Science.gov

Sample records for 28s ribosomal dna1

  1. Phylogenetic Analysis of Ruminant Theileria spp. from China Based on 28S Ribosomal RNA Gene

    PubMed Central

    Gou, Huitian; Guan, Guiquan; Ma, Miling; Liu, Aihong; Liu, Zhijie; Xu, Zongke; Ren, Qiaoyun; Li, Youquan; Yang, Jifei; Chen, Ze

    2013-01-01

    Species identification using DNA sequences is the basis for DNA taxonomy. In this study, we sequenced the ribosomal large-subunit RNA gene sequences (3,037-3,061 bp) in length of 13 Chinese Theileria stocks that were infective to cattle and sheep. The complete 28S rRNA gene is relatively difficult to amplify and its conserved region is not important for phylogenetic study. Therefore, we selected the D2-D3 region from the complete 28S rRNA sequences for phylogenetic analysis. Our analyses of 28S rRNA gene sequences showed that the 28S rRNA was useful as a phylogenetic marker for analyzing the relationships among Theileria spp. in ruminants. In addition, the D2-D3 region was a short segment that could be used instead of the whole 28S rRNA sequence during the phylogenetic analysis of Theileria, and it may be an ideal DNA barcode. PMID:24327775

  2. PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences

    PubMed Central

    Machida, Ryuji J.; Knowlton, Nancy

    2012-01-01

    Background Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. Methodology/Principal Findings Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. Conclusions/Significance The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S) and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other marker regions as targets

  3. The sequence of 28S ribosomal RNA varies within and between human cell lines.

    PubMed Central

    Leffers, H; Andersen, A H

    1993-01-01

    The primary structure of 28S ribosomal RNA constitutes a conserved core which is similar among most 23S-like rRNAs and expansion segments which occur at specific positions in the sequence. The expansion segments account for most of the size difference between prokaryotic (archaeal and eubacterial) and eukaryotic rRNAs and they exhibit a sequence variation which is unique among rRNAs. We have investigated the sequence variation of one of the expansion segments, V8, by sequencing a total of 111 V8 segments from 9 different human cell lines and tissues and have found 35 different variants. The variation occur mainly at two 'hot spots' which are separated by 170 nucleotides in the primary sequence but are neighbours in the secondary structure. The sequence of V8 segments varies both within and between human cell lines and tissues. The implications for the evolution of the eukaryotic 28S rRNA are discussed together with possible functions of the expansion segments. We also present a secondary structure model for the V8 segment based on comparative sequence analysis and chemical and enzymatic foot printing. Images PMID:8464736

  4. DISCRIMINATION 28S RIBOSOMAL GENE OF TREMATODE CERCARIAE IN SNAILS FROM CHIANG MAI PROVINCE, THAILAND.

    PubMed

    Wongsawad, Chalobol; Wongsawad, Pheravut; Sukontason, Kom; Phalee, Anawat; Noikong-Phalee, Waraporn; Chai, Jong Yil

    2016-03-01

    Trematode cercariae are commonly found in many freshwater gastropods. These cercariae can serve to identify the occurrence of such trematodes as Centrocestus formosanus, Haplorchis taichui, Haplorchoides sp, and Stellantchasmus falcatus, which are important parasites in Chiang Mai Province, Thailand. As the species of these cercariae cannot be identified accurately based on morphology, this study employed sequencing of a fragment of 28S ribosomal DNA and phylogenetic analysis to identify the trematode cercariae found in freshwater gastropods in Chiang Mai Province. Eight types of trematode cercariae were identified, namely, distome cercaria (grouped with Philophthalmus spp clade), echinostome cercaria (grouped with Echinostoma spp clade), furcocercous cercaria (grouped with Posthodiplostomum sp/Alaria taxideae/Hysteromorpha triloba clade), monostome cercaria (grouped with Catatropis indicus clade), parapleurolophocercous cercaria (grouped with Haplorchoides sp clade), pleurolophocercous cercaria (grouped with Centrocestusformosanus clade), transversotrema cercaria (grouped with Transversotrema spp clade), and xiphidiocercaria (grouped with Prosthodendrium spp clade). These results provide important information that can be used for identifying these parasites in epidemiological surveys. PMID:27244956

  5. Nucleotide sequence neighbouring a late modified guanylic residue within the 28S ribosomal RNA of several eukaryotic cells.

    PubMed Central

    Eladari, M E; Hampe, A; Galibert, F

    1977-01-01

    The nucleotide sequence of a particular T1 oligonucleotide found in 41S and 28S RNAs of several cellular cell lines (human, mouse, rat and chicken fibroblast) but absent in 45S ribosomal RNA has been deduced. Its primary structure : A-U-U*-G*-psi-U-C-A-C-C-C-A-C-U-A-A-U-A-Gp shows the presence of a modified G residue which explains the existence of this oligonucleotide in the T1 fingerprint of 41S RNA and 28S. Its absence on the 45S RNA T1 fingerprint is accounted for by a late modification. Images PMID:561392

  6. Studies on the low molecular weight RNA associated with 28S ribosomal RNA from Crotalus durissus terrificus liver.

    PubMed Central

    Giorgini, J F; De Lucca, F L

    1976-01-01

    A low molecular weight RNA was released from the purified rattlesnake 28 S RNA by brief heat treatment as well as by treatment with 80% dimethylsulfoxide or formamide. The sedimentation coeficient of this low molecular weight RNA was found to be 5.5 S, corresponding to a nucleotide number of 140 and a molecular weight of 46 000. It was also observed that 5.5S RNA is present in equimolar ratio to 5 S rRNA. Heat treatment of the purified 60 S ribosomal subunit also released the 5.5 S RNA. The possibility that this low molecular weight RNA is located on the surface of the large ribosomal subunit is discussed. PMID:1250695

  7. Identification of Dermatophyte Species by 28S Ribosomal DNA Sequencing with a Commercial Kit

    PubMed Central

    Ninet, Béatrice; Jan, Isabelle; Bontems, Olympia; Léchenne, Barbara; Jousson, Olivier; Panizzon, Renato; Lew, Daniel; Monod, Michel

    2003-01-01

    We have shown that dermatophyte species can be easily identified on the basis of a DNA sequence encoding a part of the large-subunit (LSU) rRNA (28S rRNA) by using the MicroSeq D2 LSU rRNA Fungal Sequencing Kit. Two taxa causing distinct dermatophytoses were clearly distinguished among isolates of the Trichophyton mentagrophytes species complex. PMID:12574293

  8. The SBP2 protein central to selenoprotein synthesis contacts the human ribosome at expansion segment 7L of the 28S rRNA.

    PubMed

    Kossinova, Olga; Malygin, Alexey; Krol, Alain; Karpova, Galina

    2014-07-01

    SBP2 is a pivotal protein component in selenoprotein synthesis. It binds the SECIS stem-loop in the 3' UTR of selenoprotein mRNA and interacts with both the specialized translation elongation factor and the ribosome at the 60S subunit. In this work, our goal was to identify the binding partners of SBP2 on the ribosome. Cross-linking experiments with bifunctional reagents demonstrated that the SBP2-binding site on the human ribosome is mainly formed by the 28S rRNA. Direct hydroxyl radical probing of the entire 28S rRNA revealed that SBP2 bound to 80S ribosomes or 60S subunits protects helix ES7L-E in expansion segment 7 of the 28S rRNA. Diepoxybutane cross-linking confirmed the interaction of SBP2 with helix ES7L-E. Additionally, binding of SBP2 to the ribosome led to increased reactivity toward chemical probes of a few bases in ES7L-E and in the universally conserved helix H89, indicative of conformational changes in the 28S rRNA in response to SBP2 binding. This study revealed for the first time that SBP2 makes direct contacts with a discrete region of the human 28S rRNA. PMID:24850884

  9. Proteomic analysis of the mammalian mitochondrial ribosome. Identification of protein components in the 28 S small subunit.

    PubMed

    Suzuki, T; Terasaki, M; Takemoto-Hori, C; Hanada, T; Ueda, T; Wada, A; Watanabe, K

    2001-08-31

    The mammalian mitochondrial ribosome (mitoribosome) has a highly protein-rich composition with a small sedimentation coefficient of 55 S, consisting of 39 S large and 28 S small subunits. In the previous study, we analyzed 39 S large subunit proteins from bovine mitoribosome (Suzuki, T., Terasaki, M., Takemoto-Hori, C., Hanada, T., Ueda, T., Wada, A., and Watanabe, K. (2001) J. Biol. Chem. 276, 21724-21736). The results suggested structural compensation for the rRNA deficit through proteins of increased molecular mass in the mitoribosome. We report here the identification of 28 S small subunit proteins. Each protein was separated by radical-free high-reducing two-dimensional polyacrylamide gel electrophoresis and analyzed by liquid chromatography/mass spectrometry/mass spectrometry using electrospray ionization/ion trap mass spectrometer to identify cDNA sequence by expressed sequence tag data base searches in silico. Twenty one proteins from the small subunit were identified, including 11 new proteins along with their complete cDNA sequences from human and mouse. In addition to these proteins, three new proteins were also identified in the 55 S mitoribosome. We have clearly identified a mitochondrial homologue of S12, which is a key regulatory protein of translation fidelity and a candidate for the autosomal dominant deafness gene, DFNA4. The apoptosis-related protein DAP3 was found to be a component of the small subunit, indicating a new function for the mitoribosome in programmed cell death. In summary, we have mapped a total of 55 proteins from the 55 S mitoribosome on the two-dimensional polyacrylamide gels. PMID:11402041

  10. Integration of Bombyx mori R2 Sequences into the 28S Ribosomal RNA Genes of Drosophila melanogaster

    PubMed Central

    Eickbush, Danna G.; Luan, Dongmei D.; Eickbush, Thomas H.

    2000-01-01

    R2 non-long-terminal-repeat retrotransposable elements integrate into a precise location in the 28S rRNA genes of arthropods. The purified protein encoded by R2 can cleave the 28S gene target site and use the 3′ hydroxyl group generated by this cleavage to prime reverse transcription of its own RNA, a process called target-primed reverse transcription. An integration system is described here in which components from the R2 element of the silkmoth, Bombyx mori, are injected into the preblastoderm embryo of Drosophila melanogaster. Silkmoth R2 sequences were readily detected in the 28S rRNA genes of the surviving adults as well as in the genes of their progeny. The 3′ junctions of these insertions were similar to those seen in our in vitro assays, as well as those from endogenous R2 retrotransposition events. The 5′ junctions of the insertions originally contained major deletions of both R2 and 28S gene sequences, a problem overcome by the inclusion of upstream 28S gene sequences at the 5′ end of the injected RNA. The resulting 5′ junctions suggested a recombination event between the cDNA and the upstream target sequences. This in vivo integration system should help determine the mechanism of R2 retrotransposition and be useful as a delivery system to integrate defined DNA sequences into the rRNA genes of organisms. PMID:10594024

  11. 28S ribosomal RNA sequences separate five prominent Lygus (Hemiptera: Miridae) pest species into three species clusters

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A segment of the nuclear 28S rRNA gene was compared among six species of Lygus (L. hesperus, L. keltoni, L. borealis, L. elisus, L. lineolaris, L. vanduzeei). The DNA sequences separate into three main groups. The LL group contains L. lineolaris and L. vanduzeei. Group LBLE is comprised of L. elisus...

  12. 28S ribosomal RNA sequences separate five prominent Lygus (Hemiptera: Miridae) pest species into three species clu

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A segment of the 28S rRNA gene was compared among six species of Lygus (L. hesperus, L. keltoni, L. borealis, L. elisus, L. lineolaris, L. vanduzeii). The DNA sequences separate into three main groups. The LL group contains L. lineolaris and L. vanduzeii. Group LBLE is comprised of L. elisus and mos...

  13. Phylogenetic Relationships of Tribes Within Harpalinae (Coleoptera: Carabidae) as Inferred from 28S Ribosomal DNA and the Wingless Gene

    PubMed Central

    Ober, Karen A.; Maddison, David R.

    2008-01-01

    Harpalinae is a large, monophyletic subfamily of carabid ground beetles containing more than 19,000 species in approximately 40 tribes. The higher level phylogenetic relationships within harpalines were investigated based on nucleotide data from two nuclear genes, wingless and 28S rDNA. Phylogenetic analyses of combined data indicate that many harpaline tribes are monophyletic, however the reconstructed trees showed little support for deeper nodes. In addition, our results suggest that the Lebiomorph Assemblage (tribes Lebiini, Cyclosomini, Graphipterini, Perigonini, Odacanthini, Lachnophorini, Pentagonicini, Catapiesini and Calophaenini), which is united by a morphological synapomorphy, is not monophyletic, and the tribe Lebiini is paraphyletic with respect to members of Cyclosomini. Two unexpected clades of tribes were supported: the Zuphiitae, comprised of Anthiini, Zuphiini, Helluonini, Dryptini, Galeritini, and Physocrotaphini; and a clade comprised of Orthogoniini, Pseudomorphini, and Graphipterini. The data presented in this study represent a dense sample of taxa to examine the molecular phylogeny of Harpalinae and provide a useful framework to examine the origin and evolution of morphological and ecological diversity in this group. PMID:20302528

  14. Higher-level phylogeny of the Therevidae (Diptera: insecta) based on 28S ribosomal and elongation factor-1 alpha gene sequences.

    PubMed

    Yang, L; Wiegmann, B M; Yeates, D K; Irwin, M E

    2000-06-01

    Therevidae (stilleto flies) are a little-known family of asiloid brachyceran Diptera (Insecta). Separate and combined phylogenetic analyses of 1200 bases of the 28S ribosomal DNA and 1100 bases of elongation factor-1alpha were used to infer phylogenetic relationships within the family. The position of the enigmatic taxon Apsilocephala Kröber is evaluated in light of the molecular evidence. In all analyses, molecular data strongly support the monophyly of Therevidae, excluding Apsilocephala, and the division of Therevidae into two main clades corresponding to a previous classification of the family into the subfamilies Phycinae and Therevinae. Despite strong support for some relationships within these groups, relationships at the base of the two main clades are weakly supported. Short branch lengths for Australasian clades at the base of the Therevinae may represent a rapid radiation of therevids in Australia. PMID:10860652

  15. The Strepsiptera problem: phylogeny of the holometabolous insect orders inferred from 18S and 28S ribosomal DNA sequences and morphology.

    PubMed

    Whiting, M F; Carpenter, J C; Wheeler, Q D; Wheeler, W C

    1997-03-01

    Phylogenetic relationships among the holometabolous insect orders were inferred from cladistic analysis of nucleotide sequences of 18S ribosomal DNA (rDNA) (85 exemplars) and 28S rDNA (52 exemplars) and morphological characters. Exemplar outgroup taxa were Collembola (1 sequence), Archaeognatha (1), Ephemerida (1), Odonata (2), Plecoptera (2), Blattodea (1), Mantodea (1), Dermaptera (1), Orthoptera (1), Phasmatodea (1), Embioptera (1), Psocoptera (1), Phthiraptera (1), Hemiptera (4), and Thysanoptera (1). Exemplar ingroup taxa were Coleoptera: Archostemata (1), Adephaga (2), and Polyphaga (7); Megaloptera (1); Raphidioptera (1); Neuroptera (sensu stricto = Planipennia): Mantispoidea (2), Hemerobioidea (2), and Myrmeleontoidea (2); Hymenoptera: Symphyta (4) and Apocrita (19); Trichoptera: Hydropsychoidea (1) and Limnephiloidea (2); Lepidoptera: Ditrysia (3); Siphonaptera: Pulicoidea (1) and Ceratophylloidea (2); Mecoptera: Meropeidae (1), Boreidae (1), Panorpidae (1), and Bittacidae (2); Diptera: Nematocera (1), Brachycera (2), and Cyclorrhapha (1); and Strepsiptera: Corioxenidae (1), Myrmecolacidae (1), Elenchidae (1), and Stylopidae (3). We analyzed approximately 1 kilobase of 18S rDNA, starting 398 nucleotides downstream of the 5' end, and approximately 400 bp of 28S rDNA in expansion segment D3. Multiple alignment of the 18S and 28S sequences resulted in 1,116 nucleotide positions with 24 insert regions and 398 positions with 14 insert regions, respectively. All Strepsiptera and Neuroptera have large insert regions in 18S and 28S. The secondary structure of 18S insert 23 is composed of long stems that are GC rich in the basal Strepsiptera and AT rich in the more derived Strepsiptera. A matrix of 176 morphological characters was analyzed for holometabolous orders. Incongruence length difference tests indicate that the 28S + morphological data sets are incongruent but that 28S + 18S, 18S + morphology, and 28S + 18S + morphology fail to reject the hypothesis of

  16. Secondary structure and phylogenetic utility of the ribosomal large subunit (28S) in monogeneans of the genus Thaparocleidus and Bifurcohaptor (Monogenea: Dactylogyridae).

    PubMed

    Chaudhary, Anshu; Singh, Hridaya Shanker

    2013-04-01

    Present communication deals with secondary structure of 28S rDNA of two already known species of monogeneans viz., Bifurcohaptor indicus and Thaparocleidus parvulus parasitizing gill filaments of a freshwater fish, Mystus vittatus for phylogenetic inference. Secondary structure data are best used as accessory taxonomic characters as their phylogenetic resolving power and confidence in validity. Secondary structure of the 28S rDNA transcript could provide information for identifying homologous nucleotide characters, useful for cladistic inference of relationships. Such structure data could be used as taxonomic character. The study supports that species-level sequence variability renders 28S sequence as a unique window for examining the behavior of fast evolving, non-coding DNA sequences. Apart from this it also confirms that molecular similarity present in various species could be host-induced. PMID:24431545

  17. Fungal community analysis in the deep-sea sediments of the Pacific Ocean assessed by comparison of ITS, 18S and 28S ribosomal DNA regions

    NASA Astrophysics Data System (ADS)

    Xu, Wei; Luo, Zhu-Hua; Guo, Shuangshuang; Pang, Ka-Lai

    2016-03-01

    We investigated the diversity of fungal communities in 6 different deep-sea sediment samples of the Pacific Ocean based on three different types of clone libraries, including internal transcribed spacer (ITS), 18S rDNA, and 28S rDNA regions. A total of 1978 clones were generated from 18 environmental clone libraries, resulting in 140 fungal operational taxonomic units (OTUs), including 18 OTUs from ITS, 44 OTUs from 18S rDNA, and 78 OTUs from 28S rDNA gene primer sets. The majority of the recovered sequences belonged to diverse phylotypes of the Ascomycota and Basidiomycota. Additionally, our study revealed a total of 46 novel fungal phylotypes, which showed low similarities (<97%) with available fungal sequences in the GenBank, including a novel Zygomycete lineage, suggesting possible new fungal taxa occurring in the deep-sea sediments. The results suggested that 28S rDNA is an efficient target gene to describe fungal community in deep-sea environment.

  18. Phylogenetic relationships of the marine Haplosclerida (Phylum Porifera) employing ribosomal (28S rRNA) and mitochondrial (cox1, nad1) gene sequence data.

    PubMed

    Redmond, Niamh E; Raleigh, Jean; van Soest, Rob W M; Kelly, Michelle; Travers, Simon A A; Bradshaw, Brian; Vartia, Salla; Stephens, Kelly M; McCormack, Grace P

    2011-01-01

    The systematics of the poriferan Order Haplosclerida (Class Demospongiae) has been under scrutiny for a number of years without resolution. Molecular data suggests that the order needs revision at all taxonomic levels. Here, we provide a comprehensive view of the phylogenetic relationships of the marine Haplosclerida using many species from across the order, and three gene regions. Gene trees generated using 28S rRNA, nad1 and cox1 gene data, under maximum likelihood and Bayesian approaches, are highly congruent and suggest the presence of four clades. Clade A is comprised primarily of species of Haliclona and Callyspongia, and clade B is comprised of H. simulans and H. vansoesti (Family Chalinidae), Amphimedon queenslandica (Family Niphatidae) and Tabulocalyx (Family Phloeodictyidae), Clade C is comprised primarily of members of the Families Petrosiidae and Niphatidae, while Clade D is comprised of Aka species. The polyphletic nature of the suborders, families and genera described in other studies is also found here. PMID:21931685

  19. Phylogenetic Relationships of the Marine Haplosclerida (Phylum Porifera) Employing Ribosomal (28S rRNA) and Mitochondrial (cox1, nad1) Gene Sequence Data

    PubMed Central

    Redmond, Niamh E.; Raleigh, Jean; van Soest, Rob W. M.; Kelly, Michelle; Travers, Simon A. A.; Bradshaw, Brian; Vartia, Salla; Stephens, Kelly M.; McCormack, Grace P.

    2011-01-01

    The systematics of the poriferan Order Haplosclerida (Class Demospongiae) has been under scrutiny for a number of years without resolution. Molecular data suggests that the order needs revision at all taxonomic levels. Here, we provide a comprehensive view of the phylogenetic relationships of the marine Haplosclerida using many species from across the order, and three gene regions. Gene trees generated using 28S rRNA, nad1 and cox1 gene data, under maximum likelihood and Bayesian approaches, are highly congruent and suggest the presence of four clades. Clade A is comprised primarily of species of Haliclona and Callyspongia, and clade B is comprised of H. simulans and H. vansoesti (Family Chalinidae), Amphimedon queenslandica (Family Niphatidae) and Tabulocalyx (Family Phloeodictyidae), Clade C is comprised primarily of members of the Families Petrosiidae and Niphatidae, while Clade D is comprised of Aka species. The polyphletic nature of the suborders, families and genera described in other studies is also found here. PMID:21931685

  20. Intragenomic sequence variation at the ITS1 - ITS2 region and at the 18S and 28S nuclear ribosomal DNA genes of the New Zealand mud snail, Potamopyrgus antipodarum (Hydrobiidae: mollusca)

    USGS Publications Warehouse

    Hoy, Marshal S.; Rodriguez, Rusty J.

    2013-01-01

    Molecular genetic analysis was conducted on two populations of the invasive non-native New Zealand mud snail (Potamopyrgus antipodarum), one from a freshwater ecosystem in Devil's Lake (Oregon, USA) and the other from an ecosystem of higher salinity in the Columbia River estuary (Hammond Harbor, Oregon, USA). To elucidate potential genetic differences between the two populations, three segments of nuclear ribosomal DNA (rDNA), the ITS1-ITS2 regions and the 18S and 28S rDNA genes were cloned and sequenced. Variant sequences within each individual were found in all three rDNA segments. Folding models were utilized for secondary structure analysis and results indicated that there were many sequences which contained structure-altering polymorphisms, which suggests they could be nonfunctional pseudogenes. In addition, analysis of molecular variance (AMOVA) was used for hierarchical analysis of genetic variance to estimate variation within and among populations and within individuals. AMOVA revealed significant variation in the ITS region between the populations and among clones within individuals, while in the 5.8S rDNA significant variation was revealed among individuals within the two populations. High levels of intragenomic variation were found in the ITS regions, which are known to be highly variable in many organisms. More interestingly, intragenomic variation was also found in the 18S and 28S rDNA, which has rarely been observed in animals and is so far unreported in Mollusca. We postulate that in these P. antipodarum populations the effects of concerted evolution are diminished due to the fact that not all of the rDNA genes in their polyploid genome should be essential for sustaining cellular function. This could lead to a lessening of selection pressures, allowing mutations to accumulate in some copies, changing them into variant sequences.                   

  1. Molecular Identification of Sibling Species of Sclerodermus (Hymenoptera: Bethylidae) That Parasitize Buprestid and Cerambycid Beetles by Using Partial Sequences of Mitochondrial DNA Cytochrome Oxidase Subunit 1 and 28S Ribosomal RNA Gene

    PubMed Central

    Jiang, Yuan; Yang, Zhongqi; Wang, Xiaoyi; Hou, Yuxia

    2015-01-01

    The species belonging to Sclerodermus (Hymenoptera: Bethylidae) are currently the most important insect natural enemies of wood borer pests, mainly buprestid and cerambycid beetles, in China. However, some sibling species of this genus are very difficult to distinguish because of their similar morphological features. To address this issue, we conducted phylogenetic and genetic analyses of cytochrome oxidase subunit I (COI) and 28S RNA gene sequences from eight species of Sclerodermus reared from different wood borer pests. The eight sibling species were as follows: S. guani Xiao et Wu, S. sichuanensis Xiao, S. pupariae Yang et Yao, and Sclerodermus spp. (Nos. 1–5). A 594-bp fragment of COI and 750-bp fragment of 28S were subsequently sequenced. For COI, the G-C content was found to be low in all the species, averaging to about 30.0%. Sequence divergences (Kimura-2-parameter distances) between congeneric species averaged to 4.5%, and intraspecific divergences averaged to about 0.09%. Further, the maximum sequence divergences between congeneric species and Sclerodermus sp. (No. 5) averaged to about 16.5%. All 136 samples analyzed were included in six reciprocally monophyletic clades in the COI neighbor-joining (NJ) tree. The NJ tree inferred from the 28S rRNA sequence yielded almost identical results, but the samples from S. guani, S. sichuanensis, S. pupariae, and Sclerodermus spp. (Nos. 1–4) clustered together and only Sclerodermus sp. (No. 5) clustered separately. Our findings indicate that the standard barcode region of COI can be efficiently used to distinguish morphologically similar Sclerodermus species. Further, we speculate that Sclerodermus sp. (No. 5) might be a new species of Sclerodermus. PMID:25782000

  2. Reconstruction of phylogenetic relationships in dermatomycete genus Trichophyton Malmsten 1848 based on ribosomal internal transcribed spacer region, partial 28S rRNA and beta-tubulin genes sequences.

    PubMed

    Pchelin, Ivan M; Zlatogursky, Vasily V; Rudneva, Mariya V; Chilina, Galina A; Rezaei-Matehkolaei, Ali; Lavnikevich, Dmitry M; Vasilyeva, Natalya V; Taraskina, Anastasia E

    2016-09-01

    Trichophyton spp. are important causative agents of superficial mycoses. The phylogeny of the genus and accurate strain identification, based on the ribosomal ITS region sequencing, are still under development. The present work is aimed at (i) inferring the genus phylogeny from partial ITS, LSU and BT2 sequences (ii) description of ribosomal ITS region polymorphism in 15 strains of Trichophyton interdigitale. We performed DNA sequence-based species identification and phylogenetic analysis on 48 strains belonging to the genus Trichophyton. Phylogenetic relationships were inferred by maximum likelihood and Bayesian methods on concatenated ITS, LSU and BT2 sequences. Ribosomal ITS region polymorphisms were assessed directly on the alignment. By phylogenetic reconstruction, we reveal major anthropophilic and zoophilic species clusters in the genus Trichophyton. We describe several sequences of the ITS region of T. interdigitale, which do not fit in the traditional polymorphism scheme and propose emendations in this scheme for discrimination between ITS sequence types in T. interdigitale. The new polymorphism scheme will allow inclusion of a wider spectrum of isolates while retaining its explanatory power. This scheme was also found to be partially congruent with NTS typing technique. PMID:27071492

  3. Ribosome-inactivating proteins

    PubMed Central

    Walsh, Matthew J; Dodd, Jennifer E; Hautbergue, Guillaume M

    2013-01-01

    Ribosome-inactivating proteins (RIPs) were first isolated over a century ago and have been shown to be catalytic toxins that irreversibly inactivate protein synthesis. Elucidation of atomic structures and molecular mechanism has revealed these proteins to be a diverse group subdivided into two classes. RIPs have been shown to exhibit RNA N-glycosidase activity and depurinate the 28S rRNA of the eukaryotic 60S ribosomal subunit. In this review, we compare archetypal RIP family members with other potent toxins that abolish protein synthesis: the fungal ribotoxins which directly cleave the 28S rRNA and the newly discovered Burkholderia lethal factor 1 (BLF1). BLF1 presents additional challenges to the current classification system since, like the ribotoxins, it does not possess RNA N-glycosidase activity but does irreversibly inactivate ribosomes. We further discuss whether the RIP classification should be broadened to include toxins achieving irreversible ribosome inactivation with similar turnovers to RIPs, but through different enzymatic mechanisms. PMID:24071927

  4. Fine mapping of 28S rRNA sites specifically cleaved in cells undergoing apoptosis.

    PubMed Central

    Houge, G; Robaye, B; Eikhom, T S; Golstein, J; Mellgren, G; Gjertsen, B T; Lanotte, M; Døskeland, S O

    1995-01-01

    Bona fide apoptosis in rat and human leukemia cells, rat thymocytes, and bovine endothelial cells was accompanied by limited and specific cleavage of polysome-associated and monosome-associated 28S rRNA, with 18S rRNA being spared. Specific 28S rRNA cleavage was observed in all instances of apoptotic death accompanied by internucleosomal DNA fragmentation, with cleavage of 28S rRNA and of DNA being linked temporally. This indicates that 28S rRNA fragmentation may be as general a feature of apoptosis as internucleosomal DNA fragmentation and that concerted specific cleavage of intra- and extranuclear polynucleotides occurs in apoptosis. Apoptosis-associated cleavage sites were mapped to the 28S rRNA divergent domains D2, D6 (endothelial cells), and D8. The D2 cuts occurred in hairpin loop junctions considered to be buried in the intact ribosome, suggesting that this rRNA region becomes a target for RNase attack in apoptotic cells. D8 was cleaved in two exposed UU(U) sequences in bulge loops. Treatment with agents causing necrotic cell death or aging of cell lysates failed to produce any detectable limited D2 cleavage but did produce a more generalized cleavage in the D8 region. Of potential functional interest was the finding that the primary cuts in D2 exactly flanked a 0.3-kb hypervariable subdomain (D2c), allowing excision of the latter. The implication of hypervariable rRNA domains in apoptosis represents the first association of any functional process with these enigmatic parts of the ribosomes. PMID:7891700

  5. Ribosomal proteins: functions beyond the ribosome

    PubMed Central

    Zhou, Xiang; Liao, Wen-Juan; Liao, Jun-Ming; Liao, Peng; Lu, Hua

    2015-01-01

    Although ribosomal proteins are known for playing an essential role in ribosome assembly and protein translation, their ribosome-independent functions have also been greatly appreciated. Over the past decade, more than a dozen of ribosomal proteins have been found to activate the tumor suppressor p53 pathway in response to ribosomal stress. In addition, these ribosomal proteins are involved in various physiological and pathological processes. This review is composed to overview the current understanding of how ribosomal stress provokes the accumulation of ribosome-free ribosomal proteins, as well as the ribosome-independent functions of ribosomal proteins in tumorigenesis, immune signaling, and development. We also propose the potential of applying these pieces of knowledge to the development of ribosomal stress-based cancer therapeutics. PMID:25735597

  6. Nearly complete 28S rRNA gene sequences confirm new hypotheses of sponge evolution.

    PubMed

    Thacker, Robert W; Hill, April L; Hill, Malcolm S; Redmond, Niamh E; Collins, Allen G; Morrow, Christine C; Spicer, Lori; Carmack, Cheryl A; Zappe, Megan E; Pohlmann, Deborah; Hall, Chelsea; Diaz, Maria C; Bangalore, Purushotham V

    2013-09-01

    The highly collaborative research sponsored by the NSF-funded Assembling the Porifera Tree of Life (PorToL) project is providing insights into some of the most difficult questions in metazoan systematics. Our understanding of phylogenetic relationships within the phylum Porifera has changed considerably with increased taxon sampling and data from additional molecular markers. PorToL researchers have falsified earlier phylogenetic hypotheses, discovered novel phylogenetic alliances, found phylogenetic homes for enigmatic taxa, and provided a more precise understanding of the evolution of skeletal features, secondary metabolites, body organization, and symbioses. Some of these exciting new discoveries are shared in the papers that form this issue of Integrative and Comparative Biology. Our analyses of over 300 nearly complete 28S ribosomal subunit gene sequences provide specific case studies that illustrate how our dataset confirms new hypotheses of sponge evolution. We recovered monophyletic clades for all 4 classes of sponges, as well as the 4 major clades of Demospongiae (Keratosa, Myxospongiae, Haploscleromorpha, and Heteroscleromorpha), but our phylogeny differs in several aspects from traditional classifications. In most major clades of sponges, families within orders appear to be paraphyletic. Although additional sampling of genes and taxa are needed to establish whether this pattern results from a lack of phylogenetic resolution or from a paraphyletic classification system, many of our results are congruent with those obtained from 18S ribosomal subunit gene sequences and complete mitochondrial genomes. These data provide further support for a revision of the traditional classification of sponges. PMID:23748742

  7. Nearly Complete 28S rRNA Gene Sequences Confirm New Hypotheses of Sponge Evolution

    PubMed Central

    Thacker, Robert W.; Hill, April L.; Hill, Malcolm S.; Redmond, Niamh E.; Collins, Allen G.; Morrow, Christine C.; Spicer, Lori; Carmack, Cheryl A.; Zappe, Megan E.; Pohlmann, Deborah; Hall, Chelsea; Diaz, Maria C.; Bangalore, Purushotham V.

    2013-01-01

    The highly collaborative research sponsored by the NSF-funded Assembling the Porifera Tree of Life (PorToL) project is providing insights into some of the most difficult questions in metazoan systematics. Our understanding of phylogenetic relationships within the phylum Porifera has changed considerably with increased taxon sampling and data from additional molecular markers. PorToL researchers have falsified earlier phylogenetic hypotheses, discovered novel phylogenetic alliances, found phylogenetic homes for enigmatic taxa, and provided a more precise understanding of the evolution of skeletal features, secondary metabolites, body organization, and symbioses. Some of these exciting new discoveries are shared in the papers that form this issue of Integrative and Comparative Biology. Our analyses of over 300 nearly complete 28S ribosomal subunit gene sequences provide specific case studies that illustrate how our dataset confirms new hypotheses of sponge evolution. We recovered monophyletic clades for all 4 classes of sponges, as well as the 4 major clades of Demospongiae (Keratosa, Myxospongiae, Haploscleromorpha, and Heteroscleromorpha), but our phylogeny differs in several aspects from traditional classifications. In most major clades of sponges, families within orders appear to be paraphyletic. Although additional sampling of genes and taxa are needed to establish whether this pattern results from a lack of phylogenetic resolution or from a paraphyletic classification system, many of our results are congruent with those obtained from 18S ribosomal subunit gene sequences and complete mitochondrial genomes. These data provide further support for a revision of the traditional classification of sponges. PMID:23748742

  8. 28s rDNA group-I introns: a powerful tool for identifying strains of Beauveria brongniartii.

    PubMed

    Neuvéglise, C; Brygoo, Y; Riba, G

    1997-04-01

    The nuclear ribosomal DNA of the entomopathogenic fungus Beauveria brongniartii is polymorphic in terms of both restriction site and length. Insertions of 350-450 bp long, identified as group-I introns, were detected in the 28s rDNA. A panel of 47 strains of B. brongniartii, two B. bassiana and one Metarhizium anisopliae of various geographical and biological origins were found to contain 14 variant forms of intron differing in size and restriction pattern, at four different positions. Twelve types of ribosomal large subunit were defined on the basis of variant distribution and compared with strain clustering based on internal transcribed spacers analysis. There was a correlation between the characteristic introns and isolates collected from the sugar cane pest Hoplochelus marginalis. Primers for polymerase chain reaction amplification were chosen from these variants, and used to develop a specific method for detecting strains pathogenic towards Hoplochelus. PMID:9131812

  9. Modification of ribosomal RNA by ribosome-inactivating proteins from plants.

    PubMed Central

    Stirpe, F; Bailey, S; Miller, S P; Bodley, J W

    1988-01-01

    We have surveyed 14 different toxic and nontoxic ribosome-inactivating proteins from plants for the ability to act on the RNA of the eucaryotic 60 S ribosomal subunit. All of these proteins act to introduce a specific modification into 26-28 S RNA which renders the RNA sensitive to cleavage by aniline. Sequence analysis of the 5'-termini of the fragments produced by ricin and saporin following aniline cleavage indicate that both proteins possess identical specificity. Our observations support the conclusion of Endo and Tsurugi (J. Biol. Chem. 262, 8128-8130, 1987) that ricin is a specific N-glycosidase and we have located the site of this cleavage by direct sequence analysis. Our results further suggest that all plant ribosome-inactivating proteins function as specific N-glycosidases with the same specificity. Images PMID:3347493

  10. Structures of Eukaryotic Ribosomal Stalk Proteins and Its Complex with Trichosanthin, and Their Implications in Recruiting Ribosome-Inactivating Proteins to the Ribosomes

    PubMed Central

    Choi, Andrew K. H.; Wong, Eddie C. K.; Lee, Ka-Ming; Wong, Kam-Bo

    2015-01-01

    Ribosome-inactivating proteins (RIP) are RNA N-glycosidases that inactivate ribosomes by specifically depurinating a conserved adenine residue at the α-sarcin/ricin loop of 28S rRNA. Recent studies have pointed to the involvement of the C-terminal domain of the eukaryotic stalk proteins in facilitating the toxic action of RIPs. This review highlights how structural studies of eukaryotic stalk proteins provide insights into the recruitment of RIPs to the ribosomes. Since the C-terminal domain of eukaryotic stalk proteins is involved in specific recognition of elongation factors and some eukaryote-specific RIPs (e.g., trichosanthin and ricin), we postulate that these RIPs may have evolved to hijack the translation-factor-recruiting function of ribosomal stalk in reaching their target site of rRNA. PMID:25723321

  11. The ribosome filter redux.

    PubMed

    Mauro, Vincent P; Edelman, Gerald M

    2007-09-15

    The ribosome filter hypothesis postulates that ribosomes are not simply translation machines but also function as regulatory elements that differentially affect or filter the translation of particular mRNAs. On the basis of new information, we take the opportunity here to review the ribosome filter hypothesis, suggest specific mechanisms of action, and discuss recent examples from the literature that support it. PMID:17890902

  12. Deconstructing ribosome construction

    PubMed Central

    Connolly, Keith; Culver, Gloria

    2013-01-01

    The ribosome is an essential ribonucleoprotein enzyme, and its biogenesis is a fundamental process in all living cells. Recent X-ray crystal structures of the bacterial ribosome and new technologies have allowed a greater interrogation of in vitro ribosome assembly; however, substantially less is known about ribosome biogenesis in vivo. Ongoing investigations are focused on elucidating the cellular processes that facilitate biogenesis of the ribosomal subunits, and many extraribosomal factors, including modification enzymes, remodeling enzymes and GTPases, are being uncovered. Moreover, specific roles for ribosome biogenesis factors in subunit maturation are now being elaborated. Ultimately, such studies will reveal a more complete understanding of processes at work in in vivo ribosome biogenesis. PMID:19376708

  13. Ribosomal RNA analysis in the diagnosis of Diamond-Blackfan Anaemia.

    PubMed

    Quarello, Paola; Garelli, Emanuela; Carando, Adriana; Mancini, Cecilia; Foglia, Luiselda; Botto, Carlotta; Farruggia, Piero; De Keersmaecker, Kim; Aspesi, Anna; Ellis, Steve R; Dianzani, Irma; Ramenghi, Ugo

    2016-03-01

    Diamond-Blackfan anaemia (DBA) is an inherited disease characterized by pure erythroid aplasia that has been tagged as a 'ribosomopathy'. We report a multi-centre study focused on the analysis of rRNA processing of 53 Italian DBA patients using capillary electrophoresis analysis of rRNA maturation of the 40S and 60S ribosomal subunits. The ratio of 28S/18S rRNA was higher in patients with mutated ribosomal proteins (RPs) of the small ribosomal subunit. In contrast, patients with mutated RPs of the large ribosomal subunit (RPLs) had a lower 28S/18S ratio. The assay reported here would be amenable for development as a diagnostic tool. PMID:26763766

  14. Ribosome. The complete structure of the 55S mammalian mitochondrial ribosome.

    PubMed

    Greber, Basil J; Bieri, Philipp; Leibundgut, Marc; Leitner, Alexander; Aebersold, Ruedi; Boehringer, Daniel; Ban, Nenad

    2015-04-17

    Mammalian mitochondrial ribosomes (mitoribosomes) synthesize mitochondrially encoded membrane proteins that are critical for mitochondrial function. Here we present the complete atomic structure of the porcine 55S mitoribosome at 3.8 angstrom resolution by cryo-electron microscopy and chemical cross-linking/mass spectrometry. The structure of the 28S subunit in the complex was resolved at 3.6 angstrom resolution by focused alignment, which allowed building of a detailed atomic structure including all of its 15 mitoribosomal-specific proteins. The structure reveals the intersubunit contacts in the 55S mitoribosome, the molecular architecture of the mitoribosomal messenger RNA (mRNA) binding channel and its interaction with transfer RNAs, and provides insight into the highly specialized mechanism of mRNA recruitment to the 28S subunit. Furthermore, the structure contributes to a mechanistic understanding of aminoglycoside ototoxicity. PMID:25837512

  15. Effect of alpha-sarcin and ribosome-inactivating proteins on the interaction of elongation factors with ribosomes.

    PubMed

    Brigotti, M; Rambelli, F; Zamboni, M; Montanaro, L; Sperti, S

    1989-02-01

    alpha-Sarcin from Aspergillus giganteus and the ribosome-inactivating proteins (RIPs) from higher plants inactivate the 60 S ribosomal subunit. The former is an RNAase, whereas RIPs are N-glycosidases. The site of cleavage of RNA and that of N-glycosidic depurinization are at one nucleotide distance in 28 S rRNA [Endo & Tsurugi (1987) J. Biol. Chem. 262, 8128-8130]. The effect of alpha-sarcin and that of RIPs on the interaction of elongation factors with Artemia salina (brine shrimp) ribosomes have been investigated. alpha-Sarcin inhibits both the EF1 (elongation factor 1)-dependent binding of aminoacyl-tRNA and the GTP-dependent binding of EF2 (elongation factor 2) to ribosomes, whereas two of the RIPs tested, ricin from Ricinus communis (castor bean) and volkensin from Adenia volkensii (kilyambiti), inhibit only the latter reaction. EF2 protects ribosomes from inactivation by both alpha-sarcin and ricin. The EF1-binding site is affected only by alpha-sarcin. The sensitivity of this site to alpha-sarcin is increased by pretreatment of ribosomes with ricin. A. salina ribosomes were highly resistant to the third RIP tested, namely gelonin from Gelonium multiflorum. All four proteins tested have, however, a comparable activity on the rabbit reticulocyte-lysate system. PMID:2930482

  16. The ribosomal database project.

    PubMed Central

    Larsen, N; Olsen, G J; Maidak, B L; McCaughey, M J; Overbeek, R; Macke, T J; Marsh, T L; Woese, C R

    1993-01-01

    The Ribosomal Database Project (RDP) is a curated database that offers ribosome data along with related programs and services. The offerings include phylogenetically ordered alignments of ribosomal RNA (rRNA) sequences, derived phylogenetic trees, rRNA secondary structure diagrams and various software packages for handling, analyzing and displaying alignments and trees. The data are available via ftp and electronic mail. Certain analytic services are also provided by the electronic mail server. PMID:8332524

  17. The Ribosomal Database Project.

    PubMed Central

    Maidak, B L; Larsen, N; McCaughey, M J; Overbeek, R; Olsen, G J; Fogel, K; Blandy, J; Woese, C R

    1994-01-01

    The Ribosomal Database Project (RDP) is a curated database that offers ribosome-related data, analysis services, and associated computer programs. The offerings include phylogenetically ordered alignments of ribosomal RNA (rRNA) sequences, derived phylogenetic trees, rRNA secondary structure diagrams, and various software for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (rdp.life.uiuc.edu), electronic mail (server/rdp.life.uiuc.edu) and gopher (rdpgopher.life.uiuc.edu). The electronic mail server also provides ribosomal probe checking, approximate phylogenetic placement of user-submitted sequences, screening for chimeric nature of newly sequenced rRNAs, and automated alignment. PMID:7524021

  18. Identification of group-I introns in the 28s rDNA of the entomopathogenic fungus Beauveria brongniartii.

    PubMed

    Neuvéglise, C; Brygoo, Y

    1994-12-01

    The length of the 28s ribosomal DNA differs significantly between two strains (Bt102 and Bt114) of the entomopathogenic fungus Beauveria brongniartii. RFLP analysis on PCR products revealed the presence of three insertional elements of 350-450 bp in strain Bt114. One of the insertions has been cloned and sequenced and shown to possess all the characteristic sequences and secondary structures of a group-IC intron. Its length is 428 bp and it is devoid of any long open reading frame. The distribution of this intron elsewhere in the genome of Bt114, as well as in the chromosomal ribosomal DNA, was studied. It seems to be present as seven copies in different genes not corresponding to the mitochondrial DNA. The presence of the intron in other strains of B. brongniartii was examined by the hybridization method. Some of them seemed to possess introns with a similar core although others presented no homology with the cloned fragment. PMID:7750145

  19. The Ribosomal Database Project

    PubMed Central

    Olsen, Gary J.; Overbeek, Ross; Larsen, Niels; Marsh, Terry L.; McCaughey, Michael J.; Maciukenas, Michael A.; Kuan, Wen-Min; Macke, Thomas J.; Xing, Yuqing; Woese, Carl R.

    1992-01-01

    The Ribosomal Database Project (RDP) compiles ribosomal sequences and related data, and redistributes them in aligned and phylogenetically ordered form to its user community. It also offers various software packages for handling, analyzing and displaying sequences. In addition, the RDP offers (or will offer) certain analytic services. At present the project is in an intermediate stage of development. PMID:1598241

  20. Precursor ribosomal ribonucleic acid and ribosome accumulation in vivo during the recovery of Salmonella typhimurium from thermal injury.

    PubMed

    Tomlins, R I; Ordal, Z J

    1971-07-01

    When cells of S. typhimurium were heated at 48 C for 30 min in phosphate buffer (pH 6.0), they became sensitive to Levine Eosin Methylene Blue Agar containing 2% NaCl (EMB-NaCl). The inoculation of injured cells into fresh growth medium supported the return of their normal tolerance to EMB-NaCl within 6 hr. The fractionation of ribosomal ribonucleic acid (rRNA) from unheated and heat-injured cells by polyacrylamide gel electrophoresis demonstrated that after injury the 16S RNA species was totally degraded and the 23S RNA was partially degraded. Sucrose gradient analysis demonstrated that after injury the 30S ribosomal subunit was totally destroyed and the sedimentation coefficient of the 50S particle was decreased to 47S. During the recovery of cells from thermal injury, four species of rRNA accumulated which were demonstrated to have the following sedimentation coefficients: 16, 17, 23, and 24S. Under identical recovery conditions, 22, 26, and 28S precursors of the 30S ribosomal subunit and 31 and 48S precursors of the 50S ribosomal subunit accumulated along with both the 30 and 50S mature particles. The addition of chloramphenicol to the recovery medium inhibited both the maturation of 17S RNA and the production of mature 30S ribosomal subunits, but permitted the accumulation of a single 22S precursor particle. Chloramphenicol did not affect either the maturation of 24S RNA or the mechanism of formation of 50S ribosomal subunits during recovery. Very little old ribosomal protein was associated with the new rRNA synthesized during recovery. New ribosomal proteins were synthesized during recovery and they were found associated with the new rRNA in ribosomal particles. The rate-limiting step in the recovery of S. typhimurium from thermal injury was in the maturation of the newly synthesized rRNA. PMID:4935315

  1. When ribosomes go bad: diseases of ribosome biogenesis

    PubMed Central

    Freed, Emily F.; Bleichert, Franziska; Dutca, Laura M.; Baserga, Susan J.

    2010-01-01

    Ribosomes are vital for cell growth and survival. Until recently, it was believed that mutations in ribosomes or ribosome biogenesis factors would be lethal, due to the essential nature of these complexes. However, in the last few decades, a number of diseases of ribosome biogenesis have been discovered. It remains a challenge in the field to elucidate the molecular mechanisms underlying them. PMID:20174677

  2. The ribosomal subunit assembly line

    PubMed Central

    Dlakić, Mensur

    2005-01-01

    Recent proteomic studies in Saccharomyces cerevisiae have identified nearly 200 proteins, other than the structural ribosomal proteins, that participate in the assembly of ribosomal subunits and their transport from the nucleus. In a separate line of research, proteomic studies of mature plant ribosomes have revealed considerable variability in the protein composition of individual ribosomes. PMID:16207363

  3. The ribosome returned

    PubMed Central

    Moore, Peter B

    2009-01-01

    Since the mid-1990s, insights obtained from electron microscopy and X-ray crystallography have transformed our understanding of how the most important ribozyme in the cell, the ribosome, catalyzes protein synthesis. This review provides a brief account of how this structural revolution came to pass, and the impact it has had on our understanding of how the ribosome decodes messenger RNAs. PMID:19222865

  4. Ribosome-omics of the human ribosome

    PubMed Central

    Gupta, Varun; Warner, Jonathan R.

    2014-01-01

    The torrent of RNA-seq data becoming available not only furnishes an overview of the entire transcriptome but also provides tools to focus on specific areas of interest. Our focus on the synthesis of ribosomes asked whether the abundance of mRNAs encoding ribosomal proteins (RPs) matched the equimolar need for the RPs in the assembly of ribosomes. We were at first surprised to find, in the mapping data of ENCODE and other sources, that there were nearly 100-fold differences in the level of the mRNAs encoding the different RPs. However, after correcting for the mapping ambiguities introduced by the presence of more than 2000 pseudogenes derived from RP mRNAs, we show that for 80%–90% of the RP genes, the molar ratio of mRNAs varies less than threefold, with little tissue specificity. Nevertheless, since the RPs are needed in equimolar amounts, there must be sluggish or regulated translation of the more abundant RP mRNAs and/or substantial turnover of unused RPs. In addition, seven of the RPs have subsidiary genes, three of which are pseudogenes that have been “rescued” by the introduction of promoters and/or upstream introns. Several of these are transcribed in a tissue-specific manner, e.g., RPL10L in testis and RPL3L in muscle, leading to potential variation in ribosome structure from one tissue to another. Of the 376 introns in the RP genes, a single one is alternatively spliced in a tissue-specific manner. PMID:24860015

  5. Paradigms of ribosome synthesis: Lessons learned from ribosomal proteins

    PubMed Central

    Gamalinda, Michael; Woolford, John L

    2015-01-01

    The proteome in all cells is manufactured via the intricate process of translation by multimolecular factories called ribosomes. Nevertheless, these ribonucleoprotein particles, the largest of their kind, also have an elaborate assembly line of their own. Groundbreaking discoveries that bacterial ribosomal subunits can be self-assembled in vitro jumpstarted studies on how ribosomes are constructed. Until recently, ribosome assembly has been investigated almost entirely in vitro with bacterial small subunits under equilibrium conditions. In light of high-resolution ribosome structures and a more sophisticated toolkit, the past decade has been defined by a burst of kinetic studies in vitro and, importantly, also a shift to examining ribosome maturation in living cells, especially in eukaryotes. In this review, we summarize the principles governing ribosome assembly that emerged from studies focusing on ribosomal proteins and their interactions with rRNA. Understanding these paradigms has taken center stage, given the linkage between anomalous ribosome biogenesis and proliferative disorders. PMID:26779413

  6. Cinnamomin: a multifunctional type II ribosome-inactivating protein.

    PubMed

    He, Wen-Jun; Liu, Wang-Yi

    2003-07-01

    Plant ribosome-inactivating proteins (RIPs) are a group of toxic proteins that can irreversibly inactivate ribosomes by specifically removing the conserved adenine base from the "Sarcin/Ricin domain" of the 28S RNA in ribosome. Cinnamomin is a novel type II RIP isolated in our laboratory from the mature seeds of camphor tree. Besides site-specific deadenylation of the A4324 in the Sarcin/Ricin domain of rat ribosome, this protein could also release the adenine base from DNA molecules at multiple sites and from AMP, ADP, dAMP and adenosine. Furthermore, cinnamomin displays cytotoxicity to carcinoma cells and insect larvae by modifying their ribosomal RNA. These functions possessed by cinnamomin shed a new light on the possible application of cinnamomin in the field of immunotoxin design and transgenic reagents. In this review, we introduce the major recent results on cinnamomin obtained in our laboratory, including purification of this protein, characterization of its enzymatic mechanism, structure and function, gene pattern, physiological role and its biological implications in cytotoxicity. PMID:12672471

  7. A tRNA methyltransferase paralog is important for ribosome stability and cell division in Trypanosoma brucei.

    PubMed

    Fleming, Ian M C; Paris, Zdeněk; Gaston, Kirk W; Balakrishnan, R; Fredrick, Kurt; Rubio, Mary Anne T; Alfonzo, Juan D

    2016-01-01

    Most eukaryotic ribosomes contain 26/28S, 5S, and 5.8S large subunit ribosomal RNAs (LSU rRNAs) in addition to the 18S rRNA of the small subunit (SSU rRNA). However, in kinetoplastids, a group of organisms that include medically important members of the genus Trypanosoma and Leishmania, the 26/28S large subunit ribosomal RNA is uniquely composed of 6 rRNA fragments. In addition, recent studies have shown the presence of expansion segments in the large ribosomal subunit (60S) of Trypanosoma brucei. Given these differences in structure, processing and assembly, T. brucei ribosomes may require biogenesis factors not found in other organisms. Here, we show that one of two putative 3-methylcytidine methyltransferases, TbMTase37 (a homolog of human methyltransferase-like 6, METTL6), is important for ribosome stability in T. brucei. TbMTase37 localizes to the nucleolus and depletion of the protein results in accumulation of ribosomal particles lacking srRNA 4 and reduced levels of polysome associated ribosomes. We also find that TbMTase37 plays a role in cytokinesis, as loss of the protein leads to multi-flagellated and multi-nucleated cells. PMID:26888608

  8. A tRNA methyltransferase paralog is important for ribosome stability and cell division in Trypanosoma brucei

    PubMed Central

    Fleming, Ian M. C.; Paris, Zdeněk; Gaston, Kirk W.; Balakrishnan, R.; Fredrick, Kurt; Rubio, Mary Anne T.; Alfonzo, Juan D.

    2016-01-01

    Most eukaryotic ribosomes contain 26/28S, 5S, and 5.8S large subunit ribosomal RNAs (LSU rRNAs) in addition to the 18S rRNA of the small subunit (SSU rRNA). However, in kinetoplastids, a group of organisms that include medically important members of the genus Trypanosoma and Leishmania, the 26/28S large subunit ribosomal RNA is uniquely composed of 6 rRNA fragments. In addition, recent studies have shown the presence of expansion segments in the large ribosomal subunit (60S) of Trypanosoma brucei. Given these differences in structure, processing and assembly, T. brucei ribosomes may require biogenesis factors not found in other organisms. Here, we show that one of two putative 3-methylcytidine methyltransferases, TbMTase37 (a homolog of human methyltransferase-like 6, METTL6), is important for ribosome stability in T. brucei. TbMTase37 localizes to the nucleolus and depletion of the protein results in accumulation of ribosomal particles lacking srRNA 4 and reduced levels of polysome associated ribosomes. We also find that TbMTase37 plays a role in cytokinesis, as loss of the protein leads to multi-flagellated and multi-nucleated cells. PMID:26888608

  9. Crystallography of ribosomal particles

    NASA Astrophysics Data System (ADS)

    Yonath, A.; Frolow, F.; Shoham, M.; Müssig, J.; Makowski, I.; Glotz, C.; Jahn, W.; Weinstein, S.; Wittmann, H. G.

    1988-07-01

    Several forms of three-dimensional crystals and two-dimensional sheets of intact ribosomes and their subunits have been obtained as a result of: (a) an extensive systematic investigation of the parameters involved in crystallization, (b) a development of an experimental procedure for controlling the volumes of the crystallization droplets, (c) a study of the nucleation process, and (d) introducing a delicate seeding procedure coupled with variations in the ratios of mono- and divalent ions in the crystallization medium. In all cases only biologically active particles could be crystallized, and the crystalline material retains its integrity and activity. Crystallographic data have been collected from crystals of 50S ribosomal subunits, using synchrotron radiation at temperatures between + 19 and - 180°C. Although at 4°C the higher resolution reflections decay within minutes in the synchrotron beam, at cryo-temperature there was hardly any radiation damage, and a complete set of data to about 6Åresolution could be collected from a single crystal. Heavy-atom clusters were used for soaking as well as for specific binding to the surface of the ribosomal subunits prior to crystallization. The 50S ribosomal subunits from a mutant of B. stearothermophilus which lacks the ribosomal protein BL11 crystallize isomorphously with in the native ones. Models, aimed to be used for low resolution phasing, have been reconstructed from two-dimensional sheets of 70S ribosomes and 50S subunits at 47 and 30Å, respectively. These models show the overall structure of these particles, the contact areas between the large and small subunits, the space where protein synthesis might take place and a tunnel which may provide the path for the nascent protein chain.

  10. The Ribosome Comes Alive

    PubMed Central

    2010-01-01

    This essay is a reflection on the ways the X-ray structures of the ribosome are helping in the interpretation of cryogenic electron microscopy (cryo-EM) density maps showing the translating ribosome in motion. Through advances in classification methods, cryo-EM and single-particle reconstruction methods have recently evolved to the point where they can yield an array of structures from a single sample (“story in a sample”), providing snapshots of an entire subprocess of translation, such as translocation or decoding. PMID:21072331

  11. The Ribosome Comes Alive.

    PubMed

    Frank, Joachim

    2010-06-18

    This essay is a reflection on the ways the X-ray structures of the ribosome are helping in the interpretation of cryogenic electron microscopy (cryo-EM) density maps showing the translating ribosome in motion. Through advances in classification methods, cryo-EM and single-particle reconstruction methods have recently evolved to the point where they can yield an array of structures from a single sample ("story in a sample"), providing snapshots of an entire subprocess of translation, such as translocation or decoding. PMID:21072331

  12. A ribosome-inactivating protein in a Drosophila defensive symbiont.

    PubMed

    Hamilton, Phineas T; Peng, Fangni; Boulanger, Martin J; Perlman, Steve J

    2016-01-12

    Vertically transmitted symbionts that protect their hosts against parasites and pathogens are well known from insects, yet the underlying mechanisms of symbiont-mediated defense are largely unclear. A striking example of an ecologically important defensive symbiosis involves the woodland fly Drosophila neotestacea, which is protected by the bacterial endosymbiont Spiroplasma when parasitized by the nematode Howardula aoronymphium. The benefit of this defense strategy has led to the rapid spread of Spiroplasma throughout the range of D. neotestacea, although the molecular basis for this protection has been unresolved. Here, we show that Spiroplasma encodes a ribosome-inactivating protein (RIP) related to Shiga-like toxins from enterohemorrhagic Escherichia coli and that Howardula ribosomal RNA (rRNA) is depurinated during Spiroplasma-mediated protection of D. neotestacea. First, we show that recombinant Spiroplasma RIP catalyzes depurination of 28S rRNAs in a cell-free assay, as well as Howardula rRNA in vitro at the canonical RIP target site within the α-sarcin/ricin loop (SRL) of 28S rRNA. We then show that Howardula parasites in Spiroplasma-infected flies show a strong signal of rRNA depurination consistent with RIP-dependent modification and large decreases in the proportion of 28S rRNA intact at the α-sarcin/ricin loop. Notably, host 28S rRNA is largely unaffected, suggesting targeted specificity. Collectively, our study identifies a novel RIP in an insect defensive symbiont and suggests an underlying RIP-dependent mechanism in Spiroplasma-mediated defense. PMID:26712000

  13. A ribosome-inactivating protein in a Drosophila defensive symbiont

    PubMed Central

    Hamilton, Phineas T.; Peng, Fangni; Boulanger, Martin J.; Perlman, Steve J.

    2016-01-01

    Vertically transmitted symbionts that protect their hosts against parasites and pathogens are well known from insects, yet the underlying mechanisms of symbiont-mediated defense are largely unclear. A striking example of an ecologically important defensive symbiosis involves the woodland fly Drosophila neotestacea, which is protected by the bacterial endosymbiont Spiroplasma when parasitized by the nematode Howardula aoronymphium. The benefit of this defense strategy has led to the rapid spread of Spiroplasma throughout the range of D. neotestacea, although the molecular basis for this protection has been unresolved. Here, we show that Spiroplasma encodes a ribosome-inactivating protein (RIP) related to Shiga-like toxins from enterohemorrhagic Escherichia coli and that Howardula ribosomal RNA (rRNA) is depurinated during Spiroplasma-mediated protection of D. neotestacea. First, we show that recombinant Spiroplasma RIP catalyzes depurination of 28S rRNAs in a cell-free assay, as well as Howardula rRNA in vitro at the canonical RIP target site within the α-sarcin/ricin loop (SRL) of 28S rRNA. We then show that Howardula parasites in Spiroplasma-infected flies show a strong signal of rRNA depurination consistent with RIP-dependent modification and large decreases in the proportion of 28S rRNA intact at the α-sarcin/ricin loop. Notably, host 28S rRNA is largely unaffected, suggesting targeted specificity. Collectively, our study identifies a novel RIP in an insect defensive symbiont and suggests an underlying RIP-dependent mechanism in Spiroplasma-mediated defense. PMID:26712000

  14. Ribosome Assembly as Antimicrobial Target

    PubMed Central

    Nikolay, Rainer; Schmidt, Sabine; Schlömer, Renate; Deuerling, Elke; Nierhaus, Knud H.

    2016-01-01

    Many antibiotics target the ribosome and interfere with its translation cycle. Since translation is the source of all cellular proteins including ribosomal proteins, protein synthesis and ribosome assembly are interdependent. As a consequence, the activity of translation inhibitors might indirectly cause defective ribosome assembly. Due to the difficulty in distinguishing between direct and indirect effects, and because assembly is probably a target in its own right, concepts are needed to identify small molecules that directly inhibit ribosome assembly. Here, we summarize the basic facts of ribosome targeting antibiotics. Furthermore, we present an in vivo screening strategy that focuses on ribosome assembly by a direct fluorescence based read-out that aims to identify and characterize small molecules acting as primary assembly inhibitors. PMID:27240412

  15. Ribosome Assembly as Antimicrobial Target.

    PubMed

    Nikolay, Rainer; Schmidt, Sabine; Schlömer, Renate; Deuerling, Elke; Nierhaus, Knud H

    2016-01-01

    Many antibiotics target the ribosome and interfere with its translation cycle. Since translation is the source of all cellular proteins including ribosomal proteins, protein synthesis and ribosome assembly are interdependent. As a consequence, the activity of translation inhibitors might indirectly cause defective ribosome assembly. Due to the difficulty in distinguishing between direct and indirect effects, and because assembly is probably a target in its own right, concepts are needed to identify small molecules that directly inhibit ribosome assembly. Here, we summarize the basic facts of ribosome targeting antibiotics. Furthermore, we present an in vivo screening strategy that focuses on ribosome assembly by a direct fluorescence based read-out that aims to identify and characterize small molecules acting as primary assembly inhibitors. PMID:27240412

  16. Structural insights into ribosome translocation.

    PubMed

    Ling, Clarence; Ermolenko, Dmitri N

    2016-09-01

    During protein synthesis, tRNA and mRNA are translocated from the A to P to E sites of the ribosome thus enabling the ribosome to translate one codon of mRNA after the other. Ribosome translocation along mRNA is induced by the universally conserved ribosome GTPase, elongation factor G (EF-G) in bacteria and elongation factor 2 (EF-2) in eukaryotes. Recent structural and single-molecule studies revealed that tRNA and mRNA translocation within the ribosome is accompanied by cyclic forward and reverse rotations between the large and small ribosomal subunits parallel to the plane of the intersubunit interface. In addition, during ribosome translocation, the 'head' domain of small ribosomal subunit undergoes forward- and back-swiveling motions relative to the rest of the small ribosomal subunit around the axis that is orthogonal to the axis of intersubunit rotation. tRNA/mRNA translocation is also coupled to the docking of domain IV of EF-G into the A site of the small ribosomal subunit that converts the thermally driven motions of the ribosome and tRNA into the forward translocation of tRNA/mRNA inside the ribosome. Despite recent and enormous progress made in the understanding of the molecular mechanism of ribosome translocation, the sequence of structural rearrangements of the ribosome, EF-G and tRNA during translocation is still not fully established and awaits further investigation. WIREs RNA 2016, 7:620-636. doi: 10.1002/wrna.1354 For further resources related to this article, please visit the WIREs website. PMID:27117863

  17. Ribosomal Database Project II

    DOE Data Explorer

    The Ribosomal Database Project (RDP) provides ribosome related data and services to the scientific community, including online data analysis and aligned and annotated Bacterial small-subunit 16S rRNA sequences. As of March 2008, RDP Release 10 is available and currently (August 2009) contains 1,074,075 aligned 16S rRNA sequences. Data that can be downloaded include zipped GenBank and FASTA alignment files, a histogram (in Excel) of the number of RDP sequences spanning each base position, data in the Functional Gene Pipeline Repository, and various user submitted data. The RDP-II website also provides numerous analysis tools.[From the RDP-II home page at http://rdp.cme.msu.edu/index.jsp

  18. Hindered proton collectivity in the proton-rich nucleus 28S: Possible magic number Z = 16

    NASA Astrophysics Data System (ADS)

    Togano, Y.; Yamada, Y.; Iwasa, N.; Yamada, K.; Motobayashi, T.; Aoi, N.; Baba, H.; Bishop, S.; Cai, X.; Doornenbal, P.; Fang, D.; Furukawa, T.; Ieki, K.; Kawabata, T.; Kanno, S.; Kobayashi, N.; Kondo, Y.; Kuboki, T.; Kume, N.; Kurita, K.; Kurokawa, M.; Ma, Y. G.; Matsuo, Y.; Murakami, H.; Matsushita, M.; Nakamura, T.; Okada, K.; Ota, S.; Satou, Y.; Shimoura, S.; Shioda, R.; Tanaka, K. N.; Takeuchi, S.; Tian, W.; Wang, H.; Wang, J.; Yoneda, K.

    2012-10-01

    The reduced transition probability B(E2;0gs+→21+) for the proton-rich nucleus 28S was determined experimentally using intermediate-energy Coulomb excitation. The resultant B(E2) value 181(31) e2fm4 is smaller than those of neighboring N = 12 isotones and Z = 16 isotopes. The double ratio |Mn/Mp|/(N/Z) of the 0gs+→21+ transition in 28S was obtained to be 1.9(2) by evaluating the Mn value from the known B(E2) value of the mirror nucleus 28Mg, showing the hindrance of proton collectivity relative to that of neutrons. These results indicate the emergence of the magic number Z = 16 in 28S.

  19. Ribotoxic stress response: activation of the stress-activated protein kinase JNK1 by inhibitors of the peptidyl transferase reaction and by sequence-specific RNA damage to the alpha-sarcin/ricin loop in the 28S rRNA.

    PubMed Central

    Iordanov, M S; Pribnow, D; Magun, J L; Dinh, T H; Pearson, J A; Chen, S L; Magun, B E

    1997-01-01

    Inhibition of protein synthesis per se does not potentiate the stress-activated protein kinases (SAPKs; also known as cJun NH2-terminal kinases [JNKs]). The protein synthesis inhibitor anisomycin, however, is a potent activator of SAPKs/JNKs. The mechanism of this activation is unknown. We provide evidence that in order to activate SAPK/JNK1, anisomycin requires ribosomes that are translationally active at the time of contact with the drug, suggesting a ribosomal origin of the anisomycin-induced signaling to SAPK/JNK1. In support of this notion, we have found that aminohexose pyrimidine nucleoside antibiotics, which bind to the same region in the 28S rRNA that is the target site for anisomycin, are also potent activators of SAPK/JNK1. Binding of an antibiotic to the 28S rRNA interferes with the functioning of the molecule by altering the structural interactions of critical regions. We hypothesized, therefore, that such alterations in the 28S rRNA may act as recognition signals to activate SAPK/JNK1. To test this hypothesis, we made use of two ribotoxic enzymes, ricin A chain and alpha-sarcin, both of which catalyze sequence-specific RNA damage in the 28S rRNA. Consistent with our hypothesis, ricin A chain and alpha-sarcin were strong agonists of SAPK/JNK1 and of its activator SEK1/MKK4 and induced the expression of the immediate-early genes c-fos and c-jun. As in the case of anisomycin, ribosomes that were active at the time of exposure to ricin A chain or alpha-sarcin were able to initiate signal transduction from the damaged 28S rRNA to SAPK/JNK1 while inactive ribosomes were not. PMID:9154836

  20. Ribosome recycling induces optimal translation rate at low ribosomal availability.

    PubMed

    Marshall, E; Stansfield, I; Romano, M C

    2014-09-01

    During eukaryotic cellular protein synthesis, ribosomal translation is made more efficient through interaction between the two ends of the messenger RNA (mRNA). Ribosomes reaching the 3' end of the mRNA can thus recycle and begin translation again on the same mRNA, the so-called 'closed-loop' model. Using a driven diffusion lattice model of translation, we study the effects of ribosome recycling on the dynamics of ribosome flow and density on the mRNA. We show that ribosome recycling induces a substantial increase in ribosome current. Furthermore, for sufficiently large values of the recycling rate, the lattice does not transition directly from low to high ribosome density, as seen in lattice models without recycling. Instead, a maximal current phase becomes accessible for much lower values of the initiation rate, and multiple phase transitions occur over a wide region of the phase plane. Crucially, we show that in the presence of ribosome recycling, mRNAs can exhibit a peak in protein production at low values of the initiation rate, beyond which translation rate decreases. This has important implications for translation of certain mRNAs, suggesting that there is an optimal concentration of ribosomes at which protein synthesis is maximal, and beyond which translational efficiency is impaired. PMID:25008084

  1. Ribosome recycling induces optimal translation rate at low ribosomal availability

    PubMed Central

    Marshall, E.; Stansfield, I.; Romano, M. C.

    2014-01-01

    During eukaryotic cellular protein synthesis, ribosomal translation is made more efficient through interaction between the two ends of the messenger RNA (mRNA). Ribosomes reaching the 3′ end of the mRNA can thus recycle and begin translation again on the same mRNA, the so-called ‘closed-loop’ model. Using a driven diffusion lattice model of translation, we study the effects of ribosome recycling on the dynamics of ribosome flow and density on the mRNA. We show that ribosome recycling induces a substantial increase in ribosome current. Furthermore, for sufficiently large values of the recycling rate, the lattice does not transition directly from low to high ribosome density, as seen in lattice models without recycling. Instead, a maximal current phase becomes accessible for much lower values of the initiation rate, and multiple phase transitions occur over a wide region of the phase plane. Crucially, we show that in the presence of ribosome recycling, mRNAs can exhibit a peak in protein production at low values of the initiation rate, beyond which translation rate decreases. This has important implications for translation of certain mRNAs, suggesting that there is an optimal concentration of ribosomes at which protein synthesis is maximal, and beyond which translational efficiency is impaired. PMID:25008084

  2. Ribosomes in a Stacked Array

    PubMed Central

    Yamashita, Yui; Kadokura, Yoshitomo; Sotta, Naoyuki; Fujiwara, Toru; Takigawa, Ichigaku; Satake, Akiko; Onouchi, Hitoshi; Naito, Satoshi

    2014-01-01

    Expression of CGS1, which codes for an enzyme of methionine biosynthesis, is feedback-regulated by mRNA degradation in response to S-adenosyl-l-methionine (AdoMet). In vitro studies revealed that AdoMet induces translation arrest at Ser-94, upon which several ribosomes stack behind the arrested one, and mRNA degradation occurs at multiple sites that presumably correspond to individual ribosomes in a stacked array. Despite the significant contribution of stacked ribosomes to inducing mRNA degradation, little is known about the ribosomes in the stacked array. Here, we assigned the peptidyl-tRNA species of the stacked second and third ribosomes to their respective codons and showed that they are arranged at nine-codon intervals behind the Ser-94 codon, indicating tight stacking. Puromycin reacts with peptidyl-tRNA in the P-site, releasing the nascent peptide as peptidyl-puromycin. This reaction is used to monitor the activity of the peptidyltransferase center (PTC) in arrested ribosomes. Puromycin reaction of peptidyl-tRNA on the AdoMet-arrested ribosome, which is stalled at the pre-translocation step, was slow. This limited reactivity can be attributed to the peptidyl-tRNA occupying the A-site at this step rather than to suppression of PTC activity. In contrast, puromycin reactions of peptidyl-tRNA with the stacked second and third ribosomes were slow but were not as slow as pre-translocation step ribosomes. We propose that the anticodon end of peptidyl-tRNA resides in the A-site of the stacked ribosomes and that the stacked ribosomes are stalled at an early step of translocation, possibly at the P/E hybrid state. PMID:24652291

  3. Exploring Ribosome Positioning on Translating Transcripts with Ribosome Profiling.

    PubMed

    Spealman, Pieter; Wang, Hao; May, Gemma; Kingsford, Carl; McManus, C Joel

    2016-01-01

    Recent technological advances (e.g., microarrays and massively parallel sequencing) have facilitated genome-wide measurement of many aspects of gene regulation. Ribosome profiling is a high-throughput sequencing method used to measure gene expression at the level of translation. This is accomplished by quantifying both the number of translating ribosomes and their locations on mRNA transcripts. The inventors of this approach have published several methods papers detailing its implementation and addressing the basics of ribosome profiling data analysis. Here we describe our lab's procedure, which differs in some respects from those published previously. In addition, we describe a data analysis pipeline, Ribomap, for ribosome profiling data. Ribomap allocates sequence reads to alternative mRNA isoforms, normalizes sequencing bias along transcripts using RNA-seq data, and outputs count vectors of per-codon ribosome occupancy for each transcript. PMID:26463378

  4. Requirement for SAPK-JNK signaling in the induction of apoptosis by ribosomal stress in REH lymphoid leukemia cells.

    PubMed

    Johnson, C R; Jiffar, T; Fischer, U M; Ruvolo, P P; Jarvis, W D

    2003-11-01

    The present studies examined performance of SAPK cascades and apoptotic commitment following ribosomal trauma in REH lymphoid leukemia cells. Ribostatic insults included disruption of ribosomal activity by mechanistically dissimilar agents such as blasticidin-S (BCS) (which binds 28S-rRNA to block peptidyl bond formation), kasugamycin (KSM) (which binds 18S-rRNA to prevent translational initiation), and cycloheximide (CHX) (which blocks A-site to P-site translocation of peptidyl-tRNA). Exposure of REH cells to BCS elicited DNA degradation and apoptotic cytolysis. BCS stimulated JNK1/JNK2 and p38, and their shared targets c-Jun and ATF2. Inhibition of JNK1/JNK2 (but not of p38) antagonized blasticidin-induced apoptosis, whereas targeting alternative ribosomal sites with KSM or CHX limited translation, but failed to activate the SAPK cascade or initiate apoptosis. Our findings indicate that interference with 28S-rRNA by BCS initiates apoptosis in REH cells through recruitment of SAPK-JNK signaling. Disparities between the lethal actions of BCS, KSM, and CHX appear to reflect established differences in the subribosomal targets of these agents. We propose that the SAPK cascade comprises an essential mechanism for the transduction of specific lethal stress signals emanating from active ribosomes, and that interference with the 28S-rRNA, rather than the peptidyl transfer center of the large subunit, is critical to apoptotic commitment. PMID:12970763

  5. The complete structure of the large subunit of the mammalian mitochondrial ribosome.

    PubMed

    Greber, Basil J; Boehringer, Daniel; Leibundgut, Marc; Bieri, Philipp; Leitner, Alexander; Schmitz, Nikolaus; Aebersold, Ruedi; Ban, Nenad

    2014-11-13

    Mitochondrial ribosomes (mitoribosomes) are extensively modified ribosomes of bacterial descent specialized for the synthesis and insertion of membrane proteins that are critical for energy conversion and ATP production inside mitochondria. Mammalian mitoribosomes, which comprise 39S and 28S subunits, have diverged markedly from the bacterial ribosomes from which they are derived, rendering them unique compared to bacterial, eukaryotic cytosolic and fungal mitochondrial ribosomes. We have previously determined at 4.9 Å resolution the architecture of the porcine (Sus scrofa) 39S subunit, which is highly homologous to the human mitoribosomal large subunit. Here we present the complete atomic structure of the porcine 39S large mitoribosomal subunit determined in the context of a stalled translating mitoribosome at 3.4 Å resolution by cryo-electron microscopy and chemical crosslinking/mass spectrometry. The structure reveals the locations and the detailed folds of 50 mitoribosomal proteins, shows the highly conserved mitoribosomal peptidyl transferase active site in complex with its substrate transfer RNAs, and defines the path of the nascent chain in mammalian mitoribosomes along their idiosyncratic exit tunnel. Furthermore, we present evidence that a mitochondrial tRNA has become an integral component of the central protuberance of the 39S subunit where it architecturally substitutes for the absence of the 5S ribosomal RNA, a ubiquitous component of all cytoplasmic ribosomes. PMID:25271403

  6. Human C4orf14 interacts with the mitochondrial nucleoid and is involved in the biogenesis of the small mitochondrial ribosomal subunit

    PubMed Central

    He, J.; Cooper, H. M.; Reyes, A.; Di Re, M.; Kazak, L.; Wood, S. R.; Mao, C. C.; Fearnley, I. M.; Walker, J. E.; Holt, I. J.

    2012-01-01

    The bacterial homologue of C4orf14, YqeH, has been linked to assembly of the small ribosomal subunit. Here, recombinant C4orf14 isolated from human cells, co-purified with the small, 28S subunit of the mitochondrial ribosome and the endogenous protein co-fractionated with the 28S subunit in sucrose gradients. Gene silencing of C4orf14 specifically affected components of the small subunit, leading to decreased protein synthesis in the organelle. The GTPase of C4orf14 was critical to its interaction with the 28S subunit, as was GTP. Therefore, we propose that C4orf14, with bound GTP, binds to components of the 28S subunit facilitating its assembly, and GTP hydrolysis acts as the release mechanism. C4orf14 was also found to be associated with human mitochondrial nucleoids, and C4orf14 gene silencing caused mitochondrial DNA depletion. In vitro C4orf14 is capable of binding to DNA. The association of C4orf14 with mitochondrial translation factors and the mitochondrial nucleoid suggests that the 28S subunit is assembled at the mitochondrial nucleoid, enabling the direct transfer of messenger RNA from the nucleoid to the ribosome in the organelle. PMID:22447445

  7. Phylogenetic utility of ribosomal genes for reconstructing the phylogeny of five Chinese satyrine tribes (Lepidoptera, Nymphalidae)

    PubMed Central

    Yang, Mingsheng; Zhang, Yalin

    2015-01-01

    Abstract Satyrinae is one of twelve subfamilies of the butterfly family Nymphalidae, which currently includes nine tribes. However, phylogenetic relationships among them remain largely unresolved, though different researches have been conducted based on both morphological and molecular data. However, ribosomal genes have never been used in tribe level phylogenetic analyses of Satyrinae. In this study we investigate for the first time the phylogenetic relationships among the tribes Elymniini, Amathusiini, Zetherini and Melanitini which are indicated to be a monophyletic group, and the Satyrini, using two ribosomal genes (28s rDNA and 16s rDNA) and four protein-coding genes (EF-1α, COI, COII and Cytb). We mainly aim to assess the phylogenetic informativeness of the ribosomal genes as well as clarify the relationships among different tribes. Our results show the two ribosomal genes generally have the same high phylogenetic informativeness compared with EF-1α; and we infer the 28s rDNA would show better informativeness if the 28s rDNA sequence data for each sampling taxon are obtained in this study. The placement of the monotypic genus Callarge Leech in Zetherini is confirmed for the first time based on molecular evidence. In addition, our maximum likelihood (ML) and Bayesian inference (BI) trees consistently show that the involved Satyrinae including the Amathusiini is monophyletic with high support values. Although the relationships among the five tribes are identical among ML and BI analyses and are mostly strongly-supported in BI analysis, those in ML analysis are lowly- or moderately- supported. Therefore, the relationships among the related five tribes recovered herein need further verification based on more sampling taxa. PMID:25878526

  8. The mechanics of ribosomal translocation.

    PubMed

    Achenbach, John; Nierhaus, Knud H

    2015-07-01

    The ribosome translates the sequence of codons of an mRNA into the corresponding sequence of amino acids as it moves along the mRNA with a codon-step width of about 10 Å. The movement of the million-dalton complex ribosome is triggered by the universal elongation factor G (EF2 in archaea and eukaryotes) and is termed translocation. Unraveling the molecular details of translocation is one of the most challenging tasks of current ribosome research. In the last two years, enormous progress has been obtained by highly-resolved X-ray and cryo-electron microscopic structures as well as by sophisticated biochemical approaches concerning the trigger and control of the movement of the tRNA2·mRNA complex inside the ribosome during translocation. This review inspects and surveys these achievements. PMID:25514765

  9. The Ribosomal Database Project (RDP).

    PubMed Central

    Maidak, B L; Olsen, G J; Larsen, N; Overbeek, R; McCaughey, M J; Woese, C R

    1996-01-01

    The Ribosomal Database Project (RDP) is a curated database that offers ribosome-related data, analysis services and associated computer programs. The offerings include phylogenetically ordered alignments of ribosomal RNA (rRNA) sequences, derived phylogenetic trees, rRNA secondary structure diagrams and various software for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (rdp.life.uiuc.edu), electronic mail (server@rdp.life.uiuc.edu), gopher (rdpgopher.life.uiuc.edu) and World Wide Web (WWW)(http://rdpwww.life.uiuc.edu/). The electronic mail and WWW servers provide ribosomal probe checking, screening for possible chimeric rRNA sequences, automated alignment and approximate phylogenetic placement of user-submitted sequences on an existing phylogenetic tree. PMID:8594608

  10. Ribosome dynamics and the evolutionary history of ribosomes

    NASA Astrophysics Data System (ADS)

    Fox, George E.; Paci, Maxim; Tran, Quyen; Petrov, Anton S.; Williams, Loren D.

    2015-09-01

    The ribosome is a dynamic nanomachine responsible for coded protein synthesis. Its major subsystems were essentially in place at the time of the last universal common ancestor (LUCA). Ribosome evolutionary history thus potentially provides a window into the pre- LUCA world. This history begins with the origins of the peptidyl transferase center where the actual peptide is synthesized and then continues over an extended timeframe as additional functional centers including the GTPase center are added. The large ribosomal RNAs (rRNAs) have grown over time by an accretion process and a model exists that proposes a relative age of each accreted element. We have compared atomic resolution ribosome structures before and after EF-G bound GTP hydrolysis and thereby identified the location of 23 pivot points in the large rRNAs that facilitate ribosome dynamics. Pivots in small subunit helices h28 and h44 appear to be especially central to the process and according to the accretion model significantly older than the other helices containing pivots. Overall, the results suggest that ribosomal dynamics occurred in two phases. In the first phase, an inherently mobile h28/h44 combination provided the flexibility needed to create a dynamic ribosome that was essentially a Brownian machine. This addition likely made coded peptide synthesis possible by facilitating movement of a primitive mRNA. During the second phase, addition of pivoting elements and the creation of a factor binding site allowed the regulation of the inherent motion created by h28/h44. All of these events likely occurred before LUCA.

  11. Characterization of silk gland ribosomes from a bivoltine caddisfly, Stenopsyche marmorata: translational suppression of a silk protein in cold conditions.

    PubMed

    Nomura, Takaomi; Ito, Miho; Kanamori, Mai; Shigeno, Yuta; Uchiumi, Toshio; Arai, Ryoichi; Tsukada, Masuhiro; Hirabayashi, Kimio; Ohkawa, Kousaku

    2016-01-01

    Larval Stenopsyche marmorata constructs food capture nets and fixed retreats underwater using self-produced proteinaceous silk fibers. In the Chikuma River (Nagano Prefecture, Japan) S. marmorata has a bivoltine life cycle; overwintering larvae grow slowly with reduced net spinning activity in winter. We recently reported constant transcript abundance of S. marmorata silk protein 1 (Smsp-1), a core S. marmorata silk fiber component, in all seasons, implying translational suppression in the silk gland during winter. Herein, we prepared and characterized silk gland ribosomes from seasonally collected S. marmorata larvae. Ribosomes from silk glands immediately frozen in liquid nitrogen (LN2) after dissection exhibited comparable translation elongation activity in spring, summer, and autumn. Conversely, silk glands obtained in winter did not contain active ribosomes and Smsp-1. Ribosomes from silk glands immersed in ice-cold physiological saline solution for approximately 4 h were translationally inactive, despite summer collection and Smsp-1 expression. The ribosomal inactivation occurs because of defects in the formation of 80S ribosomes, presumably due to splitting of 60S subunits containing 28S rRNA with central hidden break, in response to cold stress. These results suggest a novel-type ribosome-regulated translation control mechanism. PMID:26646291

  12. Ribosome-inactivating proteins: from plant defense to tumor attack.

    PubMed

    de Virgilio, Maddalena; Lombardi, Alessio; Caliandro, Rocco; Fabbrini, Maria Serena

    2010-11-01

    Ribosome-inactivating proteins (RIPs) are EC3.2.32.22 N-glycosidases that recognize a universally conserved stem-loop structure in 23S/25S/28S rRNA, depurinating a single adenine (A4324 in rat) and irreversibly blocking protein translation, leading finally to cell death of intoxicated mammalian cells. Ricin, the plant RIP prototype that comprises a catalytic A subunit linked to a galactose-binding lectin B subunit to allow cell surface binding and toxin entry in most mammalian cells, shows a potency in the picomolar range. The most promising way to exploit plant RIPs as weapons against cancer cells is either by designing molecules in which the toxic domains are linked to selective tumor targeting domains or directly delivered as suicide genes for cancer gene therapy. Here, we will provide a comprehensive picture of plant RIPs and discuss successful designs and features of chimeric molecules having therapeutic potential. PMID:22069572

  13. Ribosome-Inactivating Proteins: From Plant Defense to Tumor Attack

    PubMed Central

    de Virgilio, Maddalena; Lombardi, Alessio; Caliandro, Rocco; Fabbrini, Maria Serena

    2010-01-01

    Ribosome-inactivating proteins (RIPs) are EC3.2.32.22 N-glycosidases that recognize a universally conserved stem-loop structure in 23S/25S/28S rRNA, depurinating a single adenine (A4324 in rat) and irreversibly blocking protein translation, leading finally to cell death of intoxicated mammalian cells. Ricin, the plant RIP prototype that comprises a catalytic A subunit linked to a galactose-binding lectin B subunit to allow cell surface binding and toxin entry in most mammalian cells, shows a potency in the picomolar range. The most promising way to exploit plant RIPs as weapons against cancer cells is either by designing molecules in which the toxic domains are linked to selective tumor targeting domains or directly delivered as suicide genes for cancer gene therapy. Here, we will provide a comprehensive picture of plant RIPs and discuss successful designs and features of chimeric molecules having therapeutic potential. PMID:22069572

  14. Contrasting evolutionary patterns of 28S and ITS rRNA genes reveal high intragenomic variation in Cephalenchus (Nematoda): Implications for species delimitation.

    PubMed

    Pereira, Tiago José; Baldwin, James Gordon

    2016-05-01

    Concerted evolution is often assumed to be the evolutionary force driving multi-family genes, including those from ribosomal DNA (rDNA) repeat, to complete homogenization within a species, although cases of non-concerted evolution have been also documented. In this study, sequence variation of 28S and ITS ribosomal RNA (rRNA) genes in the genus Cephalenchus is assessed at three different levels, intragenomic, intraspecific, and interspecific. The findings suggest that not all Cephalenchus species undergo concerted evolution. High levels of intraspecific polymorphism, mostly due to intragenomic variation, are found in Cephalenchus sp1 (BRA-01). Secondary structure analyses of both rRNA genes and across different species show a similar substitution pattern, including mostly compensatory (CBC) and semi-compensatory (SBC) base changes, thus suggesting the functionality of these rRNA copies despite the variation found in some species. This view is also supported by low sequence variation in the 5.8S gene in relation to the flanking ITS-1 and ITS-2 as well as by the existence of conserved motifs in the former gene. It is suggested that potential cross-fertilization in some Cephalenchus species, based on inspection of female reproductive system, might contribute to both intragenomic and intraspecific polymorphism of their rRNA genes. These results reinforce the potential implications of intragenomic and intraspecific genetic diversity on species delimitation, especially in biodiversity studies based solely on metagenetic approaches. Knowledge of sequence variation will be crucial for accurate species diversity estimation using molecular methods. PMID:26926945

  15. [Ribosomal RNA Evolution

    NASA Technical Reports Server (NTRS)

    1997-01-01

    It is generally believed that an RNA World existed at an early stage in the history of life. During this early period, RNA molecules are seen to be potentially involved in both catalysis and the storage of genetic information. Translation presents several interrelated themes of inquiry for exobiology. First, it is essential, for understanding the very origin of life, how peptides and eventually proteins might have come to be made on the early Earth in a template directed manner. Second, it is necessary to understand how a machinery of similar complexity to that found in the ribosomes of modern organisms came to exist by the time of the last common ancestor (as detected by 16S rRNA sequence studies). Third, the ribosomal RNAs themselves likely had a very early origin and studies of their history may be very informative about the nature of the RNA World. Moreover, studies of these RNAs will contribute to a better understanding of the potential roles of RNA in early evolution.During the past year we have ave conducted a comparative study of four completely sequenced bacterial genoames. We have focused initially on conservation of gene order. The second component of the project continues to build on the model system for studying the validity of variant 5S rRNA sequences in the vicinity of the modern Vibrio proteolyticus 5S rRNA that we established earlier. This system has made it possible to conduct a detailed and extensive analysis of a local portion of the sequence space. These core methods have been used to construct numerous mutants during the last several years. Although it has been a secondary focus, this work has continued over the last year such that we now have in excess of 125 V. proteolyticus derived constructs which have been made and characterized. We have also continued high resolution NMR work on RNA oligomers originally initiated by G. Kenneth Smith who was funded by a NASA Graduate Student Researcher's Fellowship Award until May of 1996. Mr. Smith

  16. Molecular characterization of Stenocarpella maydis based on nuclear ribosomal Internal Transcribed Spacer regions between the 18S and 28S nuclear rRNA gene sequences

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Diplodia ear rot of maize is caused by the fungus Stenocarpella maydis (syn. Diplodia maydis). Although considered a minor pathogen in the later 1900's, with the increased emphasis on conservation tillage, S. maydis has reestablished itself as an important ear and stalk rot pathogen. While S. maydis...

  17. Phylogenetic Information Content of Copepoda Ribosomal DNA Repeat Units: ITS1 and ITS2 Impact

    PubMed Central

    Zagoskin, Maxim V.; Lazareva, Valentina I.; Grishanin, Andrey K.; Mukha, Dmitry V.

    2014-01-01

    The utility of various regions of the ribosomal repeat unit for phylogenetic analysis was examined in 16 species representing four families, nine genera, and two orders of the subclass Copepoda (Crustacea). Fragments approximately 2000 bp in length containing the ribosomal DNA (rDNA) 18S and 28S gene fragments, the 5.8S gene, and the internal transcribed spacer regions I and II (ITS1 and ITS2) were amplified and analyzed. The DAMBE (Data Analysis in Molecular Biology and Evolution) software was used to analyze the saturation of nucleotide substitutions; this test revealed the suitability of both the 28S gene fragment and the ITS1/ITS2 rDNA regions for the reconstruction of phylogenetic trees. Distance (minimum evolution) and probabilistic (maximum likelihood, Bayesian) analyses of the data revealed that the 28S rDNA and the ITS1 and ITS2 regions are informative markers for inferring phylogenetic relationships among families of copepods and within the Cyclopidae family and associated genera. Split-graph analysis of concatenated ITS1/ITS2 rDNA regions of cyclopoid copepods suggested that the Mesocyclops, Thermocyclops, and Macrocyclops genera share complex evolutionary relationships. This study revealed that the ITS1 and ITS2 regions potentially represent different phylogenetic signals. PMID:25215300

  18. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome.

    PubMed

    Poirot, Olivier; Timsit, Youri

    2016-01-01

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through "molecular synapses", ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the "sensory-proteins" innervate the functional ribosomal sites, while the "inter-proteins" interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing. PMID:27225526

  19. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome

    PubMed Central

    Poirot, Olivier; Timsit, Youri

    2016-01-01

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through “molecular synapses”, ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the “sensory-proteins” innervate the functional ribosomal sites, while the “inter-proteins” interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing. PMID:27225526

  20. Mammalian mitochondrial ribosomal small subunit (MRPS) genes: A putative role in human disease.

    PubMed

    Gopisetty, Gopal; Thangarajan, Rajkumar

    2016-09-01

    Mitochondria are prominently understood as power houses producing ATP the primary energy currency of the cell. However, mitochondria are also known to play an important role in apoptosis and autophagy, and mitochondrial dysregulation can lead to pathological outcomes. Mitochondria are known to contain 1500 proteins of which only 13 are coded by mitochondrial DNA and the rest are coded by nuclear genes. Protein synthesis in mitochondria involves mitochondrial ribosomes which are 55-60S particles and are composed of small 28S and large 39S subunits. A feature of mammalian mitoribosome which differentiate it from bacterial ribosomes is the increased protein content. The human mitochondrial ribosomal protein (MRP) gene family comprises of 30 genes which code for mitochondrial ribosomal small subunit and 50 genes for the large subunit. The present review focuses on the mitochondrial ribosomal small subunit genes (MRPS), presents an overview of the literature and data gleaned from publicly available gene and protein expression databases. The survey revealed aberrations in MRPS gene expression patterns in varied human diseases indicating a putative role in their etiology. PMID:27170550

  1. The Hymenopteran Tree of Life: Evidence from Protein-Coding Genes and Objectively Aligned Ribosomal Data

    PubMed Central

    Klopfstein, Seraina; Vilhelmsen, Lars; Heraty, John M.; Sharkey, Michael; Ronquist, Fredrik

    2013-01-01

    Previous molecular analyses of higher hymenopteran relationships have largely been based on subjectively aligned ribosomal sequences (18S and 28S). Here, we reanalyze the 18S and 28S data (unaligned about 4.4 kb) using an objective and a semi-objective alignment approach, based on MAFFT and BAli-Phy, respectively. Furthermore, we present the first analyses of a substantial protein-coding data set (4.6 kb from one mitochondrial and four nuclear genes). Our results indicate that previous studies may have suffered from inflated support values due to subjective alignment of the ribosomal sequences, but apparently not from significant biases. The protein data provide independent confirmation of several earlier results, including the monophyly of non-xyelid hymenopterans, Pamphilioidea + Unicalcarida, Unicalcarida, Vespina, Apocrita, Proctotrupomorpha and core Proctotrupomorpha. The protein data confirm that Aculeata are nested within a paraphyletic Evaniomorpha, but cast doubt on the monophyly of Evanioidea. Combining the available morphological, ribosomal and protein-coding data, we examine the total-evidence signal as well as congruence and conflict among the three data sources. Despite an emerging consensus on many higher-level hymenopteran relationships, several problems remain unresolved or contentious, including rooting of the hymenopteran tree, relationships of the woodwasps, placement of Stephanoidea and Ceraphronoidea, and the sister group of Aculeata. PMID:23936325

  2. Functional Role of Ribosomal Signatures

    PubMed Central

    Chen, Ke; Eargle, John; Sarkar, Krishnarjun; Gruebele, Martin; Luthey-Schulten, Zaida

    2010-01-01

    Although structure and sequence signatures in ribosomal RNA and proteins are defining characteristics of the three domains of life and instrumental in constructing the modern phylogeny, little is known about their functional roles in the ribosome. In this work, the largest coevolving RNA/protein signatures in the bacterial 30S ribosome are investigated both experimentally and computationally through all-atom molecular-dynamics simulations. The complex includes the N-terminal fragment of the ribosomal protein S4, which is a primary binding protein that initiates 30S small subunit assembly from the 5′ domain, and helix 16 (h16), which is part of the five-way junction in 16S rRNA. Our results show that the S4 N-terminus signature is intrinsically disordered in solution, whereas h16 is relatively stable by itself. The dynamic disordered property of the protein is exploited to couple the folding and binding process to the five-way junction, and the results provide insight into the mechanism for the early and fast binding of S4 in the assembly of the ribosomal small subunit. PMID:21156135

  3. Chloroplast ribosomes and protein synthesis.

    PubMed Central

    Harris, E H; Boynton, J E; Gillham, N W

    1994-01-01

    Consistent with their postulated origin from endosymbiotic cyanobacteria, chloroplasts of plants and algae have ribosomes whose component RNAs and proteins are strikingly similar to those of eubacteria. Comparison of the secondary structures of 16S rRNAs of chloroplasts and bacteria has been particularly useful in identifying highly conserved regions likely to have essential functions. Comparative analysis of ribosomal protein sequences may likewise prove valuable in determining their roles in protein synthesis. This review is concerned primarily with the RNAs and proteins that constitute the chloroplast ribosome, the genes that encode these components, and their expression. It begins with an overview of chloroplast genome structure in land plants and algae and then presents a brief comparison of chloroplast and prokaryotic protein-synthesizing systems and a more detailed analysis of chloroplast rRNAs and ribosomal proteins. A description of the synthesis and assembly of chloroplast ribosomes follows. The review concludes with discussion of whether chloroplast protein synthesis is essential for cell survival. PMID:7854253

  4. Phylogenetic Analysis of the Hoplolaiminae Inferred from Combined D2 and D3 Expansion Segments of 28S rDNA.

    PubMed

    Bae, C H; Szalanski, A L; Robbins, R T

    2009-03-01

    DNA sequences of the D2-D3 expansion segments of the 28S gene of ribosomal DNA from 23 taxa of the subfamily Hoplolaiminae were obtained and aligned to infer phylogenetic relationships. The D2 and D3 expansion regions are G-C rich (59.2%), with up to 20.7% genetic divergence between Scutellonema brachyurum and Hoplolaimus concaudajuvencus. Molecular phylogenetic analysis using maximum likelihood and maximum parsimony was conducted using the D2-D3 sequence data. Of 558 characters, 254 characters (45.5%) were variable and 198 characters (35.4%) were parsimony informative. All phylogenetic methods produced a similar topology with two distinct clades: One clade consists of all Hoplolaimus species while the other clade consists of the rest of the studied Hoplolaiminae genera. This result suggests that Hoplolaimus is monophyletic. Another clade consisted of Aorolaimus, Helicotylenchus, Rotylenchus, and Scutellonema species. Phylogenetic analysis using the outgroup species Globodera rostocheinsis suggests that Hoplolaiminae is paraphyletic. In this study, the D2-D3 region had levels of DNA sequence divergence sufficient for phylogenetic analysis and delimiting species of Hoplolaiminae. PMID:22661775

  5. Structure and stability of variants of the sarcin-ricin loop of 28S rRNA: NMR studies of the prokaryotic SRL and a functional mutant.

    PubMed Central

    Seggerson, K; Moore, P B

    1998-01-01

    NMR has been used to examine the conformational properties of two variants of the sarcin-ricin loop (SRL) from eukaryotic 28S rRNA, which is essential for elongation factor interactions with the ribosome: (1) its bacterial homologue, which lacks two of the bases that flank the conserved 12-nt sequence in the middle of the SRL, but which is functionally equivalent, and (2) a functionally active variant of the eukaryotic SRL in which the bulged G within the conserved sequence is replaced by an A. The data indicate that, although the bacterial SRL is less stable than the eukaryotic SRL, its conformation is closely similar. Furthermore, even though replacement of the bulged G in the SRL with an A seriously destabilizes the center of the loop, its effect on the overall conformation of the SRL appears to be modest. In the course of this work, it was serendipitously discovered that at neutral pH, the C8 proton of the bulged G, in both PRO-SRL and E73, exchanges about 10 times faster than it does in GMP. PMID:9769095

  6. Profiling of Mycoplasma gallisepticum Ribosomes.

    PubMed

    Fisunov, G Y; Evsyutina, D V; Arzamasov, A A; Butenko, I O; Govorun, V M

    2015-01-01

    The development of high-throughput technologies is increasingly resulting in identification of numerous cases of low correlation between mRNA and the protein level in cells. These controversial observations were made on various bacteria, such as E. coli, Desulfovibrio vulgaris, and Lactococcus lactis. Thus, it is important to develop technologies, including high-throughput techniques, aimed at studying gene expression regulation at the level of translation. In the current study, we performed proteomic profiling of M. gallisepticum ribosomes and identified high abundant noncanonical proteins. We found that binding of mRNAs to ribosomes is mainly determined by two parameters: (1) abundance of mRNA itself and (2) complimentary interactions between the 3' end of 16S rRNA and the ribosome binding site in the 5'-untranslated region of mRNA. PMID:26798497

  7. Profiling of Mycoplasma gallisepticum Ribosomes

    PubMed Central

    Fisunov, G. Y.; Evsyutina, D. V.; Arzamasov, A. A.; Butenko, I. O.; Govorun, V. M.

    2015-01-01

    The development of high-throughput technologies is increasingly resulting in identification of numerous cases of low correlation between mRNA and the protein level in cells. These controversial observations were made on various bacteria, such as E. coli, Desulfovibrio vulgaris, and Lactococcus lactis. Thus, it is important to develop technologies, including high-throughput techniques, aimed at studying gene expression regulation at the level of translation. In the current study, we performed proteomic profiling of M. gallisepticum ribosomes and identified high abundant noncanonical proteins. We found that binding of mRNAs to ribosomes is mainly determined by two parameters: (1) abundance of mRNA itself and (2) complimentary interactions between the 3’ end of 16S rRNA and the ribosome binding site in the 5’-untranslated region of mRNA. PMID:26798497

  8. [Phylogeny of protostome moulting animals (Ecdysozoa) inferred from 18 and 28S rRNA gene sequences].

    PubMed

    Petrov, N B; Vladychenskaia, N S

    2005-01-01

    Reliability of reconstruction of phylogenetic relationships within a group of protostome moulting animals was evaluated by means of comparison of 18 and 28S rRNA gene sequences sets both taken separately and combined. Reliability of reconstructions was evaluated by values of the bootstrap support of major phylogenetic tree nodes and by degree of congruence of phylogenetic trees inferred by various methods. By both criteria, phylogenetic trees reconstructed from the combined 18 and 28S rRNA gene sequences were better than those inferred from 18 and 28S sequences taken separately. Results obtained are consistent with phylogenetic hypothesis separating protostome animals into two major clades, moulting Ecdysozoa (Priapulida + Kinorhyncha, Nematoda + Nematomorpha, Onychophora + Tardigrada, Myriapoda + Chelicerata, Crustacea + Hexapoda) and unmoulting Lophotrochozoa (Plathelminthes, Nemertini, Annelida, Mollusca, Echiura, Sipuncula). Clade Cephalorhyncha does not include nematomorphs (Nematomorpha). Conclusion was taken that it is necessary to use combined 18 and 28S data in phylogenetic studies. PMID:16083008

  9. Silencing of RNA helicase II/Gualpha inhibits mammalian ribosomal RNA production.

    PubMed

    Henning, Dale; So, Rolando B; Jin, Runyan; Lau, Lester F; Valdez, Benigno C

    2003-12-26

    The intricate production of ribosomal RNA is well defined in yeast, but its complexity in higher organisms is barely understood. We recently showed that down-regulation of nucleolar protein RNA helicase II/Gualpha (RH-II/Gualpha or DDX21) in Xenopus oocytes inhibited processing of 20 S rRNA to 18 S and contributed to degradation of 28 S rRNA (Yang, H., Zhou, J., Ochs, R. L., Henning, D., Jin, R., and Valdez, B. C. (2003) J. Biol. Chem. 278, 38847-38859). Since no nucleolar RNA helicase has been functionally characterized in mammalian cells, we used short interfering RNA to search for functions for RH-II/Gualpha and its paralogue RH-II/Gubeta in rRNA production. Silencing of RH-II/Gualpha by more than 80% in HeLa cells resulted in an almost 80% inhibition of 18 and 28 S rRNA production. This inhibition could be reversed by exogenous expression of wild type RH-II/Gualpha. A helicase-deficient mutant form having ATPase activity was able to rescue the production of 28 S but not 18 S rRNA. A phenotype exhibiting inhibition of 18 S and 28 S rRNA production was also observed when the paralogue RH-II/Gubeta was overexpressed. Both down-regulation of RH-II/Gualpha and overexpression of RH-II/Gubeta slowed cell proliferation. The opposite effects of the two paralogues suggest antagonistic functions. PMID:14559904

  10. Comprehensive Molecular Structure of the Eukaryotic Ribosome

    PubMed Central

    Taylor, Derek J.; Devkota, Batsal; Huang, Andrew D.; Topf, Maya; Narayanan, Eswar; Sali, Andrej; Harvey, Stephen C.; Frank, Joachim

    2009-01-01

    Despite the emergence of a large number of X-ray crystallographic models of the bacterial 70S ribosome over the past decade, an accurate atomic model of the eukaryotic 80S ribosome is still not available. Eukaryotic ribosomes possess more ribosomal proteins and ribosomal RNA than bacterial ribosomes, which are implicated in extra-ribosomal functions in the eukaryotic cells. By combining cryo-EM with RNA and protein homology modeling, we obtained an atomic model of the yeast 80S ribosome complete with all ribosomal RNA expansion segments and all ribosomal proteins for which a structural homolog can be identified. Mutation or deletion of 80S ribosomal proteins can abrogate maturation of the ribosome, leading to several human diseases. We have localized one such protein unique to eukaryotes, rpS19e, whose mutations are associated with Diamond-Blackfan anemia in humans. Additionally, we characterize crucial and novel interactions between the dynamic stalk base of the ribosome with eukaryotic elongation factor 2. PMID:20004163

  11. New ribosomes for new memories?

    PubMed Central

    Hernández, A Iván; Alarcon, Juan M; Allen, Kim D

    2015-01-01

    Widely thought to be a housekeeping process, the regulation and synthesis of rRNA emerges as a potentially central mechanism for the maintenance of synaptic plasticity and memory. We have recently shown that an essential component of late-phase synaptic plasticity is rRNA biosynthesis — the rate-limiting step in the production of new ribosomes. We hypothesize that a particular population of ribosomes is generated upon learning-associated neural activity to alter the rate of synthesis of plasticity factors at tagged synapses that will support the maintenance of synaptic plasticity and memory. PMID:26479998

  12. Identification of Scopulariopsis species by partial 28S rRNA gene sequence analysis.

    PubMed

    Jagielski, Tomasz; Kosim, Kinga; Skóra, Magdalena; Macura, Anna Barbara; Bielecki, Jacek

    2013-01-01

    The genus Scopulariopsis contains over 30 species of mitosporic moulds, which although usually saprophytic may also act as opportunistic pathogens in humans. They have mainly been associated with onychomycosis, and only sporadically reported as a cause of deep tissue infections or systemic disease. Identification of Scopulariopsis species still largely relies on phenotype-based methods. There is a need for a molecular diagnostic approach, that would allow to reliably discriminate between different Scopulariopsis species. The aim of this study was to apply sequence analysis of partial 28S rRNA gene for species identification of Scopulariopsis clinical isolates. Although the method employed did reveal some genetic polymorphism among Scopulariopsis isolates tested, it was not enough for species delineation. For this to be achieved, other genetic loci, within and beyond the rDNA operon, need to be investigated. PMID:24459837

  13. Chromatographic Purification of Highly Active Yeast Ribosomes

    PubMed Central

    Meskauskas, Arturas; Leshin, Jonathan A.; Dinman, Jonathan D.

    2011-01-01

    Eukaryotic ribosomes are much more labile as compared to their eubacterial and archael counterparts, thus posing a significant challenge to researchers. Particularly troublesome is the fact that lysis of cells releases a large number of proteases and nucleases which can degrade ribosomes. Thus, it is important to separate ribosomes from these enzymes as quickly as possible. Unfortunately, conventional differential ultracentrifugation methods leaves ribosomes exposed to these enzymes for unacceptably long periods of time, impacting their structural integrity and functionality. To address this problem, we utilize a chromatographic method using a cysteine charged Sulfolink resin. This simple and rapid application significantly reduces co-purifying proteolytic and nucleolytic activities, producing high yields of intact, highly biochemically active yeast ribosomes. We suggest that this method should also be applicable to mammalian ribosomes. The simplicity of the method, and the enhanced purity and activity of chromatographically purified ribosome represents a significant technical advancement for the study of eukaryotic ribosomes. PMID:22042245

  14. AMPLIFICATION OF RIBOSOMAL RNA SEQUENCES

    EPA Science Inventory

    This book chapter offers an overview of the use of ribosomal RNA sequences. A history of the technology traces the evolution of techniques to measure bacterial phylogenetic relationships and recent advances in obtaining rRNA sequence information. The manual also describes procedu...

  15. Studies on Pea Ribosomal Proteins

    PubMed Central

    Lin, Chu-Yung; Chia, Subrina Li-Li; Travis, Robert L.; Key, Joe L.

    1975-01-01

    Ribosomal subunits prepared by NH4Cl dissociation (0.5 m) of the monomeric ribosomes were much less active in in vitro protein synthesis than those prepared by KCl dissociation. The decrease in activity correlated with a detachment of some proteins (L2 and L9 as shown by gel electrophoresis) within the 60S ribosomal subunits. Subunits prepared with 0.3 m NH4Cl retained L2 and L9, but the activity remained low. Incubation of these 60S subunits in TKM buffer (50 mm tris [pH 7.5], 20 mm KCl, and 5 mm MgCl2) for 20 min at 37 C restored the activity almost to the level of those obtained by KCl dissociation. Treatment of the 0.3 m NH4Cl-derived 60S subunits with a protein reagent, Procion brilliant blue, prior to extraction of the ribosomal proteins resulted in the loss of L2 and L9, showing that these proteins were made accessible for dye binding. These observations suggest that a considerable degree of unfolding of the 60S subunit occurs at 0.3 m NH4Cl (this apparently leads to a preferential detachment of L2 and L9 at 0.5 m NH4Cl) and that the activity of the purified subunits depends not only on the presence of L2 and L9 but also on the organization of these proteins within the 60S subunits. Images PMID:16659254

  16. Characterizing inactive ribosomes in translational profiling.

    PubMed

    Liu, Botao; Qian, Shu-Bing

    2016-01-01

    The broad impact of translational regulation has emerged explosively in the last few years in part due to the technological advance in genome-wide interrogation of gene expression. During mRNA translation, the majority of actively translating ribosomes exist as polysomes in cells with multiple ribosomes loaded on a single transcript. The importance of the monosome, however, has been less appreciated in translational profiling analysis. Here we report that the monosome fraction isolated by sucrose sedimentation contains a large quantity of inactive ribosomes that do not engage on mRNAs to direct translation. We found that the elongation factor eEF2, but not eEF1A, stably resides in these non-translating ribosomes. This unique feature permits direct evaluation of ribosome status under various stress conditions and in the presence of translation inhibitors. Ribosome profiling reveals that the monosome has a similar but not identical pattern of ribosome footprints compared to the polysome. We show that the association of free ribosomal subunits minimally contributes to ribosome occupancy outside of the coding region. Our results not only offer a quantitative method to monitor ribosome availability, but also uncover additional layers of ribosome status needed to be considered in translational profiling analysis. PMID:27335722

  17. Alcoholic Liver Disease and the Mitochondrial Ribosome

    PubMed Central

    Cahill, Alan; Sykora, Peter

    2009-01-01

    Summary Chronic alcohol consumption has been shown to severely compromise mitochondrial protein synthesis. Hepatic mitochondria isolated from alcoholic animals contain decreased levels of respiratory complexes and display depressed respiration rates when compared to pair-fed controls. One underlying mechanism for this involves ethanol-elicited alterations in the structural and functional integrity of the mitochondrial ribosome. Ethanol feeding results in ribosomal changes that include decreased sedimentation rates, larger hydrodynamic volumes, increased levels of unassociated subunits and changes in the levels of specific ribosomal proteins. The methods presented in this chapter detail how to isolate mitochondrial ribosomes, determine ribosomal activity, separate ribosomes into nucleic acid and protein, and perform two-dimensional nonequilibrium pH gradient electrophoretic polyacrylamide gel electrophoresis to separate and subsequently identify mitochondrial ribosomal proteins. PMID:18369931

  18. [About the ribosomal biogenesis in human].

    PubMed

    Tafforeau, Lionel

    2015-01-01

    Ribosomes are cellular ribonucleoprotein particles required for a fundamental mechanism, translation of the genetic information into proteins. Ribosome biogenesis is a highly complex pathway involving many maturation steps: ribosomal RNA (rRNA) synthesis, rRNA processing, pre-rRNA modifications, its assembly with ribosomal proteins in the nuceolus, export of the subunit precursors to the nucleoplasm and the cytoplasm. Ribosome biogenesis has mainly being investigated in yeast during these last 25 years. However, recent works have shown that, despite many similarities between yeast and human ribosome structure and biogenesis, human pre-rRNA processing is far more complex than in yeast. In order to better understand diseases related to a malfunction in ribosome synthesis, the ribosomopathies, research should be conducted directly in human cells and animal models. PMID:26152166

  19. Intersubunit movement is required for ribosomal translocation

    PubMed Central

    Horan, Lucas H.; Noller, Harry F.

    2007-01-01

    Translocation of tRNA and mRNA during protein synthesis is believed to be coupled to structural changes in the ribosome. The “ratchet model,” based on cryo-EM reconstructions of ribosome complexes, invokes relative movement of the 30S and 50S ribosomal subunits in this process; however, evidence that directly demonstrates a requirement for intersubunit movement during translocation is lacking. To address this problem, we created an intersubunit disulfide cross-link to restrict potential movement. The cross-linked ribosomes were unable to carry out polypeptide synthesis; this inhibition was completely reversed upon reduction of the disulfide bridge. In vitro assays showed that the cross-linked ribosomes were specifically blocked in elongation factor G-dependent translocation. These findings show that intersubunit movement is required for ribosomal translocation, accounting for the universal two-subunit architecture of ribosomes. PMID:17360328

  20. Ribosome engineering to promote new crystal forms

    SciTech Connect

    Selmer, Maria; Gao, Yong-Gui; Weixlbaumer, Albert; Ramakrishnan, V.

    2012-05-01

    Truncation of ribosomal protein L9 in T. thermophilus allows the generation of new crystal forms and the crystallization of ribosome–GTPase complexes. Crystallographic studies of the ribosome have provided molecular details of protein synthesis. However, the crystallization of functional complexes of ribosomes with GTPase translation factors proved to be elusive for a decade after the first ribosome structures were determined. Analysis of the packing in different 70S ribosome crystal forms revealed that regardless of the species or space group, a contact between ribosomal protein L9 from the large subunit and 16S rRNA in the shoulder of a neighbouring small subunit in the crystal lattice competes with the binding of GTPase elongation factors to this region of 16S rRNA. To prevent the formation of this preferred crystal contact, a mutant strain of Thermus thermophilus, HB8-MRCMSAW1, in which the ribosomal protein L9 gene has been truncated was constructed by homologous recombination. Mutant 70S ribosomes were used to crystallize and solve the structure of the ribosome with EF-G, GDP and fusidic acid in a previously unobserved crystal form. Subsequent work has shown the usefulness of this strain for crystallization of the ribosome with other GTPase factors.

  1. Neutron scattering in the ribosome structure

    NASA Astrophysics Data System (ADS)

    Serdyuk, Igor N.

    1997-02-01

    Thermal neutron scattering has become a powerful instrument for studying the ribosome and its components. The application of neutron scattering allowed to establish some principal features of the ribosome structure: non-homogeneous distribution of the RNA and protein within ribosomal particles, the RNA role as a framework in the arrangement and maintenance of the structure of ribosomal particles, and the globular character of ribosomal proteins. The use of selective deuteration of separate ribosomal proteins in combination with the triangulation method revealed mutual spatial arrangement (the 3D-map) of all the ribosomal proteins within the small particle and in the most part of the large ribosomal particle. An essential impact has been made in the structural studies of ribosomes with the development of novel experimental approaches: triple isotopic substitution and spin contrast variation. These approaches with direct interpretation of spherical harmonics provide new possibilities for constructing models of ribosomal particles, opening principally new perspectives for joint use of X-ray synchrotron diffraction in crystals and small-angle neutron scattering in solution.

  2. Fungal community structure in disease suppressive soils assessed by 28S LSU gene sequencing.

    PubMed

    Penton, C Ryan; Gupta, V V S R; Tiedje, James M; Neate, Stephen M; Ophel-Keller, Kathy; Gillings, Michael; Harvey, Paul; Pham, Amanda; Roget, David K

    2014-01-01

    Natural biological suppression of soil-borne diseases is a function of the activity and composition of soil microbial communities. Soil microbe and phytopathogen interactions can occur prior to crop sowing and/or in the rhizosphere, subsequently influencing both plant growth and productivity. Research on suppressive microbial communities has concentrated on bacteria although fungi can also influence soil-borne disease. Fungi were analyzed in co-located soils 'suppressive' or 'non-suppressive' for disease caused by Rhizoctonia solani AG 8 at two sites in South Australia using 454 pyrosequencing targeting the fungal 28S LSU rRNA gene. DNA was extracted from a minimum of 125 g of soil per replicate to reduce the micro-scale community variability, and from soil samples taken at sowing and from the rhizosphere at 7 weeks to cover the peak Rhizoctonia infection period. A total of ∼ 994,000 reads were classified into 917 genera covering 54% of the RDP Fungal Classifier database, a high diversity for an alkaline, low organic matter soil. Statistical analyses and community ordinations revealed significant differences in fungal community composition between suppressive and non-suppressive soil and between soil type/location. The majority of differences associated with suppressive soils were attributed to less than 40 genera including a number of endophytic species with plant pathogen suppression potentials and mycoparasites such as Xylaria spp. Non-suppressive soils were dominated by Alternaria, Gibberella and Penicillum. Pyrosequencing generated a detailed description of fungal community structure and identified candidate taxa that may influence pathogen-plant interactions in stable disease suppression. PMID:24699870

  3. Fungal Community Structure in Disease Suppressive Soils Assessed by 28S LSU Gene Sequencing

    PubMed Central

    Penton, C. Ryan; Gupta, V. V. S. R.; Tiedje, James M.; Neate, Stephen M.; Ophel-Keller, Kathy; Gillings, Michael; Harvey, Paul; Pham, Amanda; Roget, David K.

    2014-01-01

    Natural biological suppression of soil-borne diseases is a function of the activity and composition of soil microbial communities. Soil microbe and phytopathogen interactions can occur prior to crop sowing and/or in the rhizosphere, subsequently influencing both plant growth and productivity. Research on suppressive microbial communities has concentrated on bacteria although fungi can also influence soil-borne disease. Fungi were analyzed in co-located soils ‘suppressive’ or ‘non-suppressive’ for disease caused by Rhizoctonia solani AG 8 at two sites in South Australia using 454 pyrosequencing targeting the fungal 28S LSU rRNA gene. DNA was extracted from a minimum of 125 g of soil per replicate to reduce the micro-scale community variability, and from soil samples taken at sowing and from the rhizosphere at 7 weeks to cover the peak Rhizoctonia infection period. A total of ∼994,000 reads were classified into 917 genera covering 54% of the RDP Fungal Classifier database, a high diversity for an alkaline, low organic matter soil. Statistical analyses and community ordinations revealed significant differences in fungal community composition between suppressive and non-suppressive soil and between soil type/location. The majority of differences associated with suppressive soils were attributed to less than 40 genera including a number of endophytic species with plant pathogen suppression potentials and mycoparasites such as Xylaria spp. Non-suppressive soils were dominated by Alternaria, Gibberella and Penicillum. Pyrosequencing generated a detailed description of fungal community structure and identified candidate taxa that may influence pathogen-plant interactions in stable disease suppression. PMID:24699870

  4. A combination of morphology and 28S rRNA gene sequences provide grouping and ranking criteria to merge eight into three Ambispora species (Ambisporaceae, Glomeromycota).

    PubMed

    Bills, Robert J; Morton, Joseph B

    2015-08-01

    Ambispora, the only genus in Ambisporaceae and one of three deeply rooted families in Archaeosporales, Glomeromycetes, is amended. Analysis of the morphology of specimens from types and living cultures and 28S ribosomal DNA (rDNA; LSU) sequences resulted in two major changes that redefined Ambispora to include only species with the potential for spore dimorphism (acaulosporoid and glomoid). First, species described as producing only glomoid spores (Ambispora leptoticha, Ambispora fecundispora, and Ambispora callosa), only acaulosporoid spores (Ambispora jimgerdemannii), or both spore morphotypes (Ambispora appendicula) were synonymized with a redefined dimorphic species, A. leptoticha. LSU sequences and more conserved SSU gene data indicated little divergence between genotypes formerly classified as separate species. Second, Ambispora fennica was synonymized with Ambispora gerdemannii based on morphological and LSU sequence variation equivalent to that measured in the sister clade A. leptoticha. With this analysis, Ambispora was reduced to three species: A. leptoticha, A. gerdemannii, and Ambispora granatensis. Morphological and molecular characters were given equal treatment in this study, as each data set informed and clarified grouping and ranking decisions. The two inner layers of the acaulosporoid spore wall were the only structural characters uniquely defining each of these three species; all other characters were shared. Phenotypes of glomoid spores were indistinguishable between species, and thus were informative only at the genus level. Distinct subclade structure of the LSU gene tree suggests fixation of discrete variants typical of clonal reproduction and possible retention of polymorphisms in rDNA repeats, so that not all discrete genetic variants are indicative of speciation. PMID:25638691

  5. Structural Insights Into Ribosome Recycling Factor Interactions with the 70S Ribosome

    PubMed Central

    Pai, Raj D.; Zhang, Wen; Schuwirth, Barbara S.; Hirokawa, Go; Kaji, Hideko; Kaji, Akira; Cate, Jamie H.D.

    2009-01-01

    SUMMARY At the end of translation in bacteria, ribosome recycling factor (RRF) is used together with Elongation Factor G (EF-G) to recycle the 30S and 50S ribosomal subunits for the next round of translation. In x-ray crystal structures of RRF with the Escherichia coli 70S ribosome, RRF binds to the large ribosomal subunit in the cleft that contains the peptidyl transferase center (PTC). Upon binding of either E. coli or T. thermophilus RRF to the E. coli ribosome, the tip of ribosomal RNA helix H69 in the large subunit moves away from the small subunit toward RRF by 8 Å, thereby disrupting a key contact between the small and large ribosomal subunits, termed bridge B2a. In the ribosome crystals, the ability of RRF to destabilize bridge B2a is influenced by crystal packing forces. Movement of H69 involves an ordered to disordered transition upon binding of RRF to the ribosome. The disruption of bridge B2a upon RRF binding to the ribosome seen in the present structures reveals one of the key roles that RRF plays in ribosome recycling, the dissociation of 70S ribosomes into subunits. The structures also reveal contacts between Domain II of RRF and protein S12 in the 30S subunit that may also play a role in ribosome recycling. PMID:18234219

  6. Synthesis of ribosomes in Saccharomyces cerevisiae.

    PubMed Central

    Warner, J R

    1989-01-01

    The assembly of a eucaryotic ribosome requires the synthesis of four ribosomal ribonucleic acid (RNA) molecules and more than 75 ribosomal proteins. It utilizes all three RNA polymerases; it requires the cooperation of the nucleus and the cytoplasm, the processing of RNA, and the specific interaction of RNA and protein molecules. It is carried out efficiently and is exquisitely sensitive to the needs of the cell. Our current understanding of this process in the genetically tractable yeast Saccharomyces cerevisiae is reviewed. The ribosomal RNA genes are arranged in a tandem array of 100 to 200 copies. This tandem array has led to unique ways of carrying out a number of functions. Replication is asymmetric and does not initiate from every autonomously replicating sequence. Recombination is suppressed. Transcription of the major ribosomal RNA appears to involve coupling between adjacent transcription units, which are separated by the 5S RNA transcription unit. Genes for many ribosomal proteins have been cloned and sequenced. Few are linked; most are duplicated; most have an intron. There is extensive homology between yeast ribosomal proteins and those of other species. Most, but not all, of the ribosomal protein genes have one or two sites that are essential for their transcription and that bind a common transcription factor. This factor binds also to many other places in the genome, including the telomeres. There is coordinated transcription of the ribosomal protein genes under a variety of conditions. However, the cell seems to possess no mechanism for regulating the transcription of individual ribosomal protein genes in response either to a deficiency or an excess of a particular ribosomal protein. A deficiency causes slow growth. Any excess ribosomal protein is degraded very rapidly, with a half-life of 1 to 5 min. Unlike most types of cells, yeast cells appear not to regulate the translation of ribosomal proteins. However, in the case of ribosomal protein L32

  7. Mechanisms for ribotoxin-induced ribosomal RNA cleavage

    SciTech Connect

    He, Kaiyu; Zhou, Hui-Ren; Pestka, James J.

    2012-11-15

    The Type B trichothecene deoxynivalenol (DON), a ribotoxic mycotoxin known to contaminate cereal-based foods, induces ribosomal RNA (rRNA) cleavage in the macrophage via p38-directed activation of caspases. Here we employed the RAW 264.7 murine macrophage model to test the hypothesis that this rRNA cleavage pathway is similarly induced by other ribotoxins. Capillary electrophoresis confirmed that the antibiotic anisomycin (≥ 25 ng/ml), the macrocylic trichothecene satratoxin G (SG) (≥ 10 ng/ml) and ribosome-inactivating protein ricin (≥ 300 ng/ml) induced 18s and 28s rRNA fragmentation patterns identical to that observed for DON. Also, as found for DON, inhibition of p38, double-stranded RNA-activated kinase (PKR) and hematopoietic cell kinase (Hck) suppressed MAPK anisomycin-induced rRNA cleavage, while, in contrast, their inhibition did not affect SG- and ricin-induced rRNA fragmentation. The p53 inhibitor pifithrin-μ and pan caspase inhibitor Z-VAD-FMK suppressed rRNA cleavage induced by anisomycin, SG and ricin, indicating that these ribotoxins shared with DON a conserved downstream pathway. Activation of caspases 8, 9 and 3 concurrently with apoptosis further suggested that rRNA cleavage occurred in parallel with both extrinsic and intrinsic pathways of programmed cell death. When specific inhibitors of cathepsins L and B (lysosomal cysteine cathepsins active at cytosolic neutral pH) were tested, only the former impaired anisomycin-, SG-, ricin- and DON-induced rRNA cleavage. Taken together, the data suggest that (1) all four ribotoxins induced p53-dependent rRNA cleavage via activation of cathepsin L and caspase 3, and (2) activation of p53 by DON and anisomycin involved p38 whereas SG and ricin activated p53 by an alternative mechanism. Highlights: ► Deoxynivalenol (DON) anisomycin, satratoxin G (SG) and ricin are ribotoxins. ► Ribotoxins induce 18s and 28s rRNA cleavage in the RAW 264.7 macrophage model. ► Ribotoxins induce rRNA cleavage via

  8. Control of ribosome formation in rat heart

    SciTech Connect

    Russo, L.A.

    1987-01-01

    Diabetes of 9 days duration produced a 17% diminution in the rate of total protein synthesis in rat hearts perfused as Langendorff preparations supplied with glucose, plasma levels of amino acids, and 400 ..mu..U/ml insulin. This reduction was attributable to a decrease in efficiency of protein synthesis and total RNA content. Total messenger RNA content decreased in diabetic hearts in proportion to the reduction in total RNA. Diabetes also resulted in diminished ribosome content as reflected by the induction in total RNA. Ribosome production was investigated by monitoring incorporation of (/sup 3/H)phenylalanine into the proteins of cytoplasmic ribosomes. Rates of ribosome formation in diabetic hearts were as fast as control rates in the presence of insulin, and were faster than control rates in the absence of the hormone. These results indicated that ribosome content fell in diabetic hearts despite unchanged or faster rates of ribosome formation.

  9. Seeing is Believing in Ribosome Assembly.

    PubMed

    Warner, Jonathan R

    2016-07-14

    Many proteins have been implicated genetically and biochemically in the assembly of eukaryotic ribosomes. Now, Kornprobst et al. show us how they are put together with a cryoEM structure of the 90S processome that initiates ribosome assembly, revealing the arrangement of U3 RNA and the several UTP complexes that form a chaperone-like structure around and within the developing 40S ribosomal subunit. PMID:27419867

  10. Ribosome biogenesis in the yeast Saccharomyces cerevisiae.

    PubMed

    Woolford, John L; Baserga, Susan J

    2013-11-01

    Ribosomes are highly conserved ribonucleoprotein nanomachines that translate information in the genome to create the proteome in all cells. In yeast these complex particles contain four RNAs (>5400 nucleotides) and 79 different proteins. During the past 25 years, studies in yeast have led the way to understanding how these molecules are assembled into ribosomes in vivo. Assembly begins with transcription of ribosomal RNA in the nucleolus, where the RNA then undergoes complex pathways of folding, coupled with nucleotide modification, removal of spacer sequences, and binding to ribosomal proteins. More than 200 assembly factors and 76 small nucleolar RNAs transiently associate with assembling ribosomes, to enable their accurate and efficient construction. Following export of preribosomes from the nucleus to the cytoplasm, they undergo final stages of maturation before entering the pool of functioning ribosomes. Elaborate mechanisms exist to monitor the formation of correct structural and functional neighborhoods within ribosomes and to destroy preribosomes that fail to assemble properly. Studies of yeast ribosome biogenesis provide useful models for ribosomopathies, diseases in humans that result from failure to properly assemble ribosomes. PMID:24190922

  11. Tricks an IRES uses to enslave ribosomes

    PubMed Central

    2012-01-01

    In eukaryotes, mRNAs are primarily translated through a cap-dependent mechanism whereby initiation factors recruit the 40S ribosomal subunit to a cap structure at the 5’ end of the mRNA. However, some viral and cellular messages initiate protein synthesis without a cap. They use a structured RNA element termed an internal ribosome entry site (IRES) to recruit the 40S ribosomal subunit. IRESs were discovered over 20 years ago but only recently have studies using a model IRES from dicistroviruses expanded our understanding of how a three dimensional RNA structure can capture and manipulate the ribosome to initiate translation. PMID:22944245

  12. Scattering studies on ribosomes in solution

    NASA Astrophysics Data System (ADS)

    Ramakrishnan, V.

    1986-02-01

    Ribosomes are organelles that play a central role in protein synthesis. They are complexes of protein and nucleic acid, and can be analysed as two-component systems by neutron scattering. Moreover, ribosomes can be biochemically prepared that have specific proteins deuterated. Both these properties have been exploited to study the structure of the ribosome by neutron scattering. This article reviews the studies carried out on the small ribosomal subunit, and describes a recent study that has resolved a conflict between the results of two classes of experiments.

  13. Mechanisms for ribotoxin-induced ribosomal RNA cleavage.

    PubMed

    He, Kaiyu; Zhou, Hui-Ren; Pestka, James J

    2012-11-15

    The Type B trichothecene deoxynivalenol (DON), a ribotoxic mycotoxin known to contaminate cereal-based foods, induces ribosomal RNA (rRNA) cleavage in the macrophage via p38-directed activation of caspases. Here we employed the RAW 264.7 murine macrophage model to test the hypothesis that this rRNA cleavage pathway is similarly induced by other ribotoxins. Capillary electrophoresis confirmed that the antibiotic anisomycin (≥25ng/ml), the macrocylic trichothecene satratoxin G (SG) (≥10ng/ml) and ribosome-inactivating protein ricin (≥300ng/ml) induced 18s and 28s rRNA fragmentation patterns identical to that observed for DON. Also, as found for DON, inhibition of p38, double-stranded RNA-activated kinase (PKR) and hematopoietic cell kinase (Hck) suppressed MAPK anisomycin-induced rRNA cleavage, while, in contrast, their inhibition did not affect SG- and ricin-induced rRNA fragmentation. The p53 inhibitor pifithrin-μ and pan caspase inhibitor Z-VAD-FMK suppressed rRNA cleavage induced by anisomycin, SG and ricin, indicating that these ribotoxins shared with DON a conserved downstream pathway. Activation of caspases 8, 9 and 3 concurrently with apoptosis further suggested that rRNA cleavage occurred in parallel with both extrinsic and intrinsic pathways of programmed cell death. When specific inhibitors of cathepsins L and B (lysosomal cysteine cathepsins active at cytosolic neutral pH) were tested, only the former impaired anisomycin-, SG-, ricin- and DON-induced rRNA cleavage. Taken together, the data suggest that (1) all four ribotoxins induced p53-dependent rRNA cleavage via activation of cathepsin L and caspase 3, and (2) activation of p53 by DON and anisomycin involved p38 whereas SG and ricin activated p53 by an alternative mechanism. PMID:23022514

  14. Mechanisms for Ribotoxin-induced Ribosomal RNA Cleavage

    PubMed Central

    He, Kaiyu; Zhou, Hui-Ren; Pestka, James J.

    2012-01-01

    The Type B trichothecene deoxynivalenol (DON), a ribotoxic mycotoxin known to contaminate cereal-based foods, induces ribosomal RNA (rRNA) cleavage in the macrophage via p38-directed activation of caspases. Here we employed the RAW 264.7 murine macrophage model to test the hypothesis that this rRNA cleavage pathway is similarly induced by other ribotoxins. Capillary electrophoresis confirmed that the antibiotic anisomycin (≥25 ng/ml), the macrocylic trichothecene satratoxin G (SG) (≥10 ng/ml) and ribosome-inactivating protein ricin (≥300 ng/ml) induced 18s and 28s rRNA fragmentation patterns identical to that observed for DON. Also, as found for DON, inhibition of p38, double-stranded RNA-activated kinase (PKR) and hematopoietic cell kinase (Hck) suppressed MAPK anisomycin-induced rRNA cleavage, while, in contrast, their inhibition did not affect SG- and ricin-induced rRNA fragmentation. The p53 inhibitor pifithrin-μ and pan caspase inhibitor Z-VAD-FMK suppressed rRNA cleavage induced by anisomycin, SG and ricin, indicating that these ribotoxins shared with DON a conserved downstream pathway. Activation of caspase 8, 9 and 3 concurrently with apoptosis further suggested rRNA cleavage occurred in parallel with both extrinsic and intrinsic pathways of programmed cell death. When specific inhibitors cathepsin L and B (lysosomal cysteine cathepsins active at cytosolic neutral pH) were tested, only the former impaired anisomycin-, SG-, ricin- and DON-induced rRNA cleavage. Taken together, the data suggest that (1) all four ribotoxins induced p53-dependent rRNA cleavage via activation of cathepsin L and caspase 3, and (2) activation of p53 by DON and anisomycin involved p38 whereas SG and ricin activated p53 by an alternative mechanism. PMID:23022514

  15. Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation.

    PubMed

    Al-Hadid, Qais; White, Jonelle; Clarke, Steven

    2016-02-12

    A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. PMID:26801560

  16. Ribosome Mechanics Informs about Mechanism.

    PubMed

    Zimmermann, Michael T; Jia, Kejue; Jernigan, Robert L

    2016-02-27

    The essential aspects of the ribosome's mechanism can be extracted from coarse-grained simulations, including the ratchet motion, the movement together of critical bases at the decoding center, and movements of the peptide tunnel lining that assist in the expulsion of the synthesized peptide. Because of its large size, coarse graining helps to simplify and to aid in the understanding of its mechanism. Results presented here utilize coarse-grained elastic network modeling to extract the dynamics, and both RNAs and proteins are coarse grained. We review our previous results, showing the well-known ratchet motions and the motions in the peptide tunnel and in the mRNA tunnel. The motions of the lining of the peptide tunnel appear to assist in the expulsion of the growing peptide chain, and clamps at the ends of the mRNA tunnel with three proteins ensure that the mRNA is held tightly during decoding and essential for the helicase activity at the entrance. The entry clamp may also assist in base recognition to ensure proper selection of the incoming tRNA. The overall precision of the ribosome machine-like motions is remarkable. PMID:26687034

  17. Mitomycin C Inhibits Ribosomal RNA

    PubMed Central

    Snodgrass, Ryan G.; Collier, Abby C.; Coon, Amy E.; Pritsos, Chris A.

    2010-01-01

    Mitomycin C (MMC) is a commonly used and extensively studied chemotherapeutic agent requiring biological reduction for activity. Damage to nuclear DNA is thought to be its primary mechanism of cell death. Due to a lack of evidence for significant MMC activation in the nucleus and for in vivo studies demonstrating the formation of MMC-DNA adducts, we chose to investigate alternative nucleic acid targets. Real-time reverse transcription-PCR was used to determine changes in mitochondrial gene expression induced by MMC treatment. Although no consistent effects on mitochondrial mRNA expression were observed, complementary results from reverse transcription-PCR experiments and gel-shift and binding assays demonstrated that MMC rapidly decreased the transcript levels of 18S ribosomal RNA in a concentration-dependent manner. Under hypoxic conditions, transcript levels of 18S rRNA decreased by 1.5-fold compared with untreated controls within 30 min. Recovery to base line required several hours, indicating that de novo synthesis of 18S was necessary. Addition of MMC to an in vitro translation reaction significantly decreased protein production in the cell-free system. Functional assays performed using a luciferase reporter construct in vivo determined that protein translation was inhibited, further confirming this mechanism of toxicity. The interaction of MMC with ribosomal RNA and subsequent inhibition of protein translation is consistent with mechanisms proposed for other natural compounds. PMID:20418373

  18. Phylogenetic Analysis of the Spider Mite Sub-Family Tetranychinae (Acari: Tetranychidae) Based on the Mitochondrial COI Gene and the 18S and the 5′ End of the 28S rRNA Genes Indicates That Several Genera Are Polyphyletic

    PubMed Central

    Matsuda, Tomoko; Morishita, Maiko; Hinomoto, Norihide; Gotoh, Tetsuo

    2014-01-01

    The spider mite sub-family Tetranychinae includes many agricultural pests. The internal transcribed spacer (ITS) region of nuclear ribosomal RNA genes and the cytochrome c oxidase subunit I (COI) gene of mitochondrial DNA have been used for species identification and phylogenetic reconstruction within the sub-family Tetranychinae, although they have not always been successful. The 18S and 28S rRNA genes should be more suitable for resolving higher levels of phylogeny, such as tribes or genera of Tetranychinae because these genes evolve more slowly and are made up of conserved regions and divergent domains. Therefore, we used both the 18S (1,825–1,901 bp) and 28S (the 5′ end of 646–743 bp) rRNA genes to infer phylogenetic relationships within the sub-family Tetranychinae with a focus on the tribe Tetranychini. Then, we compared the phylogenetic tree of the 18S and 28S genes with that of the mitochondrial COI gene (618 bp). As observed in previous studies, our phylogeny based on the COI gene was not resolved because of the low bootstrap values for most nodes of the tree. On the other hand, our phylogenetic tree of the 18S and 28S genes revealed several well-supported clades within the sub-family Tetranychinae. The 18S and 28S phylogenetic trees suggest that the tribes Bryobiini, Petrobiini and Eurytetranychini are monophyletic and that the tribe Tetranychini is polyphyletic. At the genus level, six genera for which more than two species were sampled appear to be monophyletic, while four genera (Oligonychus, Tetranychus, Schizotetranychus and Eotetranychus) appear to be polyphyletic. The topology presented here does not fully agree with the current morphology-based taxonomy, so that the diagnostic morphological characters of Tetranychinae need to be reconsidered. PMID:25289639

  19. Biochemical characterization of three mycobacterial ribosomal fractions.

    PubMed

    Portelance, V; Beaudet, R

    1983-02-01

    The induction of antituberculous immunity by crude ribosomal fractions isolated from Mycobacterium tuberculosis strain H37Ra, M. bovis strain BCG, and M. smegmatis was studied in CF-1 mice. Levels of antituberculous immunity similar to that induced by live BCG were induced by the BCG and H37Ra ribosomal fractions whereas that isolated from M. smegmatis was found to be inactive. Electrophoresis of the three ribosomal fractions in sodium dodecyl sulfate - polyacylamide gels followed by differential staining showed the two active ribosomal fractions to be similar in their proteins, carbohydrate-containing substances, and lipid profiles. The inactive smegmatis ribosomal fraction differed mainly from the active ones on the basis of its carbohydrate-containing substances profile and by the absence of lipids. The polysaccharides and the ribosomes present in the H37Ra ribosomal fractions were purified by affinity chromatography on concanavalin A - Sepharose 4B. Each purified preparation showed no or only low antituberculous activity when injected separately, but when mixed together a high protection was observed. The formation of complexes between the ribosomes and the polysaccharide fraction was suggested and appears to be necessary for the induction of antituberculous immunity. PMID:6189570

  20. Ribosome flow model with positive feedback

    PubMed Central

    Margaliot, Michael; Tuller, Tamir

    2013-01-01

    Eukaryotic mRNAs usually form a circular structure; thus, ribosomes that terminatae translation at the 3′ end can diffuse with increased probability to the 5′ end of the transcript, initiating another cycle of translation. This phenomenon describes ribosomal flow with positive feedback—an increase in the flow of ribosomes terminating translating the open reading frame increases the ribosomal initiation rate. The aim of this paper is to model and rigorously analyse translation with feedback. We suggest a modified version of the ribosome flow model, called the ribosome flow model with input and output. In this model, the input is the initiation rate and the output is the translation rate. We analyse this model after closing the loop with a positive linear feedback. We show that the closed-loop system admits a unique globally asymptotically stable equilibrium point. From a biophysical point of view, this means that there exists a unique steady state of ribosome distributions along the mRNA, and thus a unique steady-state translation rate. The solution from any initial distribution will converge to this steady state. The steady-state distribution demonstrates a decrease in ribosome density along the coding sequence. For the case of constant elongation rates, we obtain expressions relating the model parameters to the equilibrium point. These results may perhaps be used to re-engineer the biological system in order to obtain a desired translation rate. PMID:23720534

  1. Evolution of the ribosome at atomic resolution

    PubMed Central

    Petrov, Anton S.; Bernier, Chad R.; Hsiao, Chiaolong; Norris, Ashlyn M.; Kovacs, Nicholas A.; Waterbury, Chris C.; Stepanov, Victor G.; Harvey, Stephen C.; Fox, George E.; Wartell, Roger M.; Hud, Nicholas V.; Williams, Loren Dean

    2014-01-01

    The origins and evolution of the ribosome, 3–4 billion years ago, remain imprinted in the biochemistry of extant life and in the structure of the ribosome. Processes of ribosomal RNA (rRNA) expansion can be “observed” by comparing 3D rRNA structures of bacteria (small), yeast (medium), and metazoans (large). rRNA size correlates well with species complexity. Differences in ribosomes across species reveal that rRNA expansion segments have been added to rRNAs without perturbing the preexisting core. Here we show that rRNA growth occurs by a limited number of processes that include inserting a branch helix onto a preexisting trunk helix and elongation of a helix. rRNA expansions can leave distinctive atomic resolution fingerprints, which we call “insertion fingerprints.” Observation of insertion fingerprints in the ribosomal common core allows identification of probable ancestral expansion segments. Conceptually reversing these expansions allows extrapolation backward in time to generate models of primordial ribosomes. The approach presented here provides insight to the structure of pre-last universal common ancestor rRNAs and the subsequent expansions that shaped the peptidyl transferase center and the conserved core. We infer distinct phases of ribosomal evolution through which ribosomal particles evolve, acquiring coding and translocation, and extending and elaborating the exit tunnel. PMID:24982194

  2. Complementary roles of initiation factor 1 and ribosome recycling factor in 70S ribosome splitting

    PubMed Central

    Pavlov, Michael Y; Antoun, Ayman; Lovmar, Martin; Ehrenberg, Måns

    2008-01-01

    We demonstrate that ribosomes containing a messenger RNA (mRNA) with a strong Shine–Dalgarno sequence are rapidly split into subunits by initiation factors 1 (IF1) and 3 (IF3), but slowly split by ribosome recycling factor (RRF) and elongation factor G (EF-G). Post-termination-like (PTL) ribosomes containing mRNA and a P-site-bound deacylated transfer RNA (tRNA) are split very rapidly by RRF and EF-G, but extremely slowly by IF1 and IF3. Vacant ribosomes are split by RRF/EF-G much more slowly than PTL ribosomes and by IF1/IF3 much more slowly than mRNA-containing ribosomes. These observations reveal complementary splitting of different ribosomal complexes by IF1/IF3 and RRF/EF-G, and suggest the existence of two major pathways for ribosome splitting into subunits in the living cell. We show that the identity of the deacylated tRNA in the PTL ribosome strongly affects the rate by which it is split by RRF/EF-G and that IF3 is involved in the mechanism of ribosome splitting by IF1/IF3 but not by RRF/EF-G. With support from our experimental data, we discuss the principally different mechanisms of ribosome splitting by IF1/IF3 and by RRF/EF-G. PMID:18497739

  3. Systematics of Chaetognatha under the light of molecular data, using duplicated ribosomal 18S DNA sequences.

    PubMed

    Papillon, Daniel; Perez, Yvan; Caubit, Xavier; Le Parco, Yannick

    2006-03-01

    While the phylogenetic position of Chaetognatha has became central to the question of early bilaterian evolution, the internal systematics of the phylum are still not clear. The phylogenetic relationships of the chaetognaths were investigated using newly obtained small subunit ribosomal RNA nuclear 18S (SSU rRNA) sequences from 16 species together with 3 sequences available in GenBank. As previously shown with the large subunit ribosomal RNA 28S gene, two classes of Chaetognatha SSU rRNA gene can be identified, suggesting a duplication of the whole ribosomal cluster; allowing the rooting of one class of genes by another in phylogenetic analyses. Maximum Parsimony, Maximum Likelihood and Bayesian analyses of the molecular data, and statistical tests showed (1) that there are three main monophyletic groups: Sagittidae/Krohnittidae, Spadellidae/Pterosagittidae, and Eukrohniidae/Heterokrohniidae, (2) that the group of Aphragmophora without Pterosagittidae (Sagittidae/Krohnittidae) is monophyletic, (3) the Spadellidae/Pterosagittidae and Eukrohniidae/Heterokrohniidae families are very likely clustered, (4) the Krohnittidae and Pterosagittidae groups should no longer be considered as families as they are included in other groups designated as families, (5) suborder Ctenodontina is not monophyletic and the Flabellodontina should no longer be considered as a suborder, and (6) the Syngonata/Chorismogonata and the Monophragmophora/Biphragmophora hypotheses are rejected. Such conclusions are considered in the light of morphological characters, several of which are shown to be prone to homoplasy. PMID:16434216

  4. Viral IRES RNA structures and ribosome interactions.

    PubMed

    Kieft, Jeffrey S

    2008-06-01

    In eukaryotes, protein synthesis initiates primarily by a mechanism that requires a modified nucleotide 'cap' on the mRNA and also proteins that recruit and position the ribosome. Many pathogenic viruses use an alternative, cap-independent mechanism that substitutes RNA structure for the cap and many proteins. The RNAs driving this process are called internal ribosome-entry sites (IRESs) and some are able to bind the ribosome directly using a specific 3D RNA structure. Recent structures of IRES RNAs and IRES-ribosome complexes are revealing the structural basis of viral IRES' 'hijacking' of the protein-making machinery. It now seems that there are fundamental differences in the 3D structures used by different IRESs, although there are some common features in how they interact with ribosomes. PMID:18468443

  5. Differential Stoichiometry among Core Ribosomal Proteins

    PubMed Central

    Slavov, Nikolai; Semrau, Stefan; Airoldi, Edoardo; Budnik, Bogdan; van Oudenaarden, Alexander

    2015-01-01

    Summary Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs), some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC) and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function. PMID:26565899

  6. Ribosome defects in disorders of erythropoiesis.

    PubMed

    Narla, Anupama; Hurst, Slater N; Ebert, Benjamin L

    2011-02-01

    Over the past decade, genetic lesions that cause ribosome dysfunction have been identified in both congenital and acquired human disorders. These discoveries have established a new category of disorders, known as ribosomopathies, in which the primary pathophysiology is related to impaired ribosome function. The protoptypical disorders are Diamond-Blackfan anemia, a congenital bone marrow failure syndrome, and the 5q- syndrome, a subtype of myelodysplastic syndrome. In both of these disorders, impaired ribosome function causes a severe macrocytic anemia. In this review, we will discuss the evidence that defects in ribosomal biogenesis cause the hematologic phenotype of Diamond-Blackfan anemia and the 5q- syndrome. We will also explore the potential mechanisms by which a ribosomal defect, which would be expected to have widespread consequences, may lead to specific defects in erythropoiesis. PMID:21279816

  7. Viral IRES RNA structures and ribosome interactions

    PubMed Central

    Kieft, Jeffrey S.

    2009-01-01

    In eukaryotes, protein synthesis initiates primarily by a mechanism that requires a modified nucleotide ‘cap’ on the mRNA and also proteins that recruit and position the ribosome. Many pathogenic viruses use an alternative, cap-independent mechanism that substitutes RNA structure for the cap and many proteins. The RNAs driving this process are called internal ribosome-entry sites (IRESs) and some are able to bind the ribosome directly using a specific 3D RNA structure. Recent structures of IRES RNAs and IRES–ribosome complexes are revealing the structural basis of viral IRES’ ‘hijacking’ of the protein-making machinery. It now seems that there are fundamental differences in the 3D structures used by different IRESs, although there are some common features in how they interact with ribosomes. PMID:18468443

  8. Interaction of Chloramphenicol Tripeptide Analogs with Ribosomes.

    PubMed

    Tereshchenkov, A G; Shishkina, A V; Tashlitsky, V N; Korshunova, G A; Bogdanov, A A; Sumbatyan, N V

    2016-04-01

    Chloramphenicol amine peptide derivatives containing tripeptide fragments of regulatory "stop peptides" - MRL, IRA, IWP - were synthesized. The ability of the compounds to form ribosomal complexes was studied by displacement of the fluorescent erythromycin analog from its complex with E. coli ribosomes. It was found that peptide chloramphenicol analogs are able to bind to bacterial ribosomes. The dissociation constants were 4.3-10 µM, which is 100-fold lower than the corresponding values for chloramphenicol amine-ribosome complex. Interaction of the chloramphenicol peptide analogs with ribosomes was simulated by molecular docking, and the most probable contacts of "stop peptide" motifs with the elements of nascent peptide exit tunnel were identified. PMID:27293096

  9. Differential Stoichiometry among Core Ribosomal Proteins.

    PubMed

    Slavov, Nikolai; Semrau, Stefan; Airoldi, Edoardo; Budnik, Bogdan; van Oudenaarden, Alexander

    2015-11-01

    Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs), some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC) and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function. PMID:26565899

  10. NML-mediated rRNA base methylation links ribosomal subunit formation to cell proliferation in a p53-dependent manner.

    PubMed

    Waku, Tsuyoshi; Nakajima, Yuka; Yokoyama, Wataru; Nomura, Naoto; Kako, Koichiro; Kobayashi, Akira; Shimizu, Toshiyuki; Fukamizu, Akiyoshi

    2016-06-15

    Ribosomal RNAs (rRNAs) act as scaffolds and ribozymes in ribosomes, and these functions are modulated by post-transcriptional modifications. However, the biological role of base methylation, a well-conserved modification of rRNA, is poorly understood. Here, we demonstrate that a nucleolar factor, nucleomethylin (NML; also known as RRP8), is required for the N(1)-methyladenosine (m(1)A) modification in 28S rRNAs of human and mouse cells. NML also contributes to 60S ribosomal subunit formation. Intriguingly, NML depletion increases 60S ribosomal protein L11 (RPL11) levels in the ribosome-free fraction and protein levels of p53 through an RPL11-MDM2 complex, which activates the p53 pathway. Consequently, the growth of NML-depleted cells is suppressed in a p53-dependent manner. These observations reveal a new biological function of rRNA base methylation, which links ribosomal subunit formation to p53-dependent inhibition of cell proliferation in mammalian cells. PMID:27149924

  11. The catalytic subunit of shiga-like toxin 1 interacts with ribosomal stalk proteins and is inhibited by their conserved C-terminal domain.

    PubMed

    McCluskey, Andrew J; Poon, Gregory M K; Bolewska-Pedyczak, Eleonora; Srikumar, Tharan; Jeram, Stanley M; Raught, Brian; Gariépy, Jean

    2008-04-25

    Shiga-like toxin 1 (SLT-1) is a type II ribosome-inactivating protein; its A(1) domain blocks protein synthesis in eukaryotic cells by catalyzing the depurination of a single adenine base in 28 S rRNA. The molecular mechanism leading to this site-specific depurination event is thought to involve interactions with eukaryotic ribosomal proteins. Here, we present evidence that the A(1) chain of SLT-1 binds to the ribosomal proteins P0, P1, and P2. These proteins were identified from a HeLa cell lysate by tandem mass spectrometry, and subsequently confirmed to bind to SLT-1 A(1) chain by yeast-two-hybrid and pull-down experiments using candidate full-length proteins. Moreover, the removal of the last 17 amino acids of either protein P1 or P2 abolishes the interaction with the A(1) chain, whereas P0, lacking this common C terminus, still binds to the A(1) domain. In vitro pull-down experiments using fusion protein-tagged C-terminal peptides corresponding to the common 7, 11, and 17 terminal residues of P1 and P2 confirmed that the A(1) chain of SLT-1 as well as the A chain of ricin bind to this shared C-terminal peptide motif. More importantly, a synthetic peptide corresponding to the 17 amino acid C terminus of P1 and P2 was shown to inhibit the ribosome-inactivating function of the A(1) chain of SLT-1 in an in vitro transcription and translation-coupled assay. These results suggest a role for the ribosomal stalk in aiding the A(1) chain of SLT-1 and other type II ribosome-inactivating proteins in localizing its catalytic domain near the site of depurination in the 28 S rRNA. PMID:18358491

  12. Decreased activity of Blastocladiella emersonii zoospore ribosomes: correlation with developmental changes in ribosome-associated proteins.

    PubMed

    Jaworski, A J; Wilson, J B

    1989-10-01

    Ribosomal proteins isolated from dormant zoospores were compared to the ribosomal proteins found in the active growth phase by two-dimensional polyacrylamide gel electrophoresis. Zoospore ribosomes were found to contain a set of five proteins, designated Z1 to Z5, which were not present in growth phase ribosomes. The Z1-Z5 proteins were not removed by high-salt washes using either 1 M KCl or 1 M NH4 Cl. The Z1 protein is found associated with zoospore 60 S subunits while Z2-Z5 are bound to 40 S subunits. Zoospore monoribosomes and polyribosomes contain comparable levels of each of the five proteins. Approximately 60 min. after sporulation is induced, the Z1-Z5 proteins begin to accumulate on the ribosomes with the highest levels of these proteins found associated with ribosomes at the zoospore stage. During germination, the proteins gradually disappear and are not detectable on the ribosomes after 4 hr of germination. The presence of the Z1-Z5 proteins correlates with a decrease in in vitro protein synthetic activity of the fungal ribosomes. The data are consistent with the hypothesis that the proteins regulate translation by completely blocking protein synthesis on a subset of ribosomes while the remainder of the ribosomes function at normal rates. PMID:2776972

  13. Ribosomopathies: human disorders of ribosome dysfunction.

    PubMed

    Narla, Anupama; Ebert, Benjamin L

    2010-04-22

    Ribosomopathies compose a collection of disorders in which genetic abnormalities cause impaired ribosome biogenesis and function, resulting in specific clinical phenotypes. Congenital mutations in RPS19 and other genes encoding ribosomal proteins cause Diamond-Blackfan anemia, a disorder characterized by hypoplastic, macrocytic anemia. Mutations in other genes required for normal ribosome biogenesis have been implicated in other rare congenital syndromes, Schwachman-Diamond syndrome, dyskeratosis congenita, cartilage hair hypoplasia, and Treacher Collins syndrome. In addition, the 5q- syndrome, a subtype of myelodysplastic syndrome, is caused by a somatically acquired deletion of chromosome 5q, which leads to haploinsufficiency of the ribosomal protein RPS14 and an erythroid phenotype highly similar to Diamond-Blackfan anemia. Acquired abnormalities in ribosome function have been implicated more broadly in human malignancies. The p53 pathway provides a surveillance mechanism for protein translation as well as genome integrity and is activated by defects in ribosome biogenesis; this pathway appears to be a critical mediator of many of the clinical features of ribosomopathies. Elucidation of the mechanisms whereby selective abnormalities in ribosome biogenesis cause specific clinical syndromes will hopefully lead to novel therapeutic strategies for these diseases. PMID:20194897

  14. Ribonucleic acid and ribosomes of Bacillus stearothermophilus.

    PubMed

    Saunders, G F; Campbell, L L

    1966-01-01

    Saunders, Grady F. (University of Illinois, Urbana), and L. Leon Campbell. Ribonucleic acid and ribosomes of Bacillus stearothermophilus. J. Bacteriol. 91:332-339. 1966.-The ability of some thermophilic bacteria to grow at temperatures as high as 76 C emphasizes the remarkable thermal stability of their crucial macromolecules. An investigation of the ribonucleic acid (RNA) and ribosomes of Bacillus stearothermophilus was conducted. Washed log-phase cells were disrupted either by sonic treatment or by alumina grinding in 10(-2)m MgCl(2)-10(-2)m tris-(hydroxymethyl)aminomethane buffer, pH 7.4 (TM buffer). Ultracentrifugal analysis revealed peaks at 72.5S, 101S, and 135S, with the 101S peak being the most prominent. By lowering the Mg(++) concentration to 10(-3)m, the ribosome preparation was dissociated to give 40S, 31S, and 54S peaks. These in turn were reassociated in the presence of 10(-2)m Mg(++) to give the larger 73S and 135S particles. When heated in TM buffer, Escherichia coli ribosomes began a gradual dissociation at 58 C, and at 70 C underwent a large hyperchromic shift with a T(m) at 72.8 C. In contrast, B. stearothermophilus ribosomes did not show a hyperchromic shift below 70 C; they had a T(m) of 77.9 C. The thermal denaturation curves of the 4S, 16S, and 23S RNA from both organisms were virtually identical. The gross amino acid composition of B. stearothermophilus ribosomes showed no marked differences from that reported for E. coli ribosomes. These data suggest that the unusual thermal stability of B. stearothermophilus ribosomes may reflect either an unusual packing arrangement of the protein to the RNA or differences in the primary structure of the ribosomal proteins. PMID:5903099

  15. Phylogenetic Analysis Using the 28S rRNA Gene Reveals That the Genus Paracreptotrema (Digenea: Allocreadiidae) Is Not Monophyletic; Description of Two New Genera and One New Species.

    PubMed

    de León, Gerardo Pérez-Ponce; Pinacho-Pinacho, Carlos D; Mendoza-Garfias, Berenit; Choudhury, Anindo; García-Varela, Martín

    2016-02-01

    This study investigates the systematics of Paracreptotrema Choudhury, Pérez-Ponce de León, Brooks and Daverdin, 2006 using morphological data (stained whole mounts and scanning electron microscopy) and partial sequences of the 28S ribosomal rRNA gene, obtained from freshly collected material. In total, 484 specimens representing 4 species, i.e., Paracreptotrema blancoi (157), Paracreptotrema profundulusi (12), Paracreptotrema rosenthali (8), and Paracreptotrema blancoi sensu Salgado-Maldonado et al. (2011) (307) were collected. Existing museum depositions were also studied. The 28S rRNA gene sequences of these Paracreptotrema spp. were aligned, along with sequences from 22 other allocreadiids and 4 other non-allocreadiid xiphidiatan species. Bayesian inference and maximum likelihood analyses indicated a paraphyletic Paracreptotrema split into 3 clades: 1 comprising P. blancoi and P. rosenthali that was sister to a clade formed by 3 other species of allocreadiids (species of Wallinia, Creptotrematina, and Auriculostoma) typically found in characid fishes, a second clade formed solely by Paracreptotrema heterandriae as the sister taxon of the aforementioned species, and a third by P. profundulusi and specimens erroneously identified as P. blancoi. Two new taxa were erected to reflect these results: Paracreptotrematoides for Paracreptotrema heterandriae, and Pseudoparacreptotrema for Paracreptotrema profundulusi and P. macroacetabulata (the species erroneously identified as P. blancoi from profundulids across Middle America). Closer consideration of the morphology corroborates these findings. The revised systematics also indicated that Paracreptotrema spp. are found in poeciliids, whereas Pseudoparacreptotrema spp. parasitize profundulids. The study demonstrates the value of an integrative taxonomy approach to address the apparently complicated systematics of the allocreadiids. PMID:26561039

  16. A new system for naming ribosomal proteins

    PubMed Central

    Ban, Nenad; Beckmann, Roland; Cate, Jamie HD; Dinman, Jonathan D; Dragon, François; Ellis, Steven R; Lafontaine, Denis LJ; Lindahl, Lasse; Liljas, Anders; Lipton, Jeffrey M; McAlear, Michael A; Moore, Peter B; Noller, Harry F; Ortega, Joaquin; Panse, Vikram Govind; Ramakrishnan, V; Spahn, Christian MT; Steitz, Thomas A; Tchorzewski, Marek; Tollervey, David; Warren, Alan J; Williamson, James R; Wilson, Daniel; Yonath, Ada; Yusupov, Marat

    2015-01-01

    A system for naming ribosomal proteins is described that the authors intend to use in the future. They urge others to adopt it. The objective is to eliminate the confusion caused by the assignment of identical names to ribosomal proteins from different species that are unrelated in structure and function. In the system proposed here, homologous ribosomal proteins are assigned the same name, regardless of species. It is designed so that new names are similar enough to old names to be easily recognized, but are written in a format that unambiguously identifies them as ‘new system’ names. PMID:24524803

  17. The economics of ribosome biosynthesis in yeast.

    PubMed

    Warner, J R

    1999-11-01

    In a rapidly growing yeast cell, 60% of total transcription is devoted to ribosomal RNA, and 50% of RNA polymerase II transcription and 90% of mRNA splicing are devoted to ribosomal proteins (RPs). Coordinate regulation of the approximately 150 rRNA genes and 137 RP genes that make such prodigious use of resources is essential for the economy of the cell. This is entrusted to a number of signal transduction pathways that can abruptly induce or silence the ribosomal genes, leading to major implications for the expression of other genes as well. PMID:10542411

  18. Computational studies of molecular machines: the ribosome.

    PubMed

    Sanbonmatsu, Karissa Y

    2012-04-01

    The past decade has produced an avalanche of experimental data on the structure and dynamics of the ribosome. Groundbreaking studies in structural biology and kinetics have placed important constraints on ribosome structural dynamics. However, a gulf remains between static structures and time dependent data. In particular, X-ray crystallography and cryo-EM studies produce static models of the ribosome in various states, but lack dynamic information. Single molecule studies produce information on the rates of transitions between these states but do not have high-resolution spatial information. Computational studies have aided in bridging this gap by providing atomic resolution simulations of structural fluctuations and transitions between configurations. PMID:22336622

  19. Computational studies of molecular machines: the ribosome

    PubMed Central

    Sanbonmatsu, Karissa Y.

    2013-01-01

    The past decade has produced an avalanche of experimental data on the structure and dynamics of the ribosome. Groundbreaking studies in structural biology and kinetics have placed important constraints on ribosome structural dynamics. However, a gulf remains between static structures and time dependent data. In particular, x-ray crystallography and cryo-EM studies produce static models of the ribosome in various states, but lack dynamic information. Single molecule studies produce information on the rates of transitions between these states but do not have high-resolution spatial information. Computational studies have aided in bridging this gap by providing atomic resolution simulations of structural fluctuations and transitions between configurations. PMID:22336622

  20. The NF45/NF90 Heterodimer Contributes to the Biogenesis of 60S Ribosomal Subunits and Influences Nucleolar Morphology

    PubMed Central

    Wandrey, Franziska; Montellese, Christian; Koos, Krisztian; Badertscher, Lukas; Bammert, Lukas; Cook, Atlanta G.; Zemp, Ivo; Horvath, Peter

    2015-01-01

    The interleukin enhancer binding factors ILF2 (NF45) and ILF3 (NF90/NF110) have been implicated in various cellular pathways, such as transcription, microRNA (miRNA) processing, DNA repair, and translation, in mammalian cells. Using tandem affinity purification, we identified human NF45 and NF90 as components of precursors to 60S (pre-60S) ribosomal subunits. NF45 and NF90 are enriched in nucleoli and cosediment with pre-60S ribosomal particles in density gradient analysis. We show that association of the NF45/NF90 heterodimer with pre-60S ribosomal particles requires the double-stranded RNA binding domains of NF90, while depletion of NF45 and NF90 by RNA interference leads to a defect in 60S biogenesis. Nucleoli of cells depleted of NF45 and NF90 have altered morphology and display a characteristic spherical shape. These effects are not due to impaired rRNA transcription or processing of the precursors to 28S rRNA. Consistent with a role of the NF45/NF90 heterodimer in nucleolar steps of 60S subunit biogenesis, downregulation of NF45 and NF90 leads to a p53 response, accompanied by induction of the cyclin-dependent kinase inhibitor p21/CIP1, which can be counteracted by depletion of RPL11. Together, these data indicate that NF45 and NF90 are novel higher-eukaryote-specific factors required for the maturation of 60S ribosomal subunits. PMID:26240280

  1. Introns regulate the production of ribosomal proteins by modulating splicing of duplicated ribosomal protein genes.

    PubMed

    Petibon, Cyrielle; Parenteau, Julie; Catala, Mathieu; Elela, Sherif Abou

    2016-05-01

    Most budding yeast introns exist in the many duplicated ribosomal protein genes (RPGs) and it has been posited that they remain there to modulate the expression of RPGs and cell growth in response to stress. However, the mechanism by which introns regulate the expression of RPGs and their impact on the synthesis of ribosomal proteins remain unclear. In this study, we show that introns determine the ratio of ribosomal protein isoforms through asymmetric paralog-specific regulation of splicing. Exchanging the introns and 3' untranslated regions of the duplicated RPS9 genes altered the splicing efficiency and changed the ratio of the ribosomal protein isoforms. Mutational analysis of the RPS9 genes indicated that splicing is regulated by variations in the intron structure and the 3' untranslated region. Together these data suggest that preferential splicing of duplicated RPGs provides a means for adjusting the ratio of different ribosomal protein isoforms, while maintaining the overall expression level of each ribosomal protein. PMID:26945043

  2. The Ribosome Biogenesis Protein Nol9 Is Essential for Definitive Hematopoiesis and Pancreas Morphogenesis in Zebrafish.

    PubMed

    Bielczyk-Maczyńska, Ewa; Lam Hung, Laure; Ferreira, Lauren; Fleischmann, Tobias; Weis, Félix; Fernández-Pevida, Antonio; Harvey, Steven A; Wali, Neha; Warren, Alan J; Barroso, Inês; Stemple, Derek L; Cvejic, Ana

    2015-12-01

    Ribosome biogenesis is a ubiquitous and essential process in cells. Defects in ribosome biogenesis and function result in a group of human disorders, collectively known as ribosomopathies. In this study, we describe a zebrafish mutant with a loss-of-function mutation in nol9, a gene that encodes a non-ribosomal protein involved in rRNA processing. nol9sa1022/sa1022 mutants have a defect in 28S rRNA processing. The nol9sa1022/sa1022 larvae display hypoplastic pancreas, liver and intestine and have decreased numbers of hematopoietic stem and progenitor cells (HSPCs), as well as definitive erythrocytes and lymphocytes. In addition, ultrastructural analysis revealed signs of pathological processes occurring in endothelial cells of the caudal vein, emphasizing the complexity of the phenotype observed in nol9sa1022/sa1022 larvae. We further show that both the pancreatic and hematopoietic deficiencies in nol9sa1022/sa1022 embryos were due to impaired cell proliferation of respective progenitor cells. Interestingly, genetic loss of Tp53 rescued the HSPCs but not the pancreatic defects. In contrast, activation of mRNA translation via the mTOR pathway by L-Leucine treatment did not revert the erythroid or pancreatic defects. Together, we present the nol9sa1022/sa1022 mutant, a novel zebrafish ribosomopathy model, which recapitulates key human disease characteristics. The use of this genetically tractable model will enhance our understanding of the tissue-specific mechanisms following impaired ribosome biogenesis in the context of an intact vertebrate. PMID:26624285

  3. The Ribosome Biogenesis Protein Nol9 Is Essential for Definitive Hematopoiesis and Pancreas Morphogenesis in Zebrafish

    PubMed Central

    Ferreira, Lauren; Fleischmann, Tobias; Weis, Félix; Fernández-Pevida, Antonio; Harvey, Steven A.; Wali, Neha; Warren, Alan J.; Barroso, Inês; Stemple, Derek L.; Cvejic, Ana

    2015-01-01

    Ribosome biogenesis is a ubiquitous and essential process in cells. Defects in ribosome biogenesis and function result in a group of human disorders, collectively known as ribosomopathies. In this study, we describe a zebrafish mutant with a loss-of-function mutation in nol9, a gene that encodes a non-ribosomal protein involved in rRNA processing. nol9 sa1022/sa1022 mutants have a defect in 28S rRNA processing. The nol9 sa1022/sa1022 larvae display hypoplastic pancreas, liver and intestine and have decreased numbers of hematopoietic stem and progenitor cells (HSPCs), as well as definitive erythrocytes and lymphocytes. In addition, ultrastructural analysis revealed signs of pathological processes occurring in endothelial cells of the caudal vein, emphasizing the complexity of the phenotype observed in nol9 sa1022/sa1022 larvae. We further show that both the pancreatic and hematopoietic deficiencies in nol9 sa1022/sa1022 embryos were due to impaired cell proliferation of respective progenitor cells. Interestingly, genetic loss of Tp53 rescued the HSPCs but not the pancreatic defects. In contrast, activation of mRNA translation via the mTOR pathway by L-Leucine treatment did not revert the erythroid or pancreatic defects. Together, we present the nol9 sa1022/sa1022 mutant, a novel zebrafish ribosomopathy model, which recapitulates key human disease characteristics. The use of this genetically tractable model will enhance our understanding of the tissue-specific mechanisms following impaired ribosome biogenesis in the context of an intact vertebrate. PMID:26624285

  4. The tails of ubiquitin precursors are ribosomal proteins whose fusion to ubiquitin facilitates ribosome biogenesis

    NASA Astrophysics Data System (ADS)

    Finley, Daniel; Bartel, Bonnie; Varshavsky, Alexander

    1989-03-01

    Three of the four yeast ubiquitin genes encode hybrid proteins which are cleaved to yield ubiquitin and previously unidentified ribosomal proteins. The transient association between ubiquitin and these proteins promotes their incorporation into nascent ribosomes and is required for efficient ribosome biogenesis. These results suggest a novel 'chaperone' function for ubiquitin, in which its covalent association with other proteins promotes the formation of specific cellular structures.

  5. Marrow failure: a window into ribosome biology.

    PubMed

    Ruggero, Davide; Shimamura, Akiko

    2014-10-30

    Diamond-Blackfan anemia, Shwachman-Diamond syndrome, and dyskeratosis congenita are inherited syndromes characterized by marrow failure, congenital anomalies, and cancer predisposition. Genetic and molecular studies have uncovered distinct abnormalities in ribosome biogenesis underlying each of these 3 disorders. How defects in ribosomes, the essential organelles required for protein biosynthesis in all cells, cause tissue-specific abnormalities in human disease remains a question of fundamental scientific and medical importance. Here we review the overlapping and distinct clinical features of these 3 syndromes and discuss current knowledge regarding the ribosomal pathways disrupted in each of these disorders. We also explore the increasing complexity of ribosome biology and how this informs our understanding of developmental biology and human disease. PMID:25237201

  6. Marrow failure: a window into ribosome biology

    PubMed Central

    Ruggero, Davide

    2014-01-01

    Diamond-Blackfan anemia, Shwachman-Diamond syndrome, and dyskeratosis congenita are inherited syndromes characterized by marrow failure, congenital anomalies, and cancer predisposition. Genetic and molecular studies have uncovered distinct abnormalities in ribosome biogenesis underlying each of these 3 disorders. How defects in ribosomes, the essential organelles required for protein biosynthesis in all cells, cause tissue-specific abnormalities in human disease remains a question of fundamental scientific and medical importance. Here we review the overlapping and distinct clinical features of these 3 syndromes and discuss current knowledge regarding the ribosomal pathways disrupted in each of these disorders. We also explore the increasing complexity of ribosome biology and how this informs our understanding of developmental biology and human disease. PMID:25237201

  7. The immunological properties of Brucella ribosomal preparations.

    PubMed

    Corbel, M J

    1976-01-01

    Ribosomes were isolated from Brucella abortus strains 19 and 45/20 by disruption of the cells followed by differential ultracentrifugation. The ribosome preparations contained 2-3 components reacting in immunodiffusion tests but were free of detectable lipopolysaccharide-protein agglutinogen. They crossreacted with antisera to Br. abortus, Br. melitensis, Br. suis and Br. ovis and elicited intradermal delayed hypersensitivity reactions in animals infected with Br. abortus, Br. melitensis or Br. suis. The ribosomes were antigenic in rabbits, guinea pigs and mice. Those from Br. abortus S19 induced agglutinins reaction with smooth brucella strains whereas those from Br. abortus 45/20 induced agglutinins reacting with rough brucella strains. Cattle vaccinated with S19 or 45/20 vaccines or infected with Br. abortus developed pricipitins to ribosomal components at an early stage in the immune response. PMID:816681

  8. Illuminating Parasite Protein Production by Ribosome Profiling.

    PubMed

    Parsons, Marilyn; Myler, Peter J

    2016-06-01

    While technologies for global enumeration of transcript abundance are well-developed, those that assess protein abundance require tailoring to penetrate to low-abundance proteins. Ribosome profiling circumvents this challenge by measuring global protein production via sequencing small mRNA fragments protected by the assembled ribosome. This powerful approach is now being applied to protozoan parasites including trypanosomes and Plasmodium. It has been used to identify new protein-coding sequences (CDSs) and clarify the boundaries of previously annotated CDSs in Trypanosoma brucei. Ribosome profiling has demonstrated that translation efficiencies vary widely between genes and, for trypanosomes at least, for the same gene across stages. The ribosomal proteins are themselves subjected to translational control, suggesting a means of reinforcing global translational regulation. PMID:27061497

  9. Ribosome Inactivating Proteins from Rosaceae.

    PubMed

    Shang, Chenjing; Rougé, Pierre; Van Damme, Els J M

    2016-01-01

    Ribosome-inactivating proteins (RIPs) are widespread among higher plants of different taxonomic orders. In this study, we report on the RIP sequences found in the genome/transcriptome of several important Rosaceae species, including many economically important edible fruits such as apple, pear, peach, apricot, and strawberry. All RIP domains from Rosaceae share high sequence similarity with conserved residues in the catalytic site and the carbohydrate binding sites. The genomes of Malus domestica and Pyrus communis contain both type 1 and type 2 RIP sequences, whereas for Prunus mume, Prunus persica, Pyrus bretschneideri, and Pyrus communis a complex set of type 1 RIP sequences was retrieved. Heterologous expression and purification of the type 1 as well as the type 2 RIP from apple allowed to characterize the biological activity of the proteins. Both RIPs from Malus domestica can inhibit protein synthesis. Furthermore, molecular modelling suggests that RIPs from Rosaceae possess three-dimensional structures that are highly similar to the model proteins and can bind to RIP substrates. Screening of the recombinant type 2 RIP from apple on a glycan array revealed that this type 2 RIP interacts with terminal sialic acid residues. Our data suggest that the RIPs from Rosaceae are biologically active proteins. PMID:27556443

  10. Frozen spin targets in ribosomal structure research.

    PubMed

    Stuhrmann, H B

    1991-01-01

    Polarized neutron scattering strongly depends on nuclear spin polarisation, particularly on proton spin polarisation. A single proton in a deuterated environment then is as efficient as 10 electrons in X-ray anomalous diffraction. Neutron scattering from the nuclear spin label is controlled by the polarisation of neutron spins and nuclear spins. Pure deuteron spin labels and proton spin labels are created by NMR saturation. We report on results obtained from the large subunit of E. coli ribosomes which have been obtained at the research reactor of GKSS using the polarized target facility developed by CERN. The nuclear spins were oriented with respect to an external field by dynamic nuclear polarisation. Proton spin polarisations of more than 80% were obtained in ribosomes at temperatures below 0.5 K. At T = 130 mK the relaxation time of the polarized target is one month (frozen spin target). Polarized small-angle neutron scattering of the in situ structure of rRNA and the total ribosomal protein (TP) has been determined from the frozen spin targets of the large ribosomal subunit, which has been deuterated in the TP and rRNA respectively. The results agree with those from neutron scattering in H2O/D2O mixtures obtained at room temperature. This is a necessary prerequisite for the planned determination of the in situ structure of individual ribosomal proteins and especially of that of ribosome bound mRNA and tRNAs. PMID:1720669

  11. Transcription termination and RNA processing in the 3'-end spacer of mouse ribosomal RNA genes.

    PubMed Central

    Miwa, T; Kominami, R; Yoshikura, H; Sudo, K; Muramatsu, M

    1987-01-01

    The 3' termini of ribosomal RNA precursors from mouse FM3A cultured cells are mapped to eight sites within 625 bp downstream from the 3' terminus of 28 S rRNA. Three additional sites are mapped in liver RNA from C3H/He strain mice. Two of them, the sites at 570 bp and 625 bp are assumed to be termination sites in vivo, because they correspond to in vitro termination sites of RNA polymerase I, and 45 S RNAs having these 3' termini decay with kinetics distinct from others. The amount of 45 S RNA having the 3' terminus at other sites is variable among several mouse strains, despite their having the same DNA sequence in these regions. The ability to produce 3' termini in these sites seems to follow Mendel's law of inheritance. Therefore, we postulate that these nine sites are RNA processing sites which are controlled genetically. Images PMID:3031586

  12. Ribosomal DNA haplotype distribution of Bursaphelenchus xylophilus in Kyushu and Okinawa islands, Japan.

    PubMed

    Nose, Mine; Shiraishi, Susumu; Miyahara, Fumihiko; Ohira, Mineko; Matsunaga, Koji; Tobase, Masashi; Koyama, Takao; Yoshimoto, Kikuo

    2009-09-01

    Ribosomal DNA region sequences (partial 18S, 28S and complete ITS1, 5.8S, and ITS2) of the pinewood nematode (Bursaphelenchus xylophilus) were obtained from DNA extracted directly from wood pieces collected from wilted pine trees throughout the Kyushu and Okinawa islands, Japan. Either a 2569bp or 2573bp sequence was obtained from 88 of 143 samples. Together with the 45 rDNA sequences of pinewood nematode isolates previously reported, there were eight single nucleotide polymorphisms and two indels of two bases. Based on these mutations, nine haplotypes were estimated. The haplotype frequencies differed among regions in Kyushu island (northwest, northeast and center, southeast, and southwest), and the distribution was consistent with the invasion and spreading routes of the pinewood nematode previously estimated from past records of pine wilt and wood importation. There was no significant difference in haplotype frequencies among the collection sites on Okinawa island. PMID:22736814

  13. Intraspecific Variation in Ribosomal DNA in Populations of the Potato Cyst Nematode Globodera pallida.

    PubMed

    Blok, V C; Malloch, G; Harrower, B; Phillips, M S; Vrain, T C

    1998-06-01

    The relationships among a number of populations of Globodera pallida from Britian, the Netherlands, Germany, Switzerland, and South America were examined using PCR amplification of the ribosomal cistron between the 18S and 28S genes that include the two intergenic spacer regions (ITS1 and ITS2) and the 5.8S gene. Amplifications produced a similar-sized product of 1150 bp from all populations. Digestion of the amplified fragment with a number of restriction enzymes showed differences among the populations. The restriction enzyme RsaI distinguished the most populations. The RFLP patterns revealed by this enzyme were complex and could have arisen from heterogeneity between individuals within populations and from differences between the repeats of an individual. Sequence analysis from six of the populations, together with RFLP analysis of PCR products, shows that there is intraspecific variation in the rDNA of G. pallida. PMID:19274220

  14. Intraspecific Variation in Ribosomal DNA in Populations of the Potato Cyst Nematode Globodera pallida

    PubMed Central

    Blok, V. C.; Malloch, G.; Harrower, B.; Phillips, M. S.; Vrain, T. C.

    1998-01-01

    The relationships among a number of populations of Globodera pallida from Britian, the Netherlands, Germany, Switzerland, and South America were examined using PCR amplification of the ribosomal cistron between the 18S and 28S genes that include the two intergenic spacer regions (ITS1 and ITS2) and the 5.8S gene. Amplifications produced a similar-sized product of 1150 bp from all populations. Digestion of the amplified fragment with a number of restriction enzymes showed differences among the populations. The restriction enzyme RsaI distinguished the most populations. The RFLP patterns revealed by this enzyme were complex and could have arisen from heterogeneity between individuals within populations and from differences between the repeats of an individual. Sequence analysis from six of the populations, together with RFLP analysis of PCR products, shows that there is intraspecific variation in the rDNA of G. pallida. PMID:19274220

  15. Intra-Genomic Variation in the Ribosomal Repeats of Nematodes

    PubMed Central

    Bik, Holly M.; Fournier, David; Sung, Way; Bergeron, R. Daniel; Thomas, W. Kelley

    2013-01-01

    Ribosomal loci represent a major tool for investigating environmental diversity and community structure via high-throughput marker gene studies of eukaryotes (e.g. 18S rRNA). Since the estimation of species’ abundance is a major goal of environmental studies (by counting numbers of sequences), understanding the patterns of rRNA copy number across species will be critical for informing such high-throughput approaches. Such knowledge is critical, given that ribosomal RNA genes exist within multi-copy repeated arrays in a genome. Here we measured the repeat copy number for six nematode species by mapping the sequences from whole genome shotgun libraries against reference sequences for their rRNA repeat. This revealed a 6-fold variation in repeat copy number amongst taxa investigated, with levels of intragenomic variation ranging from 56 to 323 copies of the rRNA array. By applying the same approach to four C. elegans mutation accumulation lines propagated by repeated bottlenecking for an average of ~400 generations, we find on average a 2-fold increase in repeat copy number (rate of increase in rRNA estimated at 0.0285-0.3414 copies per generation), suggesting that rRNA repeat copy number is subject to selection. Within each Caenorhabditis species, the majority of intragenomic variation found across the rRNA repeat was observed within gene regions (18S, 28S, 5.8S), suggesting that such intragenomic variation is not a product of selection for rRNA coding function. We find that the dramatic variation in repeat copy number among these six nematode genomes would limit the use of rRNA in estimates of organismal abundance. In addition, the unique pattern of variation within a single genome was uncorrelated with patterns of divergence between species, reflecting a strong signature of natural selection for rRNA function. A better understanding of the factors that control or affect copy number in these arrays, as well as their rates and patterns of evolution, will be

  16. Targets and Intracellular Signaling Mechanisms for Deoxynivalenol-Induced Ribosomal RNA Cleavage

    PubMed Central

    He, Kaiyu; Zhou, Hui-Ren; Pestka, James J.

    2012-01-01

    The trichothecene mycotoxin deoxynivalenol (DON), a known translational inhibitor, induces ribosomal RNA (rRNA) cleavage. Here, we characterized this process relative to (1) specific 18S and 28S ribosomal RNA cleavage sites and (2) identity of specific upstream signaling elements in this pathway. Capillary electrophoresis indicated that DON at concentrations as low as 200 ng/ml evoked selective rRNA cleavage after 6 h and that 1000 ng/ml caused cleavage within 2 h. Northern blot analysis revealed that DON exposure induced six rRNA cleavage fragments from 28S rRNA and five fragments from 18S rRNA. When selective kinase inhibitors were used to identify potential upstream signals, RNA-activated protein kinase (PKR), hematopoietic cell kinase (Hck), and p38 were found to be required for rRNA cleavage, whereas c-Jun N-terminal kinase and extracellular signal-regulated kinase were not. Furthermore, rRNA fragmentation was suppressed by the p53 inhibitors pifithrin-α and pifithrin-μ as well as the pan caspase inhibitor Z-VAD-FMK. Concurrent apoptosis was confirmed by acridine orange/ethidium bromide staining and flow cytometry. DON activated caspases 3, 8, and 9, thus suggesting the possible coinvolvement of both extrinsic and intrinsic apoptotic pathways in rRNA cleavage. Satratoxin G (SG), anisomycin, and ricin also induced specific rRNA cleavage profiles identical to those of DON, suggesting that ribotoxins might share a conserved rRNA cleavage mechanism. Taken together, DON-induced rRNA cleavage is likely to be closely linked to apoptosis activation and appears to involve the sequential activation of PKR/Hck →p38→p53→caspase 8/9→caspase 3. PMID:22491426

  17. Targets and intracellular signaling mechanisms for deoxynivalenol-induced ribosomal RNA cleavage.

    PubMed

    He, Kaiyu; Zhou, Hui-Ren; Pestka, James J

    2012-06-01

    The trichothecene mycotoxin deoxynivalenol (DON), a known translational inhibitor, induces ribosomal RNA (rRNA) cleavage. Here, we characterized this process relative to (1) specific 18S and 28S ribosomal RNA cleavage sites and (2) identity of specific upstream signaling elements in this pathway. Capillary electrophoresis indicated that DON at concentrations as low as 200 ng/ml evoked selective rRNA cleavage after 6 h and that 1000 ng/ml caused cleavage within 2 h. Northern blot analysis revealed that DON exposure induced six rRNA cleavage fragments from 28S rRNA and five fragments from 18S rRNA. When selective kinase inhibitors were used to identify potential upstream signals, RNA-activated protein kinase (PKR), hematopoietic cell kinase (Hck), and p38 were found to be required for rRNA cleavage, whereas c-Jun N-terminal kinase and extracellular signal-regulated kinase were not. Furthermore, rRNA fragmentation was suppressed by the p53 inhibitors pifithrin-α and pifithrin-μ as well as the pan caspase inhibitor Z-VAD-FMK. Concurrent apoptosis was confirmed by acridine orange/ethidium bromide staining and flow cytometry. DON activated caspases 3, 8, and 9, thus suggesting the possible coinvolvement of both extrinsic and intrinsic apoptotic pathways in rRNA cleavage. Satratoxin G (SG), anisomycin, and ricin also induced specific rRNA cleavage profiles identical to those of DON, suggesting that ribotoxins might share a conserved rRNA cleavage mechanism. Taken together, DON-induced rRNA cleavage is likely to be closely linked to apoptosis activation and appears to involve the sequential activation of PKR/Hck →p38→p53→caspase 8/9→caspase 3. PMID:22491426

  18. The structure of ribosome-lankacidin complex reveals ribosomal sites for synergistic antibiotics

    SciTech Connect

    Auerbach, Tamar; Mermershtain, Inbal; Davidovich, Chen; Bashan, Anat; Belousoff, Matthew; Wekselman, Itai; Zimmerman, Ella; Xiong, Liqun; Klepacki, Dorota; Arakawa, Kenji; Kinashi, Haruyasu; Mankin, Alexander S.; Yonath, Ada

    2010-04-26

    Crystallographic analysis revealed that the 17-member polyketide antibiotic lankacidin produced by Streptomyces rochei binds at the peptidyl transferase center of the eubacterial large ribosomal subunit. Biochemical and functional studies verified this finding and showed interference with peptide bond formation. Chemical probing indicated that the macrolide lankamycin, a second antibiotic produced by the same species, binds at a neighboring site, at the ribosome exit tunnel. These two antibiotics can bind to the ribosome simultaneously and display synergy in inhibiting bacterial growth. The binding site of lankacidin and lankamycin partially overlap with the binding site of another pair of synergistic antibiotics, the streptogramins. Thus, at least two pairs of structurally dissimilar compounds have been selected in the course of evolution to act synergistically by targeting neighboring sites in the ribosome. These results underscore the importance of the corresponding ribosomal sites for development of clinically relevant synergistic antibiotics and demonstrate the utility of structural analysis for providing new directions for drug discovery.

  19. Transition state analogues in structures of ricin and saporin ribosome-inactivating proteins

    SciTech Connect

    Ho, Meng-Chiao; Sturm, Matthew B.; Almo, Steven C.; Schramm, Vern L.

    2010-01-12

    Ricin A-chain (RTA) and saporin-L1 (SAP) catalyze adenosine depurination of 28S rRNA to inhibit protein synthesis and cause cell death. We present the crystal structures of RTA and SAP in complex with transition state analogue inhibitors. These tight-binding inhibitors mimic the sarcin-ricin recognition loop of 28S rRNA and the dissociative ribocation transition state established for RTA catalysis. RTA and SAP share unique purine-binding geometry with quadruple {pi}-stacking interactions between adjacent adenine and guanine bases and 2 conserved tyrosines. An arginine at one end of the {pi}-stack provides cationic polarization and enhanced leaving group ability to the susceptible adenine. Common features of these ribosome-inactivating proteins include adenine leaving group activation, a remarkable lack of ribocation stabilization, and conserved glutamates as general bases for activation of the H{sub 2}O nucleophile. Catalytic forces originate primarily from leaving group activation evident in both RTA and SAP in complex with transition state analogues.

  20. Identification of a Recently Active Mammalian SINE Derived from Ribosomal RNA

    PubMed Central

    Longo, Mark S.; Brown, Judy D.; Zhang, Chu; O’Neill, Michael J.; O’Neill, Rachel J.

    2015-01-01

    Complex eukaryotic genomes are riddled with repeated sequences whose derivation does not coincide with phylogenetic history and thus is often unknown. Among such sequences, the capacity for transcriptional activity coupled with the adaptive use of reverse transcription can lead to a diverse group of genomic elements across taxa, otherwise known as selfish elements or mobile elements. Short interspersed nuclear elements (SINEs) are nonautonomous mobile elements found in eukaryotic genomes, typically derived from cellular RNAs such as tRNAs, 7SL or 5S rRNA. Here, we identify and characterize a previously unknown SINE derived from the 3′-end of the large ribosomal subunit (LSU or 28S rDNA) and transcribed via RNA polymerase III. This new element, SINE28, is represented in low-copy numbers in the human reference genome assembly, wherein we have identified 27 discrete loci. Phylogenetic analysis indicates these elements have been transpositionally active within primate lineages as recently as 6 MYA while modern humans still carry transcriptionally active copies. Moreover, we have identified SINE28s in all currently available assembled mammalian genome sequences. Phylogenetic comparisons indicate that these elements are frequently rederived from the highly conserved LSU rRNA sequences in a lineage-specific manner. We propose that this element has not been previously recognized as a SINE given its high identity to the canonical LSU, and that SINE28 likely represents one of possibly many unidentified, active transposable elements within mammalian genomes. PMID:25637222

  1. High-resolution structure of the Escherichia coli ribosome

    PubMed Central

    Noeske, Jonas; Wasserman, Michael R.; Terry, Daniel S.; Altman, Roger B.; Blanchard, Scott C.; Cate, Jamie H. D.

    2015-01-01

    Protein synthesis by the ribosome is highly dependent on the ionic conditions in the cellular environment, but the roles of ribosome solvation remain poorly understood. Moreover, the function of modifications to ribosomal RNA and ribosomal proteins are unclear. Here we present the structure of the Escherichia coli 70S ribosome to 2.4 Å resolution. The structure reveals details of the ribosomal subunit interface that are conserved in all domains of life, and suggest how solvation contributes to ribosome integrity and function. The structure also suggests how the conformation of ribosomal protein uS12 likely impacts its contribution to messenger RNA decoding. This structure helps to explain the phylogenetic conservation of key elements of the ribosome, including posttranscriptional and posttranslational modifications and should serve as a basis for future antibiotic development. PMID:25775265

  2. Differential Expression of Ribosomal Genes in Brain and Blood of Alzheimer's Disease Patients.

    PubMed

    Rasmussen, Lucas; de Labio, Roger W; Viani, Gustavo A; Chen, Elizabeth; Villares, Joao; Bertolucci, Paulo-Henrique; Minett, Thais S; Turecki, Gustavo; Cecyre, Danielle; Drigo, Sandra A; Smith, Marilia C; Payao, Spencer L M

    2015-01-01

    Changes in rRNA and rDNA expression have been associated with cellular and organism aging and have been linked to Alzheimer's disease (AD) pathogenesis. In this study, we investigated the mRNA expression of ribosomal genes (28S/18S) and β-amyloid precursor protein (APP) in different post mortem brain tissue regions (the entorhinal and auditory cortices and the hippocampus) of AD patients and elderly control subjects and also evaluated the extent of expression in peripheral blood from young, healthy, elderly, and Alzheimer's disease patients in order to investigate whether these individuals experienced the effects of aging. The comparative threshold cycle (CT) method via Real Time Polymerase Chain Reaction and the Polymerase Chain Reaction- Restriction Fragment Length Polymorphism (PCR-RFLP) were used to analyze gene expression and the Apolipoprotein E (APOE) genotype, respectively. When the brain areas were analyzed collectively, we observed a significant decrease in APP expression and a significant increase in levels of mRNA of 18S and 28S in Alzheimer's disease patients compared to healthy elderly individuals. Furthermore, there was a significant upregulation of 28SrRNA in the entorhinal cortex and hippocampus, but not in the auditory cortex of patients with AD. On the other hand, tests of blood samples verified a decreased expression of 28S rRNA in patients with AD. These results support the hypothesis that changes in rRNA are present in AD patients, are tissue-specific, and seem to occur independently and differently in each tissue. However, the next challenge is to discover the mechanisms responsible for the differences in expression observed in the blood and the brain in both healthy elderly individuals and Alzheimer's disease patients, as well as the impact of these genes on AD pathogenesis. PMID:26502820

  3. Mitochondrial ribosomal proteins (MRPs) of yeast.

    PubMed Central

    Graack, H R; Wittmann-Liebold, B

    1998-01-01

    Mitochondrial ribosomal proteins (MRPs) are the counterparts in that organelle of the cytoplasmic ribosomal proteins in the host. Although the MRPs fulfil similar functions in protein biosynthesis, they are distinct in number, features and primary structures from the latter. Most progress in the eludication of the properties of individual MRPs, and in the characterization of the corresponding genes, has been made in baker's yeast (Saccharomyces cerevisiae). To date, 50 different MRPs have been determined, although biochemical data and mutational analysis propose a total number which is substantially higher. Surprisingly, only a minority of the MRPs that have been characterized show significant sequence similarities to known ribosomal proteins from other sources, thus limiting the deduction of their functions by simple comparison of amino acid sequences. Further, individual MRPs have been characterized functionally by mutational studies, and the regulation of expression of MRP genes has been described. The interaction of the mitochondrial ribosomes with transcription factors specific for individual mitochondrial mRNAs, and the communication between mitochondria and the nucleus for the co-ordinated expression of ribosomal constituents, are other aspects of current MRP research. Although the mitochondrial translational system is still far from being described completely, the yeast MRP system serves as a model for other organisms, including that of humans. PMID:9445368

  4. Simultaneous alignment and folding of 28S rRNA sequences uncovers phylogenetic signal in structure variation.

    PubMed

    Letsch, Harald O; Greve, Carola; Kück, Patrick; Fleck, Günther; Stocsits, Roman R; Misof, Bernhard

    2009-12-01

    Secondary structure models of mitochondrial and nuclear (r)RNA sequences are frequently applied to aid the alignment of these molecules in phylogenetic analyses. Additionally, it is often speculated that structure variation of (r)RNA sequences might profitably be used as phylogenetic markers. The benefit of these approaches depends on the reliability of structure models. We used a recently developed approach to show that reliable inference of large (r)RNA secondary structures as a prerequisite of simultaneous sequence and structure alignment is feasible. The approach iteratively establishes local structure constraints of each sequence and infers fully folded individual structures by constrained MFE optimization. A comparison of structure edit distances of individual constraints and fully folded structures showed pronounced phylogenetic signal in fully folded structures. As model sequences we characterized secondary structures of 28S rRNA sequences of selected insects and examined their phylogenetic signal according to established phylogenetic hypotheses. PMID:19654047

  5. A Unique Box in 28S rRNA Is Shared by the Enigmatic Insect Order Zoraptera and Dictyoptera

    PubMed Central

    Dang, Kai; Wu, Haoyang; Wang, Ying; Xie, Qiang; Bu, Wenjun

    2013-01-01

    The position of the Zoraptera remains one of the most challenging and uncertain concerns in ordinal-level phylogenies of the insects. Zoraptera have been viewed as having a close relationship with five different groups of Polyneoptera, or as being allied to the Paraneoptera or even Holometabola. Although rDNAs have been widely used in phylogenetic studies of insects, the application of the complete 28S rDNA are still scattered in only a few orders. In this study, a secondary structure model of the complete 28S rRNAs of insects was reconstructed based on all orders of Insecta. It was found that one length-variable region, D3-4, is particularly distinctive. The length and/or sequence of D3-4 is conservative within each order of Polyneoptera, but it can be divided into two types between the different orders of the supercohort, of which the enigmatic order Zoraptera and Dictyoptera share one type, while the remaining orders of Polyneoptera share the other. Additionally, independent evidence from phylogenetic results support the clade (Zoraptera+Dictyoptera) as well. Thus, the similarity of D3-4 between Zoraptera and Dictyoptera can serve as potentially valuable autapomorphy or synapomorphy in phylogeny reconstruction. The clades of (Plecoptera+Dermaptera) and ((Grylloblattodea+Mantophasmatodea)+(Embiodea+Phasmatodea)) were also recovered in the phylogenetic study. In addition, considering the other studies based on rDNAs, this study reached the highest congruence with previous phylogenetic studies of Holometabola based on nuclear protein coding genes or morphology characters. Future comparative studies of secondary structures across deep divergences and additional taxa are likely to reveal conserved patterns, structures and motifs that can provide support for major phylogenetic lineages. PMID:23301099

  6. Large-scale isolation of mitochondrial ribosomes from mammalian tissues.

    PubMed

    Spremulli, Linda L

    2007-01-01

    The preparation of mammalian mitochondrial ribosomes in sufficient quantities for biochemical studies is best done beginning with whole tissue rather than from cells in culture. This issue arises because of the low abundance of these ribosomes in cells, making their isolation a challenge. Crude mitochondrial preparations are made by differential centrifugation and are treated with digitonin to remove the outer membrane. This treatment also effectively removes most contamination by cytoplasmic ribosomes. Purification of mammalian mitochondrial ribosomes requires treatment with detergents to release the ribosomes from their association with the membrane. Sucrose density gradient centrifugation is used to separate the ribosomes from other large oligomeric complexes from this organelle. PMID:18314732

  7. Single-Molecule Observations of Ribosome Function

    PubMed Central

    Blanchard, Scott C.

    2009-01-01

    Summary of Recent Advances Single-molecule investigations promise to greatly advance our understanding of basic and regulated ribosome functions during the process of translation. Here, recent progress towards directly imaging the elemental translation elongation steps using fluorescence resonance energy transfer (FRET)-based imaging methods is discussed, which provide striking evidence of the highly dynamic nature of the ribosome. In this view, global rates and fidelities of protein synthesis reactions may be regulated by interactions of the ribosome with mRNA, tRNA, translation factors, and potentially many other cellular ligands, that modify intrinsic conformational equilibria in the translating particle. Future investigations probing this model must aim to visualize translation processes from multiple structural and kinetic perspectives simultaneously, to provide direct correlations between factor binding and conformational events. PMID:19223173

  8. Genome Mining for Ribosomally Synthesized Natural Products

    PubMed Central

    Velásquez, Juan E.; van der Donk, Wilfred

    2011-01-01

    In recent years, the number of known peptide natural products that are synthesized via the ribosomal pathway has rapidly grown. Taking advantage of sequence homology among genes encoding precursor peptides or biosynthetic proteins, in silico mining of genomes combined with molecular biology approaches has guided the discovery of a large number of new ribosomal natural products, including lantipeptides, cyanobactins, linear thiazole/oxazole-containing peptides, microviridins, lasso peptides, amatoxins, cyclotides, and conopeptides. In this review, we describe the strategies used for the identification of these ribosomally-synthesized and posttranslationally modified peptides (RiPPs) and the structures of newly identified compounds. The increasing number of chemical entities and their remarkable structural and functional diversity may lead to novel pharmaceutical applications. PMID:21095156

  9. Phylogenetic Analysis of Myobia musculi (Schranck, 1781) by Using the 18S Small Ribosomal Subunit Sequence

    PubMed Central

    Feldman, Sanford H; Ntenda, Abraham M

    2011-01-01

    We used high-fidelity PCR to amplify 2 overlapping regions of the ribosomal gene complex from the rodent fur mite Myobia musculi. The amplicons encompassed a large portion of the mite's ribosomal gene complex spanning 3128 nucleotides containing the entire 18S rRNA, internal transcribed spacer (ITS) 1, 5.8S rRNA, ITS2, and a portion of the 5′-end of the 28S rRNA. M. musculi’s 179-nucleotide 5.8S rRNA nucleotide sequence was not conserved, so this region was identified by conservation of rRNA secondary structure. Maximum likelihood and Bayesian inference phylogenetic analyses were performed by using multiple sequence alignment consisting of 1524 nucleotides of M. musculi 18S rRNA and homologous sequences from 42 prostigmatid mites and the tick Dermacentor andersoni. The phylograms produced by both methods were in agreement regarding terminal, secondary, and some tertiary phylogenetic relationships among mites. Bayesian inference discriminated most infraordinal relationships between Eleutherengona and Parasitengona mites in the suborder Anystina. Basal relationships between suborders Anystina and Eupodina historically determined by comparing differences in anatomic characteristics were less well-supported by our molecular analysis. Our results recapitulated similar 18S rRNA sequence analyses recently reported. Our study supports M. musculi as belonging to the suborder Anystina, infraorder Eleutherenona, and superfamily Cheyletoidea. PMID:22330574

  10. Lophotrochozoa internal phylogeny: new insights from an up-to-date analysis of nuclear ribosomal genes

    PubMed Central

    Paps, Jordi; Baguñà, Jaume; Riutort, Marta

    2009-01-01

    Resolving the relationships among animal phyla is a key biological problem that remains to be solved. Morphology is unable to determine the relationships among most phyla and although molecular data have unveiled a new evolutionary scenario, they have their own limitations. Nuclear ribosomal genes (18S and 28S rDNA) have been used effectively for many years. However, they are considered of limited use for resolving deep divergences such as the origin of the bilaterians, due to certain drawbacks such as the long-branch attraction (LBA) problem. Here, we attempt to overcome these pitfalls by combining several methods suggested in previous studies and routinely used in contemporary standard phylogenetic analyses but that have not yet been applied to any bilaterian phylogeny based on these genes. The methods used include maximum likelihood and Bayesian inference, the application of models with rate heterogeneity across sites, wide taxon sampling and compartmentalized analyses for each problematic clade. The results obtained show that the combination of the above-mentioned methodologies minimizes the LBA effect, and a new Lophotrochozoa phylogeny emerges. Also, the Acoela and Nemertodermatida are confirmed with maximum support as the first branching bilaterians. Ribosomal RNA genes are thus a reliable source for the study of deep divergences in the metazoan tree, provided that the data are treated carefully. PMID:19129141

  11. Relationship between organization and function of ribosomal genes in Drosophila melanogaster

    SciTech Connect

    Karpen, G.H.

    1987-01-01

    In most eukaryotic organisms, the genes that encode the 18S and 28S ribosomal RNAs (rDNA genes) are tandemly repeated, and are located in constitutive heterochromatin and/or centromeric or telomeric regions. P-element mediated transformation was used to investigate the relationship between rDNA organization and function in Drosophila melanogaster. Tritiated-uridine incorporation under heat shock conditions and in situ hybridization to rRNA were used to demonstrate that a single rDNA gene inserted into euchromatin can be transcribed at a high rate, in polytene nuclei. P-element-mediated transformation of a single Drosophila rDNA gene was also utilized to investigate the ability of ribosomal DNA to organize a nucleolus. Cytological approaches demonstrated that structures resembling the endogenous nucleoli were preferentially associated with four different sites of rDNA insertion, in polytene nuclei. These mini-nucleoli also contained components specific to the nucleolus, as shown by in situ hybridization to rRNA and indirect immunofluorescence with an antibody that binds to Drosophila nucleoli. The transformed genes were able to partially rescue mutant phenotypes due to a deficiency of rDNA, indicating that the mini-nucleoli were functional.

  12. Ribosome-dependent activation of stringent control.

    PubMed

    Brown, Alan; Fernández, Israel S; Gordiyenko, Yuliya; Ramakrishnan, V

    2016-06-01

    In order to survive, bacteria continually sense, and respond to, environmental fluctuations. Stringent control represents a key bacterial stress response to nutrient starvation that leads to rapid and comprehensive reprogramming of metabolic and transcriptional patterns. In general, transcription of genes for growth and proliferation is downregulated, while those important for survival and virulence are upregulated. Amino acid starvation is sensed by depletion of the aminoacylated tRNA pools, and this results in accumulation of ribosomes stalled with non-aminoacylated (uncharged) tRNA in the ribosomal A site. RelA is recruited to stalled ribosomes and activated to synthesize a hyperphosphorylated guanosine analogue, (p)ppGpp, which acts as a pleiotropic secondary messenger. However, structural information about how RelA recognizes stalled ribosomes and discriminates against aminoacylated tRNAs is missing. Here we present the cryo-electron microscopy structure of RelA bound to the bacterial ribosome stalled with uncharged tRNA. The structure reveals that RelA utilizes a distinct binding site compared to the translational factors, with a multi-domain architecture that wraps around a highly distorted A-site tRNA. The TGS (ThrRS, GTPase and SpoT) domain of RelA binds the CCA tail to orient the free 3' hydroxyl group of the terminal adenosine towards a β-strand, such that an aminoacylated tRNA at this position would be sterically precluded. The structure supports a model in which association of RelA with the ribosome suppresses auto-inhibition to activate synthesis of (p)ppGpp and initiate the stringent response. Since stringent control is responsible for the survival of pathogenic bacteria under stress conditions, and contributes to chronic infections and antibiotic tolerance, RelA represents a good target for the development of novel antibacterial therapeutics. PMID:27279228

  13. Functions of ribosomal proteins in assembly of eukaryotic ribosomes in vivo.

    PubMed

    de la Cruz, Jesús; Karbstein, Katrin; Woolford, John L

    2015-01-01

    The proteome of cells is synthesized by ribosomes, complex ribonucleoproteins that in eukaryotes contain 79-80 proteins and four ribosomal RNAs (rRNAs) more than 5,400 nucleotides long. How these molecules assemble together and how their assembly is regulated in concert with the growth and proliferation of cells remain important unanswered questions. Here, we review recently emerging principles to understand how eukaryotic ribosomal proteins drive ribosome assembly in vivo. Most ribosomal proteins assemble with rRNA cotranscriptionally; their association with nascent particles is strengthened as assembly proceeds. Each subunit is assembled hierarchically by sequential stabilization of their subdomains. The active sites of both subunits are constructed last, perhaps to prevent premature engagement of immature ribosomes with active subunits. Late-assembly intermediates undergo quality-control checks for proper function. Mutations in ribosomal proteins that affect mostly late steps lead to ribosomopathies, diseases that include a spectrum of cell type-specific disorders that often transition from hypoproliferative to hyperproliferative growth. PMID:25706898

  14. Functions of Ribosomal Proteins in Assembly of Eukaryotic Ribosomes In Vivo

    PubMed Central

    2016-01-01

    The proteome of cells is synthesized by ribosomes, complex ribonucleoproteins that in eukaryotes contain 79–80 proteins and four ribosomal RNAs (rRNAs) more than 5,400 nucleotides long. How these molecules assemble together and how their assembly is regulated in concert with the growth and proliferation of cells remain important unanswered questions. Here, we review recently emerging principles to understand how eukaryotic ribosomal proteins drive ribosome assembly in vivo. Most ribosomal proteins assemble with rRNA cotranscriptionally; their association with nascent particles is strengthened as assembly proceeds. Each subunit is assembled hierarchically by sequential stabilization of their subdomains. The active sites of both subunits are constructed last, perhaps to prevent premature engagement of immature ribosomes with active subunits. Late-assembly intermediates undergo quality-control checks for proper function. Mutations in ribosomal proteins that affect mostly late steps lead to ribosomopathies, diseases that include a spectrum of cell type–specific disorders that often transition from hypoproliferative to hyperproliferative growth. PMID:25706898

  15. Modular domains of the Dicistroviridae intergenic internal ribosome entry site

    PubMed Central

    Jang, Christopher J.; Jan, Eric

    2010-01-01

    The intergenic region internal ribosome entry site (IGR IRES) of the Dicistroviridae viral family can directly assemble 80S ribosomes and initiate translation at a non-AUG codon from the ribosomal A-site. These functions are directed by two independently folded domains of the IGR IRES. One domain, composed of overlapping pseudoknots II and III (PKII/III), mediates ribosome recruitment. The second domain, composed of PKI, mimics a tRNA anticodon–codon interaction to position the ribosome at the ribosomal A-site. Although adopting a common secondary structure, the dicistrovirus IGR IRESs can be grouped into two classes based on distinct features within each domain. In this study, we report on the modularity of the IGR IRESs and show that the ribosome-binding domain and the tRNA anticodon mimicry domain are functionally interchangeable between the Type I and the Type II IGR IRESs. Using structural probing, ribosome-binding assays, and ribosome positioning analysis by toeprinting assays, we show that the chimeric IRESs fold properly, assemble 80S ribosomes, and can mediate IRES translation in rabbit reticulocyte lysates. We also demonstrate that the chimeric IRESs can stimulate the ribosome-dependent GTPase activity of eEF2, which suggests that the ribosome is primed for a step downstream from IRES binding. Overall, the results demonstrate that the dicistrovirus IGR IRESs are composed of two modular domains that work in concert to manipulate the ribosome and direct translation initiation. PMID:20423979

  16. Cryo-EM structure of the small subunit of the mammalian mitochondrial ribosome.

    PubMed

    Kaushal, Prem S; Sharma, Manjuli R; Booth, Timothy M; Haque, Emdadul M; Tung, Chang-Shung; Sanbonmatsu, Karissa Y; Spremulli, Linda L; Agrawal, Rajendra K

    2014-05-20

    The mammalian mitochondrial ribosomes (mitoribosomes) are responsible for synthesizing 13 membrane proteins that form essential components of the complexes involved in oxidative phosphorylation or ATP generation for the eukaryotic cell. The mammalian 55S mitoribosome contains significantly smaller rRNAs and a large mass of mitochondrial ribosomal proteins (MRPs), including large mito-specific amino acid extensions and insertions in MRPs that are homologous to bacterial ribosomal proteins and an additional 35 mito-specific MRPs. Here we present the cryo-EM structure analysis of the small (28S) subunit (SSU) of the 55S mitoribosome. We find that the mito-specific extensions in homologous MRPs generally are involved in inter-MRP contacts and in contacts with mito-specific MRPs, suggesting a stepwise evolution of the current architecture of the mitoribosome. Although most of the mito-specific MRPs and extensions of homologous MRPs are situated on the peripheral regions, they also contribute significantly to the formation of linings of the mRNA and tRNA paths, suggesting a tailor-made structural organization of the mito-SSU for the recruitment of mito-specific mRNAs, most of which do not possess a 5' leader sequence. In addition, docking of previously published coordinates of the large (39S) subunit (LSU) into the cryo-EM map of the 55S mitoribosome reveals that mito-specific MRPs of both the SSU and LSU are involved directly in the formation of six of the 15 intersubunit bridges. PMID:24799711

  17. Cryo-EM structure of the small subunit of the mammalian mitochondrial ribosome

    PubMed Central

    Kaushal, Prem S.; Sharma, Manjuli R.; Booth, Timothy M.; Haque, Emdadul M.; Tung, Chang-Shung; Sanbonmatsu, Karissa Y.; Spremulli, Linda L.; Agrawal, Rajendra K.

    2014-01-01

    The mammalian mitochondrial ribosomes (mitoribosomes) are responsible for synthesizing 13 membrane proteins that form essential components of the complexes involved in oxidative phosphorylation or ATP generation for the eukaryotic cell. The mammalian 55S mitoribosome contains significantly smaller rRNAs and a large mass of mitochondrial ribosomal proteins (MRPs), including large mito-specific amino acid extensions and insertions in MRPs that are homologous to bacterial ribosomal proteins and an additional 35 mito-specific MRPs. Here we present the cryo-EM structure analysis of the small (28S) subunit (SSU) of the 55S mitoribosome. We find that the mito-specific extensions in homologous MRPs generally are involved in inter-MRP contacts and in contacts with mito-specific MRPs, suggesting a stepwise evolution of the current architecture of the mitoribosome. Although most of the mito-specific MRPs and extensions of homologous MRPs are situated on the peripheral regions, they also contribute significantly to the formation of linings of the mRNA and tRNA paths, suggesting a tailor-made structural organization of the mito-SSU for the recruitment of mito-specific mRNAs, most of which do not possess a 5′ leader sequence. In addition, docking of previously published coordinates of the large (39S) subunit (LSU) into the cryo-EM map of the 55S mitoribosome reveals that mito-specific MRPs of both the SSU and LSU are involved directly in the formation of six of the 15 intersubunit bridges. PMID:24799711

  18. Structures of the human and Drosophila 80S ribosome.

    PubMed

    Anger, Andreas M; Armache, Jean-Paul; Berninghausen, Otto; Habeck, Michael; Subklewe, Marion; Wilson, Daniel N; Beckmann, Roland

    2013-05-01

    Protein synthesis in all cells is carried out by macromolecular machines called ribosomes. Although the structures of prokaryotic, yeast and protist ribosomes have been determined, the more complex molecular architecture of metazoan 80S ribosomes has so far remained elusive. Here we present structures of Drosophila melanogaster and Homo sapiens 80S ribosomes in complex with the translation factor eEF2, E-site transfer RNA and Stm1-like proteins, based on high-resolution cryo-electron-microscopy density maps. These structures not only illustrate the co-evolution of metazoan-specific ribosomal RNA with ribosomal proteins but also reveal the presence of two additional structural layers in metazoan ribosomes, a well-ordered inner layer covered by a flexible RNA outer layer. The human and Drosophila ribosome structures will provide the basis for more detailed structural, biochemical and genetic experiments. PMID:23636399

  19. Two thraustochytrid 5S ribosomal RNAs.

    PubMed Central

    MacKay, R M; Doolittle, W F

    1982-01-01

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  20. Two thraustochytrid 5S ribosomal RNAs.

    PubMed

    MacKay, R M; Doolittle, W F

    1982-12-20

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  1. Release of Nonstop Ribosomes Is Essential

    PubMed Central

    Feaga, Heather A.; Viollier, Patrick H.

    2014-01-01

    ABSTRACT Bacterial ribosomes frequently translate to the 3′ end of an mRNA without terminating at a stop codon. Almost all bacteria use the transfer-messenger RNA (tmRNA)-based trans-translation pathway to release these “nonstop” ribosomes and maintain protein synthesis capacity. trans-translation is essential in some species, but in others, such as Caulobacter crescentus, trans-translation can be inactivated. To determine why trans-translation is dispensable in C. crescentus, a Tn-seq screen was used to identify genes that specifically alter growth in cells lacking ssrA, the gene encoding tmRNA. One of these genes, CC1214, was essential in ΔssrA cells. Purified CC1214 protein could release nonstop ribosomes in vitro. CC1214 is a homolog of the Escherichia coli ArfB protein, and using the CC1214 sequence, ArfB homologs were identified in the majority of bacterial phyla. Most species in which ssrA has been deleted contain an ArfB homolog, suggesting that release of nonstop ribosomes may be essential in most or all bacteria. PMID:25389176

  2. Modeling Interactions of Erythromycin Derivatives with Ribosomes.

    PubMed

    Shishkina, A V; Makarova, T M; Tereshchenkov, A G; Makarov, G I; Korshunova, G A; Bogdanov, A A

    2015-11-01

    Using a method of static simulation, a series of erythromycin A analogs was designed with aldehyde functions introduced instead of one of the methyl substituents in the 3'-N-position of the antibiotic that was potentially capable of forming a covalent bond with an amino group of one of the nucleotide residues of the 23S rRNA in the ribosomal exit tunnel. Similar interaction is observed for antibiotics of the tylosin series, which bind tightly to the large ribosomal subunit and demonstrate high antibacterial activity. Binding of novel erythromycin derivatives with the bacterial ribosome was investigated with the method of fluorescence polarization. It was found that the erythromycin analog containing a 1-methyl-3-oxopropyl group in the 3'-N-position demonstrates the best binding. Based on the ability to inhibit protein biosynthesis, it is on the same level as erythromycin, and it is significantly better than desmethyl-erythromycin. Molecular dynamic modeling of complexes of the derivatives with ribosomes was conducted to explain the observed effects. PMID:26615442

  3. Promoter architectures in the yeast ribosomal expression program

    PubMed Central

    Bosio, Maria Cristina; Negri, Rodolfo

    2011-01-01

    Ribosome biogenesis begins with the orchestrated expression of hundreds of genes, including the three large classes of ribosomal protein, ribosome biogenesis and snoRNA genes. Current knowledge about the corresponding promoters suggests the existence of novel class-specific transcriptional strategies and crosstalk between telomere length and cell growth control. PMID:21468232

  4. Introns regulate the production of ribosomal proteins by modulating splicing of duplicated ribosomal protein genes

    PubMed Central

    Petibon, Cyrielle; Parenteau, Julie; Catala, Mathieu; Elela, Sherif Abou

    2016-01-01

    Most budding yeast introns exist in the many duplicated ribosomal protein genes (RPGs) and it has been posited that they remain there to modulate the expression of RPGs and cell growth in response to stress. However, the mechanism by which introns regulate the expression of RPGs and their impact on the synthesis of ribosomal proteins remain unclear. In this study, we show that introns determine the ratio of ribosomal protein isoforms through asymmetric paralog-specific regulation of splicing. Exchanging the introns and 3′ untranslated regions of the duplicated RPS9 genes altered the splicing efficiency and changed the ratio of the ribosomal protein isoforms. Mutational analysis of the RPS9 genes indicated that splicing is regulated by variations in the intron structure and the 3′ untranslated region. Together these data suggest that preferential splicing of duplicated RPGs provides a means for adjusting the ratio of different ribosomal protein isoforms, while maintaining the overall expression level of each ribosomal protein. PMID:26945043

  5. A RanGTP-independent mechanism allows ribosomal protein nuclear import for ribosome assembly.

    PubMed

    Schütz, Sabina; Fischer, Ute; Altvater, Martin; Nerurkar, Purnima; Peña, Cohue; Gerber, Michaela; Chang, Yiming; Caesar, Stefanie; Schubert, Olga T; Schlenstedt, Gabriel; Panse, Vikram G

    2014-01-01

    Within a single generation time a growing yeast cell imports ∼14 million ribosomal proteins (r-proteins) into the nucleus for ribosome production. After import, it is unclear how these intrinsically unstable and aggregation-prone proteins are targeted to the ribosome assembly site in the nucleolus. Here, we report the discovery of a conserved nuclear carrier Tsr2 that coordinates transfer of the r-protein eS26 to the earliest assembling pre-ribosome, the 90S. In vitro studies revealed that Tsr2 efficiently dissociates importin:eS26 complexes via an atypical RanGTP-independent mechanism that terminates the import process. Subsequently, Tsr2 binds the released eS26, shields it from proteolysis, and ensures its safe delivery to the 90S pre-ribosome. We anticipate similar carriers-termed here escortins-to securely connect the nuclear import machinery with pathways that deposit r-proteins onto developing pre-ribosomal particles. PMID:25144938

  6. A RanGTP-independent mechanism allows ribosomal protein nuclear import for ribosome assembly

    PubMed Central

    Schütz, Sabina; Fischer, Ute; Altvater, Martin; Nerurkar, Purnima; Peña, Cohue; Gerber, Michaela; Chang, Yiming; Caesar, Stefanie; Schubert, Olga T; Schlenstedt, Gabriel; Panse, Vikram G

    2014-01-01

    Within a single generation time a growing yeast cell imports ∼14 million ribosomal proteins (r-proteins) into the nucleus for ribosome production. After import, it is unclear how these intrinsically unstable and aggregation-prone proteins are targeted to the ribosome assembly site in the nucleolus. Here, we report the discovery of a conserved nuclear carrier Tsr2 that coordinates transfer of the r-protein eS26 to the earliest assembling pre-ribosome, the 90S. In vitro studies revealed that Tsr2 efficiently dissociates importin:eS26 complexes via an atypical RanGTP-independent mechanism that terminates the import process. Subsequently, Tsr2 binds the released eS26, shields it from proteolysis, and ensures its safe delivery to the 90S pre-ribosome. We anticipate similar carriers—termed here escortins—to securely connect the nuclear import machinery with pathways that deposit r-proteins onto developing pre-ribosomal particles. DOI: http://dx.doi.org/10.7554/eLife.03473.001 PMID:25144938

  7. Arabidopsis protein arginine methyltransferase 3 is required for ribosome biogenesis by affecting precursor ribosomal RNA processing

    PubMed Central

    Hang, Runlai; Liu, Chunyan; Ahmad, Ayaz; Zhang, Yong; Lu, Falong; Cao, Xiaofeng

    2014-01-01

    Ribosome biogenesis is a fundamental and tightly regulated cellular process, including synthesis, processing, and assembly of rRNAs with ribosomal proteins. Protein arginine methyltransferases (PRMTs) have been implicated in many important biological processes, such as ribosome biogenesis. Two alternative precursor rRNA (pre-rRNA) processing pathways coexist in yeast and mammals; however, how PRMT affects ribosome biogenesis remains largely unknown. Here we show that Arabidopsis PRMT3 (AtPRMT3) is required for ribosome biogenesis by affecting pre-rRNA processing. Disruption of AtPRMT3 results in pleiotropic developmental defects, imbalanced polyribosome profiles, and aberrant pre-rRNA processing. We further identify an alternative pre-rRNA processing pathway in Arabidopsis and demonstrate that AtPRMT3 is required for the balance of these two pathways to promote normal growth and development. Our work uncovers a previously unidentified function of PRMT in posttranscriptional regulation of rRNA, revealing an extra layer of complexity in the regulation of ribosome biogenesis. PMID:25352672

  8. Characteristics of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) rRNA genes of Apis mellifera (Insecta: Hymenoptera): structure, organization, and retrotransposable elements

    PubMed Central

    Gillespie, J J; Johnston, J S; Cannone, J J; Gutell, R R

    2006-01-01

    As an accompanying manuscript to the release of the honey bee genome, we report the entire sequence of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) ribosomal RNA (rRNA)-encoding gene sequences (rDNA) and related internally and externally transcribed spacer regions of Apis mellifera (Insecta: Hymenoptera: Apocrita). Additionally, we predict secondary structures for the mature rRNA molecules based on comparative sequence analyses with other arthropod taxa and reference to recently published crystal structures of the ribosome. In general, the structures of honey bee rRNAs are in agreement with previously predicted rRNA models from other arthropods in core regions of the rRNA, with little additional expansion in non-conserved regions. Our multiple sequence alignments are made available on several public databases and provide a preliminary establishment of a global structural model of all rRNAs from the insects. Additionally, we provide conserved stretches of sequences flanking the rDNA cistrons that comprise the externally transcribed spacer regions (ETS) and part of the intergenic spacer region (IGS), including several repetitive motifs. Finally, we report the occurrence of retrotransposition in the nuclear large subunit rDNA, as R2 elements are present in the usual insertion points found in other arthropods. Interestingly, functional R1 elements usually present in the genomes of insects were not detected in the honey bee rRNA genes. The reverse transcriptase products of the R2 elements are deduced from their putative open reading frames and structurally aligned with those from another hymenopteran insect, the jewel wasp Nasonia (Pteromalidae). Stretches of conserved amino acids shared between Apis and Nasonia are illustrated and serve as potential sites for primer design, as target amplicons within these R2 elements may serve as novel phylogenetic markers for Hymenoptera. Given the impending completion of the sequencing of the Nasonia genome

  9. Direct Activation of Ribosome-Associated Double-Stranded RNA-Dependent Protein Kinase (PKR) by Deoxynivalenol, Anisomycin and Ricin: A New Model for Ribotoxic Stress Response Induction

    PubMed Central

    Zhou, Hui-Ren; He, Kaiyu; Landgraf, Jeff; Pan, Xiao; Pestka, James J.

    2014-01-01

    Double-stranded RNA (dsRNA)-activated protein kinase (PKR) is a critical upstream mediator of the ribotoxic stress response (RSR) to the trichothecene deoxynivalenol (DON) and other translational inhibitors. Here, we employed HeLa cell lysates to: (1) characterize PKR’s interactions with the ribosome and ribosomal RNA (rRNA); (2) demonstrate cell-free activation of ribosomal-associated PKR and (3) integrate these findings in a unified model for RSR. Robust PKR-dependent RSR was initially confirmed in intact cells. PKR basally associated with 40S, 60S, 80S and polysome fractions at molar ratios of 7, 2, 23 and 3, respectively. Treatment of ATP-containing HeLa lysates with DON or the ribotoxins anisomycin and ricin concentration-dependently elicited phosphorylation of PKR and its substrate eIF2α. These phosphorylations could be blocked by PKR inhibitors. rRNA immunoprecipitation (RNA-IP) of HeLa lysates with PKR-specific antibody and sequencing revealed that in the presence of DON or not, the kinase associated with numerous discrete sites on both the 18S and 28S rRNA molecules, a number of which contained double-stranded hairpins. These findings are consistent with a sentinel model whereby multiple PKR molecules basally associate with the ribosome positioning them to respond to ribotoxin-induced alterations in rRNA structure by dimerizing, autoactivating and, ultimately, evoking RSR. PMID:25521494

  10. History of the ribosome and the origin of translation

    PubMed Central

    Petrov, Anton S.; Gulen, Burak; Norris, Ashlyn M.; Kovacs, Nicholas A.; Lanier, Kathryn A.; Fox, George E.; Harvey, Stephen C.; Wartell, Roger M.; Hud, Nicholas V.; Williams, Loren Dean

    2015-01-01

    We present a molecular-level model for the origin and evolution of the translation system, using a 3D comparative method. In this model, the ribosome evolved by accretion, recursively adding expansion segments, iteratively growing, subsuming, and freezing the rRNA. Functions of expansion segments in the ancestral ribosome are assigned by correspondence with their functions in the extant ribosome. The model explains the evolution of the large ribosomal subunit, the small ribosomal subunit, tRNA, and mRNA. Prokaryotic ribosomes evolved in six phases, sequentially acquiring capabilities for RNA folding, catalysis, subunit association, correlated evolution, decoding, energy-driven translocation, and surface proteinization. Two additional phases exclusive to eukaryotes led to tentacle-like rRNA expansions. In this model, ribosomal proteinization was a driving force for the broad adoption of proteins in other biological processes. The exit tunnel was clearly a central theme of all phases of ribosomal evolution and was continuously extended and rigidified. In the primitive noncoding ribosome, proto-mRNA and the small ribosomal subunit acted as cofactors, positioning the activated ends of tRNAs within the peptidyl transferase center. This association linked the evolution of the large and small ribosomal subunits, proto-mRNA, and tRNA. PMID:26621738

  11. History of the ribosome and the origin of translation.

    PubMed

    Petrov, Anton S; Gulen, Burak; Norris, Ashlyn M; Kovacs, Nicholas A; Bernier, Chad R; Lanier, Kathryn A; Fox, George E; Harvey, Stephen C; Wartell, Roger M; Hud, Nicholas V; Williams, Loren Dean

    2015-12-15

    We present a molecular-level model for the origin and evolution of the translation system, using a 3D comparative method. In this model, the ribosome evolved by accretion, recursively adding expansion segments, iteratively growing, subsuming, and freezing the rRNA. Functions of expansion segments in the ancestral ribosome are assigned by correspondence with their functions in the extant ribosome. The model explains the evolution of the large ribosomal subunit, the small ribosomal subunit, tRNA, and mRNA. Prokaryotic ribosomes evolved in six phases, sequentially acquiring capabilities for RNA folding, catalysis, subunit association, correlated evolution, decoding, energy-driven translocation, and surface proteinization. Two additional phases exclusive to eukaryotes led to tentacle-like rRNA expansions. In this model, ribosomal proteinization was a driving force for the broad adoption of proteins in other biological processes. The exit tunnel was clearly a central theme of all phases of ribosomal evolution and was continuously extended and rigidified. In the primitive noncoding ribosome, proto-mRNA and the small ribosomal subunit acted as cofactors, positioning the activated ends of tRNAs within the peptidyl transferase center. This association linked the evolution of the large and small ribosomal subunits, proto-mRNA, and tRNA. PMID:26621738

  12. The Genes for Cytoplasmic Ribosomal Ribonucleic Acid in Higher Plants

    PubMed Central

    Scott, N. Steele; Ingle, J.

    1973-01-01

    The genes for cytoplasmic ribosomal RNA are partially resolved from the bulk of the DNA by CsCl equilibrium centrifugation. Although in some plants the buoyant density of the ribosomal RNA genes is as expected from the base composition of ribosomal RNA, others show a large discrepancy which cannot be due to the presence of low G-C spacer-DNA. The cross-hybridization observed with 1.3 and 0.7 × 106 molecular weight ribosomal RNAs and DNA, which varies greatly with different plant species, is not due to contamination of the ribosomal RNAs, and is specific for the ribosomal DNA of each species, probably largely restricted to those sequences coding for the two stable ribosomal RNAs. The double reciprocal plot may be used for the extrapolation of saturation values only with caution, because in these cases such plots are not linear over the whole of the hybridization reaction. PMID:16658392

  13. Pulmonate phylogeny based on 28S rRNA gene sequences: a framework for discussing habitat transitions and character transformation.

    PubMed

    Holznagel, W E; Colgan, D J; Lydeard, C

    2010-12-01

    Pulmonate snails occupy a wide range of marine, estuarine, freshwater and terrestrial environments. Non-terrestrial forms are supposed to be basal in pulmonate evolution but the group's phylogeny is not well resolved either morphologically or on the basis of available DNA sequence data. The lack of a robust phylogeny makes it difficult to understand character polarization and habitat transformation in pulmonates. We have investigated pulmonate relationships using 27 new sequences of 28S rRNA from pulmonates and outgroups, augmented with data from GenBank. The complete alignments comprised about 3.8kb. Maximum parsimony, maximum likelihood and Bayesian analyses of alignments generated under different assumptions are reported. Complete alignments appear to have a degree of substitution saturation so where there is conflict between hypothesised relationships more weight is given to analyses where regions of random similarity are excluded and which are not affected by this complication. Monophyly of the five main pulmonate groups was robustly supported in almost all analyses. The marine group Amphiboloidea and the freshwater Glacidorbidae are the most basal. The remaining pulmonates (Siphonariidae, Hygrophila and Eupulmonata) form a moderately-supported monophyletic group in all analyses bar one probably affected by saturation of substitutions. Siphonariidae, a predominantly marine and intertidal family, and Eupulmonata (mainly terrestrial with marine, estuarine and freshwater species) form a strongly supported clade that is the sister group to Hygrophila (freshwater). Multiple colonizations of freshwater and terrestrial habitats by pulmonate snails are suggested. No analyses strongly support the possibility of habitat reversions. The colonizations of freshwater by Hygrophila and of land by Stylommatophora were apparently phylogenetically independent although it cannot yet be excluded that there were transient terrestrial phases in the history of the former group or

  14. Does hybridization increase evolutionary rate? Data from the 28S-rDNA D8 domain in echinoderms.

    PubMed

    Chenuil, Anne; Egea, Emilie; Rocher, Caroline; Touzet, Hélène; Féral, Jean-Pierre

    2008-11-01

    The divergent domain D8 of the large ribosomal RNA is very variable and extended in vertebrates compared to other eukaryotes. We provide data from 31 species of echinoderms and present the first comparative analysis of the D8 in nonvertebrate deuterostomes. In addition, we obtained 16S mitochondrial DNA sequences for the sea urchin taxa and analyzed single-strand conformation polymorphism (SSCP) of D8 in several populations within the species complex Echinocardium cordatum. A common secondary structure supported by compensatory substitutions and indels is inferred for echinoderms. Variation mostly arises at the tip of the longest stem (D8a), and the most variable taxa also display the longest and most stable D8. The most stable variants are the only ones displaying bulges in the terminal part of the stem, suggesting that selection, rather than maximizing stability of the D8 secondary structure, maintains it in a given range. Striking variation in D8 evolutionary rates was evidenced among sea urchins, by comparison with both 16S mitochondrial DNA and paleontological data. In Echinocardium cordatum and Strongylocentrotus pallidus and S. droebachiensis, belonging to very distant genera, the increase in D8 evolutionary rate is extreme. Their highly stable D8 secondary structures rule out the possibility of pseudogenes. These taxa are the only ones in which interspecific hybridization was reported. We discuss how evolutionary rates may be affected in nuclear relative to mitochondrial genes after hybridization, by selective or mutational processes such as gene silencing and concerted evolution. PMID:18949506

  15. Ribosomal Mutations in Streptococcus pneumoniae Clinical Isolates

    PubMed Central

    Pihlajamäki, Marja; Kataja, Janne; Seppälä, Helena; Elliot, John; Leinonen, Maija; Huovinen, Pentti; Jalava, Jari

    2002-01-01

    Eleven clinical isolates of Streptococcus pneumoniae, isolated in Finland during 1996 to 2000, had an unusual macrolide resistance phenotype. They were resistant to macrolides and streptogramin B but susceptible, intermediate, or low-level resistant to lincosamides. No acquired macrolide resistance genes were detected from the strains. The isolates were found to have mutations in domain V of the 23S rRNA or ribosomal protein L4. Seven isolates had an A2059C mutation in two to four out of the four alleles encoding the 23S rRNA, two isolates had an A2059G mutation in two alleles, one isolate had a C2611G mutation in all four alleles, and one isolate had a 69GTG71-to-69TPS71 substitution in ribosomal protein L4. PMID:11850244

  16. Navigating the ribosome's metastable energy landscape.

    PubMed

    Munro, James B; Sanbonmatsu, Kevin Y; Spahn, Christian M T; Blanchard, Scott C

    2009-08-01

    The molecular mechanisms by which tRNA molecules enter and transit the ribosome during mRNA translation remains elusive. However, recent genetic, biochemical and structural studies offer important new findings into the ordered sequence of events underpinning the translocation process that help place the molecular mechanism within reach. In particular, new structural and kinetic insights have been obtained regarding tRNA movements through 'hybrid state' configurations. These dynamic views reveal that the macromolecular ribosome particle, like many smaller proteins, has an intrinsic capacity to reversibly sample an ensemble of similarly stable native states. Such perspectives suggest that substrates, factors and environmental cues contribute to translation regulation by helping the dynamic system navigate through a highly complex and metastable energy landscape. PMID:19647434

  17. Energy landscape of the ribosomal decoding center.

    PubMed

    Sanbonmatsu, K Y

    2006-08-01

    The ribosome decodes the genetic information that resides in nucleic acids. A key component of the decoding mechanism is a conformational switch in the decoding center of the small ribosomal subunit discovered in high-resolution X-ray crystallography studies. It is known that small subunit nucleotides A1492 and A1493 flip out of helix 44 upon transfer RNA (tRNA) binding; however, the operation principles of this switch remain unknown. Replica molecular dynamics simulations reveal a low free energy barrier between flipped-out and flipped-in states, consistent with a switch that can be controlled by shifting the equilibrium between states. The barrier determined by the simulations is sufficiently small for the binding of ligands, such as tRNAs or aminoglycoside antibiotics, to shift the equilibrium. PMID:16905237

  18. Disassembly of yeast 80S ribosomes into subunits is a concerted action of ribosome-assisted folding of denatured protein.

    PubMed

    Chakraborty, Biprashekhar; Bhakta, Sayan; Sengupta, Jayati

    2016-01-22

    It has been shown by several groups that ribosome can assist folding of denatured protein in vitro and the process is conserved across the species. Domain V of large ribosomal rRNA which occupies the intersubunit side of the large subunit was identified as the key player responsible for chaperoning the folding process. Thus, it is conceivable that denatured protein needs to access the intersubunit space of the ribosome in order to get folded. In this study, we have investigated the mechanism of release of the protein from the eukaryotic ribosome following reactivation. We have observed significant splitting of yeast 80S ribosome when incubated with the denatured BCAII protein. Energy-free disassembly mechanism functions in low Mg(+2) ion concentration for prokaryotic ribosomes. Eukaryotic ribosomes do not show significant splitting even at low Mg(+2) ion concentration. In this respect, denatured protein-induced disassembly of eukaryotic ribosome without the involvement of any external energy source is intriguing. For prokaryotic ribosomes, it was reported that the denatured protein induces ribosome splitting into subunits in order to access domain V-rRNA. In contrast, our results suggest an alternative mechanism for eukaryotic ribosomal rRNA-mediated protein folding and subsequent separation of the subunits by which release of the activated-protein occurs. PMID:26723252

  19. Structure and Function of the Mitochondrial Ribosome.

    PubMed

    Greber, Basil J; Ban, Nenad

    2016-06-01

    Mitochondrial ribosomes (mitoribosomes) perform protein synthesis inside mitochondria, the organelles responsible for energy conversion and adenosine triphosphate production in eukaryotic cells. Throughout evolution, mitoribosomes have become functionally specialized for synthesizing mitochondrial membrane proteins, and this has been accompanied by large changes to their structure and composition. We review recent high-resolution structural data that have provided unprecedented insight into the structure and function of mitoribosomes in mammals and fungi. PMID:27023846

  20. Structural snapshots of actively translating human ribosomes.

    PubMed

    Behrmann, Elmar; Loerke, Justus; Budkevich, Tatyana V; Yamamoto, Kaori; Schmidt, Andrea; Penczek, Pawel A; Vos, Matthijn R; Bürger, Jörg; Mielke, Thorsten; Scheerer, Patrick; Spahn, Christian M T

    2015-05-01

    Macromolecular machines, such as the ribosome, undergo large-scale conformational changes during their functional cycles. Although their mode of action is often compared to that of mechanical machines, a crucial difference is that, at the molecular dimension, thermodynamic effects dominate functional cycles, with proteins fluctuating stochastically between functional states defined by energetic minima on an energy landscape. Here, we have used cryo-electron microscopy to image ex-vivo-derived human polysomes as a source of actively translating ribosomes. Multiparticle refinement and 3D variability analysis allowed us to visualize a variety of native translation intermediates. Significantly populated states include not only elongation cycle intermediates in pre- and post-translocational states, but also eEF1A-containing decoding and termination/recycling complexes. Focusing on the post-translocational state, we extended this assessment to the single-residue level, uncovering striking details of ribosome-ligand interactions and identifying both static and functionally important dynamic elements. PMID:25957688

  1. Structural snapshots of actively translating human ribosomes

    PubMed Central

    Behrmann, Elmar; Loerke, Justus; Budkevich, Tatyana V.; Yamamoto, Kaori; Schmidt, Andrea; Penczek, Pawel A.; Vos, Matthijn R.; Bürger, Jörg; Mielke, Thorsten; Scheerer, Patrick; Spahn, Christian M.T.

    2015-01-01

    Summary Macromolecular machines, such as the ribosome, undergo large-scale conformational changes during their functional cycles. While their mode of action is often compared to that of mechanical machines, a crucial difference is that at the molecular dimension, thermodynamic effects dominate functional cycles, with proteins fluctuating stochastically between functional states defined by energetic minima on an energy landscape. Here, we have used cryo-electron microscopy to image ex vivo-derived human polysomes as a source of actively translating ribosomes. Multiparticle refinement and three-dimensional variability analysis allowed us to visualize a variety of native translation intermediates. Significantly populated states include not only elongation cycle intermediates in pre- and post-translocational states, but also eEF1A-containing decoding and termination/recycling complexes. Focusing on the post-translocational state, we extended this assessment to the single-residue level, uncovering striking details of ribosome-ligand interactions and identifying both static and functionally important dynamic elements. PMID:25957688

  2. Stochastic gating and drug-ribosome interactions.

    PubMed

    Vaiana, Andrea C; Sanbonmatsu, Kevin Y

    2009-02-27

    Gentamicin is a potent antibiotic that is used in combination therapy for inhalation anthrax disease. The drug is also often used in therapy for methicillin-resistant Staphylococcusaureus. Gentamicin works by flipping a conformational switch on the ribosome, disrupting the reading head (i.e., 16S ribosomal decoding bases 1492-1493) used for decoding messenger RNA. We use explicit solvent all-atom molecular simulation to study the thermodynamics of the ribosomal decoding site and its interaction with gentamicin. The replica exchange molecular dynamics simulations used an aggregate sampling of 15 mus when summed over all replicas, allowing us to explicitly calculate the free-energy landscape, including a rigorous treatment of enthalpic and entropic effects. Here, we show that the decoding bases flip on a timescale faster than that of gentamicin binding, supporting a stochastic gating mechanism for antibiotic binding, rather than an induced-fit model where the bases only flip in the presence of a ligand. The study also allows us to explore the nonspecific binding landscape near the binding site and reveals that, rather than a two-state bound/unbound scenario, drug dissociation entails shuttling between many metastable local minima in the free-energy landscape. Special care is dedicated to validation of the obtained results, both by direct comparison to experiment and by estimation of simulation convergence. PMID:19146858

  3. Mitochondrial ribosome assembly in health and disease

    PubMed Central

    De Silva, Dasmanthie; Tu, Ya-Ting; Amunts, Alexey; Fontanesi, Flavia; Barrientos, Antoni

    2015-01-01

    The ribosome is a structurally and functionally conserved macromolecular machine universally responsible for catalyzing protein synthesis. Within eukaryotic cells, mitochondria contain their own ribosomes (mitoribosomes), which synthesize a handful of proteins, all essential for the biogenesis of the oxidative phosphorylation system. High-resolution cryo-EM structures of the yeast, porcine and human mitoribosomal subunits and of the entire human mitoribosome have uncovered a wealth of new information to illustrate their evolutionary divergence from their bacterial ancestors and their adaptation to synthesis of highly hydrophobic membrane proteins. With such structural data becoming available, one of the most important remaining questions is that of the mitoribosome assembly pathway and factors involved. The regulation of mitoribosome biogenesis is paramount to mitochondrial respiration, and thus to cell viability, growth and differentiation. Moreover, mutations affecting the rRNA and protein components produce severe human mitochondrial disorders. Despite its biological and biomedical significance, knowledge on mitoribosome biogenesis and its deviations from the much-studied bacterial ribosome assembly processes is scarce, especially the order of rRNA processing and assembly events and the regulatory factors required to achieve fully functional particles. This article focuses on summarizing the current available information on mitoribosome assembly pathway, factors that form the mitoribosome assembly machinery, and the effect of defective mitoribosome assembly on human health. PMID:26030272

  4. Variation in copy number of the 28S rDNA of Aspergillus fumigatus measured by droplet digital PCR and analog quantitative real-time PCR.

    PubMed

    Alanio, Alexandre; Sturny-Leclère, Aude; Benabou, Marion; Guigue, Nicolas; Bretagne, Stéphane

    2016-08-01

    Droplet digital PCR (ddPCR) after DNA digestion yielded a 28S rDNA copy number of 61 to 86 copies/genome when testing 10 unrelated Aspergillus fumigatus isolates, higher than with quantitative PCR. Unfortunately, ddPCR after DNA digestion did not improve the sensitivity of our PCR assay when testing serum patients with invasive aspergillosis. PMID:27316653

  5. Polar bears, antibiotics, and the evolving ribosome (Nobel Lecture).

    PubMed

    Yonath, Ada

    2010-06-14

    High-resolution structures of ribosomes, the cellular machines that translate the genetic code into proteins, revealed the decoding mechanism, detected the mRNA path, identified the sites of the tRNA molecules in the ribosome, elucidated the position and the nature of the nascent proteins exit tunnel, illuminated the interactions of the ribosome with non-ribosomal factors, such as the initiation, release and recycling factors, and provided valuable information on ribosomal antibiotics, their binding sites, modes of action, principles of selectivity and the mechanisms leading to their resistance. Notably, these structures proved that the ribosome is a ribozyme whose active site, namely where the peptide bonds are being formed, is situated within a universal symmetrical region that is embedded in the otherwise asymmetric ribosome structure. As this symmetrical region is highly conserved and provides the machinery required for peptide bond formation and for ribosome polymerase activity, it may be the remnant of the proto-ribosome, a dimeric prebiotic machine that formed peptide bonds and non-coded polypeptide chains. Structures of complexes of ribosomes with antibiotics targeting them revealed the principles allowing for their clinical use, identified resistance mechanisms and showed the structural bases for discriminating pathogenic bacteria from hosts, hence providing valuable structural information for antibiotics improvement and for the design of novel compounds that can serve as antibiotics. PMID:20535730

  6. An overview of pre-ribosomal RNA processing in eukaryotes

    PubMed Central

    Henras, Anthony K; Plisson-Chastang, Célia; O'Donohue, Marie-Françoise; Chakraborty, Anirban; Gleizes, Pierre-Emmanuel

    2015-01-01

    Ribosomal RNAs are the most abundant and universal noncoding RNAs in living organisms. In eukaryotes, three of the four ribosomal RNAs forming the 40S and 60S subunits are borne by a long polycistronic pre-ribosomal RNA. A complex sequence of processing steps is required to gradually release the mature RNAs from this precursor, concomitant with the assembly of the 79 ribosomal proteins. A large set of trans-acting factors chaperone this process, including small nucleolar ribonucleoparticles. While yeast has been the gold standard for studying the molecular basis of this process, recent technical advances have allowed to further define the mechanisms of ribosome biogenesis in animals and plants. This renewed interest for a long-lasting question has been fueled by the association of several genetic diseases with mutations in genes encoding both ribosomal proteins and ribosome biogenesis factors, and by the perspective of new anticancer treatments targeting the mechanisms of ribosome synthesis. A consensus scheme of pre-ribosomal RNA maturation is emerging from studies in various kinds of eukaryotic organisms. However, major differences between mammalian and yeast pre-ribosomal RNA processing have recently come to light. WIREs RNA 2015, 6:225–242. doi: 10.1002/wrna.1269 PMID:25346433

  7. Structure of a mitochondrial ribosome with minimal RNA.

    PubMed

    Sharma, Manjuli R; Booth, Timothy M; Simpson, Larry; Maslov, Dmitri A; Agrawal, Rajendra K

    2009-06-16

    The Leishmania tarentolae mitochondrial ribosome (Lmr) is a minimal ribosomal RNA (rRNA)-containing ribosome. We have obtained a cryo-EM map of the Lmr. The map reveals several features that have not been seen in previously-determined structures of eubacterial or eukaryotic (cytoplasmic or organellar) ribosomes to our knowledge. Comparisons of the Lmr map with X-ray crystallographic and cryo-EM maps of the eubacterial ribosomes and a cryo-EM map of the mammalian mitochondrial ribosome show that (i) the overall structure of the Lmr is considerably more porous, (ii) the topology of the intersubunit space is significantly different, with fewer intersubunit bridges, but more tunnels, and (iii) several of the functionally-important rRNA regions, including the alpha-sarcin-ricin loop, have different relative positions within the structure. Furthermore, the major portions of the mRNA channel, the tRNA passage, and the nascent polypeptide exit tunnel contain Lmr-specific proteins, suggesting that the mechanisms for mRNA recruitment, tRNA interaction, and exiting of the nascent polypeptide in Lmr must differ markedly from the mechanisms deduced for ribosomes in other organisms. Our study identifies certain structural features that are characteristic solely of mitochondrial ribosomes and other features that are characteristic of both mitochondrial and chloroplast ribosomes (i.e., organellar ribosomes). PMID:19497863

  8. Ribosomal History Reveals Origins of Modern Protein Synthesis

    PubMed Central

    Harish, Ajith; Caetano-Anollés, Gustavo

    2012-01-01

    The origin and evolution of the ribosome is central to our understanding of the cellular world. Most hypotheses posit that the ribosome originated in the peptidyl transferase center of the large ribosomal subunit. However, these proposals do not link protein synthesis to RNA recognition and do not use a phylogenetic comparative framework to study ribosomal evolution. Here we infer evolution of the structural components of the ribosome. Phylogenetic methods widely used in morphometrics are applied directly to RNA structures of thousands of molecules and to a census of protein structures in hundreds of genomes. We find that components of the small subunit involved in ribosomal processivity evolved earlier than the catalytic peptidyl transferase center responsible for protein synthesis. Remarkably, subunit RNA and proteins coevolved, starting with interactions between the oldest proteins (S12 and S17) and the oldest substructure (the ribosomal ratchet) in the small subunit and ending with the rise of a modern multi-subunit ribosome. Ancestral ribonucleoprotein components show similarities to in vitro evolved RNA replicase ribozymes and protein structures in extant replication machinery. Our study therefore provides important clues about the chicken-or-egg dilemma associated with the central dogma of molecular biology by showing that ribosomal history is driven by the gradual structural accretion of protein and RNA structures. Most importantly, results suggest that functionally important and conserved regions of the ribosome were recruited and could be relics of an ancient ribonucleoprotein world. PMID:22427882

  9. A secondary structural common core in the ribosomal ITS2 (internal transcribed spacer) of Culexspecies from diverse geographical locations

    PubMed Central

    Bhargavi, Ryavarapu; Vishwakarma, Siddharth; Murty, Upadhyayula Suryanarayana

    2005-01-01

    In the present study, sequence and structural analysis of ITS2 region (the spacer segment between 5.8S and 28S rRNA of mature rRNA sequences) of 7 Culex species belonging to 5 different geographical locations was carried out. Alignment of the ITS2 sequence from the 7 species revealed 8 homologous domains. Four species namely C. vishnui, C. annulus, C. pipiens, C. quiquefasciatusshowed high sequence (98­100%) and RNA secondary structure similarity. The ITS2 similarity among different species is high despite their varying geographical locations. Several common features of secondary structure are shared among these species, with some of them supported by compensatory changes, suggesting the significant role by ITS2 as an RNA domain during ribosome biogenesis. PMID:17597853

  10. Chemical modulators of ribosome biogenesis as biological probes.

    PubMed

    Stokes, Jonathan M; Brown, Eric D

    2015-12-01

    Small-molecule inhibitors of protein biosynthesis have been instrumental in the dissection of the complexities of ribosome structure and function. Ribosome biogenesis, on the other hand, is a complex and largely enigmatic process for which there is a paucity of chemical probes. Indeed, ribosome biogenesis has been studied almost exclusively using genetic and biochemical approaches without the benefit of small-molecule inhibitors of this process. Here, we provide a perspective on the promise of chemical inhibitors of ribosome assembly for future research. We explore key obstacles that complicate the interpretation of studies aimed at perturbing ribosome biogenesis in vivo using genetic methods, and we argue that chemical inhibitors are especially powerful because they can be used to induce perturbations in a manner that obviates these difficulties. Thus, in combination with leading-edge biochemical and structural methods, chemical probes offer unique advantages toward elucidating the molecular events that define the assembly of ribosomes. PMID:26575239

  11. High-resolution microscopy of active ribosomal genes and key members of the rRNA processing machinery inside nucleolus-like bodies of fully-grown mouse oocytes.

    PubMed

    Shishova, Kseniya V; Khodarovich, Yuriy M; Lavrentyeva, Elena A; Zatsepina, Olga V

    2015-10-01

    Nucleolus-like bodies (NLBs) of fully-grown (germinal vesicle, GV) mammalian oocytes are traditionally considered as morphologically distinct entities, which, unlike normal nucleoli, contain transcribed ribosomal genes (rDNA) solely at their surface. In the current study, we for the first time showed that active ribosomal genes are present not only on the surface but also inside NLBs of the NSN-type oocytes. The "internal" rRNA synthesis was evidenced by cytoplasmic microinjections of BrUTP as precursor and by fluorescence in situ hybridization with a probe to the short-lived 5'ETS segment of the 47S pre-rRNA. We further showed that in the NLB mass of NSN-oocytes, distribution of active rDNA, RNA polymerase I (UBF) and rRNA processing (fibrillarin) protein factors, U3 snoRNA, pre-rRNAs and 18S/28S rRNAs is remarkably similar to that in somatic nucleoli capable to make pre-ribosomes. Overall, these observations support the occurrence of rDNA transcription, rRNA processing and pre-ribosome assembly in the NSN-type NLBs and so that their functional similarity to normal nucleoli. Unlike the NSN-type NLBs, the NLBs of more mature SN-oocytes do not contain transcribed rRNA genes, U3 snoRNA, pre-rRNAs, 18S and 28S rRNAs. These results favor the idea that in a process of transformation of NSN-oocytes to SN-oocytes, NLBs cease to produce pre-ribosomes and, moreover, lose their rRNAs. We also concluded that a denaturing fixative 70% ethanol used in the study to fix oocytes could be more appropriate for light microscopy analysis of nucleolar RNAs and proteins in mammalian fully-grown oocytes than a commonly used cross-linking aldehyde fixative, formalin. PMID:26226217

  12. Features of 80S mammalian ribosome and its subunits

    PubMed Central

    Budkevich, Tatyana V.; El'skaya, Anna V.; Nierhaus, Knud H.

    2008-01-01

    It is generally believed that basic features of ribosomal functions are universally valid, but a systematic test still stands out for higher eukaryotic 80S ribosomes. Here we report: (i) differences in tRNA and mRNA binding capabilities of eukaryotic and bacterial ribosomes and their subunits. Eukaryotic 40S subunits bind mRNA exclusively in the presence of cognate tRNA, whereas bacterial 30S do bind mRNA already in the absence of tRNA. 80S ribosomes bind mRNA efficiently in the absence of tRNA. In contrast, bacterial 70S interact with mRNA more productively in the presence rather than in the absence of tRNA. (ii) States of initiation (Pi), pre-translocation (PRE) and post-translocation (POST) of the ribosome were checked and no significant functional differences to the prokaryotic counterpart were observed including the reciprocal linkage between A and E sites. (iii) Eukaryotic ribosomes bind tetracycline with an affinity 15 times lower than that of bacterial ribosomes (Kd 30 μM and 1–2 μM, respectively). The drug does not effect enzymatic A-site occupation of 80S ribosomes in contrast to non-enzymatic tRNA binding to the A-site. Both observations explain the relative resistance of eukaryotic ribosomes to this antibiotic. PMID:18632761

  13. Alterations in the ribosomal machinery in cancer and hematologic disorders

    PubMed Central

    2012-01-01

    Ribosomes are essential components of the protein translation machinery and are composed of more than 80 unique large and small ribosomal proteins. Recent studies show that in addition to their roles in protein translation, ribosomal proteins are also involved in extra-ribosomal functions of DNA repair, apoptosis and cellular homeostasis. Consequently, alterations in the synthesis or functioning of ribosomal proteins can lead to various hematologic disorders. These include congenital anemias such as Diamond Blackfan anemia and Shwachman Diamond syndrome; both of which are associated with mutations in various ribosomal genes. Acquired uniallelic deletion of RPS14 gene has also been shown to lead to the 5q syndrome, a distinct subset of MDS associated with macrocytic anemia. Recent evidence shows that specific ribosomal proteins are overexpressed in liver, colon, prostate and other tumors. Ribosomal protein overexpression can promote tumorigenesis by interactions with the p53 tumor suppressor pathway and also by direct effects on various oncogenes. These data point to a broad role of ribosome protein alterations in hematologic and oncologic diseases. PMID:22709827

  14. Dynamic Behavior of Trigger Factor on the Ribosome.

    PubMed

    Deeng, J; Chan, K Y; van der Sluis, E O; Berninghausen, O; Han, W; Gumbart, J; Schulten, K; Beatrix, B; Beckmann, R

    2016-09-11

    Trigger factor (TF) is the only ribosome-associated chaperone in bacteria. It interacts with hydrophobic segments in nascent chain (NCs) as they emerge from the ribosome. TF binds via its N-terminal ribosome-binding domain (RBD) mainly to ribosomal protein uL23 at the tunnel exit on the large ribosomal subunit. Whereas earlier structural data suggested that TF binds as a rigid molecule to the ribosome, recent comparisons of structural data on substrate-bound, ribosome-bound, and TF in solution from different species suggest that this chaperone is a rather flexible molecule. Here, we present two cryo-electron microscopy structures of TF bound to ribosomes translating an mRNA coding for a known TF substrate from Escherichia coli of a different length. The structures reveal distinct degrees of flexibility for the different TF domains, a conformational rearrangement of the RBD upon ribosome binding, and an increase in rigidity within TF when the NC is extended. Molecular dynamics simulations agree with these data and offer a molecular basis for these observations. PMID:27320387

  15. -1 Programmed Ribosomal Frameshifting as a Force-Dependent Process.

    PubMed

    Visscher, Koen

    2016-01-01

    -1 Programmed ribosomal frameshifting is a translational recoding event in which ribosomes slip backward along messenger RNA presumably due to increased tension disrupting the codon-anticodon interaction at the ribosome's coding site. Single-molecule physical methods and recent experiments characterizing the physical properties of mRNA's slippery sequence as well as the mechanical stability of downstream mRNA structure motifs that give rise to frameshifting are discussed. Progress in technology, experimental assays, and data analysis methods hold promise for accurate physical modeling and quantitative understanding of -1 programmed ribosomal frameshifting. PMID:26970190

  16. Dissociability of free and peptidyl-tRNA bound ribosomes.

    PubMed

    Surguchov, A P; Fominykch, E S; Lyzlova, L V

    1978-06-16

    The influence of peptidyl-tRNA on the dissociation of yeast 80 S ribosomes into subunits was studied. For this purpose temperature-sensitive (ts) suppressor strain of yeast Saccharomyces cervisiae carrying a defect in peptide chain termination was used. It was found that peptidyl-tRNA did not influence the dissociation of ribosomes either at high salt concentration or in the presence of dissociation factor (DF) from yeast. After dissociation of yeast ribosomes in 0.5 M KCl, peptidyl-tRNA remains bound to the 60 S subunit. Some characteristics of the termination process and release of nascent polypeptides from yeast ribosomes are discussed. PMID:355860

  17. Ribosome hibernation factor promotes Staphylococcal survival and differentially represses translation.

    PubMed

    Basu, Arnab; Yap, Mee-Ngan F

    2016-06-01

    In opportunistic Gram-positive Staphylococcus aureus, a small protein called hibernation-promoting factor (HPFSa) is sufficient to dimerize 2.5-MDa 70S ribosomes into a translationally inactive 100S complex. Although the 100S dimer is observed in only the stationary phase in Gram-negative gammaproteobacteria, it is ubiquitous throughout all growth phases in S. aureus The biological significance of the 100S ribosome is poorly understood. Here, we reveal an important role of HPFSa in preserving ribosome integrity and poising cells for translational restart, a process that has significant clinical implications for relapsed staphylococcal infections. We found that the hpf null strain is severely impaired in long-term viability concomitant with a dramatic loss of intact ribosomes. Genome-wide ribosome profiling shows that eliminating HPFSa drastically increased ribosome occupancy at the 5' end of specific mRNAs under nutrient-limited conditions, suggesting that HPFSa may suppress translation initiation. The protective function of HPFSa on ribosomes resides at the N-terminal conserved basic residues and the extended C-terminal segment, which are critical for dimerization and ribosome binding, respectively. These data provide significant insight into the functional consequences of 100S ribosome loss for protein synthesis and stress adaptation. PMID:27001516

  18. Ribosome hibernation factor promotes Staphylococcal survival and differentially represses translation

    PubMed Central

    Basu, Arnab; Yap, Mee-Ngan F.

    2016-01-01

    In opportunistic Gram-positive Staphylococcus aureus, a small protein called hibernation-promoting factor (HPFSa) is sufficient to dimerize 2.5-MDa 70S ribosomes into a translationally inactive 100S complex. Although the 100S dimer is observed in only the stationary phase in Gram-negative gammaproteobacteria, it is ubiquitous throughout all growth phases in S. aureus. The biological significance of the 100S ribosome is poorly understood. Here, we reveal an important role of HPFSa in preserving ribosome integrity and poising cells for translational restart, a process that has significant clinical implications for relapsed staphylococcal infections. We found that the hpf null strain is severely impaired in long-term viability concomitant with a dramatic loss of intact ribosomes. Genome-wide ribosome profiling shows that eliminating HPFSa drastically increased ribosome occupancy at the 5′ end of specific mRNAs under nutrient-limited conditions, suggesting that HPFSa may suppress translation initiation. The protective function of HPFSa on ribosomes resides at the N-terminal conserved basic residues and the extended C-terminal segment, which are critical for dimerization and ribosome binding, respectively. These data provide significant insight into the functional consequences of 100S ribosome loss for protein synthesis and stress adaptation. PMID:27001516

  19. Commandeering the Ribosome: Lessons Learned from Dicistroviruses about Translation.

    PubMed

    Kerr, Craig H; Jan, Eric

    2016-06-15

    To replicate, all viruses depend entirely on the enslavement of host cell ribosomes for their own advantage. To this end, viruses have evolved a multitude of translational strategies to usurp the ribosome. RNA-based structures known as internal ribosome entry sites (IRESs) are among the most notable mechanisms employed by viruses to seize host ribosomes. In this article, we spotlight the intergenic region IRES from the Dicistroviridae family of viruses and its importance as a model for IRES-dependent translation and in understanding fundamental properties of translation. PMID:27053555

  20. Replication of ribosomal DNA in Xenopus laevis.

    PubMed

    Bozzoni, I; Baldari, C T; Amaldi, F; Buongiorno-Nardelli, M

    1981-09-01

    The study of the localization of the replication origins of rDNA in Xenopus laevis has been approached by two different methods. 1. The DNA of X. laevis larvae was fractionated by CsCl gradient centrifugation in bulk and ribosomal DNA and examined in the electron microscope. In bulk DNA, clusters of microbubbles, which are related with the origins of replication, appear to be spaced along the DNA molecules at intervals comparable with the size of the 'average' replicon of X. laevis. In ribosomal DNA, the distance between adjacent clusters is much shorter and corresponds to the size of the rDNA repeating unit. When ribosomal DNA was submitted to digestion with restriction enzymes (Eco RI and HindIII) the microbubbles are observed in the non-transcribed spacer-containing fragment. 2. Cultured cells of X. laevis were synchronized by mitotic selection and incubated with 5-fluoro-2-deoxyuridine for a time longer than the G1 phase. This treatment synchronizes the replicons and allows them to start replicating very slowly. It was thus possible to obtain a preferential labelling of the regions containing the origins. The analysis by gel electrophoresis of the Eco Ri-digested rDNA showed that the radioactivity was preferentially incorporated in the fragments which contain the non-transcribed spacer. The results of these two approaches indicate that the rRNA gene cluster consists of multiple units of replication, possibly one per gene unit. Furthermore they show that the origins of replication are localized into the non-transcribed spacer. PMID:7297565

  1. Homoiterons and expansion in ribosomal RNAs.

    PubMed

    Parker, Michael S; Sallee, Floyd R; Park, Edwards A; Parker, Steven L

    2015-01-01

    Ribosomal RNAs in both prokaryotes and eukaryotes feature numerous repeats of three or more nucleotides with the same nucleobase (homoiterons). In prokaryotes these repeats are much more frequent in thermophile compared to mesophile or psychrophile species, and have similar frequency in both large RNAs. These features point to use of prokaryotic homoiterons in stabilization of both ribosomal subunits. The two large RNAs of eukaryotic cytoplasmic ribosomes have expanded to a different degree across the evolutionary ladder. The big RNA of the larger subunit (60S LSU) evolved expansion segments of up to 2400 nucleotides, and the smaller subunit (40S SSU) RNA acquired expansion segments of not more than 700 nucleotides. In the examined eukaryotes abundance of rRNA homoiterons generally follows size and nucleotide bias of the expansion segments, and increases with GC content and especially with phylogenetic rank. Both the nucleotide bias and frequency of homoiterons are much larger in metazoan and angiosperm LSU compared to the respective SSU RNAs. This is especially pronounced in the tetrapod vertebrates and seems to culminate in the hominid mammals. The stability of secondary structure in polyribonucleotides would significantly connect to GC content, and should also relate to G and C homoiteron content. RNA modeling points to considerable presence of homoiteron-rich double-stranded segments especially in vertebrate LSU RNAs, and homoiterons with four or more nucleotides in the vertebrate and angiosperm LSU RNAs are largely confined to the expansion segments. These features could mainly relate to protein export function and attachment of LSU to endoplasmic reticulum and other subcellular networks. PMID:26636029

  2. Homoiterons and expansion in ribosomal RNAs

    PubMed Central

    Parker, Michael S.; Sallee, Floyd R.; Park, Edwards A.; Parker, Steven L.

    2015-01-01

    Ribosomal RNAs in both prokaryotes and eukaryotes feature numerous repeats of three or more nucleotides with the same nucleobase (homoiterons). In prokaryotes these repeats are much more frequent in thermophile compared to mesophile or psychrophile species, and have similar frequency in both large RNAs. These features point to use of prokaryotic homoiterons in stabilization of both ribosomal subunits. The two large RNAs of eukaryotic cytoplasmic ribosomes have expanded to a different degree across the evolutionary ladder. The big RNA of the larger subunit (60S LSU) evolved expansion segments of up to 2400 nucleotides, and the smaller subunit (40S SSU) RNA acquired expansion segments of not more than 700 nucleotides. In the examined eukaryotes abundance of rRNA homoiterons generally follows size and nucleotide bias of the expansion segments, and increases with GC content and especially with phylogenetic rank. Both the nucleotide bias and frequency of homoiterons are much larger in metazoan and angiosperm LSU compared to the respective SSU RNAs. This is especially pronounced in the tetrapod vertebrates and seems to culminate in the hominid mammals. The stability of secondary structure in polyribonucleotides would significantly connect to GC content, and should also relate to G and C homoiteron content. RNA modeling points to considerable presence of homoiteron-rich double-stranded segments especially in vertebrate LSU RNAs, and homoiterons with four or more nucleotides in the vertebrate and angiosperm LSU RNAs are largely confined to the expansion segments. These features could mainly relate to protein export function and attachment of LSU to endoplasmic reticulum and other subcellular networks. PMID:26636029

  3. Towards a classification of E. coli ribosomal proteins: A hypothetical `small ribosome' as a primitive protein-synthesizing apparatus

    NASA Astrophysics Data System (ADS)

    Ohnishi, Koji

    1984-12-01

    Homologies were searched among the published primary sequences of 51 E. coli ribosomal proteins, partly by ‘eye’ and partly by computer-assisted methods. By employing Moore and Goodman's alignment statistics for evaluating homology levels, 33 out of these 51 ribosomal proteins has been classified into 9 homology groups, some of which being yet tentative and remaining to be further analyzed. Taking it into consideration that most ribosomal protein genes are clustered at str- stc region, rif region and several other regions, these results strongly suggest that most or all of the contemporary ribosomal proteins must have evolved by repeated gene duplications of very few (or only one) primitive ancestral ribosomal protein gene(s). Thus it is most reasonable to propose that a ‘ small ribosome’ consisting of very few (or only one) ribosomal protein(s) must have existed as a primitive protein-synthesizing apparatus.

  4. Ribosomal RNA: a key to phylogeny

    NASA Technical Reports Server (NTRS)

    Olsen, G. J.; Woese, C. R.

    1993-01-01

    As molecular phylogeny increasingly shapes our understanding of organismal relationships, no molecule has been applied to more questions than have ribosomal RNAs. We review this role of the rRNAs and some of the insights that have been gained from them. We also offer some of the practical considerations in extracting the phylogenetic information from the sequences. Finally, we stress the importance of comparing results from multiple molecules, both as a method for testing the overall reliability of the organismal phylogeny and as a method for more broadly exploring the history of the genome.

  5. Molecular architecture of the ribosome-bound Hepatitis C Virus internal ribosomal entry site RNA.

    PubMed

    Yamamoto, Hiroshi; Collier, Marianne; Loerke, Justus; Ismer, Jochen; Schmidt, Andrea; Hilal, Tarek; Sprink, Thiemo; Yamamoto, Kaori; Mielke, Thorsten; Bürger, Jörg; Shaikh, Tanvir R; Dabrowski, Marylena; Hildebrand, Peter W; Scheerer, Patrick; Spahn, Christian M T

    2015-12-14

    Internal ribosomal entry sites (IRESs) are structured cis-acting RNAs that drive an alternative, cap-independent translation initiation pathway. They are used by many viruses to hijack the translational machinery of the host cell. IRESs facilitate translation initiation by recruiting and actively manipulating the eukaryotic ribosome using only a subset of canonical initiation factor and IRES transacting factors. Here we present cryo-EM reconstructions of the ribosome 80S- and 40S-bound Hepatitis C Virus (HCV) IRES. The presence of four subpopulations for the 80S•HCV IRES complex reveals dynamic conformational modes of the complex. At a global resolution of 3.9 Å for the most stable complex, a derived atomic model reveals a complex fold of the IRES RNA and molecular details of its interaction with the ribosome. The comparison of obtained structures explains how a modular architecture facilitates mRNA loading and tRNA binding to the P-site. This information provides the structural foundation for understanding the mechanism of HCV IRES RNA-driven translation initiation. PMID:26604301

  6. The effect of trichloroethylene and acrylonitrile on RNA and ribosome synthesis and ribosome content in Saccharomyces cells.

    PubMed

    Lochmann, E R; Ehrlich, W; Mangir, M

    1984-04-01

    The effects of trichloroethylene (TCE) and acrylonitrile (ACN) on growth, RNA synthesis, ribosome synthesis, and ribosome content were tested in yeast cells. TCE causes a delay of the growth of a cell culture (prolongation of the lag phase), but does not cause inhibition. Cells exposed to increasing concentrations of ACN show increasing damage, so that, at a certain point of the growth curve, cell division stops altogether. Similar results were obtained when RNA synthesis was investigated: After treatment with TCE, the maximum RNA synthesis of the cell culture was retarded, but subsequently reached the same level as the untreated control cells. In the presence of ACN, however, the rate of RNA synthesis was lowered with increasing ACN concentrations. The same effect was observed upon investigation of ribosome synthesis: Whereas TCE produces only a slight effect, treatment with increasing concentrations of ACN leads to a substantial decrease in ribosome synthesis, and finally to total inhibition. Parallel to this, the content of free and membrane-bound ribosomes is diminished. Obviously, the decrease in ribosome content is caused not only by an inhibition of ribosome synthesis, but also by a degradation of existing ribosomes, as well as by induction of a ribosome-associated RNase. PMID:6714140

  7. Essential ribosome assembly factor Fap7 regulates a hierarchy of RNA-protein interactions during small ribosomal subunit biogenesis.

    PubMed

    Hellmich, Ute A; Weis, Benjamin L; Lioutikov, Anatoli; Wurm, Jan Philip; Kaiser, Marco; Christ, Nina A; Hantke, Katharina; Kötter, Peter; Entian, Karl-Dieter; Schleiff, Enrico; Wöhnert, Jens

    2013-09-17

    Factor activating Pos9 (Fap7) is an essential ribosome biogenesis factor important for the assembly of the small ribosomal subunit with an uncommon dual ATPase and adenylate kinase activity. Depletion of Fap7 or mutations in its ATPase motifs lead to defects in small ribosomal subunit rRNA maturation, the absence of ribosomal protein Rps14 from the assembled subunit, and retention of the nascent small subunit in a quality control complex with the large ribosomal subunit. The molecular basis for the role of Fap7 in ribosome biogenesis is, however, not yet understood. Here we show that Fap7 regulates multiple interactions between the precursor rRNA, ribosomal proteins, and ribosome assembly factors in a hierarchical manner. Fap7 binds to Rps14 with a very high affinity. Fap7 binding blocks both rRNA-binding elements of Rps14, suggesting that Fap7 inhibits premature interactions of Rps14 with RNA. The Fap7/Rps14 interaction is modulated by nucleotide binding to Fap7. Rps14 strongly activates the ATPase activity but not the adenylate kinase activity of Fap7, identifying Rps14 as an example of a ribosomal protein functioning as an ATPase-activating factor. In addition, Fap7 inhibits the RNA cleavage activity of Nob1, the endonuclease responsible for the final maturation step of the small subunit rRNA, in a nucleotide independent manner. Thus, Fap7 may regulate small subunit biogenesis at multiple stages. PMID:24003121

  8. Studies on membrane proteins involved in ribosome binding on the rough endoplasmic reticulum. Ribophorins have no ribosome-binding activity.

    PubMed Central

    Yoshida, H; Tondokoro, N; Asano, Y; Mizusawa, K; Yamagishi, R; Horigome, T; Sugano, H

    1987-01-01

    A membrane protein fraction showing affinity for ribosomes was isolated from rat liver microsomes (microsomal fractions) in association with ribosomes by treatment of the microsomes with Emulgen 913 and then solubilized from the ribosomes with sodium deoxycholate. This protein fraction was separated into two fractions, glycoproteins, including ribophorins I and II, and non-glycoproteins, virtually free from ribophorins I and II, on concanavalin A-Sepharose columns. The two fractions were each reconstituted into liposomes to determine their ribosome-binding activities. The specific binding activity of the non-glycoprotein fraction was approx. 2.3-fold higher than that of the glycoprotein fraction. The recovery of ribosome-binding capacity of the two fractions was about 85% of the total binding capacity of the material applied to a concanavalin A-Sepharose column, and about 90% of it was found in the non-glycoprotein fraction. The affinity constants of the ribosomes for the reconstituted liposomes were somewhat higher than those for stripped rough microsomes. The mode of ribosome binding to the reconstituted liposomes was very similar to that to the stripped rough microsomes, in its sensitivity to proteolytic enzymes and its strong inhibition by increasing KCl concentration. These results support the idea that ribosome binding to rat liver microsomes is not directly mediated by ribophorins I and II, but that another unidentified membrane protein(s) plays a role in ribosome binding. Images Fig. 1. Fig. 3. Fig. 5. PMID:3663192

  9. Hindered Proton Collectivity in the Proton-Rich Nucleus 28S: Possible Magic Number Z = 16 at Proton-Rich Side

    NASA Astrophysics Data System (ADS)

    Togano, Yasuhiro; Yamada, Yusuke; Iwasa, Naohito; Yamada, Kazunari; Motobayashi, Tohru; Aoi, Nori; Baba, Hidetada; Bishop, Shawn; Cai, Xiangzhou; Doornenbal, Pieter; Fang, Deqing; Furukawa, Takeshi; Ieki, Kazuo; Kawabata, Takahiro; Kanno, Shoko; Kobayashi, Nobuyuki; Kondo, Yosuke; Kuboki, Takamasa; Kume, Naoto; Kurita, Kazuyoshi; Kurokawa, Meiko; Ma, Yu-Gang; Matsuo, Yukari; Murakami, Hiroshi; Matsushita, Masafumi; Nakamura, Takashi; Okada, Kensuke; Ota, Shinsuke; Satou, Yoshiteru; Shimoura, Susumu; Shioda, Ryota; Tanaka, Kana; Takeuchi, Satoshi; Tian, Wendong; Wang, Hongwei; Wang, Jiansong; Yoneda, Ken-ichiro

    The reduced transition probability B(E2;0gs + to 21 + ) for the most proton-rich even-even sulfur isotope 28S was determined experimentally using Coulomb excitation at 53 MeV/nucleon. The resultant B(E2) value is smaller than those of neighboring N = 12 isotones and Z = 16 isotopes. The ratio of neutron/proton transition matrix amplitudes for the 0gs + to 21 + transition were obtained to be 1.9(2) × N/Z from the present result and known B(E2) value in the mirror nucleus 28Mg. These results indicate the emergence of the magic number Z = 16 in 28S.

  10. Molecular systematic of three species of Oithona (Copepoda, Cyclopoida) from the Atlantic Ocean: comparative analysis using 28S rDNA.

    PubMed

    Cepeda, Georgina D; Blanco-Bercial, Leocadio; Bucklin, Ann; Berón, Corina M; Viñas, María D

    2012-01-01

    Species of Oithona (Copepoda, Cyclopoida) are highly abundant, ecologically important, and widely distributed throughout the world oceans. Although there are valid and detailed descriptions of the species, routine species identifications remain challenging due to their small size, subtle morphological diagnostic traits, and the description of geographic forms or varieties. This study examined three species of Oithona (O. similis, O. atlantica and O. nana) occurring in the Argentine sector of the South Atlantic Ocean based on DNA sequence variation of a 575 base-pair region of 28S rDNA, with comparative analysis of these species from other North and South Atlantic regions. DNA sequence variation clearly resolved and discriminated the species, and revealed low levels of intraspecific variation among North and South Atlantic populations of each species. The 28S rDNA region was thus shown to provide an accurate and reliable means of identifying the species throughout the sampled domain. Analysis of 28S rDNA variation for additional species collected throughout the global ocean will be useful to accurately characterize biogeographical distributions of the species and to examine phylogenetic relationships among them. PMID:22558245

  11. Role of ribosomal protein mutations in tumor development (Review).

    PubMed

    Goudarzi, Kaveh M; Lindström, Mikael S

    2016-04-01

    Ribosomes are cellular machines essential for protein synthesis. The biogenesis of ribosomes is a highly complex and energy consuming process that initiates in the nucleolus. Recently, a series of studies applying whole-exome or whole-genome sequencing techniques have led to the discovery of ribosomal protein gene mutations in different cancer types. Mutations in ribosomal protein genes have for example been found in endometrial cancer (RPL22), T-cell acute lymphoblastic leukemia (RPL10, RPL5 and RPL11), chronic lymphocytic leukemia (RPS15), colorectal cancer (RPS20), and glioma (RPL5). Moreover, patients suffering from Diamond-Blackfan anemia, a bone marrow failure syndrome caused by mutant ribosomal proteins are also at higher risk for developing leukemia, or solid tumors. Different experimental models indicate potential mechanisms whereby ribosomal proteins may initiate cancer development. In particular, deregulation of the p53 tumor suppressor network and altered mRNA translation are mechanisms likely to be involved. We envisage that changes in expression and the occurrence of ribosomal protein gene mutations play important roles in cancer development. Ribosome biology constitutes a re-emerging vital area of basic and translational cancer research. PMID:26892688

  12. Role of ribosomal protein mutations in tumor development (Review)

    PubMed Central

    GOUDARZI, KAVEH M.; LINDSTRÖM, MIKAEL S.

    2016-01-01

    Ribosomes are cellular machines essential for protein synthesis. The biogenesis of ribosomes is a highly complex and energy consuming process that initiates in the nucleolus. Recently, a series of studies applying whole-exome or whole-genome sequencing techniques have led to the discovery of ribosomal protein gene mutations in different cancer types. Mutations in ribosomal protein genes have for example been found in endometrial cancer (RPL22), T-cell acute lymphoblastic leukemia (RPL10, RPL5 and RPL11), chronic lymphocytic leukemia (RPS15), colorectal cancer (RPS20), and glioma (RPL5). Moreover, patients suffering from Diamond-Blackfan anemia, a bone marrow failure syndrome caused by mutant ribosomal proteins are also at higher risk for developing leukemia, or solid tumors. Different experimental models indicate potential mechanisms whereby ribosomal proteins may initiate cancer development. In particular, deregulation of the p53 tumor suppressor network and altered mRNA translation are mechanisms likely to be involved. We envisage that changes in expression and the occurrence of ribosomal protein gene mutations play important roles in cancer development. Ribosome biology constitutes a re-emerging vital area of basic and translational cancer research. PMID:26892688

  13. Motion of individual ribosomes along mRNA

    NASA Astrophysics Data System (ADS)

    Visscher, Koen

    2004-11-01

    Ribosomes move along messenger RNA to translate a sequence of ribonucleotides into a corresponding sequence of amino acids that make up a protein. Efficient motion of ribosomes along the mRNA requires hydrolysis of GTP, converting chemical energy into mechanical work, like better known molecular motors such as kinesin. However, motion is just one of the many tasks of the ribosome, whereas for kinesin, motion itself is the main goal. In keeping with these functional differences, the ribosome is also much larger consisting of more than 50 proteins and with half of its mass made up of ribosomal RNA. Such structural complexity enables indirect ways of coupling GTP hydrolysis to directed motion. In order to elucidate the mechanochemical coupling in ribosomes we have developed a single-molecule assay based on using optical tweezers to record the motion of individual ribosomes along mRNA. Translation rates of 2-4 codons/s have been observed. However, when increasing the force opposing motion, we observe backward slippage of ribosomes along homopolymeric poly(U) messages. Currently, it is not clear if the motor operates in reverse or if backward motion has become completely uncoupled from GTP hydrolysis. Interestingly, force-induced backward motion is of biological relevance because of its possible role in -1 frameshifting, a mechanism used by viruses to regulate gene expression at the level of translation.

  14. Proteopedia Entry: The Large Ribosomal Subunit of "Haloarcula Marismortui"

    ERIC Educational Resources Information Center

    Decatur, Wayne A.

    2010-01-01

    This article presents a "Proteopedia" page that shows the refined version of the structure of the "Haloarcula" large ribosomal subunit as solved by the laboratories of Thomas Steitz and Peter Moore. The landmark structure is of great impact as it is the first atomic-resolution structure of the highly conserved ribosomal subunit which harbors…

  15. Balsamin, a novel ribosome-inactivating protein from the seeds of Balsam apple Momordica balsamina.

    PubMed

    Kaur, Inderdeep; Yadav, Santosh K; Hariprasad, Gururao; Gupta, R C; Srinivasan, Alagiri; Batra, Janendra K; Puri, Munish

    2012-08-01

    Plant seeds, a rich source of proteins, are considered important for their application as functional ingredients in a food system. A novel ribosome-inactivating protein (RIP), balsamin was purified from the seeds of Balsam apple, Momordica balsamina. Balsamin was purified by ion exchange chromatography on CM Sepharose and gel filtration on superdex-75. It has a molecular weight of 28 kDa as shown by SDS-PAGE analysis. Balsamin inhibits protein synthesis in a rabbit reticulocyte lysate-based cell free translation assay with an IC(50) of 90.6 ng ml(-1). It has RNA N-glycosidase activity and releases a 400-base long fragment termed the Endo fragment from 28S rRNA in the same manner as does saporin-6 from Saponaria officinalis. The N-terminal sequence analysis of the first 12 amino acids of balsamin revealed that it shares 83% similarity with type I RIP α-MMC from Momordica charantia and 50% similarity with β-MMC (from Momordica charantia), bryodin I (from Bryonia dioica) and luffin a (from Luffa cylindrica). Balsamin was further characterized by mass spectrometry. CD spectroscopic studies indicate that secondary structure of balsamin contains helix (23.5%), β-strand (24.6%), turn (20%) and random coil (31.9%). Thus RIPs activity expressed in vegetables like Momordica sp. advocates its usage in diet. PMID:22120616

  16. Hirudinella ventricosa (Pallas, 1774) Baird, 1853 represents a species complex based on ribosomal DNA.

    PubMed

    Calhoun, Dana M; Curran, Stephen S; Pulis, Eric E; Provaznik, Jennifer M; Franks, James S

    2013-10-01

    Digeneans in the genus Hirudinella de Blainville, 1828 (Hirudinellidae) from three species of pelagic fishes, Acanthocybium solandri (Cuvier), Makaira nigricans Lacépède and Thunnus albacares (Bonnaterre), and one benthic fish, Mulloidichthys martinicus (Cuvier), from the Gulf of Mexico are investigated using comparison of ribosomal DNA. Four species are identified based on molecular differences: Hirudinella ventricosa (Pallas, 1774) Baird, 1853 from A. solandri, Hirudinella ahi Yamaguti, 1970 from T. albacares, and two unidentified but distinct species of Hirudinella, herein referred to as Hirudinella sp. A (from both M. nigricans and M. martinicus) and Hirudinella sp. B from M. nigricans. Additionally, H. ahi, based tentatively on morphological identification, is reported from Thunnus thynnus (Linnaeus). This represents the first record of a hirudinellid from M. martinicus and the first record of H. ahi from T. thynnus. A phylogeny of some Hemiurata Skrjabin & Guschanskaja, 1954 using partial fragments of the 28S rDNA sequences is consistent with earlier phylogenies and the position of the Hirudinellidae Dollfus, 1932 is well-supported as a derived group most closely related to the Syncoeliidae Looss, 1899. PMID:24048751

  17. Kinetics of paused ribosome recycling in Escherichia coli

    PubMed Central

    Janssen, Brian D.; Hayes, Christopher S.

    2009-01-01

    Summary The bacterial tmRNA•SmpB system recycles stalled translation complexes in a process termed ‘ribosome rescue’. tmRNA•SmpB specifically recognizes ribosomes that are paused at or near the 3′ end of truncated mRNA, and therefore nucleolytic mRNA processing is required before paused ribosomes can be rescued from full-length transcripts. Here, we examine the recycling of ribosomes paused on both full-length and truncated mRNAs. Peptidyl-tRNAs corresponding to each paused translation complex were identified, and their turnover kinetics used to estimate the half-lives of paused ribosomes in vivo. Ribosomes were paused at stop codons on full-length mRNA using a nascent peptide motif that interferes with translation termination and elicits tmRNA•SmpB activity. Peptidyl-tRNA turnover from these termination-paused ribosomes was slightly more rapid in tmRNA+ cells (T1/2 = 22 ± 2.2 s), compared to ΔtmRNA cells (T1/2 = 32 ± 1.6 s). Overexpression of release factor-1 (RF-1) greatly accelerated peptidyl-tRNA turnover from termination-paused ribosomes in both tmRNA+ and ΔtmRNA cells, whereas other termination factors had little or no effect on recycling. In contrast to inefficient translation termination, ribosome recycling from truncated transcripts lacking in-frame stop codons was dramatically accelerated by tmRNA•SmpB. However, peptidyl-tRNA still turned over from nonstop-paused ribosomes at a significant rate (t1/2 = 61 ± 7.3 s) in ΔtmRNA cells. Overexpression of RF-1, RF-3, and ribosome recycling factor (RRF) in ΔtmRNA cells failed to accelerate ribosome recycling from nonstop mRNA. These results indicate that tmRNA•SmpB activity is rate-limited by mRNA cleavage, and that RF-3 and RRF do not constitute a tmRNA-independent rescue pathway as previously suggested. Peptidyl-tRNA turnover from nonstop-paused ribosomes in ΔtmRNA cells suggests the existence of another uncharacterized ribosome rescue pathway. PMID:19761774

  18. Probing the mechanisms underlying human diseases in making ribosomes.

    PubMed

    Farley, Katherine I; Baserga, Susan J

    2016-08-15

    Ribosomes are essential, highly complex machines responsible for protein synthesis in all growing cells. Because of their importance, the process of building these machines is intricately regulated. Although the proteins involved in regulating ribosome biogenesis are just beginning to be understood, especially in human cells, the consequences for dysregulating this process have been even less studied. Such interruptions in ribosome synthesis result in a collection of human disorders known as ribosomopathies. Ribosomopathies, which occur due to mutations in proteins involved in the global process of ribosome biogenesis, result in tissue-specific defects. The questions posed by this dichotomy and the steps taken to address these questions are therefore the focus of this review: How can tissue-specific disorders result from alterations in global processes? Could ribosome specialization account for this difference? PMID:27528749

  19. DExD/H-box RNA helicases in ribosome biogenesis

    PubMed Central

    Martin, Roman; Straub, Annika U.; Doebele, Carmen; Bohnsack, Markus T.

    2013-01-01

    Ribosome synthesis requires a multitude of cofactors, among them DExD/H-box RNA helicases. Bacterial RNA helicases involved in ribosome assembly are not essential, while eukaryotes strictly require multiple DExD/H-box proteins that are involved in the much more complex ribosome biogenesis pathway. Here, RNA helicases are thought to act in structural remodeling of the RNPs including the modulation of protein binding, and they are required for allowing access or the release of specific snoRNPs from pre-ribosomes. Interestingly, helicase action is modulated by specific cofactors that can regulate recruitment and enzymatic activity. This review summarizes the current knowledge and focuses on recent findings and open questions on RNA helicase function and regulation in ribosome synthesis. PMID:22922795

  20. Prediction of ribosome footprint profile shapes from transcript sequences

    PubMed Central

    Liu, Tzu-Yu; Song, Yun S.

    2016-01-01

    Motivation: Ribosome profiling is a useful technique for studying translational dynamics and quantifying protein synthesis. Applications of this technique have shown that ribosomes are not uniformly distributed along mRNA transcripts. Understanding how each transcript-specific distribution arises is important for unraveling the translation mechanism. Results: Here, we apply kernel smoothing to construct predictive features and build a sparse model to predict the shape of ribosome footprint profiles from transcript sequences alone. Our results on Saccharomyces cerevisiae data show that the marginal ribosome densities can be predicted with high accuracy. The proposed novel method has a wide range of applications, including inferring isoform-specific ribosome footprints, designing transcripts with fast translation speeds and discovering unknown modulation during translation. Availability and implementation: A software package called riboShape is freely available at https://sourceforge.net/projects/riboshape Contact: yss@berkeley.edu PMID:27307616

  1. Regulation of ribosomal DNA amplification by the TOR pathway

    PubMed Central

    Jack, Carmen V.; Cruz, Cristina; Hull, Ryan M.; Keller, Markus A.; Ralser, Markus; Houseley, Jonathan

    2015-01-01

    Repeated regions are widespread in eukaryotic genomes, and key functional elements such as the ribosomal DNA tend to be formed of high copy repeated sequences organized in tandem arrays. In general, high copy repeats are remarkably stable, but a number of organisms display rapid ribosomal DNA amplification at specific times or under specific conditions. Here we demonstrate that target of rapamycin (TOR) signaling stimulates ribosomal DNA amplification in budding yeast, linking external nutrient availability to ribosomal DNA copy number. We show that ribosomal DNA amplification is regulated by three histone deacetylases: Sir2, Hst3, and Hst4. These enzymes control homologous recombination-dependent and nonhomologous recombination-dependent amplification pathways that act in concert to mediate rapid, directional ribosomal DNA copy number change. Amplification is completely repressed by rapamycin, an inhibitor of the nutrient-responsive TOR pathway; this effect is separable from growth rate and is mediated directly through Sir2, Hst3, and Hst4. Caloric restriction is known to up-regulate expression of nicotinamidase Pnc1, an enzyme that enhances Sir2, Hst3, and Hst4 activity. In contrast, normal glucose concentrations stretch the ribosome synthesis capacity of cells with low ribosomal DNA copy number, and we find that these cells show a previously unrecognized transcriptional response to caloric excess by reducing PNC1 expression. PNC1 down-regulation forms a key element in the control of ribosomal DNA amplification as overexpression of PNC1 substantially reduces ribosomal DNA amplification rate. Our results reveal how a signaling pathway can orchestrate specific genome changes and demonstrate that the copy number of repetitive DNA can be altered to suit environmental conditions. PMID:26195783

  2. Regulation of ribosome biogenesis in maize embryonic axes during germination.

    PubMed

    Villa-Hernández, J M; Dinkova, T D; Aguilar-Caballero, R; Rivera-Cabrera, F; Sánchez de Jiménez, E; Pérez-Flores, L J

    2013-10-01

    Ribosome biogenesis is a pre-requisite for cell growth and proliferation; it is however, a highly regulated process that consumes a great quantity of energy. It requires the coordinated production of rRNA, ribosomal proteins and non-ribosomal factors which participate in the processing and mobilization of the new ribosomes. Ribosome biogenesis has been studied in yeast and animals; however, there is little information about this process in plants. The objective of the present work was to study ribosome biogenesis in maize seeds during germination, a stage characterized for its fast growth, and the effect of insulin in this process. Insulin has been reported to accelerate germination and to induce seedling growth. It was observed that among the first events reactivated just after 3 h of imbibition are the rDNA transcription and the pre-rRNA processing and that insulin stimulates both of them (40-230%). The transcript of nucleolin, a protein which regulates rDNA transcription and pre-rRNA processing, is among the messages stored in quiescent dry seeds and it is mobilized into the polysomal fraction during the first hours of imbibition (6 h). In contrast, de novo ribosomal protein synthesis was low during the first hours of imbibition (3 and 6 h) increasing by 60 times in later stages (24 h). Insulin increased this synthesis (75%) at 24 h of imbibition; however, not all ribosomal proteins were similarly regulated. In this regard, an increase in RPS6 and RPL7 protein levels was observed, whereas RPL3 protein levels did not change even though its transcription was induced. Results show that ribosome biogenesis in the first stages of imbibition is carried out with newly synthesized rRNA and ribosomal proteins translated from stored mRNA. PMID:23806421

  3. Crystal Structures of the uL3 Mutant Ribosome: Illustration of the Importance of Ribosomal Proteins for Translation Efficiency.

    PubMed

    Mailliot, Justine; Garreau de Loubresse, Nicolas; Yusupova, Gulnara; Meskauskas, Arturas; Dinman, Jonathan D; Yusupov, Marat

    2016-05-22

    The ribosome has been described as a ribozyme in which ribosomal RNA is responsible for peptidyl-transferase reaction catalysis. The W255C mutation of the universally conserved ribosomal protein uL3 has diverse effects on ribosome function (e.g., increased affinities for transfer RNAs, decreased rates of peptidyl-transfer), and cells harboring this mutation are resistant to peptidyl-transferase inhibitors (e.g., anisomycin). These observations beg the question of how a single amino acid mutation may have such wide ranging consequences. Here, we report the structure of the vacant yeast uL3 W255C mutant ribosome by X-ray crystallography, showing a disruption of the A-site side of the peptidyl-transferase center (PTC). An additional X-ray crystallographic structure of the anisomycin-containing mutant ribosome shows that high concentrations of this inhibitor restore a "WT-like" configuration to this region of the PTC, providing insight into the resistance mechanism of the mutant. Globally, our data demonstrate that ribosomal protein uL3 is structurally essential to ensure an optimal and catalytically efficient organization of the PTC, highlighting the importance of proteins in the RNA-centered ribosome. PMID:26906928

  4. Modifying the maker: Oxygenases target ribosome biology.

    PubMed

    Zhuang, Qinqin; Feng, Tianshu; Coleman, Mathew L

    2015-01-01

    The complexity of the eukaryotic protein synthesis machinery is partly driven by extensive and diverse modifications to associated proteins and RNAs. These modifications can have important roles in regulating translation factor activity and ribosome biogenesis and function. Further investigation of 'translational modifications' is warranted considering the growing evidence implicating protein synthesis as a critical point of gene expression control that is commonly deregulated in disease. New evidence suggests that translation is a major new target for oxidative modifications, specifically hydroxylations and demethylations, which generally are catalyzed by a family of emerging oxygenase enzymes that act at the interface of nutrient availability and metabolism. This review summarizes what is currently known about the role or these enzymes in targeting rRNA synthesis, protein translation and associated cellular processes. PMID:26779412

  5. Compilation of small ribosomal subunit RNA structures.

    PubMed Central

    Neefs, J M; Van de Peer, Y; De Rijk, P; Chapelle, S; De Wachter, R

    1993-01-01

    The database on small ribosomal subunit RNA structure contained 1804 nucleotide sequences on April 23, 1993. This number comprises 365 eukaryotic, 65 archaeal, 1260 bacterial, 30 plastidial, and 84 mitochondrial sequences. These are stored in the form of an alignment in order to facilitate the use of the database as input for comparative studies on higher-order structure and for reconstruction of phylogenetic trees. The elements of the postulated secondary structure for each molecule are indicated by special symbols. The database is available on-line directly from the authors by ftp and can also be obtained from the EMBL nucleotide sequence library by electronic mail, ftp, and on CD ROM disk. PMID:8332525

  6. Ribosome-Inactivating and Related Proteins

    PubMed Central

    Schrot, Joachim; Weng, Alexander; Melzig, Matthias F.

    2015-01-01

    Ribosome-inactivating proteins (RIPs) are toxins that act as N-glycosidases (EC 3.2.2.22). They are mainly produced by plants and classified as type 1 RIPs and type 2 RIPs. There are also RIPs and RIP related proteins that cannot be grouped into the classical type 1 and type 2 RIPs because of their different sizes, structures or functions. In addition, there is still not a uniform nomenclature or classification existing for RIPs. In this review, we give the current status of all known plant RIPs and we make a suggestion about how to unify those RIPs and RIP related proteins that cannot be classified as type 1 or type 2 RIPs. PMID:26008228

  7. Modifying the maker: Oxygenases target ribosome biology

    PubMed Central

    Zhuang, Qinqin; Feng, Tianshu; Coleman, Mathew L

    2015-01-01

    The complexity of the eukaryotic protein synthesis machinery is partly driven by extensive and diverse modifications to associated proteins and RNAs. These modifications can have important roles in regulating translation factor activity and ribosome biogenesis and function. Further investigation of ‘translational modifications’ is warranted considering the growing evidence implicating protein synthesis as a critical point of gene expression control that is commonly deregulated in disease. New evidence suggests that translation is a major new target for oxidative modifications, specifically hydroxylations and demethylations, which generally are catalyzed by a family of emerging oxygenase enzymes that act at the interface of nutrient availability and metabolism. This review summarizes what is currently known about the role or these enzymes in targeting rRNA synthesis, protein translation and associated cellular processes. PMID:26779412

  8. Ribosomal protein uS19 mutants reveal its role in coordinating ribosome structure and function

    PubMed Central

    Bowen, Alicia M; Musalgaonkar, Sharmishtha; Moomau, Christine A; Gulay, Suna P; Mirvis, Mary; Dinman, Jonathan D

    2015-01-01

    Prior studies identified allosteric information pathways connecting functional centers in the large ribosomal subunit to the decoding center in the small subunit through the B1a and B1b/c intersubunit bridges in yeast. In prokaryotes a single SSU protein, uS13, partners with H38 (the A-site finger) and uL5 to form the B1a and B1b/c bridges respectively. In eukaryotes, the SSU component was split into 2 separate proteins during the course of evolution. One, also known as uS13, participates in B1b/c bridge with uL5 in eukaryotes. The other, called uS19 is the SSU partner in the B1a bridge with H38. Here, polyalanine mutants of uS19 involved in the uS19/uS13 and the uS19/H38 interfaces were used to elucidate the important amino acid residues involved in these intersubunit communication pathways. Two key clusters of amino acids were identified: one located at the junction between uS19 and uS13, and a second that appears to interact with the distal tip of H38. Biochemical analyses reveal that these mutations shift the ribosomal rotational equilibrium toward the unrotated state, increasing ribosomal affinity for tRNAs in the P-site and for ternary complex in the A-site, and inhibit binding of the translocase, eEF2. These defects in turn affect specific aspects of translational fidelity. These findings suggest that uS19 plays a critical role as a conduit of information exchange between the large and small ribosomal subunits directly through the B1a, and indirectly through the B1b/c bridges. PMID:26824029

  9. Ribosomal protein uS19 mutants reveal its role in coordinating ribosome structure and function.

    PubMed

    Bowen, Alicia M; Musalgaonkar, Sharmishtha; Moomau, Christine A; Gulay, Suna P; Mirvis, Mary; Dinman, Jonathan D

    2015-01-01

    Prior studies identified allosteric information pathways connecting functional centers in the large ribosomal subunit to the decoding center in the small subunit through the B1a and B1b/c intersubunit bridges in yeast. In prokaryotes a single SSU protein, uS13, partners with H38 (the A-site finger) and uL5 to form the B1a and B1b/c bridges respectively. In eukaryotes, the SSU component was split into 2 separate proteins during the course of evolution. One, also known as uS13, participates in B1b/c bridge with uL5 in eukaryotes. The other, called uS19 is the SSU partner in the B1a bridge with H38. Here, polyalanine mutants of uS19 involved in the uS19/uS13 and the uS19/H38 interfaces were used to elucidate the important amino acid residues involved in these intersubunit communication pathways. Two key clusters of amino acids were identified: one located at the junction between uS19 and uS13, and a second that appears to interact with the distal tip of H38. Biochemical analyses reveal that these mutations shift the ribosomal rotational equilibrium toward the unrotated state, increasing ribosomal affinity for tRNAs in the P-site and for ternary complex in the A-site, and inhibit binding of the translocase, eEF2. These defects in turn affect specific aspects of translational fidelity. These findings suggest that uS19 plays a critical role as a conduit of information exchange between the large and small ribosomal subunits directly through the B1a, and indirectly through the B1b/c bridges. PMID:26824029

  10. Yeast Ribosomal Protein L40 Assembles Late into Precursor 60 S Ribosomes and Is Required for Their Cytoplasmic Maturation*

    PubMed Central

    Fernández-Pevida, Antonio; Rodríguez-Galán, Olga; Díaz-Quintana, Antonio; Kressler, Dieter; de la Cruz, Jesús

    2012-01-01

    Most ribosomal proteins play important roles in ribosome biogenesis and function. Here, we have examined the contribution of the essential ribosomal protein L40 in these processes in the yeast Saccharomyces cerevisiae. Deletion of either the RPL40A or RPL40B gene and in vivo depletion of L40 impair 60 S ribosomal subunit biogenesis. Polysome profile analyses reveal the accumulation of half-mers and a moderate reduction in free 60 S ribosomal subunits. Pulse-chase, Northern blotting, and primer extension analyses in the L40-depleted strain clearly indicate that L40 is not strictly required for the precursor rRNA (pre-rRNA) processing reactions but contributes to optimal 27 SB pre-rRNA maturation. Moreover, depletion of L40 hinders the nucleo-cytoplasmic export of pre-60 S ribosomal particles. Importantly, all these defects most likely appear as the direct consequence of impaired Nmd3 and Rlp24 release from cytoplasmic pre-60 S ribosomal subunits and their inefficient recycling back into the nucle(ol)us. In agreement, we show that hemagglutinin epitope-tagged L40A assembles in the cytoplasm into almost mature pre-60 S ribosomal particles. Finally, we have identified that the hemagglutinin epitope-tagged L40A confers resistance to sordarin, a translation inhibitor that impairs the function of eukaryotic elongation factor 2, whereas the rpl40a and rpl40b null mutants are hypersensitive to this antibiotic. We conclude that L40 is assembled at a very late stage into pre-60 S ribosomal subunits and that its incorporation into 60 S ribosomal subunits is a prerequisite for subunit joining and may ensure proper functioning of the translocation process. PMID:22995916

  11. Bmi1 promotes erythroid development through regulating ribosome biogenesis

    PubMed Central

    Gao, Rui; Chen, Sisi; Kobayashi, Michihiro; Yu, Hao; Zhang, Yingchi; Wan, Yang; Young, Sara K.; Soltis, Anthony; Yu, Ming; Vemula, Sasidhar; Fraenkel, Ernest; Cantor, Alan; Antipin, Yevgeniy; Xu, Yang; Yoder, Mervin C.; Wek, Ronald C.; Ellis, Steven R.; Kapur, Reuben; Zhu, Xiaofan; Liu, Yan

    2015-01-01

    While Polycomb group protein Bmi1 is important for stem cell maintenance, its role in lineage commitment is largely unknown. We have identified Bmi1 as a novel regulator of erythroid development. Bmi1 is highly expressed in mouse erythroid progenitor cells and its deficiency impairs erythroid differentiation. BMI1 is also important for human erythroid development. Furthermore, we discovered that loss of Bmi1 in erythroid progenitor cells results in down-regulation of transcription of multiple ribosomal protein genes and impaired ribosome biogenesis. Bmi1 deficiency stabilizes p53 protein, leading to upregulation of p21 expression and subsequent G0/G1 cell cycle arrest. Genetic inhibition of p53 activity rescues the erythroid defects seen in the Bmi1 null mice, demonstrating that a p53-dependent mechanism underlies the pathophysiology of the anemia. Mechanistically, Bmi1 is associated with multiple ribosomal protein genes and may positively regulate their expression in erythroid progenitor cells. Thus, Bmi1 promotes erythroid development, at least in part through regulating ribosome biogenesis. Ribosomopathies are human disorders of ribosome dysfunction, including diamond blackfan anemia (DBA) and 5q- syndrome, in which genetic abnormalities cause impaired ribosome biogenesis, resulting in specific clinical phenotypes. We observed that BMI1 expression in human hematopoietic stem and progenitor cells (HSPCs) from patients with DBA is correlated with the expression of some ribosomal protein genes, suggesting that BMI1 deficiency may play a pathological role in DBA and other ribosomopathies. PMID:25385494

  12. Bmi1 promotes erythroid development through regulating ribosome biogenesis.

    PubMed

    Gao, Rui; Chen, Sisi; Kobayashi, Michihiro; Yu, Hao; Zhang, Yingchi; Wan, Yang; Young, Sara K; Soltis, Anthony; Yu, Ming; Vemula, Sasidhar; Fraenkel, Ernest; Cantor, Alan; Antipin, Yevgeniy; Xu, Yang; Yoder, Mervin C; Wek, Ronald C; Ellis, Steven R; Kapur, Reuben; Zhu, Xiaofan; Liu, Yan

    2015-03-01

    While Polycomb group protein Bmi1 is important for stem cell maintenance, its role in lineage commitment is largely unknown. We have identified Bmi1 as a novel regulator of erythroid development. Bmi1 is highly expressed in mouse erythroid progenitor cells and its deficiency impairs erythroid differentiation. BMI1 is also important for human erythroid development. Furthermore, we discovered that loss of Bmi1 in erythroid progenitor cells results in decreased transcription of multiple ribosomal protein genes and impaired ribosome biogenesis. Bmi1 deficiency stabilizes p53 protein, leading to upregulation of p21 expression and subsequent G0/G1 cell cycle arrest. Genetic inhibition of p53 activity rescues the erythroid defects seen in the Bmi1 null mice, demonstrating that a p53-dependent mechanism underlies the pathophysiology of the anemia. Mechanistically, Bmi1 is associated with multiple ribosomal protein genes and may positively regulate their expression in erythroid progenitor cells. Thus, Bmi1 promotes erythroid development, at least in part through regulating ribosome biogenesis. Ribosomopathies are human disorders of ribosome dysfunction, including Diamond-Blackfan anemia (DBA) and 5q- syndrome, in which genetic abnormalities cause impaired ribosome biogenesis, resulting in specific clinical phenotypes. We observed that BMI1 expression in human hematopoietic stem and progenitor cells from patients with DBA is correlated with the expression of some ribosomal protein genes, suggesting that BMI1 deficiency may play a pathological role in DBA and other ribosomopathies. PMID:25385494

  13. Sharing of mitotic pre-ribosomal particles between daughter cells.

    PubMed

    Sirri, Valentina; Jourdan, Nathalie; Hernandez-Verdun, Danièle; Roussel, Pascal

    2016-04-15

    Ribosome biogenesis is a fundamental multistep process initiated by the synthesis of 90S pre-ribosomal particles in the nucleoli of higher eukaryotes. Even though synthesis of ribosomes stops during mitosis while nucleoli disappear, mitotic pre-ribosomal particles persist as observed in pre-nucleolar bodies (PNBs) during telophase. To further understand the relationship between the nucleolus and the PNBs, the presence and the fate of the mitotic pre-ribosomal particles during cell division were investigated. We demonstrate that the recently synthesized 45S precursor ribosomal RNAs (pre-rRNAs) as well as the 32S and 30S pre-rRNAs are maintained during mitosis and associated with the chromosome periphery together with pre-rRNA processing factors. Maturation of the mitotic pre-ribosomal particles, as assessed by the stability of the mitotic pre-rRNAs, is transiently arrested during mitosis by a cyclin-dependent kinase (CDK)1-cyclin-B-dependent mechanism and can be restored by CDK inhibitor treatments. At the M-G1 transition, the resumption of mitotic pre-rRNA processing in PNBs does not induce the disappearance of PNBs; this only occurs when functional nucleoli reform. Strikingly, during their maturation process, mitotic pre-rRNAs localize in reforming nucleoli. PMID:26929073

  14. Stochastic kinetics of ribosomes: Single motor properties and collective behavior

    NASA Astrophysics Data System (ADS)

    Garai, Ashok; Chowdhury, Debanjan; Chowdhury, Debashish; Ramakrishnan, T. V.

    2009-07-01

    Syntheses of protein molecules in a cell are carried out by ribosomes. A ribosome can be regarded as a molecular motor which utilizes the input chemical energy to move on a messenger RNA (mRNA) track that also serves as a template for the polymerization of the corresponding protein. The forward movement, however, is characterized by an alternating sequence of translocation and pause. Using a quantitative model, which captures the mechanochemical cycle of an individual ribosome, we derive an exact analytical expression for the distribution of its dwell times at the successive positions on the mRNA track. Inverse of the average dwell time satisfies a “Michaelis-Menten-type” equation and is consistent with the general formula for the average velocity of a molecular motor with an unbranched mechanochemical cycle. Extending this formula appropriately, we also derive the exact force-velocity relation for a ribosome. Often many ribosomes simultaneously move on the same mRNA track, while each synthesizes a copy of the same protein. We extend the model of a single ribosome by incorporating steric exclusion of different individuals on the same track. We draw the phase diagram of this model of ribosome traffic in three-dimensional spaces spanned by experimentally controllable parameters. We suggest new experimental tests of our theoretical predictions.

  15. Functional interaction of yeast elongation factor 3 with yeast ribosomes.

    PubMed

    Chakraburtty, K

    1999-01-01

    Elongation factor 3 (EF-3) is a unique and essential requirement of the fungal translational apparatus. EF-3 is a monomeric protein with a molecular mass of 116,000. EF-3 is required by yeast ribosomes for in vitro translation and for in vivo growth. The protein stimulates the binding of EF-1 alpha :GTP:aa-tRNA ternary complex to the ribosomal A-site by facilitating release of deacylated-tRNA from the E-site. The reaction requires ATP hydrolysis. EF-3 contains two ATP-binding sequence motifs (NBS). NBSI is sufficient for the intrinsic ATPase function. NBSII is essential for ribosome-stimulated activity. By limited proteolysis, EF-3 was divided into two distinct functional domains. The N-terminal domain lacking the highly charged lysine blocks failed to bind ribosomes and was inactive in the ribosome-stimulated ATPase activity. The C-terminally derived lysine-rich fragment showed strong binding to yeast ribosomes. The purported S5 homology region of EF-3 at the N-terminal end has been reported to interact with 18S ribosomal RNA. We postulate that EF-3 contacts rRNA and/or protein(s) through the C-terminal end. Removal of these residues severely weakens its interaction mediated possibly through the N-terminal domain of the protein. PMID:10216951

  16. Ribosomal crystallography: peptide bond formation and its inhibition.

    PubMed

    Bashan, Anat; Zarivach, Raz; Schluenzen, Frank; Agmon, Ilana; Harms, Joerg; Auerbach, Tamar; Baram, David; Berisio, Rita; Bartels, Heike; Hansen, Harly A S; Fucini, Paola; Wilson, Daniel; Peretz, Moshe; Kessler, Maggie; Yonath, Ada

    2003-09-01

    Ribosomes, the universal cellular organelles catalyzing the translation of genetic code into proteins, are protein/RNA assemblies, of a molecular weight 2.5 mega Daltons or higher. They are built of two subunits that associate for performing protein biosynthesis. The large subunit creates the peptide bond and provides the path for emerging proteins. The small has key roles in initiating the process and controlling its fidelity. Crystallographic studies on complexes of the small and the large eubacterial ribosomal subunits with substrate analogs, antibiotics, and inhibitors confirmed that the ribosomal RNA governs most of its activities, and indicated that the main catalytic contribution of the ribosome is the precise positioning and alignment of its substrates, the tRNA molecules. A symmetry-related region of a significant size, containing about two hundred nucleotides, was revealed in all known structures of the large ribosomal subunit, despite the asymmetric nature of the ribosome. The symmetry rotation axis, identified in the middle of the peptide-bond formation site, coincides with the bond connecting the tRNA double-helical features with its single-stranded 3' end, which is the moiety carrying the amino acids. This thus implies sovereign movements of tRNA features and suggests that tRNA translocation involves a rotatory motion within the ribosomal active site. This motion is guided and anchored by ribosomal nucleotides belonging to the active site walls, and results in geometry suitable for peptide-bond formation with no significant rearrangements. The sole geometrical requirement for this proposed mechanism is that the initial P-site tRNA adopts the flipped orientation. The rotatory motion is the major component of unified machinery for peptide-bond formation, translocation, and nascent protein progression, since its spiral nature ensures the entrance of the nascent peptide into the ribosomal exit tunnel. This tunnel, assumed to be a passive path for the

  17. Ribosomal Protein Rps26 Influences 80S Ribosome Assembly in Saccharomyces cerevisiae

    PubMed Central

    Belyy, Alexander; Levanova, Nadezhda; Tabakova, Irina; Rospert, Sabine

    2016-01-01

    ABSTRACT The eukaryotic ribosome consists of a small (40S) and a large (60S) subunit. Rps26 is one of the essential ribosomal proteins of the 40S subunit and is encoded by two almost identical genes, RPS26a and RPS26b. Previous studies demonstrated that Rps26 interacts with the 5′ untranslated region of mRNA via the eukaryote-specific 62-YXXPKXYXK-70 (Y62–K70) motif. Those observations suggested that this peptide within Rps26 might play an important and specific role during translation initiation. By using alanine-scanning mutagenesis and engineered strains of the yeast Saccharomyces cerevisiae, we found that single amino acid substitutions within the Y62–K70 motif of Rps26 did not affect the in vivo function of the protein. In contrast, complete deletion of the Y62–K70 segment was lethal. The simultaneous replacement of five conserved residues within the Y62–K70 segment by alanines resulted in growth defects under stress conditions and produced distinct changes in polysome profiles that were indicative of the accumulation of free 60S subunits. Human Rps26 (Rps26-Hs), which displays significant homology with yeast Rps26, supported the growth of an S. cerevisiae Δrps26a Δrps26b strain. However, the Δrps26a Δrps26b double deletion strain expressing Rps26-Hs displayed substantial growth defects and an altered ratio of 40S/60S ribosomal subunits. The combined data strongly suggest that the eukaryote-specific motif within Rps26 does not play a specific role in translation initiation. Rather, the data indicate that Rps26 as a whole is necessary for proper assembly of the 40S subunit and the 80S ribosome in yeast. IMPORTANCE Rps26 is an essential protein of the eukaryotic small ribosomal subunit. Previous experiments demonstrated an interaction between the eukaryote-specific Y62–K70 segment of Rps26 and the 5′ untranslated region of mRNA. The data suggested a specific role of the Y62–K70 motif during translation initiation. Here, we report that single

  18. Evidence that Yih1 resides in a complex with ribosomes.

    PubMed

    Waller, Tracey; Lee, Su Jung; Sattlegger, Evelyn

    2012-05-01

    Adjusting protein synthesis by phosphorylating eukaryotic translation initiation factor 2 (eIF2α) is a major mechanism by which eukaryotes adapt to and overcome stress. The eIF2α kinase Gcn2 is essential for overcoming amino acid starvation in all eukaryotes. We have shown that to sense starvation, the Gcn2 RWD domain must directly contact its effector protein, Gcn1, and both must bind to the ribosome, suggesting that starvation is sensed within a Gcn1-Gcn2-ribosome complex. The mammalian protein IMPACT, highly expressed in neurons, and its yeast orthologue yeast IMPACT homologue (Yih1) harbour an RWD domain with Gcn1-binding activity. We have shown that Yih1 downregulates Gcn2 by competing with Gcn2 for Gcn1-binding. Here, we provide evidence that Yih1 forms a complex with ribosomes. In velocity sedimentation assays, overexpressed glutathione S-transferase (GST)-tagged Yih1 cosedimented with polyribosomes independently of Gcn1. Reduction of polyribosomes to monosomes concomitantly decreased GST-Yih1 sedimentation in the heavy fractions where polyribosomes are normally found. Furthermore, GST-Yih1 coprecipitated large ribosomal protein Rpl39 independently of Gcn1. GST-Yih1 overexpression did not significantly affect Gcn1-ribosome or Gcn2-ribosome cosedimentation. myc-tagged Yih1 expressed from its own promoter cosedimented with polyribosomes independently of Gcn1, indicating that Yih1-ribosome interaction occurs under physiological conditions. GST-IMPACT cosedimented with yeast ribosomes and coprecipitated Rpl39 in a Gcn1-independent fashion, suggesting that Yih1/IMPACT-ribosome association is evolutionarily conserved. Moreover, GST-IMPACT coprecipitated actin as found for GST-Yih1. Taken together, our findings strongly suggest that IMPACT/Yih1 associates with ribosomes and that these ribosomes may simultaneously carry Gcn1 and Gcn2. Close physical proximity of Yih1 to the Gcn1-Gcn2-ribosome complex would allow cells to quickly inhibit Gcn2 whenever or wherever

  19. Quantitative assessment of ribosome drop-off in E. coli.

    PubMed

    Sin, Celine; Chiarugi, Davide; Valleriani, Angelo

    2016-04-01

    Premature ribosome drop-off is one of the major errors in translation of mRNA by ribosomes. However, repeated analyses of Ribo-seq data failed to quantify its strength inE. coli Relying on a novel highly sensitive data analysis method we show that a significant rate of ribosome drop-off is measurable and can be quantified also when cells are cultured under non-stressing conditions. Moreover, we find that the drop-off rate is highly variable, depending on multiple factors. In particular, under environmental stress such as amino acid starvation or ethanol intoxication, the drop-off rate markedly increases. PMID:26935582

  20. Whither Ribosome Structure and Dynamics Research? (A Perspective).

    PubMed

    Frank, Joachim

    2016-09-11

    As high-resolution cryogenic electron microscopy (cryo-EM) structures of ribosomes proliferate, at resolutions that allow atomic interactions to be visualized, this article attempts to give a perspective on the way research on ribosome structure and dynamics may be headed, and particularly the new opportunities we have gained through recent advances in cryo-EM. It is pointed out that single-molecule FRET and cryo-EM form natural complements in the characterization of ribosome dynamics and transitions among equilibrating states of in vitro translational systems. PMID:27178840

  1. Quantitative assessment of ribosome drop-off in E. coli

    PubMed Central

    Sin, Celine; Chiarugi, Davide; Valleriani, Angelo

    2016-01-01

    Premature ribosome drop-off is one of the major errors in translation of mRNA by ribosomes. However, repeated analyses of Ribo-seq data failed to quantify its strength in E. coli. Relying on a novel highly sensitive data analysis method we show that a significant rate of ribosome drop-off is measurable and can be quantified also when cells are cultured under non-stressing conditions. Moreover, we find that the drop-off rate is highly variable, depending on multiple factors. In particular, under environmental stress such as amino acid starvation or ethanol intoxication, the drop-off rate markedly increases. PMID:26935582

  2. The site-specific ribosomal DNA insertion element R1Bm belongs to a class of non-long-terminal-repeat retrotransposons

    SciTech Connect

    Xiong, Y.; Eickbush, T.H.

    1988-01-01

    Two types of insertion elements, R1 and R2 (previously called type I and type II), are known to interrupt the 28S ribosomal genes of several insect species. In the silkmoth, Bombyx mori, each element occupies approximately 10% of the estimated 240 ribosomal DNA units, while at most only a few copies are located outside the ribosomal DNA units. The authors present here the complete nucleotide sequence of an R1 insertion from B. mori (R1Bm). This 5.1-kilobase element contains two overlapping open reading frames (ORFs) which together occupy 88% of its length. ORF1 is 461 amino acids in length and exhibits characteristics of retroviral gag genes. ORF2 is 1,051 amino acids in length and contains homology to reverse transcriptase-like enzymes. The analysis of 3' and 5' ends of independent isolates from the ribosomal locus supports the suggestion that R1 is still functioning as a transposable element. The precise location of the element within the genome implies that its transposition must occur with remarkable insertion sequence specificity. Comparison of the deduced amino acid sequences from six retrotransposons, R1 and R2 of B. mori, I factor and F element of Drosophila melanogaster, L1 of Mus domesticus, and Ingi of Trypanosoma brucei, reveals a relatively high level of sequence homology in the reverse transcriptase region. Like R1, these elements lack long terminal repeats. The authors therefore named this class of related elements the non-long-terminal-repeat (non-LTR) retrotransposons.

  3. Ribosomes containing mutants of L4 ribosomal protein from Thermus thermophilus display multiple defects in ribosomal functions and sensitivity against erythromycin

    PubMed Central

    TSAGKALIA, AIKATERINI; LEONTIADOU, FOTINI; XAPLANTERI, MARIA A.; PAPADOPOULOS, GEORGIOS; KALPAXIS, DIMITRIOS L.; CHOLI-PAPADOPOULOU, THEODORA

    2005-01-01

    Protein L4 from Thermus thermophilus (TthL4) was heterologously overproduced in Escherichia coli cells. To study the implication of the extended loop of TthL4 in the exit-tunnel and peptidyltransferase functions, the highly conserved E56 was replaced by D or Q, while the semiconserved G55 was changed to E or S. Moreover, the sequence -G55E56- was inverted to -E55G56-. When we incorporated these mutants into E. coli ribosomes and investigated their impact on poly(Phe) synthesis, high variations in the synthetic activity and response to erythromycin of the resulting ribosomes were observed. In the absence of erythromycin, ribosomes harboring mutations G55E and E56D in TthL4 protein were characterized by low activity in synthesizing poly(Phe) and decreased capability in binding tRNA at the A site. On the other hand, ribosomes possessing mutations G55E, G55S, G55E-E56G, or E56Q in TthL4 protein were unexpectedly more sensitive to erythromycin. Evidence in support of these findings was drawn by in vivo experiments, assessing the erythromycin sensitivity of E. coli cells expressing wild-type or mutant TthL4 proteins. Our results emphasize the role of the extended loop of L4 ribosomal protein in the exit-tunnel and peptidyltransferase center functions. PMID:16244130

  4. Ribosome heterogeneity in tumorigenesis: the rRNA point of view

    PubMed Central

    Marcel, Virginie; Catez, Frédéric; Diaz, Jean-Jacques

    2015-01-01

    The "specialized ribosome" concept proposes that ribosome variants are produced and differentially regulate translation. Examples supporting this notion demonstrated heterogeneity of ribosomal protein composition. However, ribosome translational activity is carried out by rRNA. We, and others, recently showed that rRNA heterogeneity regulates translation to generate distinct translatomes promoting tumorigenesis. PMID:27305893

  5. Cotranslational protein folding on the ribosome monitored in real time.

    PubMed

    Holtkamp, Wolf; Kokic, Goran; Jäger, Marcus; Mittelstaet, Joerg; Komar, Anton A; Rodnina, Marina V

    2015-11-27

    Protein domains can fold into stable tertiary structures while they are synthesized on the ribosome. We used a high-performance, reconstituted in vitro translation system to investigate the folding of a small five-helix protein domain-the N-terminal domain of Escherichia coli N5-glutamine methyltransferase HemK-in real time. Our observations show that cotranslational folding of the protein, which folds autonomously and rapidly in solution, proceeds through a compact, non-native conformation that forms within the peptide tunnel of the ribosome. The compact state rearranges into a native-like structure immediately after the full domain sequence has emerged from the ribosome. Both folding transitions are rate-limited by translation, allowing for quasi-equilibrium sampling of the conformational space restricted by the ribosome. Cotranslational folding may be typical of small, intrinsically rapidly folding protein domains. PMID:26612953

  6. Metabolic Labeling in the Study of Mammalian Ribosomal RNA Synthesis.

    PubMed

    Stefanovsky, Victor Y; Moss, Tom

    2016-01-01

    RNA metabolic labeling is a method of choice in the study of dynamic changes in the rate of gene transcription and RNA processing. It is particularly applicable to transcription of the ribosomal RNA genes and their processing products due to the very high levels of ribosomal RNA synthesis. Metabolic labeling can detect changes in ribosomal RNA transcription that occur within a few minutes as opposed to the still widely used RT-PCR or Northern blot procedures that measure RNA pool sizes and at best are able to detect changes occurring over several hours or several days. Here, we describe a metabolic labeling technique applicable to the measurement of ribosomal RNA synthesis and processing rates, as well as to the determination of RNA Polymerase I transcription elongation rates. PMID:27576716

  7. Cotranslational Protein Folding inside the Ribosome Exit Tunnel.

    PubMed

    Nilsson, Ola B; Hedman, Rickard; Marino, Jacopo; Wickles, Stephan; Bischoff, Lukas; Johansson, Magnus; Müller-Lucks, Annika; Trovato, Fabio; Puglisi, Joseph D; O'Brien, Edward P; Beckmann, Roland; von Heijne, Gunnar

    2015-09-01

    At what point during translation do proteins fold? It is well established that proteins can fold cotranslationally outside the ribosome exit tunnel, whereas studies of folding inside the exit tunnel have so far detected only the formation of helical secondary structure and collapsed or partially structured folding intermediates. Here, using a combination of cotranslational nascent chain force measurements, inter-subunit fluorescence resonance energy transfer studies on single translating ribosomes, molecular dynamics simulations, and cryoelectron microscopy, we show that a small zinc-finger domain protein can fold deep inside the vestibule of the ribosome exit tunnel. Thus, for small protein domains, the ribosome itself can provide the kind of sheltered folding environment that chaperones provide for larger proteins. PMID:26321634

  8. Cotranslational Protein Folding inside the Ribosome Exit Tunnel

    PubMed Central

    Nilsson, Ola B.; Hedman, Rickard; Marino, Jacopo; Wickles, Stephan; Bischoff, Lukas; Johansson, Magnus; Müller-Lucks, Annika; Trovato, Fabio; Puglisi, Joseph D.; O’Brien, Edward P.; Beckmann, Roland; von Heijne, Gunnar

    2015-01-01

    Summary At what point during translation do proteins fold? It is well established that proteins can fold cotranslationally outside the ribosome exit tunnel, whereas studies of folding inside the exit tunnel have so far detected only the formation of helical secondary structure and collapsed or partially structured folding intermediates. Here, using a combination of cotranslational nascent chain force measurements, inter-subunit fluorescence resonance energy transfer studies on single translating ribosomes, molecular dynamics simulations, and cryoelectron microscopy, we show that a small zinc-finger domain protein can fold deep inside the vestibule of the ribosome exit tunnel. Thus, for small protein domains, the ribosome itself can provide the kind of sheltered folding environment that chaperones provide for larger proteins. PMID:26321634

  9. Direct ribosomal binding by a cellular inhibitor of translation

    PubMed Central

    Colón-Ramos, Daniel A; Shenvi, Christina L; Weitzel, Douglas H; Gan, Eugene C; Matts, Robert; Cate, Jamie; Kornbluth, Sally

    2009-01-01

    During apoptosis and under conditions of cellular stress, several signaling pathways promote inhibition of cap-dependent translation while allowing continued translation of specific messenger RNAs encoding regulatory and stress-response proteins. We report here that the apoptotic regulator Reaper inhibits protein synthesis by binding directly to the 40S ribosomal subunit. This interaction does not affect either ribosomal association of initiation factors or formation of 43S or 48S complexes. Rather, it interferes with late initiation events upstream of 60S subunit joining, apparently modulating start-codon recognition during scanning. CrPV IRES–driven translation, involving direct ribosomal recruitment to the start site, is relatively insensitive to Reaper. Thus, Reaper is the first known cellular ribosomal binding factor with the potential to allow selective translation of mRNAs initiating at alternative start codons or from certain IRES elements. This function of Reaper may modulate gene expression programs to affect cell fate. PMID:16429152

  10. Database on the structure of large ribosomal subunit RNA.

    PubMed Central

    De Rijk, P; Van de Peer, Y; Chapelle, S; De Wachter, R

    1994-01-01

    A database on large ribosomal subunit RNA is made available. It contains 258 sequences. It provides sequence, alignment and secondary structure information in computer-readable formats. Files can be obtained using ftp. PMID:7524023

  11. A process yields large quantities of pure ribosome subunits

    NASA Technical Reports Server (NTRS)

    Friedman, M.; Lu, P.; Rich, A.

    1972-01-01

    Development of process for in-vitro protein synthesis from living cells followed by dissociation of ribosomes into subunits is discussed. Process depends on dialysis or use of chelating agents. Operation of process and advantages over previous methods are outlined.

  12. Molecular phylogenetics at the Felsenstein zone: approaching the Strepsiptera problem using 5.8S and 28S rDNA sequences.

    PubMed

    Hwang, U W; Kim, W; Tautz, D; Friedrich, M

    1998-06-01

    Recent efforts to reconstruct the phylogenetic position of the insect order Strepsiptera have elicited a major controversy in molecular phylogenetics. We sequenced the 5.8S rDNA and major parts of the 28S rDNA 5' region of the strepsipteran species Stylops melittae. Their evolutionary dynamics were analyzed together with previously published insect rDNA sequences to identify tree estimation bias risks and to explore additional sources of phylogenetic information. Several major secondary structure changes were found as being autapomorphic for the Diptera, the Strepsiptera, or the Archaeognatha. Besides elevated substitution rates a significant AT bias was present in dipteran and strepsipteran 28S rDNA which, however, was restricted to stem sites in the Diptera while also affecting single-stranded sites in the Strepsiptera. When dipteran taxa were excluded from tree estimation all methods consistently supported the placement of Strepsiptera to within the Holometabola. When dipteran taxa were included maximum likelihood continued to favor a sister-group relationship of Strepsiptera with Mecoptera while remaining methods strongly supported a sister-group relationship with Diptera. Parametric bootstrap analysis revealed maximum likelihood as a consistent estimator if rate heterogeneity across sites was taken into account. Though the position of Strepsiptera within Holometabola remains elusive, we conclude that the evolution of dipteran and strepsipteran rDNA involved similar yet independent changes of substitution parameters. PMID:9667995

  13. Development and evaluation of a 28S rRNA gene-based nested PCR assay for P. falciparum and P. vivax

    PubMed Central

    Pakalapati, Deepak; Garg, Shilpi; Middha, Sheetal; Acharya, Jyoti; Subudhi, Amit K; Boopathi, Arunachalam P; Saxena, Vishal; Kochar, Sanjay K; Kochar, Dhanpat K; Das, Ashis

    2013-01-01

    The 28S rRNA gene was amplified and sequenced from P. falciparum and P. vivax isolates collected from northwest India. Based upon the sequence diversity of the Plasmodium 28SrRNA gene in comparison with its human counterpart, various nested polymerase chain reaction (PCR) primers were designed from the 3R region of the 28SrRNA gene and evaluated on field isolates. This is the first report demonstrating the utility of this gene for species-specific diagnosis of malaria for these two species, prevalent in India. The initial evaluation on 363 clinical isolates indicated that, in comparison with microscopy, which showed sensitivity and specificity of 85.39% and 100% respectively, the sensitivity and specificity of the nested PCR assay was found to be 99.08% and 100% respectively. This assay was also successful in detecting mixed infections that are undetected by microscopy. Our results demonstrate the utility of the 28S rRNA gene as a diagnostic target for the detection of the major plasmodial species infecting humans. PMID:23816509

  14. Cisplatin Targeting of Bacterial Ribosomal RNA Hairpins

    PubMed Central

    Dedduwa-Mudalige, Gayani N. P.; Chow, Christine S.

    2015-01-01

    Cisplatin is a clinically important chemotherapeutic agent known to target purine bases in nucleic acids. In addition to major deoxyribonucleic acid (DNA) intrastrand cross-links, cisplatin also forms stable adducts with many types of ribonucleic acid (RNA) including siRNA, spliceosomal RNAs, tRNA, and rRNA. All of these RNAs play vital roles in the cell, such as catalysis of protein synthesis by rRNA, and therefore serve as potential drug targets. This work focused on platination of two highly conserved RNA hairpins from E. coli ribosomes, namely pseudouridine-modified helix 69 from 23S rRNA and the 790 loop of helix 24 from 16S rRNA. RNase T1 probing, MALDI mass spectrometry, and dimethyl sulfate mapping revealed platination at GpG sites. Chemical probing results also showed platination-induced RNA structural changes. These findings reveal solvent and structural accessibility of sites within bacterial RNA secondary structures that are functionally significant and therefore viable targets for cisplatin as well as other classes of small molecules. Identifying target preferences at the nucleotide level, as well as determining cisplatin-induced RNA conformational changes, is important for the design of more potent drug molecules. Furthermore, the knowledge gained through studies of RNA-targeting by cisplatin is applicable to a broad range of organisms from bacteria to human. PMID:26370969

  15. The ribosomal gene spacer region in archaebacteria

    NASA Technical Reports Server (NTRS)

    Achenbach-Richter, L.; Woese, C. R.

    1988-01-01

    Sequences for the spacer regions that separate the 16S and 23S ribosomal RNA genes have been determined for four more (strategically placed) archaebacteria. These confirm the general rule that methanogens and extreme halophiles have spacers that contain a single tRNAala gene, while tRNA genes are not found in the spacer region of the true extreme thermophiles. The present study also shows that the spacer regions from the sulfate reducing Archaeglobus and the extreme thermophile Thermococcus (both of which cluster phylogenetically with the methanogens and extreme halophiles) contain each a tRNAala gene. Thus, not only all methanogens and extreme halophiles show this characteristic, but all organisms on the "methanogen branch" of the archaebacterial tree appear to do so. The finding of a tRNA gene in the spacer region of the extreme thermophile Thermococcus celer is the first known phenotypic property that links this organism with its phylogenetic counterparts, the methanogens, rather than with its phenotypic counterparts, the sulfur-dependent extreme thermophiles.

  16. Nonenzymatic microorganism identification based on ribosomal RNA

    NASA Astrophysics Data System (ADS)

    Ives, Jeffrey T.; Pierini, Alicia M.; Stokes, Jeffrey A.; Wahlund, Thomas M.; Read, Betsy; Bechtel, James H.; Bronk, Burt V.

    1999-11-01

    Effective defense against biological warfare (BW) agents requires rapid, fieldable and accurate systems. For micro- organisms like bacteria and viruses, ribosomal RNA (rRNA) provides a valuable target with multiple advantages of species specificity and intrinsic target amplification. Vegetative and spore forms of bacteria contain approximately 104 copies of rRNA. Direct detection of rRNA copies can eliminate some of the interference and preparation difficulties involved in enzymatic amplification methods. In order to apply the advantages of rRNA to BW defense, we are developing a fieldable system based on 16S rRNA, physical disruption of the micro-organism, solid phase hybridization, and fluorescence detection. Our goals include species-specific identification, complete operation from raw sample to identification in 15 minutes or less, and compact, fieldable instrumentation. Initial work on this project has investigated the lysis and hybridization steps, the species-specificity of oligonucleotides probes, and the development of a novel electromagnetic method to physically disrupt the micro- organisms. Target bacteria have been Escherichia coli (E. coli) and Bacillus subtilis (B. subtilis). Continuing work includes further development of methods to rapidly disrupt the micro-organisms and release the rRNA, improved integration and processing, and extension to bacterial and mammalian viruses like MS2 and vesicular stomatitis virus.

  17. Molecular mechanisms of ribosomal protein gene coregulation.

    PubMed

    Reja, Rohit; Vinayachandran, Vinesh; Ghosh, Sujana; Pugh, B Franklin

    2015-09-15

    The 137 ribosomal protein genes (RPGs) of Saccharomyces provide a model for gene coregulation. We examined the positional and functional organization of their regulators (Rap1 [repressor activator protein 1], Fhl1, Ifh1, Sfp1, and Hmo1), the transcription machinery (TFIIB, TFIID, and RNA polymerase II), and chromatin at near-base-pair resolution using ChIP-exo, as RPGs are coordinately reprogrammed. Where Hmo1 is enriched, Fhl1, Ifh1, Sfp1, and Hmo1 cross-linked broadly to promoter DNA in an RPG-specific manner and demarcated by general minor groove widening. Importantly, Hmo1 extended 20-50 base pairs (bp) downstream from Fhl1. Upon RPG repression, Fhl1 remained in place. Hmo1 dissociated, which was coupled to an upstream shift of the +1 nucleosome, as reflected by the Hmo1 extension and core promoter region. Fhl1 and Hmo1 may create two regulatable and positionally distinct barriers, against which chromatin remodelers position the +1 nucleosome into either an activating or a repressive state. Consistent with in vitro studies, we found that specific TFIID subunits, in addition to cross-linking at the core promoter, made precise cross-links at Rap1 sites, which we interpret to reflect native Rap1-TFIID interactions. Our findings suggest how sequence-specific DNA binding regulates nucleosome positioning and transcription complex assembly >300 bp away and how coregulation coevolved with coding sequences. PMID:26385964

  18. Alveolate phylogeny inferred using concatenated ribosomal proteins.

    PubMed

    Bachvaroff, Tsvetan R; Handy, Sara M; Place, Allen R; Delwiche, Charles F

    2011-01-01

    Dinoflagellates and apicomplexans are a strongly supported monophyletic group in rDNA phylogenies, although this phylogeny is not without controversy, particularly between the two groups. Here we use concatenated protein-coding genes from expressed sequence tags or genomic data to construct phylogenies including "typical" dinophycean dinoflagellates, a parasitic syndinian dinoflagellate, Amoebophrya sp., and two related species, Oxyrrhis marina, and Perkinsus marinus. Seventeen genes encoding proteins associated with the ribosome were selected for phylogenetic analysis. The dataset was limited for the most part by data availability from the dinoflagellates. Forty-five taxa from four major lineages were used: the heterokont outgroup, ciliates, dinoflagellates, and apicomplexans. Amoebophrya sp. was included in this phylogeny as a sole representative of the enigmatic marine alveolate or syndinian lineage. The atypical dinoflagellate O. marina, usually excluded from rDNA analyses due to long branches, was also included. The resulting phylogenies were well supported in concatenated analyses with only a few unstable or weakly supported branches; most features were consistent when different lineages were pruned from the tree or different genes were concatenated. The least stable branches involved the placement of Cryptosporidium spp. within the Apicomplexa and the relationships between P. marinus, Amoebophrya sp., and O. marina. Both bootstrap and approximately unbiased test results confirmed that P. marinus, Amoebophrya sp., O. marina, and the remaining dinoflagellates form a monophyletic lineage to the exclusion of Apicomplexa. PMID:21518081

  19. The 16S ribosomal RNA mutation database (16SMDB).

    PubMed Central

    Triman, K L

    1996-01-01

    The 16S ribosomal RNA mutation database (16SMDB) provides a list of mutated positions in 16S ribosomal RNA from Escherichia coli and the identity of each alteration. Information provided for each mutation includes: (i) a brief description of the phenotype(s) associated with each mutation; (ii) whether a mutant phenotype has been detected by in vivo or in vitro methods; (iii) relevant literature citations. The database is available via ftp and on the World Wide Web. PMID:8594570

  20. Comprehensive analysis of phosphorylated proteins of Escherichia coli ribosomes.

    PubMed

    Soung, George Y; Miller, Jennifer L; Koc, Hasan; Koc, Emine C

    2009-07-01

    Phosphorylation of bacterial ribosomal proteins has been known for decades; however, there is still very limited information available on specific locations of the phosphorylation sites in ribosomal proteins and the role they might play in protein synthesis. In this study, we have mapped the specific phosphorylation sites in 24 Escherichia coli ribosomal proteins by tandem mass spectrometry. Detection of phosphorylation was achieved by either phosphorylation specific visualization techniques, ProQ staining, and antibodies for phospho-Ser, Thr, and Tyr; or by mass spectrometry equipped with a capability to detect addition and loss of the phosphate moiety. Enrichment by immobilized metal affinity and/or strong cation exchange chromatography was used to improve the success of detection of the low abundance phosphopeptides. We found the small subunit (30S) proteins S3, S4, S5, S7, S11, S12, S13, S18, and S21 and the large subunit (50S) proteins L1, L2, L3, L5, L6, L7/L12, L13, L14, L16, L18, L19, L21, L22, L28, and L31 to be phosphorylated at one or more residues. Potential roles for each specific site in ribosome function were deduced through careful evaluation of the given phosphorylation sites in 3D-crystal structure models of ribosomes and the previous mutational studies of E. coli ribosomal proteins. PMID:19469554

  1. Purification, characterization and crystallization of the human 80S ribosome

    PubMed Central

    Khatter, Heena; Myasnikov, Alexander G.; Mastio, Leslie; Billas, Isabelle M. L.; Birck, Catherine; Stella, Stefano; Klaholz, Bruno P.

    2014-01-01

    Ribosomes are key macromolecular protein synthesis machineries in the cell. Human ribosomes have so far not been studied to atomic resolution because of their particularly complex structure as compared with other eukaryotic or prokaryotic ribosomes, and they are difficult to prepare to high homogeneity, which is a key requisite for high-resolution structural work. We established a purification protocol for human 80S ribosomes isolated from HeLa cells that allows obtaining large quantities of homogenous samples as characterized by biophysical methods using analytical ultracentrifugation and multiangle laser light scattering. Samples prepared under different conditions were characterized by direct single particle imaging using cryo electron microscopy, which helped optimizing the preparation protocol. From a small data set, a 3D reconstruction at subnanometric resolution was obtained showing all prominent structural features of the human ribosome, and revealing a salt concentration dependence of the presence of the exit site tRNA, which we show is critical for obtaining crystals. With these well-characterized samples first human 80S ribosome crystals were obtained from several crystallization conditions in capillaries and sitting drops, which diffract to 26 Å resolution at cryo temperatures and for which the crystallographic parameters were determined, paving the way for future high-resolution work. PMID:24452798

  2. GTPases mechanisms and functions of translation factors on the ribosome.

    PubMed

    Rodnina, M V; Stark, H; Savelsbergh, A; Wieden, H J; Mohr, D; Matassova, N B; Peske, F; Daviter, T; Gualerzi, C O; Wintermeyer, W

    2000-01-01

    The elongation factors (EF) Tu and G and initiation factor 2 (IF2) from bacteria are multidomain GTPases with essential functions in the elongation and initiation phases of translation. They bind to the same site on the ribosome where their low intrinsic GTPase activities are strongly stimulated. The factors differ fundamentally from each other, and from the majority of GTPases, in the mechanisms of GTPase control, the timing of Pi release, and the functional role of GTP hydrolysis. EF-Tu x GTP forms a ternary complex with aminoacyl-tRNA, which binds to the ribosome. Only when a matching codon is recognized, the GTPase of EF-Tu is stimulated, rapid GTP hydrolysis and Pi release take place, EF-Tu rearranges to the GDP form, and aminoacyl-tRNA is released into the peptidyltransferase center. In contrast, EF-G hydrolyzes GTP immediately upon binding to the ribosome, stimulated by ribosomal protein L7/12. Subsequent translocation is driven by the slow dissociation of Pi, suggesting a mechano-chemical function of EF-G. Accordingly, different conformations of EF-G on the ribosome are revealed by cryo-electron microscopy. GTP hydrolysis by IF2 is triggered upon formation of the 70S initiation complex, and the dissociation of Pi and/or IF2 follows a rearrangement of the ribosome into the elongation-competent state. PMID:10937868

  3. Structures of the ribosome in intermediate states of ratcheting

    PubMed Central

    Zhang, Wen; Dunkle, Jack; Cate, Jamie H. D.

    2010-01-01

    Summary Structures of the E. coli 70S ribosome show how the large and small subunits rotate to facilitate protein synthesis. Protein biosynthesis on the ribosome requires repeated cycles of ratcheting, which couples rotation of the two ribosomal subunits with respect to each other and swiveling of the head domain of the small subunit. However, the molecular basis for how the two ribosomal subunits rearrange contacts with each other during ratcheting while remaining stably associated is not known. Here we describe x-ray crystal structures of the intact Escherichia coli ribosome, either in the apo form (3.5 Å resolution) or with one (4.0 Å res) or two (4.0 Å res) anticodon stem-loop tRNA mimics bound, that reveal intermediate states of intersubunit rotation. In the structures, the interface between the small and large ribosomal subunits rearranges in discrete steps along the ratcheting pathway. Positioning of the head domain of the small subunit is controlled by interactions with the large subunit and with the tRNA bound in the peptidyl-tRNA site. The intermediates observed here provide insight into how tRNAs move into the hybrid state of binding that precedes the final steps of mRNA and tRNA translocation. PMID:19696352

  4. Targeted cancer therapy with ribosome biogenesis inhibitors: a real possibility?

    PubMed Central

    Brighenti, Elisa; Treré, Davide; Derenzini, Massimo

    2015-01-01

    The effects of many chemotherapeutic drugs on ribosome biogenesis have been underestimated for a long time. Indeed, many drugs currently used for cancer treatment – and which are known to either damage DNA or hinder DNA synthesis – have been shown to exert their toxic action mainly by inhibiting rRNA synthesis or maturation. Moreover, there are new drugs that have been proposed recently for cancer chemotherapy, which only hinder ribosome biogenesis without any genotoxic activity. Even though ribosome biogenesis occurs in both normal and cancer cells, whether resting or proliferating, there is evidence that the selective inhibition of ribosome biogenesis may, in some instances, result in a selective damage to neoplastic cells. The higher sensitivity of cancer cells to inhibitors of rRNA synthesis appears to be the consequence of either the loss of the mechanisms controlling the cell cycle progression or the acquisition of activating oncogene and inactivating tumor suppressor gene mutations that up-regulate the ribosome biogenesis rate. This article reviews those cancer cell characteristics on which the selective cancer cell cytotoxicity induced by the inhibitors of ribosome biogenesis is based. PMID:26415219

  5. On the expansion of ribosomal proteins and RNAs in eukaryotes.

    PubMed

    Parker, Michael S; Sah, Renu; Balasubramaniam, Ambikaipakan; Sallee, Floyd R; Park, Edwards A; Parker, Steven L

    2014-07-01

    While the ribosome constitution is similar in all biota, there is a considerable increase in size of both ribosomal proteins (RPs) and RNAs in eukaryotes as compared to archaea and bacteria. This is pronounced in the large (60S) ribosomal subunit (LSU). In addition to enlargement (apparently maximized already in lower eukarya), the RP changes include increases in fraction, segregation and clustering of basic residues, and decrease in hydrophobicity. The acidic fraction is lower in eukaryote as compared to prokaryote RPs. In all eukaryote groups tested, the LSU RPs have significantly higher content of basic residues and homobasic segments than the SSU RPs. The vertebrate LSU RPs have much higher sequestration of basic residues than those of bacteria, archaea and even of the lower eukarya. The basic clusters are highly aligned in the vertebrate, but less in the lower eukarya, and only within families in archaea and bacteria. Increase in the basicity of RPs, besides helping transport to the nucleus, should promote stability of the assembled ribosome as well as the association with translocons and other intracellular matrix proteins. The size and GC nucleotide bias of the expansion segments of large LSU rRNAs also culminate in the vertebrate, and should support ribosome association with the endoplasmic reticulum and other intracellular networks. However, the expansion and nucleotide bias of eukaryote LSU rRNAs do not clearly correlate with changes in ionic parameters of LSU ribosomal proteins. PMID:24633358

  6. Simultaneous Discrimination between 15 Fish Pathogens by Using 16S Ribosomal DNA PCR and DNA Microarrays

    PubMed Central

    Warsen, Adelaide E.; Krug, Melissa J.; LaFrentz, Stacey; Stanek, Danielle R.; Loge, Frank J.; Call, Douglas R.

    2004-01-01

    We developed a DNA microarray suitable for simultaneous detection and discrimination between multiple bacterial species based on 16S ribosomal DNA (rDNA) polymorphisms using glass slides. Microarray probes (22- to 31-mer oligonucleotides) were spotted onto Teflon-masked, epoxy-silane-derivatized glass slides using a robotic arrayer. PCR products (ca. 199 bp) were generated using biotinylated, universal primer sequences, and these products were hybridized overnight (55°C) to the microarray. Targets that annealed to microarray probes were detected using a combination of Tyramide Signal Amplification and Alexa Fluor 546. This methodology permitted 100% specificity for detection of 18 microbes, 15 of which were fish pathogens. With universal 16S rDNA PCR (limited to 28 cycles), detection sensitivity for purified control DNA was equivalent to <150 genomes (675 fg), and this sensitivity was not adversely impacted either by the presence of competing bacterial DNA (1.1 × 106 genomes; 5 ng) or by the addition of up to 500 ng of fish DNA. Consequently, coupling 16S rDNA PCR with a microarray detector appears suitable for diagnostic detection and surveillance for commercially important fish pathogens. PMID:15240304

  7. Increased ribosome density associated to positively charged residues is evident in ribosome profiling experiments performed in the absence of translation inhibitors.

    PubMed

    Requião, Rodrigo D; de Souza, Henrique José Araujo; Rossetto, Silvana; Domitrovic, Tatiana; Palhano, Fernando L

    2016-06-01

    It has been proposed that polybasic peptides cause slower movement of ribosomes through an electrostatic interaction with the highly negative ribosome exit tunnel. Ribosome profiling data-the sequencing of short ribosome-bound fragments of mRNA-is a powerful tool for the analysis of mRNA translation. Using the yeast Saccharomyces cerevisiae as a model, we showed that reduced translation efficiency associated with polybasic protein sequences could be inferred from ribosome profiling. However, an increase in ribosome density at polybasic sequences was evident only when the commonly used translational inhibitors cycloheximide and anisomycin were omitted during mRNA isolation. Since ribosome profiling performed without inhibitors agrees with experimental evidence obtained by other methods, we conclude that cycloheximide and anisomycin must be avoided in ribosome profiling experiments. PMID:27064519

  8. Chemical probing of the tRNA--ribosome complex.

    PubMed Central

    Peattie, D A; Herr, W

    1981-01-01

    We probed the (Escherichia coli) tRNAPhe--ribosome interaction with the chemical reagents dimethyl sulfate and diethyl pyrocarbonate. This monitored the higher-order structure of the tRNA in this biological complex and identified critical sites in the tRNA molecule involved in binding to the ribosome. The methylation of the N-7 position of guanosine and the N-3 position of cytidine as well as diethyl pyrocarbonate attack on adenosines are sensitive to secondary and tertiary interactions. Here we identify specific bases in E. coli Phe-tRNAPhe affected by the interaction with the ribosome. The 70S ribosome protects the N-3 position of cytidine-74 and 75 in the 3'-terminal C-C-A, suggesting a strong, possibly base pairing, interaction between the ribosome and that universal sequence. The ribosome also induces strong reactivities at the N-7 positions of G-24 and G-46 in the central region of the tRNA molecule near the variable-loop domain as well as less significant reactivities at 11 other guanosines. Two of these, G-10 and G-44, are close to G-24 and G-46 in the center of the molecule; the others (guanosines 1, 5, 6, 18, 19, 63, 65, 69, and 71) are in the coaxial acceptor stem-T stem helix. All of the effects are ribosome induced and occur in the presence or absence of the messenger poly(U). Prior chemical modification of the anticodon bases as well as the two adjacent 3' purines and, less effectively, four purines in the anticodon stem prevent stable poly(U)-directed ribosome binding. Thus, we identify the 3' terminal C-C-A sequence, near the peptidyl transferase site, and the anticodon stem and loop of tRNAPhe as forming critical contacts with the ribosome. Other regions of the molecule become reactive on ribosome binding, but these do not suggest a significant conformational change being more likely due to a change of environment. Images PMID:6166006

  9. Non-random expression of ribosomal DNA units in a grasshopper showing high intragenomic variation for the ITS2 region.

    PubMed

    Ruiz-Estévez, M; Ruiz-Ruano, F J; Cabrero, J; Bakkali, M; Perfectti, F; López-León, M D; Camacho, J P M

    2015-06-01

    We analyse intragenomic variation of the ITS2 internal transcribed spacer of ribosomal DNA (rDNA) in the grasshopper Eyprepocnemis plorans, by means of tagged PCR 454 amplicon sequencing performed on both genomic DNA (gDNA) and RNA-derived complementary DNA (cDNA), using part of the ITS2 flanking coding regions (5.8S and 28S rDNA) as an internal control for sequencing errors. Six different ITS2 haplotypes (i.e. variants for at least one nucleotide in the complete ITS2 sequence) were found in a single population, one of them (Hap4) being specific to a supernumerary (B) chromosome. The analysis of both gDNA and cDNA from the same individuals provided an estimate of the expression efficiency of the different haplotypes. We found random expression (i.e. about similar recovery in gDNA and cDNA) for three haplotypes (Hap1, Hap2 and Hap5), but significant underexpression for three others (Hap3, Hap4 and Hap6). Hap4 was the most extremely underexpressed and, remarkably, it showed the lowest sequence conservation for the flanking 5.8-28S coding regions in the gDNA reads but the highest conservation (100%) in the cDNA ones, suggesting the preferential expression of mutation-free rDNA units carrying this ITS2 haplotype. These results indicate that the ITS2 region of rDNA is far from complete homogenization in this species, and that the different rDNA units are not expressed at random, with some of them being severely downregulated. PMID:25565136

  10. Riproximin is a recently discovered type II ribosome inactivating protein with potential for treating cancer.

    PubMed

    Adwan, Hassan; Bayer, Helene; Pervaiz, Asim; Sagini, Micah; Berger, Martin R

    2014-11-01

    The development of new anticancer drugs is a salient problem and the traditional use of plants is a potentially rich source of information for detecting new molecules with antineoplastic activity. Riproximin is a recently detected cytotoxic type II ribosome inactivating protein with high selectivity for certain tumor cell lines. Its activity was recognized as the main component in a plant powder used by African healers for treating cancer. By ribulose bisphosphate carboxylase gene sequencing analysis, the powder was identified to be derived from the plant Ximenia americana. The cDNA sequence of riproximin was identified, the protein was modeled to contain one A- and a B-chain, respectively, and a reliable purification procedure from kernels of X. americana was established. Riproximin displays high but differential antiproliferative activity in a panel of human and rodent cancer cell lines, with concentrations inhibiting cell proliferation by 50% (IC50 values) that diverge by a factor of 100. Consistent antineoplastic activity was detected in colorectal and pancreatic cancer liver metastasis models in rats. The cytotoxic mechanism of action was determined to be based on cellular uptake of riproximin followed by its A-chain prompted depurination of the 28S ribosomal RNA and induction of unfolded protein response. Riproximin's specificity depended on its B-chain connected binding to cell surface glycans, the presence of which is crucial for subsequent internalization into cells and cytotoxicity. These N- and O-glycans include bi- and tri-antennary NA structures (NA2/NA3) as well as Tn3 structures (clustered Tn antigen). Riproximin was found to crosslink proteins with N- and O-glycan structure, thus indicating both types of binding sites on its B chain. Due to this crosslinking ability, riproximin is expected to show prominent cytotoxicity towards cells expressing both, NA2/NA3 and clustered Tn structures. Apart from the properties of riproximin, the plant X. americana

  11. The role of GTP in transient splitting of 70S ribosomes by RRF (ribosome recycling factor) and EF-G (elongation factor G)

    PubMed Central

    Hirokawa, Go; Iwakura, Nobuhiro; Kaji, Akira; Kaji, Hideko

    2008-01-01

    Ribosome recycling factor (RRF), elongation factor G (EF-G) and GTP split 70S ribosomes into subunits. Here, we demonstrated that the splitting was transient and the exhaustion of GTP resulted in re-association of the split subunits into 70S ribosomes unless IF3 (initiation factor 3) was present. However, the splitting was observed with sucrose density gradient centrifugation (SDGC) without IF3 if RRF, EF-G and GTP were present in the SDGC buffer. The splitting of 70S ribosomes causes the decrease of light scattering by ribosomes. Kinetic constants obtained from the light scattering studies are sufficient to account for the splitting of 70S ribosomes by RRF and EF-G/GTP during the lag phase for activation of ribosomes for the log phase. As the amount of 70S ribosomes increased, more RRF, EF-G and GTP were necessary to split 70S ribosomes. In the presence of a physiological amount of polyamines, GTP and factors, even 0.6 μM 70S ribosomes (12 times higher than the 70S ribosomes for routine assay) were split. Spermidine (2 mM) completely inhibited anti-association activity of IF3, and the RRF/EF-G/GTP-dependent splitting of 70S ribosomes. PMID:18948280

  12. Initiation factor 2 stabilizes the ribosome in a semirotated conformation.

    PubMed

    Ling, Clarence; Ermolenko, Dmitri N

    2015-12-29

    Intersubunit rotation and movement of the L1 stalk, a mobile domain of the large ribosomal subunit, have been shown to accompany the elongation cycle of translation. The initiation phase of protein synthesis is crucial for translational control of gene expression; however, in contrast to elongation, little is known about the conformational rearrangements of the ribosome during initiation. Bacterial initiation factors (IFs) 1, 2, and 3 mediate the binding of initiator tRNA and mRNA to the small ribosomal subunit to form the initiation complex, which subsequently associates with the large subunit by a poorly understood mechanism. Here, we use single-molecule FRET to monitor intersubunit rotation and the inward/outward movement of the L1 stalk of the large ribosomal subunit during the subunit-joining step of translation initiation. We show that, on subunit association, the ribosome adopts a distinct conformation in which the ribosomal subunits are in a semirotated orientation and the L1 stalk is positioned in a half-closed state. The formation of the semirotated intermediate requires the presence of an aminoacylated initiator, fMet-tRNA(fMet), and IF2 in the GTP-bound state. GTP hydrolysis by IF2 induces opening of the L1 stalk and the transition to the nonrotated conformation of the ribosome. Our results suggest that positioning subunits in a semirotated orientation facilitates subunit association and support a model in which L1 stalk movement is coupled to intersubunit rotation and/or IF2 binding. PMID:26668356

  13. Review of Experimental Data on Alpha-Induced Reactions on Some Nuclei (Mg-24, Si-28, S-32, Ar-36, Ca-40) in Terms of Astrophysical Applications

    SciTech Connect

    Dunaeva, S.A.; McLane, V.; Savin, M.; Taova, S.

    2005-05-24

    The present report gives a detailed analysis of experimental works and a review of alpha-induced reaction cross-section data of five alpha-alpha nuclei, Mg-24, Si-28, S-32, Ar-36 and Ca-40, for incident alpha energy up to 20 MeV. Alpha-induced reactions play an important role in the helium burning stage of stars, novae, and supernovae. These reactions are basic to the CNO and Al-Mg cycles, and also to the production of neutrons producing S and R processes occurring in stars. Thus, the availability of cross-section data for these reactions is a prime need for the study of nuclear interactions taking place in stars.These data have been compiled as part of an international collaboration, funded in part by the Civilian Research and Development Foundation, and are available in the EXFOR databases.

  14. D2 Region of the 28S RNA Gene: A Too-Conserved Fragment for Inferences on Phylogeny of South American Triatomines.

    PubMed

    Guerra, Ana Letícia; Alevi, Kaio Cesar Chaboli; Banho, Cecília Artico; de Oliveira, Jader; da Rosa, João Aristeu; Vilela de Azeredo-Oliveira, Maria Tercília

    2016-09-01

    The brasiliensis complex is composed of five triatomine species, and different approaches suggest that Triatoma lenti and Triatoma petrochiae may be the new members. Therefore, this study sought to analyze the phylogenetic relationships within this complex by means of the D2 region of the 28S RNA gene, and to analyze the degree of polymorphism and phylogenetic significance of this gene for South American triatomines. Phylogenetic analysis by using sequence fragments of the D2 domain did not allow to perform phylogenetic inferences on species within the brasiliensis complex, because the gene alignment composed of a matrix with 37 specimens exhibited only two variable sites along the 567 base pairs used. Furthermore, if all South American species are included, only four variable sites were detected, reflecting the high degree of gene conservation. Therefore, we do not recommend the use of this gene for phylogenetic reconstruction for this group of Chagas disease vectors. PMID:27382073

  15. Molecular phylogenetics of the spider infraorder Mygalomorphae using nuclear rRNA genes (18S and 28S): conflict and agreement with the current system of classification.

    PubMed

    Hedin, Marshal; Bond, Jason E

    2006-11-01

    Mygalomorph spiders, which include the tarantulas, trapdoor spiders, and their kin, represent one of three main spider lineages. Mygalomorphs are currently classified into 15 families, comprising roughly 2500 species and 300 genera. The few published phylogenies of mygalomorph relationships are based exclusively on morphological data and reveal areas of both conflict and congruence, suggesting the need for additional phylogenetic research utilizing new character systems. As part of a larger combined evidence study of global mygalomorph relationships, we have gathered approximately 3.7 kb of rRNA data (18S and 28S) for a sample of 80 genera, representing all 15 mygalomorph families. Taxon sampling was particularly intensive across families that are questionable in composition-Cyrtaucheniidae and Nemesiidae. The following primary results are supported by both Bayesian and parsimony analyses of combined matrices representing multiple 28S alignments: (1) the Atypoidea, a clade that includes the families Atypidae, Antrodiaetidae, and Mecicobothriidae, is recovered as a basal lineage sister to all other mygalomorphs, (2) diplurids and hexathelids form a paraphyletic grade at the base of the non-atypoid clade, but neither family is monophyletic in any of our analyses, (3) a clade consisting of all sampled nemesiids, Microstigmata and the cyrtaucheniid genera Kiama, Acontius, and Fufius is consistently recovered, (4) other sampled cyrtaucheniids are fragmented across three separate clades, including a monophyletic North American Euctenizinae and a South African clade, (5) of the Domiothelina, only idiopids are consistently recovered as monophyletic; ctenizids are polyphyletic and migids are only weakly supported. The Domiothelina is not monophyletic. The molecular results we present are consistent with more recent hypotheses of mygalomorph relationship; however, additional work remains before mygalomorph classification can be formally reassessed with confidence

  16. Small-Molecule Inhibitor Leads of Ribosome-Inactivating Proteins Developed Using the Doorstop Approach

    PubMed Central

    Pang, Yuan-Ping; Park, Jewn Giew; Wang, Shaohua; Vummenthala, Anuradha; Mishra, Rajesh K.; McLaughlin, John E.; Di, Rong; Kahn, Jennifer Nielsen; Tumer, Nilgun E.; Janosi, Laszlo; Davis, Jon; Millard, Charles B.

    2011-01-01

    Ribosome-inactivating proteins (RIPs) are toxic because they bind to 28S rRNA and depurinate a specific adenine residue from the α-sarcin/ricin loop (SRL), thereby inhibiting protein synthesis. Shiga-like toxins (Stx1 and Stx2), produced by Escherichia coli, are RIPs that cause outbreaks of foodborne diseases with significant morbidity and mortality. Ricin, produced by the castor bean plant, is another RIP lethal to mammals. Currently, no US Food and Drug Administration-approved vaccines nor therapeutics exist to protect against ricin, Shiga-like toxins, or other RIPs. Development of effective small-molecule RIP inhibitors as therapeutics is challenging because strong electrostatic interactions at the RIP•SRL interface make drug-like molecules ineffective in competing with the rRNA for binding to RIPs. Herein, we report small molecules that show up to 20% cell protection against ricin or Stx2 at a drug concentration of 300 nM. These molecules were discovered using the doorstop approach, a new approach to protein•polynucleotide inhibitors that identifies small molecules as doorstops to prevent an active-site residue of an RIP (e.g., Tyr80 of ricin or Tyr77 of Stx2) from adopting an active conformation thereby blocking the function of the protein rather than contenders in the competition for binding to the RIP. This work offers promising leads for developing RIP therapeutics. The results suggest that the doorstop approach might also be applicable in the development of other protein•polynucleotide inhibitors as antiviral agents such as inhibitors of the Z-DNA binding proteins in poxviruses. This work also calls for careful chemical and biological characterization of drug leads obtained from chemical screens to avoid the identification of irrelevant chemical structures and to avoid the interference caused by direct interactions between the chemicals being screened and the luciferase reporter used in screening assays. PMID:21455295

  17. The immunogenic activity of ribosomal fractions derived from Brucella abortus.

    PubMed Central

    Corbel, M. J.

    1976-01-01

    The immunizing activity of ribosome preparations derived from Brucella abortus strain 19 cells was examined in guinea-pigs and mice. After subcutaneous injections of Br. abortus ribosomes in Freund's incomplete adjuvant, both mice and guinea-pigs developed immunity to challenge by virulent Br. abortus 544 organisms which was at least as effective as the protection conferred by live strain 19 vaccine. Both mice and guinea-pigs also developed agglutinating and complement-fixing antibodies and delayed hypersensitivity to Br. Abortus antigens. Conversely, ribosome preparations elicited delayed hypersensitivity reactions on intracutaneous injection into guinea-pigs chronically infected with Br. abortus or Br. melitensis. On injection into rabbits, Br. abortus ribosomes incorporated in incomplete adjuvant induced high titres of agglutinins, complement fxing antibodies and precipitins for Br. abortus antigens. On immunochemical examination, the ribosome preparations were not grossly contaminated with antigens derived from the cell surface. They were chemically complex, however, and in addition to RNA contained numerous protein components identified by disk electrophoresis. The nature of the components responsible for conferring protection against Br. abortus was not determined. Images Fig. 1 Fig. 2 Fig. 1 Fig. 2 Fig. 1 Fig. 2 Fig. 1 Fig. 2 PMID:812900

  18. Aminoglycoside activity observed on single pre-translocation ribosome complexes

    PubMed Central

    Feldman, Michael B; Terry, Daniel S; Altman, Roger B; Blanchard, Scott C

    2010-01-01

    Aminoglycoside-class antibiotics bind directly to ribosomal RNA, imparting pleiotropic effects on ribosome function. Despite in-depth structural investigations of aminoglycoside–RNA oligonucleotide and aminoglycoside-ribosome interactions, mechanisms explaining the unique ribosome inhibition profiles of chemically similar aminoglycosides remain elusive. Here, using single-molecule fluorescence resonance energy transfer (smFRET) methods, we show that high-affinity aminoglycoside binding to the conserved decoding site region of the functional pre-translocation ribosome complex specifically remodels the nature of intrinsic dynamic processes within the particle. The extents of these effects, which are distinct for each member of the aminoglycoside class, strongly correlate with their inhibition of EF-G–catalyzed translocation. Neomycin, a 4,5-linked amino-glycoside, binds with lower affinity to one or more secondary binding sites, mediating distinct structural and dynamic perturbations that further enhance translocation inhibition. These new insights help explain why closely related aminoglycosides elicit pleiotropic translation activities and demonstrate the potential utility of smFRET as a tool for dissecting the mechanisms of antibiotic action. PMID:19946275

  19. Recycling of eukaryotic post-termination ribosomal complexes

    PubMed Central

    Pisarev, Andrey V.; Hellen, Christopher U. T.; Pestova, Tatyana V.

    2007-01-01

    SUMMARY After translational termination, mRNA and P site deacylated tRNA remain associated with ribosomes in post-termination complexes (post-TCs), which must therefore be recycled by releasing mRNA and deacylated tRNA and by dissociating ribosomes into subunits. Recycling of bacterial post-TCs requires elongation factor EF-G and a ribosome recycling factor RRF. Eukaryotes do not encode a RRF homologue and their mechanism of ribosomal recycling is unknown. We investigated eukaryotic recycling using post-TCs assembled on a model mRNA encoding a tetrapeptide followed by a UAA stop codon and report that initiation factors eIF3, eIF1, eIF1A and eIF3j, a loosely associated subunit of eIF3, can promote recycling of eukaryotic post-TCs. eIF3 is the principal factor that promotes splitting of post-termination ribosomes into 60S subunits and tRNA- and mRNA-bound 40S subunits. Its activity is enhanced by eIF3j, eIF1 and eIF1A. eIF1 also mediates release of P-site tRNA, whereas eIF3j ensures subsequent dissociation of mRNA. PMID:17956730

  20. Amino acid incorporation by ribosomes and polyribosomes from wheat chloroplasts.

    PubMed

    Hadziyev, D; Zalik, S

    1970-01-01

    Sucrose-gradient and analytical ultracentrifugation showed that chloroplast polyribosomes from 4-day-old seedlings had mono-, di-, tri-, tetra- and traces of penta-ribosomes, in contrast with those from 7-day-old seedlings in which only the mono-, di- and traces of tri-ribosomes were present. Without Mg(2+) the polyribosomes dissociated into ribosomal subunits. The rate of l-[U-(14)C]phenylalanine incorporation was threefold greater for preparations from 4- than from 7-day-old seedlings. Incorporation by the latter was stimulated by polyuridylic acid. The rates of incorporation were similar whether the reaction mixture contained chloroplast or wheat-germ transfer RNA and amino acid synthetases purified on methylated albumin-on-kieselguhr and Sephadex G-75 columns respectively. The cofactor requirement was the same as for isolated intact chloroplasts. Osmotic rupture of chloroplasts with and without Triton X-100 revealed the presence of free and bound ribosomes. Free single ribosomes isolated by osmotic shrinkage or prepared by pancreatic ribonuclease digestion of chloroplast polyribosomes had negligible incorporation activity. This activity was increased by washing or by polyuridylic acid, but was still only a fraction of that given by polyribosomes. A comparison of incorporation activity of chloroplast polyribosomes with those from the surrounding cytoplasm showed the former to be 20 times more active. PMID:5411422

  1. Structures of the Ribosome in Intermediate States of Ratcheting

    SciTech Connect

    Zhang, Wen; Dunkle, Jack A.; Cate, Jamie H.D.

    2009-10-21

    Protein biosynthesis on the ribosome requires repeated cycles of ratcheting, which couples rotation of the two ribosomal subunits with respect to each other, and swiveling of the head domain of the small subunit. However, the molecular basis for how the two ribosomal subunits rearrange contacts with each other during ratcheting while remaining stably associated is not known. Here, we describe x-ray crystal structures of the intact Escherichia coli ribosome, either in the apo-form (3.5 angstrom resolution) or with one (4.0 angstrom resolution) or two (4.0 angstrom resolution) anticodon stem-loop tRNA mimics bound, that reveal intermediate states of intersubunit rotation. In the structures, the interface between the small and large ribosomal subunits rearranges in discrete steps along the ratcheting pathway. Positioning of the head domain of the small subunit is controlled by interactions with the large subunit and with the tRNA bound in the peptidyl-tRNA site. The intermediates observed here provide insight into how tRNAs move into the hybrid state of binding that precedes the final steps of mRNA and tRNA translocation.

  2. Ribosomal Dynamics: Intrinsic Instability of a Molecular Machine

    NASA Astrophysics Data System (ADS)

    Gao, Haixiao; Le Barron, Jamie; Frank, Joachim

    Ribosomes are molecular machines that translate genetic message into nascent peptides, through a complex dynamics interplay with mRNAs, tRNAs, and various protein factors. A prominent example of ribosomal dynamics is the rotation of small ribosomal subunit with respect to a large subunit, characterized as the "ratchet motion," which is triggered by the binding of several translation factors. Here, we analyze two kinds of ribosomal ratchet motions, induced by the binding of EF-G and RF3, respectively, as previously observed by cryo-electron microscopy. Using the flexible fitting technique (real-space refinement) and an RNA secondary structure display tool (coloRNA), we obtained quasi-atomic models of the ribosome in these ratchet-motion-related functional states and mapped the observed differences onto the highly conserved RNA secondary structure. Comparisons between two sets of ratchet motions revealed that, while the overall patterns of the RNA displacement are very similar, several local regions stand out in their differential behavior, including the highly conserved GAC (GTPase-associated-center) region. We postulate that these regions are important in modulating general ratchet motion and bestowing it with the dynamic characteristics required for the specific function.

  3. Assessing the translational landscape of myogenic differentiation by ribosome profiling

    PubMed Central

    de Klerk, Eleonora; Fokkema, Ivo F.A.C.; Thiadens, Klaske A.M.H.; Goeman, Jelle J.; Palmblad, Magnus; den Dunnen, Johan T.; von Lindern, Marieke; ‘t Hoen, Peter A.C.

    2015-01-01

    The formation of skeletal muscles is associated with drastic changes in protein requirements known to be safeguarded by tight control of gene transcription and mRNA processing. The contribution of regulation of mRNA translation during myogenesis has not been studied so far. We monitored translation during myogenic differentiation of C2C12 myoblasts, using a simplified protocol for ribosome footprint profiling. Comparison of ribosome footprints to total RNA showed that gene expression is mostly regulated at the transcriptional level. However, a subset of transcripts, enriched for mRNAs encoding for ribosomal proteins, was regulated at the level of translation. Enrichment was also found for specific pathways known to regulate muscle biology. We developed a dedicated pipeline to identify translation initiation sites (TISs) and discovered 5333 unannotated TISs, providing a catalog of upstream and alternative open reading frames used during myogenesis. We identified 298 transcripts with a significant switch in TIS usage during myogenesis, which was not explained by alternative promoter usage, as profiled by DeepCAGE. Also these transcripts were enriched for ribosomal protein genes. This study demonstrates that differential mRNA translation controls protein expression of specific subsets of genes during myogenesis. Experimental protocols, analytical workflows, tools and data are available through public repositories (http://lumc.github.io/ribosome-profiling-analysis-framework/). PMID:25873627

  4. Role of ribosomes in Semliki Forest virus nucleocapsid uncoating.

    PubMed Central

    Singh, I; Helenius, A

    1992-01-01

    The mechanism by which Semliki Forest virus nucleocapsids are uncoated was analyzed in living cells and in vitro. In BHK-21 cells, uncoating occurred with virtually complete efficiency within 1 to 2 min after the nucleocapsids entered the cytoplasm. It was inhibited by monensin, which blocks nucleocapsid penetration from endosomes. As previously shown for Sindbis virus (G. Wengler and G. Wengler, Virology 134:435-442, 1984), the capsid proteins from incoming nucleocapsids became associated with ribosomes. The ribosome-bound capsid proteins were distributed throughout the cytoplasm, while the viral RNA remained associated with vacuolar membranes. Using purified nucleocapsids and ribosomes in vitro, we established that ribosomes alone were sufficient for uncoating. Their role was to release the capsid proteins from nucleocapsids and irreversibly sequester them, in a process independent of energy and translation. The process was stoichiometric rather than catalytic, with a maximum of three to six capsid proteins bound to each ribosome. More than 80% of the capsid proteins could thus be removed from the viral RNA, resulting in the formation of nucleocapsid remnants whose sedimentation coefficients progressively decreased from 140S to 80S as uncoating proceeded. Images PMID:1433506

  5. ABC-F Proteins Mediate Antibiotic Resistance through Ribosomal Protection

    PubMed Central

    Sharkey, Liam K. R.; Edwards, Thomas A.

    2016-01-01

    ABSTRACT Members of the ABC-F subfamily of ATP-binding cassette proteins mediate resistance to a broad array of clinically important antibiotic classes that target the ribosome of Gram-positive pathogens. The mechanism by which these proteins act has been a subject of long-standing controversy, with two competing hypotheses each having gained considerable support: antibiotic efflux versus ribosomal protection. Here, we report on studies employing a combination of bacteriological and biochemical techniques to unravel the mechanism of resistance of these proteins, and provide several lines of evidence that together offer clear support to the ribosomal protection hypothesis. Of particular note, we show that addition of purified ABC-F proteins to an in vitro translation assay prompts dose-dependent rescue of translation, and demonstrate that such proteins are capable of displacing antibiotic from the ribosome in vitro. To our knowledge, these experiments constitute the first direct evidence that ABC-F proteins mediate antibiotic resistance through ribosomal protection. PMID:27006457

  6. Cyclic nucleotide-independent protein kinases from ribosomes and phosphorylation of a single 40S ribosomal subunit protein in zoospores of Blastocladiella emersonii.

    PubMed

    Bonato, M C; da Costa Maia, J C; Juliani, M H

    1983-06-01

    Cyclic nucleotide-independent protein kinase (EC 2.7.1.37) activity was found in the nuclear cap organelle, within which ribosomes of zoospores of Blastocladiella emersonii are sequestered. Two protein kinase activities were resolved from the high-salt wash fraction of zoospore ribosomes by selective adsorption to DEAE-cellulose. Both enzymes phosphorylated in vitro a 32,000 Mr protein of the 40S ribosomal subunit. Phosphorylation of this ribosomal protein, which exhibits electrophoretic properties similar to those of mammalian ribosomal protein S6, was also observed in vivo in 32P-labeled zoospores. PMID:6853450

  7. Stability of the inner structure constituting a 'kernel' in ribosomal cores probed by dielectric spectroscopy

    NASA Astrophysics Data System (ADS)

    Blasi, M.; Bonincontro, A.; Calandrini, V.; Onori, G.; Risuleo, G.

    2001-05-01

    In this communication we present an investigation on ribosomal cores, i.e. ribosomes deprived of a select group of ribosomal proteins by LiCl treatment. This study was conducted by dielectric spectroscopy technique. The aim was to elucidate the role of ribosomal proteins in the stabilization of a very stable structural nucleus previously observed within the ribosome. The results show that this structure withstands relatively high concentrations of LiCl and is demolished within a limited range of salt concentration. The data discussed here corroborate the idea that this structure constitutes the ribosomal kernel.

  8. RNA structures regulating ribosomal protein biosynthesis in bacilli.

    PubMed

    Deiorio-Haggar, Kaila; Anthony, Jon; Meyer, Michelle M

    2013-07-01

    In Bacilli, there are three experimentally validated ribosomal-protein autogenous regulatory RNAs that are not shared with E. coli. Each of these RNAs forms a unique secondary structure that interacts with a ribosomal protein encoded by a downstream gene, namely S4, S15, and L20. Only one of these RNAs that interacts with L20 is currently found in the RNA Families Database. We created, or modified, existing structural alignments for these three RNAs and used them to perform homology searches. We have determined that each structure exhibits a narrow phylogenetic distribution, mostly relegated to the Firmicute class Bacilli. This work, in conjunction with other similar work, demonstrates that there are most likely many non-homologous RNA regulatory elements regulating ribosomal protein biosynthesis that still await discovery and characterization in other bacterial species. PMID:23611891

  9. Identification of Two Distinct Hybrid State Intermediates On the Ribosome

    PubMed Central

    Munro, James B.; Altman, Roger B.; O’Connor, Nathan; Blanchard, Scott C.

    2007-01-01

    SUMMARY High-spatial and –time resolution single-molecule fluorescence resonance energy transfer measurements have been used to probe the structural and kinetic parameters of transfer RNA (tRNA) movements within the aminoacyl (A) and peptidyl (P) sites of the ribosome. Our investigation of tRNA motions, quantified on wild-type, mutant, and L1-depleted ribosome complexes, reveals a dynamic exchange between three metastable tRNA configurations, one of which is a previously unidentified hybrid state in which only deacylated-tRNA adopts its hybrid (P/E) configuration. These new dynamic information suggests a framework in which the formation of intermediate states in the translocation process is achieved through global conformational rearrangements of the ribosome particle. PMID:17317624

  10. [Mechanism of tRNA translocation on the ribosome].

    PubMed

    Rodnina, M V; Semenkov, Iu P; Savelsbergh, A; Katunin, V I; Peske, F; Wilden, B; Wintermeyer, W

    2001-01-01

    During the translocation step of the elongation cycle of peptide synthesis two tRNAs together with the mRNA move synchronously and rapidly on the ribosome. Translocation is catalyzed by the elongation factor G (EF-G) and requires GTP hydrolysis. The fundamental biochemical features of the process were worked out in the 1970-80s, to a large part by A.S. Spirin and his colleagues. Recent results from pre-steady-state kinetic analysis and cryoelectron microscopy suggest that translocation is a multistep dynamic process that entails large-scale structural rearrangements of both ribosome and EF-G. Kinetic and thermodynamic data, together with the structural information on the conformational changes of the ribosome and of EF-G, provide a detailed mechanistic model of translocation and suggest a mechanism of translocation catalysis by EF-G. PMID:11524952

  11. RNA structures regulating ribosomal protein biosynthesis in bacilli

    PubMed Central

    Deiorio-Haggar, Kaila; Anthony, Jon; Meyer, Michelle M.

    2013-01-01

    In Bacilli, there are three experimentally validated ribosomal-protein autogenous regulatory RNAs that are not shared with E. coli. Each of these RNAs forms a unique secondary structure that interacts with a ribosomal protein encoded by a downstream gene, namely S4, S15, and L20. Only one of these RNAs that interacts with L20 is currently found in the RNA Families Database. We created, or modified, existing structural alignments for these three RNAs and used them to perform homology searches. We have determined that each structure exhibits a narrow phylogenetic distribution, mostly relegated to the Firmicute class Bacilli. This work, in conjunction with other similar work, demonstrates that there are most likely many non-homologous RNA regulatory elements regulating ribosomal protein biosynthesis that still await discovery and characterization in other bacterial species. PMID:23611891

  12. The bacterial translocon SecYEG opens upon ribosome binding.

    PubMed

    Knyazev, Denis G; Lents, Alexander; Krause, Eberhard; Ollinger, Nicole; Siligan, Christine; Papinski, Daniel; Winter, Lukas; Horner, Andreas; Pohl, Peter

    2013-06-21

    In co-translational translocation, the ribosome funnel and the channel of the protein translocation complex SecYEG are aligned. For the nascent chain to enter the channel immediately after synthesis, a yet unidentified signal triggers displacement of the SecYEG sealing plug from the pore. Here, we show that ribosome binding to the resting SecYEG channel triggers this conformational transition. The purified and reconstituted SecYEG channel opens to form a large ion-conducting channel, which has the conductivity of the plug deletion mutant. The number of ion-conducting channels inserted into the planar bilayer per fusion event roughly equals the number of SecYEG channels counted by fluorescence correlation spectroscopy in a single proteoliposome. Thus, the open probability of the channel must be close to unity. To prevent the otherwise lethal proton leak, a closed post-translational conformation of the SecYEG complex bound to a ribosome must exist. PMID:23645666

  13. A Ribosome Flow Model for Analyzing Translation Elongation

    NASA Astrophysics Data System (ADS)

    Reuveni, Shlomi; Meilijson, Isaac; Kupiec, Martin; Ruppin, Eytan; Tuller, Tamir

    We describe the first genome wide analysis of translation based on a model aimed at capturing the physical and dynamical aspects of this process. The Ribosomal Flow Model (RFM) is a computationally efficient approximation of the Totally Asymmetric Exclusion Process (TASEP) model (e.g. see [1]). The RFM is sensitive to the order of codons in the coding sequence, the tRNA pool of the organism, interactions between ribosomes and their size (see Figure [1]). The RFM predicts fundamental outcomes of the translation process, including translation rates, protein abundance and ribosomal densities [2] and the relation between all these variables, better than alternative ('non-physical') approaches (e.g. see [3,4]). In addition, we show that the RFM model can be used for accurate inference of initiation rates, the effect of codon order on protein abundance and the cost of translation. All these variables could not be inferred by previous predictors.

  14. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    PubMed

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-01

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. PMID:26490961

  15. Small protein domains fold inside the ribosome exit tunnel.

    PubMed

    Marino, Jacopo; von Heijne, Gunnar; Beckmann, Roland

    2016-03-01

    Cotranslational folding of small protein domains within the ribosome exit tunnel may be an important cellular strategy to avoid protein misfolding. However, the pathway of cotranslational folding has so far been described only for a few proteins, and therefore, it is unclear whether folding in the ribosome exit tunnel is a common feature for small protein domains. Here, we have analyzed nine small protein domains and determined at which point during translation their folding generates sufficient force on the nascent chain to release translational arrest by the SecM arrest peptide, both in vitro and in live E. coli cells. We find that all nine protein domains initiate folding while still located well within the ribosome exit tunnel. PMID:26879042

  16. Imprints of the genetic code in the ribosome

    PubMed Central

    Johnson, David B. F.; Wang, Lei

    2010-01-01

    The establishment of the genetic code remains elusive nearly five decades after the code was elucidated. The stereochemical hypothesis postulates that the code developed from interactions between nucleotides and amino acids, yet supporting evidence in a biological context is lacking. We show here that anticodons are selectively enriched near their respective amino acids in the ribosome, and that such enrichment is significantly correlated with the canonical code over random codes. Ribosomal anticodon-amino acid enrichment further reveals that specific codons were reassigned during code evolution, and that the code evolved through a two-stage transition from ancient amino acids without anticodon interaction to newer additions with anticodon interaction. The ribosome thus serves as a molecular fossil, preserving biological evidence that anticodon-amino acid interactions shaped the evolution of the genetic code. PMID:20385807

  17. Molecular profiling of activated neurons by phosphorylated ribosome capture.

    PubMed

    Knight, Zachary A; Tan, Keith; Birsoy, Kivanc; Schmidt, Sarah; Garrison, Jennifer L; Wysocki, Robert W; Emiliano, Ana; Ekstrand, Mats I; Friedman, Jeffrey M

    2012-11-21

    The mammalian brain is composed of thousands of interacting neural cell types. Systematic approaches to establish the molecular identity of functional populations of neurons would advance our understanding of neural mechanisms controlling behavior. Here, we show that ribosomal protein S6, a structural component of the ribosome, becomes phosphorylated in neurons activated by a wide range of stimuli. We show that these phosphorylated ribosomes can be captured from mouse brain homogenates, thereby enriching directly for the mRNAs expressed in discrete subpopulations of activated cells. We use this approach to identify neurons in the hypothalamus regulated by changes in salt balance or food availability. We show that galanin neurons are activated by fasting and that prodynorphin neurons restrain food intake during scheduled feeding. These studies identify elements of the neural circuit that controls food intake and illustrate how the activity-dependent capture of cell-type-specific transcripts can elucidate the functional organization of a complex tissue. PMID:23178128

  18. The Bacterial Translocon SecYEG Opens upon Ribosome Binding*

    PubMed Central

    Knyazev, Denis G.; Lents, Alexander; Krause, Eberhard; Ollinger, Nicole; Siligan, Christine; Papinski, Daniel; Winter, Lukas; Horner, Andreas; Pohl, Peter

    2013-01-01

    In co-translational translocation, the ribosome funnel and the channel of the protein translocation complex SecYEG are aligned. For the nascent chain to enter the channel immediately after synthesis, a yet unidentified signal triggers displacement of the SecYEG sealing plug from the pore. Here, we show that ribosome binding to the resting SecYEG channel triggers this conformational transition. The purified and reconstituted SecYEG channel opens to form a large ion-conducting channel, which has the conductivity of the plug deletion mutant. The number of ion-conducting channels inserted into the planar bilayer per fusion event roughly equals the number of SecYEG channels counted by fluorescence correlation spectroscopy in a single proteoliposome. Thus, the open probability of the channel must be close to unity. To prevent the otherwise lethal proton leak, a closed post-translational conformation of the SecYEG complex bound to a ribosome must exist. PMID:23645666

  19. 5SRNAdb: an information resource for 5S ribosomal RNAs

    PubMed Central

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A.; Karlowski, Wojciech M.

    2016-01-01

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA–protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. PMID:26490961

  20. Ribosomal RNAs in translation termination: facts and hypotheses.

    PubMed

    Arkov, A L; Murgola, E J

    1999-12-01

    It is now well established that ribosomal RNAs (rRNAs) play an active role in every aspect of translation. This review focuses on recent evidence for the involvement of rRNAs from both subunits of the ribosome in translation termination. This evidence comprises data obtained with rRNA mutants both in vivo and in vitro. In particular, mutations in specific regions of rRNAs caused readthrough of nonsense codons in vivo. Consistent with their in vivo characteristics, the mutations decreased the productive association of the ribosome with release factor 2 (RF2) and the efficiency of catalysis of peptidyl-tRNA hydrolysis in the presence of RF2 in realistic in vitro termination systems. It is now evident that genetic selections for termination-defective mutants in vivo and their characterization in realistic in vitro termination assays will rapidly advance our understanding of the mechanism of termination. PMID:10648958

  1. Structural Basis for the Rescue of Stalled Ribosomes: Structure of YaeJ Bound to the Ribosome

    SciTech Connect

    Gagnon, Matthieu G.; Seetharaman, Sai V.; Bulkley, David; Steitz, Thomas A.

    2012-06-19

    In bacteria, the hybrid transfer-messenger RNA (tmRNA) rescues ribosomes stalled on defective messenger RNAs (mRNAs). However, certain gram-negative bacteria have evolved proteins that are capable of rescuing stalled ribosomes in a tmRNA-independent manner. Here, we report a 3.2 angstrom-resolution crystal structure of the rescue factor YaeJ bound to the Thermus thermophilus 70S ribosome in complex with the initiator tRNA{sub i}{sup fMet} and a short mRNA. The structure reveals that the C-terminal tail of YaeJ functions as a sensor to discriminate between stalled and actively translating ribosomes by binding in the mRNA entry channel downstream of the A site between the head and shoulder of the 30S subunit. This allows the N-terminal globular domain to sample different conformations, so that its conserved GGQ motif is optimally positioned to catalyze the hydrolysis of peptidyl-tRNA. This structure gives insights into the mechanism of YaeJ function and provides a basis for understanding how it rescues stalled ribosomes.

  2. Architecture of the 90S Pre-ribosome: A Structural View on the Birth of the Eukaryotic Ribosome.

    PubMed

    Kornprobst, Markus; Turk, Martin; Kellner, Nikola; Cheng, Jingdong; Flemming, Dirk; Koš-Braun, Isabelle; Koš, Martin; Thoms, Matthias; Berninghausen, Otto; Beckmann, Roland; Hurt, Ed

    2016-07-14

    The 90S pre-ribosome is an early biogenesis intermediate formed during co-transcriptional ribosome formation, composed of ∼70 assembly factors and several small nucleolar RNAs (snoRNAs) that associate with nascent pre-rRNA. We report the cryo-EM structure of the Chaetomium thermophilum 90S pre-ribosome, revealing how a network of biogenesis factors including 19 β-propellers and large α-solenoid proteins engulfs the pre-rRNA. Within the 90S pre-ribosome, we identify the UTP-A, UTP-B, Mpp10-Imp3-Imp4, Bms1-Rcl1, and U3 snoRNP modules, which are organized around 5'-ETS and partially folded 18S rRNA. The U3 snoRNP is strategically positioned at the center of the 90S particle to perform its multiple tasks during pre-rRNA folding and processing. The architecture of the elusive 90S pre-ribosome gives unprecedented structural insight into the early steps of pre-rRNA maturation. Nascent rRNA that is co-transcriptionally folded and given a particular shape by encapsulation within a dedicated mold-like structure is reminiscent of how polypeptides use chaperone chambers for their protein folding. PMID:27419870

  3. Purification of a new ribosome-inactivating protein from the seeds of Cinnamomum porrectum and characterization of the RNA N-glycosidase activity of the toxic protein.

    PubMed

    Li, X D; Liu, W Y; Niu, C L

    1996-12-01

    Porrectin, a new type II ribosome-inactivating protein (RIP), was purified from the seeds of the camphor tree (Cinnamomum porrectum) by affinity chromatography on acid-treated Sepharose 4B. Porrectin is a glycoprotein (M(r)64,500, sugar content 2.5%) consisting of an A-chain (M(r)30,500) and a B-chain (M(r)33,500) linked by the disulfide bond. The terminal sugar of glycan in porrectin B-chain is determined to be mannose. By non-denaturing polyacrylamide gel electrophoresis, porrectin displayed three isoforms that have different pl values with the same molecular weight. Porrectin is a potent inhibitor of eukaryotic protein synthesis in the rabbit reticulocyte lysate system. The molecular mechanism of action of porrectin on rat liver ribosomes is demonstrated to be specific for RNA N-glycosidase. The cleavage site is the adenosine at position 4324 (rat liver 28S rRNA) embedded in the highly conserved ricin/alpha-sarcin ('R/S') domain. PMID:8997493

  4. Time-resolved binding of azithromycin to Escherichia coli ribosomes.

    PubMed

    Petropoulos, Alexandros D; Kouvela, Ekaterini C; Starosta, Agata L; Wilson, Daniel N; Dinos, George P; Kalpaxis, Dimitrios L

    2009-01-30

    Azithromycin is a semisynthetic derivative of erythromycin that inhibits bacterial protein synthesis by binding within the peptide exit tunnel of the 50S ribosomal subunit. Nevertheless, there is still debate over what localization is primarily responsible for azithromycin binding and as to how many molecules of the drug actually bind per ribosome. In the present study, kinetic methods and footprinting analysis are coupled together to provide time-resolved details of the azithromycin binding process. It is shown that azithromycin binds to Escherichia coli ribosomes in a two-step process: The first-step involves recognition of azithromycin by the ribosomal machinery and places the drug in a low-affinity site located in the upper part of the exit tunnel. The second step corresponds to the slow formation of a final complex that is both much tighter and more potent in hindering the progression of the nascent peptide through the exit tunnel. Substitution of uracil by cytosine at nucleoside 2609 of 23S rRNA, a base implicated in the high-affinity site, facilitates the shift of azithromycin to this site. In contrast, mutation U754A hardly affects the binding process. Binding of azithromycin to both sites is hindered by high concentrations of Mg(2+) ions. Unlike Mg(2+) ions, polyamines do not significantly affect drug binding to the low-affinity site but attenuate the formation of the final complex. The low- and high-affinity sites of azithromycin binding are mutually exclusive, which means that one molecule of the drug binds per E. coli ribosome at a time. In contrast, kinetic and binding data indicate that in Deinococcus radiodurans, two molecules of azithromycin bind cooperatively to the ribosome. This finding confirms previous crystallographic results and supports the notion that species-specific structural differences may primarily account for the apparent discrepancies between the antibiotic binding modes obtained for different organisms. PMID:19071138

  5. An analysis of the origin of metazoans, using comparisons of partial sequences of the 28S RNA, reveals an early emergence of triploblasts.

    PubMed Central

    Christen, R; Ratto, A; Baroin, A; Perasso, R; Grell, K G; Adoutte, A

    1991-01-01

    In order to study the origin of metazoans, we have compared sequences from the 5' end of the large subunit ribosomal RNA of a number of protists, fungi, plants and metazoans, including all diploblastic phyla (sequences of 10 new species have been determined, including that of the placozoan, Trichoplax adhaerens). These sequences were analyzed using distance matrix, maximum parsimony and maximum likelihood methods, and the validity of the results was ascertained with bootstrapping and species removal or addition. Triploblasts and diploblasts formed two clearly separated monophyletic units; this divergence, which apparently preceded the diversification of diploblastic animals (i.e. the successive sponge, ctenophore, cnidarian radiations), showed a much more ancient origin of triploblasts with respect to diploblasts than classically assumed. These results do not exclude the possibility that triploblasts and diploblasts arose independently from different protists. PMID:2001670

  6. Depletion of U3 small nucleolar RNA inhibits cleavage in the 5' external transcribed spacer of yeast pre-ribosomal RNA and impairs formation of 18S ribosomal RNA.

    PubMed Central

    Hughes, J M; Ares, M

    1991-01-01

    Multiple processing events are required to convert a single eukaryotic pre-ribosomal RNA (pre-rRNA) into mature 18S (small subunit), 5.8S and 25-28S (large subunit) rRNAs. We have asked whether U3 small nucleolar RNA is required for pre-rRNA processing in vivo by depleting Saccharomyces cerevisiae of U3 by conditional repression of U3 synthesis. The resulting pattern of accumulation and depletion of specific pre-rRNAs indicates that U3 is required for multiple events leading to the maturation of 18S rRNA. These include an initial cleavage within the 5' external transcribed spacer, resembling the U3 dependent initial processing event of mammalian pre-rRNA. Formation of large subunit rRNAs is unaffected by U3 depletion. The similarity between the effects of U3 depletion and depletion of U14 small nucleolar RNA and the nucleolar protein fibrillarin (NOP1) suggests that these could be components of a single highly conserved processing complex. Images PMID:1756730

  7. Synthesis of Amplified DNA That Codes for Ribosomal RNA

    PubMed Central

    Crippa, Marco; Tocchini-Valentini, Glauco P.

    1971-01-01

    During the amplification stage in ovaries, the complete repetitive unit of the DNA that codes for ribosomal RNA in Xenopus appears to be transcribed. This large RNA transcript is found in a complex with DNA. Substitution experiments with 5-bromodeoxyuridine do not show any evidence that a complete amplified cistron is used as a template for further amplification. A derivative of rifampicin, 2′,5′-dimethyl-N(4′)benzyl-N(4′)[desmethyl] rifampicin, preferentially inhibits the DNA synthesis responsible for ribosomal gene amplification. These results are consistent with the hypothesis that RNA-dependent DNA synthesis is involved in gene amplification. PMID:5288254

  8. Ribosomal Translocation: One Step Closer to the Molecular Mechanism

    PubMed Central

    Shoji, Shinichiro; Walker, Sarah E.; Fredrick, Kurt

    2010-01-01

    Protein synthesis occurs in ribosomes, the targets of numerous antibiotics. How these large and complex machines read and move along mRNA have proven to be challenging questions. In this Review, we focus on translocation, the last step of the elongation cycle in which movement of tRNA and mRNA is catalyzed by elongation factor G. Translocation entails large-scale movements of the tRNAs and conformational changes in the ribosome that require numerous tertiary contacts to be disrupted and reformed. We highlight recent progress toward elucidating the molecular basis of translocation and how various antibiotics influence tRNA–mRNA movement. PMID:19173642

  9. Ribosome Dwell Times and the Protein Copy Number Distribution

    NASA Astrophysics Data System (ADS)

    Gorissen, Mieke; Vanderzande, Carlo

    2012-09-01

    Translation is the cellular process in which ribosomes make proteins from information encoded on messenger RNA (mRNA). We model translation with an exclusion process taking into account the experimentally determined, non-exponential, waiting time between steps of a ribosome. From numerical simulations using realistic parameter values, we determine the distribution P( E) of the number of proteins E produced by one mRNA. We find that for small E this distribution is not geometric. We present a simplified and analytically solvable model that relates P( E) to the distributions of the times to produce the first E proteins.

  10. Ribosomal crystallography: from crystal growth to initial phasing

    NASA Astrophysics Data System (ADS)

    Thygesen, J.; Krumbholz, S.; Levin, I.; Zaytzev-Bashan, A.; Harms, J.; Bartels, H.; Schlünzen, F.; Hansen, H. A. S.; Bennett, W. S.; Volkmann, N.; Agmon, I.; Eisenstein, M.; Dribin, A.; Maltz, E.; Sagi, I.; Morlang, S.; Fua, M.; Franceschi, F.; Weinstein, S.; Böddeker, N.; Sharon, R.; Anagnostopoulos, K.; Peretz, M.; Geva, M.; Berkovitch-Yellin, Z.; Yonath, A.

    1996-10-01

    Preliminary phases were determined by the application of the isomorphous replacement method at low and intermediate resolution for structure factor amplitudes collected from crystals of large and small ribosomal subunits from halophilic and thermophilic bacteria. Derivatization was performed with dense heavy atom clusters, either by soaking or by specific covalent binding prior to the crystallization. The resulting initial electron density maps contain features comparable in size to those expected for the corresponding particles. The packing arrangements of these maps have been compared with motifs observed by electron microscopy in positively stained thin sections of embedded three-dimensional crystals, as well as with phase sets obtained by ab-initio computations. Aimed at higher resolution phasing, procedures are being developed for multi-site binding of relatively small dense metal clusters at selected locations. Potential sites are being inserted either by mutagenesis or by chemical modifications to facilitate cluster binding to the large halophilic and the small thermophilic ribosomal subunits which yield crystals diffracting to the highest resolution obtained so far for ribosomes, 2.9 and 7.3 Å, respectively. For this purpose the surfaces of these ribosomal particles have been characterized and conditions for quantitative reversible detachment of selected ribosomal proteins have been found. The corresponding genes are being cloned, sequenced, mutated to introduce the reactive side-groups (mainly cysteines) and overexpressed. To assist the interpretation of the anticipated electron density maps, sub-ribosomal stable complexes were isolated from H50S. One of these complexes is composed of two proteins and the other is made of a stretch of the rRNA and a protein. For exploiting the exposed parts of the surface of these complexes for heavy atom binding and for attempting the determination of their three-dimensional structure, their components are being produced

  11. Eukaryotic ribosomes that lack a 5.8S RNA

    NASA Technical Reports Server (NTRS)

    Vossbrinck, C. R.; Woese, C. R.

    1986-01-01

    The 5.8S ribosomal RNA is believed to be a universal eukaryotic characteristic. It has no (size) counterpart among the prokaryotes, although its sequence is homologous with the first 150 or so nucleotides of the prokaryotic large subunit (23S) ribosomal RNA. An exception to this rule is reported here. The microsporidian Vairimorpha necatrix is a eukaryote that has no 5.8S rRNA. As in the prokaryotes, it has a single large subunit rRNA, whose 5-prime region corresponds to the 5.8S rRNA.

  12. Identification by affinity chromatography of the eukaryotic ribosomal proteins that bind to 5.8 S ribosomal ribonucleic acid.

    PubMed

    Ulbrich, N; Lin, A; Wool, I G

    1979-09-10

    The proteins that bind to rat liver 5.8 S ribosomal ribonucleic acid were identified by affinity chromatography. The nucleic acid was oxidized with periodate and coupled by its 3'-terminus to Sepharose 4B through and adipic acid dihydrazide spacer. The ribosomal proteins that associate with the immobilized 5.8 S rRNA were identified by polyacrylamide gel electrophoresiss: they were L19, L8, and L6 from the 60 S subunit; and S13 and S9 from the small subparticle. Small amounts of L14, L17', L18, L27/L27', and L35', and of S11, S15, S23/S24, and S26 also were bound to the affinity column, but whether they associate directly and specifically with 5.8 S rRNA is not known. Escherichia coli ribosomal proteins did not bind to the rat liver 5.8 S rRNA affinity column. PMID:468846

  13. Ribosomal DNA organization patterns within the dinoflagellate genus Alexandrium as revealed by FISH: life cycle and evolutionary implications.

    PubMed

    Figueroa, Rosa Isabel; Cuadrado, Angeles; Stüken, Anke; Rodríguez, Francisco; Fraga, Santiago

    2014-05-01

    Dinoflagellates are a group of protists whose genome differs from that of other eukaryotes in terms of size (contains up to 250pg per haploid cell), base composition, chromosomal organization, and gene expression. But rDNA gene mapping of the active nucleolus in this unusual eukaryotic genome has not been carried out thus far. Here we used FISH in dinoflagellate species belonging to the genus Alexandrium (genome sizes ranging from 21 to 170 pg of DNA per haploid genome) to localize the sequences encoding the 18S, 5.8S, and 28S rRNA genes. The results can be summarized as follows: 1) Each dinoflagellate cell contains only one active nucleolus, with no hybridization signals outside it. However, the rDNA organization varies among species, from repetitive clusters forming discrete nuclear organizer regions (NORs) in some to specialized "ribosomal chromosomes" in other species. The latter chromosomes, never reported before in other eukaryotes, are mainly formed by rDNA genes and appeared in the species with the highest DNA content. 2) Dinoflagellate chromosomes are first characterized by several eukaryotic features, such as structural differentiation (centromere-like constrictions), size differences (dot chromosomes), and SAT (satellite) chromosomes. 3) NOR patterns prove to be useful in discriminating between cryptic species and life cycle stages in protists. PMID:24846057

  14. Modeling the Overproduction of Ribosomes when Antibacterial Drugs Act on Cells.

    PubMed

    Maitra, Arijit; Dill, Ken A

    2016-02-01

    Bacteria that are subjected to ribosome-inhibiting antibiotic drugs show an interesting behavior: Although the drug slows down cell growth, it also paradoxically increases the cell's concentration of ribosomes. We combine our earlier nonlinear model of the energy-biomass balance in undrugged Escherichia coli cells with Michaelis-Menten binding of drugs that inactivate ribosomes. Predictions are in good agreement with experiments on ribosomal concentrations and synthesis rates versus drug concentrations and growth rates. The model indicates that the added drug drives the cell to overproduce ribosomes, keeping roughly constant the level of ribosomes producing ribosomal proteins, an important quantity for cell growth. The model also predicts that ribosomal production rates should increase and then decrease with added drug. This model gives insights into the driving forces in cells and suggests new experiments. PMID:26840738

  15. Secondary structure of mouse 28S rRNA and general model for the folding of the large rRNA in eukaryotes.

    PubMed Central

    Michot, B; Hassouna, N; Bachellerie, J P

    1984-01-01

    We present a secondary structure model for the entire sequence of mouse 28S rRNA (1) which is based on an extensive comparative analysis of the available eukaryotic sequences, i.e. yeast (2, 3), Physarum polycephalum (4), Xenopus laevis (5) and rat (6). It has been derived with close reference to the models previously proposed for yeast 26S rRNA (2) and for prokaryotic 23S rRNA (7-9). Examination of the recently published eukaryotic sequences confirms that all pro- and eukaryotic large rRNAs share a largely conserved secondary structure core, as already apparent from the previous analysis of yeast 26S rRNA (2). These new comparative data confirm most features of the yeast model (2). They also provide the basis for a few modifications and for new proposals which extend the boundaries of the common structural core (now representing about 85% of E. coli 23S rRNA length) and bring new insights for tracing the structural evolution, in higher eukaryotes, of the domains which have no prokaryotic equivalent and are inserted at specific locations within the common structural core of the large subunit rRNA. PMID:6374617

  16. Does Blood of Healthy Subjects Contain Bacterial Ribosomal DNA?

    PubMed Central

    Nikkari, Simo; McLaughlin, Ian J.; Bi, Wanli; Dodge, Deborah E.; Relman, David A.

    2001-01-01

    Real-time PCR methods with primers and a probe targeting conserved regions of the bacterial 16S ribosomal DNA (rDNA) revealed a larger amount of rDNA in blood specimens from healthy individuals than in matched reagent controls. However, the origins and identities of these blood-associated bacterial rDNA sequences remain obscure. PMID:11326021

  17. Exploring Internal Ribosome Entry Sites as Therapeutic Targets

    PubMed Central

    Komar, Anton A.; Hatzoglou, Maria

    2015-01-01

    Initiation of eukaryotic mRNA translation may proceed via several different routes, each requiring a different subset of factors and relying on different and specific interactions between the mRNA and the ribosome. Two modes predominate: (i) so-called cap-dependent initiation, which requires all canonical initiation factors and is responsible for about 95–97% of all initiation events in eukaryotic cells; and (ii) cap-independent internal initiation, which requires a reduced subset of initiation factors and accounts for up to 5% of the remaining initiation events. Internal initiation relies on the presence of so-called internal ribosome entry site (IRES) elements in the 5′ UTRs of some viral and cellular mRNAs. These elements (often possessing complex secondary and tertiary structures) promote efficient interaction of the mRNA with the 40S ribosome and allow for internal ribosome entry. Internal initiation of translation of specific mRNAs may contribute to development of severe disease and pathological states, such as hepatitis C and cancer. Therefore, this cellular mechanism represents an attractive target for pharmacological modulation. The purpose of this review is to provide insight into current strategies used to target viral and cellular IRESs and discuss the physiological consequences (and potential therapeutic implications) of abrogation/modulation of IRES-mediated translation. PMID:26539410

  18. Mutations in ribosomal proteins: Apoptosis, cell competition, and cancer.

    PubMed

    Baker, Nicholas E; Kale, Abhijit

    2016-01-01

    Mutations affecting multiple ribosomal proteins are implicated in cancer. Using genetic mosaics in the fruit fly Drosophila, we describe 3 apoptotic mechanisms that affect Rp/Rp homozygous mutant cells, Rp/+ heterozygous cells, or Rp/+ heterozygous cells in competition with nearby wild type cells, and discuss how apoptosis might be related to cancer predisposition. PMID:27308545

  19. The ABC of Ribosome-Related Antibiotic Resistance

    PubMed Central

    Wilson, Daniel N.

    2016-01-01

    ABSTRACT The increase in multidrug-resistant pathogenic bacteria is limiting the utility of our current arsenal of antimicrobial agents. Mechanistically understanding how bacteria obtain antibiotic resistance is a critical first step to the development of improved inhibitors. One common mechanism for bacteria to obtain antibiotic resistance is by employing ATP-binding cassette (ABC) transporters to actively pump the drug from the cell. The ABC-F family includes proteins conferring resistance to a variety of clinically important ribosome-targeting antibiotics; however, controversy remains as to whether resistance is conferred via efflux like other ABC transporters or whether another mechanism, such as ribosome protection, is at play. A recent study by Sharkey and coworkers (L. K. Sharkey, T. A. Edwards, and A. J. O’Neill, mBio 7:e01975-15, 2016, http://dx.doi.org/10.1128/mBio.01975-15) provides strong evidence that ABC-F proteins conferring antibiotic resistance utilize ribosome protection mechanisms, namely, by interacting with the ribosome and displacing the drug from its binding site, thus revealing a novel role for ABC-F proteins in antibiotic resistance. PMID:27143393

  20. Protein folding on the ribosome studied using NMR spectroscopy

    PubMed Central

    Waudby, Christopher A.; Launay, Hélène; Cabrita, Lisa D.; Christodoulou, John

    2013-01-01

    NMR spectroscopy is a powerful tool for the investigation of protein folding and misfolding, providing a characterization of molecular structure, dynamics and exchange processes, across a very wide range of timescales and with near atomic resolution. In recent years NMR methods have also been developed to study protein folding as it might occur within the cell, in a de novo manner, by observing the folding of nascent polypeptides in the process of emerging from the ribosome during synthesis. Despite the 2.3 MDa molecular weight of the bacterial 70S ribosome, many nascent polypeptides, and some ribosomal proteins, have sufficient local flexibility that sharp resonances may be observed in solution-state NMR spectra. In providing information on dynamic regions of the structure, NMR spectroscopy is therefore highly complementary to alternative methods such as X-ray crystallography and cryo-electron microscopy, which have successfully characterized the rigid core of the ribosome particle. However, the low working concentrations and limited sample stability associated with ribosome–nascent chain complexes means that such studies still present significant technical challenges to the NMR spectroscopist. This review will discuss the progress that has been made in this area, surveying all NMR studies that have been published to date, and with a particular focus on strategies for improving experimental sensitivity. PMID:24083462

  1. Differential expression of ribosomal proteins in myelodysplastic syndromes.

    PubMed

    Rinker, Elizabeth B; Dueber, Julie C; Qualtieri, Julianne; Tedesco, Jason; Erdogan, Begum; Bosompem, Amma; Kim, Annette S

    2016-02-01

    Aberrations of ribosomal biogenesis have been implicated in several congenital bone marrow failure syndromes, such as Diamond-Blackfan anaemia, Shwachman-Diamond syndrome and Dyskeratosis Congenita. Recent studies have identified haploinsufficiency of RPS14 in the acquired bone marrow disease isolated 5q minus syndrome, a subtype of myelodysplastic syndromes (MDS). However, the expression of various proteins comprising the ribosomal subunits and other proteins enzymatically involved in the synthesis of the ribosome has not been explored in non-5q minus MDS. Furthermore, differences in the effects of these expression alterations among myeloid, erythroid and megakaryocyte lineages have not been well elucidated. We examined the expression of several proteins related to ribosomal biogenesis in bone marrow biopsy specimens from patients with MDS (5q minus patients excluded) and controls with no known myeloid disease. Specifically, we found that there is overexpression of RPS24, DKC1 and SBDS in MDS. This overexpression is in contrast to the haploinsufficiency identified in the congenital bone marrow failure syndromes and in acquired 5q minus MDS. Potential mechanisms for these differences and aetiology for these findings in MDS are discussed. PMID:26408650

  2. Conformation of the signal recognition particle in ribosomal targeting complexes

    PubMed Central

    Buskiewicz, Iwona A.; Jöckel, Johannes; Rodnina, Marina V.; Wintermeyer, Wolfgang

    2009-01-01

    The bacterial signal recognition particle (SRP) binds to ribosomes synthesizing inner membrane proteins and, by interaction with the SRP receptor, FtsY, targets them to the translocon at the membrane. Here we probe the conformation of SRP and SRP protein, Ffh, at different stages of targeting by measuring fluorescence resonance energy transfer (FRET) between fluorophores placed at various positions within SRP. Distances derived from FRET indicate that SRP binding to nontranslating ribosomes triggers a global conformational change of SRP that facilitates binding of the SRP receptor, FtsY. Binding of SRP to a signal-anchor sequence exposed on a ribosome-nascent chain complex (RNC) causes a further change of the SRP conformation, involving the flexible part of the Ffh(M) domain, which increases the affinity for FtsY of ribosome-bound SRP up to the affinity exhibited by the isolated NG domain of Ffh. This indicates that in the RNC–SRP complex the Ffh(NG) domain is fully exposed for binding FtsY to form the targeting complex. Binding of FtsY to the RNC–SRP complex results in a limited conformational change of SRP, which may initiate subsequent targeting steps. PMID:19029307

  3. Dependency Map of Proteins in the Small Ribosomal Subunit

    PubMed Central

    Hamacher, Kay; Trylska, Joanna; McCammon, J. Andrew

    2006-01-01

    The assembly of the ribosome has recently become an interesting target for antibiotics in several bacteria. In this work, we extended an analytical procedure to determine native state fluctuations and contact breaking to investigate the protein stability dependence in the 30S small ribosomal subunit of Thermus thermophilus. We determined the causal influence of the presence and absence of proteins in the 30S complex on the binding free energies of other proteins. The predicted dependencies are in overall agreement with the experimentally determined assembly map for another organism, Escherichia coli. We found that the causal influences result from two distinct mechanisms: one is pure internal energy change, the other originates from the entropy change. We discuss the implications on how to target the ribosomal assembly most effectively by suggesting six proteins as targets for mutations or other hindering of their binding. Our results show that by blocking one out of this set of proteins, the association of other proteins is eventually reduced, thus reducing the translation efficiency even more. We could additionally determine the binding dependency of THX—a peptide not present in the ribosome of E. coli—and suggest its assembly path. PMID:16485038

  4. PCR Primers for Metazoan Mitochondrial 12S Ribosomal DNA Sequences

    PubMed Central

    Machida, Ryuji J.; Kweskin, Matthew; Knowlton, Nancy

    2012-01-01

    Background Assessment of the biodiversity of communities of small organisms is most readily done using PCR-based analysis of environmental samples consisting of mixtures of individuals. Known as metagenetics, this approach has transformed understanding of microbial communities and is beginning to be applied to metazoans as well. Unlike microbial studies, where analysis of the 16S ribosomal DNA sequence is standard, the best gene for metazoan metagenetics is less clear. In this study we designed a set of PCR primers for the mitochondrial 12S ribosomal DNA sequence based on 64 complete mitochondrial genomes and then tested their efficacy. Methodology/Principal Findings A total of the 64 complete mitochondrial genome sequences representing all metazoan classes available in GenBank were downloaded using the NCBI Taxonomy Browser. Alignment of sequences was performed for the excised mitochondrial 12S ribosomal DNA sequences, and conserved regions were identified for all 64 mitochondrial genomes. These regions were used to design a primer pair that flanks a more variable region in the gene. Then all of the complete metazoan mitochondrial genomes available in NCBI's Organelle Genome Resources database were used to determine the percentage of taxa that would likely be amplified using these primers. Results suggest that these primers will amplify target sequences for many metazoans. Conclusions/Significance Newly designed 12S ribosomal DNA primers have considerable potential for metazoan metagenetic analysis because of their ability to amplify sequences from many metazoans. PMID:22536450

  5. Ribosomal proteins of the Asian citrus psyllid, Diaphornia citri

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We developed and sequenced 88 ribosomal protein sequences for their use as genetic markers to monitor and identify current and exotic introductions of psyllids into the U.S.A. The sequences were produced and submitted as a psyllid specific dataset into the National Center for Biotechnology Informati...

  6. The toxin GraT inhibits ribosome biogenesis.

    PubMed

    Ainelo, Andres; Tamman, Hedvig; Leppik, Margus; Remme, Jaanus; Hõrak, Rita

    2016-05-01

    Most bacteria encode numerous chromosomal toxin-antitoxin (TA) systems that are proposed to contribute to stress tolerance, as they are able to shift the cells to a dormant state. Toxins act on a variety of targets with the majority attacking the translational apparatus. Intriguingly, the toxicity mechanisms of even closely related toxins may differ essentially. Here, we report on a new type of TA toxin that inhibits ribosome biogenesis. GraT of the GraTA system has previously been described in Pseudomonas putida as an unusually moderate toxin at optimal growth temperatures. However, GraT causes a severe growth defect at lower temperatures. Here, we demonstrate that GraT causes the accumulation of free ribosomal subunits. Mapping the rRNA 5' ends reveals incomplete processing of the free subunits and quantification of modified nucleosides shows an underrepresentation of late subunit assembly specific modifications. This indicates that GraT inhibits ribosome subunit assembly. Interestingly, GraT effects can be alleviated by modification of the chaperone DnaK, a known facilitator of late stages in ribosome biogenesis. We show that GraT directly interacts with DnaK and suggest two possible models for the role of this interaction in GraT toxicity. PMID:26833678

  7. Protein-guided RNA dynamics during early ribosome assembly

    NASA Astrophysics Data System (ADS)

    Kim, Hajin; Abeysirigunawarden, Sanjaya C.; Chen, Ke; Mayerle, Megan; Ragunathan, Kaushik; Luthey-Schulten, Zaida; Ha, Taekjip; Woodson, Sarah A.

    2014-02-01

    The assembly of 30S ribosomes requires the precise addition of 20 proteins to the 16S ribosomal RNA. How early binding proteins change the ribosomal RNA structure so that later proteins may join the complex is poorly understood. Here we use single-molecule fluorescence resonance energy transfer (FRET) to observe real-time encounters between Escherichia coli ribosomal protein S4 and the 16S 5' domain RNA at an early stage of 30S assembly. Dynamic initial S4-RNA complexes pass through a stable non-native intermediate before converting to the native complex, showing that non-native structures can offer a low free-energy path to protein-RNA recognition. Three-colour FRET and molecular dynamics simulations reveal how S4 changes the frequency and direction of RNA helix motions, guiding a conformational switch that enforces the hierarchy of protein addition. These protein-guided dynamics offer an alternative explanation for induced fit in RNA-protein complexes.

  8. The Structure of LepA, the Ribosomal Back Translocase

    SciTech Connect

    Evans,R.; Blaha, G.; Bailey, S.; Steitz, T.

    2008-01-01

    LepA is a highly conserved elongation factor that promotes the back translocation of tRNAs on the ribosome during the elongation cycle. We have determined the crystal structure of LepA from Escherichia coli at 2.8- Angstroms resolution. The high degree of sequence identity between LepA and EF-G is reflected in the structural similarity between the individual homologous domains of LepA and EF-G. However, the orientation of domains III and V in LepA differs from their orientations in EF-G. LepA also contains a C-terminal domain (CTD) not found in EF-G that has a previously unobserved protein fold. The high structural similarity between LepA and EF-G enabled us to derive a homology model for LepA bound to the ribosome using a 7.3- Angstroms cryo-EM structure of a complex between EF-G and the 70S ribosome. In this model, the very electrostatically positive CTD of LepA is placed in the direct vicinity of the A site of the large ribosomal subunit, suggesting a possible interaction between the CTD and the back translocated tRNA or 23S rRNA.

  9. Affinity labeling of the ribosomal P site in Drosophila melanogaster

    SciTech Connect

    North, D.

    1987-01-01

    Several recent studies have probed the peptidyl transferase region of the Drosophila ribosome via the use of reactive site specific analogues (affinity labels). P site proteins adjacent to the 3' end of the amino acid bearing tRNA strand were labeled with modified tRNA fragments. Drugs affecting the binding of these agents were used to further clarify the nature of the region. The nascent peptide region of the P site was not labeled in previous experiments. To label that region radioactive Bromoacetylphenylalanyl-tRNA (BrAcphe-tRNA) was synthesized. The alpha-bromoacetyl group of this analogue is potentially reactive with nucleophiles present in either proteins or RNAs. Charged tRNAs and tRNA analogues bearing a peptide bond on the N-terminus of their amino acid are recognized as having affinity for the ribosomal P site. Specific labeling of the P site by BrAcphe-tRNA was confirmed by its ability to radioactively label proteins indirectly. As many as 8 ribosomal proteins may be labeled under these conditions, however, the majority of the bound label is associated with 3 large subunit proteins and 2 small subunit proteins. Overlaps between the proteins labeled by BrAcphe-tRNA and those labeled by other affinity labels are examined and a model of the peptidyl transferase region of Drosophila ribosomes is presented.

  10. Mutations in ribosomal proteins: Apoptosis, cell competition, and cancer

    PubMed Central

    Baker, Nicholas E.; Kale, Abhijit

    2016-01-01

    Mutations affecting multiple ribosomal proteins are implicated in cancer. Using genetic mosaics in the fruit fly Drosophila, we describe 3 apoptotic mechanisms that affect Rp/Rp homozygous mutant cells, Rp/+ heterozygous cells, or Rp/+ heterozygous cells in competition with nearby wild type cells, and discuss how apoptosis might be related to cancer predisposition. PMID:27308545

  11. Ribosomal protein L3: Gatekeeper to the A-site

    PubMed Central

    2007-01-01

    Summary Ribosomal protein L3 (L3) is an essential and indispensable component for formation of the peptidyltransferase center. Atomic resolution ribosome structures reveal two extensions of L3 protruding deep into the core of the large subunit. The central extension of L3 in Saccharomyces cerevisiae was investigated using a combination of molecular genetic, biochemical, chemical probing and molecular modeling methods. A reciprocal relationship between ribosomal affinity for eEF-1A stimulated binding of aa-tRNA and for eEF2 suggests that the central extension of L3 may function as an allosteric switch in coordinating binding of the elongation factors. Opening of the aa-tRNA accommodation corridor promoted resistance to the A-site specific translational inhibitor anisomycin, suggesting a competitive model for anisomycin resistance. These changes were also found to inhibit peptidyltransferase activity, stimulating programmed -1 ribosomal frameshifting, and promoting virus propagation defects. These studies provide a basis for deeper insight for rational design of small molecule antiviral therapeutics. PMID:17386264

  12. N-terminal sequence of some ribosome-inactivating proteins.

    PubMed

    Montecucchi, P C; Lazzarini, A M; Barbieri, L; Stirpe, F; Soria, M; Lappi, D

    1989-04-01

    The N-terminal portion of some type 1 ribosome-inactivating proteins (RIPs) isolated from the seeds of Gelonium multiflorum, Momordica charantia, Bryonia dioica, Saponaria officinalis and from the leaves of Saponaria officinalis are reported in the present paper. Their relationship with other RIPs is discussed. PMID:2753596

  13. Ribosomal RNA sequence suggest microsporidia are extremely ancient eukaryotes

    NASA Technical Reports Server (NTRS)

    Vossbrinck, C. R.; Maddox, J. V.; Friedman, S.; Debrunner-Vossbrinck, B. A.; Woese, C. R.

    1987-01-01

    A comparative sequence analysis of the 18S small subunit ribosomal RNA (rRNA) of the microsporidium Vairimorpha necatrix is presented. The results show that this rRNA sequence is more unlike those of other eukaryotes than any known eukaryote rRNA sequence. It is concluded that the lineage leading to microsporidia branched very early from that leading to other eukaryotes.

  14. Reverse Translocation of tRNA in the Ribosome

    PubMed Central

    Shoji, Shinichiro; Walker, Sarah E.; Fredrick, Kurt

    2009-01-01

    Summary A widely held view is that directional movement of tRNA in the ribosome is determined by an intrinsic mechanism and driven thermodynamically by transpeptidation. Here, we show that, in certain ribosomal complexes, the pretranslocation (PRE) state is thermodynamically favored over the posttranslocation (POST) state. Spontaneous and efficient conversion from the POST to PRE state is observed when EF-G is depleted from ribosomes in the POST state or when tRNA is added to the E site of ribosomes containing P-site tRNA. In the latter assay, the rate of tRNA movement is increased by streptomycin and neomycin, decreased by tetracycline, and not affected by the acylation state of the tRNA. In one case, we provide evidence that complex conversion occurs by reverse translocation (i.e., direct movement of the tRNAs from the E and P sites to the P and A sites, respectively). These findings have important implications for the energetics of translocation. PMID:17189194

  15. The ribosome-associated complex antagonizes prion formation in yeast

    PubMed Central

    Amor, Alvaro J; Castanzo, Dominic T; Delany, Sean P; Selechnik, Daniel M; van Ooy, Alex; Cameron, Dale M

    2015-01-01

    Abstract The number of known fungal proteins capable of switching between alternative stable conformations is steadily increasing, suggesting that a prion-like mechanism may be broadly utilized as a means to propagate altered cellular states. To gain insight into the mechanisms by which cells regulate prion formation and toxicity we examined the role of the yeast ribosome-associated complex (RAC) in modulating both the formation of the [PSI+] prion – an alternative conformer of Sup35 protein – and the toxicity of aggregation-prone polypeptides. The Hsp40 RAC chaperone Zuo1 anchors the RAC to ribosomes and stimulates the ATPase activity of the Hsp70 chaperone Ssb. We found that cells lacking Zuo1 are sensitive to over-expression of some aggregation-prone proteins, including the Sup35 prion domain, suggesting that co-translational protein misfolding increases in Δzuo1 strains. Consistent with this finding, Δzuo1 cells exhibit higher frequencies of spontaneous and induced prion formation. Cells expressing mutant forms of Zuo1 lacking either a C-terminal charged region required for ribosome association, or the J-domain responsible for Ssb ATPase stimulation, exhibit similarly high frequencies of prion formation. Our findings are consistent with a role for the RAC in chaperoning nascent Sup35 to regulate folding of the N-terminal prion domain as it emerges from the ribosome. PMID:25739058

  16. Two orthogonal cleavages separate subunit RNAs in mouse ribosome biogenesis

    PubMed Central

    Wang, Minshi; Anikin, Leonid; Pestov, Dimitri G.

    2014-01-01

    Ribosome biogenesis is a dynamic multistep process, many features of which are still incompletely documented. Here, we show that changes in this pathway can be captured and annotated by means of a graphic set of pre-rRNA ratios, a technique we call Ratio Analysis of Multiple Precursors (RAMP). We find that knocking down a ribosome synthesis factor produces a characteristic RAMP profile that exhibits consistency across a range of depletion levels. This facilitates the inference of affected steps and simplifies comparative analysis. We applied RAMP to examine how endonucleolytic cleavages of the mouse pre-rRNA transcript in the internal transcribed spacer 1 (ITS1) are affected by depletion of factors required for maturation of the small ribosomal subunit (Rcl1, Fcf1/Utp24, Utp23) and the large subunit (Pes1, Nog1). The data suggest that completion of early maturation in a subunit triggers its release from the common pre-rRNA transcript by stimulating cleavage at the proximal site in ITS1. We also find that splitting of pre-rRNA in the 3′ region of ITS1 is prevalent in adult mouse tissues and quiescent cells, as it is in human cells. We propose a model for subunit separation during mammalian ribosome synthesis and discuss its implications for understanding pre-rRNA processing pathways. PMID:25190460

  17. A model for competition for ribosomes in the cell.

    PubMed

    Raveh, Alon; Margaliot, Michael; Sontag, Eduardo D; Tuller, Tamir

    2016-03-01

    A single mammalian cell includes an order of 10(4)-10(5) mRNA molecules and as many as 10(5)-10(6) ribosomes. Large-scale simultaneous mRNA translation induces correlations between the mRNA molecules, as they all compete for the finite pool of available ribosomes. This has important implications for the cell's functioning and evolution. Developing a better understanding of the intricate correlations between these simultaneous processes, rather than focusing on the translation of a single isolated transcript, should help in gaining a better understanding of mRNA translation regulation and the way elongation rates affect organismal fitness. A model of simultaneous translation is specifically important when dealing with highly expressed genes, as these consume more resources. In addition, such a model can lead to more accurate predictions that are needed in the interconnection of translational modules in synthetic biology. We develop and analyse a general dynamical model for large-scale simultaneous mRNA translation and competition for ribosomes. This is based on combining several ribosome flow models (RFMs) interconnected via a pool of free ribosomes. We use this model to explore the interactions between the various mRNA molecules and ribosomes at steady state. We show that the compound system always converges to a steady state and that it always entrains or phase locks to periodically time-varying transition rates in any of the mRNA molecules. We then study the effect of changing the transition rates in one mRNA molecule on the steady-state translation rates of the other mRNAs that results from the competition for ribosomes. We show that increasing any of the codon translation rates in a specific mRNA molecule yields a local effect, an increase in the translation rate of this mRNA, and also a global effect, the translation rates in the other mRNA molecules all increase or all decrease. These results suggest that the effect of codon decoding rates of endogenous and

  18. Ribosomal Synthesis of Peptides with Multiple β-Amino Acids.

    PubMed

    Fujino, Tomoshige; Goto, Yuki; Suga, Hiroaki; Murakami, Hiroshi

    2016-02-17

    The compatibility of β-amino acids with ribosomal translation was studied for decades, but it has been still unclear whether the ribosome can accept various β-amino acids, and whether the ribosome can introduce multiple β-amino acids in a peptide. In the present study, by using the Escherichia coli reconstituted cell-free translation system with a reprogramed genetic code, we screened β-amino acids that give high single incorporation efficiency and used them to synthesize peptides containing multiple β-amino acids. The experiments of single β-amino acid incorporation into a peptide revealed that 13 β-amino acids are compatible with ribosomal translation. Six of the tested β-amino acids (βhGly, l-βhAla, l-βhGln, l-βhPhg, l-βhMet, and d-βhPhg) showed high incorporation efficiencies, and seven (l-βhLeu, l-βhIle, l-βhAsn, l-βhPhe, l-βhLys, d-βhAla, and d-βhLeu) showed moderate incorporation efficiencies; whereas no full-length peptide was produced using other β-amino acids (l-βhPro, l-βhTrp, and l-βhGlu). Subsequent double-incorporation experiments using β-amino acids with high single incorporation efficiency revealed that elongation of peptides with successive β-amino acids is prohibited. Efficiency of the double-incorporation of the β-amino acids was restored by the insertion of Tyr or Ile between the two β-amino acids. On the basis of these experiments, we also designed mRNA sequences of peptides, and demonstrated the ribosomal synthesis of peptides containing different types of β-amino acids at multiple positions. PMID:26807980

  19. Visualization of the joining of ribosomal subunits reveals the presence of 80S ribosomes in the nucleus

    PubMed Central

    Al-Jubran, Khalid; Wen, Jikai; Abdullahi, Akilu; Roy Chaudhury, Subhendu; Li, Min; Ramanathan, Preethi; Matina, Annunziata; De, Sandip; Piechocki, Kim; Rugjee, Kushal Nivriti; Brogna, Saverio

    2013-01-01

    In eukaryotes the 40S and 60S ribosomal subunits are assembled in the nucleolus, but there appear to be mechanisms preventing mRNA binding, 80S formation, and initiation of translation in the nucleus. To visualize association between ribosomal subunits, we tagged pairs of Drosophila ribosomal proteins (RPs) located in different subunits with mutually complementing halves of fluorescent proteins. Pairs of tagged RPs expected to interact, or be adjacent in the 80S structure, showed strong fluorescence, while pairs that were not in close proximity did not. Moreover, the complementation signal is found in ribosomal fractions and it was enhanced by translation elongation inhibitors and reduced by initiation inhibitors. Our technique achieved 80S visualization both in cultured cells and in fly tissues in vivo. Notably, while the main 80S signal was in the cytoplasm, clear signals were also seen in the nucleolus and at other nuclear sites. Furthermore, we detected rapid puromycin incorporation in the nucleolus and at transcription sites, providing an independent indication of functional 80S in the nucleolus and 80S association with nascent transcripts. PMID:24129492

  20. The ribosome profiling strategy for monitoring translation in vivo by deep sequencing of ribosome-protected mRNA fragments

    PubMed Central

    Ingolia, Nicholas T.; Brar, Gloria A.; Rouskin, Silvia; McGeachy, Anna M.; Weissman, Jonathan S.

    2012-01-01

    Recent studies highlight the importance of translational control in determining protein abundance, underscoring the value of measuring gene expression at the level of translation. We present a protocol for genome-wide, quantitative analysis of in vivo translation by deep sequencing. This ribosome profiling approach maps the exact positions of ribosomes on transcripts by nuclease footprinting. The nuclease-protected mRNA fragments are converted into a DNA library suitable for deep sequencing using a strategy that minimizes bias. The abundance of different footprint fragments in deep sequencing data reports on the amount of translation of a gene. Additionally, footprints reveal the exact regions of the transcriptome that are translated. To better define translated reading frames, we describe an adaptation that reveals the sites of translation initiation by pre-treating cells with harringtonine to immobilize initiating ribosomes. The protocol we describe requires 5–7 days to generate a completed ribosome profiling sequencing library. Sequencing and data analysis requires a further 4 – 5 days. PMID:22836135

  1. Differential effects of ribosomal proteins and Mg2+ ions on a conformational switch during 30S ribosome 5'-domain assembly.

    PubMed

    Abeysirigunawardena, Sanjaya C; Woodson, Sarah A

    2015-11-01

    Ribosomal protein S4 nucleates assembly of the 30S ribosome 5' and central domains, which is crucial for the survival of cells. Protein S4 changes the structure of its 16S rRNA binding site, passing through a non-native intermediate complex before forming native S4-rRNA contacts. Ensemble FRET was used to measure the thermodynamic stability of non-native and native S4 complexes in the presence of Mg(2+) ions and other 5'-domain proteins. Equilibrium titrations of Cy3-labeled 5'-domain RNA with Cy5-labeled protein S4 showed that Mg(2+) ions preferentially stabilize the native S4-rRNA complex. In contrast, ribosomal proteins S20 and S16 act by destabilizing the non-native S4-rRNA complex. The full cooperative switch to the native complex requires S4, S16, and S20 and is achieved to a lesser degree by S4 and S16. The resulting thermodynamic model for assembly of the 30S body illustrates how ribosomal proteins selectively bias the equilibrium between alternative rRNA conformations, increasing the cooperativity of rRNA folding beyond what can be achieved by Mg(2+) ions alone. PMID:26354770

  2. EttA regulates translation by binding to the ribosomal E site and restricting ribosome-tRNA dynamics

    PubMed Central

    Chen, Bo; Boël, Grégory; Hashem, Yaser; Ning, Wei; Fei, Jingyi; Wang, Chi; Gonzalez, Ruben L.; Hunt, John F.; Frank, Joachim

    2014-01-01

    Cells express many ribosome-interacting factors whose functions and molecular mechanisms remain unknown. Here, we elucidate the mechanism of a newly characterized regulatory translation factor, Energy-dependent Translational Throttle A (EttA), which is an Escherichia coli representative of the ATP-binding cassette F (ABC-F) protein family. Using cryo-EM, we demonstrate that the ATP-bound form of EttA binds to the ribosomal tRNA exit (E) site, where it forms bridging interactions between the ribosomal L1 stalk and the tRNA bound in the peptidyl-tRNA binding (P) site. Using single-molecule fluorescence resonance energy transfer (smFRET), we show that the ATP-bound form of EttA restricts ribosome and tRNA dynamics required for protein synthesis. This work represents the first example, to our knowledge, where the detailed molecular mechanism of any ABC-F family protein has been determined and establishes a framework for elucidating the mechanisms of other regulatory translation factors. PMID:24389465

  3. Attachment of UDP-hexosamines to the ribosomes isolated from rat liver

    SciTech Connect

    Kopacz-Jodczyk, T.; Paszkiewicz-Gadek, A.; Galasinski, W.

    1988-06-01

    The binding of UDP-N-acetylhexosamines with purified ribosomes was studied and it was found that the radioactive nucleotides can be attached to these particles. The radioactivity of the purified ribosomal pellet depends on the amounts of ribosomes and UDP-N-acetylhexosamines. Some characteristics of the binding system indicate that the attachment of UDP-sugar to ribosome does not require the participation of glycosyltransferases. The results of the competition experiment would suggest that there are specific sites on ribosomes for the binding of UDP-N-acetylglucosamine.

  4. The impact of transcriptional tuning on in vitro integrated rRNA transcription and ribosome construction

    PubMed Central

    Fritz, Brian R.; Jewett, Michael C.

    2014-01-01

    In vitro ribosome construction could enable studies of ribosome assembly and function, provide a route toward constructing minimal cells for synthetic biology, and permit the construction of ribosome variants with new functions. Toward these long-term goals, we recently reported on an integrated, one-pot ribosomal RNA synthesis (rRNA), ribosome assembly, and translation technology (termed iSAT) for the construction of Escherichia coli ribosomes in crude ribosome-free S150 extracts. Here, we aimed to improve the activity of iSAT through transcriptional tuning. Specifically, we increased transcriptional efficiency through 3′ modifications to the rRNA gene sequences, optimized plasmid and polymerase concentrations, and demonstrated the use of a T7-promoted rRNA operon for stoichiometrically balanced rRNA synthesis and native rRNA processing. Our modifications produced a 45-fold improvement in iSAT protein synthesis activity, enabling synthesis of 429 ± 15 nmol/l green fluorescent protein in 6 h batch reactions. Further, we show that the translational activity of ribosomes purified from iSAT reactions is about 20% the activity of native ribosomes purified directly from E. coli cells. Looking forward, we believe iSAT will enable unique studies to unravel the systems biology of ribosome biogenesis and open the way to new methods for making and studying ribosomal variants. PMID:24792158

  5. Ribosomal Oxygenases are Structurally Conserved from Prokaryotes to Humans

    PubMed Central

    Chowdhury, Rasheduzzaman; Krojer, Tobias; Ho, Chia-hua; Ng, Stanley S.; Clifton, Ian J.; Ge, Wei; Kershaw, Nadia J.; Fox, Gavin C.; Muniz, Joao R. C.; Vollmar, Melanie; Phillips, Claire; Pilka, Ewa S.; Kavanagh, Kathryn L.; von Delft, Frank; Oppermann, Udo; McDonough, Michael A.; Doherty, Aiden J.; Schofield, Christopher J.

    2014-01-01

    2-Oxoglutarate (2OG)-dependent oxygenases play important roles in the regulation of gene expression via demethylation of N-methylated chromatin components1,2, hydroxylation of transcription factors3, and of splicing factor proteins4. Recently, 2OG-oxygenases that catalyze hydroxylation of tRNA5-7 and ribosomal proteins8, have been shown to play roles in translation relating to cellular growth, TH17-cell differentiation and translational accuracy9-12. The finding that the ribosomal oxygenases (ROX) occur in organisms ranging from prokaryotes to humans8 raises questions as to their structural and evolutionary relationships. In Escherichia coli, ycfD catalyzes arginine-hydroxylation in the ribosomal protein L16; in humans, Mina53 (MYC-induced nuclear antigen) and NO66 (Nucleolar protein 66) catalyze histidine-hydroxylation in ribosomal proteins rpL27a and rpL8, respectively. The functional assignments of the ROX open therapeutic possibilities via either ROX inhibition or targeting of differentially modified ribosomes. Despite differences in residue- and protein-selectivities of prokaryotic and eukaryotic ROX, crystal structures of ycfD and ycfDRM from E. coli and Rhodothermus marinus with those of human Mina53 and NO66 (hROX) reveal highly conserved folds and novel dimerization modes defining a new structural subfamily of 2OG-oxygenases. ROX structures in complex with/without their substrates, support their functional assignments as hydroxylases, but not demethylases and reveal how the subfamily has evolved to catalyze the hydroxylation of different residue sidechains of ribosomal proteins. Comparison of ROX crystal structures with those of other JmjC-hydroxylases including the hypoxia-inducible factor asparaginyl-hydroxylase (FIH) and histone Nε-methyl lysine demethylases (KDMs) identifies branchpoints in 2OG-oxygenase evolution and distinguishes between JmjC-hydroxylases and -demethylases catalyzing modifications of translational and transcriptional machinery. The

  6. HCV IRES manipulates the ribosome to promote the switch from translation initiation to elongation.

    PubMed

    Filbin, Megan E; Vollmar, Breanna S; Shi, Dan; Gonen, Tamir; Kieft, Jeffrey S

    2013-02-01

    The internal ribosome entry site (IRES) of the hepatitis C virus (HCV) drives noncanonical initiation of protein synthesis necessary for viral replication. Functional studies of the HCV IRES have focused on 80S ribosome formation but have not explored its role after the 80S ribosome is poised at the start codon. Here, we report that mutations of an IRES domain that docks in the 40S subunit's decoding groove cause only a local perturbation in IRES structure and result in conformational changes in the IRES-rabbit 40S subunit complex. Functionally, the mutations decrease IRES activity by inhibiting the first ribosomal translocation event, and modeling results suggest that this effect occurs through an interaction with a single ribosomal protein. The ability of the HCV IRES to manipulate the ribosome provides insight into how the ribosome's structure and function can be altered by bound RNAs, including those derived from cellular invaders. PMID:23262488

  7. Single-Molecule Study of Ribosome Hierarchic Dynamics at the Peptidyl Transferase Center

    PubMed Central

    Altuntop, Mediha Esra; Ly, Cindy Tu; Wang, Yuhong

    2010-01-01

    During protein biosynthesis the ribosome moves along mRNA in steps of precisely three nucleotides. The mechanism for this ribosome motion remains elusive. Using a classification algorithm to sort single-molecule fluorescence resonance energy transfer data into subpopulations, we found that the ribosome dynamics detected at the peptidyl transferase center are highly inhomogeneous. The pretranslocation complex has at least four subpopulations that sample two hybrid states, whereas the posttranslocation complex is mainly static. We observed transitions among the ribosome subpopulations under various conditions, including 1), in the presence of EF-G; 2), spontaneously; 3), in different buffers, and 4), bound to antibiotics. Therefore, these subpopulations represent biologically active ribosomes. One key observation indicates that the Hy2 hybrid state only exists in a fluctuating ribosome subpopulation, which prompts us to propose that ribosome dynamics are hierarchically arranged. This proposal may have important implications for the regulation of cellular translation rates. PMID:21044598

  8. Interplay between trigger factor and other protein biogenesis factors on the ribosome

    NASA Astrophysics Data System (ADS)

    Bornemann, Thomas; Holtkamp, Wolf; Wintermeyer, Wolfgang

    2014-06-01

    Nascent proteins emerging from translating ribosomes in bacteria are screened by a number of ribosome-associated protein biogenesis factors, among them the chaperone trigger factor (TF), the signal recognition particle (SRP) that targets ribosomes synthesizing membrane proteins to the membrane and the modifying enzymes, peptide deformylase (PDF) and methionine aminopeptidase (MAP). Here, we examine the interplay between these factors both kinetically and at equilibrium. TF rapidly scans the ribosomes until it is stabilized on ribosomes presenting TF-specific nascent chains. SRP binding to those complexes is strongly impaired. Thus, TF in effect prevents SRP binding to the majority of ribosomes, except those presenting SRP-specific signal sequences, explaining how the small amount of SRP in the cell can be effective in membrane targeting. PDF and MAP do not interfere with TF or SRP binding to translating ribosomes, indicating that nascent-chain processing can take place before or in parallel with TF or SRP binding.

  9. Structure of Vibrio cholerae ribosome hibernation promoting factor

    PubMed Central

    De Bari, Heather; Berry, Edward A.

    2013-01-01

    The X-ray crystal structure of ribosome hibernation promoting factor (HPF) from Vibrio cholerae is presented at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The asymmetric unit contained two molecules of HPF linked by four Co atoms. The metal-binding sites observed in the crystal are probably not related to biological function. The structure of HPF has a typical β–α–β–β–β–α fold consistent with previous structures of YfiA and HPF from Escherichia coli. Comparison of the new structure with that of HPF from E. coli bound to the Thermus thermophilus ribosome [Polikanov et al. (2012 ▶), Science, 336, 915–918] shows that no significant structural changes are induced in HPF by binding. PMID:23519794

  10. Structure of the large ribosomal subunit from human mitochondria

    PubMed Central

    Bai, Xiao-chen; Sugimoto, Yoichiro; Edwards, Patricia C.; Murshudov, Garib; Scheres, Sjors H. W.; Ramakrishnan, V.

    2014-01-01

    Human mitochondrial ribosomes are highly divergent from all other known ribosomes and are specialized to exclusively translate membrane proteins. They are linked with hereditary mitochondrial diseases, and are often the unintended targets of various clinically useful antibiotics. Using single-particle electron cryo-microscopy we have determined the structure of its large subunit to 3.4 angstrom resolution, revealing 48 proteins, 21 of which are specific to mitochondria. The structure unveils an adaptation of the exit tunnel for hydrophobic nascent peptides, extensive remodeling of the central protuberance including recruitment of mitochondrial tRNAVal to play an integral structural role, and changes in the tRNA binding sites related to the unusual characteristics of mitochondrial tRNAs. PMID:25278503

  11. Size matters: a view of selenocysteine incorporation from the ribosome.

    PubMed

    Caban, K; Copeland, P R

    2006-01-01

    This review focuses on the known factors required for selenocysteine (Sec) incorporation in eukaryotes and highlights recent findings that have compelled us to propose a new model for the mechanism of Sec incorporation. In light of this data we also review the controversial aspects of the previous model specifically regarding the proposed interaction between SBP2 and eEFSec. In addition, the relevance of two recently discovered factors in the recoding of Sec are reviewed. The role of the ribosome in this process is emphasized along with a detailed analysis of kinkturn structures present in the ribosome and the L7Ae RNA-binding motif present in SBP2 and other proteins. PMID:16416259

  12. Evaluation of phylogenetic relationships in Lemnaceae using nuclear ribosomal data.

    PubMed

    Tippery, N P; Les, D H; Crawford, D J

    2015-01-01

    Nuclear DNA sequence data are essential for obtaining a complete understanding of plant species relationships, yet these data have been conspicuously absent from phylogenetic analyses of Lemnaceae (duckweeds). Using a modified Sanger sequencing protocol, we obtained DNA sequences of duckweed nuclear ribosomal regions, including 18S and 26S rDNA genes, the external transcribed spacer (ETS) and the frequently used internal transcribed spacer (ITS). After obtaining sequence data for all Lemnaceae species, we ascertained that prior difficulty in sequencing the ITS regions likely resulted from extremely rigid secondary structures, precipitated by a high proportion of G/C nucleotides. In phylogenetic analyses, nuclear ribosomal data largely supported relationships that had been inferred using chloroplast DNA sequence data. PMID:24942778

  13. Ribosomal Slowdown Mediates Translational Arrest during Cellular Division▿

    PubMed Central

    Sivan, Gilad; Kedersha, Nancy; Elroy-Stein, Orna

    2007-01-01

    Global mRNA translation is transiently inhibited during cellular division. We demonstrate that mitotic cells contain heavy polysomes, but these are significantly less translationally active than polysomes in cycling cells. Several observations indicate that mitotic translational attenuation occurs during the elongation stage: (i) in cycling nonsynchronized cultures, only mitotic cells fail to assemble stress granules when treated with agents that inhibit translational initiation; (ii) mitotic cells contain fewer free 80S complexes, which are less sensitive to high salt disassembly; (iii) mitotic polysomes are more resistant to enforced disassembly using puromycin; and (iv) ribosome transit time increases during mitosis. Elongation slowdown guarantees that polysomes are retained even if initiation is inhibited at the same time. Stalling translating ribosomes during mitosis may protect mRNAs and allow rapid resumption of translation immediately upon entry into the G1 phase. PMID:17664278

  14. Effect of ribosome shielding on mRNA stability

    NASA Astrophysics Data System (ADS)

    Deneke, Carlus; Lipowsky, Reinhard; Valleriani, Angelo

    2013-08-01

    Based on the experimental evidence that translating ribosomes stabilize the mRNAs, we introduce and study a theoretical model for the dynamic shielding of mRNA by ribosomes. We present an improved fitting of published decay assay data in E. coli and show that only one third of the decay patterns are exponential. Our new transcriptome-wide estimate of the average lifetimes and mRNA half-lives shows that these timescales are considerably shorter than previous estimates. We also explain why there is a negative correlation between mRNA length and average lifetime when the mRNAs are subdivided in classes sharing the same degradation parameters. As a by-product, our model indicates that co-transcriptional translation in E. coli may be less common than previously believed.

  15. Structural Basis for Translation Termination on the 70S Ribosome

    SciTech Connect

    Laurberg, M.; Asahara, H.; Korostelev, A.; Zhu, J.; Trakhanov, S.; Noller, H.F.

    2009-05-20

    At termination of protein synthesis, type I release factors promote hydrolysis of the peptidyl-transfer RNA linkage in response to recognition of a stop codon. Here we describe the crystal structure of the Thermus thermophilus 70S ribosome in complex with the release factor RF1, tRNA and a messenger RNA containing a UAA stop codon, at 3.2 {angstrom} resolution. The stop codon is recognized in a pocket formed by conserved elements of RF1, including its PxT recognition motif, and 16S ribosomal RNA. The codon and the 30S subunit A site undergo an induced fit that results in stabilization of a conformation of RF1 that promotes its interaction with the peptidyl transferase centre. Unexpectedly, the main-chain amide group of Gln 230 in the universally conserved GGQ motif of the factor is positioned to contribute directly to peptidyl-tRNA hydrolysis.

  16. A streamlined ribosome profiling protocol for the characterization of microorganisms.

    PubMed

    Latif, Haythem; Szubin, Richard; Tan, Justin; Brunk, Elizabeth; Lechner, Anna; Zengler, Karsten; Palsson, Bernhard O

    2015-06-01

    Ribosome profiling is a powerful tool for characterizing in vivo protein translation at the genome scale, with multiple applications ranging from detailed molecular mechanisms to systems-level predictive modeling. Though highly effective, this intricate technique has yet to become widely used in the microbial research community. Here we present a streamlined ribosome profiling protocol with reduced barriers to entry for microbial characterization studies. Our approach provides simplified alternatives during harvest, lysis, and recovery of monosomes and also eliminates several time-consuming steps, in particular size-selection steps during library construction. Furthermore, the abundance of rRNAs and tRNAs in the final library is drastically reduced. Our streamlined workflow enables greater throughput, cuts the time from harvest to the final library in half (down to 3-4 days), and generates a high fraction of informative reads, all while retaining the high quality standards of the existing protocol. PMID:26054770

  17. Ribosome Patterns in Escherichia coli Growing at Various Rates

    PubMed Central

    Varricchio, Frederick; Monier, Roger

    1971-01-01

    The distribution of ribosomes, 30 and 50S subunits and polysomes, at three different growth rates of Escherichia coli strains B and K-12 has been studied. The usual percentage of subunits is about 20%. However, at the lowest growth rate (μ = generations/hour), μ = 0.45 at 30C, the proportion of subunits is about 30%. An exceptional situation exists in K-12 strains growing at maximum growth rate, μ = 1.35, where the percentage of subunits is 45%. Several points of control over ribosome production are thus indicated. It is suggested that “subunit pool” is essentially a reserve. Furthermore, the polysome content when related to deoxyribonucleic acid content varies directly with the growth rate, which indicates the average efficiency of polysomes in protein synthesis does not vary over the range of growth rates tested. PMID:5001192

  18. Hierarchical RNA Processing Is Required for Mitochondrial Ribosome Assembly.

    PubMed

    Rackham, Oliver; Busch, Jakob D; Matic, Stanka; Siira, Stefan J; Kuznetsova, Irina; Atanassov, Ilian; Ermer, Judith A; Shearwood, Anne-Marie J; Richman, Tara R; Stewart, James B; Mourier, Arnaud; Milenkovic, Dusanka; Larsson, Nils-Göran; Filipovska, Aleksandra

    2016-08-16

    The regulation of mitochondrial RNA processing and its importance for ribosome biogenesis and energy metabolism are not clear. We generated conditional knockout mice of the endoribonuclease component of the RNase P complex, MRPP3, and report that it is essential for life and that heart and skeletal-muscle-specific knockout leads to severe cardiomyopathy, indicating that its activity is non-redundant. Transcriptome-wide parallel analyses of RNA ends (PARE) and RNA-seq enabled us to identify that in vivo 5' tRNA cleavage precedes 3' tRNA processing, and this is required for the correct biogenesis of the mitochondrial ribosomal subunits. We identify that mitoribosomal biogenesis proceeds co-transcriptionally because large mitoribosomal proteins can form a subcomplex on an unprocessed RNA containing the 16S rRNA. Taken together, our data show that RNA processing links transcription to translation via assembly of the mitoribosome. PMID:27498866

  19. Effects of induction of rRNA overproduction on ribosomal protein synthesis and ribosome subunit assembly in Escherichia coli.

    PubMed Central

    Yamagishi, M; Nomura, M

    1988-01-01

    Overproduction of rRNA was artificially induced in Escherichia coli cells to test whether the synthesis of ribosomal protein (r-protein) is normally repressed by feedback regulation. When rRNA was overproduced more than twofold from a hybrid plasmid carrying the rrnB operon fused to the lambda pL promoter (pL-rrnB), synthesis of individual r-proteins increased by an average of about 60%. This demonstrates that the synthesis of r-proteins is repressed under normal conditions. The increase of r-protein production, however, for unknown reasons, was not as great as the increase in rRNA synthesis and resulted in an imbalance between the amounts of rRNA and r-protein synthesis. Therefore, only a small (less than 20%) increase in the synthesis of complete 30S and 50S ribosome subunits was detected, and a considerable fraction of the excess rRNA was degraded. Lack of complete cooperativity in the assembly of ribosome subunits in vivo is discussed as a possible explanation for the absence of a large stimulation of ribosome synthesis observed under these conditions. In addition to the induction of intact rRNA overproduction from the pL-rrnB operon, the effects of unbalanced overproduction of each of the two large rRNAs, 16S rRNA and 23S rRNA, on r-protein synthesis were examined using pL-rrnB derivatives carrying a large deletion in either the 23S rRNA gene or the 16S rRNA gene. Operon-specific derepression after 23S or 16S rRNA overproduction correlated with the overproduction of rRNA containing the target site for the operon-specific repressor r-protein. These results are discussed to explain the apparent coupling of the assembly of one ribosomal subunit with that of the other which was observed in earlier studies on conditionally lethal mutants with defects in ribosome assembly. PMID:3053641

  20. Kinetoplast DNA-encoded ribosomal protein S12

    PubMed Central

    Aphasizheva, Inna; Maslov, Dmitri A; Aphasizhev, Ruslan

    2013-01-01

    Mitochondrial ribosomes of Trypanosoma brucei are composed of 9S and 12S rRNAs, which are encoded by the kinetoplast genome, and more than 150 proteins encoded in the nucleus and imported from the cytoplasm. However, a single ribosomal protein RPS12 is encoded by the kinetoplast DNA (kDNA) in all trypanosomatid species examined. As typical for these organisms, the gene itself is cryptic and its transcript undergoes an extensive U-insertion/deletion editing. An evolutionary trend to reduce or eliminate RNA editing could be traced with other cryptogenes, but the invariably pan-edited RPS12 cryptogene is apparently spared. Here we inquired whether editing of RPS12 mRNA is essential for mitochondrial translation. By RNAi-mediated knockdowns of RNA editing complexes and inducible knock-in of a key editing enzyme in procyclic parasites, we could reversibly downregulate production of edited RPS12 mRNA and, by inference, synthesis of this protein. While inhibition of editing decreased edited mRNA levels, the translation of edited (Cyb) and unedited (COI) mRNAs was blocked. Furthermore, the population of SSU-related 45S complexes declined upon inactivation of editing and so did the amount of mRNA-bound ribosomes. In bloodstream parasites, which lack active electron transport chain but still require translation of ATP synthase subunit 6 mRNA (A6), both edited RPS12 and A6 mRNAs were detected in translation complexes. Collectively, our results indicate that a single ribosomal protein gene retained by the kinetoplast mitochondrion serves as a possible functional link between editing and translation processes and provide the rationale for the evolutionary conservation of RPS12 pan-editing. PMID:24270388

  1. Ribosome biogenesis in replicating cells: Integration of experiment and theory.

    PubMed

    Earnest, Tyler M; Cole, John A; Peterson, Joseph R; Hallock, Michael J; Kuhlman, Thomas E; Luthey-Schulten, Zaida

    2016-10-01

    Ribosomes-the primary macromolecular machines responsible for translating the genetic code into proteins-are complexes of precisely folded RNA and proteins. The ways in which their production and assembly are managed by the living cell is of deep biological importance. Here we extend a recent spatially resolved whole-cell model of ribosome biogenesis in a fixed volume [Earnest et al., Biophys J 2015, 109, 1117-1135] to include the effects of growth, DNA replication, and cell division. All biological processes are described in terms of reaction-diffusion master equations and solved stochastically using the Lattice Microbes simulation software. In order to determine the replication parameters, we construct and analyze a series of Escherichia coli strains with fluorescently labeled genes distributed evenly throughout their chromosomes. By measuring these cells' lengths and number of gene copies at the single-cell level, we could fit a statistical model of the initiation and duration of chromosome replication. We found that for our slow-growing (120 min doubling time) E. coli cells, replication was initiated 42 min into the cell cycle and completed after an additional 42 min. While simulations of the biogenesis model produce the correct ribosome and mRNA counts over the cell cycle, the kinetic parameters for transcription and degradation are lower than anticipated from a recent analytical time dependent model of in vivo mRNA production. Describing expression in terms of a simple chemical master equation, we show that the discrepancies are due to the lack of nonribosomal genes in the extended biogenesis model which effects the competition of mRNA for ribosome binding, and suggest corrections to parameters to be used in the whole-cell model when modeling expression of the entire transcriptome. © 2016 Wiley Periodicals, Inc. Biopolymers 105: 735-751, 2016. PMID:27294303

  2. Parallel Structural Evolution of Mitochondrial Ribosomes and OXPHOS Complexes.

    PubMed

    van der Sluis, Eli O; Bauerschmitt, Heike; Becker, Thomas; Mielke, Thorsten; Frauenfeld, Jens; Berninghausen, Otto; Neupert, Walter; Herrmann, Johannes M; Beckmann, Roland

    2015-05-01

    The five macromolecular complexes that jointly mediate oxidative phosphorylation (OXPHOS) in mitochondria consist of many more subunits than those of bacteria, yet, it remains unclear by which evolutionary mechanism(s) these novel subunits were recruited. Even less well understood is the structural evolution of mitochondrial ribosomes (mitoribosomes): while it was long thought that their exceptionally high protein content would physically compensate for their uniquely low amount of ribosomal RNA (rRNA), this hypothesis has been refuted by structural studies. Here, we present a cryo-electron microscopy structure of the 73S mitoribosome from Neurospora crassa, together with genomic and proteomic analyses of mitoribosome composition across the eukaryotic domain. Surprisingly, our findings reveal that both structurally and compositionally, mitoribosomes have evolved very similarly to mitochondrial OXPHOS complexes via two distinct phases: A constructive phase that mainly acted early in eukaryote evolution, resulting in the recruitment of altogether approximately 75 novel subunits, and a reductive phase that acted during metazoan evolution, resulting in gradual length-reduction of mitochondrially encoded rRNAs and OXPHOS proteins. Both phases can be well explained by the accumulation of (slightly) deleterious mutations and deletions, respectively, in mitochondrially encoded rRNAs and OXPHOS proteins. We argue that the main role of the newly recruited (nuclear encoded) ribosomal- and OXPHOS proteins is to provide structural compensation to the mutationally destabilized mitochondrially encoded components. While the newly recruited proteins probably provide a selective advantage owing to their compensatory nature, and while their presence may have opened evolutionary pathways toward novel mitochondrion-specific functions, we emphasize that the initial events that resulted in their recruitment was nonadaptive in nature. Our framework is supported by population genetic

  3. Structural Insights into tRNA Dynamics on the Ribosome

    PubMed Central

    Agirrezabala, Xabier; Valle, Mikel

    2015-01-01

    High-resolution structures at different stages, as well as biochemical, single molecule and computational approaches have highlighted the elasticity of tRNA molecules when bound to the ribosome. It is well acknowledged that the inherent structural flexibility of the tRNA lies at the heart of the protein synthesis process. Here, we review the recent advances and describe considerations that the conformational changes of the tRNA molecules offer about the mechanisms grounded in translation. PMID:25941930

  4. Structural Insights into tRNA Dynamics on the Ribosome.

    PubMed

    Agirrezabala, Xabier; Valle, Mikel

    2015-01-01

    High-resolution structures at different stages, as well as biochemical, single molecule and computational approaches have highlighted the elasticity of tRNA molecules when bound to the ribosome. It is well acknowledged that the inherent structural flexibility of the tRNA lies at the heart of the protein synthesis process. Here, we review the recent advances and describe considerations that the conformational changes of the tRNA molecules offer about the mechanisms grounded in translation. PMID:25941930

  5. Parallel Structural Evolution of Mitochondrial Ribosomes and OXPHOS Complexes

    PubMed Central

    van der Sluis, Eli O.; Bauerschmitt, Heike; Becker, Thomas; Mielke, Thorsten; Frauenfeld, Jens; Berninghausen, Otto; Neupert, Walter; Herrmann, Johannes M.; Beckmann, Roland

    2015-01-01

    The five macromolecular complexes that jointly mediate oxidative phosphorylation (OXPHOS) in mitochondria consist of many more subunits than those of bacteria, yet, it remains unclear by which evolutionary mechanism(s) these novel subunits were recruited. Even less well understood is the structural evolution of mitochondrial ribosomes (mitoribosomes): while it was long thought that their exceptionally high protein content would physically compensate for their uniquely low amount of ribosomal RNA (rRNA), this hypothesis has been refuted by structural studies. Here, we present a cryo-electron microscopy structure of the 73S mitoribosome from Neurospora crassa, together with genomic and proteomic analyses of mitoribosome composition across the eukaryotic domain. Surprisingly, our findings reveal that both structurally and compositionally, mitoribosomes have evolved very similarly to mitochondrial OXPHOS complexes via two distinct phases: A constructive phase that mainly acted early in eukaryote evolution, resulting in the recruitment of altogether approximately 75 novel subunits, and a reductive phase that acted during metazoan evolution, resulting in gradual length-reduction of mitochondrially encoded rRNAs and OXPHOS proteins. Both phases can be well explained by the accumulation of (slightly) deleterious mutations and deletions, respectively, in mitochondrially encoded rRNAs and OXPHOS proteins. We argue that the main role of the newly recruited (nuclear encoded) ribosomal- and OXPHOS proteins is to provide structural compensation to the mutationally destabilized mitochondrially encoded components. While the newly recruited proteins probably provide a selective advantage owing to their compensatory nature, and while their presence may have opened evolutionary pathways toward novel mitochondrion-specific functions, we emphasize that the initial events that resulted in their recruitment was nonadaptive in nature. Our framework is supported by population genetic

  6. Database on the structure of small ribosomal subunit RNA.

    PubMed Central

    Van de Peer, Y; Caers, A; De Rijk, P; De Wachter, R

    1998-01-01

    About 8600 complete or nearly complete sequences are now available from the Antwerp database on small ribosomal subunit RNA. All these sequences are aligned with one another on the basis of the adopted secondary structure model, which is corroborated by the observation of compensating substitutions in the alignment. Literature references, accession numbers and detailed taxonomic information are also compiled. The database can be consulted via the World Wide Web at URL http://rrna.uia.ac.be/ssu/ PMID:9399829

  7. Database on the structure of large ribosomal subunit RNA.

    PubMed Central

    De Rijk, P; Van de Peer, Y; De Wachter, R

    1996-01-01

    Our database on large ribosomal subunit RNA contained 334 sequences in July, 1995. All sequences in the database are aligned, taking into account secondary structure. The aligned sequences are provided, together with incorporated secondary structure information, in several computer-readable formats. These data can easily be obtained through the World Wide Web. The files in the database are also available via anonymous ftp. PMID:8594610

  8. Database on the structure of large ribosomal subunit RNA.

    PubMed Central

    De Rijk, P; Caers, A; Van de Peer, Y; De Wachter, R

    1998-01-01

    The rRNA WWW Server at URL http://rrna.uia.ac.be/ now provides a database of 496 large subunit ribosomal RNA sequences. All these sequences are aligned, incorporate secondary structure information, and can be obtained in a number of formats. Other information about the sequences, such as literature references, accession numbers and taxonomic information is also available and searchable. If necessary, the data on the server can also be obtained by anonymous ftp. PMID:9399830

  9. Further use of nearly complete 28S and 18S rRNA genes to classify Ecdysozoa: 37 more arthropods and a kinorhynch.

    PubMed

    Mallatt, Jon; Giribet, Gonzalo

    2006-09-01

    This work expands on a study from 2004 by Mallatt, Garey, and Shultz [Mallatt, J.M., Garey, J.R., Shultz, J.W., 2004. Ecdysozoan phylogeny and Bayesian inference: first use of nearly complete 28S and 18S rRNA gene sequences to classify the arthropods and their kin. Mol. Phylogenet. Evol. 31, 178-191] that evaluated the phylogenetic relationships in Ecdysozoa (molting animals), especially arthropods. Here, the number of rRNA gene-sequences was effectively doubled for each major group of arthropods, and sequences from the phylum Kinorhyncha (mud dragons) were also included, bringing the number of ecdysozoan taxa to over 80. The methods emphasized maximum likelihood, Bayesian inference and statistical testing with parametric bootstrapping, but also included parsimony and minimum evolution. Prominent findings from our combined analysis of both genes are as follows. The fundamental subdivisions of Hexapoda (insects and relatives) are Insecta and Entognatha, with the latter consisting of collembolans (springtails) and a clade of proturans plus diplurans. Our rRNA-gene data provide the strongest evidence to date that the sister group of Hexapoda is Branchiopoda (fairy shrimps, tadpole shrimps, etc.), not Malacostraca. The large, Pancrustacea clade (hexapods within a paraphyletic Crustacea) divided into a few basic subclades: hexapods plus branchiopods; cirripedes (barnacles) plus malacostracans (lobsters, crabs, true shrimps, isopods, etc.); and the basally located clades of (a) ostracods (seed shrimps) and (b) branchiurans (fish lice) plus the bizarre pentastomids (tongue worms). These findings about Pancrustacea agree with a recent study by Regier, Shultz, and Kambic that used entirely different genes [Regier, J.C., Shultz, J.W., Kambic, R.E., 2005a. Pancrustacean phylogeny: hexapods are terrestrial crustaceans and maxillopods are not monophyletic. Proc. R. Soc. B 272, 395-401]. In Malacostraca, the stomatopod (mantis shrimp) was not at the base of the eumalacostracans

  10. Characterization of Cryptocaryon irritans isolates from marine fishes in Mainland China by ITS ribosomal DNA sequences.

    PubMed

    Sun, H Y; Zhu, X Q; Xie, M Q; Wu, X Y; Li, A X; Lin, R Q; Song, H Q

    2006-07-01

    Seven isolates of Cryptocaryon irritans from different host species and geographical locations in Mainland China were characterized by the first (ITS-1) and second (ITS-2) internal transcribed spacers (ITS) of nuclear ribosomal DNA (rDNA) using two isolates of Ichthyophthirius multifiliis for comparative purposes. The rDNA region including the ITS-1, 5.8S, ITS-2, and flanking 18S and 28S sequences were amplified by polymerase chain reaction and the amplicons were sequenced directly. The ITS-1, 5.8S, and ITS-2 sequences were 129, 160, and 190 bp in length, respectively, for all seven C. irritans isolates, whereas the corresponding sequences for the two I. multifiliis isolates were 142, 153, and 194 bp, respectively. While sequence variation among the seven C. irritans isolates ranged from 0 to 1.6% in both the ITS-1 and ITS-2, and the two I. multifiliis isolates differed by 1.4% in the ITS-1 and 1.0% in the ITS-2; C. irritans differed from I. multifiliis by 57.1-60.9% in the ITS-1 and 79.4-83.0% in the ITS-2, indicating that ITS sequences provide reliable genetic markers for the identification and differentiation of the two species. Phylogenetic analysis using the sequence pairwise-distance data using the neighbor-joining method inferred that the seven C. irritans isolates from Mainland China and two other isolates (T.A and Aus.C) from other countries clustered together to show monophyly, which could be readily distinguished from the other monophyletic group all from other regions. Therefore, ITS sequence data and phylogenetic analysis provided strong support that C. irritans isolates from Mainland China represent a single species. The definition of genetic markers in the ITS rDNA provide opportunities for studying the ecology and population genetic structures of the C. irritans from Mainland China and elsewhere and is also relevant to the diagnosis and control of fish diseases they cause. PMID:16523350

  11. Analysis of the interactome of ribosomal protein S19 mutants.

    PubMed

    Caterino, Marianna; Aspesi, Anna; Pavesi, Elisa; Imperlini, Esther; Pagnozzi, Daniela; Ingenito, Laura; Santoro, Claudio; Dianzani, Irma; Ruoppolo, Margherita

    2014-10-01

    Diamond-Blackfan anemia, characterized by defective erythroid progenitor maturation, is caused in one-fourth of cases by mutations of ribosomal protein S19 (RPS19), which is a component of the ribosomal 40S subunit. Our previous work described proteins interacting with RPS19 with the aim to determine its functions. Here, two RPS19 mutants, R62W and R101H, have been selected to compare their interactomes versus the wild-type protein one, using the same functional proteomic approach that we employed to characterize RPS19 interactome. Mutations R62W and R101H impair RPS19 ability to associate with the ribosome. Results presented in this paper highlight the striking differences between the interactomes of wild-type and mutant RPS19 proteins. In particular, mutations abolish interactions with proteins having splicing, translational and helicase activity, thus confirming the role of RPS19 in RNA processing/metabolism and translational control. The data have been deposited to the ProteomeXchange with identifier PXD000640 (http://proteomecentral.proteomexchange.org/dataset/PXD000640). PMID:25069755

  12. Positive modulation of RNA polymerase III transcription by ribosomal proteins

    SciTech Connect

    Dieci, Giorgio; Carpentieri, Andrea; Amoresano, Angela; Ottonello, Simone

    2009-02-06

    A yeast nuclear fraction of unknown composition, named TFIIIE, was reported previously to enhance transcription of tRNA and 5S rRNA genes in vitro. We show that TFIIIE activity co-purifies with a specific subset of ribosomal proteins (RPs) which, as revealed by chromatin immunoprecipitation analysis, generally interact with tRNA and 5S rRNA genes, but not with a Pol II-specific promoter. Only Rpl6Ap and Rpl6Bp, among the tested RPs, were found associated to a TATA-containing tRNA{sup Ile}(TAT) gene. The RPL6A gene also emerged as a strong multicopy suppressor of a conditional mutation in the basal transcription factor TFIIIC, while RPL26A and RPL14A behaved as weak suppressors. The data delineate a novel extra-ribosomal role for one or a few RPs which, by influencing 5S rRNA and tRNA synthesis, could play a key role in the coordinate regulation of the different sub-pathways required for ribosome biogenesis and functionality.

  13. Further characterization of ribosome binding to thylakoid membranes. [Pisum sativum

    SciTech Connect

    Hurewitz, J.; Jagendorf, A.T.

    1987-05-01

    Previous work indicated more polysomes bound to pea (Pisum sativum cv Progress No. 9) thylakoids in light than in the dark, in vivo. With isolated intact chloroplasts incubated in darkness, addition of MgATP had no effect but 24 to 74% more RNA was thylakoid-bound at pH 8.3 than at pH 7. Thus, the major effect of light on ribosome-binding in vivo may be due to higher stroma pH. In isolated pea chloroplasts, initiation inhibitors (pactamycin and kanamycin) decreased the extent of RNA binding, and elongation inhibitors (lincomycin and streptomycin) increased it. Thus, cycling of ribosomes is controlled by translation, initiation, and termination. Bound RNA accounted for 19 to 24% of the total chloroplast RNA and the incorporation of (/sup 3/H)leucine into thylakoids was proportional to the amount of this bound RNA. These data support the concept that stroma ribosomes are recruited into thylakoid polysomes, which are active in synthesizing thylakoid proteins.

  14. Eukaryotic rpL10 drives ribosomal rotation

    PubMed Central

    Sulima, Sergey O.; Gülay, Suna P.; Anjos, Margarida; Patchett, Stephanie; Meskauskas, Arturas; Johnson, Arlen W.; Dinman, Jonathan D.

    2014-01-01

    Ribosomes transit between two conformational states, non-rotated and rotated, through the elongation cycle. Here, we present evidence that an internal loop in the essential yeast ribosomal protein rpL10 is a central controller of this process. Mutations in this loop promote opposing effects on the natural equilibrium between these two extreme conformational states. rRNA chemical modification analyses reveals allosteric interactions involved in coordinating intersubunit rotation originating from rpL10 in the core of the large subunit (LSU) through both subunits, linking all the functional centers of the ribosome. Mutations promoting rotational disequilibria showed catalytic, biochemical and translational fidelity defects. An rpL3 mutation promoting opposing structural and biochemical effects, suppressed an rpL10 mutant, re-establishing rotational equilibrium. The rpL10 loop is also involved in Sdo1p recruitment, suggesting that rotational status is important for ensuring late-stage maturation of the LSU, supporting a model in which pre-60S subunits undergo a ‘test drive’ before final maturation. PMID:24214990

  15. Eukaryotic rpL10 drives ribosomal rotation.

    PubMed

    Sulima, Sergey O; Gülay, Suna P; Anjos, Margarida; Patchett, Stephanie; Meskauskas, Arturas; Johnson, Arlen W; Dinman, Jonathan D

    2014-02-01

    Ribosomes transit between two conformational states, non-rotated and rotated, through the elongation cycle. Here, we present evidence that an internal loop in the essential yeast ribosomal protein rpL10 is a central controller of this process. Mutations in this loop promote opposing effects on the natural equilibrium between these two extreme conformational states. rRNA chemical modification analyses reveals allosteric interactions involved in coordinating intersubunit rotation originating from rpL10 in the core of the large subunit (LSU) through both subunits, linking all the functional centers of the ribosome. Mutations promoting rotational disequilibria showed catalytic, biochemical and translational fidelity defects. An rpL3 mutation promoting opposing structural and biochemical effects, suppressed an rpL10 mutant, re-establishing rotational equilibrium. The rpL10 loop is also involved in Sdo1p recruitment, suggesting that rotational status is important for ensuring late-stage maturation of the LSU, supporting a model in which pre-60S subunits undergo a 'test drive' before final maturation. PMID:24214990

  16. PROTEOFORMER: deep proteome coverage through ribosome profiling and MS integration

    PubMed Central

    Crappé, Jeroen; Ndah, Elvis; Koch, Alexander; Steyaert, Sandra; Gawron, Daria; De Keulenaer, Sarah; De Meester, Ellen; De Meyer, Tim; Van Criekinge, Wim; Van Damme, Petra; Menschaert, Gerben

    2015-01-01

    An increasing amount of studies integrate mRNA sequencing data into MS-based proteomics to complement the translation product search space. However, several factors, including extensive regulation of mRNA translation and the need for three- or six-frame-translation, impede the use of mRNA-seq data for the construction of a protein sequence search database. With that in mind, we developed the PROTEOFORMER tool that automatically processes data of the recently developed ribosome profiling method (sequencing of ribosome-protected mRNA fragments), resulting in genome-wide visualization of ribosome occupancy. Our tool also includes a translation initiation site calling algorithm allowing the delineation of the open reading frames (ORFs) of all translation products. A complete protein synthesis-based sequence database can thus be compiled for mass spectrometry-based identification. This approach increases the overall protein identification rates with 3% and 11% (improved and new identifications) for human and mouse, respectively, and enables proteome-wide detection of 5′-extended proteoforms, upstream ORF translation and near-cognate translation start sites. The PROTEOFORMER tool is available as a stand-alone pipeline and has been implemented in the galaxy framework for ease of use. PMID:25510491

  17. Dynamic evolution of mitochondrial ribosomal proteins in Holozoa.

    PubMed

    Scheel, Bettina M; Hausdorf, Bernhard

    2014-07-01

    We studied the highly dynamic evolution of mitochondrial ribosomal proteins (MRPs) in Holozoa. Most major clades within Holozoa are characterized by gains and/or losses of MRPs. The usefulness of gains of MRPs as rare genomic changes in phylogenetics is undermined by the high frequency of secondary losses. However, phylogenetic analyses of the MRP sequences provide evidence for the Acrosomata hypothesis, a sister group relationship between Ctenophora and Bilateria. An extensive restructuring of the mitochondrial genome and, as a consequence, of the mitochondrial ribosomes occurred in the ancestor of metazoans. The last MRP genes encoded in the mitochondrial genome were either moved to the nuclear genome or were lost. The strong decrease in size of the mitochondrial genome was probably caused by selection for rapid replication of mitochondrial DNA during oogenesis in the metazoan ancestor. A phylogenetic analysis of MRPL56 sequences provided evidence for a horizontal gene transfer of the corresponding MRP gene between metazoans and Dictyostelidae (Amoebozoa). The hypothesis that the requisition of additional MRPs compensated for a loss of rRNA segments in the mitochondrial ribosomes is corroborated by a significant negative correlation between the number of MRPs and length of the rRNA. Newly acquired MRPs evolved faster than bacterial MRPs and positions in eukaryote-specific MRPs were more strongly affected by coevolution than positions in prokaryotic MRPs in accordance with the necessity to fit these proteins into the pre-existing structure of the mitoribosome. PMID:24631858

  18. Epigeneitc silencing of ribosomal RNA genes by Mybbp1a

    PubMed Central

    2012-01-01

    Background Transcription of the ribosomal RNA gene repeats by Pol I occurs in the nucleolus and is a fundamental step in ribosome biogenesis and protein translation. Due to tight coordination between ribosome biogenesis and cell proliferation, transcription of rRNA and stable maintenance of rDNA clusters are thought to be under intricate control by intercalated mechanisms, particularly at the epigenetic level. Methods and Results Here we identify the nucleolar protein Myb-binding protein 1a (Mybbp1a) as a novel negative regulator of rRNA expression. Suppression of rDNA transcription by Mybbp1a was linked to promoter regulation as illustrated by its binding to the chromatin around the hypermethylated, inactive rDNA gene promoters. Our data further showed that downregulation of Mybbp1a abrogated the local DNA methylation levels and histone marks associated with gene silencing, and altered the promoter occupancy of various factors such UBF and HDACs, consequently leading to elevated rRNA expression. Mechanistically, we propose that Mybbp1a maintains rDNA repeats in a silenced state while in association with the negative epigenetic modifiers HDAC1/2. Conclusions Results from our present work reveal a previously unrecognized co-repressor role of Mybbp1a in rRNA expression. They are further consistent with the scenario that Mybbp1a is an integral constituent of the rDNA epigenetic regulation that underlies the balanced state of rDNA clusters. PMID:22686419

  19. Simulation and analysis of single-ribosome translation

    NASA Astrophysics Data System (ADS)

    Tinoco, Ignacio Jr; Wen, Jin-Der

    2009-06-01

    In the cell, proteins are synthesized by ribosomes in a multi-step process called translation. The ribosome translocates along the messenger RNA to read the codons that encode the amino acid sequence of a protein. Elongation factors, including EF-G and EF-Tu, are used to catalyze the process. Recently, we have shown that translation can be followed at the single-molecule level using optical tweezers; this technique allows us to study the kinetics of translation by measuring the lifetime the ribosome spends at each codon. Here, we analyze the data from single-molecule experiments and fit the data with simple kinetic models. We also simulate the translation kinetics based on a multi-step mechanism from ensemble kinetic measurements. The mean lifetimes from the simulation were consistent with our experimental single-molecule measurements. We found that the calculated lifetime distributions were fit in general by equations with up to five rate-determining steps. Two rate-determining steps were only obtained at low concentrations of elongation factors. These analyses can be used to design new single-molecule experiments to better understand the kinetics and mechanism of translation.

  20. tRNA dynamics on the ribosome during translation

    PubMed Central

    Blanchard, Scott C.; Kim, Harold D.; Gonzalez, Ruben L.; Puglisi, Joseph D.; Chu, Steven

    2004-01-01

    Using single-molecule fluorescence spectroscopy, time-resolved conformational changes between fluorescently labeled tRNA have been characterized within surface-immobilized ribosomes proceeding through a complete cycle of translation elongation. Fluorescence resonance energy transfer was used to observe aminoacyl-tRNA (aa-tRNA) stably accommodating into the aminoacyl site (A site) of the ribosome via a multistep, elongation factor-Tu dependent process. Subsequently, tRNA molecules, bound at the peptidyl site and A site, fluctuate between two configurations assigned as classical and hybrid states. The lifetime of classical and hybrid states, measured for complexes carrying aa-tRNA and peptidyl-tRNA at the A site, shows that peptide bond formation decreases the lifetime of the classical-state tRNA configuration by ≈6-fold. These data suggest that the growing peptide chain plays a role in modulating fluctuations between hybrid and classical states. Single-molecule fluorescence resonance energy transfer was also used to observe aa-tRNA accommodation coupled with elongation factor G-mediated translocation. Dynamic rearrangements in tRNA configuration are also observed subsequent to the translocation reaction. This work underscores the importance of dynamics in ribosome function and demonstrates single-particle enzymology in a system of more than two components. PMID:15317937

  1. Trajectories of the ribosome as a Brownian nanomachine

    PubMed Central

    Dashti, Ali; Schwander, Peter; Langlois, Robert; Fung, Russell; Li, Wen; Hosseinizadeh, Ahmad; Liao, Hstau Y.; Pallesen, Jesper; Sharma, Gyanesh; Stupina, Vera A.; Simon, Anne E.; Dinman, Jonathan D.; Frank, Joachim; Ourmazd, Abbas

    2014-01-01

    A Brownian machine, a tiny device buffeted by the random motions of molecules in the environment, is capable of exploiting these thermal motions for many of the conformational changes in its work cycle. Such machines are now thought to be ubiquitous, with the ribosome, a molecular machine responsible for protein synthesis, increasingly regarded as prototypical. Here we present a new analytical approach capable of determining the free-energy landscape and the continuous trajectories of molecular machines from a large number of snapshots obtained by cryogenic electron microscopy. We demonstrate this approach in the context of experimental cryogenic electron microscope images of a large ensemble of nontranslating ribosomes purified from yeast cells. The free-energy landscape is seen to contain a closed path of low energy, along which the ribosome exhibits conformational changes known to be associated with the elongation cycle. Our approach allows model-free quantitative analysis of the degrees of freedom and the energy landscape underlying continuous conformational changes in nanomachines, including those important for biological function. PMID:25422471

  2. A new version of the RDP (Ribosomal Database Project)

    NASA Technical Reports Server (NTRS)

    Maidak, B. L.; Cole, J. R.; Parker, C. T. Jr; Garrity, G. M.; Larsen, N.; Li, B.; Lilburn, T. G.; McCaughey, M. J.; Olsen, G. J.; Overbeek, R.; Pramanik, S.; Schmidt, T. M.; Tiedje, J. M.; Woese, C. R.

    1999-01-01

    The Ribosomal Database Project (RDP-II), previously described by Maidak et al. [ Nucleic Acids Res. (1997), 25, 109-111], is now hosted by the Center for Microbial Ecology at Michigan State University. RDP-II is a curated database that offers ribosomal RNA (rRNA) nucleotide sequence data in aligned and unaligned forms, analysis services, and associated computer programs. During the past two years, data alignments have been updated and now include >9700 small subunit rRNA sequences. The recent development of an ObjectStore database will provide more rapid updating of data, better data accuracy and increased user access. RDP-II includes phylogenetically ordered alignments of rRNA sequences, derived phylogenetic trees, rRNA secondary structure diagrams, and various software programs for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (ftp.cme.msu. edu) and WWW (http://www.cme.msu.edu/RDP). The WWW server provides ribosomal probe checking, approximate phylogenetic placement of user-submitted sequences, screening for possible chimeric rRNA sequences, automated alignment, and a suggested placement of an unknown sequence on an existing phylogenetic tree. Additional utilities also exist at RDP-II, including distance matrix, T-RFLP, and a Java-based viewer of the phylogenetic trees that can be used to create subtrees.

  3. Detecting actively translated open reading frames in ribosome profiling data.

    PubMed

    Calviello, Lorenzo; Mukherjee, Neelanjan; Wyler, Emanuel; Zauber, Henrik; Hirsekorn, Antje; Selbach, Matthias; Landthaler, Markus; Obermayer, Benedikt; Ohler, Uwe

    2016-02-01

    RNA-sequencing protocols can quantify gene expression regulation from transcription to protein synthesis. Ribosome profiling (Ribo-seq) maps the positions of translating ribosomes over the entire transcriptome. We have developed RiboTaper (available at https://ohlerlab.mdc-berlin.de/software/), a rigorous statistical approach that identifies translated regions on the basis of the characteristic three-nucleotide periodicity of Ribo-seq data. We used RiboTaper with deep Ribo-seq data from HEK293 cells to derive an extensive map of translation that covered open reading frame (ORF) annotations for more than 11,000 protein-coding genes. We also found distinct ribosomal signatures for several hundred upstream ORFs and ORFs in annotated noncoding genes (ncORFs). Mass spectrometry data confirmed that RiboTaper achieved excellent coverage of the cellular proteome. Although dozens of novel peptide products were validated in this manner, few of the currently annotated long noncoding RNAs appeared to encode stable polypeptides. RiboTaper is a powerful method for comprehensive de novo identification of actively used ORFs from Ribo-seq data. PMID:26657557

  4. Studies on the Coordination of Ribosomal Protein Assembly Events Involved in Processing and Stabilization of Yeast Early Large Ribosomal Subunit Precursors.

    PubMed

    Ohmayer, Uli; Gil-Hernández, Álvaro; Sauert, Martina; Martín-Marcos, Pilar; Tamame, Mercedes; Tschochner, Herbert; Griesenbeck, Joachim; Milkereit, Philipp

    2015-01-01

    Cellular production of ribosomes involves the formation of highly defined interactions between ribosomal proteins (r-proteins) and ribosomal RNAs (rRNAs). Moreover in eukaryotic cells, efficient ribosome maturation requires the transient association of a large number of ribosome biogenesis factors (RBFs) with newly forming ribosomal subunits. Here, we investigated how r-protein assembly events in the large ribosomal subunit (LSU) rRNA domain II are coordinated with each other and with the association of RBFs in early LSU precursors of the yeast Saccharomyces cerevisiae. Specific effects on the pre-ribosomal association of RBFs could be observed in yeast mutants blocked in LSU rRNA domain II assembly. Moreover, formation of a cluster of r-proteins was identified as a downstream event in LSU rRNA domain II assembly. We analyzed in more detail the functional relevance of eukaryote specific bridges established by this r-protein cluster between LSU rRNA domain II and VI and discuss how they can support the stabilization and efficient processing of yeast early LSU precursor RNAs. PMID:26642313

  5. Studies on the Coordination of Ribosomal Protein Assembly Events Involved in Processing and Stabilization of Yeast Early Large Ribosomal Subunit Precursors

    PubMed Central

    Sauert, Martina; Martín-Marcos, Pilar; Tamame, Mercedes; Tschochner, Herbert; Griesenbeck, Joachim; Milkereit, Philipp

    2015-01-01

    Cellular production of ribosomes involves the formation of highly defined interactions between ribosomal proteins (r-proteins) and ribosomal RNAs (rRNAs). Moreover in eukaryotic cells, efficient ribosome maturation requires the transient association of a large number of ribosome biogenesis factors (RBFs) with newly forming ribosomal subunits. Here, we investigated how r-protein assembly events in the large ribosomal subunit (LSU) rRNA domain II are coordinated with each other and with the association of RBFs in early LSU precursors of the yeast Saccharomyces cerevisiae. Specific effects on the pre-ribosomal association of RBFs could be observed in yeast mutants blocked in LSU rRNA domain II assembly. Moreover, formation of a cluster of r-proteins was identified as a downstream event in LSU rRNA domain II assembly. We analyzed in more detail the functional relevance of eukaryote specific bridges established by this r-protein cluster between LSU rRNA domain II and VI and discuss how they can support the stabilization and efficient processing of yeast early LSU precursor RNAs. PMID:26642313

  6. The N-terminal extension of Escherichia coli ribosomal protein L20 is important for ribosome assembly, but dispensable for translational feedback control

    PubMed Central

    GUILLIER, MAUDE; ALLEMAND, FRÉDÉRIC; GRAFFE, MONIQUE; RAIBAUD, SOPHIE; DARDEL, FRÉDÉRIC; SPRINGER, MATHIAS; CHIARUTTINI, CLAUDE

    2005-01-01

    The Escherichia coli autoregulatory ribosomal protein L20 consists of two structurally distinct domains. The C-terminal domain is globular and sits on the surface of the large ribosomal subunit whereas the N-terminal domain has an extended shape and penetrates deep into the RNA-rich core of the subunit. Many other ribosomal proteins have analogous internal or terminal extensions. However, the biological functions of these extended domains remain obscure. Here we show that the N-terminal tail of L20 is important for ribosome assembly in vivo. Indeed, a truncated version of L20 without its N-terminal tail is unable to complement the deletion of rplT, the gene encoding L20. In addition, this L20 truncation confers a lethal-dominant phenotype, suggesting that the N-terminal domain is essential for cell growth because it could be required for ribosome assembly. Supporting this hypothesis, partial deletions of the N-terminal tail of the protein are shown to cause a slow-growth phenotype due to altered ribosome assembly in vivo as large amounts of intermediate 40S ribosomal particles accumulate. In addition to being a ribosomal protein, L20 also acts as an autogenous repressor. Using L20 truncations, we also show that the N-terminal tail of L20 is dispensable for autogenous control. PMID:15840820

  7. The extended loops of ribosomal proteins uL4 and uL22 of Escherichia coli contribute to ribosome assembly and protein translation.

    PubMed

    Lawrence, Marlon G; Shamsuzzaman, Md; Kondopaka, Maithri; Pascual, Clarence; Zengel, Janice M; Lindahl, Lasse

    2016-07-01

    Nearly half of ribosomal proteins are composed of a domain on the ribosome surface and a loop or extension that penetrates into the organelle's RNA core. Our previous work showed that ribosomes lacking the loops of ribosomal proteins uL4 or uL22 are still capable of entering polysomes. However, in those experiments we could not address the formation of mutant ribosomes, because we used strains that also expressed wild-type uL4 and uL22. Here, we have focused on ribosome assembly and function in strains in which loop deletion mutant genes are the ONLY: sources of uL4 or uL22 protein. The uL4 and uL22 loop deletions have different effects, but both mutations result in accumulation of immature particles that do not accumulate in detectable amounts in wild-type strains. Thus, our results suggest that deleting the loops creates kinetic barriers in the normal assembly pathway, possibly resulting in assembly via alternate pathway(s). Furthermore, deletion of the uL4 loop results in cold-sensitive ribosome assembly and function. Finally, ribosomes carrying either of the loop-deleted proteins responded normally to the secM translation pausing peptide, but the uL4 mutant responded very inefficiently to the cmlA(crb) pause peptide. PMID:27257065

  8. Yeast ribosomal protein L7 and its homologue Rlp7 are simultaneously present at distinct sites on pre-60S ribosomal particles

    PubMed Central

    Babiano, Reyes; Badis, Gwenael; Saveanu, Cosmin; Namane, Abdelkader; Doyen, Antonia; Díaz-Quintana, Antonio; Jacquier, Alain; Fromont-Racine, Micheline; de la Cruz, Jesús

    2013-01-01

    Ribosome biogenesis requires >300 assembly factors in Saccharomyces cerevisiae. Ribosome assembly factors Imp3, Mrt4, Rlp7 and Rlp24 have sequence similarity to ribosomal proteins S9, P0, L7 and L24, suggesting that these pre-ribosomal factors could be placeholders that prevent premature assembly of the corresponding ribosomal proteins to nascent ribosomes. However, we found L7 to be a highly specific component of Rlp7-associated complexes, revealing that the two proteins can bind simultaneously to pre-ribosomal particles. Cross-linking and cDNA analysis experiments showed that Rlp7 binds to the ITS2 region of 27S pre-rRNAs, at two sites, in helix III and in a region adjacent to the pre-rRNA processing sites C1 and E. However, L7 binds to mature 25S and 5S rRNAs and cross-linked predominantly to helix ES7Lb within 25S rRNA. Thus, despite their predicted structural similarity, our data show that Rlp7 and L7 clearly bind at different positions on the same pre-60S particles. Our results also suggest that Rlp7 facilitates the formation of the hairpin structure of ITS2 during 60S ribosomal subunit maturation. PMID:23945946

  9. The extended loops of ribosomal proteins uL4 and uL22 of Escherichia coli contribute to ribosome assembly and protein translation

    PubMed Central

    Lawrence, Marlon G.; Shamsuzzaman, Md; Kondopaka, Maithri; Pascual, Clarence; Zengel, Janice M.; Lindahl, Lasse

    2016-01-01

    Nearly half of ribosomal proteins are composed of a domain on the ribosome surface and a loop or extension that penetrates into the organelle's RNA core. Our previous work showed that ribosomes lacking the loops of ribosomal proteins uL4 or uL22 are still capable of entering polysomes. However, in those experiments we could not address the formation of mutant ribosomes, because we used strains that also expressed wild-type uL4 and uL22. Here, we have focused on ribosome assembly and function in strains in which loop deletion mutant genes are the only sources of uL4 or uL22 protein. The uL4 and uL22 loop deletions have different effects, but both mutations result in accumulation of immature particles that do not accumulate in detectable amounts in wild-type strains. Thus, our results suggest that deleting the loops creates kinetic barriers in the normal assembly pathway, possibly resulting in assembly via alternate pathway(s). Furthermore, deletion of the uL4 loop results in cold-sensitive ribosome assembly and function. Finally, ribosomes carrying either of the loop-deleted proteins responded normally to the secM translation pausing peptide, but the uL4 mutant responded very inefficiently to the cmlAcrb pause peptide. PMID:27257065

  10. Highly efficient ribosome display selection by use of purified components for in vitro translation.

    PubMed

    Villemagne, Denis; Jackson, Ronald; Douthwaite, Julie A

    2006-06-30

    Ribosome display is a powerful in vitro technology for the selection and directed evolution of proteins. The ribosome display process exploits cell-free translation to achieve coupling of phenotype and genotype by the production of stabilised ribosome complexes in which translated proteins and their encoding mRNA remain attached to the ribosome. Current ribosome display systems that are well proven, by the evolution of high affinity antibodies and the optimisation of defined protein characteristics, use an Escherichia coli cell extract for in vitro translation and display of an mRNA library. Recently, a cell-free translation system has been produced by combining recombinant E. coli protein factors with purified 70S ribosomes. We have applied this development in cell-free translation technology to ribosome display by using the reconstituted system to generate stabilised ribosome complexes for selection. We show that higher cDNA yields are recovered from ribosome display selections when using a reconstituted translation system and the degree of improvement seen is selection specific. These effects are likely to reflect higher mRNA and protein stability and potentially other advantages that may include protein specific improvements in expression. Reconstituted translation systems therefore enable a highly efficient, robust and accessible prokaryotic ribosome display technology. PMID:16730021

  11. PIM1 destabilization activates a p53-dependent response to ribosomal stress in cancer cells.

    PubMed

    Sagar, Vinay; Caldarola, Sara; Aria, Valentina; Monteleone, Valentina; Fuoco, Claudia; Gargioli, Cesare; Cannata, Stefano; Loreni, Fabrizio

    2016-04-26

    Defects in ribosome biogenesis triggers a stress response (ribosomal stress) that can lead to growth arrest and apoptosis. Signaling pathways activated by ribosomal stress are specifically involved in the pathological mechanism of a group of disorders defined as ribosomopathies. However, more generally, the quality control of ribosome synthesis is part of the regulatory circuits that control cell metabolism. A number of studies identified tumor suppressor p53 as a central player in ribosomal stress. We have previously reported that the kinase PIM1 plays a role as a sensor for ribosome deficiency. In this report we address the relationship between PIM1 and p53 in cancer cell lines after depletion of a ribosomal protein. We identified a novel signaling pathway that includes the kinase AKT and the ubiquitin ligase MDM2. In fact, our results indicate that the lower level of PIM1, induced by ribosomal stress, causes inactivation of AKT, inhibition of MDM2 and a consequent p53 stabilization. Therefore, we propose that activation of p53 in response to ribosomal stress, is dependent on the pathway PIM1-AKT-MDM2. In addition, we report evidence that PIM1 level may be relevant to assess the sensitivity of cancer cells to chemotherapeutic drugs that induce ribosomal stress. PMID:26993775

  12. Distinct functions of elongation factor G in ribosome recycling and translocation

    PubMed Central

    Savelsbergh, Andreas; Rodnina, Marina V.; Wintermeyer, Wolfgang

    2009-01-01

    Elongation factor G (EF-G) promotes the translocation step in bacterial protein synthesis and, together with ribosome recycling factor (RRF), the disassembly of the post-termination ribosome. Unlike translocation, ribosome disassembly strictly requires GTP hydrolysis by EF-G. Here we report that ribosome disassembly is strongly inhibited by vanadate, an analog of inorganic phosphate (Pi), indicating that Pi release is required for ribosome disassembly. In contrast, the function of EF-G in single-round translocation is not affected by vanadate, while the turnover reaction is strongly inhibited. We also show that the antibiotic fusidic acid blocks ribosome disassembly by EF-G/RRF at a 1000-fold lower concentration than required for the inhibition of EF-G turnover in vitro and close to the effective inhibitory concentration in vivo, suggesting that the antimicrobial activity of fusidic acid is primarily due to the direct inhibition of ribosome recycling. Our results indicate that conformational coupling between EF-G and the ribosome is principally different in translocation and ribosome disassembly. Pi release is not required for the mechanochemical function of EF-G in translocation, whereas the interactions between RRF and EF-G introduce tight coupling between the conformational change of EF-G induced by Pi release and ribosome disassembly. PMID:19324963

  13. Assembly and nuclear export of pre-ribosomal particles in budding yeast.

    PubMed

    Gerhardy, Stefan; Menet, Anna Maria; Peña, Cohue; Petkowski, Janusz Jurand; Panse, Vikram Govind

    2014-08-01

    The ribosome is responsible for the final step of decoding genetic information into proteins. Therefore, correct assembly of ribosomes is a fundamental task for all living cells. In eukaryotes, the construction of the ribosome which begins in the nucleolus requires coordinated efforts of >350 specialized factors that associate with pre-ribosomal particles at distinct stages to perform specific assembly steps. On their way through the nucleus, diverse energy-consuming enzymes are thought to release assembly factors from maturing pre-ribosomal particles after accomplishing their task(s). Subsequently, recruitment of export factors prepares pre-ribosomal particles for transport through nuclear pore complexes. Pre-ribosomes are exported into the cytoplasm in a functionally inactive state, where they undergo final maturation before initiating translation. Accumulating evidence indicates a tight coupling between nuclear export, cytoplasmic maturation, and final proofreading of the ribosome. In this review, we summarize our current understanding of nuclear export of pre-ribosomal subunits and cytoplasmic maturation steps that render pre-ribosomal subunits translation-competent. PMID:24817020

  14. Ribosomal proteins produced in excess are degraded by the ubiquitin-proteasome system.

    PubMed

    Sung, Min-Kyung; Reitsma, Justin M; Sweredoski, Michael J; Hess, Sonja; Deshaies, Raymond J

    2016-09-01

    Ribosome assembly is an essential process that consumes prodigious quantities of cellular resources. Ribosomal proteins cannot be overproduced in Saccharomyces cerevisiae because the excess proteins are rapidly degraded. However, the responsible quality control (QC) mechanisms remain poorly characterized. Here we demonstrate that overexpression of multiple proteins of the small and large yeast ribosomal subunits is suppressed. Rpl26 overexpressed from a plasmid can be detected in the nucleolus and nucleoplasm, but it largely fails to assemble into ribosomes and is rapidly degraded. However, if the endogenous RPL26 loci are deleted, plasmid-encoded Rpl26 assembles into ribosomes and localizes to the cytosol. Chemical and genetic perturbation studies indicate that overexpressed ribosomal proteins are degraded by the ubiquitin-proteasome system and not by autophagy. Inhibition of the proteasome led to accumulation of multiple endogenous ribosomal proteins in insoluble aggregates, consistent with the operation of this QC mechanism in the absence of ribosomal protein overexpression. Our studies reveal that ribosomal proteins that fail to assemble into ribosomes are rapidly distinguished from their assembled counterparts and ubiquitinated and degraded within the nuclear compartment. PMID:27385339

  15. Nucleocytoplasmic transport of ribosomes in a eukaryotic system: Is there a facilitated transport process

    SciTech Connect

    Khanna-Gupta, A.; Ware, V.C. )

    1989-03-01

    The authors have examined the kinetics of the process by which ribosomes are exported from the nucleus to the cytoplasm using Xenopus laevis oocytes microinjected into the germinal vesicle with radiolabeled ribosomes or ribosomal subunits from X. laevis, Tetrahymena thermophila, or Escherichia coli. Microinjected eukaryotic mature ribosomes are redistributed into the oocyte cytoplasm by an apparent carrier-mediated transport process that exhibits saturation kinetics as increasing amounts of ribosomes are injected. T. thermophila ribosomes are competent to traverse the Xenopus nuclear envelope, suggesting that the basic mechanism underlying ribosome transport is evolutionarily conserved. Microinjected E. coli ribosomes are not transported in this system, indicating that prokaryotic ribosomes lack the signals required for transport. Surprisingly, coinjected small (40S) and large (60S) subunits from T. thermophila are transported significantly faster than individual subunits. These observations support a facilitated transport model for the translocation of ribosomal subunits as separate units across the nuclear envelope whereby the transport rate of 60S or 40S subunits is enhanced by the presence of the partner subunit. Although the basic features of the transport mechanism have been preserved through evolution, other aspects of the process may be mediated through species-specific interactions. They hypothesize that a species-specific nuclear 40S-60S subunit association may expedite the transport of individual subunits across the nuclear envelope.

  16. Preparation of ribosomes for smFRET studies: A simplified approach.

    PubMed

    Shebl, Bassem; Menke, Drew E; Pennella, Min; Poudyal, Raghav R; Burke, Donald H; Cornish, Peter V

    2016-08-01

    During the past decade, single-molecule studies of the ribosome have significantly advanced our understanding of protein synthesis. The broadest application of these methods has been towards the investigation of ribosome conformational dynamics using single-molecule Förster resonance energy transfer (smFRET). The recent advances in fluorescently labeled ribosomes and translation components have resulted in success of smFRET experiments. Various methods have been employed to target fluorescent dyes to specific locations within the ribosome. Primarily, these methods have involved additional steps including subunit dissociation and/or full reconstitution, which could result in ribosomes of reduced activity and translation efficiency. In addition, substantial time and effort are required to produce limited quantities of material. To enable rapid and large-scale production of highly active, fluorescently labeled ribosomes, we have developed a procedure that combines partial reconstitution with His-tag purification. This allows for a homogeneous single-step purification of mutant ribosomes and subsequent integration of labeled proteins. Ribosomes produced with this method are shown to be as active as ribosomes purified using classical methods. While we have focused on two labeling sites in this report, the method is generalizable and can in principle be extended to any non-essential ribosomal protein. PMID:27208427

  17. Disruption of ribosome assembly in yeast blocks cotranscriptional pre-rRNA processing and affects the global hierarchy of ribosome biogenesis.

    PubMed

    Talkish, Jason; Biedka, Stephanie; Jakovljevic, Jelena; Zhang, Jingyu; Tang, Lan; Strahler, John R; Andrews, Philip C; Maddock, Janine R; Woolford, John L

    2016-06-01

    In higher eukaryotes, pre-rRNA processing occurs almost exclusively post-transcriptionally. This is not the case in rapidly dividing yeast, as the majority of nascent pre-rRNAs are processed cotranscriptionally, with cleavage at the A2 site first releasing a pre-40S ribosomal subunit followed by release of a pre-60S ribosomal subunit upon transcription termination. Ribosome assembly is driven in part by hierarchical association of assembly factors and r-proteins. Groups of proteins are thought to associate with pre-ribosomes cotranscriptionally during early assembly steps, whereas others associate later, after transcription is completed. Here we describe a previously uncharacterized phenotype observed upon disruption of ribosome assembly, in which normally late-binding proteins associate earlier, with pre-ribosomes containing 35S pre-rRNA. As previously observed by many other groups, we show that disruption of 60S subunit biogenesis results in increased amounts of 35S pre-rRNA, suggesting that a greater fraction of pre-rRNAs are processed post-transcriptionally. Surprisingly, we found that early pre-ribosomes containing 35S pre-rRNA also contain proteins previously thought to only associate with pre-ribosomes after early pre-rRNA processing steps have separated maturation of the two subunits. We believe the shift to post-transcriptional processing is ultimately due to decreased cellular division upon disruption of ribosome assembly. When cells are grown under stress or to high density, a greater fraction of pre-rRNAs are processed post-transcriptionally and follow an alternative processing pathway. Together, these results affirm the principle that ribosome assembly occurs through different, parallel assembly pathways and suggest that there is a kinetic foot-race between the formation of protein binding sites and pre-rRNA processing events. PMID:27036125

  18. The ribosomal RNA transcription unit of Entamoeba invadens: accumulation of unprocessed pre-rRNA and a long non coding RNA during encystation.

    PubMed

    Ojha, Sandeep; Singh, Nishant; Bhattacharya, Alok; Bhattacharya, Sudha

    2013-01-01

    The ribosomal RNA genes in Entamoeba spp. are located on extrachromosomal circular molecules. Unlike model organisms where rRNA transcription stops during growth stress, Entamoeba histolytica continues transcription; but unprocessed pre-rRNA accumulates during stress, along with a novel class of circular transcripts from the 5'-external transcribed spacer (ETS). To determine the fate of rRNA transcription during stage conversion between trophozoite to cyst we analyzed Entamoeba invadens, a model system for differentiation studies in Entamoeba. We characterized the complete rDNA transcription unit by mapping the ends of pre-rRNA and mature rRNAs. The 3' end of mature 28S rRNA was located 321 nt downstream of the end predicted by sequence homology with E. histolytica. The major processing sites were mapped in external and internal transcribed spacers. The promoter located within 146 nt upstream of 5' ETS was used to transcribe the pre-rRNA. On the other hand, a second promoter located at the 3' end of 28S rDNA was used to transcribe almost the entire intergenic spacer into a long non coding (nc) RNA (>10 kb). Interestingly we found that the levels of pre-rRNA and long ncRNA, measured by northern hybridization, decreased initially in cells shifted to encystation medium, after which they began to increase and reached high levels by 72 h when mature cysts were formed. Unlike E. histolytica, no circular transcripts were found in E. invadens. E. histolytica and E. invadens express fundamentally different ncRNAs from the rDNA locus, which may reflect their adaptation to different hosts (human and reptiles, respectively). This is the first description of rDNA organization and transcription in E. invadens, and provides the framework for further studies on regulation of rRNA synthesis during cyst formation. PMID:24200639

  19. Characterization of recombinant bacteriophages containing mosquito ribosomal RNA genes

    SciTech Connect

    Park, Y.J.

    1988-01-01

    A family of nine recombinant bacteriophages containing rRNA genes from cultured cells of the mosquito, Aedes albopictus, has been isolated by screening two different genomic DNA libraries - Charon 30 and EMBL 3 using {sup 32}P-labeled 18S and 28S rRNA as probes. These nine recombinant bacteriophages were characterized by restriction mapping, Southern blotting, and S1 nuclease analysis. The 18S rRNA coding region contains an evolutionarily conserved EcoRI site near the 3{prime}-end, and measures 1800 bp. The 28S rRNA genes were divided into {alpha} and {beta} coding regions measuring 1750 bp and 2000 bp, respectively. The gap between these two regions measures about 340 bp. No insertion sequences were found in the rRNA coding regions. The entire rDNA repeat unit had a minimum length of 15.6 kb, including a nontranscribed spacer region. The non-transcribed spacer region of cloned A. albopictus rDNA contained a common series of seven PvuI sites within a 1250 bp region upstream of the 18S rRNA coding region, and a proportion of this region also showed heterogeneity both in the length and in the restriction sites.

  20. HCV IRES manipulates the ribosome to promote the switch from translation initiation to elongation

    PubMed Central

    Filbin, Megan E.; Vollmar, Breanna S.; Shi, Dan; Gonen, Tamir; Kieft, Jeffrey S.

    2012-01-01

    The hepatitis C virus (HCV) internal ribosome entry site (IRES) drives non-canonical initiation of protein synthesis necessary for viral replication. HCV IRES functional studies have focused on 80S ribosome formation, but have not explored roles after the 80S ribosome is poised at the start codon. Here, we report that mutations of an IRES domain that docks in the 40S subunit’s decoding groove and cause only a local perturbation in IRES structure result in conformational changes in the IRES-rabbit 40S subunit complex. Functionally, we find the mutation decreases IRES activity by inhibiting the first ribosome translocation event, and modeling suggests that this effect is through an interaction with a single ribosomal protein. The HCV IRES’ ability to manipulate the ribosome provides insight into how the ribosome’s structure and function can be altered by bound RNAs, including those derived from cellular invaders. PMID:23262488

  1. The fail-safe system to rescue the stalled ribosomes in Escherichia coli

    PubMed Central

    Abo, Tatsuhiko; Chadani, Yuhei

    2014-01-01

    Translation terminates at stop codon. Without stop codon, ribosome cannot terminate translation properly and reaches and stalls at the 3′-end of the mRNA lacking stop codon. Bacterial tmRNA-mediated trans-translation releases such stalled ribosome and targets the protein product to degradation by adding specific “degradation tag.” Recently two alternative ribosome rescue factors, ArfA (YhdL) and ArfB (YaeJ), have been found in Escherichia coli. These three ribosome rescue systems are different each other in terms of molecular mechanism of ribosome rescue and their activity, but they are mutually related and co-operate to maintain the translation system in shape. This suggests the biological significance of ribosome rescue. PMID:24782844

  2. A structural view on the mechanism of the ribosome-catalyzed peptide bond formation

    PubMed Central

    Simonović, Miljan; Steitz, Thomas A.

    2009-01-01

    The ribosome is a large ribonucleoprotein particle that translates zgenetic information encoded in mRNA into specific proteins. Its highly conserved active site, the peptidyl-transferase center (PTC), is located on the large (50S) ribosomal subunit and is comprised solely of rRNA, which makes the ribosome the only natural ribozyme with polymerase activity. The last decade witnessed a rapid accumulation of atomic-resolution structural data on both ribosomal subunits as well as on the entire ribosome. This has allowed studies on the mechanism of peptide bond formation at a level of detail that surpasses that for the classical protein enzymes. A current understanding of the mechanism of the ribosome-catalyzed peptide bond formation is the focus of this review. Implications on the mechanism of peptide release are discussed as well. PMID:19595805

  3. Senescent changes in the ribosomes of animal cells in vivo and in vitro

    NASA Technical Reports Server (NTRS)

    Miquel, J.; Johnson, J. E., Jr.

    1979-01-01

    The paper examines RNA-ribosomal changes observed in protozoa and fixed postmitotic cells, as well as the characteristics of intermitotic cells. Attention is given to a discussion of the implications of the reported ribosomal changes as to the senescent deterioration of protein synthesis and physiological functions. A survey of the literature suggests that, while the data on ribosomal change in dividing cells both in vivo and in vitro are inconclusive, there is strong histological and biochemical evidence in favor of some degree of quantitative ribosomal loss in fixed postmitotic cells. Since these decreases in ribosomes are demonstrated in differential cells from nematodes, insects and mammals, they may represent a universal manifestation of cytoplasmic senescence in certain types of fixed postmitotic animal cells. The observed variability in ribosomal loss for cells belonging to the same type suggests that this involution phenomenon is rather related to the wear and tear suffered by a particular cell.

  4. Structures of the Bacterial Ribosome in Classical and Hybrid States of tRNA Binding

    SciTech Connect

    Dunkle, Jack A.; Wang, Leyi; Feldman, Michael B.; Pulk, Arto; Chen, Vincent B.; Kapral, Gary J.; Noeske, Jonas; Richardson, Jane S.; Blanchard, Scott C.; Cate, Jamie H. Doudna

    2011-09-06

    During protein synthesis, the ribosome controls the movement of tRNA and mRNA by means of large-scale structural rearrangements. We describe structures of the intact bacterial ribosome from Escherichia coli that reveal how the ribosome binds tRNA in two functionally distinct states, determined to a resolution of {approx}3.2 angstroms by means of x-ray crystallography. One state positions tRNA in the peptidyl-tRNA binding site. The second, a fully rotated state, is stabilized by ribosome recycling factor and binds tRNA in a highly bent conformation in a hybrid peptidyl/exit site. The structures help to explain how the ratchet-like motion of the two ribosomal subunits contributes to the mechanisms of translocation, termination, and ribosome recycling.

  5. Regulation of the mammalian elongation cycle by subunit rolling: a eukaryotic-specific ribosome rearrangement.

    PubMed

    Budkevich, Tatyana V; Giesebrecht, Jan; Behrmann, Elmar; Loerke, Justus; Ramrath, David J F; Mielke, Thorsten; Ismer, Jochen; Hildebrand, Peter W; Tung, Chang-Shung; Nierhaus, Knud H; Sanbonmatsu, Karissa Y; Spahn, Christian M T

    2014-07-01

    The extent to which bacterial ribosomes and the significantly larger eukaryotic ribosomes share the same mechanisms of ribosomal elongation is unknown. Here, we present subnanometer resolution cryoelectron microscopy maps of the mammalian 80S ribosome in the posttranslocational state and in complex with the eukaryotic eEF1A⋅Val-tRNA⋅GMPPNP ternary complex, revealing significant differences in the elongation mechanism between bacteria and mammals. Surprisingly, and in contrast to bacterial ribosomes, a rotation of the small subunit around its long axis and orthogonal to the well-known intersubunit rotation distinguishes the posttranslocational state from the classical pretranslocational state ribosome. We term this motion "subunit rolling." Correspondingly, a mammalian decoding complex visualized in substates before and after codon recognition reveals structural distinctions from the bacterial system. These findings suggest how codon recognition leads to GTPase activation in the mammalian system and demonstrate that in mammalia subunit rolling occurs during tRNA selection. PMID:24995983

  6. All-atom homology model of the Escherichia coli 30S ribosomal subunit.

    PubMed

    Tung, Chang-Shung; Joseph, Simpson; Sanbonmatsu, Kevin Y

    2002-10-01

    Understanding the structural basis of ribosomal function requires close comparison between biochemical and structural data. Although a large amount of biochemical data are available for the Escherichia coli ribosome, the structure has not been solved to atomic resolution. Using a new RNA homology procedure, we have modeled the all-atom structure of the E. coli 30S ribosomal subunit. We find that the tertiary structure of the ribosome core, including the A-, P- and E-sites, is highly conserved. The hypervariable regions in our structure, which differ from the structure of the 30S ribosomal subunit from Thermus thermophilus, are consistent with the cryo-EM map of the E. coli ribosome. PMID:12244297

  7. Genome-wide polysomal analysis of a yeast strain with mutated ribosomal protein S9

    PubMed Central

    Pnueli, Lilach; Arava, Yoav

    2007-01-01

    Background The yeast ribosomal protein S9 (S9) is located at the entrance tunnel of the mRNA into the ribosome. It is known to play a role in accurate decoding and its bacterial homolog (S4) has recently been shown to be involved in opening RNA duplexes. Here we examined the effects of changing the C terminus of S9, which is rich in acidic amino acids and extends out of the ribosome surface. Results We performed a genome-wide analysis to reveal effects at the transcription and translation levels of all yeast genes. While negligible relative changes were observed in steady-state mRNA levels, a significant number of mRNAs appeared to have altered ribosomal density. Notably, 40% of the genes having reliable signals changed their ribosomal association by more than one ribosome. Yet, no general correlations with physical or functional features of the mRNA were observed. Ribosome Density Mapping (RDM) along four of the mRNAs with increased association revealed an increase in ribosomal density towards the end of the coding region for at least two of them. Read-through analysis did not reveal any increase in read-through of a premature stop codon by the mutant strain. Conclusion The ribosomal protein rpS9 appears to be involved in the translation of many mRNAs, since altering its C terminus led to a significant change in ribosomal association of many mRNAs. We did not find strong correlations between these changes and several physical features of the mRNA, yet future studies with advanced tools may allow such correlations to be determined. Importantly, our results indicate an accumulation of ribosomes towards the end of the coding regions of some mRNAs. This suggests an involvement of S9 in ribosomal dissociation during translation termination. PMID:17711575

  8. LOCAL TRANSLATION. Comment on "Principles of ER cotranslational translocation revealed by proximity-specific ribosome profiling".

    PubMed

    Reid, David W; Nicchitta, Christopher V

    2015-06-12

    Jan et al. (Research Articles, 7 November 2014, p. 716) propose that ribosomes translating secretome messenger RNAs (mRNAs) traffic from the cytosol to the endoplasmic reticulum (ER) upon emergence of the signal peptide and return to the cytosol after termination. An accounting of controls demonstrates that mRNAs initiate translation on ER-bound ribosomes and that ribosomes are retained on the ER through many cycles of translation. PMID:26068841

  9. Reverse taxonomy: an approach towards determining the diversity of meiobenthic organisms based on ribosomal RNA signature sequences

    PubMed Central

    Markmann, Melanie; Tautz, Diethard

    2005-01-01

    Organisms living in or on the sediment layer of water bodies constitute the benthos fauna, which is known to harbour a large number of species of diverse taxonomic groups. The benthos plays a significant role in the nutrient cycle and it is, therefore, of high ecological relevance. Here, we have explored a DNA-taxonomic approach to access the meiobenthic organismic diversity, by focusing on obtaining signature sequences from a part of the large ribosomal subunit rRNA (28S), the D3–D5 region. To obtain a broad representation of taxa, benthos samples were taken from 12 lakes in Germany, representing different ecological conditions. In a first approach, we have extracted whole DNA from these samples, amplified the respective fragment by PCR, cloned the fragments and sequenced individual clones. However, we found a relatively large number of recombinant clones that must be considered PCR artefacts. In a second approach we have, therefore, directly sequenced PCR fragments that were obtained from DNA extracts of randomly picked individual organisms. In total, we have obtained 264 new unique sequences, which can be readily placed into taxon groups, based on phylogenetic comparison with currently available database sequences. The group with the highest taxon abundance were nematodes and protozoa, followed by chironomids. However, we find also that we have by far not exhausted the diversity of organisms in the samples. Still, our data provide a framework within which a meiobenthos DNA signature sequence database can be constructed, that will allow to develop the necessary techniques for studying taxon diversity in the context of ecological analysis. Since many taxa in our analysis are initially only identified via their signature sequences, but not yet their morphology, we propose to call this approach ‘reverse taxonomy’. PMID:16214749

  10. Reduced expression of the mouse ribosomal protein Rpl17 alters the diversity of mature ribosomes by enhancing production of shortened 5.8S rRNA

    PubMed Central

    Wang, Minshi; Parshin, Andrey V.; Shcherbik, Natalia; Pestov, Dimitri G.

    2015-01-01

    Processing of rRNA during ribosome assembly can proceed through alternative pathways but it is unclear whether this could affect the structure of the ribosome. Here, we demonstrate that shortage of a ribosomal protein can change pre-rRNA processing in a way that over time alters ribosome diversity in the cell. Reducing the amount of Rpl17 in mouse cells led to stalled 60S subunit maturation, causing degradation of most of the synthesized precursors. A fraction of pre-60S subunits, however, were able to complete maturation, but with a 5′-truncated 5.8S rRNA, which we named 5.8SC. The 5′ exoribonuclease Xrn2 is involved in the generation of both 5.8SC and the canonical long form of 5.8S rRNA. Ribosomes containing 5.8SC rRNA are present in various mouse and human cells and engage in translation. These findings uncover a previously undescribed form of mammalian 5.8S rRNA and demonstrate that perturbations in ribosome assembly can be a source of heterogeneity in mature ribosomes. PMID:25995445

  11. Ribosome biogenesis: emerging evidence for a central role in the regulation of skeletal muscle mass†

    PubMed Central

    Chaillou, Thomas; Kirby, Tyler J.; McCarthy, John J.

    2016-01-01

    The ribosome is a supramolecular ribonucleoprotein complex that functions at the heart of the translation machinery to convert mRNA into protein. Ribosome biogenesis is the primary determinant of translational capacity of the cell and accordingly has an essential role in the control of cell growth in eukaryotes. Cumulative evidence supports the hypothesis that ribosome biogenesis has an important role in the regulation of skeletal muscle mass. The purpose of this review is to, first, summarize the main mechanisms known to regulate ribosome biogenesis and, second, put forth the hypothesis that ribosome biogenesis is a central mechanism used by skeletal muscle to regulate protein synthesis and control skeletal muscle mass in response to anabolic and catabolic stimuli. The mTORC1 and Wnt/β-catenin/c-myc signaling pathways are discussed as the major pathways that work in concert with each of the three RNA polymerases (RNA Pol I, II and III) in regulating ribosome biogenesis. Consistent with our hypothesis, activation of these two pathways has been shown to be associated with ribosome biogenesis during skeletal muscle hypertrophy. Although further study is required, the finding that ribosome biogenesis is altered under catabolic states, in particular during disuse atrophy, suggests that its activation represents a novel therapeutic target to reduce or prevent muscle atrophy. Lastly, the emerging field of ribosome specialization is discussed and its potential role in the regulation of gene expression during periods of skeletal muscle plasticity. PMID:24604615

  12. Direct and high throughput (HT) interactions on the ribosomal surface by iRIA

    PubMed Central

    Pesce, Elisa; Minici, Claudia; Baβler, Jochen; Hurt, Ed; Degano, Massimo; Calamita, Piera; Biffo, Stefano

    2015-01-01

    Ribosomes function as platforms for binding of other molecules, but technologies for studying this process are lacking. Therefore we developed iRIA (in vitro Ribosomes Interaction Assay). In approach I, Artemia salina ribosomes spotted on solid phase are used for binding picomoles of analytes; in approach II, cellular extracts allow the measurement of ribosome activity in different conditions. We apply the method to analyze several features of eIF6 binding to 60S subunits. By approach I, we show that the off-rate of eIF6 from preribosomes is slower than from mature ribosomes and that its binding to mature 60S occurs in the nM affinity range. By approach II we show that eIF6 binding sites on 60S are increased with mild eIF6 depletion and decreased in cells that are devoid of SBDS, a ribosomal factor necessary for 60S maturation and involved in Swachman Diamond syndrome. We show binding conditions to immobilized ribosomes adaptable to HT and quantify free ribosomes in cell extracts. In conclusion, we suggest that iRIA will greatly facilitate the study of interactions on the ribosomal surface. PMID:26486184

  13. Expression of ribosomal genes in pea cotyledons at the initial stages of germination

    SciTech Connect

    Gumilevskaya, N.A.; Chumikhina, L.V.; Akhmatova, A.T.; Kretovich, V.L.

    1986-01-20

    The time of appearance of newly synthesized rRNAs and ribosomal proteins (r-proteins) in the ribosomes of pea cotyledons (Pisum sativum L.) during germination was investigated. The ribosomal fraction was isolated and analyzed according to the method of germination of the embryo in the presence of labeled precursors or after pulse labeling of the embryos at different stages of germination. For the identification of newly synthesized rRNAs in the ribosomes we estimated the relative stability of labeled RNAs to the action of RNase, the sedimentation rate, the ability to be methylated in vivo in the presence of (/sup 14/C)CH/sub 3/-methionine, and the localization in the subunits of dissociated ribosomes. The presence of newly synthesized r-proteins in the ribosomes was judged on the basis of the electrophoretic similarity in SDS-disc electrophoresis of labeled polypeptides of purified ribosome preparations and of genuine r-proteins, as well as according to the localization of labeled proteins in the subunits of the dissociated ribosomes. It was shown that the expression of the ribosomal genes in highly specialized cells of pea cotyledons that have completed their growth occurs at very early stages of germination.

  14. Ribosomes: Ribozymes that Survived Evolution Pressures but Is Paralyzed by Tiny Antibiotics

    NASA Astrophysics Data System (ADS)

    Yonath, Ada

    An impressive number of crystal structures of ribosomes, the universal cellular machines that translate the genetic code into proteins, emerged during the last decade. The determination of ribosome high resolution structure, which was widely considered formidable, led to novel insights into the ribosomal function, namely, fidelity, catalytic mechanism, and polymerize activities. They also led to suggestions concerning its origin and shed light on the action, selectivity and synergism of ribosomal antibiotics; illuminated mechanisms acquiring bacterial resistance and provided structural information for drug improvement and design. These studies required the pioneering and implementation of advanced technologies, which directly influenced the remarkable increase of the number of structures deposited in the Protein Data Bank.

  15. Modeling of ribosome dynamics on a ds-mRNA under an external load

    NASA Astrophysics Data System (ADS)

    Shakiba, Bahareh; Dayeri, Maryam; Mohammad-Rafiee, Farshid

    2016-07-01

    Protein molecules in cells are synthesized by macromolecular machines called ribosomes. According to the recent experimental data, we reduce the complexity of the ribosome and propose a model to express its activity in six main states. Using our model, we study the translation rate in different biological relevant situations in the presence of external force and the translation through the RNA double stranded region in the absence or presence of the external force. In the present study, we give a quantitative theory for translation rate and show that the ribosome behaves more like a Brownian Ratchet motor. Our findings could shed some light on understanding behaviors of the ribosome in biological conditions.

  16. Effects of ribosome-inactivating proteins on Escherichia coli and Agrobacterium tumefaciens translation systems.

    PubMed Central

    Girbés, T; Barbieri, L; Ferreras, M; Arias, F J; Rojo, M A; Iglesias, R; Alegre, C; Escarmis, C; Stirpe, F

    1993-01-01

    The effects of 30 type 1 and of 2 (ricin and volkensin) type 2 ribosome-inactivating proteins (RIPs) on Escherichia coli and Agrobacterium tumefaciens cell-free translation systems were compared with the effects on a rabbit reticulocyte translation system. The depurinating activity of RIPs on E. coli ribosomes was also evaluated. Only six type 1 RIPs inhibited endogenous mRNA-directed translational activity of E. coli lysates, with submicromolar 50% inhibitory concentrations. Four RIPs had similar activities on poly(U)-directed phenylalanine polymerization by E. coli ribosomes, and three RIPs inhibited poly(U)-directed polyphenylalanine synthesis by A. tumefaciens ribosomes, with submicromolar 50% inhibitory concentrations. Images PMID:8407849

  17. Atomic model of the Thermus thermophilus 70S ribosome developed in silico.

    PubMed

    Tung, Chang-Shung; Sanbonmatsu, Kevin Y

    2004-10-01

    The ribosome is a large molecular complex that consists of at least three ribonucleic acid molecules and a large number of proteins. It translates genetic information from messenger ribonucleic acid and makes protein accordingly. To better understand ribosomal function and provide information for designing biochemical experiments require knowledge of the complete structure of the ribosome. For expanding the structural information of the ribosome, we took on the challenge of developing a detailed Thermus thermophilus ribosomal structure computationally. By combining information derived from the low-resolution x-ray structure of the 70S ribosome (providing the overall fold), high-resolution structures of the ribosomal subunits (providing the local structure), sequences, and secondary structures, we have developed an atomic model of the T. thermophilus ribosome using a homology modeling approach. Our model is stereochemically sound with a consistent single-species sequence. The overall folds of the three ribosomal ribonucleic acids in our model are consistent with those in the low-resolution crystal structure (root mean-square differences are all <1.9 angstroms). The large overall interface area (approximately 2500 angstroms2) of intersubunit bridges B2a, B3, and B5, and the inherent flexibility in regions connecting the contact residues are consistent with these bridges serving as anchoring patches for the ratcheting and rolling motions between the two subunits during translocation. PMID:15454463

  18. A vestige of a prebiotic bonding machine is functioning within the contemporary ribosome.

    PubMed

    Krupkin, Miri; Matzov, Donna; Tang, Hua; Metz, Markus; Kalaora, Rinat; Belousoff, Matthew J; Zimmerman, Ella; Bashan, Anat; Yonath, Ada

    2011-10-27

    Based on the presumed capability of a prebiotic pocket-like entity to accommodate substrates whose stereochemistry enables the creation of chemical bonds, it is suggested that a universal symmetrical region identified within all contemporary ribosomes originated from an entity that we term the 'proto-ribosome'. This 'proto-ribosome' could have evolved from an earlier machine that was capable of performing essential tasks in the RNA world, called here the 'pre-proto-ribosome', which was adapted for producing proteins. PMID:21930590

  19. A fluorescence-based screen for ribosome binding antibiotics

    PubMed Central

    Watkins, Derrick; Norris, F.A.; Kumar, Sunil; Arya, Dev P.

    2014-01-01

    The development of new antibacterial agents has become necessary to treat the large number of emerging bacterial strains resistant to current antibiotics. Despite the different methods of resistance developed by these new strains, the A-site of the bacterial ribosome remains an attractive target for new antibiotics. To develop new drugs that target the ribosomal A-site, a high-throughput screen is necessary to identify compounds that bind to the target with high affinity. To this end, we present an assay that uses a novel fluorescein-conjugated neomycin (F-neo) molecule as a binding probe to determine the relative binding affinity of a drug library. We show here that the binding of F-neo to a model Escherichia coli ribosomal A-site results in a large decrease in the fluorescence of the molecule. Furthermore, we have determined that the change in fluorescence is due to the relative change in the pKa of the probe resulting from the change in the electrostatic environment that occurs when the probe is taken from the solvent and localized into the negative potential of the A-site major groove. Finally, we demonstrate that F-neo can be used in a robust, highly reproducible assay, determined by a Z′-factor greater than 0.80 for 3 consecutive days. The assay is capable of rapidly determining the relative binding affinity of a compound library in a 96-well plate format using a single channel electronic pipette. The current assay format will be easily adaptable to a high-throughput format with the use of a liquid handling robot for large drug libraries currently available and under development. PMID:23262284

  20. Analysis of interactions between ribosomal proteins and RNA structural motifs

    PubMed Central

    2010-01-01

    Background One important goal of structural bioinformatics is to recognize and predict the interactions between protein binding sites and RNA. Recently, a comprehensive analysis of ribosomal proteins and their interactions with rRNA has been done. Interesting results emerged from the comparison of r-proteins within the small subunit in T. thermophilus and E. coli, supporting the idea of a core made by both RNA and proteins, conserved by evolution. Recent work showed also that ribosomal RNA is modularly composed. Motifs are generally single-stranded sequences of consecutive nucleotides (ssRNA) with characteristic folding. The role of these motifs in protein-RNA interactions has been so far only sparsely investigated. Results This work explores the role of RNA structural motifs in the interaction of proteins with ribosomal RNA (rRNA). We analyze composition, local geometries and conformation of interface regions involving motifs such as tetraloops, kink turns and single extruded nucleotides. We construct an interaction map of protein binding sites that allows us to identify the common types of shared 3-D physicochemical binding patterns for tetraloops. Furthermore, we investigate the protein binding pockets that accommodate single extruded nucleotides either involved in kink-turns or in arbitrary RNA strands. This analysis reveals a new structural motif, called tripod. It corresponds to small pockets consisting of three aminoacids arranged at the vertices of an almost equilateral triangle. We developed a search procedure for the recognition of tripods, based on an empirical tripod fingerprint. Conclusion A comparative analysis with the overall RNA surface and interfaces shows that contact surfaces involving RNA motifs have distinctive features that may be useful for the recognition and prediction of interactions. PMID:20122215

  1. Transactivation of programmed ribosomal frameshifting by a viral protein.

    PubMed

    Li, Yanhua; Treffers, Emmely E; Napthine, Sawsan; Tas, Ali; Zhu, Longchao; Sun, Zhi; Bell, Susanne; Mark, Brian L; van Veelen, Peter A; van Hemert, Martijn J; Firth, Andrew E; Brierley, Ian; Snijder, Eric J; Fang, Ying

    2014-05-27

    Programmed -1 ribosomal frameshifting (-1 PRF) is a widely used translational mechanism facilitating the expression of two polypeptides from a single mRNA. Commonly, the ribosome interacts with an mRNA secondary structure that promotes -1 frameshifting on a homopolymeric slippery sequence. Recently, we described an unusual -2 frameshifting (-2 PRF) signal directing efficient expression of a transframe protein [nonstructural protein 2TF (nsp2TF)] of porcine reproductive and respiratory syndrome virus (PRRSV) from an alternative reading frame overlapping the viral replicase gene. Unusually, this arterivirus PRF signal lacks an obvious stimulatory RNA secondary structure, but as confirmed here, can also direct the occurrence of -1 PRF, yielding a third, truncated nsp2 variant named "nsp2N." Remarkably, we now show that both -2 and -1 PRF are transactivated by a protein factor, specifically a PRRSV replicase subunit (nsp1β). Embedded in nsp1β's papain-like autoproteinase domain, we identified a highly conserved, putative RNA-binding motif that is critical for PRF transactivation. The minimal RNA sequence required for PRF was mapped within a 34-nt region that includes the slippery sequence and a downstream conserved CCCANCUCC motif. Interaction of nsp1β with the PRF signal was demonstrated in pull-down assays. These studies demonstrate for the first time, to our knowledge, that a protein can function as a transactivator of ribosomal frameshifting. The newly identified frameshifting determinants provide potential antiviral targets for arterivirus disease control and prevention. Moreover, protein-induced transactivation of frameshifting may be a widely used mechanism, potentially including previously undiscovered viral strategies to regulate viral gene expression and/or modulate host cell translation upon infection. PMID:24825891

  2. Molecular characterisation of three regions of the nuclear ribosomal DNA unit and the mitochondrial cox1 gene of Sarcocystis fusiformis from water buffaloes (Bubalus bubalis) in Egypt.

    PubMed

    Gjerde, Bjørn; Hilali, Mosaad; Mawgood, Sahar Abdel

    2015-09-01

    A total of 33 macroscopically visible (3-11 × 1-5 mm) sarcocysts of Sarcocystis fusiformis were excised from the oesophagus of 12 freshly slaughtered water buffalos in Giza, Egypt. Genomic DNA was extracted from the sarcocysts, and all isolates were characterised at the mitochondrial cytochrome c oxidase subunit I (cox1) gene through PCR amplification and direct sequencing, whereas a few selected isolates were characterised at the 18S and 28S ribosomal (r) RNA genes and the internal transcribed spacer 1 (ITS1) region of the nuclear rDNA unit following cloning. Among the 33 cox1 sequences (1,038-bp long), there was a total of 13 haplotypes, differing from each other by one to seven substitutions and sharing an identity of 99.3-99.9 %. In comparison, the sequence identity was 98.8-99.0 % among eight complete 18S rRNA gene sequences (1,873-1,879-bp long), 98.1-100 % among 28 complete ITS1 sequences (853-864-bp long) and 97.4-99.6 % among five partial 28S rRNA gene sequences (1,607-1,622 bp). At the three nuclear loci, the intraspecific (and intra-isolate) sequence variation was due to both substitutions and indels, which necessitated cloning of the PCR products before sequencing. Some additional clones of the 18S and 28S rRNA genes were highly divergent from the more typical clones, but the true nature of these aberrant clones could not be determined. Sequence comparisons and phylogenetic analyses based on either 18S rRNA gene or cox1 nucleotide sequences, placed S. fusiformis closest to Sarcocystis cafferi from the African buffalo, but only the analyses based on cox1 data separated the two taxa clearly from each other and showed that they were separate species (monophyletic clusters and 93 % sequence identity at cox1 versus interleaved sequences and 98.7-99.1 % sequence identity at the 18S rRNA gene). Two cats experimentally infected with sarcocysts of S. fusiformis started shedding small numbers of sporocysts 8-10 days post-infection (dpi) and were euthanized 15

  3. Phylogenetic relationships of Cryptosporidium determined by ribosomal RNA sequence comparison.

    PubMed

    Johnson, A M; Fielke, R; Lumb, R; Baverstock, P R

    1990-04-01

    Reverse transcription of total cellular RNA was used to obtain a partial sequence of the small subunit ribosomal RNA of Cryptosporidium, a protist currently placed in the phylum Apicomplexa. The semi-conserved regions were aligned with homologous sequences in a range of other eukaryotes, and the evolutionary relationships of Cryptosporidium were determined by two different methods of phylogenetic analysis. The prokaryotes Escherichia coli and Halobacterium cuti were included as outgroups. The results do not show an especially close relationship of Cryptosporidium to other members of the phylum Apicomplexa. PMID:2332273

  4. Structure of psoralen-crosslinked ribosomal RNA from Drosophila melanogaster.

    PubMed Central

    Wollenzien, P L; Youvan, D C; Hearst, J E

    1978-01-01

    Ribosomal RNA from Drosophila melanogaster photoreacted with hydroxymethyltrioxsalen has been examined by electron microscopy. Reproducible patterns of hairpins were found in both the 26S and 18S RNA. The frequency of these hairpins and the amount of incorporated drug were dependent upon the conditions under which the crosslinking was performed. A prominent central hairpin occurs in the 26S RNA and the break that interrupts the continuity of the RNA chain is located within it. In addition to several small hairpins, the crosslinked 18S RNA contains a large open loop. Images PMID:417342

  5. Database on the structure of small ribosomal subunit RNA.

    PubMed Central

    Van de Peer, Y; Jansen, J; De Rijk, P; De Wachter, R

    1997-01-01

    The Antwerp database on small ribosomal subunit RNA now offers more than 6000 nucleotide sequences (August 1996). All these sequences are stored in the form of an alignment based on the adopted secondary structure model, which is corroborated by the observation of compensating substitutions in the alignment. Besides the primary and secondary structure information, literature references, accession numbers and detailed taxonomic information are also compiled. For ease of use, the complete database is made available to the scientific community via World Wide Web at URL http://rrna.uia.ac.be/ssu/ . PMID:9016516

  6. Database on the structure of small ribosomal subunit RNA.

    PubMed Central

    Van de Peer, Y; Van den Broeck, I; De Rijk, P; De Wachter, R

    1994-01-01

    The database on small ribosomal subunit RNA structure contains (June 1994) 2824 nucleotide sequences. All these sequences are stored in the form of an alignment based on the adopted secondary structure model, which in turn is corroborated by the observation of compensating substitutions in the alignment. The complete database is made available to the scientific community through anonymous ftp on our server in Antwerp. A special effort was made to improve electronic retrieval and a program is supplied that allows to create different file formats. The database can also be obtained from the EMBL nucleotide sequence library. PMID:7524022

  7. Database on the structure of small ribosomal subunit RNA.

    PubMed Central

    Van de Peer, Y; Nicolaï, S; De Rijk, P; De Wachter, R

    1996-01-01

    The Antwerp database on small ribosomal subunit RNA offers over 4300 nucleotide sequences (August 1995). All these sequences are stored in the form of an alignment based on the adopted secondary structure model, which in turn is corroborated by the observation of compensating substitutions in the alignment. Besides the primary and secondary structure information, literature references, accession numbers and detailed taxonomic information are also compiled. The complete database is made available to the scientific community through anonymous ftp and World Wide Web(WWW). PMID:8594609

  8. Database on the structure of large ribosomal subunit RNA.

    PubMed Central

    De Rijk, P; Van de Peer, Y; De Wachter, R

    1997-01-01

    The latest release of the large ribosomal subunit RNA database contains 429 sequences. All these sequences are aligned, and incorporate secondary structure information. The rRNA WWW Server at URL http://rrna.uia.ac.be/ provides researchers with an easily accessible resource to obtain the data in this database in a number of computer-readable formats. A new query interface has been added to the server. If necessary, the data can also be obtained by anonymous ftp from the same site. PMID:9016517

  9. Proteins of rough microsomal membranes related to ribosome binding. II. Cross-linking of bound ribosomes to specific membrane proteins exposed at the binding sites

    PubMed Central

    1978-01-01

    Two proteins (ribophorins I and II), which are integral components of rough microsomal membranes and appear to be related to the bound ribosomes, were shown to be exposed on the surface of rat liver rough microsomes (RM) and to be in close proximity to the bound ribosomes. Both proteins were labeled when intact RM were incubated with a lactoperoxidase iodinating system, but only ribophorin I was digested during mild trypsinization of intact RM. Ribophorin II (63,000 daltons) was only proteolyzed when the luminal face of the microsomal vesicles was made accessible to trypsin by the addition of sublytical detergent concentrations. Only 30--40% of the bound ribosomes were released during trypsinization on intact RM, but ribosome release was almost complete in the presence of low detergent concentrations. Very low glutaraldehyde concentrations (0.005--0.02%) led to the preferential cross-linking of large ribosomal subunits of bound ribosomes to the microsomal membranes. This cross-linking prevented the release of subunits caused by puromycin in media of high ionic strength, but not the incorporation of [3H]puromycin into nascent polypeptide chains. SDS- acrylamide gel electrophoresis of cross-linked samples a preferential reduction in the intensity of the bands representing the ribophorins and the formation of aggregates which did not penetrate into the gels. At low methyl-4-mercaptobutyrimidate (MMB) concentrations (0.26 mg/ml) only 30% of the ribosomes were cross-linked to the microsomal membranes, as shown by the puromycin-KCl test, but membranes could still be solubilized with 1% DOC. This allowed the isolation of the ribophorins together with the sedimentable ribosomes, as was shown by electrophoresis of the sediments after disruption of the cross-links by reduction. Experiments with RM which contained only inactive ribosomes showed that the presence of nascent chains was not necessary for the reversible cross-linking of ribosomes to the membranes. These

  10. [Eukaryogenesis: a model derivated from ribosomal RNA molecular phylogenise].

    PubMed

    Perasso, R; Baroin-Tourancheau, A

    1992-01-01

    We have undertaken the construction of a broad molecular phylogeny of protists through the comparison of 28S rRNA molecules. The sequences from several major protistan phyla were aligned and combined with a broad database of metazoans, metaphytes, fungi and bacteria and we have derived dendrograms from both distance matrix and parsimony methods. In agreement with classical systematics, a number of monophyletic groups separated by large evolutionary distances were observed (those of the ciliates, the chlorophytes, etc.). From this analysis, several inferences on the eukaryogenesis can be made among which the ancient origin of the cytoskeleton, the late occurrence of the chloroplastic endosymbiosis and the simultaneous emergence of the triploblastic and diploblastic metazoan patterns. PMID:1339595

  11. Both the Exact Target Site Sequence and a Long Poly(A) Tail Are Required for Precise Insertion of the 18S Ribosomal DNA-Specific Non-Long Terminal Repeat Retrotransposon R7Ag.

    PubMed

    Nichuguti, Narisu; Hayase, Mayumi; Fujiwara, Haruhiko

    2016-05-15

    Ribosomal elements (R elements) are site-specific non-long terminal repeat (LTR) retrotransposons that target ribosomal DNA (rDNA). To elucidate how R elements specifically access their target sites, we isolated and characterized the 18S rDNA-specific R element R7Ag from Anopheles gambiae Using an in vivo and ex vivo recombinant baculovirus retrotransposition system, we found that the exact host 18S rDNA sequence at the target site is essential for the precise insertion of R7Ag. In addition, a long poly(A) tail is necessary for the accurate initiation of R7Ag reverse transcription, a novel mechanism found in non-LTR elements. We further compared the subcellular localizations of proteins in R7Ag as well as R1Bm, another R element that targets 28S rDNA. Although the open reading frame 1 proteins (ORF1ps) of both R7Ag and R1Bm localized predominantly in the cytoplasm, ORF2 proteins (ORF2ps) colocalized in the nucleus with the nucleolar marker fibrillarin. The ORF1ps and ORF2ps of both R elements colocalized largely in the nuclear periphery and to a lesser extent within the nucleus. These results suggest that R7Ag and R1Bm proteins may access nucleolar rDNA targets in an ORF2p-dependent manner. PMID:26976636

  12. Ribosomal protein S14 negatively regulates c-Myc activity.

    PubMed

    Zhou, Xiang; Hao, Qian; Liao, Jun-Ming; Liao, Peng; Lu, Hua

    2013-07-26

    The ribosomal gene RPS14 is associated with the cancer-prone 5q-syndrome, which is caused by an interstitial deletion of the long arm of human chromosome 5. Previously, we found that ribosomal protein S14 (RPS14) binds to and inactivates MDM2, consequently leading to p53-dependent cell-cycle arrest and growth inhibition. However, it remains elusive whether RPS14 regulates cell proliferation in a p53-independent manner. Here, we show that RPS14 interacts with the Myc homology box II (MBII) and the C-terminal basic helix-loop-helix leucine zipper (bHLH-LZ) domains of the oncoprotein c-Myc. Further, RPS14 inhibited c-Myc transcriptional activity by preventing the recruitment of c-Myc and its cofactor, TRRAP, to the target gene promoters, as thus suppressing c-Myc-induced cell proliferation. Also, siRNA-mediated RPS14 depletion elevated c-Myc transcriptional activity determined by its target gene, Nucleolin, expression. Interestingly, RPS14 depletion also resulted in the induction of c-Myc mRNA and subsequent protein levels. Consistent with this, RPS14 promoted c-Myc mRNA turnover through an Argonaute 2 (Ago2)- and microRNA-mediated pathway. Taken together, our study demonstrates that RPS14 negates c-Myc functions by directly inhibiting its transcriptional activity and mediating its mRNA degradation via miRNA. PMID:23775087

  13. Ribosomal small subunit domains radiate from a central core.

    PubMed

    Gulen, Burak; Petrov, Anton S; Okafor, C Denise; Vander Wood, Drew; O'Neill, Eric B; Hud, Nicholas V; Williams, Loren Dean

    2016-01-01

    The domain architecture of a large RNA can help explain and/or predict folding, function, biogenesis and evolution. We offer a formal and general definition of an RNA domain and use that definition to experimentally characterize the rRNA of the ribosomal small subunit. Here the rRNA comprising a domain is compact, with a self-contained system of molecular interactions. A given rRNA helix or stem-loop must be allocated uniquely to a single domain. Local changes such as mutations can give domain-wide effects. Helices within a domain have interdependent orientations, stabilities and interactions. With these criteria we identify a core domain (domain A) of small subunit rRNA. Domain A acts as a hub, linking the four peripheral domains and imposing orientational and positional restraints on the other domains. Experimental characterization of isolated domain A, and mutations and truncations of it, by methods including selective 2'OH acylation analyzed by primer extension and circular dichroism spectroscopy are consistent with our architectural model. The results support the utility of the concept of an RNA domain. Domain A, which exhibits structural similarity to tRNA, appears to be an essential core of the small ribosomal subunit. PMID:26876483

  14. Ribosomal small subunit domains radiate from a central core

    NASA Astrophysics Data System (ADS)

    Gulen, Burak; Petrov, Anton S.; Okafor, C. Denise; Vander Wood, Drew; O'Neill, Eric B.; Hud, Nicholas V.; Williams, Loren Dean

    2016-02-01

    The domain architecture of a large RNA can help explain and/or predict folding, function, biogenesis and evolution. We offer a formal and general definition of an RNA domain and use that definition to experimentally characterize the rRNA of the ribosomal small subunit. Here the rRNA comprising a domain is compact, with a self-contained system of molecular interactions. A given rRNA helix or stem-loop must be allocated uniquely to a single domain. Local changes such as mutations can give domain-wide effects. Helices within a domain have interdependent orientations, stabilities and interactions. With these criteria we identify a core domain (domain A) of small subunit rRNA. Domain A acts as a hub, linking the four peripheral domains and imposing orientational and positional restraints on the other domains. Experimental characterization of isolated domain A, and mutations and truncations of it, by methods including selective 2‧OH acylation analyzed by primer extension and circular dichroism spectroscopy are consistent with our architectural model. The results support the utility of the concept of an RNA domain. Domain A, which exhibits structural similarity to tRNA, appears to be an essential core of the small ribosomal subunit.

  15. Ribosomal small subunit domains radiate from a central core

    PubMed Central

    Gulen, Burak; Petrov, Anton S.; Okafor, C. Denise; Vander Wood, Drew; O’Neill, Eric B.; Hud, Nicholas V.; Williams, Loren Dean

    2016-01-01

    The domain architecture of a large RNA can help explain and/or predict folding, function, biogenesis and evolution. We offer a formal and general definition of an RNA domain and use that definition to experimentally characterize the rRNA of the ribosomal small subunit. Here the rRNA comprising a domain is compact, with a self-contained system of molecular interactions. A given rRNA helix or stem-loop must be allocated uniquely to a single domain. Local changes such as mutations can give domain-wide effects. Helices within a domain have interdependent orientations, stabilities and interactions. With these criteria we identify a core domain (domain A) of small subunit rRNA. Domain A acts as a hub, linking the four peripheral domains and imposing orientational and positional restraints on the other domains. Experimental characterization of isolated domain A, and mutations and truncations of it, by methods including selective 2′OH acylation analyzed by primer extension and circular dichroism spectroscopy are consistent with our architectural model. The results support the utility of the concept of an RNA domain. Domain A, which exhibits structural similarity to tRNA, appears to be an essential core of the small ribosomal subunit. PMID:26876483

  16. The Thioredoxin System Protects Ribosomes against Stress-induced Aggregation

    PubMed Central

    Rand, Jonathan D.; Grant, Chris M.

    2006-01-01

    We previously showed that thioredoxins are required for dithiothreitol (DTT) tolerance, suggesting they maintain redox homeostasis in response to both oxidative and reductive stress conditions. In this present study, we screened the complete set of viable deletion strains in Saccharomyces cerevisiae for sensitivity to DTT to identify cell functions involved in resistance to reductive stress. We identified 195 mutants, whose gene products are localized throughout the cell. DTT-sensitive mutants were distributed among most major biological processes, but they particularly affected gene expression, metabolism, and the secretory pathway. Strikingly, a mutant lacking TSA1, encoding a peroxiredoxin, showed a similar sensitivity to DTT as a thioredoxin mutant. Epistasis analysis indicated that thioredoxins function upstream of Tsa1 in providing tolerance to DTT. Our data show that the chaperone function of Tsa1, rather than its peroxidase function, is required for this activity. Cells lacking TSA1 were found to accumulate aggregated proteins, and this was exacerbated by exposure to DTT. Analysis of the protein aggregates revealed that they are predominantly composed of ribosomal proteins. Furthermore, aggregation was found to correlate with an inhibition of translation initiation. We propose that Tsa1 normally functions to chaperone misassembled ribosomal proteins, preventing the toxicity that arises from their aggregation. PMID:16251355

  17. Phylogeny of Porphyromonas gingivalis by Ribosomal Intergenic Spacer Region Analysis

    PubMed Central

    Rumpf, Robert W.; Griffen, Ann L.; Leys, Eugene J.

    2000-01-01

    Periodontitis has been associated with the presence of Porphyromonas gingivalis, and previous studies have shown phenotypic differences in the pathogenicities of strains of P. gingivalis. An accurate and comprehensive phylogeny of strains of P. gingivalis would be useful in determining if there is an evolutionary basis to pathogenicity in this species. Previous phylogenies of P. gingivalis strains based on random amplified polymorphic DNA (RAPD) analysis and multilocus enzyme electrophoresis (MLEE) show little agreement. While the 16S ribosomal gene is the standard for phylogenetic reconstruction among bacterial species, it is insufficiently variable for this purpose. In the present study, the phylogeny of P. gingivalis was constructed on the basis of the sequence of the most variable region of the ribosomal operon, the intergenic spacer region (ISR). Heteroduplex analysis of the ISR has been used to study the variability of P. gingivalis strains in periodontitis. In the present study, typing by heteroduplex analysis was compared to ISR sequence-based phylogeny and close agreement was observed. The two strains of P. gingivalis whose heteroduplex types are strongly associated with periodontitis were found to be closely related and were well separated from strains whose heteroduplex types are less strongly associated with disease, suggesting a relationship between pathogenicity and phylogeny. PMID:10790104

  18. Nuclear and nucleolar targeting of human ribosomal protein S6.

    PubMed Central

    Schmidt, C; Lipsius, E; Kruppa, J

    1995-01-01

    Chimeric proteins were constructed to define the nuclear localization signals (NLSs) of human ribosomal protein S6. The complete cDNA sequence, different cDNA fragments and oligonucleotides of the human ribosomal proteins S6, respectively, were joined to the 5' end of the entire LacZ gene of Escherichia coli by using recombinant techniques. The hybrid genes were transfected into L cells, transiently expressed, and the intracellular location of the fusion proteins was determined by their beta-galactosidase activity. Three NLSs were identified in the C-terminal half of the S6 protein. Deletion mutagenesis demonstrated that a single NLS is sufficient for targeting the corresponding S6-beta-galactosidase chimera into the nucleus. Removal of all three putative NLSs completely blocked the nuclear import of the resulting S6-beta-galactosidase fusion protein, which instead became evenly distributed in the cytoplasm. Chimeras containing deletion mutants of S6 with at least one single NLS or unmodified S6 accumulated in the nucleolus. Analysis of several constructs reveals the existence of a specific domain that is essential but not sufficient for nucleolar accumulation of S6. Images PMID:8590812

  19. Genomic architecture and inheritance of human ribosomal RNA gene clusters

    PubMed Central

    Stults, Dawn M.; Killen, Michael W.; Pierce, Heather H.; Pierce, Andrew J.

    2008-01-01

    The finishing of the Human Genome Project largely completed the detailing of human euchromatic sequences; however, the most highly repetitive regions of the genome still could not be assembled. The 12 gene clusters producing the structural RNA components of the ribosome are critically important for cellular viability, yet fall into this unassembled region of the Human Genome Project. To determine the extent of human variation in ribosomal RNA gene content (rDNA) and patterns of rDNA cluster inheritance, we have determined the physical lengths of the rDNA clusters in peripheral blood white cells of healthy human volunteers. The cluster lengths exhibit striking variability between and within human individuals, ranging from 50 kb to >6 Mb, manifest essentially complete heterozygosity, and provide each person with their own unique rDNA electrophoretic karyotype. Analysis of these rDNA fingerprints in multigenerational human families demonstrates that the rDNA clusters are subject to meiotic rearrangement at a frequency >10% per cluster, per meiosis. With this high intrinsic recombinational instability, the rDNA clusters may serve as a unique paradigm of potential human genomic plasticity. PMID:18025267

  20. Characterization of anti-P monoclonal antibodies directed against the ribosomal protein–RNA complex antigen and produced using Murphy Roths large autoimmune-prone mice

    PubMed Central

    Sato, H; Onozuka, M; Hagiya, A; Hoshino, S; Narita, I; Uchiumi, T

    2015-01-01

    Autoantibodies, including anti-ribosomal P proteins (anti-P), are thought to be produced by an antigen-driven immune response in systemic lupus erythematosus (SLE). To test this hypothesis, we reconstituted the ribosomal antigenic complex in vitro using human P0, phosphorylated P1 and P2 and a 28S rRNA fragment covering the P0 binding site, and immunized Murphy Roths large (MRL)/lrp lupus mice with this complex without any added adjuvant to generate anti-P antibodies. Using hybridoma technology, we subsequently obtained 34 clones, each producing an anti-P monoclonal antibody (mAb) that recognized the conserved C-terminal tail sequence common to all three P proteins. We also obtained two P0-specific monoclonal antibodies, but no antibody specific to P1, P2 or rRNA fragment. Two types of mAbs were found among these anti-P antibodies: one type (e.g. 9D5) reacted more strongly with the phosphorylated P1 and P2 than that with their non-phosphorylated forms, whereas the other type (e.g. 4H11) reacted equally with both phosphorylated and non-phosphorylated forms of P1/P2. Both 9D5 and 4H11 inhibited the ribosome/eukaryotic elongation factor-2 (eEF-2)-coupled guanosine triphosphate (GTP)ase activity. However, preincubation with a synthetic peptide corresponding to the C-terminal sequence common to all three P proteins, but not the peptide that lacked the last three C-terminal amino acids, mostly prevented the mAb-induced inhibition of GTPase activity. Thus, at least two types of anti-P were produced preferentially following the immunization of MRL mice with the reconstituted antigenic complex. Presence of multiple copies of the C-termini, particularly that of the last three C-terminal amino acid residues, in the antigenic complex appears to contribute to the immunogenic stimulus. PMID:25255895

  1. Ribosome-associated Asc1/RACK1 is required for endonucleolytic cleavage induced by stalled ribosome at the 3' end of nonstop mRNA.

    PubMed

    Ikeuchi, Ken; Inada, Toshifumi

    2016-01-01

    Dom34-Hbs1 stimulates degradation of aberrant mRNAs lacking termination codons by dissociating ribosomes stalled at the 3' ends, and plays crucial roles in Nonstop Decay (NSD) and No-Go Decay (NGD). In the dom34Δ mutant, nonstop mRNA is degraded by sequential endonucleolytic cleavages induced by a stalled ribosome at the 3' end. Here, we report that ribosome-associated Asc1/RACK1 is required for the endonucleolytic cleavage of nonstop mRNA by stalled ribosome at the 3' end of mRNA in dom34Δ mutant cells. Asc1/RACK1 facilitates degradation of truncated GFP-Rz mRNA in the absence of Dom34 and exosome-dependent decay. Asc1/RACK1 is required for the sequential endonucleolytic cleavages by the stalled ribosome in the dom34Δ mutant, depending on its ribosome-binding activity. The levels of peptidyl-tRNA derived from nonstop mRNA were elevated in dom34Δasc1Δ mutant cells, and overproduction of nonstop mRNA inhibited growth of mutant cells. E3 ubiquitin ligase Ltn1 degrades the arrest products from truncated GFP-Rz mRNA in dom34Δ and dom34Δasc1Δ mutant cells, and Asc1/RACK1 represses the levels of substrates for Ltn1-dependent degradation. These indicate that ribosome-associated Asc1/RACK1 facilitates endonucleolytic cleavage of nonstop mRNA by stalled ribosomes and represses the levels of aberrant products even in the absence of Dom34. We propose that Asc1/RACK1 acts as a fail-safe in quality control for nonstop mRNA. PMID:27312062

  2. Characterization of the ribosomal binding site in rat liver rough microsomes: ribophorins I and II, two integral membrane proteins related to ribosome binding.

    PubMed

    Kreibich, G; Czakó-Graham, M; Grebenau, R; Mok, W; Rodriguez-Boulan, E; Sabatini, D D

    1978-01-01

    Rat liver rough endoplasmic reticulum membranes (ER) contain two characteristic transmembrane glycoproteins which have been designated ribophorins I and II and are absent from smooth ER membranes. These proteins (MW 65,000 and 63,000 respectively) are related to the binding sites for ribosomes, as suggested by the following findings: i) The ribophorin content of the rough ER membranes corresponds stoichiometrically to the number of bound ribosomes; ii) ribophorins are quantitatively recovered with the bound polysomes after most other ER membrane proteins are dissolved with the nonionic detergent Kyro EOB; iii) in intact rough microsomes ribophorins can be cross-linked chemically to the ribosomes and therefore are in close proximity to them. Treatment of rough microsomes with a low Triton-X-100 concentration leads to the lateral displacement of ribosomes on the microsomal surface and to the formation of aggregates of bound ribosomes in areas of membranes which frequently invaginate into the microsomal lumen. Subfractionation of Triton-treated microsomes containing invaginations led to the recovery of smooth and "rough-inverted" vesicles. Ribophorins were present only in the latter fraction, indicating that both proteins are displaced together with the ribosomes when these aggregate without detaching. Measurements of the ribosome-binding capacity of rough and smooth microsomal membranes reconstituted after solubilization with detergents suggest that ribophorins are necessary for in vitro ribosome binding. Ribophorin-like proteins were found in rough microsomes obtained from secretory tissues of several animal species. The two proteins present in rat lacrimal gland microsomes have the same mobility as hepatocyte ribophorins and cross-react with antisera against them. PMID:723266

  3. Ribosome-associated Asc1/RACK1 is required for endonucleolytic cleavage induced by stalled ribosome at the 3′ end of nonstop mRNA

    PubMed Central

    Ikeuchi, Ken; Inada, Toshifumi

    2016-01-01

    Dom34-Hbs1 stimulates degradation of aberrant mRNAs lacking termination codons by dissociating ribosomes stalled at the 3′ ends, and plays crucial roles in Nonstop Decay (NSD) and No-Go Decay (NGD). In the dom34Δ mutant, nonstop mRNA is degraded by sequential endonucleolytic cleavages induced by a stalled ribosome at the 3′ end. Here, we report that ribosome-associated Asc1/RACK1 is required for the endonucleolytic cleavage of nonstop mRNA by stalled ribosome at the 3′ end of mRNA in dom34Δ mutant cells. Asc1/RACK1 facilitates degradation of truncated GFP-Rz mRNA in the absence of Dom34 and exosome-dependent decay. Asc1/RACK1 is required for the sequential endonucleolytic cleavages by the stalled ribosome in the dom34Δ mutant, depending on its ribosome-binding activity. The levels of peptidyl-tRNA derived from nonstop mRNA were elevated in dom34Δasc1Δ mutant cells, and overproduction of nonstop mRNA inhibited growth of mutant cells. E3 ubiquitin ligase Ltn1 degrades the arrest products from truncated GFP-Rz mRNA in dom34Δ and dom34Δasc1Δ mutant cells, and Asc1/RACK1 represses the levels of substrates for Ltn1-dependent degradation. These indicate that ribosome-associated Asc1/RACK1 facilitates endonucleolytic cleavage of nonstop mRNA by stalled ribosomes and represses the levels of aberrant products even in the absence of Dom34. We propose that Asc1/RACK1 acts as a fail-safe in quality control for nonstop mRNA. PMID:27312062

  4. Maize reas1 Mutant Stimulates Ribosome Use Efficiency and Triggers Distinct Transcriptional and Translational Responses.

    PubMed

    Qi, Weiwei; Zhu, Jie; Wu, Qiao; Wang, Qun; Li, Xia; Yao, Dongsheng; Jin, Ying; Wang, Gang; Wang, Guifeng; Song, Rentao

    2016-02-01

    Ribosome biogenesis is a fundamental cellular process in all cells. Impaired ribosome biogenesis causes developmental defects; however, its molecular and cellular bases are not fully understood. We cloned a gene responsible for a maize (Zea mays) small seed mutant, dek* (for defective kernel), and found that it encodes Ribosome export associated1 (ZmReas1). Reas1 is an AAA-ATPase that controls 60S ribosome export from the nucleus to the cytoplasm after ribosome maturation. dek* is a weak mutant allele with decreased Reas1 function. In dek* cells, mature 60S ribosome subunits are reduced in the nucleus and cytoplasm, but the proportion of actively translating polyribosomes in cytosol is significantly increased. Reduced phosphorylation of eukaryotic initiation factor 2α and the increased elongation factor 1α level indicate an enhancement of general translational efficiency in dek* cells. The mutation also triggers dramatic changes in differentially transcribed genes and differentially translated RNAs. Discrepancy was observed between differentially transcribed genes and differentially translated RNAs, indicating distinct cellular responses at transcription and translation levels to the stress of defective ribosome processing. DNA replication and nucleosome assembly-related gene expression are selectively suppressed at the translational level, resulting in inhibited cell growth and proliferation in dek* cells. This study provides insight into cellular responses due to impaired ribosome biogenesis. PMID:26645456

  5. Ribosomes in the balance: structural equilibrium ensures translational fidelity and proper gene expression

    PubMed Central

    Musalgaonkar, Sharmishtha; Moomau, Christine A.; Dinman, Jonathan D.

    2014-01-01

    At equilibrium, empty ribosomes freely transit between the rotated and un-rotated states. In the cell, the binding of two translation elongation factors to the same general region of the ribosome stabilizes one state over the other. These stabilized states are resolved by expenditure of energy in the form of GTP hydrolysis. A prior study employing mutants of a late assembling peripheral ribosomal protein suggested that ribosome rotational status determines its affinity for elongation factors, and hence translational fidelity and gene expression. Here, mutants of the early assembling integral ribosomal protein uL2 are used to test the generality of this hypothesis. rRNA structure probing analyses reveal that mutations in the uL2 B7b bridge region shift the equilibrium toward the rotated state, propagating rRNA structural changes to all of the functional centers of ribosome. Structural disequilibrium unbalances ribosome biochemically: rotated ribosomes favor binding of the eEF2 translocase and disfavor that of the elongation ternary complex. This manifests as specific translational fidelity defects, impacting the expression of genes involved in telomere maintenance. A model is presented describing how cyclic intersubunit rotation ensures the unidirectionality of translational elongation, and how perturbation of rotational equilibrium affects specific aspects of translational fidelity and cellular gene expression. PMID:25389262

  6. Bypass of the pre-60S ribosomal quality control as a pathway to oncogenesis.

    PubMed

    Sulima, Sergey O; Patchett, Stephanie; Advani, Vivek M; De Keersmaecker, Kim; Johnson, Arlen W; Dinman, Jonathan D

    2014-04-15

    Ribosomopathies are a class of diseases caused by mutations that affect the biosynthesis and/or functionality of the ribosome. Although they initially present as hypoproliferative disorders, such as anemia, patients have elevated risk of hyperproliferative disease (cancer) by midlife. Here, this paradox is explored using the rpL10-R98S (uL16-R98S) mutant yeast model of the most commonly identified ribosomal mutation in acute lymphoblastic T-cell leukemia. This mutation causes a late-stage 60S subunit maturation failure that targets mutant ribosomes for degradation. The resulting deficit in ribosomes causes the hypoproliferative phenotype. This 60S subunit shortage, in turn, exerts pressure on cells to select for suppressors of the ribosome biogenesis defect, allowing them to reestablish normal levels of ribosome production and cell proliferation. However, suppression at this step releases structurally and functionally defective ribosomes into the translationally active pool, and the translational fidelity defects of these mutants culminate in destabilization of selected mRNAs and shortened telomeres. We suggest that in exchange for resolving their short-term ribosome deficits through compensatory trans-acting suppressors, cells are penalized in the long term by changes in gene expression that ultimately undermine cellular homeostasis. PMID:24706786

  7. The Saccharomyces cerevisiae protein Stm1p facilitates ribosome preservation during quiescence

    SciTech Connect

    Van Dyke, Natalya; Chanchorn, Ekkawit; Van Dyke, Michael W.

    2013-01-11

    Highlights: Black-Right-Pointing-Pointer Stm1p confers increased resistance to the macrolide starvation-mimic rapamycin. Black-Right-Pointing-Pointer Stm1p maintains 80S ribosome integrity during stationary phase-induced quiescence. Black-Right-Pointing-Pointer Stm1p facilitates polysome formation following quiescence exit. Black-Right-Pointing-Pointer Stm1p facilitates protein synthesis following quiescence exit. Black-Right-Pointing-Pointer Stm1p is a ribosome preservation factor under conditions of nutrient deprivation. -- Abstract: Once cells exhaust nutrients from their environment, they enter an alternative resting state known as quiescence, whereby proliferation ceases and essential nutrients are obtained through internal stores and through the catabolism of existing macromolecules and organelles. One example of this is ribophagy, the degradation of ribosomes through the process of autophagy. However, some ribosomes need to be preserved for an anticipated recovery from nutrient deprivation. We found that the ribosome-associated protein Stm1p greatly increases the quantity of 80S ribosomes present in quiescent yeast cells and that these ribosomes facilitate increased protein synthesis rates once nutrients are restored. These findings suggest that Stm1p can act as a ribosome preservation factor under conditions of nutrient deprivation and restoration.

  8. The Ribosome: The Cell's Protein-Synthesizing Machine and How Antibiotics Disrupt It

    ScienceCinema

    Venki Ramakrishnan

    2010-01-08

    Determining the structure of the ribosome has made it possible for Ramakrishnan and his colleagues to image antibiotics bound to the ribosome, leading to a better understanding of their action, which could help in the development of novel drugs. In his ta

  9. Autogenous Regulation of Splicing of the Transcript of a Yeast Ribosomal Protein Gene

    NASA Astrophysics Data System (ADS)

    Dabeva, Mariana D.; Post-Beittenmiller, Martha A.; Warner, Jonathan R.

    1986-08-01

    The gene for a yeast ribosomal protein, RPL32, contains a single intron. The product of this gene appears to participate in feedback control of the splicing of the intron from the transcript. This autogenous regulation of splicing provides a striking analogy to the autogenous regulation of translation of ribosomal proteins in Escherichia coli.

  10. LIMITED PROTEOLYSIS ANALYSIS OF THE RIBOSOME IS AFFECTED BY SUBUNIT ASSOCIATION

    PubMed Central

    Hamburg, Daisy-Malloy; Suh, Moo-Jin; Limbach, Patrick A.

    2010-01-01

    Our understanding of the structural organization of ribosome assembly intermediates, in particular those intermediates that result from mis-folding leading to their eventual degradation within the cell, is limited due to the lack of methods available to characterize assembly intermediate structures. Because conventional structural approaches, such as NMR, X-ray crystallography and cryo-EM, are not ideally suited to characterize the structural organization of these flexible and sometimes heterogeneous assembly intermediates, we have set out to develop an approach combining limited proteolysis with matrix-assisted laser desorption/ionization mass spectrometry (MALDI-MS) that might be applicable to ribonucleoprotein complexes as large as the ribosome. This study focuses on the limited proteolysis behavior of appropriately assembled ribosome subunits. Isolated subunits were analyzed using limited proteolysis and MALDI-MS and the results were compared to previous data obtained from 70S ribosomes. Generally, ribosomal proteins were found to be more stable in 70S ribosomes than in their isolated subunits, consistent with a reduction in conformational flexibility upon subunit assembly. This approach demonstrates that limited proteolysis combined with MALDI-MS can reveal structural changes to ribosomes upon subunit assembly or disassembly, and provides the appropriate benchmark data from 30S, 50S and 70S proteins to enable studies of ribosome assembly intermediates. PMID:19213046

  11. Mutations Outside the Anisomycin-Binding Site Can Make Ribosomes Drug-Resistant

    SciTech Connect

    Blaha,G.; Gurel, G.; Schroeder, S.; Moore, P.; Steitz, T.

    2008-01-01

    Eleven mutations that make Haloarcula marismortui resistant to anisomycin, an antibiotic that competes with the amino acid side chains of aminoacyl tRNAs for binding to the A-site cleft of the large ribosomal unit, have been identified in 23S rRNA. The correlation observed between the sensitivity of H. marismortui to anisomycin and the affinity of its large ribosomal subunits for the drug indicates that its response to anisomycin is determined primarily by the binding of the drug to its large ribosomal subunit. The structures of large ribosomal subunits containing resistance mutations show that these mutations can be divided into two classes: (1) those that interfere with specific drug-ribosome interactions and (2) those that stabilize the apo conformation of the A-site cleft of the ribosome relative to its drug-bound conformation. The conformational effects of some mutations of the second kind propagate through the ribosome for considerable distances and are reversed when A-site substrates bind to the ribosome.

  12. Control of ribosome traffic by position-dependent choice of synonymous codons

    NASA Astrophysics Data System (ADS)

    Mitarai, Namiko; Pedersen, Steen

    2013-10-01

    Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby ribosomes by affecting the appearance of ‘traffic jams’ where multiple ribosomes collide and form queues. To test this ‘context effect’ further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated from experiments. We compare the ribosome traffic on wild-type (WT) sequences and sequences where the synonymous codons were swapped randomly. By simulating translation of 87 genes, we demonstrate that the WT sequences, especially those with a high bias in codon usage, tend to have the ability to reduce ribosome collisions, hence optimizing the cellular investment in the translation apparatus. The magnitude of such reduction of the translation time might have a significant impact on the cellular growth rate and thereby have importance for the survival of the species.

  13. Structural studies of E. coli ribosomes by spectroscopic techniques: A specialized review

    NASA Astrophysics Data System (ADS)

    Bonicontro, Adalberto; Risuleo, Gianfranco

    2005-12-01

    We present a review on our interdisciplinary line of research based on strategies of molecular biology and biophysics. These have been applied to the study of the prokaryotic ribosome of the bacterium Escherichia coli. Our investigations on this organelle have continued for more than a decade and we have adopted different spectroscopic biophysical techniques such as: dielectric and fluorescence spectroscopy as well as light scattering (photon correlation spectroscopy). Here we report studies on the whole 70S ribosomes and on the separated subunits 30S and 50S. Our results evidence intrinsic structural features of the subunits: the small shows a more "floppy" structure, while the large one appears to be more rigid. Also, an inner "kernel" formed by the RNA/protein association is found within the ribosome. This kernel is surrounded by a ribonucleoprotein complex more exposed to the solvent. Initial analyses were done on the so called Kaldtschmit-Wittmann ribosome: more recently we have extended the studies to the "tight couple" ribosome known for its better functional performance in vitro. Data evidence a phenomenological correlation between the differential biological activity and the intrinsic structural properties of the two-ribosome species. Finally, investigations were also conducted on particles treated at sub-denaturing temperatures and on ribosomes partially deproteinized by salt treatment (ribosomal cores). Results suggest that the thermal treatment and the selective removal of proteins cause analogous structural alterations.

  14. Regulation of the protein-conducting channel by a bound ribosome

    PubMed Central

    Gumbart, James; Trabuco, Leonardo G.; Schreiner, Eduard; Villa, Elizabeth; Schulten, Klaus

    2009-01-01

    Summary During protein synthesis, it is often necessary for the ribosome to form a complex with a membrane-bound channel, the SecY/Sec61 complex, in order to translocate nascent proteins across a cellular membrane. Structural data on the ribosome-channel complex are currently limited to low-resolution cryo-electron microscopy maps, including one showing a bacterial ribosome bound to a monomeric SecY complex. Using that map along with available atomic-level models of the ribosome and SecY, we have determined, through molecular dynamics flexible fitting (MDFF), an atomic-resolution model of the ribosome-channel complex. We characterized computationally the sites of ribosome-SecY interaction within the complex and determined the effect of ribosome binding on the SecY channel. We also constructed a model of a ribosome in complex with a SecY dimer by adding a second copy of SecY to the MDFF-derived model. The study involved 2.7-million-atom simulations over altogether nearly 50 ns. PMID:19913480

  15. A protein residing at the subunit interface of the bacterial ribosome.

    PubMed

    Agafonov, D E; Kolb, V A; Nazimov, I V; Spirin, A S

    1999-10-26

    Surface labeling of Escherichia coli ribosomes with the use of the tritium bombardment technique has revealed a minor unidentified ribosome-bound protein (spot Y) that is hidden in the 70S ribosome and becomes highly labeled on dissociation of the 70S ribosome into subunits. In the present work, the N-terminal sequence of the protein Y was determined and its gene was identified as yfia, an ORF located upstream the phe operon of E. coli. This 12.7-kDa protein was isolated and characterized. An affinity of the purified protein Y for the 30S subunit, but not for the 50S ribosomal subunit, was shown. The protein proved to be exposed on the surface of the 30S subunit. The attachment of the 50S subunit resulted in hiding the protein Y, thus suggesting the protein location at the subunit interface in the 70S ribosome. The protein was shown to stabilize ribosomes against dissociation. The possible role of the protein Y as ribosome association factor in translation is discussed. PMID:10535924

  16. Hypoxic stress-induced changes in ribosomes of maize seedling roots. [Zea mays L

    SciTech Connect

    Bailey-Serres, J.; Freeling, M. )

    1990-11-01

    The hypoxic stress response of Zea mays L. seedling roots involves regulation of gene expression at transcriptional and posttranscriptional levels. We investigated the effect of hypoxia on the translational machinery of seedling roots. The levels of monoribosomes and ribosomal subunits increased dramatically within 1 hour of stress. Prolonged hypoxia resulted in continued accumulation of nontranslating ribosomes, as well as increased levels of small polyribosomes. The return of seedlings to normal aerobic conditions resulted in recovery of normal polyribosome levels. Comparison of ribosomal proteins from control and hypoxic roots revealed differences in quantity and electrophoretic mobility. In vivo labeling of roots with ({sup 35}S)methionine revealed variations in newly synthesized ribosomal proteins. In vivo labeling of roots with ({sup 32}P)orthophosphate revealed a major reduction in the phosphorylation of a 31 kilodalton ribosomal protein in hypoxic stressed roots. In vitro phosphorylation of ribosomal proteins by endogenous kinases was used to probe for differences in ribosome structure and composition. The patterns of in vitro kinased phosphoproteins of ribosomes from control and hypoxic roots were not identical. Variation in phosphoproteins of polyribosomes from control and hypoxic roots, as well as among polyribosomes from hypoxic roots were observed. These results indicate that modification of the translational machinery occurs in response to hypoxic stress.

  17. The Ribosomal RNA is a Useful Marker to Visualize Rhizobia Interacting with Legume Plants

    ERIC Educational Resources Information Center

    Rinaudi, Luciana; Isola, Maria C.; Giordano, Walter

    2004-01-01

    Symbiosis between rhizobia and leguminous plants leads to the formation of nitrogen-fixing root nodules. In the present article, we recommend the use of the ribosomal RNA (rRNA) isolated from legume nodules in an experimental class with the purpose of introducing students to the structure of eukaryotic and prokaryotic ribosomes and of…

  18. The activity of the acidic phosphoproteins from the 80 S rat liver ribosome.

    PubMed

    MacConnell, W P; Kaplan, N O

    1982-05-25

    The selective removal of acidic phosphoproteins from the 80 S rat liver ribosome was accomplished by successive alcohol extractions at low salt concentration. The resulting core ribosomes lost over 90% of their translation activity and were unable to support the elongation factor 2 GTPase reaction. Both activities were partially restored when the dialyzed extracts were added back to the core ribosome. The binding of labeled adenosine diphosphoribosyl-elongation factor 2 to ribosomes was also affected by extraction and could be reconstituted, although not to the same extent as the GTPase activity associated with elongation factor 2 in the presence of the ribosome. The alcohol extracts of the 80 S ribosome contained mostly phosphoproteins P1 and P2 which could be dephosphorylated and rephosphorylated in solution by alkaline phosphatase and protein kinase, respectively. Dephosphorylation of the P1/P2 mixture in the extracts caused a decrease in the ability of these proteins to reactivate the polyphenylalanine synthesis activity of the core ribosome. However, treatment of the dephosphorylated proteins with the catalytic subunit of 3':5'-cAMP-dependent protein kinase in the presence of ATP reactivated the proteins when compared to the activity of the native extracts. Rabbit antisera raised against the alcohol-extracted proteins were capable of impairing both the polyphenylalanine synthesis reaction and the elongation factor 2-dependent GTPase reaction in the intact ribosomes. PMID:6121796

  19. The Ribosome: The Cell's Protein-Synthesizing Machine and How Antibiotics Disrupt It

    SciTech Connect

    Venki Ramakrishnan

    2009-10-08

    Determining the structure of the ribosome has made it possible for Ramakrishnan and his colleagues to image antibiotics bound to the ribosome, leading to a better understanding of their action, which could help in the development of novel drugs. In his ta

  20. UtpA and UtpB chaperone nascent pre-ribosomal RNA and U3 snoRNA to initiate eukaryotic ribosome assembly

    PubMed Central

    Hunziker, Mirjam; Barandun, Jonas; Petfalski, Elisabeth; Tan, Dongyan; Delan-Forino, Clémentine; Molloy, Kelly R.; Kim, Kelly H.; Dunn-Davies, Hywel; Shi, Yi; Chaker-Margot, Malik; Chait, Brian T.; Walz, Thomas; Tollervey, David; Klinge, Sebastian

    2016-01-01

    Early eukaryotic ribosome biogenesis involves large multi-protein complexes, which co-transcriptionally associate with pre-ribosomal RNA to form the small subunit processome. The precise mechanisms by which two of the largest multi-protein complexes—UtpA and UtpB—interact with nascent pre-ribosomal RNA are poorly understood. Here, we combined biochemical and structural biology approaches with ensembles of RNA–protein cross-linking data to elucidate the essential functions of both complexes. We show that UtpA contains a large composite RNA-binding site and captures the 5′ end of pre-ribosomal RNA. UtpB forms an extended structure that binds early pre-ribosomal intermediates in close proximity to architectural sites such as an RNA duplex formed by the 5′ ETS and U3 snoRNA as well as the 3′ boundary of the 18S rRNA. Both complexes therefore act as vital RNA chaperones to initiate eukaryotic ribosome assembly. PMID:27354316

  1. UtpA and UtpB chaperone nascent pre-ribosomal RNA and U3 snoRNA to initiate eukaryotic ribosome assembly

    NASA Astrophysics Data System (ADS)

    Hunziker, Mirjam; Barandun, Jonas; Petfalski, Elisabeth; Tan, Dongyan; Delan-Forino, Clémentine; Molloy, Kelly R.; Kim, Kelly H.; Dunn-Davies, Hywel; Shi, Yi; Chaker-Margot, Malik; Chait, Brian T.; Walz, Thomas; Tollervey, David; Klinge, Sebastian

    2016-06-01

    Early eukaryotic ribosome biogenesis involves large multi-protein complexes, which co-transcriptionally associate with pre-ribosomal RNA to form the small subunit processome. The precise mechanisms by which two of the largest multi-protein complexes--UtpA and UtpB--interact with nascent pre-ribosomal RNA are poorly understood. Here, we combined biochemical and structural biology approaches with ensembles of RNA-protein cross-linking data to elucidate the essential functions of both complexes. We show that UtpA contains a large composite RNA-binding site and captures the 5' end of pre-ribosomal RNA. UtpB forms an extended structure that binds early pre-ribosomal intermediates in close proximity to architectural sites such as an RNA duplex formed by the 5' ETS and U3 snoRNA as well as the 3' boundary of the 18S rRNA. Both complexes therefore act as vital RNA chaperones to initiate eukaryotic ribosome assembly.

  2. Phosphorylation of ribosomal proteins induced by auxins in maize embryonic tissues. [Zea mays

    SciTech Connect

    Perez, L.; Aguilar, R.; Mendez, A.P.; de Jimenez, E.S.

    1990-11-01

    The effect of auxin on ribosomal protein phosphorylation of germinating maize (Zea mays) tissues was investigated. Two-dimensional gel electrophoresis and autoradiography of ({sup 32}P) ribosomal protein patterns for natural and synthetic auxin-treated tissues were performed. Both the rate of {sup 32}P incorporation and the electrophoretic patterns were dependent on {sup 32}P pulse length, suggesting that active protein phosphorylation-dephosphorylation occurred in small and large subunit proteins, in control as well as in auxin-treated tissues. The effect of ribosomal protein phosphorylation on in vitro translation was tested. Measurements of poly(U) translation rates as a function of ribosome concentration provided apparent K{sub m} values significantly different for auxin-treated and nontreated tissues. These findings suggest that auxin might exert some kind of translational control by regulating the phosphorylated status of ribosomal proteins.

  3. High Precision Analysis of Translational Pausing by Ribosome Profiling in Bacteria Lacking EFP

    PubMed Central

    Woolstenhulme, Christopher J.; Guydosh, Nicholas R.; Green, Rachel; Buskirk, Allen R.

    2015-01-01

    Summary Ribosome profiling is a powerful method for globally assessing the activity of ribosomes in a cell. Despite its application in many organisms, ribosome profiling studies in bacteria have struggled to obtain the resolution necessary to precisely define translational pauses. Here we report improvements that yield much higher resolution in E. coli profiling data, enabling us to more accurately assess ribosome pausing and refine earlier studies of the impact of polyproline motifs on elongation. We comprehensively characterize pausing at proline-rich motifs in the absence of elongation factor EFP. We find that only a small fraction of genes with strong pausing motifs have reduced ribosome density downstream and identify features that explain this phenomenon. These features allow us to predict which proteins likely have reduced output in the efp knockout strain. PMID:25843707

  4. Structure of the GTP Form of Elongation Factor 4 (EF4) Bound to the Ribosome.

    PubMed

    Kumar, Veerendra; Ero, Rya; Ahmed, Tofayel; Goh, Kwok Jian; Zhan, Yin; Bhushan, Shashi; Gao, Yong-Gui

    2016-06-17

    Elongation factor 4 (EF4) is a member of the family of ribosome-dependent translational GTPase factors, along with elongation factor G and BPI-inducible protein A. Although EF4 is highly conserved in bacterial, mitochondrial, and chloroplast genomes, its exact biological function remains controversial. Here we present the cryo-EM reconstitution of the GTP form of EF4 bound to the ribosome with P and E site tRNAs at 3.8-Å resolution. Interestingly, our structure reveals an unrotated ribosome rather than a clockwise-rotated ribosome, as observed in the presence of EF4-GDP and P site tRNA. In addition, we also observed a counterclockwise-rotated form of the above complex at 5.7-Å resolution. Taken together, our results shed light on the interactions formed between EF4, the ribosome, and the P site tRNA and illuminate the GTPase activation mechanism at previously unresolved detail. PMID:27137929

  5. Direct measurement of the mechanical work during translocation by the ribosome.

    PubMed

    Liu, Tingting; Kaplan, Ariel; Alexander, Lisa; Yan, Shannon; Wen, Jin-Der; Lancaster, Laura; Wickersham, Charles E; Fredrick, Kurt; Fredrik, Kurt; Noller, Harry; Tinoco, Ignacio; Bustamante, Carlos J

    2014-01-01

    A detailed understanding of tRNA/mRNA translocation requires measurement of the forces generated by the ribosome during this movement. Such measurements have so far remained elusive and, thus, little is known about the relation between force and translocation and how this reflects on its mechanism and regulation. Here, we address these questions using optical tweezers to follow translation by individual ribosomes along single mRNA molecules, against an applied force. We find that translocation rates depend exponentially on the force, with a characteristic distance close to the one-codon step, ruling out the existence of sub-steps and showing that the ribosome likely functions as a Brownian ratchet. We show that the ribosome generates ∼13 pN of force, barely sufficient to unwind the most stable structures in mRNAs, thus providing a basis for their regulatory role. Our assay opens the way to characterizing the ribosome's full mechano-chemical cycle. PMID:25114092

  6. Oligosaccharyltransferase directly binds to ribosome at a location near the translocon-binding site

    SciTech Connect

    Harada, Y.; Li, H.; Li, Hua; Lennarz, W. J.

    2009-04-28

    Oligosaccharyltransferase (OT) transfers high mannose-type glycans to the nascent polypeptides that are translated by the membrane-bound ribosome and translocated into the lumen of the endoplasmic reticulum through the Sec61 translocon complex. In this article, we show that purified ribosomes and OT can form a binary complex with a stoichiometry of {approx}1 to 1 in the presence of detergent. We present evidence that OT may bind to the large ribosomal subunit near the site where nascent polypeptides exit. We further show that OT and the Sec61 complex can simultaneously bind to ribosomes in vitro. Based on existing data and our findings, we propose that cotranslational translocation and N-glycosylation of nascent polypeptides are mediated by a ternary supramolecular complex consisting of OT, the Sec61 complex, and ribosomes.

  7. A model for the study of ligand binding to the ribosomal RNA helix h44

    SciTech Connect

    Dibrov, Sergey M.; Parsons, Jerod; Hermann, Thomas

    2010-09-02

    Oligonucleotide models of ribosomal RNA domains are powerful tools to study the binding and molecular recognition of antibiotics that interfere with bacterial translation. Techniques such as selective chemical modification, fluorescence labeling and mutations are cumbersome for the whole ribosome but readily applicable to model RNAs, which are readily crystallized and often give rise to higher resolution crystal structures suitable for detailed analysis of ligand-RNA interactions. Here, we have investigated the HX RNA construct which contains two adjacent ligand binding regions of helix h44 in 16S ribosomal RNA. High-resolution crystal structure analysis confirmed that the HX RNA is a faithful structural model of the ribosomal target. Solution studies showed that HX RNA carrying a fluorescent 2-aminopurine modification provides a model system that can be used to monitor ligand binding to both the ribosomal decoding site and, through an indirect effect, the hygromycin B interaction region.

  8. The ribosome as an optimal decoder: a lesson in molecular recognition

    NASA Astrophysics Data System (ADS)

    Tlusty, Tsvi; Savir, Yonatan

    2013-03-01

    The ribosome is a complex molecular machine that, in order to synthesize proteins, has to decode mRNAs by pairing their codons with matching tRNAs. Decoding is a major determinant of fitness and requires accurate and fast selection of correct tRNAs among many similar competitors. However, it is unclear whether the present ribosome, and in particular its large deformations during decoding, are the outcome of adaptation to its task as a decoder or the result of other constraints. Here, we derive the energy landscape that provides optimal discrimination between competing substrates, and thereby optimal tRNA decoding. We show that the measured landscape of the prokaryotic ribosome is indeed sculpted in this way. This suggests that conformational changes of the ribosome and tRNA during decoding are means to obtain an optimal decoder. Our analysis puts forward a generic mechanism that may be utilized by other ribosomes and other molecular recognition systems.

  9. SANS measurements on sulfolobus solfataricus ribosome as a function of temperature and magnesium concentration

    NASA Astrophysics Data System (ADS)

    Briganti, G.; Giordano, R.; Londei, P.; Pedone, F.

    1997-02-01

    The ribosomes of the extremely thermophylic archaebacterium Sulfolobus solfataricus (optimal growth at T = 87°C) are stable and active at temperatures close to 90°C, in spite of the fact that their composition is very similar to the ribosomes of the mesophilic bacterium E. coli, growing at 37°C. We present the first SANS analysis of the intact S. solfataricus 70S monomers as well as of the isolated 30S and 50S subunits as a function of the temperature and the magnesium ion concentration. Our results indicate that, under conditions similar to those employed for the analysis of E. coli ribosomes, supramolecular aggregates are present in S. solfataricus, their extent depending on temperature, ribosome concentration and magnesium ion content. Only above 70°C changes in the scattering profile are observed, concomitant with the specific biological activation of this kind of ribosome.

  10. PTRF/Cavin-1 promotes efficient ribosomal RNA transcription in response to metabolic challenges.

    PubMed

    Liu, Libin; Pilch, Paul F

    2016-01-01

    Ribosomal RNA transcription mediated by RNA polymerase I represents the rate-limiting step in ribosome biogenesis. In eukaryotic cells, nutrients and growth factors regulate ribosomal RNA transcription through various key factors coupled to cell growth. We show here in mature adipocytes, ribosomal transcription can be acutely regulated in response to metabolic challenges. This acute response is mediated by PTRF (polymerase I transcription and release factor, also known as cavin-1), which has previously been shown to play a critical role in caveolae formation. The caveolae-independent rDNA transcriptional role of PTRF not only explains the lipodystrophy phenotype observed in PTRF deficient mice and humans, but also highlights its crucial physiological role in maintaining adipocyte allostasis. Multiple post-translational modifications of PTRF provide mechanistic bases for its regulation. The role of PTRF in ribosomal transcriptional efficiency is likely relevant to many additional physiological situations of cell growth and organismal metabolism. PMID:27528195

  11. Ribosome dimerization is essential for the efficient regrowth of Bacillus subtilis.

    PubMed

    Akanuma, Genki; Kazo, Yuka; Tagami, Kazumi; Hiraoka, Hirona; Yano, Koichi; Suzuki, Shota; Hanai, Ryo; Nanamiya, Hideaki; Kato-Yamada, Yasuyuki; Kawamura, Fujio

    2016-03-01

    Ribosome dimers are a translationally inactive form of ribosomes found in Escherichia coli and many other bacterial cells. In this study, we found that the 70S ribosomes of Bacillus subtilis dimerized during the early stationary phase and these dimers remained in the cytoplasm until regrowth was initiated. Ribosome dimerization during the stationary phase required the hpf gene, which encodes a homologue of the E. coli hibernation-promoting factor (Hpf). The expression of hpf was induced at an early stationary phase and its expression was observed throughout the rest of the experimental period, including the entire 6 h of the stationary phase. Ribosome dimerization followed the induction of hpf in WT cells, but the dimerization was impaired in cells harbouring a deletion in the hpf gene. Although the absence of ribosome dimerization in these Hpf-deficient cells did not affect their viability in the stationary phase, their ability to regrow from the stationary phase decreased. Thus, following the transfer of stationary-phase cells to fresh LB medium, Δhpf mutant cells grew slower than WT cells. This observed lag in growth of Δhpf cells was probably due to a delay in restoring their translational activity. During regrowth, the abundance of ribosome dimers in WT cells decreased with a concomitant increase in the abundance of 70S ribosomes and growth rate. These results suggest that the ribosome dimers, by providing 70S ribosomes to the cells, play an important role in facilitating rapid and efficient regrowth of cells under nutrient-rich conditions. PMID:26743942

  12. Mutations in the leader region of ribosomal RNA operons cause structurally defective 30 S ribosomes as revealed by in vivo structural probing.

    PubMed

    Balzer, M; Wagner, R

    1998-02-27

    The biogenesis of functional ribosomes is regulated in a very complex manner, involving different proteins and RNA molecules. RNAs are not only essential components of both ribosomal subunits but also transiently interacting factors during particle formation. In eukaryotes snoRNAs act as molecular chaperones to assist maturation, modification and assembly. In a very similar way highly conserved leader sequences of bacterial rRNA operons are involved in the correct formation of 30 S ribosomal subunits. Certain mutations in the rRNA leader region cause severe growth defects due to malfunction of ribosomes which are assembled from such transcription units. To understand how the leader sequences act to facilitate the formation of the correct 30 S subunits we performed in vivo chemical probing to assess structural differences between ribosomes assembled either from rRNA transcribed from wild-type operons or from operons which contain mutations in the rRNA leader region. Cells transformed with plasmids containing the respective rRNA operons were reacted with dimethylsulphate (DMS). Ribosomes were isolated by sucrose gradient centrifugation and modified nucleotides within the 16 S rRNA were identified by primer extension reaction. Structural differences between ribosomes from wild-type and mutant rRNA operons occur in several clusters within the 16 S rRNA secondary structure. The most prominent differences are located in the central domain including the universally conserved pseudoknot structure which connects the 5', the central and the 3' domain of 16 S rRNA. Two other clusters with structural differences fall in the 5' domain where the leader had been shown to interact with mature 16 S rRNA and within the ribosomal protein S4 binding site. The other differences in structure are located in sites which are also known as sites for the action of several antibiotics. The data explain the functional defects of ribosomes from rRNA operons with leader mutations and help to

  13. A stochastic model of translation with -1 programmed ribosomal frameshifting

    NASA Astrophysics Data System (ADS)

    Bailey, Brenae L.; Visscher, Koen; Watkins, Joseph

    2014-02-01

    Many viruses produce multiple proteins from a single mRNA sequence by encoding overlapping genes. One mechanism to decode both genes, which reside in alternate reading frames, is -1 programmed ribosomal frameshifting. Although recognized for over 25 years, the molecular and physical mechanism of -1 frameshifting remains poorly understood. We have developed a mathematical model that treats mRNA translation and associated -1 frameshifting as a stochastic process in which the transition probabilities are based on the energetics of local molecular interactions. The model predicts both the location and efficiency of -1 frameshift events in HIV-1. Moreover, we compute -1 frameshift efficiencies upon mutations in the viral mRNA sequence and variations in relative tRNA abundances, predictions that are directly testable in experiment.

  14. The Evolution of the Ribosome and the Genetic Code

    PubMed Central

    Hartman, Hyman; Smith, Temple F.

    2014-01-01

    The evolution of the genetic code is mapped out starting with the aminoacyl tRNA-synthetases and their interaction with the operational code in the tRNA acceptor arm. Combining this operational code with a metric based on the biosynthesis of amino acids from the Citric acid, we come to the conclusion that the earliest genetic code was a Guanine Cytosine (GC) code. This has implications for the likely earliest positively charged amino acids. The progression from this pure GC code to the extant one is traced out in the evolution of the Large Ribosomal Subunit, LSU, and its proteins; in particular those associated with the Peptidyl Transfer Center (PTC) and the nascent peptide exit tunnel. This progression has implications for the earliest encoded peptides and their evolutionary progression into full complex proteins. PMID:25370196

  15. The emerging roles of ribosome biogenesis in craniofacial development.

    PubMed

    Ross, Adam P; Zarbalis, Konstantinos S

    2014-01-01

    Neural crest cells (NCCs) are a transient, migratory cell population, which originates during neurulation at the neural folds and contributes to the majority of tissues, including the mesenchymal structures of the craniofacial skeleton. The deregulation of the complex developmental processes that guide migration, proliferation, and differentiation of NCCs may result in a wide range of pathological conditions grouped together as neurocristopathies. Recently, due to their multipotent properties neural crest stem cells have received considerable attention as a possible source for stem cell based regenerative therapies. This exciting prospect underlines the need to further explore the developmental programs that guide NCC differentiation. This review explores the particular importance of ribosome biogenesis defects in this context since a specific interface between ribosomopathies and neurocristopathies exists as evidenced by disorders such as Treacher-Collins-Franceschetti syndrome (TCS) and Diamond-Blackfan anemia (DBA). PMID:24550838

  16. Ribosomal protein S6 kinase 1 signaling regulates mammalian lifespan

    PubMed Central

    Selman, Colin; Tullet, Jennifer M.A.; Wieser, Daniela; Irvine, Elaine; Lingard, Steven J.; Choudhury, Agharul I.; Claret, Marc; Al-Qassab, Hind; Carmignac, Danielle; Ramadani, Faruk; Woods, Angela; Robinson, Iain C.A.; Schuster, Eugene; Batterham, Rachel L.; Kozma, Sara C.; Thomas, George; Carling, David; Okkenhaug, Klaus; Thornton, Janet M.; Partridge, Linda; Gems, David; Withers, Dominic J.

    2016-01-01

    Caloric restriction (CR) protects against aging and disease but the mechanisms by which this affects mammalian lifespan are unclear. We show in mice that deletion of the nutrient-responsive mTOR (mammalian target of rapamycin) signaling pathway component ribosomal S6 protein kinase 1 (S6K1) led to increased lifespan and resistance to age-related pathologies such as bone, immune and motor dysfunction and loss of insulin sensitivity. Deletion of S6K1 induced gene expression patterns similar to those seen in CR or with pharmacological activation of adenosine monophosphate (AMP)-activated protein kinase (AMPK), a conserved regulator of the metabolic response to CR. Our results demonstrate that S6K1 influences healthy mammalian lifespan, and suggest therapeutic manipulation of S6K1 and AMPK might mimic CR and provide broad protection against diseases of aging. PMID:19797661

  17. Length-dependent translation of messenger RNA by ribosomes

    NASA Astrophysics Data System (ADS)

    Valleriani, Angelo; Zhang, Gong; Nagar, Apoorva; Ignatova, Zoya; Lipowsky, Reinhard

    2011-04-01

    A simple measure for the efficiency of protein synthesis by ribosomes is provided by the steady state amount of protein per messenger RNA (mRNA), the so-called translational ratio, which is proportional to the translation rate. Taking the degradation of mRNA into account, we show theoretically that both the translation rate and the translational ratio decrease with increasing mRNA length, in agreement with available experimental data for the prokaryote Escherichia coli. We also show that, compared to prokaryotes, mRNA degradation in eukaryotes leads to a less rapid decrease of the translational ratio. This finding is consistent with the fact that, compared to prokaryotes, eukaryotes tend to have longer proteins.

  18. The Fragmented Mitochondrial Ribosomal RNAs of Plasmodium falciparum

    PubMed Central

    Feagin, Jean E.; Harrell, Maria Isabel; Lee, Jung C.; Coe, Kevin J.; Sands, Bryan H.; Cannone, Jamie J.; Tami, Germaine; Schnare, Murray N.; Gutell, Robin R.

    2012-01-01

    Background The mitochondrial genome in the human malaria parasite Plasmodium falciparum is most unusual. Over half the genome is composed of the genes for three classic mitochondrial proteins: cytochrome oxidase subunits I and III and apocytochrome b. The remainder encodes numerous small RNAs, ranging in size from 23 to 190 nt. Previous analysis revealed that some of these transcripts have significant sequence identity with highly conserved regions of large and small subunit rRNAs, and can form the expected secondary structures. However, these rRNA fragments are not encoded in linear order; instead, they are intermixed with one another and the protein coding genes, and are coded on both strands of the genome. This unorthodox arrangement hindered the identification of transcripts corresponding to other regions of rRNA that are highly conserved and/or are known to participate directly in protein synthesis. Principal Findings The identification of 14 additional small mitochondrial transcripts from P. falcipaurm and the assignment of 27 small RNAs (12 SSU RNAs totaling 804 nt, 15 LSU RNAs totaling 1233 nt) to specific regions of rRNA are supported by multiple lines of evidence. The regions now represented are highly similar to those of the small but contiguous mitochondrial rRNAs of Caenorhabditis elegans. The P. falciparum rRNA fragments cluster on the interfaces of the two ribosomal subunits in the three-dimensional structure of the ribosome. Significance All of the rRNA fragments are now presumed to have been identified with experimental methods, and nearly all of these have been mapped onto the SSU and LSU rRNAs. Conversely, all regions of the rRNAs that are known to be directly associated with protein synthesis have been identified in the P. falciparum mitochondrial genome and RNA transcripts. The fragmentation of the rRNA in the P. falciparum mitochondrion is the most extreme example of any rRNA fragmentation discovered. PMID:22761677

  19. Hydroxylation of the eukaryotic ribosomal decoding center affects translational accuracy

    PubMed Central

    Loenarz, Christoph; Sekirnik, Rok; Thalhammer, Armin; Ge, Wei; Spivakovsky, Ekaterina; Mackeen, Mukram M.; McDonough, Michael A.; Cockman, Matthew E.; Kessler, Benedikt M.; Ratcliffe, Peter J.; Wolf, Alexander; Schofield, Christopher J.

    2014-01-01

    The mechanisms by which gene expression is regulated by oxygen are of considerable interest from basic science and therapeutic perspectives. Using mass spectrometric analyses of Saccharomyces cerevisiae ribosomes, we found that the amino acid residue in closest proximity to the decoding center, Pro-64 of the 40S subunit ribosomal protein Rps23p (RPS23 Pro-62 in humans) undergoes posttranslational hydroxylation. We identify RPS23 hydroxylases as a highly conserved eukaryotic subfamily of Fe(II) and 2-oxoglutarate dependent oxygenases; their catalytic domain is closely related to transcription factor prolyl trans-4-hydroxylases that act as oxygen sensors in the hypoxic response in animals. The RPS23 hydroxylases in S. cerevisiae (Tpa1p), Schizosaccharomyces pombe and green algae catalyze an unprecedented dihydroxylation modification. This observation contrasts with higher eukaryotes, where RPS23 is monohydroxylated; the human Tpa1p homolog OGFOD1 catalyzes prolyl trans-3-hydroxylation. TPA1 deletion modulates termination efficiency up to ∼10-fold, including of pathophysiologically relevant sequences; we reveal Rps23p hydroxylation as its molecular basis. In contrast to most previously characterized accuracy modulators, including antibiotics and the prion state of the S. cerevisiae translation termination factor eRF3, Rps23p hydroxylation can either increase or decrease translational accuracy in a stop codon context-dependent manner. We identify conditions where Rps23p hydroxylation status determines viability as a consequence of nonsense codon suppression. The results reveal a direct link between oxygenase catalysis and the regulation of gene expression at the translational level. They will also aid in the development of small molecules altering translational accuracy for the treatment of genetic diseases linked to nonsense mutations. PMID:24550462

  20. A rapid and simple pipeline for synthesis of mRNA-ribosome-V(H)H complexes used in single-domain antibody ribosome display.

    PubMed

    Bencurova, Elena; Pulzova, Lucia; Flachbartova, Zuzana; Bhide, Mangesh

    2015-06-01

    The single-domain antibody (VHH) is a promising building block for a number of antibody-based applications. Ribosome display can successfully be used in the production of VHH. However, the construction of the expression cassette, confirmation of the translation and proper folding of the nascent chain, and the purification of the ribosome complexes, remain cumbersome tasks. Additionally, selection of the most suitable expression system can be challenging. We have designed primers that will amplify virtually all Camelidae VHH. With the help of a double-overlap extension (OE) polymerase chain reaction (PCR) we have fused VHH with the F1 fragment (T7 promoter and species-independent translation sequence) and the F2 fragment (mCherry, Myc-tag, tether, SecM arrest sequence and 3' stem loop) to generate a full-length DNA cassette. OE-PCR generated fragments were incubated directly with cell-free lysates (Leishmania torentolae, rabbit reticulocyte or E. coli) for the synthesis of mRNA-VHH-mCherry-ribosome complexes in vitro. Alternatively, the cassette was ligated in pQE-30 vector and transformed into E. coli to produce ribosome complexes in vivo. The results showed that the same expression cassette could be used to synthesize ribosome complexes with different expression systems. mCherry reporter served to confirm the synthesis and proper folding of the nascent chain, Myc-tag was useful in the rapid purification of ribosome complexes, and combination of the SecM sequence and 3' stem loop made the cassette universal, both for cells-free and E. coli in vivo. This rapid and universal pipeline can effectively be used in antibody ribosome display and VHH production. PMID:25902394