determinations come from spectroscopy of the member galaxies, where only a fraction of the members need to be spectroscopically observed [25,42] to get an accurate redshift to the whole system. If light traces mass in the Universe, then the locations

  14. AGE-R3/galectin-3 expression in osteoblast-like cells: regulation by AGEs.

    PubMed

    Mercer, Natalia; Ahmed, Hafiz; McCarthy, Antonio D; Etcheverry, Susana B; Vasta, Gerardo R; Cortizo, Ana M

    2004-11-01

    The accumulation of irreversible advanced glycation endproducts (AGEs) on long-lived proteins, and the interaction of AGEs with cellular receptors such as AGE-R3/galectin-3 and RAGE, are considered to be key events in the development of long-term complications of diabetes mellitus, Alzheimer's disease, uremia and ageing. The aim of this study was to investigate the expression and sub-cellular distribution of galectin-3, as well as its possible modulation by AGEs, in MC3T3E1 mouse calvaria-derived osteoblasts and in UMR 106 rat osteosarcoma cells. Both osteoblastic lines were cultured either with control bovine serum albumin (BSA) or with AGEs-BSA for 48 h. Cells were evaluated for galectin-3 expression by fixing and immunofluorescent microscopic analysis; or Western blot analysis of whole cell extracts, sub-cellular fractions and culture media. Both cell lines express 30 kDa (monomeric) galectin-3, although expression was about 15-fold lower in the UMR106 osteosarcoma cells. Dimeric (70 kDa) galectin-3 was additionally observed in the UMR106 cells. Immunofluorescent analysis of galectin-3 distribution showed a diffuse cytoplasmic and strong nuclear pattern in MC3T3E1 osteoblasts, and a patchy cytoplasmic pattern in UMR106 cells. Western blot analysis for both cell lines showed that galectin-3 was mainly found in the cytoplasm and in minor amounts in the microsomal fraction, while considerable amounts were secreted into the culture media. Exposure to 100-200 microg/mL AGEs-BSA increased the cellular content of 30 kDa galectin-3 (20-25% for MC3T3E1 and 35-70% for UMR106 versus control BSA, p < 0.05), and decreased the culture media levels of galectin-3 (10-20% for MC3T3E1 and for UMR106 versus control BSA, p < 0.05). These results confirm the expression of galectin-3 in osteoblastic cells, and suggest different levels and sub-cellular distribution of this protein in transformed versus non-transformed osteoblasts. Osteoblastic exposure to AGEs alters their expression

  15. Effect of selective thiol-group derivatization on enzyme kinetics of (R)-3-hydroxybutyrate dehydrogenase.

    PubMed Central

    Dalton, L A; McIntyre, J O; Fleischer, S

    1993-01-01

    (R)-3-Hydroxybutyrate dehydrogenase (BDH) is a phosphatidylcholine-requiring tetrameric enzyme with two thiol groups (SH-1 and SH-2) per protomer. By first protecting the more rapidly reacting thiol group (SH-1) with diamide [1,1'-azobis-(NN'-dimethylformamide), DM] to form DM(SH-1)BDH, SH-2 can be selectively derivatized by reaction with maleimide reagents such as 4-maleimido-2,2,6,6-tetramethyl-piperidine-N-oxyl (MSL), which gives DM(SH-1)MSL(SH-2)BDH. Reduction with dithiothreitol (DTT) regenerates SH-1, yielding MAL(SH-2)BDH (where MAL is the diamagnetic reduction product of MSL-BDH and DTT). The enzymic activity of DM(SH-1)BDH is decreased to approx. 4% relative to the native purified enzyme, and the apparent Km for substrate, KmBOH, is increased approx. 100-fold. Reduction of DM(SH-1)BDH with DTT regenerates SH-1 and restores normal enzymic function. Modification of SH-2 with piperidinylmaleimide [MAL(SH-2)BDH] diminishes enzymic activity to approx. 35% of its original value, but has no significant effect on apparent KmBOH. The doubly derivatized enzyme, DM(SH-1)MSL(SH-2)BDH, has lower enzymic activity [about half that for DM(SH-2)BDH] and a yet higher apparent KmBOH than DM(SH-1)BDH. Derivatization of SH-2 with different maleimide reagents results in diminished activity approximately proportional to the size of the maleimide substituent, suggesting that this inhibition is steric. Whereas modification of SH-1 results in marked changes in kinetic parameters (increased apparent Km and reduced apparent Vmax), derivatization of SH-2 has a lesser effect on enzymic function. Thus SH-1 is postulated to be closer to the active centre than is SH-2, although neither is involved in catalysis, since: (1) the activity of the derivatized enzyme is not abolished; and (2) activity can be enhanced by increasing substrate (and cofactor) concentrations. PMID:8280053

  16. Occupational Clusters.

    ERIC Educational Resources Information Center

    Pottawattamie County School System, Council Bluffs, IA.

    The 15 occupational clusters (transportation, fine arts and humanities, communications and media, personal service occupations, construction, hospitality and recreation, health occupations, marine science occupations, consumer and homemaking-related occupations, agribusiness and natural resources, environment, public service, business and office…

  17. Data Clustering

    NASA Astrophysics Data System (ADS)

    Wagstaff, Kiri L.

    2012-03-01

    On obtaining a new data set, the researcher is immediately faced with the challenge of obtaining a high-level understanding from the observations. What does a typical item look like? What are the dominant trends? How many distinct groups are included in the data set, and how is each one characterized? Which observable values are common, and which rarely occur? Which items stand out as anomalies or outliers from the rest of the data? This challenge is exacerbated by the steady growth in data set size [11] as new instruments push into new frontiers of parameter space, via improvements in temporal, spatial, and spectral resolution, or by the desire to "fuse" observations from different modalities and instruments into a larger-picture understanding of the same underlying phenomenon. Data clustering algorithms provide a variety of solutions for this task. They can generate summaries, locate outliers, compress data, identify dense or sparse regions of feature space, and build data models. It is useful to note up front that "clusters" in this context refer to groups of items within some descriptive feature space, not (necessarily) to "galaxy clusters" which are dense regions in physical space. The goal of this chapter is to survey a variety of data clustering methods, with an eye toward their applicability to astronomical data analysis. In addition to improving the individual researcher’s understanding of a given data set, clustering has led directly to scientific advances, such as the discovery of new subclasses of stars [14] and gamma-ray bursts (GRBs) [38]. All clustering algorithms seek to identify groups within a data set that reflect some observed, quantifiable structure. Clustering is traditionally an unsupervised approach to data analysis, in the sense that it operates without any direct guidance about which items should be assigned to which clusters. There has been a recent trend in the clustering literature toward supporting semisupervised or constrained

  18. Cluster generator

    DOEpatents

    Donchev, Todor I.; Petrov, Ivan G.

    2011-05-31

    Described herein is an apparatus and a method for producing atom clusters based on a gas discharge within a hollow cathode. The hollow cathode includes one or more walls. The one or more walls define a sputtering chamber within the hollow cathode and include a material to be sputtered. A hollow anode is positioned at an end of the sputtering chamber, and atom clusters are formed when a gas discharge is generated between the hollow anode and the hollow cathode.

  19. R3-R4 deletion in the PRNP gene is associated with Creutzfeldt-Jakob disease (CJD)

    SciTech Connect

    Cervenakova, L.; Brown, P.; Nagle, J.

    1994-09-01

    There are conflicting reports on the association of deletions in the PRNP gene on chromosome 20 with CJD, a rapidly progressive fatal spongiform encephalopathy. We accumulated data suggesting that a deletion of R3-R4 type (parts of the third and fourth repeats are deleted from the area of four repeating 24 bp sequences in the 5{prime} region of the gene) is causing CJD. Screening of 129 unaffected control individuals demonstrated presence of a deletion of R2 type in four (1.55% of the studied chromosomes), but none of them had the R3-R4 type. Of 181 screened patients with spongiform encephalopathies, two had a deletion of R3-R4 type with no other mutations in the coding sequence. Both patients had a classical rapidly progressive dementing disease and diffuse spongiform degeneration, and both cases were apparently sporadic. The same R3-R4 type of deletion was detected in three additional neuropathologically confirmed spongiform encephalopathy patients, of which two had other known pathogenic mutations in the PRNP gene: at codon 178 on the methionine allele exhibiting the phenotype of fatal familial insomnia, and codon 200 causing CJD with severe dementia; the third was a patient with iatrogenic CJD who developed the disease after treatment with growth hormone extracted from cadaveric human pituitary glands. In all cases the deletion coincided with a variant sequence at position 129 coding for methionine.

  20. Crystal structure analysis of a glycosides hydrolase family 42 cold-adapted ß-galactosidase from Rahnella sp. R3

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The ß-galactosidase isolated from a psychrotrophic bacterium, Rahnella sp. R3 (R-ß-Gal), exhibits high activity at low temperature. R-ß-Gal is a member of the glycoside hydrolases family 42 (GH42), and forms a 225 kDa trimeric structure in solution. The X-ray crystal structure of R-ß-Gal was determi...

  1. Evaluation of Radial Flow Fluidized Filter (R3F) Followed by Microfiltration and Ultrafiltration Systems in Calimesa, California

    EPA Science Inventory

    U.S. EPA coordinated a field study with South Mesa Water Utility to look for treatment alternatives for California State Project Water in the small community of Calimesa, California. EPA evaluated the performance of a system comprised of Radial Flow Fluidized Filtration (R3f) fo...

  2. Cloning, expression and structural stability of a cold-adapted ß-Galactosidase from Rahnella sp.R3

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A novel gene was isolated for the first time from a psychrophilic gram-negative bacterium Rahnella sp.R3. It encoded a cold-adapted ß-galactosidase (R-ß-Gal). Recombinant R-ß-Gal was expressed in Escherichia coli BL21 (DE3), purified, and characterized. R-ß-Gal belongs to the glycosyl hydrolase fami...

  3. Characterization of a citrus R2R3-MYB transcription factor that regulates the flavonol and hydroxycinnamic acid biosynthesis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Flavonols and hydroxycinnamic acids are important phenylpropanoid metabolites in plants. In this study, we isolated and characterized a citrus R2R3-MYB transcription factor CsMYBF1, encoding a protein belonging to the flavonol-specific MYB subgroup. Ectopic expression of CsMYBF1 in tomato led to an ...

  4. 76 FR 71044 - International Conference on Harmonisation; E2B(R3) Electronic Transmission of Individual Case...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-11-16

    ... (76 FR 65199). The document announced the availability of a draft guidance entitled ``E2B(R3... 20993-0002, (301) 796-3601. SUPPLEMENTARY INFORMATION: In FR Doc. 2011-27147, appearing on page 65199...) Electronic Transmission of Individual Case Safety Reports; Draft Guidance on Implementation; Data...

  5. 76 FR 65199 - International Conference on Harmonisation; E2B(R3) Electronic Transmission of Individual Case...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-10-20

    ...) Electronic Transmission of Individual Case Safety Reports; Draft Guidance on Implementation; Data Elements... Safety Reports (ICSRs): Implementation Guide--Data Elements and Message Specification'' (the draft E2B(R3... BFC appendix describes the relationship between data elements from the 2001 ICH E2B guidance and...

  6. Two Distinct Determinants of Ligand Specificity in T1R1/T1R3 (the Umami Taste Receptor)*

    PubMed Central

    Toda, Yasuka; Nakagita, Tomoya; Hayakawa, Takashi; Okada, Shinji; Narukawa, Masataka; Imai, Hiroo; Ishimaru, Yoshiro; Misaka, Takumi

    2013-01-01

    Umami taste perception in mammals is mediated by a heteromeric complex of two G-protein-coupled receptors, T1R1 and T1R3. T1R1/T1R3 exhibits species-dependent differences in ligand specificity; human T1R1/T1R3 specifically responds to l-Glu, whereas mouse T1R1/T1R3 responds more strongly to other l-amino acids than to l-Glu. The mechanism underlying this species difference remains unknown. In this study we analyzed chimeric human-mouse receptors and point mutants of T1R1/T1R3 and identified 12 key residues that modulate amino acid recognition in the human- and mouse-type responses in the extracellular Venus flytrap domain of T1R1. Molecular modeling revealed that the residues critical for human-type acidic amino acid recognition were located at the orthosteric ligand binding site. In contrast, all of the key residues for the mouse-type broad response were located at regions outside of both the orthosteric ligand binding site and the allosteric binding site for inosine-5′-monophosphate (IMP), a known natural umami taste enhancer. Site-directed mutagenesis demonstrated that the newly identified key residues for the mouse-type responses modulated receptor activity in a manner distinct from that of the allosteric modulation via IMP. Analyses of multiple point mutants suggested that the combination of two distinct determinants, amino acid selectivity at the orthosteric site and receptor activity modulation at the non-orthosteric sites, may mediate the ligand specificity of T1R1/T1R3. This hypothesis was supported by the results of studies using nonhuman primate T1R1 receptors. A complex molecular mechanism involving changes in the properties of both the orthosteric and non-orthosteric sites of T1R1 underlies the determination of ligand specificity in mammalian T1R1/T1R3. PMID:24214976

  7. The Rapid Response Radiation Survey (R3S) Mission Using the HiSat Conformal Satellite Architecture

    NASA Technical Reports Server (NTRS)

    Miller, Nathanael A.; Norman, Ryan B.; Soto, Hector L.; Stewart, Victor A.; Jones, Mark L.; Kowalski, Matthew C.; Ben Shabat, Adam; Gough, Kerry M.; Stavely, Rebecca L.; Shim, Alex C.; Jaeger, Gene T. K.

    2015-01-01

    The Rapid Response Radiation Survey (R3S) experiment, designed as a quick turnaround mission to make radiation measurements in Low Earth Orbit (LEO), will fly as a hosted payload in partnership with NovaWurks using their Hyper-integrated Satlet (HISat) architecture. The need for the mission arises as the Nowcast of Atmospheric Ionization Radiation for Aviation Safety (NAIRAS) model moves from a research effort into an operational radiation assessment tool. Currently, airline professionals are the second largest demographic of radiation workers and to date their radiation exposure is undocumented in the USA. The NAIRAS model seeks to fill this information gap. The data collected by R3S, in addition to the complementary data from a NASA Langley Research Center (LaRC) atmospheric balloon mission entitled Radiation Dosimetry Experiment (RaD-X), will validate exposure prediction capabilities of NAIRAS. The R3S mission collects total dose and radiation spectrum measurements using a Teledyne µDosimeter and a Liulin-6SA2 LED spectrometer. These two radiation sensors provide a cross correlated radiometric measurement in combination with the Honeywell HMR2300 Smart Digital Magnetometer. The magnetometer assesses the Earth's magnetic field in the LEO environment and allows radiation dose to be mapped as a function of the Earth's magnetic shielding. R3S is also unique in that the radiation sensors will be exposed on the outer surface of the spacecraft, possibly making this the first measurements of the LEO radiation environment with bare sensors. Viability of R3S as an extremely fast turnaround mission is due, in part, to the nature of the robust, well-defined interfaces of the conformal satellite HiSat Architecture. The HiSat architecture, which was developed with the support of the Defense Advanced Research Projects Agency's (DARPA's) Phoenix Program, enabled the R3S system to advance from the first concept to delivery of preliminary design review (PDR) level documents in

  8. [Involvement of Tas1r3 receptor protein in control of the metabolism of glucose at different levels of glycemia in mice].

    PubMed

    Murovets, V O; Bachmanov, A A; Travnikov, S V; Tchurikova, A A; Zolotarev, V A

    2014-01-01

    The heterodimeric protein T1R2/T1R3 is a chemoreceptor mediating taste perception of sugars, several amino acids, and non-caloric sweeteners in humans and many other vertebrate species. The T1R2 and T1R3 proteins are expressed not only in the oral cavity, but also in the intestine, pancreas, liver, adipose, tissue, and in structures of the central nervous system, which suggests their involvement in functions other than gustatory perception. In this study, we analyzed the role of the T1R3 protein in regulation of glucose metabolism in experiments with the gene-knockout mouse strain C57BL6J-Tas1r3(tm1Rfm) (Tas1r3-/-), with a deletion of the Tas1r3 gene encoding T1R3, and the control strain C57BL/6ByJ with the intact gene. Glucose tolerance was measured in euglycemic or food-deprived mice after intraperitoneal to disappearance glucose administration. We have shown that in the Tas1r3-/- strain, in addition to disappearance of taste preference for sucrose, glucose tolerance is also substantially reduced, and insulin resistance is observed. The effect of the Tas1r3 gene knockout on glucose utilization was more pronounced in the euglycemic state than after food deprivation. The baseline glucose level after food deprivation was lower in the Tas1r3-/- strain than in the control strain, which suggested that the T1R3 is involved in regulation of endogenous glucose production. These data suggest that the T1R3-mediated glucoreception interacts with the K(ATP)-dependent mechanisms of regulation of the glucose metabolism, and that the main role is likely played by T1R3 expressed in the pancreas and possibly in the central nervous system, but not in the intestinal mucosa, as it was suggested earlier. PMID:25775865

  9. The Involvement of the T1R3 Receptor Protein in the Control of Glucose Metabolism in Mice at Different Levels of Glycemia

    PubMed Central

    Murovets, V. O.; Bachmanov, A. A.; Travnikov, S. V.; Churikova, A. A.; Zolotarev, V. A.

    2015-01-01

    The heterodimeric protein T1R2/T1R3 is a chemoreceptor mediating taste perception of sugars, several amino acids, and non-caloric sweeteners in humans and many other vertebrate species. The T1R2 and T1R3 proteins are expressed not only in the oral cavity, but also in the intestine, pancreas, liver, adipose tissue, and in structures of the central nervous system, which suggests their involvement in functions other than gustatory perception. In this study, we analyzed the role of the T1R3 protein in regulation of glucose metabolism in experiments with the gene-knockout mouse strain C57BL/6J–Tas1r3tm1Rfm (Tas1r3−/−), with a deletion of the Tas1r3 gene encoding T1R3, and the control strain C57BL/6ByJ with the intact gene. Glucose tolerance was measured in euglycemic or food-deprived mice after intraperitoneal or intragastric glucose administration. We have shown that in the Tas1r3−/− strain, in addition to the disappearance of taste preference for sucrose, glucose tolerance is also substantially reduced, and insulin resistance is observed. The effect of the Tas1r3 gene knockout on glucose utilization was more pronounced in the euglycemic state than after food deprivation. The baseline glucose level after food deprivation was lower in the Tas1r3−/− strain than in the control strain, which suggests that T1R3 is involved in regulation of endogenous glucose production. These data suggest that the T1R3-mediated glucoreception interacts with the KATP-dependent mechanisms of regulation of the glucose metabolism, and that the main role is likely played by T1R3 expressed in the pancreas and possibly in the central nervous system, but not in the intestinal mucosa, as it was suggested earlier. PMID:25983343

  10. Response of isolated ruminant mammary arteries to the long R3 analogue of insulin-like growth factor I.

    PubMed

    Gow, I F

    2000-05-01

    Isolated mammary arteries from ruminants were used in a conventional organ bath system. Acetylcholine relaxed bovine but not ovine mammary arteries; both types responded to sodium nitroprusside. Noradrenaline (NA) caused a dose-dependent increase in generated tension. An analogue of insulin-like growth factor I (long R3-IGF-I) caused a rightward shift in the NA response curve in bovine vessels with intact endothelium (P < 0.02), and also in sheep arteries (P < 0.01). In bovine vessels, this effect was abolished when the endothelium was removed. The effect of long R3-IGF-I in bovine vessels was abolished by N -nitro-L-arginine methyl ester (L-NAME) an inhibitor of nitric oxide synthase, suggesting the effect of IGF-I on mammary arteries in vitro requires NO generation. PMID:10825414

  11. Action of long(R3)-insulin-like growth factor-1 on protein metabolism in beef heifers.

    PubMed

    Hill, R A; Hunter, R A; Lindsay, D B; Owens, P C

    1999-05-01

    Insulin-like growth factor-1 (IGF-1) is perhaps the most important endogenous factor controlling growth. Most studies to date in livestock have shown that IGF-1 has greatest efficacy when animals are in a catabolic state. We have determined the effects of an i.v. infusion of the IGF-1 analog Long(R3)-IGF-1 on protein metabolism in beef heifers that were slowly losing liveweight because of restricted feeding. There was a tendency for both whole-body protein and skeletal muscle protein to be conserved in Long(R3)-IGF-1-treated heifers. Long(R3)-IGF-1 administration markedly reduced the plasma concentrations of all amino acids measured and glucose. There was a significant change in the profile differences of endogenous plasma IGF-1 concentrations during the 8-hr infusion period, with plasma IGF-1 decreasing sharply in the test group. There was a significant difference in mean profiles for plasma IGF-2 between the test and control groups. Overall, plasma IGF-2 for the control group decreased only slightly over time (about 40 ng/ml), whereas the test group decreased dramatically (by about 140 ng/ml). Increased plasma concentrations of a 31-32-kDa IGF-binding protein (possibly IGF-binding protein-1) in the treated group was detected by radioligand blot. We found that Long(R3)-IGF-1 infusion tended to preserve whole-body and muscle protein in beef heifers on a low-quality diet, and suggest that further investigation of this treatment may provide an alternative approach to reducing weight loss during the dry season. PMID:10370861

  12. The optical counterpart of the supersoft X-ray source r3-8 in M31

    NASA Astrophysics Data System (ADS)

    Orio, M.; Luna, G. J. M.; Kotulla, R.; Gallagher, J. S. G.

    2015-10-01

    On behalf of a larger collaboration we announce that we have obtained spectra of the M31 supersoft X-ray source defined as r3-8 in the Chandra catalogs (see Chiosi et al. 2014, MNRAS 443, 1821, and references therein) using GMOS and the B600 grating at Gemini North, in the 4150-7100 Angstrom range, on 2015/9/9.

  13. Absolute quantification of DcR3 and GDF15 from human serum by LC-ESI MS

    PubMed Central

    Lancrajan, Ioana; Schneider-Stock, Regine; Naschberger, Elisabeth; Schellerer, Vera S; Stürzl, Michael; Enz, Ralf

    2015-01-01

    Biomarkers are widely used in clinical diagnosis, prognosis and therapy monitoring. Here, we developed a protocol for the efficient and selective enrichment of small and low concentrated biomarkers from human serum, involving a 95% effective depletion of high-abundant serum proteins by partial denaturation and enrichment of low-abundant biomarkers by size exclusion chromatography. The recovery of low-abundance biomarkers was above 97%. Using this protocol, we quantified the tumour markers DcR3 and growth/differentiation factor (GDF)15 from 100 μl human serum by isotope dilution mass spectrometry, using 15N metabolically labelled and concatamerized fingerprint peptides for the both proteins. Analysis of three different fingerprint peptides for each protein by liquid chromatography electrospray ionization mass spectrometry resulted in comparable concentrations in three healthy human serum samples (DcR3: 27.23 ± 2.49 fmol/ml; GDF15: 98.11 ± 0.49 fmol/ml). In contrast, serum levels were significantly elevated in tumour patients for DcR3 (116.94 ± 57.37 fmol/ml) and GDF15 (164.44 ± 79.31 fmol/ml). Obtained data were in good agreement with ELISA and qPCR measurements, as well as with literature data. In summary, our protocol allows the reliable quantification of biomarkers, shows a higher resolution at low biomarker concentrations than antibody-based strategies, and offers the possibility of multiplexing. Our proof-of-principle studies in patient sera encourage the future analysis of the prognostic value of DcR3 and GDF15 for colon cancer patients in larger patient cohorts. PMID:25823874

  14. Stereospecific enzymatic transformation of alpha-ketoglutarate to (2S,3R)-3-methyl glutamate during acidic lipopeptide biosynthesis.

    PubMed

    Mahlert, Christoph; Kopp, Florian; Thirlway, Jenny; Micklefield, Jason; Marahiel, Mohamed A

    2007-10-01

    The acidic lipopeptides, including the calcium-dependent antibiotics (CDA), daptomycin, and A54145, are important macrocyclic peptide natural products produced by Streptomyces species. All three compounds contain a 3-methyl glutamate (3-MeGlu) as the penultimate C-terminal residue, which is important for bioactivity. Here, biochemical in vitro reconstitution of the 3-MeGlu biosynthetic pathway is presented, using exclusively enzymes from the CDA producer Streptomyces coelicolor. It is shown that the predicted 3-MeGlu methyltransferase GlmT and its homologues DptI from the daptomycin producer Streptomyces roseosporus and LptI from the A54145 producer Streptomyces fradiae do not methylate free glutamic acid, PCP-bound glutamate, or Glu-containing CDA in vitro. Instead, GlmT, DptI, and LptI are S-adenosyl methionine (SAM)-dependent alpha-ketoglutarate methyltransferases that catalyze the stereospecific methylation of alpha-ketoglutarate (alphaKG) leading to (3R)-3-methyl-2-oxoglutarate. Subsequent enzyme screening identified the branched chain amino acid transaminase IlvE (SCO5523) as an efficient catalyst for the transformation of (3R)-3-methyl-2-oxoglutarate into (2S,3R)-3-MeGlu. Comparison of reversed-phase HPLC retention time of dabsylated 3-MeGlu generated by the coupled enzymatic reaction with dabsylated synthetic standards confirmed complete stereocontrol during enzymatic catalysis. This stereospecific two-step conversion of alphaKG to (2S,3R)-3-MeGlu completes our understanding of the biosynthesis and incorporation of beta-methylated amino acids into the nonribosomal lipopeptides. Finally, understanding this pathway may provide new possibilities for the production of modified peptides in engineered microbes. PMID:17784761

  15. Mediation of Autophagic Cell Death by Type 3 Ryanodine Receptor (RyR3) in Adult Hippocampal Neural Stem Cells

    PubMed Central

    Chung, Kyung Min; Jeong, Eun-Ji; Park, Hyunhee; An, Hyun-Kyu; Yu, Seong-Woon

    2016-01-01

    Cytoplasmic Ca2+ actively engages in diverse intracellular processes from protein synthesis, folding and trafficking to cell survival and death. Dysregulation of intracellular Ca2+ levels is observed in various neuropathological states including Alzheimer’s and Parkinson’s diseases. Ryanodine receptors (RyRs) and inositol 1,4,5-triphosphate receptors (IP3Rs), the main Ca2+ release channels located in endoplasmic reticulum (ER) membranes, are known to direct various cellular events such as autophagy and apoptosis. Here we investigated the intracellular Ca2+-mediated regulation of survival and death of adult hippocampal neural stem (HCN) cells utilizing an insulin withdrawal model of autophagic cell death (ACD). Despite comparable expression levels of RyR and IP3R transcripts in HCN cells at normal state, the expression levels of RyRs—especially RyR3—were markedly upregulated upon insulin withdrawal. While treatment with the RyR agonist caffeine significantly promoted the autophagic death of insulin-deficient HCN cells, treatment with its inhibitor dantrolene prevented the induction of autophagy following insulin withdrawal. Furthermore, CRISPR/Cas9-mediated knockout of the RyR3 gene abolished ACD of HCN cells. This study delineates a distinct, RyR3-mediated ER Ca2+ regulation of autophagy and programmed cell death in neural stem cells. Our findings provide novel insights into the critical, yet understudied mechanisms underlying the regulatory function of ER Ca2+ in neural stem cell biology. PMID:27199668

  16. Ground state sign-changing solutions for a class of Schrödinger-Poisson type problems in R3

    NASA Astrophysics Data System (ADS)

    Chen, Sitong; Tang, Xianhua

    2016-08-01

    This paper is dedicated to studying the following Schrödinger-Poisson system -triangle u+V(x)u+λφ u=K(x)f(u),& quad xin R3,-triangleφ= u^2,quad xin R3, where V, K are positive continuous potentials, f is a continuous function and {λ} is a positive parameter. We develop a direct approach to establish the existence of one ground state sign-changing solution {u_λ} with precisely two nodal domains, by introducing a weaker condition that there exists {θ_0in (0,1)} such that K(x)[f(τ)/τ^3-f(tτ)/(tτ)^3 ]sign(1-t)+θ_0V(x)|1-t^2|/(tτ)^2 ≥ 0, quad forall x in R^3, t > 0, τ≠ 0 than the usual increasing condition on {f(t)/|t|^3}. Under the above condition, we also prove that the energy of any sign-changing solution is strictly larger than two times the least energy, and give a convergence property of {u_λ} as {λsearrow 0}.

  17. SVM clustering

    PubMed Central

    Winters-Hilt, Stephen; Merat, Sam

    2007-01-01

    Background Support Vector Machines (SVMs) provide a powerful method for classification (supervised learning). Use of SVMs for clustering (unsupervised learning) is now being considered in a number of different ways. Results An SVM-based clustering algorithm is introduced that clusters data with no a priori knowledge of input classes. The algorithm initializes by first running a binary SVM classifier against a data set with each vector in the set randomly labelled, this is repeated until an initial convergence occurs. Once this initialization step is complete, the SVM confidence parameters for classification on each of the training instances can be accessed. The lowest confidence data (e.g., the worst of the mislabelled data) then has its' labels switched to the other class label. The SVM is then re-run on the data set (with partly re-labelled data) and is guaranteed to converge in this situation since it converged previously, and now it has fewer data points to carry with mislabelling penalties. This approach appears to limit exposure to the local minima traps that can occur with other approaches. Thus, the algorithm then improves on its weakly convergent result by SVM re-training after each re-labeling on the worst of the misclassified vectors – i.e., those feature vectors with confidence factor values beyond some threshold. The repetition of the above process improves the accuracy, here a measure of separability, until there are no misclassifications. Variations on this type of clustering approach are shown. Conclusion Non-parametric SVM-based clustering methods may allow for much improved performance over parametric approaches, particularly if they can be designed to inherit the strengths of their supervised SVM counterparts. PMID:18047717

  18. Impact of T1r3 and Trpm5 on carbohydrate preference and acceptance in C57BL/6 mice.

    PubMed

    Zukerman, Steven; Glendinning, John I; Margolskee, Robert F; Sclafani, Anthony

    2013-06-01

    Knockout (KO) mice missing the sweet taste receptor subunit T1r3 or the signaling protein Trpm5 have greatly attenuated sweetener preferences but learn to prefer sucrose in 24-h tests. Here, we examined 24-h preferences of T1r3 KO, Trpm5 KO, and C57BL/6J wild-type (WT) mice for glucose, fructose, galactose, and corn starch. Unlike glucose, fructose has little postoral reward effect in WT mice, whereas conflicting data have been obtained with galactose. Naïve KO mice were initially indifferent to dilute glucose solutions (0.5-4%) but exhibited strong preferences for 8-32% concentrations. In a second test, they strongly preferred (~90%) all glucose concentrations although they drank less sugar than WT mice. Naïve KO mice were indifferent to 0.5-8% fructose and avoided 16-32% fructose. However, the glucose-experienced KO mice displayed significant preferences for all fructose solutions. Naïve KO mice preferred only 8% galactose, whereas WT mice preferred 4-16% galactose, and all mice avoided 32% galactose. Galactose experience enhanced the preference for this sugar in KO and WT mice. Naïve T1r3 KO and WT mice displayed similar preferences for 0.5-32% corn starch, which were enhanced by starch experience. Naïve Trpm5 KO mice did not prefer starch but did so after 1-bottle starch experience. The results confirm the sweet taste deficits of T1r3 KO and Trpm5 KO mice but demonstrate their ability to develop strong glucose and milder galactose preferences attributed to the postoral actions of these sugars. The acquired preference for the non-sweet flavor properties of glucose generalized to those of fructose. The findings further demonstrate that although Trpm5 (but not T1r3) signaling is essential for starch preference, Trpm5 KO mice can learn to prefer starch based on its postoral effects. PMID:23547138

  19. The receptor-like kinase SOBIR1 interacts with Brassica napus LepR3 and is required for Leptosphaeria maculans AvrLm1-triggered immunity.

    PubMed

    Ma, Lisong; Borhan, M Hossein

    2015-01-01

    The fungus Leptosphaeria maculans (L. maculans) is the causal agent of blackleg disease of canola/oilseed rape (Brassica napus) worldwide. We previously reported cloning of the B. napus blackleg resistance gene, LepR3, which encodes a receptor-like protein. LepR3 triggers localized cell death upon recognition of its cognate Avr protein, AvrLm1. Here, we exploited the Nicotiana benthamiana model plant to investigate the recognition mechanism of AvrLm1 by LepR3. Co-expression of the LepR3/AvrLm1 gene pair in N. benthamiana resulted in development of a hypersensitive response (HR). However, a truncated AvrLm1 lacking its indigenous signal peptide was compromised in its ability to induce LepR3-mediated HR, indicating that AvrLm1 is perceived by LepR3 extracellularly. Structure-function analysis of the AvrLm1 protein revealed that the C-terminal region of AvrLm1 was required for LepR3-mediated HR in N. benthamiana and for resistance to L. maculans in B. napus. LepR3 was shown to be physically interacting with the B. napus receptor like kinase, SOBIR1 (BnSOBIR1). Silencing of NbSOBIR1 or NbSERK3 (BAK1) compromised LepR3-AvrLm1-dependent HR in N. benthamiana, suggesting that LepR3-mediated resistance to L. maculans in B. napus requires SOBIR1 and BAK1/SERK3. Using this model system, we determined that BnSOBIR1 and SERK3/BAK1 are essential partners in the LepR3 signaling complex and were able to define the AvrLm1 effector domain. PMID:26579176

  20. Return of the glucoreceptor: Glucose activates the glucose-sensing receptor T1R3 and facilitates metabolism in pancreatic β-cells.

    PubMed

    Kojima, Itaru; Nakagawa, Yuko; Ohtsu, Yoshiaki; Hamano, Kunihisa; Medina, Johan; Nagasawa, Masahiro

    2015-05-01

    Subunits of the sweet taste receptor, namely T1R2 and T1R3, are expressed in mouse pancreatic islets. Quantitatively, the expression of messenger ribonucleic acid for T1R2 is much lower than that of T1R3, and immunoreactive T1R2 is in fact undetectable. Presumably, a homodimer of T1R3 could function as a signaling receptor. Activation of this receptor by adding an artificial sweetener, sucralose, leads to an increase in intracellular adenosine triphosphate ([ATP]c). This increase in [ATP]c is observed in the absence of ambient glucose. Sucralose also augments elevation of [ATP]c induced by methylsuccinate, a substrate for mitochondria. Consequently, activation of T1R3 promotes metabolism in mitochondria and increases [ATP]c. 3-O-Methylglucose, a non-metabolizable analog of glucose, also increases [ATP]c. Conversely, knockdown of T1R3 attenuates elevation of [ATP]c induced by glucose. Hence, glucose promotes its own metabolism by activating T1R3 and augmenting ATP production. Collectively, a homodimer of T1R3 functions as a cell surface glucose-sensing receptor and participates in the action of glucose on insulin secretion. The glucose-sensing receptor T1R3 might be the putative glucoreceptor proposed decades ago by Niki et al. The glucose-sensing receptor is involved in the action of glucose and modulates glucose metabolism in pancreatic β-cells. PMID:25969708

  1. Return of the glucoreceptor: Glucose activates the glucose-sensing receptor T1R3 and facilitates metabolism in pancreatic β-cells

    PubMed Central

    Kojima, Itaru; Nakagawa, Yuko; Ohtsu, Yoshiaki; Hamano, Kunihisa; Medina, Johan; Nagasawa, Masahiro

    2015-01-01

    Subunits of the sweet taste receptor, namely T1R2 and T1R3, are expressed in mouse pancreatic islets. Quantitatively, the expression of messenger ribonucleic acid for T1R2 is much lower than that of T1R3, and immunoreactive T1R2 is in fact undetectable. Presumably, a homodimer of T1R3 could function as a signaling receptor. Activation of this receptor by adding an artificial sweetener, sucralose, leads to an increase in intracellular adenosine triphosphate ([ATP]c). This increase in [ATP]c is observed in the absence of ambient glucose. Sucralose also augments elevation of [ATP]c induced by methylsuccinate, a substrate for mitochondria. Consequently, activation of T1R3 promotes metabolism in mitochondria and increases [ATP]c. 3-O-Methylglucose, a non-metabolizable analog of glucose, also increases [ATP]c. Conversely, knockdown of T1R3 attenuates elevation of [ATP]c induced by glucose. Hence, glucose promotes its own metabolism by activating T1R3 and augmenting ATP production. Collectively, a homodimer of T1R3 functions as a cell surface glucose-sensing receptor and participates in the action of glucose on insulin secretion. The glucose-sensing receptor T1R3 might be the putative glucoreceptor proposed decades ago by Niki et al. The glucose-sensing receptor is involved in the action of glucose and modulates glucose metabolism in pancreatic β-cells. PMID:25969708

  2. Ectopic expression of R3 MYB transcription factor gene OsTCL1 in Arabidopsis, but not rice, affects trichome and root hair formation.

    PubMed

    Zheng, Kaijie; Tian, Hainan; Hu, Qingnan; Guo, Hongyan; Yang, Li; Cai, Ling; Wang, Xutong; Liu, Bao; Wang, Shucai

    2016-01-01

    In Arabidopsis, a MYB-bHLH-WD40 (MBW) transcriptional activator complex activates the homeodomain protein gene GLABRA2 (GL2), leading to the promotion of trichome formation and inhibition of root hair formation. The same MBW complex also activates single-repeat R3 MYB genes. R3 MYBs in turn, play a negative feedback role by competing with R2R3 MYB proteins for binding bHLH proteins, thus blocking the formation of the MBW complex. By BLASTing the rice (Oryza sativa) protein database using the entire amino acid sequence of Arabidopsis R3 MYB transcription factor TRICHOMELESS1 (TCL1), we found that there are two genes in rice genome encoding R3 MYB transcription factors, namely Oryza sativa TRICHOMELESS1 (OsTCL1) and OsTCL2. Expressing OsTCL1 in Arabidopsis inhibited trichome formation and promoted root hair formation, and OsTCL1 interacted with GL3 when tested in Arabidopsis protoplasts. Consistent with these observations, expression levels of GL2, R2R3 MYB transcription factor gene GLABRA1 (GL1) and several R3 MYB genes were greatly reduced, indicating that OsTCL1 is functional R3 MYB. However, trichome and root hair formation in transgenic rice plants overexpressing OsTCL1 remained largely unchanged, and elevated expression of OsGL2 was observed in the transgenic rice plants, indicating that rice may use different mechanisms to regulate trichome formation. PMID:26758286

  3. Ectopic expression of R3 MYB transcription factor gene OsTCL1 in Arabidopsis, but not rice, affects trichome and root hair formation

    PubMed Central

    Zheng, Kaijie; Tian, Hainan; Hu, Qingnan; Guo, Hongyan; Yang, Li; Cai, Ling; Wang, Xutong; Liu, Bao; Wang, Shucai

    2016-01-01

    In Arabidopsis, a MYB-bHLH-WD40 (MBW) transcriptional activator complex activates the homeodomain protein gene GLABRA2 (GL2), leading to the promotion of trichome formation and inhibition of root hair formation. The same MBW complex also activates single-repeat R3 MYB genes. R3 MYBs in turn, play a negative feedback role by competing with R2R3 MYB proteins for binding bHLH proteins, thus blocking the formation of the MBW complex. By BLASTing the rice (Oryza sativa) protein database using the entire amino acid sequence of Arabidopsis R3 MYB transcription factor TRICHOMELESS1 (TCL1), we found that there are two genes in rice genome encoding R3 MYB transcription factors, namely Oryza sativa TRICHOMELESS1 (OsTCL1) and OsTCL2. Expressing OsTCL1 in Arabidopsis inhibited trichome formation and promoted root hair formation, and OsTCL1 interacted with GL3 when tested in Arabidopsis protoplasts. Consistent with these observations, expression levels of GL2, R2R3 MYB transcription factor gene GLABRA1 (GL1) and several R3 MYB genes were greatly reduced, indicating that OsTCL1 is functional R3 MYB. However, trichome and root hair formation in transgenic rice plants overexpressing OsTCL1 remained largely unchanged, and elevated expression of OsGL2 was observed in the transgenic rice plants, indicating that rice may use different mechanisms to regulate trichome formation. PMID:26758286

  4. Synthesis of (2R, 3R)-epigallocatechin-3-O-(4-hydroxybenzoate), a novel catechin from Cistus salvifolius, and evaluation of its proteasome inhibitory activities.

    PubMed

    Osanai, Kumi; Huo, Congde; Landis-Piwowar, Kristin R; Dou, Q Ping; Chan, Tak Hang

    2007-08-01

    The total and semi syntheses of (2R, 3R)-epigallocatechin-3-O-(4-hydroxybenzoate), a novel catechin from Cistus salvifolius, was accomplished. The proteasome inhibition and cytotoxic activities of the synthetic compound and its acetyl derivative were studied and compared with (2R, 3R)-epigallocatechin-3-gallate (EGCG), the active component from green tea. PMID:21152270

  5. Biosurfactins production by Bacillus amyloliquefaciens R3 and their antibacterial activity against multi-drug resistant pathogenic E. coli.

    PubMed

    Chi, Zhe; Rong, Yan-Jun; Li, Yang; Tang, Mei-Juan; Chi, Zhen-Ming

    2015-05-01

    In this work, the anti-Escherichia coli activity of the bioactive substances produced by Bacillus amyloliquefaciens R3 was examined. A new and cheap medium for production of the anti-E. coli substances which contained 20.0 g L(-1) soybean powder, 20.0 g L(-1) wheat flour, pH 6.0 was developed. A crude surfactant concentration of 0.48 mg mL(-1) was obtained after 27 h of 10-L fermentation, and the diameter of the clear zone on the plate seeded with the pathogenic E. coli 2# was 23.3 mm. A preliminary characterization suggested that the anti-E. coli substances produced by B. amyloliquefaciens R3 were the biosurfactins (F1, F2, F3, F4, and F5) with amino acids (GLLVDLL) and hydroxy fatty acids (of 12-15 carbons in length). It was found that all the strains of the pathogenic E. coli showed resistance to several different antibiotics, suggesting that they were the multi-drug resistance and all the strains of the pathogenic E. coli were sensitive to the biosurfactins, indicating that the biosurfactins produced by B. amyloliquefaciens R3 had a broad spectrum of antibacterial activity against the pathogenic E. coli with multi-drug resistant profiles. After the treatment with the purified biosurfactin (F1), the cell membrane of both the whole cells and protoplasts of the E. coli 2# was damaged and the whole cells of the bacterium were broken. PMID:25407729

  6. The impact of Ghana’s R3M programme on the provision of safe abortions and postabortion care

    PubMed Central

    Sundaram, Aparna; Juarez, Fatima; Ahiadeke, Clement; Bankole, Akinrinola; Blades, Nakeisha

    2015-01-01

    In 2006, in response to the high maternal mortality, driven largely by unsafe abortions, the government of Ghana, in partnership with other organizations, launched the reducing maternal mortality and morbidity (R3M) programme in seven districts in Greater Accra, Ashanti and Eastern, to improve comprehensive abortion care services. This article examines whether this intervention made a difference to the provision of safe abortion services and postabortion care (PAC). We also examine the role played by provider attitudes and knowledge of the abortion law, on providers with clinical training in service provision. Primary data on health care providers in Ghana, collected using a quasi-experimental design, were analysed using propensity score weighting. Apart from the treatment group, the sample included two controls: (1) Districts in Accra, Ashanti and Eastern, not exposed to the treatment; and (2) Districts from distant Brong Ahafo, also not exposed to the treatment. The findings show that providers in the treatment group are nearly 16 times as likely to provide safe abortions compared with their peers in Brong Ahafo, and ∼2.5 times as likely compared with providers in the other control group. R3M providers were also different from their peers in providing PAC. Associations between provider attitudes and knowledge of the law on both outcomes were either non-significant or inconsistent including for providers with clinical knowledge of abortion provision. Provider confidence however is strongly associated with service provision. We conclude that the R3M programme is helping safe abortion provision, with the differences being greater with control groups that are geographically distant, perhaps owing to lower contamination from movement of providers between facilities. Increasing provider confidence is key to improving both safe abortion provision and PAC. PMID:25261230

  7. Lactisole inhibits the glucose-sensing receptor T1R3 expressed in mouse pancreatic β-cells.

    PubMed

    Hamano, Kunihisa; Nakagawa, Yuko; Ohtsu, Yoshiaki; Li, Longfei; Medina, Johan; Tanaka, Yuji; Masuda, Katsuyoshi; Komatsu, Mitsuhisa; Kojima, Itaru

    2015-07-01

    Glucose activates the glucose-sensing receptor T1R3 and facilitates its own metabolism in pancreatic β-cells. An inhibitor of this receptor would be helpful in elucidating the physiological function of the glucose-sensing receptor. The present study was conducted to examine whether or not lactisole can be used as an inhibitor of the glucose-sensing receptor. In MIN6 cells, in a dose-dependent manner, lactisole inhibited insulin secretion induced by sweeteners, acesulfame-K, sucralose and glycyrrhizin. The IC50 was ∼4 mmol/l. Lactisole attenuated the elevation of cytoplasmic Ca2+ concentration ([Ca2+]c) evoked by sucralose and acesulfame-K but did not affect the elevation of intracellular cAMP concentration ([cAMP]c) induced by these sweeteners. Lactisole also inhibited the action of glucose in MIN6 cells. Thus, lactisole significantly reduced elevations of intracellular [NADH] and intracellular [ATP] induced by glucose, and also inhibited glucose-induced insulin secretion. To further examine the effect of lactisole on T1R3, we prepared HEK293 cells stably expressing mouse T1R3. In these cells, sucralose elevated both [Ca2+]c and [cAMP]c. Lactisole attenuated the sucralose-induced increase in [Ca2+]c but did not affect the elevation of [cAMP]c. Finally, lactisole inhibited insulin secretion induced by a high concentration of glucose in mouse islets. These results indicate that the mouse glucose-sensing receptor was inhibited by lactisole. Lactisole may be useful in assessing the role of the glucose-sensing receptor in mouse pancreatic β-cells. PMID:25994004

  8. Membrane-Bound CYB5R3 Is a Common Effector of Nutritional and Oxidative Stress Response Through FOXO3a and Nrf2

    PubMed Central

    Siendones, Emilio; SantaCruz-Calvo, Sara; Martín-Montalvo, Alejandro; Cascajo, María V.; Ariza, Julia; López-Lluch, Guillermo; Villalba, José M.; Acquaviva-Bourdain, Cécile; Roze, Emmanuel; Bernier, Michel; de Cabo, Rafael

    2014-01-01

    Abstract Aims: Membrane-bound CYB5R3 deficiency in humans causes recessive hereditary methaemoglobinaemia (RHM), an incurable disease that is characterized by severe neurological disorders. CYB5R3 encodes for NADH-dependent redox enzyme that contributes to metabolic homeostasis and stress protection; however, how it is involved in the neurological pathology of RHM remains unknown. Here, the role and transcriptional regulation of CYB5R3 was studied under nutritional and oxidative stress. Results: CYB5R3-deficient cells exhibited a decrease of the NAD+/NADH ratio, mitochondrial respiration rate, ATP production, and mitochondrial electron transport chain activities, which were associated with higher sensitivity to oxidative stress, and an increase in senescence-associated β-galactosidase activity. Overexpression of either forkhead box class O 3a (FOXO3a) or nuclear factor (erythroid-derived 2)-like2 (Nrf2) was associated with increased CYB5R3 levels, and genetic ablation of Nrf2 resulted in lower CYB5R3 expression. The presence of two antioxidant response element sequences in the CYB5R3 promoter led to chromatin immunoprecipitation studies, which showed that cellular stressors enhanced the binding of Nrf2 and FOXO3a to the CYB5R3 promoter. Innovation: Our findings demonstrate that CYB5R3 contributes to regulate redox homeostasis, aerobic metabolism, and cellular senescence, suggesting that CYB5R3 might be a key effector of oxidative and nutritional stress pathways. The expression of CYB5R3 is regulated by the cooperation of Nrf2 and FOXO3a. Conclusion: CYB5R3 is an essential gene that appears as a final effector for both nutritional and oxidative stress responses through FOXO3a and Nrf2, respectively, and their interaction promotes CYB5R3 expression. These results unveil a potential mechanism of action by which CYB5R3 deficiency contributes to the pathophysiological underpinnings of neurological disorders in RHM patients. Antioxid. Redox Signal. 21, 1708–1725. PMID

  9. [USAGE OF FUMARATE BY SULPHATE-REDUCING BACTERIA DESULFOMICROBIUM SP. CrR3 AND DESULFOTOMACULUM SP].

    PubMed

    Sholiak, K V; Peretyatko, T B; Gudz, S P; Hnatush, S O; Verkholyak, N S; Halushka, A A

    2015-01-01

    Sulphate-reducing bacteria Desulfomicrobium sp. CrR3 and Desulfotomaculum. sp. are able to use fumarate as electron donor and acceptor. When they use fumarate as an electron acceptor succinate accumulates in the medium. If fumarate serves as electron donor, minor amounts of citrate, isocitrate and acetate are detected except succinate. In the case of simultaneous introduction of fumarate, SO4(2-) and Cr2O7(2-), the last inhibits usage of fumarate and SO4(2-). PMID:26638481

  10. Investigation of the Dipole Response in Exotic Nuclei --- Experiments at the LAND-R^3B Setup

    NASA Astrophysics Data System (ADS)

    Rossi, D.; Adrich, P.; Aksouh, F.; Alvarez-Pol, H.; Aumann, T.; Benlliure, J.; Böhmer, M.; Boretzky, K.; Casarejos, E.; Chartier, M.; Chatillon, A.; Cortina-Gil, D.; Pramanik, U. D.; Emling, H.; Ershova, O.; Fernando-Dominguez, B.; Geissel, H.; Gorska, M.; Heil, M.; Johansson, H. k.; Junghans, A.; Kiselev, O.; Klimkiewicz, A.; Kratz, J.; Kurz, N.; Labiche, M.; Bleis, T. L.; Lemmon, R.; Litvinov, Y.; Mahata, K.; Maierbeck, P.; Movsesyan, A.; Nilsson, T.; Nociforo, C.; Palit, R.; Paschalis, S.; Plag, R.; Reifarth, R.; Simon, H.; Sümmerer, K.; Wagner, A.; Walus, W.; Weick, H.; Winkler, M.

    We present experimental results on the electromagneticexcitation of neutron-rich nickel isotopes, making use of the R^{3}B-LAND setup at GSI. Exotic beams were produced at approximately 500 MeV/u and their reactions were studied in inverse kinematics. Integral cross sections for ^{58}Ni are discussed and compared to previous data, providing a validation of our experimental method. The E1 excitation-energy distribution of the unstable ^{68}Ni is presented as well, showing an excess in cross section in the 1n decay channel when compared only with a typical Giant Dipole Resonance.

  11. The mechanical design of the BARREL section of the detector CALIFA for R3B-FAIR.

    NASA Astrophysics Data System (ADS)

    Casarejos, E.; Alvarez-Pol, H.; Cortina-Gil, D.; Durán, I.; Izquierdo, P.; Yañez, P.; Vilán, J. A.

    2014-03-01

    In this work we present the mechanical concept proposed for one of the sections of the detector CALIFA of the R3B experiment for FAIR. The use of an alveolar structure made of carbon-fiber composites allows for a light and robust solution to hold the active elements with an extreme mass ratio below 0.7%. The active core is supported by structural elements designed to make a fully operational assembly, taking care of different configurations and functionality. All the design has been developed using intensive calculation based in finite elements models and physical simulations.

  12. Genetic Variation in CYB5R3 is Associated with Methemoglobin Levels in Preterm Infants Receiving Nitric Oxide Therapy

    PubMed Central

    Fuller, Tyson D; Spracklen, Cassandra N; Ryckman, Kelli K; Knake, Lindsey A; Busch, Tamara D; Momany, Allison M; Murray, Jeffrey C; Dagle, John M

    2015-01-01

    Background In recent years, increasing numbers of preterm infants have been exposed to inhaled nitric oxide (iNO). This population has decreased methemoglobin (MetHb) reductase activity in their erythrocytes, which may increase the risk of MetHb toxicity. We sought to determine if genetic factors are associated with the observed variance in MetHb levels. Methods A population of 127 preterm infants was genotyped for five single-nucleotide polymorphisms (SNPs) in the CYB5A and CYB5R3 genes. iNO dose and levels of MetHb were obtained by chart abstraction. Analysis of variance was performed to identify genetic associations with MetHb levels. Results An association was found between the heterozygous genotype (GA) of rs916321 in the CYB5R3 gene and the mean of the first recorded MetHb levels in Caucasian infants (p=0.01). This result remained significant after adjustment for the iNO dose (p=0.009), gender (p=0.03), multiple gestation (p=0.03), birth weight (p=0.02), and gestational age (p=0.02). No significant associations were found with the other SNPs. Conclusion We demonstrate a novel genetic association with neonatal MetHb levels. Identification of genetic risk factors may be useful in determining which preterm infants are most at risk of developing MetHb toxicity with the use of iNO. PMID:25521918

  13. CONSTRAINTS ON THE PHYSICAL PROPERTIES OF MAIN BELT COMET P/2013 R3 FROM ITS BREAKUP EVENT

    SciTech Connect

    Hirabayashi, Masatoshi; Sánchez, Diego Paul; Gabriel, Travis; Scheeres, Daniel J.

    2014-07-01

    Jewitt et al. recently reported that main belt comet P/2013 R3 experienced a breakup, probably due to rotational disruption, with its components separating on mutually hyperbolic orbits. We propose a technique for constraining physical properties of the proto-body, especially the initial spin period and cohesive strength, as a function of the body's estimated size and density. The breakup conditions are developed by combining mutual orbit dynamics of the smaller components and the failure condition of the proto-body. Given a proto-body with a bulk density ranging from 1000 kg m{sup –3} to 1500 kg m{sup –3} (a typical range of the bulk density of C-type asteroids), we obtain possible values of the cohesive strength (40-210 Pa) and the initial spin state (0.48-1.9 hr). From this result, we conclude that although the proto-body could have been a rubble pile, it was likely spinning beyond its gravitational binding limit and would have needed cohesive strength to hold itself together. Additional observations of P/2013 R3 will enable stronger constraints on this event, and the present technique will be able to give more precise estimates of its internal structure.

  14. Production of Chiral (R)-3-Hydroxyoctanoic Acid Monomers, Catalyzed by Pseudomonas fluorescens GK13 Poly(3-Hydroxyoctanoic Acid) Depolymerase▿

    PubMed Central

    Gangoiti, Joana; Santos, Marta; Llama, María J.; Serra, Juan L.

    2010-01-01

    The extracellular medium-chain-length polyhydroxyalkanoate (MCL-PHA) depolymerase of Pseudomonas fluorescens GK13 catalyzes the hydrolysis of poly(3-hydroxyoctanoic acid) [P(3HO)]. Based on the strong tendency of the enzyme to interact with hydrophobic materials, a low-cost method which allows the rapid and easy purification and immobilization of the enzyme has been developed. Thus, the extracellular P(3HO) depolymerase present in the culture broth of cells of P. fluorescens GK13 grown on mineral medium supplemented with P(3HO) as the sole carbon and energy source has been tightly adsorbed onto a commercially available polypropylene support (Accurel MP-1000) with high yield and specificity. The activity of the pure enzyme was enhanced by the presence of detergents and organic solvents, and it was retained after treatment with an SDS-denaturing cocktail under both reducing and nonreducing conditions. The time course of the P(3HO) hydrolysis catalyzed by the soluble and immobilized enzyme has been assessed, and the resulting products have been identified. After 24 h of hydrolysis, the dimeric ester of 3-HO [(R)-3-HO-HO] was obtained as the main product of the soluble enzyme. However, the immobilized enzyme catalyzes almost the complete hydrolysis of P(3HO) polymer to (R)-3-HO monomers under the same conditions. PMID:20400568

  15. Characterization of two tartary buckwheat R2R3-MYB transcription factors and their regulation of proanthocyanidin biosynthesis.

    PubMed

    Bai, Yue-Chen; Li, Cheng-Lei; Zhang, Jin-Wen; Li, Shuang-Jiang; Luo, Xiao-Peng; Yao, Hui-Peng; Chen, Hui; Zhao, Hai-Xia; Park, Sang-Un; Wu, Qi

    2014-11-01

    Tartary buckwheat (Fagopyrum tataricum Gaertn.) contains high concentrations of flavonoids. The flavonoids are mainly represented by rutin, anthocyanins and proanthocyanins in tartary buckwheat. R2R3-type MYB transcription factors (TFs) play key roles in the transcriptional regulation of the flavonoid biosynthetic pathway. In this study, two TF genes, FtMYB1 and FtMYB2, were isolated from F. tataricum and characterized. The results of bioinformatic analysis indicated that the putative FtMYB1 and FtMYB2 proteins belonged to the R2R3-MYB family and displayed a high degree of similarity with TaMYB14 and AtMYB123/TT2. In vitro and in vivo evidence both showed the two proteins were located in the nucleus and exhibited transcriptional activation activities. During florescence, both FtMYB1 and FtMYB2 were more highly expressed in the flowers than any other organ. The overexpression of FtMYB1 and FtMYB2 significantly enhanced the accumulation of proanthocyanidins (PAs) and showed a strong effect on the target genes' expression in Nicotiana tabacum. The expression of dihydroflavonol-4-reductase (DFR) was upregulated to 5.6-fold higher than that of control, and the expression level was lower for flavonol synthase (FLS). To our knowledge, this is the first functional characterization of two MYB TFs from F. tataricum that control the PA pathway. PMID:24730512

  16. CARTILAGE CELL CLUSTERS

    PubMed Central

    Lotz, Martin K.; Otsuki, Shuhei; Grogan, Shawn P.; Sah, Robert; Terkeltaub, Robert; D’Lima, Darryl

    2010-01-01

    The formation of new cell clusters is a histological hallmark of arthritic cartilage but the biology of clusters and their role in disease are poorly understood. This is the first comprehensive review of clinical and experimental conditions associated with cluster formation. Genes and proteins that are expressed in cluster cells, the cellular origin of the clusters, mechanisms that lead to cluster formation and the role of cluster cells in pathogenesis are discussed. PMID:20506158

  17. Efficient secretion of (R)-3-hydroxybutyric acid from Halomonas sp. KM-1 by nitrate fed-batch cultivation with glucose under microaerobic conditions.

    PubMed

    Kawata, Yoshikazu; Ando, Hitoshi; Matsushita, Isao; Tsubota, Jun

    2014-03-01

    To establish a sustainable society, commodity chemicals need to be developed from biomass resources. Recently, (R)-3-hydroxybutyric acid ((R)-3-HB), a monomer of bioplastic poly-(R)-3-hydroxybutyric acid (PHB), has attracted attention for its possible use in the chemical industry. Halophilic bacteria have been considered for bioprocess applications due to certain characteristics such as the ability to grow in media containing high levels of the starting carbon source and the ability to be rarely contaminated. A halophilic bacterium Halomonas sp. KM-1 stores PHB intracellularly under aerobic conditions and secretes (R)-3-HB under microaerobic conditions. In this study, we optimized culture conditions to maximize (R)-3-HB secretion by KM-1 cells. By a simple nitrate fed-batch cultivation, Halomonas sp. KM-1 secreted 40.3g/L (R)-3-HB with a productivity of 0.48g L(-1)h(-1) with 20% (w/v) glucose. This level is one of the highest recorded productivity of (R)-3-HB to date. PMID:24503050

  18. Multiflavor QCD∗ on R3 ×S1: Studying transition from Abelian to non-Abelian confinement

    NASA Astrophysics Data System (ADS)

    Shifman, M.; Ünsal, M.

    2009-11-01

    The center-stabilized multiflavor QCD∗ theories formulated on R3 ×S1 exhibit both Abelian and non-Abelian confinement as a function of the S1 radius, similar to the Seiberg-Witten theory as a function of the mass deformation parameter. For sufficiently small number of flavors and small r (S1), we show occurrence of a mass gap in gauge fluctuations, and linear confinement. This is a regime of confinement without continuous chiral symmetry breaking (χSB). Unlike one-flavor theories where there is no phase transition in r (S1), the multiflavor theories possess a single phase transition associated with breaking of the continuous χS. We conjecture that the scale of the χSB is parametrically tied up with the scale of Abelian to non-Abelian confinement transition.

  19. On the stability of triangular points in the relativistic R3BP with oblate primaries and bigger radiating

    NASA Astrophysics Data System (ADS)

    Bello, Nakone; Singh, Jagadish

    2016-01-01

    We consider a version of the relativistic R3BP which includes the effects of oblateness of the primaries and radiation of the bigger primary as well on the stability of triangular points. We observe that the positions of the triangular points and their stability are affected by the relativistic effect apart from the radiation and oblateness of the primaries. It is further seen for these points that the range of stability region increases or decreases according as the part of the critical mass value, depending upon relativistic terms, radiation and oblateness coefficients, is positive or negative. A numerical exploration shows that in the Sun-Saturn, Sun-Uranus, Sun-Neptune systems, the oblateness has no influence on their positions and range of stability region; whereas it has a little influence on the Sun-Mars, Sun-Jupiter systems. On the other hand, we found that radiation pressure has an observable effect on the solar system.

  20. An R2R3 MYB transcription factor associated with regulation of the anthocyanin biosynthetic pathway in Rosaceae

    PubMed Central

    2010-01-01

    Background The control of plant anthocyanin accumulation is via transcriptional regulation of the genes encoding the biosynthetic enzymes. A key activator appears to be an R2R3 MYB transcription factor. In apple fruit, skin anthocyanin levels are controlled by a gene called MYBA or MYB1, while the gene determining fruit flesh and foliage anthocyanin has been termed MYB10. In order to further understand tissue-specific anthocyanin regulation we have isolated orthologous MYB genes from all the commercially important rosaceous species. Results We use gene specific primers to show that the three MYB activators of apple anthocyanin (MYB10/MYB1/MYBA) are likely alleles of each other. MYB transcription factors, with high sequence identity to the apple gene were isolated from across the rosaceous family (e.g. apples, pears, plums, cherries, peaches, raspberries, rose, strawberry). Key identifying amino acid residues were found in both the DNA-binding and C-terminal domains of these MYBs. The expression of these MYB10 genes correlates with fruit and flower anthocyanin levels. Their function was tested in tobacco and strawberry. In tobacco, these MYBs were shown to induce the anthocyanin pathway when co-expressed with bHLHs, while over-expression of strawberry and apple genes in the crop of origin elevates anthocyanins. Conclusions This family-wide study of rosaceous R2R3 MYBs provides insight into the evolution of this plant trait. It has implications for the development of new coloured fruit and flowers, as well as aiding the understanding of temporal-spatial colour change. PMID:20302676

  1. An R2R3-MYB Transcription Factor Regulates Eugenol Production in Ripe Strawberry Fruit Receptacles1

    PubMed Central

    Medina-Puche, Laura; Molina-Hidalgo, Francisco Javier; Boersma, Maaike; Schuurink, Robert C.; López-Vidriero, Irene; Solano, Roberto; Franco-Zorrilla, José-Manuel; Caballero, José Luis; Blanco-Portales, Rosario; Muñoz-Blanco, Juan

    2015-01-01

    Eugenol is a volatile phenylpropanoid that contributes to flower and ripe fruit scent. In ripe strawberry (Fragaria × ananassa) fruit receptacles, eugenol is biosynthesized by eugenol synthase (FaEGS2). However, the transcriptional regulation of this process is still unknown. We have identified and functionally characterized an R2R3 MYB transcription factor (EMISSION OF BENZENOID II [FaEOBII]) that seems to be the orthologous gene of PhEOBII from Petunia hybrida, which contributes to the regulation of eugenol biosynthesis in petals. The expression of FaEOBII was ripening related and fruit receptacle specific, although high expression values were also found in petals. This expression pattern of FaEOBII correlated with eugenol content in both fruit receptacle and petals. The expression of FaEOBII was repressed by auxins and activated by abscisic acid, in parallel to the ripening process. In ripe strawberry receptacles, where the expression of FaEOBII was silenced, the expression of CINNAMYL ALCOHOL DEHYDROGENASE1 and FaEGS2, two structural genes involved in eugenol production, was down-regulated. A subsequent decrease in eugenol content in ripe receptacles was also observed, confirming the involvement of FaEOBII in eugenol metabolism. Additionally, the expression of FaEOBII was under the control of FaMYB10, another R2R3 MYB transcription factor that regulates the early and late biosynthetic genes from the flavonoid/phenylpropanoid pathway. In parallel, the amount of eugenol in FaMYB10-silenced receptacles was also diminished. Taken together, these data indicate that FaEOBII plays a regulating role in the volatile phenylpropanoid pathway gene expression that gives rise to eugenol production in ripe strawberry receptacles. PMID:25931522

  2. A single-repeat R3-MYB transcription factor MYBC1 negatively regulates freezing tolerance in Arabidopsis

    SciTech Connect

    Zhai, Hong; Bai, Xi; Zhu, Yanming; Li, Yong; Cai, Hua; Ji, Wei; Ji, Zuojun; Liu, Xiaofei; Liu, Xin; Li, Jing

    2010-04-16

    We had previously identified the MYBC1 gene, which encodes a single-repeat R3-MYB protein, as a putative osmotic responding gene; however, no R3-MYB transcription factor has been reported to regulate osmotic stress tolerance. Thus, we sought to elucidate the function of MYBC1 in response to osmotic stresses. Real-time RT-PCR analysis indicated that MYBC1 expression responded to cold, dehydration, salinity and exogenous ABA at the transcript level. mybc1 mutants exhibited an increased tolerance to freezing stress, whereas 35S::MYBC1 transgenic plants exhibited decreased cold tolerance. Transcript levels of some cold-responsive genes, including CBF/DREB genes, KIN1, ADC1, ADC2 and ZAT12, though, were not altered in the mybc1 mutants or the 35S::MYBC1 transgenic plants in response to cold stress, as compared to the wild type. Microarray analysis results that are publically available were investigated and found transcript level of MYBC1 was not altered by overexpression of CBF1, CBF2, and CBF3, suggesting that MYBC1 is not down regulated by these CBF family members. Together, these results suggested that MYBC1is capable of negatively regulating the freezing tolerance of Arabidopsis in the CBF-independent pathway. In transgenic Arabidopsis carrying an MYBC1 promoter driven {beta}-glucuronidase (GUS) construct, GUS activity was observed in all tissues and was relatively stronger in the vascular tissues. Fused MYBC1 and GFP protein revealed that MYBC1 was localized exclusively in the nuclear compartment.

  3. Development of a Functionally Minimized Mutant of the R3C Ligase Ribozyme Offers Insight into the Plausibility of the RNA World Hypothesis

    PubMed Central

    Kurihara, Eri; Uchida, Sayuri; Umehara, Takuya; Tamura, Koji

    2014-01-01

    The R3C ligase ribozyme is an artificial ligase ribozyme produced by modification of the ribozyme that lacks cytidine. Here, we attempted to modify the original R3C ribozyme (73 nucleotides) by reducing the number of nucleotides while maintaining the maximum possible catalytic efficiency. By partially deleting both the “grip” (P4 + P5) and “hammer” (P3) stem-loops, we found the critical border to retain activity comparable to that of full-length R3C. The three-way junction structure was necessary to maintain enzymatic function and the stability of the “grip” (P4 + P5) stem had a large influence on the catalytic activity of R3C. The final minimized ribozyme we obtained comprised ~50 nucleotides, comparable to the estimated length of prebiotically synthesized RNA. Our findings suggest that the autocatalytic function in ribozymes is indeed possible to obtain using sequence lengths achievable with prebiotic synthesis. PMID:25256424

  4. Comparison of the RT3 Research Tracker and Tritrac R3D accelerometers during a backpacking expedition by a single subject.

    PubMed

    DeVoe, Dale

    2004-10-01

    This study compared the RT3 Research Tracker accelerometer and the Tritrac R3D accelerometer in a field setting. A six-day backpacking expedition (122.4 km in length) was completed by a single subject in the Grand Canyon National Park, Arizona. The overall correlation between the counts of vector magnitude activity for the RT3 and R3D was moderate (r =.75, p<.001), with the overall calculated bias [mean difference (RT3 minus R3D) and standard deviation of the differences] across all six days estimated at 235+/-436 vector magnitude activity counts. However, agreement between the instruments is problematic; the RT3 might be 201 activity counts below or 671 activity counts above the R3D in assessing physical activity during backpacking. PMID:15560342

  5. A phase I study of 99mTc-hR3 (DiaCIM), a humanized immunoconjugate directed towards the epidermal growth factor receptor.

    PubMed

    Vallis, K A; Reilly, R M; Chen, P; Oza, A; Hendler, A; Cameron, R; Hershkop, M; Iznaga-Escobar, N; Ramos-Suzarte, M; Keane, P

    2002-12-01

    A phase I trial was conducted to evaluate the safety, tumour and normal tissue localization, pharmacokinetics and radiation dosimetry of Tc-hR3, a humanized monoclonal antibody directed towards the epidermal growth factor receptor, in 12 patients with recurrent or metastatic epithelial malignancies. Patients were injected intravenously with 3.0 mg or 6.0 mg (1010 MBq) of Tc-hR3. Blood and plasma concentrations of radioactivity were measured and a complete 24 h urine collection was obtained. Whole-body images were acquired up to 24 h post-injection and normal organ uptake quantified. Radiation dosimetry was estimated using MIRDose. Safety was evaluated by clinical observation, biochemical/haematological testing and by measuring immune response to Tc-hR3. There were no adverse effects, no changes in biochemical/haematological indices and no immune response to Tc-hR3. Tc-hR3 was rapidly cleared from the blood with a distribution half-life of 10.8+/-3.8 min. The volume of distribution, and clearance, were 180+/-37 ml.kg and 14+/-3 ml.kg.min, respectively. The elimination phase could not be discerned due to increasing blood radioactivity at later times. About 19-24% was excreted in the urine. Normal tissue uptake was mainly in the liver (44-50%), spleen (3-4%) and kidneys (3%). Imaging was positive in one patient with squamous cell carcinoma of the mouth and an involved cervical lymph node. The whole-body radiation dose from Tc-hR3 was 1.34+/-0.02x10 mSv.Bq. We conclude that Tc-hR3 exhibited an excellent safety profile. Future studies to determine the sensitivity and specificity of imaging with Tc-hR3 in a larger group of patients with pre-selection for epidermal growth factor receptor positivity are planned. PMID:12464779

  6. Genome-Wide Analysis of Citrus R2R3MYB Genes and Their Spatiotemporal Expression under Stresses and Hormone Treatments

    PubMed Central

    He, Shaolan; Zheng, Yongqiang; Yi, Shilai; Lv, Qiang; Deng, Lie

    2014-01-01

    The R2R3MYB proteins represent one of the largest families of transcription factors, which play important roles in plant growth and development. Although genome-wide analysis of this family has been conducted in many species, little is known about R2R3MYB genes in citrus, In this study, 101 R2R3MYB genes has been identified in the citrus (Citrus sinesis and Citrus clementina) genomes, which are almost equal to the number of rice. Phylogenetic analysis revealed that they could be subdivided into 21 subgroups. The evolutionary relationships and the intro-exon organizations were also analyzed, revealing strong gene conservation but also the expansions of particular functional genes during the plant evolution. Tissue-specific expression profiles showed that 95 citrus R2R3MYB genes were expressed in at least one tissue and the other 6 genes showed very low expression in all tissues tested, suggesting that citrus R2R3MYB genes play important roles in the development of all citrus organs. The transcript abundance level analysis during abiotic conditions (NaCl, abscisic acid, jasmonic acid, drought and low temperature) identified a group of R2R3MYB genes that responded to one or multiple treatments, which showed a promising for improving citrus adaptation to stresses. Our results provided an essential foundation for the future selection of the citrus R2R3MYB genes for cloning and functional dissection with an aim of uncovering their roles in citrus growth and development. PMID:25473954

  7. Decoy Receptor 3 (DcR3) as a Biomarker of Tumor Deterioration in Female Reproductive Cancers: A Meta-Analysis.

    PubMed

    Jiang, Mengtong; Lin, Xiaomiao; He, Rongquan; Lin, Xinggu; Liang, Lu; Tang, Ruixue; Xiong, Dandan; Wei, Kanglai; Dang, Yiwu; Feng, Zhenbo; Chen, Gang

    2016-01-01

    BACKGROUND DcR3 (decoy receptor 3) has been proposed be involved in development and prognosis of female reproductive cancers, including cervical cancer, ovarian cancer, and breast cancer. The purpose of this meta-analysis was to explore the evidence for the correlation between DcR3 and the clinicopathological characteristics, as well as the overall survival time, in female reproductive cancers. MATERIAL AND METHODS Relevant studies were searched for in PubMed, Wiley Online Library, Web of Science, Science Direct, Cochrane Central Register of Controlled Trials, Google Scholar, EMBASE, Ovid, LILACS, Chinese CNKI, Chong Qing VIP, Wan Fang, and China Biology Medicine disc up to 30 September 2015. Data on the relationship between DcR3 expression and TNM stage, differentiation, lymph node metastasis, age, and overall survival time were extracted. Pooled odds ratios (ORs) and 95% CIs (confidence intervals) were estimated by forest plot. RESULTS Twelve studies with 1127 patients met the inclusion criteria for this meta-analysis. Overexpression of DcR3 was significantly related to the risk of female reproductive cancers (OR=10.69, 95% CI: 6.33-18.05), TNM stage (OR=5.51, 95% CI: 2.83-10.71), differentiation (OR=4.16, 95% CI: 2.28-7.60), lymph node metastasis (OR=5.89, 95% CI: 3.16-10.9), age (OR=0.85, 95% CI: 0.51-1.44), and overall survival time (OR=1.84, 95% CI: 0.58-5.83). Subgroup analyses showed that overexpression of DcR3 in cervical, ovarian, and breast cancer all had similar relationships with these clinicopathological parameters. CONCLUSIONS Our meta-analysis suggests that overexpression of DcR3 may play vital roles in the tumorigenesis and deterioration of female reproductive cancers. However, the relationship between DcR3 expression and prognosis needs further investigation. PMID:27246752

  8. Expression of tumor necrosis factor-α-induced protein 8 in stage III gastric cancer and the correlation with DcR3 and ERK1/2

    PubMed Central

    HU, RUYI; LIU, WENMING; QIU, XINGFENG; LIN, ZHENGHE; XIE, YAN; HONG, XINGYA; PAERHATI, REYILA; QI, ZHONGQUAN; ZHUANG, GUOHONG; LIU, ZHONGCHEN

    2016-01-01

    Tumor necrosis factor (TNF)-α-induced protein 8 (TIPE) is a recently identified protein that is considered to be associated with various malignancies, including esophageal, breast and pancreatic cancer; however, the importance of TIPE in gastric cancer (GC) remains unknown. Decoy receptor 3 (DcR3) is a member of the tumor necrosis factor receptor superfamily that is expressed in digestive system neoplasms. The expression of DcR3 is regulated by the mitogen-activated protein kinase (MAPK)/MAPK kinase/extracellular signal-regulated kinase (ERK) signaling pathway. Reverse transcription-polymerase chain reaction was performed to detect the expression of TIPE, ERK and DcR3 in the pathological and tumor-adjacent normal gastric tissues of 30 patients that demonstrated stage III gastric adenocarcinoma. The expression and distribution of the TIPE protein was examined using immunohistochemistry, and the clinical significance and expression levels of DcR3 and ERK1/2 were evaluated. The expression of TIPE, ERK1/2 and DcR3 in the tumor tissues of GC was significantly increased compared with paracarcinoma tissues (P<0.05). In addition, TIPE expression positively correlated with DcR3 and ERK1 levels (r=0.538 and r=0.462, respectively; P<0.05). There was no statistical difference between tumor tissues from patients with varying age, gender, differentiation or lymph node metastasis (P>0.05). TIPE may be vital in the progression of GC. TIPE may be associated with the expression of DcR3 and ERK1/2, which may be involved in the cell apoptosis of GC. The present study elucidates the potential function of TIPE as a novel marker and therapeutic target for GC. PMID:26998086

  9. Genome-wide analysis of citrus R2R3MYB genes and their spatiotemporal expression under stresses and hormone treatments.

    PubMed

    Xie, Rangjin; Li, Yongjie; He, Shaolan; Zheng, Yongqiang; Yi, Shilai; Lv, Qiang; Deng, Lie

    2014-01-01

    The R2R3MYB proteins represent one of the largest families of transcription factors, which play important roles in plant growth and development. Although genome-wide analysis of this family has been conducted in many species, little is known about R2R3MYB genes in citrus, In this study, 101 R2R3MYB genes has been identified in the citrus (Citrus sinesis and Citrus clementina) genomes, which are almost equal to the number of rice. Phylogenetic analysis revealed that they could be subdivided into 21 subgroups. The evolutionary relationships and the intro-exon organizations were also analyzed, revealing strong gene conservation but also the expansions of particular functional genes during the plant evolution. Tissue-specific expression profiles showed that 95 citrus R2R3MYB genes were expressed in at least one tissue and the other 6 genes showed very low expression in all tissues tested, suggesting that citrus R2R3MYB genes play important roles in the development of all citrus organs. The transcript abundance level analysis during abiotic conditions (NaCl, abscisic acid, jasmonic acid, drought and low temperature) identified a group of R2R3MYB genes that responded to one or multiple treatments, which showed a promising for improving citrus adaptation to stresses. Our results provided an essential foundation for the future selection of the citrus R2R3MYB genes for cloning and functional dissection with an aim of uncovering their roles in citrus growth and development. PMID:25473954

  10. The simultaneous production of sphingan Ss and poly(R-3-hydroxybutyrate) in Sphingomonas sanxanigenens NX02.

    PubMed

    Wu, Mengmeng; Li, Guoqiang; Huang, Haidong; Chen, Sibin; Luo, Ying; Zhang, Wenwen; Li, Keran; Zhou, Jiefang; Ma, Ting

    2016-01-01

    Sphingans and poly(R-3-hydroxybutyrate) (PHB) are both widely used biopolymers produced by bacteria. In the batch fermentation of Sphingomonas sanxanigenens NX02 in a 5L fermenter using glucose as carbon source, ivory colored sphingan Ss production was a growth-associated process with a maximum purified production of 14.88 ± 0.83 g/L, while 6.08 ± 0.23 g/L PHB was simultaneously produced. Sphingan Ss and PHB were separated by a simple dilution, heating and centrifugation or filtration process, and sphingan Ss can be cost-effectively extracted using a small amount of acid rather than multi-fold volumes of alcohols. From ultrathin sections of S. sanxanigenens NX02, we found that the interior space of the cells was filled with PHB granules, and the outside was surrounded by abundant Ss. The purified sphingan Ss can be used as an excellent gelling and emulsifying agent in biotechnology applications such as food, personal care and production processes. Proposed pathways of Ss and PHB biosynthesis from glucose are also presented. PMID:26434528

  11. Characterization of a Citrus R2R3-MYB Transcription Factor that Regulates the Flavonol and Hydroxycinnamic Acid Biosynthesis.

    PubMed

    Liu, Chaoyang; Long, Jianmei; Zhu, Kaijie; Liu, Linlin; Yang, Wei; Zhang, Hongyan; Li, Li; Xu, Qiang; Deng, Xiuxin

    2016-01-01

    Flavonols and hydroxycinnamic acids are important phenylpropanoid metabolites in plants. In this study, we isolated and characterized a citrus R2R3-MYB transcription factor CsMYBF1, encoding a protein belonging to the flavonol-specific MYB subgroup. Ectopic expression of CsMYBF1 in tomato led to an up-regulation of a series of genes involved in primary metabolism and the phenylpropanoid pathway, and induced a strong accumulation of hydroxycinnamic acid compounds but not the flavonols. The RNAi suppression of CsMYBF1 in citrus callus caused a down-regulation of many phenylpropanoid pathway genes and reduced the contents of hydroxycinnamic acids and flavonols. Transactivation assays indicated that CsMYBF1 activated several promoters of phenylpropanoid pathway genes in tomato and citrus. Interestingly, CsMYBF1 could activate the CHS gene promoter in citrus, but not in tomato. Further examinations revealed that the MYBPLANT cis-elements were essential for CsMYBF1 in activating phenylpropanoid pathway genes. In summary, our data indicated that CsMYBF1 possessed the function in controlling the flavonol and hydroxycinnamic acid biosynthesis, and the regulatory differences in the target metabolite accumulation between two species may be due to the differential activation of CHS promoters by CsMYBF1. Therefore, CsMYBF1 constitutes an important gene source for the engineering of specific phenylpropanoid components. PMID:27162196

  12. The soybean R2R3 MYB transcription factor GmMYB100 negatively regulates plant flavonoid biosynthesis.

    PubMed

    Yan, Junhui; Wang, Biao; Zhong, Yunpeng; Yao, Luming; Cheng, Linjing; Wu, Tianlong

    2015-09-01

    Soybean flavonoids, a group of important signaling molecules in plant-environment interaction, ubiquitously exist in soybean and are tightly regulated by many genes. Here we reported that GmMYB100, a gene encoding a R2R3 MYB transcription factor, is involved in soybean flavonoid biosynthesis. GmMYB100 is mainly expressed in flowers, leaves and immature embryo, and its level is decreased after pod ripening. Subcellular localization assay indicates that GmMYB100 is a nuclear protein. GmMYB100 has transactivation ability revealed by a yeast functional assay; whereas bioinformatic analysis suggests that GmMYB100 has a negative function in flavonoid biosynthesis. GmMYB100-overexpression represses the transcript levels of flavonoid-related genes in transgenic soybean hairy roots and Arabidopsis, and inhibits isoflavonoid (soybean) and flavonol (Arabidopsis) production in transgenic plants. Furthermore, the transcript levels of six flavonoid-related genes and flavonoid (isoflavonoid and flavone aglycones) accumulation are elevated in the GmMYB100-RNAi transgenic hairy roots. We also demonstrate that GmMYB100 protein depresses the promoter activities of soybean chalcone synthase and chalcone isomerase. These findings indicate that GmMYB100 is a negative regulator in soybean flavonoid biosynthesis pathway. PMID:26231207

  13. A chimeric repressor of petunia PH4 R2R3-MYB family transcription factor generates margined flowers in torenia.

    PubMed

    Kasajima, Ichiro; Sasaki, Katsutomo

    2016-05-01

    The development of new phenotypes is key to the commercial development of the main floricultural species and cultivars. Important new phenotypes include features such as multiple-flowers, color variations, increased flower size, new petal shapes, variegation and distinctive petal margin colourations. Although their commercial use is not yet common, the transgenic technologies provide a potentially rapid means of generating interesting new phenotypes. In this report, we construct 5 vectors which we expected to change the color of the flower anthocyanins, from purple to blue, regulating vacuolar pH. When these constructs were transformed into purple torenia, we unexpectedly recovered some genotypes having slightly margined petals. These transgenic lines expressed a chimeric repressor of the petunia PhPH4 gene under the control of Cauliflower mosaic virus 35 S RNA promoter. PhPH4 is an R2R3-type MYB transcription factor. The transgenic lines lacked pigmentation in the petal margin cells both on the adaxial and abaxial surfaces. Expressions of Flavanone 3-hydroxylase (F3H), Flavonoid 3'-hydroxylase (F3'H) and Flavonoid 3'5'-hydroxylase (F3'5'H) genes were reduced in the margins of these transgenic lines, suggesting an inhibitory effect of PhPH4 repressor on anthocyanin synthesis. PMID:27089475

  14. The Evolutionary History of R2R3-MYB Proteins Across 50 Eukaryotes: New Insights Into Subfamily Classification and Expansion

    PubMed Central

    Du, Hai; Liang, Zhe; Zhao, Sen; Nan, Ming-Ge; Phan Tran, Lam-Son; Lu, Kun; Huang, Yu-Bi; Li, Jia-Na

    2015-01-01

    R2R3-MYB proteins (2R-MYBs) are one of the main transcription factor families in higher plants. Since the evolutionary history of this gene family across the eukaryotic kingdom remains unknown, we performed a comparative analysis of 2R-MYBs from 50 major eukaryotic lineages, with particular emphasis on land plants. A total of 1548 candidates were identified among diverse taxonomic groups, which allowed for an updated classification of 73 highly conserved subfamilies, including many newly identified subfamilies. Our results revealed that the protein architectures, intron patterns, and sequence characteristics were remarkably conserved in each subfamily. At least four subfamilies were derived from early land plants, 10 evolved from spermatophytes, and 19 from angiosperms, demonstrating the diversity and preferential expansion of this gene family in land plants. Moreover, we determined that their remarkable expansion was mainly attributed to whole genome and segmental duplication, where duplicates were preferentially retained within certain subfamilies that shared three homologous intron patterns (a, b, and c) even though up to 12 types of patterns existed. Through our integrated distributions, sequence characteristics, and phylogenetic tree analyses, we confirm that 2R-MYBs are old and postulate that 3R-MYBs may be evolutionarily derived from 2R-MYBs via intragenic domain duplication. PMID:26047035

  15. MULTIPASS, a rice R2R3-type MYB transcription factor, regulates adaptive growth by integrating multiple hormonal pathways.

    PubMed

    Schmidt, Romy; Schippers, Jos H M; Mieulet, Delphine; Obata, Toshihiro; Fernie, Alisdair R; Guiderdoni, Emmanuel; Mueller-Roeber, Bernd

    2013-10-01

    Growth regulation is an important aspect of plant adaptation during environmental perturbations. Here, the role of MULTIPASS (OsMPS), an R2R3-type MYB transcription factor of rice, was explored. OsMPS is induced by salt stress and expressed in vegetative and reproductive tissues. Over-expression of OsMPS reduces growth under non-stress conditions, while knockdown plants display increased biomass. OsMPS expression is induced by abscisic acid and cytokinin, but is repressed by auxin, gibberellin and brassinolide. Growth retardation caused by OsMPS over-expression is partially restored by auxin application. Expression profiling revealed that OsMPS negatively regulates the expression of EXPANSIN (EXP) and cell-wall biosynthesis as well as phytohormone signaling genes. Furthermore, the expression of OsMPS-dependent genes is regulated by auxin, cytokinin and abscisic acid. Moreover, we show that OsMPS is a direct upstream regulator of OsEXPA4, OsEXPA8, OsEXPB2, OsEXPB3, OsEXPB6 and the endoglucanase genes OsGLU5 and OsGLU14. The multiple responses of OsMPS and its target genes to various hormones suggest an integrative function of OsMPS in the cross-talk between phytohormones and the environment to regulate adaptive growth. PMID:23855375

  16. The Evolutionary History of R2R3-MYB Proteins Across 50 Eukaryotes: New Insights Into Subfamily Classification and Expansion.

    PubMed

    Du, Hai; Liang, Zhe; Zhao, Sen; Nan, Ming-Ge; Tran, Lam-Son Phan; Lu, Kun; Huang, Yu-Bi; Li, Jia-Na

    2015-01-01

    R2R3-MYB proteins (2R-MYBs) are one of the main transcription factor families in higher plants. Since the evolutionary history of this gene family across the eukaryotic kingdom remains unknown, we performed a comparative analysis of 2R-MYBs from 50 major eukaryotic lineages, with particular emphasis on land plants. A total of 1548 candidates were identified among diverse taxonomic groups, which allowed for an updated classification of 73 highly conserved subfamilies, including many newly identified subfamilies. Our results revealed that the protein architectures, intron patterns, and sequence characteristics were remarkably conserved in each subfamily. At least four subfamilies were derived from early land plants, 10 evolved from spermatophytes, and 19 from angiosperms, demonstrating the diversity and preferential expansion of this gene family in land plants. Moreover, we determined that their remarkable expansion was mainly attributed to whole genome and segmental duplication, where duplicates were preferentially retained within certain subfamilies that shared three homologous intron patterns (a, b, and c) even though up to 12 types of patterns existed. Through our integrated distributions, sequence characteristics, and phylogenetic tree analyses, we confirm that 2R-MYBs are old and postulate that 3R-MYBs may be evolutionarily derived from 2R-MYBs via intragenic domain duplication. PMID:26047035

  17. Time Profile of Cosmic Radiation Exposure During the EXPOSE-E Mission: The R3DE Instrument

    PubMed Central

    Horneck, Gerda; Häder, Donat-Peter; Schuster, Martin; Richter, Peter; Lebert, Michael; Demets, Rene

    2012-01-01

    Abstract The aim of this paper is to present the time profile of cosmic radiation exposure obtained by the Radiation Risk Radiometer-Dosimeter during the EXPOSE-E mission in the European Technology Exposure Facility on the International Space Station's Columbus module. Another aim is to make the obtained results available to other EXPOSE-E teams for use in their data analysis. Radiation Risk Radiometer-Dosimeter is a low-mass and small-dimension automatic device that measures solar radiation in four channels and cosmic ionizing radiation as well. The main results of the present study include the following: (1) three different radiation sources were detected and quantified—galactic cosmic rays (GCR), energetic protons from the South Atlantic Anomaly (SAA) region of the inner radiation belt, and energetic electrons from the outer radiation belt (ORB); (2) the highest daily averaged absorbed dose rate of 426 μGy d−1 came from SAA protons; (3) GCR delivered a much smaller daily absorbed dose rate of 91.1 μGy d−1, and the ORB source delivered only 8.6 μGy d−1. The analysis of the UV and temperature data is a subject of another article (Schuster et al., 2012). Key Words: Ionizing radiation—R3D—ISS. Astrobiology 12, 403–411. PMID:22680687

  18. The R2R3-MYB transcription factors MYB14 and MYB15 regulate stilbene biosynthesis in Vitis vinifera.

    PubMed

    Höll, Janine; Vannozzi, Alessandro; Czemmel, Stefan; D'Onofrio, Claudio; Walker, Amanda R; Rausch, Thomas; Lucchin, Margherita; Boss, Paul K; Dry, Ian B; Bogs, Jochen

    2013-10-01

    Plant stilbenes are phytoalexins that accumulate in a small number of plant species, including grapevine (Vitis vinifera), in response to biotic and abiotic stresses and have been implicated in many beneficial effects on human health. In particular, resveratrol, the basic unit of all other complex stilbenes, has received widespread attention because of its cardio-protective, anticarcinogenic, and antioxidant properties. Although stilbene synthases (STSs), the key enzymes responsible for resveratrol biosynthesis, have been isolated and characterized from several plant species, the transcriptional regulation underlying stilbene biosynthesis is unknown. Here, we report the identification and functional characterization of two R2R3-MYB-type transcription factors (TFs) from grapevine, which regulate the stilbene biosynthetic pathway. These TFs, designated MYB14 and MYB15, strongly coexpress with STS genes, both in leaf tissues under biotic and abiotic stress and in the skin and seed of healthy developing berries during maturation. In transient gene reporter assays, MYB14 and MYB15 were demonstrated to specifically activate the promoters of STS genes, and the ectopic expression of MYB15 in grapevine hairy roots resulted in increased STS expression and in the accumulation of glycosylated stilbenes in planta. These results demonstrate the involvement of MYB14 and MYB15 in the transcriptional regulation of stilbene biosynthesis in grapevine. PMID:24151295

  19. Circular Dichroism in Mass Spectrometry: Quantum Chemical Investigations for the Differences between (R)-3-Methylcyclopentanone and Its Cation.

    PubMed

    Kröner, Dominik; Gaebel, Tina

    2015-08-27

    In mass spectrometry enantiomers can be distinguished by multiphoton ionization employing circular polarized laser pulses. The circular dichroism (CD) is detected from the normalized difference in the ion yield after excitation with light of opposite handedness. While there are cases in which fragment and parent ions exhibit the same sign of the CD in the ion yield, several experiments show that they might also differ in sign and magnitude. Supported by experimental observations it has been proposed that the parent ion, once it has been formed, is further excited by the laser, which may result in a change of the CD in the ion yield of the formed fragments compared to the parent ion. To gain a deeper insight in possible excitation pathways we calculated and compared the electronic CD absorption spectra of neutral and cationic (R)-3-methylcyclopentanone, applying density functional theory. In addition, electron wavepacket dynamics were used to compare the CD of one- and two-photon transitions. Our results support the proposed subsequent excitation of the parent ion as a possible origin of the difference of the CD in the ion yield between parent ion and fragments. PMID:26214257

  20. Antibodies targeting human IL1RAP (IL1R3) show therapeutic effects in xenograft models of acute myeloid leukemia

    PubMed Central

    Ågerstam, Helena; Karlsson, Christine; Hansen, Nils; Sandén, Carl; Askmyr, Maria; von Palffy, Sofia; Högberg, Carl; Rissler, Marianne; Wunderlich, Mark; Juliusson, Gunnar; Richter, Johan; Sjöström, Kjell; Bhatia, Ravi; Mulloy, James C.; Järås, Marcus; Fioretos, Thoas

    2015-01-01

    Acute myeloid leukemia (AML) is associated with a poor survival rate, and there is an urgent need for novel and more efficient therapies, ideally targeting AML stem cells that are essential for maintaining the disease. The interleukin 1 receptor accessory protein (IL1RAP; IL1R3) is expressed on candidate leukemic stem cells in the majority of AML patients, but not on normal hematopoietic stem cells. We show here that monoclonal antibodies targeting IL1RAP have strong antileukemic effects in xenograft models of human AML. We demonstrate that effector-cell–mediated killing is essential for the observed therapeutic effects and that natural killer cells constitute a critical human effector cell type. Because IL-1 signaling is important for the growth of AML cells, we generated an IL1RAP-targeting antibody capable of blocking IL-1 signaling and show that this antibody suppresses the proliferation of primary human AML cells. Hence, IL1RAP can be efficiently targeted with an anti-IL1RAP antibody capable of both achieving antibody-dependent cellular cytotoxicity and blocking of IL-1 signaling as modes of action. Collectively, these results provide important evidence in support of IL1RAP as a target for antibody-based treatment of AML. PMID:26261316

  1. Characterization, biodegradability and blood compatibility of poly[(R)-3-hydroxybutyrate] based poly(ester-urethane)s.

    PubMed

    Liu, Qiaoyan; Cheng, Shaoting; Li, Zibiao; Xu, Kaitian; Chen, Guo-Qiang

    2009-09-15

    Poly(ester-urethane)s (PUs) were synthesized using hexamethylene diisocyanate (HDI) or toluene diisocyanate (TDI) to join short chains (M(n) = 2000) of poly(R-3-hydroxybutyrate) (PHB) diols and poly(epsilon-caprolactone) (PCL) diols with different feed ratios under different reaction conditions. The multiblock copolymers were characterized by nuclear magnetic resonance spectrometer (NMR), gel permeation chromatography (GPC), differential scanning calorimetry (DSC), thermogravimetric analyses (TGA), X-ray diffraction (XRD), and scanning electron microscope (SEM). XRD spectra and second DSC heat thermograms of the multiblock copolymers revealed that the crystallization of both PHB and PCL segments was mutually restricted, and, especially, the PCL segment limited the cold crystallization of the PHB segment. The SEM of platelet adhesion experiments showed that the hemocompatibility was affected to some extent by the chain flexibility of the polymers. Hydrolysis studies demonstrated that the hydrolytic degradation of PUs was generated from the scission of their ester bonds or/and urethane bonds. Simultaneously, the rate of ester bond scission was determined to some extent by the crystallization degree, which was further affected by the configuration of polymer chains. These highly elastic multiblock copolymers combining hemocompatibility and biodegradability may be developed into blood contact implant materials for biomedical applications. PMID:18671259

  2. Characterization of a Citrus R2R3-MYB Transcription Factor that Regulates the Flavonol and Hydroxycinnamic Acid Biosynthesis

    PubMed Central

    Liu, Chaoyang; Long, Jianmei; Zhu, Kaijie; Liu, Linlin; Yang, Wei; Zhang, Hongyan; Li, Li; Xu, Qiang; Deng, Xiuxin

    2016-01-01

    Flavonols and hydroxycinnamic acids are important phenylpropanoid metabolites in plants. In this study, we isolated and characterized a citrus R2R3-MYB transcription factor CsMYBF1, encoding a protein belonging to the flavonol-specific MYB subgroup. Ectopic expression of CsMYBF1 in tomato led to an up-regulation of a series of genes involved in primary metabolism and the phenylpropanoid pathway, and induced a strong accumulation of hydroxycinnamic acid compounds but not the flavonols. The RNAi suppression of CsMYBF1 in citrus callus caused a down-regulation of many phenylpropanoid pathway genes and reduced the contents of hydroxycinnamic acids and flavonols. Transactivation assays indicated that CsMYBF1 activated several promoters of phenylpropanoid pathway genes in tomato and citrus. Interestingly, CsMYBF1 could activate the CHS gene promoter in citrus, but not in tomato. Further examinations revealed that the MYBPLANT cis-elements were essential for CsMYBF1 in activating phenylpropanoid pathway genes. In summary, our data indicated that CsMYBF1 possessed the function in controlling the flavonol and hydroxycinnamic acid biosynthesis, and the regulatory differences in the target metabolite accumulation between two species may be due to the differential activation of CHS promoters by CsMYBF1. Therefore, CsMYBF1 constitutes an important gene source for the engineering of specific phenylpropanoid components. PMID:27162196

  3. Foodservice Occupations Cluster Guide.

    ERIC Educational Resources Information Center

    Oregon State Dept. of Education, Salem.

    Intended to assist vocational teachers in developing and implementing a cluster program in food service occupations, this guide contains sections on cluster organization and implementation and instructional emphasis areas. The cluster organization and implementation section covers goal-based planning and includes a proposed cluster curriculum, a…

  4. Cluster-impact fusion

    SciTech Connect

    Echenique, P.M.; Manson, J.R.; Ritchie, R.H. )

    1990-03-19

    We present a model for the cluster-impact-fusion experiments of Buehler, Friedlander, and Friedman, Calculated fusion rates as a function of bombarding energy for constant cluster size agree well with experiment. The dependence of the fusion rate on cluster size at fixed bombarding energy is explained qualitatively. The role of correlated, coherent collisions in enhanced energy loss by clusters is emphasized.

  5. Endocrine and metabolic changes in neonatal calves in response to growth hormone and long-R3-insulin-like growth factor-I administration.

    PubMed

    Hammon, H; Blum, J W

    1998-01-01

    Postnatal growth is primarily controlled by growth hormone (GH) and insulin-like growth factor-I (IGF-I). We have studied effects of recombinant bovine GH (rbGH) and Long-R3-insulin-like growth factor-I (Long-R3-IGF-I) on metabolic and endocrine characteristics of neonatal calves. Group GrC (control) was fed colostrum as first meal and then milk replacer up to day 7. Groups GrIGFf, GrIGFi and GrGH were fed as GrC. In group GrIGFf, Long-R3-IGF-I (50 micrograms/[kg x day], twice daily for 7 days) was fed together with colostrum or milk replacer and in group GrIGFi, Long-R3-IGF-I (50 micrograms/[kg x day], twice daily for 7 days) was injected subcutaneously at times of feeding. Calves of group GrGH were injected rbGH (1 mg/[kg x day, s.c.], twice daily for 7 days) at times of feeding. While orally administered Long-R3-IGF-I had no effects, subcutaneously administered Long-R3-IGF-I lowered plasma glucose and insulin concentrations (p < 0.05). In group GrGH, day-2 postprandial plasma insulin concentrations were increased more than in Long-R3-IGF-I-treated groups (p < 0.05) and day-2 postprandial prolactin responses were greater in group GrGH than in controls (p < 0.05). Other traits (lactic acid, nonesterified fatty acids, glucagon, cortisol, thyroxine and 3.5.3'-triiodothyronine) exhibited age-dependent changes, but were not significantly affected by rbGH or Long-R3-IGF-I. The study shows, that parenteral, but not oral, Long-R3-IGF-I affects plasma glucose and insulin concentrations, and that rbGH transiently influences plasma prolactin concentrations in neonatal calves. PMID:9483305

  6. Monitoring and kinetic analysis of the molecular interactions by which a repressor protein, PhaR, binds to target DNAs and poly[(R)-3-hydroxybutyrate

    PubMed Central

    2013-01-01

    The repressor protein PhaR, which is a component of poly[(R)-3-hydroxybutyrate] granules, functions as a repressor of the gene expression of the phasin PhaP and of PhaR itself. We used a quartz crystal microbalance to investigate the binding behavior by which PhaR in Ralstonia eutropha H16 targets DNAs and amorphous poly[(R)-3-hydroxybutyrate] thin films. Binding rate constants, dissociation rate constants, and dissociation constants of the binding of PhaR to DNA and to amorphous poly[(R)-3-hydroxybutyrate] suggested that PhaR bind to both in a similar manner. On the basis of the binding rate constant values, we proposed that the phaP gene would be derepressed in harmony with the ratio of the concentration of the target DNA to the concentration of amorphous poly[(R)-3-hydroxybutyrate] at the start of poly[(R)-3-hydroxybutyrate] synthesis in R. eutropha H16. PMID:23351303

  7. Triangular libration points in the R3BP under combined effects of oblateness, radiation and power-law profile

    NASA Astrophysics Data System (ADS)

    Falaye, B. J.; Dong, Shi-Hai; Oyewumi, K. J.; Falaiye, O. A.; Joshua, E. S.; Omojola, J.; Abimbola, O. J.; Kalu, O.; Ikhdair, S. M.

    2016-01-01

    We study the effects of oblateness up to J4 of the primaries and power-law density profile (PDP) on the linear stability of libration location of an infinitesimal mass within the framework of restricted three body problem (R3BP), by using a more realistic model in which a disc with PDP is rotating around the common center of the system mass with perturbed mean motion. The existence and stability of triangular equilibrium points have been explored. It has been shown that triangular equilibrium points are stable for 0 < μ <μc and unstable for μc ⩽ μ≤ 1 / 2 , where μc denotes the critical mass parameter. We find that, the oblateness up to J2 of the primaries and the radiation reduces the stability range while the oblateness up to J4 of the primaries increases the size of stability both in the context where PDP is considered and ignored. The PDP has an effect of about ≈ 0.01 reduction on the application of μc to Earth-Moon and Jupiter-Moons systems. We find that the comprehensive effects of the perturbations have a stabilizing proclivity. However, the oblateness up to J2 of the primaries and the radiation of the primaries have tendency for instability, while coefficients up to J4 of the primaries have stability predisposition. In the limiting case c = 0 , and also by setting appropriate parameter(s) to zero, our results are in excellent agreement with the ones obtained previously. Libration points play a very important role in space mission and as a consequence, our results have a practical application in space dynamics and related areas. The model may be applied to study the navigation and stationkeeping operations of spacecraft (infinitesimal mass) around the Jupiter (more massive) -Callisto (less massive) system, where PDP accounts for the circumsolar ring of asteroidal dust, which has a cloud of dust permanently in its wake.

  8. Three R2R3-MYB Transcription Factors Regulate Distinct Floral Pigmentation Patterning in Phalaenopsis spp.1[OPEN

    PubMed Central

    Hsu, Chia-Chi; Chen, You-Yi; Tsai, Wen-Chieh; Chen, Wen-Huei; Chen, Hong-Hwa

    2015-01-01

    Orchidaceae are well known for their fascinating floral morphologic features, specialized pollination, and distinctive ecological strategies. With their long-lasting flowers of various colors and pigmentation patterning, Phalaenopsis spp. have become important ornamental plants worldwide. In this study, we identified three R2R3-MYB transcription factors PeMYB2, PeMYB11, and PeMYB12. Their expression profiles were concomitant with red color formation in Phalaenopsis spp. flowers. Transient assay of overexpression of three PeMYBs verified that PeMYB2 resulted in anthocyanin accumulation, and these PeMYBs could activate the expression of three downstream structural genes Phalaenopsis spp. Flavanone 3-hydroxylase5, Phalaenopsis spp. Dihydroflavonol 4-reductase1, and Phalaenopsis spp. Anthocyanidin synthase3. In addition, these three PeMYBs participated in the distinct pigmentation patterning in a single flower, which was revealed by virus-induced gene silencing. In the sepals/petals, silencing of PeMYB2, PeMYB11, and PeMYB12 resulted in the loss of the full-red pigmentation, red spots, and venation patterns, respectively. Moreover, different pigmentation patterning was regulated by PeMYBs in the sepals/petals and lip. PeMYB11 was responsive to the red spots in the callus of the lip, and PeMYB12 participated in the full pigmentation in the central lobe of the lip. The differential pigmentation patterning was validated by RNA in situ hybridization. Additional assessment was performed in six Phalaenopsis spp. cultivars with different color patterns. The combined expression of these three PeMYBs in different ratios leads to a wealth of complicated floral pigmentation patterning in Phalaenopsis spp. PMID:25739699

  9. Survey on granularity clustering.

    PubMed

    Ding, Shifei; Du, Mingjing; Zhu, Hong

    2015-12-01

    With the rapid development of uncertain artificial intelligent and the arrival of big data era, conventional clustering analysis and granular computing fail to satisfy the requirements of intelligent information processing in this new case. There is the essential relationship between granular computing and clustering analysis, so some researchers try to combine granular computing with clustering analysis. In the idea of granularity, the researchers expand the researches in clustering analysis and look for the best clustering results with the help of the basic theories and methods of granular computing. Granularity clustering method which is proposed and studied has attracted more and more attention. This paper firstly summarizes the background of granularity clustering and the intrinsic connection between granular computing and clustering analysis, and then mainly reviews the research status and various methods of granularity clustering. Finally, we analyze existing problem and propose further research. PMID:26557926

  10. A convenient method for europium-labeling of a recombinant chimeric relaxin family peptide R3/I5 for receptor-binding assays.

    PubMed

    Zhang, Wei-Jie; Jiang, Qian; Wang, Xin-Yi; Song, Ge; Shao, Xiao-Xia; Guo, Zhan-Yun

    2013-06-01

    Relaxin family peptides have important biological functions, and so far, four G-protein-coupled receptors have been identified as their receptors (RXFP1-4). A chimeric relaxin family peptide R3/I5, containing the B-chain of relaxin-3 and the A-chain of INSL5, is a selective agonist for both RXFP3 and RXFP4. In a previous study, europium-labeled R3/I5, as a nonradioactive and low-background receptor-binding tracer, was prepared through a chemical synthesis approach. In the present study, we established a convenient alternative approach for preparing the europium-labeled R3/I5 tracer based on a recombinant R3/I5 designed to carry a solubilizing tag at the A-chain N-terminus and a pyroglutamate residue at the B-chain N-terminus. Because of the presence of a single primary amine moiety, the recombinant R3/I5 peptide was site-specifically mono-labeled at the A-chain N-terminus by a diethylenetriaminepentaacetic acid/europium moiety through a convenient one-step procedure. The diethylenetriaminepentaacetic acid/Eu3+-labeled R3/I5 bound both receptors RXFP3 and RXFP4 with high binding affinities and low nonspecific binding. Thus, we have presented a valuable nonradioactive tracer for future interaction studies on RXFP3 and RXFP4 with various natural or designed ligands. The present approach could also be adapted for preparing and labeling of other chimeric relaxin family peptides. PMID:23526726

  11. The somatotropic axis in neonatal calves can be modulated by nutrition, growth hormone, and Long-R3-IGF-I.

    PubMed

    Hammon, H; Blum, J W

    1997-07-01

    Effects on the somatotropic axis [plasma levels of insulin-like growth factors (IGFs) I and II, IGF-binding proteins (IGFBPs), and growth hormone (GH)] of feeding different amounts of colostrum or milk replacer, of Long-R3-IGF-I (administered subcutaneously or orally; 50 micrograms.kg body wt-1.day-1 for 7 days), and of subcutaneously injected recombinant bovine GH (rbGH; 1 mg.kg body wt-1.day-1 for 7 days) were evaluated in calves during the 1st wk of life. Plasma Long-R3-IGF-I increased after subcutaneous application but not with the oral dose. Endogenous IGF-I was higher in calves fed colostrum six times compared with those fed only milk replacer. Native IGF-I was highest in rbGH-injected calves but was lowered by the subcutaneous injection of Long-R3-IGF-I. IGF-II concentrations were not modified by any of the treatments. IGFBP-2 increased in calves fed only milk replacer and those receiving subcutaneous Long-R3-IGF-I. GH was not modulated by differences in nutrition but increased after rbGH administration and similarly in all groups after intravenous injection of GH-releasing factor analog GRF-(1-29). Parenteral administration of Long-R3-IGF-I decreased GH concentration but did not affect the secretory pattern. The data demonstrate that the somatotrophic axis is basically functioning in neonatal calves and is influenced by nutrition, GH, and Long-R3-IGF-I. PMID:9252489

  12. Opposite action of R2R3-MYBs from different subgroups on key genes of the shikimate and monolignol pathways in spruce.

    PubMed

    Bomal, Claude; Duval, Isabelle; Giguère, Isabelle; Fortin, Élise; Caron, Sébastien; Stewart, Don; Boyle, Brian; Séguin, Armand; MacKay, John J

    2014-02-01

    Redundancy and competition between R2R3-MYB activators and repressors on common target genes has been proposed as a fine-tuning mechanism for the regulation of plant secondary metabolism. This hypothesis was tested in white spruce [Picea glauca (Moench) Voss] by investigating the effects of R2R3-MYBs from different subgroups on common targets from distinct metabolic pathways. Comparative analysis of transcript profiling data in spruces overexpressing R2R3-MYBs from loblolly pine (Pinus taeda L.), PtMYB1, PtMYB8, and PtMYB14, defined a set of common genes that display opposite regulation effects. The relationship between the closest MYB homologues and 33 putative target genes was explored by quantitative PCR expression profiling in wild-type P. glauca plants during the diurnal cycle. Significant Spearman's correlation estimates were consistent with the proposed opposite effect of different R2R3-MYBs on several putative target genes in a time-related and tissue-preferential manner. Expression of sequences coding for 4CL, DHS2, COMT1, SHM4, and a lipase thio/esterase positively correlated with that of PgMYB1 and PgMYB8, but negatively with that of PgMYB14 and PgMYB15. Complementary electrophoretic mobility shift assay (EMSA) and transactivation assay provided experimental evidence that these different R2R3-MYBs are able to bind similar AC cis-elements in the promoter region of Pg4CL and PgDHS2 genes but have opposite effects on their expression. Competitive binding EMSA experiments showed that PgMYB8 competes more strongly than PgMYB15 for the AC-I MYB binding site in the Pg4CL promoter. Together, the results bring a new perspective to the action of R2R3-MYB proteins in the regulation of distinct but interconnecting metabolism pathways. PMID:24336492

  13. Relativistic electron fluxes and dose rate variations during April-May 2010 geomagnetic disturbances in the R3DR data on ISS

    NASA Astrophysics Data System (ADS)

    Dachev, Ts. P.; Tomov, B. T.; Matviichuk, Yu. N.; Dimitrov, Pl. G.; Bankov, N. G.; Reitz, G.; Horneck, G.; Häder, D.-P.; Lebert, M.; Schuster, M.

    2012-07-01

    Space radiation has been monitored successfully using the Radiation Risks Radiometer-Dosimeter (R3D) installed at the ESA EXPOSE-R (R3DR) facility outside of the Russian Zvezda module of the International Space Station (ISS) between March 2009 and January 2011. R3DR is a Liulin type spectrometer-dosimeter with a single Si PIN detector 2 cm2 of area and 0.3 mm thick. The R3DR instrument accumulated about 2 million measurements of the absorbed dose rate and flux of 10 s resolution. The total external and internal shielding before the detector of R3DR device is 0.41 g cm-2. The calculated stopping energy of normally incident particles to the detector is 0.78 MeV for electrons and 15.8 MeV for protons. After the Coronal Mass Ejection (CME) at 09:54 UTC on 3 April 2010, a shock was observed at the ACE spacecraft at 0756 UTC on 5 April, which led to a sudden impulse on Earth at 08:26 UTC. Nevertheless, while the magnetic substorms on 5 and 6 of April were moderate; the second largest in history of GOES fluence of electrons with energy >2 MeV was measured. The R3DR data show a relatively small amount of relativistic electrons on 5 April. The maximum dose rate of 2323 μGy day-1 was reached on 7 April; by 9 April, a dose of 6600 μGy was accumulated. By the end of the period on 7 May 2010 a total dose of 11,587 μGy was absorbed. Our data were compared with AE-8 MIN, CRESS and ESA-SEE1 models using SPENVIS and with similar observations on American, Japanese and Russian satellites.

  14. Comparative genomic analysis of the R2R3 MYB secondary cell wall regulators of Arabidopsis, poplar, rice, maize, and switchgrass

    PubMed Central

    2014-01-01

    Background R2R3 MYB proteins constitute one of the largest plant transcription factor clades and regulate diverse plant-specific processes. Several R2R3 MYB proteins act as regulators of secondary cell wall (SCW) biosynthesis in Arabidopsis thaliana (At), a dicotyledenous plant. Relatively few studies have examined SCW R2R3 MYB function in grasses, which may have diverged from dicots in terms of SCW regulatory mechanisms, as they have in cell wall composition and patterning. Understanding cell wall regulation is especially important for improving lignocellulosic bioenergy crops, such as switchgrass. Results Here, we describe the results of applying phylogenic, OrthoMCL, and sequence identity analyses to classify the R2R3 MYB family proteins from the annotated proteomes of Arabidposis, poplar, rice, maize and the initial genome (v0.0) and translated transcriptome of switchgrass (Panicum virgatum). We find that the R2R3 MYB proteins of the five species fall into 48 subgroups, including three dicot-specific, six grass-specific, and two panicoid grass-expanded subgroups. We observe four classes of phylogenetic relationships within the subgroups of known SCW-regulating MYB proteins between Arabidopsis and rice, ranging from likely one-to-one orthology (for AtMYB26, AtMYB103, AtMYB69) to no homologs identifiable (for AtMYB75). Microarray data for putative switchgrass SCW MYBs indicate that many maintain similar expression patterns with the Arabidopsis SCW regulators. However, some of the switchgrass-expanded candidate SCW MYBs exhibit differences in gene expression patterns among paralogs, consistent with subfunctionalization. Furthermore, some switchgrass representatives of grass-expanded clades have gene expression patterns consistent with regulating SCW development. Conclusions Our analysis suggests that no single comparative genomics tool is able to provide a complete picture of the R2R3 MYB protein family without leaving ambiguities, and establishing likely false

  15. Cluster Morphology Analysis

    PubMed Central

    Jacquez, Geoffrey M.

    2009-01-01

    Most disease clustering methods assume specific shapes and do not evaluate statistical power using the applicable geography, at-risk population, and covariates. Cluster Morphology Analysis (CMA) conducts power analyses of alternative techniques assuming clusters of different relative risks and shapes. Results are ranked by statistical power and false positives, under the rationale that surveillance should (1) find true clusters while (2) avoiding false clusters. CMA then synthesizes results of the most powerful methods. CMA was evaluated in simulation studies and applied to pancreatic cancer mortality in Michigan, and finds clusters of flexible shape while routinely evaluating statistical power. PMID:20234799

  16. Effect of DcR3-specific siRNA on cell growth suppression and apoptosis induction in glioma cells via affecting ERK and AKT

    PubMed Central

    Zhang, Yu; Huang, Suning; Leng, Yuhua; Chen, Xin; Liu, Tiantian; Wang, Hanlin; Wei, Fanglin; Luo, Dianzhong; Chen, Gang; Wei, Zhuxin

    2016-01-01

    Background Previously, we found that the expression of decoy receptor 3 (DcR3) in gliomas was significantly upregulated compared to normal brain tissues. However, the effect of DcR3-specific small interfering RNA (siRNA) on cell biological function of glioma cells remains incompletely understood. Objective The aim of this study was to explore the effect of DcR3 siRNA on cell growth and apoptosis of glioma cells and to investigate the potential downstream pathways affected by DcR3. Methods DcR3-specific siRNA was transfected into three glioma cell lines (U251MG, LN-308, and U87MG) using combiMAGnetofection method. MTS tetrazolium assay and fluorimetric resorufin viability assay were used to assess the growth of glioma cells. Then, apoptosis was examined using the Hoechst 33342/propidium iodide double-staining assay and fluorescent caspase-3/7 assay. Meanwhile, Western blot was performed to explore the probable pathway by which DcR3-specific siRNA acts in glioma cells. Also, microarray dataset analysis was applied to analyze the potential function of DcR3 in glioma. Results The DcR3-specific siRNA had a potent effect on cell growth and apoptosis of all three glioma cells tested, and the effects were time dependent. Among these three glioma cell lines, U251MG had the most significant effect with regard to growth inhibition and apoptosis induction. MTS assay showed that the proliferation rate at 72 and 96 hours after the transfection was 76.333%±5.131% (t=7.611, P=0.002) and 64.333%±5.859% (t=10.983, P<0.001), respectively. The viability rate of U251MG cells was 80.667%±2.309% (t=12.302, P<0.001) and 62.333%±2.082% (t=21.213, P<0.001) at 72 and 96 hours posttreatment, respectively. The caspase-3/7 activity of U251MG cells was 2.76 (t=−6.601, P=0.003) and 4.75 (t=−9.189, P=0.001) folds that of the mock control at 72 and 96 hours, respectively. The apoptosis rate was increased to 1.85 (t=−2.496, P=0.067) and 3.93 (t=−12.587, P<0.001) folds at 72 and 96 hours

  17. Universal Cluster Deposition System

    NASA Astrophysics Data System (ADS)

    Qiang, You; Sun, Zhiguang; Sellmyer, David J.

    2001-03-01

    We have developed a universal cluster deposition system (UCDS), which combines a new kind of sputtering-gas-aggregation (SGA) cluster beam source with two atom beams from magnetron sputtering. A highly intense, very stable beam of nanoclusters (like Co, Fe, Ni, Si, CoSm or CoPt) are produced. A quadrupole and/or a new high transmission infinite range mass selector have been designed for the cluster beam. The size distribution (Δd/d) is between 0.05+/-0.10, measured in situ by TOF. A range of mean cluster size is 2 to 10 nm. Usually the deposition rate is about 5 deg/s. The cluster concentration in the film is adjusted through the ratio of cluster and atomic beam deposition rates, as measured in situ with a rotatable quartz microbalance. The UCDS can be used to prepare coated clusters. After exiting from the cluster source, the clusters can be coated first with an atomic or molecular species in an evaporation chamber, and deposited alone or co-deposited with another material. This system is used to deposit simultaneously or alternately mesoscopic thin films or multilayers, and offers the possibility to control independently the incident cluster size and concentration, and thereby the interaction between clusters and cluster-matrix material which is of interest for fundamental research and industry applications. Magnetic properties of Co cluster-assembled materials will be discussed. * Research supported by NSF, DARPA through ARO, and CMRA

  18. EINSTEIN Cluster Alignments Revisited

    NASA Astrophysics Data System (ADS)

    Chambers, S. W.; Melott, A. L.; Miller, C. J.

    2000-12-01

    We have examined whether the major axes of rich galaxy clusters tend to point (in projection) toward their nearest neighboring cluster. We used the data of Ulmer, McMillan and Kowalski, who used x-ray morphology to define position angles. Our cluster samples, with well measured redshifts and updated positions, were taken from the MX Northern Abell Cluster Survey. The usual Kolmogorov-Smirnov test shows no significant alignment signal for nonrandom angles for all separations less than 100 Mpc/h. Refining the null hypothesis, however, with the Wilcoxon rank-sum test, reveals a high confidence signal for alignment. This confidence is highest when we restrict our sample to small nearest neighbor separations. We conclude that we have identified a more powerful tool for testing cluster-cluster alignments. Moreover, there is a strong signal in the data for alignment, consistent with a picture of hierarchical cluster formation in which matter falls into clusters along large scale filamentary structures.

  19. Matlab Cluster Ensemble Toolbox

    SciTech Connect

    Sapio, Vincent De; Kegelmeyer, Philip

    2009-04-27

    This is a Matlab toolbox for investigating the application of cluster ensembles to data classification, with the objective of improving the accuracy and/or speed of clustering. The toolbox divides the cluster ensemble problem into four areas, providing functionality for each. These include, (1) synthetic data generation, (2) clustering to generate individual data partitions and similarity matrices, (3) consensus function generation and final clustering to generate ensemble data partitioning, and (4) implementation of accuracy metrics. With regard to data generation, Gaussian data of arbitrary dimension can be generated. The kcenters algorithm can then be used to generate individual data partitions by either, (a) subsampling the data and clustering each subsample, or by (b) randomly initializing the algorithm and generating a clustering for each initialization. In either case an overall similarity matrix can be computed using a consensus function operating on the individual similarity matrices. A final clustering can be performed and performance metrics are provided for evaluation purposes.

  20. [Pathophysiology of cluster headache].

    PubMed

    Donnet, Anne

    2015-11-01

    The aetiology of cluster headache is partially unknown. Three areas are involved in the pathogenesis of cluster headache: the trigeminal nociceptive pathways, the autonomic system and the hypothalamus. The cluster headache attack involves activation of the trigeminal autonomic reflex. A dysfunction located in posterior hypothalamic gray matter is probably pivotal in the process. There is a probable association between smoke exposure, a possible genetic predisposition and the development of cluster headache. PMID:26470883

  1. Poly(3-hydroxybutyrate-co-R-3-hydroxyhexanoate) nanoparticles with polyethylenimine coat as simple, safe, and versatile vehicles for cell targeting: population characteristics, cell uptake, and intracellular trafficking.

    PubMed

    Wu, Lin-Ping; Wang, Danyang; Parhamifar, Ladan; Hall, Arnaldur; Chen, Guo-Qiang; Moghimi, Seyed M

    2014-06-01

    A simple and highly safe poly(3-hydroxybutyrate-co-R-3-hydroxyhexanoate) nanoparticulate delivery system that targets different cell types is developed. A sub-cytotoxic level of polyethylenimine coat mediates universal cell targeting. Internalized nanoparticles traffic along endolysosomal compartments, endoplasmic reticulum and the Golgi complex. Nanoparticles have no detrimental effects on cell morphology and respiration. PMID:24408356

  2. Positive Selection and Functional Divergence of R2R3-MYB Paralogous Genes Expressed in Inflorescence Buds of Scutellaria Species (Labiatae)

    PubMed Central

    Huang, Bing-Hong; Pang, Erli; Chen, Yi-Wen; Cao, Huifen; Ruan, Yu; Liao, Pei-Chun

    2015-01-01

    Anthocyanin is the main pigment forming floral diversity. Several transcription factors that regulate the expression of anthocyanin biosynthetic genes belong to the R2R3-MYB family. Here we examined the transcriptomes of inflorescence buds of Scutellaria species (skullcaps), identified the expression R2R3-MYBs, and detected the genetic signatures of positive selection for adaptive divergence across the rapidly evolving skullcaps. In the inflorescence buds, seven R2R3-MYBs were identified. MYB11 and MYB16 were detected to be positively selected. The signature of positive selection on MYB genes indicated that species diversification could be affected by transcriptional regulation, rather than at the translational level. When comparing among the background lineages of Arabidopsis, tomato, rice, and Amborella, heterogeneous evolutionary rates were detected among MYB paralogs, especially between MYB13 and MYB19. Significantly different evolutionary rates were also evidenced by type-I functional divergence between MYB13 and MYB19, and the accelerated evolutionary rates in MYB19, implied the acquisition of novel functions. Another paralogous pair, MYB2/7 and MYB11, revealed significant radical amino acid changes, indicating divergence in the regulation of different anthocyanin-biosynthetic enzymes. Our findings not only showed that Scutellaria R2R3-MYBs are functionally divergent and positively selected, but also indicated the adaptive relevance of regulatory genes in floral diversification. PMID:25782156

  3. PRMT5-mediated methylation of histone H4R3 recruits DNMT3A, coupling histone and DNA methylation in gene silencing.

    PubMed

    Zhao, Quan; Rank, Gerhard; Tan, Yuen T; Li, Haitao; Moritz, Robert L; Simpson, Richard J; Cerruti, Loretta; Curtis, David J; Patel, Dinshaw J; Allis, C David; Cunningham, John M; Jane, Stephen M

    2009-03-01

    Mammalian gene silencing is established through methylation of histones and DNA, although the order in which these modifications occur remains contentious. Using the human beta-globin locus as a model, we demonstrate that symmetric methylation of histone H4 arginine 3 (H4R3me2s) by the protein arginine methyltransferase PRMT5 is required for subsequent DNA methylation. H4R3me2s serves as a direct binding target for the DNA methyltransferase DNMT3A, which interacts through the ADD domain containing the PHD motif. Loss of the H4R3me2s mark through short hairpin RNA-mediated knockdown of PRMT5 leads to reduced DNMT3A binding, loss of DNA methylation and gene activation. In primary erythroid progenitors from adult bone marrow, H4R3me2s marks the inactive methylated globin genes coincident with localization of PRMT5. Our findings define DNMT3A as both a reader and a writer of repressive epigenetic marks, thereby directly linking histone and DNA methylation in gene silencing. PMID:19234465

  4. Project R-3; A Motivational Program Emphasizing Student Readiness, Subject Relevance, and Learning Reinforcement Through Individualized Instruction, Intensive Involvement, and Gaming/Simulation.

    ERIC Educational Resources Information Center

    San Jose Unified School District, CA.

    A course intended to upgrade essential reading and mathematics skills in students who show poor performance or negative attitudes towards school has been developed at A. Lincoln High School in San Jose, California. Called Project R-3, it seeks to motivate students by emphasizing student readiness, subject relevance, and learning reinforcement…

  5. Cotton (Gossypium spp.) R2R3-MYB transcription factors SNP identification, phylo-genomic characterization, chromosome localization and linkage mapping

    Technology Transfer Automated Retrieval System (TEKTRAN)

    R2R3-MYB transcription factors of plants are involved in the regulation of trichome length and density. Several of them are differentially expressed with initiation and expansion of cotton fibers. We report sequence phylo-genomic characterization of the six MYB genes, their chromosomal localizatio...

  6. Evaluation of Polymorphisms in the Sulfonamide Detoxification Genes CYB5A and CYB5R3 in Dogs with Sulfonamide Hypersensitivity

    PubMed Central

    Funk-Keenan, J.; Sacco, J.; (Amos) Wong, Y. Y.; Rasmussen, S.; Motsinger-Reif, A.; Trepanier, L. A.

    2015-01-01

    Background Delayed hypersensitivity (HS) reactions to potentiated sulfonamide antimicrobials occur in both dogs and humans, and involve an intermediate hydroxylamine metabolite that is detoxified by cytochrome b5 and NADH cytochrome b5 reductase. Hypothesis/Objectives We hypothesized that polymorphisms in the genes (CYB5A and CYB5R3) encoding these 2 enzymes would be associated with risk of sulfonamide HS in dogs. Animals A total of 18 dogs with delayed HS to potentiated sulfonamide antimicrobials and 16 dogs that tolerated (TOL) a therapeutic course of these drugs without adverse effect. Methods CYB5A and CYB5R3 were sequenced from canine liver, and the promoter, exons, and 3′ untranslated regions of both genes were resequenced from genomic DNA obtained from all dogs. Results Multiple polymorphisms were found in both genes. When controlled for multiple comparisons, the 729GG variant in CYB5R3 was significantly overrepresented in dogs with sulfonamide HS (78% of dogs), compared to TOL dogs (31%; P = .003). Conclusions and Clinical Importance The CYB5R3 729GG variant may contribute to the risk of sulfonamide HS in dogs. Functional characterization of this polymorphism, as well as genotyping in a larger number of HS and TOL dogs, is warranted. PMID:22816446

  7. Positive selection and functional divergence of R2R3-MYB paralogous genes expressed in inflorescence buds of Scutellaria species (Labiatae).

    PubMed

    Huang, Bing-Hong; Pang, Erli; Chen, Yi-Wen; Cao, Huifen; Ruan, Yu; Liao, Pei-Chun

    2015-01-01

    Anthocyanin is the main pigment forming floral diversity. Several transcription factors that regulate the expression of anthocyanin biosynthetic genes belong to the R2R3-MYB family. Here we examined the transcriptomes of inflorescence buds of Scutellaria species (skullcaps), identified the expression R2R3-MYBs, and detected the genetic signatures of positive selection for adaptive divergence across the rapidly evolving skullcaps. In the inflorescence buds, seven R2R3-MYBs were identified. MYB11 and MYB16 were detected to be positively selected. The signature of positive selection on MYB genes indicated that species diversification could be affected by transcriptional regulation, rather than at the translational level. When comparing among the background lineages of Arabidopsis, tomato, rice, and Amborella, heterogeneous evolutionary rates were detected among MYB paralogs, especially between MYB13 and MYB19. Significantly different evolutionary rates were also evidenced by type-I functional divergence between MYB13 and MYB19, and the accelerated evolutionary rates in MYB19, implied the acquisition of novel functions. Another paralogous pair, MYB2/7 and MYB11, revealed significant radical amino acid changes, indicating divergence in the regulation of different anthocyanin-biosynthetic enzymes. Our findings not only showed that Scutellaria R2R3-MYBs are functionally divergent and positively selected, but also indicated the adaptive relevance of regulatory genes in floral diversification. PMID:25782156

  8. Requirement of IP3 receptor 3 (IP3R3) in nitric oxide induced cardiomyocyte differentiation of mouse embryonic stem cells.

    PubMed

    Wei, Wenjie; Huang, Wei; Yue, Jianbo

    2016-08-01

    Nitric oxide (NO) markedly induces cardiomyocyte (CM) differentiation of embryonic stem (ES) cells. Here we examined the role of the Ca(2+) signaling in the NO-induced CM differentiation of mouse ES cells. We found that NO induced intracellular Ca(2+) increases in ES cells in a dose-dependent manner, and application of IP3 pathway antagonists not only significantly inhibited this induced Ca(2+) increase but also abolished NO-induced CM differentiation of ES cells. Subsequently, all 3 types of inositol 1, 4, 5-trisphosphate (IP3) receptors (IP3Rs) in mouse ES cells were individually or triply knocked down. Interestingly, only knockdown of type 3 IP3R (IP3R3) or triple-knockdown of three types of IP3Rs significantly inhibited the NO-induced Ca(2+) increases. Consistently, IP3R3 knockdown blocked the NO-induced CM differentiation of ES cells. CMs derived from IP3R3 knockdown ES cells also showed both structural and functional defects. In summary, our results indicate that the IP3R3-Ca(2+) pathway is required for NO-induced CM differentiation of ES cells. PMID:27349290

  9. Existence and asymptotic behavior of sign-changing solutions for the nonlinear Schrödinger-Poisson system in {R^3}

    NASA Astrophysics Data System (ADS)

    Shuai, Wei; Wang, Qingfang

    2015-12-01

    We are interested in the existence and asymptotic behavior of sign-changing solutions to the following nonlinear Schrödinger-Poisson system -Δ u+V(x)u+λ φ(x)u =f(u), \\quad x in {R}^3, -Δ φ=u^2, \\quad x in {R}^3, where V( x) is a smooth function and λ is a positive parameter. Because the so-called nonlocal term {λ φ_u(x)u} is involving in the equation, the variational functional of the equation has totally different properties from the case of {λ=0}. Under suitable conditions, combining constraint variational method and quantitative deformation lemma, we prove that the problem possesses one sign-changing solution {u_λ}. Moreover, we show that any sign-changing solution of the problem has an energy exceeding twice the least energy, and for any sequence {{λ_n} → 0^+(n → ∞)}, there is a subsequence {λ_{n_k}}, such that {u_{λ_{n_k}}} converges in {H^1({R}^3)} to {u_0} as {k→ ∞}, where {u_0} is a sign-changing solution of the following equation -Δ u+V(x)u=f(u),quad x in R^3.

  10. Crystal structure of methyl (2R,3S)-3-[(tert-butyl­sulfin­yl)amino]-2-fluoro-3-phenyl­propano­ate

    PubMed Central

    Zhao, Zhiwei; Fan, Wenqiang; Zhang, Yixiang; Li, Ya

    2015-01-01

    The title compound, C14H20FNO3S, contains two chiral carbon centres and the absolute configuration has been confirmed as (2R,3S). In the crystal, adjacent mol­ecules are linked by weak C—H⋯O hydrogen bonds, generating zigzag chains along the a-axis direction. PMID:26870495

  11. Protection against glucose-induced neuronal death by NAAG and GCP II inhibition is regulated by mGluR3.

    PubMed

    Berent-Spillson, Alison; Robinson, Amanda M; Golovoy, David; Slusher, Barbara; Rojas, Camilo; Russell, James W

    2004-04-01

    Glutamate carboxypeptidase II (GCP II) inhibition has previously been shown to be protective against long-term neuropathy in diabetic animals. In the current study, we have determined that the GCP II inhibitor 2-(phosphonomethyl) pentanedioic acid (2-PMPA) is protective against glucose-induced programmed cell death (PCD) and neurite degeneration in dorsal root ganglion (DRG) neurons in a cell culture model of diabetic neuropathy. In this model, inhibition of caspase activation is mediated through the group II metabotropic glutamate receptor, mGluR3. 2-PMPA neuroprotection is completely reversed by the mGluR3 antagonist (S)-alpha-ethylglutamic acid (EGLU). In contrast, group I and III mGluR inhibitors have no effect on 2-PMPA neuroprotection. Furthermore, we show that two mGluR3 agonists, the direct agonist (2R,4R)-4-aminopyrrolidine-2, 4-dicarboxylate (APDC) and N-acetyl-aspartyl-glutamate (NAAG) provide protection to neurons exposed to high glucose conditions, consistent with the concept that 2-PMPA neuroprotection is mediated by increased NAAG activity. Inhibition of GCP II or mGluR3 may represent a novel mechanism to treat neuronal degeneration under high-glucose conditions. PMID:15030392

  12. Polymorphisms in the carcinogen detoxification genes CYB5A and CYB5R3 and breast cancer risk in African American women

    PubMed Central

    Blanke, Kristina L.; Sacco, James C.; Millikan, Robert C.; Olshan, Andrew F.; Luo, Jingchun; Trepanier, Lauren A.

    2014-01-01

    Purpose Cytochrome b5 (encoded by CYB5A) and NADH cytochrome b5 reductase (encoded by CYB5R3) detoxify aromatic and heterocyclic amine mammary carcinogens found in cigarette smoke. We hypothesized that CYB5A and CYB5R3 polymorphisms would be associated with breast cancer risk in women. Methods We characterized the prevalence of 18 CYB5A and CYB5R3 variants in genomic DNA from African American (AfrAm) and Caucasian (Cauc) women from the Carolina Breast Cancer Study population (1946 cases and 1747 controls), and determined their associations with breast cancer risk, with effect modification by smoking. Results A CYB5R3 variant, I1M+6T (rs8190370) was significantly more common in breast cancer cases (MAF 0.0238) compared to controls (0.0169, P =0.039); this was attributable to a higher MAF in AfrAm cases (0.0611) compared to AfrAm controls (0.0441, P=0.046; adjusted OR 1.41, CI 0.98-2.04; P=0.062). When smoking was considered, I1M+6T was more strongly associated with breast cancer risk in AfrAm smokers (adjusted OR 2.10, 1.08-4.07; P=0.028) compared to never-smokers (OR=1.21; 0.77-1.88; P for interaction=0.176). I1M+6T and three additional CYB5R3 variants, -251T, I8-1676C, and *392C, as well as two CYB5A variants, 13G and I2-992T, were significantly more common in AfrAms compared to Caucs. Conclusions CYB5R3 I1M+6 C>T should be considered in future molecular epidemiologic studies of breast cancer risk in AfrAms. Further, variants in CYB5A and CYB5R3 should be considered in the evaluation of other tumors in AfrAms that are associated with aromatic and heterocyclic amine exposures, to include prostate, bladder, and colon cancers. PMID:25225034

  13. Decoy Receptor 3 (DcR3) as a Biomarker of Tumor Deterioration in Female Reproductive Cancers: A Meta-Analysis

    PubMed Central

    Jiang, Mengtong; Lin, Xiaomiao; He, Rongquan; Lin, Xinggu; Liang, Lu; Tang, Ruixue; Xiong, Dandan; Wei, Kanglai; Dang, Yiwu; Feng, Zhenbo; Chen, Gang

    2016-01-01

    Background DcR3 (decoy receptor 3) has been proposed be involved in development and prognosis of female reproductive cancers, including cervical cancer, ovarian cancer, and breast cancer. The purpose of this meta-analysis was to explore the evidence for the correlation between DcR3 and the clinicopathological characteristics, as well as the overall survival time, in female reproductive cancers. Material/Methods Relevant studies were searched for in PubMed, Wiley Online Library, Web of Science, Science Direct, Cochrane Central Register of Controlled Trials, Google Scholar, EMBASE, Ovid, LILACS, Chinese CNKI, Chong Qing VIP, Wan Fang, and China Biology Medicine disc up to 30 September 2015. Data on the relationship between DcR3 expression and TNM stage, differentiation, lymph node metastasis, age, and overall survival time were extracted. Pooled odds ratios (ORs) and 95% CIs (confidence intervals) were estimated by forest plot. Results Twelve studies with 1127 patients met the inclusion criteria for this meta-analysis. Overexpression of DcR3 was significantly related to the risk of female reproductive cancers (OR=10.69, 95% CI: 6.33–18.05), TNM stage (OR=5.51, 95% CI: 2.83–10.71), differentiation (OR=4.16, 95% CI: 2.28–7.60), lymph node metastasis (OR=5.89, 95% CI: 3.16–10.9), age (OR=0.85, 95% CI: 0.51–1.44), and overall survival time (OR=1.84, 95% CI: 0.58–5.83). Subgroup analyses showed that overexpression of DcR3 in cervical, ovarian, and breast cancer all had similar relationships with these clinicopathological parameters. Conclusions Our meta-analysis suggests that overexpression of DcR3 may play vital roles in the tumorigenesis and deterioration of female reproductive cancers. However, the relationship between DcR3 expression and prognosis needs further investigation. PMID:27246752

  14. CLUSTERING OF RARE EVENTS

    EPA Science Inventory

    The clustering of cases of a rare disease is considered. The number of events observed for each unit is assumed to have a Poisson distribution, the mean of which depends upon the population size and the cluster membership of that unit. Here a cluster consists of those units that ...

  15. Design and characterisation of long-R3-insulin-like growth factor-I muteins which show resistance to pepsin digestion.

    PubMed

    Bryant, K J; Read, L C; Forsberg, G; Wallace, J C

    1996-01-01

    Site-directed mutagenesis was used to construct pepsin-resistant, single-point mutations of the N-terminal extended IGF-I analogue, long-R3-IGF-I. In order to identify the most susceptible sites, the kinetics of long-R3-IGF-I digestion by purified porcine pepsin were determined. Pepsin initially cleaved the Leu10-Phe11 bond in the N-terminal extension peptide to generate FVN-R3-IGF-I, followed in rapid succession by cleavage at Gln15-Phe16, Tyr24-Phe25, Leu10-Val11 and Met59-Tyr60 in the IGF-I moiety. Single-point mutations at these sites were designed on the basis of the preferred cleavage bonds for pepsin, as well as amino acid substitutions less likely to disturb protein structure. These included Leu10Val, Phe16Ala, Phe25Leu, Asp53Glu and Met59Gln. All five muteins retained growth-promoting activity equivalent to or higher than that of IGF-I. In terms of pepsin susceptibility, Leu10Val and Asp53Glu were degraded as rapidly as the parent long-R3-IGF-I, Met59Gln and Phe25Leu were partially stabilised, and Phe16Ala showed a marked improvement in stability over a wide range of pepsin:substrate ratios. Accordingly, the Phe16Ala mutein, long-R3A16-IGF-I, has potential for oral applications to enhance gastric growth and repair. PMID:8919033

  16. Sugar-induced cephalic-phase insulin release is mediated by a T1r2+T1r3-independent taste transduction pathway in mice.

    PubMed

    Glendinning, John I; Stano, Sarah; Holter, Marlena; Azenkot, Tali; Goldman, Olivia; Margolskee, Robert F; Vasselli, Joseph R; Sclafani, Anthony

    2015-09-01

    Sensory stimulation from foods elicits cephalic phase responses, which facilitate digestion and nutrient assimilation. One such response, cephalic-phase insulin release (CPIR), enhances glucose tolerance. Little is known about the chemosensory mechanisms that activate CPIR. We studied the contribution of the sweet taste receptor (T1r2+T1r3) to sugar-induced CPIR in C57BL/6 (B6) and T1r3 knockout (KO) mice. First, we measured insulin release and glucose tolerance following oral (i.e., normal ingestion) or intragastric (IG) administration of 2.8 M glucose. Both groups of mice exhibited a CPIR following oral but not IG administration, and this CPIR improved glucose tolerance. Second, we examined the specificity of CPIR. Both mouse groups exhibited a CPIR following oral administration of 1 M glucose and 1 M sucrose but not 1 M fructose or water alone. Third, we studied behavioral attraction to the same three sugar solutions in short-term acceptability tests. B6 mice licked more avidly for the sugar solutions than for water, whereas T1r3 KO mice licked no more for the sugar solutions than for water. Finally, we examined chorda tympani (CT) nerve responses to each of the sugars. Both mouse groups exhibited CT nerve responses to the sugars, although those of B6 mice were stronger. We propose that mice possess two taste transduction pathways for sugars. One mediates behavioral attraction to sugars and requires an intact T1r2+T1r3. The other mediates CPIR but does not require an intact T1r2+T1r3. If the latter taste transduction pathway exists in humans, it should provide opportunities for the development of new treatments for controlling blood sugar. PMID:26157055

  17. Sensing of amino acids by the gut-expressed taste receptor T1R1-T1R3 stimulates CCK secretion.

    PubMed

    Daly, Kristian; Al-Rammahi, Miran; Moran, Andrew; Marcello, Marco; Ninomiya, Yuzo; Shirazi-Beechey, Soraya P

    2013-02-01

    CCK is secreted by endocrine cells of the proximal intestine in response to dietary components, including amino acids. CCK plays a variety of roles in digestive processes, including inhibition of food intake, consistent with a role in satiety. In the lingual epithelium, the sensing of a broad spectrum of L-amino acids is accomplished by the heteromeric amino acid (umami) taste receptor (T1R1-T1R3). T1R1 and T1R3 subunits are also expressed in the intestine. A defining characteristic of umami sensing by T1R1-T1R3 is its potentiation by IMP or GMP. Furthermore, T1R1-T1R3 is not activated by Trp. We show here that, in response to L-amino acids (Phe, Leu, Glu, and Trp), but not D-amino acids, STC-1 enteroendocrine cells and mouse proximal small intestinal tissue explants secrete CCK and that IMP enhances Phe-, Leu-, and Glu-induced, but not Trp-induced, CCK secretion. Furthermore, small interfering RNA inhibition of T1R1 expression in STC-1 cells results in significant diminution of Phe-, Leu-, and Glu-stimulated, but not Trp-stimulated, CCK release. In STC-1 cells and mouse intestine, gurmarin inhibits Phe-, Leu-, and Glu-induced, but not Trp-stimulated, CCK secretion. In contrast, the Ca(2+)-sensing receptor antagonist NPS2143 inhibits Phe-stimulated CCK release partially and Trp-induced CCK secretion totally in mouse intestine. However, NPS2143 has no effect on Leu- or Glu-induced CCK secretion. Collectively, our data demonstrate that functional characteristics and cellular location of the gut-expressed T1R1-T1R3 support its role as a luminal sensor for Phe-, Leu-, and Glu-induced CCK secretion. PMID:23203156

  18. Activation of the umami taste receptor (T1R1/T1R3) initiates the peristaltic reflex and pellet propulsion in the distal colon

    PubMed Central

    Kendig, Derek M.; Hurst, Norman R.; Bradley, Zachary L.; Mahavadi, Sunila; Kuemmerle, John F.; Lyall, Vijay; DeSimone, John; Murthy, Karnam S.

    2014-01-01

    Intraluminal nutrients in the gut affect the peristaltic reflex, although the mechanism is not well defined. Recent evidence supports the presence of taste receptors and their signaling components in enteroendocrine cells, although their function is unclear. This study aimed to determine if nutrients modify colonic motility through activation of taste receptors. Colonic sections were immunostained for the umami taste receptor T1R1/T1R3, which mediates the response to umami ligands, such as monosodium glutamate (MSG), in taste cells. Ascending contraction, descending relaxation, and calcitonin gene-related peptide release were measured in three-chamber flat-sheet preparations of rat colon in response to MSG alone or with inosine 5′-monophosphate (IMP). Velocity of artificial fecal pellet propulsion was measured by video recording in guinea pig distal colon. T1R1/T1R3 receptors were present in enteroendocrine cells of colonic sections from human, rat, mouse, and guinea pig. MSG initiated ascending contraction and descending relaxation components of the peristaltic reflex and calcitonin gene-related peptide release in flat-sheet preparations. IMP augmented the MSG-induced effects, suggesting activation of T1R1/T1R3 receptors. In T1R1−/− mice, mucosal stroking, but not MSG, elicited a peristaltic reflex. Intraluminal perfusion of MSG enhanced the velocity of artificial fecal pellet propulsion, which was also augmented by IMP. Propulsion was also increased by l-cysteine, but not l-tryptophan, supporting a role of T1R1/T1R3 receptors. We conclude that T1R1/T1R3 activation by luminal MSG or l-cysteine elicits a peristaltic reflex and CGRP release and increases the velocity of pellet propulsion in distal colon. This mechanism may explain how nutrients regulate colonic propulsion. PMID:25324508

  19. Sugar-induced cephalic-phase insulin release is mediated by a T1r2+T1r3-independent taste transduction pathway in mice

    PubMed Central

    Stano, Sarah; Holter, Marlena; Azenkot, Tali; Goldman, Olivia; Margolskee, Robert F.; Vasselli, Joseph R.; Sclafani, Anthony

    2015-01-01

    Sensory stimulation from foods elicits cephalic phase responses, which facilitate digestion and nutrient assimilation. One such response, cephalic-phase insulin release (CPIR), enhances glucose tolerance. Little is known about the chemosensory mechanisms that activate CPIR. We studied the contribution of the sweet taste receptor (T1r2+T1r3) to sugar-induced CPIR in C57BL/6 (B6) and T1r3 knockout (KO) mice. First, we measured insulin release and glucose tolerance following oral (i.e., normal ingestion) or intragastric (IG) administration of 2.8 M glucose. Both groups of mice exhibited a CPIR following oral but not IG administration, and this CPIR improved glucose tolerance. Second, we examined the specificity of CPIR. Both mouse groups exhibited a CPIR following oral administration of 1 M glucose and 1 M sucrose but not 1 M fructose or water alone. Third, we studied behavioral attraction to the same three sugar solutions in short-term acceptability tests. B6 mice licked more avidly for the sugar solutions than for water, whereas T1r3 KO mice licked no more for the sugar solutions than for water. Finally, we examined chorda tympani (CT) nerve responses to each of the sugars. Both mouse groups exhibited CT nerve responses to the sugars, although those of B6 mice were stronger. We propose that mice possess two taste transduction pathways for sugars. One mediates behavioral attraction to sugars and requires an intact T1r2+T1r3. The other mediates CPIR but does not require an intact T1r2+T1r3. If the latter taste transduction pathway exists in humans, it should provide opportunities for the development of new treatments for controlling blood sugar. PMID:26157055

  20. TCP3 interacts with R2R3-MYB proteins, promotes flavonoid biosynthesis and negatively regulates the auxin response in Arabidopsis thaliana.

    PubMed

    Li, Shutian; Zachgo, Sabine

    2013-12-01

    TCP proteins belong to the plant-specific bHLH transcription factor family, and function as key regulators of diverse developmental processes. Functional redundancy amongst family members and post-transcriptional down-regulation by miRJAW of several TCP genes complicate their functional characterization. Here, we explore the role of TCP3 by analyzing transgenic plants expressing miRJAW-resistant mTCP3 and dominant-negative TCP3SRDX. Seedlings and seeds of mTCP3 plants were found to hyper-accumulate flavonols, anthocyanins and proanthocyanidins, whereas levels of proanthocyanidins were slightly reduced in TCP3SRDX plants. R2R3-MYB proteins control not only early flavonoid biosynthetic steps but also activate late flavonoid biosynthetic genes by forming ternary R2R3-MYB/bHLH/WD40 (MBW) complexes. TCP3 interacted in yeast with R2R3-MYB proteins, which was further confirmed in planta using BiFC experiments. Yeast three-hybrid assays revealed that TCP3 significantly strengthened the transcriptional activation capacity of R2R3-MYBs bound by the bHLH protein TT8. Transcriptome analysis of mTCP3 and TCP3SRDX plants supported a role for TCP3 in enhancing flavonoid biosynthesis. Moreover, several auxin-related developmental abnormalities were observed in mTCP3 plants. Transcriptome data coupled with studies of an auxin response reporter and auxin efflux carriers showed that TCP3 negatively modulates the auxin response, probably by compromising auxin transport capacity. Genetic experiments revealed that the chalcone synthase mutant tt4-11 lacking flavonoid biosynthesis abrogated the auxin-related defects caused by mTCP3. Together, these data suggest that TCP3 interactions with R2R3-MYBs lead to enhanced flavonoid production, which further negatively modulates the auxin response. PMID:24118612

  1. Analysis of the DNA-Binding Activities of the Arabidopsis R2R3-MYB Transcription Factor Family by One-Hybrid Experiments in Yeast

    PubMed Central

    Kelemen, Zsolt; Sebastian, Alvaro; Xu, Wenjia; Grain, Damaris; Salsac, Fabien; Avon, Alexandra; Berger, Nathalie; Tran, Joseph; Dubreucq, Bertrand; Lurin, Claire; Lepiniec, Loïc; Contreras-Moreira, Bruno; Dubos, Christian

    2015-01-01

    The control of growth and development of all living organisms is a complex and dynamic process that requires the harmonious expression of numerous genes. Gene expression is mainly controlled by the activity of sequence-specific DNA binding proteins called transcription factors (TFs). Amongst the various classes of eukaryotic TFs, the MYB superfamily is one of the largest and most diverse, and it has considerably expanded in the plant kingdom. R2R3-MYBs have been extensively studied over the last 15 years. However, DNA-binding specificity has been characterized for only a small subset of these proteins. Therefore, one of the remaining challenges is the exhaustive characterization of the DNA-binding specificity of all R2R3-MYB proteins. In this study, we have developed a library of Arabidopsis thaliana R2R3-MYB open reading frames, whose DNA-binding activities were assayed in vivo (yeast one-hybrid experiments) with a pool of selected cis-regulatory elements. Altogether 1904 interactions were assayed leading to the discovery of specific patterns of interactions between the various R2R3-MYB subgroups and their DNA target sequences and to the identification of key features that govern these interactions. The present work provides a comprehensive in vivo analysis of R2R3-MYB binding activities that should help in predicting new DNA motifs and identifying new putative target genes for each member of this very large family of TFs. In a broader perspective, the generated data will help to better understand how TF interact with their target DNA sequences. PMID:26484765

  2. Activation of the umami taste receptor (T1R1/T1R3) initiates the peristaltic reflex and pellet propulsion in the distal colon.

    PubMed

    Kendig, Derek M; Hurst, Norman R; Bradley, Zachary L; Mahavadi, Sunila; Kuemmerle, John F; Lyall, Vijay; DeSimone, John; Murthy, Karnam S; Grider, John R

    2014-12-01

    Intraluminal nutrients in the gut affect the peristaltic reflex, although the mechanism is not well defined. Recent evidence supports the presence of taste receptors and their signaling components in enteroendocrine cells, although their function is unclear. This study aimed to determine if nutrients modify colonic motility through activation of taste receptors. Colonic sections were immunostained for the umami taste receptor T1R1/T1R3, which mediates the response to umami ligands, such as monosodium glutamate (MSG), in taste cells. Ascending contraction, descending relaxation, and calcitonin gene-related peptide release were measured in three-chamber flat-sheet preparations of rat colon in response to MSG alone or with inosine 5'-monophosphate (IMP). Velocity of artificial fecal pellet propulsion was measured by video recording in guinea pig distal colon. T1R1/T1R3 receptors were present in enteroendocrine cells of colonic sections from human, rat, mouse, and guinea pig. MSG initiated ascending contraction and descending relaxation components of the peristaltic reflex and calcitonin gene-related peptide release in flat-sheet preparations. IMP augmented the MSG-induced effects, suggesting activation of T1R1/T1R3 receptors. In T1R1(-/-) mice, mucosal stroking, but not MSG, elicited a peristaltic reflex. Intraluminal perfusion of MSG enhanced the velocity of artificial fecal pellet propulsion, which was also augmented by IMP. Propulsion was also increased by l-cysteine, but not l-tryptophan, supporting a role of T1R1/T1R3 receptors. We conclude that T1R1/T1R3 activation by luminal MSG or l-cysteine elicits a peristaltic reflex and CGRP release and increases the velocity of pellet propulsion in distal colon. This mechanism may explain how nutrients regulate colonic propulsion. PMID:25324508

  3. mGluR3 promotes proliferation of human embryonic cortical neural progenitor cells by activating ERK1/2 and JNK2 signaling pathway in vitro.

    PubMed

    Guo, J; Zhou, X; Chen, Y; Bai, M; Yang, X; Zhao, K; Hao, W; Wei, W; Zhang, Y

    2014-01-01

    Metabotropic glutamate receptors (mGluRs) regulate the proliferation and differentiation of neural progenitor cells (NPCs) in brain; however, the mechanisms remain unknown. In this study, we investigated the effect of mGluR3 on the proliferation of human embryonic neural progenitor cells (NPCs), the expression of cyclin D1 and the activation of signaling pathways of mitogen-activated protein kinases (MAPKs). The results showed that mGluR3 agonist N-Acetylaspartylglutamate (NAAG) increased the proliferation of NPCs by increasing cell activity, diameter of neurospheres and cell division. In addition, mGluR3 siRNA decreased the NPC proliferation. The protein expressions of cyclin D1 increased with NAAG treatment and decreased after siRNA treatment. It was also found that activation of extracellular signal-regulated protein kinase (ERK) and c-Jun N-terminal protein kinase (JNK) signaling pathways were involved in the proliferation of NPCs. NAAG increased phosphorylation of ERK1/2 and JNK2 levels, and meanwhile p-p38 level decreased; but p-ERK1/2 and p-JNK2 levels decreased after siRNA treatment, and p-p38 level increased. ERK1/2 inhibitor U0126 and JNK2 inhibitor SP600125 attenuated the increase of proliferation induced by NAAG. These findings demonstrated that mGluR3 promoted the proliferation of human embryonic cortical NPCs and increased cyclin D1 expression by activating ERK1/2 and JNK2 signaling pathways in vitro, suggesting that mGluR3 may be a target molecule for regulating NPC proliferation in brain development. PMID:25198581

  4. A new clustering strategy

    NASA Astrophysics Data System (ADS)

    Feng, Jian-xin; Tang, Jia-fu; Wang, Guang-xing

    2007-04-01

    On the basis of the analysis of clustering algorithm that had been proposed for MANET, a novel clustering strategy was proposed in this paper. With the trust defined by statistical hypothesis in probability theory and the cluster head selected by node trust and node mobility, this strategy can realize the function of the malicious nodes detection which was neglected by other clustering algorithms and overcome the deficiency of being incapable of implementing the relative mobility metric of corresponding nodes in the MOBIC algorithm caused by the fact that the receiving power of two consecutive HELLO packet cannot be measured. It's an effective solution to cluster MANET securely.

  5. Unconventional methods for clustering

    NASA Astrophysics Data System (ADS)

    Kotyrba, Martin

    2016-06-01

    Cluster analysis or clustering is a task of grouping a set of objects in such a way that objects in the same group (called a cluster) are more similar (in some sense or another) to each other than to those in other groups (clusters). It is the main task of exploratory data mining and a common technique for statistical data analysis used in many fields, including machine learning, pattern recognition, image analysis, information retrieval, and bioinformatics. The topic of this paper is one of the modern methods of clustering namely SOM (Self Organising Map). The paper describes the theory needed to understand the principle of clustering and descriptions of algorithm used with clustering in our experiments.

  6. Modeling Clustered Data with Very Few Clusters.

    PubMed

    McNeish, Daniel; Stapleton, Laura M

    2016-01-01

    Small-sample inference with clustered data has received increased attention recently in the methodological literature, with several simulation studies being presented on the small-sample behavior of many methods. However, nearly all previous studies focus on a single class of methods (e.g., only multilevel models, only corrections to sandwich estimators), and the differential performance of various methods that can be implemented to accommodate clustered data with very few clusters is largely unknown, potentially due to the rigid disciplinary preferences. Furthermore, a majority of these studies focus on scenarios with 15 or more clusters and feature unrealistically simple data-generation models with very few predictors. This article, motivated by an applied educational psychology cluster randomized trial, presents a simulation study that simultaneously addresses the extreme small sample and differential performance (estimation bias, Type I error rates, and relative power) of 12 methods to account for clustered data with a model that features a more realistic number of predictors. The motivating data are then modeled with each method, and results are compared. Results show that generalized estimating equations perform poorly; the choice of Bayesian prior distributions affects performance; and fixed effect models perform quite well. Limitations and implications for applications are also discussed. PMID:27269278

  7. [Clustering of simple obesity].

    PubMed

    Yoshida, K; Matsuda, H; Kurita, M; Umetada, Y

    1988-05-01

    An attempt was made to classify persons with simple obesity from the viewpoint of health education. Subjects of the study were 1,278 male workers in a financing company who underwent health examination. At the time of health examinations, questionnaire survey concerning their life styles was carried out on all the subjects. The obese group consisted of 127 subjects whose obesity indices were over 15% and the control group consisted of 342 subjects whose obesity indices ranged from -5 to 5%. Subjects in the obese group were classified into four clusters based on cluster analysis using five life-style parameters; that is, frequency of taking breakfast, frequency of taking staple food, drinking habits, smoking habits, and frequency of exercise. The first cluster (N = 10) included inactive persons, the second cluster (N = 46) non smokers, the third cluster (N = 39) smokers and heavy drinkers, and the fourth cluster (N = 32) smokers and non-drinkers. Comparison of the four clusters of obese persons with the control group revealed the following findings: 1) All the four clusters had significantly high frequencies of abnormal values of triglyceride (TG) and fasting blood sugar (FBS). 2) The first cluster had significantly high frequencies of abnormal values of glutamic oxalacetic transaminase (GOT) and glutamic pyruvic transaminase (GPT). 3) The second cluster had significantly high frequencies of abnormal values of systolic and diastolic blood pressure, total cholesterol, TG, FBS, uric acid, GOT, GPT and gamma glutamyl transferase (GGT).(ABSTRACT TRUNCATED AT 250 WORDS) PMID:3172544

  8. BaCO3: High-Temperature crystal Structures and the Pmcn → R3m Phase Transition at 811 Celius

    SciTech Connect

    Antao,S.; Hassan, I.

    2007-01-01

    The temperature (T) evolution of the barium carbonate (BaCO3) structure was studied using Rietveld structure refinements based on synchrotron X-ray diffraction and a powdered synthetic sample. BaCO3 transforms from an orthorhombic, Pmcn, a phase to a trigonal, R3m, {beta} phase at 811 C. The orthorhombic BaCO3 structure is isotypic with aragonite, CaCO3. In trigonal R3m BaCO3, the CO3 group occupies one orientation and shows no rotational disorder. The average distances increase while the distances decrease linearly with T in the orthorhombic phase. After the 811 C phase transition, the distances increase while C-O distances decrease. There is also a significant volume change of 2.8% at the phase transition.

  9. [Population frequency and age of c.806C > T mutation in CYB5R3 gene as cause of recessive congenital methemoglobinemia in Yakutia].

    PubMed

    Galeeva, N M; Voevoda, M I; Spiridonova, M G; Stepanov, V A; Poliakov, A V

    2013-04-01

    Type-1recessive congenital methemoglobinemia (RCM) is a rare autosomal disease characterized by a deficiency of the soluble form of nicotineamide adenine dinucleotide (NADH)-cytochrome b5 reductase (b5R) and clinically manifests as cyanosis of skin and mucous membranes. In the Russian Federation, type-I RCM is widely disturbed in Yakutia due to the local founder effect. The molecular genetics cause of type-I RCM in Yakutia is mutation c.806C > T in the CYB5R3 gene. In this work we used 13 polymorphic markers, which flanking the CYB5R3 gene to establish the founder haplotype. The age of the mutation was estimated as about 285 +/- 135 years. In this work, we have evaluated the frequency of the c.806 C > T mutation in Yakutia, which averaged 55 : 1000 Yakuts. The calculated frequency of disease was 1: 1250 Yakuts. PMID:23866629

  10. Effect of recombinant porcine IGFBP-3 on IGF-I and long-R3-IGF-I-stimulated proliferation and differentiation of L6 myogenic cells.

    PubMed

    Xi, G; Kamanga-Sollo, E; Pampusch, M S; White, M E; Hathaway, M R; Dayton, William R

    2004-09-01

    Insulin-like growth factor (IGF)-I stimulates both proliferation and differentiation of myogenic precursor cells. In vivo, IGFs are bound to one of the members of a family of six high-affinity IGF binding proteins (IGFBP 1-6) that regulate their biological activity. One of these binding proteins, IGFBP-3, affects cell proliferation via both IGF-dependent and IGF-independent mechanisms and it has generally been shown to suppress proliferation of cultured cells; however, it also may stimulate proliferation depending upon the cell type and the assay conditions. Cultured porcine embryonic myogenic cells (PEMCs) produce IGFBP-3 and its level drops significantly immediately prior to differentiation. Additionally, IGFBP-3 suppresses both IGF-I and Long-R3-IGF-I-stimulated proliferation of embryonic porcine myogenic cells. In this study, we have examined the effects of recombinant porcine IGFBP-3 (rpIGFBP-3) on IGF-I- and Long-R3-IGF-I-stimulated proliferation and differentiation of the L6 myogenic cell line. L6 cells potentially provide a good model for studying the actions of IGFBP-3 on muscle because they contain no non-muscle cells and they do not produce detectable levels of IGFBP-3. RpIGFBP-3 suppresses both IGF-I and Long-R3-IGF-I-stimulated proliferation of L6 cells, indicating that it suppresses proliferation via both IGF-dependent and IGF-independent mechanisms. Our data also show that rpIGFBP-3 causes IGF-independent suppression of proliferation without increasing the level of phosphosmad-2 in L6 cultures. Additionally, rpIGFBP-3 suppresses IGF-I-stimulated differentiation of L6 cells. In contrast, however, rpIGFBP-3 does not suppress Long-R3-IGF-I-stimulated differentiation. This suggests that rpIGFBP-3 does not have IGF-independent effects on L6 cell differentiation. PMID:15254966

  11. Evaluation of polymorphisms in the sulfonamide detoxification genes NAT2, CYB5A, and CYB5R3 in patients with sulfonamide hypersensitivity

    PubMed Central

    Sacco, James; Abouraya, Mahmoud; Motsinger-Reif, Alison; Yale, Steven; McCarty, Catherine; Trepanier, Lauren

    2013-01-01

    Objective To determine whether polymorphisms in the sulfonamide detoxification genes, CYB5A (encoding cytochrome b5), CYB5R3 (encoding cytochrome b5 reductase), or NAT2 (encoding N-acetyltransferase 2) were over-represented in patients with delayed sulfonamide drug hypersensitivity, compared to control patients that tolerated a therapeutic course of trimethoprim-sulfamethoxazole without adverse event. Methods DNA from 99 non-immunocompromised patients with sulfonamide hypersensitivity that were identified from the Personalized Medicine Research Project at the Marshfield Clinic, and from 99 age-, race-, and gender-matched drug-tolerant controls, were genotyped for four CYB5A and five CYB5R3 polymorphisms, and for all coding NAT2 SNPs. Results CYB5A and CYB5R3 SNPs were found at low allele frequencies (less than 3–4%), which did not differ between hypersensitive and tolerant patients. NAT2 allele and haplotype frequencies, as well as inferred NAT2 phenotypes, also did not differ between groups (60% vs. 59% slow acetylators). Finally, no difference in NAT2 status was found in a subset of patients with more severe hypersensitivity signs (drug reaction with eosinophilia and systemic symptoms; DRESS) compared to tolerant patients. Conclusions We found no evidence for a substantial involvement of these 9 CYB5A or CYB5R3 polymorphisms in sulfonamide HS risk, although minor effects cannot be completely ruled out. Despite careful medical record review and full re-sequencing of the NAT2 coding region, we found no association of NAT2 coding alleles with sulfonamide hypersensitivity (predominantly cutaneous eruptions) in this adult Caucasian population. PMID:22850190

  12. R3P-Loc: a compact multi-label predictor using ridge regression and random projection for protein subcellular localization.

    PubMed

    Wan, Shibiao; Mak, Man-Wai; Kung, Sun-Yuan

    2014-11-01

    Locating proteins within cellular contexts is of paramount significance in elucidating their biological functions. Computational methods based on knowledge databases (such as gene ontology annotation (GOA) database) are known to be more efficient than sequence-based methods. However, the predominant scenarios of knowledge-based methods are that (1) knowledge databases typically have enormous size and are growing exponentially, (2) knowledge databases contain redundant information, and (3) the number of extracted features from knowledge databases is much larger than the number of data samples with ground-truth labels. These properties render the extracted features liable to redundant or irrelevant information, causing the prediction systems suffer from overfitting. To address these problems, this paper proposes an efficient multi-label predictor, namely R3P-Loc, which uses two compact databases for feature extraction and applies random projection (RP) to reduce the feature dimensions of an ensemble ridge regression (RR) classifier. Two new compact databases are created from Swiss-Prot and GOA databases. These databases possess almost the same amount of information as their full-size counterparts but with much smaller size. Experimental results on two recent datasets (eukaryote and plant) suggest that R3P-Loc can reduce the dimensions by seven-folds and significantly outperforms state-of-the-art predictors. This paper also demonstrates that the compact databases reduce the memory consumption by 39 times without causing degradation in prediction accuracy. For readers׳ convenience, the R3P-Loc server is available online at url:http://bioinfo.eie.polyu.edu.hk/R3PLocServer/. PMID:24997236

  13. T1R2 and T1R3 subunits are individually unnecessary for normal affective licking responses to Polycose: implications for saccharide taste receptors in mice.

    PubMed

    Treesukosol, Yada; Blonde, Ginger D; Spector, Alan C

    2009-04-01

    The T1R2 and T1R3 proteins are expressed in taste receptor cells and form a heterodimer binding with compounds described as sweet by humans. We examined whether Polycose taste might be mediated through this heterodimer by testing T1R2 knockout (KO) and T1R3 KO mice and their wild-type (WT) littermate controls in a series of brief-access taste tests (25-min sessions with 5-s trials). Sucrose, Na-saccharin, and Polycose were each tested for three consecutive sessions with order of presentation varied among subgroups in a Latin-Square manner. Both KO groups displayed blunted licking responses and initiated significantly fewer trials of sucrose and Na-saccharin across a range of concentrations. KO mice tested after Polycose exposure demonstrated some degree of concentration-dependent licking of sucrose, likely attributable to learning related to prior postingestive experience. These results are consistent with prior findings in the literature, implicating the T1R2+3 heterodimer as the principal taste receptor for sweet-tasting ligands, and also provide support for the potential of postingestive experience to influence responding in the KO mice. In contrast, T1R2 KO and T1R3 KO mice displayed concentration-dependent licking responses to Polycose that tracked those of their WT controls and in some cases licked midrange concentrations more; the number of Polycose trials initiated overall did not differ between KO and WT mice. Thus, the T1R2 and T1R3 proteins are individually unnecessary for normal concentration-dependent licking of Polycose to be expressed in a brief-access test. Whether at least one of these T1R protein subunits is necessary for normal Polycose responsiveness remains untested. Alternatively, there may be a novel taste receptor(s) that mediates polysaccharide taste. PMID:19158407

  14. Electron: Cluster interactions

    SciTech Connect

    Scheidemann, A.A.; Kresin, V.V.; Knight, W.D.

    1994-02-01

    Beam depletion spectroscopy has been used to measure absolute total inelastic electron-sodium cluster collision cross sections in the energy range from E {approximately} 0.1 to E {approximately} 6 eV. The investigation focused on the closed shell clusters Na{sub 8}, Na{sub 20}, Na{sub 40}. The measured cross sections show an increase for the lowest collision energies where electron attachment is the primary scattering channel. The electron attachment cross section can be understood in terms of Langevin scattering, connecting this measurement with the polarizability of the cluster. For energies above the dissociation energy the measured electron-cluster cross section is energy independent, thus defining an electron-cluster interaction range. This interaction range increases with the cluster size.

  15. Information-based clustering

    PubMed Central

    Slonim, Noam; Atwal, Gurinder Singh; Tkačik, Gašper; Bialek, William

    2005-01-01

    In an age of increasingly large data sets, investigators in many different disciplines have turned to clustering as a tool for data analysis and exploration. Existing clustering methods, however, typically depend on several nontrivial assumptions about the structure of data. Here, we reformulate the clustering problem from an information theoretic perspective that avoids many of these assumptions. In particular, our formulation obviates the need for defining a cluster “prototype,” does not require an a priori similarity metric, is invariant to changes in the representation of the data, and naturally captures nonlinear relations. We apply this approach to different domains and find that it consistently produces clusters that are more coherent than those extracted by existing algorithms. Finally, our approach provides a way of clustering based on collective notions of similarity rather than the traditional pairwise measures. PMID:16352721

  16. Function search in a large transcription factor gene family in Arabidopsis: assessing the potential of reverse genetics to identify insertional mutations in R2R3 MYB genes.

    PubMed Central

    Meissner, R C; Jin, H; Cominelli, E; Denekamp, M; Fuertes, A; Greco, R; Kranz, H D; Penfield, S; Petroni, K; Urzainqui, A; Martin, C; Paz-Ares, J; Smeekens, S; Tonelli, C; Weisshaar, B; Baumann, E; Klimyuk, V; Marillonnet, S; Patel, K; Speulman, E; Tissier, A F; Bouchez, D; Jones, J J; Pereira, A; Wisman, E

    1999-01-01

    More than 92 genes encoding MYB transcription factors of the R2R3 class have been described in Arabidopsis. The functions of a few members of this large gene family have been described, indicating important roles for R2R3 MYB transcription factors in the regulation of secondary metabolism, cell shape, and disease resistance, and in responses to growth regulators and stresses. For the majority of the genes in this family, however, little functional information is available. As the first step to characterizing these genes functionally, the sequences of >90 family members, and the map positions and expression profiles of >60 members, have been determined previously. An important second step in the functional analysis of the MYB family, through a process of reverse genetics that entails the isolation of insertion mutants, is described here. For this purpose, a variety of gene disruption resources has been used, including T-DNA-insertion populations and three distinct populations that harbor transposon insertions. We report the isolation of 47 insertions into 36 distinct MYB genes by screening a total of 73 genes. These defined insertion lines will provide the foundation for subsequent detailed functional analyses for the assignment of specific functions to individual members of the R2R3 MYB gene family. PMID:10521515

  17. Reversal of multidrug resistance in breast cancer MCF-7/ADR cells by h-R3-siMDR1-PAMAM complexes.

    PubMed

    Li, Jun; Liu, Jing; Guo, Nana; Zhang, Xiaoning

    2016-09-10

    Multidrug resistance (MDR) among breast cancer cells is the paramount obstacle for the successful chemotherapy. In this study, anti-EGFR antibody h-R3 was designed to self-assembled h-R3-siRNA-PAMAM-complexes (HSPCs) via electrostatic interactions for siRNA delivery. The physicochemical characterization, cell uptake, MDR1 silencing efficiency, cell migration, cell growth and cell apoptosis were investigated. The HSPCs presented lower cytotoxicity, higher cellular uptake and enhanced endosomal escape ability. Also, HSPCs encapsulating siMDR1 knockdowned 99.4% MDR1 gene with up to ∼6 times of enhancement compared to naked siMDR1, increased the doxorubicin accumulation, down-regulated P-glycoprotein (P-gp) expression and suppressed cellular migration in breast cancer MCF-7/ADR cells. Moreover, the combination of anticancer drug paclitaxel (PTX) and siMDR1 loaded HSPCs showed synergistic effect on overcoming MDR, which inhibited cell growth and induced cell apoptosis. This h-R3-mediated siMDR1 delivery system could be a promising vector for effective siRNA therapy of drug resistant breast cancer. PMID:27444552

  18. Members of an R2R3-MYB transcription factor family in Petunia are developmentally and environmentally regulated to control complex floral and vegetative pigmentation patterning.

    PubMed

    Albert, Nick W; Lewis, David H; Zhang, Huaibi; Schwinn, Kathy E; Jameson, Paula E; Davies, Kevin M

    2011-03-01

    We present an investigation of anthocyanin regulation over the entire petunia plant, determining the mechanisms governing complex floral pigmentation patterning and environmentally induced vegetative anthocyanin synthesis. DEEP PURPLE (DPL) and PURPLE HAZE (PHZ) encode members of the R2R3-MYB transcription factor family that regulate anthocyanin synthesis in petunia, and control anthocyanin production in vegetative tissues and contribute to floral pigmentation. In addition to these two MYB factors, the basic helix-loop-helix (bHLH) factor ANTHOCYANIN1 (AN1) and WD-repeat protein AN11, are also essential for vegetative pigmentation. The induction of anthocyanins in vegetative tissues by high light was tightly correlated to the induction of transcripts for PHZ and AN1. Interestingly, transcripts for PhMYB27, a putative R2R3-MYB active repressor, were highly expressed during non-inductive shade conditions and repressed during high light. The competitive inhibitor PhMYBx (R3-MYB) was expressed under high light, which may provide feedback repression. In floral tissues DPL regulates vein-associated anthocyanin pigmentation in the flower tube, while PHZ determines light-induced anthocyanin accumulation on exposed petal surfaces (bud-blush). A model is presented suggesting how complex floral and vegetative pigmentation patterns are derived in petunia in terms of MYB, bHLH and WDR co-regulators. PMID:21235651

  19. Stereoselective chemo-enzymatic oxidation routes for (1R,3E,7E,11S,12S)-3,7,18-dolabellatriene

    PubMed Central

    Görner, Christian; Hirte, Max; Huber, Stephanie; Schrepfer, Patrick; Brück, Thomas

    2015-01-01

    The diterpene (1R,3E,7E,11S,12S)-3,7,18-dolabellatriene from the marine brown alga Dilophus spiralis belongs to the dolabellanes natural product family and has antimicrobial activity against multi-drug resistant Staphylococcus aureus. Recently, we generated a CotB2 diterpene synthase mutant (W288G), which instead of its native product cyclooctat-9-en-7-ol, generates (1R,3E,7E,11S,12S)-3,7,18-dolabellatriene. In vivo CotB2 W288G reconstitution in an Escherichia coli based terpene production system, allowed efficient production of this olefinic macrocycle. To diversify the 3,7,18-dolabellatriene bioactivity we evaluated chemical and enzymatic methods for selective oxidation. Epoxidation by acetic peracid, which was formed in situ by a lipase catalyzed reaction of acetic acid with H2O2, provided efficient access to two monooxidized dolabellanes and to a novel di-epoxidated dolabellane species. These compounds could act as synthons en-route to new dolabellanes with diversified bioactivities. Furthermore, we demonstrate the almost quantitative 3,7,18-dolabellatriene conversion into the new, non-natural compound (1R,3E,7E,11S,12S,18R)-dolabella-3,7-diene-20-ol by hydroboration–oxidation with an enantiomeric excess of 94%, for the first time. PMID:26528263

  20. Metabolism of myo-[2-3H]Inositol and scyllo-[R-3H]Inositol in Ripening Wheat Kernels 1

    PubMed Central

    Sasaki, Ken; Loewus, Frank A.

    1980-01-01

    Injection of myo-[2-3H]inositol or scyllo-[R-3H]inositol into the peduncular cavity of wheat stalks about 2 to 4 weeks postanthesis led to rapid translocation into the spike and accumulation of label in developing kernels, especially the bran fraction. With myo-[2-3H]inositol, about 50 to 60% of the label was incorporated into high molecular weight cell wall substance in the region of the injection. That portion translocated to the kernels was utilized primarily for cell wall polysaccharide formation and phytate biosynthesis. A small amount was recovered as free myo-inositol and galactinol. When scyllo-[R-3H]inositol was supplied, most of the label was translocated into the developing kernels where it accumulated as free scyllo-inositol and O-α-d-galactopyranosyl-scyllo-inositol in approximately equal amount. None of the label from scyllo-[R-3H]inositol was utilized for either phytate biosynthesis or cell wall polysaccharide formation. PMID:16661513

  1. Mini-clusters

    NASA Technical Reports Server (NTRS)

    Chinellato, J. A.; Dobrigkeit, C.; Bellandifilho, J.; Lattes, C. M. G.; Menon, M. J.; Navia, C. E.; Pamilaju, A.; Sawayanagi, K.; Shibuya, E. H.; Turtelli, A., Jr.

    1985-01-01

    Experimental results of mini-clusters observed in Chacaltaya emulsion chamber no.19 are summarized. The study was made on 54 single core shower upper and 91 shower clusters of E(gamma) 10 TeV from 30 families which are visible energy greater than 80 TeV and penetrate through both upper and lower detectors of the two-story chamber. The association of hadrons in mini-cluster is made clear from their penetrative nature and microscopic observation of shower continuation in lower chamber. Small P sub t (gamma) of hadrons in mini-clusters remained in puzzle.

  2. Management of cluster headache.

    PubMed

    Tfelt-Hansen, Peer C; Jensen, Rigmor H

    2012-07-01

    The prevalence of cluster headache is 0.1% and cluster headache is often not diagnosed or misdiagnosed as migraine or sinusitis. In cluster headache there is often a considerable diagnostic delay - an average of 7 years in a population-based survey. Cluster headache is characterized by very severe or severe orbital or periorbital pain with a duration of 15-180 minutes. The cluster headache attacks are accompanied by characteristic associated unilateral symptoms such as tearing, nasal congestion and/or rhinorrhoea, eyelid oedema, miosis and/or ptosis. In addition, there is a sense of restlessness and agitation. Patients may have up to eight attacks per day. Episodic cluster headache (ECH) occurs in clusters of weeks to months duration, whereas chronic cluster headache (CCH) attacks occur for more than 1 year without remissions. Management of cluster headache is divided into acute attack treatment and prophylactic treatment. In ECH and CCH the attacks can be treated with oxygen (12 L/min) or subcutaneous sumatriptan 6 mg. For both oxygen and sumatriptan there are two randomized, placebo-controlled trials demonstrating efficacy. In both ECH and CCH, verapamil is the prophylactic drug of choice. Verapamil 360 mg/day was found to be superior to placebo in one clinical trial. In clinical practice, daily doses of 480-720 mg are mostly used. Thus, the dose of verapamil used in cluster headache treatment may be double the dose used in cardiology, and with the higher doses the PR interval should be checked with an ECG. At the start of a cluster, transitional preventive treatment such as corticosteroids or greater occipital nerve blockade can be given. In CCH and in long-standing clusters of ECH, lithium, methysergide, topiramate, valproic acid and ergotamine tartrate can be used as add-on prophylactic treatment. In drug-resistant CCH, neuromodulation with either occipital nerve stimulation or deep brain stimulation of the hypothalamus is an alternative treatment strategy

  3. The youngest globular clusters

    NASA Astrophysics Data System (ADS)

    Beck, Sara

    2015-11-01

    It is likely that all stars are born in clusters, but most clusters are not bound and disperse. None of the many protoclusters in our Galaxy are likely to develop into long-lived bound clusters. The super star clusters (SSCs) seen in starburst galaxies are more massive and compact and have better chances of survival. The birth and early development of SSCs takes place deep in molecular clouds, and during this crucial stage the embedded clusters are invisible to optical or UV observations but are studied via the radio-infrared supernebulae (RISN) they excite. We review observations of embedded clusters and identify RISN within 10 Mpc whose exciting clusters have ≈ 106 M⊙ or more in volumes of a few pc3 and which are likely to not only survive as bound clusters, but to evolve into objects as massive and compact as Galactic globulars. These clusters are distinguished by very high star formation efficiency η, at least a factor of 10 higher than the few percent seen in the Galaxy, probably due to the violent disturbances their host galaxies have undergone. We review recent observations of the kinematics of the ionized gas in RISN showing outflows through low-density channels in the ambient molecular cloud; this may protect the cloud from feedback by the embedded H II region.

  4. Clustering versus non-clustering phase synchronizations.

    PubMed

    Liu, Shuai; Zhan, Meng

    2014-03-01

    Clustering phase synchronization (CPS) is a common scenario to the global phase synchronization of coupled dynamical systems. In this work, a novel scenario, the non-clustering phase synchronization (NPS), is reported. It is found that coupled systems do not transit to the global synchronization until a certain sufficiently large coupling is attained, and there is no clustering prior to the global synchronization. To reveal the relationship between CPS and NPS, we further analyze the noise effect on coupled phase oscillators and find that the coupled oscillator system can change from CPS to NPS with the increase of noise intensity or system disorder. These findings are expected to shed light on the mechanism of various intriguing self-organized behaviors in coupled systems. PMID:24697366

  5. Clustering versus non-clustering phase synchronizations

    SciTech Connect

    Liu, Shuai; Zhan, Meng

    2014-03-15

    Clustering phase synchronization (CPS) is a common scenario to the global phase synchronization of coupled dynamical systems. In this work, a novel scenario, the non-clustering phase synchronization (NPS), is reported. It is found that coupled systems do not transit to the global synchronization until a certain sufficiently large coupling is attained, and there is no clustering prior to the global synchronization. To reveal the relationship between CPS and NPS, we further analyze the noise effect on coupled phase oscillators and find that the coupled oscillator system can change from CPS to NPS with the increase of noise intensity or system disorder. These findings are expected to shed light on the mechanism of various intriguing self-organized behaviors in coupled systems.

  6. A nonparametric clustering technique which estimates the number of clusters

    NASA Technical Reports Server (NTRS)

    Ramey, D. B.

    1983-01-01

    In applications of cluster analysis, one usually needs to determine the number of clusters, K, and the assignment of observations to each cluster. A clustering technique based on recursive application of a multivariate test of bimodality which automatically estimates both K and the cluster assignments is presented.

  7. Reactive accelerated cluster erosion (RACE) by ionized cluster beams

    NASA Astrophysics Data System (ADS)

    Gspann, Jürgen

    1996-05-01

    Beams of ionized clusters accelerated up to about 120 keV kinetic energy per cluster are used for cluster impact lithography. Chemical reactions of clusters of CO 2, or of SF 6, respectively, are found to assist the physical erosion by hypervelocity cluster impacts in yielding volatile products. Natural diamond, silicon and Pyrex glass have been microstructured showing very smooth eroded surfaces.

  8. The LLNL Cluster Tool

    SciTech Connect

    Hunter, S L

    2007-03-27

    {lg_bullet} The Cluster Tool -is a set of linked vacuum chambers -can deposit multiple layers of metal and metal oxides {lg_bullet} Each layer can be deposited without breaking vacuum {lg_bullet} Shadow masks can give each layer a different pattern {lg_bullet} The Cluster Tool will be operational in April

  9. Cluster Interest Inventory.

    ERIC Educational Resources Information Center

    Herzog, Douglas

    The Cluster Interest Inventory is designed to familiarize students with representative occupations in 13 career clusters: (1) agribusiness and natural resources, (2) business marketing, and office occupations, (3) communications and media, (4) consumer and homemaker, (5) fine arts and humanities, (6) health, (7) manufacturing and processing, (8)…

  10. Coma cluster of galaxies

    NASA Technical Reports Server (NTRS)

    1999-01-01

    Atlas Image mosaic, covering 34' x 34' on the sky, of the Coma cluster, aka Abell 1656. This is a particularly rich cluster of individual galaxies (over 1000 members), most prominently the two giant ellipticals, NGC 4874 (right) and NGC 4889 (left). The remaining members are mostly smaller ellipticals, but spiral galaxies are also evident in the 2MASS image. The cluster is seen toward the constellation Coma Berenices, but is actually at a distance of about 100 Mpc (330 million light years, or a redshift of 0.023) from us. At this distance, the cluster is in what is known as the 'Hubble flow,' or the overall expansion of the Universe. As such, astronomers can measure the Hubble Constant, or the universal expansion rate, based on the distance to this cluster. Large, rich clusters, such as Coma, allow astronomers to measure the 'missing mass,' i.e., the matter in the cluster that we cannot see, since it gravitationally influences the motions of the member galaxies within the cluster. The near-infrared maps the overall luminous mass content of the member galaxies, since the light at these wavelengths is dominated by the more numerous older stellar populations. Galaxies, as seen by 2MASS, look fairly smooth and homogeneous, as can be seen from the Hubble 'tuning fork' diagram of near-infrared galaxy morphology. Image mosaic by S. Van Dyk (IPAC).

  11. Probability and Cancer Clusters

    ERIC Educational Resources Information Center

    Hamilton-Keene, Rachael; Lenard, Christoper T.; Mills, Terry M.

    2009-01-01

    Recently there have been several news items about possible cancer clusters in the Australian media. The term "cancer cluster" is used when an unusually large number of people in one geographic area, often a workplace, are diagnosed with cancer in a short space of time. In this paper the authors explore this important health issue using probability…

  12. Illinois' Career Cluster Model

    ERIC Educational Resources Information Center

    Jankowski, Natasha A.; Kirby, Catherine L.; Bragg, Debra D.; Taylor, Jason L.; Oertle, Kathleen M.

    2009-01-01

    This booklet provides information to multiple stakeholders on the implementation of career clusters in Illinois. The booklet is an extension of the previous edition titled "An Introduction to Illinois CTE Programs of Study" (2008), and provides a resource for partners to understand Illinois' Career Cluster Model as its own adaptation of the…

  13. Matlab Cluster Ensemble Toolbox

    Energy Science and Technology Software Center (ESTSC)

    2009-04-27

    This is a Matlab toolbox for investigating the application of cluster ensembles to data classification, with the objective of improving the accuracy and/or speed of clustering. The toolbox divides the cluster ensemble problem into four areas, providing functionality for each. These include, (1) synthetic data generation, (2) clustering to generate individual data partitions and similarity matrices, (3) consensus function generation and final clustering to generate ensemble data partitioning, and (4) implementation of accuracy metrics. Withmore » regard to data generation, Gaussian data of arbitrary dimension can be generated. The kcenters algorithm can then be used to generate individual data partitions by either, (a) subsampling the data and clustering each subsample, or by (b) randomly initializing the algorithm and generating a clustering for each initialization. In either case an overall similarity matrix can be computed using a consensus function operating on the individual similarity matrices. A final clustering can be performed and performance metrics are provided for evaluation purposes.« less

  14. Mixed-Initiative Clustering

    ERIC Educational Resources Information Center

    Huang, Yifen

    2010-01-01

    Mixed-initiative clustering is a task where a user and a machine work collaboratively to analyze a large set of documents. We hypothesize that a user and a machine can both learn better clustering models through enriched communication and interactive learning from each other. The first contribution or this thesis is providing a framework of…

  15. Young Massive Star Clusters

    NASA Astrophysics Data System (ADS)

    Portegies Zwart, Simon F.; McMillan, Stephen L. W.; Gieles, Mark

    2010-09-01

    Young massive clusters (YMCs) are dense aggregates of young stars that form the fundamental building blocks of galaxies. Several examples exist in the Milky Way Galaxy and the Local Group, but they are particularly abundant in starburst and interacting galaxies. The few YMCs that are close enough to resolve are of prime interest for studying the stellar mass function and the ecological interplay between stellar evolution and stellar dynamics. The distant unresolved clusters may be effectively used to study the star-cluster mass function, and they provide excellent constraints on the formation mechanisms of young cluster populations. YMCs are expected to be the nurseries for many unusual objects, including a wide range of exotic stars and binaries. So far only a few such objects have been found in YMCs, although their older cousins, the globular clusters, are unusually rich in stellar exotica. In this review, we focus on star clusters younger than ˜100 Myr, more than a few current crossing times old, and more massive than ˜104M⊙; the size of the cluster and its environment are considered less relevant as distinguishing parameters. We describe the global properties of the currently known young massive star clusters in the Local Group and beyond, and discuss the state of the art in observations and dynamical modeling of these systems. In order to make this review readable by observers, theorists, and computational astrophysicists, we also review the cross-disciplinary terminology.

  16. Blue emitting undecaplatinum clusters

    NASA Astrophysics Data System (ADS)

    Chakraborty, Indranath; Bhuin, Radha Gobinda; Bhat, Shridevi; Pradeep, T.

    2014-07-01

    A blue luminescent 11-atom platinum cluster showing step-like optical features and the absence of plasmon absorption was synthesized. The cluster was purified using high performance liquid chromatography (HPLC). Electrospray ionization (ESI) and matrix assisted laser desorption ionization (MALDI) mass spectrometry (MS) suggest a composition, Pt11(BBS)8, which was confirmed by a range of other experimental tools. The cluster is highly stable and compatible with many organic solvents.A blue luminescent 11-atom platinum cluster showing step-like optical features and the absence of plasmon absorption was synthesized. The cluster was purified using high performance liquid chromatography (HPLC). Electrospray ionization (ESI) and matrix assisted laser desorption ionization (MALDI) mass spectrometry (MS) suggest a composition, Pt11(BBS)8, which was confirmed by a range of other experimental tools. The cluster is highly stable and compatible with many organic solvents. Electronic supplementary information (ESI) available: Details of experimental procedures, instrumentation, chromatogram of the crude cluster; SEM/EDAX, DLS, PXRD, TEM, FT-IR, and XPS of the isolated Pt11 cluster; UV/Vis, MALDI MS and SEM/EDAX of isolated 2 and 3; and 195Pt NMR of the K2PtCl6 standard. See DOI: 10.1039/c4nr02778g

  17. Brightest Cluster Galaxy Identification

    NASA Astrophysics Data System (ADS)

    Leisman, Luke; Haarsma, D. B.; Sebald, D. A.; ACCEPT Team

    2011-01-01

    Brightest cluster galaxies (BCGs) play an important role in several fields of astronomical research. The literature includes many different methods and criteria for identifying the BCG in the cluster, such as choosing the brightest galaxy, the galaxy nearest the X-ray peak, or the galaxy with the most extended profile. Here we examine a sample of 75 clusters from the Archive of Chandra Cluster Entropy Profile Tables (ACCEPT) and the Sloan Digital Sky Survey (SDSS), measuring masked magnitudes and profiles for BCG candidates in each cluster. We first identified galaxies by hand; in 15% of clusters at least one team member selected a different galaxy than the others.We also applied 6 other identification methods to the ACCEPT sample; in 30% of clusters at least one of these methods selected a different galaxy than the other methods. We then developed an algorithm that weighs brightness, profile, and proximity to the X-ray peak and centroid. This algorithm incorporates the advantages of by-hand identification (weighing multiple properties) and automated selection (repeatable and consistent). The BCG population chosen by the algorithm is more uniform in its properties than populations selected by other methods, particularly in the relation between absolute magnitude (a proxy for galaxy mass) and average gas temperature (a proxy for cluster mass). This work supported by a Barry M. Goldwater Scholarship and a Sid Jansma Summer Research Fellowship.

  18. Marketing Occupations. Cluster Guide.

    ERIC Educational Resources Information Center

    Oregon State Dept. of Education, Salem.

    This cluster guide, which is designed to show teachers what specific knowledge and skills qualify high school students for entry-level employment (or postsecondary training) in marketing occupations, is organized into three sections: (1) cluster organization and implementation, (2) instructional emphasis areas, and (3) assessment. The first…

  19. Muster: Massively Scalable Clustering

    Energy Science and Technology Software Center (ESTSC)

    2010-05-20

    Muster is a framework for scalable cluster analysis. It includes implementations of classic K-Medoids partitioning algorithms, as well as infrastructure for making these algorithms run scalably on very large systems. In particular, Muster contains algorithms such as CAPEK (described in reference 1) that are capable of clustering highly distributed data sets in-place on a hundred thousand or more processes.

  20. Cosmology with galaxy clusters

    NASA Astrophysics Data System (ADS)

    Sartoris, Barbara

    2015-08-01

    Clusters of galaxies are powerful probes to constrain parameters that describe the cosmological models and to distinguish among different models. Since, the evolution of the cluster mass function and large-scale clustering contain the informations about the linear growth rate of perturbations and the expansion history of the Universe, clusters have played an important role in establishing the current cosmological paradigm. It is crucial to know how to determine the cluster mass from observational quantities when using clusters as cosmological tools. For this, numerical simulations are helpful to define and study robust cluster mass proxies that have minimal and well understood scatter across the mass and redshift ranges of interest. Additionally, the bias in cluster mass determination can be constrained via observations of the strong and weak lensing effect, X-ray emission, the Sunyaev- Zel’dovic effect, and the dynamics of galaxies.A major advantage of X-ray surveys is that the observable-mass relation is tight. Moreover, clusters can be easily identified in X-ray as continuous, extended sources. As of today, interesting cosmological constraints have been obtained from relatively small cluster samples (~102), X-ray selected by the ROSAT satellite over a wide redshift range (0clusters, the ROSAT All-Sky Survey.The next generation of X-ray telescopes will enhance the statistics of detected clusters and enlarge their redshift coverage. In particular, eROSITA will produce a catalog of >105 clusters with photometric redshifts from multi-band optical surveys (e.g. PanSTARRS, DES, and LSST). This will vastly improve upon current cosmological constraints, especially by the synergy with other cluster surveys that

  1. Cool Cluster Correctly Correlated

    SciTech Connect

    Sergey Aleksandrovich Varganov

    2005-12-17

    Atomic clusters are unique objects, which occupy an intermediate position between atoms and condensed matter systems. For a long time it was thought that physical and chemical properties of atomic dusters monotonically change with increasing size of the cluster from a single atom to a condensed matter system. However, recently it has become clear that many properties of atomic clusters can change drastically with the size of the clusters. Because physical and chemical properties of clusters can be adjusted simply by changing the cluster's size, different applications of atomic clusters were proposed. One example is the catalytic activity of clusters of specific sizes in different chemical reactions. Another example is a potential application of atomic clusters in microelectronics, where their band gaps can be adjusted by simply changing cluster sizes. In recent years significant advances in experimental techniques allow one to synthesize and study atomic clusters of specified sizes. However, the interpretation of the results is often difficult. The theoretical methods are frequently used to help in interpretation of complex experimental data. Most of the theoretical approaches have been based on empirical or semiempirical methods. These methods allow one to study large and small dusters using the same approximations. However, since empirical and semiempirical methods rely on simple models with many parameters, it is often difficult to estimate the quantitative and even qualitative accuracy of the results. On the other hand, because of significant advances in quantum chemical methods and computer capabilities, it is now possible to do high quality ab-initio calculations not only on systems of few atoms but on clusters of practical interest as well. In addition to accurate results for specific clusters, such methods can be used for benchmarking of different empirical and semiempirical approaches. The atomic clusters studied in this work contain from a few atoms to

  2. Hybridization schemes for clusters

    NASA Astrophysics Data System (ADS)

    Wales, David J.

    The concept of an optimum hybridization scheme for cluster compounds is developed with particular reference to electron counting. The prediction of electron counts for clusters and the interpretation of the bonding is shown to depend critically upon the presumed hybridization pattern of the cluster vertex atoms. This fact has not been properly appreciated in previous work, particularly in applications of Stone's tensor surface harmonic (TSH) theory, but is found to be a useful tool when dealt with directly. A quantitative definition is suggested for the optimum cluster hybridization pattern based directly upon the ease of interpretation of the molecular orbitals, and results are given for a range of species. The relationship of this scheme to the detailed cluster geometry is described using Löwdin's partitioned perturbation theory, and the success and range of application of TSH theory are discussed.

  3. Document clustering methods, document cluster label disambiguation methods, document clustering apparatuses, and articles of manufacture

    DOEpatents

    Sanfilippo, Antonio; Calapristi, Augustin J.; Crow, Vernon L.; Hetzler, Elizabeth G.; Turner, Alan E.

    2009-12-22

    Document clustering methods, document cluster label disambiguation methods, document clustering apparatuses, and articles of manufacture are described. In one aspect, a document clustering method includes providing a document set comprising a plurality of documents, providing a cluster comprising a subset of the documents of the document set, using a plurality of terms of the documents, providing a cluster label indicative of subject matter content of the documents of the cluster, wherein the cluster label comprises a plurality of word senses, and selecting one of the word senses of the cluster label.

  4. Cryptosporidium hominis genotypes involved in increased incidence and clusters of cases, Navarra, Spain, 2012.

    PubMed

    Fuentes, I; Martín, C; Beristain, X; Mazón, A; Saugar, J M; Blanco, A; García Cenoz, M; Valle-Cristia, M; Ezpeleta, C; Castilla, J

    2015-04-01

    SUMMARY Two clusters of confirmed cryptosporidiosis infections were detected in Navarra, Spain, in the summer of 2012, in the context of an increased incidence in the region. Molecular subtyping of Cryptosporidium hominis determined that one cluster, occurring in an urban area, was due to the predominant circulating subtype IbA10G2R2 and the other cluster, with cases occurring in a rural area, was due to a rare subtype IaA18R3. No single exposure was associated with infection, although exposure to certain children's pools was reported by a majority of patients interviewed in each cluster. Genotyping tools were useful in the investigation and could aid investigation of cryptosporidiosis outbreaks in Spain in the future. PMID:25017000

  5. Excitonic emissions and above-band-gap luminescence in the single-crystal perovskite semiconductors CsPbB r3 and CsPbC l3

    NASA Astrophysics Data System (ADS)

    Sebastian, M.; Peters, J. A.; Stoumpos, C. C.; Im, J.; Kostina, S. S.; Liu, Z.; Kanatzidis, M. G.; Freeman, A. J.; Wessels, B. W.

    2015-12-01

    The ternary compounds CsPb X3 (X =Br or Cl) have perovskite structures that are being considered for optical and electronic applications such as lasing and gamma-ray detection. An above-band-gap excitonic photoluminescence (PL) band is seen in both CsPb X3 compounds. An excitonic emission peak centered at 2.98 eV, ˜ 0.1 eV above the room-temperature band gap, is observed for CsPbC l3 . The thermal quenching of the excitonic luminescence is well described by a two-step quenching model, yielding activation energies of 0.057 and 0.0076 eV for high- and low-temperature regimes, respectively. CsPbB r3 exhibits bound excitonic luminescence peaks located at 2.29 and 2.33 eV that are attributed to recombination involving Br vacancy centers. Activation energies for thermal quenching of the excitonic luminescence of 0.017 and 0.0007 eV were calculated for CsPbB r3 . Temperature-dependent PL experiments reveal unexpected blueshifts for all excitonic emission peaks in CsPb X3 compounds. A phonon-assisted step-up process leads to the blueshift in CsPbB r3 emission, while there is a contribution from band-gap widening in CsPbC l3 . The absence of significant deep level defect luminescence in these compounds makes them attractive candidates for high-resolution, room-temperature radiation detection.

  6. An R2R3-type transcription factor gene AtMYB59 regulates root growth and cell cycle progression in Arabidopsis.

    PubMed

    Mu, Rui-Ling; Cao, Yang-Rong; Liu, Yun-Feng; Lei, Gang; Zou, Hong-Feng; Liao, Yong; Wang, Hui-Wen; Zhang, Wan-Ke; Ma, Biao; Du, Ji-Zhou; Yuan, Ming; Zhang, Jin-Song; Chen, Shou-Yi

    2009-11-01

    MYB proteins play important roles in eukaryotic organisms. In plants, the R1R2R3-type MYB proteins function in cell cycle control. However, whether the R2R3-type MYB protein is also involved in the cell division process remains unknown. Here, we report that an R2R3-type transcription factor gene, AtMYB59, is involved in the regulation of cell cycle progression and root growth. The AtMYB59 protein is localized in the nuclei of onion epidermal cells and has transactivation activity. Expression of AtMYB59 in yeast cells suppresses cell proliferation, and the transformants have more nuclei and higher aneuploid DNA content with longer cells. Mutation in the conserved domain of AtMYB59 abolishes its effects on yeast cell growth. In synchronized Arabidopsis cell suspensions, the AtMYB59 gene is specifically expressed in the S phase during cell cycle progression. Expression and promoter-GUS analysis reveals that the AtMYB59 gene is abundantly expressed in roots. Transgenic plants overexpressing AtMYB59 have shorter roots compared with wild-type plants (Arabidopsis accession Col-0), and around half of the mitotic cells in root tips are at metaphase. Conversely, the null mutant myb59-1 has longer roots and fewer mitotic cells at metaphase than Col, suggesting that AtMYB59 may inhibit root growth by extending the metaphase of mitotic cells. AtMYB59 regulates many downstream genes, including the CYCB1;1 gene, probably through binding to MYB-responsive elements. These results support a role for AtMYB59 in cell cycle regulation and plant root growth. PMID:19581938

  7. Orosensory detection of sucrose, maltose, and glucose is severely impaired in mice lacking T1R2 or T1R3, but Polycose sensitivity remains relatively normal.

    PubMed

    Treesukosol, Yada; Spector, Alan C

    2012-07-15

    Evidence in the literature supports the hypothesis that the T1R2+3 heterodimer binds to compounds that humans describe as sweet. Here, we assessed the necessity of the T1R2 and T1R3 subunits in the maintenance of normal taste sensitivity to carbohydrate stimuli. We trained and tested water-restricted T1R2 knockout (KO), T1R3 KO and their wild-type (WT) same-sex littermate controls in a two-response operant procedure to sample a fluid and differentially respond on the basis of whether the stimulus was water or a tastant. Correct responses were reinforced with water and incorrect responses were punished with a time-out. Testing was conducted with a modified descending method of limits procedure across daily 25-min sessions. Both KO groups displayed severely impaired performance and markedly decreased sensitivity when required to discriminate water from sucrose, glucose, or maltose. In contrast, when Polycose was tested, KO mice had normal EC(50) values for their psychometric functions, with some slight, but significant, impairment in performance. Sensitivity to NaCl did not differ between these mice and their WT controls. Our findings support the view that the T1R2+3 heterodimer is the principal receptor that mediates taste detection of natural sweeteners, but not of all carbohydrate stimuli. The combined presence of T1R2 and T1R3 appears unnecessary for the maintenance of relatively normal sensitivity to Polycose, at least in this task. Some detectability of sugars at high concentrations might be mediated by the putative polysaccharide taste receptor, the remaining T1R subunit forming either a homodimer or heteromer with another protein(s), or nontaste orosensory cues. PMID:22621968

  8. PagP Activation in the Outer Membrane Triggers R3 Core Oligosaccharide Truncation in the Cytoplasm of Escherichia coli O157:H7

    PubMed Central

    Smith, Abigail E.; Kim, Sang-Hyun; Liu, Feng; Jia, Wenyi; Vinogradov, Evgeny; Gyles, Carlton L.; Bishop, Russell E.

    2016-01-01

    The Escherichia coli outer membrane phospholipid:lipid A palmitoyltransferase PagP is normally a latent enzyme, but it can be directly activated in outer membranes by lipid redistribution associated with a breach in the permeability barrier. We now demonstrate that a lipid A myristate deficiency in an E. coli O157:H7 msbB mutant constitutively activates PagP in outer membranes. The lipid A myristate deficiency is associated with hydrophobic antibiotic sensitivity and, unexpectedly, with serum sensitivity, which resulted from O-antigen polysaccharide absence due to a cytoplasmically determined truncation at the first outer core glucose unit of the R3 core oligosaccharide. Mutational inactivation of pagP in the myristate-deficient lipid A background aggravated the hydrophobic antibiotic sensitivity as a result of losing a partially compensatory increase in lipid A palmitoylation while simultaneously restoring serum resistance and O-antigen attachment to intact lipopolysaccharide. Complementation with either wild-type pagP or catalytically inactive pagPSer77Ala alleles restored the R3 core truncation. However, the intact lipopolysaccharide was preserved after complementation with an internal deletion pagPΔ5–14 allele, which mostly eliminates a periplasmic amphipathic α-helical domain but fully supports cell surface lipid A palmitoylation. Our findings indicate that activation of PagP not only triggers lipid A palmitoylation in the outer membrane but also separately truncates the R3 core oligosaccharide in the cytoplasm. We discuss the implication that PagP might function as an apical sensory transducer, which can be activated by a breach in the outer membrane permeability barrier. PMID:18070877

  9. Streptococcus salivarius mutants defective in mannose phosphotransferase systems show reduced sensitivity to mutacins I-T9 and R-3B.

    PubMed

    Nicolas, Guillaume G; Frenette, Michel; Lavoie, Marc C

    2010-08-01

    Twenty-four mutacin-producing Streptococcus mutans strains were screened for their propensity to produce class II one-peptide bacteriocin using a deferred antagonism assay. Streptococcus salivarius and 3 mutants defective in their mannose phosphotransferase systems (mannose-PTS) were used as sensitive strains to identify which mannose-PTS could act as the docking site for class II one-peptide bacteriocin activity. We observed that only 2 strains of S. mutans, T9 and 3B, potentially produce class II one-peptide bacteriocin, namely mutacins I-T9 and R-3B, but with no preference for any mannose-PTS complex as a target. PMID:20725132

  10. Synthesis of enantiomerically pure (2S,3S)-5,5,5-trifluoroisoleucine and (2R,3S)-5,5,5-trifluoro-allo-isoleucine

    PubMed Central

    Huhmann, Susanne; Gerling, Ulla I M; Lentz, Dieter

    2013-01-01

    Summary A practical route for the stereoselective synthesis of (2S,3S)-5,5,5-trifluoroisoleucine (L-5-F3Ile) and (2R,3S)-5,5,5-trifluoro-allo-isoleucine (D-5-F3-allo-Ile) was developed. The hydrophobicity of L-5-F3Ile was examined and it was incorporated into a model peptide via solid phase peptide synthesis to determine its α-helix propensity. The α-helix propensity of 5-F3Ile is significantly lower than Ile, but surprisingly high when compared with 4’-F3Ile. PMID:24204411

  11. Synthesis of enantiomerically pure (2S,3S)-5,5,5-trifluoroisoleucine and (2R,3S)-5,5,5-trifluoro-allo-isoleucine.

    PubMed

    Erdbrink, Holger; Nyakatura, Elisabeth K; Huhmann, Susanne; Gerling, Ulla I M; Lentz, Dieter; Koksch, Beate; Czekelius, Constantin

    2013-01-01

    A practical route for the stereoselective synthesis of (2S,3S)-5,5,5-trifluoroisoleucine (L-5-F3Ile) and (2R,3S)-5,5,5-trifluoro-allo-isoleucine (D-5-F3-allo-Ile) was developed. The hydrophobicity of L-5-F3Ile was examined and it was incorporated into a model peptide via solid phase peptide synthesis to determine its α-helix propensity. The α-helix propensity of 5-F3Ile is significantly lower than Ile, but surprisingly high when compared with 4'-F3Ile. PMID:24204411

  12. (2R,1'S,2'R)- and (2S,1'S,2'R)-3-[2-Mono(di,tri)fluoromethylcyclopropyl]alanines and their incorporation into hormaomycin analogues

    PubMed Central

    Kozhushkov, Sergei I; Yufit, Dmitrii S; Grosse, Christian; Kaiser, Marcel

    2014-01-01

    Summary Efficient and scalable syntheses of enantiomerically pure (2R,1'S,2'R)- and (2S,1'S,2'R)-3-[2-mono(di,tri)fluoromethylcyclopropyl]alanines 9a–c, as well as allo-D-threonine (4) and (2S,3R)-β-methylphenylalanine (3), using the Belokon' approach with (S)- and (R)-2-[(N-benzylprolyl)amino]benzophenone [(S)- and (R)-10] as reusable chiral auxiliaries have been developed. Three new fluoromethyl analogues of the naturally occurring octadepsipeptide hormaomycin (1) with (fluoromethylcyclopropyl)alanine moieties have been synthesized and subjected to preliminary tests of their antibiotic activity. PMID:25550751

  13. A R2R3-MYB Transcription Factor Regulates the Flavonol Biosynthetic Pathway in a Traditional Chinese Medicinal Plant, Epimedium sagittatum

    PubMed Central

    Huang, Wenjun; Khaldun, A. B. M.; Chen, Jianjun; Zhang, Chanjuan; Lv, Haiyan; Yuan, Ling; Wang, Ying

    2016-01-01

    Flavonols as plant secondary metabolites with vital roles in plant development and defense against UV light, have been demonstrated to be the main bioactive components (BCs) in the genus Epimedium plants, several species of which are used as materials for Herba Epimedii, an important traditional Chinese medicine. The flavonol biosynthetic pathway genes had been already isolated from Epimedium sagittatum, but a R2R3-MYB transcription factor regulating the flavonol synthesis has not been functionally characterized so far in Epimedium plants. In this study, we isolated and characterized the R2R3-MYB transcription factor EsMYBF1 involved in regulation of the flavonol biosynthetic pathway from E. sagittatum. Sequence analysis indicated that EsMYBF1 belongs to the subgroup 7 of R2R3-MYB family which contains the flavonol-specific MYB regulators identified to date. Transient reporter assay showed that EsMYBF1 strongly activated the promoters of EsF3H (flavanone 3-hydroxylase) and EsFLS (flavonol synthase), but not the promoters of EsDFRs (dihydroflavonol 4-reductase) and EsANS (anthocyanidin synthase) in transiently transformed Nicotiana benthamiana leaves. Both yeast two-hybrid assay and transient reporter assay validated EsMYBF1 to be independent of EsTT8, or AtTT8 bHLH regulators of the flavonoid pathway as cofactors. Ectopic expression of EsMYBF1 in transgenic tobacco resulted in the increased flavonol content and the decreased anthocyanin content in flowers. Correspondingly, the structural genes involved in flavonol synthesis were upregulated in the EsMYBF1 overexpression lines, including NtCHS (chalcone synthase), NtCHI (chalcone isomerase), NtF3H and NtFLS, whereas the late biosynthetic genes of the anthocyanin pathway (NtDFR and NtANS) were remarkably downregulated, compared to the controls. These results suggest that EsMYBF1 is a flavonol-specific R2R3-MYB regulator, and involved in regulation of the biosynthesis of the flavonol-derived BCs in E. sagittatum. Thus

  14. A R2R3-MYB Transcription Factor Regulates the Flavonol Biosynthetic Pathway in a Traditional Chinese Medicinal Plant, Epimedium sagittatum.

    PubMed

    Huang, Wenjun; Khaldun, A B M; Chen, Jianjun; Zhang, Chanjuan; Lv, Haiyan; Yuan, Ling; Wang, Ying

    2016-01-01

    Flavonols as plant secondary metabolites with vital roles in plant development and defense against UV light, have been demonstrated to be the main bioactive components (BCs) in the genus Epimedium plants, several species of which are used as materials for Herba Epimedii, an important traditional Chinese medicine. The flavonol biosynthetic pathway genes had been already isolated from Epimedium sagittatum, but a R2R3-MYB transcription factor regulating the flavonol synthesis has not been functionally characterized so far in Epimedium plants. In this study, we isolated and characterized the R2R3-MYB transcription factor EsMYBF1 involved in regulation of the flavonol biosynthetic pathway from E. sagittatum. Sequence analysis indicated that EsMYBF1 belongs to the subgroup 7 of R2R3-MYB family which contains the flavonol-specific MYB regulators identified to date. Transient reporter assay showed that EsMYBF1 strongly activated the promoters of EsF3H (flavanone 3-hydroxylase) and EsFLS (flavonol synthase), but not the promoters of EsDFRs (dihydroflavonol 4-reductase) and EsANS (anthocyanidin synthase) in transiently transformed Nicotiana benthamiana leaves. Both yeast two-hybrid assay and transient reporter assay validated EsMYBF1 to be independent of EsTT8, or AtTT8 bHLH regulators of the flavonoid pathway as cofactors. Ectopic expression of EsMYBF1 in transgenic tobacco resulted in the increased flavonol content and the decreased anthocyanin content in flowers. Correspondingly, the structural genes involved in flavonol synthesis were upregulated in the EsMYBF1 overexpression lines, including NtCHS (chalcone synthase), NtCHI (chalcone isomerase), NtF3H and NtFLS, whereas the late biosynthetic genes of the anthocyanin pathway (NtDFR and NtANS) were remarkably downregulated, compared to the controls. These results suggest that EsMYBF1 is a flavonol-specific R2R3-MYB regulator, and involved in regulation of the biosynthesis of the flavonol-derived BCs in E. sagittatum. Thus

  15. Statistical properties of convex clustering

    PubMed Central

    Tan, Kean Ming; Witten, Daniela

    2016-01-01

    In this manuscript, we study the statistical properties of convex clustering. We establish that convex clustering is closely related to single linkage hierarchical clustering and k-means clustering. In addition, we derive the range of the tuning parameter for convex clustering that yields a non-trivial solution. We also provide an unbiased estimator of the degrees of freedom, and provide a finite sample bound for the prediction error for convex clustering. We compare convex clustering to some traditional clustering methods in simulation studies.

  16. Partially supervised speaker clustering.

    PubMed

    Tang, Hao; Chu, Stephen Mingyu; Hasegawa-Johnson, Mark; Huang, Thomas S

    2012-05-01

    Content-based multimedia indexing, retrieval, and processing as well as multimedia databases demand the structuring of the media content (image, audio, video, text, etc.), one significant goal being to associate the identity of the content to the individual segments of the signals. In this paper, we specifically address the problem of speaker clustering, the task of assigning every speech utterance in an audio stream to its speaker. We offer a complete treatment to the idea of partially supervised speaker clustering, which refers to the use of our prior knowledge of speakers in general to assist the unsupervised speaker clustering process. By means of an independent training data set, we encode the prior knowledge at the various stages of the speaker clustering pipeline via 1) learning a speaker-discriminative acoustic feature transformation, 2) learning a universal speaker prior model, and 3) learning a discriminative speaker subspace, or equivalently, a speaker-discriminative distance metric. We study the directional scattering property of the Gaussian mixture model (GMM) mean supervector representation of utterances in the high-dimensional space, and advocate exploiting this property by using the cosine distance metric instead of the euclidean distance metric for speaker clustering in the GMM mean supervector space. We propose to perform discriminant analysis based on the cosine distance metric, which leads to a novel distance metric learning algorithm—linear spherical discriminant analysis (LSDA). We show that the proposed LSDA formulation can be systematically solved within the elegant graph embedding general dimensionality reduction framework. Our speaker clustering experiments on the GALE database clearly indicate that 1) our speaker clustering methods based on the GMM mean supervector representation and vector-based distance metrics outperform traditional speaker clustering methods based on the “bag of acoustic features” representation and statistical

  17. Dwarfs in Coma Cluster

    NASA Technical Reports Server (NTRS)

    2007-01-01

    [figure removed for brevity, see original site] Click on image for larger poster version

    This false-color mosaic of the central region of the Coma cluster combines infrared and visible-light images to reveal thousands of faint objects (green). Follow-up observations showed that many of these objects, which appear here as faint green smudges, are dwarf galaxies belonging to the cluster. Two large elliptical galaxies, NGC 4889 and NGC 4874, dominate the cluster's center. The mosaic combines visible-light data from the Sloan Digital Sky Survey (color coded blue) with long- and short-wavelength infrared views (red and green, respectively) from NASA's Spitzer Space Telescope.

  18. H-cluster stars

    NASA Astrophysics Data System (ADS)

    Lai, X. Y.; Gao, C. Y.; Xu, R. X.

    2013-06-01

    The study of dense matter at ultrahigh density has a very long history, which is meaningful for us to understand not only cosmic events in extreme circumstances but also fundamental laws of physics. It is well known that the state of cold matter at supranuclear density depends on the non-perturbative nature of quantum chromodynamics (QCD) and is essential for modelling pulsars. A so-called H-cluster matter is proposed in this paper as the nature of dense matter in reality. In compact stars at only a few nuclear densities but low temperature, quarks could be interacting strongly with each other there. That might render quarks grouped in clusters, although the hypothetical quark clusters in cold dense matter have not been confirmed due to the lack of both theoretical and experimental evidence. Motivated by recent lattice QCD simulations of the H-dibaryons (with structure uuddss), we therefore consider here a possible kind of quark clusters, H-clusters, that could emerge inside compact stars during their initial cooling as the dominant components inside (the degree of freedom could then be H-clusters there). Taking into account the in-medium stiffening effect, we find that at baryon densities of compact stars H-cluster matter could be more stable than nuclear matter. We also find that for the H-cluster matter with lattice structure, the equation of state could be so stiff that it would seem to be `superluminal' in the most dense region. However, the real sound speed for H-cluster matter is in fact difficult to calculate, so at this stage we do not put constraints on our model from the usual requirement of causality. We study the stars composed of H-clusters, i.e. H-cluster stars, and derive the dependence of their maximum mass on the in-medium stiffening effect, showing that the maximum mass could be well above 2 M⊙ as observed and that the resultant mass-radius relation fits the measurement of the rapid burster under reasonable parameters. Besides a general

  19. Extending Beowulf Clusters

    USGS Publications Warehouse

    Steinwand, Daniel R.; Maddox, Brian; Beckmann, Tim; Hamer, George

    2003-01-01

    Beowulf clusters can provide a cost-effective way to compute numerical models and process large amounts of remote sensing image data. Usually a Beowulf cluster is designed to accomplish a specific set of processing goals, and processing is very efficient when the problem remains inside the constraints of the original design. There are cases, however, when one might wish to compute a problem that is beyond the capacity of the local Beowulf system. In these cases, spreading the problem to multiple clusters or to other machines on the network may provide a cost-effective solution.

  20. Combining cluster number counts and galaxy clustering

    NASA Astrophysics Data System (ADS)

    Lacasa, Fabien; Rosenfeld, Rogerio

    2016-08-01

    The abundance of clusters and the clustering of galaxies are two of the important cosmological probes for current and future large scale surveys of galaxies, such as the Dark Energy Survey. In order to combine them one has to account for the fact that they are not independent quantities, since they probe the same density field. It is important to develop a good understanding of their correlation in order to extract parameter constraints. We present a detailed modelling of the joint covariance matrix between cluster number counts and the galaxy angular power spectrum. We employ the framework of the halo model complemented by a Halo Occupation Distribution model (HOD). We demonstrate the importance of accounting for non-Gaussianity to produce accurate covariance predictions. Indeed, we show that the non-Gaussian covariance becomes dominant at small scales, low redshifts or high cluster masses. We discuss in particular the case of the super-sample covariance (SSC), including the effects of galaxy shot-noise, halo second order bias and non-local bias. We demonstrate that the SSC obeys mathematical inequalities and positivity. Using the joint covariance matrix and a Fisher matrix methodology, we examine the prospects of combining these two probes to constrain cosmological and HOD parameters. We find that the combination indeed results in noticeably better constraints, with improvements of order 20% on cosmological parameters compared to the best single probe, and even greater improvement on HOD parameters, with reduction of error bars by a factor 1.4-4.8. This happens in particular because the cross-covariance introduces a synergy between the probes on small scales. We conclude that accounting for non-Gaussian effects is required for the joint analysis of these observables in galaxy surveys.

  1. Differences in saccharin preference and genetic alterations of the Tas1r3 gene among senescence-accelerated mouse strains and their parental AKR/J strain.

    PubMed

    Niimi, Kimie; Takahashi, Eiki

    2014-05-10

    The senescence-accelerated mouse (SAM) is used as an animal model of senescence acceleration and age-associated disorders. SAM is derived from unexpected crosses between the AKR/J and unknown mouse strains. There are nine senescence-prone (SAMP) strains and three senescence-resistant (SAMR) strains. Although SAMP strains exhibit strain-specific and age-related pathological changes, the genes responsible for the pathologic changes in SAMP strains have not been comprehensively identified. In the present study, we evaluated sweet taste perception using the two-bottle test. We compared genotypes of the taste related gene, Tas1r3, using SAM strains and the parental AKR/J strain. The two-bottle test revealed that SAMR1 (R1), SAMP6 (P6), SAMP8 (P8), and SAMP10 (P10) mice were saccharin-preferring strains, whereas AKR/J did not prefer saccharin. All genotypes of the R1, P6, P8, and P10 strains at the polymorphic sites in Tas1r3, which is known to influence saccharin preference, were identical to those of C57BL6/J, a well-known saccharin-preferring strain, and were completely different from those of the parental AKR/J strain. These genetic alterations in SAM strains appear to arise from an unknown strain that is thought to have been crossed with AKR/J initially. PMID:24726396

  2. Regulation of secondary cell wall biosynthesis by poplar R2R3 MYB transcription factor PtrMYB152 in Arabidopsis

    SciTech Connect

    Wang, Shucai; Li, Eryang; Porth, Ilga; Chen, Jin-Gui; Mansfield, Shawn D.; Douglas, Carl

    2014-05-23

    Poplar has 192 annotated R2R3 MYB genes, of which only three have been shown to play a role in the regulation of secondary cell wall formation. Here we report the characterization of PtrMYB152, a poplar homolog of the Arabidopsis R2R3 MYB transcription factor AtMYB43, in the regulation of secondary cell wall biosynthesis. The expression of PtrMYB152 in secondary xylem is about 18 times of that in phloem. When expressed in Arabidopsis under the control of either 35S or PtrCesA8 promoters, PtrMYB152 increased secondary cell wall thickness, which is likely caused by increased lignification. Accordingly, elevated expression of genes encoding sets of enzymes in secondary wall biosynthesis were observed in transgenic plants expressing PtrMYB152. Arabidopsis protoplast transfection assays suggested that PtrMYB152 functions as a transcriptional activator. Taken together, our results suggest that PtrMYB152 may be part of a regulatory network activating expression of discrete sets of secondary cell wall biosynthesis genes.

  3. The Heterologous Expression of the Chrysanthemum R2R3-MYB Transcription Factor CmMYB1 Alters Lignin Composition and Represses Flavonoid Synthesis in Arabidopsis thaliana

    PubMed Central

    Chen, Sumei; Jiang, Jiafu; Gu, Chunsun; Zhou, Guoqin; Chen, Yu; Song, Aiping; Chen, Fadi

    2013-01-01

    Plant R2R3-MYB transcription factor genes are widely distributed in higher plants and play important roles in the regulation of many secondary metabolites at the transcriptional level. In this study, a chrysanthemum subgroup 4 R2R3-MYB transcription factor gene, designated CmMYB1, was isolated through screening chrysanthemum EST (expressed sequence tag) libraries and using rapid application of cDNA ends (RACE) methods and functionally characterized. CmMYB1 is expressed in the root, stem, leaf and flowers, but most strongly in the stem and most weakly in the root. Its heterologous expression in Arabidopsis thaliana reduced the lignin content and altered the lignin composition. The heterologous expression also repressed the flavonoids content in A. thaliana. Together, these results suggested that CmMYB1 is a negative regulator of genes involved in the lignin pathway and flavonoid pathway, it may be a promising gene for controlling lignin and flavonoids profiles in plants. PMID:23840353

  4. Green polymer chemistry: investigating the mechanism of radical ring-opening redox polymerization (R3P) of 3,6-dioxa-1,8-octanedithiol (DODT).

    PubMed

    Rosenthal-Kim, Emily Q; Puskas, Judit E

    2015-01-01

    The mechanism of the new Radical Ring-opening Redox Polymerization (R3P) of 3,6-dioxa-1,8-octanedithiol (DODT) by triethylamine (TEA) and dilute H2O2 was investigated. Scouting studies showed that the formation of high molecular weight polymers required a 1:2 molar ratio of DODT to TEA and of DODT to H2O2. Further investigation into the chemical composition of the organic and aqueous phases by 1H-NMR spectroscopy and mass spectrometry demonstrated that DODT is ionized by two TEA molecules (one for each thiol group) and thus transferred into the aqueous phase. The organic phase was found to have cyclic disulfide dimers, trimers and tetramers. Dissolving DODT and TEA in water before the addition of H2O2 yielded a polymer with Mn = 55,000 g/mol, in comparison with Mn = 92,000 g/mol when aqueous H2O2 was added to a DODT/TEA mixture. After polymer removal, MALDI-ToF MS analysis of the residual reaction mixtures showed only cyclic oligomers remaining. Below the LCST for TEA in water, 18.7 °C, the system yielded a stable emulsion, and only cyclic oligomers were found. Below DODT/TEA and H2O2 1:2 molar ratio mostly linear oligomers were formed, with <20% cyclic oligomers. The findings support the proposed mechanism of R3P. PMID:25871370

  5. The wheat R2R3-MYB transcription factor TaRIM1 participates in resistance response against the pathogen Rhizoctonia cerealis infection through regulating defense genes.

    PubMed

    Shan, Tianlei; Rong, Wei; Xu, Huijun; Du, Lipu; Liu, Xin; Zhang, Zengyan

    2016-01-01

    The necrotrophic fungus Rhizoctonia cerealis is a major pathogen of sharp eyespot that is a devastating disease of wheat (Triticum aestivum). Little is known about roles of MYB genes in wheat defense response to R. cerealis. In this study, TaRIM1, a R. cerealis-induced wheat MYB gene, was identified by transcriptome analysis, then cloned from resistant wheat CI12633, and its function and preliminary mechanism were studied. Sequence analysis showed that TaRIM1 encodes a R2R3-MYB transcription factor with transcription-activation activity. The molecular-biological assays revealed that the TaRIM1 protein localizes to nuclear and can bind to five MYB-binding site cis-elements. Functional dissection results showed that following R. cerealis inoculation, TaRIM1 silencing impaired the resistance of wheat CI12633, whereas TaRIM1 overexpression significantly increased resistance of transgenic wheat compared with susceptible recipient. TaRIM1 positively regulated the expression of five defense genes (Defensin, PR10, PR17c, nsLTP1, and chitinase1) possibly through binding to MYB-binding sites in their promoters. These results suggest that the R2R3-MYB transcription factor TaRIM1 positively regulates resistance response to R. cerealis infection through modulating the expression of a range of defense genes, and that TaRIM1 is a candidate gene to improve sharp eyespot resistance in wheat. PMID:27364458

  6. Comparison of Z and R3 antigen expression and of genes encoding other antigenic markers in invasive human and bovine Streptococcus agalactiae strains from Norway.

    PubMed

    Maeland, Johan A; Radtke, Andreas

    2013-12-27

    Streptococcus agalactiae (GBS) may cause a variety of infectious diseases in humans caused by human GBS and mastitis in cattle caused by bovine GBS. Over the last few years molecular testing has provided evidence that human and bovine GBS have evolved along diverse phylogenetic lines. In the present study 173 invasive human GBS strains and 52 invasive bovine strains were tested for altogether 18 strain-variable and surface-localized antigenic markers including all 10 capsular polysaccharides (CPS) and proteins including Cβ, the alpha-like proteins, R3 and the recently described Z1 and Z2 antigens. PCR was used to detect encoding genes and antibody-based methods to detect expression of antigens. Thirteen of the 18 markers were detected in isolates of both strain categories. Seven of the ten CPS antigens were detected in both groups with types III and V predominating in the human GBS strains, types IV and V in the bovine isolates. Z1, Z2 and/or R3 expression and the genes encoding Cβ, Cα, Alp1, Alp2/3 or R4 (Rib) were detected in both groups. Protein antigen-CPS associations well known for human strains were essentially the same in the bovine isolates. The results show that in spite of evolution along different lines, human and bovine GBS share a variety of surface-exposed antigenic markers, substantiating close relationship between the two GBS subpopulations. PMID:24120184

  7. The wheat R2R3-MYB transcription factor TaRIM1 participates in resistance response against the pathogen Rhizoctonia cerealis infection through regulating defense genes

    PubMed Central

    Shan, Tianlei; Rong, Wei; Xu, Huijun; Du, Lipu; Liu, Xin; Zhang, Zengyan

    2016-01-01

    The necrotrophic fungus Rhizoctonia cerealis is a major pathogen of sharp eyespot that is a devastating disease of wheat (Triticum aestivum). Little is known about roles of MYB genes in wheat defense response to R. cerealis. In this study, TaRIM1, a R. cerealis-induced wheat MYB gene, was identified by transcriptome analysis, then cloned from resistant wheat CI12633, and its function and preliminary mechanism were studied. Sequence analysis showed that TaRIM1 encodes a R2R3-MYB transcription factor with transcription-activation activity. The molecular-biological assays revealed that the TaRIM1 protein localizes to nuclear and can bind to five MYB-binding site cis-elements. Functional dissection results showed that following R. cerealis inoculation, TaRIM1 silencing impaired the resistance of wheat CI12633, whereas TaRIM1 overexpression significantly increased resistance of transgenic wheat compared with susceptible recipient. TaRIM1 positively regulated the expression of five defense genes (Defensin, PR10, PR17c, nsLTP1, and chitinase1) possibly through binding to MYB-binding sites in their promoters. These results suggest that the R2R3-MYB transcription factor TaRIM1 positively regulates resistance response to R. cerealis infection through modulating the expression of a range of defense genes, and that TaRIM1 is a candidate gene to improve sharp eyespot resistance in wheat. PMID:27364458

  8. Mantis BT Cluster Support

    Energy Science and Technology Software Center (ESTSC)

    2009-06-05

    The software is a modidication to the Mantis BT V1.5 open source application provided by the mantis BT group to support cluster web servers. It also provides various cosmetic modifications used a LLNL.

  9. Cyclostomes Lack Clustered Protocadherins.

    PubMed

    Ravi, Vydianathan; Yu, Wei-Ping; Pillai, Nisha E; Lian, Michelle M; Tay, Boon-Hui; Tohari, Sumanty; Brenner, Sydney; Venkatesh, Byrappa

    2016-02-01

    The brain, comprising billions of neurons and intricate neural networks, is arguably the most complex organ in vertebrates. The diversity of individual neurons is fundamental to the neuronal network complexity and the overall function of the vertebrate brain. In jawed vertebrates, clustered protocadherins provide the molecular basis for this neuronal diversity, through stochastic and combinatorial expression of their various isoforms in individual neurons. Based on analyses of transcriptomes from the Japanese lamprey brain and sea lamprey embryos, genome assemblies of the two lampreys, and brain expressed sequence tags of the inshore hagfish, we show that extant jawless vertebrates (cyclostomes) lack the clustered protocadherins. Our findings indicate that the clustered protocadherins originated from a nonclustered protocadherin in the jawed vertebrate ancestor, after the two rounds of whole-genome duplication. In the absence of clustered protocadherins, cyclostomes might have evolved novel molecules or mechanisms for generating neuronal diversity which remains to be discovered. PMID:26545918

  10. Dynamic Bayesian clustering.

    PubMed

    Fowler, Anna; Menon, Vilas; Heard, Nicholas A

    2013-10-01

    Clusters of time series data may change location and memberships over time; in gene expression data, this occurs as groups of genes or samples respond differently to stimuli or experimental conditions at different times. In order to uncover this underlying temporal structure, we consider dynamic clusters with time-dependent parameters which split and merge over time, enabling cluster memberships to change. These interesting time-dependent structures are useful in understanding the development of organisms or complex organs, and could not be identified using traditional clustering methods. In cell cycle data, these time-dependent structure may provide links between genes and stages of the cell cycle, whilst in developmental data sets they may highlight key developmental transitions. PMID:24131050

  11. [Cluster headache differential diagnosis].

    PubMed

    Guégan-Massardier, Evelyne; Laubier, Cécile

    2015-11-01

    Cluster headache is characterized by disabling stereotyped headache. Early diagnosis allows appropriate treatment, unfortunately diagnostic errors are frequent. The main differential diagnoses are other primary or essential headaches. Migraine, more frequent and whose diagnosis is carried by excess, trigeminal neuralgia or other trigemino-autonomic cephalgia. Vascular or tumoral underlying condition can mimic cluster headache, neck and brain imaging is recommended, ideally MRI. PMID:26549687

  12. Wild Duck Cluster

    NASA Technical Reports Server (NTRS)

    2005-01-01

    On April 7, 2005, the Deep Impact spacecraft's Impactor Target Sensor camera recorded this image of M11, the Wild Duck cluster, a galactic open cluster located 6 thousand light years away. The camera is located on the impactor spacecraft, which will image comet Tempel 1 beginning 22 hours before impact until about 2 seconds before impact. Impact with comet Tempel 1 is planned for July 4, 2005.

  13. Cluster functional renormalization group

    NASA Astrophysics Data System (ADS)

    Reuther, Johannes; Thomale, Ronny

    2014-01-01

    Functional renormalization group (FRG) has become a diverse and powerful tool to derive effective low-energy scattering vertices of interacting many-body systems. Starting from a free expansion point of the action, the flow of the RG parameter Λ allows us to trace the evolution of the effective one- and two-particle vertices towards low energies by taking into account the vertex corrections between all parquet channels in an unbiased fashion. In this work, we generalize the expansion point at which the diagrammatic resummation procedure is initiated from a free UV limit to a cluster product state. We formulate a cluster FRG scheme where the noninteracting building blocks (i.e., decoupled spin clusters) are treated exactly, and the intercluster couplings are addressed via RG. As a benchmark study, we apply our cluster FRG scheme to the spin-1/2 bilayer Heisenberg model (BHM) on a square lattice where the neighboring sites in the two layers form the individual two-site clusters. Comparing with existing numerical evidence for the BHM, we obtain reasonable findings for the spin susceptibility, the spin-triplet excitation energy, and quasiparticle weight even in coupling regimes close to antiferromagnetic order. The concept of cluster FRG promises applications to a large class of interacting electron systems.

  14. Communication: The cluster vapor to cluster solid transition

    NASA Astrophysics Data System (ADS)

    Sweatman, Martin B.; Lue, Leo

    2016-05-01

    Until now, depletion induced transitions have been the hallmark of multicomponent systems only. Monte Carlo simulations reveal a depletion-induced phase transition from cluster vapor to cluster solid in a one-component fluid with competing short range and long range interactions. This confirms a prediction made by earlier theoretical work. Analysis of renormalized cluster-cluster and cluster-vapor interactions suggests that a cluster liquid is also expected within a very narrow range of model parameters. These insights could help identify the mechanisms of clustering in experiments and assist the design of colloidal structures through engineered self-assembly.

  15. The Clustering of Young Stellar Cluster Populations in Nearby Galaxies

    NASA Astrophysics Data System (ADS)

    Grasha, Kathryn; Calzetti, Daniela

    2016-01-01

    We present measurements of clustering among star clusters for several galaxies drawn from the Legacy ExtraGalactic UV Survey (LEGUS), in order to establish whether the clustering strength depends on properties of the cluster population. We use the two point autocorrelation function to study clustering as a function of spatial scale, age, concentration index (CI), and mass. We separate the clusters into different classes, defined by their (a)symmetry and number of peaks, comparing the trends of the autocorrelation functions between all the cluster classes. For one galaxy, NGC 628, we find that younger star clusters are more strongly clustered over small spatial scales and that the clustering disappears rapidly for ages as young as 40 Myr. We present here a similar analysis for the other galaxies. We also measure the power-law slope and amplitude of the autocorrelation functions and discuss the results.

  16. Relation chain based clustering analysis

    NASA Astrophysics Data System (ADS)

    Zhang, Cheng-ning; Zhao, Ming-yang; Luo, Hai-bo

    2011-08-01

    Clustering analysis is currently one of well-developed branches in data mining technology which is supposed to find the hidden structures in the multidimensional space called feature or pattern space. A datum in the space usually possesses a vector form and the elements in the vector represent several specifically selected features. These features are often of efficiency to the problem oriented. Generally, clustering analysis goes into two divisions: one is based on the agglomerative clustering method, and the other one is based on divisive clustering method. The former refers to a bottom-up process which regards each datum as a singleton cluster while the latter refers to a top-down process which regards entire data as a cluster. As the collected literatures, it is noted that the divisive clustering is currently overwhelming both in application and research. Although some famous divisive clustering methods are designed and well developed, clustering problems are still far from being solved. The k - means algorithm is the original divisive clustering method which initially assigns some important index values, such as the clustering number and the initial clustering prototype positions, and that could not be reasonable in some certain occasions. More than the initial problem, the k - means algorithm may also falls into local optimum, clusters in a rigid way and is not available for non-Gaussian distribution. One can see that seeking for a good or natural clustering result, in fact, originates from the one's understanding of the concept of clustering. Thus, the confusion or misunderstanding of the definition of clustering always derives some unsatisfied clustering results. One should consider the definition deeply and seriously. This paper demonstrates the nature of clustering, gives the way of understanding clustering, discusses the methodology of designing a clustering algorithm, and proposes a new clustering method based on relation chains among 2D patterns. In

  17. Transcriptional Profiling of Cultured, Embryonic Epicardial Cells Identifies Novel Genes and Signaling Pathways Regulated by TGFβR3 In Vitro

    PubMed Central

    DeLaughter, Daniel M.; Clark, Cynthia R.; Christodoulou, Danos C.; Seidman, Christine E.; Baldwin, H. Scott; Seidman, J. G.; Barnett, Joey V.

    2016-01-01

    The epicardium plays an important role in coronary vessel formation and Tgfbr3-/- mice exhibit failed coronary vessel development associated with decreased epicardial cell invasion. Immortalized Tgfbr3-/- epicardial cells display the same defects. Tgfbr3+/+ and Tgfbr3-/- cells incubated for 72 hours with VEH or ligands known to promote invasion via TGFβR3 (TGFβ1, TGFβ2, BMP2), for 72 hours were harvested for RNA-seq analysis. We selected for genes >2-fold differentially expressed between Tgfbr3+/+ and Tgfbr3-/- cells when incubated with VEH (604), TGFβ1 (515), TGFβ2 (553), or BMP2 (632). Gene Ontology (GO) analysis of these genes identified dysregulated biological processes consistent with the defects observed in Tgfbr3-/- cells, including those associated with extracellular matrix interaction. GO and Gene Regulatory Network (GRN) analysis identified distinct expression profiles between TGFβ1-TGFβ2 and VEH-BMP2 incubated cells, consistent with the differential response of epicardial cells to these ligands in vitro. Despite the differences observed between Tgfbr3+/+ and Tgfbr3-/- cells after TGFβ and BMP ligand addition, GRNs constructed from these gene lists identified NF-ĸB as a key nodal point for all ligands examined. Tgfbr3-/- cells exhibited decreased expression of genes known to be activated by NF-ĸB signaling. NF-ĸB activity was stimulated in Tgfbr3+/+ epicardial cells after TGFβ2 or BMP2 incubation, while Tgfbr3-/- cells failed to activate NF-ĸB in response to these ligands. Tgfbr3+/+ epicardial cells incubated with an inhibitor of NF-ĸB signaling no longer invaded into a collagen gel in response to TGFβ2 or BMP2. These data suggest that NF-ĸB signaling is dysregulated in Tgfbr3-/- epicardial cells and that NF-ĸB signaling is required for epicardial cell invasion in vitro. Our approach successfully identified a signaling pathway important in epicardial cell behavior downstream of TGFβR3. Overall, the genes and signaling pathways identified

  18. Comparisons of the clinical outcomes of thoracoscopic sympathetic surgery for palmar hyperhidrosis: R4 sympathicotomy versus R4 sympathetic clipping versus R3 sympathetic clipping

    PubMed Central

    Joo, Seok; Haam, Seokjin; Lee, Sungsoo

    2016-01-01

    Background Thoracoscopic sympathetic surgery is regarded as a definitive treatment for palmar hyperhidrosis. However, the optimal surgical strategy remains unclear. The aim of this study was to compare outcomes based on the level and type of sympathetic disconnection in patients with palmar hyperhidrosis. Methods From January 2009 to December 2014, 101 patients with palmar hyperhidrosis underwent thoracoscopic sympathetic surgery at Gangnam Severance Hospital. Complete follow-up information was obtained from 59 patients. We retrospectively analyzed the results of operation, degree of palmar sweating (%), grade of compensatory sweating (none, mild, moderate, severe, very severe), grade of satisfaction (very satisfied, satisfied, moderate, dissatisfied, very dissatisfied), and recurrence/failure. Results R4 sympathicotomy, R4 sympathetic clipping, and R3 sympathetic clipping were performed in 16, 20, and 23 patients, respectively. The mean degree of palmar sweating after sympathetic surgery was not significantly different between these three groups (17.50% vs. 27.00% vs. 29.78%; P=0.38). The rate of life-bothering compensatory sweating was lower in the R4 sympathicotomy group compared with those of other two groups (0% vs. 25%, 47.8%; P=0.09). The rate of very satisfied to moderate grades of satisfaction were lower in the R3 sympathetic clipping group compared with those of other two groups (93.8%, 100% vs. 73.9%; P=0.07). The rate of recurrence/failure rates were lower in the R4 sympathicotomy group compared with those of other two groups (12.50% vs. 35.00%, 34.8%; P=0.25). Sympathetic surgery at the R3 level was the only significant risk factor for patient dissatisfaction (odd ratio =12.353, 95% confidence interval =1.376–110.914; P=0.025). Conclusions Our data support that R4 sympathicotomy had lower grades of compensatory sweating, higher grades of satisfaction, and lower rates of recurrence/failure. We therefore consider R4 sympathicotomy as an optimal

  19. Clustering in bubbly liquids

    NASA Astrophysics Data System (ADS)

    Figueroa, Bernardo; Zenit, Roberto

    2004-11-01

    We are conducting experiments to determine the amount of clustering that occurs when small gas bubbles ascend in clean water. In particular, we are interested in flows for which the liquid motion around the bubbles can be described, with a certain degree of accuracy, using potential flow theory. This model is applicable for the case of bubbly liquids in which the Reynolds number is large and the Weber number is small. To clearly observe the formation of bubble clusters we propose the use of a Hele-Shaw-type channel. In this thin channel the bubbles cannot overlap in the depth direction, therefore the identification of bubble clusters cannot be misinterpreted. Direct video image analysis is performed to calculate the velocity and size of the bubbles, as well as the formation of clusters. Although the walls do affect the motion of the bubbles, the clustering phenomena does occur and has the same qualitative behavior as in fully three-dimensional flows. A series of preliminary measurements are presented. A brief discussion of our plans to perform PIV measurements to obtain the liquid velocity fields is also presented.

  20. HST Cluster Supernova Survey

    NASA Astrophysics Data System (ADS)

    Suzuki, Nao; Aldering, G.; Amanullah, R.; Barbary, K.; Barrientos, L.; Brodwin, M.; Connolly, N.; Dawson, K.; de Jong, R.; Dey, A.; Doi, M.; Donahue, M.; Eisenhardt, P.; Ellingson, E.; Faccioli, L.; Fadeyev, V.; Fakhouri, H.; Fruchter, A.; Gilbank, D.; Gladders, M.; Goldhaber, G.; Gonzalez, A.; Goobar, A.; Gude, A.; Hennawi, J.; Hoekstra, H.; Hsiao, E.; Huang, X.; Ihara, Y.; Jannuzi, B.; Jee, M. J.; Koester, B.; Kowalski, M.; Lidman, C.; Linder, E.; Lubin, L.; Morokuma, T.; Perlmutter, S.; Postman, M.; Rhodes, J.; Rosati, P.; Ripoche, P.; Rubin, D.; Schlegel, D.; Spadafora, A.; Stanford, A.; Stern, D.; Yasuda, N.; Yee, H.; Cosmology Project, Supernova

    2010-01-01

    We report results from the Hubble Space Telescope (HST) Cluster Supernova Survey with the Advanced Camera for Surveys (ACS) (PI: Perlmutter; see Dawson et al. AJ, 2009). We have introduced a novel approach to discover and follow Type Ia supernovae (SNeIa). With HST, we monitored 25 massive clusters (0.9 < z < 1.4) found by the RCS, XMM, IRAC, and RDCS surveys and conducted spectroscopic observations with the Keck, Subaru, and VLT telescopes. Sixteen SNe were discovered at 0.95 < z < 1.41, nine of which were in galaxy clusters (for a discussion of the rates, see K. Barbary, oral presentation at this meeting). The SNe in galaxy clusters are found primarily in early type galaxies in the cluster red-sequence that have been shown to be nearly dust-free and uniform populations (see poster presentation by Meyers et al.). The reduction and control of systematic error is an urgent task for the study of dark energy today (see Rubin et al. poster presentation), and we discuss how this unique SNe Ia data set reduces both statistical and more importantly systematic uncertainty at the highest redshifts. This work has been supported by the Office of Science, U.S. Department of Energy, through contract DE-AC02-05CH11231 and in part by NASA through grants associated with HST-GO-10496.

  1. ROTATING GLOBULAR CLUSTERS

    SciTech Connect

    Bianchini, P.; Varri, A. L.; Bertin, G.; Zocchi, A.

    2013-07-20

    Internal rotation is thought to play a major role in the dynamics of some globular clusters. However, in only a few cases has internal rotation been studied by the quantitative application of realistic and physically justified global models. Here, we present a dynamical analysis of the photometry and three-dimensional kinematics of {omega} Cen, 47 Tuc, and M15, by means of a recently introduced family of self-consistent axisymmetric rotating models. The three clusters, characterized by different relaxation conditions, show evidence of differential rotation and deviations from sphericity. The combination of line-of-sight velocities and proper motions allows us to determine their internal dynamics, predict their morphology, and estimate their dynamical distance. The well-relaxed cluster 47 Tuc is interpreted very well by our model; internal rotation is found to explain the observed morphology. For M15, we provide a global model in good agreement with the data, including the central behavior of the rotation profile and the shape of the ellipticity profile. For the partially relaxed cluster {omega} Cen, the selected model reproduces the complex three-dimensional kinematics; in particular, the observed anisotropy profile, characterized by a transition from isotropy to weakly radial anisotropy and then to tangential anisotropy in the outer parts. The discrepancy found for the steep central gradient in the observed line-of-sight velocity dispersion profile and for the ellipticity profile is ascribed to the condition of only partial relaxation of this cluster and the interplay between rotation and radial anisotropy.

  2. Tomato R2R3-MYB Proteins SlANT1 and SlAN2: Same Protein Activity, Different Roles

    PubMed Central

    Bassolino, Laura; Povero, Giovanni; Spelt, Cornelis; Buti, Sara; Giuliano, Giovanni; Quattrocchio, Francesca; Koes, Ronald; Perata, Pierdomenico; Gonzali, Silvia

    2015-01-01

    Anthocyanins are water-soluble polyphenolic compounds with a high nutraceutical value. Despite the fact that cultivated tomato varieties do not accumulate anthocyanins in the fruit, the biosynthetic pathway can be activated in the vegetative organs by several environmental stimuli. Little is known about the molecular mechanisms regulating anthocyanin synthesis in tomato. Here, we carried out a molecular and functional characterization of two genes, SlAN2 and SlANT1, encoding two R2R3-MYB transcription factors. We show that both can induce ectopic anthocyanin synthesis in transgenic tomato lines, including the fruit. However, only SlAN2 acts as a positive regulator of anthocyanin synthesis in vegetative tissues under high light or low temperature conditions. PMID:26308527

  3. Design and construction of the structure of the DEMONSTRATOR of the CALIFA detector for R3B-FAIR using carbon-fiber composites

    NASA Astrophysics Data System (ADS)

    Casarejos, E.; Alvarez-Pol, H.; Cortina-Gil, D.; Durán, I.; Iglesias, A.; Izquierdo, P.; Yañez, P.; Vilán, J. A.

    2014-03-01

    In this paper we describe the DEMONSTRATOR structures and active units (PETALs) developed for the detector CALIFA of the experiment R3B - FAIR. The design is based in the CALIFA BARREL mechanical solutions, but adapted to the characteristics of the PETALs, namely in what concerns the load distribution during setup and service. The R&D program defined the materials and procedures for both producing the pieces of carbon fiber (CF) composites as well as the mounting of the bundles to make an alveolar structure. The procedures also include a quality control program to ensure the dimensional properties of the CF assemblies. We are also developing the use of tomographic imaging analysis for this quality program, that will be of mayor interest in the construction of the future CALIFA CF-structure.

  4. [Novel large deletion c.22-1320_633+1224del in the CYB5R3 gene from patients with hereditary methemoglobinemia].

    PubMed

    Galeeva, N M; Nenasheva, S A; Kleĭmenova, I S; Poliakov, A V

    2012-11-01

    Hereditary types I and II methemoglobinemia is a rare autosomal recessive disease due to a deficiency of either soluble or soluble and membrane-bound forms of the enzyme NADH-cytochrome b5 reductase. The molecular genetic bases of both types of the disease consist in changes in the CYB5R3 gene. In this study, the novel and, to date, only large deletion in this gene is described, discovered in two unrelated families with types I and II methemoglobinemia. The common founder haplotype on the chromosomes carrying this mutation was identified. A universal approach for searching for the deletion boundaries was developed, and the c.22-1320_633+1224del deletion breakpoints were determined. In addition, a system for identifying the deletion in heterozygous and homozygous states was designed. PMID:23297489

  5. Effect of Perturbations in the Coriolis and Centrifugal Forces on the Stability of L 4 in the Relativistic R3BP

    NASA Astrophysics Data System (ADS)

    Singh, Jagadish; Bello, Nakone

    2015-02-01

    The centrifugal and Coriolis forces do not appear as a result of physically imposed forces, but are due to a special property of a rotation. Thus, these forces are called pseudo-forces or `fictitious forces'. They are merely an artifact of the rotation of the reference frame adopted. This paper studies the motion of a test particle in the neighbourhood of the triangular point L 4 in the framework of the perturbed relativistic restricted three-body problem (R3BP) when small perturbations are conferred to the centrifugal and Coriolis forces. It is found that the position and stability of the triangular point are affected by both the relativistic factor and small perturbations in the Coriolis and centrifugal forces. As an application, the Sun-Earth system is considered.

  6. Control of root hair development in Arabidopsis thaliana by an endoplasmic reticulum anchored member of the R2R3-MYB transcription factor family.

    PubMed

    Slabaugh, Erin; Held, Michael; Brandizzi, Federica

    2011-08-01

    The evolution of roots and root hairs was a crucial innovation that contributed to the adaptation of plants to a terrestrial environment. Initiation of root hairs involves transcriptional cues that in part determine cell patterning of the root epidermis. Once root hair initiation has occurred, elongation of the root hair takes place. Although many genes have been identified as being involved in root hair development, many contributors remain uncharacterized. In this study we report on the involvement of a member (here dubbed maMYB) of the plant-specific R2R3-MYB family of transcription factors in root hair elongation in Arabidopsis. We show that maMYB is associated with the endoplasmic reticulum membrane with the transcription factor domain exposed to the cytosol, suggesting that it may function as a membrane-tethered transcription factor. We demonstrate that a truncated form of maMYB (maMYB⁸⁴⁻³⁰⁹), which contains the R2R3-MYB transcription factor domain, is localized and retained in the nucleus, where it regulates gene expression. Silencing of maMyb resulted in plants with significantly shorter root hairs but similar root hair density compared with wild type, implying a role of the protein in root hair elongation. 2,4-D (2,4-dichlorophenoxyacetic acid), an exogenous auxin analog that promotes root hair elongation, rescued the short root hair phenotype and maMyb mRNA was induced in the presence of 2,4-D and IAA (indole-3-acetic acid). These results indicate a functional role of maMYB, which is integrated with auxin, in root hair elongation in Arabidopsis. PMID:21477080

  7. Vanadogermanate cluster anions.

    PubMed

    Whitfield, T; Wang, X; Jacobson, A J

    2003-06-16

    Three novel vanadogermanate cluster anions have been synthesized by hydrothermal reactions. The cluster anions are derived from the (V(18)O(42)) Keggin cluster shell by substitution of V=O(2+) "caps" by Ge(2)O(OH)(2)(4+) species. In Cs(8)[Ge(4)V(16)O(42)(OH)(4)].4.7H(2)O, 1, (monoclinic, space group C2/c (No. 15), Z = 8, a = 44.513(2) A, b = 12.7632(7) A, c = 22.923(1) A, beta = 101.376(1) degrees ) and (pipH(2))(4)(pipH)(4)[Ge(8)V(14)O(50).(H(2)O)] (pip = C(4)N(2)H(10)), 2 (tetragonal, space group P4(2)/nnm (No. 134), Z = 2, a = 14.9950(7) A, c = 18.408(1) A), two and four VO(2+) caps are replaced, respectively, and each cluster anion encapsulates a water molecule. In K(5)H(8)Ge(8)V(12)SO(52).10H(2)O, 3, (tetragonal, space group I4/m (No. 87), Z = 2, a = 15.573(1) A, c = 10.963(1) A), four VO(2+) caps are replaced by Ge(2)O(OH)(2)(4+) species, and an additional two are omitted. The cluster ion in 3 contains a sulfate anion disordered over two positions. The cluster anions are analogous to the vanadoarsenate anions [V(18)(-)(n)()As(2)(n)()O(42)(X)](m)(-) (X = SO(3), SO(4), Cl; n = 3, 4) previously reported. PMID:12793808

  8. Clusters in storage rings

    SciTech Connect

    Hvelplund, P.; Andersen, J. U.; Hansen, K.

    1999-01-15

    Anions of fullerenes and small metal clusters have been stored in the storage rings ASTRID and ELISA. Decays on a millisecond time scale are due to electron emission from metastable excited states. For the fullerenes the decay curves have been interpreted in terms of thermionic emission quenched by radiative cooling. The stored clusters were heated by a Nd:YAG laser resulting in increased emission rates. With an OPO laser this effect was used to study the wavelength dependence of the absorption of light in hot C{sub 60}{sup -} ion molecules.

  9. Clustering of Resting State Networks

    PubMed Central

    Lee, Megan H.; Hacker, Carl D.; Snyder, Abraham Z.; Corbetta, Maurizio; Zhang, Dongyang; Leuthardt, Eric C.; Shimony, Joshua S.

    2012-01-01

    Background The goal of the study was to demonstrate a hierarchical structure of resting state activity in the healthy brain using a data-driven clustering algorithm. Methodology/Principal Findings The fuzzy-c-means clustering algorithm was applied to resting state fMRI data in cortical and subcortical gray matter from two groups acquired separately, one of 17 healthy individuals and the second of 21 healthy individuals. Different numbers of clusters and different starting conditions were used. A cluster dispersion measure determined the optimal numbers of clusters. An inner product metric provided a measure of similarity between different clusters. The two cluster result found the task-negative and task-positive systems. The cluster dispersion measure was minimized with seven and eleven clusters. Each of the clusters in the seven and eleven cluster result was associated with either the task-negative or task-positive system. Applying the algorithm to find seven clusters recovered previously described resting state networks, including the default mode network, frontoparietal control network, ventral and dorsal attention networks, somatomotor, visual, and language networks. The language and ventral attention networks had significant subcortical involvement. This parcellation was consistently found in a large majority of algorithm runs under different conditions and was robust to different methods of initialization. Conclusions/Significance The clustering of resting state activity using different optimal numbers of clusters identified resting state networks comparable to previously obtained results. This work reinforces the observation that resting state networks are hierarchically organized. PMID:22792291

  10. Precision Photometric Redshifts Of Clusters

    NASA Astrophysics Data System (ADS)

    Holden, L.; Annis, J.

    2006-06-01

    Clusters of galaxies provide a means to achieve more precise photometric redshifts than achievable using individual galaxies simply because of the numbers of galaxies available in clusters. Here we examine the expectation that one can achieve root-N improvement using the N galaxies in a cluster. We extracted from a maxBCG SDSS cluster catalog 28,000 clusters and used SDSS DR4 spectra to find spectroscopic redshifts for the cluster. We examined both using the brightest cluster galaxy redshift as the proxy for the cluster and using the mean of a collection of galaxies within a given angular diameter and redshift (about the cluster photo-z) range. We find that the BCG provides a better estimate of the cluster redshift, to be understood in the context of a handful of spectra in the neighborhood of the cluster. We find that the cluster photo-z has an approximate root-N scaling behavior with the normalization for maxBCG techniques being 0.07. We predict what ``afterburner photo-z'' techniques, which use individual galaxy photo-z's good to 0.03-0.05, can achieve for cluster catalogs and for cluster cosmology.

  11. 78 FR 56921 - South Bay Salt Pond Restoration Project, Phase 2 (Ponds R3, R4, R5, S5, A1, A2W, A8, A8S, A19...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-09-16

    ... Fish and Wildlife Service South Bay Salt Pond Restoration Project, Phase 2 (Ponds R3, R4, R5, S5, A1... restoration of ponds R3, R4, R5, S5, A1, A2W, A8, A8S, A19, A20, and A21 at the Don Edwards National Wildlife... 2 of the South Bay Salt Pond Restoration Project and consists of restoring and enhancing over...

  12. Trans-tail regulation of MLL4-catalyzed H3K4 methylation by H4R3 symmetric dimethylation is mediated by a tandem PHD of MLL4.

    PubMed

    Dhar, Shilpa S; Lee, Sung-Hun; Kan, Pu-Yeh; Voigt, Philipp; Ma, Li; Shi, Xiaobing; Reinberg, Danny; Lee, Min Gyu

    2012-12-15

    Mixed-lineage leukemia 4 (MLL4; also called MLL2 and ALR) enzymatically generates trimethylated histone H3 Lys 4 (H3K4me3), a hallmark of gene activation. However, how MLL4-deposited H3K4me3 interplays with other histone marks in epigenetic processes remains largely unknown. Here, we show that MLL4 plays an essential role in differentiating NT2/D1 stem cells by activating differentiation-specific genes. A tandem plant homeodomain (PHD(4-6)) of MLL4 recognizes unmethylated or asymmetrically dimethylated histone H4 Arg 3 (H4R3me0 or H4R3me2a) and is required for MLL4's nucleosomal methyltransferase activity and MLL4-mediated differentiation. Kabuki syndrome mutations in PHD(4-6) reduce PHD(4-6)'s binding ability and MLL4's catalytic activity. PHD(4-6)'s binding strength is inhibited by H4R3 symmetric dimethylation (H4R3me2s), a gene-repressive mark. The protein arginine methyltransferase 7 (PRMT7), but not PRMT5, represses MLL4 target genes by up-regulating H4R3me2s levels and antagonizes MLL4-mediated differentiation. Consistently, PRMT7 knockdown increases MLL4-catalyzed H3K4me3 levels. During differentiation, decreased H4R3me2s levels are associated with increased H3K4me3 levels at a cohort of genes, including many HOXA and HOXB genes. These findings indicate that the trans-tail inhibition of MLL4-generated H3K4me3 by PRMT7-regulated H4R3me2s may result from H4R3me2s's interference with PHD(4-6)'s binding activity and is a novel epigenetic mechanism that underlies opposing effects of MLL4 and PRMT7 on cellular differentiation. PMID:23249737

  13. Antibody h-R3-dendrimer mediated siRNA has excellent endosomal escape and tumor targeted delivery ability, and represents efficient siPLK1 silencing and inhibition of cell proliferation, migration and invasion

    PubMed Central

    Li, Jun; Liu, Jing; Li, Shengnan; Hao, Yanli; Chen, Lei; Zhang, Xiaoning

    2016-01-01

    The major obstacle to developing siRNA delivery is their extracellular and intracellular barriers. Herein, a humanized anti-EGFR monoclonal antibody h-R3 was developed to modify the self-assembled binary complexes (dendriplexes) of PAMAM and siRNA via electrostatic interactions, and two common ligands HSA and EGF were used as a control. Compared to dendriplexes, h-R3/EGF/HSA-dendriplexes showed increased particle size, decreased zeta potentials and lower cytotoxicity. Moreover, h-R3-dendriplexes presented greater cellular uptake and excellent endosomal escape ability in HepG2 cells. Ex vivo fluorescence imaging revealed that h-R3-dendriplexes showed higher targeted delivery and gene expression in the tumors than dendriplexes, HSA-dendriplexes and EGF-dendriplexes, which was in agreement with confocal results of cryosections. Furthermore, h-R3-dendriplexes for siPLK1 delivery indicated efficient gene silencing, potentiated cell growth inhibition and cell apoptosis, and suppressed cellular migration/invasion. These results indicate that h-R3-dendriplexes represent a great potential to be used as efficient targeted siRNA delivery carriers. PMID:26883109

  14. Selective expression of the type 3 isoform of ryanodine receptor Ca{sup 2+} release channel (RyR3) in a subset of slow fibers in diaphragm and cephalic muscles of adult rabbits

    SciTech Connect

    Conti, Antonio; Reggiani, Carlo; Sorrentino, Vincenzo . E-mail: v.sorrentino@unisi.it

    2005-11-11

    The expression pattern of the RyR3 isoform of Ca{sup 2+} release channels was analysed by Western blot in neonatal and adult rabbit skeletal muscles. The results obtained show that the expression of the RyR3 isoform is developmentally regulated. In fact, RyR3 expression was detected in all muscles analysed at 2 and 15 days after birth while, in adult animals, it was restricted to a subset of muscles that includes diaphragm, masseter, pterygoideus, digastricus, and tongue. Interestingly, all of these muscles share a common embryonic origin being derived from the somitomeres or from the cephalic region of the embryo. Immunofluorescence analysis of rabbit skeletal muscle cross-sections showed that RyR3 staining was detected in all fibers of neonatal muscles. In contrast, in those adult muscles expressing RyR3 only a fraction of fibers was labelled. Staining of these muscles with antibodies against fast and slow myosins revealed a close correlation between expression of RyR3 and fibers expressing slow myosin isoform.

  15. The metabotropic glutamate receptor mGluR3 is critically required for hippocampal long-term depression and modulates long-term potentiation in the dentate gyrus of freely moving rats.

    PubMed

    Pöschel, Beatrice; Wroblewska, Barbara; Heinemann, Uwe; Manahan-Vaughan, Denise

    2005-09-01

    Group II metabotropic glutamate receptors (mGluRs) play an important role in the regulation of hippocampal synaptic plasticity in vivo: long-term potentiation (LTP) is inhibited and long-term depression (LTD) is enhanced by activation of these receptors. The contribution, in vivo, of the individual group II mGluR subtypes has not been characterized. We analysed the involvement of the subtype mGluR3 in LTD and LTP. Rats were implanted with electrodes to enable chronic measurement of evoked potentials from medial perforant path-dentate gyrus synapses. Neither the selective mGluR3 agonist, N-acetylaspartylglutamate (NAAG), nor the antagonist beta-NAAG, given intracerebrally, affected basal synaptic transmission. beta-NAAG significantly inhibited LTD expression. NAAG exhibited transient inhibitory effects on the intermediate phase of LTD. Whereas NAAG altered paired-pulse responses, beta-NAAG had no effect, suggesting that antagonism of mGluR3 prevents LTD via a postsynaptic mechanism, whereas agonist activation of mGluR3 modulates LTD at a presynaptic locus. NAAG impaired the expression of LTP, whereas beta-NAAG had no effect. NAAG effects on LTP were blocked by EGLU, a selective group II mGluR antagonist. Our data suggest an essential role for mGluR3 in LTD, and a modulatory role for mGluR3 in LTP, with effects being mediated by distinct pre- and post-synaptic loci. PMID:15635057

  16. Identification, cloning and characterization of R2R3-MYB gene family in canola (Brassica napus L.) identify a novel member modulating ROS accumulation and hypersensitive-like cell death.

    PubMed

    Chen, Bisi; Niu, Fangfang; Liu, Wu-Zhen; Yang, Bo; Zhang, Jingxiao; Ma, Jieyu; Cheng, Hao; Han, Feng; Jiang, Yuan-Qing

    2016-04-01

    The R2R3-MYB proteins comprise one of the largest families of transcription factors in plants. Although genome-wide analysis of this family has been carried out in some plant species, little is known about R2R3-MYB genes in canola (Brassica napus L.). In this study, we have identified 76 R2R3-MYB genes in the canola genome through mining of expressed sequence tags (ESTs). The cDNA sequences of 44 MYB genes were successfully cloned. The transcriptional activities of BnaMYB proteins encoded by these genes were assayed in yeast. The subcellular localizations of representative R2R3-MYB proteins were investigated through GFP fusion. Besides, the transcript abundance level analysis during abiotic conditions and ABA treatment identified a group of R2R3-MYB genes that responded to one or more treatments. Furthermore, we identified a previously functionally unknown MYB gene-BnaMYB78, which modulates reactive oxygen species (ROS)-dependent cell death in Nicotiana benthamiana, through regulating the transcription of a few ROS- and defence-related genes. Taken together, this study has provided a solid foundation for understanding the roles and regulatory mechanism of canola R2R3-MYB genes. PMID:26800702

  17. Identification, cloning and characterization of R2R3-MYB gene family in canola (Brassica napus L.) identify a novel member modulating ROS accumulation and hypersensitive-like cell death

    PubMed Central

    Chen, Bisi; Niu, Fangfang; Liu, Wu-Zhen; Yang, Bo; Zhang, Jingxiao; Ma, Jieyu; Cheng, Hao; Han, Feng; Jiang, Yuan-Qing

    2016-01-01

    The R2R3-MYB proteins comprise one of the largest families of transcription factors in plants. Although genome-wide analysis of this family has been carried out in some plant species, little is known about R2R3-MYB genes in canola (Brassica napus L.). In this study, we have identified 76 R2R3-MYB genes in the canola genome through mining of expressed sequence tags (ESTs). The cDNA sequences of 44 MYB genes were successfully cloned. The transcriptional activities of BnaMYB proteins encoded by these genes were assayed in yeast. The subcellular localizations of representative R2R3-MYB proteins were investigated through GFP fusion. Besides, the transcript abundance level analysis during abiotic conditions and ABA treatment identified a group of R2R3-MYB genes that responded to one or more treatments. Furthermore, we identified a previously functionally unknown MYB gene-BnaMYB78, which modulates reactive oxygen species (ROS)-dependent cell death in Nicotiana benthamiana, through regulating the transcription of a few ROS- and defence-related genes. Taken together, this study has provided a solid foundation for understanding the roles and regulatory mechanism of canola R2R3-MYB genes. PMID:26800702

  18. Construction Cluster Skills Standards.

    ERIC Educational Resources Information Center

    DePaul Univ., Chicago, IL. Built Environment Partnership.

    Twelve construction cluster skill standards and associated benchmarks were developed as part of a federally funded school-to-work initiative that included the following parties: the Chicago Public Schools; City Colleges of Chicago; and business, labor, and community organizations. The standards, which include core academic, generic workplace…

  19. Clustered for Success

    ERIC Educational Resources Information Center

    Brulles, Dina; Winebrenner, Susan

    2012-01-01

    Schools need to address the needs of their students with high ability. Not only does this raise achievement levels schoolwide, it also attracts students from surrounding districts and recaptures advanced learners who left the school because their needs weren't being met. One practical intervention--cluster grouping--provides an inclusive…

  20. Nuclear Cluster Physics

    SciTech Connect

    Kamimura, Masayasu

    2011-05-06

    Predictive power of theory needs good models and accurate calculation methods to solve the Schroedinger equations of the systems concerned. We present some examples of successful predictions based on the nuclear cluster models of light nuclei and hypernuclei and on the calculation methods that have been developed by Kyushu group.

  1. Detecting alternative graph clusterings.

    PubMed

    Mandala, Supreet; Kumara, Soundar; Yao, Tao

    2012-07-01

    The problem of graph clustering or community detection has enjoyed a lot of attention in complex networks literature. A quality function, modularity, quantifies the strength of clustering and on maximization yields sensible partitions. However, in most real world networks, there are an exponentially large number of near-optimal partitions with some being very different from each other. Therefore, picking an optimal clustering among the alternatives does not provide complete information about network topology. To tackle this problem, we propose a graph perturbation scheme which can be used to identify an ensemble of near-optimal and diverse clusterings. We establish analytical properties of modularity function under the perturbation which ensures diversity. Our approach is algorithm independent and therefore can leverage any of the existing modularity maximizing algorithms. We numerically show that our methodology can systematically identify very different partitions on several existing data sets. The knowledge of diverse partitions sheds more light into the topological organization and helps gain a more complete understanding of the underlying complex network. PMID:23005495

  2. Detecting alternative graph clusterings

    NASA Astrophysics Data System (ADS)

    Mandala, Supreet; Kumara, Soundar; Yao, Tao

    2012-07-01

    The problem of graph clustering or community detection has enjoyed a lot of attention in complex networks literature. A quality function, modularity, quantifies the strength of clustering and on maximization yields sensible partitions. However, in most real world networks, there are an exponentially large number of near-optimal partitions with some being very different from each other. Therefore, picking an optimal clustering among the alternatives does not provide complete information about network topology. To tackle this problem, we propose a graph perturbation scheme which can be used to identify an ensemble of near-optimal and diverse clusterings. We establish analytical properties of modularity function under the perturbation which ensures diversity. Our approach is algorithm independent and therefore can leverage any of the existing modularity maximizing algorithms. We numerically show that our methodology can systematically identify very different partitions on several existing data sets. The knowledge of diverse partitions sheds more light into the topological organization and helps gain a more complete understanding of the underlying complex network.

  3. The Cluster Active Archive

    NASA Astrophysics Data System (ADS)

    Laakso, H.; Perry, C. H.; Escoubet, C. P.; McCaffrey, S.; Herment, D.; Esson, S.; Bowen, H.; Buggy, O.; Taylor, M. G.

    2008-05-01

    The four-satellite Cluster mission investigates small-scale structures (in three dimensions) of the Earth's plasma environment, such as those involved in the interaction between the solar wind and the magnetospheric plasma, in global magnetotail dynamics, in cross-tail currents, and in the formation and dynamics of the neutral line and of plasmoids. The Cluster Active Archive CAA (http://caa.estec.esa.int/) will contain the entire set of Cluster high resolution data and other allied products in a standard format and with a complete set of metadata in machine readable form. The data archived are (1) publicly accessible, (2) of the best quality achievable with the given resources, and (3) suitable for science use and publication by both the Cluster and broader scientific community. The CAA to provide user friendly services for searching and accessing these data, e.g. users can save and restore their selections speeding up similar requests. The CAA is continuing to extend and improve the online capabilities of the system, e.g., the CAA products can be downloaded either via a web interface or a machine accessible interface.

  4. Health Occupations Cluster.

    ERIC Educational Resources Information Center

    Walraven, Catherine; And Others

    These instructional materials consist of a series of curriculum worksheets that cover tasks to be mastered by students in health occupations cluster programs. Covered in the curriculum worksheets are diagnostic procedures; observing/recording/reporting/planning; safety; nutrition/elimination; hygiene/personal care/comfort;…

  5. FUEL ROD CLUSTERS

    DOEpatents

    Schultz, A.B.

    1959-08-01

    A cluster of nuclear fuel rods and a tubular casing therefor through which a coolant flows in heat-exchange contact with the fuel rods is described. The fuel rcds are held in the casing by virtue of the compressive force exerted between longitudinal ribs of the fuel rcds and internal ribs of the casing or the internal surfaces thereof.

  6. Clustering in Bubble Suspensions

    NASA Astrophysics Data System (ADS)

    Zenit, Roberto

    2000-11-01

    A monidisperse bubble suspension is studied experimentally for the limit in which the Weber number is small and the Reynolds number is large. For this regime the suspension can be modeled using potential flow theory to describe the dynamics of the interstitial fluid. Complete theoretical descriptions have been composed (Spelt and Sangani, 1998) to model the behavior of these suspensions. Bubble clustering is a natural instability that arises from the potential flow considerations, in which bubbles tend to align in horizontal rafts as they move upwards. The appearance of bubble clusters was recently corroborated experimentally by Zenit et al. (2000), who found that although clusters did appear, their strength was not as strong as the predictions. Experiments involving gravity driven shear flows are used to explain the nature of the clustering observed in these type of flows. Balances of the bubble phase pressure (in terms of a calculated diffusion coefficient) and the Maxwell pressure (from the potential flow description) are presented to predict the stability of the bubble suspension. The predictions are compared with experimental results.

  7. Buckets, Clusters and Dienst

    NASA Technical Reports Server (NTRS)

    Nelson, Michael L.; Maly, Kurt; Shen, Stewart N. T.

    1997-01-01

    In this paper we describe NCSTRL+, a unified, canonical digital library for scientific and technical information (STI). NCSTRL+ is based on the Networked Computer Science Technical Report Library (NCSTRL), a World Wide Web (WWW) accessible digital library (DL) that provides access to over 80 university departments and laboratories. NCSTRL+ implements two new technologies: cluster functionality and publishing "buckets." We have extended the Dienst protocol, the protocol underlying NCSTRL, to provide the ability to "cluster" independent collections into a logically centralized digital library based upon subject category classification, type of organization, and genres of material. The concept of "buckets" provides a mechanism for publishing and managing logically linked entities with multiple data formats. The NCSTRL+ prototype DL contains the holdings of NCSTRL and the NASA Technical Report Server (NTRS). The prototype demonstrates the feasibility of publishing into a multi-cluster DL, searching across clusters, and storing and presenting buckets of information. We show that the overhead for these additional capabilities is minimal to both the author and the user when compared to the equivalent process within NCSTRL.

  8. Curriculum Guide Construction Cluster.

    ERIC Educational Resources Information Center

    Kline, Ken

    As part of a model construction cluster curriculum development project, this guide was developed and implemented in the Beaverton (Oregon) School District. The curriculum guide contains 16 units covering the following topics: introduction to construction jobs; safety and first aid; blueprint readings; basic mathematics; site work; framing; roofing…

  9. Health Occupations Cluster Guide.

    ERIC Educational Resources Information Center

    Oregon State Dept. of Education, Salem.

    Intended to assist the vocational teacher in designing and implementing a cluster program in health occupations, this guide suggests ideas for teaching the specific knowledge and skills that qualify students for entry-level employment in the health occupations field. The knowledge and skills are applicable to 12 occupations: dental assistant;…

  10. PDMS embedded Ag clusters: Coalescence and cluster-matrix interaction

    NASA Astrophysics Data System (ADS)

    Roese, S.; Engemann, D.; Hoffmann, S.; Latussek, K.; Sternemann, C.; Hövel, H.

    2016-05-01

    Polydimethylsiloxane (PDMS) has proven to be a suitable embedding medium for silver clusters to prevent aggregation. In order to investigate the influence of the PDMS on the electronic and local atomic structure of the clusters the measurement of x-ray absorption near edge structure (XANES) spectra for different coverages of silver clusters in PDMS and calculations of corresponding XANES spectra have been performed. The coalescence process and the cluster-PDMS interaction were investigated with XANES.

  11. The Rotation of Galaxy Clusters

    NASA Astrophysics Data System (ADS)

    Tovmassian, H. M.

    2015-09-01

    The method for detection of the galaxy cluster rotation based on the study of distribution of member galaxies with velocities lower and higher than the cluster mean velocity over the cluster image is proposed. The search for rotation is made for flat clusters with a/b > 1.8 and BMI type clusters which are expected to be rotating. For comparison there were studied also round clusters and clusters of NBMI type, the second by brightness galaxy, which does not differ significantly from the cluster cD galaxy. Seventeen out of studied 65 clusters are found to be rotating. It was found that the detection rate is sufficiently high for flat clusters, over 60%, and clusters of BMI type with dominant cD galaxy, ≈ 35% . The obtained results show that clusters were formed from the huge primordial gas clouds and preserved the rotation of the primordial clouds, unless they did not experience mergings with other clusters and groups of galaxies, as a result of which the rotation was prevented.

  12. Femtosecond dynamics of cluster expansion

    NASA Astrophysics Data System (ADS)

    Gao, Xiaohui; Wang, Xiaoming; Shim, Bonggu; Arefiev, Alexey; Tushentsov, Mikhail; Breizman, Boris; Downer, Mike

    2010-03-01

    Noble gas clusters irradiated by intense ultrafast laser expand quickly and become typical plasma in picosecond time scale. During the expansion, the clustered plasma demonstrates unique optical properties such as strong absorption and positive contribution to the refractive index. Here we studied cluster expansion dynamics by fs-time-resolved refractive index and absorption measurements in cluster gas jets after ionization and heating by an intense pump pulse. The refractive index measured by frequency domain interferometry (FDI) shows the transient positive peak of refractive index due to clustered plasma. By separating it from the negative contribution of the monomer plasma, we are able to determine the cluster fraction. The absorption measured by a delayed probe shows the contribution from clusters of various sizes. The plasma resonances in the cluster explain the enhancement of the absorption in our isothermal expanding cluster model. The cluster size distribution can be determined. A complete understanding of the femtosecond dynamics of cluster expansion is essential in the accurate interpretation and control of laser-cluster experiments such as phase-matched harmonic generation in cluster medium.

  13. Cluster Active Archive: Overview

    NASA Astrophysics Data System (ADS)

    Laakso, H.; Perry, C.; McCaffrey, S.; Herment, D.; Allen, A. J.; Harvey, C. C.; Escoubet, C. P.; Gruenberger, C.; Taylor, M. G. G. T.; Turner, R.

    The four-satellite Cluster mission investigates the small-scale structures and physical processes related to interaction between the solar wind and the magnetospheric plasma. The Cluster Active Archive (CAA) (URL: http://caa.estec.esa.int) will contain the entire set of Cluster high-resolution data and other allied products in a standard format and with a complete set of metadata in machine readable format. The total amount of the data files in compressed format is expected to exceed 50 TB. The data archive is publicly accessible and suitable for science use and publication by the world-wide scientific community. The CAA aims to provide user-friendly services for searching and accessing these data and ancillary products. The CAA became operational in February 2006 and as of Summer 2008 has data from most of the Cluster instruments for at least the first 5 years of operations (2001-2005). The coverage and range of products are being continually improved with more than 200 datasets available from each spacecraft, including high-resolution magnetic and electric DC fields and wave spectra; full three-dimensional electron and ion distribution functions from a few eV to hundreds of keV; and various ancillary and browse products to help with spacecraft and event location. The CAA is continuing to extend and improve the online capabilities of the system and the quality of the existing data. It will add new data files for years 2006-2009 and is preparing for the long-term archive with complete coverage after the completion of the Cluster mission.

  14. Choosing the Number of Clusters in K-Means Clustering

    ERIC Educational Resources Information Center

    Steinley, Douglas; Brusco, Michael J.

    2011-01-01

    Steinley (2007) provided a lower bound for the sum-of-squares error criterion function used in K-means clustering. In this article, on the basis of the lower bound, the authors propose a method to distinguish between 1 cluster (i.e., a single distribution) versus more than 1 cluster. Additionally, conditional on indicating there are multiple…

  15. Animation of the Phoenix Cluster

    NASA Video Gallery

    This animation shows how large numbers of stars form in the Phoenix Cluster. It begins by showing several galaxies in the cluster and hot gas (in red). This hot gas contains more normal matter than...

  16. The Assembly of Galaxy Clusters

    SciTech Connect

    Berrier, Joel C.; Stewart, Kyle R.; Bullock, James S.; Purcell, Chris W.; Barton, Elizabeth J.; Wechsler, Risa H.

    2008-05-16

    We study the formation of fifty-three galaxy cluster-size dark matter halos (M = 10{sup 14.0-14.76} M{sub {circle_dot}}) formed within a pair of cosmological {Lambda}CDM N-body simulations, and track the accretion histories of cluster subhalos with masses large enough to host {approx} 0.1L{sub *} galaxies. By associating subhalos with cluster galaxies, we find the majority of galaxies in clusters experience no 'pre-processing' in the group environment prior to their accretion into the cluster. On average, {approx} 70% of cluster galaxies fall into the cluster potential directly from the field, with no luminous companions in their host halos at the time of accretion; and less than {approx} 12% are accreted as members of groups with five or more galaxies. Moreover, we find that cluster galaxies are significantly less likely to have experienced a merger in the recent past ({approx}< 6 Gyr) than a field halo of the same mass. These results suggest that local, cluster processes like ram-pressure stripping, galaxy harassment, or strangulation play the dominant role in explaining the difference between cluster and field populations at a fixed stellar mass; and that pre-evolution or past merging in the group environment is of secondary importance for setting cluster galaxy properties for most clusters. The accretion times for z = 0 cluster members are quite extended, with {approx} 20% incorporated into the cluster halo more than 7 Gyr ago and {approx} 20% within the last 2 Gyr. By comparing the observed morphological fractions in cluster and field populations, we estimate an approximate time-scale for late-type to early-type transformation within the cluster environment to be {approx} 6 Gyr.

  17. [Cluster analysis in biomedical researches].

    PubMed

    Akopov, A S; Moskovtsev, A A; Dolenko, S A; Savina, G D

    2013-01-01

    Cluster analysis is one of the most popular methods for the analysis of multi-parameter data. The cluster analysis reveals the internal structure of the data, group the separate observations on the degree of their similarity. The review provides a definition of the basic concepts of cluster analysis, and discusses the most popular clustering algorithms: k-means, hierarchical algorithms, Kohonen networks algorithms. Examples are the use of these algorithms in biomedical research. PMID:24640781

  18. The Orion nebula star cluster

    NASA Technical Reports Server (NTRS)

    Panek, R. J.

    1982-01-01

    Photography through filters which suppress nebular light reveal a clustering of faint red stars centered on the Trapezium, this evidences a distinct cluster within the larger OB1 association. Stars within about 20 ft of trapezium comprise the Orion Nebula star cluster are considered. Topics discussed re: (1) extinction by dust grains; (2) photometric peculiarities; (3) spectroscopic peculiarities; (4) young variables; (5) the distribution and motion of gas within the cluster.

  19. Clustering signatures classify directed networks

    NASA Astrophysics Data System (ADS)

    Ahnert, S. E.; Fink, T. M. A.

    2008-09-01

    We use a clustering signature, based on a recently introduced generalization of the clustering coefficient to directed networks, to analyze 16 directed real-world networks of five different types: social networks, genetic transcription networks, word adjacency networks, food webs, and electric circuits. We show that these five classes of networks are cleanly separated in the space of clustering signatures due to the statistical properties of their local neighborhoods, demonstrating the usefulness of clustering signatures as a classifier of directed networks.

  20. Observations of Distant Clusters

    NASA Technical Reports Server (NTRS)

    Donahue, Megan

    2004-01-01

    The is the proceedings and papers supported by the LTSA grant: Homer, D. J.\\& Donahue, M. 2003, in "The Emergence of Cosmic Structure": 13'h Astrophysics Conference Proceedings, Vol. 666,3 1 1-3 14, (AIP). Baumgartner, W. H., Loewenstein, M., Horner, D. J., Mushotzky, R. F. 2003, HEAD- AAS, 35.3503. Homer, D. J. , Donahue, M., Voit G. M. 2003, HEAD-AAS, 35.1309. Nowak, M. A., Smith, B., Donahue, M., Stocke, J. 2003, HEAD-AAS, 35.1316. Scott, D., Borys, C., Chapman, S. C., Donahue, M., Fahlman, G. G., Halpem, M. Newbury, P. 2002, AAS, 128.01. Jones, L. R. et al. 2002, A new era in cosmology, ASP Conference Proceedings, Vol. 283, p. 223 Donahue, M., Daly, R. A., Homer, D. J. 2003, ApJ, 584, 643, Constraints on the Cluster Environments and Hotspot magnetic field strengths for radio sources 3280 and 3254. Donahue, M., et al. 2003, ApJ, 598, 190. The mass, baryonic fraction, and x-ray temperature of the luminous, high-redshift cluster of galaxies MS045 1.6-0305 Perlman, E. S. et al. 2002, ApJS, 140, 256. Smith, B. J., Nowak, M., Donahue, M., Stocke, J. 2003, AJ, 126, 1763. Chandra Observations of the Interacting NGC44 10 Group of Galaxies. Postman, M., Lauer, T. R., Oegerle, W., Donahue, M. 2002, ApJ, 579, 93. The KPNO/deep-range cluster survey I. The catalog and space density of intermediate-redshift clusters. Molnar, S. M., Hughes, J. P., Donahue, M., Joy, M. 2002, ApJ, 573, L91, Chandra Observations of Unresolved X-Ray Sources around Two Clusters of Galaxies. Donahue, M., Mack, J., 2002 NewAR, 46, 155, HST NIcmos and WFPC2 observations of molecular hydrogen and dust around cooling flows. Koekemoer, A. M. et al. 2002 NewAR, 46, 149, Interactions between the A2597 central radio source and dense gas host galaxy. Donahue, M. et al. 2002 ApJ, 569,689, Distant cluster hunting II.

  1. Derivatized gold clusters and antibody-gold cluster conjugates

    DOEpatents

    Hainfeld, James F.; Furuya, Frederic R.

    1994-11-01

    Antibody- or antibody fragment-gold cluster conjugates are shown wherein the conjugate size can be as small as 5.0 nm. Methods and reagents are disclosed in which antibodies, Fab' or F(ab').sub.2 fragments thereof are covalently bound to a stable cluster of gold atoms. The gold clusters may contain 6, 8, 9, 11, 13, 55 or 67 gold atoms in their inner core. The clusters may also contain radioactive gold. The antibody-cluster conjugates are useful in electron microscopy applications as well as in clinical applications that include imaging, diagnosis and therapy.

  2. Derivatized gold clusters and antibody-gold cluster conjugates

    DOEpatents

    Hainfeld, J.F.; Furuya, F.R.

    1994-11-01

    Antibody- or antibody fragment-gold cluster conjugates are shown wherein the conjugate size can be as small as 5.0 nm. Methods and reagents are disclosed in which antibodies, Fab' or F(ab')[sub 2] fragments are covalently bound to a stable cluster of gold atoms. The gold clusters may contain 6, 8, 9, 11, 13, 55 or 67 gold atoms in their inner core. The clusters may also contain radioactive gold. The antibody-cluster conjugates are useful in electron microscopy applications as well as in clinical applications that include imaging, diagnosis and therapy. 7 figs.

  3. Connecting Remote Clusters with ATM

    SciTech Connect

    Hu, T.C.; Wyckoff, P.S.

    1998-10-01

    Sandia's entry into utilizing clusters of networked workstations is called Computational Plant or CPlant for short. The design of CPlant uses Ethernet to boot the individual nodes, Myrinet to communicate within a node cluster, and ATM to connect between remote clusters. This SAND document covers the work done to enable the use of ATM on the CPlant nodes in the Fall of 1997.

  4. Adaptive Clustering of Hypermedia Documents.

    ERIC Educational Resources Information Center

    Johnson, Andrew; Fotouhi, Farshad

    1996-01-01

    Discussion of hypermedia systems focuses on a comparison of two types of adaptive algorithm (genetic algorithm and neural network) in clustering hypermedia documents. These clusters allow the user to index into the nodes to find needed information more quickly, since clustering is "personalized" based on the user's paths rather than representing…

  5. Occurrence of corrensite and ordered (R3) illite/smectite (I/S) in a VLGM Middle Ordovician K-bentonite from the Hamburg Klippe, central Pennsylvania

    SciTech Connect

    Krekeler, M.P.S.; Huff, W.D. . Dept. of Geology)

    1993-03-01

    Corrensite, and ordered (R3) illite/smectite was observed in the Middle Ordovician Millbrig K-bentonite and in some stratigraphically higher K-bentonites in the Hamburg Klippe. The beds occur in the Oranda formation, and according to previously published conodont color alteration index, have been subjected to a very low grade metamorphic temperatures, on the order of 300 C. Ten samples representing a vertical profile through the thickness of the Millbrig bed were examined using XRD in the less than 5.0, 2.0, 0.5, 0.2, and smaller micrometer size fractions where applicable. High resolution XRD analysis of (060) reflections of the bulk clay were used in conjunction with computer model data, to identify corrensite, and to calculate I/S ratios. A demonstrable relationship between grain size and illite percentages through the bed exists. The abundance of corrensite increases with increasing grain size within the bed. Variations in illite percentages and the volumetric abundance are thought to be related to fluid migration through the bed. Magnesium supply for the formation of corrensite probably originated from a volumetrically equivalent amount of biotite. I/S conversion to illite may be the result of Ostwald ripening in conjunction with abundant pore water.

  6. A R2R3-MYB transcription factor that is specifically expressed in cotton (Gossypium hirsutum) fibers affects secondary cell wall biosynthesis and deposition in transgenic Arabidopsis.

    PubMed

    Sun, Xiang; Gong, Si-Ying; Nie, Xiao-Ying; Li, Yang; Li, Wen; Huang, Geng-Qing; Li, Xue-Bao

    2015-07-01

    Secondary cell wall (SCW) is an important industrial raw material for pulping, papermaking, construction, lumbering, textiles and potentially for biofuel production. The process of SCW thickening of cotton fibers lays down the cellulose that will constitute the bulk (up to 96%) of the fiber at maturity. In this study, a gene encoding a MYB-domain protein was identified in cotton (Gossypium hirsutum) and designated as GhMYBL1. Quantitative real-time polymerase chain reaction (RT-PCR) analysis revealed that GhMYBL1 was specifically expressed in cotton fibers at the stage of secondary wall deposition. Further analysis indicated that this protein is a R2R3-MYB transcription factor, and is targeted to the cell nucleus. Overexpression of GhMYBL1 in Arabidopsis affected the formation of SCW in the stem xylem of the transgenic plants. The enhanced SCW thickening also occurred in the interfascicular fibers, xylary fibers and vessels of the GhMYBL1-overexpression transgenic plants. The expression of secondary wall-associated genes, such as CesA4, CesA7, CesA8, PAL1, F5H and 4CL1, were upregulated, and consequently, cellulose and lignin biosynthesis were enhanced in the GhMYBL1 transgenic plants. These data suggested that GhMYBL1 may participate in modulating the process of secondary wall biosynthesis and deposition of cotton fibers. PMID:25534543

  7. First sex pheromone of the order strepsiptera: (3R,5R,9R)-3,5,9-trimethyldodecanal in Stylops melittae KIRBY, 1802.

    PubMed

    Tolasch, Till; Kehl, Siegfried; Dötterl, Stefan

    2012-12-01

    The twisted-wing parasites (Strepsiptera) are an unusual and small order of insects with about 600 known species. As obligate endoparasitoids, they develop and spend most of their lives living in other insects. Adults show an extreme sexual dimorphism: The free-living males have large eyes, branched antennae, reduced forewings, and well developed hind wings, while the neotenic females of most species lack all external characters that normally define an insect, remain endoparasitic, and only extrude the cephalothorax from the host. Due to the males' short life span of only a few hours, there must be an efficient means of mate finding. This is believed to be mediated by chemical cues released by virgin females. Here, we report the first identification and synthesis of a female-produced strepsipteran sex pheromone, (3R,5R,9R)-3,5,9-trimethyldodecanal, from Stylops melittae, a species parasitizing andrenid bees. We found this highly EAD-active compound to be present in cephalothoraxes of and released from unmated females, and synthetic samples proved to be extremely attractive when offered in the field during the swarming period of the males. The structural features of this new natural compound may further support the re-establishment of the Strepsiptera as the closest living relatives of the Coleoptera. PMID:23224569

  8. Changing a conserved amino acid in R2R3-MYB transcription repressors results in cytoplasmic accumulation and abolishes their repressive activity in Arabidopsis.

    PubMed

    Zhou, Meiliang; Sun, Zhanmin; Wang, Chenglong; Zhang, Xinquan; Tang, Yixiong; Zhu, Xuemei; Shao, Jirong; Wu, Yanmin

    2015-10-01

    Sub-group 4 R2R3-type MYB transcription factors, including MYB3, MYB4, MYB7 and MYB32, act as repressors in phenylpropanoid metabolism. These proteins contain the conserved MYB domain and the ethylene-responsive element binding factor-associated amphiphilic repression (EAR) repression domain. Additionally, MYB4, MYB7 and MYB32 possess a putative zinc-finger domain and a conserved GY/FDFLGL motif in their C-termini. The protein 'sensitive to ABA and drought 2' (SAD2) recognizes the nuclear pore complex, which then transports the SAD2-MYB4 complex into the nucleus. Here, we show that the conserved GY/FDFLGL motif contributes to the interaction between MYB factors and SAD2. The Asp → Asn mutation in the GY/FDFLGL motif abolishes the interaction between MYB transcription factors and SAD2, and therefore they cannot be transported into the nucleus and cannot repress their target genes. We found that MYB4(D261N) loses the capacity to repress expression of the cinnamate 4-hydroxylase (C4H) gene and biosynthesis of sinapoyl malate. Our results indicate conservation among MYB transcription factors in terms of their interaction with SAD2. Therefore, the Asp → Asn mutation may be used to engineer transcription factors. PMID:26332741

  9. Purple foliage coloration in tea (Camellia sinensis L.) arises from activation of the R2R3-MYB transcription factor CsAN1

    PubMed Central

    Sun, Binmei; Zhu, Zhangsheng; Cao, Panrong; Chen, Hao; Chen, Changming; Zhou, Xin; Mao, Yanhui; Lei, Jianjun; Jiang, Yanpin; Meng, Wei; Wang, Yingxi; Liu, Shaoqun

    2016-01-01

    Purple foliage always appears in Camellia sinensis families; however, the transcriptional regulation of anthocyanin biosynthesis is unknown. The tea bud sport cultivar ‘Zijuan’ confers an abnormal pattern of anthocyanin accumulation, resulting in a mutant phenotype that has a striking purple color in young foliage and in the stem. In this study, we aimed to unravel the underlying molecular mechanism of anthocyanin biosynthetic regulation in C. sinensis. Our results revealed that activation of the R2R3-MYB transcription factor (TF) anthocyanin1 (CsAN1) specifically upregulated the bHLH TF CsGL3 and anthocyanin late biosynthetic genes (LBGs) to confer ectopic accumulation of pigment in purple tea. We found CsAN1 interacts with bHLH TFs (CsGL3 and CsEGL3) and recruits a WD-repeat protein CsTTG1 to form the MYB-bHLH-WDR (MBW) complex that regulates anthocyanin accumulation. We determined that the hypomethylation of a CpG island in the CsAN1 promoter is associated with the purple phenotype. Furthermore, we demonstrated that low temperature and long illumination induced CsAN1 promoter demethylation, resulting in upregulated expression to promote anthocyanin accumulation in the foliage. The successful isolation of CsAN1 provides important information on the regulatory control of anthocyanin biosynthesis in C. sinensis and offers a genetic resource for the development of new varieties with enhanced anthocyanin content. PMID:27581206

  10. OsMYB103L, an R2R3-MYB transcription factor, influences leaf rolling and mechanical strength in rice (Oryza sativa L.)

    PubMed Central

    2014-01-01

    Background The shape of grass leaves possesses great value in both agronomy and developmental biology research. Leaf rolling is one of the important traits in rice (Oryza sativa L.) breeding. MYB transcription factors are one of the largest gene families and have important roles in plant development, metabolism and stress responses. However, little is known about their functions in rice. Results In this study, we report the functional characterization of a rice gene, OsMYB103L, which encodes an R2R3-MYB transcription factor. OsMYB103L was localized in the nucleus with transactivation activity. Overexpression of OsMYB103L in rice resulted in a rolled leaf phenotype. Further analyses showed that expression levels of several cellulose synthase genes (CESAs) were significantly increased, as was the cellulose content in OsMYB103L overexpressing lines. Knockdown of OsMYB103L by RNA interference led to a decreased level of cellulose content and reduced mechanical strength in leaves. Meanwhile, the expression levels of several CESA genes were decreased in these knockdown lines. Conclusions These findings suggest that OsMYB103L may target CESA genes for regulation of cellulose synthesis and could potentially be engineered for desirable leaf shape and mechanical strength in rice. PMID:24906444

  11. Cloning and Characterization of a Putative R2R3 MYB Transcriptional Repressor of the Rosmarinic Acid Biosynthetic Pathway from Salvia miltiorrhiza

    PubMed Central

    Zhang, Shuncang; Ma, Pengda; Yang, Dongfeng; Li, Wenjing; Liang, Zongsuo; Liu, Yan; Liu, Fenghua

    2013-01-01

    Salvia miltiorrhiza Bunge is one of the most renowned traditional medicinal plants in China. Phenolic acids that are derived from the rosmarinic acid pathway, such as rosmarinic acid and salvianolic acid B, are important bioactive components in S. miltiorrhiza. Accumulations of these compounds have been reported to be induced by various elicitors, while little is known about transcription factors that function in their biosynthetic pathways. We cloned a subgroup 4 R2R3 MYB transcription factor gene (SmMYB39) from S. miltiorrhiza and characterized its roles through overexpression and RNAi-mediated silencing. As the results showed, the content of 4-coumaric acid, rosmarinic acid, salvianolic acid B, salvianolic acid A and total phenolics was dramatically decreased in SmMYB39-overexpressing S. miltiorrhiza lines while being enhanced by folds in SmMYB39-RNAi lines. Quantitative real-time PCR and enzyme activities analyses showed that SmMYB39 negatively regulated transcripts and enzyme activities of 4-hydroxylase (C4H) and tyrosine aminotransferase (TAT). These data suggest that SmMYB39 is involved in regulation of rosmarinic acid pathway and acts as a repressor through suppressing transcripts of key enzyme genes. PMID:24039895

  12. Purple foliage coloration in tea (Camellia sinensis L.) arises from activation of the R2R3-MYB transcription factor CsAN1.

    PubMed

    Sun, Binmei; Zhu, Zhangsheng; Cao, Panrong; Chen, Hao; Chen, Changming; Zhou, Xin; Mao, Yanhui; Lei, Jianjun; Jiang, Yanpin; Meng, Wei; Wang, Yingxi; Liu, Shaoqun

    2016-01-01

    Purple foliage always appears in Camellia sinensis families; however, the transcriptional regulation of anthocyanin biosynthesis is unknown. The tea bud sport cultivar 'Zijuan' confers an abnormal pattern of anthocyanin accumulation, resulting in a mutant phenotype that has a striking purple color in young foliage and in the stem. In this study, we aimed to unravel the underlying molecular mechanism of anthocyanin biosynthetic regulation in C. sinensis. Our results revealed that activation of the R2R3-MYB transcription factor (TF) anthocyanin1 (CsAN1) specifically upregulated the bHLH TF CsGL3 and anthocyanin late biosynthetic genes (LBGs) to confer ectopic accumulation of pigment in purple tea. We found CsAN1 interacts with bHLH TFs (CsGL3 and CsEGL3) and recruits a WD-repeat protein CsTTG1 to form the MYB-bHLH-WDR (MBW) complex that regulates anthocyanin accumulation. We determined that the hypomethylation of a CpG island in the CsAN1 promoter is associated with the purple phenotype. Furthermore, we demonstrated that low temperature and long illumination induced CsAN1 promoter demethylation, resulting in upregulated expression to promote anthocyanin accumulation in the foliage. The successful isolation of CsAN1 provides important information on the regulatory control of anthocyanin biosynthesis in C. sinensis and offers a genetic resource for the development of new varieties with enhanced anthocyanin content. PMID:27581206

  13. Overexpression of soybean R2R3-MYB transcription factor, GmMYB12B2, and tolerance to UV radiation and salt stress in transgenic Arabidopsis.

    PubMed

    Li, X W; Wang, Y; Yan, F; Li, J W; Zhao, Y; Zhao, X; Zhai, Y; Wang, Q Y

    2016-01-01

    MYB, v-myb avian myeloblastosis viral oncogene homolog, proteins play central roles in plant stress response. Previously, we identified a novel R2R3-MYB transcription factor, GmMYB12B2, which affected the expression levels of some key enzyme genes involved in flavonoid biosynthesis in transgenic Arabidopsis. In the present study, we analyzed the expression levels of GmMYB12B2 under salt, low temperature, drought, abscisic acid (ABA), and ultraviolet (UV) radiation treatments in soybean using semi-quantitative reverse transcription polymerase chain reaction. The expression of GmMYB12B2 was drastically induced by UV irradiation and salt treatment, but no response was detected under low temperature, drought, and ABA stresses. A detailed characterization of the GmMYB12B2 overexpression lines revealed that GmMYB12B2 might be involved in response of plants to UV radiation and salt stresses. Transgenic Arabidopsis lines constitutively expressing GmMYB12B2 showed an increased tolerance to salt and UV radiation treatment compared with wild-type plants. The expression levels of certain salt stress-responsive genes, such as DREB2A and RD17, were found to be elevated in the transgenic plants. These results indicate that GmMYB12B2 acts as a regulator in the plant stress response. PMID:27323089

  14. Magnetism of a rhombohedral-type pyrochlore-derived Kagome series, Mn2R3Sb3O14 (R = Rare-earths)

    NASA Astrophysics Data System (ADS)

    Chandragiri, Venkatesh; Iyer, Kartik K.; Maiti, K.; Sampathkumaran, E. V.

    2016-06-01

    The results of magnetic investigations on a new series of compounds, Mn2R3Sb3O14, containing 2-dimensional Kagome lattice of R ions and belonging to pyrochlore family, are presented. Crystallographic features of light R members (R = La, Pr, and Nd) of this family, as established in the recent literature, have been reported to be novel in many aspects, in particular, the rhombohedral nature of the structure which is rare among pyrochlores. It was also reported that, as the R becomes heavier, beyond R = Sm, the fraction of well-known cubic pyrochlore phase tends to gradually dominate. Here, we report that we are able to form the Gd member in the rhombohedral form without noticeable admixture from the cubic phase. With respect to magnetic behavior, our magnetization measurements on the La member reveal that Mn exists in divalent state without any evidence for long range magnetic ordering down to 2 K, a behavior (that is, suppressed magnetism) which is not so common for Mn based oxides, though antiferromagnetism below 2 K is not ruled out. Nd and Gd members are, however, found to show distinct features above 2 K in magnetic susceptibility and heat-capacity, attributable to long-range magnetic ordering from respective rare-earth sublattice. The experimental results with respect to magnetism are found to be consistent with the results from ab initio band structure calculations performed for the La case. The calculations imply that electron correlation is important to describe insulating behavior.

  15. Crystal structure and magnetic properties of novel Hf3Ni2Si3-type R3Co2Ge3 compounds (R=Y, Sm, Tb-Tm)

    NASA Astrophysics Data System (ADS)

    Morozkin, A. V.; Nirmala, R.; Yao, Jinlei; Mozharivskyj, Y.; Isnard, O.

    2012-12-01

    The novel R3Co2Ge3 compounds with R=Y, Sm, Tb-Tm adopt the Hf3Ni2Si3-type structure (ordered variant of the Ca3Ga5-type one, space group Cmcm). Sm3Co2Ge3, Tb3Co2Ge3, Ho3Co2Ge3 and Er3Co2Ge3 undergo an antiferromagnetic-type ordering and Tb3Co2Ge3 demonstrates a field-sensitive magnetic behavior. Tm3Co2Ge3 is a pure paramagnet down to 5 K, whereas Y3Co2Ge3 demonstrates Pauli paramagnetism down to ∼120 K. In zero applied field and between ∼50 and ∼15 K Tb3Co2Ge3 shows a non-collinear antiferromagnetic ordering with wave vectors K0=[0, 0, 0] and K1=[±1/3, 0, 0] and a magnetic unit cell 3aTb3Co2Ge2×bTb3Co2Ge3×cTb3Co2Ge3 , whereas below ∼15 K it exhibits a complex antiferromagnetic ordering with K0=[0, 0, 0], K1=[±1/3, 0, 0] and K2=[1/2, 0, 0] wave vectors and magnetic unit cell 6aTb3Co2Ge2×bTb3Co2Ge2×cTb3Co2Ge2.

  16. Conformational flexibility and absolute stereochemistry of (3R)-3-hydroxy-4-aryl-β-lactams investigated by chiroptical properties and TD-DFT calculations.

    PubMed

    Tedesco, Daniele; Zanasi, Riccardo; Guerrini, Andrea; Bertucci, Carlo

    2012-09-01

    The effect of conformational flexibility on the chiroptical properties of a series of synthetic (3R)-3-hydroxy-4-aryl-β-lactams of known stereochemistry (1-6) was investigated by means of electronic circular dichroism (ECD) measurements and time-dependent density functional theory (TD-DFT) calculations. The application of the β-lactam sector rules allowed a correct stereochemical characterization of these compounds, with the exception of a thienyl-substituted derivative (cis-). TD-DFT calculations yielded accurate predictions of experimental ECD spectra and [α](D) values, allowing us to assign the correct absolute configuration to all the investigated compounds. A detailed analysis of the β-lactam ring equilibrium geometry on optimized conformers identified regular patterns for the arrangement of atoms around the amide chromophore, confirming the validity of the β-lactam sector rules. However, relevant variations in theoretical chiroptical properties were found for compounds bearing a heterocyclic substituent at C4 or a phenyl substituent at C3, whose conformers deviate from these regular geometric patterns. This behavior explains the failure of the β-lactam sector rules in cis-. This study showed the importance of conformational flexibility for the determination of chiroptical properties and highlighted the strengths and weaknesses of the different methods for the stereochemical characterization of chiral molecules in solution. PMID:22544665

  17. The R2R3-MYB Transcription Factors MYB14 and MYB15 Regulate Stilbene Biosynthesis in Vitis vinifera[W

    PubMed Central

    Höll, Janine; Vannozzi, Alessandro; Czemmel, Stefan; D'Onofrio, Claudio; Walker, Amanda R.; Rausch, Thomas; Lucchin, Margherita; Boss, Paul K.; Dry, Ian B.; Bogs, Jochen

    2013-01-01

    Plant stilbenes are phytoalexins that accumulate in a small number of plant species, including grapevine (Vitis vinifera), in response to biotic and abiotic stresses and have been implicated in many beneficial effects on human health. In particular, resveratrol, the basic unit of all other complex stilbenes, has received widespread attention because of its cardio-protective, anticarcinogenic, and antioxidant properties. Although stilbene synthases (STSs), the key enzymes responsible for resveratrol biosynthesis, have been isolated and characterized from several plant species, the transcriptional regulation underlying stilbene biosynthesis is unknown. Here, we report the identification and functional characterization of two R2R3-MYB–type transcription factors (TFs) from grapevine, which regulate the stilbene biosynthetic pathway. These TFs, designated MYB14 and MYB15, strongly coexpress with STS genes, both in leaf tissues under biotic and abiotic stress and in the skin and seed of healthy developing berries during maturation. In transient gene reporter assays, MYB14 and MYB15 were demonstrated to specifically activate the promoters of STS genes, and the ectopic expression of MYB15 in grapevine hairy roots resulted in increased STS expression and in the accumulation of glycosylated stilbenes in planta. These results demonstrate the involvement of MYB14 and MYB15 in the transcriptional regulation of stilbene biosynthesis in grapevine. PMID:24151295

  18. Gas deficiency in cluster galaxies - A comparison of nine clusters

    NASA Technical Reports Server (NTRS)

    Giovanelli, R.; Haynes, M. P.

    1985-01-01

    The available 21 cm line data in the literature for galaxies in nine clusters is combined with new high-sensitivity observations of 51 galaxies in five of the nine clusters in order to test for discriminating circumstances between those clusters which show H I deficiency among their spiral population and those which do not. An H I deficiency for the complete cluster sample is derived employing a comparison sample of galaxies chosen from the Catalog of Isolated Galaxies. The deficiency and its radial dependence is summarized for each cluster and a composite. A comparison of the environments in different clusters leads to the conclusion that the occurrence of H I deficiency is correlated with the presence of a hot X-ray intracluster medium, and that an ongoing interaction process is active through the cores of X-ray clusters.

  19. Clusterization in Ternary Fission

    NASA Astrophysics Data System (ADS)

    Kamanin, D. V.; Pyatkov, Y. V.

    This lecture notes are devoted to the new kind of ternary decay of low excited heavy nuclei called by us "collinear cluster tri-partition" (CCT) due to the features of the effect observed, namely, decay partners fly away almost collinearly and at least one of them has magic nucleon composition. At the early stage of our work the process of "true ternary fission" (fission of the nucleus into three fragments of comparable masses) was considered to be undiscovered for low excited heavy nuclei. Another possible prototype—three body cluster radioactivity—was also unknown. The most close to the CCT phenomenon, at least cinematically, stands so called "polar emission", but only very light ions (up to isotopes of Be) were observed so far.

  20. Swirling granular solidlike clusters

    NASA Astrophysics Data System (ADS)

    Scherer, Michael A.; Kötter, Karsten; Markus, Mario; Goles, Eric; Rehberg, Ingo

    2000-04-01

    Experiments and three-dimensional numerical simulations are presented to elucidate the dynamics of granular material in a cylindrical dish driven by a horizontal, periodic motion. The following phenomena are obtained both in the experiments and in the simulations: First, for large particle numbers N the particles describe hypocycloidal trajectories. In this state the particles are embedded in a solidlike cluster (``pancake'') which counter-rotates with respect to the external driving (reptation). Self-organization within the cluster occurs such that the probability distribution of the particles consists of concentric rings. Second, the system undergoes phase transitions. These can be identified by changes of the quantity dEkin/dN (Ekin is the mean kinetic energy) between zero (rotation), positive (reptation), and negative values (appearance of the totality of concentric rings).

  1. Massive cold cloud clusters

    NASA Astrophysics Data System (ADS)

    Toth, L. Viktor; Marton, Gabor; Zahorecz, Sarolta

    2015-08-01

    The all-sky Planck catalogue of Galactic Cold Clumps (PGCC, Planck 2015 results XXVIII 2015) allows an almost unbiased study of the early phases of star-formation in our Galaxy. Several thousand of the clumps have also distance estimates allowing a mass, and density determination. The nature of Planck clumps varies from IRDCs to tiny nearby cold clouds with masses ranging from one to several tens of thousands solar masses. Some of the clumps are embedded in GMCs, others are isolated. Some are close or even very close to OB associations, while others lay far from any UV luminous objects.The small scale clustering of these objects was studied with the improved Minimum Spanning Tree method of Cartwright & Whitworth identifying groups in 3D space. As a result also massive cold cloud clusters were identified. We analyse the MST structures, and discuss their relation to ongoing and future massive star formation.

  2. Fractal polyzirconosiloxane cluster coatings

    SciTech Connect

    Sugama, T.

    1992-08-01

    Fractal polyzirconosiloxane (PZS) cluster films were prepared through the hydrolysis-polycondensation-pyrolysis synthesis of two-step HCl acid-NaOH base catalyzed sol precursors consisting of N-[3-(triethoxysilyl)propyl]-4,5-dihydroimidazole, Zr(OC{sub 3}H{sub 7}){sub 4}, methanol, and water. When amorphous PZSs were applied to aluminum as protective coatings against NaCl-induced corrosion, the effective film was that derived from the sol having a pH near the isoelectric point in the positive zeta potential region. The following four factors played an important role in assembling the protective PZS coating films: (1) a proper rate of condensation, (2) a moderate ratio of Si-O-Si to Si-O-Zr linkages formed in the PZS network, (3) hydrophobic characteristics, and (4) a specific microstructural geometry, in which large fractal clusters were linked together.

  3. Fractal polyzirconosiloxane cluster coatings

    SciTech Connect

    Sugama, T.

    1992-01-01

    Fractal polyzirconosiloxane (PZS) cluster films were prepared through the hydrolysis-polycondensation-pyrolysis synthesis of two-step HCl acid-NaOH base catalyzed sol precursors consisting of N-(3-(triethoxysilyl)propyl)-4,5-dihydroimidazole, Zr(OC{sub 3}H{sub 7}){sub 4}, methanol, and water. When amorphous PZSs were applied to aluminum as protective coatings against NaCl-induced corrosion, the effective film was that derived from the sol having a pH near the isoelectric point in the positive zeta potential region. The following four factors played an important role in assembling the protective PZS coating films: (1) a proper rate of condensation, (2) a moderate ratio of Si-O-Si to Si-O-Zr linkages formed in the PZS network, (3) hydrophobic characteristics, and (4) a specific microstructural geometry, in which large fractal clusters were linked together.

  4. Hydrated hydride anion clusters

    NASA Astrophysics Data System (ADS)

    Lee, Han Myoung; Kim, Dongwook; Singh, N. Jiten; Kołaski, Maciej; Kim, Kwang S.

    2007-10-01

    On the basis of density functional theory (DFT) and high level ab initio theory, we report the structures, binding energies, thermodynamic quantities, IR spectra, and electronic properties of the hydride anion hydrated by up to six water molecules. Ground state DFT molecular dynamics simulations (based on the Born-Oppenheimer potential surface) show that as the temperature increases, the surface-bound hydride anion changes to the internally bound structure. Car-Parrinello molecular dynamics simulations are also carried out for the spectral analysis of the monohydrated hydride. Excited-state ab initio molecular dynamics simulations show that the photoinduced charge-transfer-to-solvent phenomena are accompanied by the formation of the excess electron-water clusters and the detachment of the H radical from the clusters. The dynamics of the detachment process of a hydrogen radical upon the excitation is discussed.

  5. Layers in Crater Cluster

    NASA Technical Reports Server (NTRS)

    2003-01-01

    MGS MOC Release No. MOC2-431, 24 July 2003

    This Mars Global Surveyor (MGS) Mars Orbiter Camera (MOC) image shows a cluster of old, small impact craters near 36.3oN, 281.9oW. The group of craters was probably formed by secondary impacts following a much larger impact that occurred some distance away; the material that created these craters would have been the ejecta from the larger crater, rather than meteoroids from outer space. The craters cluster is considered to be relatively old because none of the craters have ejecta blankets any more, and each was filled, or partially filled, with layered material that was later eroded to form the terraced mounds found in their floors. This picture is illuminated from the lower left.

  6. Cosmology, Clusters and Calorimeters

    NASA Technical Reports Server (NTRS)

    Figueroa-Feliciano, Enectali

    2005-01-01

    I will review the current state of Cosmology with Clusters and discuss the application of microcalorimeter arrays to this field. With the launch of Astro-E2 this summer and a slew of new missions being developed, microcalorimeters are the next big thing in x-ray astronomy. I will cover the basics and not-so-basic concepts of microcalorimeter designs and look at the future to see where this technology will go.

  7. Cluster galaxies die hard

    NASA Astrophysics Data System (ADS)

    Weinmann, Simone M.; Kauffmann, Guinevere; von der Linden, Anja; De Lucia, Gabriella

    2010-08-01

    We investigate how the specific star formation rates of galaxies of different masses depend on cluster-centric radius and on the central/satellite dichotomy in both field and cluster environments. Recent data from a variety of sources, including the cluster catalogue of von der Linden et al., are compared to the semi-analytic models of De Lucia & Blaizot. We find that these models predict too many passive satellite galaxies in clusters, too few passive central galaxies with low stellar masses and too many passive central galaxies with high masses. We then outline a series of modifications to the model necessary to solve these problems: (a) instead of instantaneous stripping of the external gas reservoir after a galaxy becomes a satellite, the gas supply is assumed to decrease at the same rate that the surrounding halo loses mass due to tidal stripping and (b) the active galactic nuclei (AGN) feedback efficiency is lowered to bring the fraction of massive passive centrals in better agreement with the data. We also allow for radio mode AGN feedback in satellite galaxies. (c) We assume that satellite galaxies residing in host haloes with masses below 1012h-1Msolar do not undergo any stripping. We highlight the fact that in low-mass galaxies, the external reservoir is composed primarily of gas that has been expelled from the galactic disc by supernovae-driven winds. This gas must remain available as a future reservoir for star formation, even in satellite galaxies. Finally, we present a simple recipe for the stripping of gas and dark matter in satellites that can be used in models where subhalo evolution is not followed in detail.

  8. Embedded Clusters in Molecular Clouds

    NASA Astrophysics Data System (ADS)

    Lada, Charles J.; Lada, Elizabeth A.

    Stellar clusters are born embedded within giant molecular clouds (GMCs) and during their formation and early evolution are often only visible at infrared wavelengths, being heavily obscured by dust. Over the past 15 years advances in infrared detection capabilities have enabled the first systematic studies of embedded clusters in galactic molecular clouds. In this article we review the current state of empirical knowledge concerning these extremely young protocluster systems. From a survey of the literature we compile the first extensive catalog of galactic embedded clusters. We use the catalog to construct the mass function and estimate the birthrate for embedded clusters within 2 kpc of the sun. We find that the embedded cluster birthrate exceeds that of visible open clusters by an order of magnitude or more indicating a high infant mortality rate for protocluster systems. Less than 4-7% of embedded clusters survive emergence from molecular clouds to become bound clusters of Pleiades age. The vast majority (90%) of stars that form in embedded clusters form in rich clusters of 100 or more members with masses in excess of 50 M⊙. Moreover, observations of nearby cloud complexes indicate that embedded clusters account for a significant (70-90%) fraction of all stars formed in GMCs. We review the role of embedded clusters in investigating the nature of the initial mass function (IMF) that, in one nearby example, has been measured over the entire range of stellar and substellar mass, from OB stars to substellar objects near the deuterium burning limit. We also review the role embedded clusters play in the investigation of circumstellar disk evolution and the important constraints they provide for understanding the origin of planetary systems. Finally, we discuss current ideas concerning the origin and dynamical evolution of embedded clusters and the implications for the formation of bound open clusters.

  9. Astrophysics of galaxy clusters

    NASA Astrophysics Data System (ADS)

    Ettori, Stefano

    2016-07-01

    As the nodes of the cosmic web, clusters of galaxies trace the large-scale distribution of matter in the Universe. They are thus privileged sites in which to investigate the complex physics of structure formation. However, the complete story of how these structures grow, and how they dissipate the gravitational and non-thermal components of their energy budget over cosmic time, is still beyond our grasp. Most of the baryons gravitationally bound to the cluster's halo is in the form of a diffuse, hot, metal-enriched plasma that radiates primarily in the X-ray band. X-ray observations of the evolving cluster population provide a unique opportunity to address such fundamental open questions as: How do hot diffuse baryons accrete and dynamically evolve in dark matter potentials? How and when was the energy that we observe in the ICM generated and distributed? Where and when are heavy elements produced and how are they circulated? We will present the ongoing activities to define the strategy on how an X-ray observatory with large collecting area and an unprecedented combination of high spectral and angular resolution, such as Athena, can address these questions.

  10. Stormy weather in galaxy clusters

    PubMed

    Burns

    1998-04-17

    Recent x-ray, optical, and radio observations coupled with particle and gas dynamics numerical simulations reveal an unexpectedly complex environment within clusters of galaxies, driven by ongoing accretion of matter from large-scale supercluster filaments. Mergers between clusters and continuous infall of dark matter and baryons from the cluster periphery produce long-lived "stormy weather" within the gaseous cluster atmosphere-shocks, turbulence, and winds of more than 1000 kilometers per second. This weather may be responsible for shaping a rich variety of extended radio sources, which in turn act as "barometers" and "anemometers" of cluster weather. PMID:9545210

  11. Cluster headache after orbital exenteration.

    PubMed

    Evers, S; Sörös, P; Brilla, R; Gerding, H; Husstedt, I W

    1997-10-01

    A 37-year-old man developed an ipsilateral headache which fulfilled the criteria for cluster headache after orbital extenteration because of a traumatic lesion of the bulb. The headache could be treated successfully by drugs usually applied in the therapy of cluster headache. Six similar cases of cluster headache after orbital exenteration could be identified in the literature suggesting that the eye itself is not necessarily part of the pathogenesis of cluster headache. We hypothesize that orbital exenteration can cause cluster headache by lesions of sympathetic structures. Possibly, these mechanisms are similar to those of sympathetic reflex dystrophy (Sudeck-Leriche syndrome) causing pain of the limbs. PMID:9350391

  12. Multiscale hierarchical support vector clustering

    NASA Astrophysics Data System (ADS)

    Hansen, Michael Saas; Holm, David Alberg; Sjöstrand, Karl; Ley, Carsten Dan; Rowland, Ian John; Larsen, Rasmus

    2008-03-01

    Clustering is the preferred choice of method in many applications, and support vector clustering (SVC) has proven efficient for clustering noisy and high-dimensional data sets. A method for multiscale support vector clustering is demonstrated, using the recently emerged method for fast calculation of the entire regularization path of the support vector domain description. The method is illustrated on artificially generated examples, and applied for detecting blood vessels from high resolution time series of magnetic resonance imaging data. The obtained results are robust while the need for parameter estimation is reduced, compared to support vector clustering.

  13. Stellar Snowflake Cluster

    NASA Technical Reports Server (NTRS)

    2005-01-01

    [figure removed for brevity, see original site] Figure 1 Stellar Snowflake Cluster Combined Image [figure removed for brevity, see original site] Figure 2 Infrared Array CameraFigure 3 Multiband Imaging Photometer

    Newborn stars, hidden behind thick dust, are revealed in this image of a section of the Christmas Tree cluster from NASA's Spitzer Space Telescope, created in joint effort between Spitzer's infrared array camera and multiband imaging photometer instruments.

    The newly revealed infant stars appear as pink and red specks toward the center of the combined image (fig. 1). The stars appear to have formed in regularly spaced intervals along linear structures in a configuration that resembles the spokes of a wheel or the pattern of a snowflake. Hence, astronomers have nicknamed this the 'Snowflake' cluster.

    Star-forming clouds like this one are dynamic and evolving structures. Since the stars trace the straight line pattern of spokes of a wheel, scientists believe that these are newborn stars, or 'protostars.' At a mere 100,000 years old, these infant structures have yet to 'crawl' away from their location of birth. Over time, the natural drifting motions of each star will break this order, and the snowflake design will be no more.

    While most of the visible-light stars that give the Christmas Tree cluster its name and triangular shape do not shine brightly in Spitzer's infrared eyes, all of the stars forming from this dusty cloud are considered part of the cluster.

    Like a dusty cosmic finger pointing up to the newborn clusters, Spitzer also illuminates the optically dark and dense Cone nebula, the tip of which can be seen towards the bottom left corner of each image.

    This combined image shows the presence of organic molecules mixed with dust as wisps of green, which have been illuminated by nearby star formation. The larger yellowish dots neighboring the baby red stars in the Snowflake Cluster are massive stellar infants forming

  14. Convex Clustering: An Attractive Alternative to Hierarchical Clustering

    PubMed Central

    Chen, Gary K.; Chi, Eric C.; Ranola, John Michael O.; Lange, Kenneth

    2015-01-01

    The primary goal in cluster analysis is to discover natural groupings of objects. The field of cluster analysis is crowded with diverse methods that make special assumptions about data and address different scientific aims. Despite its shortcomings in accuracy, hierarchical clustering is the dominant clustering method in bioinformatics. Biologists find the trees constructed by hierarchical clustering visually appealing and in tune with their evolutionary perspective. Hierarchical clustering operates on multiple scales simultaneously. This is essential, for instance, in transcriptome data, where one may be interested in making qualitative inferences about how lower-order relationships like gene modules lead to higher-order relationships like pathways or biological processes. The recently developed method of convex clustering preserves the visual appeal of hierarchical clustering while ameliorating its propensity to make false inferences in the presence of outliers and noise. The solution paths generated by convex clustering reveal relationships between clusters that are hidden by static methods such as k-means clustering. The current paper derives and tests a novel proximal distance algorithm for minimizing the objective function of convex clustering. The algorithm separates parameters, accommodates missing data, and supports prior information on relationships. Our program CONVEXCLUSTER incorporating the algorithm is implemented on ATI and nVidia graphics processing units (GPUs) for maximal speed. Several biological examples illustrate the strengths of convex clustering and the ability of the proximal distance algorithm to handle high-dimensional problems. CONVEXCLUSTER can be freely downloaded from the UCLA Human Genetics web site at http://www.genetics.ucla.edu/software/ PMID:25965340

  15. Zeaxanthin ([3R,3'R]-beta, beta-carotene-3-3'diol) as a resonance Raman and visible absorption probe of membrane structure.

    PubMed Central

    Mendelsohn, R; Van Holten, R W

    1979-01-01

    When zeaxanthin ([3R,3R']-beta, beta-carotene-3,3'diol) is inserted into phospholipid dispersions and the latter heated through their gel-liquid crystal phase transitions, large changes are noted in the resonance Raman and absorption spectra of the carotenoid molecule. By analogy with the data of Carey and co-workers (J. Raman Spectrosc. 6:282) who studied the aggregation of zeaxanthin in acetone-water solutions, it is suggested that the carotenoid aggregates in the phospholipid gel state while forming a monomer in liquid crystal phases. The alterations in both the visible absorption and resonance Raman data have been used to monitor phospholipid phase behavior in dipalmitoylphosphatidylcholine and distearoylphosphatidylcholine, (DSPC) one-component systems and binary mixtures. The phase diagram obtained for the binary system, as constructed from visible absorption and resonance Raman data, is compared with that of Shimshick and McConnell (Biochemistry. 12:2351) obtained from electron spin resonance (ESR) studies. Although the agreement between absorption and ESR data is generally satisfactory, onset temperatures for phase separation at low DSPC mole fractions deduced from resonance Raman measurements are several degrees lower than those from the other methods. Nevertheless, the use of zeaxanthin as a resonance Raman and visible absorption probe behavior will be useful in some situations where ordinary Raman spectroscopic data cannot be obtained easily. The advantage of the resonance Raman approach is illustrated in a study of the phase behavior of a phospholipid extract of a cel- mutant of Neurospora crassa. A phase separation region is observed with onset and completion temperatures of -19 and -6 degrees C, respectively. PMID:162448

  16. Designing poly[(R)-3-hydroxybutyrate]-based polyurethane block copolymers for electrospun nanofiber scaffolds with improved mechanical properties and enhanced mineralization capability.

    PubMed

    Liu, Kerh Li; Choo, Eugene Shi Guang; Wong, Siew Yee; Li, Xu; He, Chao Bin; Wang, John; Li, Jun

    2010-06-10

    Efforts to mineralize electrospun hydrophobic polyester scaffold often require prior surface modification such as plasma or alkaline treatment, which may affect the mechanical integrity of the resultant scaffold. Here through rational design we developed a series of polyurethane block copolymers containing poly[(R)-3-hydroxybutyrate] (PHB) as hard segment and poly(ethylene glycol) (PEG) as soft segment that could be easily fabricated into mineralizable electrospun scaffold without the need of additional surface treatment. To ensure that the block copolymers do not swell excessively in water, PEG content in the polymers was kept below 50 wt %. To obtain good dry and hydrated state mechanical properties with limited PEG, low-molecular-weight PHB-diol with M(n) 1230 and 1790 were used in various molar feed ratios. The macromolecular characteristics of the block copolymers were confirmed by (1)H NMR spectroscopy, gel permeation chromatography (GPC), and thermal gravimetric analyses (TGA). With the incorporation of the hydrophilic PEG segments, the surface and bulk hydrophilicity of the block copolymers were significantly improved. Differential scanning calorimetry (DSC) revealed that the block copolymers had low PHB crystallinity and no PEG crystallinity. This was further confirmed by X-ray diffraction analyses (XRD) in both dry and hydrated states. With short PHB segments and soft PEG coupled together, the block copolymers were no longer brittle. Tensile measurements showed that the block copolymers with higher PEG content or shorter PHB segments were more ductile. Furthermore, their ductility was enhanced in hydrated states with one particular example showing increment in strain at break from 1090 to 1962%. The block copolymers were fabricated into an electrospun fibrous scaffold that was easily mineralized by simple incubation in simulated body fluid. The materials have good potential for bone regeneration application and may be extended to other applications by

  17. New member of the R2R3-MYB transcription factors family in grapevine suppresses the anthocyanin accumulation in the flowers of transgenic tobacco.

    PubMed

    Pérez-Díaz, J Ricardo; Pérez-Díaz, Jorge; Madrid-Espinoza, José; González-Villanueva, Enrique; Moreno, Yerko; Ruiz-Lara, Simón

    2016-01-01

    In grapevine, anthocyanins and proanthocyanidins are the main flavonoids in berries, which are associated to organoleptic properties in red wine such as color and astringency. Flavonoid pathway is specifically regulated at transcriptional level and several R2R3-MYB proteins have shown to act as positive regulators. However, some members of this family have shown to repress the flavonoid biosynthesis. In this work, we present the characterization of VvMYB4-like gene, which encodes a putative transcriptional factor highly expressed in the skin of berries at the pre veraison stage in grapevine. Its over-expression in tobacco resulted in the loss of pigmentation in flowers due a decrease in anthocyanin accumulation. Severity in anthocyanin suppression observed in petals could be associated with the expression level of the VvMYB4-like transgene. Expression analysis of flavonoid structural genes revealed the strong down-regulation of the flavonoid-related genes anthocyanidin synthase (ANS) and dihydroflavonol reductase (DFR) genes and also the reduction of the anthocyanin-related gene UDP glucose:flavonoid 3-O-glucosyl transferase (UFGT), which was dependent of the transgene expression. In addition, expression of VvMYB4-like in the model plant Arabidopsis showed similar results, with the higher down-regulation observed in the AtDFR and AtLDOX genes. These results suggest that VvMYB4-like may play an important role in regulation of anthocyanin biosynthesis in grapevine acting as a transcriptional repressor of flavonoid structural genes. PMID:26497001

  18. The Phenylpropanoid Pathway Is Controlled at Different Branches by a Set of R2R3-MYB C2 Repressors in Grapevine1

    PubMed Central

    Cavallini, Erika; Matus, José Tomás; Finezzo, Laura; Zenoni, Sara; Loyola, Rodrigo; Guzzo, Flavia; Schlechter, Rudolf; Ageorges, Agnès; Arce-Johnson, Patricio

    2015-01-01

    Because of the vast range of functions that phenylpropanoids possess, their synthesis requires precise spatiotemporal coordination throughout plant development and in response to the environment. The accumulation of these secondary metabolites is transcriptionally controlled by positive and negative regulators from the MYB and basic helix-loop-helix protein families. We characterized four grapevine (Vitis vinifera) R2R3-MYB proteins from the C2 repressor motif clade, all of which harbor the ethylene response factor-associated amphiphilic repression domain but differ in the presence of an additional TLLLFR repression motif found in the strong flavonoid repressor Arabidopsis (Arabidopsis thaliana) AtMYBL2. Constitutive expression of VvMYB4a and VvMYB4b in petunia (Petunia hybrida) repressed general phenylpropanoid biosynthetic genes and selectively reduced the amount of small-weight phenolic compounds. Conversely, transgenic petunia lines expressing VvMYBC2-L1 and VvMYBC2-L3 showed a severe reduction in petal anthocyanins and seed proanthocyanidins together with a higher pH of crude petal extracts. The distinct function of these regulators was further confirmed by transient expression in tobacco (Nicotiana benthamiana) leaves and grapevine plantlets. Finally, VvMYBC2-L3 was ectopically expressed in grapevine hairy roots, showing a reduction in proanthocyanidin content together with the down-regulation of structural and regulatory genes of the flavonoid pathway as revealed by a transcriptomic analysis. The physiological role of these repressors was inferred by combining the results of the functional analyses and their expression patterns in grapevine during development and in response to ultraviolet B radiation. Our results indicate that VvMYB4a and VvMYB4b may play a key role in negatively regulating the synthesis of small-weight phenolic compounds, whereas VvMYBC2-L1 and VvMYBC2-L3 may additionally fine tune flavonoid levels, balancing the inductive effects of

  19. Differential Regulation of ERK1/2 and mTORC1 Through T1R1/T1R3 in MIN6 Cells

    PubMed Central

    Wauson, Eric M.; Guerra, Marcy L.; Dyachok, Julia; McGlynn, Kathleen; Giles, Jennifer; Ross, Elliott M.

    2015-01-01

    The MAPKs ERK1/2 respond to nutrients and other insulin secretagogues in pancreatic β-cells and mediate nutrient-dependent insulin gene transcription. Nutrients also stimulate the mechanistic target of rapamycin complex 1 (mTORC1) to regulate protein synthesis. We showed previously that activation of both ERK1/2 and mTORC1 in the MIN6 pancreatic β-cell-derived line by extracellular amino acids (AAs) is at least in part mediated by the heterodimeric T1R1/T1R3, a G protein-coupled receptor. We show here that AAs differentially activate these two signaling pathways in MIN6 cells. Pretreatment with pertussis toxin did not prevent the activation of either ERK1/2 or mTORC1 by AAs, indicating that Gi is not central to either pathway. Although glucagon-like peptide 1, an agonist for a Gs-coupled receptor, activated ERK1/2 well and mTORC1 to a small extent, AAs had no effect on cytosolic cAMP accumulation. Ca2+ entry is required for ERK1/2 activation by AAs but is dispensable for AA activation of mTORC1. Pretreatment with UBO-QIC, a selective Gq inhibitor, reduced the activation of ERK1/2 but had little effect on the activation of mTORC1 by AAs, suggesting a differential requirement for Gq. Inhibition of G12/13 by the overexpression of the regulator of G protein signaling domain of p115 ρ-guanine nucleotide exchange factor had no effect on mTORC1 activation by AAs, suggesting that these G proteins are also not involved. We conclude that AAs regulate ERK1/2 and mTORC1 through distinct signaling pathways. PMID:26168033

  20. Validation of an r3AB1-FMDV-NSP ELISA to distinguish between cattle infected and vaccinated with foot-and-mouth disease virus.

    PubMed

    Jaworski, J Pablo; Compaired, D; Trotta, M; Perez, M; Trono, K; Fondevila, N

    2011-12-01

    Foot-and-mouth disease (FMD) is a highly contagious disease of cloven-hoofed livestock which has a drastic economic impact for affected countries. Although FMDV is distributed worldwide, many regional programs have been effective eradicating this agent. In Argentina, as in many other regions of South America, the combination of a systematic vaccination plan, together with an effective detection system capable of differentiating infection from vaccination, has been successful for eradicating this agent from the country. The properties of recombinant 3AB1 FMDV non-structural protein (r3AB1 FMDV-NSP), as a marker for the detection of antibodies to differentiate between cattle infected and vaccinated with FMDV, have been described previously. The goal of the present study was to validate the 3AB1 ELISA using a well characterized serum panel from Argentina (n=559) including eight national and one international reference sera. Overall, the 3AB1 ELISA demonstrated good feasibility, repeatability, reproducibility, analytical sensitivity and specificity, and accuracy. The results from the 3AB1 ELISA when compared with those obtained from the OIE index test (NCPanaftosa screening) showed a similar performance of both tests [diagnostic sensitivity=84% (C.I.=79-88%) and 80% (C.I.=75-85%), respectively; and diagnostic specificity=98.6% (C.I.=97-100%) and 95% (C.I.=91-98%), respectively]. The present work proposes the 3AB1 ELISA as an alternative to imported kits for FMD internal screening and transboundary sero-surveillance. PMID:21946290

  1. Poly(ester urethane)s consisting of poly[(R)-3-hydroxybutyrate] and poly(ethylene glycol) as candidate biomaterials: characterization and mechanical property study.

    PubMed

    Li, Xu; Loh, Xian Jun; Wang, Ke; He, Chaobin; Li, Jun

    2005-01-01

    Poly(ester urethane)s with poly[(R)-3-hydroxybutyrate] (PHB) as the hard and hydrophobic segment and poly(ethylene glycol) (PEG) as the soft and hydrophilic segment were synthesized from telechelic hydroxylated PHB (PHB-diol) and PEG using 1,6-hexamethylene diisocyanate as a nontoxic coupling reagent. Their chemical structures and molecular characteristics were studied by gel permeation chromatography, 1H NMR, and Fourier transform infrared spectroscopy. Results of differential scanning calorimetry and X-ray diffraction indicated that the PHB segment and PEG segment in the poly(ester urethane)s formed separate crystalline phases with lower crystallinity and a lower melting point than those of their corresponding precursors, except no PHB crystalline phase was observed in those with a relatively low PHB fraction. Thermogravimetric analysis showed that the poly(ester urethane)s had better thermal stability than their precursors. The segment compositions were calculated from the two-step thermal decomposition profiles, which were in good agreement with those obtained from 1H NMR. Water contact angle measurement and water swelling analysis revealed that both surface hydrophilicity and bulk hydrophilicity of the poly(ester urethane)s were enhanced by incorporating the PEG segment into PHB polymer chains. The mechanical properties of the poly(ester urethane)s were also assessed by tensile strength measurement. It was found that the poly(ester urethane)s were ductile, while natural source PHB is brittle. Young's modulus and the stress at break increased with increasing PHB segment length or PEG segment length, whereas the strain at break increased with increasing PEG segment length or decreasing PHB segment length. PMID:16153114

  2. R2R3-type MYB transcription factor, CmMYB1, is a central nitrogen assimilation regulator in Cyanidioschyzon merolae

    PubMed Central

    Imamura, Sousuke; Kanesaki, Yu; Ohnuma, Mio; Inouye, Takayuki; Sekine, Yasuhiko; Fujiwara, Takayuki; Kuroiwa, Tsuneyoshi; Tanaka, Kan

    2009-01-01

    Plant cells sense environmental nitrogen levels and alter their gene expression accordingly to survive; however, the underlying regulatory mechanisms still remains to be elucidated. Here, we identified and characterized a transcription factor that is responsible for expression of nitrogen assimilation genes in a unicellular red alga Cyanidioschyzon merolae. DNA microarray and Northern blot analyses revealed that transcript of the gene encoding CmMYB1, an R2R3-type MYB transcription factor, increased 1 h after nitrogen depletion. The CmMYB1 protein started to accumulate after 2 h and reached a peak after 4 h after nitrogen depletion, correlating with the expression of key nitrogen assimilation genes, such as CmNRT, CmNAR, CmNIR, CmAMT, and CmGS. Although the transcripts of these nitrogen assimilation genes were detected in nitrate-grown cells, they disappeared upon the addition of preferred nitrogen source such as ammonium or glutamine, suggesting the presence of a nitrogen catabolite repression (NCR) mechanism. The nitrogen depletion-induced gene expression disappeared in a CmMYB1-null mutant, and the mutant showed decreased cell viability after exposure to the nitrogen-depleted conditions compared with the parental strain. Chromatin immunoprecipitation analysis demonstrated that CmMYB1 specifically occupied these nitrogen-responsive promoter regions only under nitrogen-depleted conditions, and electrophoretic mobility shift assays using crude cell extract revealed specific binding of CmMYB1, or a complex containing CmMYB1, to these promoters. Thus, the presented results indicated that CmMYB1 is a central nitrogen regulator in C. merolae. PMID:19592510

  3. R2R3-type MYB transcription factor, CmMYB1, is a central nitrogen assimilation regulator in Cyanidioschyzon merolae.

    PubMed

    Imamura, Sousuke; Kanesaki, Yu; Ohnuma, Mio; Inouye, Takayuki; Sekine, Yasuhiko; Fujiwara, Takayuki; Kuroiwa, Tsuneyoshi; Tanaka, Kan

    2009-07-28

    Plant cells sense environmental nitrogen levels and alter their gene expression accordingly to survive; however, the underlying regulatory mechanisms still remains to be elucidated. Here, we identified and characterized a transcription factor that is responsible for expression of nitrogen assimilation genes in a unicellular red alga Cyanidioschyzon merolae. DNA microarray and Northern blot analyses revealed that transcript of the gene encoding CmMYB1, an R2R3-type MYB transcription factor, increased 1 h after nitrogen depletion. The CmMYB1 protein started to accumulate after 2 h and reached a peak after 4 h after nitrogen depletion, correlating with the expression of key nitrogen assimilation genes, such as CmNRT, CmNAR, CmNIR, CmAMT, and CmGS. Although the transcripts of these nitrogen assimilation genes were detected in nitrate-grown cells, they disappeared upon the addition of preferred nitrogen source such as ammonium or glutamine, suggesting the presence of a nitrogen catabolite repression (NCR) mechanism. The nitrogen depletion-induced gene expression disappeared in a CmMYB1-null mutant, and the mutant showed decreased cell viability after exposure to the nitrogen-depleted conditions compared with the parental strain. Chromatin immunoprecipitation analysis demonstrated that CmMYB1 specifically occupied these nitrogen-responsive promoter regions only under nitrogen-depleted conditions, and electrophoretic mobility shift assays using crude cell extract revealed specific binding of CmMYB1, or a complex containing CmMYB1, to these promoters. Thus, the presented results indicated that CmMYB1 is a central nitrogen regulator in C. merolae. PMID:19592510

  4. Measuring Cluster Relaxedness

    SciTech Connect

    Moreland, Blythe; /Michigan U. /SLAC

    2012-08-24

    When is a dark matter halo 'relaxed'? In our efforts to understand the structure of the universe, dark matter simulations have provided essential grounds for theoretical predictions. These simulations provide a wealth of ways of parameterizing and measuring the features of astronomical objects. It is these measurements on which we base comparisons of our world and our attempts to re-create it. One of the essential questions dark matter simulations help address is how dark matter halos evolve. How does one characterize different states of that evolution? The focus of this project is identifying cluster relaxedness and how it relates to the internal structure of the halo. A dark matter simulation consists of an N-body simulation which takes an initial set of positions and velocities of the dark matter particles and evolves them under the influence of gravity [6]. Though scientists have so far not been able to detect dark matter particles, the information from these simulations is still valuable especially given the relationship between dark matter halos and galaxy clusters. Galaxies sit within dark matter halos and recent evidence points to filaments of dark matter forming the framework on which galaxy clusters grow [7]. A dark matter halo is a collapsed group of gravitationally bound dark matter particles. Subsets of bound particles form subhalos or substructures. The dark matter simulation is carried out over time - with decreasing redshift (z) or increasing scale factor (a = 1/1+z ). (Thus, z = 0 or a = 1.0 is present-day.) The merger history of a halo can be represented pictorally by a merger tree. A major merger event occurs when a structure joins the main halo with the mass ratio between it and the main halo being above a certain threshold. These events mark important points in the halo's evolution. And it is at these events that one hopes, and perhaps is more likely, to relate measures of relaxedness to this mass accretion. Cluster relaxedness is not a well

  5. The Ages of Globular Clusters

    NASA Astrophysics Data System (ADS)

    McNamara, D. H.

    2001-03-01

    We examine the luminosity levels of the main-sequence turnoffs, MTOv, and horizontal branches, Mv(HB), in 16 globular clusters. An entirely new approach of inferring the luminosity levels by utilizing high-amplitude δ Scuti variables (HADS) is introduced. When the MTOv values are compared with theoretical values inferred from models, we find all 16 clusters (metal-strong to metal-poor) are coeval with an average age of ~11.3 Gyr. A considerable scatter of Mv(HB) values of clusters at similar [Fe/H] values is found. A trend for clusters with blue horizontal branches to have brighter Mv(HB) than clusters with blue-red horizontal branches is suggested by the data. The Mv(HB) values appear to depend on another or other parameters in addition to the [Fe/H] values. In spite of this problem, we derive an equation relating Mv(HB) values of globular clusters to their [Fe/H] values. We also derive an equation relating the MTOv values of clusters to their [Fe/H] values. Both of these equations can be utilized to find cluster distances. The distance modulus of the LMC is found to be 18.66 from the VTO values of three LMC globular clusters; RR Lyrae stars in seven globular clusters yield 18.61, and RR Lyrae stars in the LMC bar yield 18.64.

  6. GPU-based Multilevel Clustering.

    PubMed

    Chiosa, Iurie; Kolb, Andreas

    2010-04-01

    The processing power of parallel co-processors like the Graphics Processing Unit (GPU) are dramatically increasing. However, up until now only a few approaches have been presented to utilize this kind of hardware for mesh clustering purposes. In this paper we introduce a Multilevel clustering technique designed as a parallel algorithm and solely implemented on the GPU. Our formulation uses the spatial coherence present in the cluster optimization and hierarchical cluster merging to significantly reduce the number of comparisons in both parts . Our approach provides a fast, high quality and complete clustering analysis. Furthermore, based on the original concept we present a generalization of the method to data clustering. All advantages of the meshbased techniques smoothly carry over to the generalized clustering approach. Additionally, this approach solves the problem of the missing topological information inherent to general data clustering and leads to a Local Neighbors k-means algorithm. We evaluate both techniques by applying them to Centroidal Voronoi Diagram (CVD) based clustering. Compared to classical approaches, our techniques generate results with at least the same clustering quality. Our technique proves to scale very well, currently being limited only by the available amount of graphics memory. PMID:20421676

  7. Photoionization of argon clusters

    SciTech Connect

    Dehmer, Patricia M.; Pratt, Stephen T.

    1982-01-01

    Argon clusters were produced in a free supersonic molecular beam expansion of pure argon at room temperature and the photoionization efficiency curves of the trimer through hexamer were measured in the wavelength regions from threshold to 700 Â. A study of the Ar⁺3 photoionization efficiency curve as a function of nozzle stagnation pressure shows that fragmentation of heavier clusters can dominate the spectrum, even near threshold, and even when the nozzle conditions are such that the Ar⁺4 intensity is only a small fraction of the Ar⁺3 intensity. The Ar⁺3 photoionization efficiency curve, obtained using nozzle stagnation conditions such that no heavier ions were detected, exhibits several broad peaks near threshold which show similarities to bands of the dimer. At high nozzle stagnation pressures, the photoionization efficiency curves for Ar⁺3 to Ar⁺6 are nearly identical due to the effects of fragmentation. These spectra exhibit two very broad features which are similar to features observed in the solid. The threshold regions for all the positive ions show extremely gradual onsets, making it difficult to determine the appearance potentials accurately. The appearance potentials for Ar⁺2 and Ar⁺3 are 855.0±1.5 and 865.0±1.5 Â, respectively, yielding a value of 0.18±0.05 eV for the dissociation energy of Ar⁺3. The appearance potentials for the heavier clusters Ar⁺4 through Ar⁺6 are all approximately 870±2 Â.

  8. Velocity correlations of galaxy clusters

    NASA Technical Reports Server (NTRS)

    Cen, Renyue; Bahcall, Neta A.; Gramann, Mirt

    1994-01-01

    We determine the velocity correlation function, pairwise peculiar velocity difference, and rms pairwise peculiar velocity dispersion of rich clusters of galaxies, as a function of pair separation, for three cosmological models: Omega = 1 and Omega = 0.3 cold dark matter (CDM), and Omega = 0.3 primeval baryonic isocurvature (PBI) models (all flat and Cosmic Background Explorer (COBE)-normalized). We find that close cluster pairs, with separation r is less than or equal to 10/h Mpc, exhibit strong attractive peculiar velocities in all models; the cluster pairwise velocities depend sensitively on the model. The mean pairwise attractive velocity of clusters on 5/h Mpc scale ranges from approximately 1700 km/s for Omega = 1 CDM to approximately 1000 km/s for PBI to approximately 700 km/s for Omega = 0.3 CDM. The small-scale pairwise velocities depend also on cluster mass: richer, more massive clusters exhibit stronger attractive velocities than less massive clusters. On large scales, from approximately 20 to 200/h Mpc, the cluster peculiar velocities are increasingly dominated by bulk and random motions; they are independent of cluster mass. The cluster velocity correlation function is negative on small scales for Omega = 1 and Omega = 0.3 CDM, indicating strong pairwise motion relative to bulk motion on small scales; PBI exhibits relatively larger bulk motions. The cluster velocity correlation function is positive on very large scales, from r approximately 10/h Mpc to r approximately 200/h Mpc, for all models. These positive correlations, which decrease monotonically with scale, indicate significant bulk motions of clusters up to approximately 200/h Mpc. The strong dependence of the cluster velocity functions on models, especially at small separations, makes them useful tools in constraining cosmological models when compared with observations.

  9. Are Earthquake Magnitudes Clustered?

    SciTech Connect

    Davidsen, Joern; Green, Adam

    2011-03-11

    The question of earthquake predictability is a long-standing and important challenge. Recent results [Phys. Rev. Lett. 98, 098501 (2007); ibid.100, 038501 (2008)] have suggested that earthquake magnitudes are clustered, thus indicating that they are not independent in contrast to what is typically assumed. Here, we present evidence that the observed magnitude correlations are to a large extent, if not entirely, an artifact due to the incompleteness of earthquake catalogs and the well-known modified Omori law. The latter leads to variations in the frequency-magnitude distribution if the distribution is constrained to those earthquakes that are close in space and time to the directly following event.

  10. Poxvirus Orthologous Clusters (POCs).

    PubMed

    Ehlers, Angelika; Osborne, John; Slack, Stephanie; Roper, Rachel L; Upton, Chris

    2002-11-01

    Poxvirus Orthologous Clusters (POCs) is a JAVA client-server application which accesses an updated database containing all complete poxvirus genomes; it automatically groups orthologous genes into families based on BLASTP scores for assessment by a human database curator. POCs has a user-friendly interface permitting complex SQL queries to retrieve interesting groups of DNA and protein sequences as well as gene families for subsequent interrogation by a variety of integrated tools: BLASTP, BLASTX, TBLASTN, Jalview (multiple alignment), Dotlet (Dotplot), Laj (local alignment), and NAP (nucleotide to amino acid alignment). PMID:12424130

  11. Properties of The Brightest Cluster Galaxy and Its Host Cluster

    NASA Astrophysics Data System (ADS)

    Katayama, H.; Hayashida, K.; Takahara, F.

    2001-09-01

    We investigate the relation between the brightest cluster galaxy (BCG) and its host cluster. A BCG is a bright and massive elliptical galaxy in a cluster of galaxies. The luminosity of a BCG is 10 times larger than that of normal field galaxy and the mass of a BCG is about 1013Msolar which corresponds to that of galaxy group. In order to explain the origin of BCGs, the following three models are proposed: (1) star formation from cooling flow. In this model, intracluster gas gradually condenses at the center of the cluster and forms the BCG. (2) ``Galactic cannibalism'' or the accretion of smaller galaxies. In this model, dynamical friction accounts for the formation of the BCG. These two models predict the BCG evolves with the evolution of cluster. (3) Galaxy merging in the early history of the formation of the cluster. In this model, the property of BCGs is determined no later than cluster collapse. In any model, the formation of BCGs is related to the collapse and formation of its host cluster. The relation between the BCG and its host cluster was studied by Edge (1991). Edge (1991) found that the optical luminosity of the BCG is positively correlated with the X-ray luminosity and temperature of its host cluster. Edge (1991) concludes that these correlations indicate that the BCG responds to the overall cluster properties. In order to investigate the other relation between the BCG and its host cluster, we analyzed ROSAT archival data and compared the displacement between the X-ray peak and the BCG with the Z parameter of the fundamental relation found by Fujita and Takahara (1999). It is found that the displacement is larger with decreasing Z. Furthermore, the large Z clusters tend to have a regular X-ray profile, which implies a relaxed system. The fundamental parameter Z depends mainly on the virial density ρvir, and is considered to be related to the formation epoch of the cluster, i.e., large Z clusters are old clusters and small Z clusters are young

  12. Modes of clustered star formation

    NASA Astrophysics Data System (ADS)

    Pfalzner, S.; Kaczmarek, T.; Olczak, C.

    2012-09-01

    Context. The recent realization that most stars form in clusters, immediately raises the question of whether star and planet formation are influenced by the cluster environment. The stellar density in the most prevalent clusters is the key factor here. Whether dominant modes of clustered star formation exist is a fundamental question. Using near-neighbour searches in young clusters, Bressert and collaborators claim this not to be the case. They conclude that - at least in the solar neighbourhood - star formation is continuous from isolated to densely clustered environments and that the environment plays a minor role in star and planet formation. Aims: We investigate under which conditions near-neighbour searches in young clusters can distinguish between different modes of clustered star formation. Methods: Model star clusters with different memberships and density distributions are set up and near-neighbour searches are performed. We investigate the influence of the combination of different cluster modes, observational biases, and types of diagnostic on the results. Results: We find that the specific cluster density profile, the relative sample sizes, the limitations of the observation, and the choice of diagnostic method decide, whether modelled modes of clustered star formation are detected by near-neighbour searches. For density distributions that are centrally concentrated but span a wide density range (for example, King profiles), separate cluster modes are only detectable under ideal conditions (sample selection, completeness) if the mean density of the individual clusters differs by at least a factor of ~65. Introducing a central cut-off can lead to an underestimate of the mean density by more than a factor of ten especially in high density regions. The environmental effect on star and planet formation is similarly underestimated for half of the population in dense systems. Conclusions: Local surface-density distributions are a very useful tool for single

  13. Decaying neutrinos in galaxy clusters

    NASA Technical Reports Server (NTRS)

    Melott, Adrian L.; Splinter, Randall J.; Persic, Massimo; Salucci, Paolo

    1994-01-01

    Davidsen et al. (1991) have argued that the failure to detect UV photons from the dark matter (DM) in cluster A665 excludes the decaying neutrino hypothesis. Sciama et al. (1993) argued that because of high central concentration the DM in that cluster must be baryonic. We study the DM profile in clusters of galaxies simulated using the Harrison-Zel'dovich spectrum of density fluctuations, and an amplitude previously derived from numerical simulations (Melott 1984b; Anninos et al. 1991) and in agreement with microwave background fluctuations (Smoot et al. 1992). We find that with this amplitude normalization cluster neutrino DM densities are comparable to observed cluster DM values. We conclude that given this normalization, the cluster DM should be at least largely composed of neutrinos. The constraint of Davidsen et al. can be somewhat weakened by the presence of baryonic DM; but it cannot be eliminated given our assumptions.

  14. Textures and clusters. [of galaxies

    NASA Technical Reports Server (NTRS)

    Bartlett, James G.; Gooding, Andrew K.; Spergel, David N.

    1993-01-01

    We discuss the properties of galaxy clusters expected in a texture-seeded, CDM-dominated, Omega = 1 universe. Assuming that the textures are spherical, we use the spherical collapse model to compute the cluster velocity dispersion (or temperature) distribution function. For objects of mass 10 exp 11 to 10 exp 15 solar masses, we find v varies as M super gamma with gamma of about 0.25. An unbiased (b = 1) texture model predicts too many high-velocity dispersion clusters. A biased texture model appears to be compatible with cluster properties inferred from optical and X-ray observations. In the texture model, the cluster velocity distribution functio does not evolve rapidly; thus, the model predicts the existence of rich clusters at moderate redshift (about 1-2).

  15. The SMART CLUSTER METHOD - adaptive earthquake cluster analysis and declustering

    NASA Astrophysics Data System (ADS)

    Schaefer, Andreas; Daniell, James; Wenzel, Friedemann

    2016-04-01

    Earthquake declustering is an essential part of almost any statistical analysis of spatial and temporal properties of seismic activity with usual applications comprising of probabilistic seismic hazard assessments (PSHAs) and earthquake prediction methods. The nature of earthquake clusters and subsequent declustering of earthquake catalogues plays a crucial role in determining the magnitude-dependent earthquake return period and its respective spatial variation. Various methods have been developed to address this issue from other researchers. These have differing ranges of complexity ranging from rather simple statistical window methods to complex epidemic models. This study introduces the smart cluster method (SCM), a new methodology to identify earthquake clusters, which uses an adaptive point process for spatio-temporal identification. Hereby, an adaptive search algorithm for data point clusters is adopted. It uses the earthquake density in the spatio-temporal neighbourhood of each event to adjust the search properties. The identified clusters are subsequently analysed to determine directional anisotropy, focussing on a strong correlation along the rupture plane and adjusts its search space with respect to directional properties. In the case of rapid subsequent ruptures like the 1992 Landers sequence or the 2010/2011 Darfield-Christchurch events, an adaptive classification procedure is applied to disassemble subsequent ruptures which may have been grouped into an individual cluster using near-field searches, support vector machines and temporal splitting. The steering parameters of the search behaviour are linked to local earthquake properties like magnitude of completeness, earthquake density and Gutenberg-Richter parameters. The method is capable of identifying and classifying earthquake clusters in space and time. It is tested and validated using earthquake data from California and New Zealand. As a result of the cluster identification process, each event in

  16. Long [R3] insulin-like growth factor-I reduces growth, plasma growth hormone, IGF binding protein-3 and endogenous IGF-I concentrations in pigs.

    PubMed

    Dunaiski, V; Dunshea, F R; Walton, P E; Goddard, C

    1997-12-01

    Growth hormone (GH) improves growth performance in the pig. Analogues of insulin-like growth factor-I (IGF-I) that bind poorly to IGF binding proteins (IGFBP) stimulate growth in the rat but, in contrast, inhibit growth in the pig. This study was designed to determine the effect of IGF peptides alone or in combination with porcine GH (pGH) on growth characteristics and plasma hormone concentrations in finisher pigs. A four-day infusion of Long [R3] IGF-I (LR3IGF-I; 180 micrograms/kg/day) decreased the average daily gain, food intake, and plasma IGFBP-3, IGF-I and insulin concentrations. The mean plasma GH concentration was decreased by 23% and the area under the GH peaks was reduced by 60%. Co-administration of pGH (30 micrograms/kg/day) with LR3IGF-I had no interactive effect on growth performance, and plasma insulin, IGFBP-3 and IGF-I concentrations remained suppressed. The area under the GH peaks was not restored with this combination treatment although mean plasma GH concentrations were elevated in all animals receiving pGH. Infusion of IGF-I (180 micrograms/kg/day) decreased plasma insulin and mean GH concentrations but had no significant effect on IGFBP-3 concentrations. Average daily gain and feed intake were not changed by IGF-I treatment. A combination of IGF-I and pGH injection (30 micrograms/kg/day) increased plasma IGFBP-3 concentrations but plasma insulin levels remained suppressed. Plasma glucose levels were unaffected by any treatment. The study demonstrates that both IGF-I and LR3IGF-I suppress plasma GH concentrations in finisher pigs. This, in turn, may be responsible for the reduction in the plasma concentration of IGF-I, IGFBP-3 and insulin seen in LR3IGF-I-treated animals. The decrease in these parameters may contribute to the inhibitory effect of LR3IGF-I on growth performance in the pig. PMID:9488001

  17. Magnetic order of Y3NiSi3-type R3NiSi3 (R=Gd-DY) compounds

    NASA Astrophysics Data System (ADS)

    Morozkin, A. V.; Yapaskurt, V. O.; Nirmala, R.; Malik, S. K.; Quezado, S.; Yao, Jinlei; Mozharivskyj, Y.; Nigam, A. K.; Isnard, O.

    2016-01-01

    Magnetic measurements and neutron powder diffraction investigations on the Y3NiSi3-type R3NiSi3 compounds (R=Gd, Tb, Dy) reveal their complex antiferromagnetic ordering. Magnetic measurements on Gd3NiSi3, Tb3NiSi3 and Dy3NiSi3 indicate antiferromagnetic-like transition at temperatures 260 K, 202 K and 140 K, respectively. Also, the Tb3NiSi3 and Dy3NiSi3 compounds show spin-reorientation transition at 132 K and 99 K, respectively. Below the spin-reorientation transition, the isothermal magnetization curves indicate the metamagnetic-like behavior of Tb3NiSi3 and Dy3NiSi3. The magnetocaloric effect of Dy3NiSi3 is calculated in terms of isothermal magnetic entropy change and it reaches a maximum value of -1.2 J/kg K and -1.1 J/kg K for a field change of 50 kOe near 146 K and 92 K, respectively. The neutron diffraction studies of Tb3NiSi3 suggest the magnetic ordering of the Tb2 4j sublattice and no magnetic ordering of the Tb1 2a sublattice. Tb3NiSi3 transforms from the high temperature paramagnetic state to the commensurate high-temperature a- and c-axis antiferromagnet of I‧2/m magnetic space group below 250 K. Below 150 K, the high-temperature antiferromagnet transforms into the low-temperature a-, b- and c-axis antiferromagnet of I‧i magnetic space group. At 1.5 K, the terbium magnetic moment in Tb2 sublattice and its a-, b- and c-axis components reach the values of MTb2=8.2(1) μB, MaTb2=5.9(1) μB, MbTb2=4.3(2) μB and McTb2=3.7(2) μB, respectively.

  18. Accumulation of poly[(R)-3-hydroxyalkanoates] in Pseudomonas oleovorans during growth in batch and chemostat culture with different carbon sources.

    PubMed

    Durner, R; Zinn, M; Witholt, B; Egli, T

    2001-02-01

    Pseudomonas oleovorans (ATCC 29347) was grown in batch and chemostat cultures with citrate, hexanoate, heptanoate, octanoate, and nonanoate as single carbon substrates. The growth medium for batch cultures was adjusted such that nitrogen (NH(4)(+)) limitation terminated the exponential-growth phase. During batch cultivation with octanoate or nonanoate the biomass continued to increase after depletion of ammonium due to the accumulation of medium-chain-length poly[(R)-3-hydroxyalkanoates] (mcl-PHAs). Additionally, a significant rate of mcl-PHA accumulation was also observed in the exponential-growth phase of batch cultures. It is well known that the accumulation of reserve materials is strongly dependent on the ratio of nutrients (here of carbon, C, and of nitrogen, N) and that in a batch culture the ratio of C:N is continuously changing. Therefore, we have also investigated the effect of defined ratios of C:N under constant cultivation conditions, namely at a fixed dilution rate (D) in a chemostat fed with different medium C:N ratios. These experiments were performed at a constant D of 0.2 h(-1). The concentration of the nitrogen source in the inflowing medium (N()) was kept constant, while its carbon concentration (C()) was increased stepwise, resulting in an increase of the medium carbon to nitrogen ratio (C()/N() ratio). The culture parameters and the cell composition of steady-state cultures were determined as a function of the C()/N() ratio in the feed medium. Mcl-PHA accumulation was detected during growth with the fatty acids, and three distinct regimes of growth limitation were discovered: In addition to carbon limitation at low, and nitrogen limitation at high C()/N() ratios, an intermediate growth regime of simultaneous limitation by carbon and nitrogen was detected where both substrates were used to completion. The width of this dual-nutrient-limited growth regime was dependent on the change in the yield factors for carbon and nitrogen (Y(X/C), Y

  19. Ectopic Expression of the Coleus R2R3 MYB-Type Proanthocyanidin Regulator Gene SsMYB3 Alters the Flower Color in Transgenic Tobacco

    PubMed Central

    Zhu, Qinlong; Sui, Shunzhao; Lei, Xinghua; Yang, Zhongfang; Lu, Kun; Liu, Guangde; Liu, Yao-Guang; Li, Mingyang

    2015-01-01

    Proanthocyanidins (PAs) play an important role in plant disease defense and have beneficial effects on human health. We isolated and characterized a novel R2R3 MYB-type PA-regulator SsMYB3 from a well-known ornamental plant, coleus (Solenostemon scutellarioides), to study the molecular regulation of PAs and to engineer PAs biosynthesis. The expression level of SsMYB3 was correlated with condensed tannins contents in various coleus tissues and was induced by wounding and light. A complementation test in the Arabidopsis tt2 mutant showed that SsMYB3 could restore the PA-deficient seed coat phenotype and activated expression of the PA-specific gene ANR and two related genes, DFR and ANS. In yeast two-hybrid assays, SsMYB3 interacted with the Arabidopsis AtTT8 and AtTTG1 to reform the ternary transcriptional complex, and also interacted with two tobacco bHLH proteins (NtAn1a and NtJAF13-1) and a WD40 protein, NtAn11-1. Ectopic overexpression of SsMYB3 in transgenic tobacco led to almost-white flowers by greatly reducing anthocyanin levels and enhancing accumulation of condensed tannins. This overexpression of SsMYB3 upregulated the key PA genes (NtLAR and NtANR) and late anthocyanin structural genes (NtDFR and NtANS), but downregulated the expression of the final anthocyanin gene NtUFGT. The formative SsMYB3-complex represses anthocyanin accumulation by directly suppressing the expression of the final anthocyanin structural gene NtUFGT, through competitive inhibition or destabilization of the endogenous NtAn2-complex formation. These results suggested that SsMYB3 may form a transcription activation complex to regulate PA biosynthesis in the Arabidopsis tt2 mutant and transgenic tobacco. Our findings suggest that SsMYB3 is involved in the regulation of PA biosynthesis in coleus and has the potential as a molecular tool for manipulating biosynthesis of PAs in fruits and other crops using metabolic engineering. PMID:26448466

  20. Ectopic Expression of the Coleus R2R3 MYB-Type Proanthocyanidin Regulator Gene SsMYB3 Alters the Flower Color in Transgenic Tobacco.

    PubMed

    Zhu, Qinlong; Sui, Shunzhao; Lei, Xinghua; Yang, Zhongfang; Lu, Kun; Liu, Guangde; Liu, Yao-Guang; Li, Mingyang

    2015-01-01

    Proanthocyanidins (PAs) play an important role in plant disease defense and have beneficial effects on human health. We isolated and characterized a novel R2R3 MYB-type PA-regulator SsMYB3 from a well-known ornamental plant, coleus (Solenostemon scutellarioides), to study the molecular regulation of PAs and to engineer PAs biosynthesis. The expression level of SsMYB3 was correlated with condensed tannins contents in various coleus tissues and was induced by wounding and light. A complementation test in the Arabidopsis tt2 mutant showed that SsMYB3 could restore the PA-deficient seed coat phenotype and activated expression of the PA-specific gene ANR and two related genes, DFR and ANS. In yeast two-hybrid assays, SsMYB3 interacted with the Arabidopsis AtTT8 and AtTTG1 to reform the ternary transcriptional complex, and also interacted with two tobacco bHLH proteins (NtAn1a and NtJAF13-1) and a WD40 protein, NtAn11-1. Ectopic overexpression of SsMYB3 in transgenic tobacco led to almost-white flowers by greatly reducing anthocyanin levels and enhancing accumulation of condensed tannins. This overexpression of SsMYB3 upregulated the key PA genes (NtLAR and NtANR) and late anthocyanin structural genes (NtDFR and NtANS), but downregulated the expression of the final anthocyanin gene NtUFGT. The formative SsMYB3-complex represses anthocyanin accumulation by directly suppressing the expression of the final anthocyanin structural gene NtUFGT, through competitive inhibition or destabilization of the endogenous NtAn2-complex formation. These results suggested that SsMYB3 may form a transcription activation complex to regulate PA biosynthesis in the Arabidopsis tt2 mutant and transgenic tobacco. Our findings suggest that SsMYB3 is involved in the regulation of PA biosynthesis in coleus and has the potential as a molecular tool for manipulating biosynthesis of PAs in fruits and other crops using metabolic engineering. PMID:26448466

  1. Active matter clusters at interfaces.

    NASA Astrophysics Data System (ADS)

    Copenhagen, Katherine; Gopinathan, Ajay

    2016-03-01

    Collective and directed motility or swarming is an emergent phenomenon displayed by many self-organized assemblies of active biological matter such as clusters of embryonic cells during tissue development, cancerous cells during tumor formation and metastasis, colonies of bacteria in a biofilm, or even flocks of birds and schools of fish at the macro-scale. Such clusters typically encounter very heterogeneous environments. What happens when a cluster encounters an interface between two different environments has implications for its function and fate. Here we study this problem by using a mathematical model of a cluster that treats it as a single cohesive unit that moves in two dimensions by exerting a force/torque per unit area whose magnitude depends on the nature of the local environment. We find that low speed (overdamped) clusters encountering an interface with a moderate difference in properties can lead to refraction or even total internal reflection of the cluster. For large speeds (underdamped), where inertia dominates, the clusters show more complex behaviors crossing the interface multiple times and deviating from the predictable refraction and reflection for the low velocity clusters. We then present an extreme limit of the model in the absence of rotational damping where clusters can become stuck spiraling along the interface or move in large circular trajectories after leaving the interface. Our results show a wide range of behaviors that occur when collectively moving active biological matter moves across interfaces and these insights can be used to control motion by patterning environments.

  2. Digging Deep in Pandora's Cluster

    NASA Astrophysics Data System (ADS)

    Blakeslee, John P.; Alamo-Martinez, Karla; Toloba, Elisa; Barro, Guillermo; Peng, Eric W.

    2015-01-01

    Abell 2744, the first and nearest (z=0.31) of the Hubble Frontier Fields, is extraordinarily rich in the number and variety of galaxies it contains. Nicknamed "Pandora's Cluster," it exhibits multiple peaks in the dark matter, X-ray, and galaxy density distributions, suggesting an ongoing collision of several massive clusters. The exceptional depth of the Hubble Frontier Field imaging now makes it possible to throw open Pandora's cluster and peer deep inside. To do this, we first model and remove the stellar light of the cluster galaxies; underneath we find not only distant background galaxies, but (like the Hope that lay at the bottom of Pandora's box) a large population of globular star clusters and compact cluster members within Abell 2744 itself. Our earlier work on the massive lensing cluster Abell 1689 (Alamo-Martinez et al. 2013) revealed the largest known population of globular clusters, with a spatial profile intermediate between the galaxy light and the dark matter. Abell 2744 is similarly massive, but far less regular in its density distribution; we examine what implications this has for the copious globular clusters coursing through its multiple cores.

  3. Lattice QCD clusters at Fermilab

    SciTech Connect

    Holmgren, D.; Mackenzie, Paul B.; Singh, Anitoj; Simone, Jim; /Fermilab

    2004-12-01

    As part of the DOE SciDAC ''National Infrastructure for Lattice Gauge Computing'' project, Fermilab builds and operates production clusters for lattice QCD simulations. This paper will describe these clusters. The design of lattice QCD clusters requires careful attention to balancing memory bandwidth, floating point throughput, and network performance. We will discuss our investigations of various commodity processors, including Pentium 4E, Xeon, Opteron, and PPC970. We will also discuss our early experiences with the emerging Infiniband and PCI Express architectures. Finally, we will present our predictions and plans for future clusters.

  4. Constrained Clustering With Imperfect Oracles.

    PubMed

    Zhu, Xiatian; Loy, Chen Change; Gong, Shaogang

    2016-06-01

    While clustering is usually an unsupervised operation, there are circumstances where we have access to prior belief that pairs of samples should (or should not) be assigned with the same cluster. Constrained clustering aims to exploit this prior belief as constraint (or weak supervision) to influence the cluster formation so as to obtain a data structure more closely resembling human perception. Two important issues remain open: 1) how to exploit sparse constraints effectively and 2) how to handle ill-conditioned/noisy constraints generated by imperfect oracles. In this paper, we present a novel pairwise similarity measure framework to address the above issues. Specifically, in contrast to existing constrained clustering approaches that blindly rely on all features for constraint propagation, our approach searches for neighborhoods driven by discriminative feature selection for more effective constraint diffusion. Crucially, we formulate a novel approach to handling the noisy constraint problem, which has been unrealistically ignored in the constrained clustering literature. Extensive comparative results show that our method is superior to the state-of-the-art constrained clustering approaches and can generally benefit existing pairwise similarity-based data clustering algorithms, such as spectral clustering and affinity propagation. PMID:25622327

  5. A2111: A z= 0.23 Butcher-Oemler Cluster with a Non-Isothermal Atmosphere and Normal Metallicity

    NASA Technical Reports Server (NTRS)

    Wang, Q. Daniel; Henriksen, Mark

    1998-01-01

    We report results from an x-ray spectral study of the z=0.23 Abell 2111 galaxy cluster using the Advanced Satellite for Astrophysics and Cosmology and the ROSAT Position Sensitive Proportional Counter. By correcting for the energy-dependent point-spread function of the instruments, we have examined the temperature structure of the cluster. The cluster's core within 3 is found to have a temperature of 5.4 +/- 0.5 keV, significantly higher than 2.8 +/-0.7 keV in the surrounding region of r = 3-6. This radially decreasing temperature structure can be parameterized by a polytropic index of gamma less than 1.4. Furthermore, the intracluster medium appears clumpy on scales less than 1. Early studies have revealed that the x-ray centroid of the cluster shifts with spatial scale and the overall optical and x-ray morphology is strongly elongated. These results together suggest that A2111 in undergoing a merger, which is likely responsible for the high fraction of blue galaxies observed in the cluster. We have further measured the abundance of the medium as 0.25 +/- 0.14 solar. This value is similar to those of nearby clusters which do not show a large blue galaxy function, suggesting that star formation in disk galaxies and subsequent loss to the intracluster medium do not drastically alter the average abundance of a cluster since z=0.23.

  6. Signalling profiles of H3 relaxin, H2 relaxin and R3(BΔ23–27)R/I5 acting at the relaxin family peptide receptor 3 (RXFP3)

    PubMed Central

    Kocan, M; Sarwar, M; Hossain, M A; Wade, J D; Summers, R J

    2014-01-01

    Background and Purpose Relaxin family peptide receptor 3 (RXFP3) is expressed in brain areas important for processing sensory information and feeding, suggesting that it may be a target for anti-anxiety and anti-obesity drugs. We examined the effects of H3 relaxin, the biased agonist H2 relaxin and the antagonist, R3(BΔ23–27)R/I5, on RXFP3 signalling to establish their suitability as tools to assess the physiological roles of RXFP3. Experimental Approach The signalling profile of the RXFP3 ligands was determined using reporter gene assays, multiplexed signalling assays and direct examination of receptor–G protein and receptor–β-arrestin interactions using BRET. Key Results H2 relaxin activated p38MAPK and ERK1/2 with lower efficacy than H3 relaxin, but had similar efficacy for JNK1/2 phosphorylation. H2 or H3 relaxin activation of p38MAPK, JNK1/2 or ERK1/2 involved Pertussis toxin-sensitive G-proteins. R3(BΔ23–27)R/I5 blocked H3 relaxin AP-1 reporter gene activation, but not H2 relaxin AP-1 activation or H3 relaxin NF-κB activation. R3(BΔ23–27)R/I5 activated the SRE reporter, but did not inhibit either H2 or H3 relaxin SRE activation. R3(BΔ23–27)R/I5 blocked H3 relaxin-stimulated p38MAPK and ERK1/2 phosphorylation, but was a weak partial agonist for p38MAPK and ERK1/2 signalling. p38MAPK activation by R3(BΔ23–27)R/I5 was G protein-independent. H3 relaxin-activated RXFP3 interacts with Gαi2, Gαi3, GαoA and GαoB whereas H2 relaxin or R3(BΔ23–27)R/I5 induce interactions only with Gαi2 or GαoB. Only H3 relaxin promoted RXFP3/β-arrestin interactions that were blocked by R3(BΔ23–27)R/I5. Conclusion and Implications Understanding signalling profile of drugs acting at RXFP3 is essential for development of therapies targeting this receptor. PMID:24641548

  7. Analyzing geographic clustered response

    SciTech Connect

    Merrill, D.W.; Selvin, S.; Mohr, M.S.

    1991-08-01

    In the study of geographic disease clusters, an alternative to traditional methods based on rates is to analyze case locations on a transformed map in which population density is everywhere equal. Although the analyst's task is thereby simplified, the specification of the density equalizing map projection (DEMP) itself is not simple and continues to be the subject of considerable research. Here a new DEMP algorithm is described, which avoids some of the difficulties of earlier approaches. The new algorithm (a) avoids illegal overlapping of transformed polygons; (b) finds the unique solution that minimizes map distortion; (c) provides constant magnification over each map polygon; (d) defines a continuous transformation over the entire map domain; (e) defines an inverse transformation; (f) can accept optional constraints such as fixed boundaries; and (g) can use commercially supported minimization software. Work is continuing to improve computing efficiency and improve the algorithm. 21 refs., 15 figs., 2 tabs.

  8. Biological Cluster Mass Spectrometry

    PubMed Central

    Winograd, Nicholas; Garrison, Barbara J.

    2010-01-01

    This article reviews the new physics and new applications of secondary ion mass spectrometry using cluster ion probes. These probes, particularly C60, exhibit enhanced molecular desorption with improved sensitivity owing to the unique nature of the energy-deposition process. In addition, these projectiles are capable of eroding molecular solids while retaining the molecular specificity of mass spectrometry. When the beams are microfocused to a spot on the sample, bioimaging experiments in two and three dimensions are feasible. We describe emerging theoretical models that allow the energy-deposition process to be understood on an atomic and molecular basis. Moreover, experiments on model systems are described that allow protocols for imaging on biological materials to be implemented. Finally, we present recent applications of imaging to biological tissue and single cells to illustrate the future directions of this methodology. PMID:20055679

  9. Clustered engine study

    NASA Technical Reports Server (NTRS)

    Shepard, Kyle; Sager, Paul; Kusunoki, Sid; Porter, John; Campion, AL; Mouritzan, Gunnar; Glunt, George; Vegter, George; Koontz, Rob

    1993-01-01

    Several topics are presented in viewgraph form which together encompass the preliminary assessment of nuclear thermal rocket engine clustering. The study objectives, schedule, flow, and groundrules are covered. This is followed by the NASA groundrules mission and our interpretation of the associated operational scenario. The NASA reference vehicle is illustrated, then the four propulsion system options are examined. Each propulsion system's preliminary design, fluid systems, operating characteristics, thrust structure, dimensions, and mass properties are detailed as well as the associated key propulsion system/vehicle interfaces. A brief series of systems analysis is also covered including: thrust vector control requirements, engine out possibilities, propulsion system failure modes, surviving system requirements, and technology requirements. An assessment of vehicle/propulsion system impacts due to the lessons learned are presented.

  10. Ionized cluster beam deposition

    NASA Technical Reports Server (NTRS)

    Kirkpatrick, A. R.

    1983-01-01

    Ionized Cluster Beam (ICB) deposition, a new technique originated by Takagi of Kyoto University in Japan, offers a number of unique capabilities for thin film metallization as well as for deposition of active semiconductor materials. ICB allows average energy per deposited atom to be controlled and involves impact kinetics which result in high diffusion energies of atoms on the growth surface. To a greater degree than in other techniques, ICB involves quantitative process parameters which can be utilized to strongly control the characteristics of films being deposited. In the ICB deposition process, material to be deposited is vaporized into a vacuum chamber from a confinement crucible at high temperature. Crucible nozzle configuration and operating temperature are such that emerging vapor undergoes supercondensation following adiabatic expansion through the nozzle.

  11. Cross-Clustering: A Partial Clustering Algorithm with Automatic Estimation of the Number of Clusters

    PubMed Central

    Tellaroli, Paola; Bazzi, Marco; Donato, Michele; Brazzale, Alessandra R.; Drăghici, Sorin

    2016-01-01

    Four of the most common limitations of the many available clustering methods are: i) the lack of a proper strategy to deal with outliers; ii) the need for a good a priori estimate of the number of clusters to obtain reasonable results; iii) the lack of a method able to detect when partitioning of a specific data set is not appropriate; and iv) the dependence of the result on the initialization. Here we propose Cross-clustering (CC), a partial clustering algorithm that overcomes these four limitations by combining the principles of two well established hierarchical clustering algorithms: Ward’s minimum variance and Complete-linkage. We validated CC by comparing it with a number of existing clustering methods, including Ward’s and Complete-linkage. We show on both simulated and real datasets, that CC performs better than the other methods in terms of: the identification of the correct number of clusters, the identification of outliers, and the determination of real cluster memberships. We used CC to cluster samples in order to identify disease subtypes, and on gene profiles, in order to determine groups of genes with the same behavior. Results obtained on a non-biological dataset show that the method is general enough to be successfully used in such diverse applications. The algorithm has been implemented in the statistical language R and is freely available from the CRAN contributed packages repository. PMID:27015427

  12. Effects of insulin-like growth factor-I and its analogue, long-R3-IGF-I, on intestinal absorption of 3-O-methyl-D-glucose are less pronounced than gut mucosal growth responses.

    PubMed

    Garnaut, Sonja M; Howarth, Gordon S; Read, Leanna C

    2002-03-01

    The relationship between insulin-like growth factor-I (IGF-I) peptide-induced increases in bowel mass and functional improvement is unclear. We utilised three independent methods to investigate the effects of IGF-I peptides on intestinal absorption of the glucose analogue, 3-O-methyl-D-glucose (3MG) in rats. Rats received vehicle, IGF-I or the more potent analogue, long-R3-IGF-I via subcutaneously implanted mini-pump, for 7 days, at which time intestinal absorption was assessed by: (1) plasma 3MG appearance following oral gavage, (2) single-pass- or (3) recirculating-perfusion of a jejunal segment. 3MG (320 or 800 mg) was gavaged on day 7 to rats treated with vehicle, IGR-I or long-R3-IGF-I. With the lower 3MG dose, only long-R3-IGF-I increased (40%) the initial rate of 3MG appearance in plasma. IGF-I had no significant effect, whilst at the higher 3MG dose neither peptide was effective. Utilising perfusion techniques, long-R3-IGF-I, but not IGF-I, significantly increased 3MG uptake per cm of jejunum by up to 69%, although significance was lost when expressed as a function of tissue weight. Long-R3-IGF-I, but not native IGF-I, enhanced 3MG absorption from the intestinal lumen, presumably reflecting an increased mucosal mass rather than an up-regulation of specific epithelial glucose transporters. PMID:11999215

  13. Niobium Cluster Compounds with Transition Metals: K 2Mn[Nb 6Cl 18

    NASA Astrophysics Data System (ADS)

    Sitar, Jennifer; Lachgar, Abdessadek; Womelsdorf, Hermann; Meyer, H.-Jürgen

    1996-03-01

    A new quaternary niobium cluster chloride, K2Mn[Nb6Cl18], has been synthesized in a sealed quartz tube from stoichiometric amounts of NbCl5, niobium metal, KCl, and MnCl2at 720°C. The structure, as determined by single-crystal X-ray diffraction, is rhombohedral, space groupR3 (No. 148) withZ= 3 and has lattice parametersa= 914.01 (4) pm,c= 2522.9 (2) pm (hexagonal setting). The structure refinement based onF2yielded wR2 = 0.040. (For comparison, a refinement based onFvalues yieldedR1 = 0.016). The structure contains isolated [Nb6Cl18]4-clusters, separated by K+and Mn2+cations, being located in an anticubeoctahedral and octahedral chloride coordination environment, respectively.

  14. Information Clustering Based on Fuzzy Multisets.

    ERIC Educational Resources Information Center

    Miyamoto, Sadaaki

    2003-01-01

    Proposes a fuzzy multiset model for information clustering with application to information retrieval on the World Wide Web. Highlights include search engines; term clustering; document clustering; algorithms for calculating cluster centers; theoretical properties concerning clustering algorithms; and examples to show how the algorithms work.…

  15. Antibody-gold cluster conjugates

    DOEpatents

    Hainfeld, J.F.

    1988-06-28

    Antibody- or antibody fragment-gold cluster conjugates are shown wherein the conjugate size can be about 5.0 nm. Methods and reagents are disclosed in which antibodies or Fab' fragments thereof are covalently bound to a stable cluster of gold atoms. 2 figs.

  16. Two generalizations of Kohonen clustering

    NASA Technical Reports Server (NTRS)

    Bezdek, James C.; Pal, Nikhil R.; Tsao, Eric C. K.

    1993-01-01

    The relationship between the sequential hard c-means (SHCM), learning vector quantization (LVQ), and fuzzy c-means (FCM) clustering algorithms is discussed. LVQ and SHCM suffer from several major problems. For example, they depend heavily on initialization. If the initial values of the cluster centers are outside the convex hull of the input data, such algorithms, even if they terminate, may not produce meaningful results in terms of prototypes for cluster representation. This is due in part to the fact that they update only the winning prototype for every input vector. The impact and interaction of these two families with Kohonen's self-organizing feature mapping (SOFM), which is not a clustering method, but which often leads ideas to clustering algorithms is discussed. Then two generalizations of LVQ that are explicitly designed as clustering algorithms are presented; these algorithms are referred to as generalized LVQ = GLVQ; and fuzzy LVQ = FLVQ. Learning rules are derived to optimize an objective function whose goal is to produce 'good clusters'. GLVQ/FLVQ (may) update every node in the clustering net for each input vector. Neither GLVQ nor FLVQ depends upon a choice for the update neighborhood or learning rate distribution - these are taken care of automatically. Segmentation of a gray tone image is used as a typical application of these algorithms to illustrate the performance of GLVQ/FLVQ.

  17. Active matter clusters at interfaces

    NASA Astrophysics Data System (ADS)

    Copenhagen, Katherine; Gopinathan, Ajay

    Collective and directed motility or swarming is an emergent phenomenon displayed by many self-organized assemblies of active biological matter such as clusters of embryonic cells during tissue development and flocks of birds. Such clusters typically encounter very heterogeneous environments. What happens when a cluster encounters an interface between two different environments has implications for its function and fate. Here we study this problem by using a mathematical model of a cluster that treats it as a single cohesive unit whose movement depends on the nature of the local environment. We find that low speed clusters which exert forces but no active torques, encountering an interface with a moderate difference in properties can lead to refraction or even total internal reflection of the cluster. For large speeds and clusters with active torques, they show more complex behaviors crossing the interface multiple times, becoming trapped at the interface and deviating from the predictable refraction and reflection of the low velocity clusters. Our results show a wide range of behaviors that occur when collectively moving active biological matter moves across interfaces and these insights can be used to control motion by patterning environments.

  18. Cluster highlights in magnetospheric physics

    NASA Astrophysics Data System (ADS)

    Escoubet, C. Philippe; Laakso, Harri; Taylor, Matthew; Goldstein, Mevlyn; Hapgood, Mike; Masson, Arnaud; Volpp, Juergen; Sieg, Detlef

    The Cluster mission has been operated successfully for 14 years. As the first science mission comprising four identical spacecraft, Cluster has faced many challenges during its lifetime: its long selection process together with SOHO, the failure of the first Ariane V launch, its fast rebuilt, and the launch on two Soyuz rockets in 2000. The separation of the Cluster spacecraft was changed more than 25 times from a few kilometers up to 36000 km to address the various scientific objectives; the smallest distance achieved between two Cluster spacecraft was 4 km, about 50 times smaller than planned at the beginning of the mission. The main goal of the Cluster mission is to study in three dimensions small-scale plasma structures in key plasma regions of Earth’s geospace environment: solar wind and bow shock, magnetopause, polar cusps, magnetotail, plasmasphere and auroral zone. We will present science highlights obtained such as ripples on the bow shock, 3D current measurements and Kelvin-Helmholtz waves at the magnetopause, bifurcated current sheet in the magnetotail, and first measurement of the electron pressure tensor near a site of magnetic reconnection. In addition, we highlight Cluster results on understanding the impact of Coronal Mass Ejections (CME) on the Earth's environment. We will also present the distribution of data through the Cluster Science Data System (CSDS), and the Cluster Archive. Those systems were implemented to provide, for the first time for a plasma physics mission, a permanent and public archive of all the high resolution data from all instruments.

  19. Multidimensional model of cluster radioactivity

    NASA Astrophysics Data System (ADS)

    Denisov, V. Yu.

    2013-10-01

    The cluster decays 228Th→208Pb+20O, 232U→208Pb+24Ne, 236Pu→208Pb+28Mg, and 242Cm→208Pb+34Si are considered in the framework of the multidimensional cluster-preformation model. The macroscopic potential-energy surface related to the interaction between the cluster and the residue nucleus is evaluated in the framework of the nonlocal ℏ4 extended Thomas-Fermi approach with Skyrme and Coulomb forces. The shell correction to the macroscopic potential energy is also taken into account. The dynamical surface deformations of both the cluster and the residue nucleus are taken into consideration at the barrier penetration path. The heights of saddle points related to deformed nuclear shapes are lower than the barrier height between the spherical cluster and residue nuclei; therefore the dynamical deformations of nuclei increase the barrier penetrability and reduce the half-life of cluster decay. The shell-correction contribution into the potential energy between cluster and residue nucleus is important for both the potential landscape and the half-life evaluation. The experimental values of cluster-decay half-lives are well reproduced in the model.

  20. Theoretical Studies on Cluster Compounds

    NASA Astrophysics Data System (ADS)

    Lin, Zhenyang

    Available from UMI in association with The British Library. Requires signed TDF. The Thesis describes some theoretical studies on ligated and bare clusters. Chapter 1 gives a review of the two theoretical models, Tensor Surface Harmonic Theory (TSH) and Jellium Model, accounting for the electronic structures of ligated and bare clusters. The Polyhedral Skeletal Electron Pair Theory (PSEPT), which correlates the structures and electron counts (total number of valence electrons) of main group and transition metal ligated clusters, is briefly described. A structural jellium model is developed in Chapter 2 which accounts for the electronic structures of clusters using a crystal-field perturbation. The zero-order potential we derive is of central-field form, depends on the geometry of the cluster, and has a well-defined relationship to the full nuclear-electron potential. Qualitative arguments suggest that this potential produces different energy level orderings for clusters with a nucleus with large positive charge at the centre of the cluster. Analysis of the effects of the non-spherical perturbation on the spherical jellium shell structures leads to the conclusion that for a cluster with a closed shell electronic structure a high symmetry arrangement which is approximately or precisely close packed will be preferred. It also provides a basis for rationalising those structures of clusters with incomplete shell electronic configurations. In Chapter 3, the geometric conclusions derived in the structural jellium model are developed in more detail. The group theoretical consequences of the Tensor Surface Harmonic Theory are developed in Chapter 4 for (ML_2) _{rm n}, (ML_4) _{rm n} and (ML_5 ) _{rm n} clusters where either the xz and yz or x^2 -y^2 and xy components to L_sp{rm d}{pi } and L_sp{rm d} {delta} do not contribute equally to the bonding. The closed shell requirements for such clusters are defined and the orbital symmetry constraints pertaining to the

  1. Cluster beam analysis via photoionization

    SciTech Connect

    Grover, J.R. ); Herron, W.J.; Coolbaugh, M.T.; Peifer, W.R.; Garvey, J.F. )

    1991-08-22

    A photoionization method for quantitatively analyzing the neutral products of free jet expansions is described. The basic principle is to measure the yield of an ion characterization of each component cluster at a photon energy just below that at which production of the same ion from larger clusters can be detected. Since there is then no problem with fragmentation, the beam density of each neutral cluster can be measured in the presence of larger clusters. Although these measurements must be done in the test ions' onset regions where their yields are often quite small, the technique is made highly practicable by the large intensities of widely tunable vacuum-ultraviolet synchrotron light now available at electron storage rings. As an example, the method is applied to the analysis of cluster beams collimated from the free jet expansion of a 200:1 ammonia-chlorobenzene mixture.

  2. Single System Image Cluster Management

    Energy Science and Technology Software Center (ESTSC)

    2004-02-13

    Cluster computing has quickly proven itself to be a capable workhorse for a wide variety of production computing tasks; however, setting up and maintaining a cluster still requires significantly more effort than administrating just a single machine. As computing hardware descreases in price and cluster sizes grow, it is becoming increasingly important to manage clusters cleverly so that a system administration effort can "scale" as well. To ease the task of mananging many machines, administratorsmore » often deploy an environment that is homogeneous across all nodes of a cluster, and maintain a snapshot of the filesystem as a 'master image'. However due to operational, behavioral, and physical constraints, many nodes often require numerous deviations from the master image in order to operate as desired.« less

  3. Decaying neutrinos in galaxy clusters

    NASA Technical Reports Server (NTRS)

    Melott, Adrian L.; Splinter, Randall J.; Persic, Massimo; Salucci, Paolo

    1993-01-01

    The DM profile in clusters of galaxies was studied and simulated using the Harrison-Zel'dovich spectrum of density fluctuations, and an amplitude previously derived from numerical simulations and in agreement with microwave background fluctuations. Neutrino DM densities, with this amplitude normalization cluster, are comparable to observed cluster DM values. It was concluded that given this normalization, the cluster DM should be al least largely composed of neutrinos. The constraint of Davidson et al., who argued that the failure to detect uv photons from the dark matter (DM) in cluster A665 excludes the decaying neutrino hypothesis, could be somewhat weakened by the presence of baryonic DM; but it cannot be eliminated given our assumptions.

  4. SACS: Spitzer Archival Cluster Survey

    NASA Astrophysics Data System (ADS)

    Stern, Daniel

    Emerging from the cosmic web, galaxy clusters are the most massive gravitationally bound structures in the universe. Thought to have begun their assembly at z > 2, clusters provide insights into the growth of large-scale structure as well as the physics that drives galaxy evolution. Understanding how and when the most massive galaxies assemble their stellar mass, stop forming stars, and acquire their observed morphologies in these environments remain outstanding questions. The redshift range 1.3 < z < 2 is a key epoch in this respect: elliptical galaxies start to become the dominant population in cluster cores, and star formation in spiral galaxies is being quenched. Until recently, however, this redshift range was essentially unreachable with available instrumentation, with clusters at these redshifts exceedingly challenging to identify from either ground-based optical/nearinfrared imaging or from X-ray surveys. Mid-infrared (MIR) imaging with the IRAC camera on board of the Spitzer Space Telescope has changed the landscape. High-redshift clusters are easily identified in the MIR due to a combination of the unique colors of distant galaxies and a negative k-correction in the 3-5 μm range which makes such galaxies bright. Even 90-sec observations with Spitzer/IRAC, a depth which essentially all extragalactic observations in the archive achieve, is sufficient to robustly detect overdensities of L* galaxies out to z~2. Here we request funding to embark on a ambitious scientific program, the “SACS: Spitzer Archival Cluster Survey”, a comprehensive search for the most distant galaxy clusters in all Spitzer/IRAC extragalactic pointings available in the archive. With the SACS we aim to discover ~2000 of 1.3 < z < 2.5 clusters, thus provide the ultimate catalog for high-redshift MIR selected clusters: a lasting legacy for Spitzer. The study we propose will increase by more than a factor of 10 the number of high-redshift clusters discovered by all previous surveys

  5. Protonated water clusters in TPC's

    NASA Astrophysics Data System (ADS)

    Kaya, Yunus; Kalkan, Yalçın; Veenhof, Rob

    2016-07-01

    Water vapour is added to the ALICE TPC gas to enhance its stability. These polar molecules create large protonated water clusters around a H+ core. In this context, the reactions H3O+(H2O)n-1 +H2 O →H3O+(H2O)n (n=1-9) were studied in the gas phase. Structures for these clusters are suggested and the most stable structures for each cluster size are shown. The thermodynamic parameters Δ Hn-1,n0,Δ Gn-1,n0,Δ Sn-1,n0 and equilibrium constants Kn-1,n for the reaction were calculated to determine the size of the water clusters. The results are close to experimental data found in the literature. Protonated water clusters at stp have a size of 6-9 which corresponds to a mass of 127.1 - 181.2 g / mole.

  6. Versatile cluster based photoelectron spectrometer

    SciTech Connect

    Knappenberger, K. L. Jr.; Jones, C. E. Jr.; Sobhy, M. A.; Castleman, A. W. Jr.

    2006-12-15

    A recently constructed cluster based photoelectron spectrometer is described. This instrumentation is unique in that it enables the kinetic energy analysis of electrons ejected from both anions and neutral clusters. This capability permits the investigation of discrete electronic levels in all charge states (anionic, neutral, and cationic). A laser vaporization plasma reactor cluster source affixed with a sublimation cell is employed to produce a variety of metal clusters, and the resulting cluster distributions are analyzed with time-of-flight mass spectrometry. The corresponding electronic structure is analyzed with a 'magnetic bottle' photoelectron spectrometer. Examples of instrument performance operating in both anion photodetachment and neutral multiphoton ionization (MPI) modes are provided. In the case of neutral MPI, the corresponding product distribution is collected with a Wiley-McLaren [Rev. Sci. Instrum. 26, 1150 (1955)] mass spectrometer mounted perpendicular to the magnetic bottle photoelectron spectrometer.

  7. Seven poor clusters of galaxies

    NASA Technical Reports Server (NTRS)

    Beers, T. C.; Geller, M. J.; Huchra, J. P.; Latham, D. W.; Davis, R. J.

    1984-01-01

    The measurement of 83 new redshifts from galaxies in the region of seven of the poor clusters of galaxies identified by Morgan et al (1975) and Albert et al (1977) has been followed by an estimation of cluster masses through the application of both the virial theorem and the projected mas method. For each system, these two estimates are consistent. For the two clusters with highest X-ray luminosities, the line-of-sight velocity dispersions are about 700 km/sec, while for the five other clusters, the dispersions are of the order of less than about 370 km/sec. The D or cD galaxy in each poor cluster is at the kinematic center of each system.

  8. Clusterization and quadrupole deformation in nuclei

    SciTech Connect

    Cseh, J.; Algora, A.; Antonenko, N. V.; Jolos, R. V.; Scheid, W.; Darai, J.; Hess, P. O.

    2006-04-26

    We study the interrelation of the clusterization and quadrupole deformation of atomic nuclei, by applying cluster models. Both the energetic stability and the exclusion principle is investigated. Special attention is paid to the relative orientations of deformed clusters.

  9. Plug cluster module demonstration

    NASA Technical Reports Server (NTRS)

    Rousar, D. C.

    1978-01-01

    The low pressure, film cooled rocket engine design concept developed during two previous ALRC programs was re-evaluated for application as a module for a plug cluster engine capable of performing space shuttle OTV missions. The nominal engine mixture ratio was 5.5 and the engine life requirements were 1200 thermal cycles and 10 hours total operating life. The program consisted of pretest analysis; engine tests, performed using residual components; and posttest analysis. The pretest analysis indicated that operation of the operation of the film cooled engine at O/F = 5.5 was feasible. During the engine tests, steady state wall temperature and performance measurement were obtained over a range of film cooling flow rates, and the durability of the engine was demonstrated by firing the test engine 1220 times at a nominal performance ranging from 430 - 432 seconds. The performance of the test engine was limited by film coolant sleeve damage which had occurred during previous testing. The post-test analyses indicated that the nominal performance level can be increased to 436 seconds.

  10. Dust cluster explosion

    SciTech Connect

    Saxena, Vikrant; Avinash, K.; Sen, A.

    2012-09-15

    A model for the dust cluster explosion where micron/sub-micron sized particles are accelerated at the expense of plasma thermal energy, in the afterglow phase of a complex plasma discharge is proposed. The model is tested by molecular dynamics simulations of dust particles in a confining potential. The nature of the explosion (caused by switching off the discharge) and the concomitant dust acceleration is found to depend critically on the pressure of the background neutral gas. At low gas pressure, the explosion is due to unshielded Coulomb repulsion between dust particles and yields maximum acceleration, while in the high pressure regime it is due to shielded Yukawa repulsion and yields much feebler acceleration. These results are in agreement with experimental findings. Our simulations also confirm a recently proposed electrostatic (ES) isothermal scaling relation, P{sub E}{proportional_to}V{sub d}{sup -2} (where P{sub E} is the ES pressure of the dust particles and V{sub d} is the confining volume).

  11. Novae in globular clusters

    SciTech Connect

    Kato, Mariko; Hachisu, Izumi; Henze, Martin

    2013-12-10

    We present the first light-curve analysis of Population II novae that appeared in M31 globular clusters. Our light-curve models, based on the optically thick wind theory, reproduce well both the X-ray turn-on and turnoff times with the white dwarf (WD) mass of about 1.2 M {sub ☉} for M31N 2007-06b in Bol 111 and about 1.37 M {sub ☉} for M31N 2010-10f in Bol 126. The transient supersoft X-ray source CXO J004345 in Bol 194 is highly likely a nova remnant of 1.2-1.3 M {sub ☉} WD. These WD masses are quite consistent with the temperatures deduced from X-ray spectra. We also present the dependence of nova light curves on the metallicity in the range from [Fe/H] = 0.4 to –2.7. Whereas strong optically thick winds are accelerated in Galactic disk novae owing to a large Fe opacity peak, only weak winds occur in Population II novae with low Fe abundance. Thus, nova light curves are systematically slow in low Fe environment. For an extremely low Fe abundance normal nova outbursts may not occur unless the WD is very massive. We encourage V or y filter observation rather than R as well as high cadence X-ray monitorings to open quantitative studies of extragalactic novae.

  12. Neuromodulation in cluster headache.

    PubMed

    Fontaine, Denys; Vandersteen, Clair; Magis, Delphine; Lanteri-Minet, Michel

    2015-01-01

    Medically refractory chronic cluster headache (CH) is a severely disabling headache condition for which several surgical procedures have been proposed as a prophylactic treatment. None of them have been evaluated in controlled conditions, only open studies and case series being available. Destructive procedures (radiofrequency lesioning, radiosurgery, section) and microvascular decompression of the trigeminal nerve or the sphenopalatine ganglion (SPG) have induced short-term improvement which did not maintain on long term in most of the patients. They carried a high risk of complications, including severe sensory loss and neuropathic pain, and consequently should not be proposed in first intention.Deep brain stimulation (DBS), targeting the presumed CH generator in the retro-hypothalamic region or fibers connecting it, decreased the attack frequency >50 in 60 % of the 52 patients reported. Complications were infrequent: gaze disturbances, autonomic disturbances, and intracranial hemorrhage (2).Occipital nerve stimulation (ONS) was efficient (decrease of attack frequency >50 %) in about 70 % of the 60 patients reported, with a low risk of complications (essentially hardware related). Considering their respective risks, ONS should be proposed first and DBS only in case of ONS failure.New on-demand chronically implanted SPG stimulation seemed to be efficient to abort CH attacks in a pilot controlled trial, but its long-term safety needs to be further studied. PMID:25411142

  13. The Extended Virgo Cluster Catalog

    NASA Astrophysics Data System (ADS)

    Kim, Suk; Rey, Soo-Chang; Jerjen, Helmut; Lisker, Thorsten; Sung, Eon-Chang; Lee, Youngdae; Chung, Jiwon; Pak, Mina; Yi, Wonhyeong; Lee, Woong

    2014-12-01

    We present a new catalog of galaxies in the wider region of the Virgo cluster, based on the Sloan Digital Sky Survey (SDSS) Data Release 7. The Extended Virgo Cluster Catalog (EVCC) covers an area of 725 deg2 or 60.1 Mpc2. It is 5.2 times larger than the footprint of the classical Virgo Cluster Catalog (VCC) and reaches out to 3.5 times the virial radius of the Virgo cluster. We selected 1324 spectroscopically targeted galaxies with radial velocities less than 3000 km s-1. In addition, 265 galaxies that have been overlooked in the SDSS spectroscopic survey but have available redshifts in the NASA Extragalactic Database are also included. Our selection process secured a total of 1589 galaxies, 676 of which are not included in the VCC. The certain and possible cluster members are defined by means of redshift comparison with a cluster infall model. We employed two independent and complementary galaxy classification schemes: the traditional morphological classification based on the visual inspection of optical images and a characterization of galaxies from their spectroscopic features. SDSS u, g, r, i, and z passband photometry of all EVCC galaxies was performed using Source Extractor. We compare the EVCC galaxies with the VCC in terms of morphology, spatial distribution, and luminosity function. The EVCC defines a comprehensive galaxy sample covering a wider range in galaxy density that is significantly different from the inner region of the Virgo cluster. It will be the foundation for forthcoming galaxy evolution studies in the extended Virgo cluster region, complementing ongoing and planned Virgo cluster surveys at various wavelengths.

  14. The Extended Virgo Cluster Catalog

    NASA Astrophysics Data System (ADS)

    Rey, Soo-Chang

    2015-08-01

    We present a new catalog of galaxies in the wider region of the Virgo cluster, based on the Sloan Digital Sky Survey (SDSS) Data Release 7. The Extended Virgo Cluster Catalog (EVCC) covers an area of 725 deg2 or 60.1 Mpc2. It is 5.2 times larger than the footprint of the classical Virgo Cluster Catalog (VCC) and reaches out to 3.5 times the virial radius of the Virgo cluster. We selected 1324 spectroscopically targeted galaxies with radial velocities less than 3000 km s-1. In addition, 265 galaxies that have been overlooked in the SDSS spectroscopic survey but have available redshifts in the NASA Extragalactic Database are also included. Our selection process secured a total of 1589 galaxies, 676 of which are not included in the VCC. The certain and possible cluster members are defined by means of redshift comparison with a cluster infall model. We employed two independent and complementary galaxy classification schemes: the traditional morphological classification based on the visual inspection of optical images and a characterization of galaxies from their spectroscopic features. SDSS u, g, r, i, and z passband photometry of all EVCC galaxies was performed using Source Extractor. We compare the EVCC galaxies with the VCC in terms of morphology, spatial distribution, and luminosity function. The EVCC defines a comprehensive galaxy sample covering a wider range in galaxy density that is significantly different from the inner region of the Virgo cluster. It will be the foundation for forthcoming galaxy evolution studies in the extended Virgo cluster region, complementing ongoing and planned Virgo cluster surveys at various wavelengths.

  15. THE EXTENDED VIRGO CLUSTER CATALOG

    SciTech Connect

    Kim, Suk; Rey, Soo-Chang; Lee, Youngdae; Chung, Jiwon; Pak, Mina; Yi, Wonhyeong; Lee, Woong; Jerjen, Helmut; Lisker, Thorsten; Sung, Eon-Chang

    2015-01-01

    We present a new catalog of galaxies in the wider region of the Virgo cluster, based on the Sloan Digital Sky Survey (SDSS) Data Release 7. The Extended Virgo Cluster Catalog (EVCC) covers an area of 725 deg{sup 2} or 60.1 Mpc{sup 2}. It is 5.2 times larger than the footprint of the classical Virgo Cluster Catalog (VCC) and reaches out to 3.5 times the virial radius of the Virgo cluster. We selected 1324 spectroscopically targeted galaxies with radial velocities less than 3000 km s{sup –1}. In addition, 265 galaxies that have been overlooked in the SDSS spectroscopic survey but have available redshifts in the NASA Extragalactic Database are also included. Our selection process secured a total of 1589 galaxies, 676 of which are not included in the VCC. The certain and possible cluster members are defined by means of redshift comparison with a cluster infall model. We employed two independent and complementary galaxy classification schemes: the traditional morphological classification based on the visual inspection of optical images and a characterization of galaxies from their spectroscopic features. SDSS u, g, r, i, and z passband photometry of all EVCC galaxies was performed using Source Extractor. We compare the EVCC galaxies with the VCC in terms of morphology, spatial distribution, and luminosity function. The EVCC defines a comprehensive galaxy sample covering a wider range in galaxy density that is significantly different from the inner region of the Virgo cluster. It will be the foundation for forthcoming galaxy evolution studies in the extended Virgo cluster region, complementing ongoing and planned Virgo cluster surveys at various wavelengths.

  16. The evolution of clusters of galaxies. I - Very rich clusters

    NASA Technical Reports Server (NTRS)

    Richstone, D. O.; Malumuth, E. M.

    1983-01-01

    A multiple one-body Monte Carlo code is used to investigate the evolution of galaxies in a steady cluster potential under the influence of dynamical friction, two-body relaxation, tidal stripping, and galaxy mergers. The basic assumptions, estimated time scales, method and computer program, and effects of uncertainties in galaxy encounter physics are addressed. Numerical experiments in which the mass initially carried by galaxies and the mass function are varied are reported. It is shown that the formation of a very massive cluster galaxy depends critically on the number of galaxies, the initial division of cluster material between galaxies and a smooth intracluster medium, the mass spectrum of the galaxies, and chance. By the end of all simulations, less than half of the mass in the central regions of the cluster is bound to galaxies. It appears possible to produce any of the Bautz-Morgan classes from very similar initial conditions.

  17. Clustering Acoustic Segments Using Multi-Stage Agglomerative Hierarchical Clustering

    PubMed Central

    2015-01-01

    Agglomerative hierarchical clustering becomes infeasible when applied to large datasets due to its O(N2) storage requirements. We present a multi-stage agglomerative hierarchical clustering (MAHC) approach aimed at large datasets of speech segments. The algorithm is based on an iterative divide-and-conquer strategy. The data is first split into independent subsets, each of which is clustered separately. Thus reduces the storage required for sequential implementations, and allows concurrent computation on parallel computing hardware. The resultant clusters are merged and subsequently re-divided into subsets, which are passed to the following iteration. We show that MAHC can match and even surpass the performance of the exact implementation when applied to datasets of speech segments. PMID:26517376

  18. Systolic architecture for heirarchical clustering

    SciTech Connect

    Ku, L.C.

    1984-01-01

    Several hierarchical clustering methods (including single-linkage complete-linkage, centroid, and absolute overlap methods) are reviewed. The absolute overlap clustering method is selected for the design of systolic architecture mainly due to its simplicity. Two versions of systolic architectures for the absolute overlap hierarchical clustering algorithm are proposed: one-dimensional version that leads to the development of a two dimensional version which fully takes advantage of the underlying data structure of the problems. The two dimensional systolic architecture can achieve a time complexity of O(m + n) in comparison with the conventional computer implementation of a time complexity of O(m/sup 2*/n).

  19. Spectral lineshapes of molecular clusters

    NASA Astrophysics Data System (ADS)

    Islampour, Reza; Mukamel, Shaul

    1984-06-01

    The electronic spectral lineshape of an impurity molecule in a cluster is calculated. Both a rigid (solid-like) and a non-rigid (droplet-like) model for the cluster are considered and compared. The spectrum is calculated using the spectral density J(ω) which is related to the correlation function of the time-dependent enegy gap between the two electronic states. Our calculations demonstrate how the information regarding individual eigenstates is lost under the broadened lineshape envelope in large clusters.

  20. Haplotyping Problem, A Clustering Approach

    SciTech Connect

    Eslahchi, Changiz; Sadeghi, Mehdi; Pezeshk, Hamid; Kargar, Mehdi; Poormohammadi, Hadi

    2007-09-06

    Construction of two haplotypes from a set of Single Nucleotide Polymorphism (SNP) fragments is called haplotype reconstruction problem. One of the most popular computational model for this problem is Minimum Error Correction (MEC). Since MEC is an NP-hard problem, here we propose a novel heuristic algorithm based on clustering analysis in data mining for haplotype reconstruction problem. Based on hamming distance and similarity between two fragments, our iterative algorithm produces two clusters of fragments; then, in each iteration, the algorithm assigns a fragment to one of the clusters. Our results suggest that the algorithm has less reconstruction error rate in comparison with other algorithms.

  1. Neurostimulation for chronic cluster headache

    PubMed Central

    Kaube, Holger

    2012-01-01

    Neurostimulation techniques for the treatment of primary headache syndromes, particularly of chronic cluster headache, have received much interest in recent years. Occipital nerve stimulation (ONS) has yielded favourable clinical results and, despite the limited numbers of published cases, is becoming a routine treatment for refractory chronic cluster headache in specialized centres. Meanwhile, other promising techniques such as spinal cord stimulation (SCS) or sphenopalate ganglion stimulation have emerged. In this article the current state of clinical research for neurostimulation techniques for chronic cluster headache is reviewed. PMID:22590481

  2. Properties of star clusters - II. Scaleheight evolution of clusters

    NASA Astrophysics Data System (ADS)

    Buckner, Anne S. M.; Froebrich, Dirk

    2014-10-01

    Until now, it has been impossible to observationally measure how star cluster scaleheight evolves beyond 1 Gyr as only small samples have been available. Here, we establish a novel method to determine the scaleheight of a cluster sample using modelled distributions and Kolmogorov-Smirnov tests. This allows us to determine the scaleheight with a 25 per cent accuracy for samples of 38 clusters or more. We apply our method to investigate the temporal evolution of cluster scaleheight, using homogeneously selected sub-samples of Kharchenko et al. (MWSC), Dias et al. (DAML02), WEBDA, and Froebrich et al. (FSR). We identify a linear relationship between scaleheight and log(age/yr) of clusters, considerably different from field stars. The scaleheight increases from about 40 pc at 1 Myr to 75 pc at 1 Gyr, most likely due to internal evolution and external scattering events. After 1 Gyr, there is a marked change of the behaviour, with the scaleheight linearly increasing with log(age/yr) to about 550 pc at 3.5 Gyr. The most likely interpretation is that the surviving clusters are only observable because they have been scattered away from the mid-plane in their past. A detailed understanding of this observational evidence can only be achieved with numerical simulations of the evolution of cluster samples in the Galactic disc. Furthermore, we find a weak trend of an age-independent increase in scaleheight with Galactocentric distance. There are no significant temporal or spatial variations of the cluster distribution zero-point. We determine the Sun's vertical displacement from the Galactic plane as Z⊙ = 18.5 ± 1.2 pc.

  3. AMOEBA clustering revisited. [cluster analysis, classification, and image display program

    NASA Technical Reports Server (NTRS)

    Bryant, Jack

    1990-01-01

    A description of the clustering, classification, and image display program AMOEBA is presented. Using a difficult high resolution aircraft-acquired MSS image, the steps the program takes in forming clusters are traced. A number of new features are described here for the first time. Usage of the program is discussed. The theoretical foundation (the underlying mathematical model) is briefly presented. The program can handle images of any size and dimensionality.

  4. Brightest cluster galaxies in the extended GMRT radio halo cluster sample. Radio properties and cluster dynamics

    NASA Astrophysics Data System (ADS)

    Kale, R.; Venturi, T.; Cassano, R.; Giacintucci, S.; Bardelli, S.; Dallacasa, D.; Zucca, E.

    2015-09-01

    Aims: First-ranked galaxies in clusters, usually referred to as brightest cluster galaxies (BCGs), show exceptional properties over the whole electromagnetic spectrum. They are the most massive elliptical galaxies and show the highest probability to be radio loud. Moreover, their special location at the centres of galaxy clusters raises the question of the role of the environment in shaping their radio properties. In the attempt to separate the effect of the galaxy mass and of the environment on their statistical radio properties, we investigate the possible dependence of the occurrence of radio loudness and of the fractional radio luminosity function on the dynamical state of the hosting cluster. Methods: We studied the radio properties of the BCGs in the Extended GMRT Radio Halo Survey (EGRHS), which consists of 65 clusters in the redshift range 0.2-0.4, with X-ray luminosity LX ≥ 5 × 1044 erg s-1, and quantitative information on their dynamical state from high-quality Chandra imaging. We obtained a statistical sample of 59 BCGs, which we divided into two classes, depending on whether the dynamical state of the host cluster was merging (M) or relaxed (R). Results: Of the 59 BCGs, 28 are radio loud and 31 are radio quiet. The radio-loud sources are favourably located in relaxed clusters (71%), while the reverse is true for the radio-quiet BCGs, which are mostly located in merging systems (81%). The fractional radio luminosity function for the BCGs in merging and relaxed clusters is different, and it is considerably higher for BCGs in relaxed clusters, where the total fraction of radio loudness reaches almost 90%, to be compared to the ~30% in merging clusters. For relaxed clusters, we found a positive correlation between the radio power of the BCGs and the strength of the cool core, consistent with previous studies on local samples. Conclusions: Our study suggests that the radio loudness of the BCGs strongly depends on the cluster dynamics; their fraction is

  5. Review of methods for handling confounding by cluster and informative cluster size in clustered data

    PubMed Central

    Seaman, Shaun; Pavlou, Menelaos; Copas, Andrew

    2014-01-01

    Clustered data are common in medical research. Typically, one is interested in a regression model for the association between an outcome and covariates. Two complications that can arise when analysing clustered data are informative cluster size (ICS) and confounding by cluster (CBC). ICS and CBC mean that the outcome of a member given its covariates is associated with, respectively, the number of members in the cluster and the covariate values of other members in the cluster. Standard generalised linear mixed models for cluster-specific inference and standard generalised estimating equations for population-average inference assume, in general, the absence of ICS and CBC. Modifications of these approaches have been proposed to account for CBC or ICS. This article is a review of these methods. We express their assumptions in a common format, thus providing greater clarity about the assumptions that methods proposed for handling CBC make about ICS and vice versa, and about when different methods can be used in practice. We report relative efficiencies of methods where available, describe how methods are related, identify a previously unreported equivalence between two key methods, and propose some simple additional methods. Unnecessarily using a method that allows for ICS/CBC has an efficiency cost when ICS and CBC are absent. We review tools for identifying ICS/CBC. A strategy for analysis when CBC and ICS are suspected is demonstrated by examining the association between socio-economic deprivation and preterm neonatal death in Scotland. PMID:25087978

  6. A Clustering Graph Generator

    SciTech Connect

    Winlaw, Manda; De Sterck, Hans; Sanders, Geoffrey

    2015-10-26

    In very simple terms a network can be de ned as a collection of points joined together by lines. Thus, networks can be used to represent connections between entities in a wide variety of elds including engi- neering, science, medicine, and sociology. Many large real-world networks share a surprising number of properties, leading to a strong interest in model development research and techniques for building synthetic networks have been developed, that capture these similarities and replicate real-world graphs. Modeling these real-world networks serves two purposes. First, building models that mimic the patterns and prop- erties of real networks helps to understand the implications of these patterns and helps determine which patterns are important. If we develop a generative process to synthesize real networks we can also examine which growth processes are plausible and which are not. Secondly, high-quality, large-scale network data is often not available, because of economic, legal, technological, or other obstacles [7]. Thus, there are many instances where the systems of interest cannot be represented by a single exemplar network. As one example, consider the eld of cybersecurity, where systems require testing across diverse threat scenarios and validation across diverse network structures. In these cases, where there is no single exemplar network, the systems must instead be modeled as a collection of networks in which the variation among them may be just as important as their common features. By developing processes to build synthetic models, so-called graph generators, we can build synthetic networks that capture both the essential features of a system and realistic variability. Then we can use such synthetic graphs to perform tasks such as simulations, analysis, and decision making. We can also use synthetic graphs to performance test graph analysis algorithms, including clustering algorithms and anomaly detection algorithms.

  7. Cluster Randomized Controlled Trial

    PubMed Central

    Young, John; Chapman, Katie; Nixon, Jane; Patel, Anita; Holloway, Ivana; Mellish, Kirste; Anwar, Shamaila; Breen, Rachel; Knapp, Martin; Murray, Jenni; Farrin, Amanda

    2015-01-01

    Background and Purpose— We developed a new postdischarge system of care comprising a structured assessment covering longer-term problems experienced by patients with stroke and their carers, linked to evidence-based treatment algorithms and reference guides (the longer-term stroke care system of care) to address the poor longer-term recovery experienced by many patients with stroke. Methods— A pragmatic, multicentre, cluster randomized controlled trial of this system of care. Eligible patients referred to community-based Stroke Care Coordinators were randomized to receive the new system of care or usual practice. The primary outcome was improved patient psychological well-being (General Health Questionnaire-12) at 6 months; secondary outcomes included functional outcomes for patients, carer outcomes, and cost-effectiveness. Follow-up was through self-completed postal questionnaires at 6 and 12 months. Results— Thirty-two stroke services were randomized (29 participated); 800 patients (399 control; 401 intervention) and 208 carers (100 control; 108 intervention) were recruited. In intention to treat analysis, the adjusted difference in patient General Health Questionnaire-12 mean scores at 6 months was −0.6 points (95% confidence interval, −1.8 to 0.7; P=0.394) indicating no evidence of statistically significant difference between the groups. Costs of Stroke Care Coordinator inputs, total health and social care costs, and quality-adjusted life year gains at 6 months, 12 months, and over the year were similar between the groups. Conclusions— This robust trial demonstrated no benefit in clinical or cost-effectiveness outcomes associated with the new system of care compared with usual Stroke Care Coordinator practice. Clinical Trial Registration— URL: http://www.controlled-trials.com. Unique identifier: ISRCTN 67932305. PMID:26152298

  8. Functional diversification of the potato R2R3 MYB anthocyanin activators AN1, MYBA1, and MYB113 and their interaction with basic helix-loop-helix cofactors.

    PubMed

    Liu, Yuhui; Lin-Wang, Kui; Espley, Richard V; Wang, Li; Yang, Hongyu; Yu, Bin; Dare, Andrew; Varkonyi-Gasic, Erika; Wang, Jing; Zhang, Junlian; Wang, Di; Allan, Andrew C

    2016-04-01

    In potato (Solanum tuberosumL.), R2R3 MYBs are involved in the regulation of anthocyanin biosynthesis. We examined sequences of these MYBs in cultivated potatoes, which are more complex than diploid potato due to ploidy and heterozygosity. We found amino acid variants in the C-terminus of the MYB StAN1, termed R0, R1, and R3, due to the presence of a repeated 10-amino acid motif. These variant MYBs showed some expression in both white and pigmented tubers. We found several new alleles or gene family members of R2R3 MYBs,StMYBA1andStMYB113, which were also expressed in white potato tubers. From functional analysis in tobacco, we showed that the presence of a C-terminal 10-amino acid motif is optimal for activating anthocyanin accumulation. Engineering a motif back into a MYB lacking this sequence enhanced its activating ability. Versions ofStMYBA1andStMYB113can also activate anthocyanin accumulation in tobacco leaves, with the exception ofStMYB113-3, which has a partial R2R3 domain. We isolated five family members of potatoStbHLH1, and oneStJAF13, to test their ability to interact with MYB variants. The results showed that two alleles ofStbHLH1from white skin and red skin are non-functional, while three otherStbHLH1s have different co-regulating abilities, and need to be activated by StJAF13. Combined with expression analysis in potato tuber, results suggest thatStbHLH1andStJAF13are key co-regulators of anthocyanin biosynthesis, while the transcripts of MYB variantsStAN1,StMYBA1, andStMYB113are well expressed, even in the absence of pigmentation. PMID:26884602

  9. Fine mapping of the pleiotropic locus B for black spine and orange mature fruit color in cucumber identifies a 50 kb region containing a R2R3-MYB transcription factor.

    PubMed

    Li, Yuhong; Wen, Changlong; Weng, Yiqun

    2013-08-01

    In cucumber, Cucumis sativus L., the spine and skin colors are two important fruit quality traits for variety improvement. In this study, we investigated the inheritance of spine and mature fruit skin colors in F2 and F3 populations derived from a cross between two inbred lines WI7200 (black spine and orange fruit skin colors) and WI7201 (white spine and creamy fruit skin colors). We confirmed that a single, dominant gene, B, controlled both black spine color and orange mature fruit color. Initial framework mapping with microsatellite markers located the B locus in the distal region of the short arm of cucumber chromosome 4. Fine mapping was conducted with draft genome scaffold-assisted chromosome walking and stepwise increase of mapping population sizes, which allowed for the assignment of the B locus to a 50 kb genomic DNA region with two flanking markers that were 0.06 and 0.09 cM, respectively, from the B locus in a mapping population of 2,001 F2 plants. Gene annotation of this 50 kb region identified six genes including one encoding for a R2R3-MYB transcription factor. Sequence alignment of the R2R3-MYB homologs between the two parent inbreds identified a 1 bp deletion in the third intron of this gene in WI 7201. A molecular marker based on this indel was co-segregating with the spine and fruit colors. Quantitative RT-PCR revealed higher level of expression of this R2R3-MYB gene in WI7200 than in WI7201 in both immature and mature fruits. This R2R3-MYB gene seems to be the best candidate gene for the B locus conditioning black spine and orange mature fruit colors of cultivated cucumber. PMID:23689749

  10. R3DE: Radiation Risk Radiometer-Dosimeter on the International Space Station--optical radiation data recorded during 18 months of EXPOSE-E exposure to open space.

    PubMed

    Schuster, Martin; Dachev, Tsvetan; Richter, Peter; Häder, Donat-Peter

    2012-05-01

    Radiation Risk Radiometer-Dosimeter E (R3DE) served as a device for measuring ionizing and non-ionizing radiation as well as cosmic radiation reaching biological samples located on the EXPOSE platform EXPOSE-E. The duration of the mission was almost 1.5 years (2008-2009). With four channels, R3DE detected the wavelength ranges of photosynthetically active radiation (PAR, 400-700 nm), UVA (315-400 nm), UVB (280-315 nm), and UVC (<280 nm). In addition, the temperature was recorded. Cosmic ionizing radiation was assessed with a 256-channel spectrometer dosimeter (see separate report in this issue). The light and UV sensors of the device were calibrated with spectral measurement data obtained by the Solar Radiation and Climate Experiment (SORCE) satellite as standard. The data were corrected with respect to the cosine error of the diodes. Measurement frequency was 0.1 Hz. Due to errors in data transmission or temporary termination of EXPOSE power, not all data could be acquired. Radiation was not constant during the mission. At regular intervals of about 2 months, low or almost no radiation was encountered. The radiation dose during the mission was 1823.98 MJ m(-2) for PAR, 269.03 MJ m(-2) for UVA, 45.73 MJ m(-2) for UVB, or 18.28 MJ m(-2) for UVC. Registered sunshine duration during the mission was about 152 days (about 27% of mission time).The surface of EXPOSE was most likely turned away from the Sun for considerably longer. R3DE played a crucial role on EXPOSE-EuTEF (EuTEF, European Technology Exposure Facility), because evaluation of the astrobiology experiments depended on reliability of the data collected by the device. Observed effects in the samples were weighted by radiation doses measured by R3DE. PMID:22680686

  11. Functional diversification of the potato R2R3 MYB anthocyanin activators AN1, MYBA1, and MYB113 and their interaction with basic helix-loop-helix cofactors

    PubMed Central

    Liu, Yuhui; Lin-Wang, Kui; Espley, Richard V.; Wang, Li; Yang, Hongyu; Yu, Bin; Dare, Andrew; Varkonyi-Gasic, Erika; Wang, Jing; Zhang, Junlian; Wang, Di; Allan, Andrew C.

    2016-01-01

    In potato (Solanum tuberosum L.), R2R3 MYBs are involved in the regulation of anthocyanin biosynthesis. We examined sequences of these MYBs in cultivated potatoes, which are more complex than diploid potato due to ploidy and heterozygosity. We found amino acid variants in the C-terminus of the MYB StAN1, termed R0, R1, and R3, due to the presence of a repeated 10-amino acid motif. These variant MYBs showed some expression in both white and pigmented tubers. We found several new alleles or gene family members of R2R3 MYBs, StMYBA1 and StMYB113, which were also expressed in white potato tubers. From functional analysis in tobacco, we showed that the presence of a C-terminal 10-amino acid motif is optimal for activating anthocyanin accumulation. Engineering a motif back into a MYB lacking this sequence enhanced its activating ability. Versions of StMYBA1 and StMYB113 can also activate anthocyanin accumulation in tobacco leaves, with the exception of StMYB113-3, which has a partial R2R3 domain. We isolated five family members of potato StbHLH1, and one StJAF13, to test their ability to interact with MYB variants. The results showed that two alleles of StbHLH1 from white skin and red skin are non-functional, while three other StbHLH1s have different co-regulating abilities, and need to be activated by StJAF13. Combined with expression analysis in potato tuber, results suggest that StbHLH1 and StJAF13 are key co-regulators of anthocyanin biosynthesis, while the transcripts of MYB variants StAN1, StMYBA1, and StMYB113 are well expressed, even in the absence of pigmentation. PMID:26884602

  12. Architecture of Eph receptor clusters

    SciTech Connect

    Himanen, Juha P.; Yermekbayeva, Laila; Janes, Peter W.; Walker, John R.; Xu, Kai; Atapattu, Lakmali; Rajashankar, Kanagalaghatta R.; Mensinga, Anneloes; Lackmann, Martin; Nikolov, Dimitar B.; Dhe-Paganon, Sirano

    2010-10-04

    Eph receptor tyrosine kinases and their ephrin ligands regulate cell navigation during normal and oncogenic development. Signaling of Ephs is initiated in a multistep process leading to the assembly of higher-order signaling clusters that set off bidirectional signaling in interacting cells. However, the structural and mechanistic details of this assembly remained undefined. Here we present high-resolution structures of the complete EphA2 ectodomain and complexes with ephrin-A1 and A5 as the base unit of an Eph cluster. The structures reveal an elongated architecture with novel Eph/Eph interactions, both within and outside of the Eph ligand-binding domain, that suggest the molecular mechanism underlying Eph/ephrin clustering. Structure-function analysis, by using site-directed mutagenesis and cell-based signaling assays, confirms the importance of the identified oligomerization interfaces for Eph clustering.

  13. Distant Massive Clusters and Cosmology

    NASA Technical Reports Server (NTRS)

    Donahue, Megan

    1999-01-01

    We present a status report of our X-ray study and analysis of a complete sample of distant (z=0.5-0.8), X-ray luminous clusters of galaxies. We have obtained ASCA and ROSAT observations of the five brightest Extended Medium Sensitivity (EMSS) clusters with z > 0.5. We have constructed an observed temperature function for these clusters, and measured iron abundances for all of these clusters. We have developed an analytic expression for the behavior of the mass-temperature relation in a low-density universe. We use this mass-temperature relation together with a Press-Schechter-based model to derive the expected temperature function for different values of Omega-M. We combine this analysis with the observed temperature functions at redshifts from 0 - 0.8 to derive maximum likelihood estimates for the value of Omega-M. We report preliminary results of this analysis.

  14. Chemical evolution of star clusters.

    PubMed

    van Loon, Jacco Th

    2010-02-28

    I discuss the chemical evolution of star clusters, with emphasis on old Galactic globular clusters (GCs), in relation to their formation histories. GCs are clearly formed in a complex fashion, under markedly different conditions from any younger clusters presently known. Those special conditions must be linked to the early formation epoch of the Galaxy and must not have occurred since. While a link to the formation of GCs in dwarf galaxies has been suggested, present-day dwarf galaxies are not representative of the gravitational potential wells within which the GCs formed. Instead, a formation deep within the proto-Galaxy or within dark-matter mini-haloes might be favoured. Not all GCs may have formed and evolved similarly. In particular, we may need to distinguish Galactic Halo from Galactic Bulge clusters. PMID:20083507

  15. Virtual Cluster Management with Xen

    SciTech Connect

    Bhatia, Nikhil; Vetter, Jeffrey S

    2008-01-01

    Recently, virtualization of hardware resources to run multiple instances of independent virtual machines over physical hosts has gained popularity due to an industry-wide focus on the need to reduce the cost of operation of an enterprise computing infrastructure. Xen is an open source hypervisor that provides a virtual machine abstraction layer which is very similar to the underlying physical machine. Using multiple physical hosts, each hosting multiple virtual machines over a VMM like Xen, system administrators can setup a high-availability virtual cluster to meet the ever-increasing demands of their data centers. In such an environment, the Xen hypervisor enables live migration of individual virtual machine instances from one physical node to another without significantly affecting the performance of the applications running on a target virtual machine. This paper describes a scalable Virtual Cluster Manager that provides such application agnostic cluster management capabilities to the system administrators maintaining virtual clusters over Xen powered virtual nodes.

  16. Galaxy and cluster redshift surveys

    NASA Technical Reports Server (NTRS)

    Geller, Margaret J.; Huchra, John P.

    1988-01-01

    The present evaluation of galaxy and cluster redshift surveys gives attention to the CfA redshift survey and a deep Abell cluster redshift survey. These data support a structure in which galaxies lie on thin sheets which nearly surround vast, low-density voids. Voids such as that in Bootes are a common feature of galaxy distribution, posing a serious challenge for models. The Huchra et al. (1988) deep-cluster survey exhibits a correlation function amplitude that is a factor of about 2 smaller than that of the earlier Bahcall and Soneira (1983) sample; the difference may not be significant, however, because the cluster samples are sufficiently small to be dominated by single systems.

  17. Infrared spectroscopy of ionic clusters

    SciTech Connect

    Price, J.M. . Dept. of Chemistry Lawrence Berkeley Lab., CA )

    1990-11-01

    This thesis describes new experiments wherein the infrared vibrational predissociation spectra of a number of mass-selected ionic cluster systems have been obtained and analyzed in the 2600 to 4000 cm{sup {minus}1} region. The species studied include: the hydrated hydronium ions, H{sub 3}O{sup +} (H{sub 2}O){sub 3 {minus}10}, ammoniated ammonium ions, NH{sub 4}{sup +}(NH{sub 3}){sub 1 {minus}10} and cluster ions involving both water and ammonia around an ammonium ion core, (mixed clusters) NH{sub 4}{sup +}(NH{sub 3}){sub n}(H{sub 2}O){sub m} (n+m=4). In each case, the spectra reveal well resolved structures that can be assigned to transitions arising from the vibrational motions of both the ion core of the clusters and the surrounding neutral solvent molecules. 154 refs., 19 figs., 8 tabs.

  18. Small intestinal morphology in eight-day-old calves fed colostrum for different durations or only milk replacer and treated with long-R3-insulin-like growth factor I and growth hormone.

    PubMed

    Bühler, C; Hammon, H; Rossi, G L; Blum, J W

    1998-03-01

    The effects of feeding different amounts of colostrum or only milk replacer and the effects of Long-R3-IGF-I (administered s.c. or orally; 50 microg/[kg BW x d] for 7 d), and of s.c. injected recombinant bovine GH (rbGH; 1 mg/[kg BW x d] for 7 d) on small intestinal mucosal morphology in newborn calves were studied by histomorphometry. Neonatal calves fed colostrum six times exhibited greater (P < .01) villus circumferences, areas, and heights in total small intestine and especially in the duodenum than calves fed only milk replacer. Furthermore, villus circumferences and areas in total small intestine were greater (P < .05) in calves fed colostrum once than in calves fed no colostrum. Villus size in total small intestine was smaller (P < .05) in rbGH-treated than in control calves; jejunum villus circumferences and heights were especially reduced (P < .05). Crypt depths in ileum were greater (P < .05) in rbGH-treated calves. In conclusion, prolonged colostrum supply significantly enhanced small intestinal villus size in neonatal calves. In contrast, Long-R3-IGF-I had no significant influence on small intestinal morphology, and rbGH in supraphysiological amounts even reduced small intestinal mucosal variables after 1 wk of treatment. The study demonstrated enhanced postnatal development of the gastrointestinal tract by prolonged colostrum feeding, but not by Long-R3-IGF-I or GH. PMID:9535335

  19. Deep RGS Observations of Clusters

    NASA Technical Reports Server (NTRS)

    Smith, R.; Mushotzky, R.; Loewenstein, M.

    2007-01-01

    This viewgraph presentation reviews the Reflection Grating Spectrometers (RGS) observations of clusters. It includes charts detailing the resolution difference between the European Photon Imaging Camera (EPIC) and the RGS and a partial review of existing observations, in graphic format, and as a table. Other sources show up in the ROSAT observations. The presentation reviews possible results that could be achieved in the event that 300 ks of time were allocated for the observations of clusters.

  20. PC Clusters for Lattice QCD

    NASA Astrophysics Data System (ADS)

    Holmgren, D. J.

    2005-03-01

    In the last several years, tightly coupled PC clusters have become widely applied, cost effective resources for lattice gauge computations. This paper discusses the practice of building such clusters, in particular balanced design requirements. I review and quantify the improvements over time of key performance parameters and overall price to performance ratio. Applying these trends and technology forecasts given by computer equipment manufacturers, I predict the range of price to performance for lattice codes expected in the next several years.

  1. Reactions and properties of clusters

    NASA Astrophysics Data System (ADS)

    Castleman, A. W., Jr.

    1992-09-01

    The elucidation from a molecular point of view of the differences and similarities in the properties and reactivity of matter in the gaseous compared to the condensed state is a subject of considerable current interest. One of the promising approaches to this problem is to utilize mass spectrometry in conjunction with laser spectroscopy and fast-flow reaction devices to investigate the changing properties, structure and reactivity of clusters as a function of the degree of solvation under well-controlled conditions. In this regard, an investigation of molecular cluster ions has provided considerable new insight into the basic mechanisms of ion reactions within a cluster, and this paper reviews some of the recent advances in cluster production, the origin of magic numbers and relationship to cluster ion stabilities, and solvation effects on reactions. There have been some notable advances in the production of large cluster ions under thermal reaction conditions, enabling a systematic study of the influence of solvation on reactions to be carried out. These and other new studies of magic numbers have traced their origin to the thermochemical stability of cluster ions. There are several classes of reaction where solvation has a notable influence on reactivity. A particularly interesting example comes from recent studies of the reactions of the hydroxyl anion with CO2 and SO2, studied as a function of the degree of hydration of OH-. Both reactions are highly exothermic, yet the differences in reactivity are dramatic. In the case of SO2, the reaction occurs at near the collision rate. By contrast, CO2 reactivity plummets dramatically for clusters having more than four water molecules. The slow rate is in accord with observations in the liquid phase.

  2. Re-shaping colloidal clusters

    NASA Astrophysics Data System (ADS)

    Kraft, Daniela

    2015-03-01

    Controlling the geometry and yield of anisotropic colloidal particles remains a challenge for hierarchical self-assembly. I will discuss a synthetic strategy for fabricating colloidal clusters by creating order in randomly aggregated polymer spheres using surface tension and geometrical constraints. The technique can be extended to a variety of charge-stabilized polymer spheres and offers control over the cluster size distribution. VENI grant from The Netherlands Organization for Scientific Research (NWO).

  3. Autophagy selectivity through receptor clustering

    NASA Astrophysics Data System (ADS)

    Rutenberg, Andrew; Brown, Aidan

    Substrate selectivity in autophagy requires an all-or-none cellular response. We focus on peroxisomes, for which autophagy receptor proteins NBR1 and p62 are well characterized. Using computational models, we explore the hypothesis that physical clustering of autophagy receptor proteins on the peroxisome surface provides an appropriate all-or-none response. We find that larger peroxisomes nucleate NBR1 clusters first, and lose them due to competitive coarsening last, resulting in significant size-selectivity. We then consider a secondary hypothesis that p62 inhibits NBR1 cluster formation. We find that p62 inhibition enhances size-selectivity enough that, even if there is no change of the pexophagy rate, the volume of remaining peroxisomes can significantly decrease. We find that enhanced ubiquitin levels suppress size-selectivity, and that this effect is more pronounced for individual peroxisomes. Sufficient ubiquitin allows receptor clusters to form on even the smallest peroxisomes. We conclude that NBR1 cluster formation provides a viable physical mechanism for all-or-none substrate selectivity in pexophagy. We predict that cluster formation is associated with significant size-selectivity. Now at Simon Fraser University.

  4. Collective thermoregulation in bee clusters.

    PubMed

    Ocko, Samuel A; Mahadevan, L

    2014-02-01

    Swarming is an essential part of honeybee behaviour, wherein thousands of bees cling onto each other to form a dense cluster that may be exposed to the environment for several days. This cluster has the ability to maintain its core temperature actively without a central controller. We suggest that the swarm cluster is akin to an active porous structure whose functional requirement is to adjust to outside conditions by varying its porosity to control its core temperature. Using a continuum model that takes the form of a set of advection-diffusion equations for heat transfer in a mobile porous medium, we show that the equalization of an effective 'behavioural pressure', which propagates information about the ambient temperature through variations in density, leads to effective thermoregulation. Our model extends and generalizes previous models by focusing the question of mechanism on the form and role of the behavioural pressure, and allows us to explain the vertical asymmetry of the cluster (as a consequence of buoyancy-driven flows), the ability of the cluster to overpack at low ambient temperatures without breaking up at high ambient temperatures, and the relative insensitivity to large variations in the ambient temperature. Our theory also makes testable hypotheses for the response of the cluster to external temperature inhomogeneities and suggests strategies for biomimetic thermoregulation. PMID:24335563

  5. Understanding Galaxy Cluster MKW10

    NASA Astrophysics Data System (ADS)

    Sanders, Tim; Henry, Swain; Coble, Kimberly A.; Rosenberg, Jessica L.; Koopmann, Rebecca A.

    2015-01-01

    As part of the Undergraduate ALFALFA Team (UAT), we are studying the galaxy cluster MKW 10 (RA = 175.454, Dec = 10.306, z ~ 0.02), a poor cluster with a compact core in which tidal interactions have occurred. This cluster has been observed in HI and Hα. We used SDSS and NED to search for optical counterparts. By comparing data at multiple wavelengths, we hope to understand the structure, environment, and star formation history of this cluster. Following the techniques of others involved in the groups project and using the program TOPCAT to manipulate the data, we explored both the spatial and velocity distributions to determine cluster membership. We have determined that this cluster consists of 11 galaxies, mostly spiral in shape. Chicago State University is new the UAT and we began our work after taking part in the winter workshop at Arecibo.This work was supported by: Undergraduate ALFALFA Team NSF Grant AST-1211005 and the Illinois Space Grant Consortium.

  6. AMIC@: All MIcroarray Clusterings @ once

    PubMed Central

    Geraci, Filippo; Pellegrini, Marco; Renda, M. Elena

    2008-01-01

    The AMIC@ Web Server offers a light-weight multi-method clustering engine for microarray gene-expression data. AMIC@ is a highly interactive tool that stresses user-friendliness and robustness by adopting AJAX technology, thus allowing an effective interleaved execution of different clustering algorithms and inspection of results. Among the salient features AMIC@ offers, there are: (i) automatic file format detection, (ii) suggestions on the number of clusters using a variant of the stability-based method of Tibshirani et al. (iii) intuitive visual inspection of the data via heatmaps and (iv) measurements of the clustering quality using cluster homogeneity. Large data sets can be processed efficiently by selecting algorithms (such as FPF-SB and k-Boost), specifically designed for this purpose. In case of very large data sets, the user can opt for a batch-mode use of the system by means of the Clustering wizard that runs all algorithms at once and delivers the results via email. AMIC@ is freely available and open to all users with no login requirement at the following URL http://bioalgo.iit.cnr.it/amica. PMID:18477631

  7. AMIC@: All MIcroarray Clusterings @ once.

    PubMed

    Geraci, Filippo; Pellegrini, Marco; Renda, M Elena

    2008-07-01

    The AMIC@ Web Server offers a light-weight multi-method clustering engine for microarray gene-expression data. AMIC@ is a highly interactive tool that stresses user-friendliness and robustness by adopting AJAX technology, thus allowing an effective interleaved execution of different clustering algorithms and inspection of results. Among the salient features AMIC@ offers, there are: (i) automatic file format detection, (ii) suggestions on the number of clusters using a variant of the stability-based method of Tibshirani et al. (iii) intuitive visual inspection of the data via heatmaps and (iv) measurements of the clustering quality using cluster homogeneity. Large data sets can be processed efficiently by selecting algorithms (such as FPF-SB and k-Boost), specifically designed for this purpose. In case of very large data sets, the user can opt for a batch-mode use of the system by means of the Clustering wizard that runs all algorithms at once and delivers the results via email. AMIC@ is freely available and open to all users with no login requirement at the following URL http://bioalgo.iit.cnr.it/amica. PMID:18477631

  8. Calibrating AGN Feedback in Clusters

    NASA Astrophysics Data System (ADS)

    Wise, M. W.

    2009-12-01

    Whether caused by AGN jets, shocks, or mergers, the most definitive evidence for heating in cluster cores comes from X-ray spectroscopy. Unfortunately such spectra are essentially limited to studying the emission spectrum from the cluster as a whole. However since the same underlying emission measure distribution produces both the observed CCD and RGS spectra, X-ray imaging can still provide spatial information on the heating process. Using Chandra archival data for a sample of 9 clusters, we demonstrate how imaging data can be used to constrain departures from a canonical, isobaric cooling flow model as a function of position in a given cluster. The results of this analysis are also shown for the deep archival exposure of the Perseus cluster. Such ``heating maps'' can provide constraints on both the location and magnitude of the heating in the cores of clusters. When combined with detections and spectral index maps from low-frequency radio observations, these maps can be used to distinguish between different models for heating in these objects.

  9. Collective thermoregulation in bee clusters

    PubMed Central

    Ocko, Samuel A.; Mahadevan, L.

    2014-01-01

    Swarming is an essential part of honeybee behaviour, wherein thousands of bees cling onto each other to form a dense cluster that may be exposed to the environment for several days. This cluster has the ability to maintain its core temperature actively without a central controller. We suggest that the swarm cluster is akin to an active porous structure whose functional requirement is to adjust to outside conditions by varying its porosity to control its core temperature. Using a continuum model that takes the form of a set of advection–diffusion equations for heat transfer in a mobile porous medium, we show that the equalization of an effective ‘behavioural pressure’, which propagates information about the ambient temperature through variations in density, leads to effective thermoregulation. Our model extends and generalizes previous models by focusing the question of mechanism on the form and role of the behavioural pressure, and allows us to explain the vertical asymmetry of the cluster (as a consequence of buoyancy-driven flows), the ability of the cluster to overpack at low ambient temperatures without breaking up at high ambient temperatures, and the relative insensitivity to large variations in the ambient temperature. Our theory also makes testable hypotheses for the response of the cluster to external temperature inhomogeneities and suggests strategies for biomimetic thermoregulation. PMID:24335563

  10. Electrodynamic properties of fractal clusters

    NASA Astrophysics Data System (ADS)

    Maksimenko, V. V.; Zagaynov, V. A.; Agranovski, I. E.

    2014-07-01

    An influence of interference on a character of light interaction both with individual fractal cluster (FC) consisting of nanoparticles and with agglomerates of such clusters is investigated. Using methods of the multiple scattering theory, effective dielectric permeability of a micron-size FC composed of non-absorbing nanoparticles is calculated. The cluster could be characterized by a set of effective dielectric permeabilities. Their number coincides with the number of particles, where space arrangement in the cluster is correlated. If the fractal dimension is less than some critical value and frequency corresponds to the frequency of the visible spectrum, then the absolute value of effective dielectric permeability becomes very large. This results in strong renormalization (decrease) of the incident radiation wavelength inside the cluster. The renormalized photons are cycled or trapped inside the system of multi-scaled cavities inside the cluster. A lifetime of a photon localized inside an agglomerate of FCs is a macroscopic value allowing to observe the stimulated emission of the localized light. The latter opens up a possibility for creation of lasers without inverse population of energy levels. Moreover, this allows to reconsider problems of optical cloaking of macroscopic objects. One more feature of fractal structures is a possibility of unimpeded propagation of light when any resistance associated with scattering disappears.

  11. Identification of Urban Leprosy Clusters

    PubMed Central

    Paschoal, José Antonio Armani; Paschoal, Vania Del'Arco; Nardi, Susilene Maria Tonelli; Rosa, Patrícia Sammarco; Ismael, Manuela Gallo y Sanches; Sichieri, Eduvaldo Paulo

    2013-01-01

    Overpopulation of urban areas results from constant migrations that cause disordered urban growth, constituting clusters defined as sets of people or activities concentrated in relatively small physical spaces that often involve precarious conditions. Aim. Using residential grouping, the aim was to identify possible clusters of individuals in São José do Rio Preto, Sao Paulo, Brazil, who have or have had leprosy. Methods. A population-based, descriptive, ecological study using the MapInfo and CrimeStat techniques, geoprocessing, and space-time analysis evaluated the location of 425 people treated for leprosy between 1998 and 2010. Clusters were defined as concentrations of at least 8 people with leprosy; a distance of up to 300 meters between residences was adopted. Additionally, the year of starting treatment and the clinical forms of the disease were analyzed. Results. Ninety-eight (23.1%) of 425 geocoded cases were located within one of ten clusters identified in this study, and 129 cases (30.3%) were in the region of a second-order cluster, an area considered of high risk for the disease. Conclusion. This study identified ten clusters of leprosy cases in the city and identified an area of high risk for the appearance of new cases of the disease. PMID:24288467

  12. Spectral clustering of protein sequences

    PubMed Central

    Paccanaro, Alberto; Casbon, James A.; Saqi, Mansoor A. S.

    2006-01-01

    An important problem in genomics is automatically clustering homologous proteins when only sequence information is available. Most methods for clustering proteins are local, and are based on simply thresholding a measure related to sequence distance. We first show how locality limits the performance of such methods by analysing the distribution of distances between protein sequences. We then present a global method based on spectral clustering and provide theoretical justification of why it will have a remarkable improvement over local methods. We extensively tested our method and compared its performance with other local methods on several subsets of the SCOP (Structural Classification of Proteins) database, a gold standard for protein structure classification. We consistently observed that, the number of clusters that we obtain for a given set of proteins is close to the number of superfamilies in that set; there are fewer singletons; and the method correctly groups most remote homologs. In our experiments, the quality of the clusters as quantified by a measure that combines sensitivity and specificity was consistently better [on average, improvements were 84% over hierarchical clustering, 34% over Connected Component Analysis (CCA) (similar to GeneRAGE) and 72% over another global method, TribeMCL]. PMID:16547200

  13. Multi-focus cluster labeling.

    PubMed

    Eikvil, Line; Jenssen, Tor-Kristian; Holden, Marit

    2015-06-01

    Document collections resulting from searches in the biomedical literature, for instance, in PubMed, are often so large that some organization of the returned information is necessary. Clustering is an efficient tool for organizing search results. To help the user to decide how to continue the search for relevant documents, the content of each cluster can be characterized by a set of representative keywords or cluster labels. As different users may have different interests, it can be desirable with solutions that make it possible to produce labels from a selection of different topical categories. We therefore introduce the concept of multi-focus cluster labeling to give users the possibility to get an overview of the contents through labels from multiple viewpoints. The concept for multi-focus cluster labeling has been established and has been demonstrated on three different document collections. We illustrate that multi-focus visualizations can give an overview of clusters along axes that general labels are not able to convey. The approach is generic and should be applicable to any biomedical (or other) domain with any selection of foci where appropriate focus vocabularies can be established. A user evaluation also indicates that such a multi-focus concept is useful. PMID:25869415

  14. R3DE: Radiation Risk Radiometer-Dosimeter on the International Space Station—Optical Radiation Data Recorded During 18 Months of EXPOSE-E Exposure to Open Space

    PubMed Central

    Schuster, Martin; Dachev, Tsvetan; Häder, Donat-Peter

    2012-01-01

    Abstract Radiation Risk Radiometer-Dosimeter E (R3DE) served as a device for measuring ionizing and non-ionizing radiation as well as cosmic radiation reaching biological samples located on the EXPOSE platform EXPOSE-E. The duration of the mission was almost 1.5 years (2008–2009). With four channels, R3DE detected the wavelength ranges of photosynthetically active radiation (PAR, 400–700 nm), UVA (315–400 nm), UVB (280–315 nm), and UVC (<280 nm). In addition, the temperature was recorded. Cosmic ionizing radiation was assessed with a 256-channel spectrometer dosimeter (see separate report in this issue). The light and UV sensors of the device were calibrated with spectral measurement data obtained by the Solar Radiation and Climate Experiment (SORCE) satellite as standard. The data were corrected with respect to the cosine error of the diodes. Measurement frequency was 0.1 Hz. Due to errors in data transmission or temporary termination of EXPOSE power, not all data could be acquired. Radiation was not constant during the mission. At regular intervals of about 2 months, low or almost no radiation was encountered. The radiation dose during the mission was 1823.98 MJ m−2 for PAR, 269.03 MJ m−2 for UVA, 45.73 MJ m−2 for UVB, or 18.28 MJ m−2 for UVC. Registered sunshine duration during the mission was about 152 days (about 27% of mission time).The surface of EXPOSE was most likely turned away from the Sun for considerably longer. R3DE played a crucial role on EXPOSE-EuTEF (EuTEF, European Technology Exposure Facility), because evaluation of the astrobiology experiments depended on reliability of the data collected by the device. Observed effects in the samples were weighted by radiation doses measured by R3DE. Key Words: ISS—EXPOSE-E—R3DE—Radiation measurement—PAR—UV radiation. Astrobiology 12, 393–402. PMID:22680686

  15. Seminars on Occupational Clusters. A Report.

    ERIC Educational Resources Information Center

    Bureau of Occupational and Adult Education (DHEW/OE), Washington, DC. Div. of Research and Demonstration.

    The document on occupational clusters was developed from papers presented in staff seminars in the Bureau of Occupational and Adult Education and contains eight papers: Introduction to the World of Clustering, Sidney C. High; Cluster Curriculum Development, Elizabeth J. Simpson; the Cluster Concept, Development of Curricular Materials for the…

  16. Bayesian Decision Theoretical Framework for Clustering

    ERIC Educational Resources Information Center

    Chen, Mo

    2011-01-01

    In this thesis, we establish a novel probabilistic framework for the data clustering problem from the perspective of Bayesian decision theory. The Bayesian decision theory view justifies the important questions: what is a cluster and what a clustering algorithm should optimize. We prove that the spectral clustering (to be specific, the…

  17. Growth of atmospheric clusters involving cluster-cluster collisions: comparison of different growth rate methods

    NASA Astrophysics Data System (ADS)

    Kontkanen, Jenni; Olenius, Tinja; Lehtipalo, Katrianne; Vehkamäki, Hanna; Kulmala, Markku; Lehtinen, Kari E. J.

    2016-05-01

    We simulated the time evolution of atmospheric cluster concentrations in a one-component system where not only do clusters grow by condensation of monomers, but cluster-cluster collisions also significantly contribute to the growth of the clusters. Our aim was to investigate the consistency of the growth rates of sub-3 nm clusters determined with different methods and the validity of the common approach to use them to estimate particle formation rates. We compared the growth rate corresponding to particle fluxes (FGR), the growth rate derived from the appearance times of clusters (AGR), and the growth rate calculated based on irreversible vapor condensation (CGR). We found that the relation between the different growth rates depends strongly on the external conditions and the properties of the model substance. The difference between the different growth rates was typically highest at the smallest, sub-2 nm sizes. FGR was generally lower than AGR and CGR; at the smallest sizes the difference was often very large, while at sizes larger than 2 nm the growth rates were closer to each other. AGR and CGR were in most cases close to each other at all sizes. The difference between the growth rates was generally lower in conditions where cluster concentrations were high, and evaporation and other losses were thus less significant. Furthermore, our results show that the conventional method used to determine particle formation rates from growth rates may give estimates far from the true values. Thus, care must be taken not only in how the growth rate is determined but also in how it is applied.

  18. Nonlocalized clustering: a new concept in nuclear cluster structure physics.

    PubMed

    Zhou, Bo; Funaki, Y; Horiuchi, H; Ren, Zhongzhou; Röpke, G; Schuck, P; Tohsaki, A; Xu, Chang; Yamada, T

    2013-06-28

    We investigate the α+^{16}O cluster structure in the inversion-doublet band (Kπ=0(1)±}) states of 20Ne with an angular-momentum-projected version of the Tohsaki-Horiuchi-Schuck-Röpke (THSR) wave function, which was successful "in its original form" for the description of, e.g., the famous Hoyle state. In contrast with the traditional view on clusters as localized objects, especially in inversion doublets, we find that these single THSR wave functions, which are based on the concept of nonlocalized clustering, can well describe the Kπ=0(1)- band and the Kπ=0(1)+ band. For instance, they have 99.98% and 99.87% squared overlaps for 1- and 3- states (99.29%, 98.79%, and 97.75% for 0+, 2+, and 4+ states), respectively, with the corresponding exact solution of the α+16O resonating group method. These astounding results shed a completely new light on the physics of low energy nuclear cluster states in nuclei: The clusters are nonlocalized and move around in the whole nuclear volume, only avoiding mutual overlap due to the Pauli blocking effect. PMID:23848866

  19. Intra-cluster correlation selection for cluster randomized trials.

    PubMed

    Westgate, Philip M

    2016-08-30

    In this paper, we give focus to cluster randomized trials, also known as group randomized trials, which randomize clusters, or groups, of subjects to different trial arms, such as intervention or control. Outcomes from subjects within the same cluster tend to exhibit an exchangeable correlation measured by the intra-cluster correlation coefficient (ICC). Our primary interest is to test if the intervention has an impact on the marginal mean of an outcome. Using recently developed methods, we propose how to select a working ICC structure with the goal of choosing the structure that results in the smallest standard errors for regression parameter estimates and thus the greatest power for this test. Specifically, we utilize small-sample corrections for the estimation of the covariance matrix of regression parameter estimates. This matrix is incorporated within correlation selection criteria proposed in the generalized estimating equations literature to choose one of multiple working ICC structures under consideration. We demonstrate the potential power and utility of this approach when used in cluster randomized trial settings via a simulation study and application example, and we discuss practical considerations for its use in practice. Copyright © 2016 John Wiley & Sons, Ltd. PMID:26924419

  20. Theory of clustered-cavity gyroklystron

    NASA Astrophysics Data System (ADS)

    Nusinovich, G. S.; Antonsen, T. M.; Guo, H.; Granatstein, V. L.

    2002-09-01

    An analytical theory of a new device configuration, a clustered-cavity gyroklystron, is developed. The device considered has two clusters of cavities: an input cluster and an output cluster. The results show that, by using a cluster cavity concept, the bandwidth of gyroklystrons can be enlarged significantly without sacrifice of gain or efficiency which may lead to the development of a new type of high power, moderate bandwidth millimeter-wave amplifier. The theory has also been used to analyze the effect of stagger tuning between cavity frequencies within a single cluster, as well as between different clusters on the bandwidth and gain of the device.

  1. A Nonparametric Bayesian Model for Nested Clustering.

    PubMed

    Lee, Juhee; Müller, Peter; Zhu, Yitan; Ji, Yuan

    2016-01-01

    We propose a nonparametric Bayesian model for clustering where clusters of experimental units are determined by a shared pattern of clustering another set of experimental units. The proposed model is motivated by the analysis of protein activation data, where we cluster proteins such that all proteins in one cluster give rise to the same clustering of patients. That is, we define clusters of proteins by the way that patients group with respect to the corresponding protein activations. This is in contrast to (almost) all currently available models that use shared parameters in the sampling model to define clusters. This includes in particular model based clustering, Dirichlet process mixtures, product partition models, and more. We show results for two typical biostatistical inference problems that give rise to clustering. PMID:26519174

  2. STAR CLUSTERS IN M31: OLD CLUSTERS WITH BAR KINEMATICS

    SciTech Connect

    Morrison, Heather; Harding, Paul; Caldwell, Nelson; Schiavon, Ricardo P.; Athanassoula, E.

    2011-01-01

    We analyze our accurate kinematical data for the old clusters in the inner regions of M31. These velocities are based on high signal-to-noise Hectospec data. The data are well suited for analysis of M31's inner regions because we took particular care to correct for contamination by unresolved field stars from the disk and bulge in the fibers. The metal-poor clusters show kinematics that are compatible with a pressure-supported spheroid. The kinematics of metal-rich clusters, however, argue for a disk population. In particular the innermost region (inside 2 kpc) shows the kinematics of the x{sub 2} family of bar periodic orbits, arguing for the existence of an inner Lindblad resonance in M31.

  3. Internal gettering by metal alloy clusters

    DOEpatents

    Buonassisi, Anthony; Heuer, Matthias; Istratov, Andrei A.; Pickett, Matthew D.; Marcus, Mathew A.; Weber, Eicke R.

    2010-07-27

    The present invention relates to the internal gettering of impurities in semiconductors by metal alloy clusters. In particular, intermetallic clusters are formed within silicon, such clusters containing two or more transition metal species. Such clusters have melting temperatures below that of the host material and are shown to be particularly effective in gettering impurities within the silicon and collecting them into isolated, less harmful locations. Novel compositions for some of the metal alloy clusters are also described.

  4. Quantum Monte Carlo methods and lithium cluster properties. [Atomic clusters

    SciTech Connect

    Owen, R.K.

    1990-12-01

    Properties of small lithium clusters with sizes ranging from n = 1 to 5 atoms were investigated using quantum Monte Carlo (QMC) methods. Cluster geometries were found from complete active space self consistent field (CASSCF) calculations. A detailed development of the QMC method leading to the variational QMC (V-QMC) and diffusion QMC (D-QMC) methods is shown. The many-body aspect of electron correlation is introduced into the QMC importance sampling electron-electron correlation functions by using density dependent parameters, and are shown to increase the amount of correlation energy obtained in V-QMC calculations. A detailed analysis of D-QMC time-step bias is made and is found to be at least linear with respect to the time-step. The D-QMC calculations determined the lithium cluster ionization potentials to be 0.1982(14) (0.1981), 0.1895(9) (0.1874(4)), 0.1530(34) (0.1599(73)), 0.1664(37) (0.1724(110)), 0.1613(43) (0.1675(110)) Hartrees for lithium clusters n = 1 through 5, respectively; in good agreement with experimental results shown in the brackets. Also, the binding energies per atom was computed to be 0.0177(8) (0.0203(12)), 0.0188(10) (0.0220(21)), 0.0247(8) (0.0310(12)), 0.0253(8) (0.0351(8)) Hartrees for lithium clusters n = 2 through 5, respectively. The lithium cluster one-electron density is shown to have charge concentrations corresponding to nonnuclear attractors. The overall shape of the electronic charge density also bears a remarkable similarity with the anisotropic harmonic oscillator model shape for the given number of valence electrons.

  5. 3D simulation of the Cluster-Cluster Aggregation model

    NASA Astrophysics Data System (ADS)

    Li, Chao; Xiong, Hailing

    2014-12-01

    We write a program to implement the Cluster-Cluster Aggregation (CCA) model with java programming language. By using the simulation program, the fractal aggregation growth process can be displayed dynamically in the form of a three-dimensional (3D) figure. Meanwhile, the related kinetics data of aggregation simulation can be also recorded dynamically. Compared to the traditional programs, the program has better real-time performance and is more helpful to observe the fractal growth process, which contributes to the scientific study in fractal aggregation. Besides, because of adopting java programming language, the program has very good cross-platform performance.

  6. IRAC imaging of GOGREEN clusters

    NASA Astrophysics Data System (ADS)

    McGee, Sean; Balogh, Michael; Cooper, Michael; Gilbank, David; Lidman, Chris; Muzzin, Adam; Old, Lyndsay; Rudnick, Greg; Wilson, Gillian; Yee, Howard

    2016-08-01

    We propose deep IRAC imaging of three galaxy clusters drawn from the GOGREEN survey of 21 galaxy clusters in the redshift range 1 < z < 1.5. This imaging will enable the accurate measurement of unprecedentedly low stellar masses at this redshift, leveraging our deep spectroscopy. This will give a first look at environmental effects on galaxy evolution at a time when galaxies are growing in a fundamentally different way from today. With this data, we will perform accurate SED modeling in order to classify galaxies as passive or star-forming and measure stellar masses, as well as compute cluster membership using accurate photometric redshifts. These data will be augmented by approved VLT, Subaru, Magellan and CFHT imaging and by an ongoing Gemini Large Programme, with which we are obtaining deep spectroscopy of > 1000 member and > 600 field galaxies. With these data and our own lower-redshift descendant data, we will measure 1) the evolution of the quenched fraction and its dependence on distance from the cluster center and 2) the relation between stellar and halo mass and its evolution. This will provide unique constraints to our in-house theoretical models at an epoch where there are currently almost none available. The imaging that we propose will ensure all 21 GOGREEN clusters have deep IRAC data, ensuring the lasting legacy of this benchmark sample.

  7. Central Dynamics of Globular Clusters

    NASA Astrophysics Data System (ADS)

    Noyola, Eva; Baumgardt, H.

    2007-12-01

    Globular clusters have historically been classified into two groups due to their dynamical state. They are considered to be either pre-core-collapse or post-core-collapse systems. Clusters are considered as post-core-collapse when they show concentrated surface brightness profiles, with a steep central cusp; while pre-core collapse clusters are less concentrated and have flat central cores. Recent observational results show that some clusters have central surface brightness profiles with intermediate central slopes, showing shallow cusps. These observations could be explained by the presence of a single or a binary intermediate mass black hole in the center of the clusters. In this work, we create realistic synthetic images from the output of N-body models. The images attempt to mock the resolution and point spread function of the high resolution cameras on board the Hubble Space Telescope. The models are created with and without central black holes, where the no black hole models are allowed to reach core-collapse. We measure surface brightness profiles both from integrated light and from star counts. From the profiles, we obtain parameters such as central surface brightness slope, core radius, and half light radius. We also test how well a King model describes each profile. We find that the black hole models produce shallow cusps if the black hole is larger than a certain mass; while models without central black holes produce more concentrated profiles. This approach, allows to make a thorough comparison between observations and models.

  8. Seven poor clusters of galaxies

    NASA Astrophysics Data System (ADS)

    Beers, T. C.; Geller, M. J.; Huchra, J. P.; Latham, D. W.; Davis, R. J.

    1984-08-01

    The authors have measured 83 new redshifts for galaxies in the region of seven of the poor clusters of galaxies identified by Morgan, Kayser, and White and Albert, White, and Morgan. For three systems (MKW 1s, AWM 1, and AWM 7) complete redshift samples were obtained for galaxies brighter than mB(0) = 15.7 within 1° of the D or cD galaxy. The authors estimate masses for the clusters by applying both the virial theorem and the projected mass method. For the two clusters with the highest X-ray luminosities, the line-of-sight velocity dispersions are ≡700 km s-1, and mass-to-light ratios M/LB(0) ⪆ 400 M_sun;/L_sun;. For the five other clusters the velocity dispersions are ⪉370 km s-1, and four of the five have mass-to-light ratios ⪉250 M_sun;/L_sun;. The D or cD galaxy in each poor cluster is at the kinematic center of the system.

  9. Color Distributions of 29 Galactic Globular Clusters

    NASA Astrophysics Data System (ADS)

    Sohn, Young-Jong; Byun, Yong-Ik; Yim, Hong-Suh; Rhee, Myung-Hyun; Chun, Mun-Suk

    1998-06-01

    U, B, and V CCD images are used to investigate the radial color gradients of twenty nine Galactic globular clusters - twenty two King type clusters and seven Post Core Collapse (PCC) clusters classified on their surface brightness distributions. For King type clusters, eight clusters show radial color gradients with redder center and seven clusters with bluer centers in (B-V). Seven King type clusters have redder centers in (U-B), and five King type clusters show radial color gradients with bluer center in the same color. Among seven PCC clusters, one cluster show a redder center and five clusters show bluer centers in (B-V). Two PCC clusters have redder centers in (U-B), four PCC clusters show radial color gradients with bluer centers in the same color. These results bring an evidence that the color gradient is not unique to PCC clusters with bluer center. >From the Pearson's correlation coefficient tests, we found the horizontal branch morphologies have weak correlations to the radial color gradients within globular clusters.

  10. The ARCHES Integrated Cluster Finder

    NASA Astrophysics Data System (ADS)

    Mints, A.; Schwope, A.

    2014-07-01

    We are developing a tool to search for galaxy clusters associated with X-ray sources from the 3XMM catalog within the ARCHES project (Astronomical Resource cross-matching for High-Energy Studies). We make use of the new cross-matching tool developed for ARCHES to select galaxies in different catalogs around X-ray positions and then try to find clusters by searching for overdensities in the multi-color space. Colors are related to redshifts using spectroscopic data for passively evolving galaxies from the BOSS and VIPERS catalogs. So far we are making use of SDSS, UKIDSS, WISE, and CFHTLS photometric catalogs, but the method can easily be expanded to other data as well (e.g. Pan-STARRS and DES). We present test results of our tool performed on reference samples from the XMM/SDSS cluster survey (Takey et al 2012) and the NORAS/REFLEX surveys.

  11. Cluster headache management and beyond.

    PubMed

    Martelletti, Paolo

    2015-01-01

    The therapeutic management of cluster headache is based on a very stable triad of drugs. Acute treatment has, in subcutaneous sumatriptan, its gold standard if compared to pure oxygen or indomethacin. Preventative treatment is based on verapamil at high doses (≥ 360 mg) and is a gold standard if compared to lithium carbonate or topiramate. Transitional treatments, based on the short-term use of corticosteroids with either systemic or local administration (GON), can be useful for the suppression of most resistant cluster periods, but with a well-known carry-over phenomenon related to the length of the cluster period itself. The role of invasive or noninvasive neuromodulation approaches must still be determined on a large scale; therefore, its use is not recommended as of yet. Lifestyle changes, including alcohol avoidance during the active phase of the disease, sleep hygiene and use of vasodilation drugs, should be carefully considered and the patients should be fully informed. PMID:26027515

  12. Homotypic Regulatory Clusters in Drosophila

    PubMed Central

    Lifanov, Alexander P.; Makeev, Vsevolod J.; Nazina, Anna G.; Papatsenko, Dmitri A.

    2003-01-01

    Cis-regulatory modules (CRMs) are transcription regulatory DNA segments (∼1 Kb range) that control the expression of developmental genes in higher eukaryotes. We analyzed clustering of known binding motifs for transcription factors (TFs) in over 60 known CRMs from 20 Drosophila developmental genes, and we present evidence that each type of recognition motif forms significant clusters within the regulatory regions regulated by the corresponding TF. We demonstrate how a search with a single binding motif can be applied to explore gene regulatory networks and to discover coregulated genes in the genome. We also discuss the potential of the clustering method in interpreting the differential response of genes to various levels of transcriptional regulators. PMID:12670999

  13. Au20: A Tetrahedral Cluster

    SciTech Connect

    Li, Jun; Li, Xi; Zhai, Hua Jin; Wang, Lai S.

    2003-02-07

    Photoelectron spectroscopy revealed that a 20 atom gold cluster has an extremely large energy gap, which is even greater than that of C60, and an electron affinity comparable with that of C60. This observation suggests that the Au20 cluster must be extremely stable and chemically inert. Using relativistic density functional calculations, we found that Au20 possesses a remarkable tetrahedral structure, which is a fragment of the bulk face-centered cubic lattice of gold with a small structural relaxation. Au20 is thus a true cluster molecule, while at the same time it is exactly part of the bulk, but with very different properties. The tetrahedral Au20 may possess interesting catalytic properties and may be synthesized in bulk quantity or assembled on non-interacting surfaces.

  14. Ariane-5 and Cluster update

    NASA Astrophysics Data System (ADS)

    1996-06-01

    The Enquiry Board started work on 13 June and will report by mid-July. The Launch Qualification Committee resumed its activities on 14 June. The ESA Director General and the CNES Chairman will have to rule on the Enquiry Board's recommendations and the Launch Qualification Committee's requirements. The ESA Executive will then be able to determine - with CNES - the technical and programmatic implications for the Ariane-5 development programme. The Enquiry Board's findings and recommendations and their implications will be made known to the press soon afterwards. The Ariane Launcher Programme Board (the ESA delegate body that supervises the programme) will meet on 12 August, when the ESA Executive will present the programmatic implications. On the payload side, the Cluster Science Working Team (SWT) met on 17 and 18 June to assess the situation after the loss of the Cluster mission and to explore ways in which its scientific objectives could be revived. The SWT proposed the following approach: a. integration of the Cluster structural model with flight spare subsystems (the Phoenix project) together with a rebuild of three spacecraft identical to the originals. This scenario offers alternative options: a1. integration and testing of the Cluster spare (Phoenix), storage and launch at a later date together with the three rebuilt satellites, and a2. integration and reflight of Phoenix as soon as possible and production and launch of the three rebuilt satellites at a later date. The SWT stressed that the case for an early launch of Phoenix was largely dependent on whether the follow-on programme was also approved. A further option would call for: b. use of the Cluster spare (Phoenix) as outlined above, augmented by three new "mini" satellites funded and produced by ESA Member States that would carry subsets of the Cluster instrumentation. This mission would thus fly one main spacecraft and three "companion" spacecraft, as described in an early proposal for Cluster. On 21

  15. Amphoteric Aqueous Hafnium Cluster Chemistry.

    PubMed

    Goberna-Ferrón, Sara; Park, Deok-Hie; Amador, Jenn M; Keszler, Douglas A; Nyman, May

    2016-05-17

    Selective dissolution of hafnium-peroxo-sulfate films in aqueous tetramethylammonium hydroxide enables extreme UV lithographic patterning of sub-10 nm HfO2 structures. Hafnium speciation under these basic conditions (pH>10), however, is unknown, as studies of hafnium aqueous chemistry have been limited to acid. Here, we report synthesis, crystal growth, and structural characterization of the first polynuclear hydroxo hafnium cluster isolated from base, [TMA]6 [Hf6 (μ-O2 )6 (μ-OH)6 (OH)12 ]⋅38 H2 O. The solution behavior of the cluster, including supramolecular assembly via hydrogen bonding is detailed via small-angle X-ray scattering (SAXS) and electrospray ionization mass spectrometry (ESI-MS). The study opens a new chapter in the aqueous chemistry of hafnium, exemplifying the concept of amphoteric clusters and informing a critical process in single-digit-nm lithography. PMID:27094575

  16. Transport on exploding percolation clusters

    NASA Astrophysics Data System (ADS)

    Andrade, José S., Jr.; Herrmann, Hans J.; Moreira, André A.; Oliveira, Cláudio L. N.

    2011-03-01

    We propose a simple generalization of the explosive percolation process [Achlioptas , ScienceSCIEAS0036-807510.1126/science.1167782 323, 1453 (2009)], and investigate its structural and transport properties. In this model, at each step, a set of q unoccupied bonds is randomly chosen. Each of these bonds is then associated with a weight given by the product of the cluster sizes that they would potentially connect, and only that bond among the q set which has the smallest weight becomes occupied. Our results indicate that, at criticality, all finite-size scaling exponents for the spanning cluster, the conducting backbone, the cutting bonds, and the global conductance of the system, change continuously and significantly with q. Surprisingly, we also observe that systems with intermediate values of q display the worst conductive performance. This is explained by the strong inhibition of loops in the spanning cluster, resulting in a substantially smaller associated conducting backbone.

  17. Cluster assembly of hierarchical nanostructures

    SciTech Connect

    Siegel, R.W.

    1992-02-01

    In the past few years, atom clusters with diameters in the range of 2--20 nm of a variety of materials, including both metals and ceramics, have been synthesized by evaporation and condensation in high-purity gases and subsequently consolidated in situ under ultrahigh vacuum conditions to create nanophase materials. These new utlrafine-grained materials have properties that are often significantly different and considerably improved relative to those of their coarser-grained counterparts owing to both their small grain-size scale and the large percentage of their atoms in grain boundary environments. Since their properties can be engineered during the synthesis and processing steps, cluster-assembled materials appear to have significant potential for the introduction of a hierarchy of both structure and properties. Some of the recent research on nanophase materials related to properties and scale are reviewed and some of the possibilities for synthesizing hierarchical nanostructures via cluster assembly are considered.

  18. The KMOS Galaxy Clusters Project

    NASA Astrophysics Data System (ADS)

    Davies, Roger L.; Beifiori, A.; Bender, R.; Cappellari, M.; Chan, J.; Houghton, R.; Mendel, T.; Saglia, R.; Sharples, R.; Stott, J.; Smith, R.; Wilman, D.

    2015-04-01

    KMOS is a cryogenic infrared spectrograph fed by twentyfour deployable integral field units that patrol a 7.2 arcminute diameter field of view at the Nasmyth focus of the ESO VLT. It is well suited to the study of galaxy clusters at 1 < z < 2 where the well understood features in the restframe V-band are shifted into the KMOS spectral bands. Coupled with HST imagining, KMOS offers a window on the critical epoch for galaxy evolution, 7-10 Gyrs ago, when the key properties of cluster galaxies were established. We aim to investigate the size, mass, morphology and star formation history of galaxies in the clusters. Here we describe the instrument, discuss the status of the observations and report some preliminary results.

  19. Collaborative Clustering for Sensor Networks

    NASA Technical Reports Server (NTRS)

    Wagstaff. Loro :/; Green Jillian; Lane, Terran

    2011-01-01

    Traditionally, nodes in a sensor network simply collect data and then pass it on to a centralized node that archives, distributes, and possibly analyzes the data. However, analysis at the individual nodes could enable faster detection of anomalies or other interesting events, as well as faster responses such as sending out alerts or increasing the data collection rate. There is an additional opportunity for increased performance if individual nodes can communicate directly with their neighbors. Previously, a method was developed by which machine learning classification algorithms could collaborate to achieve high performance autonomously (without requiring human intervention). This method worked for supervised learning algorithms, in which labeled data is used to train models. The learners collaborated by exchanging labels describing the data. The new advance enables clustering algorithms, which do not use labeled data, to also collaborate. This is achieved by defining a new language for collaboration that uses pair-wise constraints to encode useful information for other learners. These constraints specify that two items must, or cannot, be placed into the same cluster. Previous work has shown that clustering with these constraints (in isolation) already improves performance. In the problem formulation, each learner resides at a different node in the sensor network and makes observations (collects data) independently of the other learners. Each learner clusters its data and then selects a pair of items about which it is uncertain and uses them to query its neighbors. The resulting feedback (a must and cannot constraint from each neighbor) is combined by the learner into a consensus constraint, and it then reclusters its data while incorporating the new constraint. A strategy was also proposed for cleaning the resulting constraint sets, which may contain conflicting constraints; this improves performance significantly. This approach has been applied to collaborative

  20. Galaxy Cluster Smashes Distance Record

    NASA Astrophysics Data System (ADS)

    2009-10-01

    he most distant galaxy cluster yet has been discovered by combining data from NASA's Chandra X-ray Observatory and optical and infrared telescopes. The cluster is located about 10.2 billion light years away, and is observed as it was when the Universe was only about a quarter of its present age. The galaxy cluster, known as JKCS041, beats the previous record holder by about a billion light years. Galaxy clusters are the largest gravitationally bound objects in the Universe. Finding such a large structure at this very early epoch can reveal important information about how the Universe evolved at this crucial stage. JKCS041 is found at the cusp of when scientists think galaxy clusters can exist in the early Universe based on how long it should take for them to assemble. Therefore, studying its characteristics - such as composition, mass, and temperature - will reveal more about how the Universe took shape. "This object is close to the distance limit expected for a galaxy cluster," said Stefano Andreon of the National Institute for Astrophysics (INAF) in Milan, Italy. "We don't think gravity can work fast enough to make galaxy clusters much earlier." Distant galaxy clusters are often detected first with optical and infrared observations that reveal their component galaxies dominated by old, red stars. JKCS041 was originally detected in 2006 in a survey from the United Kingdom Infrared Telescope (UKIRT). The distance to the cluster was then determined from optical and infrared observations from UKIRT, the Canada-France-Hawaii telescope in Hawaii and NASA's Spitzer Space Telescope. Infrared observations are important because the optical light from the galaxies at large distances is shifted into infrared wavelengths because of the expansion of the universe. The Chandra data were the final - but crucial - piece of evidence as they showed that JKCS041 was, indeed, a genuine galaxy cluster. The extended X-ray emission seen by Chandra shows that hot gas has been detected