Science.gov

Sample records for 28s ribosomal dna1

  1. Phylogenetic Analysis of Ruminant Theileria spp. from China Based on 28S Ribosomal RNA Gene

    PubMed Central

    Gou, Huitian; Guan, Guiquan; Ma, Miling; Liu, Aihong; Liu, Zhijie; Xu, Zongke; Ren, Qiaoyun; Li, Youquan; Yang, Jifei; Chen, Ze

    2013-01-01

    Species identification using DNA sequences is the basis for DNA taxonomy. In this study, we sequenced the ribosomal large-subunit RNA gene sequences (3,037-3,061 bp) in length of 13 Chinese Theileria stocks that were infective to cattle and sheep. The complete 28S rRNA gene is relatively difficult to amplify and its conserved region is not important for phylogenetic study. Therefore, we selected the D2-D3 region from the complete 28S rRNA sequences for phylogenetic analysis. Our analyses of 28S rRNA gene sequences showed that the 28S rRNA was useful as a phylogenetic marker for analyzing the relationships among Theileria spp. in ruminants. In addition, the D2-D3 region was a short segment that could be used instead of the whole 28S rRNA sequence during the phylogenetic analysis of Theileria, and it may be an ideal DNA barcode. PMID:24327775

  2. PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences

    PubMed Central

    Machida, Ryuji J.; Knowlton, Nancy

    2012-01-01

    Background Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. Methodology/Principal Findings Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. Conclusions/Significance The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S) and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other marker regions as targets

  3. The sequence of 28S ribosomal RNA varies within and between human cell lines.

    PubMed Central

    Leffers, H; Andersen, A H

    1993-01-01

    The primary structure of 28S ribosomal RNA constitutes a conserved core which is similar among most 23S-like rRNAs and expansion segments which occur at specific positions in the sequence. The expansion segments account for most of the size difference between prokaryotic (archaeal and eubacterial) and eukaryotic rRNAs and they exhibit a sequence variation which is unique among rRNAs. We have investigated the sequence variation of one of the expansion segments, V8, by sequencing a total of 111 V8 segments from 9 different human cell lines and tissues and have found 35 different variants. The variation occur mainly at two 'hot spots' which are separated by 170 nucleotides in the primary sequence but are neighbours in the secondary structure. The sequence of V8 segments varies both within and between human cell lines and tissues. The implications for the evolution of the eukaryotic 28S rRNA are discussed together with possible functions of the expansion segments. We also present a secondary structure model for the V8 segment based on comparative sequence analysis and chemical and enzymatic foot printing. Images PMID:8464736

  4. DISCRIMINATION 28S RIBOSOMAL GENE OF TREMATODE CERCARIAE IN SNAILS FROM CHIANG MAI PROVINCE, THAILAND.

    PubMed

    Wongsawad, Chalobol; Wongsawad, Pheravut; Sukontason, Kom; Phalee, Anawat; Noikong-Phalee, Waraporn; Chai, Jong Yil

    2016-03-01

    Trematode cercariae are commonly found in many freshwater gastropods. These cercariae can serve to identify the occurrence of such trematodes as Centrocestus formosanus, Haplorchis taichui, Haplorchoides sp, and Stellantchasmus falcatus, which are important parasites in Chiang Mai Province, Thailand. As the species of these cercariae cannot be identified accurately based on morphology, this study employed sequencing of a fragment of 28S ribosomal DNA and phylogenetic analysis to identify the trematode cercariae found in freshwater gastropods in Chiang Mai Province. Eight types of trematode cercariae were identified, namely, distome cercaria (grouped with Philophthalmus spp clade), echinostome cercaria (grouped with Echinostoma spp clade), furcocercous cercaria (grouped with Posthodiplostomum sp/Alaria taxideae/Hysteromorpha triloba clade), monostome cercaria (grouped with Catatropis indicus clade), parapleurolophocercous cercaria (grouped with Haplorchoides sp clade), pleurolophocercous cercaria (grouped with Centrocestusformosanus clade), transversotrema cercaria (grouped with Transversotrema spp clade), and xiphidiocercaria (grouped with Prosthodendrium spp clade). These results provide important information that can be used for identifying these parasites in epidemiological surveys. PMID:27244956

  5. Nucleotide sequence neighbouring a late modified guanylic residue within the 28S ribosomal RNA of several eukaryotic cells.

    PubMed Central

    Eladari, M E; Hampe, A; Galibert, F

    1977-01-01

    The nucleotide sequence of a particular T1 oligonucleotide found in 41S and 28S RNAs of several cellular cell lines (human, mouse, rat and chicken fibroblast) but absent in 45S ribosomal RNA has been deduced. Its primary structure : A-U-U*-G*-psi-U-C-A-C-C-C-A-C-U-A-A-U-A-Gp shows the presence of a modified G residue which explains the existence of this oligonucleotide in the T1 fingerprint of 41S RNA and 28S. Its absence on the 45S RNA T1 fingerprint is accounted for by a late modification. Images PMID:561392

  6. Studies on the low molecular weight RNA associated with 28S ribosomal RNA from Crotalus durissus terrificus liver.

    PubMed Central

    Giorgini, J F; De Lucca, F L

    1976-01-01

    A low molecular weight RNA was released from the purified rattlesnake 28 S RNA by brief heat treatment as well as by treatment with 80% dimethylsulfoxide or formamide. The sedimentation coeficient of this low molecular weight RNA was found to be 5.5 S, corresponding to a nucleotide number of 140 and a molecular weight of 46 000. It was also observed that 5.5S RNA is present in equimolar ratio to 5 S rRNA. Heat treatment of the purified 60 S ribosomal subunit also released the 5.5 S RNA. The possibility that this low molecular weight RNA is located on the surface of the large ribosomal subunit is discussed. PMID:1250695

  7. Identification of Dermatophyte Species by 28S Ribosomal DNA Sequencing with a Commercial Kit

    PubMed Central

    Ninet, Béatrice; Jan, Isabelle; Bontems, Olympia; Léchenne, Barbara; Jousson, Olivier; Panizzon, Renato; Lew, Daniel; Monod, Michel

    2003-01-01

    We have shown that dermatophyte species can be easily identified on the basis of a DNA sequence encoding a part of the large-subunit (LSU) rRNA (28S rRNA) by using the MicroSeq D2 LSU rRNA Fungal Sequencing Kit. Two taxa causing distinct dermatophytoses were clearly distinguished among isolates of the Trichophyton mentagrophytes species complex. PMID:12574293

  8. The SBP2 protein central to selenoprotein synthesis contacts the human ribosome at expansion segment 7L of the 28S rRNA.

    PubMed

    Kossinova, Olga; Malygin, Alexey; Krol, Alain; Karpova, Galina

    2014-07-01

    SBP2 is a pivotal protein component in selenoprotein synthesis. It binds the SECIS stem-loop in the 3' UTR of selenoprotein mRNA and interacts with both the specialized translation elongation factor and the ribosome at the 60S subunit. In this work, our goal was to identify the binding partners of SBP2 on the ribosome. Cross-linking experiments with bifunctional reagents demonstrated that the SBP2-binding site on the human ribosome is mainly formed by the 28S rRNA. Direct hydroxyl radical probing of the entire 28S rRNA revealed that SBP2 bound to 80S ribosomes or 60S subunits protects helix ES7L-E in expansion segment 7 of the 28S rRNA. Diepoxybutane cross-linking confirmed the interaction of SBP2 with helix ES7L-E. Additionally, binding of SBP2 to the ribosome led to increased reactivity toward chemical probes of a few bases in ES7L-E and in the universally conserved helix H89, indicative of conformational changes in the 28S rRNA in response to SBP2 binding. This study revealed for the first time that SBP2 makes direct contacts with a discrete region of the human 28S rRNA. PMID:24850884

  9. Proteomic analysis of the mammalian mitochondrial ribosome. Identification of protein components in the 28 S small subunit.

    PubMed

    Suzuki, T; Terasaki, M; Takemoto-Hori, C; Hanada, T; Ueda, T; Wada, A; Watanabe, K

    2001-08-31

    The mammalian mitochondrial ribosome (mitoribosome) has a highly protein-rich composition with a small sedimentation coefficient of 55 S, consisting of 39 S large and 28 S small subunits. In the previous study, we analyzed 39 S large subunit proteins from bovine mitoribosome (Suzuki, T., Terasaki, M., Takemoto-Hori, C., Hanada, T., Ueda, T., Wada, A., and Watanabe, K. (2001) J. Biol. Chem. 276, 21724-21736). The results suggested structural compensation for the rRNA deficit through proteins of increased molecular mass in the mitoribosome. We report here the identification of 28 S small subunit proteins. Each protein was separated by radical-free high-reducing two-dimensional polyacrylamide gel electrophoresis and analyzed by liquid chromatography/mass spectrometry/mass spectrometry using electrospray ionization/ion trap mass spectrometer to identify cDNA sequence by expressed sequence tag data base searches in silico. Twenty one proteins from the small subunit were identified, including 11 new proteins along with their complete cDNA sequences from human and mouse. In addition to these proteins, three new proteins were also identified in the 55 S mitoribosome. We have clearly identified a mitochondrial homologue of S12, which is a key regulatory protein of translation fidelity and a candidate for the autosomal dominant deafness gene, DFNA4. The apoptosis-related protein DAP3 was found to be a component of the small subunit, indicating a new function for the mitoribosome in programmed cell death. In summary, we have mapped a total of 55 proteins from the 55 S mitoribosome on the two-dimensional polyacrylamide gels. PMID:11402041

  10. Integration of Bombyx mori R2 Sequences into the 28S Ribosomal RNA Genes of Drosophila melanogaster

    PubMed Central

    Eickbush, Danna G.; Luan, Dongmei D.; Eickbush, Thomas H.

    2000-01-01

    R2 non-long-terminal-repeat retrotransposable elements integrate into a precise location in the 28S rRNA genes of arthropods. The purified protein encoded by R2 can cleave the 28S gene target site and use the 3′ hydroxyl group generated by this cleavage to prime reverse transcription of its own RNA, a process called target-primed reverse transcription. An integration system is described here in which components from the R2 element of the silkmoth, Bombyx mori, are injected into the preblastoderm embryo of Drosophila melanogaster. Silkmoth R2 sequences were readily detected in the 28S rRNA genes of the surviving adults as well as in the genes of their progeny. The 3′ junctions of these insertions were similar to those seen in our in vitro assays, as well as those from endogenous R2 retrotransposition events. The 5′ junctions of the insertions originally contained major deletions of both R2 and 28S gene sequences, a problem overcome by the inclusion of upstream 28S gene sequences at the 5′ end of the injected RNA. The resulting 5′ junctions suggested a recombination event between the cDNA and the upstream target sequences. This in vivo integration system should help determine the mechanism of R2 retrotransposition and be useful as a delivery system to integrate defined DNA sequences into the rRNA genes of organisms. PMID:10594024

  11. 28S ribosomal RNA sequences separate five prominent Lygus (Hemiptera: Miridae) pest species into three species clusters

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A segment of the nuclear 28S rRNA gene was compared among six species of Lygus (L. hesperus, L. keltoni, L. borealis, L. elisus, L. lineolaris, L. vanduzeei). The DNA sequences separate into three main groups. The LL group contains L. lineolaris and L. vanduzeei. Group LBLE is comprised of L. elisus...

  12. 28S ribosomal RNA sequences separate five prominent Lygus (Hemiptera: Miridae) pest species into three species clu

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A segment of the 28S rRNA gene was compared among six species of Lygus (L. hesperus, L. keltoni, L. borealis, L. elisus, L. lineolaris, L. vanduzeii). The DNA sequences separate into three main groups. The LL group contains L. lineolaris and L. vanduzeii. Group LBLE is comprised of L. elisus and mos...

  13. Phylogenetic Relationships of Tribes Within Harpalinae (Coleoptera: Carabidae) as Inferred from 28S Ribosomal DNA and the Wingless Gene

    PubMed Central

    Ober, Karen A.; Maddison, David R.

    2008-01-01

    Harpalinae is a large, monophyletic subfamily of carabid ground beetles containing more than 19,000 species in approximately 40 tribes. The higher level phylogenetic relationships within harpalines were investigated based on nucleotide data from two nuclear genes, wingless and 28S rDNA. Phylogenetic analyses of combined data indicate that many harpaline tribes are monophyletic, however the reconstructed trees showed little support for deeper nodes. In addition, our results suggest that the Lebiomorph Assemblage (tribes Lebiini, Cyclosomini, Graphipterini, Perigonini, Odacanthini, Lachnophorini, Pentagonicini, Catapiesini and Calophaenini), which is united by a morphological synapomorphy, is not monophyletic, and the tribe Lebiini is paraphyletic with respect to members of Cyclosomini. Two unexpected clades of tribes were supported: the Zuphiitae, comprised of Anthiini, Zuphiini, Helluonini, Dryptini, Galeritini, and Physocrotaphini; and a clade comprised of Orthogoniini, Pseudomorphini, and Graphipterini. The data presented in this study represent a dense sample of taxa to examine the molecular phylogeny of Harpalinae and provide a useful framework to examine the origin and evolution of morphological and ecological diversity in this group. PMID:20302528

  14. Higher-level phylogeny of the Therevidae (Diptera: insecta) based on 28S ribosomal and elongation factor-1 alpha gene sequences.

    PubMed

    Yang, L; Wiegmann, B M; Yeates, D K; Irwin, M E

    2000-06-01

    Therevidae (stilleto flies) are a little-known family of asiloid brachyceran Diptera (Insecta). Separate and combined phylogenetic analyses of 1200 bases of the 28S ribosomal DNA and 1100 bases of elongation factor-1alpha were used to infer phylogenetic relationships within the family. The position of the enigmatic taxon Apsilocephala Kröber is evaluated in light of the molecular evidence. In all analyses, molecular data strongly support the monophyly of Therevidae, excluding Apsilocephala, and the division of Therevidae into two main clades corresponding to a previous classification of the family into the subfamilies Phycinae and Therevinae. Despite strong support for some relationships within these groups, relationships at the base of the two main clades are weakly supported. Short branch lengths for Australasian clades at the base of the Therevinae may represent a rapid radiation of therevids in Australia. PMID:10860652

  15. The Strepsiptera problem: phylogeny of the holometabolous insect orders inferred from 18S and 28S ribosomal DNA sequences and morphology.

    PubMed

    Whiting, M F; Carpenter, J C; Wheeler, Q D; Wheeler, W C

    1997-03-01

    Phylogenetic relationships among the holometabolous insect orders were inferred from cladistic analysis of nucleotide sequences of 18S ribosomal DNA (rDNA) (85 exemplars) and 28S rDNA (52 exemplars) and morphological characters. Exemplar outgroup taxa were Collembola (1 sequence), Archaeognatha (1), Ephemerida (1), Odonata (2), Plecoptera (2), Blattodea (1), Mantodea (1), Dermaptera (1), Orthoptera (1), Phasmatodea (1), Embioptera (1), Psocoptera (1), Phthiraptera (1), Hemiptera (4), and Thysanoptera (1). Exemplar ingroup taxa were Coleoptera: Archostemata (1), Adephaga (2), and Polyphaga (7); Megaloptera (1); Raphidioptera (1); Neuroptera (sensu stricto = Planipennia): Mantispoidea (2), Hemerobioidea (2), and Myrmeleontoidea (2); Hymenoptera: Symphyta (4) and Apocrita (19); Trichoptera: Hydropsychoidea (1) and Limnephiloidea (2); Lepidoptera: Ditrysia (3); Siphonaptera: Pulicoidea (1) and Ceratophylloidea (2); Mecoptera: Meropeidae (1), Boreidae (1), Panorpidae (1), and Bittacidae (2); Diptera: Nematocera (1), Brachycera (2), and Cyclorrhapha (1); and Strepsiptera: Corioxenidae (1), Myrmecolacidae (1), Elenchidae (1), and Stylopidae (3). We analyzed approximately 1 kilobase of 18S rDNA, starting 398 nucleotides downstream of the 5' end, and approximately 400 bp of 28S rDNA in expansion segment D3. Multiple alignment of the 18S and 28S sequences resulted in 1,116 nucleotide positions with 24 insert regions and 398 positions with 14 insert regions, respectively. All Strepsiptera and Neuroptera have large insert regions in 18S and 28S. The secondary structure of 18S insert 23 is composed of long stems that are GC rich in the basal Strepsiptera and AT rich in the more derived Strepsiptera. A matrix of 176 morphological characters was analyzed for holometabolous orders. Incongruence length difference tests indicate that the 28S + morphological data sets are incongruent but that 28S + 18S, 18S + morphology, and 28S + 18S + morphology fail to reject the hypothesis of

  16. Secondary structure and phylogenetic utility of the ribosomal large subunit (28S) in monogeneans of the genus Thaparocleidus and Bifurcohaptor (Monogenea: Dactylogyridae).

    PubMed

    Chaudhary, Anshu; Singh, Hridaya Shanker

    2013-04-01

    Present communication deals with secondary structure of 28S rDNA of two already known species of monogeneans viz., Bifurcohaptor indicus and Thaparocleidus parvulus parasitizing gill filaments of a freshwater fish, Mystus vittatus for phylogenetic inference. Secondary structure data are best used as accessory taxonomic characters as their phylogenetic resolving power and confidence in validity. Secondary structure of the 28S rDNA transcript could provide information for identifying homologous nucleotide characters, useful for cladistic inference of relationships. Such structure data could be used as taxonomic character. The study supports that species-level sequence variability renders 28S sequence as a unique window for examining the behavior of fast evolving, non-coding DNA sequences. Apart from this it also confirms that molecular similarity present in various species could be host-induced. PMID:24431545

  17. Fungal community analysis in the deep-sea sediments of the Pacific Ocean assessed by comparison of ITS, 18S and 28S ribosomal DNA regions

    NASA Astrophysics Data System (ADS)

    Xu, Wei; Luo, Zhu-Hua; Guo, Shuangshuang; Pang, Ka-Lai

    2016-03-01

    We investigated the diversity of fungal communities in 6 different deep-sea sediment samples of the Pacific Ocean based on three different types of clone libraries, including internal transcribed spacer (ITS), 18S rDNA, and 28S rDNA regions. A total of 1978 clones were generated from 18 environmental clone libraries, resulting in 140 fungal operational taxonomic units (OTUs), including 18 OTUs from ITS, 44 OTUs from 18S rDNA, and 78 OTUs from 28S rDNA gene primer sets. The majority of the recovered sequences belonged to diverse phylotypes of the Ascomycota and Basidiomycota. Additionally, our study revealed a total of 46 novel fungal phylotypes, which showed low similarities (<97%) with available fungal sequences in the GenBank, including a novel Zygomycete lineage, suggesting possible new fungal taxa occurring in the deep-sea sediments. The results suggested that 28S rDNA is an efficient target gene to describe fungal community in deep-sea environment.

  18. Phylogenetic relationships of the marine Haplosclerida (Phylum Porifera) employing ribosomal (28S rRNA) and mitochondrial (cox1, nad1) gene sequence data.

    PubMed

    Redmond, Niamh E; Raleigh, Jean; van Soest, Rob W M; Kelly, Michelle; Travers, Simon A A; Bradshaw, Brian; Vartia, Salla; Stephens, Kelly M; McCormack, Grace P

    2011-01-01

    The systematics of the poriferan Order Haplosclerida (Class Demospongiae) has been under scrutiny for a number of years without resolution. Molecular data suggests that the order needs revision at all taxonomic levels. Here, we provide a comprehensive view of the phylogenetic relationships of the marine Haplosclerida using many species from across the order, and three gene regions. Gene trees generated using 28S rRNA, nad1 and cox1 gene data, under maximum likelihood and Bayesian approaches, are highly congruent and suggest the presence of four clades. Clade A is comprised primarily of species of Haliclona and Callyspongia, and clade B is comprised of H. simulans and H. vansoesti (Family Chalinidae), Amphimedon queenslandica (Family Niphatidae) and Tabulocalyx (Family Phloeodictyidae), Clade C is comprised primarily of members of the Families Petrosiidae and Niphatidae, while Clade D is comprised of Aka species. The polyphletic nature of the suborders, families and genera described in other studies is also found here. PMID:21931685

  19. Phylogenetic Relationships of the Marine Haplosclerida (Phylum Porifera) Employing Ribosomal (28S rRNA) and Mitochondrial (cox1, nad1) Gene Sequence Data

    PubMed Central

    Redmond, Niamh E.; Raleigh, Jean; van Soest, Rob W. M.; Kelly, Michelle; Travers, Simon A. A.; Bradshaw, Brian; Vartia, Salla; Stephens, Kelly M.; McCormack, Grace P.

    2011-01-01

    The systematics of the poriferan Order Haplosclerida (Class Demospongiae) has been under scrutiny for a number of years without resolution. Molecular data suggests that the order needs revision at all taxonomic levels. Here, we provide a comprehensive view of the phylogenetic relationships of the marine Haplosclerida using many species from across the order, and three gene regions. Gene trees generated using 28S rRNA, nad1 and cox1 gene data, under maximum likelihood and Bayesian approaches, are highly congruent and suggest the presence of four clades. Clade A is comprised primarily of species of Haliclona and Callyspongia, and clade B is comprised of H. simulans and H. vansoesti (Family Chalinidae), Amphimedon queenslandica (Family Niphatidae) and Tabulocalyx (Family Phloeodictyidae), Clade C is comprised primarily of members of the Families Petrosiidae and Niphatidae, while Clade D is comprised of Aka species. The polyphletic nature of the suborders, families and genera described in other studies is also found here. PMID:21931685

  20. Intragenomic sequence variation at the ITS1 - ITS2 region and at the 18S and 28S nuclear ribosomal DNA genes of the New Zealand mud snail, Potamopyrgus antipodarum (Hydrobiidae: mollusca)

    USGS Publications Warehouse

    Hoy, Marshal S.; Rodriguez, Rusty J.

    2013-01-01

    Molecular genetic analysis was conducted on two populations of the invasive non-native New Zealand mud snail (Potamopyrgus antipodarum), one from a freshwater ecosystem in Devil's Lake (Oregon, USA) and the other from an ecosystem of higher salinity in the Columbia River estuary (Hammond Harbor, Oregon, USA). To elucidate potential genetic differences between the two populations, three segments of nuclear ribosomal DNA (rDNA), the ITS1-ITS2 regions and the 18S and 28S rDNA genes were cloned and sequenced. Variant sequences within each individual were found in all three rDNA segments. Folding models were utilized for secondary structure analysis and results indicated that there were many sequences which contained structure-altering polymorphisms, which suggests they could be nonfunctional pseudogenes. In addition, analysis of molecular variance (AMOVA) was used for hierarchical analysis of genetic variance to estimate variation within and among populations and within individuals. AMOVA revealed significant variation in the ITS region between the populations and among clones within individuals, while in the 5.8S rDNA significant variation was revealed among individuals within the two populations. High levels of intragenomic variation were found in the ITS regions, which are known to be highly variable in many organisms. More interestingly, intragenomic variation was also found in the 18S and 28S rDNA, which has rarely been observed in animals and is so far unreported in Mollusca. We postulate that in these P. antipodarum populations the effects of concerted evolution are diminished due to the fact that not all of the rDNA genes in their polyploid genome should be essential for sustaining cellular function. This could lead to a lessening of selection pressures, allowing mutations to accumulate in some copies, changing them into variant sequences.                   

  1. Reconstruction of phylogenetic relationships in dermatomycete genus Trichophyton Malmsten 1848 based on ribosomal internal transcribed spacer region, partial 28S rRNA and beta-tubulin genes sequences.

    PubMed

    Pchelin, Ivan M; Zlatogursky, Vasily V; Rudneva, Mariya V; Chilina, Galina A; Rezaei-Matehkolaei, Ali; Lavnikevich, Dmitry M; Vasilyeva, Natalya V; Taraskina, Anastasia E

    2016-09-01

    Trichophyton spp. are important causative agents of superficial mycoses. The phylogeny of the genus and accurate strain identification, based on the ribosomal ITS region sequencing, are still under development. The present work is aimed at (i) inferring the genus phylogeny from partial ITS, LSU and BT2 sequences (ii) description of ribosomal ITS region polymorphism in 15 strains of Trichophyton interdigitale. We performed DNA sequence-based species identification and phylogenetic analysis on 48 strains belonging to the genus Trichophyton. Phylogenetic relationships were inferred by maximum likelihood and Bayesian methods on concatenated ITS, LSU and BT2 sequences. Ribosomal ITS region polymorphisms were assessed directly on the alignment. By phylogenetic reconstruction, we reveal major anthropophilic and zoophilic species clusters in the genus Trichophyton. We describe several sequences of the ITS region of T. interdigitale, which do not fit in the traditional polymorphism scheme and propose emendations in this scheme for discrimination between ITS sequence types in T. interdigitale. The new polymorphism scheme will allow inclusion of a wider spectrum of isolates while retaining its explanatory power. This scheme was also found to be partially congruent with NTS typing technique. PMID:27071492

  2. Molecular Identification of Sibling Species of Sclerodermus (Hymenoptera: Bethylidae) That Parasitize Buprestid and Cerambycid Beetles by Using Partial Sequences of Mitochondrial DNA Cytochrome Oxidase Subunit 1 and 28S Ribosomal RNA Gene

    PubMed Central

    Jiang, Yuan; Yang, Zhongqi; Wang, Xiaoyi; Hou, Yuxia

    2015-01-01

    The species belonging to Sclerodermus (Hymenoptera: Bethylidae) are currently the most important insect natural enemies of wood borer pests, mainly buprestid and cerambycid beetles, in China. However, some sibling species of this genus are very difficult to distinguish because of their similar morphological features. To address this issue, we conducted phylogenetic and genetic analyses of cytochrome oxidase subunit I (COI) and 28S RNA gene sequences from eight species of Sclerodermus reared from different wood borer pests. The eight sibling species were as follows: S. guani Xiao et Wu, S. sichuanensis Xiao, S. pupariae Yang et Yao, and Sclerodermus spp. (Nos. 1–5). A 594-bp fragment of COI and 750-bp fragment of 28S were subsequently sequenced. For COI, the G-C content was found to be low in all the species, averaging to about 30.0%. Sequence divergences (Kimura-2-parameter distances) between congeneric species averaged to 4.5%, and intraspecific divergences averaged to about 0.09%. Further, the maximum sequence divergences between congeneric species and Sclerodermus sp. (No. 5) averaged to about 16.5%. All 136 samples analyzed were included in six reciprocally monophyletic clades in the COI neighbor-joining (NJ) tree. The NJ tree inferred from the 28S rRNA sequence yielded almost identical results, but the samples from S. guani, S. sichuanensis, S. pupariae, and Sclerodermus spp. (Nos. 1–4) clustered together and only Sclerodermus sp. (No. 5) clustered separately. Our findings indicate that the standard barcode region of COI can be efficiently used to distinguish morphologically similar Sclerodermus species. Further, we speculate that Sclerodermus sp. (No. 5) might be a new species of Sclerodermus. PMID:25782000

  3. Ribosome-inactivating proteins

    PubMed Central

    Walsh, Matthew J; Dodd, Jennifer E; Hautbergue, Guillaume M

    2013-01-01

    Ribosome-inactivating proteins (RIPs) were first isolated over a century ago and have been shown to be catalytic toxins that irreversibly inactivate protein synthesis. Elucidation of atomic structures and molecular mechanism has revealed these proteins to be a diverse group subdivided into two classes. RIPs have been shown to exhibit RNA N-glycosidase activity and depurinate the 28S rRNA of the eukaryotic 60S ribosomal subunit. In this review, we compare archetypal RIP family members with other potent toxins that abolish protein synthesis: the fungal ribotoxins which directly cleave the 28S rRNA and the newly discovered Burkholderia lethal factor 1 (BLF1). BLF1 presents additional challenges to the current classification system since, like the ribotoxins, it does not possess RNA N-glycosidase activity but does irreversibly inactivate ribosomes. We further discuss whether the RIP classification should be broadened to include toxins achieving irreversible ribosome inactivation with similar turnovers to RIPs, but through different enzymatic mechanisms. PMID:24071927

  4. Fine mapping of 28S rRNA sites specifically cleaved in cells undergoing apoptosis.

    PubMed Central

    Houge, G; Robaye, B; Eikhom, T S; Golstein, J; Mellgren, G; Gjertsen, B T; Lanotte, M; Døskeland, S O

    1995-01-01

    Bona fide apoptosis in rat and human leukemia cells, rat thymocytes, and bovine endothelial cells was accompanied by limited and specific cleavage of polysome-associated and monosome-associated 28S rRNA, with 18S rRNA being spared. Specific 28S rRNA cleavage was observed in all instances of apoptotic death accompanied by internucleosomal DNA fragmentation, with cleavage of 28S rRNA and of DNA being linked temporally. This indicates that 28S rRNA fragmentation may be as general a feature of apoptosis as internucleosomal DNA fragmentation and that concerted specific cleavage of intra- and extranuclear polynucleotides occurs in apoptosis. Apoptosis-associated cleavage sites were mapped to the 28S rRNA divergent domains D2, D6 (endothelial cells), and D8. The D2 cuts occurred in hairpin loop junctions considered to be buried in the intact ribosome, suggesting that this rRNA region becomes a target for RNase attack in apoptotic cells. D8 was cleaved in two exposed UU(U) sequences in bulge loops. Treatment with agents causing necrotic cell death or aging of cell lysates failed to produce any detectable limited D2 cleavage but did produce a more generalized cleavage in the D8 region. Of potential functional interest was the finding that the primary cuts in D2 exactly flanked a 0.3-kb hypervariable subdomain (D2c), allowing excision of the latter. The implication of hypervariable rRNA domains in apoptosis represents the first association of any functional process with these enigmatic parts of the ribosomes. PMID:7891700

  5. Ribosomal proteins: functions beyond the ribosome

    PubMed Central

    Zhou, Xiang; Liao, Wen-Juan; Liao, Jun-Ming; Liao, Peng; Lu, Hua

    2015-01-01

    Although ribosomal proteins are known for playing an essential role in ribosome assembly and protein translation, their ribosome-independent functions have also been greatly appreciated. Over the past decade, more than a dozen of ribosomal proteins have been found to activate the tumor suppressor p53 pathway in response to ribosomal stress. In addition, these ribosomal proteins are involved in various physiological and pathological processes. This review is composed to overview the current understanding of how ribosomal stress provokes the accumulation of ribosome-free ribosomal proteins, as well as the ribosome-independent functions of ribosomal proteins in tumorigenesis, immune signaling, and development. We also propose the potential of applying these pieces of knowledge to the development of ribosomal stress-based cancer therapeutics. PMID:25735597

  6. Nearly Complete 28S rRNA Gene Sequences Confirm New Hypotheses of Sponge Evolution

    PubMed Central

    Thacker, Robert W.; Hill, April L.; Hill, Malcolm S.; Redmond, Niamh E.; Collins, Allen G.; Morrow, Christine C.; Spicer, Lori; Carmack, Cheryl A.; Zappe, Megan E.; Pohlmann, Deborah; Hall, Chelsea; Diaz, Maria C.; Bangalore, Purushotham V.

    2013-01-01

    The highly collaborative research sponsored by the NSF-funded Assembling the Porifera Tree of Life (PorToL) project is providing insights into some of the most difficult questions in metazoan systematics. Our understanding of phylogenetic relationships within the phylum Porifera has changed considerably with increased taxon sampling and data from additional molecular markers. PorToL researchers have falsified earlier phylogenetic hypotheses, discovered novel phylogenetic alliances, found phylogenetic homes for enigmatic taxa, and provided a more precise understanding of the evolution of skeletal features, secondary metabolites, body organization, and symbioses. Some of these exciting new discoveries are shared in the papers that form this issue of Integrative and Comparative Biology. Our analyses of over 300 nearly complete 28S ribosomal subunit gene sequences provide specific case studies that illustrate how our dataset confirms new hypotheses of sponge evolution. We recovered monophyletic clades for all 4 classes of sponges, as well as the 4 major clades of Demospongiae (Keratosa, Myxospongiae, Haploscleromorpha, and Heteroscleromorpha), but our phylogeny differs in several aspects from traditional classifications. In most major clades of sponges, families within orders appear to be paraphyletic. Although additional sampling of genes and taxa are needed to establish whether this pattern results from a lack of phylogenetic resolution or from a paraphyletic classification system, many of our results are congruent with those obtained from 18S ribosomal subunit gene sequences and complete mitochondrial genomes. These data provide further support for a revision of the traditional classification of sponges. PMID:23748742

  7. Nearly complete 28S rRNA gene sequences confirm new hypotheses of sponge evolution.

    PubMed

    Thacker, Robert W; Hill, April L; Hill, Malcolm S; Redmond, Niamh E; Collins, Allen G; Morrow, Christine C; Spicer, Lori; Carmack, Cheryl A; Zappe, Megan E; Pohlmann, Deborah; Hall, Chelsea; Diaz, Maria C; Bangalore, Purushotham V

    2013-09-01

    The highly collaborative research sponsored by the NSF-funded Assembling the Porifera Tree of Life (PorToL) project is providing insights into some of the most difficult questions in metazoan systematics. Our understanding of phylogenetic relationships within the phylum Porifera has changed considerably with increased taxon sampling and data from additional molecular markers. PorToL researchers have falsified earlier phylogenetic hypotheses, discovered novel phylogenetic alliances, found phylogenetic homes for enigmatic taxa, and provided a more precise understanding of the evolution of skeletal features, secondary metabolites, body organization, and symbioses. Some of these exciting new discoveries are shared in the papers that form this issue of Integrative and Comparative Biology. Our analyses of over 300 nearly complete 28S ribosomal subunit gene sequences provide specific case studies that illustrate how our dataset confirms new hypotheses of sponge evolution. We recovered monophyletic clades for all 4 classes of sponges, as well as the 4 major clades of Demospongiae (Keratosa, Myxospongiae, Haploscleromorpha, and Heteroscleromorpha), but our phylogeny differs in several aspects from traditional classifications. In most major clades of sponges, families within orders appear to be paraphyletic. Although additional sampling of genes and taxa are needed to establish whether this pattern results from a lack of phylogenetic resolution or from a paraphyletic classification system, many of our results are congruent with those obtained from 18S ribosomal subunit gene sequences and complete mitochondrial genomes. These data provide further support for a revision of the traditional classification of sponges. PMID:23748742

  8. 28s rDNA group-I introns: a powerful tool for identifying strains of Beauveria brongniartii.

    PubMed

    Neuvéglise, C; Brygoo, Y; Riba, G

    1997-04-01

    The nuclear ribosomal DNA of the entomopathogenic fungus Beauveria brongniartii is polymorphic in terms of both restriction site and length. Insertions of 350-450 bp long, identified as group-I introns, were detected in the 28s rDNA. A panel of 47 strains of B. brongniartii, two B. bassiana and one Metarhizium anisopliae of various geographical and biological origins were found to contain 14 variant forms of intron differing in size and restriction pattern, at four different positions. Twelve types of ribosomal large subunit were defined on the basis of variant distribution and compared with strain clustering based on internal transcribed spacers analysis. There was a correlation between the characteristic introns and isolates collected from the sugar cane pest Hoplochelus marginalis. Primers for polymerase chain reaction amplification were chosen from these variants, and used to develop a specific method for detecting strains pathogenic towards Hoplochelus. PMID:9131812

  9. Modification of ribosomal RNA by ribosome-inactivating proteins from plants.

    PubMed Central

    Stirpe, F; Bailey, S; Miller, S P; Bodley, J W

    1988-01-01

    We have surveyed 14 different toxic and nontoxic ribosome-inactivating proteins from plants for the ability to act on the RNA of the eucaryotic 60 S ribosomal subunit. All of these proteins act to introduce a specific modification into 26-28 S RNA which renders the RNA sensitive to cleavage by aniline. Sequence analysis of the 5'-termini of the fragments produced by ricin and saporin following aniline cleavage indicate that both proteins possess identical specificity. Our observations support the conclusion of Endo and Tsurugi (J. Biol. Chem. 262, 8128-8130, 1987) that ricin is a specific N-glycosidase and we have located the site of this cleavage by direct sequence analysis. Our results further suggest that all plant ribosome-inactivating proteins function as specific N-glycosidases with the same specificity. Images PMID:3347493

  10. Structures of Eukaryotic Ribosomal Stalk Proteins and Its Complex with Trichosanthin, and Their Implications in Recruiting Ribosome-Inactivating Proteins to the Ribosomes

    PubMed Central

    Choi, Andrew K. H.; Wong, Eddie C. K.; Lee, Ka-Ming; Wong, Kam-Bo

    2015-01-01

    Ribosome-inactivating proteins (RIP) are RNA N-glycosidases that inactivate ribosomes by specifically depurinating a conserved adenine residue at the α-sarcin/ricin loop of 28S rRNA. Recent studies have pointed to the involvement of the C-terminal domain of the eukaryotic stalk proteins in facilitating the toxic action of RIPs. This review highlights how structural studies of eukaryotic stalk proteins provide insights into the recruitment of RIPs to the ribosomes. Since the C-terminal domain of eukaryotic stalk proteins is involved in specific recognition of elongation factors and some eukaryote-specific RIPs (e.g., trichosanthin and ricin), we postulate that these RIPs may have evolved to hijack the translation-factor-recruiting function of ribosomal stalk in reaching their target site of rRNA. PMID:25723321

  11. The ribosome filter redux.

    PubMed

    Mauro, Vincent P; Edelman, Gerald M

    2007-09-15

    The ribosome filter hypothesis postulates that ribosomes are not simply translation machines but also function as regulatory elements that differentially affect or filter the translation of particular mRNAs. On the basis of new information, we take the opportunity here to review the ribosome filter hypothesis, suggest specific mechanisms of action, and discuss recent examples from the literature that support it. PMID:17890902

  12. Deconstructing ribosome construction

    PubMed Central

    Connolly, Keith; Culver, Gloria

    2013-01-01

    The ribosome is an essential ribonucleoprotein enzyme, and its biogenesis is a fundamental process in all living cells. Recent X-ray crystal structures of the bacterial ribosome and new technologies have allowed a greater interrogation of in vitro ribosome assembly; however, substantially less is known about ribosome biogenesis in vivo. Ongoing investigations are focused on elucidating the cellular processes that facilitate biogenesis of the ribosomal subunits, and many extraribosomal factors, including modification enzymes, remodeling enzymes and GTPases, are being uncovered. Moreover, specific roles for ribosome biogenesis factors in subunit maturation are now being elaborated. Ultimately, such studies will reveal a more complete understanding of processes at work in in vivo ribosome biogenesis. PMID:19376708

  13. Ribosomal RNA analysis in the diagnosis of Diamond-Blackfan Anaemia.

    PubMed

    Quarello, Paola; Garelli, Emanuela; Carando, Adriana; Mancini, Cecilia; Foglia, Luiselda; Botto, Carlotta; Farruggia, Piero; De Keersmaecker, Kim; Aspesi, Anna; Ellis, Steve R; Dianzani, Irma; Ramenghi, Ugo

    2016-03-01

    Diamond-Blackfan anaemia (DBA) is an inherited disease characterized by pure erythroid aplasia that has been tagged as a 'ribosomopathy'. We report a multi-centre study focused on the analysis of rRNA processing of 53 Italian DBA patients using capillary electrophoresis analysis of rRNA maturation of the 40S and 60S ribosomal subunits. The ratio of 28S/18S rRNA was higher in patients with mutated ribosomal proteins (RPs) of the small ribosomal subunit. In contrast, patients with mutated RPs of the large ribosomal subunit (RPLs) had a lower 28S/18S ratio. The assay reported here would be amenable for development as a diagnostic tool. PMID:26763766

  14. Ribosome. The complete structure of the 55S mammalian mitochondrial ribosome.

    PubMed

    Greber, Basil J; Bieri, Philipp; Leibundgut, Marc; Leitner, Alexander; Aebersold, Ruedi; Boehringer, Daniel; Ban, Nenad

    2015-04-17

    Mammalian mitochondrial ribosomes (mitoribosomes) synthesize mitochondrially encoded membrane proteins that are critical for mitochondrial function. Here we present the complete atomic structure of the porcine 55S mitoribosome at 3.8 angstrom resolution by cryo-electron microscopy and chemical cross-linking/mass spectrometry. The structure of the 28S subunit in the complex was resolved at 3.6 angstrom resolution by focused alignment, which allowed building of a detailed atomic structure including all of its 15 mitoribosomal-specific proteins. The structure reveals the intersubunit contacts in the 55S mitoribosome, the molecular architecture of the mitoribosomal messenger RNA (mRNA) binding channel and its interaction with transfer RNAs, and provides insight into the highly specialized mechanism of mRNA recruitment to the 28S subunit. Furthermore, the structure contributes to a mechanistic understanding of aminoglycoside ototoxicity. PMID:25837512

  15. Effect of alpha-sarcin and ribosome-inactivating proteins on the interaction of elongation factors with ribosomes.

    PubMed

    Brigotti, M; Rambelli, F; Zamboni, M; Montanaro, L; Sperti, S

    1989-02-01

    alpha-Sarcin from Aspergillus giganteus and the ribosome-inactivating proteins (RIPs) from higher plants inactivate the 60 S ribosomal subunit. The former is an RNAase, whereas RIPs are N-glycosidases. The site of cleavage of RNA and that of N-glycosidic depurinization are at one nucleotide distance in 28 S rRNA [Endo & Tsurugi (1987) J. Biol. Chem. 262, 8128-8130]. The effect of alpha-sarcin and that of RIPs on the interaction of elongation factors with Artemia salina (brine shrimp) ribosomes have been investigated. alpha-Sarcin inhibits both the EF1 (elongation factor 1)-dependent binding of aminoacyl-tRNA and the GTP-dependent binding of EF2 (elongation factor 2) to ribosomes, whereas two of the RIPs tested, ricin from Ricinus communis (castor bean) and volkensin from Adenia volkensii (kilyambiti), inhibit only the latter reaction. EF2 protects ribosomes from inactivation by both alpha-sarcin and ricin. The EF1-binding site is affected only by alpha-sarcin. The sensitivity of this site to alpha-sarcin is increased by pretreatment of ribosomes with ricin. A. salina ribosomes were highly resistant to the third RIP tested, namely gelonin from Gelonium multiflorum. All four proteins tested have, however, a comparable activity on the rabbit reticulocyte-lysate system. PMID:2930482

  16. The ribosomal database project.

    PubMed Central

    Larsen, N; Olsen, G J; Maidak, B L; McCaughey, M J; Overbeek, R; Macke, T J; Marsh, T L; Woese, C R

    1993-01-01

    The Ribosomal Database Project (RDP) is a curated database that offers ribosome data along with related programs and services. The offerings include phylogenetically ordered alignments of ribosomal RNA (rRNA) sequences, derived phylogenetic trees, rRNA secondary structure diagrams and various software packages for handling, analyzing and displaying alignments and trees. The data are available via ftp and electronic mail. Certain analytic services are also provided by the electronic mail server. PMID:8332524

  17. The Ribosomal Database Project.

    PubMed Central

    Maidak, B L; Larsen, N; McCaughey, M J; Overbeek, R; Olsen, G J; Fogel, K; Blandy, J; Woese, C R

    1994-01-01

    The Ribosomal Database Project (RDP) is a curated database that offers ribosome-related data, analysis services, and associated computer programs. The offerings include phylogenetically ordered alignments of ribosomal RNA (rRNA) sequences, derived phylogenetic trees, rRNA secondary structure diagrams, and various software for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (rdp.life.uiuc.edu), electronic mail (server/rdp.life.uiuc.edu) and gopher (rdpgopher.life.uiuc.edu). The electronic mail server also provides ribosomal probe checking, approximate phylogenetic placement of user-submitted sequences, screening for chimeric nature of newly sequenced rRNAs, and automated alignment. PMID:7524021

  18. Identification of group-I introns in the 28s rDNA of the entomopathogenic fungus Beauveria brongniartii.

    PubMed

    Neuvéglise, C; Brygoo, Y

    1994-12-01

    The length of the 28s ribosomal DNA differs significantly between two strains (Bt102 and Bt114) of the entomopathogenic fungus Beauveria brongniartii. RFLP analysis on PCR products revealed the presence of three insertional elements of 350-450 bp in strain Bt114. One of the insertions has been cloned and sequenced and shown to possess all the characteristic sequences and secondary structures of a group-IC intron. Its length is 428 bp and it is devoid of any long open reading frame. The distribution of this intron elsewhere in the genome of Bt114, as well as in the chromosomal ribosomal DNA, was studied. It seems to be present as seven copies in different genes not corresponding to the mitochondrial DNA. The presence of the intron in other strains of B. brongniartii was examined by the hybridization method. Some of them seemed to possess introns with a similar core although others presented no homology with the cloned fragment. PMID:7750145

  19. The Ribosomal Database Project

    PubMed Central

    Olsen, Gary J.; Overbeek, Ross; Larsen, Niels; Marsh, Terry L.; McCaughey, Michael J.; Maciukenas, Michael A.; Kuan, Wen-Min; Macke, Thomas J.; Xing, Yuqing; Woese, Carl R.

    1992-01-01

    The Ribosomal Database Project (RDP) compiles ribosomal sequences and related data, and redistributes them in aligned and phylogenetically ordered form to its user community. It also offers various software packages for handling, analyzing and displaying sequences. In addition, the RDP offers (or will offer) certain analytic services. At present the project is in an intermediate stage of development. PMID:1598241

  20. Precursor ribosomal ribonucleic acid and ribosome accumulation in vivo during the recovery of Salmonella typhimurium from thermal injury.

    PubMed

    Tomlins, R I; Ordal, Z J

    1971-07-01

    When cells of S. typhimurium were heated at 48 C for 30 min in phosphate buffer (pH 6.0), they became sensitive to Levine Eosin Methylene Blue Agar containing 2% NaCl (EMB-NaCl). The inoculation of injured cells into fresh growth medium supported the return of their normal tolerance to EMB-NaCl within 6 hr. The fractionation of ribosomal ribonucleic acid (rRNA) from unheated and heat-injured cells by polyacrylamide gel electrophoresis demonstrated that after injury the 16S RNA species was totally degraded and the 23S RNA was partially degraded. Sucrose gradient analysis demonstrated that after injury the 30S ribosomal subunit was totally destroyed and the sedimentation coefficient of the 50S particle was decreased to 47S. During the recovery of cells from thermal injury, four species of rRNA accumulated which were demonstrated to have the following sedimentation coefficients: 16, 17, 23, and 24S. Under identical recovery conditions, 22, 26, and 28S precursors of the 30S ribosomal subunit and 31 and 48S precursors of the 50S ribosomal subunit accumulated along with both the 30 and 50S mature particles. The addition of chloramphenicol to the recovery medium inhibited both the maturation of 17S RNA and the production of mature 30S ribosomal subunits, but permitted the accumulation of a single 22S precursor particle. Chloramphenicol did not affect either the maturation of 24S RNA or the mechanism of formation of 50S ribosomal subunits during recovery. Very little old ribosomal protein was associated with the new rRNA synthesized during recovery. New ribosomal proteins were synthesized during recovery and they were found associated with the new rRNA in ribosomal particles. The rate-limiting step in the recovery of S. typhimurium from thermal injury was in the maturation of the newly synthesized rRNA. PMID:4935315

  1. When ribosomes go bad: diseases of ribosome biogenesis

    PubMed Central

    Freed, Emily F.; Bleichert, Franziska; Dutca, Laura M.; Baserga, Susan J.

    2010-01-01

    Ribosomes are vital for cell growth and survival. Until recently, it was believed that mutations in ribosomes or ribosome biogenesis factors would be lethal, due to the essential nature of these complexes. However, in the last few decades, a number of diseases of ribosome biogenesis have been discovered. It remains a challenge in the field to elucidate the molecular mechanisms underlying them. PMID:20174677

  2. The ribosomal subunit assembly line

    PubMed Central

    Dlakić, Mensur

    2005-01-01

    Recent proteomic studies in Saccharomyces cerevisiae have identified nearly 200 proteins, other than the structural ribosomal proteins, that participate in the assembly of ribosomal subunits and their transport from the nucleus. In a separate line of research, proteomic studies of mature plant ribosomes have revealed considerable variability in the protein composition of individual ribosomes. PMID:16207363

  3. The ribosome returned

    PubMed Central

    Moore, Peter B

    2009-01-01

    Since the mid-1990s, insights obtained from electron microscopy and X-ray crystallography have transformed our understanding of how the most important ribozyme in the cell, the ribosome, catalyzes protein synthesis. This review provides a brief account of how this structural revolution came to pass, and the impact it has had on our understanding of how the ribosome decodes messenger RNAs. PMID:19222865

  4. Ribosome-omics of the human ribosome

    PubMed Central

    Gupta, Varun; Warner, Jonathan R.

    2014-01-01

    The torrent of RNA-seq data becoming available not only furnishes an overview of the entire transcriptome but also provides tools to focus on specific areas of interest. Our focus on the synthesis of ribosomes asked whether the abundance of mRNAs encoding ribosomal proteins (RPs) matched the equimolar need for the RPs in the assembly of ribosomes. We were at first surprised to find, in the mapping data of ENCODE and other sources, that there were nearly 100-fold differences in the level of the mRNAs encoding the different RPs. However, after correcting for the mapping ambiguities introduced by the presence of more than 2000 pseudogenes derived from RP mRNAs, we show that for 80%–90% of the RP genes, the molar ratio of mRNAs varies less than threefold, with little tissue specificity. Nevertheless, since the RPs are needed in equimolar amounts, there must be sluggish or regulated translation of the more abundant RP mRNAs and/or substantial turnover of unused RPs. In addition, seven of the RPs have subsidiary genes, three of which are pseudogenes that have been “rescued” by the introduction of promoters and/or upstream introns. Several of these are transcribed in a tissue-specific manner, e.g., RPL10L in testis and RPL3L in muscle, leading to potential variation in ribosome structure from one tissue to another. Of the 376 introns in the RP genes, a single one is alternatively spliced in a tissue-specific manner. PMID:24860015

  5. Paradigms of ribosome synthesis: Lessons learned from ribosomal proteins

    PubMed Central

    Gamalinda, Michael; Woolford, John L

    2015-01-01

    The proteome in all cells is manufactured via the intricate process of translation by multimolecular factories called ribosomes. Nevertheless, these ribonucleoprotein particles, the largest of their kind, also have an elaborate assembly line of their own. Groundbreaking discoveries that bacterial ribosomal subunits can be self-assembled in vitro jumpstarted studies on how ribosomes are constructed. Until recently, ribosome assembly has been investigated almost entirely in vitro with bacterial small subunits under equilibrium conditions. In light of high-resolution ribosome structures and a more sophisticated toolkit, the past decade has been defined by a burst of kinetic studies in vitro and, importantly, also a shift to examining ribosome maturation in living cells, especially in eukaryotes. In this review, we summarize the principles governing ribosome assembly that emerged from studies focusing on ribosomal proteins and their interactions with rRNA. Understanding these paradigms has taken center stage, given the linkage between anomalous ribosome biogenesis and proliferative disorders. PMID:26779413

  6. Cinnamomin: a multifunctional type II ribosome-inactivating protein.

    PubMed

    He, Wen-Jun; Liu, Wang-Yi

    2003-07-01

    Plant ribosome-inactivating proteins (RIPs) are a group of toxic proteins that can irreversibly inactivate ribosomes by specifically removing the conserved adenine base from the "Sarcin/Ricin domain" of the 28S RNA in ribosome. Cinnamomin is a novel type II RIP isolated in our laboratory from the mature seeds of camphor tree. Besides site-specific deadenylation of the A4324 in the Sarcin/Ricin domain of rat ribosome, this protein could also release the adenine base from DNA molecules at multiple sites and from AMP, ADP, dAMP and adenosine. Furthermore, cinnamomin displays cytotoxicity to carcinoma cells and insect larvae by modifying their ribosomal RNA. These functions possessed by cinnamomin shed a new light on the possible application of cinnamomin in the field of immunotoxin design and transgenic reagents. In this review, we introduce the major recent results on cinnamomin obtained in our laboratory, including purification of this protein, characterization of its enzymatic mechanism, structure and function, gene pattern, physiological role and its biological implications in cytotoxicity. PMID:12672471

  7. A tRNA methyltransferase paralog is important for ribosome stability and cell division in Trypanosoma brucei.

    PubMed

    Fleming, Ian M C; Paris, Zdeněk; Gaston, Kirk W; Balakrishnan, R; Fredrick, Kurt; Rubio, Mary Anne T; Alfonzo, Juan D

    2016-01-01

    Most eukaryotic ribosomes contain 26/28S, 5S, and 5.8S large subunit ribosomal RNAs (LSU rRNAs) in addition to the 18S rRNA of the small subunit (SSU rRNA). However, in kinetoplastids, a group of organisms that include medically important members of the genus Trypanosoma and Leishmania, the 26/28S large subunit ribosomal RNA is uniquely composed of 6 rRNA fragments. In addition, recent studies have shown the presence of expansion segments in the large ribosomal subunit (60S) of Trypanosoma brucei. Given these differences in structure, processing and assembly, T. brucei ribosomes may require biogenesis factors not found in other organisms. Here, we show that one of two putative 3-methylcytidine methyltransferases, TbMTase37 (a homolog of human methyltransferase-like 6, METTL6), is important for ribosome stability in T. brucei. TbMTase37 localizes to the nucleolus and depletion of the protein results in accumulation of ribosomal particles lacking srRNA 4 and reduced levels of polysome associated ribosomes. We also find that TbMTase37 plays a role in cytokinesis, as loss of the protein leads to multi-flagellated and multi-nucleated cells. PMID:26888608

  8. A tRNA methyltransferase paralog is important for ribosome stability and cell division in Trypanosoma brucei

    PubMed Central

    Fleming, Ian M. C.; Paris, Zdeněk; Gaston, Kirk W.; Balakrishnan, R.; Fredrick, Kurt; Rubio, Mary Anne T.; Alfonzo, Juan D.

    2016-01-01

    Most eukaryotic ribosomes contain 26/28S, 5S, and 5.8S large subunit ribosomal RNAs (LSU rRNAs) in addition to the 18S rRNA of the small subunit (SSU rRNA). However, in kinetoplastids, a group of organisms that include medically important members of the genus Trypanosoma and Leishmania, the 26/28S large subunit ribosomal RNA is uniquely composed of 6 rRNA fragments. In addition, recent studies have shown the presence of expansion segments in the large ribosomal subunit (60S) of Trypanosoma brucei. Given these differences in structure, processing and assembly, T. brucei ribosomes may require biogenesis factors not found in other organisms. Here, we show that one of two putative 3-methylcytidine methyltransferases, TbMTase37 (a homolog of human methyltransferase-like 6, METTL6), is important for ribosome stability in T. brucei. TbMTase37 localizes to the nucleolus and depletion of the protein results in accumulation of ribosomal particles lacking srRNA 4 and reduced levels of polysome associated ribosomes. We also find that TbMTase37 plays a role in cytokinesis, as loss of the protein leads to multi-flagellated and multi-nucleated cells. PMID:26888608

  9. Crystallography of ribosomal particles

    NASA Astrophysics Data System (ADS)

    Yonath, A.; Frolow, F.; Shoham, M.; Müssig, J.; Makowski, I.; Glotz, C.; Jahn, W.; Weinstein, S.; Wittmann, H. G.

    1988-07-01

    Several forms of three-dimensional crystals and two-dimensional sheets of intact ribosomes and their subunits have been obtained as a result of: (a) an extensive systematic investigation of the parameters involved in crystallization, (b) a development of an experimental procedure for controlling the volumes of the crystallization droplets, (c) a study of the nucleation process, and (d) introducing a delicate seeding procedure coupled with variations in the ratios of mono- and divalent ions in the crystallization medium. In all cases only biologically active particles could be crystallized, and the crystalline material retains its integrity and activity. Crystallographic data have been collected from crystals of 50S ribosomal subunits, using synchrotron radiation at temperatures between + 19 and - 180°C. Although at 4°C the higher resolution reflections decay within minutes in the synchrotron beam, at cryo-temperature there was hardly any radiation damage, and a complete set of data to about 6Åresolution could be collected from a single crystal. Heavy-atom clusters were used for soaking as well as for specific binding to the surface of the ribosomal subunits prior to crystallization. The 50S ribosomal subunits from a mutant of B. stearothermophilus which lacks the ribosomal protein BL11 crystallize isomorphously with in the native ones. Models, aimed to be used for low resolution phasing, have been reconstructed from two-dimensional sheets of 70S ribosomes and 50S subunits at 47 and 30Å, respectively. These models show the overall structure of these particles, the contact areas between the large and small subunits, the space where protein synthesis might take place and a tunnel which may provide the path for the nascent protein chain.

  10. The Ribosome Comes Alive

    PubMed Central

    2010-01-01

    This essay is a reflection on the ways the X-ray structures of the ribosome are helping in the interpretation of cryogenic electron microscopy (cryo-EM) density maps showing the translating ribosome in motion. Through advances in classification methods, cryo-EM and single-particle reconstruction methods have recently evolved to the point where they can yield an array of structures from a single sample (“story in a sample”), providing snapshots of an entire subprocess of translation, such as translocation or decoding. PMID:21072331

  11. The Ribosome Comes Alive.

    PubMed

    Frank, Joachim

    2010-06-18

    This essay is a reflection on the ways the X-ray structures of the ribosome are helping in the interpretation of cryogenic electron microscopy (cryo-EM) density maps showing the translating ribosome in motion. Through advances in classification methods, cryo-EM and single-particle reconstruction methods have recently evolved to the point where they can yield an array of structures from a single sample ("story in a sample"), providing snapshots of an entire subprocess of translation, such as translocation or decoding. PMID:21072331

  12. A ribosome-inactivating protein in a Drosophila defensive symbiont.

    PubMed

    Hamilton, Phineas T; Peng, Fangni; Boulanger, Martin J; Perlman, Steve J

    2016-01-12

    Vertically transmitted symbionts that protect their hosts against parasites and pathogens are well known from insects, yet the underlying mechanisms of symbiont-mediated defense are largely unclear. A striking example of an ecologically important defensive symbiosis involves the woodland fly Drosophila neotestacea, which is protected by the bacterial endosymbiont Spiroplasma when parasitized by the nematode Howardula aoronymphium. The benefit of this defense strategy has led to the rapid spread of Spiroplasma throughout the range of D. neotestacea, although the molecular basis for this protection has been unresolved. Here, we show that Spiroplasma encodes a ribosome-inactivating protein (RIP) related to Shiga-like toxins from enterohemorrhagic Escherichia coli and that Howardula ribosomal RNA (rRNA) is depurinated during Spiroplasma-mediated protection of D. neotestacea. First, we show that recombinant Spiroplasma RIP catalyzes depurination of 28S rRNAs in a cell-free assay, as well as Howardula rRNA in vitro at the canonical RIP target site within the α-sarcin/ricin loop (SRL) of 28S rRNA. We then show that Howardula parasites in Spiroplasma-infected flies show a strong signal of rRNA depurination consistent with RIP-dependent modification and large decreases in the proportion of 28S rRNA intact at the α-sarcin/ricin loop. Notably, host 28S rRNA is largely unaffected, suggesting targeted specificity. Collectively, our study identifies a novel RIP in an insect defensive symbiont and suggests an underlying RIP-dependent mechanism in Spiroplasma-mediated defense. PMID:26712000

  13. A ribosome-inactivating protein in a Drosophila defensive symbiont

    PubMed Central

    Hamilton, Phineas T.; Peng, Fangni; Boulanger, Martin J.; Perlman, Steve J.

    2016-01-01

    Vertically transmitted symbionts that protect their hosts against parasites and pathogens are well known from insects, yet the underlying mechanisms of symbiont-mediated defense are largely unclear. A striking example of an ecologically important defensive symbiosis involves the woodland fly Drosophila neotestacea, which is protected by the bacterial endosymbiont Spiroplasma when parasitized by the nematode Howardula aoronymphium. The benefit of this defense strategy has led to the rapid spread of Spiroplasma throughout the range of D. neotestacea, although the molecular basis for this protection has been unresolved. Here, we show that Spiroplasma encodes a ribosome-inactivating protein (RIP) related to Shiga-like toxins from enterohemorrhagic Escherichia coli and that Howardula ribosomal RNA (rRNA) is depurinated during Spiroplasma-mediated protection of D. neotestacea. First, we show that recombinant Spiroplasma RIP catalyzes depurination of 28S rRNAs in a cell-free assay, as well as Howardula rRNA in vitro at the canonical RIP target site within the α-sarcin/ricin loop (SRL) of 28S rRNA. We then show that Howardula parasites in Spiroplasma-infected flies show a strong signal of rRNA depurination consistent with RIP-dependent modification and large decreases in the proportion of 28S rRNA intact at the α-sarcin/ricin loop. Notably, host 28S rRNA is largely unaffected, suggesting targeted specificity. Collectively, our study identifies a novel RIP in an insect defensive symbiont and suggests an underlying RIP-dependent mechanism in Spiroplasma-mediated defense. PMID:26712000

  14. Ribosome Assembly as Antimicrobial Target.

    PubMed

    Nikolay, Rainer; Schmidt, Sabine; Schlömer, Renate; Deuerling, Elke; Nierhaus, Knud H

    2016-01-01

    Many antibiotics target the ribosome and interfere with its translation cycle. Since translation is the source of all cellular proteins including ribosomal proteins, protein synthesis and ribosome assembly are interdependent. As a consequence, the activity of translation inhibitors might indirectly cause defective ribosome assembly. Due to the difficulty in distinguishing between direct and indirect effects, and because assembly is probably a target in its own right, concepts are needed to identify small molecules that directly inhibit ribosome assembly. Here, we summarize the basic facts of ribosome targeting antibiotics. Furthermore, we present an in vivo screening strategy that focuses on ribosome assembly by a direct fluorescence based read-out that aims to identify and characterize small molecules acting as primary assembly inhibitors. PMID:27240412

  15. Ribosome Assembly as Antimicrobial Target

    PubMed Central

    Nikolay, Rainer; Schmidt, Sabine; Schlömer, Renate; Deuerling, Elke; Nierhaus, Knud H.

    2016-01-01

    Many antibiotics target the ribosome and interfere with its translation cycle. Since translation is the source of all cellular proteins including ribosomal proteins, protein synthesis and ribosome assembly are interdependent. As a consequence, the activity of translation inhibitors might indirectly cause defective ribosome assembly. Due to the difficulty in distinguishing between direct and indirect effects, and because assembly is probably a target in its own right, concepts are needed to identify small molecules that directly inhibit ribosome assembly. Here, we summarize the basic facts of ribosome targeting antibiotics. Furthermore, we present an in vivo screening strategy that focuses on ribosome assembly by a direct fluorescence based read-out that aims to identify and characterize small molecules acting as primary assembly inhibitors. PMID:27240412

  16. Structural insights into ribosome translocation.

    PubMed

    Ling, Clarence; Ermolenko, Dmitri N

    2016-09-01

    During protein synthesis, tRNA and mRNA are translocated from the A to P to E sites of the ribosome thus enabling the ribosome to translate one codon of mRNA after the other. Ribosome translocation along mRNA is induced by the universally conserved ribosome GTPase, elongation factor G (EF-G) in bacteria and elongation factor 2 (EF-2) in eukaryotes. Recent structural and single-molecule studies revealed that tRNA and mRNA translocation within the ribosome is accompanied by cyclic forward and reverse rotations between the large and small ribosomal subunits parallel to the plane of the intersubunit interface. In addition, during ribosome translocation, the 'head' domain of small ribosomal subunit undergoes forward- and back-swiveling motions relative to the rest of the small ribosomal subunit around the axis that is orthogonal to the axis of intersubunit rotation. tRNA/mRNA translocation is also coupled to the docking of domain IV of EF-G into the A site of the small ribosomal subunit that converts the thermally driven motions of the ribosome and tRNA into the forward translocation of tRNA/mRNA inside the ribosome. Despite recent and enormous progress made in the understanding of the molecular mechanism of ribosome translocation, the sequence of structural rearrangements of the ribosome, EF-G and tRNA during translocation is still not fully established and awaits further investigation. WIREs RNA 2016, 7:620-636. doi: 10.1002/wrna.1354 For further resources related to this article, please visit the WIREs website. PMID:27117863

  17. Ribosomal Database Project II

    DOE Data Explorer

    The Ribosomal Database Project (RDP) provides ribosome related data and services to the scientific community, including online data analysis and aligned and annotated Bacterial small-subunit 16S rRNA sequences. As of March 2008, RDP Release 10 is available and currently (August 2009) contains 1,074,075 aligned 16S rRNA sequences. Data that can be downloaded include zipped GenBank and FASTA alignment files, a histogram (in Excel) of the number of RDP sequences spanning each base position, data in the Functional Gene Pipeline Repository, and various user submitted data. The RDP-II website also provides numerous analysis tools.[From the RDP-II home page at http://rdp.cme.msu.edu/index.jsp

  18. Ribotoxic stress response: activation of the stress-activated protein kinase JNK1 by inhibitors of the peptidyl transferase reaction and by sequence-specific RNA damage to the alpha-sarcin/ricin loop in the 28S rRNA.

    PubMed Central

    Iordanov, M S; Pribnow, D; Magun, J L; Dinh, T H; Pearson, J A; Chen, S L; Magun, B E

    1997-01-01

    Inhibition of protein synthesis per se does not potentiate the stress-activated protein kinases (SAPKs; also known as cJun NH2-terminal kinases [JNKs]). The protein synthesis inhibitor anisomycin, however, is a potent activator of SAPKs/JNKs. The mechanism of this activation is unknown. We provide evidence that in order to activate SAPK/JNK1, anisomycin requires ribosomes that are translationally active at the time of contact with the drug, suggesting a ribosomal origin of the anisomycin-induced signaling to SAPK/JNK1. In support of this notion, we have found that aminohexose pyrimidine nucleoside antibiotics, which bind to the same region in the 28S rRNA that is the target site for anisomycin, are also potent activators of SAPK/JNK1. Binding of an antibiotic to the 28S rRNA interferes with the functioning of the molecule by altering the structural interactions of critical regions. We hypothesized, therefore, that such alterations in the 28S rRNA may act as recognition signals to activate SAPK/JNK1. To test this hypothesis, we made use of two ribotoxic enzymes, ricin A chain and alpha-sarcin, both of which catalyze sequence-specific RNA damage in the 28S rRNA. Consistent with our hypothesis, ricin A chain and alpha-sarcin were strong agonists of SAPK/JNK1 and of its activator SEK1/MKK4 and induced the expression of the immediate-early genes c-fos and c-jun. As in the case of anisomycin, ribosomes that were active at the time of exposure to ricin A chain or alpha-sarcin were able to initiate signal transduction from the damaged 28S rRNA to SAPK/JNK1 while inactive ribosomes were not. PMID:9154836

  19. Hindered proton collectivity in the proton-rich nucleus 28S: Possible magic number Z = 16

    NASA Astrophysics Data System (ADS)

    Togano, Y.; Yamada, Y.; Iwasa, N.; Yamada, K.; Motobayashi, T.; Aoi, N.; Baba, H.; Bishop, S.; Cai, X.; Doornenbal, P.; Fang, D.; Furukawa, T.; Ieki, K.; Kawabata, T.; Kanno, S.; Kobayashi, N.; Kondo, Y.; Kuboki, T.; Kume, N.; Kurita, K.; Kurokawa, M.; Ma, Y. G.; Matsuo, Y.; Murakami, H.; Matsushita, M.; Nakamura, T.; Okada, K.; Ota, S.; Satou, Y.; Shimoura, S.; Shioda, R.; Tanaka, K. N.; Takeuchi, S.; Tian, W.; Wang, H.; Wang, J.; Yoneda, K.

    2012-10-01

    The reduced transition probability B(E2;0gs+→21+) for the proton-rich nucleus 28S was determined experimentally using intermediate-energy Coulomb excitation. The resultant B(E2) value 181(31) e2fm4 is smaller than those of neighboring N = 12 isotones and Z = 16 isotopes. The double ratio |Mn/Mp|/(N/Z) of the 0gs+→21+ transition in 28S was obtained to be 1.9(2) by evaluating the Mn value from the known B(E2) value of the mirror nucleus 28Mg, showing the hindrance of proton collectivity relative to that of neutrons. These results indicate the emergence of the magic number Z = 16 in 28S.

  20. Ribosome recycling induces optimal translation rate at low ribosomal availability.

    PubMed

    Marshall, E; Stansfield, I; Romano, M C

    2014-09-01

    During eukaryotic cellular protein synthesis, ribosomal translation is made more efficient through interaction between the two ends of the messenger RNA (mRNA). Ribosomes reaching the 3' end of the mRNA can thus recycle and begin translation again on the same mRNA, the so-called 'closed-loop' model. Using a driven diffusion lattice model of translation, we study the effects of ribosome recycling on the dynamics of ribosome flow and density on the mRNA. We show that ribosome recycling induces a substantial increase in ribosome current. Furthermore, for sufficiently large values of the recycling rate, the lattice does not transition directly from low to high ribosome density, as seen in lattice models without recycling. Instead, a maximal current phase becomes accessible for much lower values of the initiation rate, and multiple phase transitions occur over a wide region of the phase plane. Crucially, we show that in the presence of ribosome recycling, mRNAs can exhibit a peak in protein production at low values of the initiation rate, beyond which translation rate decreases. This has important implications for translation of certain mRNAs, suggesting that there is an optimal concentration of ribosomes at which protein synthesis is maximal, and beyond which translational efficiency is impaired. PMID:25008084

  1. Ribosome recycling induces optimal translation rate at low ribosomal availability

    PubMed Central

    Marshall, E.; Stansfield, I.; Romano, M. C.

    2014-01-01

    During eukaryotic cellular protein synthesis, ribosomal translation is made more efficient through interaction between the two ends of the messenger RNA (mRNA). Ribosomes reaching the 3′ end of the mRNA can thus recycle and begin translation again on the same mRNA, the so-called ‘closed-loop’ model. Using a driven diffusion lattice model of translation, we study the effects of ribosome recycling on the dynamics of ribosome flow and density on the mRNA. We show that ribosome recycling induces a substantial increase in ribosome current. Furthermore, for sufficiently large values of the recycling rate, the lattice does not transition directly from low to high ribosome density, as seen in lattice models without recycling. Instead, a maximal current phase becomes accessible for much lower values of the initiation rate, and multiple phase transitions occur over a wide region of the phase plane. Crucially, we show that in the presence of ribosome recycling, mRNAs can exhibit a peak in protein production at low values of the initiation rate, beyond which translation rate decreases. This has important implications for translation of certain mRNAs, suggesting that there is an optimal concentration of ribosomes at which protein synthesis is maximal, and beyond which translational efficiency is impaired. PMID:25008084

  2. Ribosomes in a Stacked Array

    PubMed Central

    Yamashita, Yui; Kadokura, Yoshitomo; Sotta, Naoyuki; Fujiwara, Toru; Takigawa, Ichigaku; Satake, Akiko; Onouchi, Hitoshi; Naito, Satoshi

    2014-01-01

    Expression of CGS1, which codes for an enzyme of methionine biosynthesis, is feedback-regulated by mRNA degradation in response to S-adenosyl-l-methionine (AdoMet). In vitro studies revealed that AdoMet induces translation arrest at Ser-94, upon which several ribosomes stack behind the arrested one, and mRNA degradation occurs at multiple sites that presumably correspond to individual ribosomes in a stacked array. Despite the significant contribution of stacked ribosomes to inducing mRNA degradation, little is known about the ribosomes in the stacked array. Here, we assigned the peptidyl-tRNA species of the stacked second and third ribosomes to their respective codons and showed that they are arranged at nine-codon intervals behind the Ser-94 codon, indicating tight stacking. Puromycin reacts with peptidyl-tRNA in the P-site, releasing the nascent peptide as peptidyl-puromycin. This reaction is used to monitor the activity of the peptidyltransferase center (PTC) in arrested ribosomes. Puromycin reaction of peptidyl-tRNA on the AdoMet-arrested ribosome, which is stalled at the pre-translocation step, was slow. This limited reactivity can be attributed to the peptidyl-tRNA occupying the A-site at this step rather than to suppression of PTC activity. In contrast, puromycin reactions of peptidyl-tRNA with the stacked second and third ribosomes were slow but were not as slow as pre-translocation step ribosomes. We propose that the anticodon end of peptidyl-tRNA resides in the A-site of the stacked ribosomes and that the stacked ribosomes are stalled at an early step of translocation, possibly at the P/E hybrid state. PMID:24652291

  3. Exploring Ribosome Positioning on Translating Transcripts with Ribosome Profiling.

    PubMed

    Spealman, Pieter; Wang, Hao; May, Gemma; Kingsford, Carl; McManus, C Joel

    2016-01-01

    Recent technological advances (e.g., microarrays and massively parallel sequencing) have facilitated genome-wide measurement of many aspects of gene regulation. Ribosome profiling is a high-throughput sequencing method used to measure gene expression at the level of translation. This is accomplished by quantifying both the number of translating ribosomes and their locations on mRNA transcripts. The inventors of this approach have published several methods papers detailing its implementation and addressing the basics of ribosome profiling data analysis. Here we describe our lab's procedure, which differs in some respects from those published previously. In addition, we describe a data analysis pipeline, Ribomap, for ribosome profiling data. Ribomap allocates sequence reads to alternative mRNA isoforms, normalizes sequencing bias along transcripts using RNA-seq data, and outputs count vectors of per-codon ribosome occupancy for each transcript. PMID:26463378

  4. Requirement for SAPK-JNK signaling in the induction of apoptosis by ribosomal stress in REH lymphoid leukemia cells.

    PubMed

    Johnson, C R; Jiffar, T; Fischer, U M; Ruvolo, P P; Jarvis, W D

    2003-11-01

    The present studies examined performance of SAPK cascades and apoptotic commitment following ribosomal trauma in REH lymphoid leukemia cells. Ribostatic insults included disruption of ribosomal activity by mechanistically dissimilar agents such as blasticidin-S (BCS) (which binds 28S-rRNA to block peptidyl bond formation), kasugamycin (KSM) (which binds 18S-rRNA to prevent translational initiation), and cycloheximide (CHX) (which blocks A-site to P-site translocation of peptidyl-tRNA). Exposure of REH cells to BCS elicited DNA degradation and apoptotic cytolysis. BCS stimulated JNK1/JNK2 and p38, and their shared targets c-Jun and ATF2. Inhibition of JNK1/JNK2 (but not of p38) antagonized blasticidin-induced apoptosis, whereas targeting alternative ribosomal sites with KSM or CHX limited translation, but failed to activate the SAPK cascade or initiate apoptosis. Our findings indicate that interference with 28S-rRNA by BCS initiates apoptosis in REH cells through recruitment of SAPK-JNK signaling. Disparities between the lethal actions of BCS, KSM, and CHX appear to reflect established differences in the subribosomal targets of these agents. We propose that the SAPK cascade comprises an essential mechanism for the transduction of specific lethal stress signals emanating from active ribosomes, and that interference with the 28S-rRNA, rather than the peptidyl transfer center of the large subunit, is critical to apoptotic commitment. PMID:12970763

  5. The complete structure of the large subunit of the mammalian mitochondrial ribosome.

    PubMed

    Greber, Basil J; Boehringer, Daniel; Leibundgut, Marc; Bieri, Philipp; Leitner, Alexander; Schmitz, Nikolaus; Aebersold, Ruedi; Ban, Nenad

    2014-11-13

    Mitochondrial ribosomes (mitoribosomes) are extensively modified ribosomes of bacterial descent specialized for the synthesis and insertion of membrane proteins that are critical for energy conversion and ATP production inside mitochondria. Mammalian mitoribosomes, which comprise 39S and 28S subunits, have diverged markedly from the bacterial ribosomes from which they are derived, rendering them unique compared to bacterial, eukaryotic cytosolic and fungal mitochondrial ribosomes. We have previously determined at 4.9 Å resolution the architecture of the porcine (Sus scrofa) 39S subunit, which is highly homologous to the human mitoribosomal large subunit. Here we present the complete atomic structure of the porcine 39S large mitoribosomal subunit determined in the context of a stalled translating mitoribosome at 3.4 Å resolution by cryo-electron microscopy and chemical crosslinking/mass spectrometry. The structure reveals the locations and the detailed folds of 50 mitoribosomal proteins, shows the highly conserved mitoribosomal peptidyl transferase active site in complex with its substrate transfer RNAs, and defines the path of the nascent chain in mammalian mitoribosomes along their idiosyncratic exit tunnel. Furthermore, we present evidence that a mitochondrial tRNA has become an integral component of the central protuberance of the 39S subunit where it architecturally substitutes for the absence of the 5S ribosomal RNA, a ubiquitous component of all cytoplasmic ribosomes. PMID:25271403

  6. Human C4orf14 interacts with the mitochondrial nucleoid and is involved in the biogenesis of the small mitochondrial ribosomal subunit

    PubMed Central

    He, J.; Cooper, H. M.; Reyes, A.; Di Re, M.; Kazak, L.; Wood, S. R.; Mao, C. C.; Fearnley, I. M.; Walker, J. E.; Holt, I. J.

    2012-01-01

    The bacterial homologue of C4orf14, YqeH, has been linked to assembly of the small ribosomal subunit. Here, recombinant C4orf14 isolated from human cells, co-purified with the small, 28S subunit of the mitochondrial ribosome and the endogenous protein co-fractionated with the 28S subunit in sucrose gradients. Gene silencing of C4orf14 specifically affected components of the small subunit, leading to decreased protein synthesis in the organelle. The GTPase of C4orf14 was critical to its interaction with the 28S subunit, as was GTP. Therefore, we propose that C4orf14, with bound GTP, binds to components of the 28S subunit facilitating its assembly, and GTP hydrolysis acts as the release mechanism. C4orf14 was also found to be associated with human mitochondrial nucleoids, and C4orf14 gene silencing caused mitochondrial DNA depletion. In vitro C4orf14 is capable of binding to DNA. The association of C4orf14 with mitochondrial translation factors and the mitochondrial nucleoid suggests that the 28S subunit is assembled at the mitochondrial nucleoid, enabling the direct transfer of messenger RNA from the nucleoid to the ribosome in the organelle. PMID:22447445

  7. Phylogenetic utility of ribosomal genes for reconstructing the phylogeny of five Chinese satyrine tribes (Lepidoptera, Nymphalidae)

    PubMed Central

    Yang, Mingsheng; Zhang, Yalin

    2015-01-01

    Abstract Satyrinae is one of twelve subfamilies of the butterfly family Nymphalidae, which currently includes nine tribes. However, phylogenetic relationships among them remain largely unresolved, though different researches have been conducted based on both morphological and molecular data. However, ribosomal genes have never been used in tribe level phylogenetic analyses of Satyrinae. In this study we investigate for the first time the phylogenetic relationships among the tribes Elymniini, Amathusiini, Zetherini and Melanitini which are indicated to be a monophyletic group, and the Satyrini, using two ribosomal genes (28s rDNA and 16s rDNA) and four protein-coding genes (EF-1α, COI, COII and Cytb). We mainly aim to assess the phylogenetic informativeness of the ribosomal genes as well as clarify the relationships among different tribes. Our results show the two ribosomal genes generally have the same high phylogenetic informativeness compared with EF-1α; and we infer the 28s rDNA would show better informativeness if the 28s rDNA sequence data for each sampling taxon are obtained in this study. The placement of the monotypic genus Callarge Leech in Zetherini is confirmed for the first time based on molecular evidence. In addition, our maximum likelihood (ML) and Bayesian inference (BI) trees consistently show that the involved Satyrinae including the Amathusiini is monophyletic with high support values. Although the relationships among the five tribes are identical among ML and BI analyses and are mostly strongly-supported in BI analysis, those in ML analysis are lowly- or moderately- supported. Therefore, the relationships among the related five tribes recovered herein need further verification based on more sampling taxa. PMID:25878526

  8. The mechanics of ribosomal translocation.

    PubMed

    Achenbach, John; Nierhaus, Knud H

    2015-07-01

    The ribosome translates the sequence of codons of an mRNA into the corresponding sequence of amino acids as it moves along the mRNA with a codon-step width of about 10 Å. The movement of the million-dalton complex ribosome is triggered by the universal elongation factor G (EF2 in archaea and eukaryotes) and is termed translocation. Unraveling the molecular details of translocation is one of the most challenging tasks of current ribosome research. In the last two years, enormous progress has been obtained by highly-resolved X-ray and cryo-electron microscopic structures as well as by sophisticated biochemical approaches concerning the trigger and control of the movement of the tRNA2·mRNA complex inside the ribosome during translocation. This review inspects and surveys these achievements. PMID:25514765

  9. The Ribosomal Database Project (RDP).

    PubMed Central

    Maidak, B L; Olsen, G J; Larsen, N; Overbeek, R; McCaughey, M J; Woese, C R

    1996-01-01

    The Ribosomal Database Project (RDP) is a curated database that offers ribosome-related data, analysis services and associated computer programs. The offerings include phylogenetically ordered alignments of ribosomal RNA (rRNA) sequences, derived phylogenetic trees, rRNA secondary structure diagrams and various software for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (rdp.life.uiuc.edu), electronic mail (server@rdp.life.uiuc.edu), gopher (rdpgopher.life.uiuc.edu) and World Wide Web (WWW)(http://rdpwww.life.uiuc.edu/). The electronic mail and WWW servers provide ribosomal probe checking, screening for possible chimeric rRNA sequences, automated alignment and approximate phylogenetic placement of user-submitted sequences on an existing phylogenetic tree. PMID:8594608

  10. Ribosome dynamics and the evolutionary history of ribosomes

    NASA Astrophysics Data System (ADS)

    Fox, George E.; Paci, Maxim; Tran, Quyen; Petrov, Anton S.; Williams, Loren D.

    2015-09-01

    The ribosome is a dynamic nanomachine responsible for coded protein synthesis. Its major subsystems were essentially in place at the time of the last universal common ancestor (LUCA). Ribosome evolutionary history thus potentially provides a window into the pre- LUCA world. This history begins with the origins of the peptidyl transferase center where the actual peptide is synthesized and then continues over an extended timeframe as additional functional centers including the GTPase center are added. The large ribosomal RNAs (rRNAs) have grown over time by an accretion process and a model exists that proposes a relative age of each accreted element. We have compared atomic resolution ribosome structures before and after EF-G bound GTP hydrolysis and thereby identified the location of 23 pivot points in the large rRNAs that facilitate ribosome dynamics. Pivots in small subunit helices h28 and h44 appear to be especially central to the process and according to the accretion model significantly older than the other helices containing pivots. Overall, the results suggest that ribosomal dynamics occurred in two phases. In the first phase, an inherently mobile h28/h44 combination provided the flexibility needed to create a dynamic ribosome that was essentially a Brownian machine. This addition likely made coded peptide synthesis possible by facilitating movement of a primitive mRNA. During the second phase, addition of pivoting elements and the creation of a factor binding site allowed the regulation of the inherent motion created by h28/h44. All of these events likely occurred before LUCA.

  11. Characterization of silk gland ribosomes from a bivoltine caddisfly, Stenopsyche marmorata: translational suppression of a silk protein in cold conditions.

    PubMed

    Nomura, Takaomi; Ito, Miho; Kanamori, Mai; Shigeno, Yuta; Uchiumi, Toshio; Arai, Ryoichi; Tsukada, Masuhiro; Hirabayashi, Kimio; Ohkawa, Kousaku

    2016-01-01

    Larval Stenopsyche marmorata constructs food capture nets and fixed retreats underwater using self-produced proteinaceous silk fibers. In the Chikuma River (Nagano Prefecture, Japan) S. marmorata has a bivoltine life cycle; overwintering larvae grow slowly with reduced net spinning activity in winter. We recently reported constant transcript abundance of S. marmorata silk protein 1 (Smsp-1), a core S. marmorata silk fiber component, in all seasons, implying translational suppression in the silk gland during winter. Herein, we prepared and characterized silk gland ribosomes from seasonally collected S. marmorata larvae. Ribosomes from silk glands immediately frozen in liquid nitrogen (LN2) after dissection exhibited comparable translation elongation activity in spring, summer, and autumn. Conversely, silk glands obtained in winter did not contain active ribosomes and Smsp-1. Ribosomes from silk glands immersed in ice-cold physiological saline solution for approximately 4 h were translationally inactive, despite summer collection and Smsp-1 expression. The ribosomal inactivation occurs because of defects in the formation of 80S ribosomes, presumably due to splitting of 60S subunits containing 28S rRNA with central hidden break, in response to cold stress. These results suggest a novel-type ribosome-regulated translation control mechanism. PMID:26646291

  12. Ribosome-inactivating proteins: from plant defense to tumor attack.

    PubMed

    de Virgilio, Maddalena; Lombardi, Alessio; Caliandro, Rocco; Fabbrini, Maria Serena

    2010-11-01

    Ribosome-inactivating proteins (RIPs) are EC3.2.32.22 N-glycosidases that recognize a universally conserved stem-loop structure in 23S/25S/28S rRNA, depurinating a single adenine (A4324 in rat) and irreversibly blocking protein translation, leading finally to cell death of intoxicated mammalian cells. Ricin, the plant RIP prototype that comprises a catalytic A subunit linked to a galactose-binding lectin B subunit to allow cell surface binding and toxin entry in most mammalian cells, shows a potency in the picomolar range. The most promising way to exploit plant RIPs as weapons against cancer cells is either by designing molecules in which the toxic domains are linked to selective tumor targeting domains or directly delivered as suicide genes for cancer gene therapy. Here, we will provide a comprehensive picture of plant RIPs and discuss successful designs and features of chimeric molecules having therapeutic potential. PMID:22069572

  13. Ribosome-Inactivating Proteins: From Plant Defense to Tumor Attack

    PubMed Central

    de Virgilio, Maddalena; Lombardi, Alessio; Caliandro, Rocco; Fabbrini, Maria Serena

    2010-01-01

    Ribosome-inactivating proteins (RIPs) are EC3.2.32.22 N-glycosidases that recognize a universally conserved stem-loop structure in 23S/25S/28S rRNA, depurinating a single adenine (A4324 in rat) and irreversibly blocking protein translation, leading finally to cell death of intoxicated mammalian cells. Ricin, the plant RIP prototype that comprises a catalytic A subunit linked to a galactose-binding lectin B subunit to allow cell surface binding and toxin entry in most mammalian cells, shows a potency in the picomolar range. The most promising way to exploit plant RIPs as weapons against cancer cells is either by designing molecules in which the toxic domains are linked to selective tumor targeting domains or directly delivered as suicide genes for cancer gene therapy. Here, we will provide a comprehensive picture of plant RIPs and discuss successful designs and features of chimeric molecules having therapeutic potential. PMID:22069572

  14. Contrasting evolutionary patterns of 28S and ITS rRNA genes reveal high intragenomic variation in Cephalenchus (Nematoda): Implications for species delimitation.

    PubMed

    Pereira, Tiago José; Baldwin, James Gordon

    2016-05-01

    Concerted evolution is often assumed to be the evolutionary force driving multi-family genes, including those from ribosomal DNA (rDNA) repeat, to complete homogenization within a species, although cases of non-concerted evolution have been also documented. In this study, sequence variation of 28S and ITS ribosomal RNA (rRNA) genes in the genus Cephalenchus is assessed at three different levels, intragenomic, intraspecific, and interspecific. The findings suggest that not all Cephalenchus species undergo concerted evolution. High levels of intraspecific polymorphism, mostly due to intragenomic variation, are found in Cephalenchus sp1 (BRA-01). Secondary structure analyses of both rRNA genes and across different species show a similar substitution pattern, including mostly compensatory (CBC) and semi-compensatory (SBC) base changes, thus suggesting the functionality of these rRNA copies despite the variation found in some species. This view is also supported by low sequence variation in the 5.8S gene in relation to the flanking ITS-1 and ITS-2 as well as by the existence of conserved motifs in the former gene. It is suggested that potential cross-fertilization in some Cephalenchus species, based on inspection of female reproductive system, might contribute to both intragenomic and intraspecific polymorphism of their rRNA genes. These results reinforce the potential implications of intragenomic and intraspecific genetic diversity on species delimitation, especially in biodiversity studies based solely on metagenetic approaches. Knowledge of sequence variation will be crucial for accurate species diversity estimation using molecular methods. PMID:26926945

  15. [Ribosomal RNA Evolution

    NASA Technical Reports Server (NTRS)

    1997-01-01

    It is generally believed that an RNA World existed at an early stage in the history of life. During this early period, RNA molecules are seen to be potentially involved in both catalysis and the storage of genetic information. Translation presents several interrelated themes of inquiry for exobiology. First, it is essential, for understanding the very origin of life, how peptides and eventually proteins might have come to be made on the early Earth in a template directed manner. Second, it is necessary to understand how a machinery of similar complexity to that found in the ribosomes of modern organisms came to exist by the time of the last common ancestor (as detected by 16S rRNA sequence studies). Third, the ribosomal RNAs themselves likely had a very early origin and studies of their history may be very informative about the nature of the RNA World. Moreover, studies of these RNAs will contribute to a better understanding of the potential roles of RNA in early evolution.During the past year we have ave conducted a comparative study of four completely sequenced bacterial genoames. We have focused initially on conservation of gene order. The second component of the project continues to build on the model system for studying the validity of variant 5S rRNA sequences in the vicinity of the modern Vibrio proteolyticus 5S rRNA that we established earlier. This system has made it possible to conduct a detailed and extensive analysis of a local portion of the sequence space. These core methods have been used to construct numerous mutants during the last several years. Although it has been a secondary focus, this work has continued over the last year such that we now have in excess of 125 V. proteolyticus derived constructs which have been made and characterized. We have also continued high resolution NMR work on RNA oligomers originally initiated by G. Kenneth Smith who was funded by a NASA Graduate Student Researcher's Fellowship Award until May of 1996. Mr. Smith

  16. Phylogenetic Information Content of Copepoda Ribosomal DNA Repeat Units: ITS1 and ITS2 Impact

    PubMed Central

    Zagoskin, Maxim V.; Lazareva, Valentina I.; Grishanin, Andrey K.; Mukha, Dmitry V.

    2014-01-01

    The utility of various regions of the ribosomal repeat unit for phylogenetic analysis was examined in 16 species representing four families, nine genera, and two orders of the subclass Copepoda (Crustacea). Fragments approximately 2000 bp in length containing the ribosomal DNA (rDNA) 18S and 28S gene fragments, the 5.8S gene, and the internal transcribed spacer regions I and II (ITS1 and ITS2) were amplified and analyzed. The DAMBE (Data Analysis in Molecular Biology and Evolution) software was used to analyze the saturation of nucleotide substitutions; this test revealed the suitability of both the 28S gene fragment and the ITS1/ITS2 rDNA regions for the reconstruction of phylogenetic trees. Distance (minimum evolution) and probabilistic (maximum likelihood, Bayesian) analyses of the data revealed that the 28S rDNA and the ITS1 and ITS2 regions are informative markers for inferring phylogenetic relationships among families of copepods and within the Cyclopidae family and associated genera. Split-graph analysis of concatenated ITS1/ITS2 rDNA regions of cyclopoid copepods suggested that the Mesocyclops, Thermocyclops, and Macrocyclops genera share complex evolutionary relationships. This study revealed that the ITS1 and ITS2 regions potentially represent different phylogenetic signals. PMID:25215300

  17. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome

    PubMed Central

    Poirot, Olivier; Timsit, Youri

    2016-01-01

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through “molecular synapses”, ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the “sensory-proteins” innervate the functional ribosomal sites, while the “inter-proteins” interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing. PMID:27225526

  18. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome.

    PubMed

    Poirot, Olivier; Timsit, Youri

    2016-01-01

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through "molecular synapses", ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the "sensory-proteins" innervate the functional ribosomal sites, while the "inter-proteins" interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing. PMID:27225526

  19. Molecular characterization of Stenocarpella maydis based on nuclear ribosomal Internal Transcribed Spacer regions between the 18S and 28S nuclear rRNA gene sequences

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Diplodia ear rot of maize is caused by the fungus Stenocarpella maydis (syn. Diplodia maydis). Although considered a minor pathogen in the later 1900's, with the increased emphasis on conservation tillage, S. maydis has reestablished itself as an important ear and stalk rot pathogen. While S. maydis...

  20. Mammalian mitochondrial ribosomal small subunit (MRPS) genes: A putative role in human disease.

    PubMed

    Gopisetty, Gopal; Thangarajan, Rajkumar

    2016-09-01

    Mitochondria are prominently understood as power houses producing ATP the primary energy currency of the cell. However, mitochondria are also known to play an important role in apoptosis and autophagy, and mitochondrial dysregulation can lead to pathological outcomes. Mitochondria are known to contain 1500 proteins of which only 13 are coded by mitochondrial DNA and the rest are coded by nuclear genes. Protein synthesis in mitochondria involves mitochondrial ribosomes which are 55-60S particles and are composed of small 28S and large 39S subunits. A feature of mammalian mitoribosome which differentiate it from bacterial ribosomes is the increased protein content. The human mitochondrial ribosomal protein (MRP) gene family comprises of 30 genes which code for mitochondrial ribosomal small subunit and 50 genes for the large subunit. The present review focuses on the mitochondrial ribosomal small subunit genes (MRPS), presents an overview of the literature and data gleaned from publicly available gene and protein expression databases. The survey revealed aberrations in MRPS gene expression patterns in varied human diseases indicating a putative role in their etiology. PMID:27170550

  1. The Hymenopteran Tree of Life: Evidence from Protein-Coding Genes and Objectively Aligned Ribosomal Data

    PubMed Central

    Klopfstein, Seraina; Vilhelmsen, Lars; Heraty, John M.; Sharkey, Michael; Ronquist, Fredrik

    2013-01-01

    Previous molecular analyses of higher hymenopteran relationships have largely been based on subjectively aligned ribosomal sequences (18S and 28S). Here, we reanalyze the 18S and 28S data (unaligned about 4.4 kb) using an objective and a semi-objective alignment approach, based on MAFFT and BAli-Phy, respectively. Furthermore, we present the first analyses of a substantial protein-coding data set (4.6 kb from one mitochondrial and four nuclear genes). Our results indicate that previous studies may have suffered from inflated support values due to subjective alignment of the ribosomal sequences, but apparently not from significant biases. The protein data provide independent confirmation of several earlier results, including the monophyly of non-xyelid hymenopterans, Pamphilioidea + Unicalcarida, Unicalcarida, Vespina, Apocrita, Proctotrupomorpha and core Proctotrupomorpha. The protein data confirm that Aculeata are nested within a paraphyletic Evaniomorpha, but cast doubt on the monophyly of Evanioidea. Combining the available morphological, ribosomal and protein-coding data, we examine the total-evidence signal as well as congruence and conflict among the three data sources. Despite an emerging consensus on many higher-level hymenopteran relationships, several problems remain unresolved or contentious, including rooting of the hymenopteran tree, relationships of the woodwasps, placement of Stephanoidea and Ceraphronoidea, and the sister group of Aculeata. PMID:23936325

  2. Chloroplast ribosomes and protein synthesis.

    PubMed Central

    Harris, E H; Boynton, J E; Gillham, N W

    1994-01-01

    Consistent with their postulated origin from endosymbiotic cyanobacteria, chloroplasts of plants and algae have ribosomes whose component RNAs and proteins are strikingly similar to those of eubacteria. Comparison of the secondary structures of 16S rRNAs of chloroplasts and bacteria has been particularly useful in identifying highly conserved regions likely to have essential functions. Comparative analysis of ribosomal protein sequences may likewise prove valuable in determining their roles in protein synthesis. This review is concerned primarily with the RNAs and proteins that constitute the chloroplast ribosome, the genes that encode these components, and their expression. It begins with an overview of chloroplast genome structure in land plants and algae and then presents a brief comparison of chloroplast and prokaryotic protein-synthesizing systems and a more detailed analysis of chloroplast rRNAs and ribosomal proteins. A description of the synthesis and assembly of chloroplast ribosomes follows. The review concludes with discussion of whether chloroplast protein synthesis is essential for cell survival. PMID:7854253

  3. Functional Role of Ribosomal Signatures

    PubMed Central

    Chen, Ke; Eargle, John; Sarkar, Krishnarjun; Gruebele, Martin; Luthey-Schulten, Zaida

    2010-01-01

    Although structure and sequence signatures in ribosomal RNA and proteins are defining characteristics of the three domains of life and instrumental in constructing the modern phylogeny, little is known about their functional roles in the ribosome. In this work, the largest coevolving RNA/protein signatures in the bacterial 30S ribosome are investigated both experimentally and computationally through all-atom molecular-dynamics simulations. The complex includes the N-terminal fragment of the ribosomal protein S4, which is a primary binding protein that initiates 30S small subunit assembly from the 5′ domain, and helix 16 (h16), which is part of the five-way junction in 16S rRNA. Our results show that the S4 N-terminus signature is intrinsically disordered in solution, whereas h16 is relatively stable by itself. The dynamic disordered property of the protein is exploited to couple the folding and binding process to the five-way junction, and the results provide insight into the mechanism for the early and fast binding of S4 in the assembly of the ribosomal small subunit. PMID:21156135

  4. Phylogenetic Analysis of the Hoplolaiminae Inferred from Combined D2 and D3 Expansion Segments of 28S rDNA.

    PubMed

    Bae, C H; Szalanski, A L; Robbins, R T

    2009-03-01

    DNA sequences of the D2-D3 expansion segments of the 28S gene of ribosomal DNA from 23 taxa of the subfamily Hoplolaiminae were obtained and aligned to infer phylogenetic relationships. The D2 and D3 expansion regions are G-C rich (59.2%), with up to 20.7% genetic divergence between Scutellonema brachyurum and Hoplolaimus concaudajuvencus. Molecular phylogenetic analysis using maximum likelihood and maximum parsimony was conducted using the D2-D3 sequence data. Of 558 characters, 254 characters (45.5%) were variable and 198 characters (35.4%) were parsimony informative. All phylogenetic methods produced a similar topology with two distinct clades: One clade consists of all Hoplolaimus species while the other clade consists of the rest of the studied Hoplolaiminae genera. This result suggests that Hoplolaimus is monophyletic. Another clade consisted of Aorolaimus, Helicotylenchus, Rotylenchus, and Scutellonema species. Phylogenetic analysis using the outgroup species Globodera rostocheinsis suggests that Hoplolaiminae is paraphyletic. In this study, the D2-D3 region had levels of DNA sequence divergence sufficient for phylogenetic analysis and delimiting species of Hoplolaiminae. PMID:22661775

  5. Structure and stability of variants of the sarcin-ricin loop of 28S rRNA: NMR studies of the prokaryotic SRL and a functional mutant.

    PubMed Central

    Seggerson, K; Moore, P B

    1998-01-01

    NMR has been used to examine the conformational properties of two variants of the sarcin-ricin loop (SRL) from eukaryotic 28S rRNA, which is essential for elongation factor interactions with the ribosome: (1) its bacterial homologue, which lacks two of the bases that flank the conserved 12-nt sequence in the middle of the SRL, but which is functionally equivalent, and (2) a functionally active variant of the eukaryotic SRL in which the bulged G within the conserved sequence is replaced by an A. The data indicate that, although the bacterial SRL is less stable than the eukaryotic SRL, its conformation is closely similar. Furthermore, even though replacement of the bulged G in the SRL with an A seriously destabilizes the center of the loop, its effect on the overall conformation of the SRL appears to be modest. In the course of this work, it was serendipitously discovered that at neutral pH, the C8 proton of the bulged G, in both PRO-SRL and E73, exchanges about 10 times faster than it does in GMP. PMID:9769095

  6. Profiling of Mycoplasma gallisepticum Ribosomes

    PubMed Central

    Fisunov, G. Y.; Evsyutina, D. V.; Arzamasov, A. A.; Butenko, I. O.; Govorun, V. M.

    2015-01-01

    The development of high-throughput technologies is increasingly resulting in identification of numerous cases of low correlation between mRNA and the protein level in cells. These controversial observations were made on various bacteria, such as E. coli, Desulfovibrio vulgaris, and Lactococcus lactis. Thus, it is important to develop technologies, including high-throughput techniques, aimed at studying gene expression regulation at the level of translation. In the current study, we performed proteomic profiling of M. gallisepticum ribosomes and identified high abundant noncanonical proteins. We found that binding of mRNAs to ribosomes is mainly determined by two parameters: (1) abundance of mRNA itself and (2) complimentary interactions between the 3’ end of 16S rRNA and the ribosome binding site in the 5’-untranslated region of mRNA. PMID:26798497

  7. Profiling of Mycoplasma gallisepticum Ribosomes.

    PubMed

    Fisunov, G Y; Evsyutina, D V; Arzamasov, A A; Butenko, I O; Govorun, V M

    2015-01-01

    The development of high-throughput technologies is increasingly resulting in identification of numerous cases of low correlation between mRNA and the protein level in cells. These controversial observations were made on various bacteria, such as E. coli, Desulfovibrio vulgaris, and Lactococcus lactis. Thus, it is important to develop technologies, including high-throughput techniques, aimed at studying gene expression regulation at the level of translation. In the current study, we performed proteomic profiling of M. gallisepticum ribosomes and identified high abundant noncanonical proteins. We found that binding of mRNAs to ribosomes is mainly determined by two parameters: (1) abundance of mRNA itself and (2) complimentary interactions between the 3' end of 16S rRNA and the ribosome binding site in the 5'-untranslated region of mRNA. PMID:26798497

  8. Silencing of RNA helicase II/Gualpha inhibits mammalian ribosomal RNA production.

    PubMed

    Henning, Dale; So, Rolando B; Jin, Runyan; Lau, Lester F; Valdez, Benigno C

    2003-12-26

    The intricate production of ribosomal RNA is well defined in yeast, but its complexity in higher organisms is barely understood. We recently showed that down-regulation of nucleolar protein RNA helicase II/Gualpha (RH-II/Gualpha or DDX21) in Xenopus oocytes inhibited processing of 20 S rRNA to 18 S and contributed to degradation of 28 S rRNA (Yang, H., Zhou, J., Ochs, R. L., Henning, D., Jin, R., and Valdez, B. C. (2003) J. Biol. Chem. 278, 38847-38859). Since no nucleolar RNA helicase has been functionally characterized in mammalian cells, we used short interfering RNA to search for functions for RH-II/Gualpha and its paralogue RH-II/Gubeta in rRNA production. Silencing of RH-II/Gualpha by more than 80% in HeLa cells resulted in an almost 80% inhibition of 18 and 28 S rRNA production. This inhibition could be reversed by exogenous expression of wild type RH-II/Gualpha. A helicase-deficient mutant form having ATPase activity was able to rescue the production of 28 S but not 18 S rRNA. A phenotype exhibiting inhibition of 18 S and 28 S rRNA production was also observed when the paralogue RH-II/Gubeta was overexpressed. Both down-regulation of RH-II/Gualpha and overexpression of RH-II/Gubeta slowed cell proliferation. The opposite effects of the two paralogues suggest antagonistic functions. PMID:14559904

  9. Comprehensive Molecular Structure of the Eukaryotic Ribosome

    PubMed Central

    Taylor, Derek J.; Devkota, Batsal; Huang, Andrew D.; Topf, Maya; Narayanan, Eswar; Sali, Andrej; Harvey, Stephen C.; Frank, Joachim

    2009-01-01

    Despite the emergence of a large number of X-ray crystallographic models of the bacterial 70S ribosome over the past decade, an accurate atomic model of the eukaryotic 80S ribosome is still not available. Eukaryotic ribosomes possess more ribosomal proteins and ribosomal RNA than bacterial ribosomes, which are implicated in extra-ribosomal functions in the eukaryotic cells. By combining cryo-EM with RNA and protein homology modeling, we obtained an atomic model of the yeast 80S ribosome complete with all ribosomal RNA expansion segments and all ribosomal proteins for which a structural homolog can be identified. Mutation or deletion of 80S ribosomal proteins can abrogate maturation of the ribosome, leading to several human diseases. We have localized one such protein unique to eukaryotes, rpS19e, whose mutations are associated with Diamond-Blackfan anemia in humans. Additionally, we characterize crucial and novel interactions between the dynamic stalk base of the ribosome with eukaryotic elongation factor 2. PMID:20004163

  10. New ribosomes for new memories?

    PubMed Central

    Hernández, A Iván; Alarcon, Juan M; Allen, Kim D

    2015-01-01

    Widely thought to be a housekeeping process, the regulation and synthesis of rRNA emerges as a potentially central mechanism for the maintenance of synaptic plasticity and memory. We have recently shown that an essential component of late-phase synaptic plasticity is rRNA biosynthesis — the rate-limiting step in the production of new ribosomes. We hypothesize that a particular population of ribosomes is generated upon learning-associated neural activity to alter the rate of synthesis of plasticity factors at tagged synapses that will support the maintenance of synaptic plasticity and memory. PMID:26479998

  11. [Phylogeny of protostome moulting animals (Ecdysozoa) inferred from 18 and 28S rRNA gene sequences].

    PubMed

    Petrov, N B; Vladychenskaia, N S

    2005-01-01

    Reliability of reconstruction of phylogenetic relationships within a group of protostome moulting animals was evaluated by means of comparison of 18 and 28S rRNA gene sequences sets both taken separately and combined. Reliability of reconstructions was evaluated by values of the bootstrap support of major phylogenetic tree nodes and by degree of congruence of phylogenetic trees inferred by various methods. By both criteria, phylogenetic trees reconstructed from the combined 18 and 28S rRNA gene sequences were better than those inferred from 18 and 28S sequences taken separately. Results obtained are consistent with phylogenetic hypothesis separating protostome animals into two major clades, moulting Ecdysozoa (Priapulida + Kinorhyncha, Nematoda + Nematomorpha, Onychophora + Tardigrada, Myriapoda + Chelicerata, Crustacea + Hexapoda) and unmoulting Lophotrochozoa (Plathelminthes, Nemertini, Annelida, Mollusca, Echiura, Sipuncula). Clade Cephalorhyncha does not include nematomorphs (Nematomorpha). Conclusion was taken that it is necessary to use combined 18 and 28S data in phylogenetic studies. PMID:16083008

  12. Identification of Scopulariopsis species by partial 28S rRNA gene sequence analysis.

    PubMed

    Jagielski, Tomasz; Kosim, Kinga; Skóra, Magdalena; Macura, Anna Barbara; Bielecki, Jacek

    2013-01-01

    The genus Scopulariopsis contains over 30 species of mitosporic moulds, which although usually saprophytic may also act as opportunistic pathogens in humans. They have mainly been associated with onychomycosis, and only sporadically reported as a cause of deep tissue infections or systemic disease. Identification of Scopulariopsis species still largely relies on phenotype-based methods. There is a need for a molecular diagnostic approach, that would allow to reliably discriminate between different Scopulariopsis species. The aim of this study was to apply sequence analysis of partial 28S rRNA gene for species identification of Scopulariopsis clinical isolates. Although the method employed did reveal some genetic polymorphism among Scopulariopsis isolates tested, it was not enough for species delineation. For this to be achieved, other genetic loci, within and beyond the rDNA operon, need to be investigated. PMID:24459837

  13. Chromatographic Purification of Highly Active Yeast Ribosomes

    PubMed Central

    Meskauskas, Arturas; Leshin, Jonathan A.; Dinman, Jonathan D.

    2011-01-01

    Eukaryotic ribosomes are much more labile as compared to their eubacterial and archael counterparts, thus posing a significant challenge to researchers. Particularly troublesome is the fact that lysis of cells releases a large number of proteases and nucleases which can degrade ribosomes. Thus, it is important to separate ribosomes from these enzymes as quickly as possible. Unfortunately, conventional differential ultracentrifugation methods leaves ribosomes exposed to these enzymes for unacceptably long periods of time, impacting their structural integrity and functionality. To address this problem, we utilize a chromatographic method using a cysteine charged Sulfolink resin. This simple and rapid application significantly reduces co-purifying proteolytic and nucleolytic activities, producing high yields of intact, highly biochemically active yeast ribosomes. We suggest that this method should also be applicable to mammalian ribosomes. The simplicity of the method, and the enhanced purity and activity of chromatographically purified ribosome represents a significant technical advancement for the study of eukaryotic ribosomes. PMID:22042245

  14. AMPLIFICATION OF RIBOSOMAL RNA SEQUENCES

    EPA Science Inventory

    This book chapter offers an overview of the use of ribosomal RNA sequences. A history of the technology traces the evolution of techniques to measure bacterial phylogenetic relationships and recent advances in obtaining rRNA sequence information. The manual also describes procedu...

  15. Studies on Pea Ribosomal Proteins

    PubMed Central

    Lin, Chu-Yung; Chia, Subrina Li-Li; Travis, Robert L.; Key, Joe L.

    1975-01-01

    Ribosomal subunits prepared by NH4Cl dissociation (0.5 m) of the monomeric ribosomes were much less active in in vitro protein synthesis than those prepared by KCl dissociation. The decrease in activity correlated with a detachment of some proteins (L2 and L9 as shown by gel electrophoresis) within the 60S ribosomal subunits. Subunits prepared with 0.3 m NH4Cl retained L2 and L9, but the activity remained low. Incubation of these 60S subunits in TKM buffer (50 mm tris [pH 7.5], 20 mm KCl, and 5 mm MgCl2) for 20 min at 37 C restored the activity almost to the level of those obtained by KCl dissociation. Treatment of the 0.3 m NH4Cl-derived 60S subunits with a protein reagent, Procion brilliant blue, prior to extraction of the ribosomal proteins resulted in the loss of L2 and L9, showing that these proteins were made accessible for dye binding. These observations suggest that a considerable degree of unfolding of the 60S subunit occurs at 0.3 m NH4Cl (this apparently leads to a preferential detachment of L2 and L9 at 0.5 m NH4Cl) and that the activity of the purified subunits depends not only on the presence of L2 and L9 but also on the organization of these proteins within the 60S subunits. Images PMID:16659254

  16. Characterizing inactive ribosomes in translational profiling.

    PubMed

    Liu, Botao; Qian, Shu-Bing

    2016-01-01

    The broad impact of translational regulation has emerged explosively in the last few years in part due to the technological advance in genome-wide interrogation of gene expression. During mRNA translation, the majority of actively translating ribosomes exist as polysomes in cells with multiple ribosomes loaded on a single transcript. The importance of the monosome, however, has been less appreciated in translational profiling analysis. Here we report that the monosome fraction isolated by sucrose sedimentation contains a large quantity of inactive ribosomes that do not engage on mRNAs to direct translation. We found that the elongation factor eEF2, but not eEF1A, stably resides in these non-translating ribosomes. This unique feature permits direct evaluation of ribosome status under various stress conditions and in the presence of translation inhibitors. Ribosome profiling reveals that the monosome has a similar but not identical pattern of ribosome footprints compared to the polysome. We show that the association of free ribosomal subunits minimally contributes to ribosome occupancy outside of the coding region. Our results not only offer a quantitative method to monitor ribosome availability, but also uncover additional layers of ribosome status needed to be considered in translational profiling analysis. PMID:27335722

  17. Intersubunit movement is required for ribosomal translocation

    PubMed Central

    Horan, Lucas H.; Noller, Harry F.

    2007-01-01

    Translocation of tRNA and mRNA during protein synthesis is believed to be coupled to structural changes in the ribosome. The “ratchet model,” based on cryo-EM reconstructions of ribosome complexes, invokes relative movement of the 30S and 50S ribosomal subunits in this process; however, evidence that directly demonstrates a requirement for intersubunit movement during translocation is lacking. To address this problem, we created an intersubunit disulfide cross-link to restrict potential movement. The cross-linked ribosomes were unable to carry out polypeptide synthesis; this inhibition was completely reversed upon reduction of the disulfide bridge. In vitro assays showed that the cross-linked ribosomes were specifically blocked in elongation factor G-dependent translocation. These findings show that intersubunit movement is required for ribosomal translocation, accounting for the universal two-subunit architecture of ribosomes. PMID:17360328

  18. Alcoholic Liver Disease and the Mitochondrial Ribosome

    PubMed Central

    Cahill, Alan; Sykora, Peter

    2009-01-01

    Summary Chronic alcohol consumption has been shown to severely compromise mitochondrial protein synthesis. Hepatic mitochondria isolated from alcoholic animals contain decreased levels of respiratory complexes and display depressed respiration rates when compared to pair-fed controls. One underlying mechanism for this involves ethanol-elicited alterations in the structural and functional integrity of the mitochondrial ribosome. Ethanol feeding results in ribosomal changes that include decreased sedimentation rates, larger hydrodynamic volumes, increased levels of unassociated subunits and changes in the levels of specific ribosomal proteins. The methods presented in this chapter detail how to isolate mitochondrial ribosomes, determine ribosomal activity, separate ribosomes into nucleic acid and protein, and perform two-dimensional nonequilibrium pH gradient electrophoretic polyacrylamide gel electrophoresis to separate and subsequently identify mitochondrial ribosomal proteins. PMID:18369931

  19. [About the ribosomal biogenesis in human].

    PubMed

    Tafforeau, Lionel

    2015-01-01

    Ribosomes are cellular ribonucleoprotein particles required for a fundamental mechanism, translation of the genetic information into proteins. Ribosome biogenesis is a highly complex pathway involving many maturation steps: ribosomal RNA (rRNA) synthesis, rRNA processing, pre-rRNA modifications, its assembly with ribosomal proteins in the nuceolus, export of the subunit precursors to the nucleoplasm and the cytoplasm. Ribosome biogenesis has mainly being investigated in yeast during these last 25 years. However, recent works have shown that, despite many similarities between yeast and human ribosome structure and biogenesis, human pre-rRNA processing is far more complex than in yeast. In order to better understand diseases related to a malfunction in ribosome synthesis, the ribosomopathies, research should be conducted directly in human cells and animal models. PMID:26152166

  20. Ribosome engineering to promote new crystal forms

    SciTech Connect

    Selmer, Maria; Gao, Yong-Gui; Weixlbaumer, Albert; Ramakrishnan, V.

    2012-05-01

    Truncation of ribosomal protein L9 in T. thermophilus allows the generation of new crystal forms and the crystallization of ribosome–GTPase complexes. Crystallographic studies of the ribosome have provided molecular details of protein synthesis. However, the crystallization of functional complexes of ribosomes with GTPase translation factors proved to be elusive for a decade after the first ribosome structures were determined. Analysis of the packing in different 70S ribosome crystal forms revealed that regardless of the species or space group, a contact between ribosomal protein L9 from the large subunit and 16S rRNA in the shoulder of a neighbouring small subunit in the crystal lattice competes with the binding of GTPase elongation factors to this region of 16S rRNA. To prevent the formation of this preferred crystal contact, a mutant strain of Thermus thermophilus, HB8-MRCMSAW1, in which the ribosomal protein L9 gene has been truncated was constructed by homologous recombination. Mutant 70S ribosomes were used to crystallize and solve the structure of the ribosome with EF-G, GDP and fusidic acid in a previously unobserved crystal form. Subsequent work has shown the usefulness of this strain for crystallization of the ribosome with other GTPase factors.

  1. Neutron scattering in the ribosome structure

    NASA Astrophysics Data System (ADS)

    Serdyuk, Igor N.

    1997-02-01

    Thermal neutron scattering has become a powerful instrument for studying the ribosome and its components. The application of neutron scattering allowed to establish some principal features of the ribosome structure: non-homogeneous distribution of the RNA and protein within ribosomal particles, the RNA role as a framework in the arrangement and maintenance of the structure of ribosomal particles, and the globular character of ribosomal proteins. The use of selective deuteration of separate ribosomal proteins in combination with the triangulation method revealed mutual spatial arrangement (the 3D-map) of all the ribosomal proteins within the small particle and in the most part of the large ribosomal particle. An essential impact has been made in the structural studies of ribosomes with the development of novel experimental approaches: triple isotopic substitution and spin contrast variation. These approaches with direct interpretation of spherical harmonics provide new possibilities for constructing models of ribosomal particles, opening principally new perspectives for joint use of X-ray synchrotron diffraction in crystals and small-angle neutron scattering in solution.

  2. A combination of morphology and 28S rRNA gene sequences provide grouping and ranking criteria to merge eight into three Ambispora species (Ambisporaceae, Glomeromycota).

    PubMed

    Bills, Robert J; Morton, Joseph B

    2015-08-01

    Ambispora, the only genus in Ambisporaceae and one of three deeply rooted families in Archaeosporales, Glomeromycetes, is amended. Analysis of the morphology of specimens from types and living cultures and 28S ribosomal DNA (rDNA; LSU) sequences resulted in two major changes that redefined Ambispora to include only species with the potential for spore dimorphism (acaulosporoid and glomoid). First, species described as producing only glomoid spores (Ambispora leptoticha, Ambispora fecundispora, and Ambispora callosa), only acaulosporoid spores (Ambispora jimgerdemannii), or both spore morphotypes (Ambispora appendicula) were synonymized with a redefined dimorphic species, A. leptoticha. LSU sequences and more conserved SSU gene data indicated little divergence between genotypes formerly classified as separate species. Second, Ambispora fennica was synonymized with Ambispora gerdemannii based on morphological and LSU sequence variation equivalent to that measured in the sister clade A. leptoticha. With this analysis, Ambispora was reduced to three species: A. leptoticha, A. gerdemannii, and Ambispora granatensis. Morphological and molecular characters were given equal treatment in this study, as each data set informed and clarified grouping and ranking decisions. The two inner layers of the acaulosporoid spore wall were the only structural characters uniquely defining each of these three species; all other characters were shared. Phenotypes of glomoid spores were indistinguishable between species, and thus were informative only at the genus level. Distinct subclade structure of the LSU gene tree suggests fixation of discrete variants typical of clonal reproduction and possible retention of polymorphisms in rDNA repeats, so that not all discrete genetic variants are indicative of speciation. PMID:25638691

  3. Fungal community structure in disease suppressive soils assessed by 28S LSU gene sequencing.

    PubMed

    Penton, C Ryan; Gupta, V V S R; Tiedje, James M; Neate, Stephen M; Ophel-Keller, Kathy; Gillings, Michael; Harvey, Paul; Pham, Amanda; Roget, David K

    2014-01-01

    Natural biological suppression of soil-borne diseases is a function of the activity and composition of soil microbial communities. Soil microbe and phytopathogen interactions can occur prior to crop sowing and/or in the rhizosphere, subsequently influencing both plant growth and productivity. Research on suppressive microbial communities has concentrated on bacteria although fungi can also influence soil-borne disease. Fungi were analyzed in co-located soils 'suppressive' or 'non-suppressive' for disease caused by Rhizoctonia solani AG 8 at two sites in South Australia using 454 pyrosequencing targeting the fungal 28S LSU rRNA gene. DNA was extracted from a minimum of 125 g of soil per replicate to reduce the micro-scale community variability, and from soil samples taken at sowing and from the rhizosphere at 7 weeks to cover the peak Rhizoctonia infection period. A total of ∼ 994,000 reads were classified into 917 genera covering 54% of the RDP Fungal Classifier database, a high diversity for an alkaline, low organic matter soil. Statistical analyses and community ordinations revealed significant differences in fungal community composition between suppressive and non-suppressive soil and between soil type/location. The majority of differences associated with suppressive soils were attributed to less than 40 genera including a number of endophytic species with plant pathogen suppression potentials and mycoparasites such as Xylaria spp. Non-suppressive soils were dominated by Alternaria, Gibberella and Penicillum. Pyrosequencing generated a detailed description of fungal community structure and identified candidate taxa that may influence pathogen-plant interactions in stable disease suppression. PMID:24699870

  4. Fungal Community Structure in Disease Suppressive Soils Assessed by 28S LSU Gene Sequencing

    PubMed Central

    Penton, C. Ryan; Gupta, V. V. S. R.; Tiedje, James M.; Neate, Stephen M.; Ophel-Keller, Kathy; Gillings, Michael; Harvey, Paul; Pham, Amanda; Roget, David K.

    2014-01-01

    Natural biological suppression of soil-borne diseases is a function of the activity and composition of soil microbial communities. Soil microbe and phytopathogen interactions can occur prior to crop sowing and/or in the rhizosphere, subsequently influencing both plant growth and productivity. Research on suppressive microbial communities has concentrated on bacteria although fungi can also influence soil-borne disease. Fungi were analyzed in co-located soils ‘suppressive’ or ‘non-suppressive’ for disease caused by Rhizoctonia solani AG 8 at two sites in South Australia using 454 pyrosequencing targeting the fungal 28S LSU rRNA gene. DNA was extracted from a minimum of 125 g of soil per replicate to reduce the micro-scale community variability, and from soil samples taken at sowing and from the rhizosphere at 7 weeks to cover the peak Rhizoctonia infection period. A total of ∼994,000 reads were classified into 917 genera covering 54% of the RDP Fungal Classifier database, a high diversity for an alkaline, low organic matter soil. Statistical analyses and community ordinations revealed significant differences in fungal community composition between suppressive and non-suppressive soil and between soil type/location. The majority of differences associated with suppressive soils were attributed to less than 40 genera including a number of endophytic species with plant pathogen suppression potentials and mycoparasites such as Xylaria spp. Non-suppressive soils were dominated by Alternaria, Gibberella and Penicillum. Pyrosequencing generated a detailed description of fungal community structure and identified candidate taxa that may influence pathogen-plant interactions in stable disease suppression. PMID:24699870

  5. Structural Insights Into Ribosome Recycling Factor Interactions with the 70S Ribosome

    PubMed Central

    Pai, Raj D.; Zhang, Wen; Schuwirth, Barbara S.; Hirokawa, Go; Kaji, Hideko; Kaji, Akira; Cate, Jamie H.D.

    2009-01-01

    SUMMARY At the end of translation in bacteria, ribosome recycling factor (RRF) is used together with Elongation Factor G (EF-G) to recycle the 30S and 50S ribosomal subunits for the next round of translation. In x-ray crystal structures of RRF with the Escherichia coli 70S ribosome, RRF binds to the large ribosomal subunit in the cleft that contains the peptidyl transferase center (PTC). Upon binding of either E. coli or T. thermophilus RRF to the E. coli ribosome, the tip of ribosomal RNA helix H69 in the large subunit moves away from the small subunit toward RRF by 8 Å, thereby disrupting a key contact between the small and large ribosomal subunits, termed bridge B2a. In the ribosome crystals, the ability of RRF to destabilize bridge B2a is influenced by crystal packing forces. Movement of H69 involves an ordered to disordered transition upon binding of RRF to the ribosome. The disruption of bridge B2a upon RRF binding to the ribosome seen in the present structures reveals one of the key roles that RRF plays in ribosome recycling, the dissociation of 70S ribosomes into subunits. The structures also reveal contacts between Domain II of RRF and protein S12 in the 30S subunit that may also play a role in ribosome recycling. PMID:18234219

  6. Synthesis of ribosomes in Saccharomyces cerevisiae.

    PubMed Central

    Warner, J R

    1989-01-01

    The assembly of a eucaryotic ribosome requires the synthesis of four ribosomal ribonucleic acid (RNA) molecules and more than 75 ribosomal proteins. It utilizes all three RNA polymerases; it requires the cooperation of the nucleus and the cytoplasm, the processing of RNA, and the specific interaction of RNA and protein molecules. It is carried out efficiently and is exquisitely sensitive to the needs of the cell. Our current understanding of this process in the genetically tractable yeast Saccharomyces cerevisiae is reviewed. The ribosomal RNA genes are arranged in a tandem array of 100 to 200 copies. This tandem array has led to unique ways of carrying out a number of functions. Replication is asymmetric and does not initiate from every autonomously replicating sequence. Recombination is suppressed. Transcription of the major ribosomal RNA appears to involve coupling between adjacent transcription units, which are separated by the 5S RNA transcription unit. Genes for many ribosomal proteins have been cloned and sequenced. Few are linked; most are duplicated; most have an intron. There is extensive homology between yeast ribosomal proteins and those of other species. Most, but not all, of the ribosomal protein genes have one or two sites that are essential for their transcription and that bind a common transcription factor. This factor binds also to many other places in the genome, including the telomeres. There is coordinated transcription of the ribosomal protein genes under a variety of conditions. However, the cell seems to possess no mechanism for regulating the transcription of individual ribosomal protein genes in response either to a deficiency or an excess of a particular ribosomal protein. A deficiency causes slow growth. Any excess ribosomal protein is degraded very rapidly, with a half-life of 1 to 5 min. Unlike most types of cells, yeast cells appear not to regulate the translation of ribosomal proteins. However, in the case of ribosomal protein L32

  7. Mechanisms for ribotoxin-induced ribosomal RNA cleavage

    SciTech Connect

    He, Kaiyu; Zhou, Hui-Ren; Pestka, James J.

    2012-11-15

    The Type B trichothecene deoxynivalenol (DON), a ribotoxic mycotoxin known to contaminate cereal-based foods, induces ribosomal RNA (rRNA) cleavage in the macrophage via p38-directed activation of caspases. Here we employed the RAW 264.7 murine macrophage model to test the hypothesis that this rRNA cleavage pathway is similarly induced by other ribotoxins. Capillary electrophoresis confirmed that the antibiotic anisomycin (≥ 25 ng/ml), the macrocylic trichothecene satratoxin G (SG) (≥ 10 ng/ml) and ribosome-inactivating protein ricin (≥ 300 ng/ml) induced 18s and 28s rRNA fragmentation patterns identical to that observed for DON. Also, as found for DON, inhibition of p38, double-stranded RNA-activated kinase (PKR) and hematopoietic cell kinase (Hck) suppressed MAPK anisomycin-induced rRNA cleavage, while, in contrast, their inhibition did not affect SG- and ricin-induced rRNA fragmentation. The p53 inhibitor pifithrin-μ and pan caspase inhibitor Z-VAD-FMK suppressed rRNA cleavage induced by anisomycin, SG and ricin, indicating that these ribotoxins shared with DON a conserved downstream pathway. Activation of caspases 8, 9 and 3 concurrently with apoptosis further suggested that rRNA cleavage occurred in parallel with both extrinsic and intrinsic pathways of programmed cell death. When specific inhibitors of cathepsins L and B (lysosomal cysteine cathepsins active at cytosolic neutral pH) were tested, only the former impaired anisomycin-, SG-, ricin- and DON-induced rRNA cleavage. Taken together, the data suggest that (1) all four ribotoxins induced p53-dependent rRNA cleavage via activation of cathepsin L and caspase 3, and (2) activation of p53 by DON and anisomycin involved p38 whereas SG and ricin activated p53 by an alternative mechanism. Highlights: ► Deoxynivalenol (DON) anisomycin, satratoxin G (SG) and ricin are ribotoxins. ► Ribotoxins induce 18s and 28s rRNA cleavage in the RAW 264.7 macrophage model. ► Ribotoxins induce rRNA cleavage via

  8. Control of ribosome formation in rat heart

    SciTech Connect

    Russo, L.A.

    1987-01-01

    Diabetes of 9 days duration produced a 17% diminution in the rate of total protein synthesis in rat hearts perfused as Langendorff preparations supplied with glucose, plasma levels of amino acids, and 400 ..mu..U/ml insulin. This reduction was attributable to a decrease in efficiency of protein synthesis and total RNA content. Total messenger RNA content decreased in diabetic hearts in proportion to the reduction in total RNA. Diabetes also resulted in diminished ribosome content as reflected by the induction in total RNA. Ribosome production was investigated by monitoring incorporation of (/sup 3/H)phenylalanine into the proteins of cytoplasmic ribosomes. Rates of ribosome formation in diabetic hearts were as fast as control rates in the presence of insulin, and were faster than control rates in the absence of the hormone. These results indicated that ribosome content fell in diabetic hearts despite unchanged or faster rates of ribosome formation.

  9. Seeing is Believing in Ribosome Assembly.

    PubMed

    Warner, Jonathan R

    2016-07-14

    Many proteins have been implicated genetically and biochemically in the assembly of eukaryotic ribosomes. Now, Kornprobst et al. show us how they are put together with a cryoEM structure of the 90S processome that initiates ribosome assembly, revealing the arrangement of U3 RNA and the several UTP complexes that form a chaperone-like structure around and within the developing 40S ribosomal subunit. PMID:27419867

  10. Tricks an IRES uses to enslave ribosomes

    PubMed Central

    2012-01-01

    In eukaryotes, mRNAs are primarily translated through a cap-dependent mechanism whereby initiation factors recruit the 40S ribosomal subunit to a cap structure at the 5’ end of the mRNA. However, some viral and cellular messages initiate protein synthesis without a cap. They use a structured RNA element termed an internal ribosome entry site (IRES) to recruit the 40S ribosomal subunit. IRESs were discovered over 20 years ago but only recently have studies using a model IRES from dicistroviruses expanded our understanding of how a three dimensional RNA structure can capture and manipulate the ribosome to initiate translation. PMID:22944245

  11. Scattering studies on ribosomes in solution

    NASA Astrophysics Data System (ADS)

    Ramakrishnan, V.

    1986-02-01

    Ribosomes are organelles that play a central role in protein synthesis. They are complexes of protein and nucleic acid, and can be analysed as two-component systems by neutron scattering. Moreover, ribosomes can be biochemically prepared that have specific proteins deuterated. Both these properties have been exploited to study the structure of the ribosome by neutron scattering. This article reviews the studies carried out on the small ribosomal subunit, and describes a recent study that has resolved a conflict between the results of two classes of experiments.

  12. Ribosome biogenesis in the yeast Saccharomyces cerevisiae.

    PubMed

    Woolford, John L; Baserga, Susan J

    2013-11-01

    Ribosomes are highly conserved ribonucleoprotein nanomachines that translate information in the genome to create the proteome in all cells. In yeast these complex particles contain four RNAs (>5400 nucleotides) and 79 different proteins. During the past 25 years, studies in yeast have led the way to understanding how these molecules are assembled into ribosomes in vivo. Assembly begins with transcription of ribosomal RNA in the nucleolus, where the RNA then undergoes complex pathways of folding, coupled with nucleotide modification, removal of spacer sequences, and binding to ribosomal proteins. More than 200 assembly factors and 76 small nucleolar RNAs transiently associate with assembling ribosomes, to enable their accurate and efficient construction. Following export of preribosomes from the nucleus to the cytoplasm, they undergo final stages of maturation before entering the pool of functioning ribosomes. Elaborate mechanisms exist to monitor the formation of correct structural and functional neighborhoods within ribosomes and to destroy preribosomes that fail to assemble properly. Studies of yeast ribosome biogenesis provide useful models for ribosomopathies, diseases in humans that result from failure to properly assemble ribosomes. PMID:24190922

  13. Mechanisms for ribotoxin-induced ribosomal RNA cleavage.

    PubMed

    He, Kaiyu; Zhou, Hui-Ren; Pestka, James J

    2012-11-15

    The Type B trichothecene deoxynivalenol (DON), a ribotoxic mycotoxin known to contaminate cereal-based foods, induces ribosomal RNA (rRNA) cleavage in the macrophage via p38-directed activation of caspases. Here we employed the RAW 264.7 murine macrophage model to test the hypothesis that this rRNA cleavage pathway is similarly induced by other ribotoxins. Capillary electrophoresis confirmed that the antibiotic anisomycin (≥25ng/ml), the macrocylic trichothecene satratoxin G (SG) (≥10ng/ml) and ribosome-inactivating protein ricin (≥300ng/ml) induced 18s and 28s rRNA fragmentation patterns identical to that observed for DON. Also, as found for DON, inhibition of p38, double-stranded RNA-activated kinase (PKR) and hematopoietic cell kinase (Hck) suppressed MAPK anisomycin-induced rRNA cleavage, while, in contrast, their inhibition did not affect SG- and ricin-induced rRNA fragmentation. The p53 inhibitor pifithrin-μ and pan caspase inhibitor Z-VAD-FMK suppressed rRNA cleavage induced by anisomycin, SG and ricin, indicating that these ribotoxins shared with DON a conserved downstream pathway. Activation of caspases 8, 9 and 3 concurrently with apoptosis further suggested that rRNA cleavage occurred in parallel with both extrinsic and intrinsic pathways of programmed cell death. When specific inhibitors of cathepsins L and B (lysosomal cysteine cathepsins active at cytosolic neutral pH) were tested, only the former impaired anisomycin-, SG-, ricin- and DON-induced rRNA cleavage. Taken together, the data suggest that (1) all four ribotoxins induced p53-dependent rRNA cleavage via activation of cathepsin L and caspase 3, and (2) activation of p53 by DON and anisomycin involved p38 whereas SG and ricin activated p53 by an alternative mechanism. PMID:23022514

  14. Mechanisms for Ribotoxin-induced Ribosomal RNA Cleavage

    PubMed Central

    He, Kaiyu; Zhou, Hui-Ren; Pestka, James J.

    2012-01-01

    The Type B trichothecene deoxynivalenol (DON), a ribotoxic mycotoxin known to contaminate cereal-based foods, induces ribosomal RNA (rRNA) cleavage in the macrophage via p38-directed activation of caspases. Here we employed the RAW 264.7 murine macrophage model to test the hypothesis that this rRNA cleavage pathway is similarly induced by other ribotoxins. Capillary electrophoresis confirmed that the antibiotic anisomycin (≥25 ng/ml), the macrocylic trichothecene satratoxin G (SG) (≥10 ng/ml) and ribosome-inactivating protein ricin (≥300 ng/ml) induced 18s and 28s rRNA fragmentation patterns identical to that observed for DON. Also, as found for DON, inhibition of p38, double-stranded RNA-activated kinase (PKR) and hematopoietic cell kinase (Hck) suppressed MAPK anisomycin-induced rRNA cleavage, while, in contrast, their inhibition did not affect SG- and ricin-induced rRNA fragmentation. The p53 inhibitor pifithrin-μ and pan caspase inhibitor Z-VAD-FMK suppressed rRNA cleavage induced by anisomycin, SG and ricin, indicating that these ribotoxins shared with DON a conserved downstream pathway. Activation of caspase 8, 9 and 3 concurrently with apoptosis further suggested rRNA cleavage occurred in parallel with both extrinsic and intrinsic pathways of programmed cell death. When specific inhibitors cathepsin L and B (lysosomal cysteine cathepsins active at cytosolic neutral pH) were tested, only the former impaired anisomycin-, SG-, ricin- and DON-induced rRNA cleavage. Taken together, the data suggest that (1) all four ribotoxins induced p53-dependent rRNA cleavage via activation of cathepsin L and caspase 3, and (2) activation of p53 by DON and anisomycin involved p38 whereas SG and ricin activated p53 by an alternative mechanism. PMID:23022514

  15. Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation.

    PubMed

    Al-Hadid, Qais; White, Jonelle; Clarke, Steven

    2016-02-12

    A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. PMID:26801560

  16. Ribosome Mechanics Informs about Mechanism.

    PubMed

    Zimmermann, Michael T; Jia, Kejue; Jernigan, Robert L

    2016-02-27

    The essential aspects of the ribosome's mechanism can be extracted from coarse-grained simulations, including the ratchet motion, the movement together of critical bases at the decoding center, and movements of the peptide tunnel lining that assist in the expulsion of the synthesized peptide. Because of its large size, coarse graining helps to simplify and to aid in the understanding of its mechanism. Results presented here utilize coarse-grained elastic network modeling to extract the dynamics, and both RNAs and proteins are coarse grained. We review our previous results, showing the well-known ratchet motions and the motions in the peptide tunnel and in the mRNA tunnel. The motions of the lining of the peptide tunnel appear to assist in the expulsion of the growing peptide chain, and clamps at the ends of the mRNA tunnel with three proteins ensure that the mRNA is held tightly during decoding and essential for the helicase activity at the entrance. The entry clamp may also assist in base recognition to ensure proper selection of the incoming tRNA. The overall precision of the ribosome machine-like motions is remarkable. PMID:26687034

  17. Mitomycin C Inhibits Ribosomal RNA

    PubMed Central

    Snodgrass, Ryan G.; Collier, Abby C.; Coon, Amy E.; Pritsos, Chris A.

    2010-01-01

    Mitomycin C (MMC) is a commonly used and extensively studied chemotherapeutic agent requiring biological reduction for activity. Damage to nuclear DNA is thought to be its primary mechanism of cell death. Due to a lack of evidence for significant MMC activation in the nucleus and for in vivo studies demonstrating the formation of MMC-DNA adducts, we chose to investigate alternative nucleic acid targets. Real-time reverse transcription-PCR was used to determine changes in mitochondrial gene expression induced by MMC treatment. Although no consistent effects on mitochondrial mRNA expression were observed, complementary results from reverse transcription-PCR experiments and gel-shift and binding assays demonstrated that MMC rapidly decreased the transcript levels of 18S ribosomal RNA in a concentration-dependent manner. Under hypoxic conditions, transcript levels of 18S rRNA decreased by 1.5-fold compared with untreated controls within 30 min. Recovery to base line required several hours, indicating that de novo synthesis of 18S was necessary. Addition of MMC to an in vitro translation reaction significantly decreased protein production in the cell-free system. Functional assays performed using a luciferase reporter construct in vivo determined that protein translation was inhibited, further confirming this mechanism of toxicity. The interaction of MMC with ribosomal RNA and subsequent inhibition of protein translation is consistent with mechanisms proposed for other natural compounds. PMID:20418373

  18. Phylogenetic Analysis of the Spider Mite Sub-Family Tetranychinae (Acari: Tetranychidae) Based on the Mitochondrial COI Gene and the 18S and the 5′ End of the 28S rRNA Genes Indicates That Several Genera Are Polyphyletic

    PubMed Central

    Matsuda, Tomoko; Morishita, Maiko; Hinomoto, Norihide; Gotoh, Tetsuo

    2014-01-01

    The spider mite sub-family Tetranychinae includes many agricultural pests. The internal transcribed spacer (ITS) region of nuclear ribosomal RNA genes and the cytochrome c oxidase subunit I (COI) gene of mitochondrial DNA have been used for species identification and phylogenetic reconstruction within the sub-family Tetranychinae, although they have not always been successful. The 18S and 28S rRNA genes should be more suitable for resolving higher levels of phylogeny, such as tribes or genera of Tetranychinae because these genes evolve more slowly and are made up of conserved regions and divergent domains. Therefore, we used both the 18S (1,825–1,901 bp) and 28S (the 5′ end of 646–743 bp) rRNA genes to infer phylogenetic relationships within the sub-family Tetranychinae with a focus on the tribe Tetranychini. Then, we compared the phylogenetic tree of the 18S and 28S genes with that of the mitochondrial COI gene (618 bp). As observed in previous studies, our phylogeny based on the COI gene was not resolved because of the low bootstrap values for most nodes of the tree. On the other hand, our phylogenetic tree of the 18S and 28S genes revealed several well-supported clades within the sub-family Tetranychinae. The 18S and 28S phylogenetic trees suggest that the tribes Bryobiini, Petrobiini and Eurytetranychini are monophyletic and that the tribe Tetranychini is polyphyletic. At the genus level, six genera for which more than two species were sampled appear to be monophyletic, while four genera (Oligonychus, Tetranychus, Schizotetranychus and Eotetranychus) appear to be polyphyletic. The topology presented here does not fully agree with the current morphology-based taxonomy, so that the diagnostic morphological characters of Tetranychinae need to be reconsidered. PMID:25289639

  19. Biochemical characterization of three mycobacterial ribosomal fractions.

    PubMed

    Portelance, V; Beaudet, R

    1983-02-01

    The induction of antituberculous immunity by crude ribosomal fractions isolated from Mycobacterium tuberculosis strain H37Ra, M. bovis strain BCG, and M. smegmatis was studied in CF-1 mice. Levels of antituberculous immunity similar to that induced by live BCG were induced by the BCG and H37Ra ribosomal fractions whereas that isolated from M. smegmatis was found to be inactive. Electrophoresis of the three ribosomal fractions in sodium dodecyl sulfate - polyacylamide gels followed by differential staining showed the two active ribosomal fractions to be similar in their proteins, carbohydrate-containing substances, and lipid profiles. The inactive smegmatis ribosomal fraction differed mainly from the active ones on the basis of its carbohydrate-containing substances profile and by the absence of lipids. The polysaccharides and the ribosomes present in the H37Ra ribosomal fractions were purified by affinity chromatography on concanavalin A - Sepharose 4B. Each purified preparation showed no or only low antituberculous activity when injected separately, but when mixed together a high protection was observed. The formation of complexes between the ribosomes and the polysaccharide fraction was suggested and appears to be necessary for the induction of antituberculous immunity. PMID:6189570

  20. Ribosome flow model with positive feedback

    PubMed Central

    Margaliot, Michael; Tuller, Tamir

    2013-01-01

    Eukaryotic mRNAs usually form a circular structure; thus, ribosomes that terminatae translation at the 3′ end can diffuse with increased probability to the 5′ end of the transcript, initiating another cycle of translation. This phenomenon describes ribosomal flow with positive feedback—an increase in the flow of ribosomes terminating translating the open reading frame increases the ribosomal initiation rate. The aim of this paper is to model and rigorously analyse translation with feedback. We suggest a modified version of the ribosome flow model, called the ribosome flow model with input and output. In this model, the input is the initiation rate and the output is the translation rate. We analyse this model after closing the loop with a positive linear feedback. We show that the closed-loop system admits a unique globally asymptotically stable equilibrium point. From a biophysical point of view, this means that there exists a unique steady state of ribosome distributions along the mRNA, and thus a unique steady-state translation rate. The solution from any initial distribution will converge to this steady state. The steady-state distribution demonstrates a decrease in ribosome density along the coding sequence. For the case of constant elongation rates, we obtain expressions relating the model parameters to the equilibrium point. These results may perhaps be used to re-engineer the biological system in order to obtain a desired translation rate. PMID:23720534

  1. Evolution of the ribosome at atomic resolution

    PubMed Central

    Petrov, Anton S.; Bernier, Chad R.; Hsiao, Chiaolong; Norris, Ashlyn M.; Kovacs, Nicholas A.; Waterbury, Chris C.; Stepanov, Victor G.; Harvey, Stephen C.; Fox, George E.; Wartell, Roger M.; Hud, Nicholas V.; Williams, Loren Dean

    2014-01-01

    The origins and evolution of the ribosome, 3–4 billion years ago, remain imprinted in the biochemistry of extant life and in the structure of the ribosome. Processes of ribosomal RNA (rRNA) expansion can be “observed” by comparing 3D rRNA structures of bacteria (small), yeast (medium), and metazoans (large). rRNA size correlates well with species complexity. Differences in ribosomes across species reveal that rRNA expansion segments have been added to rRNAs without perturbing the preexisting core. Here we show that rRNA growth occurs by a limited number of processes that include inserting a branch helix onto a preexisting trunk helix and elongation of a helix. rRNA expansions can leave distinctive atomic resolution fingerprints, which we call “insertion fingerprints.” Observation of insertion fingerprints in the ribosomal common core allows identification of probable ancestral expansion segments. Conceptually reversing these expansions allows extrapolation backward in time to generate models of primordial ribosomes. The approach presented here provides insight to the structure of pre-last universal common ancestor rRNAs and the subsequent expansions that shaped the peptidyl transferase center and the conserved core. We infer distinct phases of ribosomal evolution through which ribosomal particles evolve, acquiring coding and translocation, and extending and elaborating the exit tunnel. PMID:24982194

  2. Complementary roles of initiation factor 1 and ribosome recycling factor in 70S ribosome splitting

    PubMed Central

    Pavlov, Michael Y; Antoun, Ayman; Lovmar, Martin; Ehrenberg, Måns

    2008-01-01

    We demonstrate that ribosomes containing a messenger RNA (mRNA) with a strong Shine–Dalgarno sequence are rapidly split into subunits by initiation factors 1 (IF1) and 3 (IF3), but slowly split by ribosome recycling factor (RRF) and elongation factor G (EF-G). Post-termination-like (PTL) ribosomes containing mRNA and a P-site-bound deacylated transfer RNA (tRNA) are split very rapidly by RRF and EF-G, but extremely slowly by IF1 and IF3. Vacant ribosomes are split by RRF/EF-G much more slowly than PTL ribosomes and by IF1/IF3 much more slowly than mRNA-containing ribosomes. These observations reveal complementary splitting of different ribosomal complexes by IF1/IF3 and RRF/EF-G, and suggest the existence of two major pathways for ribosome splitting into subunits in the living cell. We show that the identity of the deacylated tRNA in the PTL ribosome strongly affects the rate by which it is split by RRF/EF-G and that IF3 is involved in the mechanism of ribosome splitting by IF1/IF3 but not by RRF/EF-G. With support from our experimental data, we discuss the principally different mechanisms of ribosome splitting by IF1/IF3 and by RRF/EF-G. PMID:18497739

  3. Interaction of Chloramphenicol Tripeptide Analogs with Ribosomes.

    PubMed

    Tereshchenkov, A G; Shishkina, A V; Tashlitsky, V N; Korshunova, G A; Bogdanov, A A; Sumbatyan, N V

    2016-04-01

    Chloramphenicol amine peptide derivatives containing tripeptide fragments of regulatory "stop peptides" - MRL, IRA, IWP - were synthesized. The ability of the compounds to form ribosomal complexes was studied by displacement of the fluorescent erythromycin analog from its complex with E. coli ribosomes. It was found that peptide chloramphenicol analogs are able to bind to bacterial ribosomes. The dissociation constants were 4.3-10 µM, which is 100-fold lower than the corresponding values for chloramphenicol amine-ribosome complex. Interaction of the chloramphenicol peptide analogs with ribosomes was simulated by molecular docking, and the most probable contacts of "stop peptide" motifs with the elements of nascent peptide exit tunnel were identified. PMID:27293096

  4. Differential Stoichiometry among Core Ribosomal Proteins.

    PubMed

    Slavov, Nikolai; Semrau, Stefan; Airoldi, Edoardo; Budnik, Bogdan; van Oudenaarden, Alexander

    2015-11-01

    Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs), some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC) and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function. PMID:26565899

  5. Viral IRES RNA structures and ribosome interactions.

    PubMed

    Kieft, Jeffrey S

    2008-06-01

    In eukaryotes, protein synthesis initiates primarily by a mechanism that requires a modified nucleotide 'cap' on the mRNA and also proteins that recruit and position the ribosome. Many pathogenic viruses use an alternative, cap-independent mechanism that substitutes RNA structure for the cap and many proteins. The RNAs driving this process are called internal ribosome-entry sites (IRESs) and some are able to bind the ribosome directly using a specific 3D RNA structure. Recent structures of IRES RNAs and IRES-ribosome complexes are revealing the structural basis of viral IRES' 'hijacking' of the protein-making machinery. It now seems that there are fundamental differences in the 3D structures used by different IRESs, although there are some common features in how they interact with ribosomes. PMID:18468443

  6. Differential Stoichiometry among Core Ribosomal Proteins

    PubMed Central

    Slavov, Nikolai; Semrau, Stefan; Airoldi, Edoardo; Budnik, Bogdan; van Oudenaarden, Alexander

    2015-01-01

    Summary Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs), some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC) and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function. PMID:26565899

  7. Ribosome defects in disorders of erythropoiesis.

    PubMed

    Narla, Anupama; Hurst, Slater N; Ebert, Benjamin L

    2011-02-01

    Over the past decade, genetic lesions that cause ribosome dysfunction have been identified in both congenital and acquired human disorders. These discoveries have established a new category of disorders, known as ribosomopathies, in which the primary pathophysiology is related to impaired ribosome function. The protoptypical disorders are Diamond-Blackfan anemia, a congenital bone marrow failure syndrome, and the 5q- syndrome, a subtype of myelodysplastic syndrome. In both of these disorders, impaired ribosome function causes a severe macrocytic anemia. In this review, we will discuss the evidence that defects in ribosomal biogenesis cause the hematologic phenotype of Diamond-Blackfan anemia and the 5q- syndrome. We will also explore the potential mechanisms by which a ribosomal defect, which would be expected to have widespread consequences, may lead to specific defects in erythropoiesis. PMID:21279816

  8. Viral IRES RNA structures and ribosome interactions

    PubMed Central

    Kieft, Jeffrey S.

    2009-01-01

    In eukaryotes, protein synthesis initiates primarily by a mechanism that requires a modified nucleotide ‘cap’ on the mRNA and also proteins that recruit and position the ribosome. Many pathogenic viruses use an alternative, cap-independent mechanism that substitutes RNA structure for the cap and many proteins. The RNAs driving this process are called internal ribosome-entry sites (IRESs) and some are able to bind the ribosome directly using a specific 3D RNA structure. Recent structures of IRES RNAs and IRES–ribosome complexes are revealing the structural basis of viral IRES’ ‘hijacking’ of the protein-making machinery. It now seems that there are fundamental differences in the 3D structures used by different IRESs, although there are some common features in how they interact with ribosomes. PMID:18468443

  9. Systematics of Chaetognatha under the light of molecular data, using duplicated ribosomal 18S DNA sequences.

    PubMed

    Papillon, Daniel; Perez, Yvan; Caubit, Xavier; Le Parco, Yannick

    2006-03-01

    While the phylogenetic position of Chaetognatha has became central to the question of early bilaterian evolution, the internal systematics of the phylum are still not clear. The phylogenetic relationships of the chaetognaths were investigated using newly obtained small subunit ribosomal RNA nuclear 18S (SSU rRNA) sequences from 16 species together with 3 sequences available in GenBank. As previously shown with the large subunit ribosomal RNA 28S gene, two classes of Chaetognatha SSU rRNA gene can be identified, suggesting a duplication of the whole ribosomal cluster; allowing the rooting of one class of genes by another in phylogenetic analyses. Maximum Parsimony, Maximum Likelihood and Bayesian analyses of the molecular data, and statistical tests showed (1) that there are three main monophyletic groups: Sagittidae/Krohnittidae, Spadellidae/Pterosagittidae, and Eukrohniidae/Heterokrohniidae, (2) that the group of Aphragmophora without Pterosagittidae (Sagittidae/Krohnittidae) is monophyletic, (3) the Spadellidae/Pterosagittidae and Eukrohniidae/Heterokrohniidae families are very likely clustered, (4) the Krohnittidae and Pterosagittidae groups should no longer be considered as families as they are included in other groups designated as families, (5) suborder Ctenodontina is not monophyletic and the Flabellodontina should no longer be considered as a suborder, and (6) the Syngonata/Chorismogonata and the Monophragmophora/Biphragmophora hypotheses are rejected. Such conclusions are considered in the light of morphological characters, several of which are shown to be prone to homoplasy. PMID:16434216

  10. NML-mediated rRNA base methylation links ribosomal subunit formation to cell proliferation in a p53-dependent manner.

    PubMed

    Waku, Tsuyoshi; Nakajima, Yuka; Yokoyama, Wataru; Nomura, Naoto; Kako, Koichiro; Kobayashi, Akira; Shimizu, Toshiyuki; Fukamizu, Akiyoshi

    2016-06-15

    Ribosomal RNAs (rRNAs) act as scaffolds and ribozymes in ribosomes, and these functions are modulated by post-transcriptional modifications. However, the biological role of base methylation, a well-conserved modification of rRNA, is poorly understood. Here, we demonstrate that a nucleolar factor, nucleomethylin (NML; also known as RRP8), is required for the N(1)-methyladenosine (m(1)A) modification in 28S rRNAs of human and mouse cells. NML also contributes to 60S ribosomal subunit formation. Intriguingly, NML depletion increases 60S ribosomal protein L11 (RPL11) levels in the ribosome-free fraction and protein levels of p53 through an RPL11-MDM2 complex, which activates the p53 pathway. Consequently, the growth of NML-depleted cells is suppressed in a p53-dependent manner. These observations reveal a new biological function of rRNA base methylation, which links ribosomal subunit formation to p53-dependent inhibition of cell proliferation in mammalian cells. PMID:27149924

  11. The catalytic subunit of shiga-like toxin 1 interacts with ribosomal stalk proteins and is inhibited by their conserved C-terminal domain.

    PubMed

    McCluskey, Andrew J; Poon, Gregory M K; Bolewska-Pedyczak, Eleonora; Srikumar, Tharan; Jeram, Stanley M; Raught, Brian; Gariépy, Jean

    2008-04-25

    Shiga-like toxin 1 (SLT-1) is a type II ribosome-inactivating protein; its A(1) domain blocks protein synthesis in eukaryotic cells by catalyzing the depurination of a single adenine base in 28 S rRNA. The molecular mechanism leading to this site-specific depurination event is thought to involve interactions with eukaryotic ribosomal proteins. Here, we present evidence that the A(1) chain of SLT-1 binds to the ribosomal proteins P0, P1, and P2. These proteins were identified from a HeLa cell lysate by tandem mass spectrometry, and subsequently confirmed to bind to SLT-1 A(1) chain by yeast-two-hybrid and pull-down experiments using candidate full-length proteins. Moreover, the removal of the last 17 amino acids of either protein P1 or P2 abolishes the interaction with the A(1) chain, whereas P0, lacking this common C terminus, still binds to the A(1) domain. In vitro pull-down experiments using fusion protein-tagged C-terminal peptides corresponding to the common 7, 11, and 17 terminal residues of P1 and P2 confirmed that the A(1) chain of SLT-1 as well as the A chain of ricin bind to this shared C-terminal peptide motif. More importantly, a synthetic peptide corresponding to the 17 amino acid C terminus of P1 and P2 was shown to inhibit the ribosome-inactivating function of the A(1) chain of SLT-1 in an in vitro transcription and translation-coupled assay. These results suggest a role for the ribosomal stalk in aiding the A(1) chain of SLT-1 and other type II ribosome-inactivating proteins in localizing its catalytic domain near the site of depurination in the 28 S rRNA. PMID:18358491

  12. Decreased activity of Blastocladiella emersonii zoospore ribosomes: correlation with developmental changes in ribosome-associated proteins.

    PubMed

    Jaworski, A J; Wilson, J B

    1989-10-01

    Ribosomal proteins isolated from dormant zoospores were compared to the ribosomal proteins found in the active growth phase by two-dimensional polyacrylamide gel electrophoresis. Zoospore ribosomes were found to contain a set of five proteins, designated Z1 to Z5, which were not present in growth phase ribosomes. The Z1-Z5 proteins were not removed by high-salt washes using either 1 M KCl or 1 M NH4 Cl. The Z1 protein is found associated with zoospore 60 S subunits while Z2-Z5 are bound to 40 S subunits. Zoospore monoribosomes and polyribosomes contain comparable levels of each of the five proteins. Approximately 60 min. after sporulation is induced, the Z1-Z5 proteins begin to accumulate on the ribosomes with the highest levels of these proteins found associated with ribosomes at the zoospore stage. During germination, the proteins gradually disappear and are not detectable on the ribosomes after 4 hr of germination. The presence of the Z1-Z5 proteins correlates with a decrease in in vitro protein synthetic activity of the fungal ribosomes. The data are consistent with the hypothesis that the proteins regulate translation by completely blocking protein synthesis on a subset of ribosomes while the remainder of the ribosomes function at normal rates. PMID:2776972

  13. Ribosomopathies: human disorders of ribosome dysfunction.

    PubMed

    Narla, Anupama; Ebert, Benjamin L

    2010-04-22

    Ribosomopathies compose a collection of disorders in which genetic abnormalities cause impaired ribosome biogenesis and function, resulting in specific clinical phenotypes. Congenital mutations in RPS19 and other genes encoding ribosomal proteins cause Diamond-Blackfan anemia, a disorder characterized by hypoplastic, macrocytic anemia. Mutations in other genes required for normal ribosome biogenesis have been implicated in other rare congenital syndromes, Schwachman-Diamond syndrome, dyskeratosis congenita, cartilage hair hypoplasia, and Treacher Collins syndrome. In addition, the 5q- syndrome, a subtype of myelodysplastic syndrome, is caused by a somatically acquired deletion of chromosome 5q, which leads to haploinsufficiency of the ribosomal protein RPS14 and an erythroid phenotype highly similar to Diamond-Blackfan anemia. Acquired abnormalities in ribosome function have been implicated more broadly in human malignancies. The p53 pathway provides a surveillance mechanism for protein translation as well as genome integrity and is activated by defects in ribosome biogenesis; this pathway appears to be a critical mediator of many of the clinical features of ribosomopathies. Elucidation of the mechanisms whereby selective abnormalities in ribosome biogenesis cause specific clinical syndromes will hopefully lead to novel therapeutic strategies for these diseases. PMID:20194897

  14. Ribonucleic acid and ribosomes of Bacillus stearothermophilus.

    PubMed

    Saunders, G F; Campbell, L L

    1966-01-01

    Saunders, Grady F. (University of Illinois, Urbana), and L. Leon Campbell. Ribonucleic acid and ribosomes of Bacillus stearothermophilus. J. Bacteriol. 91:332-339. 1966.-The ability of some thermophilic bacteria to grow at temperatures as high as 76 C emphasizes the remarkable thermal stability of their crucial macromolecules. An investigation of the ribonucleic acid (RNA) and ribosomes of Bacillus stearothermophilus was conducted. Washed log-phase cells were disrupted either by sonic treatment or by alumina grinding in 10(-2)m MgCl(2)-10(-2)m tris-(hydroxymethyl)aminomethane buffer, pH 7.4 (TM buffer). Ultracentrifugal analysis revealed peaks at 72.5S, 101S, and 135S, with the 101S peak being the most prominent. By lowering the Mg(++) concentration to 10(-3)m, the ribosome preparation was dissociated to give 40S, 31S, and 54S peaks. These in turn were reassociated in the presence of 10(-2)m Mg(++) to give the larger 73S and 135S particles. When heated in TM buffer, Escherichia coli ribosomes began a gradual dissociation at 58 C, and at 70 C underwent a large hyperchromic shift with a T(m) at 72.8 C. In contrast, B. stearothermophilus ribosomes did not show a hyperchromic shift below 70 C; they had a T(m) of 77.9 C. The thermal denaturation curves of the 4S, 16S, and 23S RNA from both organisms were virtually identical. The gross amino acid composition of B. stearothermophilus ribosomes showed no marked differences from that reported for E. coli ribosomes. These data suggest that the unusual thermal stability of B. stearothermophilus ribosomes may reflect either an unusual packing arrangement of the protein to the RNA or differences in the primary structure of the ribosomal proteins. PMID:5903099

  15. A new system for naming ribosomal proteins

    PubMed Central

    Ban, Nenad; Beckmann, Roland; Cate, Jamie HD; Dinman, Jonathan D; Dragon, François; Ellis, Steven R; Lafontaine, Denis LJ; Lindahl, Lasse; Liljas, Anders; Lipton, Jeffrey M; McAlear, Michael A; Moore, Peter B; Noller, Harry F; Ortega, Joaquin; Panse, Vikram Govind; Ramakrishnan, V; Spahn, Christian MT; Steitz, Thomas A; Tchorzewski, Marek; Tollervey, David; Warren, Alan J; Williamson, James R; Wilson, Daniel; Yonath, Ada; Yusupov, Marat

    2015-01-01

    A system for naming ribosomal proteins is described that the authors intend to use in the future. They urge others to adopt it. The objective is to eliminate the confusion caused by the assignment of identical names to ribosomal proteins from different species that are unrelated in structure and function. In the system proposed here, homologous ribosomal proteins are assigned the same name, regardless of species. It is designed so that new names are similar enough to old names to be easily recognized, but are written in a format that unambiguously identifies them as ‘new system’ names. PMID:24524803

  16. The economics of ribosome biosynthesis in yeast.

    PubMed

    Warner, J R

    1999-11-01

    In a rapidly growing yeast cell, 60% of total transcription is devoted to ribosomal RNA, and 50% of RNA polymerase II transcription and 90% of mRNA splicing are devoted to ribosomal proteins (RPs). Coordinate regulation of the approximately 150 rRNA genes and 137 RP genes that make such prodigious use of resources is essential for the economy of the cell. This is entrusted to a number of signal transduction pathways that can abruptly induce or silence the ribosomal genes, leading to major implications for the expression of other genes as well. PMID:10542411

  17. Computational studies of molecular machines: the ribosome.

    PubMed

    Sanbonmatsu, Karissa Y

    2012-04-01

    The past decade has produced an avalanche of experimental data on the structure and dynamics of the ribosome. Groundbreaking studies in structural biology and kinetics have placed important constraints on ribosome structural dynamics. However, a gulf remains between static structures and time dependent data. In particular, X-ray crystallography and cryo-EM studies produce static models of the ribosome in various states, but lack dynamic information. Single molecule studies produce information on the rates of transitions between these states but do not have high-resolution spatial information. Computational studies have aided in bridging this gap by providing atomic resolution simulations of structural fluctuations and transitions between configurations. PMID:22336622

  18. Computational studies of molecular machines: the ribosome

    PubMed Central

    Sanbonmatsu, Karissa Y.

    2013-01-01

    The past decade has produced an avalanche of experimental data on the structure and dynamics of the ribosome. Groundbreaking studies in structural biology and kinetics have placed important constraints on ribosome structural dynamics. However, a gulf remains between static structures and time dependent data. In particular, x-ray crystallography and cryo-EM studies produce static models of the ribosome in various states, but lack dynamic information. Single molecule studies produce information on the rates of transitions between these states but do not have high-resolution spatial information. Computational studies have aided in bridging this gap by providing atomic resolution simulations of structural fluctuations and transitions between configurations. PMID:22336622

  19. The NF45/NF90 Heterodimer Contributes to the Biogenesis of 60S Ribosomal Subunits and Influences Nucleolar Morphology

    PubMed Central

    Wandrey, Franziska; Montellese, Christian; Koos, Krisztian; Badertscher, Lukas; Bammert, Lukas; Cook, Atlanta G.; Zemp, Ivo; Horvath, Peter

    2015-01-01

    The interleukin enhancer binding factors ILF2 (NF45) and ILF3 (NF90/NF110) have been implicated in various cellular pathways, such as transcription, microRNA (miRNA) processing, DNA repair, and translation, in mammalian cells. Using tandem affinity purification, we identified human NF45 and NF90 as components of precursors to 60S (pre-60S) ribosomal subunits. NF45 and NF90 are enriched in nucleoli and cosediment with pre-60S ribosomal particles in density gradient analysis. We show that association of the NF45/NF90 heterodimer with pre-60S ribosomal particles requires the double-stranded RNA binding domains of NF90, while depletion of NF45 and NF90 by RNA interference leads to a defect in 60S biogenesis. Nucleoli of cells depleted of NF45 and NF90 have altered morphology and display a characteristic spherical shape. These effects are not due to impaired rRNA transcription or processing of the precursors to 28S rRNA. Consistent with a role of the NF45/NF90 heterodimer in nucleolar steps of 60S subunit biogenesis, downregulation of NF45 and NF90 leads to a p53 response, accompanied by induction of the cyclin-dependent kinase inhibitor p21/CIP1, which can be counteracted by depletion of RPL11. Together, these data indicate that NF45 and NF90 are novel higher-eukaryote-specific factors required for the maturation of 60S ribosomal subunits. PMID:26240280

  20. Phylogenetic Analysis Using the 28S rRNA Gene Reveals That the Genus Paracreptotrema (Digenea: Allocreadiidae) Is Not Monophyletic; Description of Two New Genera and One New Species.

    PubMed

    de León, Gerardo Pérez-Ponce; Pinacho-Pinacho, Carlos D; Mendoza-Garfias, Berenit; Choudhury, Anindo; García-Varela, Martín

    2016-02-01

    This study investigates the systematics of Paracreptotrema Choudhury, Pérez-Ponce de León, Brooks and Daverdin, 2006 using morphological data (stained whole mounts and scanning electron microscopy) and partial sequences of the 28S ribosomal rRNA gene, obtained from freshly collected material. In total, 484 specimens representing 4 species, i.e., Paracreptotrema blancoi (157), Paracreptotrema profundulusi (12), Paracreptotrema rosenthali (8), and Paracreptotrema blancoi sensu Salgado-Maldonado et al. (2011) (307) were collected. Existing museum depositions were also studied. The 28S rRNA gene sequences of these Paracreptotrema spp. were aligned, along with sequences from 22 other allocreadiids and 4 other non-allocreadiid xiphidiatan species. Bayesian inference and maximum likelihood analyses indicated a paraphyletic Paracreptotrema split into 3 clades: 1 comprising P. blancoi and P. rosenthali that was sister to a clade formed by 3 other species of allocreadiids (species of Wallinia, Creptotrematina, and Auriculostoma) typically found in characid fishes, a second clade formed solely by Paracreptotrema heterandriae as the sister taxon of the aforementioned species, and a third by P. profundulusi and specimens erroneously identified as P. blancoi. Two new taxa were erected to reflect these results: Paracreptotrematoides for Paracreptotrema heterandriae, and Pseudoparacreptotrema for Paracreptotrema profundulusi and P. macroacetabulata (the species erroneously identified as P. blancoi from profundulids across Middle America). Closer consideration of the morphology corroborates these findings. The revised systematics also indicated that Paracreptotrema spp. are found in poeciliids, whereas Pseudoparacreptotrema spp. parasitize profundulids. The study demonstrates the value of an integrative taxonomy approach to address the apparently complicated systematics of the allocreadiids. PMID:26561039

  1. Introns regulate the production of ribosomal proteins by modulating splicing of duplicated ribosomal protein genes.

    PubMed

    Petibon, Cyrielle; Parenteau, Julie; Catala, Mathieu; Elela, Sherif Abou

    2016-05-01

    Most budding yeast introns exist in the many duplicated ribosomal protein genes (RPGs) and it has been posited that they remain there to modulate the expression of RPGs and cell growth in response to stress. However, the mechanism by which introns regulate the expression of RPGs and their impact on the synthesis of ribosomal proteins remain unclear. In this study, we show that introns determine the ratio of ribosomal protein isoforms through asymmetric paralog-specific regulation of splicing. Exchanging the introns and 3' untranslated regions of the duplicated RPS9 genes altered the splicing efficiency and changed the ratio of the ribosomal protein isoforms. Mutational analysis of the RPS9 genes indicated that splicing is regulated by variations in the intron structure and the 3' untranslated region. Together these data suggest that preferential splicing of duplicated RPGs provides a means for adjusting the ratio of different ribosomal protein isoforms, while maintaining the overall expression level of each ribosomal protein. PMID:26945043

  2. The Ribosome Biogenesis Protein Nol9 Is Essential for Definitive Hematopoiesis and Pancreas Morphogenesis in Zebrafish.

    PubMed

    Bielczyk-Maczyńska, Ewa; Lam Hung, Laure; Ferreira, Lauren; Fleischmann, Tobias; Weis, Félix; Fernández-Pevida, Antonio; Harvey, Steven A; Wali, Neha; Warren, Alan J; Barroso, Inês; Stemple, Derek L; Cvejic, Ana

    2015-12-01

    Ribosome biogenesis is a ubiquitous and essential process in cells. Defects in ribosome biogenesis and function result in a group of human disorders, collectively known as ribosomopathies. In this study, we describe a zebrafish mutant with a loss-of-function mutation in nol9, a gene that encodes a non-ribosomal protein involved in rRNA processing. nol9sa1022/sa1022 mutants have a defect in 28S rRNA processing. The nol9sa1022/sa1022 larvae display hypoplastic pancreas, liver and intestine and have decreased numbers of hematopoietic stem and progenitor cells (HSPCs), as well as definitive erythrocytes and lymphocytes. In addition, ultrastructural analysis revealed signs of pathological processes occurring in endothelial cells of the caudal vein, emphasizing the complexity of the phenotype observed in nol9sa1022/sa1022 larvae. We further show that both the pancreatic and hematopoietic deficiencies in nol9sa1022/sa1022 embryos were due to impaired cell proliferation of respective progenitor cells. Interestingly, genetic loss of Tp53 rescued the HSPCs but not the pancreatic defects. In contrast, activation of mRNA translation via the mTOR pathway by L-Leucine treatment did not revert the erythroid or pancreatic defects. Together, we present the nol9sa1022/sa1022 mutant, a novel zebrafish ribosomopathy model, which recapitulates key human disease characteristics. The use of this genetically tractable model will enhance our understanding of the tissue-specific mechanisms following impaired ribosome biogenesis in the context of an intact vertebrate. PMID:26624285

  3. The Ribosome Biogenesis Protein Nol9 Is Essential for Definitive Hematopoiesis and Pancreas Morphogenesis in Zebrafish

    PubMed Central

    Ferreira, Lauren; Fleischmann, Tobias; Weis, Félix; Fernández-Pevida, Antonio; Harvey, Steven A.; Wali, Neha; Warren, Alan J.; Barroso, Inês; Stemple, Derek L.; Cvejic, Ana

    2015-01-01

    Ribosome biogenesis is a ubiquitous and essential process in cells. Defects in ribosome biogenesis and function result in a group of human disorders, collectively known as ribosomopathies. In this study, we describe a zebrafish mutant with a loss-of-function mutation in nol9, a gene that encodes a non-ribosomal protein involved in rRNA processing. nol9 sa1022/sa1022 mutants have a defect in 28S rRNA processing. The nol9 sa1022/sa1022 larvae display hypoplastic pancreas, liver and intestine and have decreased numbers of hematopoietic stem and progenitor cells (HSPCs), as well as definitive erythrocytes and lymphocytes. In addition, ultrastructural analysis revealed signs of pathological processes occurring in endothelial cells of the caudal vein, emphasizing the complexity of the phenotype observed in nol9 sa1022/sa1022 larvae. We further show that both the pancreatic and hematopoietic deficiencies in nol9 sa1022/sa1022 embryos were due to impaired cell proliferation of respective progenitor cells. Interestingly, genetic loss of Tp53 rescued the HSPCs but not the pancreatic defects. In contrast, activation of mRNA translation via the mTOR pathway by L-Leucine treatment did not revert the erythroid or pancreatic defects. Together, we present the nol9 sa1022/sa1022 mutant, a novel zebrafish ribosomopathy model, which recapitulates key human disease characteristics. The use of this genetically tractable model will enhance our understanding of the tissue-specific mechanisms following impaired ribosome biogenesis in the context of an intact vertebrate. PMID:26624285

  4. The tails of ubiquitin precursors are ribosomal proteins whose fusion to ubiquitin facilitates ribosome biogenesis

    NASA Astrophysics Data System (ADS)

    Finley, Daniel; Bartel, Bonnie; Varshavsky, Alexander

    1989-03-01

    Three of the four yeast ubiquitin genes encode hybrid proteins which are cleaved to yield ubiquitin and previously unidentified ribosomal proteins. The transient association between ubiquitin and these proteins promotes their incorporation into nascent ribosomes and is required for efficient ribosome biogenesis. These results suggest a novel 'chaperone' function for ubiquitin, in which its covalent association with other proteins promotes the formation of specific cellular structures.

  5. Illuminating Parasite Protein Production by Ribosome Profiling.

    PubMed

    Parsons, Marilyn; Myler, Peter J

    2016-06-01

    While technologies for global enumeration of transcript abundance are well-developed, those that assess protein abundance require tailoring to penetrate to low-abundance proteins. Ribosome profiling circumvents this challenge by measuring global protein production via sequencing small mRNA fragments protected by the assembled ribosome. This powerful approach is now being applied to protozoan parasites including trypanosomes and Plasmodium. It has been used to identify new protein-coding sequences (CDSs) and clarify the boundaries of previously annotated CDSs in Trypanosoma brucei. Ribosome profiling has demonstrated that translation efficiencies vary widely between genes and, for trypanosomes at least, for the same gene across stages. The ribosomal proteins are themselves subjected to translational control, suggesting a means of reinforcing global translational regulation. PMID:27061497

  6. Marrow failure: a window into ribosome biology.

    PubMed

    Ruggero, Davide; Shimamura, Akiko

    2014-10-30

    Diamond-Blackfan anemia, Shwachman-Diamond syndrome, and dyskeratosis congenita are inherited syndromes characterized by marrow failure, congenital anomalies, and cancer predisposition. Genetic and molecular studies have uncovered distinct abnormalities in ribosome biogenesis underlying each of these 3 disorders. How defects in ribosomes, the essential organelles required for protein biosynthesis in all cells, cause tissue-specific abnormalities in human disease remains a question of fundamental scientific and medical importance. Here we review the overlapping and distinct clinical features of these 3 syndromes and discuss current knowledge regarding the ribosomal pathways disrupted in each of these disorders. We also explore the increasing complexity of ribosome biology and how this informs our understanding of developmental biology and human disease. PMID:25237201

  7. The immunological properties of Brucella ribosomal preparations.

    PubMed

    Corbel, M J

    1976-01-01

    Ribosomes were isolated from Brucella abortus strains 19 and 45/20 by disruption of the cells followed by differential ultracentrifugation. The ribosome preparations contained 2-3 components reacting in immunodiffusion tests but were free of detectable lipopolysaccharide-protein agglutinogen. They crossreacted with antisera to Br. abortus, Br. melitensis, Br. suis and Br. ovis and elicited intradermal delayed hypersensitivity reactions in animals infected with Br. abortus, Br. melitensis or Br. suis. The ribosomes were antigenic in rabbits, guinea pigs and mice. Those from Br. abortus S19 induced agglutinins reaction with smooth brucella strains whereas those from Br. abortus 45/20 induced agglutinins reacting with rough brucella strains. Cattle vaccinated with S19 or 45/20 vaccines or infected with Br. abortus developed pricipitins to ribosomal components at an early stage in the immune response. PMID:816681

  8. Marrow failure: a window into ribosome biology

    PubMed Central

    Ruggero, Davide

    2014-01-01

    Diamond-Blackfan anemia, Shwachman-Diamond syndrome, and dyskeratosis congenita are inherited syndromes characterized by marrow failure, congenital anomalies, and cancer predisposition. Genetic and molecular studies have uncovered distinct abnormalities in ribosome biogenesis underlying each of these 3 disorders. How defects in ribosomes, the essential organelles required for protein biosynthesis in all cells, cause tissue-specific abnormalities in human disease remains a question of fundamental scientific and medical importance. Here we review the overlapping and distinct clinical features of these 3 syndromes and discuss current knowledge regarding the ribosomal pathways disrupted in each of these disorders. We also explore the increasing complexity of ribosome biology and how this informs our understanding of developmental biology and human disease. PMID:25237201

  9. Ribosome Inactivating Proteins from Rosaceae.

    PubMed

    Shang, Chenjing; Rougé, Pierre; Van Damme, Els J M

    2016-01-01

    Ribosome-inactivating proteins (RIPs) are widespread among higher plants of different taxonomic orders. In this study, we report on the RIP sequences found in the genome/transcriptome of several important Rosaceae species, including many economically important edible fruits such as apple, pear, peach, apricot, and strawberry. All RIP domains from Rosaceae share high sequence similarity with conserved residues in the catalytic site and the carbohydrate binding sites. The genomes of Malus domestica and Pyrus communis contain both type 1 and type 2 RIP sequences, whereas for Prunus mume, Prunus persica, Pyrus bretschneideri, and Pyrus communis a complex set of type 1 RIP sequences was retrieved. Heterologous expression and purification of the type 1 as well as the type 2 RIP from apple allowed to characterize the biological activity of the proteins. Both RIPs from Malus domestica can inhibit protein synthesis. Furthermore, molecular modelling suggests that RIPs from Rosaceae possess three-dimensional structures that are highly similar to the model proteins and can bind to RIP substrates. Screening of the recombinant type 2 RIP from apple on a glycan array revealed that this type 2 RIP interacts with terminal sialic acid residues. Our data suggest that the RIPs from Rosaceae are biologically active proteins. PMID:27556443

  10. Frozen spin targets in ribosomal structure research.

    PubMed

    Stuhrmann, H B

    1991-01-01

    Polarized neutron scattering strongly depends on nuclear spin polarisation, particularly on proton spin polarisation. A single proton in a deuterated environment then is as efficient as 10 electrons in X-ray anomalous diffraction. Neutron scattering from the nuclear spin label is controlled by the polarisation of neutron spins and nuclear spins. Pure deuteron spin labels and proton spin labels are created by NMR saturation. We report on results obtained from the large subunit of E. coli ribosomes which have been obtained at the research reactor of GKSS using the polarized target facility developed by CERN. The nuclear spins were oriented with respect to an external field by dynamic nuclear polarisation. Proton spin polarisations of more than 80% were obtained in ribosomes at temperatures below 0.5 K. At T = 130 mK the relaxation time of the polarized target is one month (frozen spin target). Polarized small-angle neutron scattering of the in situ structure of rRNA and the total ribosomal protein (TP) has been determined from the frozen spin targets of the large ribosomal subunit, which has been deuterated in the TP and rRNA respectively. The results agree with those from neutron scattering in H2O/D2O mixtures obtained at room temperature. This is a necessary prerequisite for the planned determination of the in situ structure of individual ribosomal proteins and especially of that of ribosome bound mRNA and tRNAs. PMID:1720669

  11. Ribosomal DNA haplotype distribution of Bursaphelenchus xylophilus in Kyushu and Okinawa islands, Japan.

    PubMed

    Nose, Mine; Shiraishi, Susumu; Miyahara, Fumihiko; Ohira, Mineko; Matsunaga, Koji; Tobase, Masashi; Koyama, Takao; Yoshimoto, Kikuo

    2009-09-01

    Ribosomal DNA region sequences (partial 18S, 28S and complete ITS1, 5.8S, and ITS2) of the pinewood nematode (Bursaphelenchus xylophilus) were obtained from DNA extracted directly from wood pieces collected from wilted pine trees throughout the Kyushu and Okinawa islands, Japan. Either a 2569bp or 2573bp sequence was obtained from 88 of 143 samples. Together with the 45 rDNA sequences of pinewood nematode isolates previously reported, there were eight single nucleotide polymorphisms and two indels of two bases. Based on these mutations, nine haplotypes were estimated. The haplotype frequencies differed among regions in Kyushu island (northwest, northeast and center, southeast, and southwest), and the distribution was consistent with the invasion and spreading routes of the pinewood nematode previously estimated from past records of pine wilt and wood importation. There was no significant difference in haplotype frequencies among the collection sites on Okinawa island. PMID:22736814

  12. Transcription termination and RNA processing in the 3'-end spacer of mouse ribosomal RNA genes.

    PubMed Central

    Miwa, T; Kominami, R; Yoshikura, H; Sudo, K; Muramatsu, M

    1987-01-01

    The 3' termini of ribosomal RNA precursors from mouse FM3A cultured cells are mapped to eight sites within 625 bp downstream from the 3' terminus of 28 S rRNA. Three additional sites are mapped in liver RNA from C3H/He strain mice. Two of them, the sites at 570 bp and 625 bp are assumed to be termination sites in vivo, because they correspond to in vitro termination sites of RNA polymerase I, and 45 S RNAs having these 3' termini decay with kinetics distinct from others. The amount of 45 S RNA having the 3' terminus at other sites is variable among several mouse strains, despite their having the same DNA sequence in these regions. The ability to produce 3' termini in these sites seems to follow Mendel's law of inheritance. Therefore, we postulate that these nine sites are RNA processing sites which are controlled genetically. Images PMID:3031586

  13. Intraspecific Variation in Ribosomal DNA in Populations of the Potato Cyst Nematode Globodera pallida.

    PubMed

    Blok, V C; Malloch, G; Harrower, B; Phillips, M S; Vrain, T C

    1998-06-01

    The relationships among a number of populations of Globodera pallida from Britian, the Netherlands, Germany, Switzerland, and South America were examined using PCR amplification of the ribosomal cistron between the 18S and 28S genes that include the two intergenic spacer regions (ITS1 and ITS2) and the 5.8S gene. Amplifications produced a similar-sized product of 1150 bp from all populations. Digestion of the amplified fragment with a number of restriction enzymes showed differences among the populations. The restriction enzyme RsaI distinguished the most populations. The RFLP patterns revealed by this enzyme were complex and could have arisen from heterogeneity between individuals within populations and from differences between the repeats of an individual. Sequence analysis from six of the populations, together with RFLP analysis of PCR products, shows that there is intraspecific variation in the rDNA of G. pallida. PMID:19274220

  14. Intraspecific Variation in Ribosomal DNA in Populations of the Potato Cyst Nematode Globodera pallida

    PubMed Central

    Blok, V. C.; Malloch, G.; Harrower, B.; Phillips, M. S.; Vrain, T. C.

    1998-01-01

    The relationships among a number of populations of Globodera pallida from Britian, the Netherlands, Germany, Switzerland, and South America were examined using PCR amplification of the ribosomal cistron between the 18S and 28S genes that include the two intergenic spacer regions (ITS1 and ITS2) and the 5.8S gene. Amplifications produced a similar-sized product of 1150 bp from all populations. Digestion of the amplified fragment with a number of restriction enzymes showed differences among the populations. The restriction enzyme RsaI distinguished the most populations. The RFLP patterns revealed by this enzyme were complex and could have arisen from heterogeneity between individuals within populations and from differences between the repeats of an individual. Sequence analysis from six of the populations, together with RFLP analysis of PCR products, shows that there is intraspecific variation in the rDNA of G. pallida. PMID:19274220

  15. Intra-Genomic Variation in the Ribosomal Repeats of Nematodes

    PubMed Central

    Bik, Holly M.; Fournier, David; Sung, Way; Bergeron, R. Daniel; Thomas, W. Kelley

    2013-01-01

    Ribosomal loci represent a major tool for investigating environmental diversity and community structure via high-throughput marker gene studies of eukaryotes (e.g. 18S rRNA). Since the estimation of species’ abundance is a major goal of environmental studies (by counting numbers of sequences), understanding the patterns of rRNA copy number across species will be critical for informing such high-throughput approaches. Such knowledge is critical, given that ribosomal RNA genes exist within multi-copy repeated arrays in a genome. Here we measured the repeat copy number for six nematode species by mapping the sequences from whole genome shotgun libraries against reference sequences for their rRNA repeat. This revealed a 6-fold variation in repeat copy number amongst taxa investigated, with levels of intragenomic variation ranging from 56 to 323 copies of the rRNA array. By applying the same approach to four C. elegans mutation accumulation lines propagated by repeated bottlenecking for an average of ~400 generations, we find on average a 2-fold increase in repeat copy number (rate of increase in rRNA estimated at 0.0285-0.3414 copies per generation), suggesting that rRNA repeat copy number is subject to selection. Within each Caenorhabditis species, the majority of intragenomic variation found across the rRNA repeat was observed within gene regions (18S, 28S, 5.8S), suggesting that such intragenomic variation is not a product of selection for rRNA coding function. We find that the dramatic variation in repeat copy number among these six nematode genomes would limit the use of rRNA in estimates of organismal abundance. In addition, the unique pattern of variation within a single genome was uncorrelated with patterns of divergence between species, reflecting a strong signature of natural selection for rRNA function. A better understanding of the factors that control or affect copy number in these arrays, as well as their rates and patterns of evolution, will be

  16. Targets and Intracellular Signaling Mechanisms for Deoxynivalenol-Induced Ribosomal RNA Cleavage

    PubMed Central

    He, Kaiyu; Zhou, Hui-Ren; Pestka, James J.

    2012-01-01

    The trichothecene mycotoxin deoxynivalenol (DON), a known translational inhibitor, induces ribosomal RNA (rRNA) cleavage. Here, we characterized this process relative to (1) specific 18S and 28S ribosomal RNA cleavage sites and (2) identity of specific upstream signaling elements in this pathway. Capillary electrophoresis indicated that DON at concentrations as low as 200 ng/ml evoked selective rRNA cleavage after 6 h and that 1000 ng/ml caused cleavage within 2 h. Northern blot analysis revealed that DON exposure induced six rRNA cleavage fragments from 28S rRNA and five fragments from 18S rRNA. When selective kinase inhibitors were used to identify potential upstream signals, RNA-activated protein kinase (PKR), hematopoietic cell kinase (Hck), and p38 were found to be required for rRNA cleavage, whereas c-Jun N-terminal kinase and extracellular signal-regulated kinase were not. Furthermore, rRNA fragmentation was suppressed by the p53 inhibitors pifithrin-α and pifithrin-μ as well as the pan caspase inhibitor Z-VAD-FMK. Concurrent apoptosis was confirmed by acridine orange/ethidium bromide staining and flow cytometry. DON activated caspases 3, 8, and 9, thus suggesting the possible coinvolvement of both extrinsic and intrinsic apoptotic pathways in rRNA cleavage. Satratoxin G (SG), anisomycin, and ricin also induced specific rRNA cleavage profiles identical to those of DON, suggesting that ribotoxins might share a conserved rRNA cleavage mechanism. Taken together, DON-induced rRNA cleavage is likely to be closely linked to apoptosis activation and appears to involve the sequential activation of PKR/Hck →p38→p53→caspase 8/9→caspase 3. PMID:22491426

  17. Targets and intracellular signaling mechanisms for deoxynivalenol-induced ribosomal RNA cleavage.

    PubMed

    He, Kaiyu; Zhou, Hui-Ren; Pestka, James J

    2012-06-01

    The trichothecene mycotoxin deoxynivalenol (DON), a known translational inhibitor, induces ribosomal RNA (rRNA) cleavage. Here, we characterized this process relative to (1) specific 18S and 28S ribosomal RNA cleavage sites and (2) identity of specific upstream signaling elements in this pathway. Capillary electrophoresis indicated that DON at concentrations as low as 200 ng/ml evoked selective rRNA cleavage after 6 h and that 1000 ng/ml caused cleavage within 2 h. Northern blot analysis revealed that DON exposure induced six rRNA cleavage fragments from 28S rRNA and five fragments from 18S rRNA. When selective kinase inhibitors were used to identify potential upstream signals, RNA-activated protein kinase (PKR), hematopoietic cell kinase (Hck), and p38 were found to be required for rRNA cleavage, whereas c-Jun N-terminal kinase and extracellular signal-regulated kinase were not. Furthermore, rRNA fragmentation was suppressed by the p53 inhibitors pifithrin-α and pifithrin-μ as well as the pan caspase inhibitor Z-VAD-FMK. Concurrent apoptosis was confirmed by acridine orange/ethidium bromide staining and flow cytometry. DON activated caspases 3, 8, and 9, thus suggesting the possible coinvolvement of both extrinsic and intrinsic apoptotic pathways in rRNA cleavage. Satratoxin G (SG), anisomycin, and ricin also induced specific rRNA cleavage profiles identical to those of DON, suggesting that ribotoxins might share a conserved rRNA cleavage mechanism. Taken together, DON-induced rRNA cleavage is likely to be closely linked to apoptosis activation and appears to involve the sequential activation of PKR/Hck →p38→p53→caspase 8/9→caspase 3. PMID:22491426

  18. The structure of ribosome-lankacidin complex reveals ribosomal sites for synergistic antibiotics

    SciTech Connect

    Auerbach, Tamar; Mermershtain, Inbal; Davidovich, Chen; Bashan, Anat; Belousoff, Matthew; Wekselman, Itai; Zimmerman, Ella; Xiong, Liqun; Klepacki, Dorota; Arakawa, Kenji; Kinashi, Haruyasu; Mankin, Alexander S.; Yonath, Ada

    2010-04-26

    Crystallographic analysis revealed that the 17-member polyketide antibiotic lankacidin produced by Streptomyces rochei binds at the peptidyl transferase center of the eubacterial large ribosomal subunit. Biochemical and functional studies verified this finding and showed interference with peptide bond formation. Chemical probing indicated that the macrolide lankamycin, a second antibiotic produced by the same species, binds at a neighboring site, at the ribosome exit tunnel. These two antibiotics can bind to the ribosome simultaneously and display synergy in inhibiting bacterial growth. The binding site of lankacidin and lankamycin partially overlap with the binding site of another pair of synergistic antibiotics, the streptogramins. Thus, at least two pairs of structurally dissimilar compounds have been selected in the course of evolution to act synergistically by targeting neighboring sites in the ribosome. These results underscore the importance of the corresponding ribosomal sites for development of clinically relevant synergistic antibiotics and demonstrate the utility of structural analysis for providing new directions for drug discovery.

  19. High-resolution structure of the Escherichia coli ribosome

    PubMed Central

    Noeske, Jonas; Wasserman, Michael R.; Terry, Daniel S.; Altman, Roger B.; Blanchard, Scott C.; Cate, Jamie H. D.

    2015-01-01

    Protein synthesis by the ribosome is highly dependent on the ionic conditions in the cellular environment, but the roles of ribosome solvation remain poorly understood. Moreover, the function of modifications to ribosomal RNA and ribosomal proteins are unclear. Here we present the structure of the Escherichia coli 70S ribosome to 2.4 Å resolution. The structure reveals details of the ribosomal subunit interface that are conserved in all domains of life, and suggest how solvation contributes to ribosome integrity and function. The structure also suggests how the conformation of ribosomal protein uS12 likely impacts its contribution to messenger RNA decoding. This structure helps to explain the phylogenetic conservation of key elements of the ribosome, including posttranscriptional and posttranslational modifications and should serve as a basis for future antibiotic development. PMID:25775265

  20. Transition state analogues in structures of ricin and saporin ribosome-inactivating proteins

    SciTech Connect

    Ho, Meng-Chiao; Sturm, Matthew B.; Almo, Steven C.; Schramm, Vern L.

    2010-01-12

    Ricin A-chain (RTA) and saporin-L1 (SAP) catalyze adenosine depurination of 28S rRNA to inhibit protein synthesis and cause cell death. We present the crystal structures of RTA and SAP in complex with transition state analogue inhibitors. These tight-binding inhibitors mimic the sarcin-ricin recognition loop of 28S rRNA and the dissociative ribocation transition state established for RTA catalysis. RTA and SAP share unique purine-binding geometry with quadruple {pi}-stacking interactions between adjacent adenine and guanine bases and 2 conserved tyrosines. An arginine at one end of the {pi}-stack provides cationic polarization and enhanced leaving group ability to the susceptible adenine. Common features of these ribosome-inactivating proteins include adenine leaving group activation, a remarkable lack of ribocation stabilization, and conserved glutamates as general bases for activation of the H{sub 2}O nucleophile. Catalytic forces originate primarily from leaving group activation evident in both RTA and SAP in complex with transition state analogues.

  1. Identification of a Recently Active Mammalian SINE Derived from Ribosomal RNA

    PubMed Central

    Longo, Mark S.; Brown, Judy D.; Zhang, Chu; O’Neill, Michael J.; O’Neill, Rachel J.

    2015-01-01

    Complex eukaryotic genomes are riddled with repeated sequences whose derivation does not coincide with phylogenetic history and thus is often unknown. Among such sequences, the capacity for transcriptional activity coupled with the adaptive use of reverse transcription can lead to a diverse group of genomic elements across taxa, otherwise known as selfish elements or mobile elements. Short interspersed nuclear elements (SINEs) are nonautonomous mobile elements found in eukaryotic genomes, typically derived from cellular RNAs such as tRNAs, 7SL or 5S rRNA. Here, we identify and characterize a previously unknown SINE derived from the 3′-end of the large ribosomal subunit (LSU or 28S rDNA) and transcribed via RNA polymerase III. This new element, SINE28, is represented in low-copy numbers in the human reference genome assembly, wherein we have identified 27 discrete loci. Phylogenetic analysis indicates these elements have been transpositionally active within primate lineages as recently as 6 MYA while modern humans still carry transcriptionally active copies. Moreover, we have identified SINE28s in all currently available assembled mammalian genome sequences. Phylogenetic comparisons indicate that these elements are frequently rederived from the highly conserved LSU rRNA sequences in a lineage-specific manner. We propose that this element has not been previously recognized as a SINE given its high identity to the canonical LSU, and that SINE28 likely represents one of possibly many unidentified, active transposable elements within mammalian genomes. PMID:25637222

  2. Differential Expression of Ribosomal Genes in Brain and Blood of Alzheimer's Disease Patients.

    PubMed

    Rasmussen, Lucas; de Labio, Roger W; Viani, Gustavo A; Chen, Elizabeth; Villares, Joao; Bertolucci, Paulo-Henrique; Minett, Thais S; Turecki, Gustavo; Cecyre, Danielle; Drigo, Sandra A; Smith, Marilia C; Payao, Spencer L M

    2015-01-01

    Changes in rRNA and rDNA expression have been associated with cellular and organism aging and have been linked to Alzheimer's disease (AD) pathogenesis. In this study, we investigated the mRNA expression of ribosomal genes (28S/18S) and β-amyloid precursor protein (APP) in different post mortem brain tissue regions (the entorhinal and auditory cortices and the hippocampus) of AD patients and elderly control subjects and also evaluated the extent of expression in peripheral blood from young, healthy, elderly, and Alzheimer's disease patients in order to investigate whether these individuals experienced the effects of aging. The comparative threshold cycle (CT) method via Real Time Polymerase Chain Reaction and the Polymerase Chain Reaction- Restriction Fragment Length Polymorphism (PCR-RFLP) were used to analyze gene expression and the Apolipoprotein E (APOE) genotype, respectively. When the brain areas were analyzed collectively, we observed a significant decrease in APP expression and a significant increase in levels of mRNA of 18S and 28S in Alzheimer's disease patients compared to healthy elderly individuals. Furthermore, there was a significant upregulation of 28SrRNA in the entorhinal cortex and hippocampus, but not in the auditory cortex of patients with AD. On the other hand, tests of blood samples verified a decreased expression of 28S rRNA in patients with AD. These results support the hypothesis that changes in rRNA are present in AD patients, are tissue-specific, and seem to occur independently and differently in each tissue. However, the next challenge is to discover the mechanisms responsible for the differences in expression observed in the blood and the brain in both healthy elderly individuals and Alzheimer's disease patients, as well as the impact of these genes on AD pathogenesis. PMID:26502820

  3. Mitochondrial ribosomal proteins (MRPs) of yeast.

    PubMed Central

    Graack, H R; Wittmann-Liebold, B

    1998-01-01

    Mitochondrial ribosomal proteins (MRPs) are the counterparts in that organelle of the cytoplasmic ribosomal proteins in the host. Although the MRPs fulfil similar functions in protein biosynthesis, they are distinct in number, features and primary structures from the latter. Most progress in the eludication of the properties of individual MRPs, and in the characterization of the corresponding genes, has been made in baker's yeast (Saccharomyces cerevisiae). To date, 50 different MRPs have been determined, although biochemical data and mutational analysis propose a total number which is substantially higher. Surprisingly, only a minority of the MRPs that have been characterized show significant sequence similarities to known ribosomal proteins from other sources, thus limiting the deduction of their functions by simple comparison of amino acid sequences. Further, individual MRPs have been characterized functionally by mutational studies, and the regulation of expression of MRP genes has been described. The interaction of the mitochondrial ribosomes with transcription factors specific for individual mitochondrial mRNAs, and the communication between mitochondria and the nucleus for the co-ordinated expression of ribosomal constituents, are other aspects of current MRP research. Although the mitochondrial translational system is still far from being described completely, the yeast MRP system serves as a model for other organisms, including that of humans. PMID:9445368

  4. Large-scale isolation of mitochondrial ribosomes from mammalian tissues.

    PubMed

    Spremulli, Linda L

    2007-01-01

    The preparation of mammalian mitochondrial ribosomes in sufficient quantities for biochemical studies is best done beginning with whole tissue rather than from cells in culture. This issue arises because of the low abundance of these ribosomes in cells, making their isolation a challenge. Crude mitochondrial preparations are made by differential centrifugation and are treated with digitonin to remove the outer membrane. This treatment also effectively removes most contamination by cytoplasmic ribosomes. Purification of mammalian mitochondrial ribosomes requires treatment with detergents to release the ribosomes from their association with the membrane. Sucrose density gradient centrifugation is used to separate the ribosomes from other large oligomeric complexes from this organelle. PMID:18314732

  5. Simultaneous alignment and folding of 28S rRNA sequences uncovers phylogenetic signal in structure variation.

    PubMed

    Letsch, Harald O; Greve, Carola; Kück, Patrick; Fleck, Günther; Stocsits, Roman R; Misof, Bernhard

    2009-12-01

    Secondary structure models of mitochondrial and nuclear (r)RNA sequences are frequently applied to aid the alignment of these molecules in phylogenetic analyses. Additionally, it is often speculated that structure variation of (r)RNA sequences might profitably be used as phylogenetic markers. The benefit of these approaches depends on the reliability of structure models. We used a recently developed approach to show that reliable inference of large (r)RNA secondary structures as a prerequisite of simultaneous sequence and structure alignment is feasible. The approach iteratively establishes local structure constraints of each sequence and infers fully folded individual structures by constrained MFE optimization. A comparison of structure edit distances of individual constraints and fully folded structures showed pronounced phylogenetic signal in fully folded structures. As model sequences we characterized secondary structures of 28S rRNA sequences of selected insects and examined their phylogenetic signal according to established phylogenetic hypotheses. PMID:19654047

  6. Single-Molecule Observations of Ribosome Function

    PubMed Central

    Blanchard, Scott C.

    2009-01-01

    Summary of Recent Advances Single-molecule investigations promise to greatly advance our understanding of basic and regulated ribosome functions during the process of translation. Here, recent progress towards directly imaging the elemental translation elongation steps using fluorescence resonance energy transfer (FRET)-based imaging methods is discussed, which provide striking evidence of the highly dynamic nature of the ribosome. In this view, global rates and fidelities of protein synthesis reactions may be regulated by interactions of the ribosome with mRNA, tRNA, translation factors, and potentially many other cellular ligands, that modify intrinsic conformational equilibria in the translating particle. Future investigations probing this model must aim to visualize translation processes from multiple structural and kinetic perspectives simultaneously, to provide direct correlations between factor binding and conformational events. PMID:19223173

  7. Genome Mining for Ribosomally Synthesized Natural Products

    PubMed Central

    Velásquez, Juan E.; van der Donk, Wilfred

    2011-01-01

    In recent years, the number of known peptide natural products that are synthesized via the ribosomal pathway has rapidly grown. Taking advantage of sequence homology among genes encoding precursor peptides or biosynthetic proteins, in silico mining of genomes combined with molecular biology approaches has guided the discovery of a large number of new ribosomal natural products, including lantipeptides, cyanobactins, linear thiazole/oxazole-containing peptides, microviridins, lasso peptides, amatoxins, cyclotides, and conopeptides. In this review, we describe the strategies used for the identification of these ribosomally-synthesized and posttranslationally modified peptides (RiPPs) and the structures of newly identified compounds. The increasing number of chemical entities and their remarkable structural and functional diversity may lead to novel pharmaceutical applications. PMID:21095156

  8. A Unique Box in 28S rRNA Is Shared by the Enigmatic Insect Order Zoraptera and Dictyoptera

    PubMed Central

    Dang, Kai; Wu, Haoyang; Wang, Ying; Xie, Qiang; Bu, Wenjun

    2013-01-01

    The position of the Zoraptera remains one of the most challenging and uncertain concerns in ordinal-level phylogenies of the insects. Zoraptera have been viewed as having a close relationship with five different groups of Polyneoptera, or as being allied to the Paraneoptera or even Holometabola. Although rDNAs have been widely used in phylogenetic studies of insects, the application of the complete 28S rDNA are still scattered in only a few orders. In this study, a secondary structure model of the complete 28S rRNAs of insects was reconstructed based on all orders of Insecta. It was found that one length-variable region, D3-4, is particularly distinctive. The length and/or sequence of D3-4 is conservative within each order of Polyneoptera, but it can be divided into two types between the different orders of the supercohort, of which the enigmatic order Zoraptera and Dictyoptera share one type, while the remaining orders of Polyneoptera share the other. Additionally, independent evidence from phylogenetic results support the clade (Zoraptera+Dictyoptera) as well. Thus, the similarity of D3-4 between Zoraptera and Dictyoptera can serve as potentially valuable autapomorphy or synapomorphy in phylogeny reconstruction. The clades of (Plecoptera+Dermaptera) and ((Grylloblattodea+Mantophasmatodea)+(Embiodea+Phasmatodea)) were also recovered in the phylogenetic study. In addition, considering the other studies based on rDNAs, this study reached the highest congruence with previous phylogenetic studies of Holometabola based on nuclear protein coding genes or morphology characters. Future comparative studies of secondary structures across deep divergences and additional taxa are likely to reveal conserved patterns, structures and motifs that can provide support for major phylogenetic lineages. PMID:23301099

  9. Phylogenetic Analysis of Myobia musculi (Schranck, 1781) by Using the 18S Small Ribosomal Subunit Sequence

    PubMed Central

    Feldman, Sanford H; Ntenda, Abraham M

    2011-01-01

    We used high-fidelity PCR to amplify 2 overlapping regions of the ribosomal gene complex from the rodent fur mite Myobia musculi. The amplicons encompassed a large portion of the mite's ribosomal gene complex spanning 3128 nucleotides containing the entire 18S rRNA, internal transcribed spacer (ITS) 1, 5.8S rRNA, ITS2, and a portion of the 5′-end of the 28S rRNA. M. musculi’s 179-nucleotide 5.8S rRNA nucleotide sequence was not conserved, so this region was identified by conservation of rRNA secondary structure. Maximum likelihood and Bayesian inference phylogenetic analyses were performed by using multiple sequence alignment consisting of 1524 nucleotides of M. musculi 18S rRNA and homologous sequences from 42 prostigmatid mites and the tick Dermacentor andersoni. The phylograms produced by both methods were in agreement regarding terminal, secondary, and some tertiary phylogenetic relationships among mites. Bayesian inference discriminated most infraordinal relationships between Eleutherengona and Parasitengona mites in the suborder Anystina. Basal relationships between suborders Anystina and Eupodina historically determined by comparing differences in anatomic characteristics were less well-supported by our molecular analysis. Our results recapitulated similar 18S rRNA sequence analyses recently reported. Our study supports M. musculi as belonging to the suborder Anystina, infraorder Eleutherenona, and superfamily Cheyletoidea. PMID:22330574

  10. Lophotrochozoa internal phylogeny: new insights from an up-to-date analysis of nuclear ribosomal genes

    PubMed Central

    Paps, Jordi; Baguñà, Jaume; Riutort, Marta

    2009-01-01

    Resolving the relationships among animal phyla is a key biological problem that remains to be solved. Morphology is unable to determine the relationships among most phyla and although molecular data have unveiled a new evolutionary scenario, they have their own limitations. Nuclear ribosomal genes (18S and 28S rDNA) have been used effectively for many years. However, they are considered of limited use for resolving deep divergences such as the origin of the bilaterians, due to certain drawbacks such as the long-branch attraction (LBA) problem. Here, we attempt to overcome these pitfalls by combining several methods suggested in previous studies and routinely used in contemporary standard phylogenetic analyses but that have not yet been applied to any bilaterian phylogeny based on these genes. The methods used include maximum likelihood and Bayesian inference, the application of models with rate heterogeneity across sites, wide taxon sampling and compartmentalized analyses for each problematic clade. The results obtained show that the combination of the above-mentioned methodologies minimizes the LBA effect, and a new Lophotrochozoa phylogeny emerges. Also, the Acoela and Nemertodermatida are confirmed with maximum support as the first branching bilaterians. Ribosomal RNA genes are thus a reliable source for the study of deep divergences in the metazoan tree, provided that the data are treated carefully. PMID:19129141

  11. Relationship between organization and function of ribosomal genes in Drosophila melanogaster

    SciTech Connect

    Karpen, G.H.

    1987-01-01

    In most eukaryotic organisms, the genes that encode the 18S and 28S ribosomal RNAs (rDNA genes) are tandemly repeated, and are located in constitutive heterochromatin and/or centromeric or telomeric regions. P-element mediated transformation was used to investigate the relationship between rDNA organization and function in Drosophila melanogaster. Tritiated-uridine incorporation under heat shock conditions and in situ hybridization to rRNA were used to demonstrate that a single rDNA gene inserted into euchromatin can be transcribed at a high rate, in polytene nuclei. P-element-mediated transformation of a single Drosophila rDNA gene was also utilized to investigate the ability of ribosomal DNA to organize a nucleolus. Cytological approaches demonstrated that structures resembling the endogenous nucleoli were preferentially associated with four different sites of rDNA insertion, in polytene nuclei. These mini-nucleoli also contained components specific to the nucleolus, as shown by in situ hybridization to rRNA and indirect immunofluorescence with an antibody that binds to Drosophila nucleoli. The transformed genes were able to partially rescue mutant phenotypes due to a deficiency of rDNA, indicating that the mini-nucleoli were functional.

  12. Ribosome-dependent activation of stringent control.

    PubMed

    Brown, Alan; Fernández, Israel S; Gordiyenko, Yuliya; Ramakrishnan, V

    2016-06-01

    In order to survive, bacteria continually sense, and respond to, environmental fluctuations. Stringent control represents a key bacterial stress response to nutrient starvation that leads to rapid and comprehensive reprogramming of metabolic and transcriptional patterns. In general, transcription of genes for growth and proliferation is downregulated, while those important for survival and virulence are upregulated. Amino acid starvation is sensed by depletion of the aminoacylated tRNA pools, and this results in accumulation of ribosomes stalled with non-aminoacylated (uncharged) tRNA in the ribosomal A site. RelA is recruited to stalled ribosomes and activated to synthesize a hyperphosphorylated guanosine analogue, (p)ppGpp, which acts as a pleiotropic secondary messenger. However, structural information about how RelA recognizes stalled ribosomes and discriminates against aminoacylated tRNAs is missing. Here we present the cryo-electron microscopy structure of RelA bound to the bacterial ribosome stalled with uncharged tRNA. The structure reveals that RelA utilizes a distinct binding site compared to the translational factors, with a multi-domain architecture that wraps around a highly distorted A-site tRNA. The TGS (ThrRS, GTPase and SpoT) domain of RelA binds the CCA tail to orient the free 3' hydroxyl group of the terminal adenosine towards a β-strand, such that an aminoacylated tRNA at this position would be sterically precluded. The structure supports a model in which association of RelA with the ribosome suppresses auto-inhibition to activate synthesis of (p)ppGpp and initiate the stringent response. Since stringent control is responsible for the survival of pathogenic bacteria under stress conditions, and contributes to chronic infections and antibiotic tolerance, RelA represents a good target for the development of novel antibacterial therapeutics. PMID:27279228

  13. Functions of ribosomal proteins in assembly of eukaryotic ribosomes in vivo.

    PubMed

    de la Cruz, Jesús; Karbstein, Katrin; Woolford, John L

    2015-01-01

    The proteome of cells is synthesized by ribosomes, complex ribonucleoproteins that in eukaryotes contain 79-80 proteins and four ribosomal RNAs (rRNAs) more than 5,400 nucleotides long. How these molecules assemble together and how their assembly is regulated in concert with the growth and proliferation of cells remain important unanswered questions. Here, we review recently emerging principles to understand how eukaryotic ribosomal proteins drive ribosome assembly in vivo. Most ribosomal proteins assemble with rRNA cotranscriptionally; their association with nascent particles is strengthened as assembly proceeds. Each subunit is assembled hierarchically by sequential stabilization of their subdomains. The active sites of both subunits are constructed last, perhaps to prevent premature engagement of immature ribosomes with active subunits. Late-assembly intermediates undergo quality-control checks for proper function. Mutations in ribosomal proteins that affect mostly late steps lead to ribosomopathies, diseases that include a spectrum of cell type-specific disorders that often transition from hypoproliferative to hyperproliferative growth. PMID:25706898

  14. Functions of Ribosomal Proteins in Assembly of Eukaryotic Ribosomes In Vivo

    PubMed Central

    2016-01-01

    The proteome of cells is synthesized by ribosomes, complex ribonucleoproteins that in eukaryotes contain 79–80 proteins and four ribosomal RNAs (rRNAs) more than 5,400 nucleotides long. How these molecules assemble together and how their assembly is regulated in concert with the growth and proliferation of cells remain important unanswered questions. Here, we review recently emerging principles to understand how eukaryotic ribosomal proteins drive ribosome assembly in vivo. Most ribosomal proteins assemble with rRNA cotranscriptionally; their association with nascent particles is strengthened as assembly proceeds. Each subunit is assembled hierarchically by sequential stabilization of their subdomains. The active sites of both subunits are constructed last, perhaps to prevent premature engagement of immature ribosomes with active subunits. Late-assembly intermediates undergo quality-control checks for proper function. Mutations in ribosomal proteins that affect mostly late steps lead to ribosomopathies, diseases that include a spectrum of cell type–specific disorders that often transition from hypoproliferative to hyperproliferative growth. PMID:25706898

  15. Modular domains of the Dicistroviridae intergenic internal ribosome entry site

    PubMed Central

    Jang, Christopher J.; Jan, Eric

    2010-01-01

    The intergenic region internal ribosome entry site (IGR IRES) of the Dicistroviridae viral family can directly assemble 80S ribosomes and initiate translation at a non-AUG codon from the ribosomal A-site. These functions are directed by two independently folded domains of the IGR IRES. One domain, composed of overlapping pseudoknots II and III (PKII/III), mediates ribosome recruitment. The second domain, composed of PKI, mimics a tRNA anticodon–codon interaction to position the ribosome at the ribosomal A-site. Although adopting a common secondary structure, the dicistrovirus IGR IRESs can be grouped into two classes based on distinct features within each domain. In this study, we report on the modularity of the IGR IRESs and show that the ribosome-binding domain and the tRNA anticodon mimicry domain are functionally interchangeable between the Type I and the Type II IGR IRESs. Using structural probing, ribosome-binding assays, and ribosome positioning analysis by toeprinting assays, we show that the chimeric IRESs fold properly, assemble 80S ribosomes, and can mediate IRES translation in rabbit reticulocyte lysates. We also demonstrate that the chimeric IRESs can stimulate the ribosome-dependent GTPase activity of eEF2, which suggests that the ribosome is primed for a step downstream from IRES binding. Overall, the results demonstrate that the dicistrovirus IGR IRESs are composed of two modular domains that work in concert to manipulate the ribosome and direct translation initiation. PMID:20423979

  16. Cryo-EM structure of the small subunit of the mammalian mitochondrial ribosome.

    PubMed

    Kaushal, Prem S; Sharma, Manjuli R; Booth, Timothy M; Haque, Emdadul M; Tung, Chang-Shung; Sanbonmatsu, Karissa Y; Spremulli, Linda L; Agrawal, Rajendra K

    2014-05-20

    The mammalian mitochondrial ribosomes (mitoribosomes) are responsible for synthesizing 13 membrane proteins that form essential components of the complexes involved in oxidative phosphorylation or ATP generation for the eukaryotic cell. The mammalian 55S mitoribosome contains significantly smaller rRNAs and a large mass of mitochondrial ribosomal proteins (MRPs), including large mito-specific amino acid extensions and insertions in MRPs that are homologous to bacterial ribosomal proteins and an additional 35 mito-specific MRPs. Here we present the cryo-EM structure analysis of the small (28S) subunit (SSU) of the 55S mitoribosome. We find that the mito-specific extensions in homologous MRPs generally are involved in inter-MRP contacts and in contacts with mito-specific MRPs, suggesting a stepwise evolution of the current architecture of the mitoribosome. Although most of the mito-specific MRPs and extensions of homologous MRPs are situated on the peripheral regions, they also contribute significantly to the formation of linings of the mRNA and tRNA paths, suggesting a tailor-made structural organization of the mito-SSU for the recruitment of mito-specific mRNAs, most of which do not possess a 5' leader sequence. In addition, docking of previously published coordinates of the large (39S) subunit (LSU) into the cryo-EM map of the 55S mitoribosome reveals that mito-specific MRPs of both the SSU and LSU are involved directly in the formation of six of the 15 intersubunit bridges. PMID:24799711

  17. Cryo-EM structure of the small subunit of the mammalian mitochondrial ribosome

    PubMed Central

    Kaushal, Prem S.; Sharma, Manjuli R.; Booth, Timothy M.; Haque, Emdadul M.; Tung, Chang-Shung; Sanbonmatsu, Karissa Y.; Spremulli, Linda L.; Agrawal, Rajendra K.

    2014-01-01

    The mammalian mitochondrial ribosomes (mitoribosomes) are responsible for synthesizing 13 membrane proteins that form essential components of the complexes involved in oxidative phosphorylation or ATP generation for the eukaryotic cell. The mammalian 55S mitoribosome contains significantly smaller rRNAs and a large mass of mitochondrial ribosomal proteins (MRPs), including large mito-specific amino acid extensions and insertions in MRPs that are homologous to bacterial ribosomal proteins and an additional 35 mito-specific MRPs. Here we present the cryo-EM structure analysis of the small (28S) subunit (SSU) of the 55S mitoribosome. We find that the mito-specific extensions in homologous MRPs generally are involved in inter-MRP contacts and in contacts with mito-specific MRPs, suggesting a stepwise evolution of the current architecture of the mitoribosome. Although most of the mito-specific MRPs and extensions of homologous MRPs are situated on the peripheral regions, they also contribute significantly to the formation of linings of the mRNA and tRNA paths, suggesting a tailor-made structural organization of the mito-SSU for the recruitment of mito-specific mRNAs, most of which do not possess a 5′ leader sequence. In addition, docking of previously published coordinates of the large (39S) subunit (LSU) into the cryo-EM map of the 55S mitoribosome reveals that mito-specific MRPs of both the SSU and LSU are involved directly in the formation of six of the 15 intersubunit bridges. PMID:24799711

  18. Structures of the human and Drosophila 80S ribosome.

    PubMed

    Anger, Andreas M; Armache, Jean-Paul; Berninghausen, Otto; Habeck, Michael; Subklewe, Marion; Wilson, Daniel N; Beckmann, Roland

    2013-05-01

    Protein synthesis in all cells is carried out by macromolecular machines called ribosomes. Although the structures of prokaryotic, yeast and protist ribosomes have been determined, the more complex molecular architecture of metazoan 80S ribosomes has so far remained elusive. Here we present structures of Drosophila melanogaster and Homo sapiens 80S ribosomes in complex with the translation factor eEF2, E-site transfer RNA and Stm1-like proteins, based on high-resolution cryo-electron-microscopy density maps. These structures not only illustrate the co-evolution of metazoan-specific ribosomal RNA with ribosomal proteins but also reveal the presence of two additional structural layers in metazoan ribosomes, a well-ordered inner layer covered by a flexible RNA outer layer. The human and Drosophila ribosome structures will provide the basis for more detailed structural, biochemical and genetic experiments. PMID:23636399

  19. Release of Nonstop Ribosomes Is Essential

    PubMed Central

    Feaga, Heather A.; Viollier, Patrick H.

    2014-01-01

    ABSTRACT Bacterial ribosomes frequently translate to the 3′ end of an mRNA without terminating at a stop codon. Almost all bacteria use the transfer-messenger RNA (tmRNA)-based trans-translation pathway to release these “nonstop” ribosomes and maintain protein synthesis capacity. trans-translation is essential in some species, but in others, such as Caulobacter crescentus, trans-translation can be inactivated. To determine why trans-translation is dispensable in C. crescentus, a Tn-seq screen was used to identify genes that specifically alter growth in cells lacking ssrA, the gene encoding tmRNA. One of these genes, CC1214, was essential in ΔssrA cells. Purified CC1214 protein could release nonstop ribosomes in vitro. CC1214 is a homolog of the Escherichia coli ArfB protein, and using the CC1214 sequence, ArfB homologs were identified in the majority of bacterial phyla. Most species in which ssrA has been deleted contain an ArfB homolog, suggesting that release of nonstop ribosomes may be essential in most or all bacteria. PMID:25389176

  20. Two thraustochytrid 5S ribosomal RNAs.

    PubMed Central

    MacKay, R M; Doolittle, W F

    1982-01-01

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  1. Two thraustochytrid 5S ribosomal RNAs.

    PubMed

    MacKay, R M; Doolittle, W F

    1982-12-20

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  2. Modeling Interactions of Erythromycin Derivatives with Ribosomes.

    PubMed

    Shishkina, A V; Makarova, T M; Tereshchenkov, A G; Makarov, G I; Korshunova, G A; Bogdanov, A A

    2015-11-01

    Using a method of static simulation, a series of erythromycin A analogs was designed with aldehyde functions introduced instead of one of the methyl substituents in the 3'-N-position of the antibiotic that was potentially capable of forming a covalent bond with an amino group of one of the nucleotide residues of the 23S rRNA in the ribosomal exit tunnel. Similar interaction is observed for antibiotics of the tylosin series, which bind tightly to the large ribosomal subunit and demonstrate high antibacterial activity. Binding of novel erythromycin derivatives with the bacterial ribosome was investigated with the method of fluorescence polarization. It was found that the erythromycin analog containing a 1-methyl-3-oxopropyl group in the 3'-N-position demonstrates the best binding. Based on the ability to inhibit protein biosynthesis, it is on the same level as erythromycin, and it is significantly better than desmethyl-erythromycin. Molecular dynamic modeling of complexes of the derivatives with ribosomes was conducted to explain the observed effects. PMID:26615442

  3. Promoter architectures in the yeast ribosomal expression program

    PubMed Central

    Bosio, Maria Cristina; Negri, Rodolfo

    2011-01-01

    Ribosome biogenesis begins with the orchestrated expression of hundreds of genes, including the three large classes of ribosomal protein, ribosome biogenesis and snoRNA genes. Current knowledge about the corresponding promoters suggests the existence of novel class-specific transcriptional strategies and crosstalk between telomere length and cell growth control. PMID:21468232

  4. A RanGTP-independent mechanism allows ribosomal protein nuclear import for ribosome assembly

    PubMed Central

    Schütz, Sabina; Fischer, Ute; Altvater, Martin; Nerurkar, Purnima; Peña, Cohue; Gerber, Michaela; Chang, Yiming; Caesar, Stefanie; Schubert, Olga T; Schlenstedt, Gabriel; Panse, Vikram G

    2014-01-01

    Within a single generation time a growing yeast cell imports ∼14 million ribosomal proteins (r-proteins) into the nucleus for ribosome production. After import, it is unclear how these intrinsically unstable and aggregation-prone proteins are targeted to the ribosome assembly site in the nucleolus. Here, we report the discovery of a conserved nuclear carrier Tsr2 that coordinates transfer of the r-protein eS26 to the earliest assembling pre-ribosome, the 90S. In vitro studies revealed that Tsr2 efficiently dissociates importin:eS26 complexes via an atypical RanGTP-independent mechanism that terminates the import process. Subsequently, Tsr2 binds the released eS26, shields it from proteolysis, and ensures its safe delivery to the 90S pre-ribosome. We anticipate similar carriers—termed here escortins—to securely connect the nuclear import machinery with pathways that deposit r-proteins onto developing pre-ribosomal particles. DOI: http://dx.doi.org/10.7554/eLife.03473.001 PMID:25144938

  5. Introns regulate the production of ribosomal proteins by modulating splicing of duplicated ribosomal protein genes

    PubMed Central

    Petibon, Cyrielle; Parenteau, Julie; Catala, Mathieu; Elela, Sherif Abou

    2016-01-01

    Most budding yeast introns exist in the many duplicated ribosomal protein genes (RPGs) and it has been posited that they remain there to modulate the expression of RPGs and cell growth in response to stress. However, the mechanism by which introns regulate the expression of RPGs and their impact on the synthesis of ribosomal proteins remain unclear. In this study, we show that introns determine the ratio of ribosomal protein isoforms through asymmetric paralog-specific regulation of splicing. Exchanging the introns and 3′ untranslated regions of the duplicated RPS9 genes altered the splicing efficiency and changed the ratio of the ribosomal protein isoforms. Mutational analysis of the RPS9 genes indicated that splicing is regulated by variations in the intron structure and the 3′ untranslated region. Together these data suggest that preferential splicing of duplicated RPGs provides a means for adjusting the ratio of different ribosomal protein isoforms, while maintaining the overall expression level of each ribosomal protein. PMID:26945043

  6. A RanGTP-independent mechanism allows ribosomal protein nuclear import for ribosome assembly.

    PubMed

    Schütz, Sabina; Fischer, Ute; Altvater, Martin; Nerurkar, Purnima; Peña, Cohue; Gerber, Michaela; Chang, Yiming; Caesar, Stefanie; Schubert, Olga T; Schlenstedt, Gabriel; Panse, Vikram G

    2014-01-01

    Within a single generation time a growing yeast cell imports ∼14 million ribosomal proteins (r-proteins) into the nucleus for ribosome production. After import, it is unclear how these intrinsically unstable and aggregation-prone proteins are targeted to the ribosome assembly site in the nucleolus. Here, we report the discovery of a conserved nuclear carrier Tsr2 that coordinates transfer of the r-protein eS26 to the earliest assembling pre-ribosome, the 90S. In vitro studies revealed that Tsr2 efficiently dissociates importin:eS26 complexes via an atypical RanGTP-independent mechanism that terminates the import process. Subsequently, Tsr2 binds the released eS26, shields it from proteolysis, and ensures its safe delivery to the 90S pre-ribosome. We anticipate similar carriers-termed here escortins-to securely connect the nuclear import machinery with pathways that deposit r-proteins onto developing pre-ribosomal particles. PMID:25144938

  7. Arabidopsis protein arginine methyltransferase 3 is required for ribosome biogenesis by affecting precursor ribosomal RNA processing

    PubMed Central

    Hang, Runlai; Liu, Chunyan; Ahmad, Ayaz; Zhang, Yong; Lu, Falong; Cao, Xiaofeng

    2014-01-01

    Ribosome biogenesis is a fundamental and tightly regulated cellular process, including synthesis, processing, and assembly of rRNAs with ribosomal proteins. Protein arginine methyltransferases (PRMTs) have been implicated in many important biological processes, such as ribosome biogenesis. Two alternative precursor rRNA (pre-rRNA) processing pathways coexist in yeast and mammals; however, how PRMT affects ribosome biogenesis remains largely unknown. Here we show that Arabidopsis PRMT3 (AtPRMT3) is required for ribosome biogenesis by affecting pre-rRNA processing. Disruption of AtPRMT3 results in pleiotropic developmental defects, imbalanced polyribosome profiles, and aberrant pre-rRNA processing. We further identify an alternative pre-rRNA processing pathway in Arabidopsis and demonstrate that AtPRMT3 is required for the balance of these two pathways to promote normal growth and development. Our work uncovers a previously unidentified function of PRMT in posttranscriptional regulation of rRNA, revealing an extra layer of complexity in the regulation of ribosome biogenesis. PMID:25352672

  8. Direct Activation of Ribosome-Associated Double-Stranded RNA-Dependent Protein Kinase (PKR) by Deoxynivalenol, Anisomycin and Ricin: A New Model for Ribotoxic Stress Response Induction

    PubMed Central

    Zhou, Hui-Ren; He, Kaiyu; Landgraf, Jeff; Pan, Xiao; Pestka, James J.

    2014-01-01

    Double-stranded RNA (dsRNA)-activated protein kinase (PKR) is a critical upstream mediator of the ribotoxic stress response (RSR) to the trichothecene deoxynivalenol (DON) and other translational inhibitors. Here, we employed HeLa cell lysates to: (1) characterize PKR’s interactions with the ribosome and ribosomal RNA (rRNA); (2) demonstrate cell-free activation of ribosomal-associated PKR and (3) integrate these findings in a unified model for RSR. Robust PKR-dependent RSR was initially confirmed in intact cells. PKR basally associated with 40S, 60S, 80S and polysome fractions at molar ratios of 7, 2, 23 and 3, respectively. Treatment of ATP-containing HeLa lysates with DON or the ribotoxins anisomycin and ricin concentration-dependently elicited phosphorylation of PKR and its substrate eIF2α. These phosphorylations could be blocked by PKR inhibitors. rRNA immunoprecipitation (RNA-IP) of HeLa lysates with PKR-specific antibody and sequencing revealed that in the presence of DON or not, the kinase associated with numerous discrete sites on both the 18S and 28S rRNA molecules, a number of which contained double-stranded hairpins. These findings are consistent with a sentinel model whereby multiple PKR molecules basally associate with the ribosome positioning them to respond to ribotoxin-induced alterations in rRNA structure by dimerizing, autoactivating and, ultimately, evoking RSR. PMID:25521494

  9. History of the ribosome and the origin of translation

    PubMed Central

    Petrov, Anton S.; Gulen, Burak; Norris, Ashlyn M.; Kovacs, Nicholas A.; Lanier, Kathryn A.; Fox, George E.; Harvey, Stephen C.; Wartell, Roger M.; Hud, Nicholas V.; Williams, Loren Dean

    2015-01-01

    We present a molecular-level model for the origin and evolution of the translation system, using a 3D comparative method. In this model, the ribosome evolved by accretion, recursively adding expansion segments, iteratively growing, subsuming, and freezing the rRNA. Functions of expansion segments in the ancestral ribosome are assigned by correspondence with their functions in the extant ribosome. The model explains the evolution of the large ribosomal subunit, the small ribosomal subunit, tRNA, and mRNA. Prokaryotic ribosomes evolved in six phases, sequentially acquiring capabilities for RNA folding, catalysis, subunit association, correlated evolution, decoding, energy-driven translocation, and surface proteinization. Two additional phases exclusive to eukaryotes led to tentacle-like rRNA expansions. In this model, ribosomal proteinization was a driving force for the broad adoption of proteins in other biological processes. The exit tunnel was clearly a central theme of all phases of ribosomal evolution and was continuously extended and rigidified. In the primitive noncoding ribosome, proto-mRNA and the small ribosomal subunit acted as cofactors, positioning the activated ends of tRNAs within the peptidyl transferase center. This association linked the evolution of the large and small ribosomal subunits, proto-mRNA, and tRNA. PMID:26621738

  10. History of the ribosome and the origin of translation.

    PubMed

    Petrov, Anton S; Gulen, Burak; Norris, Ashlyn M; Kovacs, Nicholas A; Bernier, Chad R; Lanier, Kathryn A; Fox, George E; Harvey, Stephen C; Wartell, Roger M; Hud, Nicholas V; Williams, Loren Dean

    2015-12-15

    We present a molecular-level model for the origin and evolution of the translation system, using a 3D comparative method. In this model, the ribosome evolved by accretion, recursively adding expansion segments, iteratively growing, subsuming, and freezing the rRNA. Functions of expansion segments in the ancestral ribosome are assigned by correspondence with their functions in the extant ribosome. The model explains the evolution of the large ribosomal subunit, the small ribosomal subunit, tRNA, and mRNA. Prokaryotic ribosomes evolved in six phases, sequentially acquiring capabilities for RNA folding, catalysis, subunit association, correlated evolution, decoding, energy-driven translocation, and surface proteinization. Two additional phases exclusive to eukaryotes led to tentacle-like rRNA expansions. In this model, ribosomal proteinization was a driving force for the broad adoption of proteins in other biological processes. The exit tunnel was clearly a central theme of all phases of ribosomal evolution and was continuously extended and rigidified. In the primitive noncoding ribosome, proto-mRNA and the small ribosomal subunit acted as cofactors, positioning the activated ends of tRNAs within the peptidyl transferase center. This association linked the evolution of the large and small ribosomal subunits, proto-mRNA, and tRNA. PMID:26621738

  11. Characteristics of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) rRNA genes of Apis mellifera (Insecta: Hymenoptera): structure, organization, and retrotransposable elements

    PubMed Central

    Gillespie, J J; Johnston, J S; Cannone, J J; Gutell, R R

    2006-01-01

    As an accompanying manuscript to the release of the honey bee genome, we report the entire sequence of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) ribosomal RNA (rRNA)-encoding gene sequences (rDNA) and related internally and externally transcribed spacer regions of Apis mellifera (Insecta: Hymenoptera: Apocrita). Additionally, we predict secondary structures for the mature rRNA molecules based on comparative sequence analyses with other arthropod taxa and reference to recently published crystal structures of the ribosome. In general, the structures of honey bee rRNAs are in agreement with previously predicted rRNA models from other arthropods in core regions of the rRNA, with little additional expansion in non-conserved regions. Our multiple sequence alignments are made available on several public databases and provide a preliminary establishment of a global structural model of all rRNAs from the insects. Additionally, we provide conserved stretches of sequences flanking the rDNA cistrons that comprise the externally transcribed spacer regions (ETS) and part of the intergenic spacer region (IGS), including several repetitive motifs. Finally, we report the occurrence of retrotransposition in the nuclear large subunit rDNA, as R2 elements are present in the usual insertion points found in other arthropods. Interestingly, functional R1 elements usually present in the genomes of insects were not detected in the honey bee rRNA genes. The reverse transcriptase products of the R2 elements are deduced from their putative open reading frames and structurally aligned with those from another hymenopteran insect, the jewel wasp Nasonia (Pteromalidae). Stretches of conserved amino acids shared between Apis and Nasonia are illustrated and serve as potential sites for primer design, as target amplicons within these R2 elements may serve as novel phylogenetic markers for Hymenoptera. Given the impending completion of the sequencing of the Nasonia genome

  12. The Genes for Cytoplasmic Ribosomal Ribonucleic Acid in Higher Plants

    PubMed Central

    Scott, N. Steele; Ingle, J.

    1973-01-01

    The genes for cytoplasmic ribosomal RNA are partially resolved from the bulk of the DNA by CsCl equilibrium centrifugation. Although in some plants the buoyant density of the ribosomal RNA genes is as expected from the base composition of ribosomal RNA, others show a large discrepancy which cannot be due to the presence of low G-C spacer-DNA. The cross-hybridization observed with 1.3 and 0.7 × 106 molecular weight ribosomal RNAs and DNA, which varies greatly with different plant species, is not due to contamination of the ribosomal RNAs, and is specific for the ribosomal DNA of each species, probably largely restricted to those sequences coding for the two stable ribosomal RNAs. The double reciprocal plot may be used for the extrapolation of saturation values only with caution, because in these cases such plots are not linear over the whole of the hybridization reaction. PMID:16658392

  13. Ribosomal Mutations in Streptococcus pneumoniae Clinical Isolates

    PubMed Central

    Pihlajamäki, Marja; Kataja, Janne; Seppälä, Helena; Elliot, John; Leinonen, Maija; Huovinen, Pentti; Jalava, Jari

    2002-01-01

    Eleven clinical isolates of Streptococcus pneumoniae, isolated in Finland during 1996 to 2000, had an unusual macrolide resistance phenotype. They were resistant to macrolides and streptogramin B but susceptible, intermediate, or low-level resistant to lincosamides. No acquired macrolide resistance genes were detected from the strains. The isolates were found to have mutations in domain V of the 23S rRNA or ribosomal protein L4. Seven isolates had an A2059C mutation in two to four out of the four alleles encoding the 23S rRNA, two isolates had an A2059G mutation in two alleles, one isolate had a C2611G mutation in all four alleles, and one isolate had a 69GTG71-to-69TPS71 substitution in ribosomal protein L4. PMID:11850244

  14. Navigating the ribosome's metastable energy landscape.

    PubMed

    Munro, James B; Sanbonmatsu, Kevin Y; Spahn, Christian M T; Blanchard, Scott C

    2009-08-01

    The molecular mechanisms by which tRNA molecules enter and transit the ribosome during mRNA translation remains elusive. However, recent genetic, biochemical and structural studies offer important new findings into the ordered sequence of events underpinning the translocation process that help place the molecular mechanism within reach. In particular, new structural and kinetic insights have been obtained regarding tRNA movements through 'hybrid state' configurations. These dynamic views reveal that the macromolecular ribosome particle, like many smaller proteins, has an intrinsic capacity to reversibly sample an ensemble of similarly stable native states. Such perspectives suggest that substrates, factors and environmental cues contribute to translation regulation by helping the dynamic system navigate through a highly complex and metastable energy landscape. PMID:19647434

  15. Energy landscape of the ribosomal decoding center.

    PubMed

    Sanbonmatsu, K Y

    2006-08-01

    The ribosome decodes the genetic information that resides in nucleic acids. A key component of the decoding mechanism is a conformational switch in the decoding center of the small ribosomal subunit discovered in high-resolution X-ray crystallography studies. It is known that small subunit nucleotides A1492 and A1493 flip out of helix 44 upon transfer RNA (tRNA) binding; however, the operation principles of this switch remain unknown. Replica molecular dynamics simulations reveal a low free energy barrier between flipped-out and flipped-in states, consistent with a switch that can be controlled by shifting the equilibrium between states. The barrier determined by the simulations is sufficiently small for the binding of ligands, such as tRNAs or aminoglycoside antibiotics, to shift the equilibrium. PMID:16905237

  16. Disassembly of yeast 80S ribosomes into subunits is a concerted action of ribosome-assisted folding of denatured protein.

    PubMed

    Chakraborty, Biprashekhar; Bhakta, Sayan; Sengupta, Jayati

    2016-01-22

    It has been shown by several groups that ribosome can assist folding of denatured protein in vitro and the process is conserved across the species. Domain V of large ribosomal rRNA which occupies the intersubunit side of the large subunit was identified as the key player responsible for chaperoning the folding process. Thus, it is conceivable that denatured protein needs to access the intersubunit space of the ribosome in order to get folded. In this study, we have investigated the mechanism of release of the protein from the eukaryotic ribosome following reactivation. We have observed significant splitting of yeast 80S ribosome when incubated with the denatured BCAII protein. Energy-free disassembly mechanism functions in low Mg(+2) ion concentration for prokaryotic ribosomes. Eukaryotic ribosomes do not show significant splitting even at low Mg(+2) ion concentration. In this respect, denatured protein-induced disassembly of eukaryotic ribosome without the involvement of any external energy source is intriguing. For prokaryotic ribosomes, it was reported that the denatured protein induces ribosome splitting into subunits in order to access domain V-rRNA. In contrast, our results suggest an alternative mechanism for eukaryotic ribosomal rRNA-mediated protein folding and subsequent separation of the subunits by which release of the activated-protein occurs. PMID:26723252

  17. Structure and Function of the Mitochondrial Ribosome.

    PubMed

    Greber, Basil J; Ban, Nenad

    2016-06-01

    Mitochondrial ribosomes (mitoribosomes) perform protein synthesis inside mitochondria, the organelles responsible for energy conversion and adenosine triphosphate production in eukaryotic cells. Throughout evolution, mitoribosomes have become functionally specialized for synthesizing mitochondrial membrane proteins, and this has been accompanied by large changes to their structure and composition. We review recent high-resolution structural data that have provided unprecedented insight into the structure and function of mitoribosomes in mammals and fungi. PMID:27023846

  18. Does hybridization increase evolutionary rate? Data from the 28S-rDNA D8 domain in echinoderms.

    PubMed

    Chenuil, Anne; Egea, Emilie; Rocher, Caroline; Touzet, Hélène; Féral, Jean-Pierre

    2008-11-01

    The divergent domain D8 of the large ribosomal RNA is very variable and extended in vertebrates compared to other eukaryotes. We provide data from 31 species of echinoderms and present the first comparative analysis of the D8 in nonvertebrate deuterostomes. In addition, we obtained 16S mitochondrial DNA sequences for the sea urchin taxa and analyzed single-strand conformation polymorphism (SSCP) of D8 in several populations within the species complex Echinocardium cordatum. A common secondary structure supported by compensatory substitutions and indels is inferred for echinoderms. Variation mostly arises at the tip of the longest stem (D8a), and the most variable taxa also display the longest and most stable D8. The most stable variants are the only ones displaying bulges in the terminal part of the stem, suggesting that selection, rather than maximizing stability of the D8 secondary structure, maintains it in a given range. Striking variation in D8 evolutionary rates was evidenced among sea urchins, by comparison with both 16S mitochondrial DNA and paleontological data. In Echinocardium cordatum and Strongylocentrotus pallidus and S. droebachiensis, belonging to very distant genera, the increase in D8 evolutionary rate is extreme. Their highly stable D8 secondary structures rule out the possibility of pseudogenes. These taxa are the only ones in which interspecific hybridization was reported. We discuss how evolutionary rates may be affected in nuclear relative to mitochondrial genes after hybridization, by selective or mutational processes such as gene silencing and concerted evolution. PMID:18949506

  19. Pulmonate phylogeny based on 28S rRNA gene sequences: a framework for discussing habitat transitions and character transformation.

    PubMed

    Holznagel, W E; Colgan, D J; Lydeard, C

    2010-12-01

    Pulmonate snails occupy a wide range of marine, estuarine, freshwater and terrestrial environments. Non-terrestrial forms are supposed to be basal in pulmonate evolution but the group's phylogeny is not well resolved either morphologically or on the basis of available DNA sequence data. The lack of a robust phylogeny makes it difficult to understand character polarization and habitat transformation in pulmonates. We have investigated pulmonate relationships using 27 new sequences of 28S rRNA from pulmonates and outgroups, augmented with data from GenBank. The complete alignments comprised about 3.8kb. Maximum parsimony, maximum likelihood and Bayesian analyses of alignments generated under different assumptions are reported. Complete alignments appear to have a degree of substitution saturation so where there is conflict between hypothesised relationships more weight is given to analyses where regions of random similarity are excluded and which are not affected by this complication. Monophyly of the five main pulmonate groups was robustly supported in almost all analyses. The marine group Amphiboloidea and the freshwater Glacidorbidae are the most basal. The remaining pulmonates (Siphonariidae, Hygrophila and Eupulmonata) form a moderately-supported monophyletic group in all analyses bar one probably affected by saturation of substitutions. Siphonariidae, a predominantly marine and intertidal family, and Eupulmonata (mainly terrestrial with marine, estuarine and freshwater species) form a strongly supported clade that is the sister group to Hygrophila (freshwater). Multiple colonizations of freshwater and terrestrial habitats by pulmonate snails are suggested. No analyses strongly support the possibility of habitat reversions. The colonizations of freshwater by Hygrophila and of land by Stylommatophora were apparently phylogenetically independent although it cannot yet be excluded that there were transient terrestrial phases in the history of the former group or

  20. Structural snapshots of actively translating human ribosomes.

    PubMed

    Behrmann, Elmar; Loerke, Justus; Budkevich, Tatyana V; Yamamoto, Kaori; Schmidt, Andrea; Penczek, Pawel A; Vos, Matthijn R; Bürger, Jörg; Mielke, Thorsten; Scheerer, Patrick; Spahn, Christian M T

    2015-05-01

    Macromolecular machines, such as the ribosome, undergo large-scale conformational changes during their functional cycles. Although their mode of action is often compared to that of mechanical machines, a crucial difference is that, at the molecular dimension, thermodynamic effects dominate functional cycles, with proteins fluctuating stochastically between functional states defined by energetic minima on an energy landscape. Here, we have used cryo-electron microscopy to image ex-vivo-derived human polysomes as a source of actively translating ribosomes. Multiparticle refinement and 3D variability analysis allowed us to visualize a variety of native translation intermediates. Significantly populated states include not only elongation cycle intermediates in pre- and post-translocational states, but also eEF1A-containing decoding and termination/recycling complexes. Focusing on the post-translocational state, we extended this assessment to the single-residue level, uncovering striking details of ribosome-ligand interactions and identifying both static and functionally important dynamic elements. PMID:25957688

  1. Stochastic gating and drug-ribosome interactions.

    PubMed

    Vaiana, Andrea C; Sanbonmatsu, Kevin Y

    2009-02-27

    Gentamicin is a potent antibiotic that is used in combination therapy for inhalation anthrax disease. The drug is also often used in therapy for methicillin-resistant Staphylococcusaureus. Gentamicin works by flipping a conformational switch on the ribosome, disrupting the reading head (i.e., 16S ribosomal decoding bases 1492-1493) used for decoding messenger RNA. We use explicit solvent all-atom molecular simulation to study the thermodynamics of the ribosomal decoding site and its interaction with gentamicin. The replica exchange molecular dynamics simulations used an aggregate sampling of 15 mus when summed over all replicas, allowing us to explicitly calculate the free-energy landscape, including a rigorous treatment of enthalpic and entropic effects. Here, we show that the decoding bases flip on a timescale faster than that of gentamicin binding, supporting a stochastic gating mechanism for antibiotic binding, rather than an induced-fit model where the bases only flip in the presence of a ligand. The study also allows us to explore the nonspecific binding landscape near the binding site and reveals that, rather than a two-state bound/unbound scenario, drug dissociation entails shuttling between many metastable local minima in the free-energy landscape. Special care is dedicated to validation of the obtained results, both by direct comparison to experiment and by estimation of simulation convergence. PMID:19146858

  2. Mitochondrial ribosome assembly in health and disease

    PubMed Central

    De Silva, Dasmanthie; Tu, Ya-Ting; Amunts, Alexey; Fontanesi, Flavia; Barrientos, Antoni

    2015-01-01

    The ribosome is a structurally and functionally conserved macromolecular machine universally responsible for catalyzing protein synthesis. Within eukaryotic cells, mitochondria contain their own ribosomes (mitoribosomes), which synthesize a handful of proteins, all essential for the biogenesis of the oxidative phosphorylation system. High-resolution cryo-EM structures of the yeast, porcine and human mitoribosomal subunits and of the entire human mitoribosome have uncovered a wealth of new information to illustrate their evolutionary divergence from their bacterial ancestors and their adaptation to synthesis of highly hydrophobic membrane proteins. With such structural data becoming available, one of the most important remaining questions is that of the mitoribosome assembly pathway and factors involved. The regulation of mitoribosome biogenesis is paramount to mitochondrial respiration, and thus to cell viability, growth and differentiation. Moreover, mutations affecting the rRNA and protein components produce severe human mitochondrial disorders. Despite its biological and biomedical significance, knowledge on mitoribosome biogenesis and its deviations from the much-studied bacterial ribosome assembly processes is scarce, especially the order of rRNA processing and assembly events and the regulatory factors required to achieve fully functional particles. This article focuses on summarizing the current available information on mitoribosome assembly pathway, factors that form the mitoribosome assembly machinery, and the effect of defective mitoribosome assembly on human health. PMID:26030272

  3. Structural snapshots of actively translating human ribosomes

    PubMed Central

    Behrmann, Elmar; Loerke, Justus; Budkevich, Tatyana V.; Yamamoto, Kaori; Schmidt, Andrea; Penczek, Pawel A.; Vos, Matthijn R.; Bürger, Jörg; Mielke, Thorsten; Scheerer, Patrick; Spahn, Christian M.T.

    2015-01-01

    Summary Macromolecular machines, such as the ribosome, undergo large-scale conformational changes during their functional cycles. While their mode of action is often compared to that of mechanical machines, a crucial difference is that at the molecular dimension, thermodynamic effects dominate functional cycles, with proteins fluctuating stochastically between functional states defined by energetic minima on an energy landscape. Here, we have used cryo-electron microscopy to image ex vivo-derived human polysomes as a source of actively translating ribosomes. Multiparticle refinement and three-dimensional variability analysis allowed us to visualize a variety of native translation intermediates. Significantly populated states include not only elongation cycle intermediates in pre- and post-translocational states, but also eEF1A-containing decoding and termination/recycling complexes. Focusing on the post-translocational state, we extended this assessment to the single-residue level, uncovering striking details of ribosome-ligand interactions and identifying both static and functionally important dynamic elements. PMID:25957688

  4. Polar bears, antibiotics, and the evolving ribosome (Nobel Lecture).

    PubMed

    Yonath, Ada

    2010-06-14

    High-resolution structures of ribosomes, the cellular machines that translate the genetic code into proteins, revealed the decoding mechanism, detected the mRNA path, identified the sites of the tRNA molecules in the ribosome, elucidated the position and the nature of the nascent proteins exit tunnel, illuminated the interactions of the ribosome with non-ribosomal factors, such as the initiation, release and recycling factors, and provided valuable information on ribosomal antibiotics, their binding sites, modes of action, principles of selectivity and the mechanisms leading to their resistance. Notably, these structures proved that the ribosome is a ribozyme whose active site, namely where the peptide bonds are being formed, is situated within a universal symmetrical region that is embedded in the otherwise asymmetric ribosome structure. As this symmetrical region is highly conserved and provides the machinery required for peptide bond formation and for ribosome polymerase activity, it may be the remnant of the proto-ribosome, a dimeric prebiotic machine that formed peptide bonds and non-coded polypeptide chains. Structures of complexes of ribosomes with antibiotics targeting them revealed the principles allowing for their clinical use, identified resistance mechanisms and showed the structural bases for discriminating pathogenic bacteria from hosts, hence providing valuable structural information for antibiotics improvement and for the design of novel compounds that can serve as antibiotics. PMID:20535730

  5. An overview of pre-ribosomal RNA processing in eukaryotes

    PubMed Central

    Henras, Anthony K; Plisson-Chastang, Célia; O'Donohue, Marie-Françoise; Chakraborty, Anirban; Gleizes, Pierre-Emmanuel

    2015-01-01

    Ribosomal RNAs are the most abundant and universal noncoding RNAs in living organisms. In eukaryotes, three of the four ribosomal RNAs forming the 40S and 60S subunits are borne by a long polycistronic pre-ribosomal RNA. A complex sequence of processing steps is required to gradually release the mature RNAs from this precursor, concomitant with the assembly of the 79 ribosomal proteins. A large set of trans-acting factors chaperone this process, including small nucleolar ribonucleoparticles. While yeast has been the gold standard for studying the molecular basis of this process, recent technical advances have allowed to further define the mechanisms of ribosome biogenesis in animals and plants. This renewed interest for a long-lasting question has been fueled by the association of several genetic diseases with mutations in genes encoding both ribosomal proteins and ribosome biogenesis factors, and by the perspective of new anticancer treatments targeting the mechanisms of ribosome synthesis. A consensus scheme of pre-ribosomal RNA maturation is emerging from studies in various kinds of eukaryotic organisms. However, major differences between mammalian and yeast pre-ribosomal RNA processing have recently come to light. WIREs RNA 2015, 6:225–242. doi: 10.1002/wrna.1269 PMID:25346433

  6. Ribosomal History Reveals Origins of Modern Protein Synthesis

    PubMed Central

    Harish, Ajith; Caetano-Anollés, Gustavo

    2012-01-01

    The origin and evolution of the ribosome is central to our understanding of the cellular world. Most hypotheses posit that the ribosome originated in the peptidyl transferase center of the large ribosomal subunit. However, these proposals do not link protein synthesis to RNA recognition and do not use a phylogenetic comparative framework to study ribosomal evolution. Here we infer evolution of the structural components of the ribosome. Phylogenetic methods widely used in morphometrics are applied directly to RNA structures of thousands of molecules and to a census of protein structures in hundreds of genomes. We find that components of the small subunit involved in ribosomal processivity evolved earlier than the catalytic peptidyl transferase center responsible for protein synthesis. Remarkably, subunit RNA and proteins coevolved, starting with interactions between the oldest proteins (S12 and S17) and the oldest substructure (the ribosomal ratchet) in the small subunit and ending with the rise of a modern multi-subunit ribosome. Ancestral ribonucleoprotein components show similarities to in vitro evolved RNA replicase ribozymes and protein structures in extant replication machinery. Our study therefore provides important clues about the chicken-or-egg dilemma associated with the central dogma of molecular biology by showing that ribosomal history is driven by the gradual structural accretion of protein and RNA structures. Most importantly, results suggest that functionally important and conserved regions of the ribosome were recruited and could be relics of an ancient ribonucleoprotein world. PMID:22427882

  7. Structure of a mitochondrial ribosome with minimal RNA.

    PubMed

    Sharma, Manjuli R; Booth, Timothy M; Simpson, Larry; Maslov, Dmitri A; Agrawal, Rajendra K

    2009-06-16

    The Leishmania tarentolae mitochondrial ribosome (Lmr) is a minimal ribosomal RNA (rRNA)-containing ribosome. We have obtained a cryo-EM map of the Lmr. The map reveals several features that have not been seen in previously-determined structures of eubacterial or eukaryotic (cytoplasmic or organellar) ribosomes to our knowledge. Comparisons of the Lmr map with X-ray crystallographic and cryo-EM maps of the eubacterial ribosomes and a cryo-EM map of the mammalian mitochondrial ribosome show that (i) the overall structure of the Lmr is considerably more porous, (ii) the topology of the intersubunit space is significantly different, with fewer intersubunit bridges, but more tunnels, and (iii) several of the functionally-important rRNA regions, including the alpha-sarcin-ricin loop, have different relative positions within the structure. Furthermore, the major portions of the mRNA channel, the tRNA passage, and the nascent polypeptide exit tunnel contain Lmr-specific proteins, suggesting that the mechanisms for mRNA recruitment, tRNA interaction, and exiting of the nascent polypeptide in Lmr must differ markedly from the mechanisms deduced for ribosomes in other organisms. Our study identifies certain structural features that are characteristic solely of mitochondrial ribosomes and other features that are characteristic of both mitochondrial and chloroplast ribosomes (i.e., organellar ribosomes). PMID:19497863

  8. A secondary structural common core in the ribosomal ITS2 (internal transcribed spacer) of Culexspecies from diverse geographical locations

    PubMed Central

    Bhargavi, Ryavarapu; Vishwakarma, Siddharth; Murty, Upadhyayula Suryanarayana

    2005-01-01

    In the present study, sequence and structural analysis of ITS2 region (the spacer segment between 5.8S and 28S rRNA of mature rRNA sequences) of 7 Culex species belonging to 5 different geographical locations was carried out. Alignment of the ITS2 sequence from the 7 species revealed 8 homologous domains. Four species namely C. vishnui, C. annulus, C. pipiens, C. quiquefasciatusshowed high sequence (98­100%) and RNA secondary structure similarity. The ITS2 similarity among different species is high despite their varying geographical locations. Several common features of secondary structure are shared among these species, with some of them supported by compensatory changes, suggesting the significant role by ITS2 as an RNA domain during ribosome biogenesis. PMID:17597853

  9. Variation in copy number of the 28S rDNA of Aspergillus fumigatus measured by droplet digital PCR and analog quantitative real-time PCR.

    PubMed

    Alanio, Alexandre; Sturny-Leclère, Aude; Benabou, Marion; Guigue, Nicolas; Bretagne, Stéphane

    2016-08-01

    Droplet digital PCR (ddPCR) after DNA digestion yielded a 28S rDNA copy number of 61 to 86 copies/genome when testing 10 unrelated Aspergillus fumigatus isolates, higher than with quantitative PCR. Unfortunately, ddPCR after DNA digestion did not improve the sensitivity of our PCR assay when testing serum patients with invasive aspergillosis. PMID:27316653

  10. Chemical modulators of ribosome biogenesis as biological probes.

    PubMed

    Stokes, Jonathan M; Brown, Eric D

    2015-12-01

    Small-molecule inhibitors of protein biosynthesis have been instrumental in the dissection of the complexities of ribosome structure and function. Ribosome biogenesis, on the other hand, is a complex and largely enigmatic process for which there is a paucity of chemical probes. Indeed, ribosome biogenesis has been studied almost exclusively using genetic and biochemical approaches without the benefit of small-molecule inhibitors of this process. Here, we provide a perspective on the promise of chemical inhibitors of ribosome assembly for future research. We explore key obstacles that complicate the interpretation of studies aimed at perturbing ribosome biogenesis in vivo using genetic methods, and we argue that chemical inhibitors are especially powerful because they can be used to induce perturbations in a manner that obviates these difficulties. Thus, in combination with leading-edge biochemical and structural methods, chemical probes offer unique advantages toward elucidating the molecular events that define the assembly of ribosomes. PMID:26575239

  11. High-resolution microscopy of active ribosomal genes and key members of the rRNA processing machinery inside nucleolus-like bodies of fully-grown mouse oocytes.

    PubMed

    Shishova, Kseniya V; Khodarovich, Yuriy M; Lavrentyeva, Elena A; Zatsepina, Olga V

    2015-10-01

    Nucleolus-like bodies (NLBs) of fully-grown (germinal vesicle, GV) mammalian oocytes are traditionally considered as morphologically distinct entities, which, unlike normal nucleoli, contain transcribed ribosomal genes (rDNA) solely at their surface. In the current study, we for the first time showed that active ribosomal genes are present not only on the surface but also inside NLBs of the NSN-type oocytes. The "internal" rRNA synthesis was evidenced by cytoplasmic microinjections of BrUTP as precursor and by fluorescence in situ hybridization with a probe to the short-lived 5'ETS segment of the 47S pre-rRNA. We further showed that in the NLB mass of NSN-oocytes, distribution of active rDNA, RNA polymerase I (UBF) and rRNA processing (fibrillarin) protein factors, U3 snoRNA, pre-rRNAs and 18S/28S rRNAs is remarkably similar to that in somatic nucleoli capable to make pre-ribosomes. Overall, these observations support the occurrence of rDNA transcription, rRNA processing and pre-ribosome assembly in the NSN-type NLBs and so that their functional similarity to normal nucleoli. Unlike the NSN-type NLBs, the NLBs of more mature SN-oocytes do not contain transcribed rRNA genes, U3 snoRNA, pre-rRNAs, 18S and 28S rRNAs. These results favor the idea that in a process of transformation of NSN-oocytes to SN-oocytes, NLBs cease to produce pre-ribosomes and, moreover, lose their rRNAs. We also concluded that a denaturing fixative 70% ethanol used in the study to fix oocytes could be more appropriate for light microscopy analysis of nucleolar RNAs and proteins in mammalian fully-grown oocytes than a commonly used cross-linking aldehyde fixative, formalin. PMID:26226217

  12. Ribosome hibernation factor promotes Staphylococcal survival and differentially represses translation

    PubMed Central

    Basu, Arnab; Yap, Mee-Ngan F.

    2016-01-01

    In opportunistic Gram-positive Staphylococcus aureus, a small protein called hibernation-promoting factor (HPFSa) is sufficient to dimerize 2.5-MDa 70S ribosomes into a translationally inactive 100S complex. Although the 100S dimer is observed in only the stationary phase in Gram-negative gammaproteobacteria, it is ubiquitous throughout all growth phases in S. aureus. The biological significance of the 100S ribosome is poorly understood. Here, we reveal an important role of HPFSa in preserving ribosome integrity and poising cells for translational restart, a process that has significant clinical implications for relapsed staphylococcal infections. We found that the hpf null strain is severely impaired in long-term viability concomitant with a dramatic loss of intact ribosomes. Genome-wide ribosome profiling shows that eliminating HPFSa drastically increased ribosome occupancy at the 5′ end of specific mRNAs under nutrient-limited conditions, suggesting that HPFSa may suppress translation initiation. The protective function of HPFSa on ribosomes resides at the N-terminal conserved basic residues and the extended C-terminal segment, which are critical for dimerization and ribosome binding, respectively. These data provide significant insight into the functional consequences of 100S ribosome loss for protein synthesis and stress adaptation. PMID:27001516

  13. Alterations in the ribosomal machinery in cancer and hematologic disorders

    PubMed Central

    2012-01-01

    Ribosomes are essential components of the protein translation machinery and are composed of more than 80 unique large and small ribosomal proteins. Recent studies show that in addition to their roles in protein translation, ribosomal proteins are also involved in extra-ribosomal functions of DNA repair, apoptosis and cellular homeostasis. Consequently, alterations in the synthesis or functioning of ribosomal proteins can lead to various hematologic disorders. These include congenital anemias such as Diamond Blackfan anemia and Shwachman Diamond syndrome; both of which are associated with mutations in various ribosomal genes. Acquired uniallelic deletion of RPS14 gene has also been shown to lead to the 5q syndrome, a distinct subset of MDS associated with macrocytic anemia. Recent evidence shows that specific ribosomal proteins are overexpressed in liver, colon, prostate and other tumors. Ribosomal protein overexpression can promote tumorigenesis by interactions with the p53 tumor suppressor pathway and also by direct effects on various oncogenes. These data point to a broad role of ribosome protein alterations in hematologic and oncologic diseases. PMID:22709827

  14. Dynamic Behavior of Trigger Factor on the Ribosome.

    PubMed

    Deeng, J; Chan, K Y; van der Sluis, E O; Berninghausen, O; Han, W; Gumbart, J; Schulten, K; Beatrix, B; Beckmann, R

    2016-09-11

    Trigger factor (TF) is the only ribosome-associated chaperone in bacteria. It interacts with hydrophobic segments in nascent chain (NCs) as they emerge from the ribosome. TF binds via its N-terminal ribosome-binding domain (RBD) mainly to ribosomal protein uL23 at the tunnel exit on the large ribosomal subunit. Whereas earlier structural data suggested that TF binds as a rigid molecule to the ribosome, recent comparisons of structural data on substrate-bound, ribosome-bound, and TF in solution from different species suggest that this chaperone is a rather flexible molecule. Here, we present two cryo-electron microscopy structures of TF bound to ribosomes translating an mRNA coding for a known TF substrate from Escherichia coli of a different length. The structures reveal distinct degrees of flexibility for the different TF domains, a conformational rearrangement of the RBD upon ribosome binding, and an increase in rigidity within TF when the NC is extended. Molecular dynamics simulations agree with these data and offer a molecular basis for these observations. PMID:27320387

  15. -1 Programmed Ribosomal Frameshifting as a Force-Dependent Process.

    PubMed

    Visscher, Koen

    2016-01-01

    -1 Programmed ribosomal frameshifting is a translational recoding event in which ribosomes slip backward along messenger RNA presumably due to increased tension disrupting the codon-anticodon interaction at the ribosome's coding site. Single-molecule physical methods and recent experiments characterizing the physical properties of mRNA's slippery sequence as well as the mechanical stability of downstream mRNA structure motifs that give rise to frameshifting are discussed. Progress in technology, experimental assays, and data analysis methods hold promise for accurate physical modeling and quantitative understanding of -1 programmed ribosomal frameshifting. PMID:26970190

  16. Features of 80S mammalian ribosome and its subunits

    PubMed Central

    Budkevich, Tatyana V.; El'skaya, Anna V.; Nierhaus, Knud H.

    2008-01-01

    It is generally believed that basic features of ribosomal functions are universally valid, but a systematic test still stands out for higher eukaryotic 80S ribosomes. Here we report: (i) differences in tRNA and mRNA binding capabilities of eukaryotic and bacterial ribosomes and their subunits. Eukaryotic 40S subunits bind mRNA exclusively in the presence of cognate tRNA, whereas bacterial 30S do bind mRNA already in the absence of tRNA. 80S ribosomes bind mRNA efficiently in the absence of tRNA. In contrast, bacterial 70S interact with mRNA more productively in the presence rather than in the absence of tRNA. (ii) States of initiation (Pi), pre-translocation (PRE) and post-translocation (POST) of the ribosome were checked and no significant functional differences to the prokaryotic counterpart were observed including the reciprocal linkage between A and E sites. (iii) Eukaryotic ribosomes bind tetracycline with an affinity 15 times lower than that of bacterial ribosomes (Kd 30 μM and 1–2 μM, respectively). The drug does not effect enzymatic A-site occupation of 80S ribosomes in contrast to non-enzymatic tRNA binding to the A-site. Both observations explain the relative resistance of eukaryotic ribosomes to this antibiotic. PMID:18632761

  17. Ribosome hibernation factor promotes Staphylococcal survival and differentially represses translation.

    PubMed

    Basu, Arnab; Yap, Mee-Ngan F

    2016-06-01

    In opportunistic Gram-positive Staphylococcus aureus, a small protein called hibernation-promoting factor (HPFSa) is sufficient to dimerize 2.5-MDa 70S ribosomes into a translationally inactive 100S complex. Although the 100S dimer is observed in only the stationary phase in Gram-negative gammaproteobacteria, it is ubiquitous throughout all growth phases in S. aureus The biological significance of the 100S ribosome is poorly understood. Here, we reveal an important role of HPFSa in preserving ribosome integrity and poising cells for translational restart, a process that has significant clinical implications for relapsed staphylococcal infections. We found that the hpf null strain is severely impaired in long-term viability concomitant with a dramatic loss of intact ribosomes. Genome-wide ribosome profiling shows that eliminating HPFSa drastically increased ribosome occupancy at the 5' end of specific mRNAs under nutrient-limited conditions, suggesting that HPFSa may suppress translation initiation. The protective function of HPFSa on ribosomes resides at the N-terminal conserved basic residues and the extended C-terminal segment, which are critical for dimerization and ribosome binding, respectively. These data provide significant insight into the functional consequences of 100S ribosome loss for protein synthesis and stress adaptation. PMID:27001516

  18. Commandeering the Ribosome: Lessons Learned from Dicistroviruses about Translation.

    PubMed

    Kerr, Craig H; Jan, Eric

    2016-06-15

    To replicate, all viruses depend entirely on the enslavement of host cell ribosomes for their own advantage. To this end, viruses have evolved a multitude of translational strategies to usurp the ribosome. RNA-based structures known as internal ribosome entry sites (IRESs) are among the most notable mechanisms employed by viruses to seize host ribosomes. In this article, we spotlight the intergenic region IRES from the Dicistroviridae family of viruses and its importance as a model for IRES-dependent translation and in understanding fundamental properties of translation. PMID:27053555

  19. Dissociability of free and peptidyl-tRNA bound ribosomes.

    PubMed

    Surguchov, A P; Fominykch, E S; Lyzlova, L V

    1978-06-16

    The influence of peptidyl-tRNA on the dissociation of yeast 80 S ribosomes into subunits was studied. For this purpose temperature-sensitive (ts) suppressor strain of yeast Saccharomyces cervisiae carrying a defect in peptide chain termination was used. It was found that peptidyl-tRNA did not influence the dissociation of ribosomes either at high salt concentration or in the presence of dissociation factor (DF) from yeast. After dissociation of yeast ribosomes in 0.5 M KCl, peptidyl-tRNA remains bound to the 60 S subunit. Some characteristics of the termination process and release of nascent polypeptides from yeast ribosomes are discussed. PMID:355860

  20. Replication of ribosomal DNA in Xenopus laevis.

    PubMed

    Bozzoni, I; Baldari, C T; Amaldi, F; Buongiorno-Nardelli, M

    1981-09-01

    The study of the localization of the replication origins of rDNA in Xenopus laevis has been approached by two different methods. 1. The DNA of X. laevis larvae was fractionated by CsCl gradient centrifugation in bulk and ribosomal DNA and examined in the electron microscope. In bulk DNA, clusters of microbubbles, which are related with the origins of replication, appear to be spaced along the DNA molecules at intervals comparable with the size of the 'average' replicon of X. laevis. In ribosomal DNA, the distance between adjacent clusters is much shorter and corresponds to the size of the rDNA repeating unit. When ribosomal DNA was submitted to digestion with restriction enzymes (Eco RI and HindIII) the microbubbles are observed in the non-transcribed spacer-containing fragment. 2. Cultured cells of X. laevis were synchronized by mitotic selection and incubated with 5-fluoro-2-deoxyuridine for a time longer than the G1 phase. This treatment synchronizes the replicons and allows them to start replicating very slowly. It was thus possible to obtain a preferential labelling of the regions containing the origins. The analysis by gel electrophoresis of the Eco Ri-digested rDNA showed that the radioactivity was preferentially incorporated in the fragments which contain the non-transcribed spacer. The results of these two approaches indicate that the rRNA gene cluster consists of multiple units of replication, possibly one per gene unit. Furthermore they show that the origins of replication are localized into the non-transcribed spacer. PMID:7297565

  1. Homoiterons and expansion in ribosomal RNAs.

    PubMed

    Parker, Michael S; Sallee, Floyd R; Park, Edwards A; Parker, Steven L

    2015-01-01

    Ribosomal RNAs in both prokaryotes and eukaryotes feature numerous repeats of three or more nucleotides with the same nucleobase (homoiterons). In prokaryotes these repeats are much more frequent in thermophile compared to mesophile or psychrophile species, and have similar frequency in both large RNAs. These features point to use of prokaryotic homoiterons in stabilization of both ribosomal subunits. The two large RNAs of eukaryotic cytoplasmic ribosomes have expanded to a different degree across the evolutionary ladder. The big RNA of the larger subunit (60S LSU) evolved expansion segments of up to 2400 nucleotides, and the smaller subunit (40S SSU) RNA acquired expansion segments of not more than 700 nucleotides. In the examined eukaryotes abundance of rRNA homoiterons generally follows size and nucleotide bias of the expansion segments, and increases with GC content and especially with phylogenetic rank. Both the nucleotide bias and frequency of homoiterons are much larger in metazoan and angiosperm LSU compared to the respective SSU RNAs. This is especially pronounced in the tetrapod vertebrates and seems to culminate in the hominid mammals. The stability of secondary structure in polyribonucleotides would significantly connect to GC content, and should also relate to G and C homoiteron content. RNA modeling points to considerable presence of homoiteron-rich double-stranded segments especially in vertebrate LSU RNAs, and homoiterons with four or more nucleotides in the vertebrate and angiosperm LSU RNAs are largely confined to the expansion segments. These features could mainly relate to protein export function and attachment of LSU to endoplasmic reticulum and other subcellular networks. PMID:26636029

  2. Homoiterons and expansion in ribosomal RNAs

    PubMed Central

    Parker, Michael S.; Sallee, Floyd R.; Park, Edwards A.; Parker, Steven L.

    2015-01-01

    Ribosomal RNAs in both prokaryotes and eukaryotes feature numerous repeats of three or more nucleotides with the same nucleobase (homoiterons). In prokaryotes these repeats are much more frequent in thermophile compared to mesophile or psychrophile species, and have similar frequency in both large RNAs. These features point to use of prokaryotic homoiterons in stabilization of both ribosomal subunits. The two large RNAs of eukaryotic cytoplasmic ribosomes have expanded to a different degree across the evolutionary ladder. The big RNA of the larger subunit (60S LSU) evolved expansion segments of up to 2400 nucleotides, and the smaller subunit (40S SSU) RNA acquired expansion segments of not more than 700 nucleotides. In the examined eukaryotes abundance of rRNA homoiterons generally follows size and nucleotide bias of the expansion segments, and increases with GC content and especially with phylogenetic rank. Both the nucleotide bias and frequency of homoiterons are much larger in metazoan and angiosperm LSU compared to the respective SSU RNAs. This is especially pronounced in the tetrapod vertebrates and seems to culminate in the hominid mammals. The stability of secondary structure in polyribonucleotides would significantly connect to GC content, and should also relate to G and C homoiteron content. RNA modeling points to considerable presence of homoiteron-rich double-stranded segments especially in vertebrate LSU RNAs, and homoiterons with four or more nucleotides in the vertebrate and angiosperm LSU RNAs are largely confined to the expansion segments. These features could mainly relate to protein export function and attachment of LSU to endoplasmic reticulum and other subcellular networks. PMID:26636029

  3. Towards a classification of E. coli ribosomal proteins: A hypothetical `small ribosome' as a primitive protein-synthesizing apparatus

    NASA Astrophysics Data System (ADS)

    Ohnishi, Koji

    1984-12-01

    Homologies were searched among the published primary sequences of 51 E. coli ribosomal proteins, partly by ‘eye’ and partly by computer-assisted methods. By employing Moore and Goodman's alignment statistics for evaluating homology levels, 33 out of these 51 ribosomal proteins has been classified into 9 homology groups, some of which being yet tentative and remaining to be further analyzed. Taking it into consideration that most ribosomal protein genes are clustered at str- stc region, rif region and several other regions, these results strongly suggest that most or all of the contemporary ribosomal proteins must have evolved by repeated gene duplications of very few (or only one) primitive ancestral ribosomal protein gene(s). Thus it is most reasonable to propose that a ‘ small ribosome’ consisting of very few (or only one) ribosomal protein(s) must have existed as a primitive protein-synthesizing apparatus.

  4. Ribosomal RNA: a key to phylogeny

    NASA Technical Reports Server (NTRS)

    Olsen, G. J.; Woese, C. R.

    1993-01-01

    As molecular phylogeny increasingly shapes our understanding of organismal relationships, no molecule has been applied to more questions than have ribosomal RNAs. We review this role of the rRNAs and some of the insights that have been gained from them. We also offer some of the practical considerations in extracting the phylogenetic information from the sequences. Finally, we stress the importance of comparing results from multiple molecules, both as a method for testing the overall reliability of the organismal phylogeny and as a method for more broadly exploring the history of the genome.

  5. Molecular architecture of the ribosome-bound Hepatitis C Virus internal ribosomal entry site RNA.

    PubMed

    Yamamoto, Hiroshi; Collier, Marianne; Loerke, Justus; Ismer, Jochen; Schmidt, Andrea; Hilal, Tarek; Sprink, Thiemo; Yamamoto, Kaori; Mielke, Thorsten; Bürger, Jörg; Shaikh, Tanvir R; Dabrowski, Marylena; Hildebrand, Peter W; Scheerer, Patrick; Spahn, Christian M T

    2015-12-14

    Internal ribosomal entry sites (IRESs) are structured cis-acting RNAs that drive an alternative, cap-independent translation initiation pathway. They are used by many viruses to hijack the translational machinery of the host cell. IRESs facilitate translation initiation by recruiting and actively manipulating the eukaryotic ribosome using only a subset of canonical initiation factor and IRES transacting factors. Here we present cryo-EM reconstructions of the ribosome 80S- and 40S-bound Hepatitis C Virus (HCV) IRES. The presence of four subpopulations for the 80S•HCV IRES complex reveals dynamic conformational modes of the complex. At a global resolution of 3.9 Å for the most stable complex, a derived atomic model reveals a complex fold of the IRES RNA and molecular details of its interaction with the ribosome. The comparison of obtained structures explains how a modular architecture facilitates mRNA loading and tRNA binding to the P-site. This information provides the structural foundation for understanding the mechanism of HCV IRES RNA-driven translation initiation. PMID:26604301

  6. Studies on membrane proteins involved in ribosome binding on the rough endoplasmic reticulum. Ribophorins have no ribosome-binding activity.

    PubMed Central

    Yoshida, H; Tondokoro, N; Asano, Y; Mizusawa, K; Yamagishi, R; Horigome, T; Sugano, H

    1987-01-01

    A membrane protein fraction showing affinity for ribosomes was isolated from rat liver microsomes (microsomal fractions) in association with ribosomes by treatment of the microsomes with Emulgen 913 and then solubilized from the ribosomes with sodium deoxycholate. This protein fraction was separated into two fractions, glycoproteins, including ribophorins I and II, and non-glycoproteins, virtually free from ribophorins I and II, on concanavalin A-Sepharose columns. The two fractions were each reconstituted into liposomes to determine their ribosome-binding activities. The specific binding activity of the non-glycoprotein fraction was approx. 2.3-fold higher than that of the glycoprotein fraction. The recovery of ribosome-binding capacity of the two fractions was about 85% of the total binding capacity of the material applied to a concanavalin A-Sepharose column, and about 90% of it was found in the non-glycoprotein fraction. The affinity constants of the ribosomes for the reconstituted liposomes were somewhat higher than those for stripped rough microsomes. The mode of ribosome binding to the reconstituted liposomes was very similar to that to the stripped rough microsomes, in its sensitivity to proteolytic enzymes and its strong inhibition by increasing KCl concentration. These results support the idea that ribosome binding to rat liver microsomes is not directly mediated by ribophorins I and II, but that another unidentified membrane protein(s) plays a role in ribosome binding. Images Fig. 1. Fig. 3. Fig. 5. PMID:3663192

  7. The effect of trichloroethylene and acrylonitrile on RNA and ribosome synthesis and ribosome content in Saccharomyces cells.

    PubMed

    Lochmann, E R; Ehrlich, W; Mangir, M

    1984-04-01

    The effects of trichloroethylene (TCE) and acrylonitrile (ACN) on growth, RNA synthesis, ribosome synthesis, and ribosome content were tested in yeast cells. TCE causes a delay of the growth of a cell culture (prolongation of the lag phase), but does not cause inhibition. Cells exposed to increasing concentrations of ACN show increasing damage, so that, at a certain point of the growth curve, cell division stops altogether. Similar results were obtained when RNA synthesis was investigated: After treatment with TCE, the maximum RNA synthesis of the cell culture was retarded, but subsequently reached the same level as the untreated control cells. In the presence of ACN, however, the rate of RNA synthesis was lowered with increasing ACN concentrations. The same effect was observed upon investigation of ribosome synthesis: Whereas TCE produces only a slight effect, treatment with increasing concentrations of ACN leads to a substantial decrease in ribosome synthesis, and finally to total inhibition. Parallel to this, the content of free and membrane-bound ribosomes is diminished. Obviously, the decrease in ribosome content is caused not only by an inhibition of ribosome synthesis, but also by a degradation of existing ribosomes, as well as by induction of a ribosome-associated RNase. PMID:6714140

  8. Essential ribosome assembly factor Fap7 regulates a hierarchy of RNA-protein interactions during small ribosomal subunit biogenesis.

    PubMed

    Hellmich, Ute A; Weis, Benjamin L; Lioutikov, Anatoli; Wurm, Jan Philip; Kaiser, Marco; Christ, Nina A; Hantke, Katharina; Kötter, Peter; Entian, Karl-Dieter; Schleiff, Enrico; Wöhnert, Jens

    2013-09-17

    Factor activating Pos9 (Fap7) is an essential ribosome biogenesis factor important for the assembly of the small ribosomal subunit with an uncommon dual ATPase and adenylate kinase activity. Depletion of Fap7 or mutations in its ATPase motifs lead to defects in small ribosomal subunit rRNA maturation, the absence of ribosomal protein Rps14 from the assembled subunit, and retention of the nascent small subunit in a quality control complex with the large ribosomal subunit. The molecular basis for the role of Fap7 in ribosome biogenesis is, however, not yet understood. Here we show that Fap7 regulates multiple interactions between the precursor rRNA, ribosomal proteins, and ribosome assembly factors in a hierarchical manner. Fap7 binds to Rps14 with a very high affinity. Fap7 binding blocks both rRNA-binding elements of Rps14, suggesting that Fap7 inhibits premature interactions of Rps14 with RNA. The Fap7/Rps14 interaction is modulated by nucleotide binding to Fap7. Rps14 strongly activates the ATPase activity but not the adenylate kinase activity of Fap7, identifying Rps14 as an example of a ribosomal protein functioning as an ATPase-activating factor. In addition, Fap7 inhibits the RNA cleavage activity of Nob1, the endonuclease responsible for the final maturation step of the small subunit rRNA, in a nucleotide independent manner. Thus, Fap7 may regulate small subunit biogenesis at multiple stages. PMID:24003121

  9. Hindered Proton Collectivity in the Proton-Rich Nucleus 28S: Possible Magic Number Z = 16 at Proton-Rich Side

    NASA Astrophysics Data System (ADS)

    Togano, Yasuhiro; Yamada, Yusuke; Iwasa, Naohito; Yamada, Kazunari; Motobayashi, Tohru; Aoi, Nori; Baba, Hidetada; Bishop, Shawn; Cai, Xiangzhou; Doornenbal, Pieter; Fang, Deqing; Furukawa, Takeshi; Ieki, Kazuo; Kawabata, Takahiro; Kanno, Shoko; Kobayashi, Nobuyuki; Kondo, Yosuke; Kuboki, Takamasa; Kume, Naoto; Kurita, Kazuyoshi; Kurokawa, Meiko; Ma, Yu-Gang; Matsuo, Yukari; Murakami, Hiroshi; Matsushita, Masafumi; Nakamura, Takashi; Okada, Kensuke; Ota, Shinsuke; Satou, Yoshiteru; Shimoura, Susumu; Shioda, Ryota; Tanaka, Kana; Takeuchi, Satoshi; Tian, Wendong; Wang, Hongwei; Wang, Jiansong; Yoneda, Ken-ichiro

    The reduced transition probability B(E2;0gs + to 21 + ) for the most proton-rich even-even sulfur isotope 28S was determined experimentally using Coulomb excitation at 53 MeV/nucleon. The resultant B(E2) value is smaller than those of neighboring N = 12 isotones and Z = 16 isotopes. The ratio of neutron/proton transition matrix amplitudes for the 0gs + to 21 + transition were obtained to be 1.9(2) × N/Z from the present result and known B(E2) value in the mirror nucleus 28Mg. These results indicate the emergence of the magic number Z = 16 in 28S.

  10. Motion of individual ribosomes along mRNA

    NASA Astrophysics Data System (ADS)

    Visscher, Koen

    2004-11-01

    Ribosomes move along messenger RNA to translate a sequence of ribonucleotides into a corresponding sequence of amino acids that make up a protein. Efficient motion of ribosomes along the mRNA requires hydrolysis of GTP, converting chemical energy into mechanical work, like better known molecular motors such as kinesin. However, motion is just one of the many tasks of the ribosome, whereas for kinesin, motion itself is the main goal. In keeping with these functional differences, the ribosome is also much larger consisting of more than 50 proteins and with half of its mass made up of ribosomal RNA. Such structural complexity enables indirect ways of coupling GTP hydrolysis to directed motion. In order to elucidate the mechanochemical coupling in ribosomes we have developed a single-molecule assay based on using optical tweezers to record the motion of individual ribosomes along mRNA. Translation rates of 2-4 codons/s have been observed. However, when increasing the force opposing motion, we observe backward slippage of ribosomes along homopolymeric poly(U) messages. Currently, it is not clear if the motor operates in reverse or if backward motion has become completely uncoupled from GTP hydrolysis. Interestingly, force-induced backward motion is of biological relevance because of its possible role in -1 frameshifting, a mechanism used by viruses to regulate gene expression at the level of translation.

  11. Role of ribosomal protein mutations in tumor development (Review).

    PubMed

    Goudarzi, Kaveh M; Lindström, Mikael S

    2016-04-01

    Ribosomes are cellular machines essential for protein synthesis. The biogenesis of ribosomes is a highly complex and energy consuming process that initiates in the nucleolus. Recently, a series of studies applying whole-exome or whole-genome sequencing techniques have led to the discovery of ribosomal protein gene mutations in different cancer types. Mutations in ribosomal protein genes have for example been found in endometrial cancer (RPL22), T-cell acute lymphoblastic leukemia (RPL10, RPL5 and RPL11), chronic lymphocytic leukemia (RPS15), colorectal cancer (RPS20), and glioma (RPL5). Moreover, patients suffering from Diamond-Blackfan anemia, a bone marrow failure syndrome caused by mutant ribosomal proteins are also at higher risk for developing leukemia, or solid tumors. Different experimental models indicate potential mechanisms whereby ribosomal proteins may initiate cancer development. In particular, deregulation of the p53 tumor suppressor network and altered mRNA translation are mechanisms likely to be involved. We envisage that changes in expression and the occurrence of ribosomal protein gene mutations play important roles in cancer development. Ribosome biology constitutes a re-emerging vital area of basic and translational cancer research. PMID:26892688

  12. Role of ribosomal protein mutations in tumor development (Review)

    PubMed Central

    GOUDARZI, KAVEH M.; LINDSTRÖM, MIKAEL S.

    2016-01-01

    Ribosomes are cellular machines essential for protein synthesis. The biogenesis of ribosomes is a highly complex and energy consuming process that initiates in the nucleolus. Recently, a series of studies applying whole-exome or whole-genome sequencing techniques have led to the discovery of ribosomal protein gene mutations in different cancer types. Mutations in ribosomal protein genes have for example been found in endometrial cancer (RPL22), T-cell acute lymphoblastic leukemia (RPL10, RPL5 and RPL11), chronic lymphocytic leukemia (RPS15), colorectal cancer (RPS20), and glioma (RPL5). Moreover, patients suffering from Diamond-Blackfan anemia, a bone marrow failure syndrome caused by mutant ribosomal proteins are also at higher risk for developing leukemia, or solid tumors. Different experimental models indicate potential mechanisms whereby ribosomal proteins may initiate cancer development. In particular, deregulation of the p53 tumor suppressor network and altered mRNA translation are mechanisms likely to be involved. We envisage that changes in expression and the occurrence of ribosomal protein gene mutations play important roles in cancer development. Ribosome biology constitutes a re-emerging vital area of basic and translational cancer research. PMID:26892688

  13. Proteopedia Entry: The Large Ribosomal Subunit of "Haloarcula Marismortui"

    ERIC Educational Resources Information Center

    Decatur, Wayne A.

    2010-01-01

    This article presents a "Proteopedia" page that shows the refined version of the structure of the "Haloarcula" large ribosomal subunit as solved by the laboratories of Thomas Steitz and Peter Moore. The landmark structure is of great impact as it is the first atomic-resolution structure of the highly conserved ribosomal subunit which harbors…

  14. Molecular systematic of three species of Oithona (Copepoda, Cyclopoida) from the Atlantic Ocean: comparative analysis using 28S rDNA.

    PubMed

    Cepeda, Georgina D; Blanco-Bercial, Leocadio; Bucklin, Ann; Berón, Corina M; Viñas, María D

    2012-01-01

    Species of Oithona (Copepoda, Cyclopoida) are highly abundant, ecologically important, and widely distributed throughout the world oceans. Although there are valid and detailed descriptions of the species, routine species identifications remain challenging due to their small size, subtle morphological diagnostic traits, and the description of geographic forms or varieties. This study examined three species of Oithona (O. similis, O. atlantica and O. nana) occurring in the Argentine sector of the South Atlantic Ocean based on DNA sequence variation of a 575 base-pair region of 28S rDNA, with comparative analysis of these species from other North and South Atlantic regions. DNA sequence variation clearly resolved and discriminated the species, and revealed low levels of intraspecific variation among North and South Atlantic populations of each species. The 28S rDNA region was thus shown to provide an accurate and reliable means of identifying the species throughout the sampled domain. Analysis of 28S rDNA variation for additional species collected throughout the global ocean will be useful to accurately characterize biogeographical distributions of the species and to examine phylogenetic relationships among them. PMID:22558245

  15. Kinetics of paused ribosome recycling in Escherichia coli

    PubMed Central

    Janssen, Brian D.; Hayes, Christopher S.

    2009-01-01

    Summary The bacterial tmRNA•SmpB system recycles stalled translation complexes in a process termed ‘ribosome rescue’. tmRNA•SmpB specifically recognizes ribosomes that are paused at or near the 3′ end of truncated mRNA, and therefore nucleolytic mRNA processing is required before paused ribosomes can be rescued from full-length transcripts. Here, we examine the recycling of ribosomes paused on both full-length and truncated mRNAs. Peptidyl-tRNAs corresponding to each paused translation complex were identified, and their turnover kinetics used to estimate the half-lives of paused ribosomes in vivo. Ribosomes were paused at stop codons on full-length mRNA using a nascent peptide motif that interferes with translation termination and elicits tmRNA•SmpB activity. Peptidyl-tRNA turnover from these termination-paused ribosomes was slightly more rapid in tmRNA+ cells (T1/2 = 22 ± 2.2 s), compared to ΔtmRNA cells (T1/2 = 32 ± 1.6 s). Overexpression of release factor-1 (RF-1) greatly accelerated peptidyl-tRNA turnover from termination-paused ribosomes in both tmRNA+ and ΔtmRNA cells, whereas other termination factors had little or no effect on recycling. In contrast to inefficient translation termination, ribosome recycling from truncated transcripts lacking in-frame stop codons was dramatically accelerated by tmRNA•SmpB. However, peptidyl-tRNA still turned over from nonstop-paused ribosomes at a significant rate (t1/2 = 61 ± 7.3 s) in ΔtmRNA cells. Overexpression of RF-1, RF-3, and ribosome recycling factor (RRF) in ΔtmRNA cells failed to accelerate ribosome recycling from nonstop mRNA. These results indicate that tmRNA•SmpB activity is rate-limited by mRNA cleavage, and that RF-3 and RRF do not constitute a tmRNA-independent rescue pathway as previously suggested. Peptidyl-tRNA turnover from nonstop-paused ribosomes in ΔtmRNA cells suggests the existence of another uncharacterized ribosome rescue pathway. PMID:19761774

  16. Hirudinella ventricosa (Pallas, 1774) Baird, 1853 represents a species complex based on ribosomal DNA.

    PubMed

    Calhoun, Dana M; Curran, Stephen S; Pulis, Eric E; Provaznik, Jennifer M; Franks, James S

    2013-10-01

    Digeneans in the genus Hirudinella de Blainville, 1828 (Hirudinellidae) from three species of pelagic fishes, Acanthocybium solandri (Cuvier), Makaira nigricans Lacépède and Thunnus albacares (Bonnaterre), and one benthic fish, Mulloidichthys martinicus (Cuvier), from the Gulf of Mexico are investigated using comparison of ribosomal DNA. Four species are identified based on molecular differences: Hirudinella ventricosa (Pallas, 1774) Baird, 1853 from A. solandri, Hirudinella ahi Yamaguti, 1970 from T. albacares, and two unidentified but distinct species of Hirudinella, herein referred to as Hirudinella sp. A (from both M. nigricans and M. martinicus) and Hirudinella sp. B from M. nigricans. Additionally, H. ahi, based tentatively on morphological identification, is reported from Thunnus thynnus (Linnaeus). This represents the first record of a hirudinellid from M. martinicus and the first record of H. ahi from T. thynnus. A phylogeny of some Hemiurata Skrjabin & Guschanskaja, 1954 using partial fragments of the 28S rDNA sequences is consistent with earlier phylogenies and the position of the Hirudinellidae Dollfus, 1932 is well-supported as a derived group most closely related to the Syncoeliidae Looss, 1899. PMID:24048751

  17. Balsamin, a novel ribosome-inactivating protein from the seeds of Balsam apple Momordica balsamina.

    PubMed

    Kaur, Inderdeep; Yadav, Santosh K; Hariprasad, Gururao; Gupta, R C; Srinivasan, Alagiri; Batra, Janendra K; Puri, Munish

    2012-08-01

    Plant seeds, a rich source of proteins, are considered important for their application as functional ingredients in a food system. A novel ribosome-inactivating protein (RIP), balsamin was purified from the seeds of Balsam apple, Momordica balsamina. Balsamin was purified by ion exchange chromatography on CM Sepharose and gel filtration on superdex-75. It has a molecular weight of 28 kDa as shown by SDS-PAGE analysis. Balsamin inhibits protein synthesis in a rabbit reticulocyte lysate-based cell free translation assay with an IC(50) of 90.6 ng ml(-1). It has RNA N-glycosidase activity and releases a 400-base long fragment termed the Endo fragment from 28S rRNA in the same manner as does saporin-6 from Saponaria officinalis. The N-terminal sequence analysis of the first 12 amino acids of balsamin revealed that it shares 83% similarity with type I RIP α-MMC from Momordica charantia and 50% similarity with β-MMC (from Momordica charantia), bryodin I (from Bryonia dioica) and luffin a (from Luffa cylindrica). Balsamin was further characterized by mass spectrometry. CD spectroscopic studies indicate that secondary structure of balsamin contains helix (23.5%), β-strand (24.6%), turn (20%) and random coil (31.9%). Thus RIPs activity expressed in vegetables like Momordica sp. advocates its usage in diet. PMID:22120616

  18. Probing the mechanisms underlying human diseases in making ribosomes.

    PubMed

    Farley, Katherine I; Baserga, Susan J

    2016-08-15

    Ribosomes are essential, highly complex machines responsible for protein synthesis in all growing cells. Because of their importance, the process of building these machines is intricately regulated. Although the proteins involved in regulating ribosome biogenesis are just beginning to be understood, especially in human cells, the consequences for dysregulating this process have been even less studied. Such interruptions in ribosome synthesis result in a collection of human disorders known as ribosomopathies. Ribosomopathies, which occur due to mutations in proteins involved in the global process of ribosome biogenesis, result in tissue-specific defects. The questions posed by this dichotomy and the steps taken to address these questions are therefore the focus of this review: How can tissue-specific disorders result from alterations in global processes? Could ribosome specialization account for this difference? PMID:27528749

  19. Prediction of ribosome footprint profile shapes from transcript sequences

    PubMed Central

    Liu, Tzu-Yu; Song, Yun S.

    2016-01-01

    Motivation: Ribosome profiling is a useful technique for studying translational dynamics and quantifying protein synthesis. Applications of this technique have shown that ribosomes are not uniformly distributed along mRNA transcripts. Understanding how each transcript-specific distribution arises is important for unraveling the translation mechanism. Results: Here, we apply kernel smoothing to construct predictive features and build a sparse model to predict the shape of ribosome footprint profiles from transcript sequences alone. Our results on Saccharomyces cerevisiae data show that the marginal ribosome densities can be predicted with high accuracy. The proposed novel method has a wide range of applications, including inferring isoform-specific ribosome footprints, designing transcripts with fast translation speeds and discovering unknown modulation during translation. Availability and implementation: A software package called riboShape is freely available at https://sourceforge.net/projects/riboshape Contact: yss@berkeley.edu PMID:27307616

  20. DExD/H-box RNA helicases in ribosome biogenesis

    PubMed Central

    Martin, Roman; Straub, Annika U.; Doebele, Carmen; Bohnsack, Markus T.

    2013-01-01

    Ribosome synthesis requires a multitude of cofactors, among them DExD/H-box RNA helicases. Bacterial RNA helicases involved in ribosome assembly are not essential, while eukaryotes strictly require multiple DExD/H-box proteins that are involved in the much more complex ribosome biogenesis pathway. Here, RNA helicases are thought to act in structural remodeling of the RNPs including the modulation of protein binding, and they are required for allowing access or the release of specific snoRNPs from pre-ribosomes. Interestingly, helicase action is modulated by specific cofactors that can regulate recruitment and enzymatic activity. This review summarizes the current knowledge and focuses on recent findings and open questions on RNA helicase function and regulation in ribosome synthesis. PMID:22922795

  1. Regulation of ribosomal DNA amplification by the TOR pathway

    PubMed Central

    Jack, Carmen V.; Cruz, Cristina; Hull, Ryan M.; Keller, Markus A.; Ralser, Markus; Houseley, Jonathan

    2015-01-01

    Repeated regions are widespread in eukaryotic genomes, and key functional elements such as the ribosomal DNA tend to be formed of high copy repeated sequences organized in tandem arrays. In general, high copy repeats are remarkably stable, but a number of organisms display rapid ribosomal DNA amplification at specific times or under specific conditions. Here we demonstrate that target of rapamycin (TOR) signaling stimulates ribosomal DNA amplification in budding yeast, linking external nutrient availability to ribosomal DNA copy number. We show that ribosomal DNA amplification is regulated by three histone deacetylases: Sir2, Hst3, and Hst4. These enzymes control homologous recombination-dependent and nonhomologous recombination-dependent amplification pathways that act in concert to mediate rapid, directional ribosomal DNA copy number change. Amplification is completely repressed by rapamycin, an inhibitor of the nutrient-responsive TOR pathway; this effect is separable from growth rate and is mediated directly through Sir2, Hst3, and Hst4. Caloric restriction is known to up-regulate expression of nicotinamidase Pnc1, an enzyme that enhances Sir2, Hst3, and Hst4 activity. In contrast, normal glucose concentrations stretch the ribosome synthesis capacity of cells with low ribosomal DNA copy number, and we find that these cells show a previously unrecognized transcriptional response to caloric excess by reducing PNC1 expression. PNC1 down-regulation forms a key element in the control of ribosomal DNA amplification as overexpression of PNC1 substantially reduces ribosomal DNA amplification rate. Our results reveal how a signaling pathway can orchestrate specific genome changes and demonstrate that the copy number of repetitive DNA can be altered to suit environmental conditions. PMID:26195783

  2. Regulation of ribosome biogenesis in maize embryonic axes during germination.

    PubMed

    Villa-Hernández, J M; Dinkova, T D; Aguilar-Caballero, R; Rivera-Cabrera, F; Sánchez de Jiménez, E; Pérez-Flores, L J

    2013-10-01

    Ribosome biogenesis is a pre-requisite for cell growth and proliferation; it is however, a highly regulated process that consumes a great quantity of energy. It requires the coordinated production of rRNA, ribosomal proteins and non-ribosomal factors which participate in the processing and mobilization of the new ribosomes. Ribosome biogenesis has been studied in yeast and animals; however, there is little information about this process in plants. The objective of the present work was to study ribosome biogenesis in maize seeds during germination, a stage characterized for its fast growth, and the effect of insulin in this process. Insulin has been reported to accelerate germination and to induce seedling growth. It was observed that among the first events reactivated just after 3 h of imbibition are the rDNA transcription and the pre-rRNA processing and that insulin stimulates both of them (40-230%). The transcript of nucleolin, a protein which regulates rDNA transcription and pre-rRNA processing, is among the messages stored in quiescent dry seeds and it is mobilized into the polysomal fraction during the first hours of imbibition (6 h). In contrast, de novo ribosomal protein synthesis was low during the first hours of imbibition (3 and 6 h) increasing by 60 times in later stages (24 h). Insulin increased this synthesis (75%) at 24 h of imbibition; however, not all ribosomal proteins were similarly regulated. In this regard, an increase in RPS6 and RPL7 protein levels was observed, whereas RPL3 protein levels did not change even though its transcription was induced. Results show that ribosome biogenesis in the first stages of imbibition is carried out with newly synthesized rRNA and ribosomal proteins translated from stored mRNA. PMID:23806421

  3. Crystal Structures of the uL3 Mutant Ribosome: Illustration of the Importance of Ribosomal Proteins for Translation Efficiency.

    PubMed

    Mailliot, Justine; Garreau de Loubresse, Nicolas; Yusupova, Gulnara; Meskauskas, Arturas; Dinman, Jonathan D; Yusupov, Marat

    2016-05-22

    The ribosome has been described as a ribozyme in which ribosomal RNA is responsible for peptidyl-transferase reaction catalysis. The W255C mutation of the universally conserved ribosomal protein uL3 has diverse effects on ribosome function (e.g., increased affinities for transfer RNAs, decreased rates of peptidyl-transfer), and cells harboring this mutation are resistant to peptidyl-transferase inhibitors (e.g., anisomycin). These observations beg the question of how a single amino acid mutation may have such wide ranging consequences. Here, we report the structure of the vacant yeast uL3 W255C mutant ribosome by X-ray crystallography, showing a disruption of the A-site side of the peptidyl-transferase center (PTC). An additional X-ray crystallographic structure of the anisomycin-containing mutant ribosome shows that high concentrations of this inhibitor restore a "WT-like" configuration to this region of the PTC, providing insight into the resistance mechanism of the mutant. Globally, our data demonstrate that ribosomal protein uL3 is structurally essential to ensure an optimal and catalytically efficient organization of the PTC, highlighting the importance of proteins in the RNA-centered ribosome. PMID:26906928

  4. Modifying the maker: Oxygenases target ribosome biology

    PubMed Central

    Zhuang, Qinqin; Feng, Tianshu; Coleman, Mathew L

    2015-01-01

    The complexity of the eukaryotic protein synthesis machinery is partly driven by extensive and diverse modifications to associated proteins and RNAs. These modifications can have important roles in regulating translation factor activity and ribosome biogenesis and function. Further investigation of ‘translational modifications’ is warranted considering the growing evidence implicating protein synthesis as a critical point of gene expression control that is commonly deregulated in disease. New evidence suggests that translation is a major new target for oxidative modifications, specifically hydroxylations and demethylations, which generally are catalyzed by a family of emerging oxygenase enzymes that act at the interface of nutrient availability and metabolism. This review summarizes what is currently known about the role or these enzymes in targeting rRNA synthesis, protein translation and associated cellular processes. PMID:26779412

  5. Modifying the maker: Oxygenases target ribosome biology.

    PubMed

    Zhuang, Qinqin; Feng, Tianshu; Coleman, Mathew L

    2015-01-01

    The complexity of the eukaryotic protein synthesis machinery is partly driven by extensive and diverse modifications to associated proteins and RNAs. These modifications can have important roles in regulating translation factor activity and ribosome biogenesis and function. Further investigation of 'translational modifications' is warranted considering the growing evidence implicating protein synthesis as a critical point of gene expression control that is commonly deregulated in disease. New evidence suggests that translation is a major new target for oxidative modifications, specifically hydroxylations and demethylations, which generally are catalyzed by a family of emerging oxygenase enzymes that act at the interface of nutrient availability and metabolism. This review summarizes what is currently known about the role or these enzymes in targeting rRNA synthesis, protein translation and associated cellular processes. PMID:26779412

  6. Compilation of small ribosomal subunit RNA structures.

    PubMed Central

    Neefs, J M; Van de Peer, Y; De Rijk, P; Chapelle, S; De Wachter, R

    1993-01-01

    The database on small ribosomal subunit RNA structure contained 1804 nucleotide sequences on April 23, 1993. This number comprises 365 eukaryotic, 65 archaeal, 1260 bacterial, 30 plastidial, and 84 mitochondrial sequences. These are stored in the form of an alignment in order to facilitate the use of the database as input for comparative studies on higher-order structure and for reconstruction of phylogenetic trees. The elements of the postulated secondary structure for each molecule are indicated by special symbols. The database is available on-line directly from the authors by ftp and can also be obtained from the EMBL nucleotide sequence library by electronic mail, ftp, and on CD ROM disk. PMID:8332525

  7. Ribosome-Inactivating and Related Proteins

    PubMed Central

    Schrot, Joachim; Weng, Alexander; Melzig, Matthias F.

    2015-01-01

    Ribosome-inactivating proteins (RIPs) are toxins that act as N-glycosidases (EC 3.2.2.22). They are mainly produced by plants and classified as type 1 RIPs and type 2 RIPs. There are also RIPs and RIP related proteins that cannot be grouped into the classical type 1 and type 2 RIPs because of their different sizes, structures or functions. In addition, there is still not a uniform nomenclature or classification existing for RIPs. In this review, we give the current status of all known plant RIPs and we make a suggestion about how to unify those RIPs and RIP related proteins that cannot be classified as type 1 or type 2 RIPs. PMID:26008228

  8. Ribosomal protein uS19 mutants reveal its role in coordinating ribosome structure and function

    PubMed Central

    Bowen, Alicia M; Musalgaonkar, Sharmishtha; Moomau, Christine A; Gulay, Suna P; Mirvis, Mary; Dinman, Jonathan D

    2015-01-01

    Prior studies identified allosteric information pathways connecting functional centers in the large ribosomal subunit to the decoding center in the small subunit through the B1a and B1b/c intersubunit bridges in yeast. In prokaryotes a single SSU protein, uS13, partners with H38 (the A-site finger) and uL5 to form the B1a and B1b/c bridges respectively. In eukaryotes, the SSU component was split into 2 separate proteins during the course of evolution. One, also known as uS13, participates in B1b/c bridge with uL5 in eukaryotes. The other, called uS19 is the SSU partner in the B1a bridge with H38. Here, polyalanine mutants of uS19 involved in the uS19/uS13 and the uS19/H38 interfaces were used to elucidate the important amino acid residues involved in these intersubunit communication pathways. Two key clusters of amino acids were identified: one located at the junction between uS19 and uS13, and a second that appears to interact with the distal tip of H38. Biochemical analyses reveal that these mutations shift the ribosomal rotational equilibrium toward the unrotated state, increasing ribosomal affinity for tRNAs in the P-site and for ternary complex in the A-site, and inhibit binding of the translocase, eEF2. These defects in turn affect specific aspects of translational fidelity. These findings suggest that uS19 plays a critical role as a conduit of information exchange between the large and small ribosomal subunits directly through the B1a, and indirectly through the B1b/c bridges. PMID:26824029

  9. Ribosomal protein uS19 mutants reveal its role in coordinating ribosome structure and function.

    PubMed

    Bowen, Alicia M; Musalgaonkar, Sharmishtha; Moomau, Christine A; Gulay, Suna P; Mirvis, Mary; Dinman, Jonathan D

    2015-01-01

    Prior studies identified allosteric information pathways connecting functional centers in the large ribosomal subunit to the decoding center in the small subunit through the B1a and B1b/c intersubunit bridges in yeast. In prokaryotes a single SSU protein, uS13, partners with H38 (the A-site finger) and uL5 to form the B1a and B1b/c bridges respectively. In eukaryotes, the SSU component was split into 2 separate proteins during the course of evolution. One, also known as uS13, participates in B1b/c bridge with uL5 in eukaryotes. The other, called uS19 is the SSU partner in the B1a bridge with H38. Here, polyalanine mutants of uS19 involved in the uS19/uS13 and the uS19/H38 interfaces were used to elucidate the important amino acid residues involved in these intersubunit communication pathways. Two key clusters of amino acids were identified: one located at the junction between uS19 and uS13, and a second that appears to interact with the distal tip of H38. Biochemical analyses reveal that these mutations shift the ribosomal rotational equilibrium toward the unrotated state, increasing ribosomal affinity for tRNAs in the P-site and for ternary complex in the A-site, and inhibit binding of the translocase, eEF2. These defects in turn affect specific aspects of translational fidelity. These findings suggest that uS19 plays a critical role as a conduit of information exchange between the large and small ribosomal subunits directly through the B1a, and indirectly through the B1b/c bridges. PMID:26824029

  10. Yeast Ribosomal Protein L40 Assembles Late into Precursor 60 S Ribosomes and Is Required for Their Cytoplasmic Maturation*

    PubMed Central

    Fernández-Pevida, Antonio; Rodríguez-Galán, Olga; Díaz-Quintana, Antonio; Kressler, Dieter; de la Cruz, Jesús

    2012-01-01

    Most ribosomal proteins play important roles in ribosome biogenesis and function. Here, we have examined the contribution of the essential ribosomal protein L40 in these processes in the yeast Saccharomyces cerevisiae. Deletion of either the RPL40A or RPL40B gene and in vivo depletion of L40 impair 60 S ribosomal subunit biogenesis. Polysome profile analyses reveal the accumulation of half-mers and a moderate reduction in free 60 S ribosomal subunits. Pulse-chase, Northern blotting, and primer extension analyses in the L40-depleted strain clearly indicate that L40 is not strictly required for the precursor rRNA (pre-rRNA) processing reactions but contributes to optimal 27 SB pre-rRNA maturation. Moreover, depletion of L40 hinders the nucleo-cytoplasmic export of pre-60 S ribosomal particles. Importantly, all these defects most likely appear as the direct consequence of impaired Nmd3 and Rlp24 release from cytoplasmic pre-60 S ribosomal subunits and their inefficient recycling back into the nucle(ol)us. In agreement, we show that hemagglutinin epitope-tagged L40A assembles in the cytoplasm into almost mature pre-60 S ribosomal particles. Finally, we have identified that the hemagglutinin epitope-tagged L40A confers resistance to sordarin, a translation inhibitor that impairs the function of eukaryotic elongation factor 2, whereas the rpl40a and rpl40b null mutants are hypersensitive to this antibiotic. We conclude that L40 is assembled at a very late stage into pre-60 S ribosomal subunits and that its incorporation into 60 S ribosomal subunits is a prerequisite for subunit joining and may ensure proper functioning of the translocation process. PMID:22995916