Science.gov

Sample records for 30s ribosome assembly

  1. Visualizing ribosome biogenesis: parallel assembly pathways for the 30S subunit.

    PubMed

    Mulder, Anke M; Yoshioka, Craig; Beck, Andrea H; Bunner, Anne E; Milligan, Ronald A; Potter, Clinton S; Carragher, Bridget; Williamson, James R

    2010-10-29

    Ribosomes are self-assembling macromolecular machines that translate DNA into proteins, and an understanding of ribosome biogenesis is central to cellular physiology. Previous studies on the Escherichia coli 30S subunit suggest that ribosome assembly occurs via multiple parallel pathways rather than through a single rate-limiting step, but little mechanistic information is known about this process. Discovery single-particle profiling (DSP), an application of time-resolved electron microscopy, was used to obtain more than 1 million snapshots of assembling 30S subunits, identify and visualize the structures of 14 assembly intermediates, and monitor the population flux of these intermediates over time. DSP results were integrated with mass spectrometry data to construct the first ribosome-assembly mechanism that incorporates binding dependencies, rate constants, and structural characterization of populated intermediates. PMID:21030658

  2. Concurrent Nucleation of 16S Folding and Induced Fit in 30S Ribosome Assembly

    SciTech Connect

    Adilakshmi, T.; Bellur, D; Woodson, S

    2008-01-01

    Rapidly growing cells produce thousands of new ribosomes each minute, in a tightly regulated process that is essential to cell growth. How the Escherichia coli 16S ribosomal RNA and the 20 proteins that make up the 30S ribosomal subunit can assemble correctly in a few minutes remains a challenging problem, partly because of the lack of real-time data on the earliest stages of assembly. By providing snapshots of individual RNA and protein interactions as they emerge in real time, here we show that 30S assembly nucleates concurrently from different points along the rRNA. Time-resolved hydroxyl radical footprinting3 was used to map changes in the structure of the rRNA within 20 milliseconds after the addition of total 30S proteins. Helical junctions in each domain fold within 100 ms. In contrast, interactions surrounding the decoding site and between the 5', the central and the 3' domains require 2-200 seconds to form. Unexpectedly, nucleotides contacted by the same protein are protected at different rates, indicating that initial RNA-protein encounter complexes refold during assembly. Although early steps in assembly are linked to intrinsically stable rRNA structure, later steps correspond to regions of induced fit between the proteins and the rRNA.

  3. Differential effects of ribosomal proteins and Mg2+ ions on a conformational switch during 30S ribosome 5'-domain assembly.

    PubMed

    Abeysirigunawardena, Sanjaya C; Woodson, Sarah A

    2015-11-01

    Ribosomal protein S4 nucleates assembly of the 30S ribosome 5' and central domains, which is crucial for the survival of cells. Protein S4 changes the structure of its 16S rRNA binding site, passing through a non-native intermediate complex before forming native S4-rRNA contacts. Ensemble FRET was used to measure the thermodynamic stability of non-native and native S4 complexes in the presence of Mg(2+) ions and other 5'-domain proteins. Equilibrium titrations of Cy3-labeled 5'-domain RNA with Cy5-labeled protein S4 showed that Mg(2+) ions preferentially stabilize the native S4-rRNA complex. In contrast, ribosomal proteins S20 and S16 act by destabilizing the non-native S4-rRNA complex. The full cooperative switch to the native complex requires S4, S16, and S20 and is achieved to a lesser degree by S4 and S16. The resulting thermodynamic model for assembly of the 30S body illustrates how ribosomal proteins selectively bias the equilibrium between alternative rRNA conformations, increasing the cooperativity of rRNA folding beyond what can be achieved by Mg(2+) ions alone. PMID:26354770

  4. A combined quantitative mass spectrometry and electron microscopy analysis of ribosomal 30S subunit assembly in E. coli

    PubMed Central

    Sashital, Dipali G; Greeman, Candacia A; Lyumkis, Dmitry; Potter, Clinton S; Carragher, Bridget; Williamson, James R

    2014-01-01

    Ribosome assembly is a complex process involving the folding and processing of ribosomal RNAs (rRNAs), concomitant binding of ribosomal proteins (r-proteins), and participation of numerous accessory cofactors. Here, we use a quantitative mass spectrometry/electron microscopy hybrid approach to determine the r-protein composition and conformation of 30S ribosome assembly intermediates in Escherichia coli. The relative timing of assembly of the 3′ domain and the formation of the central pseudoknot (PK) structure depends on the presence of the assembly factor RimP. The central PK is unstable in the absence of RimP, resulting in the accumulation of intermediates in which the 3′-domain is unanchored and the 5′-domain is depleted for r-proteins S5 and S12 that contact the central PK. Our results reveal the importance of the cofactor RimP in central PK formation, and introduce a broadly applicable method for characterizing macromolecular assembly in cells. DOI: http://dx.doi.org/10.7554/eLife.04491.001 PMID:25313868

  5. Protein-RNA Dynamics in the Central Junction Control 30S Ribosome Assembly.

    PubMed

    Baker, Kris Ann; Lamichhane, Rajan; Lamichhane, Tek; Rueda, David; Cunningham, Philip R

    2016-09-11

    Interactions between ribosomal proteins (rproteins) and ribosomal RNA (rRNA) facilitate the formation of functional ribosomes. S15 is a central domain primary binding protein that has been shown to trigger a cascade of conformational changes in 16S rRNA, forming the functional structure of the central domain. Previous biochemical and structural studies in vitro have revealed that S15 binds a three-way junction of helices 20, 21, and 22, including nucleotides 652-654 and 752-754. All junction nucleotides except 653 are highly conserved among the Bacteria. To identify functionally important motifs within the junction, we subjected nucleotides 652-654 and 752-754 to saturation mutagenesis and selected and analyzed functional mutants. Only 64 mutants with greater than 10% ribosome function in vivo were isolated. S15 overexpression complemented mutations in the junction loop in each of the partially active mutants, although mutations that produced inactive ribosomes were not complemented by overexpression of S15. Single-molecule Förster or fluorescence resonance energy transfer (smFRET) was used to study the Mg(2+)- and S15-induced conformational dynamics of selected junction mutants. Comparison of the structural dynamics of these mutants with the wild type in the presence and absence of S15 revealed specific sequence and structural motifs in the central junction that are important in ribosome function. PMID:27192112

  6. The ribosomal subunit assembly line

    PubMed Central

    Dlakić, Mensur

    2005-01-01

    Recent proteomic studies in Saccharomyces cerevisiae have identified nearly 200 proteins, other than the structural ribosomal proteins, that participate in the assembly of ribosomal subunits and their transport from the nucleus. In a separate line of research, proteomic studies of mature plant ribosomes have revealed considerable variability in the protein composition of individual ribosomes. PMID:16207363

  7. Ribosome Assembly as Antimicrobial Target

    PubMed Central

    Nikolay, Rainer; Schmidt, Sabine; Schlömer, Renate; Deuerling, Elke; Nierhaus, Knud H.

    2016-01-01

    Many antibiotics target the ribosome and interfere with its translation cycle. Since translation is the source of all cellular proteins including ribosomal proteins, protein synthesis and ribosome assembly are interdependent. As a consequence, the activity of translation inhibitors might indirectly cause defective ribosome assembly. Due to the difficulty in distinguishing between direct and indirect effects, and because assembly is probably a target in its own right, concepts are needed to identify small molecules that directly inhibit ribosome assembly. Here, we summarize the basic facts of ribosome targeting antibiotics. Furthermore, we present an in vivo screening strategy that focuses on ribosome assembly by a direct fluorescence based read-out that aims to identify and characterize small molecules acting as primary assembly inhibitors. PMID:27240412

  8. Ribosome Assembly as Antimicrobial Target.

    PubMed

    Nikolay, Rainer; Schmidt, Sabine; Schlömer, Renate; Deuerling, Elke; Nierhaus, Knud H

    2016-01-01

    Many antibiotics target the ribosome and interfere with its translation cycle. Since translation is the source of all cellular proteins including ribosomal proteins, protein synthesis and ribosome assembly are interdependent. As a consequence, the activity of translation inhibitors might indirectly cause defective ribosome assembly. Due to the difficulty in distinguishing between direct and indirect effects, and because assembly is probably a target in its own right, concepts are needed to identify small molecules that directly inhibit ribosome assembly. Here, we summarize the basic facts of ribosome targeting antibiotics. Furthermore, we present an in vivo screening strategy that focuses on ribosome assembly by a direct fluorescence based read-out that aims to identify and characterize small molecules acting as primary assembly inhibitors. PMID:27240412

  9. All-atom homology model of the Escherichia coli 30S ribosomal subunit.

    PubMed

    Tung, Chang-Shung; Joseph, Simpson; Sanbonmatsu, Kevin Y

    2002-10-01

    Understanding the structural basis of ribosomal function requires close comparison between biochemical and structural data. Although a large amount of biochemical data are available for the Escherichia coli ribosome, the structure has not been solved to atomic resolution. Using a new RNA homology procedure, we have modeled the all-atom structure of the E. coli 30S ribosomal subunit. We find that the tertiary structure of the ribosome core, including the A-, P- and E-sites, is highly conserved. The hypervariable regions in our structure, which differ from the structure of the 30S ribosomal subunit from Thermus thermophilus, are consistent with the cryo-EM map of the E. coli ribosome. PMID:12244297

  10. Goniometer-based femtosecond X-ray diffraction of mutant 30S ribosomal subunit crystals

    SciTech Connect

    Dao, E. Han; Sierra, Raymond G.; Laksmono, Hartawan; Lemke, Henrik T.; Alonso-Mori, Roberto; Coey, Aaron; Larsen, Kevin; Baxter, Elizabeth L.; Cohen, Aina E.; Soltis, S. Michael; DeMirci, Hasan

    2015-04-30

    In this work, we collected radiation-damage-free data from a set of cryo-cooled crystals for a novel 30S ribosomal subunit mutant using goniometer-based femtosecond crystallography. Crystal quality assessment for these samples was conducted at the X-ray Pump Probe end-station of the Linac Coherent Light Source (LCLS) using recently introduced goniometer-based instrumentation. These 30S subunit crystals were genetically engineered to omit a 26-residue protein, Thx, which is present in the wild-type Thermus thermophilus 30S ribosomal subunit. We are primarily interested in elucidating the contribution of this ribosomal protein to the overall 30S subunit structure. To assess the viability of this study, femtosecond X-ray diffraction patterns from these crystals were recorded at the LCLS during a protein crystal screening beam time. During our data collection, we successfully observed diffraction from these difficult-to-grow 30S ribosomal subunit crystals. Most of our crystals were found to diffract to low resolution, while one crystal diffracted to 3.2 Å resolution. These data suggest the feasibility of pursuing high-resolution data collection as well as the need to improve sample preparation and handling in order to collect a complete radiation-damage-free data set using an X-ray Free Electron Laser.

  11. Goniometer-based femtosecond X-ray diffraction of mutant 30S ribosomal subunit crystals.

    PubMed

    Dao, E Han; Sierra, Raymond G; Laksmono, Hartawan; Lemke, Henrik T; Alonso-Mori, Roberto; Coey, Aaron; Larsen, Kevin; Baxter, Elizabeth L; Cohen, Aina E; Soltis, S Michael; DeMirci, Hasan

    2015-07-01

    In this work, we collected radiation-damage-free data from a set of cryo-cooled crystals for a novel 30S ribosomal subunit mutant using goniometer-based femtosecond crystallography. Crystal quality assessment for these samples was conducted at the X-ray Pump Probe end-station of the Linac Coherent Light Source (LCLS) using recently introduced goniometer-based instrumentation. These 30S subunit crystals were genetically engineered to omit a 26-residue protein, Thx, which is present in the wild-type Thermus thermophilus 30S ribosomal subunit. We are primarily interested in elucidating the contribution of this ribosomal protein to the overall 30S subunit structure. To assess the viability of this study, femtosecond X-ray diffraction patterns from these crystals were recorded at the LCLS during a protein crystal screening beam time. During our data collection, we successfully observed diffraction from these difficult-to-grow 30S ribosomal subunit crystals. Most of our crystals were found to diffract to low resolution, while one crystal diffracted to 3.2 Å resolution. These data suggest the feasibility of pursuing high-resolution data collection as well as the need to improve sample preparation and handling in order to collect a complete radiation-damage-free data set using an X-ray Free Electron Laser. PMID:26798805

  12. Goniometer-based femtosecond X-ray diffraction of mutant 30S ribosomal subunit crystals

    DOE PAGESBeta

    Dao, E. Han; Sierra, Raymond G.; Laksmono, Hartawan; Lemke, Henrik T.; Alonso-Mori, Roberto; Coey, Aaron; Larsen, Kevin; Baxter, Elizabeth L.; Cohen, Aina E.; Soltis, S. Michael; et al

    2015-04-30

    In this work, we collected radiation-damage-free data from a set of cryo-cooled crystals for a novel 30S ribosomal subunit mutant using goniometer-based femtosecond crystallography. Crystal quality assessment for these samples was conducted at the X-ray Pump Probe end-station of the Linac Coherent Light Source (LCLS) using recently introduced goniometer-based instrumentation. These 30S subunit crystals were genetically engineered to omit a 26-residue protein, Thx, which is present in the wild-type Thermus thermophilus 30S ribosomal subunit. We are primarily interested in elucidating the contribution of this ribosomal protein to the overall 30S subunit structure. To assess the viability of this study, femtosecondmore » X-ray diffraction patterns from these crystals were recorded at the LCLS during a protein crystal screening beam time. During our data collection, we successfully observed diffraction from these difficult-to-grow 30S ribosomal subunit crystals. Most of our crystals were found to diffract to low resolution, while one crystal diffracted to 3.2 Å resolution. These data suggest the feasibility of pursuing high-resolution data collection as well as the need to improve sample preparation and handling in order to collect a complete radiation-damage-free data set using an X-ray Free Electron Laser.« less

  13. Mutations in the leader region of ribosomal RNA operons cause structurally defective 30 S ribosomes as revealed by in vivo structural probing.

    PubMed

    Balzer, M; Wagner, R

    1998-02-27

    The biogenesis of functional ribosomes is regulated in a very complex manner, involving different proteins and RNA molecules. RNAs are not only essential components of both ribosomal subunits but also transiently interacting factors during particle formation. In eukaryotes snoRNAs act as molecular chaperones to assist maturation, modification and assembly. In a very similar way highly conserved leader sequences of bacterial rRNA operons are involved in the correct formation of 30 S ribosomal subunits. Certain mutations in the rRNA leader region cause severe growth defects due to malfunction of ribosomes which are assembled from such transcription units. To understand how the leader sequences act to facilitate the formation of the correct 30 S subunits we performed in vivo chemical probing to assess structural differences between ribosomes assembled either from rRNA transcribed from wild-type operons or from operons which contain mutations in the rRNA leader region. Cells transformed with plasmids containing the respective rRNA operons were reacted with dimethylsulphate (DMS). Ribosomes were isolated by sucrose gradient centrifugation and modified nucleotides within the 16 S rRNA were identified by primer extension reaction. Structural differences between ribosomes from wild-type and mutant rRNA operons occur in several clusters within the 16 S rRNA secondary structure. The most prominent differences are located in the central domain including the universally conserved pseudoknot structure which connects the 5', the central and the 3' domain of 16 S rRNA. Two other clusters with structural differences fall in the 5' domain where the leader had been shown to interact with mature 16 S rRNA and within the ribosomal protein S4 binding site. The other differences in structure are located in sites which are also known as sites for the action of several antibiotics. The data explain the functional defects of ribosomes from rRNA operons with leader mutations and help to

  14. Characterization of GE82832, a peptide inhibitor of translocation interacting with bacterial 30S ribosomal subunits

    PubMed Central

    Brandi, Letizia; Fabbretti, Attilio; Stefano, Michele Di; Lazzarini, Ameriga; Abbondi, Monica; Gualerzi, Claudio O.

    2006-01-01

    GE82832, a secondary metabolite produced by Streptosporangium cinnabarinum (strain GE82832), has been identified as a translational inhibitor by in vitro screening of a library of natural products. Secondary functional tests specific for individual steps of the translational pathway demonstrated that translocation is the specific target of GE82832. Chemical probing in situ demonstrated that this antibiotic protects bases A1324 and A1333 and exposes C1336 of 16S rRNA, thereby indicating that its binding site is located on the head of the 30S ribosomal subunit. The ribosomal location of GE82832, near ribosomal protein S13 and G1338, two elements of the small subunit that are part of or close to the B1a intrasubunit bridge, suggests that translocation inhibition results from an altered dynamics of 30S–50S ribosomal subunit interaction. PMID:16699167

  15. Neutron Scattering and the 30 S Ribosomal Subunit of E. Coli

    DOE R&D Accomplishments Database

    Moore, P. B.; Engelman, D. M.; Langer, J. A.; Ramakrishnan, V. R.; Schindler, D. G.; Schoenborn, B. P.; Sillers, I. Y.; Yabuki, S.

    1982-06-01

    This paper reviews the progress made in the study of the internal organization of the 30 S ribosomal subunit of E. coli by neutron scattering since 1975. A map of that particle showing the position of 14 of the subunit's 21 proteins is presented, and the methods currently used for collecting and analyzing such data are discussed. Also discussed is the possibility of extending the interpretation of neutron mapping data beyond the limits practical today.

  16. Seeing is Believing in Ribosome Assembly.

    PubMed

    Warner, Jonathan R

    2016-07-14

    Many proteins have been implicated genetically and biochemically in the assembly of eukaryotic ribosomes. Now, Kornprobst et al. show us how they are put together with a cryoEM structure of the 90S processome that initiates ribosome assembly, revealing the arrangement of U3 RNA and the several UTP complexes that form a chaperone-like structure around and within the developing 40S ribosomal subunit. PMID:27419867

  17. Crystal Structure of the 30S Ribosomal Subunit from Thermus Thermophilus. Purification, Crystallization and Structure Determination

    SciTech Connect

    Clemons, William M.; Brodersen, Ditlev E.; McCutcheonn, John P.; May, Joanna L.C.; Carter, Andrew P.; Morgan-Warren, Robert J.; Wimberly, Brian T.; Ramakrishnan, Venki

    2009-10-07

    We describe the crystallization and structure determination of the 30 S ribosomal subunit from Thermus thermophilus. Previous reports of crystals that diffracted to 10 {angstrom} resolution were used as a starting point to improve the quality of the diffraction. Eventually, ideas such as the addition of substrates or factors to eliminate conformational heterogeneity proved less important than attention to detail in yielding crystals that diffracted beyond 3 {angstrom} resolution. Despite improvements in technology and methodology in the last decade, the structure determination of the 30 S subunit presented some very challenging technical problems because of the size of the asymmetric unit, crystal variability and sensitivity to radiation damage. Some steps that were useful for determination of the atomic structure were: the use of anomalous scattering from the LIII edges of osmium and lutetium to obtain the necessary phasing signal; the use of tunable, third-generation synchrotron sources to obtain data of reasonable quality at high resolution; collection of derivative data precisely about a mirror plane to preserve small anomalous differences between Bijvoet mates despite extensive radiation damage and multi-crystal scaling; the pre-screening of crystals to ensure quality, isomorphism and the efficient use of scarce third-generation synchrotron time; pre-incubation of crystals in cobalt hexaammine to ensure isomorphism with other derivatives; and finally, the placement of proteins whose structures had been previously solved in isolation, in conjunction with biochemical data on protein-RNA interactions, to map out the architecture of the 30 S subunit prior to the construction of a detailed atomic-resolution model.

  18. Protein-guided RNA dynamics during early ribosome assembly

    NASA Astrophysics Data System (ADS)

    Kim, Hajin; Abeysirigunawarden, Sanjaya C.; Chen, Ke; Mayerle, Megan; Ragunathan, Kaushik; Luthey-Schulten, Zaida; Ha, Taekjip; Woodson, Sarah A.

    2014-02-01

    The assembly of 30S ribosomes requires the precise addition of 20 proteins to the 16S ribosomal RNA. How early binding proteins change the ribosomal RNA structure so that later proteins may join the complex is poorly understood. Here we use single-molecule fluorescence resonance energy transfer (FRET) to observe real-time encounters between Escherichia coli ribosomal protein S4 and the 16S 5' domain RNA at an early stage of 30S assembly. Dynamic initial S4-RNA complexes pass through a stable non-native intermediate before converting to the native complex, showing that non-native structures can offer a low free-energy path to protein-RNA recognition. Three-colour FRET and molecular dynamics simulations reveal how S4 changes the frequency and direction of RNA helix motions, guiding a conformational switch that enforces the hierarchy of protein addition. These protein-guided dynamics offer an alternative explanation for induced fit in RNA-protein complexes.

  19. Conformation of 4.5S RNA in the signal recognition particle and on the 30S ribosomal subunit

    PubMed Central

    GU, SHAN-QING; JÖCKEL, JOHANNES; BEINKER, PHILIPP; WARNECKE, JENS; SEMENKOV, YURI P.; RODNINA, MARINA V.; WINTERMEYER, WOLFGANG

    2005-01-01

    The signal recognition particle (SRP) from Escherichia coli consists of 4.5S RNA and protein Ffh. It is essential for targeting ribosomes that are translating integral membrane proteins to the translocation pore in the plasma membrane. Independently of Ffh, 4.5S RNA also interacts with elongation factor G (EF-G) and the 30S ribosomal subunit. Here we use a cross-linking approach to probe the conformation of 4.5S RNA in SRP and in the complex with the 30S ribosomal subunit and to map the binding site. The UV-activatable cross-linker p-azidophenacyl bromide (AzP) was attached to positions 1, 21, and 54 of wild-type or modified 4.5S RNA. In SRP, cross-links to Ffh were formed from AzP in all three positions in 4.5S RNA, indicating a strongly bent conformation in which the 5′ end (position 1) and the tetraloop region (including position 54) of the molecule are close to one another and to Ffh. In ribosomal complexes of 4.5S RNA, AzP in both positions 1 and 54 formed cross-links to the 30S ribosomal subunit, independently of the presence of Ffh. The major cross-linking target on the ribosome was protein S7; minor cross-links were formed to S2, S18, and S21. There were no cross-links from 4.5S RNA to the 50S subunit, where the primary binding site of SRP is located close to the peptide exit. The functional role of 4.5S RNA binding to the 30S subunit is unclear, as the RNA had no effect on translation or tRNA translocation on the ribosome. PMID:16043501

  20. Mitochondrial ribosome assembly in health and disease

    PubMed Central

    De Silva, Dasmanthie; Tu, Ya-Ting; Amunts, Alexey; Fontanesi, Flavia; Barrientos, Antoni

    2015-01-01

    The ribosome is a structurally and functionally conserved macromolecular machine universally responsible for catalyzing protein synthesis. Within eukaryotic cells, mitochondria contain their own ribosomes (mitoribosomes), which synthesize a handful of proteins, all essential for the biogenesis of the oxidative phosphorylation system. High-resolution cryo-EM structures of the yeast, porcine and human mitoribosomal subunits and of the entire human mitoribosome have uncovered a wealth of new information to illustrate their evolutionary divergence from their bacterial ancestors and their adaptation to synthesis of highly hydrophobic membrane proteins. With such structural data becoming available, one of the most important remaining questions is that of the mitoribosome assembly pathway and factors involved. The regulation of mitoribosome biogenesis is paramount to mitochondrial respiration, and thus to cell viability, growth and differentiation. Moreover, mutations affecting the rRNA and protein components produce severe human mitochondrial disorders. Despite its biological and biomedical significance, knowledge on mitoribosome biogenesis and its deviations from the much-studied bacterial ribosome assembly processes is scarce, especially the order of rRNA processing and assembly events and the regulatory factors required to achieve fully functional particles. This article focuses on summarizing the current available information on mitoribosome assembly pathway, factors that form the mitoribosome assembly machinery, and the effect of defective mitoribosome assembly on human health. PMID:26030272

  1. Depletion of Free 30S Ribosomal Subunits in Escherichia coli by Expression of RNA Containing Shine-Dalgarno-Like Sequences

    PubMed Central

    Mawn, Mary V.; Fournier, Maurille J.; Tirrell, David A.; Mason, Thomas L.

    2002-01-01

    We have constructed synthetic coding sequences for the expression of poly(α,l-glutamic acid) (PLGA) as fusion proteins with dihydrofolate reductase (DHFR) in Escherichia coli. These PLGA coding sequences use both GAA and GAG codons for glutamic acid and contain sequence elements (5′-GAGGAGG-3′) that resemble the consensus Shine-Dalgarno (SD) sequence found at translation initiation sites in bacterial mRNAs. An unusual feature of DHFR-PLGA expression is that accumulation of the protein is inversely related to the level of induction of its mRNA. Cellular protein synthesis was inhibited >95% by induction of constructs for either translatable or untranslatable PLGA RNAs. Induction of PLGA RNA resulted in the depletion of free 30S ribosomal subunits and the appearance of new complexes in the polyribosome region of the gradient. Unlike normal polyribosomes, these complexes were resistant to breakdown in the presence of puromycin. The novel complexes contained 16S rRNA, 23S rRNA, and PLGA RNA. We conclude that multiple noninitiator SD-like sequences in the PLGA RNA inhibit cellular protein synthesis by sequestering 30S small ribosomal subunits and 70S ribosomes in nonfunctional complexes on the PLGA mRNA. PMID:11751827

  2. S-adenosylmethionine directly inhibits binding of 30S ribosomal subunits to the SMK box translational riboswitch RNA

    PubMed Central

    Fuchs, Ryan T.; Grundy, Frank J.; Henkin, Tina M.

    2007-01-01

    The SMK box is a conserved riboswitch motif found in the 5′ untranslated region of metK genes [encoding S-adenosylmethionine (SAM) synthetase] in lactic acid bacteria, including Enterococcus, Streptococcus, and Lactococcus sp. Previous studies showed that this RNA element binds SAM in vitro, and SAM binding causes a structural rearrangement that sequesters the Shine–Dalgarno (SD) sequence by pairing with an anti-SD (ASD) element. A model was proposed in which SAM binding inhibits metK translation by preventing binding of the ribosome to the SD region of the mRNA. In the current work, the addition of SAM was shown to inhibit binding of 30S ribosomal subunits to SMK box RNA; in contrast, the addition of S-adenosylhomocysteine (SAH) had no effect. A mutant RNA, which has a disrupted SD-ASD pairing, was defective in SAM binding and showed no reduction of ribosome binding in the presence of SAM, whereas a compensatory mutation that restored SD-ASD pairing restored the response to SAM. Primer extension inhibition assays provided further evidence for SD-ASD pairing in the presence of SAM. These results strongly support the model that SMK box translational repression operates through occlusion of the ribosome binding site and that SAM binding requires the SD-ASD pairing. PMID:17360376

  3. Positions of S2, S13, S16, S17, S19 and S21 in the 30 S ribosomal subunit of Escherichia coli.

    PubMed

    Capel, M S; Kjeldgaard, M; Engelman, D M; Moore, P B

    1988-03-01

    Neutron scattering distance data are presented for 33 protein pairs in the 30 S ribosomal subunit from Escherichia coli, along with the methods used for measuring distances between its exchangeable components. When combined with prior data, these new results permit the positioning of S2, S13, S16, S17, S19 and S21 in the 30 S ribosomal subunit, completing the mapping of its proteins by neutron scattering. Comparisons with other data suggest that the neutron map is a reliable guide to the quaternary structure of the 30 S subunit. PMID:3288761

  4. Functions of ribosomal proteins in assembly of eukaryotic ribosomes in vivo.

    PubMed

    de la Cruz, Jesús; Karbstein, Katrin; Woolford, John L

    2015-01-01

    The proteome of cells is synthesized by ribosomes, complex ribonucleoproteins that in eukaryotes contain 79-80 proteins and four ribosomal RNAs (rRNAs) more than 5,400 nucleotides long. How these molecules assemble together and how their assembly is regulated in concert with the growth and proliferation of cells remain important unanswered questions. Here, we review recently emerging principles to understand how eukaryotic ribosomal proteins drive ribosome assembly in vivo. Most ribosomal proteins assemble with rRNA cotranscriptionally; their association with nascent particles is strengthened as assembly proceeds. Each subunit is assembled hierarchically by sequential stabilization of their subdomains. The active sites of both subunits are constructed last, perhaps to prevent premature engagement of immature ribosomes with active subunits. Late-assembly intermediates undergo quality-control checks for proper function. Mutations in ribosomal proteins that affect mostly late steps lead to ribosomopathies, diseases that include a spectrum of cell type-specific disorders that often transition from hypoproliferative to hyperproliferative growth. PMID:25706898

  5. Functions of Ribosomal Proteins in Assembly of Eukaryotic Ribosomes In Vivo

    PubMed Central

    2016-01-01

    The proteome of cells is synthesized by ribosomes, complex ribonucleoproteins that in eukaryotes contain 79–80 proteins and four ribosomal RNAs (rRNAs) more than 5,400 nucleotides long. How these molecules assemble together and how their assembly is regulated in concert with the growth and proliferation of cells remain important unanswered questions. Here, we review recently emerging principles to understand how eukaryotic ribosomal proteins drive ribosome assembly in vivo. Most ribosomal proteins assemble with rRNA cotranscriptionally; their association with nascent particles is strengthened as assembly proceeds. Each subunit is assembled hierarchically by sequential stabilization of their subdomains. The active sites of both subunits are constructed last, perhaps to prevent premature engagement of immature ribosomes with active subunits. Late-assembly intermediates undergo quality-control checks for proper function. Mutations in ribosomal proteins that affect mostly late steps lead to ribosomopathies, diseases that include a spectrum of cell type–specific disorders that often transition from hypoproliferative to hyperproliferative growth. PMID:25706898

  6. Serial femtosecond X-ray diffraction of 30S ribosomal subunit microcrystals in liquid suspension at ambient temperature using an X-ray free-electron laser

    PubMed Central

    Demirci, Hasan; Sierra, Raymond G.; Laksmono, Hartawan; Shoeman, Robert L.; Botha, Sabine; Barends, Thomas R. M.; Nass, Karol; Schlichting, Ilme; Doak, R. Bruce; Gati, Cornelius; Williams, Garth J.; Boutet, Sébastien; Messerschmidt, Marc; Jogl, Gerwald; Dahlberg, Albert E.; Gregory, Steven T.; Bogan, Michael J.

    2013-01-01

    High-resolution ribosome structures determined by X-ray crystallography have provided important insights into the mechanism of translation. Such studies have thus far relied on large ribosome crystals kept at cryogenic temperatures to reduce radiation damage. Here, the application of serial femtosecond X-ray crystallography (SFX) using an X-ray free-electron laser (XFEL) to obtain diffraction data from ribosome microcrystals in liquid suspension at ambient temperature is described. 30S ribosomal subunit microcrystals diffracted to beyond 6 Å resolution, demonstrating the feasibility of using SFX for ribosome structural studies. The ability to collect diffraction data at near-physiological temperatures promises to provide fundamental insights into the structural dynamics of the ribosome and its functional complexes. PMID:23989164

  7. Physical and biochemical nature of the bacterial cytoplasm: movement and localization of mRNA and the 30S subunits of ribosomes.

    PubMed

    Trevors, J T

    2012-05-01

    There is a paucity of knowledge on how mRNA transcripts in the spatially crowded, but molecularly organized bacterial cytoplasm contact the 30S ribosomal subunits. Does simple diffusion in the cytoplasm account for transcript-ribosome interactions given that a large number of ribosomes (e.g., about 72,000 in Escherichia coli during exponential growth) can be present in the cytoplasm? Or are undiscovered mechanisms present where specific transcripts are directed to specific ribosomes at specific cytoplasmic locations, while others are mobilized in a random manner? Moreover, is it possible that cytoplasmic mobilization occurs in bacteria, driven possibly by thermal infrared (IR) radiation and the generation of exclusion zone (EZ) water? These aspects will be discussed in this article and hypotheses presented. PMID:22710107

  8. Effects of induction of rRNA overproduction on ribosomal protein synthesis and ribosome subunit assembly in Escherichia coli.

    PubMed Central

    Yamagishi, M; Nomura, M

    1988-01-01

    Overproduction of rRNA was artificially induced in Escherichia coli cells to test whether the synthesis of ribosomal protein (r-protein) is normally repressed by feedback regulation. When rRNA was overproduced more than twofold from a hybrid plasmid carrying the rrnB operon fused to the lambda pL promoter (pL-rrnB), synthesis of individual r-proteins increased by an average of about 60%. This demonstrates that the synthesis of r-proteins is repressed under normal conditions. The increase of r-protein production, however, for unknown reasons, was not as great as the increase in rRNA synthesis and resulted in an imbalance between the amounts of rRNA and r-protein synthesis. Therefore, only a small (less than 20%) increase in the synthesis of complete 30S and 50S ribosome subunits was detected, and a considerable fraction of the excess rRNA was degraded. Lack of complete cooperativity in the assembly of ribosome subunits in vivo is discussed as a possible explanation for the absence of a large stimulation of ribosome synthesis observed under these conditions. In addition to the induction of intact rRNA overproduction from the pL-rrnB operon, the effects of unbalanced overproduction of each of the two large rRNAs, 16S rRNA and 23S rRNA, on r-protein synthesis were examined using pL-rrnB derivatives carrying a large deletion in either the 23S rRNA gene or the 16S rRNA gene. Operon-specific derepression after 23S or 16S rRNA overproduction correlated with the overproduction of rRNA containing the target site for the operon-specific repressor r-protein. These results are discussed to explain the apparent coupling of the assembly of one ribosomal subunit with that of the other which was observed in earlier studies on conditionally lethal mutants with defects in ribosome assembly. PMID:3053641

  9. Structural aspects of RbfA action during small ribosomal subunit assembly

    PubMed Central

    Datta, Partha P.; Wilson, Daniel N.; Kawazoe, Masahito; Swami, Neil K.; Kaminishi, Tatsuya; Sharma, Manjuli R.; Booth, Timothy M.; Takemoto, Chie; Fucini, Paola; Yokoyama, Shigeyuki; Agrawal, Rajendra K.

    2007-01-01

    Summary Ribosome binding factor A (RbfA) is a bacterial cold-shock response protein, required for an efficient processing of the 5′end of the 16S ribosomal RNA (rRNA) during assembly of the small (30S) ribosomal subunit. Here we present a crystal structure of Thermus thermophilus RbfA and a three-dimensional cryo-electron microscopic (EM) map of the T. thermophilus 30S·RbfA complex. RbfA binds to the 30S subunit in a position overlapping the binding sites of the A- and P-site tRNAs, and RbfA’s functionally important C-terminus extends toward the 5′ end of the 16S rRNA. In the presence of RbfA, a portion of the 16S rRNA encompassing helix 44, which is known to be directly involved in mRNA decoding and tRNA binding, is displaced. These results shed light on the role played by RbfA during maturation of the 30S subunit, and also indicate how RbfA provides cells with a translational advantage under conditions of cold shock. PMID:17996707

  10. A RanGTP-independent mechanism allows ribosomal protein nuclear import for ribosome assembly.

    PubMed

    Schütz, Sabina; Fischer, Ute; Altvater, Martin; Nerurkar, Purnima; Peña, Cohue; Gerber, Michaela; Chang, Yiming; Caesar, Stefanie; Schubert, Olga T; Schlenstedt, Gabriel; Panse, Vikram G

    2014-01-01

    Within a single generation time a growing yeast cell imports ∼14 million ribosomal proteins (r-proteins) into the nucleus for ribosome production. After import, it is unclear how these intrinsically unstable and aggregation-prone proteins are targeted to the ribosome assembly site in the nucleolus. Here, we report the discovery of a conserved nuclear carrier Tsr2 that coordinates transfer of the r-protein eS26 to the earliest assembling pre-ribosome, the 90S. In vitro studies revealed that Tsr2 efficiently dissociates importin:eS26 complexes via an atypical RanGTP-independent mechanism that terminates the import process. Subsequently, Tsr2 binds the released eS26, shields it from proteolysis, and ensures its safe delivery to the 90S pre-ribosome. We anticipate similar carriers-termed here escortins-to securely connect the nuclear import machinery with pathways that deposit r-proteins onto developing pre-ribosomal particles. PMID:25144938

  11. A RanGTP-independent mechanism allows ribosomal protein nuclear import for ribosome assembly

    PubMed Central

    Schütz, Sabina; Fischer, Ute; Altvater, Martin; Nerurkar, Purnima; Peña, Cohue; Gerber, Michaela; Chang, Yiming; Caesar, Stefanie; Schubert, Olga T; Schlenstedt, Gabriel; Panse, Vikram G

    2014-01-01

    Within a single generation time a growing yeast cell imports ∼14 million ribosomal proteins (r-proteins) into the nucleus for ribosome production. After import, it is unclear how these intrinsically unstable and aggregation-prone proteins are targeted to the ribosome assembly site in the nucleolus. Here, we report the discovery of a conserved nuclear carrier Tsr2 that coordinates transfer of the r-protein eS26 to the earliest assembling pre-ribosome, the 90S. In vitro studies revealed that Tsr2 efficiently dissociates importin:eS26 complexes via an atypical RanGTP-independent mechanism that terminates the import process. Subsequently, Tsr2 binds the released eS26, shields it from proteolysis, and ensures its safe delivery to the 90S pre-ribosome. We anticipate similar carriers—termed here escortins—to securely connect the nuclear import machinery with pathways that deposit r-proteins onto developing pre-ribosomal particles. DOI: http://dx.doi.org/10.7554/eLife.03473.001 PMID:25144938

  12. Incorporation of single dinitrophenyl-modified proteins in to the 30S subunit of Escherichia coli ribosomes by total reconstitution for localization by immune electron microscopy

    SciTech Connect

    Olah, T.V.

    1989-01-01

    The ribosome is a structurally defined organelle whose function is central to the existence of all organisms. It is the unique site of protein biosynthesis in all cells. A detailed understanding of ribosome structure is essential in understanding the process of translation. This thesis represents a new approach to the systematic localization of individual proteins contained in the small subunit of Escherichia coli ribosomes using immunoelectron microscopy. All 30S proteins were purified using high performance liquid chromatography (HPLC) and eight isolated proteins (S12,S21,S14,S19,S18,S17,S16 and S13) were derivatized with 2,4-(3,5-{sup 3}H)dinitrofluorobenzene (DNFB). The extent of modification of these proteins was estimated by both radioactivity and integrated peak areas, using dual wavelength monitoring at 214nm to detect protein and 360nm (to detect dinitrophenyl groups). Each dinitrophenylated protein was introduced in place of the corresponding unmodified protein into totally reconstituted 30S subunits. Antibodies raised against the DNP-hapten bound effectively to such reconstituted subunits and did not cause dissociation of the modified protein from the subunit. Electron microscopy of the immune complexes was used to localize the modified protein on the subunit surface. Incorporation of any of the DNP-modified proteins, with the exception of DNP-S18, does not interfere with the functionality of the ribosome as measure by the binding of Phe-tRNA{sup Phe} or the synthesis of poly(Phe) in a poly(U)-dependent manner. Results show that unmodified protein competes with DNP-protein and that DNP-protein can function, as its native counterpart, in stimulating uptake of specific proteins during reconstitution. This data provides evidence that each DNP-protein occupies the same position in 30S subunits as does the corresponding unmodified protein.

  13. Structural change induced by removal of magnesium ions on E. coli 70S ribosomes and 30S and 50S separated subunits

    NASA Astrophysics Data System (ADS)

    Briganti, G.; Giansanti, A.; Bonincontro, A.; Mengoni, M.; Giordano, R.

    1996-09-01

    To clarify the intra- and inter-particle effects of magnesium ions on E. coli ribosomes we have performed measurements of light scattering intensity, index of refraction and small-angle neutron scattering on the 70S complex and 30S and 50S subunits with and without magnesium. The results indicate that magnesium has a specific intra-particle effect on the subunits as well as on the 70S complex. Besides, the distance distribution function shows that magnesium has an effect on the supra-ribosomal aggregation. The combination of these intra- and inter-particle effects completely hides, in the scattering experiments, any effect of magnesium on the degree of association of the two subunits into the 70S complex.

  14. The antibiotic Furvina® targets the P-site of 30S ribosomal subunits and inhibits translation initiation displaying start codon bias

    PubMed Central

    Fabbretti, Attilio; Brandi, Letizia; Petrelli, Dezemona; Pon, Cynthia L.; Castañedo, Nilo R.; Medina, Ricardo; Gualerzi, Claudio O.

    2012-01-01

    Furvina®, also denominated G1 (MW 297), is a synthetic nitrovinylfuran [2-bromo-5-(2-bromo-2-nitrovinyl)-furan] antibiotic with a broad antimicrobial spectrum. An ointment (Dermofural®) containing G1 as the only active principle is currently marketed in Cuba and successfully used to treat dermatological infections. Here we describe the molecular target and mechanism of action of G1 in bacteria and demonstrate that in vivo G1 preferentially inhibits protein synthesis over RNA, DNA and cell wall synthesis. Furthermore, we demonstrate that G1 targets the small ribosomal subunit, binds at or near the P-decoding site and inhibits its function interfering with the ribosomal binding of fMet-tRNA during 30S initiation complex (IC) formation ultimately inhibiting translation. Notably, this G1 inhibition displays a bias for the nature (purine vs. pyrimidine) of the 3′-base of the codon, occurring efficiently only when the mRNA directing 30S IC formation and translation contains the canonical AUG initiation triplet or the rarely found AUA triplet, but hardly occurs when the mRNA start codon is either one of the non-canonical triplets AUU or AUC. This codon discrimination by G1 is reminiscent, though of opposite type of that displayed by IF3 in its fidelity function, and remarkably does not occur in the absence of this factor. PMID:22941660

  15. The antibiotic Furvina® targets the P-site of 30S ribosomal subunits and inhibits translation initiation displaying start codon bias.

    PubMed

    Fabbretti, Attilio; Brandi, Letizia; Petrelli, Dezemona; Pon, Cynthia L; Castañedo, Nilo R; Medina, Ricardo; Gualerzi, Claudio O

    2012-11-01

    Furvina®, also denominated G1 (MW 297), is a synthetic nitrovinylfuran [2-bromo-5-(2-bromo-2-nitrovinyl)-furan] antibiotic with a broad antimicrobial spectrum. An ointment (Dermofural®) containing G1 as the only active principle is currently marketed in Cuba and successfully used to treat dermatological infections. Here we describe the molecular target and mechanism of action of G1 in bacteria and demonstrate that in vivo G1 preferentially inhibits protein synthesis over RNA, DNA and cell wall synthesis. Furthermore, we demonstrate that G1 targets the small ribosomal subunit, binds at or near the P-decoding site and inhibits its function interfering with the ribosomal binding of fMet-tRNA during 30S initiation complex (IC) formation ultimately inhibiting translation. Notably, this G1 inhibition displays a bias for the nature (purine vs. pyrimidine) of the 3'-base of the codon, occurring efficiently only when the mRNA directing 30S IC formation and translation contains the canonical AUG initiation triplet or the rarely found AUA triplet, but hardly occurs when the mRNA start codon is either one of the non-canonical triplets AUU or AUC. This codon discrimination by G1 is reminiscent, though of opposite type of that displayed by IF3 in its fidelity function, and remarkably does not occur in the absence of this factor. PMID:22941660

  16. Essential ribosome assembly factor Fap7 regulates a hierarchy of RNA-protein interactions during small ribosomal subunit biogenesis.

    PubMed

    Hellmich, Ute A; Weis, Benjamin L; Lioutikov, Anatoli; Wurm, Jan Philip; Kaiser, Marco; Christ, Nina A; Hantke, Katharina; Kötter, Peter; Entian, Karl-Dieter; Schleiff, Enrico; Wöhnert, Jens

    2013-09-17

    Factor activating Pos9 (Fap7) is an essential ribosome biogenesis factor important for the assembly of the small ribosomal subunit with an uncommon dual ATPase and adenylate kinase activity. Depletion of Fap7 or mutations in its ATPase motifs lead to defects in small ribosomal subunit rRNA maturation, the absence of ribosomal protein Rps14 from the assembled subunit, and retention of the nascent small subunit in a quality control complex with the large ribosomal subunit. The molecular basis for the role of Fap7 in ribosome biogenesis is, however, not yet understood. Here we show that Fap7 regulates multiple interactions between the precursor rRNA, ribosomal proteins, and ribosome assembly factors in a hierarchical manner. Fap7 binds to Rps14 with a very high affinity. Fap7 binding blocks both rRNA-binding elements of Rps14, suggesting that Fap7 inhibits premature interactions of Rps14 with RNA. The Fap7/Rps14 interaction is modulated by nucleotide binding to Fap7. Rps14 strongly activates the ATPase activity but not the adenylate kinase activity of Fap7, identifying Rps14 as an example of a ribosomal protein functioning as an ATPase-activating factor. In addition, Fap7 inhibits the RNA cleavage activity of Nob1, the endonuclease responsible for the final maturation step of the small subunit rRNA, in a nucleotide independent manner. Thus, Fap7 may regulate small subunit biogenesis at multiple stages. PMID:24003121

  17. Hierarchical RNA Processing Is Required for Mitochondrial Ribosome Assembly.

    PubMed

    Rackham, Oliver; Busch, Jakob D; Matic, Stanka; Siira, Stefan J; Kuznetsova, Irina; Atanassov, Ilian; Ermer, Judith A; Shearwood, Anne-Marie J; Richman, Tara R; Stewart, James B; Mourier, Arnaud; Milenkovic, Dusanka; Larsson, Nils-Göran; Filipovska, Aleksandra

    2016-08-16

    The regulation of mitochondrial RNA processing and its importance for ribosome biogenesis and energy metabolism are not clear. We generated conditional knockout mice of the endoribonuclease component of the RNase P complex, MRPP3, and report that it is essential for life and that heart and skeletal-muscle-specific knockout leads to severe cardiomyopathy, indicating that its activity is non-redundant. Transcriptome-wide parallel analyses of RNA ends (PARE) and RNA-seq enabled us to identify that in vivo 5' tRNA cleavage precedes 3' tRNA processing, and this is required for the correct biogenesis of the mitochondrial ribosomal subunits. We identify that mitoribosomal biogenesis proceeds co-transcriptionally because large mitoribosomal proteins can form a subcomplex on an unprocessed RNA containing the 16S rRNA. Taken together, our data show that RNA processing links transcription to translation via assembly of the mitoribosome. PMID:27498866

  18. Ribosomal Protein Rps26 Influences 80S Ribosome Assembly in Saccharomyces cerevisiae

    PubMed Central

    Belyy, Alexander; Levanova, Nadezhda; Tabakova, Irina; Rospert, Sabine

    2016-01-01

    ABSTRACT The eukaryotic ribosome consists of a small (40S) and a large (60S) subunit. Rps26 is one of the essential ribosomal proteins of the 40S subunit and is encoded by two almost identical genes, RPS26a and RPS26b. Previous studies demonstrated that Rps26 interacts with the 5′ untranslated region of mRNA via the eukaryote-specific 62-YXXPKXYXK-70 (Y62–K70) motif. Those observations suggested that this peptide within Rps26 might play an important and specific role during translation initiation. By using alanine-scanning mutagenesis and engineered strains of the yeast Saccharomyces cerevisiae, we found that single amino acid substitutions within the Y62–K70 motif of Rps26 did not affect the in vivo function of the protein. In contrast, complete deletion of the Y62–K70 segment was lethal. The simultaneous replacement of five conserved residues within the Y62–K70 segment by alanines resulted in growth defects under stress conditions and produced distinct changes in polysome profiles that were indicative of the accumulation of free 60S subunits. Human Rps26 (Rps26-Hs), which displays significant homology with yeast Rps26, supported the growth of an S. cerevisiae Δrps26a Δrps26b strain. However, the Δrps26a Δrps26b double deletion strain expressing Rps26-Hs displayed substantial growth defects and an altered ratio of 40S/60S ribosomal subunits. The combined data strongly suggest that the eukaryote-specific motif within Rps26 does not play a specific role in translation initiation. Rather, the data indicate that Rps26 as a whole is necessary for proper assembly of the 40S subunit and the 80S ribosome in yeast. IMPORTANCE Rps26 is an essential protein of the eukaryotic small ribosomal subunit. Previous experiments demonstrated an interaction between the eukaryote-specific Y62–K70 segment of Rps26 and the 5′ untranslated region of mRNA. The data suggested a specific role of the Y62–K70 motif during translation initiation. Here, we report that single

  19. Structural change of E. coli separated and complexed 30S and 50S ribosomal subunits due to Mg 2+ ions: SANS experiments

    NASA Astrophysics Data System (ADS)

    Briganti, G.; Pedone, F.; Giansanti, A.; Giordano, R.

    1995-02-01

    Small-angle neutron-scattering experiments have been performed on E. Coli 70S ribosomes and on 50S and 30S separated subunits in the presence and absence of magnesium ions. In the 70S complex in presence of magnesium, the scattering intensity at Q = 0 ( I(0)) is roughly two times higher than without magnesium, in apparent agreement with the general view of an association-dissociation of the subunits induced by magnesium. But a similar increment is observed in both separated subunits too. The probability distribution functions of the intra-particle distance p( r), obtained by Fourier transforming, the experimental data, indicate that, even at low temperature (5°C) and concentration (0.1 wt%), the 70S and the separated subunits form aggregates. In all samples, the absence of Mg 2+ ions shifts and shrinks p( r) in the single-particle region, below 200 Å, and affects the shape of the curve in the aggregate region. Our results suggest that the presence of Mg 2+ ions does not strongly affect the degree of complexation of the subunits: the 70S complex retains its individuality even in the absence of magnesium, but undergoes structural rearrangements similar to those in 30S and 50S.

  20. Yeast Ribosomal Protein L40 Assembles Late into Precursor 60 S Ribosomes and Is Required for Their Cytoplasmic Maturation*

    PubMed Central

    Fernández-Pevida, Antonio; Rodríguez-Galán, Olga; Díaz-Quintana, Antonio; Kressler, Dieter; de la Cruz, Jesús

    2012-01-01

    Most ribosomal proteins play important roles in ribosome biogenesis and function. Here, we have examined the contribution of the essential ribosomal protein L40 in these processes in the yeast Saccharomyces cerevisiae. Deletion of either the RPL40A or RPL40B gene and in vivo depletion of L40 impair 60 S ribosomal subunit biogenesis. Polysome profile analyses reveal the accumulation of half-mers and a moderate reduction in free 60 S ribosomal subunits. Pulse-chase, Northern blotting, and primer extension analyses in the L40-depleted strain clearly indicate that L40 is not strictly required for the precursor rRNA (pre-rRNA) processing reactions but contributes to optimal 27 SB pre-rRNA maturation. Moreover, depletion of L40 hinders the nucleo-cytoplasmic export of pre-60 S ribosomal particles. Importantly, all these defects most likely appear as the direct consequence of impaired Nmd3 and Rlp24 release from cytoplasmic pre-60 S ribosomal subunits and their inefficient recycling back into the nucle(ol)us. In agreement, we show that hemagglutinin epitope-tagged L40A assembles in the cytoplasm into almost mature pre-60 S ribosomal particles. Finally, we have identified that the hemagglutinin epitope-tagged L40A confers resistance to sordarin, a translation inhibitor that impairs the function of eukaryotic elongation factor 2, whereas the rpl40a and rpl40b null mutants are hypersensitive to this antibiotic. We conclude that L40 is assembled at a very late stage into pre-60 S ribosomal subunits and that its incorporation into 60 S ribosomal subunits is a prerequisite for subunit joining and may ensure proper functioning of the translocation process. PMID:22995916

  1. Protein-RNA crosslinking in Escherichia coli 30S ribosomal subunits. Identification of a 16S rRNA fragment crosslinked to protein S12 by the use of the chemical crosslinking reagent 1-ethyl-3-dimethyl-aminopropylcarbodiimide.

    PubMed Central

    Chiaruttini, C; Expert-Bezançon, A; Hayes, D; Ehresmann, B

    1982-01-01

    1-ethyl-3-dimethyl aminopropylcarbodiimide (EDC) was used to cross-link 30S ribosomal proteins to 16S rRNA within the E. coli 3OS ribosomal subunit. Covalently linked complexes containing 30S proteins and 16S rRNA, isolated by sedimentation of dissociated crosslinked 30S subunits through SDS containing sucrose gradients, were digested with RNase T1, and the resulting oligonucleotide-protein complexes were fractionated on SDS containing polyacrylamide gels. Eluted complexes containing 30S proteins S9 and S12 linked to oligonucleotides were obtained in pure form. Oligonucleotide 5'terminal labelling was successful in the case of S12 containing but not of the S9 containing complex and led to identification of the S12 bound oligonucleotide as CAACUCG which is located at positions 1316-1322 in the 16S rRNA sequence. Protein S12 is crosslinked to the terminal G of this heptanucleotide. Images PMID:6760129

  2. The NMR solution structure of the 30S ribosomal protein S27e encoded in gene RS27_ARCFU of Archaeoglobus fulgidis reveals a novel protein fold

    PubMed Central

    Herve du Penhoat, Catherine; Atreya, Hanudatta S.; Shen, Yang; Liu, Gaohua; Acton, Thomas B.; Xiao, Rong; Li, Zhaohui; Murray, Diana; Montelione, Gaetano T.; Szyperski, Thomas

    2004-01-01

    The Archaeoglobus fulgidis gene RS27_ARCFU encodes the 30S ribosomal protein S27e. Here, we present the high-quality NMR solution structure of this archaeal protein, which comprises a C4 zinc finger motif of the CX2CX14-16CX2C class. S27e was selected as a target of the Northeast Structural Genomics Consortium (target ID: GR2), and its three-dimensional structure is the first representative of a family of more than 116 homologous proteins occurring in eukaryotic and archaeal cells. As a salient feature of its molecular architecture, S27e exhibits a β-sandwich consisting of two three-stranded sheets with topology B(↓), A(↑), F(↓), and C(↑), D(↓), E(↑). Due to the uniqueness of the arrangement of the strands, the resulting fold was found to be novel. Residues that are highly conserved among the S27 proteins allowed identification of a structural motif of putative functional importance; a conserved hydrophobic patch may well play a pivotal role for functioning of S27 proteins, be it in archaeal or eukaryotic cells. The structure of human S27, which possesses a 26-residue amino-terminal extension when compared with the archaeal S27e, was modeled on the basis of two structural templates, S27e for the carboxy-terminal core and the amino-terminal segment of the archaeal ribosomal protein L37Ae for the extension. Remarkably, the electrostatic surface properties of archaeal and human proteins are predicted to be entirely different, pointing at either functional variations among archaeal and eukaryotic S27 proteins, or, assuming that the function remained invariant, to a concerted evolutionary change of the surface potential of proteins interacting with S27. PMID:15096641

  3. Assembly and nuclear export of pre-ribosomal particles in budding yeast.

    PubMed

    Gerhardy, Stefan; Menet, Anna Maria; Peña, Cohue; Petkowski, Janusz Jurand; Panse, Vikram Govind

    2014-08-01

    The ribosome is responsible for the final step of decoding genetic information into proteins. Therefore, correct assembly of ribosomes is a fundamental task for all living cells. In eukaryotes, the construction of the ribosome which begins in the nucleolus requires coordinated efforts of >350 specialized factors that associate with pre-ribosomal particles at distinct stages to perform specific assembly steps. On their way through the nucleus, diverse energy-consuming enzymes are thought to release assembly factors from maturing pre-ribosomal particles after accomplishing their task(s). Subsequently, recruitment of export factors prepares pre-ribosomal particles for transport through nuclear pore complexes. Pre-ribosomes are exported into the cytoplasm in a functionally inactive state, where they undergo final maturation before initiating translation. Accumulating evidence indicates a tight coupling between nuclear export, cytoplasmic maturation, and final proofreading of the ribosome. In this review, we summarize our current understanding of nuclear export of pre-ribosomal subunits and cytoplasmic maturation steps that render pre-ribosomal subunits translation-competent. PMID:24817020

  4. Assembly of the 5′ and the 3′ minor domains of 16S rRNA as monitored by tethered probing from ribosomal protein S20

    PubMed Central

    Dutca, Laura M.; Culver, Gloria M.

    2008-01-01

    The ribosomal protein (r-protein) S20 is a primary binding protein. As such it interacts directly and independently with the 5′ domain and the 3′ minor domain of 16S ribosomal RNA (rRNA) in minimal particles and the fully assembled 30S subunit. The interactions observed between r-protein S20 and the 5′ domain of 16S rRNA are quite extensive, while the interactions with the 3′ minor domain are significantly more limited. In this study directed hydroxyl radical probing mediated by Fe(II)-derivatized S20 proteins was used to monitor the folding of 16S rRNA during r-protein association and 30S subunit assembly. An analysis of the cleavage patterns in the minimal complexes [16S rRNA and Fe(II)-S20] and the fully assembled 30S subunit containing the same Fe(II)-derivatized proteins shows intriguing similarities and differences. These results suggest that the two domains, the 5′ and 3′ minor, are organized relative to S20 at different stages of assembly. The 5′ domain acquires, in a less complex ribonucleoprotein particle (RNP) than the 3′ minor domain, the same architecture as observed in mature subunits. These results are similar to what would be predicted of subunit assembly by the 5′ to 3′ direction assembly model. PMID:18155048

  5. Interconversion of active and inactive 30 S ribosomal subunits is accompanied by a conformational change in the decoding region of 16 S rRNA.

    PubMed

    Moazed, D; Van Stolk, B J; Douthwaite, S; Noller, H F

    1986-10-01

    Zamir, Elson and their co-workers have shown that 30 S ribosomal subunits are reversibly inactivated by depletion of monovalent or divalent cations. We have re-investigated the conformation of 16 S rRNA in the active and inactive forms of the 30 S subunit, using a strategy that is designed to eliminate reversible ion-dependent conformational effects that are unrelated to the heat-dependent Zamir-Elson transition. A combination of structure-specific chemical probes enables us to monitor the accessibility of pyrimidines at N-3 and purines at N-1 and N-7. Chemically modified bases are identified by end-labeling followed by analine-induced strand scission (in some cases preceded by hybrid selection), or by primer extension using synthetic DNA oligomers. These studies show the following: The transition from the active to the inactive state cannot be described as a simple loosening or unfolding of native structure, such as that which is observed under conditions of more severe ion depletion. Instead, it has the appearance of a reciprocal interconversion between two differently structured states; some bases become more reactive toward the probes, whilst others become less reactive as a result of inactivation. Changes in reactivity are almost exclusively confined to the "decoding site" centered at positions 1400 and 1500, but significant differences are also detected at U723 and G791 in the central domain. This may reflect possible structural and functional interactions between the central and 3' regions of 16 S rRNA. The inactive form also shows significantly decreased reactivity at positions 1533 to 1538 (the Shine-Dalgarno region), in agreement with earlier findings. The principal changes in reactivity involve the universally conserved nucleotides G926, C1395, A1398 and G1401. The three purines show reciprocal behavior at their N-1 versus N-7 positions. G926 loses its reactivity at N-1, but becomes highly reactive at N-7 as a result of the transition of the inactive

  6. Diverse roles of assembly factors revealed by structures of late nuclear pre-60S ribosomes.

    PubMed

    Wu, Shan; Tutuncuoglu, Beril; Yan, Kaige; Brown, Hailey; Zhang, Yixiao; Tan, Dan; Gamalinda, Michael; Yuan, Yi; Li, Zhifei; Jakovljevic, Jelena; Ma, Chengying; Lei, Jianlin; Dong, Meng-Qiu; Woolford, John L; Gao, Ning

    2016-06-01

    Ribosome biogenesis is a highly complex process in eukaryotes, involving temporally and spatially regulated ribosomal protein (r-protein) binding and ribosomal RNA remodelling events in the nucleolus, nucleoplasm and cytoplasm. Hundreds of assembly factors, organized into sequential functional groups, facilitate and guide the maturation process into productive assembly branches in and across different cellular compartments. However, the precise mechanisms by which these assembly factors function are largely unknown. Here we use cryo-electron microscopy to characterize the structures of yeast nucleoplasmic pre-60S particles affinity-purified using the epitope-tagged assembly factor Nog2. Our data pinpoint the locations and determine the structures of over 20 assembly factors, which are enriched in two areas: an arc region extending from the central protuberance to the polypeptide tunnel exit, and the domain including the internal transcribed spacer 2 (ITS2) that separates 5.8S and 25S ribosomal RNAs. In particular, two regulatory GTPases, Nog2 and Nog1, act as hub proteins to interact with multiple, distant assembly factors and functional ribosomal RNA elements, manifesting their critical roles in structural remodelling checkpoints and nuclear export. Moreover, our snapshots of compositionally and structurally different pre-60S intermediates provide essential mechanistic details for three major remodelling events before nuclear export: rotation of the 5S ribonucleoprotein, construction of the active centre and ITS2 removal. The rich structural information in our structures provides a framework to dissect molecular roles of diverse assembly factors in eukaryotic ribosome assembly. PMID:27251291

  7. Sequential domain assembly of ribosomal protein S3 drives 40S subunit maturation

    PubMed Central

    Mitterer, Valentin; Murat, Guillaume; Réty, Stéphane; Blaud, Magali; Delbos, Lila; Stanborough, Tamsyn; Bergler, Helmut; Leulliot, Nicolas; Kressler, Dieter; Pertschy, Brigitte

    2016-01-01

    Eukaryotic ribosomes assemble by association of ribosomal RNA with ribosomal proteins into nuclear precursor particles, which undergo a complex maturation pathway coordinated by non-ribosomal assembly factors. Here, we provide functional insights into how successive structural re-arrangements in ribosomal protein S3 promote maturation of the 40S ribosomal subunit. We show that S3 dimerizes and is imported into the nucleus with its N-domain in a rotated conformation and associated with the chaperone Yar1. Initial assembly of S3 with 40S precursors occurs via its C-domain, while the N-domain protrudes from the 40S surface. Yar1 is replaced by the assembly factor Ltv1, thereby fixing the S3 N-domain in the rotated orientation and preventing its 40S association. Finally, Ltv1 release, triggered by phosphorylation, and flipping of the S3 N-domain into its final position results in the stable integration of S3. Such a stepwise assembly may represent a new paradigm for the incorporation of ribosomal proteins. PMID:26831757

  8. Probing the structure of ribosome assembly intermediates in vivo using DMS and hydroxyl radical footprinting.

    PubMed

    Hulscher, Ryan M; Bohon, Jen; Rappé, Mollie C; Gupta, Sayan; D'Mello, Rhijuta; Sullivan, Michael; Ralston, Corie Y; Chance, Mark R; Woodson, Sarah A

    2016-07-01

    The assembly of the Escherichia coli ribosome has been widely studied and characterized in vitro. Despite this, ribosome biogenesis in living cells is only partly understood because assembly is coupled with transcription, modification and processing of the pre-ribosomal RNA. We present a method for footprinting and isolating pre-rRNA as it is synthesized in E. coli cells. Pre-rRNA synthesis is synchronized by starvation, followed by nutrient upshift. RNA synthesized during outgrowth is metabolically labeled to facilitate isolation of recent transcripts. Combining this technique with two in vivo RNA probing methods, hydroxyl radical and DMS footprinting, allows the structure of nascent RNA to be probed over time. Together, these can be used to determine changes in the structures of ribosome assembly intermediates as they fold in vivo. PMID:27016143

  9. Three distinct ribosome assemblies modulated by translation are the building blocks of polysomes.

    PubMed

    Viero, Gabriella; Lunelli, Lorenzo; Passerini, Andrea; Bianchini, Paolo; Gilbert, Robert J; Bernabò, Paola; Tebaldi, Toma; Diaspro, Alberto; Pederzolli, Cecilia; Quattrone, Alessandro

    2015-03-01

    Translation is increasingly recognized as a central control layer of gene expression in eukaryotic cells. The overall organization of mRNA and ribosomes within polysomes, as well as the possible role of this organization in translation are poorly understood. Here we show that polysomes are primarily formed by three distinct classes of ribosome assemblies. We observe that these assemblies can be connected by naked RNA regions of the transcript. We show that the relative proportions of the three classes of ribosome assemblies reflect, and probably dictate, the level of translational activity. These results reveal the existence of recurrent supra-ribosomal building blocks forming polysomes and suggest the presence of unexplored translational controls embedded in the polysome structure. PMID:25713412

  10. Three distinct ribosome assemblies modulated by translation are the building blocks of polysomes

    PubMed Central

    Lunelli, Lorenzo; Passerini, Andrea; Bianchini, Paolo; Gilbert, Robert J.; Bernabò, Paola; Tebaldi, Toma; Diaspro, Alberto; Pederzolli, Cecilia

    2015-01-01

    Translation is increasingly recognized as a central control layer of gene expression in eukaryotic cells. The overall organization of mRNA and ribosomes within polysomes, as well as the possible role of this organization in translation are poorly understood. Here we show that polysomes are primarily formed by three distinct classes of ribosome assemblies. We observe that these assemblies can be connected by naked RNA regions of the transcript. We show that the relative proportions of the three classes of ribosome assemblies reflect, and probably dictate, the level of translational activity. These results reveal the existence of recurrent supra-ribosomal building blocks forming polysomes and suggest the presence of unexplored translational controls embedded in the polysome structure. PMID:25713412

  11. Disruption of ribosome assembly in yeast blocks cotranscriptional pre-rRNA processing and affects the global hierarchy of ribosome biogenesis.

    PubMed

    Talkish, Jason; Biedka, Stephanie; Jakovljevic, Jelena; Zhang, Jingyu; Tang, Lan; Strahler, John R; Andrews, Philip C; Maddock, Janine R; Woolford, John L

    2016-06-01

    In higher eukaryotes, pre-rRNA processing occurs almost exclusively post-transcriptionally. This is not the case in rapidly dividing yeast, as the majority of nascent pre-rRNAs are processed cotranscriptionally, with cleavage at the A2 site first releasing a pre-40S ribosomal subunit followed by release of a pre-60S ribosomal subunit upon transcription termination. Ribosome assembly is driven in part by hierarchical association of assembly factors and r-proteins. Groups of proteins are thought to associate with pre-ribosomes cotranscriptionally during early assembly steps, whereas others associate later, after transcription is completed. Here we describe a previously uncharacterized phenotype observed upon disruption of ribosome assembly, in which normally late-binding proteins associate earlier, with pre-ribosomes containing 35S pre-rRNA. As previously observed by many other groups, we show that disruption of 60S subunit biogenesis results in increased amounts of 35S pre-rRNA, suggesting that a greater fraction of pre-rRNAs are processed post-transcriptionally. Surprisingly, we found that early pre-ribosomes containing 35S pre-rRNA also contain proteins previously thought to only associate with pre-ribosomes after early pre-rRNA processing steps have separated maturation of the two subunits. We believe the shift to post-transcriptional processing is ultimately due to decreased cellular division upon disruption of ribosome assembly. When cells are grown under stress or to high density, a greater fraction of pre-rRNAs are processed post-transcriptionally and follow an alternative processing pathway. Together, these results affirm the principle that ribosome assembly occurs through different, parallel assembly pathways and suggest that there is a kinetic foot-race between the formation of protein binding sites and pre-rRNA processing events. PMID:27036125

  12. The extended loops of ribosomal proteins uL4 and uL22 of Escherichia coli contribute to ribosome assembly and protein translation.

    PubMed

    Lawrence, Marlon G; Shamsuzzaman, Md; Kondopaka, Maithri; Pascual, Clarence; Zengel, Janice M; Lindahl, Lasse

    2016-07-01

    Nearly half of ribosomal proteins are composed of a domain on the ribosome surface and a loop or extension that penetrates into the organelle's RNA core. Our previous work showed that ribosomes lacking the loops of ribosomal proteins uL4 or uL22 are still capable of entering polysomes. However, in those experiments we could not address the formation of mutant ribosomes, because we used strains that also expressed wild-type uL4 and uL22. Here, we have focused on ribosome assembly and function in strains in which loop deletion mutant genes are the ONLY: sources of uL4 or uL22 protein. The uL4 and uL22 loop deletions have different effects, but both mutations result in accumulation of immature particles that do not accumulate in detectable amounts in wild-type strains. Thus, our results suggest that deleting the loops creates kinetic barriers in the normal assembly pathway, possibly resulting in assembly via alternate pathway(s). Furthermore, deletion of the uL4 loop results in cold-sensitive ribosome assembly and function. Finally, ribosomes carrying either of the loop-deleted proteins responded normally to the secM translation pausing peptide, but the uL4 mutant responded very inefficiently to the cmlA(crb) pause peptide. PMID:27257065

  13. The extended loops of ribosomal proteins uL4 and uL22 of Escherichia coli contribute to ribosome assembly and protein translation

    PubMed Central

    Lawrence, Marlon G.; Shamsuzzaman, Md; Kondopaka, Maithri; Pascual, Clarence; Zengel, Janice M.; Lindahl, Lasse

    2016-01-01

    Nearly half of ribosomal proteins are composed of a domain on the ribosome surface and a loop or extension that penetrates into the organelle's RNA core. Our previous work showed that ribosomes lacking the loops of ribosomal proteins uL4 or uL22 are still capable of entering polysomes. However, in those experiments we could not address the formation of mutant ribosomes, because we used strains that also expressed wild-type uL4 and uL22. Here, we have focused on ribosome assembly and function in strains in which loop deletion mutant genes are the only sources of uL4 or uL22 protein. The uL4 and uL22 loop deletions have different effects, but both mutations result in accumulation of immature particles that do not accumulate in detectable amounts in wild-type strains. Thus, our results suggest that deleting the loops creates kinetic barriers in the normal assembly pathway, possibly resulting in assembly via alternate pathway(s). Furthermore, deletion of the uL4 loop results in cold-sensitive ribosome assembly and function. Finally, ribosomes carrying either of the loop-deleted proteins responded normally to the secM translation pausing peptide, but the uL4 mutant responded very inefficiently to the cmlAcrb pause peptide. PMID:27257065

  14. Studies on the Coordination of Ribosomal Protein Assembly Events Involved in Processing and Stabilization of Yeast Early Large Ribosomal Subunit Precursors.

    PubMed

    Ohmayer, Uli; Gil-Hernández, Álvaro; Sauert, Martina; Martín-Marcos, Pilar; Tamame, Mercedes; Tschochner, Herbert; Griesenbeck, Joachim; Milkereit, Philipp

    2015-01-01

    Cellular production of ribosomes involves the formation of highly defined interactions between ribosomal proteins (r-proteins) and ribosomal RNAs (rRNAs). Moreover in eukaryotic cells, efficient ribosome maturation requires the transient association of a large number of ribosome biogenesis factors (RBFs) with newly forming ribosomal subunits. Here, we investigated how r-protein assembly events in the large ribosomal subunit (LSU) rRNA domain II are coordinated with each other and with the association of RBFs in early LSU precursors of the yeast Saccharomyces cerevisiae. Specific effects on the pre-ribosomal association of RBFs could be observed in yeast mutants blocked in LSU rRNA domain II assembly. Moreover, formation of a cluster of r-proteins was identified as a downstream event in LSU rRNA domain II assembly. We analyzed in more detail the functional relevance of eukaryote specific bridges established by this r-protein cluster between LSU rRNA domain II and VI and discuss how they can support the stabilization and efficient processing of yeast early LSU precursor RNAs. PMID:26642313

  15. Studies on the Coordination of Ribosomal Protein Assembly Events Involved in Processing and Stabilization of Yeast Early Large Ribosomal Subunit Precursors

    PubMed Central

    Sauert, Martina; Martín-Marcos, Pilar; Tamame, Mercedes; Tschochner, Herbert; Griesenbeck, Joachim; Milkereit, Philipp

    2015-01-01

    Cellular production of ribosomes involves the formation of highly defined interactions between ribosomal proteins (r-proteins) and ribosomal RNAs (rRNAs). Moreover in eukaryotic cells, efficient ribosome maturation requires the transient association of a large number of ribosome biogenesis factors (RBFs) with newly forming ribosomal subunits. Here, we investigated how r-protein assembly events in the large ribosomal subunit (LSU) rRNA domain II are coordinated with each other and with the association of RBFs in early LSU precursors of the yeast Saccharomyces cerevisiae. Specific effects on the pre-ribosomal association of RBFs could be observed in yeast mutants blocked in LSU rRNA domain II assembly. Moreover, formation of a cluster of r-proteins was identified as a downstream event in LSU rRNA domain II assembly. We analyzed in more detail the functional relevance of eukaryote specific bridges established by this r-protein cluster between LSU rRNA domain II and VI and discuss how they can support the stabilization and efficient processing of yeast early LSU precursor RNAs. PMID:26642313

  16. The N-terminal extension of Escherichia coli ribosomal protein L20 is important for ribosome assembly, but dispensable for translational feedback control

    PubMed Central

    GUILLIER, MAUDE; ALLEMAND, FRÉDÉRIC; GRAFFE, MONIQUE; RAIBAUD, SOPHIE; DARDEL, FRÉDÉRIC; SPRINGER, MATHIAS; CHIARUTTINI, CLAUDE

    2005-01-01

    The Escherichia coli autoregulatory ribosomal protein L20 consists of two structurally distinct domains. The C-terminal domain is globular and sits on the surface of the large ribosomal subunit whereas the N-terminal domain has an extended shape and penetrates deep into the RNA-rich core of the subunit. Many other ribosomal proteins have analogous internal or terminal extensions. However, the biological functions of these extended domains remain obscure. Here we show that the N-terminal tail of L20 is important for ribosome assembly in vivo. Indeed, a truncated version of L20 without its N-terminal tail is unable to complement the deletion of rplT, the gene encoding L20. In addition, this L20 truncation confers a lethal-dominant phenotype, suggesting that the N-terminal domain is essential for cell growth because it could be required for ribosome assembly. Supporting this hypothesis, partial deletions of the N-terminal tail of the protein are shown to cause a slow-growth phenotype due to altered ribosome assembly in vivo as large amounts of intermediate 40S ribosomal particles accumulate. In addition to being a ribosomal protein, L20 also acts as an autogenous repressor. Using L20 truncations, we also show that the N-terminal tail of L20 is dispensable for autogenous control. PMID:15840820

  17. Stage-specific assembly events of the 6-MDa small-subunit processome initiate eukaryotic ribosome biogenesis.

    PubMed

    Chaker-Margot, Malik; Hunziker, Mirjam; Barandun, Jonas; Dill, Brian D; Klinge, Sebastian

    2015-11-01

    Eukaryotic ribosome biogenesis involves a plethora of ribosome-assembly factors, and their temporal order of association with preribosomal RNA is largely unknown. By using Saccharomyces cerevisiae as a model organism, we developed a system that recapitulates and arrests ribosome assembly at early stages, thus providing in vivo snapshots of nascent preribosomal particles. Here we report the stage-specific order in which 70 ribosome-assembly factors associate with preribosomal RNA domains, thereby forming the 6-MDa small-subunit processome. PMID:26479197

  18. YsxC, an essential protein in Staphylococcus aureus crucial for ribosome assembly/stability

    PubMed Central

    2009-01-01

    Background Bacterial growth and division requires a core set of essential proteins, several of which are still of unknown function. They are also attractive targets for the development of new antibiotics. YsxC is a member of a family of GTPases highly conserved across eubacteria with a possible ribosome associated function. Results Here, we demonstrate by the creation of a conditional lethal mutant that ysxC is apparently essential for growth in S. aureus. To begin to elucidate YsxC function, a translational fusion of YsxC to the CBP-ProteinA tag in the staphylococcal chromosome was made, enabling Tandem Affinity Purification (TAP) of YsxC-interacting partners. These included the ribosomal proteins S2, S10 and L17, as well as the β' subunit of the RNA polymerase. YsxC was then shown to copurify with ribosomes as an accessory protein specifically localizing to the 50 S subunit. YsxC depletion led to a decrease in the presence of mature ribosomes, indicating a role in ribosome assembly and/or stability in S. aureus. Conclusions In this study we demonstrate that YsxC of S. aureus localizes to the ribosomes, is crucial for ribosomal stability and is apparently essential for the life of S. aureus. PMID:20021644

  19. The N-terminal extension of yeast ribosomal protein L8 is involved in two major remodeling events during late nuclear stages of 60S ribosomal subunit assembly.

    PubMed

    Tutuncuoglu, Beril; Jakovljevic, Jelena; Wu, Shan; Gao, Ning; Woolford, John L

    2016-09-01

    Assaying effects on pre-rRNA processing and ribosome assembly upon depleting individual ribosomal proteins (r-proteins) provided an initial paradigm for assembly of eukaryotic ribosomes in vivo-that each structural domain of ribosomal subunits assembles in a hierarchical fashion. However, two features suggest that a more complex pathway may exist: (i) Some r-proteins contain extensions that reach long distances across ribosomes to interact with multiple rRNA domains as well as with other r-proteins. (ii) Individual r-proteins may assemble in a stepwise fashion. For example, the globular domain of an r-protein might assemble separately from its extensions. Thus, these extensions might play roles in assembly that could not be revealed by depleting the entire protein. Here, we show that deleting or mutating extensions of r-proteins L7 (uL30) and L35 (uL29) from yeast reveal important roles in early and middle steps during 60S ribosomal subunit biogenesis. Detailed analysis of the N-terminal terminal extension of L8 (eL8) showed that it is necessary for late nuclear stages of 60S subunit assembly involving two major remodeling events: removal of the ITS2 spacer; and reorganization of the central protuberance (CP) containing 5S rRNA and r-proteins L5 (uL18) and L11 (uL5). Mutations in the L8 extension block processing of 7S pre-rRNA, prevent release of assembly factors Rpf2 and Rrs1 from pre-ribosomes, which is required for rotation of the CP, and block association of Sda1, the Rix1 complex, and the Rea1 ATPase involved in late steps of remodeling. PMID:27390266

  20. MPV17L2 is required for ribosome assembly in mitochondria

    PubMed Central

    Dalla Rosa, Ilaria; Durigon, Romina; Pearce, Sarah F.; Rorbach, Joanna; Hirst, Elizabeth M.A.; Vidoni, Sara; Reyes, Aurelio; Brea-Calvo, Gloria; Minczuk, Michal; Woellhaf, Michael W.; Herrmann, Johannes M.; Huynen, Martijn A.; Holt, Ian J.; Spinazzola, Antonella

    2014-01-01

    MPV17 is a mitochondrial protein of unknown function, and mutations in MPV17 are associated with mitochondrial deoxyribonucleic acid (DNA) maintenance disorders. Here we investigated its most similar relative, MPV17L2, which is also annotated as a mitochondrial protein. Mitochondrial fractionation analyses demonstrate MPV17L2 is an integral inner membrane protein, like MPV17. However, unlike MPV17, MPV17L2 is dependent on mitochondrial DNA, as it is absent from ρ0 cells, and co-sediments on sucrose gradients with the large subunit of the mitochondrial ribosome and the monosome. Gene silencing of MPV17L2 results in marked decreases in the monosome and both subunits of the mitochondrial ribosome, leading to impaired protein synthesis in the mitochondria. Depletion of MPV17L2 also induces mitochondrial DNA aggregation. The DNA and ribosome phenotypes are linked, as in the absence of MPV17L2 proteins of the small subunit of the mitochondrial ribosome are trapped in the enlarged nucleoids, in contrast to a component of the large subunit. These findings suggest MPV17L2 contributes to the biogenesis of the mitochondrial ribosome, uniting the two subunits to create the translationally competent monosome, and provide evidence that assembly of the small subunit of the mitochondrial ribosome occurs at the nucleoid. PMID:24948607

  1. Stepwise and dynamic assembly of the earliest precursors of small ribosomal subunits in yeast.

    PubMed

    Zhang, Liman; Wu, Chen; Cai, Gaihong; Chen, She; Ye, Keqiong

    2016-03-15

    The eukaryotic ribosomal RNA (rRNA) is associated cotranscriptionally with numerous factors into an enormous 90S preribosomal particle that conducts early processing of small ribosomal subunits. The assembly pathway and structure of the 90S particle is poorly understood. Here, we affinity-purified and analyzed the constituents of yeast 90S particles that were assembled on a series of plasmid-encoded 3'-truncated pre-18S RNAs. We determined the assembly point of 65 proteins and the U3, U14, and snR30 small nucleolar RNAs (snoRNAs), revealing a stepwise and dynamic assembly map. The 5' external transcribed spacer (ETS) alone can nucleate a large complex. When the 18S rRNA is nearly complete, the 90S structure undergoes a dramatic reorganization, releasing U14, snR30, and 14 protein factors that bind earlier. We also identified a reference state of 90S that is fully assembled yet has not undergone 5'ETS processing. The assembly map present here provides a new framework to understand small subunit biogenesis. PMID:26980190

  2. Studies on the kinetic sequence of in vitro ribosome assembly using cibacron blue F3GA as a general assembly inhibitor.

    PubMed Central

    Datta, D; Changchien, L M; Craven, G R

    1986-01-01

    We have found that all E. coli ribosomal proteins strongly bind to an agarose affinity column derivatized with the dye Cibacron Blue F3GA. We have also shown that the capacity to bind the dye is lost when the proteins are organized within the structure of the ribosome or are members of pre-formed protein-RNA complexes. We conclude that the binding of ribosomal proteins to this dye involves specific protein-RNA recognition sites. These observations led us to discover that Cibacron Blue can be used to inhibit in vitro ribosome assembly at any stage of the assembly process. This has allowed us to determine a kinetic order of ribosome assembly. Images PMID:3520481

  3. UtpA and UtpB chaperone nascent pre-ribosomal RNA and U3 snoRNA to initiate eukaryotic ribosome assembly

    PubMed Central

    Hunziker, Mirjam; Barandun, Jonas; Petfalski, Elisabeth; Tan, Dongyan; Delan-Forino, Clémentine; Molloy, Kelly R.; Kim, Kelly H.; Dunn-Davies, Hywel; Shi, Yi; Chaker-Margot, Malik; Chait, Brian T.; Walz, Thomas; Tollervey, David; Klinge, Sebastian

    2016-01-01

    Early eukaryotic ribosome biogenesis involves large multi-protein complexes, which co-transcriptionally associate with pre-ribosomal RNA to form the small subunit processome. The precise mechanisms by which two of the largest multi-protein complexes—UtpA and UtpB—interact with nascent pre-ribosomal RNA are poorly understood. Here, we combined biochemical and structural biology approaches with ensembles of RNA–protein cross-linking data to elucidate the essential functions of both complexes. We show that UtpA contains a large composite RNA-binding site and captures the 5′ end of pre-ribosomal RNA. UtpB forms an extended structure that binds early pre-ribosomal intermediates in close proximity to architectural sites such as an RNA duplex formed by the 5′ ETS and U3 snoRNA as well as the 3′ boundary of the 18S rRNA. Both complexes therefore act as vital RNA chaperones to initiate eukaryotic ribosome assembly. PMID:27354316

  4. UtpA and UtpB chaperone nascent pre-ribosomal RNA and U3 snoRNA to initiate eukaryotic ribosome assembly

    NASA Astrophysics Data System (ADS)

    Hunziker, Mirjam; Barandun, Jonas; Petfalski, Elisabeth; Tan, Dongyan; Delan-Forino, Clémentine; Molloy, Kelly R.; Kim, Kelly H.; Dunn-Davies, Hywel; Shi, Yi; Chaker-Margot, Malik; Chait, Brian T.; Walz, Thomas; Tollervey, David; Klinge, Sebastian

    2016-06-01

    Early eukaryotic ribosome biogenesis involves large multi-protein complexes, which co-transcriptionally associate with pre-ribosomal RNA to form the small subunit processome. The precise mechanisms by which two of the largest multi-protein complexes--UtpA and UtpB--interact with nascent pre-ribosomal RNA are poorly understood. Here, we combined biochemical and structural biology approaches with ensembles of RNA-protein cross-linking data to elucidate the essential functions of both complexes. We show that UtpA contains a large composite RNA-binding site and captures the 5' end of pre-ribosomal RNA. UtpB forms an extended structure that binds early pre-ribosomal intermediates in close proximity to architectural sites such as an RNA duplex formed by the 5' ETS and U3 snoRNA as well as the 3' boundary of the 18S rRNA. Both complexes therefore act as vital RNA chaperones to initiate eukaryotic ribosome assembly.

  5. Protein L5 is crucial for in vivo assembly of the bacterial 50S ribosomal subunit central protuberance

    PubMed Central

    Korepanov, Alexey P.; Korobeinikova, Anna V.; Shestakov, Sergey A.; Garber, Maria B.; Gongadze, George M.

    2012-01-01

    In the present work, ribosomes assembled in bacterial cells in the absence of essential ribosomal protein L5 were obtained. After arresting L5 synthesis, Escherichia coli cells divide a limited number of times. During this time, accumulation of defective large ribosomal subunits occurs. These 45S particles lack most of the central protuberance (CP) components (5S rRNA and proteins L5, L16, L18, L25, L27, L31, L33 and L35) and are not able to associate with the small ribosomal subunit. At the same time, 5S rRNA is found in the cytoplasm in complex with ribosomal proteins L18 and L25 at quantities equal to the amount of ribosomes. Thus, it is the first demonstration that protein L5 plays a key role in formation of the CP during assembly of the large ribosomal subunit in the bacterial cell. A possible model for the CP assembly in vivo is discussed in view of the data obtained. PMID:22821559

  6. Cyclization of polyketides and non-ribosomal peptides on and off their assembly lines.

    PubMed

    Pang, Bo; Wang, Min; Liu, Wen

    2016-02-01

    Modular polyketide synthases (PKSs) and non-ribosomal peptide synthetases (NRPSs) are multifunctional megaenzymes that serve as templates to program the assembly of short carboxylic acids and amino acids in a primarily co-linear manner. The variation, combination, permutation and evolution of their functional units (e.g., modules, domains and proteins) along with their association with external enzymes have resulted in the generation of numerous versions of templates, the roles of which have not been fully recognized in the structural diversification of polyketides, non-ribosomal peptides and their hybrids present in nature. In this Highlight, we focus on the assembly-line enzymology and associated chemistry by providing examples of some newly characterized cyclization reactions that occur on and off the assembly lines during and after chain elongation for the purpose of elucidating the template effects of PKSs and NRPSs. A fundamental understanding of the underlying biosynthetic logic would facilitate the elucidation of chemical information contained within the PKS or NRPS templates and benefit the development of strategies for genome mining, biosynthesis-inspired chemical synthesis and combinatorial biosynthesis. PMID:26604034

  7. Hrr25/CK1δ-directed release of Ltv1 from pre-40S ribosomes is necessary for ribosome assembly and cell growth

    PubMed Central

    Ghalei, Homa; Schaub, Franz X.; Doherty, Joanne R.; Noguchi, Yoshihiko; Roush, William R.; Cleveland, John L.; Stroupe, M. Elizabeth

    2015-01-01

    Casein kinase 1δ/ε (CK1δ/ε) and their yeast homologue Hrr25 are essential for cell growth. Further, CK1δ is overexpressed in several malignancies, and CK1δ inhibitors have shown promise in several preclinical animal studies. However, the substrates of Hrr25 and CK1δ/ε that are necessary for cell growth and survival are unknown. We show that Hrr25 is essential for ribosome assembly, where it phosphorylates the assembly factor Ltv1, which causes its release from nascent 40S subunits and allows subunit maturation. Hrr25 inactivation or expression of a nonphosphorylatable Ltv1 variant blocked Ltv1 release in vitro and in vivo, and prevented entry into the translation-like quality control cycle. Conversely, phosphomimetic Ltv1 variants rescued viability after Hrr25 depletion. Finally, Ltv1 knockdown in human breast cancer cells impaired apoptosis induced by CK1δ/ε inhibitors, establishing that the antiproliferative activity of these inhibitors is due, at least in part, to disruption of ribosome assembly. These findings validate the ribosome assembly pathway as a novel target for the development of anticancer therapeutics. PMID:25778921

  8. Functional Role of Ribosomal Signatures

    PubMed Central

    Chen, Ke; Eargle, John; Sarkar, Krishnarjun; Gruebele, Martin; Luthey-Schulten, Zaida

    2010-01-01

    Although structure and sequence signatures in ribosomal RNA and proteins are defining characteristics of the three domains of life and instrumental in constructing the modern phylogeny, little is known about their functional roles in the ribosome. In this work, the largest coevolving RNA/protein signatures in the bacterial 30S ribosome are investigated both experimentally and computationally through all-atom molecular-dynamics simulations. The complex includes the N-terminal fragment of the ribosomal protein S4, which is a primary binding protein that initiates 30S small subunit assembly from the 5′ domain, and helix 16 (h16), which is part of the five-way junction in 16S rRNA. Our results show that the S4 N-terminus signature is intrinsically disordered in solution, whereas h16 is relatively stable by itself. The dynamic disordered property of the protein is exploited to couple the folding and binding process to the five-way junction, and the results provide insight into the mechanism for the early and fast binding of S4 in the assembly of the ribosomal small subunit. PMID:21156135

  9. Integrative structural analysis of the UTPB complex, an early assembly factor for eukaryotic small ribosomal subunits

    PubMed Central

    Zhang, Cheng; Sun, Qi; Chen, Rongchang; Chen, Xining; Lin, Jinzhong; Ye, Keqiong

    2016-01-01

    Ribosome assembly is an essential and conserved cellular process in eukaryotes that requires numerous assembly factors. The six-subunit UTPB complex is an essential component of the 90S precursor of the small ribosomal subunit. Here, we analyzed the molecular architecture of UTPB using an integrative structural biology approach. We mapped the major interactions that associate each of six UTPB proteins. Crystallographic studies showed that Utp1, Utp21, Utp12 and Utp13 are evolutionarily related and form a dimer of dimers (Utp1–Utp21, Utp12–Utp13) through their homologous helical C-terminal domains. Molecular docking with crosslinking restraints showed that the WD domains of Utp12 and Utp13 are associated, as are the WD domains of Utp1, Utp21 and Utp18. Electron microscopy images of the entire UTPB complex revealed that it predominantly adopts elongated conformations and possesses internal flexibility. We also determined crystal structures of the WD domain of Utp18 and the HAT and deviant HAT domains of Utp6. A structural model of UTPB was derived based on these data. PMID:27330138

  10. Inferring the Ancient History of the Translation Machinery and Genetic Code via Recapitulation of Ribosomal Subunit Assembly Orders

    PubMed Central

    Fournier, Gregory P.; Neumann, Justin E.; Gogarten, J. Peter

    2010-01-01

    Universally conserved positions in ribosomal proteins have significant biases in amino acid usage, likely indicating the expansion of the genetic code at the time leading up to the most recent common ancestor(s) (MRCA). Here, we apply this principle to the evolutionary history of the ribosome before the MRCA. It has been proposed that the experimentally determined order of assembly for ribosomal subunits recapitulates their evolutionary chronology. Given this model, we produce a probabilistic evolutionary ordering of the universally conserved small subunit (SSU) and large subunit (LSU) ribosomal proteins. Optimizing the relative ordering of SSU and LSU evolutionary chronologies with respect to minimizing differences in amino acid usage bias, we find strong compositional evidence for a more ancient origin for early LSU proteins. Furthermore, we find that this ordering produces several trends in specific amino acid usages compatible with models of genetic code evolution. PMID:20208990

  11. A unique combination of rare mitochondrial ribosomal RNA variants affects the kinetics of complex I assembly.

    PubMed

    Porcelli, Anna Maria; Calvaruso, Maria Antonietta; Iommarini, Luisa; Kurelac, Ivana; Zuntini, Roberta; Ferrari, Simona; Gasparre, Giuseppe

    2016-06-01

    Mitochondrial DNA (mtDNA) mutations in respiratory complexes subunits contribute to a large spectrum of human diseases. Nonetheless, ribosomal RNA variants remain largely under-investigated from a functional point of view. We here report a unique combination of two rare mitochondrial rRNA variants detected by serendipity in a subject with chronic granulomatous disease and never reported to co-occur within the same mitochondrial haplotype. In silico prediction of the mitochondrial ribosomal structure showed a dramatic rearrangement of the rRNA secondary structure. Functional investigation of cybrids carrying this unique haplotype demonstrated that the co-occurrence of the two rRNA variants determines a slow-down of the mitochondrial protein synthesis, especially in cells with an elevated metabolic rate, which impairs the assembly kinetics of Complex I, induces a bioenergetic defect and stimulates reactive oxygen species production. In conclusion, our results point to a sub-pathogenic role for these two rare mitochondrial rRNA variants, when found in the unique combination here reported in a single individual. PMID:27102412

  12. Ribosomal proteins: functions beyond the ribosome

    PubMed Central

    Zhou, Xiang; Liao, Wen-Juan; Liao, Jun-Ming; Liao, Peng; Lu, Hua

    2015-01-01

    Although ribosomal proteins are known for playing an essential role in ribosome assembly and protein translation, their ribosome-independent functions have also been greatly appreciated. Over the past decade, more than a dozen of ribosomal proteins have been found to activate the tumor suppressor p53 pathway in response to ribosomal stress. In addition, these ribosomal proteins are involved in various physiological and pathological processes. This review is composed to overview the current understanding of how ribosomal stress provokes the accumulation of ribosome-free ribosomal proteins, as well as the ribosome-independent functions of ribosomal proteins in tumorigenesis, immune signaling, and development. We also propose the potential of applying these pieces of knowledge to the development of ribosomal stress-based cancer therapeutics. PMID:25735597

  13. Structural insights into the function of a unique tandem GTPase EngA in bacterial ribosome assembly

    PubMed Central

    Zhang, Xiaoxiao; Yan, Kaige; Zhang, Yixiao; Li, Ningning; Ma, Chengying; Li, Zhifei; Zhang, Yanqing; Feng, Boya; Liu, Jing; Sun, Yadong; Xu, Yanji; Lei, Jianlin; Gao, Ning

    2014-01-01

    Many ribosome-interacting GTPases, with proposed functions in ribosome biogenesis, are also implicated in the cellular regulatory coupling between ribosome assembly process and various growth control pathways. EngA is an essential GTPase in bacteria, and intriguingly, it contains two consecutive GTPase domains (GD), being one-of-a-kind among all known GTPases. EngA is required for the 50S subunit maturation. However, its molecular role remains elusive. Here, we present the structure of EngA bound to the 50S subunit. Our data show that EngA binds to the peptidyl transferase center (PTC) and induces dramatic conformational changes on the 50S subunit, which virtually returns the 50S subunit to a state similar to that of the late-stage 50S assembly intermediates. Very interestingly, our data show that the two GDs exhibit a pseudo-two-fold symmetry in the 50S-bound conformation. Our results indicate that EngA recognizes certain forms of the 50S assembly intermediates, and likely facilitates the conformational maturation of the PTC of the 23S rRNA in a direct manner. Furthermore, in a broad context, our data also suggest that EngA might be a sensor of the cellular GTP/GDP ratio, endowed with multiple conformational states, in response to fluctuations in cellular nucleotide pool, to facilitate and regulate ribosome assembly. PMID:25389271

  14. Late-assembly of human ribosomal protein S20 in the cytoplasm is essential for the functioning of the small subunit ribosome

    SciTech Connect

    Tai, Lin-Ru; Chou, Chang-Wei; Wu, Jing-Ying; Kirby, Ralph; Lin, Alan

    2013-11-15

    Using immuno-fluorescent probing and Western blotting analysis, we reveal the exclusive cytoplasm nature of the small subunit ribosomal protein S20. To illustrate the importance of the cellular compartmentation of S20 to the function of small subunit 40S, we created a nuclear resident S20{sub NLS} mutant gene and examined polysome profile of cells that had been transfected with the S20{sub NLS} gene. As a result, we observed the formation of recombinant 40S carried S20{sub NLS} but this recombinant 40S was never found in the polysome, suggesting such a recombinant 40S was translation incompetent. Moreover, by the tactic of the energy depletion and restoration, we were able to restrain the nuclear-resided S20{sub NLS} in the cytoplasm. Yet, along a progressive energy restoration, we observed the presence of recombinant 40S subunits carrying the S20{sub NLS} in the polysome. This proves that S20 needs to be cytoplasmic in order to make a functional 40S subunit. Furthermore, it also implies that the assembly order of ribosomal protein in eukaryote is orderly regulated. - Highlights: • The step of S20 assembled on 40S is happened in the cytoplasm. • A small subunit assembled with a nuclear S20{sub NLS} is translational incompetence. • Using energy depletion and recovery to manipulate the cellular compartment of S20{sub NLS}. • Cytoplasm-retained S20{sub NLS} is crucial for creating a functional small subunit.

  15. Histidine Methylation of Yeast Ribosomal Protein Rpl3p Is Required for Proper 60S Subunit Assembly

    PubMed Central

    Al-Hadid, Qais; Roy, Kevin; Munroe, William; Dzialo, Maria C.; Chanfreau, Guillaume F.

    2014-01-01

    Histidine protein methylation is an unusual posttranslational modification. In the yeast Saccharomyces cerevisiae, the large ribosomal subunit protein Rpl3p is methylated at histidine 243, a residue that contacts the 25S rRNA near the P site. Rpl3p methylation is dependent upon the presence of Hpm1p, a candidate seven-beta-strand methyltransferase. In this study, we elucidated the biological activities of Hpm1p in vitro and in vivo. Amino acid analyses reveal that Hpm1p is responsible for all of the detectable protein histidine methylation in yeast. The modification is found on a polypeptide corresponding to the size of Rpl3p in ribosomes and in a nucleus-containing organelle fraction but was not detected in proteins of the ribosome-free cytosol fraction. In vitro assays demonstrate that Hpm1p has methyltransferase activity on ribosome-associated but not free Rpl3p, suggesting that its activity depends on interactions with ribosomal components. hpm1 null cells are defective in early rRNA processing, resulting in a deficiency of 60S subunits and translation initiation defects that are exacerbated in minimal medium. Cells lacking Hpm1p are resistant to cycloheximide and verrucarin A and have decreased translational fidelity. We propose that Hpm1p plays a role in the orchestration of the early assembly of the large ribosomal subunit and in faithful protein production. PMID:24865971

  16. Time course of large ribosomal subunit assembly in E. coli cells overexpressing a helicase inactive DbpA protein.

    PubMed

    Gentry, Riley C; Childs, Jared J; Gevorkyan, Jirair; Gerasimova, Yulia V; Koculi, Eda

    2016-07-01

    DbpA is a DEAD-box RNA helicase implicated in Escherichia coli large ribosomal subunit assembly. Previous studies have shown that when the ATPase and helicase inactive DbpA construct, R331A, is expressed in E. coli cells, a large ribosomal subunit intermediate accumulates. The large subunit intermediate migrates as a 45S particle in a sucrose gradient. Here, using a number of structural and fluorescent assays, we investigate the ribosome profiles of cells lacking wild-type DbpA and overexpressing the R331A DbpA construct. Our data show that in addition to the 45S particle previously described, 27S and 35S particles are also present in the ribosome profiles of cells overexpressing R331A DbpA. The 27S, 35S, and 45S independently convert to the 50S subunit, suggesting that ribosome assembly in the presence of R331A and the absence of wild-type DbpA occurs via multiple pathways. PMID:27194011

  17. Cross-linking of initiation factor IF3 to Escherichia coli 30S ribosomal subunit by trans-diamminedichloroplatinum(II): characterization of two cross-linking sites in 16S rRNA; a possible way of functioning for IF3.

    PubMed Central

    Ehresmann, C; Moine, H; Mougel, M; Dondon, J; Grunberg-Manago, M; Ebel, J P; Ehresmann, B

    1986-01-01

    The initiation factor IF3 is platinated with trans-diamminedichloroplatinum(II) and cross-linked to Escherichia coli 30S ribosomal subunit. Two cross-linking sites are unambiguously identified on the 16S rRNA: a major one, in the region 819-859 in the central domain, and a minor one, in the region 1506-1529 in the 3'-terminal domain. Specific features of these sequences together with their particular location within the 30S subunit lead us to postulate a role for IF3, that conciliates topographical and functional observations made so far. Images PMID:2425339

  18. Nucleotide excision repair of the 5 S ribosomal RNA gene assembled into a nucleosome.

    PubMed

    Liu, X; Smerdon, M J

    2000-08-01

    A-175-base pair fragment containing the Xenopus borealis somatic 5 S ribosomal RNA gene was used as a model system to determine the effect of nucleosome assembly on nucleotide excision repair (NER) of the major UV photoproduct (cyclobutane pyrimidine dimer (CPD)) in DNA. Xenopus oocyte nuclear extracts were used to carry out repair in vitro on reconstituted, positioned 5 S rDNA nucleosomes. Nucleosome structure strongly inhibits NER at many CPD sites in the 5 S rDNA fragment while having little effect at a few sites. The time course of CPD removal at 35 different sites indicates that >85% of the CPDs in the naked DNA fragment have t(12) values <2 h, whereas <26% of the t(12) values in nucleosomes are <2 h, and 15% are >8 h. Moreover, removal of histone tails from these mononucleosomes has little effect on the repair rates. Finally, nucleosome inhibition of repair shows no correlation with the rotational setting of a 14-nucleotide-long pyrimidine tract located 30 base pairs from the nucleosome dyad. These results suggest that inhibition of NER by mononucleosomes is not significantly influenced by the rotational orientation of CPDs on the histone surface, and histone tails play little (or no) role in this inhibition. PMID:10821833

  19. The Dedicated Chaperone Acl4 Escorts Ribosomal Protein Rpl4 to Its Nuclear Pre-60S Assembly Site

    PubMed Central

    Pillet, Benjamin; García-Gómez, Juan J.; Pausch, Patrick; Falquet, Laurent; Bange, Gert; de la Cruz, Jesús; Kressler, Dieter

    2015-01-01

    Ribosomes are the highly complex macromolecular assemblies dedicated to the synthesis of all cellular proteins from mRNA templates. The main principles underlying the making of ribosomes are conserved across eukaryotic organisms and this process has been studied in most detail in the yeast Saccharomyces cerevisiae. Yeast ribosomes are composed of four ribosomal RNAs (rRNAs) and 79 ribosomal proteins (r-proteins). Most r-proteins need to be transported from the cytoplasm to the nucleus where they get incorporated into the evolving pre-ribosomal particles. Due to the high abundance and difficult physicochemical properties of r-proteins, their correct folding and fail-safe targeting to the assembly site depends largely on general, as well as highly specialized, chaperone and transport systems. Many r-proteins contain universally conserved or eukaryote-specific internal loops and/or terminal extensions, which were shown to mediate their nuclear targeting and association with dedicated chaperones in a growing number of cases. The 60S r-protein Rpl4 is particularly interesting since it harbours a conserved long internal loop and a prominent C-terminal eukaryote-specific extension. Here we show that both the long internal loop and the C-terminal eukaryote-specific extension are strictly required for the functionality of Rpl4. While Rpl4 contains at least five distinct nuclear localization signals (NLS), the C-terminal part of the long internal loop associates with a specific binding partner, termed Acl4. Absence of Acl4 confers a severe slow-growth phenotype and a deficiency in the production of 60S subunits. Genetic and biochemical evidence indicates that Acl4 can be considered as a dedicated chaperone of Rpl4. Notably, Acl4 localizes to both the cytoplasm and nucleus and it has the capacity to capture nascent Rpl4 in a co-translational manner. Taken together, our findings indicate that the dedicated chaperone Acl4 accompanies Rpl4 from the cytoplasm to its pre-60S

  20. The Dedicated Chaperone Acl4 Escorts Ribosomal Protein Rpl4 to Its Nuclear Pre-60S Assembly Site.

    PubMed

    Pillet, Benjamin; García-Gómez, Juan J; Pausch, Patrick; Falquet, Laurent; Bange, Gert; de la Cruz, Jesús; Kressler, Dieter

    2015-10-01

    Ribosomes are the highly complex macromolecular assemblies dedicated to the synthesis of all cellular proteins from mRNA templates. The main principles underlying the making of ribosomes are conserved across eukaryotic organisms and this process has been studied in most detail in the yeast Saccharomyces cerevisiae. Yeast ribosomes are composed of four ribosomal RNAs (rRNAs) and 79 ribosomal proteins (r-proteins). Most r-proteins need to be transported from the cytoplasm to the nucleus where they get incorporated into the evolving pre-ribosomal particles. Due to the high abundance and difficult physicochemical properties of r-proteins, their correct folding and fail-safe targeting to the assembly site depends largely on general, as well as highly specialized, chaperone and transport systems. Many r-proteins contain universally conserved or eukaryote-specific internal loops and/or terminal extensions, which were shown to mediate their nuclear targeting and association with dedicated chaperones in a growing number of cases. The 60S r-protein Rpl4 is particularly interesting since it harbours a conserved long internal loop and a prominent C-terminal eukaryote-specific extension. Here we show that both the long internal loop and the C-terminal eukaryote-specific extension are strictly required for the functionality of Rpl4. While Rpl4 contains at least five distinct nuclear localization signals (NLS), the C-terminal part of the long internal loop associates with a specific binding partner, termed Acl4. Absence of Acl4 confers a severe slow-growth phenotype and a deficiency in the production of 60S subunits. Genetic and biochemical evidence indicates that Acl4 can be considered as a dedicated chaperone of Rpl4. Notably, Acl4 localizes to both the cytoplasm and nucleus and it has the capacity to capture nascent Rpl4 in a co-translational manner. Taken together, our findings indicate that the dedicated chaperone Acl4 accompanies Rpl4 from the cytoplasm to its pre-60S

  1. LIMITED PROTEOLYSIS ANALYSIS OF THE RIBOSOME IS AFFECTED BY SUBUNIT ASSOCIATION

    PubMed Central

    Hamburg, Daisy-Malloy; Suh, Moo-Jin; Limbach, Patrick A.

    2010-01-01

    Our understanding of the structural organization of ribosome assembly intermediates, in particular those intermediates that result from mis-folding leading to their eventual degradation within the cell, is limited due to the lack of methods available to characterize assembly intermediate structures. Because conventional structural approaches, such as NMR, X-ray crystallography and cryo-EM, are not ideally suited to characterize the structural organization of these flexible and sometimes heterogeneous assembly intermediates, we have set out to develop an approach combining limited proteolysis with matrix-assisted laser desorption/ionization mass spectrometry (MALDI-MS) that might be applicable to ribonucleoprotein complexes as large as the ribosome. This study focuses on the limited proteolysis behavior of appropriately assembled ribosome subunits. Isolated subunits were analyzed using limited proteolysis and MALDI-MS and the results were compared to previous data obtained from 70S ribosomes. Generally, ribosomal proteins were found to be more stable in 70S ribosomes than in their isolated subunits, consistent with a reduction in conformational flexibility upon subunit assembly. This approach demonstrates that limited proteolysis combined with MALDI-MS can reveal structural changes to ribosomes upon subunit assembly or disassembly, and provides the appropriate benchmark data from 30S, 50S and 70S proteins to enable studies of ribosome assembly intermediates. PMID:19213046

  2. Single methylation of 23S rRNA triggers late steps of 50S ribosomal subunit assembly.

    PubMed

    Arai, Taiga; Ishiguro, Kensuke; Kimura, Satoshi; Sakaguchi, Yuriko; Suzuki, Takeo; Suzuki, Tsutomu

    2015-08-25

    Ribosome biogenesis requires multiple assembly factors. In Escherichia coli, deletion of RlmE, the methyltransferase responsible for the 2'-O-methyluridine modification at position 2552 (Um2552) in helix 92 of the 23S rRNA, results in slow growth and accumulation of the 45S particle. We demonstrate that the 45S particle that accumulates in ΔrlmE is a genuine precursor that can be assembled into the 50S subunit. Indeed, 50S formation from the 45S precursor could be promoted by RlmE-mediated Um2552 formation in vitro. Ribosomal protein L36 (encoded by rpmJ) was completely absent from the 45S precursor in ΔrlmE, and we observed a strong genetic interaction between rlmE and rpmJ. Structural probing of 23S rRNA and high-salt stripping of 45S components revealed that RlmE-mediated methylation promotes interdomain interactions via the association between helices 92 and 71, stabilized by the single 2'-O-methylation of Um2552, in concert with the incorporation of L36, triggering late steps of 50S subunit assembly. PMID:26261349

  3. Single methylation of 23S rRNA triggers late steps of 50S ribosomal subunit assembly

    PubMed Central

    Arai, Taiga; Ishiguro, Kensuke; Kimura, Satoshi; Sakaguchi, Yuriko; Suzuki, Takeo; Suzuki, Tsutomu

    2015-01-01

    Ribosome biogenesis requires multiple assembly factors. In Escherichia coli, deletion of RlmE, the methyltransferase responsible for the 2′-O-methyluridine modification at position 2552 (Um2552) in helix 92 of the 23S rRNA, results in slow growth and accumulation of the 45S particle. We demonstrate that the 45S particle that accumulates in ΔrlmE is a genuine precursor that can be assembled into the 50S subunit. Indeed, 50S formation from the 45S precursor could be promoted by RlmE-mediated Um2552 formation in vitro. Ribosomal protein L36 (encoded by rpmJ) was completely absent from the 45S precursor in ΔrlmE, and we observed a strong genetic interaction between rlmE and rpmJ. Structural probing of 23S rRNA and high-salt stripping of 45S components revealed that RlmE-mediated methylation promotes interdomain interactions via the association between helices 92 and 71, stabilized by the single 2′-O-methylation of Um2552, in concert with the incorporation of L36, triggering late steps of 50S subunit assembly. PMID:26261349

  4. ppGpp negatively impacts ribosome assembly affecting growth and antimicrobial tolerance in Gram-positive bacteria

    PubMed Central

    Corrigan, Rebecca M.; Bellows, Lauren E.; Wood, Alison

    2016-01-01

    The stringent response is a survival mechanism used by bacteria to deal with stress. It is coordinated by the nucleotides guanosine tetraphosphate and pentaphosphate [(p)ppGpp], which interact with target proteins to promote bacterial survival. Although this response has been well characterized in proteobacteria, very little is known about the effectors of this signaling system in Gram-positive species. Here, we report on the identification of seven target proteins for the stringent response nucleotides in the Gram-positive bacterium Staphylococcus aureus. We demonstrate that the GTP synthesis enzymes HprT and Gmk bind with a high affinity, leading to an inhibition of GTP production. In addition, we identified five putative GTPases—RsgA, RbgA, Era, HflX, and ObgE—as (p)ppGpp target proteins. We show that RsgA, RbgA, Era, and HflX are functional GTPases and that their activity is promoted in the presence of ribosomes but strongly inhibited by the stringent response nucleotides. By characterizing the function of RsgA in vivo, we ascertain that this protein is involved in ribosome assembly, with an rsgA deletion strain, or a strain inactivated for GTPase activity, displaying decreased growth, a decrease in the amount of mature 70S ribosomes, and an increased level of tolerance to antimicrobials. We additionally demonstrate that the interaction of ppGpp with cellular GTPases is not unique to the staphylococci, as homologs from Bacillus subtilis and Enterococcus faecalis retain this ability. Taken together, this study reveals ribosome inactivation as a previously unidentified mechanism through which the stringent response functions in Gram-positive bacteria. PMID:26951678

  5. Paradigms of ribosome synthesis: Lessons learned from ribosomal proteins

    PubMed Central

    Gamalinda, Michael; Woolford, John L

    2015-01-01

    The proteome in all cells is manufactured via the intricate process of translation by multimolecular factories called ribosomes. Nevertheless, these ribonucleoprotein particles, the largest of their kind, also have an elaborate assembly line of their own. Groundbreaking discoveries that bacterial ribosomal subunits can be self-assembled in vitro jumpstarted studies on how ribosomes are constructed. Until recently, ribosome assembly has been investigated almost entirely in vitro with bacterial small subunits under equilibrium conditions. In light of high-resolution ribosome structures and a more sophisticated toolkit, the past decade has been defined by a burst of kinetic studies in vitro and, importantly, also a shift to examining ribosome maturation in living cells, especially in eukaryotes. In this review, we summarize the principles governing ribosome assembly that emerged from studies focusing on ribosomal proteins and their interactions with rRNA. Understanding these paradigms has taken center stage, given the linkage between anomalous ribosome biogenesis and proliferative disorders. PMID:26779413

  6. Backbone and side chain NMR assignments for the ribosome assembly factor Nop6 from Saccharomyces cerevisiae.

    PubMed

    Wurm, Jan Philip; Lioutikov, Anatoli; Kötter, Peter; Entian, Karl-Dieter; Wöhnert, Jens

    2014-10-01

    The Saccharomyces cerevisiae Nop6 protein is involved in the maturation of the small ribosomal subunit. It contains a central RNA binding domain and a predicted C-terminal coiled-coil domain. Here we report the almost complete (>90%) (1)H,(13)C,(15)N backbone and side chain NMR assignment of a 15 kDa Nop6 construct comprising the RNA binding and coiled-coil domains. PMID:23921755

  7. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site

    PubMed Central

    Calviño, Fabiola R.; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-01-01

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1–RpL5-N–RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1–RpL5–RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP. PMID:25849277

  8. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site.

    PubMed

    Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-01-01

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP. PMID:25849277

  9. Dependency Map of Proteins in the Small Ribosomal Subunit

    PubMed Central

    Hamacher, Kay; Trylska, Joanna; McCammon, J. Andrew

    2006-01-01

    The assembly of the ribosome has recently become an interesting target for antibiotics in several bacteria. In this work, we extended an analytical procedure to determine native state fluctuations and contact breaking to investigate the protein stability dependence in the 30S small ribosomal subunit of Thermus thermophilus. We determined the causal influence of the presence and absence of proteins in the 30S complex on the binding free energies of other proteins. The predicted dependencies are in overall agreement with the experimentally determined assembly map for another organism, Escherichia coli. We found that the causal influences result from two distinct mechanisms: one is pure internal energy change, the other originates from the entropy change. We discuss the implications on how to target the ribosomal assembly most effectively by suggesting six proteins as targets for mutations or other hindering of their binding. Our results show that by blocking one out of this set of proteins, the association of other proteins is eventually reduced, thus reducing the translation efficiency even more. We could additionally determine the binding dependency of THX—a peptide not present in the ribosome of E. coli—and suggest its assembly path. PMID:16485038

  10. De novo Synthesis and Assembly of rRNA into Ribosomal Subunits during Cold Acclimation in Escherichia coli.

    PubMed

    Piersimoni, Lolita; Giangrossi, Mara; Marchi, Paolo; Brandi, Anna; Gualerzi, Claudio O; Pon, Cynthia L

    2016-04-24

    During the cold adaptation that follows a cold stress, bacterial cells undergo many physiological changes and extensive reprogramming of their gene expression pattern. Bulk gene expression is drastically reduced, while a set of cold shock genes is selectively and transiently expressed. The initial stage of cold acclimation is characterized by the establishment of a stoichiometric imbalance of the translation initiation factors (IFs)/ribosomes ratio that contributes to the preferential translation of cold shock transcripts. Whereas de novo synthesis of the IFs following cold stress has been documented, nothing was known concerning the activity of the rrn operons during the cold acclimation period. In this work, we focus on the expression of the rrn operons and the fate of rRNA after temperature downshift. We demonstrate that in Escherichia coli, rRNA synthesis does not stop during the cold acclimation phase, but continues with greater contribution of the P2 compared to the P1 promoter and all seven rrn operons are active, although their expression levels change with respect to pre-stress conditions. Eight hours after the 37°→10°C temperature downshift, the newly transcribed rRNA represents up to 20% of total rRNA and is preferentially found in the polysomes. However, with respect to the de novo synthesis of the IFs, both rRNA transcription and maturation are slowed down drastically by cold stress, thereby accounting in part for the stoichiometric imbalance of the IFs/ribosomes. Overall, our data indicate that new ribosomes, which are possibly suitable to function at low temperature, are slowly assembled during cold acclimation. PMID:26953262

  11. Escherichia coli rimM and yjeQ null strains accumulate immature 30S subunits of similar structure and protein complement

    PubMed Central

    Leong, Vivian; Kent, Meredith; Jomaa, Ahmad; Ortega, Joaquin

    2013-01-01

    Assembly of the Escherichia coli 30S ribosomal subunits proceeds through multiple parallel pathways. The protein factors RimM, YjeQ, RbfA, and Era work in conjunction to assist at the late stages of the maturation process of the small subunit. However, it is unclear how the functional interplay between these factors occurs in the context of multiple parallel pathways. To understand how these factors work together, we have characterized the immature 30S subunits that accumulate in ΔrimM cells and compared them with immature 30S subunits from a ΔyjeQ strain. The cryo-EM maps obtained from these particles showed that the densities representing helices 44 and 45 in the rRNA were partially missing, suggesting mobility of these motifs. These 30S subunits were also partially depleted in all tertiary ribosomal proteins, particularly those binding in the head domain. Using image classification, we identified four subpopulations of ΔrimM immature 30S subunits differing in the amount of missing density for helices 44 and 45, as well as the amount of density existing in these maps for the underrepresented proteins. The structural defects found in these immature subunits resembled those of the 30S subunits that accumulate in the ΔyjeQ strain. These findings are consistent with an “early convergency model” in which multiple parallel assembly pathways of the 30S subunit converge into a late assembly intermediate, as opposed to the mature state. Functionally related factors will bind to this intermediate to catalyze the last steps of maturation leading to the mature 30S subunit. PMID:23611982

  12. Deconstructing ribosome construction

    PubMed Central

    Connolly, Keith; Culver, Gloria

    2013-01-01

    The ribosome is an essential ribonucleoprotein enzyme, and its biogenesis is a fundamental process in all living cells. Recent X-ray crystal structures of the bacterial ribosome and new technologies have allowed a greater interrogation of in vitro ribosome assembly; however, substantially less is known about ribosome biogenesis in vivo. Ongoing investigations are focused on elucidating the cellular processes that facilitate biogenesis of the ribosomal subunits, and many extraribosomal factors, including modification enzymes, remodeling enzymes and GTPases, are being uncovered. Moreover, specific roles for ribosome biogenesis factors in subunit maturation are now being elaborated. Ultimately, such studies will reveal a more complete understanding of processes at work in in vivo ribosome biogenesis. PMID:19376708

  13. Cooperative assembly of proteins in the ribosomal GTPase centre demonstrated by their interactions with mutant 23S rRNAs.

    PubMed Central

    Rosendahl, G; Douthwaite, S

    1995-01-01

    The ribosomal protein L11 binds to the region of 23S rRNA associated with the GTPase-dependent steps of protein synthesis. Nucleotides 1054-1107 within this region of the Escherichia coli 23S rRNA gene were mutagenized with bisulphite. Twenty point mutations (G-->A and C-->T transitions) and numerous multiple mutations were generated. Expression of mutant 23S rRNAs in vivo shows that all the mutations detectably alter the phenotype, with effects ranging from a slight growth rate reduction to lack of viability. Temperature sensitivity is conferred by 1071G-->A and 1092C-->U substitutions. These effects are relieved by point mutations at other sites, indicating functional interconnections within the higher order structure of this 23S rRNA region. Several mutations prevent direct binding of r-protein L11 to 23S rRNA in vitro. These mutations are mainly in a short irregular stem (1087-1102) and within a hairpin loop (1068-1072), where the protein probably makes nucleotide contacts. Some of these mutations also interfere with binding of the r-protein complex L10.(L12)4 to an adjacent site on the rRNA. When added together to rRNA, proteins L10.(L12)4 and L11 bind cooperatively to overcome the effects of mutations at 1091 and 1099. The proteins also stimulate each others binding to rRNA mutated at 1087 or 1092, although in these cases binding remains clearly substoichiometric. Surprisingly, none of the mutations prevents incorporation of L11 into ribosomes in vivo, indicating that other, as yet unidentified, factors are involved in the cooperative assembly process. Images PMID:7630717

  14. The DEAD-box Protein Rok1 Orchestrates 40S and 60S Ribosome Assembly by Promoting the Release of Rrp5 from Pre-40S Ribosomes to Allow for 60S Maturation

    PubMed Central

    Khoshnevis, Sohail; Askenasy, Isabel; Dattolo, Maria D.; Young-Erdos, Crystal L.; Stroupe, M. Elizabeth; Karbstein, Katrin

    2016-01-01

    DEAD-box proteins are ubiquitous regulators of RNA biology. While commonly dubbed “helicases,” their activities also include duplex annealing, adenosine triphosphate (ATP)-dependent RNA binding, and RNA-protein complex remodeling. Rok1, an essential DEAD-box protein, and its cofactor Rrp5 are required for ribosome assembly. Here, we use in vivo and in vitro biochemical analyses to demonstrate that ATP-bound Rok1, but not adenosine diphosphate (ADP)-bound Rok1, stabilizes Rrp5 binding to 40S ribosomes. Interconversion between these two forms by ATP hydrolysis is required for release of Rrp5 from pre-40S ribosomes in vivo, thereby allowing Rrp5 to carry out its role in 60S subunit assembly. Furthermore, our data also strongly suggest that the previously described accumulation of snR30 upon Rok1 inactivation arises because Rrp5 release is blocked and implicate a previously undescribed interaction between Rrp5 and the DEAD-box protein Has1 in mediating snR30 accumulation when Rrp5 release from pre-40S subunits is blocked. PMID:27280440

  15. The DEAD-box Protein Rok1 Orchestrates 40S and 60S Ribosome Assembly by Promoting the Release of Rrp5 from Pre-40S Ribosomes to Allow for 60S Maturation.

    PubMed

    Khoshnevis, Sohail; Askenasy, Isabel; Johnson, Matthew C; Dattolo, Maria D; Young-Erdos, Crystal L; Stroupe, M Elizabeth; Karbstein, Katrin

    2016-06-01

    DEAD-box proteins are ubiquitous regulators of RNA biology. While commonly dubbed "helicases," their activities also include duplex annealing, adenosine triphosphate (ATP)-dependent RNA binding, and RNA-protein complex remodeling. Rok1, an essential DEAD-box protein, and its cofactor Rrp5 are required for ribosome assembly. Here, we use in vivo and in vitro biochemical analyses to demonstrate that ATP-bound Rok1, but not adenosine diphosphate (ADP)-bound Rok1, stabilizes Rrp5 binding to 40S ribosomes. Interconversion between these two forms by ATP hydrolysis is required for release of Rrp5 from pre-40S ribosomes in vivo, thereby allowing Rrp5 to carry out its role in 60S subunit assembly. Furthermore, our data also strongly suggest that the previously described accumulation of snR30 upon Rok1 inactivation arises because Rrp5 release is blocked and implicate a previously undescribed interaction between Rrp5 and the DEAD-box protein Has1 in mediating snR30 accumulation when Rrp5 release from pre-40S subunits is blocked. PMID:27280440

  16. Yeast polypeptide exit tunnel ribosomal proteins L17, L35 and L37 are necessary to recruit late-assembling factors required for 27SB pre-rRNA processing

    PubMed Central

    Gamalinda, Michael; Jakovljevic, Jelena; Babiano, Reyes; Talkish, Jason; de la Cruz, Jesús; Woolford, John L.

    2013-01-01

    Ribosome synthesis involves the coordinated folding and processing of pre-rRNAs with assembly of ribosomal proteins. In eukaryotes, these events are facilitated by trans-acting factors that propel ribosome maturation from the nucleolus to the cytoplasm. However, there is a gap in understanding how ribosomal proteins configure pre-ribosomes in vivo to enable processing to occur. Here, we have examined the role of adjacent yeast r-proteins L17, L35 and L37 in folding and processing of pre-rRNAs, and binding of other proteins within assembling ribosomes. These three essential ribosomal proteins, which surround the polypeptide exit tunnel, are required for 60S subunit formation as a consequence of their role in removal of the ITS2 spacer from 27SB pre-rRNA. L17-, L35- and L37-depleted cells exhibit turnover of aberrant pre-60S assembly intermediates. Although the structure of ITS2 does not appear to be grossly affected in their absence, these three ribosomal proteins are necessary for efficient recruitment of factors required for 27SB pre-rRNA processing, namely, Nsa2 and Nog2, which associate with pre-60S ribosomal particles containing 27SB pre-rRNAs. Altogether, these data support that L17, L35 and L37 are specifically required for a recruiting step immediately preceding removal of ITS2. PMID:23268442

  17. 16Stimator: statistical estimation of ribosomal gene copy numbers from draft genome assemblies.

    PubMed

    Perisin, Matthew; Vetter, Madlen; Gilbert, Jack A; Bergelson, Joy

    2016-04-01

    The 16S rRNA gene (16S) is an accepted marker of bacterial taxonomic diversity, even though differences in copy number obscure the relationship between amplicon and organismal abundances. Ancestral state reconstruction methods can predict 16S copy numbers through comparisons with closely related reference genomes; however, the database of closed genomes is limited. Here, we extend the reference database of 16S copy numbers to de novo assembled draft genomes by developing 16Stimator, a method to estimate 16S copy numbers when these repetitive regions collapse during assembly. Using a read depth approach, we estimate 16S copy numbers for 12 endophytic isolates from Arabidopsis thaliana and confirm estimates by qPCR. We further apply this approach to draft genomes deposited in NCBI and demonstrate accurate copy number estimation regardless of sequencing platform, with an overall median deviation of 14%. The expanded database of isolates with 16S copy number estimates increases the power of phylogenetic correction methods for determining organismal abundances from 16S amplicon surveys. PMID:26359911

  18. Rrp12 and the Exportin Crm1 Participate in Late Assembly Events in the Nucleolus during 40S Ribosomal Subunit Biogenesis

    PubMed Central

    Moriggi, Giulia; Nieto, Blanca; Dosil, Mercedes

    2014-01-01

    During the biogenesis of small ribosomal subunits in eukaryotes, the pre-40S particles formed in the nucleolus are rapidly transported to the cytoplasm. The mechanisms underlying the nuclear export of these particles and its coordination with other biogenesis steps are mostly unknown. Here we show that yeast Rrp12 is required for the exit of pre-40S particles to the cytoplasm and for proper maturation dynamics of upstream 90S pre-ribosomes. Due to this, in vivo elimination of Rrp12 leads to an accumulation of nucleoplasmic 90S to pre-40S transitional particles, abnormal 35S pre-rRNA processing, delayed elimination of processing byproducts, and no export of intermediate pre-40S complexes. The exportin Crm1 is also required for the same pre-ribosome maturation events that involve Rrp12. Thus, in addition to their implication in nuclear export, Rrp12 and Crm1 participate in earlier biosynthetic steps that take place in the nucleolus. Our results indicate that, in the 40S subunit synthesis pathway, the completion of early pre-40S particle assembly, the initiation of byproduct degradation and the priming for nuclear export occur in an integrated manner in late 90S pre-ribosomes. PMID:25474739

  19. Position of the CrPV IRES on the 40S subunit and factor dependence of IRES/80S ribosome assembly.

    PubMed

    Pestova, Tatyana V; Lomakin, Ivan B; Hellen, Christopher U T

    2004-09-01

    The cricket paralysis virus intergenic region internal ribosomal entry site (CrPV IGR IRES) can assemble translation initiation complexes by binding to 40S subunits without Met-tRNA(Met)(i) and initiation factors (eIFs) and then by joining directly with 60S subunits, yielding elongation-competent 80S ribosomes. Here, we report that eIF1, eIF1A and eIF3 do not significantly influence IRES/40S subunit binding but strongly inhibit subunit joining and the first elongation cycle. The IRES can avoid their inhibitory effect by its ability to bind directly to 80S ribosomes. The IRES's ability to bind to 40S subunits simultaneously with eIF1 allowed us to use directed hydroxyl radical cleavage to map its position relative to the known position of eIF1. A connecting loop in the IRES's pseudoknot (PK) III domain, part of PK II and the entire domain containing PK I are solvent-exposed and occupy the E site and regions of the P site that are usually occupied by Met-tRNA(Met)(i). PMID:15332113

  20. Human acidic ribosomal phosphoproteins P0, P1, and P2: Analysis of cDNA clones, in vitro synthesis, and assembly

    SciTech Connect

    Rich, B.E.; Steitz, J.A.

    1987-11-01

    cDNA clones encoding three antigenically related human ribosomal phosophoproteins (P-proteins) P0, P1, and P2 were isolated and sequenced. P1 and P2 are analogous to Escherichia coli ribosomal protein L7/L12, and P0 is likely to be an analog of L10. The three proteins have a nearly identical carboxy-terminal 17-amino-acid sequence (KEESEESD(D/E)DMGFGLFD-COOH) that is the basis of their immunological cross-reactivity. The identifies of the P1 and P2 cDNAs were confirmed by the strong similarities of their encoded amino acid sequences to published primary structures of the homologous rat, brine shrimp, and Saccharomyces cerevisiae proteins. The P0 cDNA was initially identified by translation of hybrid-selected mRNA and immunoprecipitation of the products. To demonstrate that the coding sequences are full length, the P0, P1, and P2 cDNAs were transcribed in vitro by bacteriophage T7 RNA polymerase and the resulting mRNAs were translated in vitro. The synthetic P0, P1, and P2 proteins were serologically and electrophoretically identical to P-proteins extracted from HeLa cells. These synthetic P-proteins were incorporated into 60S but not 40S ribosomes and also assembled into a complex similar to that described for E. coli L7/L12 and L10.

  1. Development, Antibiotic Production, and Ribosome Assembly in Streptomyces venezuelae Are Impacted by RNase J and RNase III Deletion

    PubMed Central

    Jones, Stephanie E.; Leong, Vivian; Ortega, Joaquin

    2014-01-01

    RNA metabolism is a critical but frequently overlooked control element affecting virtually every cellular process in bacteria. RNA processing and degradation is mediated by a suite of ribonucleases having distinct cleavage and substrate specificity. Here, we probe the role of two ribonucleases (RNase III and RNase J) in the emerging model system Streptomyces venezuelae. We show that each enzyme makes a unique contribution to the growth and development of S. venezuelae and further affects the secondary metabolism and antibiotic production of this bacterium. We demonstrate a connection between the action of these ribonucleases and translation, with both enzymes being required for the formation of functional ribosomes. RNase III mutants in particular fail to properly process 23S rRNA, form fewer 70S ribosomes, and show reduced translational processivity. The loss of either RNase III or RNase J additionally led to the appearance of a new ribosomal species (the 100S ribosome dimer) during exponential growth and dramatically sensitized these mutants to a range of antibiotics. PMID:25266378

  2. Structural Insights Into Ribosome Recycling Factor Interactions with the 70S Ribosome

    PubMed Central

    Pai, Raj D.; Zhang, Wen; Schuwirth, Barbara S.; Hirokawa, Go; Kaji, Hideko; Kaji, Akira; Cate, Jamie H.D.

    2009-01-01

    SUMMARY At the end of translation in bacteria, ribosome recycling factor (RRF) is used together with Elongation Factor G (EF-G) to recycle the 30S and 50S ribosomal subunits for the next round of translation. In x-ray crystal structures of RRF with the Escherichia coli 70S ribosome, RRF binds to the large ribosomal subunit in the cleft that contains the peptidyl transferase center (PTC). Upon binding of either E. coli or T. thermophilus RRF to the E. coli ribosome, the tip of ribosomal RNA helix H69 in the large subunit moves away from the small subunit toward RRF by 8 Å, thereby disrupting a key contact between the small and large ribosomal subunits, termed bridge B2a. In the ribosome crystals, the ability of RRF to destabilize bridge B2a is influenced by crystal packing forces. Movement of H69 involves an ordered to disordered transition upon binding of RRF to the ribosome. The disruption of bridge B2a upon RRF binding to the ribosome seen in the present structures reveals one of the key roles that RRF plays in ribosome recycling, the dissociation of 70S ribosomes into subunits. The structures also reveal contacts between Domain II of RRF and protein S12 in the 30S subunit that may also play a role in ribosome recycling. PMID:18234219

  3. Effect of an uncE ribosome-binding site mutation on the synthesis and assembly of the Escherichia coli proton-translocating ATPase.

    PubMed

    Solomon, K A; Brusilow, W S

    1988-04-15

    Plasmid pRPG54, which carries the genes for the eight subunits of the proton-translocating ATPase of Escherichia coli, has been found to carry a single base change of a G to an A in the ribosome-binding site for uncE, the gene which codes for the N,N'-dicyclohexylcarbodiimide-binding subunit c of the Fo. This noncoding region mutation both lowers expression of uncE by a factor of 2-3 and affects the function of the ATPase, specifically of the Fo sector. The presence of the mutation results in a decrease in the proton permeability of the Fo or of the entire F1Fo-ATPase complex when either is synthesized from genes on a multicopy plasmid. Expression of uncE from an F1Fo plasmid carrying the wild type ribosome binding site results in increased membrane proton permeability and decreased ability of the resultant ATPase to couple a transmembrane proton gradient to ATP synthesis both in vitro and in vivo. Also, although an Fo plasmid carrying the correct ribosome-binding site causes harmful, F1-dependent proton permeability in unc+ cells (Brusilow, W. S. S. (1987) J. Bacteriol. 169, 4984-4990), an identical plasmid carrying the mutation does not, even though it still codes for a functional reconstitutable Fo. The results show a relationship between the relative level of expression of uncE from a multicopy plasmid and the assembly pathway, proton permeability, and energy-coupling characteristics of the ATPase. PMID:2895768

  4. Intersubunit movement is required for ribosomal translocation

    PubMed Central

    Horan, Lucas H.; Noller, Harry F.

    2007-01-01

    Translocation of tRNA and mRNA during protein synthesis is believed to be coupled to structural changes in the ribosome. The “ratchet model,” based on cryo-EM reconstructions of ribosome complexes, invokes relative movement of the 30S and 50S ribosomal subunits in this process; however, evidence that directly demonstrates a requirement for intersubunit movement during translocation is lacking. To address this problem, we created an intersubunit disulfide cross-link to restrict potential movement. The cross-linked ribosomes were unable to carry out polypeptide synthesis; this inhibition was completely reversed upon reduction of the disulfide bridge. In vitro assays showed that the cross-linked ribosomes were specifically blocked in elongation factor G-dependent translocation. These findings show that intersubunit movement is required for ribosomal translocation, accounting for the universal two-subunit architecture of ribosomes. PMID:17360328

  5. Mutation at position 791 in Escherichia coli 16S ribosomal RNA affects processes involved in the initiation of protein synthesis.

    PubMed Central

    Tapprich, W E; Goss, D J; Dahlberg, A E

    1989-01-01

    A single base was mutated from guanine to adenine at position 791 in 16S rRNA in the Escherichia coli rrnB operon on the multicopy plasmid pKK3535. The plasmid-coded rRNA was processed and assembled into 30S ribosomal subunits in E. coli and caused a retardation of cell growth. The mutation affected crucial functional roles of the 30S subunit in the initiation of protein synthesis. The affinity of the mutant 30S subunits for 50S subunits was reduced and the association equilibrium constant for initiation factor 3 was decreased by a factor of 10 compared to wild-type 30S subunits. The interrelationship among the region of residue 790 in 16S rRNA, subunit association, and initiation factor 3 binding during initiation complex formation, as revealed by this study, offers insights into the functional role of rRNA in protein synthesis. PMID:2662189

  6. Ribosome recycling defects modify the balance between the synthesis and assembly of specific subunits of the oxidative phosphorylation complexes in yeast mitochondria

    PubMed Central

    Ostojić, Jelena; Panozzo, Cristina; Bourand-Plantefol, Alexa; Herbert, Christopher J.; Dujardin, Geneviève; Bonnefoy, Nathalie

    2016-01-01

    Mitochondria have their own translation machinery that produces key subunits of the OXPHOS complexes. This machinery relies on the coordinated action of nuclear-encoded factors of bacterial origin that are well conserved between humans and yeast. In humans, mutations in these factors can cause diseases; in yeast, mutations abolishing mitochondrial translation destabilize the mitochondrial DNA. We show that when the mitochondrial genome contains no introns, the loss of the yeast factors Mif3 and Rrf1 involved in ribosome recycling neither blocks translation nor destabilizes mitochondrial DNA. Rather, the absence of these factors increases the synthesis of the mitochondrially-encoded subunits Cox1, Cytb and Atp9, while strongly impairing the assembly of OXPHOS complexes IV and V. We further show that in the absence of Rrf1, the COX1 specific translation activator Mss51 accumulates in low molecular weight forms, thought to be the source of the translationally-active form, explaining the increased synthesis of Cox1. We propose that Rrf1 takes part in the coordination between translation and OXPHOS assembly in yeast mitochondria. These interactions between general and specific translation factors might reveal an evolutionary adaptation of the bacterial translation machinery to the set of integral membrane proteins that are translated within mitochondria. PMID:27257059

  7. Ribosome recycling defects modify the balance between the synthesis and assembly of specific subunits of the oxidative phosphorylation complexes in yeast mitochondria.

    PubMed

    Ostojić, Jelena; Panozzo, Cristina; Bourand-Plantefol, Alexa; Herbert, Christopher J; Dujardin, Geneviève; Bonnefoy, Nathalie

    2016-07-01

    Mitochondria have their own translation machinery that produces key subunits of the OXPHOS complexes. This machinery relies on the coordinated action of nuclear-encoded factors of bacterial origin that are well conserved between humans and yeast. In humans, mutations in these factors can cause diseases; in yeast, mutations abolishing mitochondrial translation destabilize the mitochondrial DNA. We show that when the mitochondrial genome contains no introns, the loss of the yeast factors Mif3 and Rrf1 involved in ribosome recycling neither blocks translation nor destabilizes mitochondrial DNA. Rather, the absence of these factors increases the synthesis of the mitochondrially-encoded subunits Cox1, Cytb and Atp9, while strongly impairing the assembly of OXPHOS complexes IV and V. We further show that in the absence of Rrf1, the COX1 specific translation activator Mss51 accumulates in low molecular weight forms, thought to be the source of the translationally-active form, explaining the increased synthesis of Cox1. We propose that Rrf1 takes part in the coordination between translation and OXPHOS assembly in yeast mitochondria. These interactions between general and specific translation factors might reveal an evolutionary adaptation of the bacterial translation machinery to the set of integral membrane proteins that are translated within mitochondria. PMID:27257059

  8. Ribosome biogenesis in the yeast Saccharomyces cerevisiae.

    PubMed

    Woolford, John L; Baserga, Susan J

    2013-11-01

    Ribosomes are highly conserved ribonucleoprotein nanomachines that translate information in the genome to create the proteome in all cells. In yeast these complex particles contain four RNAs (>5400 nucleotides) and 79 different proteins. During the past 25 years, studies in yeast have led the way to understanding how these molecules are assembled into ribosomes in vivo. Assembly begins with transcription of ribosomal RNA in the nucleolus, where the RNA then undergoes complex pathways of folding, coupled with nucleotide modification, removal of spacer sequences, and binding to ribosomal proteins. More than 200 assembly factors and 76 small nucleolar RNAs transiently associate with assembling ribosomes, to enable their accurate and efficient construction. Following export of preribosomes from the nucleus to the cytoplasm, they undergo final stages of maturation before entering the pool of functioning ribosomes. Elaborate mechanisms exist to monitor the formation of correct structural and functional neighborhoods within ribosomes and to destroy preribosomes that fail to assemble properly. Studies of yeast ribosome biogenesis provide useful models for ribosomopathies, diseases in humans that result from failure to properly assemble ribosomes. PMID:24190922

  9. The structure of Erb1-Ytm1 complex reveals the functional importance of a high-affinity binding between two β-propellers during the assembly of large ribosomal subunits in eukaryotes

    PubMed Central

    Wegrecki, Marcin; Rodríguez-Galán, Olga; de la Cruz, Jesús; Bravo, Jeronimo

    2015-01-01

    Ribosome biogenesis is one of the most essential pathways in eukaryotes although it is still not fully characterized. Given the importance of this process in proliferating cells, it is obvious that understanding the macromolecular details of the interactions that take place between the assembly factors, ribosomal proteins and nascent pre-rRNAs is essentially required for the development of new non-genotoxic treatments for cancer. Herein, we have studied the association between the WD40-repeat domains of Erb1 and Ytm1 proteins. These are essential factors for the biogenesis of 60S ribosomal subunits in eukaryotes that form a heterotrimeric complex together with the also essential Nop7 protein. We provide the crystal structure of a dimer formed by the C-terminal part of Erb1 and Ytm1 from Chaetomium thermophilum at 2.1 Å resolution. Using a multidisciplinary approach we show that the β-propeller domains of these proteins interact in a novel manner that leads to a high-affinity binding. We prove that a point mutation within the interface of the complex impairs the interaction between the two proteins and negatively affects growth and ribosome production in yeast. Our study suggests insights into the association of the Erb1-Ytm1 dimer with pre-ribosomal particles. PMID:26476442

  10. The structure of Erb1-Ytm1 complex reveals the functional importance of a high-affinity binding between two β-propellers during the assembly of large ribosomal subunits in eukaryotes.

    PubMed

    Wegrecki, Marcin; Rodríguez-Galán, Olga; de la Cruz, Jesús; Bravo, Jeronimo

    2015-12-15

    Ribosome biogenesis is one of the most essential pathways in eukaryotes although it is still not fully characterized. Given the importance of this process in proliferating cells, it is obvious that understanding the macromolecular details of the interactions that take place between the assembly factors, ribosomal proteins and nascent pre-rRNAs is essentially required for the development of new non-genotoxic treatments for cancer. Herein, we have studied the association between the WD40-repeat domains of Erb1 and Ytm1 proteins. These are essential factors for the biogenesis of 60S ribosomal subunits in eukaryotes that form a heterotrimeric complex together with the also essential Nop7 protein. We provide the crystal structure of a dimer formed by the C-terminal part of Erb1 and Ytm1 from Chaetomium thermophilum at 2.1 Å resolution. Using a multidisciplinary approach we show that the β-propeller domains of these proteins interact in a novel manner that leads to a high-affinity binding. We prove that a point mutation within the interface of the complex impairs the interaction between the two proteins and negatively affects growth and ribosome production in yeast. Our study suggests insights into the association of the Erb1-Ytm1 dimer with pre-ribosomal particles. PMID:26476442

  11. Ribosome-omics of the human ribosome

    PubMed Central

    Gupta, Varun; Warner, Jonathan R.

    2014-01-01

    The torrent of RNA-seq data becoming available not only furnishes an overview of the entire transcriptome but also provides tools to focus on specific areas of interest. Our focus on the synthesis of ribosomes asked whether the abundance of mRNAs encoding ribosomal proteins (RPs) matched the equimolar need for the RPs in the assembly of ribosomes. We were at first surprised to find, in the mapping data of ENCODE and other sources, that there were nearly 100-fold differences in the level of the mRNAs encoding the different RPs. However, after correcting for the mapping ambiguities introduced by the presence of more than 2000 pseudogenes derived from RP mRNAs, we show that for 80%–90% of the RP genes, the molar ratio of mRNAs varies less than threefold, with little tissue specificity. Nevertheless, since the RPs are needed in equimolar amounts, there must be sluggish or regulated translation of the more abundant RP mRNAs and/or substantial turnover of unused RPs. In addition, seven of the RPs have subsidiary genes, three of which are pseudogenes that have been “rescued” by the introduction of promoters and/or upstream introns. Several of these are transcribed in a tissue-specific manner, e.g., RPL10L in testis and RPL3L in muscle, leading to potential variation in ribosome structure from one tissue to another. Of the 376 introns in the RP genes, a single one is alternatively spliced in a tissue-specific manner. PMID:24860015

  12. [About the ribosomal biogenesis in human].

    PubMed

    Tafforeau, Lionel

    2015-01-01

    Ribosomes are cellular ribonucleoprotein particles required for a fundamental mechanism, translation of the genetic information into proteins. Ribosome biogenesis is a highly complex pathway involving many maturation steps: ribosomal RNA (rRNA) synthesis, rRNA processing, pre-rRNA modifications, its assembly with ribosomal proteins in the nuceolus, export of the subunit precursors to the nucleoplasm and the cytoplasm. Ribosome biogenesis has mainly being investigated in yeast during these last 25 years. However, recent works have shown that, despite many similarities between yeast and human ribosome structure and biogenesis, human pre-rRNA processing is far more complex than in yeast. In order to better understand diseases related to a malfunction in ribosome synthesis, the ribosomopathies, research should be conducted directly in human cells and animal models. PMID:26152166

  13. Slow formation of stable complexes during coincubation of a minimal rRNA and ribosomal protein S4

    PubMed Central

    Mayerle, Megan; Bellur, Deepti L.; Woodson, Sarah A.

    2011-01-01

    Ribosomal protein S4 binds and stabilizes a five-helix junction in the 5’ domain of the 16S rRNA, and is one of two proteins responsible for nucleating 30S ribosome assembly. Upon binding, both protein S4 and the five-helix junction reorganize their structures. We show that labile S4 complexes rearrange to stable complexes within a few minutes at 42°C, with longer coincubation leading to an increased population of stable complexes. In contrast, prefolding the rRNA has a smaller effect on stable S4 binding. Experiments with minimal rRNA fragments show this structural change depends only on 16S residues within the S4 binding site. SHAPE chemical-probing experiments showed that S4 strongly stabilizes the five-helix junction and helix 18 pseudoknot, which become tightly folded within the first minute of S4 binding. However, a kink in helix 16 that makes specific contacts with the S4 N-terminal extension, and a right angle motif between helices 3, 4 and 18, require a minute or more to become fully structured. Surprisingly, S4 structurally reorganizes the 530-loop and increases the flexibility of helix 3, which is proposed to undergo a conformational switch during 30S assembly. These elements of the S4 binding site may require other 30S proteins to reach a stable conformation. PMID:21821049

  14. A role for the 30S subunit E site in maintenance of the translational reading frame

    PubMed Central

    Devaraj, Aishwarya; Shoji, Shinichiro; Holbrook, Eric D.; Fredrick, Kurt

    2009-01-01

    The exit (E) site has been implicated in several ribosomal activities, including translocation, decoding, and maintenance of the translational reading frame. Here, we target the 30S subunit E site by introducing a deletion in rpsG that truncates the β-hairpin of ribosomal protein S7. This mutation (S7ΔR77–Y84) increases both −1 and +1 frameshifting but does not increase miscoding, providing evidence that the 30S E site plays a specific role in frame maintenance. Mutation S7ΔR77–Y84 also stimulates +1 programmed frameshifting during prfB′-lacZ translation in many synthetic contexts. However, no effect is seen when the E codon of the frameshift site corresponds to those found in nature, suggesting that E-tRNA release does not normally limit the rate of prfB frameshifting. Ribosomes containing S7ΔR77–Y84 exhibit an elevated rate of spontaneous reverse translocation and an increased K 1/2 for E-tRNA. These effects are of similar magnitude, suggesting that both result from destabilization of E-tRNA. Finally, this mutation of the 30S E site does not inhibit EF-G-dependent translocation, consistent with a primary role for the 50S E site in the mechanism. PMID:19095617

  15. Analysis of r-protein and RNA conformation of 30S subunit intermediates in bacteria

    PubMed Central

    Napper, Nathan; Culver, Gloria M.

    2015-01-01

    The ribosome is a large macromolecular complex that must be assembled efficiently and accurately for the viability of all organisms. In bacteria, this process must be robust and tunable to support life in diverse conditions from the ice of arctic glaciers to thermal hot springs. Assembly of the Small ribosomal SUbunit (SSU) of Escherichia coli has been extensively studied and is highly temperature-dependent. However, a lack of data on SSU assembly for other bacteria is problematic given the importance of the ribosome in bacterial physiology. To broaden the understanding of how optimal growth temperature may affect SSU assembly, in vitro SSU assembly of two thermophilic bacteria, Geobacillus kaustophilus and Thermus thermophilus, was compared with that of E. coli. Using these phylogenetically, morphologically, and environmentally diverse bacteria, we show that SSU assembly is highly temperature-dependent and efficient SSU assembly occurs at different temperatures for each organism. Surprisingly, the assembly landscape is characterized by at least two distinct intermediate populations in the organisms tested. This novel, second intermediate, is formed in the presence of the full complement of r-proteins, unlike the previously observed RI* particle formed in the absence of late-binding r-proteins in E. coli. This work reveals multiple distinct intermediate populations are present during SSU assembly in vitro for several bacteria, yielding insights into RNP formation and possible antimicrobial development toward this common SSU target. PMID:25999315

  16. Modular domains of the Dicistroviridae intergenic internal ribosome entry site

    PubMed Central

    Jang, Christopher J.; Jan, Eric

    2010-01-01

    The intergenic region internal ribosome entry site (IGR IRES) of the Dicistroviridae viral family can directly assemble 80S ribosomes and initiate translation at a non-AUG codon from the ribosomal A-site. These functions are directed by two independently folded domains of the IGR IRES. One domain, composed of overlapping pseudoknots II and III (PKII/III), mediates ribosome recruitment. The second domain, composed of PKI, mimics a tRNA anticodon–codon interaction to position the ribosome at the ribosomal A-site. Although adopting a common secondary structure, the dicistrovirus IGR IRESs can be grouped into two classes based on distinct features within each domain. In this study, we report on the modularity of the IGR IRESs and show that the ribosome-binding domain and the tRNA anticodon mimicry domain are functionally interchangeable between the Type I and the Type II IGR IRESs. Using structural probing, ribosome-binding assays, and ribosome positioning analysis by toeprinting assays, we show that the chimeric IRESs fold properly, assemble 80S ribosomes, and can mediate IRES translation in rabbit reticulocyte lysates. We also demonstrate that the chimeric IRESs can stimulate the ribosome-dependent GTPase activity of eEF2, which suggests that the ribosome is primed for a step downstream from IRES binding. Overall, the results demonstrate that the dicistrovirus IGR IRESs are composed of two modular domains that work in concert to manipulate the ribosome and direct translation initiation. PMID:20423979

  17. Identification of nucleosome assembly protein 1 (NAP1) as an interacting partner of plant ribosomal protein S6 (RPS6) and a positive regulator of rDNA transcription

    SciTech Connect

    Son, Ora; Kim, Sunghan; Shin, Yun-jeong; Kim, Woo-Young; Koh, Hee-Jong; Cheon, Choong-Ill

    2015-09-18

    The ribosomal protein S6 (RPS6) is a downstream component of the signaling mediated by the target of rapamycin (TOR) kinase that acts as a central regulator of the key metabolic processes, such as protein translation and ribosome biogenesis, in response to various environmental cues. In our previous study, we identified a novel role of plant RPS6, which negatively regulates rDNA transcription, forming a complex with a plant-specific histone deacetylase, AtHD2B. Here we report that the Arabidopsis RPS6 interacts additionally with a histone chaperone, nucleosome assembly protein 1(AtNAP1;1). The interaction does not appear to preclude the association of RPS6 with AtHD2B, as the AtNAP1 was also able to interact with AtHD2B as well as with an RPS6-AtHD2B fusion protein in the BiFC assay and pulldown experiment. Similar to a positive effect of the ribosomal S6 kinase 1 (AtS6K1) on rDNA transcription observed in this study, overexpression or down regulation of the AtNAP1;1 resulted in concomitant increase and decrease, respectively, in rDNA transcription suggesting a positive regulatory role played by AtNAP1 in plant rDNA transcription, possibly through derepression of the negative effect of the RPS6-AtHD2B complex. - Highlights: • Nucleosome assembly protein 1 (AtNAP1) interacts with RPS6 as well as with AtHD2B. • rDNA transcription is regulated S6K1. • Overexpression or down regulation of AtNAP1 results in concomitant increase or decrease in rDNA transcription.

  18. The Crystal Structure of the Ubiquitin-like Domain of Ribosome Assembly Factor Ytm1 and Characterization of Its Interaction with the AAA-ATPase Midasin.

    PubMed

    Romes, Erin M; Sobhany, Mack; Stanley, Robin E

    2016-01-01

    The synthesis of eukaryotic ribosomes is a complex, energetically demanding process requiring the aid of numerous non-ribosomal factors, such as the PeBoW complex. The mammalian PeBoW complex, composed of Pes1, Bop1, and WDR12, is essential for the processing of the 32S preribosomal RNA. Previous work in Saccharomyces cerevisiae has shown that release of the homologous proteins in this complex (Nop7, Erb1, and Ytm1, respectively) from preribosomal particles requires Rea1 (midasin or MDN1 in humans), a large dynein-like protein. Midasin contains a C-terminal metal ion-dependent adhesion site (MIDAS) domain that interacts with the N-terminal ubiquitin-like (UBL) domain of Ytm1/WDR12 as well as the UBL domain of Rsa4/Nle1 in a later step in the ribosome maturation pathway. Here we present the crystal structure of the UBL domain of the WDR12 homologue from S. cerevisiae at 1.7 Å resolution and demonstrate that human midasin binds to WDR12 as well as Nle1 through their respective UBL domains. Midasin contains a well conserved extension region upstream of the MIDAS domain required for binding WDR12 and Nle1, and the interaction is dependent upon metal ion coordination because removal of the metal or mutation of residues that coordinate the metal ion diminishes the interaction. Mammalian WDR12 displays prominent nucleolar localization that is dependent upon active ribosomal RNA transcription. Based upon these results, we propose that release of the PeBoW complex and subsequent release of Nle1 by midasin is a well conserved step in the ribosome maturation pathway in both yeast and mammalian cells. PMID:26601951

  19. Chloroplast ribosomes and protein synthesis.

    PubMed Central

    Harris, E H; Boynton, J E; Gillham, N W

    1994-01-01

    Consistent with their postulated origin from endosymbiotic cyanobacteria, chloroplasts of plants and algae have ribosomes whose component RNAs and proteins are strikingly similar to those of eubacteria. Comparison of the secondary structures of 16S rRNAs of chloroplasts and bacteria has been particularly useful in identifying highly conserved regions likely to have essential functions. Comparative analysis of ribosomal protein sequences may likewise prove valuable in determining their roles in protein synthesis. This review is concerned primarily with the RNAs and proteins that constitute the chloroplast ribosome, the genes that encode these components, and their expression. It begins with an overview of chloroplast genome structure in land plants and algae and then presents a brief comparison of chloroplast and prokaryotic protein-synthesizing systems and a more detailed analysis of chloroplast rRNAs and ribosomal proteins. A description of the synthesis and assembly of chloroplast ribosomes follows. The review concludes with discussion of whether chloroplast protein synthesis is essential for cell survival. PMID:7854253

  20. Synthesis of ribosomes in Saccharomyces cerevisiae.

    PubMed Central

    Warner, J R

    1989-01-01

    The assembly of a eucaryotic ribosome requires the synthesis of four ribosomal ribonucleic acid (RNA) molecules and more than 75 ribosomal proteins. It utilizes all three RNA polymerases; it requires the cooperation of the nucleus and the cytoplasm, the processing of RNA, and the specific interaction of RNA and protein molecules. It is carried out efficiently and is exquisitely sensitive to the needs of the cell. Our current understanding of this process in the genetically tractable yeast Saccharomyces cerevisiae is reviewed. The ribosomal RNA genes are arranged in a tandem array of 100 to 200 copies. This tandem array has led to unique ways of carrying out a number of functions. Replication is asymmetric and does not initiate from every autonomously replicating sequence. Recombination is suppressed. Transcription of the major ribosomal RNA appears to involve coupling between adjacent transcription units, which are separated by the 5S RNA transcription unit. Genes for many ribosomal proteins have been cloned and sequenced. Few are linked; most are duplicated; most have an intron. There is extensive homology between yeast ribosomal proteins and those of other species. Most, but not all, of the ribosomal protein genes have one or two sites that are essential for their transcription and that bind a common transcription factor. This factor binds also to many other places in the genome, including the telomeres. There is coordinated transcription of the ribosomal protein genes under a variety of conditions. However, the cell seems to possess no mechanism for regulating the transcription of individual ribosomal protein genes in response either to a deficiency or an excess of a particular ribosomal protein. A deficiency causes slow growth. Any excess ribosomal protein is degraded very rapidly, with a half-life of 1 to 5 min. Unlike most types of cells, yeast cells appear not to regulate the translation of ribosomal proteins. However, in the case of ribosomal protein L32

  1. Structure of ERA in complex with the 3′ end of 16S rRNA: Implications for ribosome biogenesis

    SciTech Connect

    Tu, Chao; Zhou, Xiaomei; Tropea, Joseph E.; Austin, Brian P.; Waugh, David S.; Court, Donald L.; Ji, Xinhua

    2009-10-09

    ERA, composed of an N-terminal GTPase domain followed by an RNA-binding KH domain, is essential for bacterial cell viability. It binds to 16S rRNA and the 30S ribosomal subunit. However, its RNA-binding site, the functional relationship between the two domains, and its role in ribosome biogenesis remain unclear. We have determined two crystal structures of ERA, a binary complex with GDP and a ternary complex with a GTP-analog and the {sub 1531}AUCACCUCCUUA{sub 1542} sequence at the 3' end of 16S rRNA. In the ternary complex, the first nine of the 12 nucleotides are recognized by the protein. We show that GTP binding is a prerequisite for RNA recognition by ERA and that RNA recognition stimulates its GTP-hydrolyzing activity. Based on these and other data, we propose a functional cycle of ERA, suggesting that the protein serves as a chaperone for processing and maturation of 16S rRNA and a checkpoint for assembly of the 30S ribosomal subunit. The AUCA sequence is highly conserved among bacteria, archaea, and eukaryotes, whereas the CCUCC, known as the anti-Shine-Dalgarno sequence, is conserved in noneukaryotes only. Therefore, these data suggest a common mechanism for a highly conserved ERA function in all three kingdoms of life by recognizing the AUCA, with a 'twist' for noneukaryotic ERA proteins by also recognizing the CCUCC.

  2. Structure of ERA in Complex with the 3 End of 16s rRNBA Implications for Ribosome Biogenesis

    SciTech Connect

    Tu, C.; Zhou, X; Tropea, J; Austin, B; Waugh, D; Court, D; Ji, X

    2009-01-01

    ERA, composed of an N-terminal GTPase domain followed by an RNA-binding KH domain, is essential for bacterial cell viability. It binds to 16S rRNA and the 30S ribosomal subunit. However, its RNA-binding site, the functional relationship between the two domains, and its role in ribosome biogenesis remain unclear. We have determined two crystal structures of ERA, a binary complex with GDP and a ternary complex with a GTP-analog and the 1531AUCACCUCCUUA1542 sequence at the 3? end of 16S rRNA. In the ternary complex, the first nine of the 12 nucleotides are recognized by the protein. We show that GTP binding is a prerequisite for RNA recognition by ERA and that RNA recognition stimulates its GTP-hydrolyzing activity. Based on these and other data, we propose a functional cycle of ERA, suggesting that the protein serves as a chaperone for processing and maturation of 16S rRNA and a checkpoint for assembly of the 30S ribosomal subunit. The AUCA sequence is highly conserved among bacteria, archaea, and eukaryotes, whereas the CCUCC, known as the anti-Shine-Dalgarno sequence, is conserved in noneukaryotes only. Therefore, these data suggest a common mechanism for a highly conserved ERA function in all three kingdoms of life by recognizing the AUCA, with a 'twist' for noneukaryotic ERA proteins by also recognizing the CCUCC.

  3. Slow formation of stable complexes during coincubation of minimal rRNA and ribosomal protein S4.

    PubMed

    Mayerle, Megan; Bellur, Deepti L; Woodson, Sarah A

    2011-09-23

    Ribosomal protein S4 binds and stabilizes a five-helix junction or five-way junction (5WJ) in the 5' domain of 16S ribosomal RNA (rRNA) and is one of two proteins responsible for nucleating 30S ribosome assembly. Upon binding, both protein S4 and 5WJ reorganize their structures. We show that labile S4 complexes rearrange into stable complexes within a few minutes at 42 °C, with longer coincubation leading to an increased population of stable complexes. In contrast, prefolding the rRNA has a smaller effect on stable S4 binding. Experiments with minimal rRNA fragments show that this structural change depends only on 16S residues within the S4 binding site. SHAPE (selective 2'-hydroxyl acylation analyzed by primer extension) chemical probing experiments showed that S4 strongly stabilizes 5WJ and the helix (H) 18 pseudoknot, which become tightly folded within the first minute of S4 binding. However, a kink in H16 that makes specific contacts with the S4 N-terminal extension, as well as a right-angle motif between H3, H4, and H18, requires a minute or more to become fully structured. Surprisingly, S4 structurally reorganizes the 530-loop and increases the flexibility of H3, which is proposed to undergo a conformational switch during 30S assembly. These elements of the S4 binding site may require other 30S proteins to reach a stable conformation. PMID:21821049

  4. SuhB Associates with Nus Factors To Facilitate 30S Ribosome Biogenesis in Escherichia coli

    PubMed Central

    Singh, Navjot; Bubunenko, Mikhail; Smith, Carol; Abbott, David M.; Stringer, Anne M.; Shi, Ronald; Court, Donald L.

    2016-01-01

    ABSTRACT A complex of highly conserved proteins consisting of NusB, NusE, NusA, and NusG is required for robust expression of rRNA in Escherichia coli. This complex is proposed to prevent Rho-dependent transcription termination by a process known as “antitermination.” The mechanism of this antitermination in rRNA is poorly understood but requires association of NusB and NusE with a specific RNA sequence in rRNA known as BoxA. Here, we identify a novel member of the rRNA antitermination machinery: the inositol monophosphatase SuhB. We show that SuhB associates with elongating RNA polymerase (RNAP) at rRNA in a NusB-dependent manner. Although we show that SuhB is required for BoxA-mediated antitermination in a reporter system, our data indicate that the major function of the NusB/E/A/G/SuhB complex is not to prevent Rho-dependent termination of rRNA but rather to promote correct rRNA maturation. This occurs through formation of a SuhB-mediated loop between NusB/E/BoxA and RNAP/NusA/G. Thus, we have reassigned the function of these proteins at rRNA and identified another key player in this complex. PMID:26980831

  5. Chemical modulators of ribosome biogenesis as biological probes.

    PubMed

    Stokes, Jonathan M; Brown, Eric D

    2015-12-01

    Small-molecule inhibitors of protein biosynthesis have been instrumental in the dissection of the complexities of ribosome structure and function. Ribosome biogenesis, on the other hand, is a complex and largely enigmatic process for which there is a paucity of chemical probes. Indeed, ribosome biogenesis has been studied almost exclusively using genetic and biochemical approaches without the benefit of small-molecule inhibitors of this process. Here, we provide a perspective on the promise of chemical inhibitors of ribosome assembly for future research. We explore key obstacles that complicate the interpretation of studies aimed at perturbing ribosome biogenesis in vivo using genetic methods, and we argue that chemical inhibitors are especially powerful because they can be used to induce perturbations in a manner that obviates these difficulties. Thus, in combination with leading-edge biochemical and structural methods, chemical probes offer unique advantages toward elucidating the molecular events that define the assembly of ribosomes. PMID:26575239

  6. The ribosome filter redux.

    PubMed

    Mauro, Vincent P; Edelman, Gerald M

    2007-09-15

    The ribosome filter hypothesis postulates that ribosomes are not simply translation machines but also function as regulatory elements that differentially affect or filter the translation of particular mRNAs. On the basis of new information, we take the opportunity here to review the ribosome filter hypothesis, suggest specific mechanisms of action, and discuss recent examples from the literature that support it. PMID:17890902

  7. Precursor ribosomal ribonucleic acid and ribosome accumulation in vivo during the recovery of Salmonella typhimurium from thermal injury.

    PubMed

    Tomlins, R I; Ordal, Z J

    1971-07-01

    When cells of S. typhimurium were heated at 48 C for 30 min in phosphate buffer (pH 6.0), they became sensitive to Levine Eosin Methylene Blue Agar containing 2% NaCl (EMB-NaCl). The inoculation of injured cells into fresh growth medium supported the return of their normal tolerance to EMB-NaCl within 6 hr. The fractionation of ribosomal ribonucleic acid (rRNA) from unheated and heat-injured cells by polyacrylamide gel electrophoresis demonstrated that after injury the 16S RNA species was totally degraded and the 23S RNA was partially degraded. Sucrose gradient analysis demonstrated that after injury the 30S ribosomal subunit was totally destroyed and the sedimentation coefficient of the 50S particle was decreased to 47S. During the recovery of cells from thermal injury, four species of rRNA accumulated which were demonstrated to have the following sedimentation coefficients: 16, 17, 23, and 24S. Under identical recovery conditions, 22, 26, and 28S precursors of the 30S ribosomal subunit and 31 and 48S precursors of the 50S ribosomal subunit accumulated along with both the 30 and 50S mature particles. The addition of chloramphenicol to the recovery medium inhibited both the maturation of 17S RNA and the production of mature 30S ribosomal subunits, but permitted the accumulation of a single 22S precursor particle. Chloramphenicol did not affect either the maturation of 24S RNA or the mechanism of formation of 50S ribosomal subunits during recovery. Very little old ribosomal protein was associated with the new rRNA synthesized during recovery. New ribosomal proteins were synthesized during recovery and they were found associated with the new rRNA in ribosomal particles. The rate-limiting step in the recovery of S. typhimurium from thermal injury was in the maturation of the newly synthesized rRNA. PMID:4935315

  8. Features of 80S mammalian ribosome and its subunits

    PubMed Central

    Budkevich, Tatyana V.; El'skaya, Anna V.; Nierhaus, Knud H.

    2008-01-01

    It is generally believed that basic features of ribosomal functions are universally valid, but a systematic test still stands out for higher eukaryotic 80S ribosomes. Here we report: (i) differences in tRNA and mRNA binding capabilities of eukaryotic and bacterial ribosomes and their subunits. Eukaryotic 40S subunits bind mRNA exclusively in the presence of cognate tRNA, whereas bacterial 30S do bind mRNA already in the absence of tRNA. 80S ribosomes bind mRNA efficiently in the absence of tRNA. In contrast, bacterial 70S interact with mRNA more productively in the presence rather than in the absence of tRNA. (ii) States of initiation (Pi), pre-translocation (PRE) and post-translocation (POST) of the ribosome were checked and no significant functional differences to the prokaryotic counterpart were observed including the reciprocal linkage between A and E sites. (iii) Eukaryotic ribosomes bind tetracycline with an affinity 15 times lower than that of bacterial ribosomes (Kd 30 μM and 1–2 μM, respectively). The drug does not effect enzymatic A-site occupation of 80S ribosomes in contrast to non-enzymatic tRNA binding to the A-site. Both observations explain the relative resistance of eukaryotic ribosomes to this antibiotic. PMID:18632761

  9. Illuminating Parasite Protein Production by Ribosome Profiling.

    PubMed

    Parsons, Marilyn; Myler, Peter J

    2016-06-01

    While technologies for global enumeration of transcript abundance are well-developed, those that assess protein abundance require tailoring to penetrate to low-abundance proteins. Ribosome profiling circumvents this challenge by measuring global protein production via sequencing small mRNA fragments protected by the assembled ribosome. This powerful approach is now being applied to protozoan parasites including trypanosomes and Plasmodium. It has been used to identify new protein-coding sequences (CDSs) and clarify the boundaries of previously annotated CDSs in Trypanosoma brucei. Ribosome profiling has demonstrated that translation efficiencies vary widely between genes and, for trypanosomes at least, for the same gene across stages. The ribosomal proteins are themselves subjected to translational control, suggesting a means of reinforcing global translational regulation. PMID:27061497

  10. The ribosomal database project.

    PubMed Central

    Larsen, N; Olsen, G J; Maidak, B L; McCaughey, M J; Overbeek, R; Macke, T J; Marsh, T L; Woese, C R

    1993-01-01

    The Ribosomal Database Project (RDP) is a curated database that offers ribosome data along with related programs and services. The offerings include phylogenetically ordered alignments of ribosomal RNA (rRNA) sequences, derived phylogenetic trees, rRNA secondary structure diagrams and various software packages for handling, analyzing and displaying alignments and trees. The data are available via ftp and electronic mail. Certain analytic services are also provided by the electronic mail server. PMID:8332524

  11. The Ribosomal Database Project.

    PubMed Central

    Maidak, B L; Larsen, N; McCaughey, M J; Overbeek, R; Olsen, G J; Fogel, K; Blandy, J; Woese, C R

    1994-01-01

    The Ribosomal Database Project (RDP) is a curated database that offers ribosome-related data, analysis services, and associated computer programs. The offerings include phylogenetically ordered alignments of ribosomal RNA (rRNA) sequences, derived phylogenetic trees, rRNA secondary structure diagrams, and various software for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (rdp.life.uiuc.edu), electronic mail (server/rdp.life.uiuc.edu) and gopher (rdpgopher.life.uiuc.edu). The electronic mail server also provides ribosomal probe checking, approximate phylogenetic placement of user-submitted sequences, screening for chimeric nature of newly sequenced rRNAs, and automated alignment. PMID:7524021

  12. An overview of pre-ribosomal RNA processing in eukaryotes

    PubMed Central

    Henras, Anthony K; Plisson-Chastang, Célia; O'Donohue, Marie-Françoise; Chakraborty, Anirban; Gleizes, Pierre-Emmanuel

    2015-01-01

    Ribosomal RNAs are the most abundant and universal noncoding RNAs in living organisms. In eukaryotes, three of the four ribosomal RNAs forming the 40S and 60S subunits are borne by a long polycistronic pre-ribosomal RNA. A complex sequence of processing steps is required to gradually release the mature RNAs from this precursor, concomitant with the assembly of the 79 ribosomal proteins. A large set of trans-acting factors chaperone this process, including small nucleolar ribonucleoparticles. While yeast has been the gold standard for studying the molecular basis of this process, recent technical advances have allowed to further define the mechanisms of ribosome biogenesis in animals and plants. This renewed interest for a long-lasting question has been fueled by the association of several genetic diseases with mutations in genes encoding both ribosomal proteins and ribosome biogenesis factors, and by the perspective of new anticancer treatments targeting the mechanisms of ribosome synthesis. A consensus scheme of pre-ribosomal RNA maturation is emerging from studies in various kinds of eukaryotic organisms. However, major differences between mammalian and yeast pre-ribosomal RNA processing have recently come to light. WIREs RNA 2015, 6:225–242. doi: 10.1002/wrna.1269 PMID:25346433

  13. The Ribosomal Database Project

    PubMed Central

    Olsen, Gary J.; Overbeek, Ross; Larsen, Niels; Marsh, Terry L.; McCaughey, Michael J.; Maciukenas, Michael A.; Kuan, Wen-Min; Macke, Thomas J.; Xing, Yuqing; Woese, Carl R.

    1992-01-01

    The Ribosomal Database Project (RDP) compiles ribosomal sequences and related data, and redistributes them in aligned and phylogenetically ordered form to its user community. It also offers various software packages for handling, analyzing and displaying sequences. In addition, the RDP offers (or will offer) certain analytic services. At present the project is in an intermediate stage of development. PMID:1598241

  14. {sup 30}S Beam Development and X-ray Bursts

    SciTech Connect

    Kahl, D.; Kubono, S.; Binh, D. N.; Hashimoto, T.; Hayakawa, S.; Kurihara, Y.; Ohshiro, Y.; Yamaguchi, H.; Chen, A. A.; Chen, J.; Setoodeh nia, K.; Kaji, D.; Nishimura, S.; Kim, A.; Lee, N. H.; Wakabayashi, Y.

    2010-03-01

    Over the past three years, we have worked on developing a well-characterized {sup 30}S radioactive beam to be used in a future experiment aiming to directly measure to extrapolate the {sup 30}S(alpha,p) stellar reaction rate within the Gamow window of Type I X-ray bursts. The importance of the {sup 30}S(alpha,p) reaction to X-ray bursts is discussed. Given the astrophysical motivation, the successful results of and challenges involved in the production of a low-energy {sup 30}S beam are detailed. Finally, an overview of our future plans regarding this on-going project are presented.

  15. Ribosomal proteins produced in excess are degraded by the ubiquitin-proteasome system.

    PubMed

    Sung, Min-Kyung; Reitsma, Justin M; Sweredoski, Michael J; Hess, Sonja; Deshaies, Raymond J

    2016-09-01

    Ribosome assembly is an essential process that consumes prodigious quantities of cellular resources. Ribosomal proteins cannot be overproduced in Saccharomyces cerevisiae because the excess proteins are rapidly degraded. However, the responsible quality control (QC) mechanisms remain poorly characterized. Here we demonstrate that overexpression of multiple proteins of the small and large yeast ribosomal subunits is suppressed. Rpl26 overexpressed from a plasmid can be detected in the nucleolus and nucleoplasm, but it largely fails to assemble into ribosomes and is rapidly degraded. However, if the endogenous RPL26 loci are deleted, plasmid-encoded Rpl26 assembles into ribosomes and localizes to the cytosol. Chemical and genetic perturbation studies indicate that overexpressed ribosomal proteins are degraded by the ubiquitin-proteasome system and not by autophagy. Inhibition of the proteasome led to accumulation of multiple endogenous ribosomal proteins in insoluble aggregates, consistent with the operation of this QC mechanism in the absence of ribosomal protein overexpression. Our studies reveal that ribosomal proteins that fail to assemble into ribosomes are rapidly distinguished from their assembled counterparts and ubiquitinated and degraded within the nuclear compartment. PMID:27385339

  16. Sharing of mitotic pre-ribosomal particles between daughter cells.

    PubMed

    Sirri, Valentina; Jourdan, Nathalie; Hernandez-Verdun, Danièle; Roussel, Pascal

    2016-04-15

    Ribosome biogenesis is a fundamental multistep process initiated by the synthesis of 90S pre-ribosomal particles in the nucleoli of higher eukaryotes. Even though synthesis of ribosomes stops during mitosis while nucleoli disappear, mitotic pre-ribosomal particles persist as observed in pre-nucleolar bodies (PNBs) during telophase. To further understand the relationship between the nucleolus and the PNBs, the presence and the fate of the mitotic pre-ribosomal particles during cell division were investigated. We demonstrate that the recently synthesized 45S precursor ribosomal RNAs (pre-rRNAs) as well as the 32S and 30S pre-rRNAs are maintained during mitosis and associated with the chromosome periphery together with pre-rRNA processing factors. Maturation of the mitotic pre-ribosomal particles, as assessed by the stability of the mitotic pre-rRNAs, is transiently arrested during mitosis by a cyclin-dependent kinase (CDK)1-cyclin-B-dependent mechanism and can be restored by CDK inhibitor treatments. At the M-G1 transition, the resumption of mitotic pre-rRNA processing in PNBs does not induce the disappearance of PNBs; this only occurs when functional nucleoli reform. Strikingly, during their maturation process, mitotic pre-rRNAs localize in reforming nucleoli. PMID:26929073

  17. When ribosomes go bad: diseases of ribosome biogenesis

    PubMed Central

    Freed, Emily F.; Bleichert, Franziska; Dutca, Laura M.; Baserga, Susan J.

    2010-01-01

    Ribosomes are vital for cell growth and survival. Until recently, it was believed that mutations in ribosomes or ribosome biogenesis factors would be lethal, due to the essential nature of these complexes. However, in the last few decades, a number of diseases of ribosome biogenesis have been discovered. It remains a challenge in the field to elucidate the molecular mechanisms underlying them. PMID:20174677

  18. The ribosome returned

    PubMed Central

    Moore, Peter B

    2009-01-01

    Since the mid-1990s, insights obtained from electron microscopy and X-ray crystallography have transformed our understanding of how the most important ribozyme in the cell, the ribosome, catalyzes protein synthesis. This review provides a brief account of how this structural revolution came to pass, and the impact it has had on our understanding of how the ribosome decodes messenger RNAs. PMID:19222865

  19. Arabidopsis protein arginine methyltransferase 3 is required for ribosome biogenesis by affecting precursor ribosomal RNA processing

    PubMed Central

    Hang, Runlai; Liu, Chunyan; Ahmad, Ayaz; Zhang, Yong; Lu, Falong; Cao, Xiaofeng

    2014-01-01

    Ribosome biogenesis is a fundamental and tightly regulated cellular process, including synthesis, processing, and assembly of rRNAs with ribosomal proteins. Protein arginine methyltransferases (PRMTs) have been implicated in many important biological processes, such as ribosome biogenesis. Two alternative precursor rRNA (pre-rRNA) processing pathways coexist in yeast and mammals; however, how PRMT affects ribosome biogenesis remains largely unknown. Here we show that Arabidopsis PRMT3 (AtPRMT3) is required for ribosome biogenesis by affecting pre-rRNA processing. Disruption of AtPRMT3 results in pleiotropic developmental defects, imbalanced polyribosome profiles, and aberrant pre-rRNA processing. We further identify an alternative pre-rRNA processing pathway in Arabidopsis and demonstrate that AtPRMT3 is required for the balance of these two pathways to promote normal growth and development. Our work uncovers a previously unidentified function of PRMT in posttranscriptional regulation of rRNA, revealing an extra layer of complexity in the regulation of ribosome biogenesis. PMID:25352672

  20. DExD/H-box RNA helicases in ribosome biogenesis

    PubMed Central

    Martin, Roman; Straub, Annika U.; Doebele, Carmen; Bohnsack, Markus T.

    2013-01-01

    Ribosome synthesis requires a multitude of cofactors, among them DExD/H-box RNA helicases. Bacterial RNA helicases involved in ribosome assembly are not essential, while eukaryotes strictly require multiple DExD/H-box proteins that are involved in the much more complex ribosome biogenesis pathway. Here, RNA helicases are thought to act in structural remodeling of the RNPs including the modulation of protein binding, and they are required for allowing access or the release of specific snoRNPs from pre-ribosomes. Interestingly, helicase action is modulated by specific cofactors that can regulate recruitment and enzymatic activity. This review summarizes the current knowledge and focuses on recent findings and open questions on RNA helicase function and regulation in ribosome synthesis. PMID:22922795

  1. A protein residing at the subunit interface of the bacterial ribosome.

    PubMed

    Agafonov, D E; Kolb, V A; Nazimov, I V; Spirin, A S

    1999-10-26

    Surface labeling of Escherichia coli ribosomes with the use of the tritium bombardment technique has revealed a minor unidentified ribosome-bound protein (spot Y) that is hidden in the 70S ribosome and becomes highly labeled on dissociation of the 70S ribosome into subunits. In the present work, the N-terminal sequence of the protein Y was determined and its gene was identified as yfia, an ORF located upstream the phe operon of E. coli. This 12.7-kDa protein was isolated and characterized. An affinity of the purified protein Y for the 30S subunit, but not for the 50S ribosomal subunit, was shown. The protein proved to be exposed on the surface of the 30S subunit. The attachment of the 50S subunit resulted in hiding the protein Y, thus suggesting the protein location at the subunit interface in the 70S ribosome. The protein was shown to stabilize ribosomes against dissociation. The possible role of the protein Y as ribosome association factor in translation is discussed. PMID:10535924

  2. Comprehensive analysis of phosphorylated proteins of Escherichia coli ribosomes.

    PubMed

    Soung, George Y; Miller, Jennifer L; Koc, Hasan; Koc, Emine C

    2009-07-01

    Phosphorylation of bacterial ribosomal proteins has been known for decades; however, there is still very limited information available on specific locations of the phosphorylation sites in ribosomal proteins and the role they might play in protein synthesis. In this study, we have mapped the specific phosphorylation sites in 24 Escherichia coli ribosomal proteins by tandem mass spectrometry. Detection of phosphorylation was achieved by either phosphorylation specific visualization techniques, ProQ staining, and antibodies for phospho-Ser, Thr, and Tyr; or by mass spectrometry equipped with a capability to detect addition and loss of the phosphate moiety. Enrichment by immobilized metal affinity and/or strong cation exchange chromatography was used to improve the success of detection of the low abundance phosphopeptides. We found the small subunit (30S) proteins S3, S4, S5, S7, S11, S12, S13, S18, and S21 and the large subunit (50S) proteins L1, L2, L3, L5, L6, L7/L12, L13, L14, L16, L18, L19, L21, L22, L28, and L31 to be phosphorylated at one or more residues. Potential roles for each specific site in ribosome function were deduced through careful evaluation of the given phosphorylation sites in 3D-crystal structure models of ribosomes and the previous mutational studies of E. coli ribosomal proteins. PMID:19469554

  3. The impact of transcriptional tuning on in vitro integrated rRNA transcription and ribosome construction

    PubMed Central

    Fritz, Brian R.; Jewett, Michael C.

    2014-01-01

    In vitro ribosome construction could enable studies of ribosome assembly and function, provide a route toward constructing minimal cells for synthetic biology, and permit the construction of ribosome variants with new functions. Toward these long-term goals, we recently reported on an integrated, one-pot ribosomal RNA synthesis (rRNA), ribosome assembly, and translation technology (termed iSAT) for the construction of Escherichia coli ribosomes in crude ribosome-free S150 extracts. Here, we aimed to improve the activity of iSAT through transcriptional tuning. Specifically, we increased transcriptional efficiency through 3′ modifications to the rRNA gene sequences, optimized plasmid and polymerase concentrations, and demonstrated the use of a T7-promoted rRNA operon for stoichiometrically balanced rRNA synthesis and native rRNA processing. Our modifications produced a 45-fold improvement in iSAT protein synthesis activity, enabling synthesis of 429 ± 15 nmol/l green fluorescent protein in 6 h batch reactions. Further, we show that the translational activity of ribosomes purified from iSAT reactions is about 20% the activity of native ribosomes purified directly from E. coli cells. Looking forward, we believe iSAT will enable unique studies to unravel the systems biology of ribosome biogenesis and open the way to new methods for making and studying ribosomal variants. PMID:24792158

  4. Crystallography of ribosomal particles

    NASA Astrophysics Data System (ADS)

    Yonath, A.; Frolow, F.; Shoham, M.; Müssig, J.; Makowski, I.; Glotz, C.; Jahn, W.; Weinstein, S.; Wittmann, H. G.

    1988-07-01

    Several forms of three-dimensional crystals and two-dimensional sheets of intact ribosomes and their subunits have been obtained as a result of: (a) an extensive systematic investigation of the parameters involved in crystallization, (b) a development of an experimental procedure for controlling the volumes of the crystallization droplets, (c) a study of the nucleation process, and (d) introducing a delicate seeding procedure coupled with variations in the ratios of mono- and divalent ions in the crystallization medium. In all cases only biologically active particles could be crystallized, and the crystalline material retains its integrity and activity. Crystallographic data have been collected from crystals of 50S ribosomal subunits, using synchrotron radiation at temperatures between + 19 and - 180°C. Although at 4°C the higher resolution reflections decay within minutes in the synchrotron beam, at cryo-temperature there was hardly any radiation damage, and a complete set of data to about 6Åresolution could be collected from a single crystal. Heavy-atom clusters were used for soaking as well as for specific binding to the surface of the ribosomal subunits prior to crystallization. The 50S ribosomal subunits from a mutant of B. stearothermophilus which lacks the ribosomal protein BL11 crystallize isomorphously with in the native ones. Models, aimed to be used for low resolution phasing, have been reconstructed from two-dimensional sheets of 70S ribosomes and 50S subunits at 47 and 30Å, respectively. These models show the overall structure of these particles, the contact areas between the large and small subunits, the space where protein synthesis might take place and a tunnel which may provide the path for the nascent protein chain.

  5. The Ribosome Comes Alive

    PubMed Central

    2010-01-01

    This essay is a reflection on the ways the X-ray structures of the ribosome are helping in the interpretation of cryogenic electron microscopy (cryo-EM) density maps showing the translating ribosome in motion. Through advances in classification methods, cryo-EM and single-particle reconstruction methods have recently evolved to the point where they can yield an array of structures from a single sample (“story in a sample”), providing snapshots of an entire subprocess of translation, such as translocation or decoding. PMID:21072331

  6. The Ribosome Comes Alive.

    PubMed

    Frank, Joachim

    2010-06-18

    This essay is a reflection on the ways the X-ray structures of the ribosome are helping in the interpretation of cryogenic electron microscopy (cryo-EM) density maps showing the translating ribosome in motion. Through advances in classification methods, cryo-EM and single-particle reconstruction methods have recently evolved to the point where they can yield an array of structures from a single sample ("story in a sample"), providing snapshots of an entire subprocess of translation, such as translocation or decoding. PMID:21072331

  7. The structure of Aquifex aeolicus ribosomal protein S8 reveals a unique subdomain that contributes to an extremely tight association with 16S rRNA.

    PubMed

    Menichelli, Elena; Edgcomb, Stephen P; Recht, Michael I; Williamson, James R

    2012-01-20

    The assembly of ribonucleoprotein complexes occurs under a broad range of conditions, but the principles that promote assembly and allow function at high temperature are poorly understood. The ribosomal protein S8 from Aquifex aeolicus (AS8) is unique in that there is a 41-residue insertion in the consensus S8 sequence. In addition, AS8 exhibits an unusually high affinity for the 16S ribosomal RNA, characterized by a picomolar dissociation constant that is approximately 26,000-fold tighter than the equivalent interaction from Escherichia coli. Deletion analysis demonstrated that binding to the minimal site on helix 21 occurred at the same nanomolar affinity found for other bacterial species. The additional affinity required the presence of a three-helix junction between helices 20, 21, and 22. The crystal structure of AS8 was solved, revealing the helix-loop-helix geometry of the unique AS8 insertion region, while the core of the molecule is conserved with known S8 structures. The AS8 structure was modeled onto the structure of the 30S ribosomal subunit from E. coli, suggesting the possibility that the unique subdomain provides additional backbone and side-chain contacts between the protein and an unpaired base within the three-way junction of helices 20, 21, and 22. Point mutations in the protein insertion subdomain resulted in a significantly reduced RNA binding affinity with respect to wild-type AS8. These results indicate that the AS8-specific subdomain provides additional interactions with the three-way junction that contribute to the extremely tight binding to ribosomal RNA. PMID:22079365

  8. Ribosome-inactivating proteins

    PubMed Central

    Walsh, Matthew J; Dodd, Jennifer E; Hautbergue, Guillaume M

    2013-01-01

    Ribosome-inactivating proteins (RIPs) were first isolated over a century ago and have been shown to be catalytic toxins that irreversibly inactivate protein synthesis. Elucidation of atomic structures and molecular mechanism has revealed these proteins to be a diverse group subdivided into two classes. RIPs have been shown to exhibit RNA N-glycosidase activity and depurinate the 28S rRNA of the eukaryotic 60S ribosomal subunit. In this review, we compare archetypal RIP family members with other potent toxins that abolish protein synthesis: the fungal ribotoxins which directly cleave the 28S rRNA and the newly discovered Burkholderia lethal factor 1 (BLF1). BLF1 presents additional challenges to the current classification system since, like the ribotoxins, it does not possess RNA N-glycosidase activity but does irreversibly inactivate ribosomes. We further discuss whether the RIP classification should be broadened to include toxins achieving irreversible ribosome inactivation with similar turnovers to RIPs, but through different enzymatic mechanisms. PMID:24071927

  9. SANS measurements on sulfolobus solfataricus ribosome as a function of temperature and magnesium concentration

    NASA Astrophysics Data System (ADS)

    Briganti, G.; Giordano, R.; Londei, P.; Pedone, F.

    1997-02-01

    The ribosomes of the extremely thermophylic archaebacterium Sulfolobus solfataricus (optimal growth at T = 87°C) are stable and active at temperatures close to 90°C, in spite of the fact that their composition is very similar to the ribosomes of the mesophilic bacterium E. coli, growing at 37°C. We present the first SANS analysis of the intact S. solfataricus 70S monomers as well as of the isolated 30S and 50S subunits as a function of the temperature and the magnesium ion concentration. Our results indicate that, under conditions similar to those employed for the analysis of E. coli ribosomes, supramolecular aggregates are present in S. solfataricus, their extent depending on temperature, ribosome concentration and magnesium ion content. Only above 70°C changes in the scattering profile are observed, concomitant with the specific biological activation of this kind of ribosome.

  10. Yeast ribosomal protein L7 and its homologue Rlp7 are simultaneously present at distinct sites on pre-60S ribosomal particles

    PubMed Central

    Babiano, Reyes; Badis, Gwenael; Saveanu, Cosmin; Namane, Abdelkader; Doyen, Antonia; Díaz-Quintana, Antonio; Jacquier, Alain; Fromont-Racine, Micheline; de la Cruz, Jesús

    2013-01-01

    Ribosome biogenesis requires >300 assembly factors in Saccharomyces cerevisiae. Ribosome assembly factors Imp3, Mrt4, Rlp7 and Rlp24 have sequence similarity to ribosomal proteins S9, P0, L7 and L24, suggesting that these pre-ribosomal factors could be placeholders that prevent premature assembly of the corresponding ribosomal proteins to nascent ribosomes. However, we found L7 to be a highly specific component of Rlp7-associated complexes, revealing that the two proteins can bind simultaneously to pre-ribosomal particles. Cross-linking and cDNA analysis experiments showed that Rlp7 binds to the ITS2 region of 27S pre-rRNAs, at two sites, in helix III and in a region adjacent to the pre-rRNA processing sites C1 and E. However, L7 binds to mature 25S and 5S rRNAs and cross-linked predominantly to helix ES7Lb within 25S rRNA. Thus, despite their predicted structural similarity, our data show that Rlp7 and L7 clearly bind at different positions on the same pre-60S particles. Our results also suggest that Rlp7 facilitates the formation of the hairpin structure of ITS2 during 60S ribosomal subunit maturation. PMID:23945946

  11. Head swivel on the ribosome facilitates translocation via intra-subunit tRNA hybrid sites

    PubMed Central

    Ratje, Andreas H.; Loerke, Justus; Mikolajka, Aleksandra; Brünner, Matthias; Hildebrand, Peter W.; Starosta, Agata L.; Dönhöfer, Alexandra; Connell, Sean R.; Fucini, Paola; Mielke, Thorsten; Whitford, Paul C.; Onuchic, Jose’ N; Yu, Yanan; Sanbonmatsu, Karissa Y.; Hartmann, Roland K.; Penczek, Pawel A.; Wilson, Daniel N.; Spahn, Christian M.T.

    2011-01-01

    The elongation cycle of protein synthesis involves the delivery of aminoacyl-tRNAs to the A-site of the ribosome, followed by peptide-bond formation and translocation of the tRNAs through the ribosome to reopen the A-site1,2. The translocation reaction is catalyzed by elongation factor G (EF-G) in a GTP-dependent fashion3. Despite the availability of structures of various EF-G-ribosome complexes, the precise mechanism by which tRNAs move through the ribosome still remains unclear. Here we use multiparticle cryo-EM analysis to resolve two previously unseen subpopulations within EF-G-ribosome complexes at sub-nanometer resolution, one of them with a partially translocated tRNA. Comparison of these sub-states reveals that translocation of tRNA on the 30S subunit parallels the swiveling of the 30S-head and is coupled to un-ratcheting of the 30S-body. Since the tRNA maintains contact with the P-site on the 30S-head and simultaneously establishes interaction with the E-site on the 30S-platform, a novel intra-subunit pe/E hybrid state is formed. This state is stabilized by domain IV of EF-G, which interacts with the swiveled 30S-head conformation. These findings provide direct structural and mechanistic insight into the “missing link” in terms of tRNA intermediates involved in the universally conserved translocation process. PMID:21124459

  12. Structural insights into ribosome translocation.

    PubMed

    Ling, Clarence; Ermolenko, Dmitri N

    2016-09-01

    During protein synthesis, tRNA and mRNA are translocated from the A to P to E sites of the ribosome thus enabling the ribosome to translate one codon of mRNA after the other. Ribosome translocation along mRNA is induced by the universally conserved ribosome GTPase, elongation factor G (EF-G) in bacteria and elongation factor 2 (EF-2) in eukaryotes. Recent structural and single-molecule studies revealed that tRNA and mRNA translocation within the ribosome is accompanied by cyclic forward and reverse rotations between the large and small ribosomal subunits parallel to the plane of the intersubunit interface. In addition, during ribosome translocation, the 'head' domain of small ribosomal subunit undergoes forward- and back-swiveling motions relative to the rest of the small ribosomal subunit around the axis that is orthogonal to the axis of intersubunit rotation. tRNA/mRNA translocation is also coupled to the docking of domain IV of EF-G into the A site of the small ribosomal subunit that converts the thermally driven motions of the ribosome and tRNA into the forward translocation of tRNA/mRNA inside the ribosome. Despite recent and enormous progress made in the understanding of the molecular mechanism of ribosome translocation, the sequence of structural rearrangements of the ribosome, EF-G and tRNA during translocation is still not fully established and awaits further investigation. WIREs RNA 2016, 7:620-636. doi: 10.1002/wrna.1354 For further resources related to this article, please visit the WIREs website. PMID:27117863

  13. Ribosomal Database Project II

    DOE Data Explorer

    The Ribosomal Database Project (RDP) provides ribosome related data and services to the scientific community, including online data analysis and aligned and annotated Bacterial small-subunit 16S rRNA sequences. As of March 2008, RDP Release 10 is available and currently (August 2009) contains 1,074,075 aligned 16S rRNA sequences. Data that can be downloaded include zipped GenBank and FASTA alignment files, a histogram (in Excel) of the number of RDP sequences spanning each base position, data in the Functional Gene Pipeline Repository, and various user submitted data. The RDP-II website also provides numerous analysis tools.[From the RDP-II home page at http://rdp.cme.msu.edu/index.jsp

  14. Structural Basis for the Rescue of Stalled Ribosomes: Structure of YaeJ Bound to the Ribosome

    SciTech Connect

    Gagnon, Matthieu G.; Seetharaman, Sai V.; Bulkley, David; Steitz, Thomas A.

    2012-06-19

    In bacteria, the hybrid transfer-messenger RNA (tmRNA) rescues ribosomes stalled on defective messenger RNAs (mRNAs). However, certain gram-negative bacteria have evolved proteins that are capable of rescuing stalled ribosomes in a tmRNA-independent manner. Here, we report a 3.2 angstrom-resolution crystal structure of the rescue factor YaeJ bound to the Thermus thermophilus 70S ribosome in complex with the initiator tRNA{sub i}{sup fMet} and a short mRNA. The structure reveals that the C-terminal tail of YaeJ functions as a sensor to discriminate between stalled and actively translating ribosomes by binding in the mRNA entry channel downstream of the A site between the head and shoulder of the 30S subunit. This allows the N-terminal globular domain to sample different conformations, so that its conserved GGQ motif is optimally positioned to catalyze the hydrolysis of peptidyl-tRNA. This structure gives insights into the mechanism of YaeJ function and provides a basis for understanding how it rescues stalled ribosomes.

  15. Ribosomal crystallography: peptide bond formation and its inhibition.

    PubMed

    Bashan, Anat; Zarivach, Raz; Schluenzen, Frank; Agmon, Ilana; Harms, Joerg; Auerbach, Tamar; Baram, David; Berisio, Rita; Bartels, Heike; Hansen, Harly A S; Fucini, Paola; Wilson, Daniel; Peretz, Moshe; Kessler, Maggie; Yonath, Ada

    2003-09-01

    Ribosomes, the universal cellular organelles catalyzing the translation of genetic code into proteins, are protein/RNA assemblies, of a molecular weight 2.5 mega Daltons or higher. They are built of two subunits that associate for performing protein biosynthesis. The large subunit creates the peptide bond and provides the path for emerging proteins. The small has key roles in initiating the process and controlling its fidelity. Crystallographic studies on complexes of the small and the large eubacterial ribosomal subunits with substrate analogs, antibiotics, and inhibitors confirmed that the ribosomal RNA governs most of its activities, and indicated that the main catalytic contribution of the ribosome is the precise positioning and alignment of its substrates, the tRNA molecules. A symmetry-related region of a significant size, containing about two hundred nucleotides, was revealed in all known structures of the large ribosomal subunit, despite the asymmetric nature of the ribosome. The symmetry rotation axis, identified in the middle of the peptide-bond formation site, coincides with the bond connecting the tRNA double-helical features with its single-stranded 3' end, which is the moiety carrying the amino acids. This thus implies sovereign movements of tRNA features and suggests that tRNA translocation involves a rotatory motion within the ribosomal active site. This motion is guided and anchored by ribosomal nucleotides belonging to the active site walls, and results in geometry suitable for peptide-bond formation with no significant rearrangements. The sole geometrical requirement for this proposed mechanism is that the initial P-site tRNA adopts the flipped orientation. The rotatory motion is the major component of unified machinery for peptide-bond formation, translocation, and nascent protein progression, since its spiral nature ensures the entrance of the nascent peptide into the ribosomal exit tunnel. This tunnel, assumed to be a passive path for the

  16. Ribosome recycling induces optimal translation rate at low ribosomal availability.

    PubMed

    Marshall, E; Stansfield, I; Romano, M C

    2014-09-01

    During eukaryotic cellular protein synthesis, ribosomal translation is made more efficient through interaction between the two ends of the messenger RNA (mRNA). Ribosomes reaching the 3' end of the mRNA can thus recycle and begin translation again on the same mRNA, the so-called 'closed-loop' model. Using a driven diffusion lattice model of translation, we study the effects of ribosome recycling on the dynamics of ribosome flow and density on the mRNA. We show that ribosome recycling induces a substantial increase in ribosome current. Furthermore, for sufficiently large values of the recycling rate, the lattice does not transition directly from low to high ribosome density, as seen in lattice models without recycling. Instead, a maximal current phase becomes accessible for much lower values of the initiation rate, and multiple phase transitions occur over a wide region of the phase plane. Crucially, we show that in the presence of ribosome recycling, mRNAs can exhibit a peak in protein production at low values of the initiation rate, beyond which translation rate decreases. This has important implications for translation of certain mRNAs, suggesting that there is an optimal concentration of ribosomes at which protein synthesis is maximal, and beyond which translational efficiency is impaired. PMID:25008084

  17. Ribosome recycling induces optimal translation rate at low ribosomal availability

    PubMed Central

    Marshall, E.; Stansfield, I.; Romano, M. C.

    2014-01-01

    During eukaryotic cellular protein synthesis, ribosomal translation is made more efficient through interaction between the two ends of the messenger RNA (mRNA). Ribosomes reaching the 3′ end of the mRNA can thus recycle and begin translation again on the same mRNA, the so-called ‘closed-loop’ model. Using a driven diffusion lattice model of translation, we study the effects of ribosome recycling on the dynamics of ribosome flow and density on the mRNA. We show that ribosome recycling induces a substantial increase in ribosome current. Furthermore, for sufficiently large values of the recycling rate, the lattice does not transition directly from low to high ribosome density, as seen in lattice models without recycling. Instead, a maximal current phase becomes accessible for much lower values of the initiation rate, and multiple phase transitions occur over a wide region of the phase plane. Crucially, we show that in the presence of ribosome recycling, mRNAs can exhibit a peak in protein production at low values of the initiation rate, beyond which translation rate decreases. This has important implications for translation of certain mRNAs, suggesting that there is an optimal concentration of ribosomes at which protein synthesis is maximal, and beyond which translational efficiency is impaired. PMID:25008084

  18. Structural studies of E. coli ribosomes by spectroscopic techniques: A specialized review

    NASA Astrophysics Data System (ADS)

    Bonicontro, Adalberto; Risuleo, Gianfranco

    2005-12-01

    We present a review on our interdisciplinary line of research based on strategies of molecular biology and biophysics. These have been applied to the study of the prokaryotic ribosome of the bacterium Escherichia coli. Our investigations on this organelle have continued for more than a decade and we have adopted different spectroscopic biophysical techniques such as: dielectric and fluorescence spectroscopy as well as light scattering (photon correlation spectroscopy). Here we report studies on the whole 70S ribosomes and on the separated subunits 30S and 50S. Our results evidence intrinsic structural features of the subunits: the small shows a more "floppy" structure, while the large one appears to be more rigid. Also, an inner "kernel" formed by the RNA/protein association is found within the ribosome. This kernel is surrounded by a ribonucleoprotein complex more exposed to the solvent. Initial analyses were done on the so called Kaldtschmit-Wittmann ribosome: more recently we have extended the studies to the "tight couple" ribosome known for its better functional performance in vitro. Data evidence a phenomenological correlation between the differential biological activity and the intrinsic structural properties of the two-ribosome species. Finally, investigations were also conducted on particles treated at sub-denaturing temperatures and on ribosomes partially deproteinized by salt treatment (ribosomal cores). Results suggest that the thermal treatment and the selective removal of proteins cause analogous structural alterations.

  19. On the expansion of ribosomal proteins and RNAs in eukaryotes.

    PubMed

    Parker, Michael S; Sah, Renu; Balasubramaniam, Ambikaipakan; Sallee, Floyd R; Park, Edwards A; Parker, Steven L

    2014-07-01

    While the ribosome constitution is similar in all biota, there is a considerable increase in size of both ribosomal proteins (RPs) and RNAs in eukaryotes as compared to archaea and bacteria. This is pronounced in the large (60S) ribosomal subunit (LSU). In addition to enlargement (apparently maximized already in lower eukarya), the RP changes include increases in fraction, segregation and clustering of basic residues, and decrease in hydrophobicity. The acidic fraction is lower in eukaryote as compared to prokaryote RPs. In all eukaryote groups tested, the LSU RPs have significantly higher content of basic residues and homobasic segments than the SSU RPs. The vertebrate LSU RPs have much higher sequestration of basic residues than those of bacteria, archaea and even of the lower eukarya. The basic clusters are highly aligned in the vertebrate, but less in the lower eukarya, and only within families in archaea and bacteria. Increase in the basicity of RPs, besides helping transport to the nucleus, should promote stability of the assembled ribosome as well as the association with translocons and other intracellular matrix proteins. The size and GC nucleotide bias of the expansion segments of large LSU rRNAs also culminate in the vertebrate, and should support ribosome association with the endoplasmic reticulum and other intracellular networks. However, the expansion and nucleotide bias of eukaryote LSU rRNAs do not clearly correlate with changes in ionic parameters of LSU ribosomal proteins. PMID:24633358

  20. Yeast Rrp14p is a nucleolar protein involved in both ribosome biogenesis and cell polarity

    PubMed Central

    Yamada, Hiroko; Horigome, Chihiro; Okada, Takafumi; Shirai, Chiharu; Mizuta, Keiko

    2007-01-01

    We previously cloned RRP14/YKL082c, whose product exhibits two-hybrid interaction with Ebp2p, a regulatory factor of assembly of 60S ribosomal subunits. Depletion of Rrp14p results in shortage of 60S ribosomal subunits and retardation of processing from 27S pre-rRNA to 25S rRNA. Furthermore, 35S pre-rRNA synthesis appears to decline in Rrp14p-depleted cells. Rrp14p interacts with regulatory factors of 60S subunit assembly and also with Utp11p and Faf1p, which are regulatory factors required for assembly of 40S ribosomal subunits. We propose that Rrp14p is involved in ribosome synthesis from the beginning of 35S pre-rRNA synthesis to assembly of the 60S ribosomal subunit. Disruption of RRP14 causes an extremely slow growth rate of the cell, a severe defect in ribosome synthesis, and a depolarized localization of cortical actin patches throughout the cell cycle. These results suggest that Rrp14p has dual functions in ribosome synthesis and polarized cell growth. PMID:17804645

  1. Ribosomes in a Stacked Array

    PubMed Central

    Yamashita, Yui; Kadokura, Yoshitomo; Sotta, Naoyuki; Fujiwara, Toru; Takigawa, Ichigaku; Satake, Akiko; Onouchi, Hitoshi; Naito, Satoshi

    2014-01-01

    Expression of CGS1, which codes for an enzyme of methionine biosynthesis, is feedback-regulated by mRNA degradation in response to S-adenosyl-l-methionine (AdoMet). In vitro studies revealed that AdoMet induces translation arrest at Ser-94, upon which several ribosomes stack behind the arrested one, and mRNA degradation occurs at multiple sites that presumably correspond to individual ribosomes in a stacked array. Despite the significant contribution of stacked ribosomes to inducing mRNA degradation, little is known about the ribosomes in the stacked array. Here, we assigned the peptidyl-tRNA species of the stacked second and third ribosomes to their respective codons and showed that they are arranged at nine-codon intervals behind the Ser-94 codon, indicating tight stacking. Puromycin reacts with peptidyl-tRNA in the P-site, releasing the nascent peptide as peptidyl-puromycin. This reaction is used to monitor the activity of the peptidyltransferase center (PTC) in arrested ribosomes. Puromycin reaction of peptidyl-tRNA on the AdoMet-arrested ribosome, which is stalled at the pre-translocation step, was slow. This limited reactivity can be attributed to the peptidyl-tRNA occupying the A-site at this step rather than to suppression of PTC activity. In contrast, puromycin reactions of peptidyl-tRNA with the stacked second and third ribosomes were slow but were not as slow as pre-translocation step ribosomes. We propose that the anticodon end of peptidyl-tRNA resides in the A-site of the stacked ribosomes and that the stacked ribosomes are stalled at an early step of translocation, possibly at the P/E hybrid state. PMID:24652291

  2. Exploring Ribosome Positioning on Translating Transcripts with Ribosome Profiling.

    PubMed

    Spealman, Pieter; Wang, Hao; May, Gemma; Kingsford, Carl; McManus, C Joel

    2016-01-01

    Recent technological advances (e.g., microarrays and massively parallel sequencing) have facilitated genome-wide measurement of many aspects of gene regulation. Ribosome profiling is a high-throughput sequencing method used to measure gene expression at the level of translation. This is accomplished by quantifying both the number of translating ribosomes and their locations on mRNA transcripts. The inventors of this approach have published several methods papers detailing its implementation and addressing the basics of ribosome profiling data analysis. Here we describe our lab's procedure, which differs in some respects from those published previously. In addition, we describe a data analysis pipeline, Ribomap, for ribosome profiling data. Ribomap allocates sequence reads to alternative mRNA isoforms, normalizes sequencing bias along transcripts using RNA-seq data, and outputs count vectors of per-codon ribosome occupancy for each transcript. PMID:26463378

  3. Ribosome Shut-Down by 16S rRNA Fragmentation in Stationary-Phase Escherichia coli.

    PubMed

    Luidalepp, Hannes; Berger, Stefan; Joss, Oliver; Tenson, Tanel; Polacek, Norbert

    2016-05-22

    Stationary-phase bacterial cells are characterized by vastly reduced metabolic activities yielding a dormant-like phenotype. Several hibernation programs ensure the establishment and maintenance of this resting growth state. Some of the stationary phase-specific modulations affect the ribosome and its translational activity directly. In stationary-phase Escherichia coli, we observed the appearance of a 16S rRNA fragmentation event at the tip of helix 6 within the small ribosomal subunit (30S). Stationary-phase 30S subunits showed markedly reduced activities in protein biosynthesis. On the other hand, the functional performance of stationary-phase large ribosomal subunits (50S) was indistinguishable from particles isolated from exponentially growing cells. Introduction of the 16S rRNA cut in vitro at helix 6 of exponential phase 30S subunits renders them less efficient in protein biosynthesis. This indicates that the helix 6 fragmentation is necessary and sufficient to attenuate translational activities of 30S ribosomal subunits. These results suggest that stationary phase-specific cleavage of 16S rRNA within the 30S subunit is an efficient means to reduce global translation activities under non-proliferating growth conditions. PMID:27067112

  4. Structural Basis for Translation Termination on the 70S Ribosome

    SciTech Connect

    Laurberg, M.; Asahara, H.; Korostelev, A.; Zhu, J.; Trakhanov, S.; Noller, H.F.

    2009-05-20

    At termination of protein synthesis, type I release factors promote hydrolysis of the peptidyl-transfer RNA linkage in response to recognition of a stop codon. Here we describe the crystal structure of the Thermus thermophilus 70S ribosome in complex with the release factor RF1, tRNA and a messenger RNA containing a UAA stop codon, at 3.2 {angstrom} resolution. The stop codon is recognized in a pocket formed by conserved elements of RF1, including its PxT recognition motif, and 16S ribosomal RNA. The codon and the 30S subunit A site undergo an induced fit that results in stabilization of a conformation of RF1 that promotes its interaction with the peptidyl transferase centre. Unexpectedly, the main-chain amide group of Gln 230 in the universally conserved GGQ motif of the factor is positioned to contribute directly to peptidyl-tRNA hydrolysis.

  5. The quaternary structure of the ribosome from E. coli. A neutron small-angle scattering study

    NASA Astrophysics Data System (ADS)

    Nowotny, V.; Nowotny, P.; Voß, H.; Nierhaus, K. H.; May, R. P.

    1989-01-01

    Ribosomes synthesize proteins in living cells. The E. coli ribosome is composed of a small (30S) and a large subunit (50S). They consist of different proteins (21 or 34, respectively) and of ribosomal RNAs (16S or 23S and 5S). The inter-protein distances within the ribosomal subunits can be measured from scattering experiments with selectively labeled protein pairs from which the quaternary distribution of the proteins is reconstructed. We have developed the strategy of the “glassy ribosome”: the rRNAs and the proteins are deuterated such that they reach the same scattering density and are “invisible” in a corresponding buffer solution. A preliminary quaternary map of the 50S subunit which is the result of our new method for the extraction of the distances from the scattering data as well as shape parameters of proteins in situ will be presented.

  6. Ribosomes in the balance: structural equilibrium ensures translational fidelity and proper gene expression

    PubMed Central

    Musalgaonkar, Sharmishtha; Moomau, Christine A.; Dinman, Jonathan D.

    2014-01-01

    At equilibrium, empty ribosomes freely transit between the rotated and un-rotated states. In the cell, the binding of two translation elongation factors to the same general region of the ribosome stabilizes one state over the other. These stabilized states are resolved by expenditure of energy in the form of GTP hydrolysis. A prior study employing mutants of a late assembling peripheral ribosomal protein suggested that ribosome rotational status determines its affinity for elongation factors, and hence translational fidelity and gene expression. Here, mutants of the early assembling integral ribosomal protein uL2 are used to test the generality of this hypothesis. rRNA structure probing analyses reveal that mutations in the uL2 B7b bridge region shift the equilibrium toward the rotated state, propagating rRNA structural changes to all of the functional centers of ribosome. Structural disequilibrium unbalances ribosome biochemically: rotated ribosomes favor binding of the eEF2 translocase and disfavor that of the elongation ternary complex. This manifests as specific translational fidelity defects, impacting the expression of genes involved in telomere maintenance. A model is presented describing how cyclic intersubunit rotation ensures the unidirectionality of translational elongation, and how perturbation of rotational equilibrium affects specific aspects of translational fidelity and cellular gene expression. PMID:25389262

  7. Reduced expression of the mouse ribosomal protein Rpl17 alters the diversity of mature ribosomes by enhancing production of shortened 5.8S rRNA

    PubMed Central

    Wang, Minshi; Parshin, Andrey V.; Shcherbik, Natalia; Pestov, Dimitri G.

    2015-01-01

    Processing of rRNA during ribosome assembly can proceed through alternative pathways but it is unclear whether this could affect the structure of the ribosome. Here, we demonstrate that shortage of a ribosomal protein can change pre-rRNA processing in a way that over time alters ribosome diversity in the cell. Reducing the amount of Rpl17 in mouse cells led to stalled 60S subunit maturation, causing degradation of most of the synthesized precursors. A fraction of pre-60S subunits, however, were able to complete maturation, but with a 5′-truncated 5.8S rRNA, which we named 5.8SC. The 5′ exoribonuclease Xrn2 is involved in the generation of both 5.8SC and the canonical long form of 5.8S rRNA. Ribosomes containing 5.8SC rRNA are present in various mouse and human cells and engage in translation. These findings uncover a previously undescribed form of mammalian 5.8S rRNA and demonstrate that perturbations in ribosome assembly can be a source of heterogeneity in mature ribosomes. PMID:25995445

  8. Linezolid-Dependent Function and Structure Adaptation of Ribosomes in a Staphylococcus epidermidis Strain Exhibiting Linezolid Dependence

    PubMed Central

    Kokkori, Sofia; Apostolidi, Maria; Tsakris, Athanassios; Pournaras, Spyros

    2014-01-01

    Linezolid-dependent growth was recently reported in Staphylococcus epidermidis clinical strains carrying mutations associated with linezolid resistance. To investigate this unexpected behavior at the molecular level, we isolated active ribosomes from one of the linezolid-dependent strains and we compared them with ribosomes isolated from a wild-type strain. Both strains were grown in the absence and presence of linezolid. Detailed biochemical and structural analyses revealed essential differences in the function and structure of isolated ribosomes which were assembled in the presence of linezolid. The catalytic activity of peptidyltransferase was found to be significantly higher in the ribosomes derived from the linezolid-dependent strain. Interestingly, the same ribosomes exhibited an abnormal ribosomal subunit dissociation profile on a sucrose gradient in the absence of linezolid, but the profile was restored after treatment of the ribosomes with an excess of the antibiotic. Our study suggests that linezolid most likely modified the ribosomal assembly procedure, leading to a new functional ribosomal population active only in the presence of linezolid. Therefore, the higher growth rate of the partially linezolid-dependent strains could be attributed to the functional and structural adaptations of ribosomes to linezolid. PMID:24890589

  9. Head swivel on the ribosome facilitates translocation by means of intra-subunit tRNA hybrid sites.

    PubMed

    Ratje, Andreas H; Loerke, Justus; Mikolajka, Aleksandra; Brünner, Matthias; Hildebrand, Peter W; Starosta, Agata L; Dönhöfer, Alexandra; Connell, Sean R; Fucini, Paola; Mielke, Thorsten; Whitford, Paul C; Onuchic, José N; Yu, Yanan; Sanbonmatsu, Karissa Y; Hartmann, Roland K; Penczek, Pawel A; Wilson, Daniel N; Spahn, Christian M T

    2010-12-01

    The elongation cycle of protein synthesis involves the delivery of aminoacyl-transfer RNAs to the aminoacyl-tRNA-binding site (A site) of the ribosome, followed by peptide-bond formation and translocation of the tRNAs through the ribosome to reopen the A site. The translocation reaction is catalysed by elongation factor G (EF-G) in a GTP-dependent manner. Despite the availability of structures of various EF-G-ribosome complexes, the precise mechanism by which tRNAs move through the ribosome still remains unclear. Here we use multiparticle cryoelectron microscopy analysis to resolve two previously unseen subpopulations within Thermus thermophilus EF-G-ribosome complexes at subnanometre resolution, one of them with a partly translocated tRNA. Comparison of these substates reveals that translocation of tRNA on the 30S subunit parallels the swivelling of the 30S head and is coupled to unratcheting of the 30S body. Because the tRNA maintains contact with the peptidyl-tRNA-binding site (P site) on the 30S head and simultaneously establishes interaction with the exit site (E site) on the 30S platform, a novel intra-subunit 'pe/E' hybrid state is formed. This state is stabilized by domain IV of EF-G, which interacts with the swivelled 30S-head conformation. These findings provide direct structural and mechanistic insight into the 'missing link' in terms of tRNA intermediates involved in the universally conserved translocation process. PMID:21124459

  10. Recycling of eukaryotic post-termination ribosomal complexes

    PubMed Central

    Pisarev, Andrey V.; Hellen, Christopher U. T.; Pestova, Tatyana V.

    2007-01-01

    SUMMARY After translational termination, mRNA and P site deacylated tRNA remain associated with ribosomes in post-termination complexes (post-TCs), which must therefore be recycled by releasing mRNA and deacylated tRNA and by dissociating ribosomes into subunits. Recycling of bacterial post-TCs requires elongation factor EF-G and a ribosome recycling factor RRF. Eukaryotes do not encode a RRF homologue and their mechanism of ribosomal recycling is unknown. We investigated eukaryotic recycling using post-TCs assembled on a model mRNA encoding a tetrapeptide followed by a UAA stop codon and report that initiation factors eIF3, eIF1, eIF1A and eIF3j, a loosely associated subunit of eIF3, can promote recycling of eukaryotic post-TCs. eIF3 is the principal factor that promotes splitting of post-termination ribosomes into 60S subunits and tRNA- and mRNA-bound 40S subunits. Its activity is enhanced by eIF3j, eIF1 and eIF1A. eIF1 also mediates release of P-site tRNA, whereas eIF3j ensures subsequent dissociation of mRNA. PMID:17956730

  11. Sites of Synthesis and Processing of Ribosomal RNA Precursors within the Nucleolus of Urechis caupo Eggs*

    PubMed Central

    Das, Nirmal K.; Micou-Eastwood, Julie; Ramamurthy, Gollu; Alfert, Max

    1970-01-01

    Nucleoli from unfertilized Urechis eggs, labeled with tritiated RNA precursors, have been isolated for simultaneous autoradiographic localization and biochemical analysis of labeled RNA. The production of the ribosomal RNA precursor (38S) and its first cleavage occur at the fibrillar core region of the nucleolus. The products, predominantly 30S RNA, are then rapidly transported and stored in the granular cortex of the nucleolus. The formation of the nucleolar cortex, therefore, seems to result from an accumulation of partially processed ribosomal RNA with its associated proteins. Images PMID:5289033

  12. The mechanics of ribosomal translocation.

    PubMed

    Achenbach, John; Nierhaus, Knud H

    2015-07-01

    The ribosome translates the sequence of codons of an mRNA into the corresponding sequence of amino acids as it moves along the mRNA with a codon-step width of about 10 Å. The movement of the million-dalton complex ribosome is triggered by the universal elongation factor G (EF2 in archaea and eukaryotes) and is termed translocation. Unraveling the molecular details of translocation is one of the most challenging tasks of current ribosome research. In the last two years, enormous progress has been obtained by highly-resolved X-ray and cryo-electron microscopic structures as well as by sophisticated biochemical approaches concerning the trigger and control of the movement of the tRNA2·mRNA complex inside the ribosome during translocation. This review inspects and surveys these achievements. PMID:25514765

  13. The Ribosomal Database Project (RDP).

    PubMed Central

    Maidak, B L; Olsen, G J; Larsen, N; Overbeek, R; McCaughey, M J; Woese, C R

    1996-01-01

    The Ribosomal Database Project (RDP) is a curated database that offers ribosome-related data, analysis services and associated computer programs. The offerings include phylogenetically ordered alignments of ribosomal RNA (rRNA) sequences, derived phylogenetic trees, rRNA secondary structure diagrams and various software for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (rdp.life.uiuc.edu), electronic mail (server@rdp.life.uiuc.edu), gopher (rdpgopher.life.uiuc.edu) and World Wide Web (WWW)(http://rdpwww.life.uiuc.edu/). The electronic mail and WWW servers provide ribosomal probe checking, screening for possible chimeric rRNA sequences, automated alignment and approximate phylogenetic placement of user-submitted sequences on an existing phylogenetic tree. PMID:8594608

  14. The toxin GraT inhibits ribosome biogenesis.

    PubMed

    Ainelo, Andres; Tamman, Hedvig; Leppik, Margus; Remme, Jaanus; Hõrak, Rita

    2016-05-01

    Most bacteria encode numerous chromosomal toxin-antitoxin (TA) systems that are proposed to contribute to stress tolerance, as they are able to shift the cells to a dormant state. Toxins act on a variety of targets with the majority attacking the translational apparatus. Intriguingly, the toxicity mechanisms of even closely related toxins may differ essentially. Here, we report on a new type of TA toxin that inhibits ribosome biogenesis. GraT of the GraTA system has previously been described in Pseudomonas putida as an unusually moderate toxin at optimal growth temperatures. However, GraT causes a severe growth defect at lower temperatures. Here, we demonstrate that GraT causes the accumulation of free ribosomal subunits. Mapping the rRNA 5' ends reveals incomplete processing of the free subunits and quantification of modified nucleosides shows an underrepresentation of late subunit assembly specific modifications. This indicates that GraT inhibits ribosome subunit assembly. Interestingly, GraT effects can be alleviated by modification of the chaperone DnaK, a known facilitator of late stages in ribosome biogenesis. We show that GraT directly interacts with DnaK and suggest two possible models for the role of this interaction in GraT toxicity. PMID:26833678

  15. Architecture of the 90S Pre-ribosome: A Structural View on the Birth of the Eukaryotic Ribosome.

    PubMed

    Kornprobst, Markus; Turk, Martin; Kellner, Nikola; Cheng, Jingdong; Flemming, Dirk; Koš-Braun, Isabelle; Koš, Martin; Thoms, Matthias; Berninghausen, Otto; Beckmann, Roland; Hurt, Ed

    2016-07-14

    The 90S pre-ribosome is an early biogenesis intermediate formed during co-transcriptional ribosome formation, composed of ∼70 assembly factors and several small nucleolar RNAs (snoRNAs) that associate with nascent pre-rRNA. We report the cryo-EM structure of the Chaetomium thermophilum 90S pre-ribosome, revealing how a network of biogenesis factors including 19 β-propellers and large α-solenoid proteins engulfs the pre-rRNA. Within the 90S pre-ribosome, we identify the UTP-A, UTP-B, Mpp10-Imp3-Imp4, Bms1-Rcl1, and U3 snoRNP modules, which are organized around 5'-ETS and partially folded 18S rRNA. The U3 snoRNP is strategically positioned at the center of the 90S particle to perform its multiple tasks during pre-rRNA folding and processing. The architecture of the elusive 90S pre-ribosome gives unprecedented structural insight into the early steps of pre-rRNA maturation. Nascent rRNA that is co-transcriptionally folded and given a particular shape by encapsulation within a dedicated mold-like structure is reminiscent of how polypeptides use chaperone chambers for their protein folding. PMID:27419870

  16. Ribosome dynamics and the evolutionary history of ribosomes

    NASA Astrophysics Data System (ADS)

    Fox, George E.; Paci, Maxim; Tran, Quyen; Petrov, Anton S.; Williams, Loren D.

    2015-09-01

    The ribosome is a dynamic nanomachine responsible for coded protein synthesis. Its major subsystems were essentially in place at the time of the last universal common ancestor (LUCA). Ribosome evolutionary history thus potentially provides a window into the pre- LUCA world. This history begins with the origins of the peptidyl transferase center where the actual peptide is synthesized and then continues over an extended timeframe as additional functional centers including the GTPase center are added. The large ribosomal RNAs (rRNAs) have grown over time by an accretion process and a model exists that proposes a relative age of each accreted element. We have compared atomic resolution ribosome structures before and after EF-G bound GTP hydrolysis and thereby identified the location of 23 pivot points in the large rRNAs that facilitate ribosome dynamics. Pivots in small subunit helices h28 and h44 appear to be especially central to the process and according to the accretion model significantly older than the other helices containing pivots. Overall, the results suggest that ribosomal dynamics occurred in two phases. In the first phase, an inherently mobile h28/h44 combination provided the flexibility needed to create a dynamic ribosome that was essentially a Brownian machine. This addition likely made coded peptide synthesis possible by facilitating movement of a primitive mRNA. During the second phase, addition of pivoting elements and the creation of a factor binding site allowed the regulation of the inherent motion created by h28/h44. All of these events likely occurred before LUCA.

  17. [Ribosomal RNA Evolution

    NASA Technical Reports Server (NTRS)

    1997-01-01

    It is generally believed that an RNA World existed at an early stage in the history of life. During this early period, RNA molecules are seen to be potentially involved in both catalysis and the storage of genetic information. Translation presents several interrelated themes of inquiry for exobiology. First, it is essential, for understanding the very origin of life, how peptides and eventually proteins might have come to be made on the early Earth in a template directed manner. Second, it is necessary to understand how a machinery of similar complexity to that found in the ribosomes of modern organisms came to exist by the time of the last common ancestor (as detected by 16S rRNA sequence studies). Third, the ribosomal RNAs themselves likely had a very early origin and studies of their history may be very informative about the nature of the RNA World. Moreover, studies of these RNAs will contribute to a better understanding of the potential roles of RNA in early evolution.During the past year we have ave conducted a comparative study of four completely sequenced bacterial genoames. We have focused initially on conservation of gene order. The second component of the project continues to build on the model system for studying the validity of variant 5S rRNA sequences in the vicinity of the modern Vibrio proteolyticus 5S rRNA that we established earlier. This system has made it possible to conduct a detailed and extensive analysis of a local portion of the sequence space. These core methods have been used to construct numerous mutants during the last several years. Although it has been a secondary focus, this work has continued over the last year such that we now have in excess of 125 V. proteolyticus derived constructs which have been made and characterized. We have also continued high resolution NMR work on RNA oligomers originally initiated by G. Kenneth Smith who was funded by a NASA Graduate Student Researcher's Fellowship Award until May of 1996. Mr. Smith

  18. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome.

    PubMed

    Poirot, Olivier; Timsit, Youri

    2016-01-01

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through "molecular synapses", ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the "sensory-proteins" innervate the functional ribosomal sites, while the "inter-proteins" interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing. PMID:27225526

  19. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome

    PubMed Central

    Poirot, Olivier; Timsit, Youri

    2016-01-01

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through “molecular synapses”, ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the “sensory-proteins” innervate the functional ribosomal sites, while the “inter-proteins” interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing. PMID:27225526

  20. Co-translational capturing of nascent ribosomal proteins by their dedicated chaperones

    PubMed Central

    Pausch, Patrick; Singh, Ujjwala; Ahmed, Yasar Luqman; Pillet, Benjamin; Murat, Guillaume; Altegoer, Florian; Stier, Gunter; Thoms, Matthias; Hurt, Ed; Sinning, Irmgard; Bange, Gert; Kressler, Dieter

    2015-01-01

    Exponentially growing yeast cells produce every minute >160,000 ribosomal proteins. Owing to their difficult physicochemical properties, the synthesis of assembly-competent ribosomal proteins represents a major challenge. Recent evidence highlights that dedicated chaperone proteins recognize the N-terminal regions of ribosomal proteins and promote their soluble expression and delivery to the assembly site. Here we explore the intuitive possibility that ribosomal proteins are captured by dedicated chaperones in a co-translational manner. Affinity purification of four chaperones (Rrb1, Syo1, Sqt1 and Yar1) selectively enriched the mRNAs encoding their specific ribosomal protein clients (Rpl3, Rpl5, Rpl10 and Rps3). X-ray crystallography reveals how the N-terminal, rRNA-binding residues of Rpl10 are shielded by Sqt1's WD-repeat β-propeller, providing mechanistic insight into the incorporation of Rpl10 into pre-60S subunits. Co-translational capturing of nascent ribosomal proteins by dedicated chaperones constitutes an elegant mechanism to prevent unspecific interactions and aggregation of ribosomal proteins on their road to incorporation. PMID:26112308

  1. Co-translational capturing of nascent ribosomal proteins by their dedicated chaperones

    NASA Astrophysics Data System (ADS)

    Pausch, Patrick; Singh, Ujjwala; Ahmed, Yasar Luqman; Pillet, Benjamin; Murat, Guillaume; Altegoer, Florian; Stier, Gunter; Thoms, Matthias; Hurt, Ed; Sinning, Irmgard; Bange, Gert; Kressler, Dieter

    2015-06-01

    Exponentially growing yeast cells produce every minute >160,000 ribosomal proteins. Owing to their difficult physicochemical properties, the synthesis of assembly-competent ribosomal proteins represents a major challenge. Recent evidence highlights that dedicated chaperone proteins recognize the N-terminal regions of ribosomal proteins and promote their soluble expression and delivery to the assembly site. Here we explore the intuitive possibility that ribosomal proteins are captured by dedicated chaperones in a co-translational manner. Affinity purification of four chaperones (Rrb1, Syo1, Sqt1 and Yar1) selectively enriched the mRNAs encoding their specific ribosomal protein clients (Rpl3, Rpl5, Rpl10 and Rps3). X-ray crystallography reveals how the N-terminal, rRNA-binding residues of Rpl10 are shielded by Sqt1's WD-repeat β-propeller, providing mechanistic insight into the incorporation of Rpl10 into pre-60S subunits. Co-translational capturing of nascent ribosomal proteins by dedicated chaperones constitutes an elegant mechanism to prevent unspecific interactions and aggregation of ribosomal proteins on their road to incorporation.

  2. Time-dependent Effects of Transcription- and Translation-halting Drugs on the Spatial Distributions of the E. coli Chromosome and Ribosomes

    PubMed Central

    Bakshi, Somenath; Choi, Heejun; Mondal, Jagannath; Weisshaar, James C.

    2014-01-01

    Summary Previously observed effects of rifampicin and chloramphenicol indicate that transcription and translation activity strongly affect the coarse spatial organization of the bacterial cytoplasm. Single-cell, time-resolved, quantitative imaging of chromosome and ribosome spatial distributions and ribosome diffusion in live E. coli provides insight into the underlying mechanisms. Monte Carlo simulations of model DNA-ribosome mixtures support a novel nucleoid-ribosome mixing hypothesis. In normal conditions, 70S-polysomes and the chromosomal DNA segregate, while 30S and 50S ribosomal subunits are able to penetrate the nucleoids. Growth conditions and drug treatments determine the partitioning of ribosomes into 70S-polysomes vs free 30S and 50S subunits. Entropic and excluded volume effects then dictate the resulting chromosome and ribosome spatial distributions. Direct observation of radial contraction of the nucleoids 0-5 min after treatment with either transcription- or translation-halting drugs supports the hypothesis that simultaneous transcription, translation, and insertion of proteins into the membrane (“transertion”) exerts an expanding force on the chromosomal DNA. Breaking of the DNA-RNA polymerase-mRNA-ribosome-membrane chain in either of two ways causes similar nucleoid contraction on a similar timescale. We suggest that chromosomal expansion due to transertion enables co-transcriptional translation throughout the nucleoids. PMID:25250841

  3. Maize reas1 Mutant Stimulates Ribosome Use Efficiency and Triggers Distinct Transcriptional and Translational Responses.

    PubMed

    Qi, Weiwei; Zhu, Jie; Wu, Qiao; Wang, Qun; Li, Xia; Yao, Dongsheng; Jin, Ying; Wang, Gang; Wang, Guifeng; Song, Rentao

    2016-02-01

    Ribosome biogenesis is a fundamental cellular process in all cells. Impaired ribosome biogenesis causes developmental defects; however, its molecular and cellular bases are not fully understood. We cloned a gene responsible for a maize (Zea mays) small seed mutant, dek* (for defective kernel), and found that it encodes Ribosome export associated1 (ZmReas1). Reas1 is an AAA-ATPase that controls 60S ribosome export from the nucleus to the cytoplasm after ribosome maturation. dek* is a weak mutant allele with decreased Reas1 function. In dek* cells, mature 60S ribosome subunits are reduced in the nucleus and cytoplasm, but the proportion of actively translating polyribosomes in cytosol is significantly increased. Reduced phosphorylation of eukaryotic initiation factor 2α and the increased elongation factor 1α level indicate an enhancement of general translational efficiency in dek* cells. The mutation also triggers dramatic changes in differentially transcribed genes and differentially translated RNAs. Discrepancy was observed between differentially transcribed genes and differentially translated RNAs, indicating distinct cellular responses at transcription and translation levels to the stress of defective ribosome processing. DNA replication and nucleosome assembly-related gene expression are selectively suppressed at the translational level, resulting in inhibited cell growth and proliferation in dek* cells. This study provides insight into cellular responses due to impaired ribosome biogenesis. PMID:26645456

  4. The importance of ribosome production, and the 5S RNP–MDM2 pathway, in health and disease

    PubMed Central

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J.

    2016-01-01

    Ribosomes are abundant, large RNA–protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. PMID:27528756

  5. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    PubMed

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. PMID:27528756

  6. Profiling of Mycoplasma gallisepticum Ribosomes.

    PubMed

    Fisunov, G Y; Evsyutina, D V; Arzamasov, A A; Butenko, I O; Govorun, V M

    2015-01-01

    The development of high-throughput technologies is increasingly resulting in identification of numerous cases of low correlation between mRNA and the protein level in cells. These controversial observations were made on various bacteria, such as E. coli, Desulfovibrio vulgaris, and Lactococcus lactis. Thus, it is important to develop technologies, including high-throughput techniques, aimed at studying gene expression regulation at the level of translation. In the current study, we performed proteomic profiling of M. gallisepticum ribosomes and identified high abundant noncanonical proteins. We found that binding of mRNAs to ribosomes is mainly determined by two parameters: (1) abundance of mRNA itself and (2) complimentary interactions between the 3' end of 16S rRNA and the ribosome binding site in the 5'-untranslated region of mRNA. PMID:26798497

  7. Profiling of Mycoplasma gallisepticum Ribosomes

    PubMed Central

    Fisunov, G. Y.; Evsyutina, D. V.; Arzamasov, A. A.; Butenko, I. O.; Govorun, V. M.

    2015-01-01

    The development of high-throughput technologies is increasingly resulting in identification of numerous cases of low correlation between mRNA and the protein level in cells. These controversial observations were made on various bacteria, such as E. coli, Desulfovibrio vulgaris, and Lactococcus lactis. Thus, it is important to develop technologies, including high-throughput techniques, aimed at studying gene expression regulation at the level of translation. In the current study, we performed proteomic profiling of M. gallisepticum ribosomes and identified high abundant noncanonical proteins. We found that binding of mRNAs to ribosomes is mainly determined by two parameters: (1) abundance of mRNA itself and (2) complimentary interactions between the 3’ end of 16S rRNA and the ribosome binding site in the 5’-untranslated region of mRNA. PMID:26798497

  8. Comprehensive Molecular Structure of the Eukaryotic Ribosome

    PubMed Central

    Taylor, Derek J.; Devkota, Batsal; Huang, Andrew D.; Topf, Maya; Narayanan, Eswar; Sali, Andrej; Harvey, Stephen C.; Frank, Joachim

    2009-01-01

    Despite the emergence of a large number of X-ray crystallographic models of the bacterial 70S ribosome over the past decade, an accurate atomic model of the eukaryotic 80S ribosome is still not available. Eukaryotic ribosomes possess more ribosomal proteins and ribosomal RNA than bacterial ribosomes, which are implicated in extra-ribosomal functions in the eukaryotic cells. By combining cryo-EM with RNA and protein homology modeling, we obtained an atomic model of the yeast 80S ribosome complete with all ribosomal RNA expansion segments and all ribosomal proteins for which a structural homolog can be identified. Mutation or deletion of 80S ribosomal proteins can abrogate maturation of the ribosome, leading to several human diseases. We have localized one such protein unique to eukaryotes, rpS19e, whose mutations are associated with Diamond-Blackfan anemia in humans. Additionally, we characterize crucial and novel interactions between the dynamic stalk base of the ribosome with eukaryotic elongation factor 2. PMID:20004163

  9. New ribosomes for new memories?

    PubMed Central

    Hernández, A Iván; Alarcon, Juan M; Allen, Kim D

    2015-01-01

    Widely thought to be a housekeeping process, the regulation and synthesis of rRNA emerges as a potentially central mechanism for the maintenance of synaptic plasticity and memory. We have recently shown that an essential component of late-phase synaptic plasticity is rRNA biosynthesis — the rate-limiting step in the production of new ribosomes. We hypothesize that a particular population of ribosomes is generated upon learning-associated neural activity to alter the rate of synthesis of plasticity factors at tagged synapses that will support the maintenance of synaptic plasticity and memory. PMID:26479998

  10. Chromatographic Purification of Highly Active Yeast Ribosomes

    PubMed Central

    Meskauskas, Arturas; Leshin, Jonathan A.; Dinman, Jonathan D.

    2011-01-01

    Eukaryotic ribosomes are much more labile as compared to their eubacterial and archael counterparts, thus posing a significant challenge to researchers. Particularly troublesome is the fact that lysis of cells releases a large number of proteases and nucleases which can degrade ribosomes. Thus, it is important to separate ribosomes from these enzymes as quickly as possible. Unfortunately, conventional differential ultracentrifugation methods leaves ribosomes exposed to these enzymes for unacceptably long periods of time, impacting their structural integrity and functionality. To address this problem, we utilize a chromatographic method using a cysteine charged Sulfolink resin. This simple and rapid application significantly reduces co-purifying proteolytic and nucleolytic activities, producing high yields of intact, highly biochemically active yeast ribosomes. We suggest that this method should also be applicable to mammalian ribosomes. The simplicity of the method, and the enhanced purity and activity of chromatographically purified ribosome represents a significant technical advancement for the study of eukaryotic ribosomes. PMID:22042245

  11. AMPLIFICATION OF RIBOSOMAL RNA SEQUENCES

    EPA Science Inventory

    This book chapter offers an overview of the use of ribosomal RNA sequences. A history of the technology traces the evolution of techniques to measure bacterial phylogenetic relationships and recent advances in obtaining rRNA sequence information. The manual also describes procedu...

  12. Studies on Pea Ribosomal Proteins

    PubMed Central

    Lin, Chu-Yung; Chia, Subrina Li-Li; Travis, Robert L.; Key, Joe L.

    1975-01-01

    Ribosomal subunits prepared by NH4Cl dissociation (0.5 m) of the monomeric ribosomes were much less active in in vitro protein synthesis than those prepared by KCl dissociation. The decrease in activity correlated with a detachment of some proteins (L2 and L9 as shown by gel electrophoresis) within the 60S ribosomal subunits. Subunits prepared with 0.3 m NH4Cl retained L2 and L9, but the activity remained low. Incubation of these 60S subunits in TKM buffer (50 mm tris [pH 7.5], 20 mm KCl, and 5 mm MgCl2) for 20 min at 37 C restored the activity almost to the level of those obtained by KCl dissociation. Treatment of the 0.3 m NH4Cl-derived 60S subunits with a protein reagent, Procion brilliant blue, prior to extraction of the ribosomal proteins resulted in the loss of L2 and L9, showing that these proteins were made accessible for dye binding. These observations suggest that a considerable degree of unfolding of the 60S subunit occurs at 0.3 m NH4Cl (this apparently leads to a preferential detachment of L2 and L9 at 0.5 m NH4Cl) and that the activity of the purified subunits depends not only on the presence of L2 and L9 but also on the organization of these proteins within the 60S subunits. Images PMID:16659254

  13. Interplay of the Bacterial Ribosomal A-Site, S12 Protein Mutations and Paromomycin Binding: A Molecular Dynamics Study

    PubMed Central

    Panecka, Joanna; Mura, Cameron; Trylska, Joanna

    2014-01-01

    The conformational properties of the aminoacyl-tRNA binding site (A-site), and its surroundings in the Escherichia coli 30S ribosomal subunit, are of great relevance in designing antibacterial agents. The 30S subunit A-site is near ribosomal protein S12, which neighbors helices h27 and H69; this latter helix, of the 50S subunit, is a functionally important component of an intersubunit bridge. Experimental work has shown that specific point mutations in S12 (K42A, R53A) yield hyper-accurate ribosomes, which in turn confers resistance to the antibiotic ‘paromomycin’ (even when this aminoglycoside is bound to the A-site). Suspecting that these effects can be elucidated in terms of the local atomic interactions and detailed dynamics of this region of the bacterial ribosome, we have used molecular dynamics simulations to explore the motion of a fragment of the E. coli ribosome, including the A-site. We found that the ribosomal regions surrounding the A-site modify the conformational space of the flexible A-site adenines 1492/93. Specifically, we found that A-site mobility is affected by stacking interactions between adenines A1493 and A1913, and by contacts between A1492 and a flexible side-chain (K43) from the S12 protein. In addition, our simulations reveal possible indirect pathways by which the R53A and K42A mutations in S12 are coupled to the dynamical properties of the A-site. Our work extends what is known about the atomistic dynamics of the A-site, and suggests possible links between the biological effects of hyper-accurate mutations in the S12 protein and conformational properties of the ribosome; the implications for S12 dynamics help elucidate how the miscoding effects of paromomycin may be evaded in antibiotic-resistant mutants of the bacterial ribosome. PMID:25379961

  14. Visualization of the joining of ribosomal subunits reveals the presence of 80S ribosomes in the nucleus

    PubMed Central

    Al-Jubran, Khalid; Wen, Jikai; Abdullahi, Akilu; Roy Chaudhury, Subhendu; Li, Min; Ramanathan, Preethi; Matina, Annunziata; De, Sandip; Piechocki, Kim; Rugjee, Kushal Nivriti; Brogna, Saverio

    2013-01-01

    In eukaryotes the 40S and 60S ribosomal subunits are assembled in the nucleolus, but there appear to be mechanisms preventing mRNA binding, 80S formation, and initiation of translation in the nucleus. To visualize association between ribosomal subunits, we tagged pairs of Drosophila ribosomal proteins (RPs) located in different subunits with mutually complementing halves of fluorescent proteins. Pairs of tagged RPs expected to interact, or be adjacent in the 80S structure, showed strong fluorescence, while pairs that were not in close proximity did not. Moreover, the complementation signal is found in ribosomal fractions and it was enhanced by translation elongation inhibitors and reduced by initiation inhibitors. Our technique achieved 80S visualization both in cultured cells and in fly tissues in vivo. Notably, while the main 80S signal was in the cytoplasm, clear signals were also seen in the nucleolus and at other nuclear sites. Furthermore, we detected rapid puromycin incorporation in the nucleolus and at transcription sites, providing an independent indication of functional 80S in the nucleolus and 80S association with nascent transcripts. PMID:24129492

  15. Binding of Dihydrostreptomycin to Escherichia coli Ribosomes: Characteristics and Equilibrium of the Reaction

    PubMed Central

    Chang, F. N.; Flaks, Joel G.

    1972-01-01

    The binding of dihydrostreptomycin to ribosomes and ribosomal subunits of a number of different Escherichia coli strains was studied, and the Mg2+ and pH dependence, as well as the effect of salts and polynucleotides, was determined. The only requirement for binding with ribosomes and subunits from susceptible strains was 10 mm Mg2+. Monovalent salts weakened the binding in a manner similar to the effects on ribonucleic acid secondary structure, and this was antagonized to some extent by increased amounts of Mg2+. Bound dihydrostreptomycin could be readily exchanged by streptomycin and any antibiotically active derivative, but not by fragments of the antibiotic or any other aminoglycoside. With native (run-off) 70S ribosomes from streptomycin-susceptible strains, the binding was rapid and relatively temperature independent over the range from 0 to 37 C. Polynucleotides did not stimulate the binding. With concentrations of dihydrostreptomycin up to 10−5m, greater than 95% of native 70S ribosomes bound exactly 1 molecule of the antibiotic tightly, with a Kdiss for the bound complex at 25 C of 9.4 × 10−8m. The following thermodynamic parameters were found for the binding with 70S ribosomes at 25 C:ΔG° = −9.6 kcal/mole, ΔH° = −6.2 kcal/mole, and ΔS° = +11.4 entropy units/mole. Differences in affinity for the antibiotic were found between ribosomes of K-12 strains and those of other E. coli strains. There was insignificant binding to 70S ribosomes or subunits from streptomycin-resistant or -dependent strains, and to 50S subunits from susceptible strains. The binding to 30S subunits from susceptible strains was weaker by an order of magnitude than that to the 70S particle, with a Kdiss at 25 C of 10−6m. Polyuridylic acid stimulated this binding slightly but did not influence the affinity of the bound molecule. At antibiotic concentrations above 10−5m, streptomycin-susceptible 70S and 30S particles bound additional molecules of the antibiotic, and

  16. Recognition of the 70S ribosome and polysome by the RNA degradosome in Escherichia coli

    PubMed Central

    Tsai, Yi-Chun; Du, Dijun; Domínguez-Malfavón, Lilianha; Dimastrogiovanni, Daniela; Cross, Jonathan; Callaghan, Anastasia J.; García-Mena, Jaime; Luisi, Ben F.

    2012-01-01

    The RNA degradosome is a multi-enzyme assembly that contributes to key processes of RNA metabolism, and it engages numerous partners in serving its varied functional roles. Small domains within the assembly recognize collectively a diverse range of macromolecules, including the core protein components, the cytoplasmic lipid membrane, mRNAs, non-coding regulatory RNAs and precursors of structured RNAs. We present evidence that the degradosome can form a stable complex with the 70S ribosome and polysomes, and we demonstrate the proximity in vivo of ribosomal proteins and the scaffold of the degradosome, RNase E. The principal interactions are mapped to two, independent, RNA-binding domains from RNase E. RhlB, the RNA helicase component of the degradosome, also contributes to ribosome binding, and this is favoured through an activating interaction with RNase E. The catalytic activity of RNase E for processing 9S RNA (the ribosomal 5S RNA precursor) is repressed in the presence of the ribosome, whereas there is little affect on the cleavage of single-stranded substrates mediated by non-coding RNA, suggestings that the enzyme retains capacity to cleave unstructured substrates when associated with the ribosome. We propose that polysomes may act as antennae that enhance the rates of capture of the limited number of degradosomes, so that they become recruited to sites of active translation to act on mRNAs as they become exposed or tagged for degradation. PMID:22923520

  17. Eukaryote-specific rRNA expansion segments function in ribosome biogenesis.

    PubMed

    Ramesh, Madhumitha; Woolford, John L

    2016-08-01

    The secondary structure of ribosomal RNA (rRNA) is largely conserved across all kingdoms of life. However, eukaryotes have evolved extra blocks of rRNA sequences, relative to those of prokaryotes, called expansion segments (ES). A thorough characterization of the potential roles of ES remains to be done, possibly because of limitations in the availability of robust systems to study rRNA mutants. We sought to systematically investigate the potential functions, if any, of the ES in 25S rRNA of Saccharomyces cerevisiae by deletion mutagenesis. We deleted 14 of the 16 different eukaryote-specific ES in yeast 25S rRNA individually and assayed their phenotypes. Our results show that all but two of the ES tested are necessary for optimal growth and are required for production of 25S rRNA, suggesting that ES play roles in ribosome biogenesis. Further, we classified expansion segments into groups that participate in early nucleolar, middle, and late nucleoplasmic steps of ribosome biogenesis, by assaying their pre-rRNA processing phenotypes. This study is the first of its kind to systematically identify the functions of eukaryote-specific expansion segments by showing that they play roles in specific steps of ribosome biogenesis. The catalog of phenotypes we identified, combined with previous investigations of the roles ribosomal proteins in large subunit biogenesis, leads us to infer that assembling ribosomes are composed of distinct RNA and protein structural neighborhood clusters that participate in specific steps of ribosome biogenesis. PMID:27317789

  18. Rational Extension of the Ribosome Biogenesis Pathway Using Network-Guided Genetics

    PubMed Central

    Li, Zhihua; Lee, Insuk; Moradi, Emily; Hung, Nai-Jung; Johnson, Arlen W.; Marcotte, Edward M.

    2009-01-01

    Biogenesis of ribosomes is an essential cellular process conserved across all eukaryotes and is known to require >170 genes for the assembly, modification, and trafficking of ribosome components through multiple cellular compartments. Despite intensive study, this pathway likely involves many additional genes. Here, we employ network-guided genetics—an approach for associating candidate genes with biological processes that capitalizes on recent advances in functional genomic and proteomic studies—to computationally identify additional ribosomal biogenesis genes. We experimentally evaluated >100 candidate yeast genes in a battery of assays, confirming involvement of at least 15 new genes, including previously uncharacterized genes (YDL063C, YIL091C, YOR287C, YOR006C/TSR3, YOL022C/TSR4). We associate the new genes with specific aspects of ribosomal subunit maturation, ribosomal particle association, and ribosomal subunit nuclear export, and we identify genes specifically required for the processing of 5S, 7S, 20S, 27S, and 35S rRNAs. These results reveal new connections between ribosome biogenesis and mRNA splicing and add >10% new genes—most with human orthologs—to the biogenesis pathway, significantly extending our understanding of a universally conserved eukaryotic process. PMID:19806183

  19. Steric interactions lead to collective tilting motion in the ribosome during mRNA–tRNA translocation

    PubMed Central

    Nguyen, Kien; Whitford, Paul C.

    2016-01-01

    Translocation of mRNA and tRNA through the ribosome is associated with large-scale rearrangements of the head domain in the 30S ribosomal subunit. To elucidate the relationship between 30S head dynamics and mRNA–tRNA displacement, we apply molecular dynamics simulations using an all-atom structure-based model. Here we provide a statistical analysis of 250 spontaneous transitions between the A/P–P/E and P/P–E/E ensembles. Consistent with structural studies, the ribosome samples a chimeric ap/P–pe/E intermediate, where the 30S head is rotated ∼18°. It then transiently populates a previously unreported intermediate ensemble, which is characterized by a ∼10° tilt of the head. To identify the origins of head tilting, we analyse 781 additional simulations in which specific steric features are perturbed. These calculations show that head tilting may be attributed to specific steric interactions between tRNA and the 30S subunit (PE loop and protein S13). Taken together, this study demonstrates how molecular structure can give rise to large-scale collective rearrangements. PMID:26838673

  20. Steric interactions lead to collective tilting motion in the ribosome during mRNA-tRNA translocation.

    PubMed

    Nguyen, Kien; Whitford, Paul C

    2016-01-01

    Translocation of mRNA and tRNA through the ribosome is associated with large-scale rearrangements of the head domain in the 30S ribosomal subunit. To elucidate the relationship between 30S head dynamics and mRNA-tRNA displacement, we apply molecular dynamics simulations using an all-atom structure-based model. Here we provide a statistical analysis of 250 spontaneous transitions between the A/P-P/E and P/P-E/E ensembles. Consistent with structural studies, the ribosome samples a chimeric ap/P-pe/E intermediate, where the 30S head is rotated ∼18°. It then transiently populates a previously unreported intermediate ensemble, which is characterized by a ∼10° tilt of the head. To identify the origins of head tilting, we analyse 781 additional simulations in which specific steric features are perturbed. These calculations show that head tilting may be attributed to specific steric interactions between tRNA and the 30S subunit (PE loop and protein S13). Taken together, this study demonstrates how molecular structure can give rise to large-scale collective rearrangements. PMID:26838673

  1. Steric interactions lead to collective tilting motion in the ribosome during mRNA-tRNA translocation

    NASA Astrophysics Data System (ADS)

    Nguyen, Kien; Whitford, Paul C.

    2016-02-01

    Translocation of mRNA and tRNA through the ribosome is associated with large-scale rearrangements of the head domain in the 30S ribosomal subunit. To elucidate the relationship between 30S head dynamics and mRNA-tRNA displacement, we apply molecular dynamics simulations using an all-atom structure-based model. Here we provide a statistical analysis of 250 spontaneous transitions between the A/P-P/E and P/P-E/E ensembles. Consistent with structural studies, the ribosome samples a chimeric ap/P-pe/E intermediate, where the 30S head is rotated ~18°. It then transiently populates a previously unreported intermediate ensemble, which is characterized by a ~10° tilt of the head. To identify the origins of head tilting, we analyse 781 additional simulations in which specific steric features are perturbed. These calculations show that head tilting may be attributed to specific steric interactions between tRNA and the 30S subunit (PE loop and protein S13). Taken together, this study demonstrates how molecular structure can give rise to large-scale collective rearrangements.

  2. Ribosomal Slowdown Mediates Translational Arrest during Cellular Division▿

    PubMed Central

    Sivan, Gilad; Kedersha, Nancy; Elroy-Stein, Orna

    2007-01-01

    Global mRNA translation is transiently inhibited during cellular division. We demonstrate that mitotic cells contain heavy polysomes, but these are significantly less translationally active than polysomes in cycling cells. Several observations indicate that mitotic translational attenuation occurs during the elongation stage: (i) in cycling nonsynchronized cultures, only mitotic cells fail to assemble stress granules when treated with agents that inhibit translational initiation; (ii) mitotic cells contain fewer free 80S complexes, which are less sensitive to high salt disassembly; (iii) mitotic polysomes are more resistant to enforced disassembly using puromycin; and (iv) ribosome transit time increases during mitosis. Elongation slowdown guarantees that polysomes are retained even if initiation is inhibited at the same time. Stalling translating ribosomes during mitosis may protect mRNAs and allow rapid resumption of translation immediately upon entry into the G1 phase. PMID:17664278

  3. A reconstituted cell-free assay for the evaluation of the intrinsic activity of purified human ribosomes.

    PubMed

    Penzo, Marianna; Carnicelli, Domenica; Montanaro, Lorenzo; Brigotti, Maurizio

    2016-07-01

    We describe a cell-free translation system for evaluating the activity of ribosomes stringently purified from human cells. This system is based on in vitro reconstitution of the cellular translation machinery, in which a ribosome-free rabbit reticulocyte lysate (RRL) is reassembled with human ribosomes and in vitro-transcribed reporter mRNAs. The protocol describes the preparation of the RRL-derived fractions, purification of ribosomes devoid of detectable nonribosomal-associated factors, and assembly of the reactions to evaluate ribosomal translational efficiency and fidelity using appropriate reporter transcripts. The whole procedure can be completed in ∼2.5 d (plus 2 weeks for RRL preparation and cell expansion time). This protocol can be applied to study intrinsic functional properties (cis-acting element-mediated translation initiation or translational fidelity) of ribosome populations from different sources (including nonhuman origin). It is therefore useful for the characterization of ribosomal function in ribosomopathies and cancer, and it will be applicable in the emerging fields of ribosome diversity and specialized ribosomes. PMID:27336708

  4. The unfolded protein response triggers site-specific regulatory ubiquitylation of 40S ribosomal proteins

    PubMed Central

    Rising, Lisa; Mak, Raymond; Webb, Kristofor; Kaiser, Stephen E.; Zuzow, Nathan; Riviere, Paul; Yang, Bing; Fenech, Emma; Tang, Xin; Lindsay, Scott A.; Christianson, John C.; Hampton, Randolph Y.; Wasserman, Steven A.; Bennett, Eric J.

    2015-01-01

    Summary Insults to endoplasmic reticulum (ER) homeostasis activate the unfolded protein response (UPR), which elevates protein folding and degradation capacity and attenuates protein synthesis. While a role for ubiquitin in regulating the degradation of misfolded ER-resident proteins is well described, ubiquitin-dependent regulation of translational reprogramming during the UPR remains uncharacterized. Using global quantitative ubiquitin proteomics, we identify evolutionarily conserved, site-specific regulatory ubiquitylation of 40S ribosomal proteins. We demonstrate that these events occur on assembled cytoplasmic ribosomes and are stimulated by both UPR activation and translation inhibition. We further show that ER stress-stimulated regulatory 40S ribosomal ubiquitylation occurs on a timescale similar to eIF2α phosphorylation, is dependent upon PERK signaling, and is required for optimal cell survival during chronic UPR activation. In total, these results reveal regulatory 40S ribosomal ubiquitylation as a previously uncharacterized and important facet of eukaryotic translational control. PMID:26051182

  5. Characterizing inactive ribosomes in translational profiling.

    PubMed

    Liu, Botao; Qian, Shu-Bing

    2016-01-01

    The broad impact of translational regulation has emerged explosively in the last few years in part due to the technological advance in genome-wide interrogation of gene expression. During mRNA translation, the majority of actively translating ribosomes exist as polysomes in cells with multiple ribosomes loaded on a single transcript. The importance of the monosome, however, has been less appreciated in translational profiling analysis. Here we report that the monosome fraction isolated by sucrose sedimentation contains a large quantity of inactive ribosomes that do not engage on mRNAs to direct translation. We found that the elongation factor eEF2, but not eEF1A, stably resides in these non-translating ribosomes. This unique feature permits direct evaluation of ribosome status under various stress conditions and in the presence of translation inhibitors. Ribosome profiling reveals that the monosome has a similar but not identical pattern of ribosome footprints compared to the polysome. We show that the association of free ribosomal subunits minimally contributes to ribosome occupancy outside of the coding region. Our results not only offer a quantitative method to monitor ribosome availability, but also uncover additional layers of ribosome status needed to be considered in translational profiling analysis. PMID:27335722

  6. Alcoholic Liver Disease and the Mitochondrial Ribosome

    PubMed Central

    Cahill, Alan; Sykora, Peter

    2009-01-01

    Summary Chronic alcohol consumption has been shown to severely compromise mitochondrial protein synthesis. Hepatic mitochondria isolated from alcoholic animals contain decreased levels of respiratory complexes and display depressed respiration rates when compared to pair-fed controls. One underlying mechanism for this involves ethanol-elicited alterations in the structural and functional integrity of the mitochondrial ribosome. Ethanol feeding results in ribosomal changes that include decreased sedimentation rates, larger hydrodynamic volumes, increased levels of unassociated subunits and changes in the levels of specific ribosomal proteins. The methods presented in this chapter detail how to isolate mitochondrial ribosomes, determine ribosomal activity, separate ribosomes into nucleic acid and protein, and perform two-dimensional nonequilibrium pH gradient electrophoretic polyacrylamide gel electrophoresis to separate and subsequently identify mitochondrial ribosomal proteins. PMID:18369931

  7. NEDDylation promotes stress granule assembly

    PubMed Central

    Jayabalan, Aravinth Kumar; Sanchez, Anthony; Park, Ra Young; Yoon, Sang Pil; Kang, Gum-Yong; Baek, Je-Hyun; Anderson, Paul; Kee, Younghoon; Ohn, Takbum

    2016-01-01

    Stress granules (SGs) harbour translationally stalled messenger ribonucleoproteins and play important roles in regulating gene expression and cell fate. Here we show that neddylation promotes SG assembly in response to arsenite-induced oxidative stress. Inhibition or depletion of key components of the neddylation machinery concomitantly inhibits stress-induced polysome disassembly and SG assembly. Affinity purification and subsequent mass-spectrometric analysis of Nedd8-conjugated proteins from translationally stalled ribosomal fractions identified ribosomal proteins, translation factors and RNA-binding proteins (RBPs), including SRSF3, a previously known SG regulator. We show that SRSF3 is selectively neddylated at Lys85 in response to arsenite. A non-neddylatable SRSF3 (K85R) mutant do not prevent arsenite-induced polysome disassembly, but fails to support the SG assembly, suggesting that the neddylation pathway plays an important role in SG assembly. PMID:27381497

  8. {sup 30}S({alpha}, p) in X-Ray Bursts at CRIB

    SciTech Connect

    Kahl, D.; Kubono, S.; Binh, D. N.; Hashimoto, T.; Hayakawa, S.; Kurihara, Y.; Ohshiro, Y.; Yamaguchi, H.; Chen, A. A.; Chen, J.; Setoodeh nia, K.; Kaji, D.; Nishimura, S.; Kim, A.; Lee, N. H.; Wakabayashi, Y.

    2010-08-12

    Over the past three years, we have worked on developing a well-characterized {sup 30}S radioactive beam to be used in a future experiment aiming to directly measure the {sup 30}S({alpha}, p) stellar reaction rate within the Gamow window of Type I X-ray bursts.

  9. Chaperoning 5S RNA assembly

    PubMed Central

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-01-01

    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2–Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2–Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2–Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. PMID:26159998

  10. Ribosome engineering to promote new crystal forms

    SciTech Connect

    Selmer, Maria; Gao, Yong-Gui; Weixlbaumer, Albert; Ramakrishnan, V.

    2012-05-01

    Truncation of ribosomal protein L9 in T. thermophilus allows the generation of new crystal forms and the crystallization of ribosome–GTPase complexes. Crystallographic studies of the ribosome have provided molecular details of protein synthesis. However, the crystallization of functional complexes of ribosomes with GTPase translation factors proved to be elusive for a decade after the first ribosome structures were determined. Analysis of the packing in different 70S ribosome crystal forms revealed that regardless of the species or space group, a contact between ribosomal protein L9 from the large subunit and 16S rRNA in the shoulder of a neighbouring small subunit in the crystal lattice competes with the binding of GTPase elongation factors to this region of 16S rRNA. To prevent the formation of this preferred crystal contact, a mutant strain of Thermus thermophilus, HB8-MRCMSAW1, in which the ribosomal protein L9 gene has been truncated was constructed by homologous recombination. Mutant 70S ribosomes were used to crystallize and solve the structure of the ribosome with EF-G, GDP and fusidic acid in a previously unobserved crystal form. Subsequent work has shown the usefulness of this strain for crystallization of the ribosome with other GTPase factors.

  11. Neutron scattering in the ribosome structure

    NASA Astrophysics Data System (ADS)

    Serdyuk, Igor N.

    1997-02-01

    Thermal neutron scattering has become a powerful instrument for studying the ribosome and its components. The application of neutron scattering allowed to establish some principal features of the ribosome structure: non-homogeneous distribution of the RNA and protein within ribosomal particles, the RNA role as a framework in the arrangement and maintenance of the structure of ribosomal particles, and the globular character of ribosomal proteins. The use of selective deuteration of separate ribosomal proteins in combination with the triangulation method revealed mutual spatial arrangement (the 3D-map) of all the ribosomal proteins within the small particle and in the most part of the large ribosomal particle. An essential impact has been made in the structural studies of ribosomes with the development of novel experimental approaches: triple isotopic substitution and spin contrast variation. These approaches with direct interpretation of spherical harmonics provide new possibilities for constructing models of ribosomal particles, opening principally new perspectives for joint use of X-ray synchrotron diffraction in crystals and small-angle neutron scattering in solution.

  12. Control of ribosome formation in rat heart

    SciTech Connect

    Russo, L.A.

    1987-01-01

    Diabetes of 9 days duration produced a 17% diminution in the rate of total protein synthesis in rat hearts perfused as Langendorff preparations supplied with glucose, plasma levels of amino acids, and 400 ..mu..U/ml insulin. This reduction was attributable to a decrease in efficiency of protein synthesis and total RNA content. Total messenger RNA content decreased in diabetic hearts in proportion to the reduction in total RNA. Diabetes also resulted in diminished ribosome content as reflected by the induction in total RNA. Ribosome production was investigated by monitoring incorporation of (/sup 3/H)phenylalanine into the proteins of cytoplasmic ribosomes. Rates of ribosome formation in diabetic hearts were as fast as control rates in the presence of insulin, and were faster than control rates in the absence of the hormone. These results indicated that ribosome content fell in diabetic hearts despite unchanged or faster rates of ribosome formation.

  13. Dual use of GTP hydrolysis by elongation factor G on the ribosome

    PubMed Central

    Cunha, Carlos E.; Belardinelli, Riccardo; Peske, Frank; Holtkamp, Wolf; Wintermeyer, Wolfgang; Rodnina, Marina V.

    2013-01-01

    Elongation factor G (EF-G) is a GTPase that catalyzes tRNA and mRNA translocation during the elongation cycle of protein synthesis. The GTP-bound state of the factor on the ribosome has been studied mainly with non-hydrolyzable analogs of GTP, which led to controversial conclusions about the role of GTP hydrolysis in translocation. Here we describe a mutant of EF-G in which the catalytic His91 is replaced with Ala. The mutant EF-G does not hydrolyze GTP, but binds GTP with unchanged affinity, allowing us to study the function of the authentic GTP-bound form of EF-G in translocation. Utilizing fluorescent reporter groups attached to the tRNAs, mRNA, and the ribosome we compile the velocity map of translocation seen from different perspectives. The data suggest that GTP hydrolysis accelerates translocation up to 30-fold and facilitates conformational rearrangements of both 30S subunit (presumably the backward rotation of the 30S head) and EF-G that lead to the dissociation of the factor. Thus, EF-G combines the energy regime characteristic for motor proteins, accelerating movement by a conformational change induced by GTP hydrolysis, with that of a switch GTPase, which upon Pi release switches the conformations of EF-G and the ribosome to low affinity, allowing the dissociation of the factor. PMID:26824016

  14. Dual use of GTP hydrolysis by elongation factor G on the ribosome.

    PubMed

    Cunha, Carlos E; Belardinelli, Riccardo; Peske, Frank; Holtkamp, Wolf; Wintermeyer, Wolfgang; Rodnina, Marina V

    2013-01-01

    Elongation factor G (EF-G) is a GTPase that catalyzes tRNA and mRNA translocation during the elongation cycle of protein synthesis. The GTP-bound state of the factor on the ribosome has been studied mainly with non-hydrolyzable analogs of GTP, which led to controversial conclusions about the role of GTP hydrolysis in translocation. Here we describe a mutant of EF-G in which the catalytic His91 is replaced with Ala. The mutant EF-G does not hydrolyze GTP, but binds GTP with unchanged affinity, allowing us to study the function of the authentic GTP-bound form of EF-G in translocation. Utilizing fluorescent reporter groups attached to the tRNAs, mRNA, and the ribosome we compile the velocity map of translocation seen from different perspectives. The data suggest that GTP hydrolysis accelerates translocation up to 30-fold and facilitates conformational rearrangements of both 30S subunit (presumably the backward rotation of the 30S head) and EF-G that lead to the dissociation of the factor. Thus, EF-G combines the energy regime characteristic for motor proteins, accelerating movement by a conformational change induced by GTP hydrolysis, with that of a switch GTPase, which upon Pi release switches the conformations of EF-G and the ribosome to low affinity, allowing the dissociation of the factor. PMID:26824016

  15. The Cryo-EM Structure of a Complete 30S Translation Initiation Complex from Escherichia coli

    PubMed Central

    Julián, Patricia; Milon, Pohl; Agirrezabala, Xabier; Lasso, Gorka; Gil, David; Rodnina, Marina V.; Valle, Mikel

    2011-01-01

    Formation of the 30S initiation complex (30S IC) is an important checkpoint in regulation of gene expression. The selection of mRNA, correct start codon, and the initiator fMet-tRNAfMet requires the presence of three initiation factors (IF1, IF2, IF3) of which IF3 and IF1 control the fidelity of the process, while IF2 recruits fMet-tRNAfMet. Here we present a cryo-EM reconstruction of the complete 30S IC, containing mRNA, fMet-tRNAfMet, IF1, IF2, and IF3. In the 30S IC, IF2 contacts IF1, the 30S subunit shoulder, and the CCA end of fMet-tRNAfMet, which occupies a novel P/I position (P/I1). The N-terminal domain of IF3 contacts the tRNA, whereas the C-terminal domain is bound to the platform of the 30S subunit. Binding of initiation factors and fMet-tRNAfMet induces a rotation of the head relative to the body of the 30S subunit, which is likely to prevail through 50S subunit joining until GTP hydrolysis and dissociation of IF2 take place. The structure provides insights into the mechanism of mRNA selection during translation initiation. PMID:21750663

  16. The Cryo-EM structure of a complete 30S translation initiation complex from Escherichia coli.

    PubMed

    Julián, Patricia; Milon, Pohl; Agirrezabala, Xabier; Lasso, Gorka; Gil, David; Rodnina, Marina V; Valle, Mikel

    2011-07-01

    Formation of the 30S initiation complex (30S IC) is an important checkpoint in regulation of gene expression. The selection of mRNA, correct start codon, and the initiator fMet-tRNA(fMet) requires the presence of three initiation factors (IF1, IF2, IF3) of which IF3 and IF1 control the fidelity of the process, while IF2 recruits fMet-tRNA(fMet). Here we present a cryo-EM reconstruction of the complete 30S IC, containing mRNA, fMet-tRNA(fMet), IF1, IF2, and IF3. In the 30S IC, IF2 contacts IF1, the 30S subunit shoulder, and the CCA end of fMet-tRNA(fMet), which occupies a novel P/I position (P/I1). The N-terminal domain of IF3 contacts the tRNA, whereas the C-terminal domain is bound to the platform of the 30S subunit. Binding of initiation factors and fMet-tRNA(fMet) induces a rotation of the head relative to the body of the 30S subunit, which is likely to prevail through 50S subunit joining until GTP hydrolysis and dissociation of IF2 take place. The structure provides insights into the mechanism of mRNA selection during translation initiation. PMID:21750663

  17. Molecular mechanisms of ribosomal protein gene coregulation.

    PubMed

    Reja, Rohit; Vinayachandran, Vinesh; Ghosh, Sujana; Pugh, B Franklin

    2015-09-15

    The 137 ribosomal protein genes (RPGs) of Saccharomyces provide a model for gene coregulation. We examined the positional and functional organization of their regulators (Rap1 [repressor activator protein 1], Fhl1, Ifh1, Sfp1, and Hmo1), the transcription machinery (TFIIB, TFIID, and RNA polymerase II), and chromatin at near-base-pair resolution using ChIP-exo, as RPGs are coordinately reprogrammed. Where Hmo1 is enriched, Fhl1, Ifh1, Sfp1, and Hmo1 cross-linked broadly to promoter DNA in an RPG-specific manner and demarcated by general minor groove widening. Importantly, Hmo1 extended 20-50 base pairs (bp) downstream from Fhl1. Upon RPG repression, Fhl1 remained in place. Hmo1 dissociated, which was coupled to an upstream shift of the +1 nucleosome, as reflected by the Hmo1 extension and core promoter region. Fhl1 and Hmo1 may create two regulatable and positionally distinct barriers, against which chromatin remodelers position the +1 nucleosome into either an activating or a repressive state. Consistent with in vitro studies, we found that specific TFIID subunits, in addition to cross-linking at the core promoter, made precise cross-links at Rap1 sites, which we interpret to reflect native Rap1-TFIID interactions. Our findings suggest how sequence-specific DNA binding regulates nucleosome positioning and transcription complex assembly >300 bp away and how coregulation coevolved with coding sequences. PMID:26385964

  18. Tricks an IRES uses to enslave ribosomes

    PubMed Central

    2012-01-01

    In eukaryotes, mRNAs are primarily translated through a cap-dependent mechanism whereby initiation factors recruit the 40S ribosomal subunit to a cap structure at the 5’ end of the mRNA. However, some viral and cellular messages initiate protein synthesis without a cap. They use a structured RNA element termed an internal ribosome entry site (IRES) to recruit the 40S ribosomal subunit. IRESs were discovered over 20 years ago but only recently have studies using a model IRES from dicistroviruses expanded our understanding of how a three dimensional RNA structure can capture and manipulate the ribosome to initiate translation. PMID:22944245

  19. Scattering studies on ribosomes in solution

    NASA Astrophysics Data System (ADS)

    Ramakrishnan, V.

    1986-02-01

    Ribosomes are organelles that play a central role in protein synthesis. They are complexes of protein and nucleic acid, and can be analysed as two-component systems by neutron scattering. Moreover, ribosomes can be biochemically prepared that have specific proteins deuterated. Both these properties have been exploited to study the structure of the ribosome by neutron scattering. This article reviews the studies carried out on the small ribosomal subunit, and describes a recent study that has resolved a conflict between the results of two classes of experiments.

  20. Plastid ribosomal protein S5 is involved in photosynthesis, plant development, and cold stress tolerance in Arabidopsis.

    PubMed

    Zhang, Junxiang; Yuan, Hui; Yang, Yong; Fish, Tara; Lyi, Sangbom M; Thannhauser, Theodore W; Zhang, Lugang; Li, Li

    2016-04-01

    Plastid ribosomal proteins are essential components of protein synthesis machinery and have diverse roles in plant growth and development. Mutations in plastid ribosomal proteins lead to a range of developmental phenotypes in plants. However, how they regulate these processes is not fully understood, and the functions of some individual plastid ribosomal proteins remain unknown. To identify genes responsible for chloroplast development, we isolated and characterized a mutant that exhibited pale yellow inner leaves with a reduced growth rate in Arabidopsis. The mutant (rps5) contained a missense mutation of plastid ribosomal protein S5 (RPS5), which caused a dramatically reduced abundance of chloroplast 16S rRNA and seriously impaired 16S rRNA processing to affect ribosome function and plastid translation. Comparative proteomic analysis revealed that the rps5 mutation suppressed the expression of a large number of core components involved in photosystems I and II as well as many plastid ribosomal proteins. Unexpectedly, a number of proteins associated with cold stress responses were greatly decreased in rps5, and overexpression of the plastid RPS5 improved plant cold stress tolerance. Our results indicate that RPS5 is an important constituent of the plastid 30S subunit and affects proteins involved in photosynthesis and cold stress responses to mediate plant growth and development. PMID:27006483

  1. Function and ribosomal localization of aIF6, a translational regulator shared by archaea and eukarya

    PubMed Central

    Benelli, Dario; Marzi, Stefano; Mancone, Carmine; Alonzi, Tonino; la Teana, Anna; Londei, Paola

    2009-01-01

    The translation factor IF6 is shared by the Archaea and the Eukarya, but is not found in Bacteria. The properties of eukaryal IF6 (eIF6) have been extensively studied, but remain somewhat elusive. eIF6 behaves as a ribosome-anti-association factor and is involved in miRNA-mediated gene silencing; however, it also seems to participate in ribosome synthesis and export. Here we have determined the function and ribosomal localization of the archaeal (Sulfolobus solfataricus) IF6 homologue (aIF6). We find that aIF6 binds specifically to the 50S ribosomal subunits, hindering the formation of 70S ribosomes and strongly inhibiting translation. aIF6 is uniformly expressed along the cell cycle, but it is upregulated following both cold- and heat shock. The aIF6 ribosomal binding site lies in the middle of the 30-S interacting surface of the 50S subunit, including a number of critical RNA and protein determinants involved in subunit association. The data suggest that the IF6 protein evolved in the archaeal–eukaryal lineage to modulate translational efficiency under unfavourable environmental conditions, perhaps acquiring additional functions during eukaryotic evolution. PMID:19036786

  2. Plastid ribosomal protein S5 is involved in photosynthesis, plant development, and cold stress tolerance in Arabidopsis

    PubMed Central

    Zhang, Junxiang; Yuan, Hui; Yang, Yong; Fish, Tara; Lyi, Sangbom M.; Thannhauser, Theodore W; Zhang, Lugang; Li, Li

    2016-01-01

    Plastid ribosomal proteins are essential components of protein synthesis machinery and have diverse roles in plant growth and development. Mutations in plastid ribosomal proteins lead to a range of developmental phenotypes in plants. However, how they regulate these processes is not fully understood, and the functions of some individual plastid ribosomal proteins remain unknown. To identify genes responsible for chloroplast development, we isolated and characterized a mutant that exhibited pale yellow inner leaves with a reduced growth rate in Arabidopsis. The mutant (rps5) contained a missense mutation of plastid ribosomal protein S5 (RPS5), which caused a dramatically reduced abundance of chloroplast 16S rRNA and seriously impaired 16S rRNA processing to affect ribosome function and plastid translation. Comparative proteomic analysis revealed that the rps5 mutation suppressed the expression of a large number of core components involved in photosystems I and II as well as many plastid ribosomal proteins. Unexpectedly, a number of proteins associated with cold stress responses were greatly decreased in rps5, and overexpression of the plastid RPS5 improved plant cold stress tolerance. Our results indicate that RPS5 is an important constituent of the plastid 30S subunit and affects proteins involved in photosynthesis and cold stress responses to mediate plant growth and development. PMID:27006483

  3. Maize reas1 Mutant Stimulates Ribosome Use Efficiency and Triggers Distinct Transcriptional and Translational Responses1[OPEN

    PubMed Central

    Qi, Weiwei; Zhu, Jie; Wu, Qiao; Wang, Qun; Li, Xia; Yao, Dongsheng; Jin, Ying; Wang, Gang; Wang, Guifeng

    2016-01-01

    Ribosome biogenesis is a fundamental cellular process in all cells. Impaired ribosome biogenesis causes developmental defects; however, its molecular and cellular bases are not fully understood. We cloned a gene responsible for a maize (Zea mays) small seed mutant, dek* (for defective kernel), and found that it encodes Ribosome export associated1 (ZmReas1). Reas1 is an AAA-ATPase that controls 60S ribosome export from the nucleus to the cytoplasm after ribosome maturation. dek* is a weak mutant allele with decreased Reas1 function. In dek* cells, mature 60S ribosome subunits are reduced in the nucleus and cytoplasm, but the proportion of actively translating polyribosomes in cytosol is significantly increased. Reduced phosphorylation of eukaryotic initiation factor 2α and the increased elongation factor 1α level indicate an enhancement of general translational efficiency in dek* cells. The mutation also triggers dramatic changes in differentially transcribed genes and differentially translated RNAs. Discrepancy was observed between differentially transcribed genes and differentially translated RNAs, indicating distinct cellular responses at transcription and translation levels to the stress of defective ribosome processing. DNA replication and nucleosome assembly-related gene expression are selectively suppressed at the translational level, resulting in inhibited cell growth and proliferation in dek* cells. This study provides insight into cellular responses due to impaired ribosome biogenesis. PMID:26645456

  4. The Ribosome-Sec61 Translocon Complex Forms a Cytosolically Restricted Environment for Early Polytopic Membrane Protein Folding.

    PubMed

    Patterson, Melissa A; Bandyopadhyay, Anannya; Devaraneni, Prasanna K; Woodward, Josha; Rooney, LeeAnn; Yang, Zhongying; Skach, William R

    2015-11-27

    Transmembrane topology of polytopic membrane proteins (PMPs) is established in the endoplasmic reticulum (ER) by the ribosome Sec61-translocon complex (RTC) through iterative cycles of translocation initiation and termination. It remains unknown, however, whether tertiary folding of transmembrane domains begins after the nascent polypeptide integrates into the lipid bilayer or within a proteinaceous environment proximal to translocon components. To address this question, we used cysteine scanning mutagenesis to monitor aqueous accessibility of stalled translation intermediates to determine when, during biogenesis, hydrophilic peptide loops of the aquaporin-4 (AQP4) water channel are delivered to cytosolic and lumenal compartments. Results showed that following ribosome docking on the ER membrane, the nascent polypeptide was shielded from the cytosol as it emerged from the ribosome exit tunnel. Extracellular loops followed a well defined path through the ribosome, the ribosome translocon junction, the Sec61-translocon pore, and into the ER lumen coincident with chain elongation. In contrast, intracellular loops (ICLs) and C-terminalresidues exited the ribosome into a cytosolically shielded environment and remained inaccessible to both cytosolic and lumenal compartments until translation was terminated. Shielding of ICL1 and ICL2, but not the C terminus, became resistant to maneuvers that disrupt electrostatic ribosome interactions. Thus, the early folding landscape of polytopic proteins is shaped by a spatially restricted environment localized within the assembled ribosome translocon complex. PMID:26254469

  5. A tRNA methyltransferase paralog is important for ribosome stability and cell division in Trypanosoma brucei.

    PubMed

    Fleming, Ian M C; Paris, Zdeněk; Gaston, Kirk W; Balakrishnan, R; Fredrick, Kurt; Rubio, Mary Anne T; Alfonzo, Juan D

    2016-01-01

    Most eukaryotic ribosomes contain 26/28S, 5S, and 5.8S large subunit ribosomal RNAs (LSU rRNAs) in addition to the 18S rRNA of the small subunit (SSU rRNA). However, in kinetoplastids, a group of organisms that include medically important members of the genus Trypanosoma and Leishmania, the 26/28S large subunit ribosomal RNA is uniquely composed of 6 rRNA fragments. In addition, recent studies have shown the presence of expansion segments in the large ribosomal subunit (60S) of Trypanosoma brucei. Given these differences in structure, processing and assembly, T. brucei ribosomes may require biogenesis factors not found in other organisms. Here, we show that one of two putative 3-methylcytidine methyltransferases, TbMTase37 (a homolog of human methyltransferase-like 6, METTL6), is important for ribosome stability in T. brucei. TbMTase37 localizes to the nucleolus and depletion of the protein results in accumulation of ribosomal particles lacking srRNA 4 and reduced levels of polysome associated ribosomes. We also find that TbMTase37 plays a role in cytokinesis, as loss of the protein leads to multi-flagellated and multi-nucleated cells. PMID:26888608

  6. A tRNA methyltransferase paralog is important for ribosome stability and cell division in Trypanosoma brucei

    PubMed Central

    Fleming, Ian M. C.; Paris, Zdeněk; Gaston, Kirk W.; Balakrishnan, R.; Fredrick, Kurt; Rubio, Mary Anne T.; Alfonzo, Juan D.

    2016-01-01

    Most eukaryotic ribosomes contain 26/28S, 5S, and 5.8S large subunit ribosomal RNAs (LSU rRNAs) in addition to the 18S rRNA of the small subunit (SSU rRNA). However, in kinetoplastids, a group of organisms that include medically important members of the genus Trypanosoma and Leishmania, the 26/28S large subunit ribosomal RNA is uniquely composed of 6 rRNA fragments. In addition, recent studies have shown the presence of expansion segments in the large ribosomal subunit (60S) of Trypanosoma brucei. Given these differences in structure, processing and assembly, T. brucei ribosomes may require biogenesis factors not found in other organisms. Here, we show that one of two putative 3-methylcytidine methyltransferases, TbMTase37 (a homolog of human methyltransferase-like 6, METTL6), is important for ribosome stability in T. brucei. TbMTase37 localizes to the nucleolus and depletion of the protein results in accumulation of ribosomal particles lacking srRNA 4 and reduced levels of polysome associated ribosomes. We also find that TbMTase37 plays a role in cytokinesis, as loss of the protein leads to multi-flagellated and multi-nucleated cells. PMID:26888608

  7. Translation Initiation is Controlled by RNA Folding Kinetics via a Ribosome Drafting Mechanism.

    PubMed

    Espah Borujeni, Amin; Salis, Howard M

    2016-06-01

    RNA folding plays an important role in controlling protein synthesis as well as other cellular processes. Existing models have focused on how RNA folding energetics control translation initiation rate under equilibrium conditions but have largely ignored the effects of nonequilibrium RNA folding. We introduce a new mechanism, called "ribosome drafting", that explains how a mRNA's folding kinetics and the ribosome's binding rate collectively control its translation initiation rate. During cycles of translation, ribosome drafting emerges whenever successive ribosomes bind to a mRNA faster than the mRNA can refold, maintaining it in a nonequilibrium state with an acceleration of protein synthesis. Using computational design, time-correlated single photon counting, and expression measurements, we demonstrate that slow-folding and fast-folding RNA structures with equivalent folding energetics can vary protein synthesis rates by 1000-fold. We determine the necessary conditions for ribosome drafting by characterizing mRNAs with rationally designed ribosome binding rates, folding kinetics, and folding energetics, confirming the predictions of a nonequilibrium Markov model of translation. Our results have widespread implications, illustrating how competitive folding and assembly kinetics can shape the gene expression machinery's sequence-structure-function relationship inside cells. PMID:27199273

  8. Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation.

    PubMed

    Al-Hadid, Qais; White, Jonelle; Clarke, Steven

    2016-02-12

    A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. PMID:26801560

  9. Ribosome biogenesis in replicating cells: Integration of experiment and theory.

    PubMed

    Earnest, Tyler M; Cole, John A; Peterson, Joseph R; Hallock, Michael J; Kuhlman, Thomas E; Luthey-Schulten, Zaida

    2016-10-01

    Ribosomes-the primary macromolecular machines responsible for translating the genetic code into proteins-are complexes of precisely folded RNA and proteins. The ways in which their production and assembly are managed by the living cell is of deep biological importance. Here we extend a recent spatially resolved whole-cell model of ribosome biogenesis in a fixed volume [Earnest et al., Biophys J 2015, 109, 1117-1135] to include the effects of growth, DNA replication, and cell division. All biological processes are described in terms of reaction-diffusion master equations and solved stochastically using the Lattice Microbes simulation software. In order to determine the replication parameters, we construct and analyze a series of Escherichia coli strains with fluorescently labeled genes distributed evenly throughout their chromosomes. By measuring these cells' lengths and number of gene copies at the single-cell level, we could fit a statistical model of the initiation and duration of chromosome replication. We found that for our slow-growing (120 min doubling time) E. coli cells, replication was initiated 42 min into the cell cycle and completed after an additional 42 min. While simulations of the biogenesis model produce the correct ribosome and mRNA counts over the cell cycle, the kinetic parameters for transcription and degradation are lower than anticipated from a recent analytical time dependent model of in vivo mRNA production. Describing expression in terms of a simple chemical master equation, we show that the discrepancies are due to the lack of nonribosomal genes in the extended biogenesis model which effects the competition of mRNA for ribosome binding, and suggest corrections to parameters to be used in the whole-cell model when modeling expression of the entire transcriptome. © 2016 Wiley Periodicals, Inc. Biopolymers 105: 735-751, 2016. PMID:27294303

  10. Biphasic character of ribosomal translocation and non-Michaelis-Menten kinetics of translation

    NASA Astrophysics Data System (ADS)

    Xie, Ping

    2014-12-01

    We study theoretically the kinetics of mRNA translocation in the wild-type (WT) Escherichia coli ribosome, which is composed of a small 30 S and large 50 S subunit, and the ribosomes with mutations to some intersubunit bridges such as B1a, B4, B7a, and B8. The theoretical results reproduce well the available in vitro experimental data on the biphasic kinetics of the forward mRNA translocation catalyzed by elongation factor G (EF-G) hydrolyzing GTP, which can be best fit by the sum of two exponentials, and the monophasic kinetics of the spontaneous reverse mRNA translocation in the absence of the elongation factor, which can be best fit by a single-exponential function, in both the WT and mutant ribosomes. We show that both the mutation-induced increase in the maximal rate of the slow phase for the forward mRNA translocation and that in the rate of the spontaneous reverse mRNA translocation result from a reduction in the intrinsic energy barrier to resist the rotational movements between the two subunits, giving the same degree of increase in the two rates. The mutation-induced increase in the maximal rate of the fast phase for the forward mRNA translocation results mainly from the increase in the rate of the ribosomal unlocking, a conformational change in the ribosome that widens the mRNA channel for the mRNA translocation to take place, which could be partly due to the effect of the mutation on the intrasubunit 30S head rotation. Moreover, we study the translation rate of the WT and mutant ribosomes. It is shown that the translation rate versus the concentration of EF-G-GTP does not follow the Michaelis-Menten (MM) kinetics, which is in sharp contrast to the general property of other enzymes that the rate of the enzymatic reaction versus the concentration of a substrate follows the MM kinetics. The physical origin of this non-MM kinetics for the ribosome is revealed.

  11. Mutational robustness of 16S ribosomal RNA, shown by experimental horizontal gene transfer in Escherichia coli

    PubMed Central

    Kitahara, Kei; Yasutake, Yoshiaki; Miyazaki, Kentaro

    2012-01-01

    The bacterial ribosome consists of three rRNA molecules and 57 proteins and plays a crucial role in translating mRNA-encoded information into proteins. Because of the ribosome’s structural and mechanistic complexity, it is believed that each ribosomal component coevolves to maintain its function. Unlike 5S rRNA, 16S and 23S rRNAs appear to lack mutational robustness, because they form the structural core of the ribosome. However, using Escherichia coli Δ7 (null mutant of operons) as a host, we have recently shown that an active hybrid ribosome whose 16S rRNA has been specifically substituted with that from non–E. coli bacteria can be reconstituted in vivo. To investigate the mutational robustness of 16S rRNA and the structural basis for its functionality, we used a metagenomic approach to screen for 16S rRNA genes that complement the growth of E. coli Δ7. Various functional genes were obtained from the Gammaproteobacteria and Betaproteobacteria lineages. Despite the large sequence diversity (80.9–99.0% identity with E. coli 16S rRNA) of the functional 16S rRNA molecules, the doubling times (DTs) of each mutant increased only modestly with decreasing sequence identity (average increase in DT, 4.6 s per mutation). The three-dimensional structure of the 30S ribosome showed that at least 40.7% (628/1,542) of the nucleotides were variable, even at ribosomal protein-binding sites, provided that the secondary structures were properly conserved. Our results clearly demonstrate that 16S rRNA functionality largely depends on the secondary structure but not on the sequence itself. PMID:23112186

  12. Ribosome Mechanics Informs about Mechanism.

    PubMed

    Zimmermann, Michael T; Jia, Kejue; Jernigan, Robert L

    2016-02-27

    The essential aspects of the ribosome's mechanism can be extracted from coarse-grained simulations, including the ratchet motion, the movement together of critical bases at the decoding center, and movements of the peptide tunnel lining that assist in the expulsion of the synthesized peptide. Because of its large size, coarse graining helps to simplify and to aid in the understanding of its mechanism. Results presented here utilize coarse-grained elastic network modeling to extract the dynamics, and both RNAs and proteins are coarse grained. We review our previous results, showing the well-known ratchet motions and the motions in the peptide tunnel and in the mRNA tunnel. The motions of the lining of the peptide tunnel appear to assist in the expulsion of the growing peptide chain, and clamps at the ends of the mRNA tunnel with three proteins ensure that the mRNA is held tightly during decoding and essential for the helicase activity at the entrance. The entry clamp may also assist in base recognition to ensure proper selection of the incoming tRNA. The overall precision of the ribosome machine-like motions is remarkable. PMID:26687034

  13. Mitomycin C Inhibits Ribosomal RNA

    PubMed Central

    Snodgrass, Ryan G.; Collier, Abby C.; Coon, Amy E.; Pritsos, Chris A.

    2010-01-01

    Mitomycin C (MMC) is a commonly used and extensively studied chemotherapeutic agent requiring biological reduction for activity. Damage to nuclear DNA is thought to be its primary mechanism of cell death. Due to a lack of evidence for significant MMC activation in the nucleus and for in vivo studies demonstrating the formation of MMC-DNA adducts, we chose to investigate alternative nucleic acid targets. Real-time reverse transcription-PCR was used to determine changes in mitochondrial gene expression induced by MMC treatment. Although no consistent effects on mitochondrial mRNA expression were observed, complementary results from reverse transcription-PCR experiments and gel-shift and binding assays demonstrated that MMC rapidly decreased the transcript levels of 18S ribosomal RNA in a concentration-dependent manner. Under hypoxic conditions, transcript levels of 18S rRNA decreased by 1.5-fold compared with untreated controls within 30 min. Recovery to base line required several hours, indicating that de novo synthesis of 18S was necessary. Addition of MMC to an in vitro translation reaction significantly decreased protein production in the cell-free system. Functional assays performed using a luciferase reporter construct in vivo determined that protein translation was inhibited, further confirming this mechanism of toxicity. The interaction of MMC with ribosomal RNA and subsequent inhibition of protein translation is consistent with mechanisms proposed for other natural compounds. PMID:20418373

  14. Ribosome hijacking: a role for small protein B during trans-translation

    PubMed Central

    Nonin-Lecomte, Sylvie; Germain-Amiot, Noella; Gillet, Reynald; Hallier, Marc; Ponchon, Luc; Dardel, Frédéric; Felden, Brice

    2009-01-01

    Tight recognition of codon–anticodon pairings by the ribosome ensures the accuracy and fidelity of protein synthesis. In eubacteria, translational surveillance and ribosome rescue are performed by the ‘tmRNA–SmpB' system (transfer messenger RNA–small protein B). Remarkably, entry and accommodation of aminoacylated-tmRNA into stalled ribosomes occur without a codon–anticodon interaction but in the presence of SmpB. Here, we show that within a stalled ribosome, SmpB interacts with the three universally conserved bases G530, A1492 and A1493 that form the 30S subunit decoding centre, in which canonical codon–anticodon pairing occurs. The footprints at positions A1492 and A1493 of a small decoding centre, as well as on a set of conserved SmpB amino acids, were identified by nuclear magnetic resonance. Mutants at these residues display the same growth defects as for ΔsmpB strains. The SmpB protein has functional and structural similarities with initiation factor 1, and is proposed to be a functional mimic of the pairing between a codon and an anticodon. PMID:19132006

  15. Biochemical characterization of three mycobacterial ribosomal fractions.

    PubMed

    Portelance, V; Beaudet, R

    1983-02-01

    The induction of antituberculous immunity by crude ribosomal fractions isolated from Mycobacterium tuberculosis strain H37Ra, M. bovis strain BCG, and M. smegmatis was studied in CF-1 mice. Levels of antituberculous immunity similar to that induced by live BCG were induced by the BCG and H37Ra ribosomal fractions whereas that isolated from M. smegmatis was found to be inactive. Electrophoresis of the three ribosomal fractions in sodium dodecyl sulfate - polyacylamide gels followed by differential staining showed the two active ribosomal fractions to be similar in their proteins, carbohydrate-containing substances, and lipid profiles. The inactive smegmatis ribosomal fraction differed mainly from the active ones on the basis of its carbohydrate-containing substances profile and by the absence of lipids. The polysaccharides and the ribosomes present in the H37Ra ribosomal fractions were purified by affinity chromatography on concanavalin A - Sepharose 4B. Each purified preparation showed no or only low antituberculous activity when injected separately, but when mixed together a high protection was observed. The formation of complexes between the ribosomes and the polysaccharide fraction was suggested and appears to be necessary for the induction of antituberculous immunity. PMID:6189570

  16. Ribosome flow model with positive feedback

    PubMed Central

    Margaliot, Michael; Tuller, Tamir

    2013-01-01

    Eukaryotic mRNAs usually form a circular structure; thus, ribosomes that terminatae translation at the 3′ end can diffuse with increased probability to the 5′ end of the transcript, initiating another cycle of translation. This phenomenon describes ribosomal flow with positive feedback—an increase in the flow of ribosomes terminating translating the open reading frame increases the ribosomal initiation rate. The aim of this paper is to model and rigorously analyse translation with feedback. We suggest a modified version of the ribosome flow model, called the ribosome flow model with input and output. In this model, the input is the initiation rate and the output is the translation rate. We analyse this model after closing the loop with a positive linear feedback. We show that the closed-loop system admits a unique globally asymptotically stable equilibrium point. From a biophysical point of view, this means that there exists a unique steady state of ribosome distributions along the mRNA, and thus a unique steady-state translation rate. The solution from any initial distribution will converge to this steady state. The steady-state distribution demonstrates a decrease in ribosome density along the coding sequence. For the case of constant elongation rates, we obtain expressions relating the model parameters to the equilibrium point. These results may perhaps be used to re-engineer the biological system in order to obtain a desired translation rate. PMID:23720534

  17. Evolution of the ribosome at atomic resolution

    PubMed Central

    Petrov, Anton S.; Bernier, Chad R.; Hsiao, Chiaolong; Norris, Ashlyn M.; Kovacs, Nicholas A.; Waterbury, Chris C.; Stepanov, Victor G.; Harvey, Stephen C.; Fox, George E.; Wartell, Roger M.; Hud, Nicholas V.; Williams, Loren Dean

    2014-01-01

    The origins and evolution of the ribosome, 3–4 billion years ago, remain imprinted in the biochemistry of extant life and in the structure of the ribosome. Processes of ribosomal RNA (rRNA) expansion can be “observed” by comparing 3D rRNA structures of bacteria (small), yeast (medium), and metazoans (large). rRNA size correlates well with species complexity. Differences in ribosomes across species reveal that rRNA expansion segments have been added to rRNAs without perturbing the preexisting core. Here we show that rRNA growth occurs by a limited number of processes that include inserting a branch helix onto a preexisting trunk helix and elongation of a helix. rRNA expansions can leave distinctive atomic resolution fingerprints, which we call “insertion fingerprints.” Observation of insertion fingerprints in the ribosomal common core allows identification of probable ancestral expansion segments. Conceptually reversing these expansions allows extrapolation backward in time to generate models of primordial ribosomes. The approach presented here provides insight to the structure of pre-last universal common ancestor rRNAs and the subsequent expansions that shaped the peptidyl transferase center and the conserved core. We infer distinct phases of ribosomal evolution through which ribosomal particles evolve, acquiring coding and translocation, and extending and elaborating the exit tunnel. PMID:24982194

  18. Specific interaction between EF-G and RRF and its implication for GTP-dependent ribosome splitting into subunits

    PubMed Central

    Gao, Ning; Zavialov, Andrey V.; Ehrenberg, Måns; Frank, Joachim

    2008-01-01

    Summary After termination of protein synthesis, the bacterial ribosome is split into its 30S and 50S subunits by the action of ribosome recycling factor (RRF) and elongation factor G (EF-G) in a GTP-hydrolysis dependent manner. Based on a previous cryo-electron microscopy (cryo-EM) study of ribosomal complexes, we have proposed that the binding of EF-G to an RRF containing post-termination ribosome triggers an inter-domain rotation of RRF, which destabilizes two strong intersubunit bridges (B2a and B3) and, ultimately, separates the two subunits. Here, we present a 9 Å (FSC at 0.5 cutoff) cryo-EM map of a 50S EFG GDPNP RRF complex and a quasi-atomic model derived from it, showing the interaction between EF-G and RRF on the 50S subunit in the presence of the non-cleavable GTP analogue GDPNP. The detailed information in this model and a comparative analysis of EF-G structures in various nucleotide- and ribosome-bound states show how rotation of the RRF head domain may be triggered by various domains of EF-G. For validation of our structural model, all known mutations in EF-G and RRF that relate to ribosome recycling have been taken into account. More importantly, our results indicate a substantial conformational change in the Switch I region of EF-G, suggesting that a conformational signal transduction mechanism, similar to that employed in tRNA translocation on the ribosome by EF-G, translates a large-scale movement of EF-G’s domain IV, induced by GTP hydrolysis, into the domain rotation of RRF that eventually splits the ribosome into subunits. PMID:17996252

  19. Scanning of 16S Ribosomal RNA for Peptide Nucleic Acid Targets.

    PubMed

    Górska, Anna; Markowska-Zagrajek, Agnieszka; Równicki, Marcin; Trylska, Joanna

    2016-08-25

    We have designed a protocol and server to aid in the search for putative binding sites in 16S rRNA that could be targeted by peptide nucleic acid oligomers. Various features of 16S rRNA were considered to score its regions as potential targets for sequence-specific binding that could result in inhibition of ribosome function. Specifically, apart from the functional importance of a particular rRNA region, we calculated its accessibility, flexibility, energetics of strand invasion by an oligomer, as well as similarity to human rRNA. To determine 16S rRNA flexibility in the ribosome context, we performed all-atom molecular dynamics simulations of the 30S subunit in explicit solvent. We proposed a few 16S RNA target sites, and one of them was tested experimentally to verify inhibition of bacterial growth by a peptide nucleic acid oligomer. PMID:27105576

  20. Complementary roles of initiation factor 1 and ribosome recycling factor in 70S ribosome splitting

    PubMed Central

    Pavlov, Michael Y; Antoun, Ayman; Lovmar, Martin; Ehrenberg, Måns

    2008-01-01

    We demonstrate that ribosomes containing a messenger RNA (mRNA) with a strong Shine–Dalgarno sequence are rapidly split into subunits by initiation factors 1 (IF1) and 3 (IF3), but slowly split by ribosome recycling factor (RRF) and elongation factor G (EF-G). Post-termination-like (PTL) ribosomes containing mRNA and a P-site-bound deacylated transfer RNA (tRNA) are split very rapidly by RRF and EF-G, but extremely slowly by IF1 and IF3. Vacant ribosomes are split by RRF/EF-G much more slowly than PTL ribosomes and by IF1/IF3 much more slowly than mRNA-containing ribosomes. These observations reveal complementary splitting of different ribosomal complexes by IF1/IF3 and RRF/EF-G, and suggest the existence of two major pathways for ribosome splitting into subunits in the living cell. We show that the identity of the deacylated tRNA in the PTL ribosome strongly affects the rate by which it is split by RRF/EF-G and that IF3 is involved in the mechanism of ribosome splitting by IF1/IF3 but not by RRF/EF-G. With support from our experimental data, we discuss the principally different mechanisms of ribosome splitting by IF1/IF3 and by RRF/EF-G. PMID:18497739

  1. Aggregation of Ribosomal Protein S6 at Nucleolus Is Cell Cycle-Controlled and Its Function in Pre-rRNA Processing Is Phosphorylation Dependent.

    PubMed

    Zhang, Duo; Chen, Hui-Peng; Duan, Hai-Feng; Gao, Li-Hua; Shao, Yong; Chen, Ke-Yan; Wang, You-Liang; Lan, Feng-Hua; Hu, Xian-Wen

    2016-07-01

    Ribosomal protein S6 (rpS6) has long been regarded as one of the primary r-proteins that functions in the early stage of 40S subunit assembly, but its actual role is still obscure. The correct forming of 18S rRNA is a key step in the nuclear synthesis of 40S subunit. In this study, we demonstrate that rpS6 participates in the processing of 30S pre-rRNA to 18S rRNA only when its C-terminal five serines are phosphorylated, however, the process of entering the nucleus and then targeting the nucleolus does not dependent its phosphorylation. Remarkably, we also find that the aggregation of rpS6 at the nucleolus correlates to the phasing of cell cycle, beginning to concentrate in the nucleolus at later S phase and disaggregate at M phase. J. Cell. Biochem. 117: 1649-1657, 2016. © 2015 Wiley Periodicals, Inc. PMID:26639987

  2. Viral IRES RNA structures and ribosome interactions.

    PubMed

    Kieft, Jeffrey S

    2008-06-01

    In eukaryotes, protein synthesis initiates primarily by a mechanism that requires a modified nucleotide 'cap' on the mRNA and also proteins that recruit and position the ribosome. Many pathogenic viruses use an alternative, cap-independent mechanism that substitutes RNA structure for the cap and many proteins. The RNAs driving this process are called internal ribosome-entry sites (IRESs) and some are able to bind the ribosome directly using a specific 3D RNA structure. Recent structures of IRES RNAs and IRES-ribosome complexes are revealing the structural basis of viral IRES' 'hijacking' of the protein-making machinery. It now seems that there are fundamental differences in the 3D structures used by different IRESs, although there are some common features in how they interact with ribosomes. PMID:18468443

  3. Differential Stoichiometry among Core Ribosomal Proteins

    PubMed Central

    Slavov, Nikolai; Semrau, Stefan; Airoldi, Edoardo; Budnik, Bogdan; van Oudenaarden, Alexander

    2015-01-01

    Summary Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs), some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC) and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function. PMID:26565899

  4. Ribosome defects in disorders of erythropoiesis.

    PubMed

    Narla, Anupama; Hurst, Slater N; Ebert, Benjamin L

    2011-02-01

    Over the past decade, genetic lesions that cause ribosome dysfunction have been identified in both congenital and acquired human disorders. These discoveries have established a new category of disorders, known as ribosomopathies, in which the primary pathophysiology is related to impaired ribosome function. The protoptypical disorders are Diamond-Blackfan anemia, a congenital bone marrow failure syndrome, and the 5q- syndrome, a subtype of myelodysplastic syndrome. In both of these disorders, impaired ribosome function causes a severe macrocytic anemia. In this review, we will discuss the evidence that defects in ribosomal biogenesis cause the hematologic phenotype of Diamond-Blackfan anemia and the 5q- syndrome. We will also explore the potential mechanisms by which a ribosomal defect, which would be expected to have widespread consequences, may lead to specific defects in erythropoiesis. PMID:21279816

  5. Viral IRES RNA structures and ribosome interactions

    PubMed Central

    Kieft, Jeffrey S.

    2009-01-01

    In eukaryotes, protein synthesis initiates primarily by a mechanism that requires a modified nucleotide ‘cap’ on the mRNA and also proteins that recruit and position the ribosome. Many pathogenic viruses use an alternative, cap-independent mechanism that substitutes RNA structure for the cap and many proteins. The RNAs driving this process are called internal ribosome-entry sites (IRESs) and some are able to bind the ribosome directly using a specific 3D RNA structure. Recent structures of IRES RNAs and IRES–ribosome complexes are revealing the structural basis of viral IRES’ ‘hijacking’ of the protein-making machinery. It now seems that there are fundamental differences in the 3D structures used by different IRESs, although there are some common features in how they interact with ribosomes. PMID:18468443

  6. Interaction of Chloramphenicol Tripeptide Analogs with Ribosomes.

    PubMed

    Tereshchenkov, A G; Shishkina, A V; Tashlitsky, V N; Korshunova, G A; Bogdanov, A A; Sumbatyan, N V

    2016-04-01

    Chloramphenicol amine peptide derivatives containing tripeptide fragments of regulatory "stop peptides" - MRL, IRA, IWP - were synthesized. The ability of the compounds to form ribosomal complexes was studied by displacement of the fluorescent erythromycin analog from its complex with E. coli ribosomes. It was found that peptide chloramphenicol analogs are able to bind to bacterial ribosomes. The dissociation constants were 4.3-10 µM, which is 100-fold lower than the corresponding values for chloramphenicol amine-ribosome complex. Interaction of the chloramphenicol peptide analogs with ribosomes was simulated by molecular docking, and the most probable contacts of "stop peptide" motifs with the elements of nascent peptide exit tunnel were identified. PMID:27293096

  7. Differential Stoichiometry among Core Ribosomal Proteins.

    PubMed

    Slavov, Nikolai; Semrau, Stefan; Airoldi, Edoardo; Budnik, Bogdan; van Oudenaarden, Alexander

    2015-11-01

    Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs), some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC) and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function. PMID:26565899

  8. Concentric-Flow Electrokinetic Injector Enables Serial Crystallography of Ribosome and Photosystem-II

    PubMed Central

    Sierra, Raymond G.; Gati, Cornelius; Laksmono, Hartawan; Dao, E. Han; Gul, Sheraz; Fuller, Franklin; Kern, Jan; Chatterjee, Ruchira; Ibrahim, Mohamed; Brewster, Aaron S.; Young, Iris D.; Michels-Clark, Tara; Aquila, Andrew; Liang, Mengning; Hunter, Mark S.; Koglin, Jason E.; Boutet, Sébastien; Junco, Elia A.; Hayes, Brandon; Bogan, Michael J.; Hampton, Christina Y.; Puglisi, Elisabetta V.; Sauter, Nicholas K.; Stan, Claudiu A.; Zouni, Athina; Yano, Junko; Yachandra, Vittal K.; Soltis, S. Michael; Puglisi, Joseph D.; DeMirci, Hasan

    2016-01-01

    In this work, a concentric-flow electrokinetic injector delivered microcrystals of Geobacillus stearothermophilus thermolysin (2.2 Å structure), Thermosynechococcus elongatus photosystem II (< 3 Å diffraction) and Thermus thermophilus small ribosomal subunit (3.4 Å structure). The first ambient-temperature X-ray crystal structure of the 30S subunit bound to the antibiotic paromomycin was obtained in its native mother liquor. Compared to previous cryo-cooled structures, this new structure showed that paromomycin binds to the decoding center in a different conformation. PMID:26619013

  9. GTP hydrolysis by EF-G synchronizes tRNA movement on small and large ribosomal subunits

    PubMed Central

    Holtkamp, Wolf; Cunha, Carlos E; Peske, Frank; Konevega, Andrey L; Wintermeyer, Wolfgang; Rodnina, Marina V

    2014-01-01

    Elongation factor G (EF-G) promotes the movement of two tRNAs and the mRNA through the ribosome in each cycle of peptide elongation. During translocation, the tRNAs transiently occupy intermediate positions on both small (30S) and large (50S) ribosomal subunits. How EF-G and GTP hydrolysis control these movements is still unclear. We used fluorescence labels that specifically monitor movements on either 30S or 50S subunits in combination with EF-G mutants and translocation-specific antibiotics to investigate timing and energetics of translocation. We show that EF-G–GTP facilitates synchronous movements of peptidyl-tRNA on the two subunits into an early post-translocation state, which resembles a chimeric state identified by structural studies. EF-G binding without GTP hydrolysis promotes only partial tRNA movement on the 50S subunit. However, rapid 30S translocation and the concomitant completion of 50S translocation require GTP hydrolysis and a functional domain 4 of EF-G. Our results reveal two distinct modes for utilizing the energy of EF-G binding and GTP hydrolysis and suggest that coupling of GTP hydrolysis to translocation is mediated through rearrangements of the 30S subunit. PMID:24614227

  10. GTP hydrolysis by EF-G synchronizes tRNA movement on small and large ribosomal subunits.

    PubMed

    Holtkamp, Wolf; Cunha, Carlos E; Peske, Frank; Konevega, Andrey L; Wintermeyer, Wolfgang; Rodnina, Marina V

    2014-05-01

    Elongation factor G (EF-G) promotes the movement of two tRNAs and the mRNA through the ribosome in each cycle of peptide elongation. During translocation, the tRNAs transiently occupy intermediate positions on both small (30S) and large (50S) ribosomal subunits. How EF-G and GTP hydrolysis control these movements is still unclear. We used fluorescence labels that specifically monitor movements on either 30S or 50S subunits in combination with EF-G mutants and translocation-specific antibiotics to investigate timing and energetics of translocation. We show that EF-G-GTP facilitates synchronous movements of peptidyl-tRNA on the two subunits into an early post-translocation state, which resembles a chimeric state identified by structural studies. EF-G binding without GTP hydrolysis promotes only partial tRNA movement on the 50S subunit. However, rapid 30S translocation and the concomitant completion of 50S translocation require GTP hydrolysis and a functional domain 4 of EF-G. Our results reveal two distinct modes for utilizing the energy of EF-G binding and GTP hydrolysis and suggest that coupling of GTP hydrolysis to translocation is mediated through rearrangements of the 30S subunit. PMID:24614227

  11. Experimental investigation of the 30S(α, p) thermonuclear reaction in x-ray bursts

    NASA Astrophysics Data System (ADS)

    Kahl, D.; Chen, A. A.; Kubono, S.; Yamaguchi, H.; Binh, D. N.; Chen, J.; Cherubini, S.; Duy, N. N.; Hashimoto, T.; Hayakawa, S.; Iwasa, N.; Jung, H. S.; Kato, S.; Kwon, Y. K.; Nishimura, S.; Ota, S.; Setoodehnia, K.; Teranishi, T.; Tokieda, H.; Yamada, T.; Yun, C. C.; Zhang, L. Y.

    2016-02-01

    We performed the first measurement of 30S+α resonant elastic scattering to experimentally examine the 30S(α, p) stellar reaction rate in type I x-ray bursts. These bursts are the most frequent thermonuclear explosions in the galaxy, resulting from thermonuclear runaway on the surface of accreting neutron star binaries. The 30S(α, p) reaction plays a critical role in burst models, yet very little is known about the compound nucleus 34Ar at these energies nor the reaction rate itself. We performed a measurement of alpha elastic scattering with a radioactive beam of 30S to experimentally probe the entrance channel. Utilizing a gaseous active target system and silicon detector array, we extracted the excitation function from 1.8 to 5.5 MeV near 160° in the center-of-mass frame. The experimental data were analyzed with an R-Matrix calculation, and we discovered several new resonances and extracted their quantum properties (resonance energy, width, spin, and parity). Finally, we calculated the narrow resonant thermonuclear reaction rate of 30S(α, p) for these new resonances.

  12. Over-represented localized sequence motifs in ribosomal protein gene promoters of basal metazoans.

    PubMed

    Perina, Drago; Korolija, Marina; Roller, Maša; Harcet, Matija; Jeličić, Branka; Mikoč, Andreja; Cetković, Helena

    2011-07-01

    Equimolecular presence of ribosomal proteins (RPs) in the cell is needed for ribosome assembly and is achieved by synchronized expression of ribosomal protein genes (RPGs) with promoters of similar strengths. Over-represented motifs of RPG promoter regions are identified as targets for specific transcription factors. Unlike RPs, those motifs are not conserved between mammals, drosophila, and yeast. We analyzed RPGs proximal promoter regions of three basal metazoans with sequenced genomes: sponge, cnidarian, and placozoan and found common features, such as 5'-terminal oligopyrimidine tracts and TATA-boxes. Furthermore, we identified over-represented motifs, some of which displayed the highest similarity to motifs abundant in human RPG promoters and not present in Drosophila or yeast. Our results indicate that humans over-represented motifs, as well as corresponding domains of transcription factors, were established very early in metazoan evolution. The fast evolving nature of RPGs regulatory network leads to formation of other, lineage specific, over-represented motifs. PMID:21457775

  13. Decreased activity of Blastocladiella emersonii zoospore ribosomes: correlation with developmental changes in ribosome-associated proteins.

    PubMed

    Jaworski, A J; Wilson, J B

    1989-10-01

    Ribosomal proteins isolated from dormant zoospores were compared to the ribosomal proteins found in the active growth phase by two-dimensional polyacrylamide gel electrophoresis. Zoospore ribosomes were found to contain a set of five proteins, designated Z1 to Z5, which were not present in growth phase ribosomes. The Z1-Z5 proteins were not removed by high-salt washes using either 1 M KCl or 1 M NH4 Cl. The Z1 protein is found associated with zoospore 60 S subunits while Z2-Z5 are bound to 40 S subunits. Zoospore monoribosomes and polyribosomes contain comparable levels of each of the five proteins. Approximately 60 min. after sporulation is induced, the Z1-Z5 proteins begin to accumulate on the ribosomes with the highest levels of these proteins found associated with ribosomes at the zoospore stage. During germination, the proteins gradually disappear and are not detectable on the ribosomes after 4 hr of germination. The presence of the Z1-Z5 proteins correlates with a decrease in in vitro protein synthetic activity of the fungal ribosomes. The data are consistent with the hypothesis that the proteins regulate translation by completely blocking protein synthesis on a subset of ribosomes while the remainder of the ribosomes function at normal rates. PMID:2776972

  14. Ribosomopathies: human disorders of ribosome dysfunction.

    PubMed

    Narla, Anupama; Ebert, Benjamin L

    2010-04-22

    Ribosomopathies compose a collection of disorders in which genetic abnormalities cause impaired ribosome biogenesis and function, resulting in specific clinical phenotypes. Congenital mutations in RPS19 and other genes encoding ribosomal proteins cause Diamond-Blackfan anemia, a disorder characterized by hypoplastic, macrocytic anemia. Mutations in other genes required for normal ribosome biogenesis have been implicated in other rare congenital syndromes, Schwachman-Diamond syndrome, dyskeratosis congenita, cartilage hair hypoplasia, and Treacher Collins syndrome. In addition, the 5q- syndrome, a subtype of myelodysplastic syndrome, is caused by a somatically acquired deletion of chromosome 5q, which leads to haploinsufficiency of the ribosomal protein RPS14 and an erythroid phenotype highly similar to Diamond-Blackfan anemia. Acquired abnormalities in ribosome function have been implicated more broadly in human malignancies. The p53 pathway provides a surveillance mechanism for protein translation as well as genome integrity and is activated by defects in ribosome biogenesis; this pathway appears to be a critical mediator of many of the clinical features of ribosomopathies. Elucidation of the mechanisms whereby selective abnormalities in ribosome biogenesis cause specific clinical syndromes will hopefully lead to novel therapeutic strategies for these diseases. PMID:20194897

  15. Ribonucleic acid and ribosomes of Bacillus stearothermophilus.

    PubMed

    Saunders, G F; Campbell, L L

    1966-01-01

    Saunders, Grady F. (University of Illinois, Urbana), and L. Leon Campbell. Ribonucleic acid and ribosomes of Bacillus stearothermophilus. J. Bacteriol. 91:332-339. 1966.-The ability of some thermophilic bacteria to grow at temperatures as high as 76 C emphasizes the remarkable thermal stability of their crucial macromolecules. An investigation of the ribonucleic acid (RNA) and ribosomes of Bacillus stearothermophilus was conducted. Washed log-phase cells were disrupted either by sonic treatment or by alumina grinding in 10(-2)m MgCl(2)-10(-2)m tris-(hydroxymethyl)aminomethane buffer, pH 7.4 (TM buffer). Ultracentrifugal analysis revealed peaks at 72.5S, 101S, and 135S, with the 101S peak being the most prominent. By lowering the Mg(++) concentration to 10(-3)m, the ribosome preparation was dissociated to give 40S, 31S, and 54S peaks. These in turn were reassociated in the presence of 10(-2)m Mg(++) to give the larger 73S and 135S particles. When heated in TM buffer, Escherichia coli ribosomes began a gradual dissociation at 58 C, and at 70 C underwent a large hyperchromic shift with a T(m) at 72.8 C. In contrast, B. stearothermophilus ribosomes did not show a hyperchromic shift below 70 C; they had a T(m) of 77.9 C. The thermal denaturation curves of the 4S, 16S, and 23S RNA from both organisms were virtually identical. The gross amino acid composition of B. stearothermophilus ribosomes showed no marked differences from that reported for E. coli ribosomes. These data suggest that the unusual thermal stability of B. stearothermophilus ribosomes may reflect either an unusual packing arrangement of the protein to the RNA or differences in the primary structure of the ribosomal proteins. PMID:5903099

  16. First measurement of the 33Cl(p,α)30S reaction

    NASA Astrophysics Data System (ADS)

    Deibel, C. M.; Rehm, K. E.; Figueira, J. M.; Greene, J. P.; Jiang, C. L.; Kay, B. P.; Lee, H. Y.; Lighthall, J. C.; Marley, S. T.; Pardo, R. C.; Patel, N.; Paul, M.; Ugalde, C.; Woodard, A.; Wuosmaa, A. H.; Zinkann, G.

    2011-10-01

    The 30S(α,p)33Cl reaction may have a significant impact on final elemental abundances and energy output of type I X-ray bursts, as well as influencing observables such as double-peaked luminosity profiles, because it could bypass the 30S waiting point. This reaction has been studied experimentally for the first time in inverse kinematics via the time-inverse reaction 1H(33Cl,30S)α with a 33Cl radioactive ion beam produced at the Argonne Tandem Linac Accelerator System facility by the “in-flight” technique. This reaction was studied at three different beam energies. The experimental method used and the resulting data are discussed.

  17. A new system for naming ribosomal proteins

    PubMed Central

    Ban, Nenad; Beckmann, Roland; Cate, Jamie HD; Dinman, Jonathan D; Dragon, François; Ellis, Steven R; Lafontaine, Denis LJ; Lindahl, Lasse; Liljas, Anders; Lipton, Jeffrey M; McAlear, Michael A; Moore, Peter B; Noller, Harry F; Ortega, Joaquin; Panse, Vikram Govind; Ramakrishnan, V; Spahn, Christian MT; Steitz, Thomas A; Tchorzewski, Marek; Tollervey, David; Warren, Alan J; Williamson, James R; Wilson, Daniel; Yonath, Ada; Yusupov, Marat

    2015-01-01

    A system for naming ribosomal proteins is described that the authors intend to use in the future. They urge others to adopt it. The objective is to eliminate the confusion caused by the assignment of identical names to ribosomal proteins from different species that are unrelated in structure and function. In the system proposed here, homologous ribosomal proteins are assigned the same name, regardless of species. It is designed so that new names are similar enough to old names to be easily recognized, but are written in a format that unambiguously identifies them as ‘new system’ names. PMID:24524803

  18. The economics of ribosome biosynthesis in yeast.

    PubMed

    Warner, J R

    1999-11-01

    In a rapidly growing yeast cell, 60% of total transcription is devoted to ribosomal RNA, and 50% of RNA polymerase II transcription and 90% of mRNA splicing are devoted to ribosomal proteins (RPs). Coordinate regulation of the approximately 150 rRNA genes and 137 RP genes that make such prodigious use of resources is essential for the economy of the cell. This is entrusted to a number of signal transduction pathways that can abruptly induce or silence the ribosomal genes, leading to major implications for the expression of other genes as well. PMID:10542411

  19. Computational studies of molecular machines: the ribosome.

    PubMed

    Sanbonmatsu, Karissa Y

    2012-04-01

    The past decade has produced an avalanche of experimental data on the structure and dynamics of the ribosome. Groundbreaking studies in structural biology and kinetics have placed important constraints on ribosome structural dynamics. However, a gulf remains between static structures and time dependent data. In particular, X-ray crystallography and cryo-EM studies produce static models of the ribosome in various states, but lack dynamic information. Single molecule studies produce information on the rates of transitions between these states but do not have high-resolution spatial information. Computational studies have aided in bridging this gap by providing atomic resolution simulations of structural fluctuations and transitions between configurations. PMID:22336622

  20. Computational studies of molecular machines: the ribosome

    PubMed Central

    Sanbonmatsu, Karissa Y.

    2013-01-01

    The past decade has produced an avalanche of experimental data on the structure and dynamics of the ribosome. Groundbreaking studies in structural biology and kinetics have placed important constraints on ribosome structural dynamics. However, a gulf remains between static structures and time dependent data. In particular, x-ray crystallography and cryo-EM studies produce static models of the ribosome in various states, but lack dynamic information. Single molecule studies produce information on the rates of transitions between these states but do not have high-resolution spatial information. Computational studies have aided in bridging this gap by providing atomic resolution simulations of structural fluctuations and transitions between configurations. PMID:22336622

  1. Experimental Investigation of the Stellar Reaction 30S(p,γ)31Cl via Coulomb Dissociation

    NASA Astrophysics Data System (ADS)

    Togano, Y.; Motobayashi, T.; Aoi, N.; Baba, H.; Bishop, S.; Cai, X.; Doornenbal, P.; Fang, D.; Furukawa, T.; Ieki, K.; Iwasa, N.; Kawabata, T.; Kanno, S.; Kobayashi, N.; Kondo, Y.; Kuboki, T.; Kume, N.; Kurita, K.; Kurokawa, M.; Ma, Y. G.; Matsuo, Y.; Murakami, H.; Matsushita, M.; Nakamura, T.; Okada, K.; Ota, S.; Satou, Y.; Shimoura, S.; Shioda, R.; Tanaka, K. N.; Takeuchi, S.; Tian, W.; Wang, H.; Wang, J.; Yamada, K.; Yamada, Y.; Yoneda, K.

    2011-09-01

    Coulomb dissociation of the proton-rich nucleus 31Cl was studied experimentally using a 31Cl beam at 58 MeV/nucleon with a lead target. The relative energy spectrum of 30S+p system was obtained from the measured momentum vectors of the reaction products detected in coincidence by the invariant mass method. The first excited state in 31Cl was observed which is relevant to the resonant capture in the stellar 30S(p,γ)31Cl reaction. Discussion for another observed state is also given.

  2. Crystal structure of release factor RF3 trapped in the GTP state on a rotated conformation of the ribosome

    SciTech Connect

    Zhou, Jie; Lancaster, Laura; Trakhanov, Sergei; Noller, Harry F.

    2012-03-26

    The class II release factor RF3 is a GTPase related to elongation factor EF-G, which catalyzes release of class I release factors RF1 and RF2 from the ribosome after termination of protein synthesis. The 3.3 {angstrom} crystal structure of the RF3 {center_dot} GDPNP {center_dot} ribosome complex provides a high-resolution description of interactions and structural rearrangements that occur when binding of this translational GTPase induces large-scale rotational movements in the ribosome. RF3 induces a 7{sup o} rotation of the body and 14{sup o} rotation of the head of the 30S ribosomal subunit, and itself undergoes inter- and intradomain conformational rearrangements. We suggest that ordering of critical elements of switch loop I and the P loop, which help to form the GTPase catalytic site, are caused by interactions between the G domain of RF3 and the sarcin-ricin loop of 23S rRNA. The rotational movements in the ribosome induced by RF3, and its distinctly different binding orientation to the sarcin-ricin loop of 23S rRNA, raise interesting implications for the mechanism of action of EF-G in translocation.

  3. Introns regulate the production of ribosomal proteins by modulating splicing of duplicated ribosomal protein genes.

    PubMed

    Petibon, Cyrielle; Parenteau, Julie; Catala, Mathieu; Elela, Sherif Abou

    2016-05-01

    Most budding yeast introns exist in the many duplicated ribosomal protein genes (RPGs) and it has been posited that they remain there to modulate the expression of RPGs and cell growth in response to stress. However, the mechanism by which introns regulate the expression of RPGs and their impact on the synthesis of ribosomal proteins remain unclear. In this study, we show that introns determine the ratio of ribosomal protein isoforms through asymmetric paralog-specific regulation of splicing. Exchanging the introns and 3' untranslated regions of the duplicated RPS9 genes altered the splicing efficiency and changed the ratio of the ribosomal protein isoforms. Mutational analysis of the RPS9 genes indicated that splicing is regulated by variations in the intron structure and the 3' untranslated region. Together these data suggest that preferential splicing of duplicated RPGs provides a means for adjusting the ratio of different ribosomal protein isoforms, while maintaining the overall expression level of each ribosomal protein. PMID:26945043

  4. The size and conformation of Artemia (brine-shrimp) ribosomal RNA free in solution.

    PubMed

    Donceel, K; Nieuwenhuysen, P; Clauwaert, J

    1982-09-01

    The RNA was isolated from the large ribosomal subunits of the brine shrimp Artemia, and its conformation free in solution was studied by determining its sedimentation and diffusion coefficients. A comparison was made of the hydrodynamic radius of the ribosomal subunit and its isolated RNA in various buffers. The conformation of the rRNA free in solution is more extended than when it is incorporated in the ribosome. This is not only the case when the rRNA solution lacks bivalent and polyvalent cations, but even in the presence of Mg2+ and spermidine, which cause a tightening of RNA. Thus the ribosomal proteins should induce a further tightening of the rRNA during the assembly of the ribosome. In the discussion, the reported data on Escherichia coli rRNA species are presented in such a way that large discrepancies between various studied are revealed, and that they can be compared with the data reported here on the larger rRNA of an eukaryote. PMID:7150228

  5. Insertion of the Biogenesis Factor Rei1 Probes the Ribosomal Tunnel during 60S Maturation.

    PubMed

    Greber, Basil Johannes; Gerhardy, Stefan; Leitner, Alexander; Leibundgut, Marc; Salem, Michèle; Boehringer, Daniel; Leulliot, Nicolas; Aebersold, Ruedi; Panse, Vikram Govind; Ban, Nenad

    2016-01-14

    Eukaryotic ribosome biogenesis depends on several hundred assembly factors to produce functional 40S and 60S ribosomal subunits. The final phase of 60S subunit biogenesis is cytoplasmic maturation, which includes the proofreading of functional centers of the 60S subunit and the release of several ribosome biogenesis factors. We report the cryo-electron microscopy (cryo-EM) structure of the yeast 60S subunit in complex with the biogenesis factors Rei1, Arx1, and Alb1 at 3.4 Å resolution. In addition to the network of interactions formed by Alb1, the structure reveals a mechanism for ensuring the integrity of the ribosomal polypeptide exit tunnel. Arx1 probes the entire set of inner-ring proteins surrounding the tunnel exit, and the C terminus of Rei1 is deeply inserted into the ribosomal tunnel, where it forms specific contacts along almost its entire length. We provide genetic and biochemical evidence that failure to insert the C terminus of Rei1 precludes subsequent steps of 60S maturation. PMID:26709046

  6. Saccharomyces cerevisiae nucleolar protein Nop7p is necessary for biogenesis of 60S ribosomal subunits.

    PubMed Central

    Adams, Cynthia C; Jakovljevic, Jelena; Roman, Judibelle; Harnpicharnchai, Piyanun; Woolford, John L

    2002-01-01

    To identify new gene products that participate in ribosome biogenesis, we carried out a screen for mutations that result in lethality in combination with mutations in DRS1, a Saccharomyces cerevisiae nucleolar DEAD-box protein required for synthesis of 60S ribosomal subunits. We identified the gene NOP7that encodes an essential protein. The temperature-sensitive nop7-1 mutation or metabolic depletion of Nop7p results in a deficiency of 60S ribosomal subunits and accumulation of halfmer polyribosomes. Analysis of pre-rRNA processing indicates that nop7 mutants exhibit a delay in processing of 27S pre-rRNA to mature 25S rRNA and decreased accumulation of 25S rRNA. Thus Nop7p, like Drs1p, is required for essential steps leading to synthesis of 60S ribosomal subunits. In addition, inactivation or depletion of Nop7p also affects processing at the A0, A1, and A2 sites, which may result from the association of Nop7p with 35S pre-rRNA in 90S pre-rRNPs. Nop7p is localized primarily in the nucleolus, where most steps in ribosome assembly occur. Nop7p is homologous to the zebrafish pescadillo protein necessary for embryonic development. The Nop7 protein contains the BRCT motif, a protein-protein interaction domain through which, for example, the human BRCA1 protein interacts with RNA helicase A. PMID:11911362

  7. The tails of ubiquitin precursors are ribosomal proteins whose fusion to ubiquitin facilitates ribosome biogenesis

    NASA Astrophysics Data System (ADS)

    Finley, Daniel; Bartel, Bonnie; Varshavsky, Alexander

    1989-03-01

    Three of the four yeast ubiquitin genes encode hybrid proteins which are cleaved to yield ubiquitin and previously unidentified ribosomal proteins. The transient association between ubiquitin and these proteins promotes their incorporation into nascent ribosomes and is required for efficient ribosome biogenesis. These results suggest a novel 'chaperone' function for ubiquitin, in which its covalent association with other proteins promotes the formation of specific cellular structures.

  8. Marrow failure: a window into ribosome biology.

    PubMed

    Ruggero, Davide; Shimamura, Akiko

    2014-10-30

    Diamond-Blackfan anemia, Shwachman-Diamond syndrome, and dyskeratosis congenita are inherited syndromes characterized by marrow failure, congenital anomalies, and cancer predisposition. Genetic and molecular studies have uncovered distinct abnormalities in ribosome biogenesis underlying each of these 3 disorders. How defects in ribosomes, the essential organelles required for protein biosynthesis in all cells, cause tissue-specific abnormalities in human disease remains a question of fundamental scientific and medical importance. Here we review the overlapping and distinct clinical features of these 3 syndromes and discuss current knowledge regarding the ribosomal pathways disrupted in each of these disorders. We also explore the increasing complexity of ribosome biology and how this informs our understanding of developmental biology and human disease. PMID:25237201

  9. Marrow failure: a window into ribosome biology

    PubMed Central

    Ruggero, Davide

    2014-01-01

    Diamond-Blackfan anemia, Shwachman-Diamond syndrome, and dyskeratosis congenita are inherited syndromes characterized by marrow failure, congenital anomalies, and cancer predisposition. Genetic and molecular studies have uncovered distinct abnormalities in ribosome biogenesis underlying each of these 3 disorders. How defects in ribosomes, the essential organelles required for protein biosynthesis in all cells, cause tissue-specific abnormalities in human disease remains a question of fundamental scientific and medical importance. Here we review the overlapping and distinct clinical features of these 3 syndromes and discuss current knowledge regarding the ribosomal pathways disrupted in each of these disorders. We also explore the increasing complexity of ribosome biology and how this informs our understanding of developmental biology and human disease. PMID:25237201

  10. The immunological properties of Brucella ribosomal preparations.

    PubMed

    Corbel, M J

    1976-01-01

    Ribosomes were isolated from Brucella abortus strains 19 and 45/20 by disruption of the cells followed by differential ultracentrifugation. The ribosome preparations contained 2-3 components reacting in immunodiffusion tests but were free of detectable lipopolysaccharide-protein agglutinogen. They crossreacted with antisera to Br. abortus, Br. melitensis, Br. suis and Br. ovis and elicited intradermal delayed hypersensitivity reactions in animals infected with Br. abortus, Br. melitensis or Br. suis. The ribosomes were antigenic in rabbits, guinea pigs and mice. Those from Br. abortus S19 induced agglutinins reaction with smooth brucella strains whereas those from Br. abortus 45/20 induced agglutinins reacting with rough brucella strains. Cattle vaccinated with S19 or 45/20 vaccines or infected with Br. abortus developed pricipitins to ribosomal components at an early stage in the immune response. PMID:816681

  11. Ribosome Inactivating Proteins from Rosaceae.

    PubMed

    Shang, Chenjing; Rougé, Pierre; Van Damme, Els J M

    2016-01-01

    Ribosome-inactivating proteins (RIPs) are widespread among higher plants of different taxonomic orders. In this study, we report on the RIP sequences found in the genome/transcriptome of several important Rosaceae species, including many economically important edible fruits such as apple, pear, peach, apricot, and strawberry. All RIP domains from Rosaceae share high sequence similarity with conserved residues in the catalytic site and the carbohydrate binding sites. The genomes of Malus domestica and Pyrus communis contain both type 1 and type 2 RIP sequences, whereas for Prunus mume, Prunus persica, Pyrus bretschneideri, and Pyrus communis a complex set of type 1 RIP sequences was retrieved. Heterologous expression and purification of the type 1 as well as the type 2 RIP from apple allowed to characterize the biological activity of the proteins. Both RIPs from Malus domestica can inhibit protein synthesis. Furthermore, molecular modelling suggests that RIPs from Rosaceae possess three-dimensional structures that are highly similar to the model proteins and can bind to RIP substrates. Screening of the recombinant type 2 RIP from apple on a glycan array revealed that this type 2 RIP interacts with terminal sialic acid residues. Our data suggest that the RIPs from Rosaceae are biologically active proteins. PMID:27556443

  12. Studies on dissociation and reconstitution of nuclear 30-S ribonucleoprotein particles containing pre-mRNA.

    PubMed

    Kulguskin, V V; Krichevskaya, A A; Lukanidin, E M; Georgiev, G P

    1980-10-17

    Treatment of nuclear 30-S ribonucleoprotein (RNP) particles containing pre-mRNA (precursor of mRNA) with 2 M NaCl leads to dissociation of RNA and protein. The protein component is present either as an aggregate with a sedimentation coefficient close to 30 S (a free informofer) or as a slowly sedimenting material (monomers or oligomers of informatin). Most of the informofers and slowly sedimenting material are in the equilibrium state. Iodination or aging of the 30-S particles stabilizes informofers. Lowering of NaCl concentration in the mixture of RNA with informofers or informatin subunits leads to reconstitution of RNP particles. In both cases, the particles formed have a sedimentation coefficient of about 30 S and a buoyant density equal to 1.4-1.41 g/cm3 but their response to pancreatic RNAase (EC 3.1.27.5) and high salt treatment is very different. Both the particles reconstituted from RNA and informofers and the original particles are very sensitive to pancreatic RNAase and after high salt treatment free informofers are formed. In contrast, the RNA of the particles reconstituted from slowly sedimenting material is much more protected against pancreatic RNAase action. These particles are also rather stable to high salt treatment. Thus, only if a protein in the form of an informofer aggregate is used, faithful reconstitution takes place. The data obtained are discussed in terms of the structure of the nuclear ribonucleoprotein particles containing precursor of messenger RNA. PMID:7437433

  13. Effect of intermittent hypoxic training on 20 km time trial and 30 s anaerobic performance.

    PubMed

    Hamlin, M J; Marshall, H C; Hellemans, J; Ainslie, P N; Anglem, N

    2010-08-01

    This study aimed to verify whether the "live low, train high" approach is beneficial for endurance and/or anaerobic cycling performance. Sixteen well-trained athletes completed 90 min of endurance training (60-70% of heart rate reserve), followed by two 30-s all-out sprints (Wingate test), daily, for 10 consecutive days. Nine subjects [intermittent hypoxic training (IHT) group] trained with an F(I)O(2) set to produce arterial oxygen saturations of approximately 88-82%, while seven subjects (placebo group) trained while breathing a normal gas mixture (F(I)O(2)=0.21). Four performance tests were conducted at sea level including a familiarization and baseline trial, followed by repeat trials at 2 and 9 days post-intervention. Relative to the placebo group, the mean power during the 30-s Wingate test increased by 3.0% (95% confidence limits, CL +/- 3.5%) 2 days, and 1.7% (+/- 3.8%) 9 days post-IHT. Changes in other performance variables (30 s peak power, 20 km mean power and 20 km oxygen cost) were unclear. During the time trial, the IHT participants' blood lactate concentration, respiratory exchange ratio, and SpO(2), relative to the placebo group, was substantially increased at 2 days post-intervention. The addition of IHT to the normal training program of well-trained athletes produced worthwhile gains in 30 s sprint performance possibly through enhanced glycolysis. PMID:19793215

  14. Frozen spin targets in ribosomal structure research.

    PubMed

    Stuhrmann, H B

    1991-01-01

    Polarized neutron scattering strongly depends on nuclear spin polarisation, particularly on proton spin polarisation. A single proton in a deuterated environment then is as efficient as 10 electrons in X-ray anomalous diffraction. Neutron scattering from the nuclear spin label is controlled by the polarisation of neutron spins and nuclear spins. Pure deuteron spin labels and proton spin labels are created by NMR saturation. We report on results obtained from the large subunit of E. coli ribosomes which have been obtained at the research reactor of GKSS using the polarized target facility developed by CERN. The nuclear spins were oriented with respect to an external field by dynamic nuclear polarisation. Proton spin polarisations of more than 80% were obtained in ribosomes at temperatures below 0.5 K. At T = 130 mK the relaxation time of the polarized target is one month (frozen spin target). Polarized small-angle neutron scattering of the in situ structure of rRNA and the total ribosomal protein (TP) has been determined from the frozen spin targets of the large ribosomal subunit, which has been deuterated in the TP and rRNA respectively. The results agree with those from neutron scattering in H2O/D2O mixtures obtained at room temperature. This is a necessary prerequisite for the planned determination of the in situ structure of individual ribosomal proteins and especially of that of ribosome bound mRNA and tRNAs. PMID:1720669

  15. Genomic architecture and inheritance of human ribosomal RNA gene clusters

    PubMed Central

    Stults, Dawn M.; Killen, Michael W.; Pierce, Heather H.; Pierce, Andrew J.

    2008-01-01

    The finishing of the Human Genome Project largely completed the detailing of human euchromatic sequences; however, the most highly repetitive regions of the genome still could not be assembled. The 12 gene clusters producing the structural RNA components of the ribosome are critically important for cellular viability, yet fall into this unassembled region of the Human Genome Project. To determine the extent of human variation in ribosomal RNA gene content (rDNA) and patterns of rDNA cluster inheritance, we have determined the physical lengths of the rDNA clusters in peripheral blood white cells of healthy human volunteers. The cluster lengths exhibit striking variability between and within human individuals, ranging from 50 kb to >6 Mb, manifest essentially complete heterozygosity, and provide each person with their own unique rDNA electrophoretic karyotype. Analysis of these rDNA fingerprints in multigenerational human families demonstrates that the rDNA clusters are subject to meiotic rearrangement at a frequency >10% per cluster, per meiosis. With this high intrinsic recombinational instability, the rDNA clusters may serve as a unique paradigm of potential human genomic plasticity. PMID:18025267

  16. The complex of tmRNA-SmpB and EF-G on translocating ribosomes.

    PubMed

    Ramrath, David J F; Yamamoto, Hiroshi; Rother, Kristian; Wittek, Daniela; Pech, Markus; Mielke, Thorsten; Loerke, Justus; Scheerer, Patrick; Ivanov, Pavel; Teraoka, Yoshika; Shpanchenko, Olga; Nierhaus, Knud H; Spahn, Christian M T

    2012-05-24

    Bacterial ribosomes stalled at the 3' end of malfunctioning messenger RNAs can be rescued by transfer-messenger RNA (tmRNA)-mediated trans-translation. The SmpB protein forms a complex with the tmRNA, and the transfer-RNA-like domain (TLD) of the tmRNA then enters the A site of the ribosome. Subsequently, the TLD-SmpB module is translocated to the P site, a process that is facilitated by the elongation factor EF-G, and translation is switched to the mRNA-like domain (MLD) of the tmRNA. Accurate loading of the MLD into the mRNA path is an unusual initiation mechanism. Despite various snapshots of different ribosome-tmRNA complexes at low to intermediate resolution, it is unclear how the large, highly structured tmRNA is translocated and how the MLD is loaded. Here we present a cryo-electron microscopy reconstruction of a fusidic-acid-stalled ribosomal 70S-tmRNA-SmpB-EF-G complex (carrying both of the large ligands, that is, EF-G and tmRNA) at 8.3 Å resolution. This post-translocational intermediate (TI(POST)) presents the TLD-SmpB module in an intrasubunit ap/P hybrid site and a tRNA(fMet) in an intrasubunit pe/E hybrid site. Conformational changes in the ribosome and tmRNA occur in the intersubunit space and on the solvent side. The key underlying event is a unique extra-large swivel movement of the 30S head, which is crucial for both tmRNA-SmpB translocation and MLD loading, thereby coupling translocation to MLD loading. This mechanism exemplifies the versatile, dynamic nature of the ribosome, and it shows that the conformational modes of the ribosome that normally drive canonical translation can also be used in a modified form to facilitate more complex tasks in specialized non-canonical pathways. PMID:22622583

  17. The structure of ribosome-lankacidin complex reveals ribosomal sites for synergistic antibiotics

    SciTech Connect

    Auerbach, Tamar; Mermershtain, Inbal; Davidovich, Chen; Bashan, Anat; Belousoff, Matthew; Wekselman, Itai; Zimmerman, Ella; Xiong, Liqun; Klepacki, Dorota; Arakawa, Kenji; Kinashi, Haruyasu; Mankin, Alexander S.; Yonath, Ada

    2010-04-26

    Crystallographic analysis revealed that the 17-member polyketide antibiotic lankacidin produced by Streptomyces rochei binds at the peptidyl transferase center of the eubacterial large ribosomal subunit. Biochemical and functional studies verified this finding and showed interference with peptide bond formation. Chemical probing indicated that the macrolide lankamycin, a second antibiotic produced by the same species, binds at a neighboring site, at the ribosome exit tunnel. These two antibiotics can bind to the ribosome simultaneously and display synergy in inhibiting bacterial growth. The binding site of lankacidin and lankamycin partially overlap with the binding site of another pair of synergistic antibiotics, the streptogramins. Thus, at least two pairs of structurally dissimilar compounds have been selected in the course of evolution to act synergistically by targeting neighboring sites in the ribosome. These results underscore the importance of the corresponding ribosomal sites for development of clinically relevant synergistic antibiotics and demonstrate the utility of structural analysis for providing new directions for drug discovery.

  18. High-resolution structure of the Escherichia coli ribosome

    PubMed Central

    Noeske, Jonas; Wasserman, Michael R.; Terry, Daniel S.; Altman, Roger B.; Blanchard, Scott C.; Cate, Jamie H. D.

    2015-01-01

    Protein synthesis by the ribosome is highly dependent on the ionic conditions in the cellular environment, but the roles of ribosome solvation remain poorly understood. Moreover, the function of modifications to ribosomal RNA and ribosomal proteins are unclear. Here we present the structure of the Escherichia coli 70S ribosome to 2.4 Å resolution. The structure reveals details of the ribosomal subunit interface that are conserved in all domains of life, and suggest how solvation contributes to ribosome integrity and function. The structure also suggests how the conformation of ribosomal protein uS12 likely impacts its contribution to messenger RNA decoding. This structure helps to explain the phylogenetic conservation of key elements of the ribosome, including posttranscriptional and posttranslational modifications and should serve as a basis for future antibiotic development. PMID:25775265

  19. Power and peak blood lactate at 5050 m with 10 and 30 s 'all out' cycling.

    PubMed

    Grassi, B; Mognoni, P; Marzorati, M; Mattiotti, S; Marconi, C; Cerretelli, P

    2001-07-01

    Anecdotal observations suggest that the reduction in peak lactate accumulation in blood ([La]b peak) after exhausting exercise, in chronic hypoxia vs. normoxia, may be related to the duration of the exercise protocol, being less pronounced after short supramaximal exercise than after incremental exercise (IE) lasting several minutes. To test this hypothesis, six healthy male Caucasians (age 36.8 +/- 7.3, X +/- SD) underwent three exercise protocols on a cycle ergometer, at sea level (SL) and after 21 +/- 10 days at 5050 m altitude (ALT): (1) 10 s, (2) 30 s 'all out' exercise and (3) IE leading to exhaustion in approximately 20-25 min. 'Average' power output (P) was calculated for 10 or 30 s 'all out'; maximal power output (Pmax) was determined for IE. Lactate concentration in arterialized capillary blood ([La]b) was measured at rest and at different times during recovery; the highest [La]b during recovery was taken as [La]b peak. No significant differences in P were observed between SL and ALT, for either 10 or 30 s 'all out' exercise; Pmax during IE was significantly lower at ALT than at SL. [La]b peak after 10 s 'all out' was unaffected by chronic hypoxia (7.0 +/- 0.9 at ALT vs. 6.3 +/- 1.8 mmol x L(-1) at SL). After 30 s 'all out' the [La]b peak decrease, at ALT (10.6 +/- 0.6 mmol x L(-1)) vs. SL (12.9 +/- 1.4 mmol x L(-1)), was only approximately 50% of that observed for IE (6.7 +/- 1.6 mmol x L(-1) vs. 11.3 +/- 2.8 mmol x L(-1)). Muscle power output and blood lactate accumulation during short supramaximal exercise are substantially unaffected by chronic hypoxia. PMID:11472305

  20. Growth, Persistence, and Desistance of Alcohol Use for At-Risk Men in Their 30s

    PubMed Central

    Capaldi, Deborah M.; Tiberio, Stacey S.; Washburn, Isaac J.; Yoerger, Karen; Feingold, Alan

    2015-01-01

    Background Little is known about heterogeneity in men's drinking behaviors and their related consequences across midadulthood, and moreover, whether individual or social factors may predict such differences. The present study examined 3 indicators of alcohol use; namely, alcohol volume, heavy episodic drinking (HED), and drinking-related problems for men in their 30s. Methods Participants were 197 at-risk men from the Oregon Youth Study assessed 5 times across ages 29–38 years. Growth mixture modeling with count outcomes was used to examine unobserved heterogeneity in alcohol trajectories. Associations of latent classes of alcohol users with (i) classes for the other alcohol indicators, (ii) alcohol use by peers and romantic partners, (iii) alcohol classes previously extracted from ages 18–29 years, and (iv) past year alcohol use disorder (AUD) diagnostic status at ages 35–36 years was examined. Results A 3-class solution afforded the best fit for each alcohol indicator. Alcohol problems were relatively established in the 30s, with an ascending use class found only for volume. Although relatively few men were in higher classes for all 3 indicators, 45% of the sample was in the highest class on at least 2 indicators of use. Peer drunkenness was a robust predictor of the alcohol classes. Concordance among classes of alcohol users was seen from the 20s to the 30s, with prior desistance likely to be maintained for alcohol volume and HED. AUD diagnoses at ages 35–36 years were more common in the higher classes obtained for alcohol volume and alcohol problems. Conclusions Many men in their 30s engaged in high volume of alcohol without frequent engagement in HED, likely relating to continuing alcohol problems. The convergence of men's alcohol use with that of their peers found at younger ages was maintained into early midadulthood. PMID:26010338

  1. Mitochondrial ribosomal proteins (MRPs) of yeast.

    PubMed Central

    Graack, H R; Wittmann-Liebold, B

    1998-01-01

    Mitochondrial ribosomal proteins (MRPs) are the counterparts in that organelle of the cytoplasmic ribosomal proteins in the host. Although the MRPs fulfil similar functions in protein biosynthesis, they are distinct in number, features and primary structures from the latter. Most progress in the eludication of the properties of individual MRPs, and in the characterization of the corresponding genes, has been made in baker's yeast (Saccharomyces cerevisiae). To date, 50 different MRPs have been determined, although biochemical data and mutational analysis propose a total number which is substantially higher. Surprisingly, only a minority of the MRPs that have been characterized show significant sequence similarities to known ribosomal proteins from other sources, thus limiting the deduction of their functions by simple comparison of amino acid sequences. Further, individual MRPs have been characterized functionally by mutational studies, and the regulation of expression of MRP genes has been described. The interaction of the mitochondrial ribosomes with transcription factors specific for individual mitochondrial mRNAs, and the communication between mitochondria and the nucleus for the co-ordinated expression of ribosomal constituents, are other aspects of current MRP research. Although the mitochondrial translational system is still far from being described completely, the yeast MRP system serves as a model for other organisms, including that of humans. PMID:9445368

  2. Global shape mimicry of tRNA within a viral internal ribosome entry site mediates translational reading frame selection

    PubMed Central

    Au, Hilda H.; Cornilescu, Gabriel; Mouzakis, Kathryn D.; Ren, Qian; Burke, Jordan E.; Lee, Seonghoon; Butcher, Samuel E.; Jan, Eric

    2015-01-01

    The dicistrovirus intergenic region internal ribosome entry site (IRES) adopts a triple-pseudoknotted RNA structure and occupies the core ribosomal E, P, and A sites to directly recruit the ribosome and initiate translation at a non-AUG codon. A subset of dicistrovirus IRESs directs translation in the 0 and +1 frames to produce the viral structural proteins and a +1 overlapping open reading frame called ORFx, respectively. Here we show that specific mutations of two unpaired adenosines located at the core of the three-helical junction of the honey bee dicistrovirus Israeli acute paralysis virus (IAPV) IRES PKI domain can uncouple 0 and +1 frame translation, suggesting that the structure adopts distinct conformations that contribute to 0 or +1 frame translation. Using a reconstituted translation system, we show that ribosomes assembled on mutant IRESs that direct exclusive 0 or +1 frame translation lack reading frame fidelity. Finally, a nuclear magnetic resonance/small-angle X-ray scattering hybrid approach reveals that the PKI domain of the IAPV IRES adopts an RNA structure that resembles a complete tRNA. The tRNA shape-mimicry enables the viral IRES to gain access to the ribosome tRNA-binding sites and form intermolecular contacts with the ribosome that are necessary for initiating IRES translation in a specific reading frame. PMID:26554019

  3. Zfrp8/PDCD2 Interacts with RpS2 Connecting Ribosome Maturation and Gene-Specific Translation.

    PubMed

    Minakhina, Svetlana; Naryshkina, Tatyana; Changela, Neha; Tan, William; Steward, Ruth

    2016-01-01

    Zfrp8/PDCD2 is a highly conserved protein essential for stem cell maintenance in both flies and mammals. It is also required in fast proliferating cells such as cancer cells. Our previous studies suggested that Zfrp8 functions in the formation of mRNP (mRNA ribonucleoprotein) complexes and also controls RNA of select Transposable Elements (TEs). Here we show that in Zfrp8/PDCD2 knock down (KD) ovaries, specific mRNAs and TE transcripts show increased nuclear accumulation. We also show that Zfrp8/PDCD2 interacts with the (40S) small ribosomal subunit through direct interaction with RpS2 (uS5). By studying the distribution of endogenous and transgenic fluorescently tagged ribosomal proteins we demonstrate that Zfrp8/PDCD2 regulates the cytoplasmic levels of components of the small (40S) ribosomal subunit, but does not control nuclear/nucleolar localization of ribosomal proteins. Our results suggest that Zfrp8/PDCD2 functions at late stages of ribosome assembly and may regulate the binding of specific mRNA-RNPs to the small ribosomal subunit ultimately controlling their cytoplasmic localization and translation. PMID:26807849

  4. Global shape mimicry of tRNA within a viral internal ribosome entry site mediates translational reading frame selection.

    PubMed

    Au, Hilda H; Cornilescu, Gabriel; Mouzakis, Kathryn D; Ren, Qian; Burke, Jordan E; Lee, Seonghoon; Butcher, Samuel E; Jan, Eric

    2015-11-24

    The dicistrovirus intergenic region internal ribosome entry site (IRES) adopts a triple-pseudoknotted RNA structure and occupies the core ribosomal E, P, and A sites to directly recruit the ribosome and initiate translation at a non-AUG codon. A subset of dicistrovirus IRESs directs translation in the 0 and +1 frames to produce the viral structural proteins and a +1 overlapping open reading frame called ORFx, respectively. Here we show that specific mutations of two unpaired adenosines located at the core of the three-helical junction of the honey bee dicistrovirus Israeli acute paralysis virus (IAPV) IRES PKI domain can uncouple 0 and +1 frame translation, suggesting that the structure adopts distinct conformations that contribute to 0 or +1 frame translation. Using a reconstituted translation system, we show that ribosomes assembled on mutant IRESs that direct exclusive 0 or +1 frame translation lack reading frame fidelity. Finally, a nuclear magnetic resonance/small-angle X-ray scattering hybrid approach reveals that the PKI domain of the IAPV IRES adopts an RNA structure that resembles a complete tRNA. The tRNA shape-mimicry enables the viral IRES to gain access to the ribosome tRNA-binding sites and form intermolecular contacts with the ribosome that are necessary for initiating IRES translation in a specific reading frame. PMID:26554019

  5. Zfrp8/PDCD2 Interacts with RpS2 Connecting Ribosome Maturation and Gene-Specific Translation

    PubMed Central

    Minakhina, Svetlana; Naryshkina, Tatyana; Changela, Neha; Tan, William; Steward, Ruth

    2016-01-01

    Zfrp8/PDCD2 is a highly conserved protein essential for stem cell maintenance in both flies and mammals. It is also required in fast proliferating cells such as cancer cells. Our previous studies suggested that Zfrp8 functions in the formation of mRNP (mRNA ribonucleoprotein) complexes and also controls RNA of select Transposable Elements (TEs). Here we show that in Zfrp8/PDCD2 knock down (KD) ovaries, specific mRNAs and TE transcripts show increased nuclear accumulation. We also show that Zfrp8/PDCD2 interacts with the (40S) small ribosomal subunit through direct interaction with RpS2 (uS5). By studying the distribution of endogenous and transgenic fluorescently tagged ribosomal proteins we demonstrate that Zfrp8/PDCD2 regulates the cytoplasmic levels of components of the small (40S) ribosomal subunit, but does not control nuclear/nucleolar localization of ribosomal proteins. Our results suggest that Zfrp8/PDCD2 functions at late stages of ribosome assembly and may regulate the binding of specific mRNA-RNPs to the small ribosomal subunit ultimately controlling their cytoplasmic localization and translation. PMID:26807849

  6. In vitro expression of Escherichia coli ribosomal protein genes: autogenous inhibition of translation.

    PubMed Central

    Yates, J L; Arfsten, A E; Nomura, M

    1980-01-01

    Escherichia coli ribosomal protein L1 (0.5 micro M) was found to inhibit the synthesis of both proteins of the L11 operon, L11 and L1, but not the synthesis of other proteins directed by lambda rifd 18 DNA. Similarly, S4 (1 micro M) selectively inhibited the synthesis of three proteins of the alpha operon, S13, S11, and S4, directed by lambda spcI DNA or a restriction enzyme fragment obtained from this DNA. S8 (3.6 micro M) also showed preferential inhibitory effects on the synthesis of some proteins encoded in the spc operon, L24 and L5 (and probably S14 and S8), directed by lambda spcl DNA or a restriction enzyme fragment carrying the genes for these proteins. The inhibitory effect of L1 was observed only with L1 and not with other proteins examined, including S4 and S8. Similarly, the effect of S4 was not observed with L1 or S8, and that of S8 was not seen with L1 or S4. Inhibition was shown to take place at the level of translation rather than transcription. Thus, at least some ribosomal proteins (L1 S4, and S8) have the ability to cause selective translational inhibition of the synthesis of certain ribosomal proteins whose genes are in the same operon as their own. These results support the hypothesis that certain free ribosomal proteins not assembled into ribosomes act as "autogenous" feedback inhibitors to regulate the synthesis of ribosomal proteins. Images PMID:6445562

  7. Detection of mRNA sequences in nuclear 30S ribonucleoprotein subcomplexes.

    PubMed Central

    Kinniburgh, A J; Martin, T E

    1976-01-01

    RNA from nuclear 30S ribonucleoprotein (RNP) complexes of mouse ascites cells has been shows to contain sequences homologous to poly(A) + mRNA by its ability to hybridize with complementary DNA prepared from poly(A) + mRNA template. Analysis of the hybridization kinetics of poly(A) + mRNA with its own complementary DNA revealed several abundancy classes. The total complexity of poly(A) + mRNA from ascites cells was estimated to be approximately 30,000 sequences of average molecular weight (6 X 10(5)). When the hybridization reaction of 30S RNP-RNA with mRNA-specific cDNA was compared to the homologous reaction the majority, and most probably all, of the poly(A) + mRNA sequences were found to be present in the RNA. The kinetics of hybridization suggest that 10-15% of the RNA in this RNP complex is homologous to poly(A) + mRNA. The 30S RNP subcomplexes therefore contain nuclear poly(A) + mRNA sequences as well as the bulk of heterogeneous RNA. PMID:1066686

  8. A residue substitution in the plastid ribosomal protein L12/AL1 produces defective plastid ribosome and causes early seedling lethality in rice.

    PubMed

    Zhao, Dong-Sheng; Zhang, Chang-Quan; Li, Qian-Feng; Yang, Qing-Qing; Gu, Ming-Hong; Liu, Qiao-Quan

    2016-05-01

    The plastid ribosome is essential for chloroplast biogenesis as well as seedling formation. As the plastid ribosome closely resembles the prokaryotic 70S ribosome, many plastid ribosomal proteins (PRPs) have been identified in higher plants. However, their assembly in the chloroplast ribosome in rice remains unclear. In the present study, we identified a novel rice mutant, albino lethal 1 (al1), from a chromosome segment substitution line population. The al1 mutant displayed an albino phenotype at the seedling stage and did not survive past the three-leaf stage. No other apparent differences in plant morphology were observed in the al1 mutant. The albino phenotype of the al1 mutant was associated with decreased chlorophyll content and abnormal chloroplast morphology. Using fine mapping, AL1 was shown to encode the PRPL12, a protein localized in the chloroplasts of rice, and a spontaneous single-nucleotide mutation (C/T), resulting in a residue substitution from leucine in AL1 to phenylalanine in al1, was found to be responsible for the early seedling lethality. This point mutation is located at the L10 interface feature of the L12/AL1 protein. Yeast two-hybrid analysis showed that there was no physical interaction between al1 and PRPL10. In addition, the mutation had little effect on the transcript abundance of al1, but had a remarkable effect on the protein abundance of al1 and transcript abundance of chloroplast biogenesis-related and photosynthesis-related genes. These results provide a first glimpse into the molecular details of L12's function in rice. PMID:26873698

  9. Large-scale isolation of mitochondrial ribosomes from mammalian tissues.

    PubMed

    Spremulli, Linda L

    2007-01-01

    The preparation of mammalian mitochondrial ribosomes in sufficient quantities for biochemical studies is best done beginning with whole tissue rather than from cells in culture. This issue arises because of the low abundance of these ribosomes in cells, making their isolation a challenge. Crude mitochondrial preparations are made by differential centrifugation and are treated with digitonin to remove the outer membrane. This treatment also effectively removes most contamination by cytoplasmic ribosomes. Purification of mammalian mitochondrial ribosomes requires treatment with detergents to release the ribosomes from their association with the membrane. Sucrose density gradient centrifugation is used to separate the ribosomes from other large oligomeric complexes from this organelle. PMID:18314732

  10. Single-Molecule Observations of Ribosome Function

    PubMed Central

    Blanchard, Scott C.

    2009-01-01

    Summary of Recent Advances Single-molecule investigations promise to greatly advance our understanding of basic and regulated ribosome functions during the process of translation. Here, recent progress towards directly imaging the elemental translation elongation steps using fluorescence resonance energy transfer (FRET)-based imaging methods is discussed, which provide striking evidence of the highly dynamic nature of the ribosome. In this view, global rates and fidelities of protein synthesis reactions may be regulated by interactions of the ribosome with mRNA, tRNA, translation factors, and potentially many other cellular ligands, that modify intrinsic conformational equilibria in the translating particle. Future investigations probing this model must aim to visualize translation processes from multiple structural and kinetic perspectives simultaneously, to provide direct correlations between factor binding and conformational events. PMID:19223173

  11. Genome Mining for Ribosomally Synthesized Natural Products

    PubMed Central

    Velásquez, Juan E.; van der Donk, Wilfred

    2011-01-01

    In recent years, the number of known peptide natural products that are synthesized via the ribosomal pathway has rapidly grown. Taking advantage of sequence homology among genes encoding precursor peptides or biosynthetic proteins, in silico mining of genomes combined with molecular biology approaches has guided the discovery of a large number of new ribosomal natural products, including lantipeptides, cyanobactins, linear thiazole/oxazole-containing peptides, microviridins, lasso peptides, amatoxins, cyclotides, and conopeptides. In this review, we describe the strategies used for the identification of these ribosomally-synthesized and posttranslationally modified peptides (RiPPs) and the structures of newly identified compounds. The increasing number of chemical entities and their remarkable structural and functional diversity may lead to novel pharmaceutical applications. PMID:21095156

  12. Ribosome-dependent activation of stringent control.

    PubMed

    Brown, Alan; Fernández, Israel S; Gordiyenko, Yuliya; Ramakrishnan, V

    2016-06-01

    In order to survive, bacteria continually sense, and respond to, environmental fluctuations. Stringent control represents a key bacterial stress response to nutrient starvation that leads to rapid and comprehensive reprogramming of metabolic and transcriptional patterns. In general, transcription of genes for growth and proliferation is downregulated, while those important for survival and virulence are upregulated. Amino acid starvation is sensed by depletion of the aminoacylated tRNA pools, and this results in accumulation of ribosomes stalled with non-aminoacylated (uncharged) tRNA in the ribosomal A site. RelA is recruited to stalled ribosomes and activated to synthesize a hyperphosphorylated guanosine analogue, (p)ppGpp, which acts as a pleiotropic secondary messenger. However, structural information about how RelA recognizes stalled ribosomes and discriminates against aminoacylated tRNAs is missing. Here we present the cryo-electron microscopy structure of RelA bound to the bacterial ribosome stalled with uncharged tRNA. The structure reveals that RelA utilizes a distinct binding site compared to the translational factors, with a multi-domain architecture that wraps around a highly distorted A-site tRNA. The TGS (ThrRS, GTPase and SpoT) domain of RelA binds the CCA tail to orient the free 3' hydroxyl group of the terminal adenosine towards a β-strand, such that an aminoacylated tRNA at this position would be sterically precluded. The structure supports a model in which association of RelA with the ribosome suppresses auto-inhibition to activate synthesis of (p)ppGpp and initiate the stringent response. Since stringent control is responsible for the survival of pathogenic bacteria under stress conditions, and contributes to chronic infections and antibiotic tolerance, RelA represents a good target for the development of novel antibacterial therapeutics. PMID:27279228

  13. Analysis of the conformation of the 3' major domain of Escherichia coli16S ribosomal RNA using site-directed photoaffinity crosslinking.

    PubMed Central

    Montpetit, A; Payant, C; Nolan, J M; Brakier-Gingras, L

    1998-01-01

    The 3' major domain of Escherichia coli 16S rRNA, which occupies the head of the small ribosomal subunit, is involved in several functions of the ribosome. We have used a site-specific crosslinking procedure to gain further insights into the higher-order structure of this domain. Circularly permuted RNAs were used to introduce an azidophenacyl group at specific positions within the 3' major domain. Crosslinks were generated in a high-ionic strength buffer that has been used for ribosome reconstitution studies and so enables the RNA to adopt a structure recognized by ribosomal proteins. The crosslinking sites were identified by primer extension and confirmed by assessing the mobility of the crosslinked RNA lariats in denaturing polyacrylamide gels. Eight crosslinks were characterized. Among them, one crosslink demonstrates that helix 28 is proximal to the top of helix 34, and two others show that the 1337 region, located in an internal loop at the junction of helices 29, 30, 41, and 42, is proximal to the center of helix 30 and to a segment connecting helix 28 to helix 29. These relationships of vicinity have previously been observed in native 30S subunits, which suggests that the free domain adopts a conformation similar to that within the 30S subunit. Furthermore, crosslinks were obtained in helix 34, which suggest that the upper and lower portions of this helix are in close proximity. PMID:9814765

  14. Fluctuations between multiple EF-G-induced chimeric tRNA states during translocation on the ribosome

    PubMed Central

    Adio, Sarah; Senyushkina, Tamara; Peske, Frank; Fischer, Niels; Wintermeyer, Wolfgang; Rodnina, Marina V.

    2015-01-01

    The coupled translocation of transfer RNA and messenger RNA through the ribosome entails large-scale structural rearrangements, including step-wise movements of the tRNAs. Recent structural work has visualized intermediates of translocation induced by elongation factor G (EF-G) with tRNAs trapped in chimeric states with respect to 30S and 50S ribosomal subunits. The functional role of the chimeric states is not known. Here we follow the formation of translocation intermediates by single-molecule fluorescence resonance energy transfer. Using EF-G mutants, a non-hydrolysable GTP analogue, and fusidic acid, we interfere with either translocation or EF-G release from the ribosome and identify several rapidly interconverting chimeric tRNA states on the reaction pathway. EF-G engagement prevents backward transitions early in translocation and increases the fraction of ribosomes that rapidly fluctuate between hybrid, chimeric and posttranslocation states. Thus, the engagement of EF-G alters the energetics of translocation towards a flat energy landscape, thereby promoting forward tRNA movement. PMID:26072700

  15. Fluctuations between multiple EF-G-induced chimeric tRNA states during translocation on the ribosome.

    PubMed

    Adio, Sarah; Senyushkina, Tamara; Peske, Frank; Fischer, Niels; Wintermeyer, Wolfgang; Rodnina, Marina V

    2015-01-01

    The coupled translocation of transfer RNA and messenger RNA through the ribosome entails large-scale structural rearrangements, including step-wise movements of the tRNAs. Recent structural work has visualized intermediates of translocation induced by elongation factor G (EF-G) with tRNAs trapped in chimeric states with respect to 30S and 50S ribosomal subunits. The functional role of the chimeric states is not known. Here we follow the formation of translocation intermediates by single-molecule fluorescence resonance energy transfer. Using EF-G mutants, a non-hydrolysable GTP analogue, and fusidic acid, we interfere with either translocation or EF-G release from the ribosome and identify several rapidly interconverting chimeric tRNA states on the reaction pathway. EF-G engagement prevents backward transitions early in translocation and increases the fraction of ribosomes that rapidly fluctuate between hybrid, chimeric and posttranslocation states. Thus, the engagement of EF-G alters the energetics of translocation towards a flat energy landscape, thereby promoting forward tRNA movement. PMID:26072700

  16. Fluctuations between multiple EF-G-induced chimeric tRNA states during translocation on the ribosome

    NASA Astrophysics Data System (ADS)

    Adio, Sarah; Senyushkina, Tamara; Peske, Frank; Fischer, Niels; Wintermeyer, Wolfgang; Rodnina, Marina V.

    2015-06-01

    The coupled translocation of transfer RNA and messenger RNA through the ribosome entails large-scale structural rearrangements, including step-wise movements of the tRNAs. Recent structural work has visualized intermediates of translocation induced by elongation factor G (EF-G) with tRNAs trapped in chimeric states with respect to 30S and 50S ribosomal subunits. The functional role of the chimeric states is not known. Here we follow the formation of translocation intermediates by single-molecule fluorescence resonance energy transfer. Using EF-G mutants, a non-hydrolysable GTP analogue, and fusidic acid, we interfere with either translocation or EF-G release from the ribosome and identify several rapidly interconverting chimeric tRNA states on the reaction pathway. EF-G engagement prevents backward transitions early in translocation and increases the fraction of ribosomes that rapidly fluctuate between hybrid, chimeric and posttranslocation states. Thus, the engagement of EF-G alters the energetics of translocation towards a flat energy landscape, thereby promoting forward tRNA movement.

  17. 30S Subunit-Dependent Activation of the Sorangium cellulosum So ce56 Aminoglycoside Resistance-Conferring 16S rRNA Methyltransferase Kmr

    PubMed Central

    Savic, Miloje; Sunita, S.; Zelinskaya, Natalia; Desai, Pooja M.; Macmaster, Rachel; Vinal, Kellie

    2015-01-01

    Methylation of bacterial 16S rRNA within the ribosomal decoding center confers exceptionally high resistance to aminoglycoside antibiotics. This resistance mechanism is exploited by aminoglycoside producers for self-protection while functionally equivalent methyltransferases have been acquired by human and animal pathogenic bacteria. Here, we report structural and functional analyses of the Sorangium cellulosum So ce56 aminoglycoside resistance-conferring methyltransferase Kmr. Our results demonstrate that Kmr is a 16S rRNA methyltransferase acting at residue A1408 to confer a canonical aminoglycoside resistance spectrum in Escherichia coli. Kmr possesses a class I methyltransferase core fold but with dramatic differences in the regions which augment this structure to confer substrate specificity in functionally related enzymes. Most strikingly, the region linking core β-strands 6 and 7, which forms part of the S-adenosyl-l-methionine (SAM) binding pocket and contributes to base flipping by the m1A1408 methyltransferase NpmA, is disordered in Kmr, correlating with an exceptionally weak affinity for SAM. Kmr is unexpectedly insensitive to substitutions of residues critical for activity of other 16S rRNA (A1408) methyltransferases and also to the effects of by-product inhibition by S-adenosylhomocysteine (SAH). Collectively, our results indicate that adoption of a catalytically competent Kmr conformation and binding of the obligatory cosubstrate SAM must be induced by interaction with the 30S subunit substrate. PMID:25733511

  18. The Caulobacter crescentus CgtAC Protein Cosediments with the Free 50S Ribosomal Subunit

    PubMed Central

    Lin, Bin; Thayer, Desiree A.; Maddock, Janine R.

    2004-01-01

    The Obg family of GTPases is widely conserved and predicted to play an as-yet-unknown role in translation. Recent reports provide circumstantial evidence that both eukaryotic and prokaryotic Obg proteins are associated with the large ribosomal subunit. Here we provide direct evidence that the Caulobacter crescentus CgtAC protein is associated with the free large (50S) ribosomal subunit but not with 70S monosomes or with translating ribosomes. In contrast to the Bacillus subtilis and Escherichia coli proteins, CgtAC does not fractionate in a large complex by gel filtration, indicating a moderately weak association with the 50S subunit. Moreover, binding of CgtAC to the 50S particle is sensitive to salt concentration and buffer composition but not guanine nucleotide occupancy of CgtAC. Assays of epitope-tagged wild-type and mutant variants of CgtAC indicate that the C terminus of CgtAC is critical for 50S association. Interestingly, the addition of a C-terminal epitope tag also affected the ability of various cgtAC alleles to function in vivo. Depletion of CgtAC led to perturbations in the polysome profile, raising the possibility that CgtAC is involved in ribosome assembly or stability. PMID:14702318

  19. Ribosomal Protein P2 from apicomplexan parasite Toxoplasma gondii is intrinsically a molten globule.

    PubMed

    Mishra, Pushpa; Choudhary, Sinjan; Hosur, Ramakrishna V

    2015-01-01

    Toxoplasma gondii is an apicomplexan parasite, which causes toxoplasmosis. Toxoplasma P2 (TgP2) is a ribosomal protein and exists as supramolecular assembly with other proteins in the ribosome. It is also shown that TgP2 is involved in some extra ribosomal functions. However, till date the protein has evaded structural characterization by any of the known techniques. In this background, we report here a systematic study using a variety of biophysical techniques and NMR, under different conditions of pH and temperature, and deduce that TgP2 consists of only helices and unstructured regions, is a monomer at low pH but forms multimers at higher pH, and has intrinsically a molten globule structure. The C-terminal half is flexible and the helices are concentrated in the N-terminal half of the chain. The dynamism inherent to the molten globule structure may have functional implications for its extra-ribosomal functions. which is contrast to that of human P2. PMID:25866913

  20. The linkage between ribosomal crystallography, metal ions, heteropolytungstates and functional flexibility

    NASA Astrophysics Data System (ADS)

    Bashan, Anat; Yonath, Ada

    2008-11-01

    Crystallography of ribosomes, the universal cell nucleoprotein assemblies facilitating the translation of the genetic-code into proteins, met with severe problems owing to the large size, complex structure, inherent flexibility and high conformational variability of the ribosome. For the case of the small ribosomal subunit, which caused extreme difficulties, post-crystallization treatment by minute amounts of a heteropolytungstate cluster allowed structure determination at atomic resolution. This cluster played a dual role: providing anomalous phasing power and dramatically increased the resolution, by stabilization of a selected functional conformation. Thus, four out of the fourteen clusters that bind to each of the crystallized small subunits are attached to a specific ribosomal protein in a fashion that may control a significant component of the subunit internal flexibility, by "gluing" symmetrical related subunits. Here, we highlight basic issues in the relationship between metal ions and macromolecules and present common traits controlling in the interactions between polymetalates and various macromolecules, which may be extended towards the exploitation of polymetalates for therapeutical treatment.

  1. Structures of two distinct conformations of holo-non-ribosomal peptide synthetases.

    PubMed

    Drake, Eric J; Miller, Bradley R; Shi, Ce; Tarrasch, Jeffrey T; Sundlov, Jesse A; Allen, C Leigh; Skiniotis, Georgios; Aldrich, Courtney C; Gulick, Andrew M

    2016-01-14

    Many important natural products are produced by multidomain non-ribosomal peptide synthetases (NRPSs). During synthesis, intermediates are covalently bound to integrated carrier domains and transported to neighbouring catalytic domains in an assembly line fashion. Understanding the structural basis for catalysis with non-ribosomal peptide synthetases will facilitate bioengineering to create novel products. Here we describe the structures of two different holo-non-ribosomal peptide synthetase modules, each revealing a distinct step in the catalytic cycle. One structure depicts the carrier domain cofactor bound to the peptide bond-forming condensation domain, whereas a second structure captures the installation of the amino acid onto the cofactor within the adenylation domain. These structures demonstrate that a conformational change within the adenylation domain guides transfer of intermediates between domains. Furthermore, one structure shows that the condensation and adenylation domains simultaneously adopt their catalytic conformations, increasing the overall efficiency in a revised structural cycle. These structures and the single-particle electron microscopy analysis demonstrate a highly dynamic domain architecture and provide the foundation for understanding the structural mechanisms that could enable engineering of novel non-ribosomal peptide synthetases. PMID:26762461

  2. Structures of the human and Drosophila 80S ribosome.

    PubMed

    Anger, Andreas M; Armache, Jean-Paul; Berninghausen, Otto; Habeck, Michael; Subklewe, Marion; Wilson, Daniel N; Beckmann, Roland

    2013-05-01

    Protein synthesis in all cells is carried out by macromolecular machines called ribosomes. Although the structures of prokaryotic, yeast and protist ribosomes have been determined, the more complex molecular architecture of metazoan 80S ribosomes has so far remained elusive. Here we present structures of Drosophila melanogaster and Homo sapiens 80S ribosomes in complex with the translation factor eEF2, E-site transfer RNA and Stm1-like proteins, based on high-resolution cryo-electron-microscopy density maps. These structures not only illustrate the co-evolution of metazoan-specific ribosomal RNA with ribosomal proteins but also reveal the presence of two additional structural layers in metazoan ribosomes, a well-ordered inner layer covered by a flexible RNA outer layer. The human and Drosophila ribosome structures will provide the basis for more detailed structural, biochemical and genetic experiments. PMID:23636399

  3. Effects of base change mutations within an Escherichia coli ribosomal RNA leader region on rRNA maturation and ribosome formation

    PubMed Central

    Schäferkordt, Jan; Wagner, Rolf

    2001-01-01

    The effects of base change mutations in a highly conserved sequence (boxC) within the leader of bacterial ribosomal RNAs (rRNAs) was studied. The boxC sequence preceding the 16S rRNA structural gene constitutes part of the RNase III processing site, one of the first cleavage sites on the pathway to mature 16S rRNA. Moreover, rRNA leader sequences facilitate correct 16S rRNA folding, thereby assisting ribosomal subunit formation. Mutations in boxC cause cold sensitivity and result in 16S rRNA and 30S subunit deficiency. Strains in which all rRNA operons are replaced by mutant transcription units are viable. Thermodynamic studies by temperature gradient gel electrophoresis reveal that mutant transcripts have a different, less ordered structure. In addition, RNA secondary structure differences between mutant and wild-type transcripts were determined by chemical and enzymatic probing. Differences are found in the leader RNA sequence itself but also in structurally important regions of the mature 16S rRNA. A minor fraction of the rRNA transcripts from mutant operons is not processed by RNase III, resulting in a significantly extended precursor half-life compared to the wild-type. The boxC mutations also give rise to a new aberrant degradation product of 16S rRNA. This intermediate cannot be detected in strains lacking RNase III. Together the results indicate that the boxC sequence, although important for RNase III processing, is likely to serve additional functions by facilitating correct formation of the mature 16S rRNA structure. They also suggest that quality control steps are acting during ribosome biogenesis. PMID:11504877

  4. Two thraustochytrid 5S ribosomal RNAs.

    PubMed Central

    MacKay, R M; Doolittle, W F

    1982-01-01

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  5. Two thraustochytrid 5S ribosomal RNAs.

    PubMed

    MacKay, R M; Doolittle, W F

    1982-12-20

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  6. Release of Nonstop Ribosomes Is Essential

    PubMed Central

    Feaga, Heather A.; Viollier, Patrick H.

    2014-01-01

    ABSTRACT Bacterial ribosomes frequently translate to the 3′ end of an mRNA without terminating at a stop codon. Almost all bacteria use the transfer-messenger RNA (tmRNA)-based trans-translation pathway to release these “nonstop” ribosomes and maintain protein synthesis capacity. trans-translation is essential in some species, but in others, such as Caulobacter crescentus, trans-translation can be inactivated. To determine why trans-translation is dispensable in C. crescentus, a Tn-seq screen was used to identify genes that specifically alter growth in cells lacking ssrA, the gene encoding tmRNA. One of these genes, CC1214, was essential in ΔssrA cells. Purified CC1214 protein could release nonstop ribosomes in vitro. CC1214 is a homolog of the Escherichia coli ArfB protein, and using the CC1214 sequence, ArfB homologs were identified in the majority of bacterial phyla. Most species in which ssrA has been deleted contain an ArfB homolog, suggesting that release of nonstop ribosomes may be essential in most or all bacteria. PMID:25389176

  7. Modeling Interactions of Erythromycin Derivatives with Ribosomes.

    PubMed

    Shishkina, A V; Makarova, T M; Tereshchenkov, A G; Makarov, G I; Korshunova, G A; Bogdanov, A A

    2015-11-01

    Using a method of static simulation, a series of erythromycin A analogs was designed with aldehyde functions introduced instead of one of the methyl substituents in the 3'-N-position of the antibiotic that was potentially capable of forming a covalent bond with an amino group of one of the nucleotide residues of the 23S rRNA in the ribosomal exit tunnel. Similar interaction is observed for antibiotics of the tylosin series, which bind tightly to the large ribosomal subunit and demonstrate high antibacterial activity. Binding of novel erythromycin derivatives with the bacterial ribosome was investigated with the method of fluorescence polarization. It was found that the erythromycin analog containing a 1-methyl-3-oxopropyl group in the 3'-N-position demonstrates the best binding. Based on the ability to inhibit protein biosynthesis, it is on the same level as erythromycin, and it is significantly better than desmethyl-erythromycin. Molecular dynamic modeling of complexes of the derivatives with ribosomes was conducted to explain the observed effects. PMID:26615442

  8. Promoter architectures in the yeast ribosomal expression program

    PubMed Central

    Bosio, Maria Cristina; Negri, Rodolfo

    2011-01-01

    Ribosome biogenesis begins with the orchestrated expression of hundreds of genes, including the three large classes of ribosomal protein, ribosome biogenesis and snoRNA genes. Current knowledge about the corresponding promoters suggests the existence of novel class-specific transcriptional strategies and crosstalk between telomere length and cell growth control. PMID:21468232

  9. Eukaryotic Initiation Factor 6, an evolutionarily conserved regulator of ribosome biogenesis and protein translation

    SciTech Connect

    Guo, Jianjun; Jin, Zhaoqing; Yang, Xiaohan; Li, Jian-Feng; Chen, Jay

    2011-01-01

    We recently identified Receptor for Activated C Kinase 1 (RACK1) as one of the molecular links between abscisic acid (ABA) signaling and its regulation on protein translation. Moreover, we identified Eukaryotic Initiation Factor 6 (eIF6) as an interacting partner of RACK1. Because the interaction between RACK1 and eIF6 in mammalian cells is known to regulate the ribosome assembly step of protein translation initiation, it was hypothesized that the same process of protein translation in Arabidopsis is also regulated by RACK1 and eIF6. In this article, we analyzed the amino acid sequences of eIF6 in different species from different lineages and discovered some intriguing differences in protein phosphorylation sites that may contribute to its action in ribosome assembly and biogenesis. In addition, we discovered that, distinct from non-plant organisms in which eIF6 is encoded by a single gene, all sequenced plant genomes contain two or more copies of eIF6 genes. While one copy of plant eIF6 is expressed ubiquitously and might possess the conserved function in ribosome biogenesis and protein translation, the other copy seems to be only expressed in specific organs and therefore may have gained some new functions. We proposed some important studies that may help us better understand the function of eIF6 in plants.

  10. Introns regulate the production of ribosomal proteins by modulating splicing of duplicated ribosomal protein genes

    PubMed Central

    Petibon, Cyrielle; Parenteau, Julie; Catala, Mathieu; Elela, Sherif Abou

    2016-01-01

    Most budding yeast introns exist in the many duplicated ribosomal protein genes (RPGs) and it has been posited that they remain there to modulate the expression of RPGs and cell growth in response to stress. However, the mechanism by which introns regulate the expression of RPGs and their impact on the synthesis of ribosomal proteins remain unclear. In this study, we show that introns determine the ratio of ribosomal protein isoforms through asymmetric paralog-specific regulation of splicing. Exchanging the introns and 3′ untranslated regions of the duplicated RPS9 genes altered the splicing efficiency and changed the ratio of the ribosomal protein isoforms. Mutational analysis of the RPS9 genes indicated that splicing is regulated by variations in the intron structure and the 3′ untranslated region. Together these data suggest that preferential splicing of duplicated RPGs provides a means for adjusting the ratio of different ribosomal protein isoforms, while maintaining the overall expression level of each ribosomal protein. PMID:26945043

  11. 2.8-Å Cryo-EM Structure of the Large Ribosomal Subunit from the Eukaryotic Parasite Leishmania.

    PubMed

    Shalev-Benami, Moran; Zhang, Yan; Matzov, Donna; Halfon, Yehuda; Zackay, Arie; Rozenberg, Haim; Zimmerman, Ella; Bashan, Anat; Jaffe, Charles L; Yonath, Ada; Skiniotis, Georgios

    2016-07-12

    Leishmania is a single-cell eukaryotic parasite of the Trypanosomatidae family, whose members cause an array of tropical diseases. The often fatal outcome of infections, lack of effective vaccines, limited selection of therapeutic drugs, and emerging resistant strains, underline the need to develop strategies to combat these pathogens. The Trypanosomatid ribosome has recently been highlighted as a promising therapeutic target due to structural features that are distinct from other eukaryotes. Here, we present the 2.8-Å resolution structure of the Leishmania donovani large ribosomal subunit (LSU) derived from a cryo-EM map, further enabling the structural observation of eukaryotic rRNA modifications that play a significant role in ribosome assembly and function. The structure illustrates the unique fragmented nature of leishmanial LSU rRNA and highlights the irregular distribution of rRNA modifications in Leishmania, a characteristic with implications for anti-parasitic drug development. PMID:27373148

  12. The structure of SAV1646 from Staphylococcus aureus belonging to a new `ribosome-associated' subfamily of bacterial proteins.

    PubMed

    Chirgadze, Yuri N; Clarke, Teresa E; Romanov, Vladimir; Kisselman, Gera; Wu-Brown, Jean; Soloveychik, Maria; Chan, Tiffany S Y; Gordon, Roni D; Battaile, Kevin P; Pai, Emil F; Chirgadze, Nickolay Y

    2015-02-01

    The crystal structure of the SAV1646 protein from the pathogenic microorganism Staphylococcus aureus has been determined at 1.7 Å resolution. The 106-amino-acid protein forms a two-layer sandwich with α/β topology. The protein molecules associate as dimers in the crystal and in solution, with the monomers related by a pseudo-twofold rotation axis. A sequence-homology search identified the protein as a member of a new subfamily of yet uncharacterized bacterial `ribosome-associated' proteins with at least 13 members to date. A detailed analysis of the crystal protein structure along with the genomic structure of the operon containing the sav1646 gene allowed a tentative functional model of this protein to be proposed. The SAV1646 dimer is assumed to form a complex with ribosomal proteins L21 and L27 which could help to complete the assembly of the large subunit of the ribosome. PMID:25664743

  13. A novel function for the 90 kDa heat-shock protein (Hsp90): facilitating nuclear export of 60 S ribosomal subunits.

    PubMed Central

    Schlatter, Harald; Langer, Thomas; Rosmus, Susann; Onneken, Marie-Luise; Fasold, Hugo

    2002-01-01

    Ribosomal subunits are assembled in the nucleus, and mature 40 S and 60 S subunits are exported stoichiometrically into the cytoplasm. The nuclear export of ribosomal subunits is a unidirectional, saturable and energy-dependent process. An in vitro assay for the nuclear export of 60 S ribosomal subunits involves the use of resealed nuclear envelopes. The export of ribosomal subunits from resealed nuclear envelopes is enhanced by cytoplasmic proteins. Here we present evidence that the export-promoting activity was due to the cytoplasmic 90 kDa heat-shock protein (Hsp90). Isolated, purified Hsp90 vastly enhanced the export of 60 S ribosomal subunits from resealed nuclear envelopes, while inhibition of Hsp90 function, either with the Hsp90-binding drug geldanamycin or with anti-Hsp90 antibodies, resulted in reduced release of 60 S ribosomal subunits. To confirm these findings under in vivo conditions, corresponding experiments were performed with Xenopus oocytes using microinjection techniques; the results obtained confirmed the findings obtained with resealed nuclear envelopes. These findings suggest that Hsp90 facilitates the nuclear export of 60 S ribosomal subunits, probably by chaperoning protein interactions during the export process. PMID:11879195

  14. Nom1 Mediates Pancreas Development by Regulating Ribosome Biogenesis in Zebrafish

    PubMed Central

    Qin, Wei; Chen, Zelin; Zhang, Yihan; Yan, Ruibin; Yan, Guanrong; Li, Song; Zhong, Hanbing; Lin, Shuo

    2014-01-01

    Ribosome biogenesis is an important biological process for proper cellular function and development. Defects leading to improper ribosome biogenesis can cause diseases such as Diamond-Blackfan anemia and Shwachman-Bodian-Diamond syndrome. Nucleolar proteins are a large family of proteins and are involved in many cellular processes, including the regulation of ribosome biogenesis. Through a forward genetic screen and positional cloning, we identified and characterized a zebrafish line carrying mutation in nucleolar protein with MIF4G domain 1 (nom1), which encodes a conserved nulceolar protein with a role in pre-rRNA processing. Zebrafish nom1 mutants exhibit major defects in endoderm development, especially in exocrine pancreas. Further studies revealed that impaired proliferation of ptf1a-expressing pancreatic progenitor cells mainly contributed to the phenotype. RNA-seq and molecular analysis showed that ribosome biogenesis and pre-mRNA splicing were both affected in the mutant embryos. Several defects of ribosome assembly have been shown to have a p53-dependent mechanism. In the nom1 mutant, loss of p53 did not rescue the pancreatic defect, suggesting a p53-independent role. Further studies indicate that protein phosphatase 1 alpha, an interacting protein to Nom1, could partially rescue the pancreatic defect in nom1 morphants if a human nucleolar localization signal sequence was artificially added. This suggests that targeting Pp1α into the nucleolus by Nom1 is important for pancreatic proliferation. Altogether, our studies revealed a new mechanism involving Nom1 in controlling vertebrate exocrine pancreas formation. PMID:24967912

  15. Harnessing natural product assembly lines: structure, promiscuity, and engineering.

    PubMed

    Ladner, Christopher C; Williams, Gavin J

    2016-03-01

    Many therapeutically relevant natural products are biosynthesized by the action of giant mega-enzyme assembly lines. By leveraging the specificity, promiscuity, and modularity of assembly lines, a variety of strategies has been developed that enables the biosynthesis of modified natural products. This review briefly summarizes recent structural advances related to natural product assembly lines, discusses chemical approaches to probing assembly line structures in the absence of traditional biophysical data, and surveys efforts that harness the inherent or engineered promiscuity of assembly lines for the synthesis of non-natural polyketides and non-ribosomal peptide analogues. PMID:26527577

  16. History of the ribosome and the origin of translation

    PubMed Central

    Petrov, Anton S.; Gulen, Burak; Norris, Ashlyn M.; Kovacs, Nicholas A.; Lanier, Kathryn A.; Fox, George E.; Harvey, Stephen C.; Wartell, Roger M.; Hud, Nicholas V.; Williams, Loren Dean

    2015-01-01

    We present a molecular-level model for the origin and evolution of the translation system, using a 3D comparative method. In this model, the ribosome evolved by accretion, recursively adding expansion segments, iteratively growing, subsuming, and freezing the rRNA. Functions of expansion segments in the ancestral ribosome are assigned by correspondence with their functions in the extant ribosome. The model explains the evolution of the large ribosomal subunit, the small ribosomal subunit, tRNA, and mRNA. Prokaryotic ribosomes evolved in six phases, sequentially acquiring capabilities for RNA folding, catalysis, subunit association, correlated evolution, decoding, energy-driven translocation, and surface proteinization. Two additional phases exclusive to eukaryotes led to tentacle-like rRNA expansions. In this model, ribosomal proteinization was a driving force for the broad adoption of proteins in other biological processes. The exit tunnel was clearly a central theme of all phases of ribosomal evolution and was continuously extended and rigidified. In the primitive noncoding ribosome, proto-mRNA and the small ribosomal subunit acted as cofactors, positioning the activated ends of tRNAs within the peptidyl transferase center. This association linked the evolution of the large and small ribosomal subunits, proto-mRNA, and tRNA. PMID:26621738

  17. History of the ribosome and the origin of translation.

    PubMed

    Petrov, Anton S; Gulen, Burak; Norris, Ashlyn M; Kovacs, Nicholas A; Bernier, Chad R; Lanier, Kathryn A; Fox, George E; Harvey, Stephen C; Wartell, Roger M; Hud, Nicholas V; Williams, Loren Dean

    2015-12-15

    We present a molecular-level model for the origin and evolution of the translation system, using a 3D comparative method. In this model, the ribosome evolved by accretion, recursively adding expansion segments, iteratively growing, subsuming, and freezing the rRNA. Functions of expansion segments in the ancestral ribosome are assigned by correspondence with their functions in the extant ribosome. The model explains the evolution of the large ribosomal subunit, the small ribosomal subunit, tRNA, and mRNA. Prokaryotic ribosomes evolved in six phases, sequentially acquiring capabilities for RNA folding, catalysis, subunit association, correlated evolution, decoding, energy-driven translocation, and surface proteinization. Two additional phases exclusive to eukaryotes led to tentacle-like rRNA expansions. In this model, ribosomal proteinization was a driving force for the broad adoption of proteins in other biological processes. The exit tunnel was clearly a central theme of all phases of ribosomal evolution and was continuously extended and rigidified. In the primitive noncoding ribosome, proto-mRNA and the small ribosomal subunit acted as cofactors, positioning the activated ends of tRNAs within the peptidyl transferase center. This association linked the evolution of the large and small ribosomal subunits, proto-mRNA, and tRNA. PMID:26621738

  18. The Functional Role of eL19 and eB12 Intersubunit Bridge in the Eukaryotic Ribosome.

    PubMed

    Kisly, Ivan; Gulay, Suna P; Mäeorg, Uno; Dinman, Jonathan D; Remme, Jaanus; Tamm, Tiina

    2016-05-22

    During translation, the two eukaryotic ribosomal subunits remain associated through 17 intersubunit bridges, five of which are eukaryote specific. These are mainly localized to the peripheral regions and are believed to stabilize the structure of the ribosome. The functional importance of these bridges remains largely unknown. Here, the essentiality of the eukaryote-specific bridge eB12 has been investigated. The main component of this bridge is ribosomal protein eL19 that is composed of an N-terminal globular domain, a middle region, and a long C-terminal α-helix. The analysis of deletion mutants demonstrated that the globular domain and middle region of eL19 are essential for cell viability, most likely functioning in ribosome assembly. The eB12 bridge, formed by contacts between the C-terminal α-helix of eL19 and 18S rRNA in concert with additional stabilizing interactions involving either eS7 or uS17, is dispensable for viability. Nevertheless, eL19 mutants impaired in eB12 bridge formation displayed slow growth phenotypes, altered sensitivity/resistance to translational inhibitors, and enhanced hyperosmotic stress tolerance. Biochemical analyses determined that the eB12 bridge contributes to the stability of ribosome subunit interactions in vitro. 60S subunits containing eL19 variants defective in eB12 bridge formation failed to form 80S ribosomes regardless of Mg(2+) concentration. The reassociation of 40S and mutant 60S subunits was markedly improved in the presence of deacetylated tRNA, emphasizing the importance of tRNAs during the subunit association. We propose that the eB12 bridge plays an important role in subunit joining and in optimizing ribosome functionality. PMID:27038511

  19. Differential scanning calorimetry of whole Escherichia coli treated with the antimicrobial peptide MSI-78 indicate a multi-hit mechanism with ribosomes as a novel target

    PubMed Central

    Brannan, Alexander M.; Whelan, William A.; Cole, Emma

    2015-01-01

    Differential Scanning Calorimetry (DSC) of intact Escherichia coli (E. coli) was used to identify non-lipidic targets of the antimicrobial peptide (AMP) MSI-78. The DSC thermograms revealed that, in addition to its known lytic properties, MSI-78 also has a striking effect on ribosomes. MSI-78’s effect on DSC scans of bacteria was similar to that of kanamycin, an antibiotic drug known to target the 30S small ribosomal subunit. An in vitro transcription/translation assay helped confirm MSI-78’s targeting of ribosomes. The scrambled version of MSI-78 also affected the ribosome peak of the DSC scans, but required greater amounts of peptide to cause a similar effect to the unscrambled peptide. Furthermore, the effect of the scrambled peptide was not specific to the ribosomes; other regions of the DSC thermogram were also affected. These results suggest that MSI-78’s effects on E. coli are at least somewhat dependent on its particular structural features, rather than a sole function of its overall charge and hydrophobicity. When considered along with earlier work detailing MSI-78’s membrane lytic properties, it appears that MSI-78 operates via a multi-hit mechanism with multiple targets. PMID:26713257

  20. The Genes for Cytoplasmic Ribosomal Ribonucleic Acid in Higher Plants

    PubMed Central

    Scott, N. Steele; Ingle, J.

    1973-01-01

    The genes for cytoplasmic ribosomal RNA are partially resolved from the bulk of the DNA by CsCl equilibrium centrifugation. Although in some plants the buoyant density of the ribosomal RNA genes is as expected from the base composition of ribosomal RNA, others show a large discrepancy which cannot be due to the presence of low G-C spacer-DNA. The cross-hybridization observed with 1.3 and 0.7 × 106 molecular weight ribosomal RNAs and DNA, which varies greatly with different plant species, is not due to contamination of the ribosomal RNAs, and is specific for the ribosomal DNA of each species, probably largely restricted to those sequences coding for the two stable ribosomal RNAs. The double reciprocal plot may be used for the extrapolation of saturation values only with caution, because in these cases such plots are not linear over the whole of the hybridization reaction. PMID:16658392

  1. Programmed Ribosomal Frameshifting Mediates Expression of the α-Carboxysome.

    PubMed

    Chaijarasphong, Thawatchai; Nichols, Robert J; Kortright, Kaitlyn E; Nixon, Charlotte F; Teng, Poh K; Oltrogge, Luke M; Savage, David F

    2016-01-16

    Many bacteria employ a protein organelle, the carboxysome, to catalyze carbon dioxide fixation in the Calvin Cycle. Only 10 genes from Halothiobacillus neapolitanus are sufficient for heterologous expression of carboxysomes in Escherichia coli, opening the door to detailed mechanistic analysis of the assembly process of this complex (more than 200MDa). One of these genes, csoS2, has been implicated in assembly but ascribing a molecular function is confounded by the observation that the single csoS2 gene yields expression of two gene products and both display an apparent molecular weight incongruent with the predicted amino acid sequence. Here, we elucidate the co-translational mechanism responsible for the expression of the two protein isoforms. Specifically, csoS2 was found to possess -1 frameshifting elements that lead to the production of the full-length protein, CsoS2B, and a truncated protein, CsoS2A, which possesses a C-terminus translated from the alternate frame. The frameshifting elements comprise both a ribosomal slippery sequence and a 3' secondary structure, and ablation of either sequence is sufficient to eliminate the slip. Using these mutants, we investigated the individual roles of CsoS2B and CsoS2A on carboxysome formation. In this in vivo formation assay, cells expressing only the CsoS2B isoform were capable of producing intact carboxysomes, while those with only CsoS2A were not. Thus, we have answered a long-standing question about the nature of CsoS2 in this model microcompartment and demonstrate that CsoS2B is functionally distinct from CsoS2A in the assembly of α-carboxysomes. PMID:26608811

  2. Biogenesis and nuclear export of ribosomal subunits in higher eukaryotes depend on the CRM1 export pathway.

    PubMed

    Thomas, Franziska; Kutay, Ulrike

    2003-06-15

    The production of ribosomes constitutes a major biosynthetic task for cells. Eukaryotic small and large ribosomal subunits are assembled in the nucleolus and independently exported to the cytoplasm. Most nuclear export pathways require RanGTP-binding export receptors. We analyzed the role of CRM1, the export receptor for leucine-rich nuclear export signals (NES), in the biogenesis of ribosomal subunits in vertebrate cells. Inhibition of the CRM1 export pathway led to a defect in nuclear export of both 40S and 60S subunits in HeLa cells. Moreover, the export of newly made ribosomal subunits in Xenopus oocytes was efficiently and specifically competed by BSA-NES conjugates. The CRM1 dependence of 60S subunit export suggested a conserved function for NMD3, a factor proposed to be a 60S subunit export adaptor in yeast. Indeed, we observed that nuclear export of human NMD3 (hNMD3) is sensitive to leptomycin B (LMB), which inactivates CRM1. It had, however, not yet been demonstrated that Nmd3 can interact with CRM1. Using purified recombinant proteins we have shown here that hNMD3 binds to CRM1 directly, in a RanGTP-dependent manner, by way of a C-terminal NES sequence. Our results suggest that the functions of CRM1 and NMD3 in ribosomal subunit export are conserved from yeast to higher eukaryotes. PMID:12724356

  3. A three-dimensional model of domain III of the Escherichia coli small ribosomal subunit.

    PubMed

    Elson, D; Spitnik-Elson, P

    1987-09-01

    A three-dimensional model of domain III (nucleotides 920 to 1395) of the 30S ribosomal subunit of E. coli is proposed. The data used as a guide in folding the secondary structure of the RNA into a tertiary structure are four long range RNA-RNA interactions proposed by us on the basis of experiments performed in this laboratory plus two sets of data from other laboratories: protein-RNA cross-linking sites for proteins S1, S3, S7, S10 and S12, and the interprotein distances determined by neutron scattering. The model is consistent with nearly all of the published experimental findings on the structure of domain III. PMID:2450593

  4. Anaerobic energy release in working muscle during 30 s to 3 min of exhausting bicycling.

    PubMed

    Medbø, J I; Tabata, I

    1993-10-01

    To examine the anaerobic energy release during intense exercise, 16 healthy young men cycled as long as possible at constant powers chosen to exhaust the subjects in approximately 30 s, 1 min, or 2-3 min. Muscle biopsies were taken before and approximately 10 s after exercise and analyzed for lactate, phosphocreatine (PCr), and other metabolites. O2 uptake was measured for determination of the accumulated O2 deficit (a whole body measure of the anaerobic energy release), and this indirect measure of the anaerobic energy release was compared with a direct value obtained from measured muscle metabolites. Muscle lactate concentration rose by 30.0 +/- 1.2 mmol/kg and muscle PCr concentration fell by 12.4 +/- 0.9 mmol/kg during the 2-3 min of exhausting exercise. The anaerobic ATP production was consequently 58 +/- 2 mmol/kg wet muscle mass, which may be the maximum anaerobic energy release for human muscle during bicycling. Because the anaerobic ATP production was 6 and 32% less for 1 min and 30 s of exercise, respectively, than for 2 min of exercise (P < 0.03), 2 min of exhausting exercise may be required for maximal use of anaerobic sources. Lactate production provided three times more ATP than PCr breakdown for all three exercise durations. There was a close linear relationship between the rates of anaerobic ATP production in muscle and the value estimated for the whole body by the O2 deficit (r = 0.94). This suggests that the accumulated O2 deficit is a valid measure of the anaerobic energy release during bicycling. PMID:8282617

  5. Ribosomal Mutations in Streptococcus pneumoniae Clinical Isolates

    PubMed Central

    Pihlajamäki, Marja; Kataja, Janne; Seppälä, Helena; Elliot, John; Leinonen, Maija; Huovinen, Pentti; Jalava, Jari

    2002-01-01

    Eleven clinical isolates of Streptococcus pneumoniae, isolated in Finland during 1996 to 2000, had an unusual macrolide resistance phenotype. They were resistant to macrolides and streptogramin B but susceptible, intermediate, or low-level resistant to lincosamides. No acquired macrolide resistance genes were detected from the strains. The isolates were found to have mutations in domain V of the 23S rRNA or ribosomal protein L4. Seven isolates had an A2059C mutation in two to four out of the four alleles encoding the 23S rRNA, two isolates had an A2059G mutation in two alleles, one isolate had a C2611G mutation in all four alleles, and one isolate had a 69GTG71-to-69TPS71 substitution in ribosomal protein L4. PMID:11850244

  6. Navigating the ribosome's metastable energy landscape.

    PubMed

    Munro, James B; Sanbonmatsu, Kevin Y; Spahn, Christian M T; Blanchard, Scott C

    2009-08-01

    The molecular mechanisms by which tRNA molecules enter and transit the ribosome during mRNA translation remains elusive. However, recent genetic, biochemical and structural studies offer important new findings into the ordered sequence of events underpinning the translocation process that help place the molecular mechanism within reach. In particular, new structural and kinetic insights have been obtained regarding tRNA movements through 'hybrid state' configurations. These dynamic views reveal that the macromolecular ribosome particle, like many smaller proteins, has an intrinsic capacity to reversibly sample an ensemble of similarly stable native states. Such perspectives suggest that substrates, factors and environmental cues contribute to translation regulation by helping the dynamic system navigate through a highly complex and metastable energy landscape. PMID:19647434

  7. Energy landscape of the ribosomal decoding center.

    PubMed

    Sanbonmatsu, K Y

    2006-08-01

    The ribosome decodes the genetic information that resides in nucleic acids. A key component of the decoding mechanism is a conformational switch in the decoding center of the small ribosomal subunit discovered in high-resolution X-ray crystallography studies. It is known that small subunit nucleotides A1492 and A1493 flip out of helix 44 upon transfer RNA (tRNA) binding; however, the operation principles of this switch remain unknown. Replica molecular dynamics simulations reveal a low free energy barrier between flipped-out and flipped-in states, consistent with a switch that can be controlled by shifting the equilibrium between states. The barrier determined by the simulations is sufficiently small for the binding of ligands, such as tRNAs or aminoglycoside antibiotics, to shift the equilibrium. PMID:16905237

  8. Disassembly of yeast 80S ribosomes into subunits is a concerted action of ribosome-assisted folding of denatured protein.

    PubMed

    Chakraborty, Biprashekhar; Bhakta, Sayan; Sengupta, Jayati

    2016-01-22

    It has been shown by several groups that ribosome can assist folding of denatured protein in vitro and the process is conserved across the species. Domain V of large ribosomal rRNA which occupies the intersubunit side of the large subunit was identified as the key player responsible for chaperoning the folding process. Thus, it is conceivable that denatured protein needs to access the intersubunit space of the ribosome in order to get folded. In this study, we have investigated the mechanism of release of the protein from the eukaryotic ribosome following reactivation. We have observed significant splitting of yeast 80S ribosome when incubated with the denatured BCAII protein. Energy-free disassembly mechanism functions in low Mg(+2) ion concentration for prokaryotic ribosomes. Eukaryotic ribosomes do not show significant splitting even at low Mg(+2) ion concentration. In this respect, denatured protein-induced disassembly of eukaryotic ribosome without the involvement of any external energy source is intriguing. For prokaryotic ribosomes, it was reported that the denatured protein induces ribosome splitting into subunits in order to access domain V-rRNA. In contrast, our results suggest an alternative mechanism for eukaryotic ribosomal rRNA-mediated protein folding and subsequent separation of the subunits by which release of the activated-protein occurs. PMID:26723252

  9. Structure and Function of the Mitochondrial Ribosome.

    PubMed

    Greber, Basil J; Ban, Nenad

    2016-06-01

    Mitochondrial ribosomes (mitoribosomes) perform protein synthesis inside mitochondria, the organelles responsible for energy conversion and adenosine triphosphate production in eukaryotic cells. Throughout evolution, mitoribosomes have become functionally specialized for synthesizing mitochondrial membrane proteins, and this has been accompanied by large changes to their structure and composition. We review recent high-resolution structural data that have provided unprecedented insight into the structure and function of mitoribosomes in mammals and fungi. PMID:27023846

  10. Structural snapshots of actively translating human ribosomes.

    PubMed

    Behrmann, Elmar; Loerke, Justus; Budkevich, Tatyana V; Yamamoto, Kaori; Schmidt, Andrea; Penczek, Pawel A; Vos, Matthijn R; Bürger, Jörg; Mielke, Thorsten; Scheerer, Patrick; Spahn, Christian M T

    2015-05-01

    Macromolecular machines, such as the ribosome, undergo large-scale conformational changes during their functional cycles. Although their mode of action is often compared to that of mechanical machines, a crucial difference is that, at the molecular dimension, thermodynamic effects dominate functional cycles, with proteins fluctuating stochastically between functional states defined by energetic minima on an energy landscape. Here, we have used cryo-electron microscopy to image ex-vivo-derived human polysomes as a source of actively translating ribosomes. Multiparticle refinement and 3D variability analysis allowed us to visualize a variety of native translation intermediates. Significantly populated states include not only elongation cycle intermediates in pre- and post-translocational states, but also eEF1A-containing decoding and termination/recycling complexes. Focusing on the post-translocational state, we extended this assessment to the single-residue level, uncovering striking details of ribosome-ligand interactions and identifying both static and functionally important dynamic elements. PMID:25957688

  11. Structural snapshots of actively translating human ribosomes

    PubMed Central

    Behrmann, Elmar; Loerke, Justus; Budkevich, Tatyana V.; Yamamoto, Kaori; Schmidt, Andrea; Penczek, Pawel A.; Vos, Matthijn R.; Bürger, Jörg; Mielke, Thorsten; Scheerer, Patrick; Spahn, Christian M.T.

    2015-01-01

    Summary Macromolecular machines, such as the ribosome, undergo large-scale conformational changes during their functional cycles. While their mode of action is often compared to that of mechanical machines, a crucial difference is that at the molecular dimension, thermodynamic effects dominate functional cycles, with proteins fluctuating stochastically between functional states defined by energetic minima on an energy landscape. Here, we have used cryo-electron microscopy to image ex vivo-derived human polysomes as a source of actively translating ribosomes. Multiparticle refinement and three-dimensional variability analysis allowed us to visualize a variety of native translation intermediates. Significantly populated states include not only elongation cycle intermediates in pre- and post-translocational states, but also eEF1A-containing decoding and termination/recycling complexes. Focusing on the post-translocational state, we extended this assessment to the single-residue level, uncovering striking details of ribosome-ligand interactions and identifying both static and functionally important dynamic elements. PMID:25957688

  12. Stochastic gating and drug-ribosome interactions.

    PubMed

    Vaiana, Andrea C; Sanbonmatsu, Kevin Y

    2009-02-27

    Gentamicin is a potent antibiotic that is used in combination therapy for inhalation anthrax disease. The drug is also often used in therapy for methicillin-resistant Staphylococcusaureus. Gentamicin works by flipping a conformational switch on the ribosome, disrupting the reading head (i.e., 16S ribosomal decoding bases 1492-1493) used for decoding messenger RNA. We use explicit solvent all-atom molecular simulation to study the thermodynamics of the ribosomal decoding site and its interaction with gentamicin. The replica exchange molecular dynamics simulations used an aggregate sampling of 15 mus when summed over all replicas, allowing us to explicitly calculate the free-energy landscape, including a rigorous treatment of enthalpic and entropic effects. Here, we show that the decoding bases flip on a timescale faster than that of gentamicin binding, supporting a stochastic gating mechanism for antibiotic binding, rather than an induced-fit model where the bases only flip in the presence of a ligand. The study also allows us to explore the nonspecific binding landscape near the binding site and reveals that, rather than a two-state bound/unbound scenario, drug dissociation entails shuttling between many metastable local minima in the free-energy landscape. Special care is dedicated to validation of the obtained results, both by direct comparison to experiment and by estimation of simulation convergence. PMID:19146858

  13. Polar bears, antibiotics, and the evolving ribosome (Nobel Lecture).

    PubMed

    Yonath, Ada

    2010-06-14

    High-resolution structures of ribosomes, the cellular machines that translate the genetic code into proteins, revealed the decoding mechanism, detected the mRNA path, identified the sites of the tRNA molecules in the ribosome, elucidated the position and the nature of the nascent proteins exit tunnel, illuminated the interactions of the ribosome with non-ribosomal factors, such as the initiation, release and recycling factors, and provided valuable information on ribosomal antibiotics, their binding sites, modes of action, principles of selectivity and the mechanisms leading to their resistance. Notably, these structures proved that the ribosome is a ribozyme whose active site, namely where the peptide bonds are being formed, is situated within a universal symmetrical region that is embedded in the otherwise asymmetric ribosome structure. As this symmetrical region is highly conserved and provides the machinery required for peptide bond formation and for ribosome polymerase activity, it may be the remnant of the proto-ribosome, a dimeric prebiotic machine that formed peptide bonds and non-coded polypeptide chains. Structures of complexes of ribosomes with antibiotics targeting them revealed the principles allowing for their clinical use, identified resistance mechanisms and showed the structural bases for discriminating pathogenic bacteria from hosts, hence providing valuable structural information for antibiotics improvement and for the design of novel compounds that can serve as antibiotics. PMID:20535730

  14. Structure of a mitochondrial ribosome with minimal RNA.

    PubMed

    Sharma, Manjuli R; Booth, Timothy M; Simpson, Larry; Maslov, Dmitri A; Agrawal, Rajendra K

    2009-06-16

    The Leishmania tarentolae mitochondrial ribosome (Lmr) is a minimal ribosomal RNA (rRNA)-containing ribosome. We have obtained a cryo-EM map of the Lmr. The map reveals several features that have not been seen in previously-determined structures of eubacterial or eukaryotic (cytoplasmic or organellar) ribosomes to our knowledge. Comparisons of the Lmr map with X-ray crystallographic and cryo-EM maps of the eubacterial ribosomes and a cryo-EM map of the mammalian mitochondrial ribosome show that (i) the overall structure of the Lmr is considerably more porous, (ii) the topology of the intersubunit space is significantly different, with fewer intersubunit bridges, but more tunnels, and (iii) several of the functionally-important rRNA regions, including the alpha-sarcin-ricin loop, have different relative positions within the structure. Furthermore, the major portions of the mRNA channel, the tRNA passage, and the nascent polypeptide exit tunnel contain Lmr-specific proteins, suggesting that the mechanisms for mRNA recruitment, tRNA interaction, and exiting of the nascent polypeptide in Lmr must differ markedly from the mechanisms deduced for ribosomes in other organisms. Our study identifies certain structural features that are characteristic solely of mitochondrial ribosomes and other features that are characteristic of both mitochondrial and chloroplast ribosomes (i.e., organellar ribosomes). PMID:19497863

  15. Ribosomal History Reveals Origins of Modern Protein Synthesis

    PubMed Central

    Harish, Ajith; Caetano-Anollés, Gustavo

    2012-01-01

    The origin and evolution of the ribosome is central to our understanding of the cellular world. Most hypotheses posit that the ribosome originated in the peptidyl transferase center of the large ribosomal subunit. However, these proposals do not link protein synthesis to RNA recognition and do not use a phylogenetic comparative framework to study ribosomal evolution. Here we infer evolution of the structural components of the ribosome. Phylogenetic methods widely used in morphometrics are applied directly to RNA structures of thousands of molecules and to a census of protein structures in hundreds of genomes. We find that components of the small subunit involved in ribosomal processivity evolved earlier than the catalytic peptidyl transferase center responsible for protein synthesis. Remarkably, subunit RNA and proteins coevolved, starting with interactions between the oldest proteins (S12 and S17) and the oldest substructure (the ribosomal ratchet) in the small subunit and ending with the rise of a modern multi-subunit ribosome. Ancestral ribonucleoprotein components show similarities to in vitro evolved RNA replicase ribozymes and protein structures in extant replication machinery. Our study therefore provides important clues about the chicken-or-egg dilemma associated with the central dogma of molecular biology by showing that ribosomal history is driven by the gradual structural accretion of protein and RNA structures. Most importantly, results suggest that functionally important and conserved regions of the ribosome were recruited and could be relics of an ancient ribonucleoprotein world. PMID:22427882

  16. Ribosome origins: The relative age of 23S rRNA Domains

    NASA Astrophysics Data System (ADS)

    Hury, James; Nagaswamy, Uma; Larios-Sanz, Maia; Fox, George E.

    2006-08-01

    The modern ribosome and its component RNAs are quite large and it is likely that at an earlier time they were much smaller. Hence, not all regions of the modern ribosomal RNAs (rRNA) are likely to be equally old. In the work described here, it is hypothesized that the oldest regions of the RNAs will usually be highly integrated into the machinery. When this is the case, an examination of the interconnectivity between local RNA regions can provide insight to the relative age of the various regions. Herein, we describe an analysis of all known long-range RNA/RNA interactions within the 23S rRNA and between the 23S rRNA and the 16S rRNA in order to assess the interconnectivity between the usual Domains as defined by secondary structure. Domain V, which contains the peptidyl transferase center is centrally located, extensively connected, and therefore likely to be the oldest region. Domain IV and Domain II are extensively interconnected with both themselves and Domain V. A portion of Domain IV is also extensively connected with the 30S subunit and hence Domain IV may be older than Domain II. These results are consistent with other evidence relating to the relative age of RNA regions. Although the relative time of addition of the GTPase center can not be reliably deduced it is pointed out that the development of this may have dramatically affected the progenotes that preceded the last common ancestor.

  17. Modification of ribosomal RNA by ribosome-inactivating proteins from plants.

    PubMed Central

    Stirpe, F; Bailey, S; Miller, S P; Bodley, J W

    1988-01-01

    We have surveyed 14 different toxic and nontoxic ribosome-inactivating proteins from plants for the ability to act on the RNA of the eucaryotic 60 S ribosomal subunit. All of these proteins act to introduce a specific modification into 26-28 S RNA which renders the RNA sensitive to cleavage by aniline. Sequence analysis of the 5'-termini of the fragments produced by ricin and saporin following aniline cleavage indicate that both proteins possess identical specificity. Our observations support the conclusion of Endo and Tsurugi (J. Biol. Chem. 262, 8128-8130, 1987) that ricin is a specific N-glycosidase and we have located the site of this cleavage by direct sequence analysis. Our results further suggest that all plant ribosome-inactivating proteins function as specific N-glycosidases with the same specificity. Images PMID:3347493

  18. Involvement of human ribosomal proteins in nucleolar structure and p53-dependent nucleolar stress.

    PubMed

    Nicolas, Emilien; Parisot, Pascaline; Pinto-Monteiro, Celina; de Walque, Roxane; De Vleeschouwer, Christophe; Lafontaine, Denis L J

    2016-01-01

    The nucleolus is a potent disease biomarker and a target in cancer therapy. Ribosome biogenesis is initiated in the nucleolus where most ribosomal (r-) proteins assemble onto precursor rRNAs. Here we systematically investigate how depletion of each of the 80 human r-proteins affects nucleolar structure, pre-rRNA processing, mature rRNA accumulation and p53 steady-state level. We developed an image-processing programme for qualitative and quantitative discrimination of normal from altered nucleolar morphology. Remarkably, we find that uL5 (formerly RPL11) and uL18 (RPL5) are the strongest contributors to nucleolar integrity. Together with the 5S rRNA, they form the late-assembling central protuberance on mature 60S subunits, and act as an Hdm2 trap and p53 stabilizer. Other major contributors to p53 homeostasis are also strictly late-assembling large subunit r-proteins essential to nucleolar structure. The identification of the r-proteins that specifically contribute to maintaining nucleolar structure and p53 steady-state level provides insights into fundamental aspects of cell and cancer biology. PMID:27265389

  19. Involvement of human ribosomal proteins in nucleolar structure and p53-dependent nucleolar stress

    PubMed Central

    Nicolas, Emilien; Parisot, Pascaline; Pinto-Monteiro, Celina; de Walque, Roxane; De Vleeschouwer, Christophe; Lafontaine, Denis L. J.

    2016-01-01

    The nucleolus is a potent disease biomarker and a target in cancer therapy. Ribosome biogenesis is initiated in the nucleolus where most ribosomal (r-) proteins assemble onto precursor rRNAs. Here we systematically investigate how depletion of each of the 80 human r-proteins affects nucleolar structure, pre-rRNA processing, mature rRNA accumulation and p53 steady-state level. We developed an image-processing programme for qualitative and quantitative discrimination of normal from altered nucleolar morphology. Remarkably, we find that uL5 (formerly RPL11) and uL18 (RPL5) are the strongest contributors to nucleolar integrity. Together with the 5S rRNA, they form the late-assembling central protuberance on mature 60S subunits, and act as an Hdm2 trap and p53 stabilizer. Other major contributors to p53 homeostasis are also strictly late-assembling large subunit r-proteins essential to nucleolar structure. The identification of the r-proteins that specifically contribute to maintaining nucleolar structure and p53 steady-state level provides insights into fundamental aspects of cell and cancer biology. PMID:27265389

  20. RNA Mimicry by the Fap7 Adenylate Kinase in Ribosome Biogenesis

    PubMed Central

    Réty, Stéphane; Lebaron, Simon; Deschamps, Patrick; Bareille, Joseph; Jombart, Julie; Robert-Paganin, Julien; Delbos, Lila; Chardon, Florian; Zhang, Elodie; Charenton, Clément; Tollervey, David; Leulliot, Nicolas

    2014-01-01

    During biogenesis of the 40S and 60S ribosomal subunits, the pre-40S particles are exported to the cytoplasm prior to final cleavage of the 20S pre-rRNA to mature 18S rRNA. Amongst the factors involved in this maturation step, Fap7 is unusual, as it both interacts with ribosomal protein Rps14 and harbors adenylate kinase activity, a function not usually associated with ribonucleoprotein assembly. Human hFap7 also regulates Cajal body assembly and cell cycle progression via the p53–MDM2 pathway. This work presents the functional and structural characterization of the Fap7–Rps14 complex. We report that Fap7 association blocks the RNA binding surface of Rps14 and, conversely, Rps14 binding inhibits adenylate kinase activity of Fap7. In addition, the affinity of Fap7 for Rps14 is higher with bound ADP, whereas ATP hydrolysis dissociates the complex. These results suggest that Fap7 chaperones Rps14 assembly into pre-40S particles via RNA mimicry in an ATP-dependent manner. Incorporation of Rps14 by Fap7 leads to a structural rearrangement of the platform domain necessary for the pre-rRNA to acquire a cleavage competent conformation. PMID:24823650

  1. Structure of the ribosomal interacting GTPase YjeQ from the enterobacterial species Salmonella typhimurium

    SciTech Connect

    Nichols, C. E.; Johnson, C.; Lamb, H. K.; Lockyer, M.; Charles, I. G.; Hawkins, A. R.; Stammers, D. K.

    2007-11-01

    The X-ray crystal structure of the GTPase YjeQ from S. typhimurium is presented and compared with those of orthologues from T. maritima and B. subtilis. The YjeQ class of P-loop GTPases assist in ribosome biogenesis and also bind to the 30S subunit of mature ribosomes. YjeQ ribosomal binding is GTP-dependent and thought to specifically direct protein synthesis, although the nature of the upstream signal causing this event in vivo is as yet unknown. The attenuating effect of YjeQ mutants on bacterial growth in Escherichia coli makes it a potential target for novel antimicrobial agents. In order to further explore the structure and function of YjeQ, the isolation, crystallization and structure determination of YjeQ from the enterobacterial species Salmonella typhimurium (StYjeQ) is reported. Whilst the overall StYjeQ fold is similar to those of the previously reported Thematoga maritima and Bacillus subtilis orthologues, particularly the GTPase domain, there are larger differences in the three OB folds. Although the zinc-finger secondary structure is conserved, significant sequence differences alter the nature of the external surface in each case and may reflect varying signalling pathways. Therefore, it may be easier to develop YjeQ-specific inhibitors that target the N- and C-terminal regions, disrupting the metabolic connectivity rather than the GTPase activity. The availability of coordinates for StYjeQ will provide a significantly improved basis for threading Gram-negative orthologue sequences and in silico compound-screening studies, with the potential for the development of species-selective drugs.

  2. Switching off the tackiness of a nanocomposite adhesive in 30 s via infrared sintering.

    PubMed

    Gurney, Robert S; Dupin, Damien; Nunes, Juliana S; Ouzineb, Keltoum; Siband, Elodie; Asua, José M; Armes, Steven P; Keddie, Joseph L

    2012-10-24

    Soft adhesives require an optimum balance of viscous and elastic properties. Adhesion is poor when the material is either too solidlike or too liquidlike. The ability to switch tack adhesion off at a desired time has many applications, such as in recycling, disassembly of electronics, and painless removal of wound dressings. Here, we describe a new strategy to switch off the tack adhesion in a model nanocomposite adhesive in which temperature is the trigger. The nanocomposite comprises hard methacrylic nanoparticles blended with a colloidal dispersion of soft copolymer particles. At relatively low volume fractions, the nanoparticles (50 nm diameter) accumulate near the film surface, where they pack around the larger soft particles (270 nm). The viscoelasticity of the nanocomposite is adjusted via the nanoparticle concentration. When the nanocomposite is heated above the glass transition temperature of the nanoparticles (T(g) = 130 °C), they sinter together to create a rigid network that raises the elastic modulus at room temperature. The tackiness is switched off. Intense infrared radiation is used to heat the nanocomposites, leading to a fast temperature rise. Tack adhesion is switched off within 30 s in optimized compositions. These one-way switchable adhesives have the potential to be patterned through localized heating. PMID:22974179

  3. Motives for physical activity among active and inactive persons in their mid-30s.

    PubMed

    Aaltonen, S; Rottensteiner, M; Kaprio, J; Kujala, U M

    2014-08-01

    The purpose of this study was to examine the motives for leisure-time physical activity among active and inactive men and women in their mid-30s. We used both cross-sectional and longitudinal designs. Altogether, 2308 participants (mean age 33.9 years, 53.4% women) were identified from the population-based FinnTwin16 Cohort. Physically active and inactive individuals were identified on the basis of their leisure-time MET h/day. We evaluated participants' physical activity motivation with a modified version of the Recreational Exercise Motivation Measure. Comparisons between active and inactive individuals were analysed using the Wald test for equality of means, and effect sizes were calculated as Cohen's d. Motives related to mastery, physical fitness, social aspect of physical activity, psychological state, enjoyment, willingness to be fitter/look better than others, and appearance were significantly more important for the active than inactive participants. Conforming to others' expectations was the only item on which the inactive persons scored higher than active persons. The longitudinal results for physical activity were parallel to the cross-sectional results. This study supports the view that motivation factors differ between active and inactive persons, and that intrinsic motives are associated with consistent leisure-time physical activity. PMID:23331765

  4. Non-Diamond Blackfan anemia disorders of ribosome function: Shwachman Diamond syndrome and 5q- syndrome.

    PubMed

    Burwick, Nicholas; Shimamura, Akiko; Liu, Johnson M

    2011-04-01

    A number of human disorders, dubbed ribosomopathies, are linked to impaired ribosome biogenesis or function. These include but are not limited to Diamond Blackfan anemia (DBA), Shwachman Diamond syndrome (SDS), and the 5q- myelodysplastic syndrome (MDS). This review focuses on the latter two non-DBA disorders of ribosome function. Both SDS and 5q- syndrome lead to impaired hematopoiesis and a predisposition to leukemia. SDS, due to bi-allelic mutations of the SBDS gene, is a multi-system disorder that also includes bony abnormalities, and pancreatic and neurocognitive dysfunction. SBDS associates with the 60S subunit in human cells and has a role in subunit joining and translational activation in yeast models. In contrast, 5q- syndrome is associated with acquired haplo-insufficiency of RPS14, a component of the small 40S subunit. RPS14 is critical for 40S assembly in yeast models, and depletion of RPS14 in human CD34(+) cells is sufficient to recapitulate the 5q- erythroid defect. Both SDS and the 5q- syndrome represent important models of ribosome function and may inform future treatment strategies for the ribosomopathies. PMID:21435510

  5. A preformed compact ribosome-binding domain in the cricket paralysis-like virus IRES RNAs

    PubMed Central

    COSTANTINO, DAVID; KIEFT, JEFFREY S.

    2005-01-01

    The internal ribosome site RNA of the cricket paralysis-like viruses (CrPV-like) binds directly to the ribosome, assembling the translation machinery without initiation factors. This mechanism does not require initiator tRNA, and translation starts from a non-AUG codon. A wealth of biochemical data has yielded a working model for this process, but the three-dimensional structure and biophysical characteristics of the unbound CrPV-like IRES RNAs are largely unexplored. Here, we demonstrate that the CrPV-like IRESes prefold into a two-part structure in the presence of magnesium ions. The largest part is a prefolded compact RNA domain that shares folding and structural characteristics with other compactly folded RNAs such as group I intron RNAs and RNase P RNA. Chemical probing reveals that the CrPV-like IRES’ compact domain contains RNA helices that are packed tightly enough to exclude solvent, and analytical ultracentrifugation indicates a large change in the shape of the IRES upon folding. Formation of this compact domain is necessary for binding of the 40S subunit, and the structural organization of the unbound IRES RNA is consistent with the hypothesis that the IRES is functionally and structurally preorganized before ribosome binding. PMID:15701733

  6. Architecture of the Rix1-Rea1 checkpoint machinery during pre-60S-ribosome remodeling.

    PubMed

    Barrio-Garcia, Clara; Thoms, Matthias; Flemming, Dirk; Kater, Lukas; Berninghausen, Otto; Baßler, Jochen; Beckmann, Roland; Hurt, Ed

    2016-01-01

    Ribosome synthesis is catalyzed by ∼200 assembly factors, which facilitate efficient production of mature ribosomes. Here, we determined the cryo-EM structure of a Saccharomyces cerevisiae nucleoplasmic pre-60S particle containing the dynein-related 550-kDa Rea1 AAA(+) ATPase and the Rix1 subcomplex. This particle differs from its preceding state, the early Arx1 particle, by two massive structural rearrangements: an ∼180° rotation of the 5S ribonucleoprotein complex and the central protuberance (CP) rRNA helices, and the removal of the 'foot' structure from the 3' end of the 5.8S rRNA. Progression from the Arx1 to the Rix1 particle was blocked by mutational perturbation of the Rix1-Rea1 interaction but not by a dominant-lethal Rea1 AAA(+) ATPase-ring mutant. After remodeling, the Rix1 subcomplex and Rea1 become suitably positioned to sense correct structural maturation of the CP, which allows unidirectional progression toward mature ribosomes. PMID:26619264

  7. Identification and Expression Analysis of Ribosome Biogenesis Factor Co-orthologs in Solanum lycopersicum

    PubMed Central

    Simm, Stefan; Fragkostefanakis, Sotirios; Paul, Puneet; Keller, Mario; Einloft, Jens; Scharf, Klaus-Dieter; Schleiff, Enrico

    2015-01-01

    Ribosome biogenesis involves a large inventory of proteinaceous and RNA cofactors. More than 250 ribosome biogenesis factors (RBFs) have been described in yeast. These factors are involved in multiple aspects like rRNA processing, folding, and modification as well as in ribosomal protein (RP) assembly. Considering the importance of RBFs for particular developmental processes, we examined the complexity of RBF and RP (co-)orthologs by bioinformatic assignment in 14 different plant species and expression profiling in the model crop Solanum lycopersicum. Assigning (co-)orthologs to each RBF revealed that at least 25% of all predicted RBFs are encoded by more than one gene. At first we realized that the occurrence of multiple RBF co-orthologs is not globally correlated to the existence of multiple RP co-orthologs. The transcript abundance of genes coding for predicted RBFs and RPs in leaves and anthers of S. lycopersicum was determined by next generation sequencing (NGS). In combination with existing expression profiles, we can conclude that co-orthologs of RBFs by large account for a preferential function in different tissue or at distinct developmental stages. This notion is supported by the differential expression of selected RBFs during male gametophyte development. In addition, co-regulated clusters of RBF and RP coding genes have been observed. The relevance of these results is discussed. PMID:25698879

  8. Circular non-coding RNA ANRIL modulates ribosomal RNA maturation and atherosclerosis in humans.

    PubMed

    Holdt, Lesca M; Stahringer, Anika; Sass, Kristina; Pichler, Garwin; Kulak, Nils A; Wilfert, Wolfgang; Kohlmaier, Alexander; Herbst, Andreas; Northoff, Bernd H; Nicolaou, Alexandros; Gäbel, Gabor; Beutner, Frank; Scholz, Markus; Thiery, Joachim; Musunuru, Kiran; Krohn, Knut; Mann, Matthias; Teupser, Daniel

    2016-01-01

    Circular RNAs (circRNAs) are broadly expressed in eukaryotic cells, but their molecular mechanism in human disease remains obscure. Here we show that circular antisense non-coding RNA in the INK4 locus (circANRIL), which is transcribed at a locus of atherosclerotic cardiovascular disease on chromosome 9p21, confers atheroprotection by controlling ribosomal RNA (rRNA) maturation and modulating pathways of atherogenesis. CircANRIL binds to pescadillo homologue 1 (PES1), an essential 60S-preribosomal assembly factor, thereby impairing exonuclease-mediated pre-rRNA processing and ribosome biogenesis in vascular smooth muscle cells and macrophages. As a consequence, circANRIL induces nucleolar stress and p53 activation, resulting in the induction of apoptosis and inhibition of proliferation, which are key cell functions in atherosclerosis. Collectively, these findings identify circANRIL as a prototype of a circRNA regulating ribosome biogenesis and conferring atheroprotection, thereby showing that circularization of long non-coding RNAs may alter RNA function and protect from human disease. PMID:27539542

  9. Circular non-coding RNA ANRIL modulates ribosomal RNA maturation and atherosclerosis in humans

    PubMed Central

    Holdt, Lesca M.; Stahringer, Anika; Sass, Kristina; Pichler, Garwin; Kulak, Nils A.; Wilfert, Wolfgang; Kohlmaier, Alexander; Herbst, Andreas; Northoff, Bernd H.; Nicolaou, Alexandros; Gäbel, Gabor; Beutner, Frank; Scholz, Markus; Thiery, Joachim; Musunuru, Kiran; Krohn, Knut; Mann, Matthias; Teupser, Daniel

    2016-01-01

    Circular RNAs (circRNAs) are broadly expressed in eukaryotic cells, but their molecular mechanism in human disease remains obscure. Here we show that circular antisense non-coding RNA in the INK4 locus (circANRIL), which is transcribed at a locus of atherosclerotic cardiovascular disease on chromosome 9p21, confers atheroprotection by controlling ribosomal RNA (rRNA) maturation and modulating pathways of atherogenesis. CircANRIL binds to pescadillo homologue 1 (PES1), an essential 60S-preribosomal assembly factor, thereby impairing exonuclease-mediated pre-rRNA processing and ribosome biogenesis in vascular smooth muscle cells and macrophages. As a consequence, circANRIL induces nucleolar stress and p53 activation, resulting in the induction of apoptosis and inhibition of proliferation, which are key cell functions in atherosclerosis. Collectively, these findings identify circANRIL as a prototype of a circRNA regulating ribosome biogenesis and conferring atheroprotection, thereby showing that circularization of long non-coding RNAs may alter RNA function and protect from human disease. PMID:27539542

  10. Alterations in the ribosomal machinery in cancer and hematologic disorders

    PubMed Central

    2012-01-01

    Ribosomes are essential components of the protein translation machinery and are composed of more than 80 unique large and small ribosomal proteins. Recent studies show that in addition to their roles in protein translation, ribosomal proteins are also involved in extra-ribosomal functions of DNA repair, apoptosis and cellular homeostasis. Consequently, alterations in the synthesis or functioning of ribosomal proteins can lead to various hematologic disorders. These include congenital anemias such as Diamond Blackfan anemia and Shwachman Diamond syndrome; both of which are associated with mutations in various ribosomal genes. Acquired uniallelic deletion of RPS14 gene has also been shown to lead to the 5q syndrome, a distinct subset of MDS associated with macrocytic anemia. Recent evidence shows that specific ribosomal proteins are overexpressed in liver, colon, prostate and other tumors. Ribosomal protein overexpression can promote tumorigenesis by interactions with the p53 tumor suppressor pathway and also by direct effects on various oncogenes. These data point to a broad role of ribosome protein alterations in hematologic and oncologic diseases. PMID:22709827

  11. Dynamic Behavior of Trigger Factor on the Ribosome.

    PubMed

    Deeng, J; Chan, K Y; van der Sluis, E O; Berninghausen, O; Han, W; Gumbart, J; Schulten, K; Beatrix, B; Beckmann, R

    2016-09-11

    Trigger factor (TF) is the only ribosome-associated chaperone in bacteria. It interacts with hydrophobic segments in nascent chain (NCs) as they emerge from the ribosome. TF binds via its N-terminal ribosome-binding domain (RBD) mainly to ribosomal protein uL23 at the tunnel exit on the large ribosomal subunit. Whereas earlier structural data suggested that TF binds as a rigid molecule to the ribosome, recent comparisons of structural data on substrate-bound, ribosome-bound, and TF in solution from different species suggest that this chaperone is a rather flexible molecule. Here, we present two cryo-electron microscopy structures of TF bound to ribosomes translating an mRNA coding for a known TF substrate from Escherichia coli of a different length. The structures reveal distinct degrees of flexibility for the different TF domains, a conformational rearrangement of the RBD upon ribosome binding, and an increase in rigidity within TF when the NC is extended. Molecular dynamics simulations agree with these data and offer a molecular basis for these observations. PMID:27320387

  12. -1 Programmed Ribosomal Frameshifting as a Force-Dependent Process.

    PubMed

    Visscher, Koen

    2016-01-01

    -1 Programmed ribosomal frameshifting is a translational recoding event in which ribosomes slip backward along messenger RNA presumably due to increased tension disrupting the codon-anticodon interaction at the ribosome's coding site. Single-molecule physical methods and recent experiments characterizing the physical properties of mRNA's slippery sequence as well as the mechanical stability of downstream mRNA structure motifs that give rise to frameshifting are discussed. Progress in technology, experimental assays, and data analysis methods hold promise for accurate physical modeling and quantitative understanding of -1 programmed ribosomal frameshifting. PMID:26970190

  13. Dissociability of free and peptidyl-tRNA bound ribosomes.

    PubMed

    Surguchov, A P; Fominykch, E S; Lyzlova, L V

    1978-06-16

    The influence of peptidyl-tRNA on the dissociation of yeast 80 S ribosomes into subunits was studied. For this purpose temperature-sensitive (ts) suppressor strain of yeast Saccharomyces cervisiae carrying a defect in peptide chain termination was used. It was found that peptidyl-tRNA did not influence the dissociation of ribosomes either at high salt concentration or in the presence of dissociation factor (DF) from yeast. After dissociation of yeast ribosomes in 0.5 M KCl, peptidyl-tRNA remains bound to the 60 S subunit. Some characteristics of the termination process and release of nascent polypeptides from yeast ribosomes are discussed. PMID:355860

  14. Ribosome hibernation factor promotes Staphylococcal survival and differentially represses translation.

    PubMed

    Basu, Arnab; Yap, Mee-Ngan F

    2016-06-01

    In opportunistic Gram-positive Staphylococcus aureus, a small protein called hibernation-promoting factor (HPFSa) is sufficient to dimerize 2.5-MDa 70S ribosomes into a translationally inactive 100S complex. Although the 100S dimer is observed in only the stationary phase in Gram-negative gammaproteobacteria, it is ubiquitous throughout all growth phases in S. aureus The biological significance of the 100S ribosome is poorly understood. Here, we reveal an important role of HPFSa in preserving ribosome integrity and poising cells for translational restart, a process that has significant clinical implications for relapsed staphylococcal infections. We found that the hpf null strain is severely impaired in long-term viability concomitant with a dramatic loss of intact ribosomes. Genome-wide ribosome profiling shows that eliminating HPFSa drastically increased ribosome occupancy at the 5' end of specific mRNAs under nutrient-limited conditions, suggesting that HPFSa may suppress translation initiation. The protective function of HPFSa on ribosomes resides at the N-terminal conserved basic residues and the extended C-terminal segment, which are critical for dimerization and ribosome binding, respectively. These data provide significant insight into the functional consequences of 100S ribosome loss for protein synthesis and stress adaptation. PMID:27001516

  15. Ribosome hibernation factor promotes Staphylococcal survival and differentially represses translation

    PubMed Central

    Basu, Arnab; Yap, Mee-Ngan F.

    2016-01-01

    In opportunistic Gram-positive Staphylococcus aureus, a small protein called hibernation-promoting factor (HPFSa) is sufficient to dimerize 2.5-MDa 70S ribosomes into a translationally inactive 100S complex. Although the 100S dimer is observed in only the stationary phase in Gram-negative gammaproteobacteria, it is ubiquitous throughout all growth phases in S. aureus. The biological significance of the 100S ribosome is poorly understood. Here, we reveal an important role of HPFSa in preserving ribosome integrity and poising cells for translational restart, a process that has significant clinical implications for relapsed staphylococcal infections. We found that the hpf null strain is severely impaired in long-term viability concomitant with a dramatic loss of intact ribosomes. Genome-wide ribosome profiling shows that eliminating HPFSa drastically increased ribosome occupancy at the 5′ end of specific mRNAs under nutrient-limited conditions, suggesting that HPFSa may suppress translation initiation. The protective function of HPFSa on ribosomes resides at the N-terminal conserved basic residues and the extended C-terminal segment, which are critical for dimerization and ribosome binding, respectively. These data provide significant insight into the functional consequences of 100S ribosome loss for protein synthesis and stress adaptation. PMID:27001516

  16. Commandeering the Ribosome: Lessons Learned from Dicistroviruses about Translation.

    PubMed

    Kerr, Craig H; Jan, Eric

    2016-06-15

    To replicate, all viruses depend entirely on the enslavement of host cell ribosomes for their own advantage. To this end, viruses have evolved a multitude of translational strategies to usurp the ribosome. RNA-based structures known as internal ribosome entry sites (IRESs) are among the most notable mechanisms employed by viruses to seize host ribosomes. In this article, we spotlight the intergenic region IRES from the Dicistroviridae family of viruses and its importance as a model for IRES-dependent translation and in understanding fundamental properties of translation. PMID:27053555

  17. Replication of ribosomal DNA in Xenopus laevis.

    PubMed

    Bozzoni, I; Baldari, C T; Amaldi, F; Buongiorno-Nardelli, M

    1981-09-01

    The study of the localization of the replication origins of rDNA in Xenopus laevis has been approached by two different methods. 1. The DNA of X. laevis larvae was fractionated by CsCl gradient centrifugation in bulk and ribosomal DNA and examined in the electron microscope. In bulk DNA, clusters of microbubbles, which are related with the origins of replication, appear to be spaced along the DNA molecules at intervals comparable with the size of the 'average' replicon of X. laevis. In ribosomal DNA, the distance between adjacent clusters is much shorter and corresponds to the size of the rDNA repeating unit. When ribosomal DNA was submitted to digestion with restriction enzymes (Eco RI and HindIII) the microbubbles are observed in the non-transcribed spacer-containing fragment. 2. Cultured cells of X. laevis were synchronized by mitotic selection and incubated with 5-fluoro-2-deoxyuridine for a time longer than the G1 phase. This treatment synchronizes the replicons and allows them to start replicating very slowly. It was thus possible to obtain a preferential labelling of the regions containing the origins. The analysis by gel electrophoresis of the Eco Ri-digested rDNA showed that the radioactivity was preferentially incorporated in the fragments which contain the non-transcribed spacer. The results of these two approaches indicate that the rRNA gene cluster consists of multiple units of replication, possibly one per gene unit. Furthermore they show that the origins of replication are localized into the non-transcribed spacer. PMID:7297565

  18. Homoiterons and expansion in ribosomal RNAs.

    PubMed

    Parker, Michael S; Sallee, Floyd R; Park, Edwards A; Parker, Steven L

    2015-01-01

    Ribosomal RNAs in both prokaryotes and eukaryotes feature numerous repeats of three or more nucleotides with the same nucleobase (homoiterons). In prokaryotes these repeats are much more frequent in thermophile compared to mesophile or psychrophile species, and have similar frequency in both large RNAs. These features point to use of prokaryotic homoiterons in stabilization of both ribosomal subunits. The two large RNAs of eukaryotic cytoplasmic ribosomes have expanded to a different degree across the evolutionary ladder. The big RNA of the larger subunit (60S LSU) evolved expansion segments of up to 2400 nucleotides, and the smaller subunit (40S SSU) RNA acquired expansion segments of not more than 700 nucleotides. In the examined eukaryotes abundance of rRNA homoiterons generally follows size and nucleotide bias of the expansion segments, and increases with GC content and especially with phylogenetic rank. Both the nucleotide bias and frequency of homoiterons are much larger in metazoan and angiosperm LSU compared to the respective SSU RNAs. This is especially pronounced in the tetrapod vertebrates and seems to culminate in the hominid mammals. The stability of secondary structure in polyribonucleotides would significantly connect to GC content, and should also relate to G and C homoiteron content. RNA modeling points to considerable presence of homoiteron-rich double-stranded segments especially in vertebrate LSU RNAs, and homoiterons with four or more nucleotides in the vertebrate and angiosperm LSU RNAs are largely confined to the expansion segments. These features could mainly relate to protein export function and attachment of LSU to endoplasmic reticulum and other subcellular networks. PMID:26636029

  19. Homoiterons and expansion in ribosomal RNAs

    PubMed Central

    Parker, Michael S.; Sallee, Floyd R.; Park, Edwards A.; Parker, Steven L.

    2015-01-01

    Ribosomal RNAs in both prokaryotes and eukaryotes feature numerous repeats of three or more nucleotides with the same nucleobase (homoiterons). In prokaryotes these repeats are much more frequent in thermophile compared to mesophile or psychrophile species, and have similar frequency in both large RNAs. These features point to use of prokaryotic homoiterons in stabilization of both ribosomal subunits. The two large RNAs of eukaryotic cytoplasmic ribosomes have expanded to a different degree across the evolutionary ladder. The big RNA of the larger subunit (60S LSU) evolved expansion segments of up to 2400 nucleotides, and the smaller subunit (40S SSU) RNA acquired expansion segments of not more than 700 nucleotides. In the examined eukaryotes abundance of rRNA homoiterons generally follows size and nucleotide bias of the expansion segments, and increases with GC content and especially with phylogenetic rank. Both the nucleotide bias and frequency of homoiterons are much larger in metazoan and angiosperm LSU compared to the respective SSU RNAs. This is especially pronounced in the tetrapod vertebrates and seems to culminate in the hominid mammals. The stability of secondary structure in polyribonucleotides would significantly connect to GC content, and should also relate to G and C homoiteron content. RNA modeling points to considerable presence of homoiteron-rich double-stranded segments especially in vertebrate LSU RNAs, and homoiterons with four or more nucleotides in the vertebrate and angiosperm LSU RNAs are largely confined to the expansion segments. These features could mainly relate to protein export function and attachment of LSU to endoplasmic reticulum and other subcellular networks. PMID:26636029

  20. Towards a classification of E. coli ribosomal proteins: A hypothetical `small ribosome' as a primitive protein-synthesizing apparatus

    NASA Astrophysics Data System (ADS)

    Ohnishi, Koji

    1984-12-01

    Homologies were searched among the published primary sequences of 51 E. coli ribosomal proteins, partly by ‘eye’ and partly by computer-assisted methods. By employing Moore and Goodman's alignment statistics for evaluating homology levels, 33 out of these 51 ribosomal proteins has been classified into 9 homology groups, some of which being yet tentative and remaining to be further analyzed. Taking it into consideration that most ribosomal protein genes are clustered at str- stc region, rif region and several other regions, these results strongly suggest that most or all of the contemporary ribosomal proteins must have evolved by repeated gene duplications of very few (or only one) primitive ancestral ribosomal protein gene(s). Thus it is most reasonable to propose that a ‘ small ribosome’ consisting of very few (or only one) ribosomal protein(s) must have existed as a primitive protein-synthesizing apparatus.

  1. Ribosomal RNA: a key to phylogeny

    NASA Technical Reports Server (NTRS)

    Olsen, G. J.; Woese, C. R.

    1993-01-01

    As molecular phylogeny increasingly shapes our understanding of organismal relationships, no molecule has been applied to more questions than have ribosomal RNAs. We review this role of the rRNAs and some of the insights that have been gained from them. We also offer some of the practical considerations in extracting the phylogenetic information from the sequences. Finally, we stress the importance of comparing results from multiple molecules, both as a method for testing the overall reliability of the organismal phylogeny and as a method for more broadly exploring the history of the genome.

  2. Molecular architecture of the ribosome-bound Hepatitis C Virus internal ribosomal entry site RNA.

    PubMed

    Yamamoto, Hiroshi; Collier, Marianne; Loerke, Justus; Ismer, Jochen; Schmidt, Andrea; Hilal, Tarek; Sprink, Thiemo; Yamamoto, Kaori; Mielke, Thorsten; Bürger, Jörg; Shaikh, Tanvir R; Dabrowski, Marylena; Hildebrand, Peter W; Scheerer, Patrick; Spahn, Christian M T

    2015-12-14

    Internal ribosomal entry sites (IRESs) are structured cis-acting RNAs that drive an alternative, cap-independent translation initiation pathway. They are used by many viruses to hijack the translational machinery of the host cell. IRESs facilitate translation initiation by recruiting and actively manipulating the eukaryotic ribosome using only a subset of canonical initiation factor and IRES transacting factors. Here we present cryo-EM reconstructions of the ribosome 80S- and 40S-bound Hepatitis C Virus (HCV) IRES. The presence of four subpopulations for the 80S•HCV IRES complex reveals dynamic conformational modes of the complex. At a global resolution of 3.9 Å for the most stable complex, a derived atomic model reveals a complex fold of the IRES RNA and molecular details of its interaction with the ribosome. The comparison of obtained structures explains how a modular architecture facilitates mRNA loading and tRNA binding to the P-site. This information provides the structural foundation for understanding the mechanism of HCV IRES RNA-driven translation initiation. PMID:26604301

  3. The conserved interaction of C7orf30 with MRPL14 promotes biogenesis of the mitochondrial large ribosomal subunit and mitochondrial translation

    PubMed Central

    Fung, Stephen; Nishimura, Tamiko; Sasarman, Florin; Shoubridge, Eric A.

    2013-01-01

    Mammalian mitochondria harbor a dedicated translation apparatus that is required for the synthesis of 13 mitochondrial DNA (mtDNA)-encoded polypeptides, all of which are essential components of the oxidative phosphorylation (OXPHOS) complexes. Little is known about the mechanism of assembly of the mitoribosomes that catalyze this process. Here we show that C7orf30, a member of the large family of DUF143 proteins, associates with the mitochondrial large ribosomal subunit (mt-LSU). Knockdown of C7orf30 by short hairpin RNA (shRNA) does not alter the sedimentation profile of the mt-LSU, but results in the depletion of several mt-LSU proteins and decreased monosome formation. This leads to a mitochondrial translation defect, involving the majority of mitochondrial polypeptides, and a severe OXPHOS assembly defect. Immunoprecipitation and mass spectrometry analyses identified mitochondrial ribosomal protein (MRP)L14 as the specific interacting protein partner of C7orf30 in the mt-LSU. Reciprocal experiments in which MRPL14 was depleted by small interfering RNA (siRNA) phenocopied the C7orf30 knockdown. Members of the DUF143 family have been suggested to be universally conserved ribosomal silencing factors, acting by sterically inhibiting the association of the small and large ribosomal subunits. Our results demonstrate that, although the interaction between C7orf30 and MRPL14 has been evolutionarily conserved, human C7orf30 is, on the contrary, essential for mitochondrial ribosome biogenesis and mitochondrial translation. PMID:23171548

  4. The effect of trichloroethylene and acrylonitrile on RNA and ribosome synthesis and ribosome content in Saccharomyces cells.

    PubMed

    Lochmann, E R; Ehrlich, W; Mangir, M

    1984-04-01

    The effects of trichloroethylene (TCE) and acrylonitrile (ACN) on growth, RNA synthesis, ribosome synthesis, and ribosome content were tested in yeast cells. TCE causes a delay of the growth of a cell culture (prolongation of the lag phase), but does not cause inhibition. Cells exposed to increasing concentrations of ACN show increasing damage, so that, at a certain point of the growth curve, cell division stops altogether. Similar results were obtained when RNA synthesis was investigated: After treatment with TCE, the maximum RNA synthesis of the cell culture was retarded, but subsequently reached the same level as the untreated control cells. In the presence of ACN, however, the rate of RNA synthesis was lowered with increasing ACN concentrations. The same effect was observed upon investigation of ribosome synthesis: Whereas TCE produces only a slight effect, treatment with increasing concentrations of ACN leads to a substantial decrease in ribosome synthesis, and finally to total inhibition. Parallel to this, the content of free and membrane-bound ribosomes is diminished. Obviously, the decrease in ribosome content is caused not only by an inhibition of ribosome synthesis, but also by a degradation of existing ribosomes, as well as by induction of a ribosome-associated RNase. PMID:6714140

  5. Studies on membrane proteins involved in ribosome binding on the rough endoplasmic reticulum. Ribophorins have no ribosome-binding activity.

    PubMed Central

    Yoshida, H; Tondokoro, N; Asano, Y; Mizusawa, K; Yamagishi, R; Horigome, T; Sugano, H

    1987-01-01

    A membrane protein fraction showing affinity for ribosomes was isolated from rat liver microsomes (microsomal fractions) in association with ribosomes by treatment of the microsomes with Emulgen 913 and then solubilized from the ribosomes with sodium deoxycholate. This protein fraction was separated into two fractions, glycoproteins, including ribophorins I and II, and non-glycoproteins, virtually free from ribophorins I and II, on concanavalin A-Sepharose columns. The two fractions were each reconstituted into liposomes to determine their ribosome-binding activities. The specific binding activity of the non-glycoprotein fraction was approx. 2.3-fold higher than that of the glycoprotein fraction. The recovery of ribosome-binding capacity of the two fractions was about 85% of the total binding capacity of the material applied to a concanavalin A-Sepharose column, and about 90% of it was found in the non-glycoprotein fraction. The affinity constants of the ribosomes for the reconstituted liposomes were somewhat higher than those for stripped rough microsomes. The mode of ribosome binding to the reconstituted liposomes was very similar to that to the stripped rough microsomes, in its sensitivity to proteolytic enzymes and its strong inhibition by increasing KCl concentration. These results support the idea that ribosome binding to rat liver microsomes is not directly mediated by ribophorins I and II, but that another unidentified membrane protein(s) plays a role in ribosome binding. Images Fig. 1. Fig. 3. Fig. 5. PMID:3663192

  6. Elongation factor G-induced structural change in helix 34 of 16S rRNA related to translocation on the ribosome.

    PubMed Central

    Matassova, A B; Rodnina, M V; Wintermeyer, W

    2001-01-01

    During the translocation step of the elongation cycle, two tRNAs together with the mRNA move synchronously and rapidly on the ribosome. The movement is catalyzed by the binding of elongation factor G (EF-G) and driven by GTP hydrolysis. Here we study structural changes of the ribosome related to EF-G binding and translocation by monitoring the accessibility of ribosomal RNA (rRNA) for chemical modification by dimethyl sulfate or cleavage by hydroxyl radicals generated by Fe(II)-EDTA. In the state of the ribosome that is formed upon binding of EF-G but before the movement of the tRNAs takes place, residues 1054,1196, and 1201 in helix 34 in 16S rRNA are strongly protected. The protections depend on EF-G binding, but do not require GTP hydrolysis, and are lost upon translocation. Mutants of EF-G, which are active in ribosome binding and GTP hydrolysis but impaired in translocation, do not bring about the protections. According to cryo-electron microscopy (Stark et al., Cell, 2000, 100:301-309), there is no contact of EF-G with the protected residues of helix 34 in the pretranslocation state, suggesting that the observed protections are due to an induced conformational change. Thus, the present results indicate that EF-G binding to the pretranslocation ribosome induces a structural change of the head of the 30S subunit that is essential for subsequent tRNA-mRNA movement in translocation. PMID:11780642

  7. Characteristics of a long-pulse (30-s), high-power (4-MW) ion source for neutral beam injection

    SciTech Connect

    Menon, M.M.; Barber, G.C.; Combs, S.K.; Dagenhart, W.K.; Gardner, W.L.; Haselton, H.H.; Moeller, J.A.; Ponte, N.S.; Ryan, P.M.; Schechter, D.E.

    1983-01-01

    A quasi-steady-state ion source has been developed for neutral beam injection applications. It is of the duoPIGatron type designed for delivering 50 A of hydrogen ions at 80 keV for 30-s-long pulses. Ion beams of 40 A at 75 keV were extracted for pulse lengths up to 30 s, maintaining excellent optical quality in the beam for the entire pulse duration. The design features and operational characteristics of the ion source are elaborated.

  8. Initiation factor IF 2 binds to the alpha-sarcin loop and helix 89 of Escherichia coli 23S ribosomal RNA.

    PubMed Central

    La Teana, A; Gualerzi, C O; Dahlberg, A E

    2001-01-01

    During initiation of protein synthesis in bacteria, translation initiation factor IF2 is responsible for the recognition of the initiator tRNA (fMet-tRNA). To perform this function, IF2 binds to the ribosome interacting with both 30S and 50S ribosomal subunits. Here we report the topographical localization of translation initiation factor IF2 on the 70S ribosome determined by base-specific chemical probing. Our results indicate that IF2 specifically protects from chemical modification two sites in domain V of 23S rRNA, namely A2476 and A2478, and residues around position 2660 in domain VI, the so-called sarcin-ricin loop. These footprints are generated by IF2 regardless of the presence of fMet-tRNA, GTP, mRNA, and IF1. IF2 causes no specific protection of 16S rRNA. We observe a decreased reactivity of residues A1418 and A1483, which is an indication that the initiation factor has a tightening effect on the association of ribosomal subunits. This result, confirmed by sucrose density gradient analysis, seems to be a universally conserved property of IF2. PMID:11497435

  9. Role of ribosomal protein mutations in tumor development (Review).

    PubMed

    Goudarzi, Kaveh M; Lindström, Mikael S

    2016-04-01

    Ribosomes are cellular machines essential for protein synthesis. The biogenesis of ribosomes is a highly complex and energy consuming process that initiates in the nucleolus. Recently, a series of studies applying whole-exome or whole-genome sequencing techniques have led to the discovery of ribosomal protein gene mutations in different cancer types. Mutations in ribosomal protein genes have for example been found in endometrial cancer (RPL22), T-cell acute lymphoblastic leukemia (RPL10, RPL5 and RPL11), chronic lymphocytic leukemia (RPS15), colorectal cancer (RPS20), and glioma (RPL5). Moreover, patients suffering from Diamond-Blackfan anemia, a bone marrow failure syndrome caused by mutant ribosomal proteins are also at higher risk for developing leukemia, or solid tumors. Different experimental models indicate potential mechanisms whereby ribosomal proteins may initiate cancer development. In particular, deregulation of the p53 tumor suppressor network and altered mRNA translation are mechanisms likely to be involved. We envisage that changes in expression and the occurrence of ribosomal protein gene mutations play important roles in cancer development. Ribosome biology constitutes a re-emerging vital area of basic and translational cancer research. PMID:26892688

  10. Role of ribosomal protein mutations in tumor development (Review)

    PubMed Central

    GOUDARZI, KAVEH M.; LINDSTRÖM, MIKAEL S.

    2016-01-01

    Ribosomes are cellular machines essential for protein synthesis. The biogenesis of ribosomes is a highly complex and energy consuming process that initiates in the nucleolus. Recently, a series of studies applying whole-exome or whole-genome sequencing techniques have led to the discovery of ribosomal protein gene mutations in different cancer types. Mutations in ribosomal protein genes have for example been found in endometrial cancer (RPL22), T-cell acute lymphoblastic leukemia (RPL10, RPL5 and RPL11), chronic lymphocytic leukemia (RPS15), colorectal cancer (RPS20), and glioma (RPL5). Moreover, patients suffering from Diamond-Blackfan anemia, a bone marrow failure syndrome caused by mutant ribosomal proteins are also at higher risk for developing leukemia, or solid tumors. Different experimental models indicate potential mechanisms whereby ribosomal proteins may initiate cancer development. In particular, deregulation of the p53 tumor suppressor network and altered mRNA translation are mechanisms likely to be involved. We envisage that changes in expression and the occurrence of ribosomal protein gene mutations play important roles in cancer development. Ribosome biology constitutes a re-emerging vital area of basic and translational cancer research. PMID:26892688

  11. Motion of individual ribosomes along mRNA

    NASA Astrophysics Data System (ADS)

    Visscher, Koen

    2004-11-01

    Ribosomes move along messenger RNA to translate a sequence of ribonucleotides into a corresponding sequence of amino acids that make up a protein. Efficient motion of ribosomes along the mRNA requires hydrolysis of GTP, converting chemical energy into mechanical work, like better known molecular motors such as kinesin. However, motion is just one of the many tasks of the ribosome, whereas for kinesin, motion itself is the main goal. In keeping with these functional differences, the ribosome is also much larger consisting of more than 50 proteins and with half of its mass made up of ribosomal RNA. Such structural complexity enables indirect ways of coupling GTP hydrolysis to directed motion. In order to elucidate the mechanochemical coupling in ribosomes we have developed a single-molecule assay based on using optical tweezers to record the motion of individual ribosomes along mRNA. Translation rates of 2-4 codons/s have been observed. However, when increasing the force opposing motion, we observe backward slippage of ribosomes along homopolymeric poly(U) messages. Currently, it is not clear if the motor operates in reverse or if backward motion has become completely uncoupled from GTP hydrolysis. Interestingly, force-induced backward motion is of biological relevance because of its possible role in -1 frameshifting, a mechanism used by viruses to regulate gene expression at the level of translation.

  12. Proteopedia Entry: The Large Ribosomal Subunit of "Haloarcula Marismortui"

    ERIC Educational Resources Information Center

    Decatur, Wayne A.

    2010-01-01

    This article presents a "Proteopedia" page that shows the refined version of the structure of the "Haloarcula" large ribosomal subunit as solved by the laboratories of Thomas Steitz and Peter Moore. The landmark structure is of great impact as it is the first atomic-resolution structure of the highly conserved ribosomal subunit which harbors…

  13. PPARA intron polymorphism associated with power performance in 30-s anaerobic Wingate Test.

    PubMed

    Petr, Miroslav; Stastny, Petr; Št'astný, Petr; Pecha, Ondřej; Šteffl, Michal; Šeda, Ondřej; Kohlíková, Eva

    2014-01-01

    To date, polymorphisms in several genes have been associated with a strength/power performance including alpha 3 actinin, ciliary neurotrophic factor, vitamin D receptor, or angiotensin I converting enzyme, underlining the importance of genetic component of the multifactorial strength/power-related phenotypes. The single nucleotide variation in peroxisome proliferator-activated receptor alpha gene (PPARA) intron 7 G/C (rs4253778; g.46630634G>C) has been repeatedly found to play a significant role in response to different types of physical activity. We investigated the effect of PPARA intron 7 G/C polymorphism specifically on anaerobic power output in a group of 77 elite male Czech ice hockey players (18-36 y). We determined the relative peak power per body weight (Pmax.kg(-1)) and relative peak power per fat free mass (W.kg(-1)FFM) during the 30-second Wingate Test (WT30) on bicycle ergometer (Monark 894E Peak bike, MONARK, Sweden). All WT30s were performed during the hockey season. Overall genotype frequencies were 50.6% GG homozygotes, 40.3% CG heterozygotes, and 9.1% CC homozygotes. We found statistically significant differences in Pmax.kg(-1) and marginally significant differences in Pmax.kg(-1)FFM values in WT30 between carriers and non-carriers for C allele (14.6 ± 0.2 vs. 13.9 ± 0.3 W.kg(-1) and 15.8 ± 0.2 vs. 15.2 ± 0.3 W.kg(-1)FFM, P = 0.036 and 0.12, respectively). Furthermore, Pmax.kg(-1)FFM strongly positively correlated with the body weight only in individuals with GG genotypes (R = 0.55; p<0.001). Our results indicate that PPARA 7C carriers exhibited higher speed strength measures in WT30. We hypothesize that C allele carriers within the cohort of trained individuals may possess a metabolic advantage towards anaerobic metabolism. PMID:25198533

  14. Concerted removal of the Erb1-Ytm1 complex in ribosome biogenesis relies on an elaborate interface.

    PubMed

    Thoms, Matthias; Ahmed, Yasar Luqman; Maddi, Karthik; Hurt, Ed; Sinning, Irmgard

    2016-01-29

    The complicated process of eukaryotic ribosome biogenesis involves about 200 assembly factors that transiently associate with the nascent pre-ribosome in a spatiotemporally ordered way. During the early steps of 60S subunit formation, several proteins, collectively called A3 cluster factors, participate in the removal of the internal transcribed spacer 1 (ITS1) from 27SA3 pre-rRNA. Among these factors is the conserved hetero-trimeric Nop7-Erb1-Ytm1 complex (or human Pes1-Bop1-Wdr12), which is removed from the evolving pre-60S particle by the AAA ATPase Rea1 to allow progression in the pathway. Here, we clarify how Ytm1 and Erb1 interact, which has implications for the release mechanism of both factors from the pre-ribosome. Biochemical studies show that Ytm1 and Erb1 bind each other via their ß-propeller domains. The crystal structure of the Erb1-Ytm1 heterodimer determined at 2.67Å resolution reveals an extended interaction surface between the propellers in a rarely observed binding mode. Structure-based mutations in the interface that impair the Erb1-Ytm1 interaction do not support growth, with specific defects in 60S subunit synthesis. Under these mutant conditions, it becomes clear that an intact Erb1-Ytm1 complex is required for 60S maturation and that loss of this stable interaction prevents ribosome production. PMID:26657628

  15. Kinetics of paused ribosome recycling in Escherichia coli

    PubMed Central

    Janssen, Brian D.; Hayes, Christopher S.

    2009-01-01

    Summary The bacterial tmRNA•SmpB system recycles stalled translation complexes in a process termed ‘ribosome rescue’. tmRNA•SmpB specifically recognizes ribosomes that are paused at or near the 3′ end of truncated mRNA, and therefore nucleolytic mRNA processing is required before paused ribosomes can be rescued from full-length transcripts. Here, we examine the recycling of ribosomes paused on both full-length and truncated mRNAs. Peptidyl-tRNAs corresponding to each paused translation complex were identified, and their turnover kinetics used to estimate the half-lives of paused ribosomes in vivo. Ribosomes were paused at stop codons on full-length mRNA using a nascent peptide motif that interferes with translation termination and elicits tmRNA•SmpB activity. Peptidyl-tRNA turnover from these termination-paused ribosomes was slightly more rapid in tmRNA+ cells (T1/2 = 22 ± 2.2 s), compared to ΔtmRNA cells (T1/2 = 32 ± 1.6 s). Overexpression of release factor-1 (RF-1) greatly accelerated peptidyl-tRNA turnover from termination-paused ribosomes in both tmRNA+ and ΔtmRNA cells, whereas other termination factors had little or no effect on recycling. In contrast to inefficient translation termination, ribosome recycling from truncated transcripts lacking in-frame stop codons was dramatically accelerated by tmRNA•SmpB. However, peptidyl-tRNA still turned over from nonstop-paused ribosomes at a significant rate (t1/2 = 61 ± 7.3 s) in ΔtmRNA cells. Overexpression of RF-1, RF-3, and ribosome recycling factor (RRF) in ΔtmRNA cells failed to accelerate ribosome recycling from nonstop mRNA. These results indicate that tmRNA•SmpB activity is rate-limited by mRNA cleavage, and that RF-3 and RRF do not constitute a tmRNA-independent rescue pathway as previously suggested. Peptidyl-tRNA turnover from nonstop-paused ribosomes in ΔtmRNA cells suggests the existence of another uncharacterized ribosome rescue pathway. PMID:19761774

  16. Probing the mechanisms underlying human diseases in making ribosomes.

    PubMed

    Farley, Katherine I; Baserga, Susan J

    2016-08-15

    Ribosomes are essential, highly complex machines responsible for protein synthesis in all growing cells. Because of their importance, the process of building these machines is intricately regulated. Although the proteins involved in regulating ribosome biogenesis are just beginning to be understood, especially in human cells, the consequences for dysregulating this process have been even less studied. Such interruptions in ribosome synthesis result in a collection of human disorders known as ribosomopathies. Ribosomopathies, which occur due to mutations in proteins involved in the global process of ribosome biogenesis, result in tissue-specific defects. The questions posed by this dichotomy and the steps taken to address these questions are therefore the focus of this review: How can tissue-specific disorders result from alterations in global processes? Could ribosome specialization account for this difference? PMID:27528749

  17. Prediction of ribosome footprint profile shapes from transcript sequences

    PubMed Central

    Liu, Tzu-Yu; Song, Yun S.

    2016-01-01

    Motivation: Ribosome profiling is a useful technique for studying translational dynamics and quantifying protein synthesis. Applications of this technique have shown that ribosomes are not uniformly distributed along mRNA transcripts. Understanding how each transcript-specific distribution arises is important for unraveling the translation mechanism. Results: Here, we apply kernel smoothing to construct predictive features and build a sparse model to predict the shape of ribosome footprint profiles from transcript sequences alone. Our results on Saccharomyces cerevisiae data show that the marginal ribosome densities can be predicted with high accuracy. The proposed novel method has a wide range of applications, including inferring isoform-specific ribosome footprints, designing transcripts with fast translation speeds and discovering unknown modulation during translation. Availability and implementation: A software package called riboShape is freely available at https://sourceforge.net/projects/riboshape Contact: yss@berkeley.edu PMID:27307616

  18. Structures of Eukaryotic Ribosomal Stalk Proteins and Its Complex with Trichosanthin, and Their Implications in Recruiting Ribosome-Inactivating Proteins to the Ribosomes

    PubMed Central

    Choi, Andrew K. H.; Wong, Eddie C. K.; Lee, Ka-Ming; Wong, Kam-Bo

    2015-01-01

    Ribosome-inactivating proteins (RIP) are RNA N-glycosidases that inactivate ribosomes by specifically depurinating a conserved adenine residue at the α-sarcin/ricin loop of 28S rRNA. Recent studies have pointed to the involvement of the C-terminal domain of the eukaryotic stalk proteins in facilitating the toxic action of RIPs. This review highlights how structural studies of eukaryotic stalk proteins provide insights into the recruitment of RIPs to the ribosomes. Since the C-terminal domain of eukaryotic stalk proteins is involved in specific recognition of elongation factors and some eukaryote-specific RIPs (e.g., trichosanthin and ricin), we postulate that these RIPs may have evolved to hijack the translation-factor-recruiting function of ribosomal stalk in reaching their target site of rRNA. PMID:25723321

  19. Regulation of ribosomal DNA amplification by the TOR pathway

    PubMed Central

    Jack, Carmen V.; Cruz, Cristina; Hull, Ryan M.; Keller, Markus A.; Ralser, Markus; Houseley, Jonathan

    2015-01-01

    Repeated regions are widespread in eukaryotic genomes, and key functional elements such as the ribosomal DNA tend to be formed of high copy repeated sequences organized in tandem arrays. In general, high copy repeats are remarkably stable, but a number of organisms display rapid ribosomal DNA amplification at specific times or under specific conditions. Here we demonstrate that target of rapamycin (TOR) signaling stimulates ribosomal DNA amplification in budding yeast, linking external nutrient availability to ribosomal DNA copy number. We show that ribosomal DNA amplification is regulated by three histone deacetylases: Sir2, Hst3, and Hst4. These enzymes control homologous recombination-dependent and nonhomologous recombination-dependent amplification pathways that act in concert to mediate rapid, directional ribosomal DNA copy number change. Amplification is completely repressed by rapamycin, an inhibitor of the nutrient-responsive TOR pathway; this effect is separable from growth rate and is mediated directly through Sir2, Hst3, and Hst4. Caloric restriction is known to up-regulate expression of nicotinamidase Pnc1, an enzyme that enhances Sir2, Hst3, and Hst4 activity. In contrast, normal glucose concentrations stretch the ribosome synthesis capacity of cells with low ribosomal DNA copy number, and we find that these cells show a previously unrecognized transcriptional response to caloric excess by reducing PNC1 expression. PNC1 down-regulation forms a key element in the control of ribosomal DNA amplification as overexpression of PNC1 substantially reduces ribosomal DNA amplification rate. Our results reveal how a signaling pathway can orchestrate specific genome changes and demonstrate that the copy number of repetitive DNA can be altered to suit environmental conditions. PMID:26195783

  20. Regulation of ribosome biogenesis in maize embryonic axes during germination.

    PubMed

    Villa-Hernández, J M; Dinkova, T D; Aguilar-Caballero, R; Rivera-Cabrera, F; Sánchez de Jiménez, E; Pérez-Flores, L J

    2013-10-01

    Ribosome biogenesis is a pre-requisite for cell growth and proliferation; it is however, a highly regulated process that consumes a great quantity of energy. It requires the coordinated production of rRNA, ribosomal proteins and non-ribosomal factors which participate in the processing and mobilization of the new ribosomes. Ribosome biogenesis has been studied in yeast and animals; however, there is little information about this process in plants. The objective of the present work was to study ribosome biogenesis in maize seeds during germination, a stage characterized for its fast growth, and the effect of insulin in this process. Insulin has been reported to accelerate germination and to induce seedling growth. It was observed that among the first events reactivated just after 3 h of imbibition are the rDNA transcription and the pre-rRNA processing and that insulin stimulates both of them (40-230%). The transcript of nucleolin, a protein which regulates rDNA transcription and pre-rRNA processing, is among the messages stored in quiescent dry seeds and it is mobilized into the polysomal fraction during the first hours of imbibition (6 h). In contrast, de novo ribosomal protein synthesis was low during the first hours of imbibition (3 and 6 h) increasing by 60 times in later stages (24 h). Insulin increased this synthesis (75%) at 24 h of imbibition; however, not all ribosomal proteins were similarly regulated. In this regard, an increase in RPS6 and RPL7 protein levels was observed, whereas RPL3 protein levels did not change even though its transcription was induced. Results show that ribosome biogenesis in the first stages of imbibition is carried out with newly synthesized rRNA and ribosomal proteins translated from stored mRNA. PMID:23806421

  1. Crystal Structures of the uL3 Mutant Ribosome: Illustration of the Importance of Ribosomal Proteins for Translation Efficiency.

    PubMed

    Mailliot, Justine; Garreau de Loubresse, Nicolas; Yusupova, Gulnara; Meskauskas, Arturas; Dinman, Jonathan D; Yusupov, Marat

    2016-05-22

    The ribosome has been described as a ribozyme in which ribosomal RNA is responsible for peptidyl-transferase reaction catalysis. The W255C mutation of the universally conserved ribosomal protein uL3 has diverse effects on ribosome function (e.g., increased affinities for transfer RNAs, decreased rates of peptidyl-transfer), and cells harboring this mutation are resistant to peptidyl-transferase inhibitors (e.g., anisomycin). These observations beg the question of how a single amino acid mutation may have such wide ranging consequences. Here, we report the structure of the vacant yeast uL3 W255C mutant ribosome by X-ray crystallography, showing a disruption of the A-site side of the peptidyl-transferase center (PTC). An additional X-ray crystallographic structure of the anisomycin-containing mutant ribosome shows that high concentrations of this inhibitor restore a "WT-like" configuration to this region of the PTC, providing insight into the resistance mechanism of the mutant. Globally, our data demonstrate that ribosomal protein uL3 is structurally essential to ensure an optimal and catalytically efficient organization of the PTC, highlighting the importance of proteins in the RNA-centered ribosome. PMID:26906928

  2. Joint assembly

    NASA Technical Reports Server (NTRS)

    Wilson, Andrew (Inventor); Punnoose, Andrew (Inventor); Strausser, Katherine (Inventor); Parikh, Neil (Inventor)

    2010-01-01

    A joint assembly is provided which includes a drive assembly and a swivel mechanism. The drive assembly features a motor operatively associated with a plurality of drive shafts for driving auxiliary elements, and a plurality of swivel shafts for pivoting the drive assembly. The swivel mechanism engages the swivel shafts and has a fixable element that may be attached to a foundation. The swivel mechanism is adapted to cooperate with the swivel shafts to pivot the drive assembly with at least two degrees of freedom relative to the foundation. The joint assembly allows for all components to remain encased in a tight, compact, and sealed package, making it ideal for space, exploratory, and commercial applications.

  3. Modifying the maker: Oxygenases target ribosome biology.

    PubMed

    Zhuang, Qinqin; Feng, Tianshu; Coleman, Mathew L

    2015-01-01

    The complexity of the eukaryotic protein synthesis machinery is partly driven by extensive and diverse modifications to associated proteins and RNAs. These modifications can have important roles in regulating translation factor activity and ribosome biogenesis and function. Further investigation of 'translational modifications' is warranted considering the growing evidence implicating protein synthesis as a critical point of gene expression control that is commonly deregulated in disease. New evidence suggests that translation is a major new target for oxidative modifications, specifically hydroxylations and demethylations, which generally are catalyzed by a family of emerging oxygenase enzymes that act at the interface of nutrient availability and metabolism. This review summarizes what is currently known about the role or these enzymes in targeting rRNA synthesis, protein translation and associated cellular processes. PMID:26779412

  4. Compilation of small ribosomal subunit RNA structures.

    PubMed Central

    Neefs, J M; Van de Peer, Y; De Rijk, P; Chapelle, S; De Wachter, R

    1993-01-01

    The database on small ribosomal subunit RNA structure contained 1804 nucleotide sequences on April 23, 1993. This number comprises 365 eukaryotic, 65 archaeal, 1260 bacterial, 30 plastidial, and 84 mitochondrial sequences. These are stored in the form of an alignment in order to facilitate the use of the database as input for comparative studies on higher-order structure and for reconstruction of phylogenetic trees. The elements of the postulated secondary structure for each molecule are indicated by special symbols. The database is available on-line directly from the authors by ftp and can also be obtained from the EMBL nucleotide sequence library by electronic mail, ftp, and on CD ROM disk. PMID:8332525

  5. Ribosome-Inactivating and Related Proteins

    PubMed Central

    Schrot, Joachim; Weng, Alexander; Melzig, Matthias F.

    2015-01-01

    Ribosome-inactivating proteins (RIPs) are toxins that act as N-glycosidases (EC 3.2.2.22). They are mainly produced by plants and classified as type 1 RIPs and type 2 RIPs. There are also RIPs and RIP related proteins that cannot be grouped into the classical type 1 and type 2 RIPs because of their different sizes, structures or functions. In addition, there is still not a uniform nomenclature or classification existing for RIPs. In this review, we give the current status of all known plant RIPs and we make a suggestion about how to unify those RIPs and RIP related proteins that cannot be classified as type 1 or type 2 RIPs. PMID:26008228

  6. Modifying the maker: Oxygenases target ribosome biology

    PubMed Central

    Zhuang, Qinqin; Feng, Tianshu; Coleman, Mathew L

    2015-01-01

    The complexity of the eukaryotic protein synthesis machinery is partly driven by extensive and diverse modifications to associated proteins and RNAs. These modifications can have important roles in regulating translation factor activity and ribosome biogenesis and function. Further investigation of ‘translational modifications’ is warranted considering the growing evidence implicating protein synthesis as a critical point of gene expression control that is commonly deregulated in disease. New evidence suggests that translation is a major new target for oxidative modifications, specifically hydroxylations and demethylations, which generally are catalyzed by a family of emerging oxygenase enzymes that act at the interface of nutrient availability and metabolism. This review summarizes what is currently known about the role or these enzymes in targeting rRNA synthesis, protein translation and associated cellular processes. PMID:26779412

  7. Ribosomal protein uS19 mutants reveal its role in coordinating ribosome structure and function

    PubMed Central

    Bowen, Alicia M; Musalgaonkar, Sharmishtha; Moomau, Christine A; Gulay, Suna P; Mirvis, Mary; Dinman, Jonathan D

    2015-01-01

    Prior studies identified allosteric information pathways connecting functional centers in the large ribosomal subunit to the decoding center in the small subunit through the B1a and B1b/c intersubunit bridges in yeast. In prokaryotes a single SSU protein, uS13, partners with H38 (the A-site finger) and uL5 to form the B1a and B1b/c bridges respectively. In eukaryotes, the SSU component was split into 2 separate proteins during the course of evolution. One, also known as uS13, participates in B1b/c bridge with uL5 in eukaryotes. The other, called uS19 is the SSU partner in the B1a bridge with H38. Here, polyalanine mutants of uS19 involved in the uS19/uS13 and the uS19/H38 interfaces were used to elucidate the important amino acid residues involved in these intersubunit communication pathways. Two key clusters of amino acids were identified: one located at the junction between uS19 and uS13, and a second that appears to interact with the distal tip of H38. Biochemical analyses reveal that these mutations shift the ribosomal rotational equilibrium toward the unrotated state, increasing ribosomal affinity for tRNAs in the P-site and for ternary complex in the A-site, and inhibit binding of the translocase, eEF2. These defects in turn affect specific aspects of translational fidelity. These findings suggest that uS19 plays a critical role as a conduit of information exchange between the large and small ribosomal subunits directly through the B1a, and indirectly through the B1b/c bridges. PMID:26824029

  8. Ribosomal protein uS19 mutants reveal its role in coordinating ribosome structure and function.

    PubMed

    Bowen, Alicia M; Musalgaonkar, Sharmishtha; Moomau, Christine A; Gulay, Suna P; Mirvis, Mary; Dinman, Jonathan D

    2015-01-01

    Prior studies identified allosteric information pathways connecting functional centers in the large ribosomal subunit to the decoding center in the small subunit through the B1a and B1b/c intersubunit bridges in yeast. In prokaryotes a single SSU protein, uS13, partners with H38 (the A-site finger) and uL5 to form the B1a and B1b/c bridges respectively. In eukaryotes, the SSU component was split into 2 separate proteins during the course of evolution. One, also known as uS13, participates in B1b/c bridge with uL5 in eukaryotes. The other, called uS19 is the SSU partner in the B1a bridge with H38. Here, polyalanine mutants of uS19 involved in the uS19/uS13 and the uS19/H38 interfaces were used to elucidate the important amino acid residues involved in these intersubunit communication pathways. Two key clusters of amino acids were identified: one located at the junction between uS19 and uS13, and a second that appears to interact with the distal tip of H38. Biochemical analyses reveal that these mutations shift the ribosomal rotational equilibrium toward the unrotated state, increasing ribosomal affinity for tRNAs in the P-site and for ternary complex in the A-site, and inhibit binding of the translocase, eEF2. These defects in turn affect specific aspects of translational fidelity. These findings suggest that uS19 plays a critical role as a conduit of information exchange between the large and small ribosomal subunits directly through the B1a, and indirectly through the B1b/c bridges. PMID:26824029

  9. Bmi1 promotes erythroid development through regulating ribosome biogenesis

    PubMed Central

    Gao, Rui; Chen, Sisi; Kobayashi, Michihiro; Yu, Hao; Zhang, Yingchi; Wan, Yang; Young, Sara K.; Soltis, Anthony; Yu, Ming; Vemula, Sasidhar; Fraenkel, Ernest; Cantor, Alan; Antipin, Yevgeniy; Xu, Yang; Yoder, Mervin C.; Wek, Ronald C.; Ellis, Steven R.; Kapur, Reuben; Zhu, Xiaofan; Liu, Yan

    2015-01-01

    While Polycomb group protein Bmi1 is important for stem cell maintenance, its role in lineage commitment is largely unknown. We have identified Bmi1 as a novel regulator of erythroid development. Bmi1 is highly expressed in mouse erythroid progenitor cells and its deficiency impairs erythroid differentiation. BMI1 is also important for human erythroid development. Furthermore, we discovered that loss of Bmi1 in erythroid progenitor cells results in down-regulation of transcription of multiple ribosomal protein genes and impaired ribosome biogenesis. Bmi1 deficiency stabilizes p53 protein, leading to upregulation of p21 expression and subsequent G0/G1 cell cycle arrest. Genetic inhibition of p53 activity rescues the erythroid defects seen in the Bmi1 null mice, demonstrating that a p53-dependent mechanism underlies the pathophysiology of the anemia. Mechanistically, Bmi1 is associated with multiple ribosomal protein genes and may positively regulate their expression in erythroid progenitor cells. Thus, Bmi1 promotes erythroid development, at least in part through regulating ribosome biogenesis. Ribosomopathies are human disorders of ribosome dysfunction, including diamond blackfan anemia (DBA) and 5q- syndrome, in which genetic abnormalities cause impaired ribosome biogenesis, resulting in specific clinical phenotypes. We observed that BMI1 expression in human hematopoietic stem and progenitor cells (HSPCs) from patients with DBA is correlated with the expression of some ribosomal protein genes, suggesting that BMI1 deficiency may play a pathological role in DBA and other ribosomopathies. PMID:25385494

  10. Bmi1 promotes erythroid development through regulating ribosome biogenesis.

    PubMed

    Gao, Rui; Chen, Sisi; Kobayashi, Michihiro; Yu, Hao; Zhang, Yingchi; Wan, Yang; Young, Sara K; Soltis, Anthony; Yu, Ming; Vemula, Sasidhar; Fraenkel, Ernest; Cantor, Alan; Antipin, Yevgeniy; Xu, Yang; Yoder, Mervin C; Wek, Ronald C; Ellis, Steven R; Kapur, Reuben; Zhu, Xiaofan; Liu, Yan

    2015-03-01

    While Polycomb group protein Bmi1 is important for stem cell maintenance, its role in lineage commitment is largely unknown. We have identified Bmi1 as a novel regulator of erythroid development. Bmi1 is highly expressed in mouse erythroid progenitor cells and its deficiency impairs erythroid differentiation. BMI1 is also important for human erythroid development. Furthermore, we discovered that loss of Bmi1 in erythroid progenitor cells results in decreased transcription of multiple ribosomal protein genes and impaired ribosome biogenesis. Bmi1 deficiency stabilizes p53 protein, leading to upregulation of p21 expression and subsequent G0/G1 cell cycle arrest. Genetic inhibition of p53 activity rescues the erythroid defects seen in the Bmi1 null mice, demonstrating that a p53-dependent mechanism underlies the pathophysiology of the anemia. Mechanistically, Bmi1 is associated with multiple ribosomal protein genes and may positively regulate their expression in erythroid progenitor cells. Thus, Bmi1 promotes erythroid development, at least in part through regulating ribosome biogenesis. Ribosomopathies are human disorders of ribosome dysfunction, including Diamond-Blackfan anemia (DBA) and 5q- syndrome, in which genetic abnormalities cause impaired ribosome biogenesis, resulting in specific clinical phenotypes. We observed that BMI1 expression in human hematopoietic stem and progenitor cells from patients with DBA is correlated with the expression of some ribosomal protein genes, suggesting that BMI1 deficiency may play a pathological role in DBA and other ribosomopathies. PMID:25385494

  11. Stochastic kinetics of ribosomes: Single motor properties and collective behavior

    NASA Astrophysics Data System (ADS)

    Garai, Ashok; Chowdhury, Debanjan; Chowdhury, Debashish; Ramakrishnan, T. V.

    2009-07-01

    Syntheses of protein molecules in a cell are carried out by ribosomes. A ribosome can be regarded as a molecular motor which utilizes the input chemical energy to move on a messenger RNA (mRNA) track that also serves as a template for the polymerization of the corresponding protein. The forward movement, however, is characterized by an alternating sequence of translocation and pause. Using a quantitative model, which captures the mechanochemical cycle of an individual ribosome, we derive an exact analytical expression for the distribution of its dwell times at the successive positions on the mRNA track. Inverse of the average dwell time satisfies a “Michaelis-Menten-type” equation and is consistent with the general formula for the average velocity of a molecular motor with an unbranched mechanochemical cycle. Extending this formula appropriately, we also derive the exact force-velocity relation for a ribosome. Often many ribosomes simultaneously move on the same mRNA track, while each synthesizes a copy of the same protein. We extend the model of a single ribosome by incorporating steric exclusion of different individuals on the same track. We draw the phase diagram of this model of ribosome traffic in three-dimensional spaces spanned by experimentally controllable parameters. We suggest new experimental tests of our theoretical predictions.

  12. Functional interaction of yeast elongation factor 3 with yeast ribosomes.

    PubMed

    Chakraburtty, K

    1999-01-01

    Elongation factor 3 (EF-3) is a unique and essential requirement of the fungal translational apparatus. EF-3 is a monomeric protein with a molecular mass of 116,000. EF-3 is required by yeast ribosomes for in vitro translation and for in vivo growth. The protein stimulates the binding of EF-1 alpha :GTP:aa-tRNA ternary complex to the ribosomal A-site by facilitating release of deacylated-tRNA from the E-site. The reaction requires ATP hydrolysis. EF-3 contains two ATP-binding sequence motifs (NBS). NBSI is sufficient for the intrinsic ATPase function. NBSII is essential for ribosome-stimulated activity. By limited proteolysis, EF-3 was divided into two distinct functional domains. The N-terminal domain lacking the highly charged lysine blocks failed to bind ribosomes and was inactive in the ribosome-stimulated ATPase activity. The C-terminally derived lysine-rich fragment showed strong binding to yeast ribosomes. The purported S5 homology region of EF-3 at the N-terminal end has been reported to interact with 18S ribosomal RNA. We postulate that EF-3 contacts rRNA and/or protein(s) through the C-terminal end. Removal of these residues severely weakens its interaction mediated possibly through the N-terminal domain of the protein. PMID:10216951

  13. A Single Acetylation of 18 S rRNA Is Essential for Biogenesis of the Small Ribosomal Subunit in Saccharomyces cerevisiae*

    PubMed Central

    Ito, Satoshi; Akamatsu, Yu; Noma, Akiko; Kimura, Satoshi; Miyauchi, Kenjyo; Ikeuchi, Yoshiho; Suzuki, Takeo; Suzuki, Tsutomu

    2014-01-01

    Biogenesis of eukaryotic ribosome is a complex event involving a number of non-ribosomal factors. During assembly of the ribosome, rRNAs are post-transcriptionally modified by 2′-O-methylation, pseudouridylation, and several base-specific modifications, which are collectively involved in fine-tuning translational fidelity and/or modulating ribosome assembly. By mass-spectrometric analysis, we demonstrated that N4-acetylcytidine (ac4C) is present at position 1773 in the 18 S rRNA of Saccharomyces cerevisiae. In addition, we found an essential gene, KRE33 (human homolog, NAT10), that we renamed RRA1 (ribosomal RNA cytidine acetyltransferase 1) encoding an RNA acetyltransferase responsible for ac4C1773 formation. Using recombinant Rra1p, we could successfully reconstitute ac4C1773 in a model rRNA fragment in the presence of both acetyl-CoA and ATP as substrates. Upon depletion of Rra1p, the 23 S precursor of 18 S rRNA was accumulated significantly, which resulted in complete loss of 18 S rRNA and small ribosomal subunit (40 S), suggesting that ac4C1773 formation catalyzed by Rra1p plays a critical role in processing of the 23 S precursor to yield 18 S rRNA. When nuclear acetyl-CoA was depleted by inactivation of acetyl-CoA synthetase 2 (ACS2), we observed temporal accumulation of the 23 S precursor, indicating that Rra1p modulates biogenesis of 40 S subunit by sensing nuclear acetyl-CoA concentration. PMID:25086048

  14. Evidence that Yih1 resides in a complex with ribosomes.

    PubMed

    Waller, Tracey; Lee, Su Jung; Sattlegger, Evelyn

    2012-05-01

    Adjusting protein synthesis by phosphorylating eukaryotic translation initiation factor 2 (eIF2α) is a major mechanism by which eukaryotes adapt to and overcome stress. The eIF2α kinase Gcn2 is essential for overcoming amino acid starvation in all eukaryotes. We have shown that to sense starvation, the Gcn2 RWD domain must directly contact its effector protein, Gcn1, and both must bind to the ribosome, suggesting that starvation is sensed within a Gcn1-Gcn2-ribosome complex. The mammalian protein IMPACT, highly expressed in neurons, and its yeast orthologue yeast IMPACT homologue (Yih1) harbour an RWD domain with Gcn1-binding activity. We have shown that Yih1 downregulates Gcn2 by competing with Gcn2 for Gcn1-binding. Here, we provide evidence that Yih1 forms a complex with ribosomes. In velocity sedimentation assays, overexpressed glutathione S-transferase (GST)-tagged Yih1 cosedimented with polyribosomes independently of Gcn1. Reduction of polyribosomes to monosomes concomitantly decreased GST-Yih1 sedimentation in the heavy fractions where polyribosomes are normally found. Furthermore, GST-Yih1 coprecipitated large ribosomal protein Rpl39 independently of Gcn1. GST-Yih1 overexpression did not significantly affect Gcn1-ribosome or Gcn2-ribosome cosedimentation. myc-tagged Yih1 expressed from its own promoter cosedimented with polyribosomes independently of Gcn1, indicating that Yih1-ribosome interaction occurs under physiological conditions. GST-IMPACT cosedimented with yeast ribosomes and coprecipitated Rpl39 in a Gcn1-independent fashion, suggesting that Yih1/IMPACT-ribosome association is evolutionarily conserved. Moreover, GST-IMPACT coprecipitated actin as found for GST-Yih1. Taken together, our findings strongly suggest that IMPACT/Yih1 associates with ribosomes and that these ribosomes may simultaneously carry Gcn1 and Gcn2. Close physical proximity of Yih1 to the Gcn1-Gcn2-ribosome complex would allow cells to quickly inhibit Gcn2 whenever or wherever

  15. Quantitative assessment of ribosome drop-off in E. coli.

    PubMed

    Sin, Celine; Chiarugi, Davide; Valleriani, Angelo

    2016-04-01

    Premature ribosome drop-off is one of the major errors in translation of mRNA by ribosomes. However, repeated analyses of Ribo-seq data failed to quantify its strength inE. coli Relying on a novel highly sensitive data analysis method we show that a significant rate of ribosome drop-off is measurable and can be quantified also when cells are cultured under non-stressing conditions. Moreover, we find that the drop-off rate is highly variable, depending on multiple factors. In particular, under environmental stress such as amino acid starvation or ethanol intoxication, the drop-off rate markedly increases. PMID:26935582

  16. Whither Ribosome Structure and Dynamics Research? (A Perspective).

    PubMed

    Frank, Joachim

    2016-09-11

    As high-resolution cryogenic electron microscopy (cryo-EM) structures of ribosomes proliferate, at resolutions that allow atomic interactions to be visualized, this article attempts to give a perspective on the way research on ribosome structure and dynamics may be headed, and particularly the new opportunities we have gained through recent advances in cryo-EM. It is pointed out that single-molecule FRET and cryo-EM form natural complements in the characterization of ribosome dynamics and transitions among equilibrating states of in vitro translational systems. PMID:27178840

  17. Quantitative assessment of ribosome drop-off in E. coli

    PubMed Central

    Sin, Celine; Chiarugi, Davide; Valleriani, Angelo

    2016-01-01

    Premature ribosome drop-off is one of the major errors in translation of mRNA by ribosomes. However, repeated analyses of Ribo-seq data failed to quantify its strength in E. coli. Relying on a novel highly sensitive data analysis method we show that a significant rate of ribosome drop-off is measurable and can be quantified also when cells are cultured under non-stressing conditions. Moreover, we find that the drop-off rate is highly variable, depending on multiple factors. In particular, under environmental stress such as amino acid starvation or ethanol intoxication, the drop-off rate markedly increases. PMID:26935582

  18. Immature large ribosomal subunits containing the 7S pre-rRNA can engage in translation in Saccharomyces cerevisiae.

    PubMed

    Rodríguez-Galán, Olga; García-Gómez, Juan J; Kressler, Dieter; de la Cruz, Jesús

    2015-01-01

    Evolution has provided eukaryotes with mechanisms that impede immature and/or aberrant ribosomes to engage in translation. These mechanisms basically either prevent the nucleo-cytoplasmic export of these particles or, once in the cytoplasm, the release of associated assembly factors, which interfere with the binding of translation initiation factors and/or the ribosomal subunit joining. We have previously shown that aberrant yeast 40S ribosomal subunits containing the 20S pre-rRNA can engage in translation. In this study, we describe that cells harbouring the dob1-1 allele, encoding a mutated version of the exosome-assisting RNA helicase Mtr4, accumulate otherwise nuclear pre-60S ribosomal particles containing the 7S pre-rRNA in the cytoplasm. Polysome fractionation analyses revealed that these particles are competent for translation and do not induce elongation stalls. This phenomenon is rather specific since most mutations in other exosome components or co-factors, impairing the 3' end processing of the mature 5.8S rRNA, accumulate 7S pre-rRNAs in the nucleus. In addition, we confirm that pre-60S ribosomal particles containing either 5.8S + 30 or 5.8S + 5 pre-rRNAs also engage in translation elongation. We propose that 7S pre-rRNA processing is not strictly required for pre-60S r-particle export and that, upon arrival in the cytoplasm, there is no specific mechanism to prevent translation by premature pre-60S r-particles containing 3' extended forms of mature 5.8S rRNA. PMID:26151772

  19. Effect of alpha-sarcin and ribosome-inactivating proteins on the interaction of elongation factors with ribosomes.

    PubMed

    Brigotti, M; Rambelli, F; Zamboni, M; Montanaro, L; Sperti, S

    1989-02-01

    alpha-Sarcin from Aspergillus giganteus and the ribosome-inactivating proteins (RIPs) from higher plants inactivate the 60 S ribosomal subunit. The former is an RNAase, whereas RIPs are N-glycosidases. The site of cleavage of RNA and that of N-glycosidic depurinization are at one nucleotide distance in 28 S rRNA [Endo & Tsurugi (1987) J. Biol. Chem. 262, 8128-8130]. The effect of alpha-sarcin and that of RIPs on the interaction of elongation factors with Artemia salina (brine shrimp) ribosomes have been investigated. alpha-Sarcin inhibits both the EF1 (elongation factor 1)-dependent binding of aminoacyl-tRNA and the GTP-dependent binding of EF2 (elongation factor 2) to ribosomes, whereas two of the RIPs tested, ricin from Ricinus communis (castor bean) and volkensin from Adenia volkensii (kilyambiti), inhibit only the latter reaction. EF2 protects ribosomes from inactivation by both alpha-sarcin and ricin. The EF1-binding site is affected only by alpha-sarcin. The sensitivity of this site to alpha-sarcin is increased by pretreatment of ribosomes with ricin. A. salina ribosomes were highly resistant to the third RIP tested, namely gelonin from Gelonium multiflorum. All four proteins tested have, however, a comparable activity on the rabbit reticulocyte-lysate system. PMID:2930482

  20. The reduction in small ribosomal subunit abundance in ethanol-stressed cells of Bacillus subtilis is mediated by a SigB-dependent antisense RNA.

    PubMed

    Mars, Ruben A T; Mendonça, Karoline; Denham, Emma L; van Dijl, Jan Maarten

    2015-10-01

    One of the best-characterized general stress responses in bacteria is the σB-mediated stress response of the Gram-positive soil bacterium Bacillus subtilis. The σB regulon contains approximately 200 protein-encoding genes and 136 putative regulatory RNAs. One of these σB-dependent RNAs, named S1136-S1134, was recently mapped as being transcribed from the S1136 promoter on the opposite strand of the essential rpsD gene, which encodes the ribosomal primary-binding protein S4. Accordingly, S1136-S1134 transcription results in an rpsD-overlapping antisense RNA (asRNA). Upon exposure of B. subtilis to ethanol, the S1136 promoter was found to be induced, while rpsD transcription was downregulated. By quantitative PCR, we show that the activation of transcription from the S1136 promoter is directly responsible for the downregulation of rpsD upon ethanol exposure. We also show that this downregulation of rpsD leads to a reduced level of the small (30S) ribosomal subunit upon ethanol stress. The activation of the S1136 promoter thus represents the first example of antisense transcription-mediated regulation in the general stress response of B. subtilis and implicates the reduction of ribosomal protein abundance as a new aspect in the σB-dependent stress response. We propose that the observed reduction in the level of the small ribosomal subunit, which contains the ribosome-decoding center, may protect B. subtilis cells against misreading and spurious translation of possibly toxic aberrant peptides under conditions of ethanol stress. PMID:26115952

  1. Ribosomes containing mutants of L4 ribosomal protein from Thermus thermophilus display multiple defects in ribosomal functions and sensitivity against erythromycin

    PubMed Central

    TSAGKALIA, AIKATERINI; LEONTIADOU, FOTINI; XAPLANTERI, MARIA A.; PAPADOPOULOS, GEORGIOS; KALPAXIS, DIMITRIOS L.; CHOLI-PAPADOPOULOU, THEODORA

    2005-01-01

    Protein L4 from Thermus thermophilus (TthL4) was heterologously overproduced in Escherichia coli cells. To study the implication of the extended loop of TthL4 in the exit-tunnel and peptidyltransferase functions, the highly conserved E56 was replaced by D or Q, while the semiconserved G55 was changed to E or S. Moreover, the sequence -G55E56- was inverted to -E55G56-. When we incorporated these mutants into E. coli ribosomes and investigated their impact on poly(Phe) synthesis, high variations in the synthetic activity and response to erythromycin of the resulting ribosomes were observed. In the absence of erythromycin, ribosomes harboring mutations G55E and E56D in TthL4 protein were characterized by low activity in synthesizing poly(Phe) and decreased capability in binding tRNA at the A site. On the other hand, ribosomes possessing mutations G55E, G55S, G55E-E56G, or E56Q in TthL4 protein were unexpectedly more sensitive to erythromycin. Evidence in support of these findings was drawn by in vivo experiments, assessing the erythromycin sensitivity of E. coli cells expressing wild-type or mutant TthL4 proteins. Our results emphasize the role of the extended loop of L4 ribosomal protein in the exit-tunnel and peptidyltransferase center functions. PMID:16244130

  2. Novel role for a bacterial nucleoid protein in translation of mRNAs with suboptimal ribosome-binding sites

    PubMed Central

    Park, Hyun-Sook; Östberg, Yngve; Johansson, Jörgen; Wagner, E. Gerhart H.; Uhlin, Bernt Eric

    2010-01-01

    In Escherichia coli, the major nucleoid protein H-NS limits transcription by acting as a repressor or transcriptional silencer, presumably by its ability to close the looped chromosome domains in the nucleoid through DNA–protein–DNA bridging. Here, we demonstrate the direct involvement of H-NS as a positive factor stimulating translation of the malT mRNA. In vitro studies showed that H-NS facilitates a repositioning of the 30S preinitiation complex on the malT mRNA. H-NS stimulation of translation depended on the AU-rich −35 to −40 region of the mRNA. Several additional examples were found demonstrating a novel function for H-NS in translation of genes with suboptimal ribosome-binding sequences. PMID:20595230

  3. Ribosome heterogeneity in tumorigenesis: the rRNA point of view

    PubMed Central

    Marcel, Virginie; Catez, Frédéric; Diaz, Jean-Jacques

    2015-01-01

    The "specialized ribosome" concept proposes that ribosome variants are produced and differentially regulate translation. Examples supporting this notion demonstrated heterogeneity of ribosomal protein composition. However, ribosome translational activity is carried out by rRNA. We, and others, recently showed that rRNA heterogeneity regulates translation to generate distinct translatomes promoting tumorigenesis. PMID:27305893

  4. Cotranslational protein folding on the ribosome monitored in real time.

    PubMed

    Holtkamp, Wolf; Kokic, Goran; Jäger, Marcus; Mittelstaet, Joerg; Komar, Anton A; Rodnina, Marina V

    2015-11-27

    Protein domains can fold into stable tertiary structures while they are synthesized on the ribosome. We used a high-performance, reconstituted in vitro translation system to investigate the folding of a small five-helix protein domain-the N-terminal domain of Escherichia coli N5-glutamine methyltransferase HemK-in real time. Our observations show that cotranslational folding of the protein, which folds autonomously and rapidly in solution, proceeds through a compact, non-native conformation that forms within the peptide tunnel of the ribosome. The compact state rearranges into a native-like structure immediately after the full domain sequence has emerged from the ribosome. Both folding transitions are rate-limited by translation, allowing for quasi-equilibrium sampling of the conformational space restricted by the ribosome. Cotranslational folding may be typical of small, intrinsically rapidly folding protein domains. PMID:26612953

  5. Metabolic Labeling in the Study of Mammalian Ribosomal RNA Synthesis.

    PubMed

    Stefanovsky, Victor Y; Moss, Tom

    2016-01-01

    RNA metabolic labeling is a method of choice in the study of dynamic changes in the rate of gene transcription and RNA processing. It is particularly applicable to transcription of the ribosomal RNA genes and their processing products due to the very high levels of ribosomal RNA synthesis. Metabolic labeling can detect changes in ribosomal RNA transcription that occur within a few minutes as opposed to the still widely used RT-PCR or Northern blot procedures that measure RNA pool sizes and at best are able to detect changes occurring over several hours or several days. Here, we describe a metabolic labeling technique applicable to the measurement of ribosomal RNA synthesis and processing rates, as well as to the determination of RNA Polymerase I transcription elongation rates. PMID:27576716

  6. Cotranslational Protein Folding inside the Ribosome Exit Tunnel.

    PubMed

    Nilsson, Ola B; Hedman, Rickard; Marino, Jacopo; Wickles, Stephan; Bischoff, Lukas; Johansson, Magnus; Müller-Lucks, Annika; Trovato, Fabio; Puglisi, Joseph D; O'Brien, Edward P; Beckmann, Roland; von Heijne, Gunnar

    2015-09-01

    At what point during translation do proteins fold? It is well established that proteins can fold cotranslationally outside the ribosome exit tunnel, whereas studies of folding inside the exit tunnel have so far detected only the formation of helical secondary structure and collapsed or partially structured folding intermediates. Here, using a combination of cotranslational nascent chain force measurements, inter-subunit fluorescence resonance energy transfer studies on single translating ribosomes, molecular dynamics simulations, and cryoelectron microscopy, we show that a small zinc-finger domain protein can fold deep inside the vestibule of the ribosome exit tunnel. Thus, for small protein domains, the ribosome itself can provide the kind of sheltered folding environment that chaperones provide for larger proteins. PMID:26321634

  7. Cotranslational Protein Folding inside the Ribosome Exit Tunnel

    PubMed Central

    Nilsson, Ola B.; Hedman, Rickard; Marino, Jacopo; Wickles, Stephan; Bischoff, Lukas; Johansson, Magnus; Müller-Lucks, Annika; Trovato, Fabio; Puglisi, Joseph D.; O’Brien, Edward P.; Beckmann, Roland; von Heijne, Gunnar

    2015-01-01

    Summary At what point during translation do proteins fold? It is well established that proteins can fold cotranslationally outside the ribosome exit tunnel, whereas studies of folding inside the exit tunnel have so far detected only the formation of helical secondary structure and collapsed or partially structured folding intermediates. Here, using a combination of cotranslational nascent chain force measurements, inter-subunit fluorescence resonance energy transfer studies on single translating ribosomes, molecular dynamics simulations, and cryoelectron microscopy, we show that a small zinc-finger domain protein can fold deep inside the vestibule of the ribosome exit tunnel. Thus, for small protein domains, the ribosome itself can provide the kind of sheltered folding environment that chaperones provide for larger proteins. PMID:26321634

  8. Direct ribosomal binding by a cellular inhibitor of translation

    PubMed Central

    Colón-Ramos, Daniel A; Shenvi, Christina L; Weitzel, Douglas H; Gan, Eugene C; Matts, Robert; Cate, Jamie; Kornbluth, Sally

    2009-01-01

    During apoptosis and under conditions of cellular stress, several signaling pathways promote inhibition of cap-dependent translation while allowing continued translation of specific messenger RNAs encoding regulatory and stress-response proteins. We report here that the apoptotic regulator Reaper inhibits protein synthesis by binding directly to the 40S ribosomal subunit. This interaction does not affect either ribosomal association of initiation factors or formation of 43S or 48S complexes. Rather, it interferes with late initiation events upstream of 60S subunit joining, apparently modulating start-codon recognition during scanning. CrPV IRES–driven translation, involving direct ribosomal recruitment to the start site, is relatively insensitive to Reaper. Thus, Reaper is the first known cellular ribosomal binding factor with the potential to allow selective translation of mRNAs initiating at alternative start codons or from certain IRES elements. This function of Reaper may modulate gene expression programs to affect cell fate. PMID:16429152

  9. Database on the structure of large ribosomal subunit RNA.

    PubMed Central

    De Rijk, P; Van de Peer, Y; Chapelle, S; De Wachter, R

    1994-01-01

    A database on large ribosomal subunit RNA is made available. It contains 258 sequences. It provides sequence, alignment and secondary structure information in computer-readable formats. Files can be obtained using ftp. PMID:7524023

  10. A process yields large quantities of pure ribosome subunits

    NASA Technical Reports Server (NTRS)

    Friedman, M.; Lu, P.; Rich, A.

    1972-01-01

    Development of process for in-vitro protein synthesis from living cells followed by dissociation of ribosomes into subunits is discussed. Process depends on dialysis or use of chelating agents. Operation of process and advantages over previous methods are outlined.

  11. Cisplatin Targeting of Bacterial Ribosomal RNA Hairpins

    PubMed Central

    Dedduwa-Mudalige, Gayani N. P.; Chow, Christine S.

    2015-01-01

    Cisplatin is a clinically important chemotherapeutic agent known to target purine bases in nucleic acids. In addition to major deoxyribonucleic acid (DNA) intrastrand cross-links, cisplatin also forms stable adducts with many types of ribonucleic acid (RNA) including siRNA, spliceosomal RNAs, tRNA, and rRNA. All of these RNAs play vital roles in the cell, such as catalysis of protein synthesis by rRNA, and therefore serve as potential drug targets. This work focused on platination of two highly conserved RNA hairpins from E. coli ribosomes, namely pseudouridine-modified helix 69 from 23S rRNA and the 790 loop of helix 24 from 16S rRNA. RNase T1 probing, MALDI mass spectrometry, and dimethyl sulfate mapping revealed platination at GpG sites. Chemical probing results also showed platination-induced RNA structural changes. These findings reveal solvent and structural accessibility of sites within bacterial RNA secondary structures that are functionally significant and therefore viable targets for cisplatin as well as other classes of small molecules. Identifying target preferences at the nucleotide level, as well as determining cisplatin-induced RNA conformational changes, is important for the design of more potent drug molecules. Furthermore, the knowledge gained through studies of RNA-targeting by cisplatin is applicable to a broad range of organisms from bacteria to human. PMID:26370969

  12. The ribosomal gene spacer region in archaebacteria

    NASA Technical Reports Server (NTRS)

    Achenbach-Richter, L.; Woese, C. R.

    1988-01-01

    Sequences for the spacer regions that separate the 16S and 23S ribosomal RNA genes have been determined for four more (strategically placed) archaebacteria. These confirm the general rule that methanogens and extreme halophiles have spacers that contain a single tRNAala gene, while tRNA genes are not found in the spacer region of the true extreme thermophiles. The present study also shows that the spacer regions from the sulfate reducing Archaeglobus and the extreme thermophile Thermococcus (both of which cluster phylogenetically with the methanogens and extreme halophiles) contain each a tRNAala gene. Thus, not only all methanogens and extreme halophiles show this characteristic, but all organisms on the "methanogen branch" of the archaebacterial tree appear to do so. The finding of a tRNA gene in the spacer region of the extreme thermophile Thermococcus celer is the first known phenotypic property that links this organism with its phylogenetic counterparts, the methanogens, rather than with its phenotypic counterparts, the sulfur-dependent extreme thermophiles.

  13. Nonenzymatic microorganism identification based on ribosomal RNA

    NASA Astrophysics Data System (ADS)

    Ives, Jeffrey T.; Pierini, Alicia M.; Stokes, Jeffrey A.; Wahlund, Thomas M.; Read, Betsy; Bechtel, James H.; Bronk, Burt V.

    1999-11-01

    Effective defense against biological warfare (BW) agents requires rapid, fieldable and accurate systems. For micro- organisms like bacteria and viruses, ribosomal RNA (rRNA) provides a valuable target with multiple advantages of species specificity and intrinsic target amplification. Vegetative and spore forms of bacteria contain approximately 104 copies of rRNA. Direct detection of rRNA copies can eliminate some of the interference and preparation difficulties involved in enzymatic amplification methods. In order to apply the advantages of rRNA to BW defense, we are developing a fieldable system based on 16S rRNA, physical disruption of the micro-organism, solid phase hybridization, and fluorescence detection. Our goals include species-specific identification, complete operation from raw sample to identification in 15 minutes or less, and compact, fieldable instrumentation. Initial work on this project has investigated the lysis and hybridization steps, the species-specificity of oligonucleotides probes, and the development of a novel electromagnetic method to physically disrupt the micro- organisms. Target bacteria have been Escherichia coli (E. coli) and Bacillus subtilis (B. subtilis). Continuing work includes further development of methods to rapidly disrupt the micro-organisms and release the rRNA, improved integration and processing, and extension to bacterial and mammalian viruses like MS2 and vesicular stomatitis virus.

  14. Alveolate phylogeny inferred using concatenated ribosomal proteins.

    PubMed

    Bachvaroff, Tsvetan R; Handy, Sara M; Place, Allen R; Delwiche, Charles F

    2011-01-01

    Dinoflagellates and apicomplexans are a strongly supported monophyletic group in rDNA phylogenies, although this phylogeny is not without controversy, particularly between the two groups. Here we use concatenated protein-coding genes from expressed sequence tags or genomic data to construct phylogenies including "typical" dinophycean dinoflagellates, a parasitic syndinian dinoflagellate, Amoebophrya sp., and two related species, Oxyrrhis marina, and Perkinsus marinus. Seventeen genes encoding proteins associated with the ribosome were selected for phylogenetic analysis. The dataset was limited for the most part by data availability from the dinoflagellates. Forty-five taxa from four major lineages were used: the heterokont outgroup, ciliates, dinoflagellates, and apicomplexans. Amoebophrya sp. was included in this phylogeny as a sole representative of the enigmatic marine alveolate or syndinian lineage. The atypical dinoflagellate O. marina, usually excluded from rDNA analyses due to long branches, was also included. The resulting phylogenies were well supported in concatenated analyses with only a few unstable or weakly supported branches; most features were consistent when different lineages were pruned from the tree or different genes were concatenated. The least stable branches involved the placement of Cryptosporidium spp. within the Apicomplexa and the relationships between P. marinus, Amoebophrya sp., and O. marina. Both bootstrap and approximately unbiased test results confirmed that P. marinus, Amoebophrya sp., O. marina, and the remaining dinoflagellates form a monophyletic lineage to the exclusion of Apicomplexa. PMID:21518081

  15. The 16S ribosomal RNA mutation database (16SMDB).

    PubMed Central

    Triman, K L

    1996-01-01

    The 16S ribosomal RNA mutation database (16SMDB) provides a list of mutated positions in 16S ribosomal RNA from Escherichia coli and the identity of each alteration. Information provided for each mutation includes: (i) a brief description of the phenotype(s) associated with each mutation; (ii) whether a mutant phenotype has been detected by in vivo or in vitro methods; (iii) relevant literature citations. The database is available via ftp and on the World Wide Web. PMID:8594570

  16. Maturation of 23S ribosomal RNA requires the exoribonuclease RNase T.

    PubMed Central

    Li, Z; Pandit, S; Deutscher, M P

    1999-01-01

    Ribosomal RNAs are generally synthesized as long, primary transcripts that must be extensively processed to generate the mature, functional species. In Escherichia coli, it is known that the initial 30S precursor is cleaved during its synthesis by the endonuclease RNase III to generate precursors to the 16S, 23S, and 5S rRNAs. However, despite extensive study, the processes by which these intermediate products are converted to their mature forms are poorly understood. In this article, we describe the maturation of 23S rRNA. Based on Northern analysis of RNA isolated from a variety of mutant strains lacking one or multiple ribonucleases, we show that maturation of the 3' terminus requires the action of RNase T, an enzyme previously implicated in the end turnover of tRNA and in the maturation of small, stable RNAs. Although other exoribonucleases can participate in shortening the 3' end of the initial RNase III cleavage product, RNase T is required for removal of the last few residues. In the absence of RNase T, 23S rRNA products with extra 3' residues accumulate and are incorporated into ribosomes, with only small effects on cell growth. Purified RNase T accurately and efficiently converts these immature ribosomes to their mature forms in vitro, whereas free RNA is processed relatively poorly. In vivo, the processing defect at the 3' end has no effect on 5' maturation, indicating that the latter process proceeds independently. We also find that a portion of the 23S rRNA that accumulates in many RNase T- cells becomes polyadenylated because of the action of poly(A) polymerase I. The requirement for RNase T in 23S rRNA maturation is discussed in relation to a model in which only this enzyme, among the eight exoribonucleases present in E. coli, is able to efficiently remove nucleotides close to the double-stranded stem generated by the pairing of the 5' and 3' termini of most stable RNAs. PMID:9917073

  17. Complete Sequence Construction of the Highly Repetitive Ribosomal RNA Gene Repeats in Eukaryotes Using Whole Genome Sequence Data.

    PubMed

    Agrawal, Saumya; Ganley, Austen R D

    2016-01-01

    The ribosomal RNA genes (rDNA) encode the major rRNA species of the ribosome, and thus are essential across life. These genes are highly repetitive in most eukaryotes, forming blocks of tandem repeats that form the core of nucleoli. The primary role of the rDNA in encoding rRNA has been long understood, but more recently the rDNA has been implicated in a number of other important biological phenomena, including genome stability, cell cycle, and epigenetic silencing. Noncoding elements, primarily located in the intergenic spacer region, appear to mediate many of these phenomena. Although sequence information is available for the genomes of many organisms, in almost all cases rDNA repeat sequences are lacking, primarily due to problems in assembling these intriguing regions during whole genome assemblies. Here, we present a method to obtain complete rDNA repeat unit sequences from whole genome assemblies. Limitations of next generation sequencing (NGS) data make them unsuitable for assembling complete rDNA unit sequences; therefore, the method we present relies on the use of Sanger whole genome sequence data. Our method makes use of the Arachne assembler, which can assemble highly repetitive regions such as the rDNA in a memory-efficient way. We provide a detailed step-by-step protocol for generating rDNA sequences from whole genome Sanger sequence data using Arachne, for refining complete rDNA unit sequences, and for validating the sequences obtained. In principle, our method will work for any species where the rDNA is organized into tandem repeats. This will help researchers working on species without a complete rDNA sequence, those working on evolutionary aspects of the rDNA, and those interested in conducting phylogenetic footprinting studies with the rDNA. PMID:27576718

  18. Crew Assembly

    NASA Video Gallery

    Train to improve your dexterity and hand-eye coordination by assembling a puzzle.The Train Like an Astronaut project uses the excitement of exploration to challenge students to set goals, practice ...

  19. Genomic location of the major ribosomal protein gene locus determines Vibrio cholerae global growth and infectivity.

    PubMed

    Soler-Bistué, Alfonso; Mondotte, Juan A; Bland, Michael Jason; Val, Marie-Eve; Saleh, María-Carla; Mazel, Didier

    2015-04-01

    The effects on cell physiology of gene order within the bacterial chromosome are poorly understood. In silico approaches have shown that genes involved in transcription and translation processes, in particular ribosomal protein (RP) genes, localize near the replication origin (oriC) in fast-growing bacteria suggesting that such a positional bias is an evolutionarily conserved growth-optimization strategy. Such genomic localization could either provide a higher dosage of these genes during fast growth or facilitate the assembly of ribosomes and transcription foci by keeping physically close the many components of these macromolecular machines. To explore this, we used novel recombineering tools to create a set of Vibrio cholerae strains in which S10-spec-α (S10), a locus bearing half of the ribosomal protein genes, was systematically relocated to alternative genomic positions. We show that the relative distance of S10 to the origin of replication tightly correlated with a reduction of S10 dosage, mRNA abundance and growth rate within these otherwise isogenic strains. Furthermore, this was accompanied by a significant reduction in the host-invasion capacity in Drosophila melanogaster. Both phenotypes were rescued in strains bearing two S10 copies highly distal to oriC, demonstrating that replication-dependent gene dosage reduction is the main mechanism behind these alterations. Hence, S10 positioning connects genome structure to cell physiology in Vibrio cholerae. Our results show experimentally for the first time that genomic positioning of genes involved in the flux of genetic information conditions global growth control and hence bacterial physiology and potentially its evolution. PMID:25875621

  20. Co-evolution of Bacterial Ribosomal Protein S15 with Diverse mRNA Regulatory Structures

    PubMed Central

    Slinger, Betty L.; Newman, Hunter; Lee, Younghan; Pei, Shermin; Meyer, Michelle M.

    2015-01-01

    RNA-protein interactions are critical in many biological processes, yet how such interactions affect the evolution of both partners is still unknown. RNA and protein structures are impacted very differently by mechanisms of genomic change. While most protein families are identifiable at the nucleotide level across large phylogenetic distances, RNA families display far less nucleotide similarity and are often only shared by closely related bacterial species. Ribosomal protein S15 has two RNA binding functions. First, it is a ribosomal protein responsible for organizing the rRNA during ribosome assembly. Second, in many bacterial species S15 also interacts with a structured portion of its own transcript to negatively regulate gene expression. While the first interaction is conserved in most bacteria, the second is not. Four distinct mRNA structures interact with S15 to enable regulation, each of which appears to be independently derived in different groups of bacteria. With the goal of understanding how protein-binding specificity may influence the evolution of such RNA regulatory structures, we examine whether examples of these mRNA structures are able to interact with, and regulate in response to, S15 homologs from organisms containing distinct mRNA structures. We find that despite their shared RNA binding function in the rRNA, S15 homologs have distinct RNA recognition profiles. We present a model to explain the specificity patterns observed, and support this model by with further mutagenesis. After analyzing the patterns of conservation for the S15 protein coding sequences, we also identified amino acid changes that alter the binding specificity of an S15 homolog. In this work we demonstrate that homologous RNA-binding proteins have different specificity profiles, and minor changes to amino acid sequences, or to RNA structural motifs, can have large impacts on RNA-protein recognition. PMID:26675164

  1. Improvement and efficient display of Bacillus thuringiensis toxins on M13 phages and ribosomes.

    PubMed

    Pacheco, Sabino; Cantón, Emiliano; Zuñiga-Navarrete, Fernando; Pecorari, Frédéric; Bravo, Alejandra; Soberón, Mario

    2015-12-01

    Bacillus thuringiensis (Bt) produces insecticidal proteins that have been used worldwide in the control of insect-pests in crops and vectors of human diseases. However, different insect species are poorly controlled by the available Bt toxins or have evolved resistance to these toxins. Evolution of Bt toxicity could provide novel toxins to control insect pests. To this aim, efficient display systems to select toxins with increased binding to insect membranes or midgut proteins involved in toxicity are likely to be helpful. Here we describe two display systems, phage display and ribosome display, that allow the efficient display of two non-structurally related Bt toxins, Cry1Ac and Cyt1Aa. Improved display of Cry1Ac and Cyt1Aa on M13 phages was achieved by changing the commonly used peptide leader sequence of the coat pIII-fusion protein, that relies on the Sec translocation pathway, for a peptide leader sequence that relies on the signal recognition particle pathway (SRP) and by using a modified M13 helper phage (Phaberge) that has an amber mutation in its pIII genomic sequence and preferentially assembles using the pIII-fusion protein. Also, both Cry1Ac and Cyt1Aa were efficiently displayed on ribosomes, which could allow the construction of large libraries of variants. Furthermore, Cry1Ac or Cyt1Aa displayed on M13 phages or ribosomes were specifically selected from a mixture of both toxins depending on which antigen was immobilized for binding selection. These improved systems may allow the selection of Cry toxin variants with improved insecticidal activities that could counter insect resistances. PMID:26606918

  2. Co-evolution of Bacterial Ribosomal Protein S15 with Diverse mRNA Regulatory Structures.

    PubMed

    Slinger, Betty L; Newman, Hunter; Lee, Younghan; Pei, Shermin; Meyer, Michelle M

    2015-12-01

    RNA-protein interactions are critical in many biological processes, yet how such interactions affect the evolution of both partners is still unknown. RNA and protein structures are impacted very differently by mechanisms of genomic change. While most protein families are identifiable at the nucleotide level across large phylogenetic distances, RNA families display far less nucleotide similarity and are often only shared by closely related bacterial species. Ribosomal protein S15 has two RNA binding functions. First, it is a ribosomal protein responsible for organizing the rRNA during ribosome assembly. Second, in many bacterial species S15 also interacts with a structured portion of its own transcript to negatively regulate gene expression. While the first interaction is conserved in most bacteria, the second is not. Four distinct mRNA structures interact with S15 to enable regulation, each of which appears to be independently derived in different groups of bacteria. With the goal of understanding how protein-binding specificity may influence the evolution of such RNA regulatory structures, we examine whether examples of these mRNA structures are able to interact with, and regulate in response to, S15 homologs from organisms containing distinct mRNA structures. We find that despite their shared RNA binding function in the rRNA, S15 homologs have distinct RNA recognition profiles. We present a model to explain the specificity patterns observed, and support this model by with further mutagenesis. After analyzing the patterns of conservation for the S15 protein coding sequences, we also identified amino acid changes that alter the binding specificity of an S15 homolog. In this work we demonstrate that homologous RNA-binding proteins have different specificity profiles, and minor changes to amino acid sequences, or to RNA structural motifs, can have large impacts on RNA-protein recognition. PMID:26675164

  3. Purification, characterization and crystallization of the human 80S ribosome

    PubMed Central

    Khatter, Heena; Myasnikov, Alexander G.; Mastio, Leslie; Billas, Isabelle M. L.; Birck, Catherine; Stella, Stefano; Klaholz, Bruno P.

    2014-01-01

    Ribosomes are key macromolecular protein synthesis machineries in the cell. Human ribosomes have so far not been studied to atomic resolution because of their particularly complex structure as compared with other eukaryotic or prokaryotic ribosomes, and they are difficult to prepare to high homogeneity, which is a key requisite for high-resolution structural work. We established a purification protocol for human 80S ribosomes isolated from HeLa cells that allows obtaining large quantities of homogenous samples as characterized by biophysical methods using analytical ultracentrifugation and multiangle laser light scattering. Samples prepared under different conditions were characterized by direct single particle imaging using cryo electron microscopy, which helped optimizing the preparation protocol. From a small data set, a 3D reconstruction at subnanometric resolution was obtained showing all prominent structural features of the human ribosome, and revealing a salt concentration dependence of the presence of the exit site tRNA, which we show is critical for obtaining crystals. With these well-characterized samples first human 80S ribosome crystals were obtained from several crystallization conditions in capillaries and sitting drops, which diffract to 26 Å resolution at cryo temperatures and for which the crystallographic parameters were determined, paving the way for future high-resolution work. PMID:24452798

  4. GTPases mechanisms and functions of translation factors on the ribosome.

    PubMed

    Rodnina, M V; Stark, H; Savelsbergh, A; Wieden, H J; Mohr, D; Matassova, N B; Peske, F; Daviter, T; Gualerzi, C O; Wintermeyer, W

    2000-01-01

    The elongation factors (EF) Tu and G and initiation factor 2 (IF2) from bacteria are multidomain GTPases with essential functions in the elongation and initiation phases of translation. They bind to the same site on the ribosome where their low intrinsic GTPase activities are strongly stimulated. The factors differ fundamentally from each other, and from the majority of GTPases, in the mechanisms of GTPase control, the timing of Pi release, and the functional role of GTP hydrolysis. EF-Tu x GTP forms a ternary complex with aminoacyl-tRNA, which binds to the ribosome. Only when a matching codon is recognized, the GTPase of EF-Tu is stimulated, rapid GTP hydrolysis and Pi release take place, EF-Tu rearranges to the GDP form, and aminoacyl-tRNA is released into the peptidyltransferase center. In contrast, EF-G hydrolyzes GTP immediately upon binding to the ribosome, stimulated by ribosomal protein L7/12. Subsequent translocation is driven by the slow dissociation of Pi, suggesting a mechano-chemical function of EF-G. Accordingly, different conformations of EF-G on the ribosome are revealed by cryo-electron microscopy. GTP hydrolysis by IF2 is triggered upon formation of the 70S initiation complex, and the dissociation of Pi and/or IF2 follows a rearrangement of the ribosome into the elongation-competent state. PMID:10937868

  5. Structures of the ribosome in intermediate states of ratcheting

    PubMed Central

    Zhang, Wen; Dunkle, Jack; Cate, Jamie H. D.

    2010-01-01

    Summary Structures of the E. coli 70S ribosome show how the large and small subunits rotate to facilitate protein synthesis. Protein biosynthesis on the ribosome requires repeated cycles of ratcheting, which couples rotation of the two ribosomal subunits with respect to each other and swiveling of the head domain of the small subunit. However, the molecular basis for how the two ribosomal subunits rearrange contacts with each other during ratcheting while remaining stably associated is not known. Here we describe x-ray crystal structures of the intact Escherichia coli ribosome, either in the apo form (3.5 Å resolution) or with one (4.0 Å res) or two (4.0 Å res) anticodon stem-loop tRNA mimics bound, that reveal intermediate states of intersubunit rotation. In the structures, the interface between the small and large ribosomal subunits rearranges in discrete steps along the ratcheting pathway. Positioning of the head domain of the small subunit is controlled by interactions with the large subunit and with the tRNA bound in the peptidyl-tRNA site. The intermediates observed here provide insight into how tRNAs move into the hybrid state of binding that precedes the final steps of mRNA and tRNA translocation. PMID:19696352

  6. Targeted cancer therapy with ribosome biogenesis inhibitors: a real possibility?

    PubMed Central

    Brighenti, Elisa; Treré, Davide; Derenzini, Massimo

    2015-01-01

    The effects of many chemotherapeutic drugs on ribosome biogenesis have been underestimated for a long time. Indeed, many drugs currently used for cancer treatment – and which are known to either damage DNA or hinder DNA synthesis – have been shown to exert their toxic action mainly by inhibiting rRNA synthesis or maturation. Moreover, there are new drugs that have been proposed recently for cancer chemotherapy, which only hinder ribosome biogenesis without any genotoxic activity. Even though ribosome biogenesis occurs in both normal and cancer cells, whether resting or proliferating, there is evidence that the selective inhibition of ribosome biogenesis may, in some instances, result in a selective damage to neoplastic cells. The higher sensitivity of cancer cells to inhibitors of rRNA synthesis appears to be the consequence of either the loss of the mechanisms controlling the cell cycle progression or the acquisition of activating oncogene and inactivating tumor suppressor gene mutations that up-regulate the ribosome biogenesis rate. This article reviews those cancer cell characteristics on which the selective cancer cell cytotoxicity induced by the inhibitors of ribosome biogenesis is based. PMID:26415219

  7. Seal assembly

    SciTech Connect

    Johnson, Roger Neal; Longfritz, William David

    2001-01-01

    A seal assembly that seals a gap formed by a groove comprises a seal body, a biasing element, and a connection that connects the seal body to the biasing element to form the seal assembly. The seal assembly further comprises a concave-shaped center section and convex-shaped contact portions at each end of the seal body. The biasing element is formed from an elastic material and comprises a convex-shaped center section and concave-shaped biasing zones that are opposed to the convex-shaped contact portions. The biasing element is adapted to be compressed to change a width of the seal assembly from a first width to a second width that is smaller than the first width. In the compressed state, the seal assembly can be disposed in the groove. After release of the compressing force, the seal assembly expands. The contact portions will move toward a surface of the groove and the biasing zones will move into contact with another surface of the groove. The biasing zones will bias the contact portions of the seal body against the surface of the groove.

  8. Increased ribosome density associated to positively charged residues is evident in ribosome profiling experiments performed in the absence of translation inhibitors.

    PubMed

    Requião, Rodrigo D; de Souza, Henrique José Araujo; Rossetto, Silvana; Domitrovic, Tatiana; Palhano, Fernando L

    2016-06-01

    It has been proposed that polybasic peptides cause slower movement of ribosomes through an electrostatic interaction with the highly negative ribosome exit tunnel. Ribosome profiling data-the sequencing of short ribosome-bound fragments of mRNA-is a powerful tool for the analysis of mRNA translation. Using the yeast Saccharomyces cerevisiae as a model, we showed that reduced translation efficiency associated with polybasic protein sequences could be inferred from ribosome profiling. However, an increase in ribosome density at polybasic sequences was evident only when the commonly used translational inhibitors cycloheximide and anisomycin were omitted during mRNA isolation. Since ribosome profiling performed without inhibitors agrees with experimental evidence obtained by other methods, we conclude that cycloheximide and anisomycin must be avoided in ribosome profiling experiments. PMID:27064519

  9. Selective Translation of Leaderless mRNAs by Specialized Ribosomes Generated by MazF in Escherichia coli

    PubMed Central

    Vesper, Oliver; Amitai, Shahar; Belitsky, Maria; Byrgazov, Konstantin; Kaberdina, Anna Chao; Engelberg-Kulka, Hanna; Moll, Isabella

    2016-01-01

    Summary Escherichia coli (E. coli) mazEF is a stress-induced toxin-antitoxin (TA) module. The toxin MazF is an endoribonuclease that cleaves single-stranded mRNAs at ACA sequences. Here, we show that MazF cleaves at ACA sites at or closely upstream of the AUG start codon of some specific mRNAs and thereby generates leaderless mRNAs. Moreover, we provide evidence that MazF also targets 16S rRNA within 30S ribosomal subunits at the decoding center, thereby removing 43 nucleotides from the 3′ terminus. As this region comprises the anti-Shine-Dalgarno (aSD) sequence that is required for translation initiation on canonical mRNAs, a subpopulation of ribosomes is formed that selectively translates the described leaderless mRNAs both in vivo and in vitro. Thus, we have discovered a modified translation machinery that is generated in response to MazF induction and that probably serves for stress adaptation in Escherichia coli. PMID:21944167

  10. 70S-scanning initiation is a novel and frequent initiation mode of ribosomal translation in bacteria

    PubMed Central

    Yamamoto, Hiroshi; Wittek, Daniela; Gupta, Romi; Qin, Bo; Ueda, Takuya; Krause, Roland; Yamamoto, Kaori; Albrecht, Renate; Pech, Markus; Nierhaus, Knud H.

    2016-01-01

    According to the standard model of bacterial translation initiation, the small ribosomal 30S subunit binds to the initiation site of an mRNA with the help of three initiation factors (IF1–IF3). Here, we describe a novel type of initiation termed “70S-scanning initiation,” where the 70S ribosome does not necessarily dissociate after translation of a cistron, but rather scans to the initiation site of the downstream cistron. We detailed the mechanism of 70S-scanning initiation by designing unique monocistronic and polycistronic mRNAs harboring translation reporters, and by reconstituting systems to characterize each distinct mode of initiation. Results show that 70S scanning is triggered by fMet-tRNA and does not require energy; the Shine–Dalgarno sequence is an essential recognition element of the initiation site. IF1 and IF3 requirements for the various initiation modes were assessed by the formation of productive initiation complexes leading to synthesis of active proteins. IF3 is essential and IF1 is highly stimulating for the 70S-scanning mode. The task of IF1 appears to be the prevention of untimely interference by ternary aminoacyl (aa)-tRNA•elongation factor thermo unstable (EF-Tu)•GTP complexes. Evidence indicates that at least 50% of bacterial initiation events use the 70S-scanning mode, underscoring the relative importance of this translation initiation mechanism. PMID:26888283

  11. Visualization Software for Molecular Assemblies

    PubMed Central

    Goddard, Thomas D; Ferrin, Thomas E

    2007-01-01

    Summary Software for viewing three-dimensional models and maps of viruses, ribosomes, filaments and other molecular assemblies is advancing on many fronts. New developments include molecular representations that offer better control over level of detail, lighting that improves the perception of depth, and two-dimensional projections that simplify data interpretation. Programmable graphics processors offer quality, speed and visual effects not previously possible, while 3D printers, haptic interaction devices, and auto-stereo displays show promise in more naturally engaging our senses. Visualization methods are developed by diverse groups of researchers with differing goals: experimental biologists, database developers, computer scientists, and package developers. We survey recent developments and problems faced by the developer community in bringing innovative visualization methods into widespread use. PMID:17728125

  12. The molecular basis for ANE syndrome revealed by the large ribosomal subunit processome interactome

    PubMed Central

    McCann, Kathleen L; Teramoto, Takamasa; Zhang, Jun; Tanaka Hall, Traci M; Baserga, Susan J

    2016-01-01

    ANE syndrome is a ribosomopathy caused by a mutation in an RNA recognition motif of RBM28, a nucleolar protein conserved to yeast (Nop4). While patients with ANE syndrome have fewer mature ribosomes, it is unclear how this mutation disrupts ribosome assembly. Here we use yeast as a model system and show that the mutation confers growth and pre-rRNA processing defects. Recently, we found that Nop4 is a hub protein in the nucleolar large subunit (LSU) processome interactome. Here we demonstrate that the ANE syndrome mutation disrupts Nop4’s hub function by abrogating several of Nop4’s protein-protein interactions. Circular dichroism and NMR demonstrate that the ANE syndrome mutation in RRM3 of human RBM28 disrupts domain folding. We conclude that the ANE syndrome mutation generates defective protein folding which abrogates protein-protein interactions and causes faulty pre-LSU rRNA processing, thus revealing one aspect of the molecular basis of this human disease. DOI: http://dx.doi.org/10.7554/eLife.16381.001 PMID:27077951

  13. Structural and Functional Characterization of Ribosomal Protein Gene Introns in Sponges

    PubMed Central

    Perina, Drago; Korolija, Marina; Mikoč, Andreja; Roller, Maša; Pleše, Bruna; Imešek, Mirna; Morrow, Christine; Batel, Renato; Ćetković, Helena

    2012-01-01

    Ribosomal protein genes (RPGs) are a powerful tool for studying intron evolution. They exist in all three domains of life and are much conserved. Accumulating genomic data suggest that RPG introns in many organisms abound with non-protein-coding-RNAs (ncRNAs). These ancient ncRNAs are small nucleolar RNAs (snoRNAs) essential for ribosome assembly. They are also mobile genetic elements and therefore probably important in diversification and enrichment of transcriptomes through various mechanisms such as intron/exon gain/loss. snoRNAs in basal metazoans are poorly characterized. We examined 449 RPG introns, in total, from four demosponges: Amphimedon queenslandica, Suberites domuncula, Suberites ficus and Suberites pagurorum and showed that RPG introns from A. queenslandica share position conservancy and some structural similarity with “higher” metazoans. Moreover, our study indicates that mobile element insertions play an important role in the evolution of their size. In four sponges 51 snoRNAs were identified. The analysis showed discrepancies between the snoRNA pools of orthologous RPG introns between S. domuncula and A. queenslandica. Furthermore, these two sponges show as much conservancy of RPG intron positions between each other as between themselves and human. Sponges from the Suberites genus show consistency in RPG intron position conservation. However, significant differences in some of the orthologous RPG introns of closely related sponges were observed. This indicates that RPG introns are dynamic even on these shorter evolutionary time scales. PMID:22880015

  14. The structure of Rpf2-Rrs1 explains its role in ribosome biogenesis.

    PubMed

    Kharde, Satyavati; Calviño, Fabiola R; Gumiero, Andrea; Wild, Klemens; Sinning, Irmgard

    2015-08-18

    The assembly of eukaryotic ribosomes is a hierarchical process involving about 200 biogenesis factors and a series of remodeling steps. The 5S RNP consisting of the 5S rRNA, RpL5 and RpL11 is recruited at an early stage, but has to rearrange during maturation of the pre-60S ribosomal subunit. Rpf2 and Rrs1 have been implicated in 5S RNP biogenesis, but their precise role was unclear. Here, we present the crystal structure of the Rpf2-Rrs1 complex from Aspergillus nidulans at 1.5 Å resolution and describe it as Brix domain of Rpf2 completed by Rrs1 to form two anticodon-binding domains with functionally important tails. Fitting the X-ray structure into the cryo-EM density of a previously described pre-60S particle correlates with biochemical data. The heterodimer forms specific contacts with the 5S rRNA, RpL5 and the biogenesis factor Rsa4. The flexible protein tails of Rpf2-Rrs1 localize to the central protuberance. Two helices in the Rrs1 C-terminal tail occupy a strategic position to block the rotation of 25S rRNA and the 5S RNP. Our data provide a structural model for 5S RNP recruitment to the pre-60S particle and explain why removal of Rpf2-Rrs1 is necessary for rearrangements to drive 60S maturation. PMID:26117542

  15. Recognition of Ribosomal Protein L11 by the Protein Trimethyltransferase PrmA

    SciTech Connect

    Demirci,H.; Gregory, S.; Dahlberg, A.; Jogl, G.

    2007-01-01

    Bacterial ribosomal protein L11 is post-translationally trimethylated at multiple residues by a single methyltransferase, PrmA. Here, we describe four structures of PrmA from the extreme thermophile Thermus thermophilus. Two apo-PrmA structures at 1.59 and 2.3 {angstrom} resolution and a third with bound cofactor S-adenosyl-L-methionine at 1.75 {angstrom} each exhibit distinct relative positions of the substrate recognition and catalytic domains, revealing how PrmA can position the L11 substrate for multiple, consecutive side-chain methylation reactions. The fourth structure, the PrmA-L11 enzyme-substrate complex at 2.4 {angstrom} resolution, illustrates the highly specific interaction of the N-terminal domain with its substrate and places Lys39 in the PrmA active site. The presence of a unique flexible loop in the cofactor-binding site suggests how exchange of AdoMet with the reaction product S-adenosyl-L-homocysteine can occur without necessitating the dissociation of PrmA from L11. Finally, the mode of interaction of PrmA with L11 explains its observed preference for L11 as substrate before its assembly into the 50S ribosomal subunit.

  16. Structural and functional characterization of ribosomal protein gene introns in sponges.

    PubMed

    Perina, Drago; Korolija, Marina; Mikoč, Andreja; Roller, Maša; Pleše, Bruna; Imešek, Mirna; Morrow, Christine; Batel, Renato; Ćetković, Helena

    2012-01-01

    Ribosomal protein genes (RPGs) are a powerful tool for studying intron evolution. They exist in all three domains of life and are much conserved. Accumulating genomic data suggest that RPG introns in many organisms abound with non-protein-coding-RNAs (ncRNAs). These ancient ncRNAs are small nucleolar RNAs (snoRNAs) essential for ribosome assembly. They are also mobile genetic elements and therefore probably important in diversification and enrichment of transcriptomes through various mechanisms such as intron/exon gain/loss. snoRNAs in basal metazoans are poorly characterized. We examined 449 RPG introns, in total, from four demosponges: Amphimedon queenslandica, Suberites domuncula, Suberites ficus and Suberites pagurorum and showed that RPG introns from A. queenslandica share position conservancy and some structural similarity with "higher" metazoans. Moreover, our study indicates that mobile element insertions play an important role in the evolution of their size. In four sponges 51 snoRNAs were identified. The analysis showed discrepancies between the snoRNA pools of orthologous RPG introns between S. domuncula and A. queenslandica. Furthermore, these two sponges show as much conservancy of RPG intron positions between each other as between themselves and human. Sponges from the Suberites genus show consistency in RPG intron position conservation. However, significant differences in some of the orthologous RPG introns of closely related sponges were observed. This indicates that RPG introns are dynamic even on these shorter evolutionary time scales. PMID:22880015

  17. Connecting the Kinetics and Energy Landscape of tRNA Translocation on the Ribosome

    PubMed Central

    Whitford, Paul C.; Blanchard, Scott C.; Cate, Jamie H. D.; Sanbonmatsu, Karissa Y.

    2013-01-01

    Functional rearrangements in biomolecular assemblies result from diffusion across an underlying energy landscape. While bulk kinetic measurements rely on discrete state-like approximations to the energy landscape, single-molecule methods can project the free energy onto specific coordinates. With measures of the diffusion, one may establish a quantitative bridge between state-like kinetic measurements and the continuous energy landscape. We used an all-atom molecular dynamics simulation of the 70S ribosome (2.1 million atoms; 1.3 microseconds) to provide this bridge for specific conformational events associated with the process of tRNA translocation. Starting from a pre-translocation configuration, we identified sets of residues that collectively undergo rotary rearrangements implicated in ribosome function. Estimates of the diffusion coefficients along these collective coordinates for translocation were then used to interconvert between experimental rates and measures of the energy landscape. This analysis, in conjunction with previously reported experimental rates of translocation, provides an upper-bound estimate of the free-energy barriers associated with translocation. While this analysis was performed for a particular kinetic scheme of translocation, the quantitative framework is general and may be applied to energetic and kinetic descriptions that include any number of intermediates and transition states. PMID:23555233

  18. Connecting the kinetics and energy landscape of tRNA translocation on the ribosome.

    PubMed

    Whitford, Paul C; Blanchard, Scott C; Cate, Jamie H D; Sanbonmatsu, Karissa Y

    2013-01-01

    Functional rearrangements in biomolecular assemblies result from diffusion across an underlying energy landscape. While bulk kinetic measurements rely on discrete state-like approximations to the energy landscape, single-molecule methods can project the free energy onto specific coordinates. With measures of the diffusion, one may establish a quantitative bridge between state-like kinetic measurements and the continuous energy landscape. We used an all-atom molecular dynamics simulation of the 70S ribosome (2.1 million atoms; 1.3 microseconds) to provide this bridge for specific conformational events associated with the process of tRNA translocation. Starting from a pre-translocation configuration, we identified sets of residues that collectively undergo rotary rearrangements implicated in ribosome function. Estimates of the diffusion coefficients along these collective coordinates for translocation were then used to interconvert between experimental rates and measures of the energy landscape. This analysis, in conjunction with previously reported experimental rates of translocation, provides an upper-bound estimate of the free-energy barriers associated with translocation. While this analysis was performed for a particular kinetic scheme of translocation, the quantitative framework is general and may be applied to energetic and kinetic descriptions that include any number of intermediates and transition states. PMID:23555233

  19. Chemical probing of the tRNA--ribosome complex.

    PubMed Central

    Peattie, D A; Herr, W

    1981-01-01

    We probed the (Escherichia coli) tRNAPhe--ribosome interaction with the chemical reagents dimethyl sulfate and diethyl pyrocarbonate. This monitored the higher-order structure of the tRNA in this biological complex and identified critical sites in the tRNA molecule involved in binding to the ribosome. The methylation of the N-7 position of guanosine and the N-3 position of cytidine as well as diethyl pyrocarbonate attack on adenosines are sensitive to secondary and tertiary interactions. Here we identify specific bases in E. coli Phe-tRNAPhe affected by the interaction with the ribosome. The 70S ribosome protects the N-3 position of cytidine-74 and 75 in the 3'-terminal C-C-A, suggesting a strong, possibly base pairing, interaction between the ribosome and that universal sequence. The ribosome also induces strong reactivities at the N-7 positions of G-24 and G-46 in the central region of the tRNA molecule near the variable-loop domain as well as less significant reactivities at 11 other guanosines. Two of these, G-10 and G-44, are close to G-24 and G-46 in the center of the molecule; the others (guanosines 1, 5, 6, 18, 19, 63, 65, 69, and 71) are in the coaxial acceptor stem-T stem helix. All of the effects are ribosome induced and occur in the presence or absence of the messenger poly(U). Prior chemical modification of the anticodon bases as well as the two adjacent 3' purines and, less effectively, four purines in the anticodon stem prevent stable poly(U)-directed ribosome binding. Thus, we identify the 3' terminal C-C-A sequence, near the peptidyl transferase site, and the anticodon stem and loop of tRNAPhe as forming critical contacts with the ribosome. Other regions of the molecule become reactive on ribosome binding, but these do not suggest a significant conformational change being more likely due to a change of environment. Images PMID:6166006

  20. The role of GTP in transient splitting of 70S ribosomes by RRF (ribosome recycling factor) and EF-G (elongation factor G)

    PubMed Central

    Hirokawa, Go; Iwakura, Nobuhiro; Kaji, Akira; Kaji, Hideko

    2008-01-01

    Ribosome recycling factor (RRF), elongation factor G (EF-G) and GTP split 70S ribosomes into subunits. Here, we demonstrated that the splitting was transient and the exhaustion of GTP resulted in re-association of the split subunits into 70S ribosomes unless IF3 (initiation factor 3) was present. However, the splitting was observed with sucrose density gradient centrifugation (SDGC) without IF3 if RRF, EF-G and GTP were present in the SDGC buffer. The splitting of 70S ribosomes causes the decrease of light scattering by ribosomes. Kinetic constants obtained from the light scattering studies are sufficient to account for the splitting of 70S ribosomes by RRF and EF-G/GTP during the lag phase for activation of ribosomes for the log phase. As the amount of 70S ribosomes increased, more RRF, EF-G and GTP were necessary to split 70S ribosomes. In the presence of a physiological amount of polyamines, GTP and factors, even 0.6 μM 70S ribosomes (12 times higher than the 70S ribosomes for routine assay) were split. Spermidine (2 mM) completely inhibited anti-association activity of IF3, and the RRF/EF-G/GTP-dependent splitting of 70S ribosomes. PMID:18948280

  1. Role of the ribosome-associated protein PY in the cold-shock response of Escherichia coli

    PubMed Central

    Di Pietro, Fabio; Brandi, Anna; Dzeladini, Nadire; Fabbretti, Attilio; Carzaniga, Thomas; Piersimoni, Lolita; Pon, Cynthia L; Giuliodori, Anna Maria

    2013-01-01

    Protein Y (PY) is an Escherichia coli cold-shock protein which has been proposed to be responsible for the repression of bulk protein synthesis during cold adaptation. Here, we present in vivo and in vitro data which clarify the role of PY and its mechanism of action. Deletion of yfiA, the gene encoding protein PY, demonstrates that this protein is dispensable for cold adaptation and is not responsible for the shutdown of bulk protein synthesis at the onset of the stress, although it is able to partially inhibit translation. In vitro assays reveal that the extent of PY inhibition changes with different mRNAs and that this inhibition is related to the capacity of PY of binding 30S subunits with a fairly strong association constant, thus stimulating the formation of 70S monomers. Furthermore, our data provide evidence that PY competes with the other ribosomal ligands for the binding to the 30S subunits. Overall these results suggest an alternative model to explain PY function during cold shock and to reconcile the inhibition caused by PY with the active translation observed for some mRNAs during cold shock. PMID:23420694

  2. Probe assembly

    SciTech Connect

    Avera, C.J.

    1981-01-06

    A hand-held probe assembly, suitable for monitoring a radioactive fibrinogen tracer, is disclosed comprising a substantially cylindrically shaped probe handle having an open end. The probe handle is adapted to be interconnected with electrical circuitry for monitoring radioactivity that is sensed or detected by the probe assembly. Mounted within the probe handle is a probe body assembly that includes a cylindrically shaped probe body inserted through the open end of the probe handle. The probe body includes a photomultiplier tube that is electrically connected with a male connector positioned at the rearward end of the probe body. Mounted at the opposite end of the probe body is a probe head which supports an optical coupler therewithin. The probe head is interconnected with a probe cap which supports a detecting crystal. The probe body assembly, which consists of the probe body, the probe head, and the probe cap is supported within the probe handle by means of a pair of compressible o-rings which permit the probe assembly to be freely rotatable, preferably through 360*, within the probe handle and removable therefrom without requiring any disassembly.

  3. Identification of sirtuin and its target as the ribosomal protein S4 in Lactobacillus paracasei.

    PubMed

    Atarashi, Hotaka; Kawasaki, Shinji; Niimura, Yoichi; Tanaka, Naoto; Okada, Sanae; Shiwa, Yuh; Endo, Akihito; Nakagawa, Junichi

    2016-01-01

    Sirtuin is a protein with an enzymatic activity of NAD(+)-dependent protein deacetylation. It was first identified in yeast and its homologous genes have been widely found in various organisms. In bacteria, sirtuin gene was first described as cobB, encoding a cobalamin processing enzyme; and later its potential involvement in regulating acetylation levels of metabolic enzymes, transcription factors, chemotactic proteins and others have been reported. In order to study its physiological relevance in probiotic lactic acid bacteria, we analyzed the whole genome of three L. paracasei strains. All strains tested had sirtuin homolog genes designated hereby as sirA, and one of them had an additional gene designated as sirB. Following confirmation of their coding sequences by individual gene cloning, corresponding recombinant proteins have been generated and purified. The enzymatic characterization revealed that the intrinsic NAD(+)-dependent deacetylation activity of LpSirA (protein encoded by sirA) is comparable to human SIRT1. Furthermore, by blocking sirtuin activity using nicotinamide in vivo, together with an in vitro deacetylation reaction using recombinant LpSirA, we identified one of the target proteins in the lactic acid bacteria as the 30S ribosomal protein S4 (rpsD product). PMID:27118078

  4. Initiation factor 2 stabilizes the ribosome in a semirotated conformation.

    PubMed

    Ling, Clarence; Ermolenko, Dmitri N

    2015-12-29

    Intersubunit rotation and movement of the L1 stalk, a mobile domain of the large ribosomal subunit, have been shown to accompany the elongation cycle of translation. The initiation phase of protein synthesis is crucial for translational control of gene expression; however, in contrast to elongation, little is known about the conformational rearrangements of the ribosome during initiation. Bacterial initiation factors (IFs) 1, 2, and 3 mediate the binding of initiator tRNA and mRNA to the small ribosomal subunit to form the initiation complex, which subsequently associates with the large subunit by a poorly understood mechanism. Here, we use single-molecule FRET to monitor intersubunit rotation and the inward/outward movement of the L1 stalk of the large ribosomal subunit during the subunit-joining step of translation initiation. We show that, on subunit association, the ribosome adopts a distinct conformation in which the ribosomal subunits are in a semirotated orientation and the L1 stalk is positioned in a half-closed state. The formation of the semirotated intermediate requires the presence of an aminoacylated initiator, fMet-tRNA(fMet), and IF2 in the GTP-bound state. GTP hydrolysis by IF2 induces opening of the L1 stalk and the transition to the nonrotated conformation of the ribosome. Our results suggest that positioning subunits in a semirotated orientation facilitates subunit association and support a model in which L1 stalk movement is coupled to intersubunit rotation and/or IF2 binding. PMID:26668356

  5. Cyclisation mechanisms in the biosynthesis of ribosomally synthesised and post-translationally modified peptides

    PubMed Central

    2016-01-01

    Summary Ribosomally synthesised and post-translationally modified peptides (RiPPs) are a large class of natural products that are remarkably chemically diverse given an intrinsic requirement to be assembled from proteinogenic amino acids. The vast chemical space occupied by RiPPs means that they possess a wide variety of biological activities, and the class includes antibiotics, co-factors, signalling molecules, anticancer and anti-HIV compounds, and toxins. A considerable amount of RiPP chemical diversity is generated from cyclisation reactions, and the current mechanistic understanding of these reactions will be discussed here. These cyclisations involve a diverse array of chemical reactions, including 1,4-nucleophilic additions, [4 + 2] cycloadditions, ATP-dependent heterocyclisation to form thiazolines or oxazolines, and radical-mediated reactions between unactivated carbons. Future prospects for RiPP pathway discovery and characterisation will also be highlighted. PMID:27559376

  6. Colicin E3 cleavage of 16S rRNA impairs decoding and accelerates tRNA translocation on Escherichia coli ribosomes

    PubMed Central

    Lancaster, Lorna E; Savelsbergh, Andreas; Kleanthous, Colin; Wintermeyer, Wolfgang; Rodnina, Marina V

    2008-01-01

    The cytotoxin colicin E3 targets the 30S subunit of bacterial ribosomes and specifically cleaves 16S rRNA at the decoding centre, thereby inhibiting translation. Although the cleavage site is well known, it is not clear which step of translation is inhibited. We studied the effects of colicin E3 cleavage on ribosome functions by analysing individual steps of protein synthesis. We find that the cleavage affects predominantly the elongation step. The inhibitory effect of colicin E3 cleavage originates from the accumulation of sequential impaired decoding events, each of which results in low occupancy of the A site and, consequently, decreasing yield of elongating peptide. The accumulation leads to an almost complete halt of translation after reading of a few codons. The cleavage of 16S rRNA does not impair monitoring of codon–anticodon complexes or GTPase activation during elongation-factor Tu-dependent binding of aminoacyl-tRNA, but decreases the stability of the codon–recognition complex and slows down aminoacyl-tRNA accommodation in the A site. The tRNA–mRNA translocation is faster on colicin E3-cleaved than on intact ribosomes and is less sensitive to inhibition by the antibiotic viomycin. PMID:18485067

  7. The 70 S monosome accumulation and in vitro initiation complex formation by Escherichia coli ribosomes at 5 C. Ph.D. Thesis

    NASA Technical Reports Server (NTRS)

    Broeze, R. J.; Pope, D. H.

    1978-01-01

    The inhibition of translation which is observed after shifting Escherichia coli to low temperature was investigated. 70 S ribosomes were isolated from E. coli 8 hours after a shift to 5 C synthesized protein in the absence of added mRNA (i.e., endogenous protein synthesis by 70 S monosomes) at a rate which was three times greater than the rate of endogenous protein synthesis by 70 S ribosomes which were isolated at the time of the shift to 5 C. Calculations based on the rates of endogenous protein synthesis and polyphenylalanine synthesis indicate that 70 S monosomes comprise only 0.1% of the total E. coli 70 S ribosome population after 8 hours at 5 c. Experiments designed to test initiation complex formation on ApUpG or formaldehyde treated MS-2 viral RNA demonstrated that, although the rate of formation of 30 S initiation complexes was not inhibited, the rate of formation of active 70 S initiation complexes, able to react with puromycin, was inhibited to a great extent at 5 C. A model depicting the effects of low temperature on the E. coli translation system is proposed.

  8. Human C4orf14 interacts with the mitochondrial nucleoid and is involved in the biogenesis of the small mitochondrial ribosomal subunit

    PubMed Central

    He, J.; Cooper, H. M.; Reyes, A.; Di Re, M.; Kazak, L.; Wood, S. R.; Mao, C. C.; Fearnley, I. M.; Walker, J. E.; Holt, I. J.

    2012-01-01

    The bacterial homologue of C4orf14, YqeH, has been linked to assembly of the small ribosomal subunit. Here, recombinant C4orf14 isolated from human cells, co-purified with the small, 28S subunit of the mitochondrial ribosome and the endogenous protein co-fractionated with the 28S subunit in sucrose gradients. Gene silencing of C4orf14 specifically affected components of the small subunit, leading to decreased protein synthesis in the organelle. The GTPase of C4orf14 was critical to its interaction with the 28S subunit, as was GTP. Therefore, we propose that C4orf14, with bound GTP, binds to components of the 28S subunit facilitating its assembly, and GTP hydrolysis acts as the release mechanism. C4orf14 was also found to be associated with human mitochondrial nucleoids, and C4orf14 gene silencing caused mitochondrial DNA depletion. In vitro C4orf14 is capable of binding to DNA. The association of C4orf14 with mitochondrial translation factors and the mitochondrial nucleoid suggests that the 28S subunit is assembled at the mitochondrial nucleoid, enabling the direct transfer of messenger RNA from the nucleoid to the ribosome in the organelle. PMID:22447445

  9. Hinge assembly

    DOEpatents

    Vandergriff, D.H.

    1999-08-31

    A hinge assembly is disclosed having a first leaf, a second leaf and linking member. The first leaf has a contact surface. The second leaf has a first contact surface and a second contact surface. The linking member pivotally connects to the first leaf and to the second leaf. The hinge assembly is capable of moving from a closed position to an open position. In the closed position, the contact surface of the first leaf merges with the first contact surface of the second leaf. In the open position, the contact surface of the first leaf merges with the second contact surface of the second leaf. The hinge assembly can include a seal on the contact surface of the first leaf. 8 figs.

  10. Hinge assembly

    DOEpatents

    Vandergriff, David Houston

    1999-01-01

    A hinge assembly having a first leaf, a second leaf and linking member. The first leaf has a contact surface. The second leaf has a first contact surface and a second contact surface. The linking member pivotally connects to the first leaf and to the second leaf. The hinge assembly is capable of moving from a closed position to an open position. In the closed position, the contact surface of the first leaf merges with the first contact surface of the second leaf. In the open position, the contact surface of the first leaf merges with the second contact surface of the second leaf. The hinge assembly can include a seal on the contact surface of the first leaf.

  11. Discovery of peptidylarginine deiminase-4 substrates by protein array: antagonistic citrullination and methylation of human ribosomal protein S2.

    PubMed

    Guo, Qin; Bedford, Mark T; Fast, Walter

    2011-07-01

    Peptidylarginine deiminase (PAD) catalyzes the posttranslational citrullination of selected proteins in a calcium dependent manner. The PAD4 isoform has been implicated in multiple sclerosis, rheumatoid arthritis, some types of cancer, and plays a role in gene regulation. However, the substrate selectivity of PAD4 is not well defined, nor is the impact of citrullination on many other pathways. Here, a high-density protein array is used as a primary screen to identify 40 previously unreported PAD4 substrates, 10 of which are selected and verified in a cell lysate-based secondary assay. One of the most prominent hits, human 40S ribosomal protein S2 (RPS2), is characterized in detail. PAD4 citrullinates the Arg-Gly repeat region of RPS2, which is also an established site for Arg methylation by protein arginine methyltransferase 3 (PRMT3). As in other systems, crosstalk is observed; citrullination and methylation modifications are found to be antagonistic to each other, suggesting a conserved posttranslational regulatory strategy. Both PAD4 and PRMT3 are found to co-sediment with the free 40S ribosomal subunit fraction from cell extracts. These findings are consistent with participation of citrullination in the regulation of RPS2 and ribosome assembly. This application of protein arrays to reveal new PAD4 substrates suggests a role for citrullination in a number of different cellular pathways. PMID:21584310

  12. Conservation and divergence of transcriptional coregulations between box C/D snoRNA and ribosomal protein genes in Ascomycota

    PubMed Central

    Diao, Li-Ting; Xiao, Zhen-Dong; Leng, Xiao-Min; Li, Bin; Li, Jun-Hao; Luo, Yu-Ping; Li, Si-Guang; Yu, Chuan-He; Zhou, Hui

    2014-01-01

    Coordinated assembly of the ribosome is essential for proper translational activity in eukaryotic cells. It is therefore critical to coordinate the expression of components of ribosomal programs with the cell's nutritional status. However, coordinating expression of these components is poorly understood. Here, by combining experimental and computational approaches, we systematically identified box C/D snoRNAs in four fission yeasts and found that the expression of box C/D snoRNA and ribosomal protein (RP) genes were orchestrated by a common Homol-D box, thereby ensuring a constant balance of these two genetic components. Interestingly, such transcriptional coregulations could be observed in most Ascomycota species and were mediated by different cis-regulatory elements. Via the reservation of cis elements, changes in spatial configuration, the substitution of cis elements, and gain or loss of cis elements, the regulatory networks of box C/D snoRNAs evolved to correspond with those of the RP genes, maintaining transcriptional coregulation between box C/D snoRNAs and RP genes. Our results indicate that coregulation via common cis elements is an important mechanism to coordinate expression of the RP and snoRNA genes, which ensures a constant balance of these two components. PMID:25002674

  13. Involvement of multiple basic amino acids in yeast ribosomal protein L1 in 5S rRNA recognition.

    PubMed

    Yeh, L C; Lee, J C

    1995-01-01

    The role of basic amino acid residues located at the C-terminal region of the yeast ribosomal protein L1 in 5S rRNA binding was characterized in vitro and in vivo. Mutant proteins containing single or multiple amino acid substitutions were generated by site-directed mutagenesis of the L1 gene carried on a plasmid. In vitro RNP formation was examined by production of the mutant protein in the presence of the RNA molecule. The thermostability of the resultant RNP was also studied. Effects of these mutations on cell viability and ribosome assembly were characterized by transformation of a conditional null L1 yeast mutant with the mutated L1 gene expressed from the plasmid. Substitution of any one of the lysine or arginine residue did not affect significantly RNA binding in vitro or cell growth in vivo. However, several mutant proteins with substitutions of two of these basic amino acids bound RNA weakly and the RNPs were less stable. Cells expressing these mutant proteins were lethal. Theoretical structural prediction of these amino acids further provided information regarding their collective contributions to RNA recognition and to interaction between the RNP and other components of the 60S ribosomal subunit. PMID:8643400

  14. MRM2 and MRM3 are involved in biogenesis of the large subunit of the mitochondrial ribosome

    PubMed Central

    Rorbach, Joanna; Boesch, Pierre; Gammage, Payam A.; Nicholls, Thomas J. J.; Pearce, Sarah F.; Patel, Dipali; Hauser, Andreas; Perocchi, Fabiana; Minczuk, Michal

    2014-01-01

    Defects of the translation apparatus in human mitochondria are known to cause disease, yet details of how protein synthesis is regulated in this organelle remain to be unveiled. Ribosome production in all organisms studied thus far entails a complex, multistep pathway involving a number of auxiliary factors. This includes several RNA processing and modification steps required for correct rRNA maturation. Little is known about the maturation of human mitochondrial 16S rRNA and its role in biogenesis of the mitoribosome. Here we investigate two methyltransferases, MRM2 (also known as RRMJ2, encoded by FTSJ2) and MRM3 (also known as RMTL1, encoded by RNMTL1), that are responsible for modification of nucleotides of the 16S rRNA A-loop, an essential component of the peptidyl transferase center. Our studies show that inactivation of MRM2 or MRM3 in human cells by RNA interference results in respiratory incompetence as a consequence of diminished mitochondrial translation. Ineffective translation in MRM2- and MRM3-depleted cells results from aberrant assembly of the large subunit of the mitochondrial ribosome (mt-LSU). Our findings show that MRM2 and MRM3 are human mitochondrial methyltransferases involved in the modification of 16S rRNA and are important factors for the biogenesis and function of the large subunit of the mitochondrial ribosome. PMID:25009282

  15. Latch assembly

    DOEpatents

    Frederickson, J.R.; Harper, W.H.; Perez, R.

    1984-08-17

    A latch assembly for releasably securing an article in the form of a canister within a container housing. The assembly includes a cam pivotally mounted on the housing wall and biased into the housing interior. The cam is urged into a disabled position by the canister as it enters the housing and a latch release plate maintains the cam disabled when the canister is properly seated in the housing. Upon displacement of the release plate, the cam snaps into latching engagement against the canister for securing the same within the housing. 2 figs.

  16. Latch assembly

    SciTech Connect

    Frederickson, James R.; Harper, William H.; Perez, Raymond

    1986-01-01

    A latch assembly for releasably securing an article in the form of a canister within a container housing. The assembly includes a cam pivotally mounted on the housing wall and biased into the housing interior. The cam is urged into a disabled position by the canister as it enters the housing and a latch release plate maintains the cam disabled when the canister is properly seated in the housing. Upon displacement of the release plate, the cam snaps into latching engagement against the canister for securing the same within the housing.

  17. The immunogenic activity of ribosomal fractions derived from Brucella abortus.

    PubMed Central

    Corbel, M. J.

    1976-01-01

    The immunizing activity of ribosome preparations derived from Brucella abortus strain 19 cells was examined in guinea-pigs and mice. After subcutaneous injections of Br. abortus ribosomes in Freund's incomplete adjuvant, both mice and guinea-pigs developed immunity to challenge by virulent Br. abortus 544 organisms which was at least as effective as the protection conferred by live strain 19 vaccine. Both mice and guinea-pigs also developed agglutinating and complement-fixing antibodies and delayed hypersensitivity to Br. Abortus antigens. Conversely, ribosome preparations elicited delayed hypersensitivity reactions on intracutaneous injection into guinea-pigs chronically infected with Br. abortus or Br. melitensis. On injection into rabbits, Br. abortus ribosomes incorporated in incomplete adjuvant induced high titres of agglutinins, complement fxing antibodies and precipitins for Br. abortus antigens. On immunochemical examination, the ribosome preparations were not grossly contaminated with antigens derived from the cell surface. They were chemically complex, however, and in addition to RNA contained numerous protein components identified by disk electrophoresis. The nature of the components responsible for conferring protection against Br. abortus was not determined. Images Fig. 1 Fig. 2 Fig. 1 Fig. 2 Fig. 1 Fig. 2 Fig. 1 Fig. 2 PMID:812900

  18. Aminoglycoside activity observed on single pre-translocation ribosome complexes

    PubMed Central

    Feldman, Michael B; Terry, Daniel S; Altman, Roger B; Blanchard, Scott C

    2010-01-01

    Aminoglycoside-class antibiotics bind directly to ribosomal RNA, imparting pleiotropic effects on ribosome function. Despite in-depth structural investigations of aminoglycoside–RNA oligonucleotide and aminoglycoside-ribosome interactions, mechanisms explaining the unique ribosome inhibition profiles of chemically similar aminoglycosides remain elusive. Here, using single-molecule fluorescence resonance energy transfer (smFRET) methods, we show that high-affinity aminoglycoside binding to the conserved decoding site region of the functional pre-translocation ribosome complex specifically remodels the nature of intrinsic dynamic processes within the particle. The extents of these effects, which are distinct for each member of the aminoglycoside class, strongly correlate with their inhibition of EF-G–catalyzed translocation. Neomycin, a 4,5-linked amino-glycoside, binds with lower affinity to one or more secondary binding sites, mediating distinct structural and dynamic perturbations that further enhance translocation inhibition. These new insights help explain why closely related aminoglycosides elicit pleiotropic translation activities and demonstrate the potential utility of smFRET as a tool for dissecting the mechanisms of antibiotic action. PMID:19946275

  19. Amino acid incorporation by ribosomes and polyribosomes from wheat chloroplasts.

    PubMed

    Hadziyev, D; Zalik, S

    1970-01-01

    Sucrose-gradient and analytical ultracentrifugation showed that chloroplast polyribosomes from 4-day-old seedlings had mono-, di-, tri-, tetra- and traces of penta-ribosomes, in contrast with those from 7-day-old seedlings in which only the mono-, di- and traces of tri-ribosomes were present. Without Mg(2+) the polyribosomes dissociated into ribosomal subunits. The rate of l-[U-(14)C]phenylalanine incorporation was threefold greater for preparations from 4- than from 7-day-old seedlings. Incorporation by the latter was stimulated by polyuridylic acid. The rates of incorporation were similar whether the reaction mixture contained chloroplast or wheat-germ transfer RNA and amino acid synthetases purified on methylated albumin-on-kieselguhr and Sephadex G-75 columns respectively. The cofactor requirement was the same as for isolated intact chloroplasts. Osmotic rupture of chloroplasts with and without Triton X-100 revealed the presence of free and bound ribosomes. Free single ribosomes isolated by osmotic shrinkage or prepared by pancreatic ribonuclease digestion of chloroplast polyribosomes had negligible incorporation activity. This activity was increased by washing or by polyuridylic acid, but was still only a fraction of that given by polyribosomes. A comparison of incorporation activity of chloroplast polyribosomes with those from the surrounding cytoplasm showed the former to be 20 times more active. PMID:5411422

  20. Structures of the Ribosome in Intermediate States of Ratcheting

    SciTech Connect

    Zhang, Wen; Dunkle, Jack A.; Cate, Jamie H.D.

    2009-10-21

    Protein biosynthesis on the ribosome requires repeated cycles of ratcheting, which couples rotation of the two ribosomal subunits with respect to each other, and swiveling of the head domain of the small subunit. However, the molecular basis for how the two ribosomal subunits rearrange contacts with each other during ratcheting while remaining stably associated is not known. Here, we describe x-ray crystal structures of the intact Escherichia coli ribosome, either in the apo-form (3.5 angstrom resolution) or with one (4.0 angstrom resolution) or two (4.0 angstrom resolution) anticodon stem-loop tRNA mimics bound, that reveal intermediate states of intersubunit rotation. In the structures, the interface between the small and large ribosomal subunits rearranges in discrete steps along the ratcheting pathway. Positioning of the head domain of the small subunit is controlled by interactions with the large subunit and with the tRNA bound in the peptidyl-tRNA site. The intermediates observed here provide insight into how tRNAs move into the hybrid state of binding that precedes the final steps of mRNA and tRNA translocation.

  1. Ribosomal Dynamics: Intrinsic Instability of a Molecular Machine

    NASA Astrophysics Data System (ADS)

    Gao, Haixiao; Le Barron, Jamie; Frank, Joachim

    Ribosomes are molecular machines that translate genetic message into nascent peptides, through a complex dynamics interplay with mRNAs, tRNAs, and various protein factors. A prominent example of ribosomal dynamics is the rotation of small ribosomal subunit with respect to a large subunit, characterized as the "ratchet motion," which is triggered by the binding of several translation factors. Here, we analyze two kinds of ribosomal ratchet motions, induced by the binding of EF-G and RF3, respectively, as previously observed by cryo-electron microscopy. Using the flexible fitting technique (real-space refinement) and an RNA secondary structure display tool (coloRNA), we obtained quasi-atomic models of the ribosome in these ratchet-motion-related functional states and mapped the observed differences onto the highly conserved RNA secondary structure. Comparisons between two sets of ratchet motions revealed that, while the overall patterns of the RNA displacement are very similar, several local regions stand out in their differential behavior, including the highly conserved GAC (GTPase-associated-center) region. We postulate that these regions are important in modulating general ratchet motion and bestowing it with the dynamic characteristics required for the specific function.

  2. Cinnamomin: a multifunctional type II ribosome-inactivating protein.

    PubMed

    He, Wen-Jun; Liu, Wang-Yi

    2003-07-01

    Plant ribosome-inactivating proteins (RIPs) are a group of toxic proteins that can irreversibly inactivate ribosomes by specifically removing the conserved adenine base from the "Sarcin/Ricin domain" of the 28S RNA in ribosome. Cinnamomin is a novel type II RIP isolated in our laboratory from the mature seeds of camphor tree. Besides site-specific deadenylation of the A4324 in the Sarcin/Ricin domain of rat ribosome, this protein could also release the adenine base from DNA molecules at multiple sites and from AMP, ADP, dAMP and adenosine. Furthermore, cinnamomin displays cytotoxicity to carcinoma cells and insect larvae by modifying their ribosomal RNA. These functions possessed by cinnamomin shed a new light on the possible application of cinnamomin in the field of immunotoxin design and transgenic reagents. In this review, we introduce the major recent results on cinnamomin obtained in our laboratory, including purification of this protein, characterization of its enzymatic mechanism, structure and function, gene pattern, physiological role and its biological implications in cytotoxicity. PMID:12672471

  3. Assessing the translational landscape of myogenic differentiation by ribosome profiling

    PubMed Central

    de Klerk, Eleonora; Fokkema, Ivo F.A.C.; Thiadens, Klaske A.M.H.; Goeman, Jelle J.; Palmblad, Magnus; den Dunnen, Johan T.; von Lindern, Marieke; ‘t Hoen, Peter A.C.

    2015-01-01

    The formation of skeletal muscles is associated with drastic changes in protein requirements known to be safeguarded by tight control of gene transcription and mRNA processing. The contribution of regulation of mRNA translation during myogenesis has not been studied so far. We monitored translation during myogenic differentiation of C2C12 myoblasts, using a simplified protocol for ribosome footprint profiling. Comparison of ribosome footprints to total RNA showed that gene expression is mostly regulated at the transcriptional level. However, a subset of transcripts, enriched for mRNAs encoding for ribosomal proteins, was regulated at the level of translation. Enrichment was also found for specific pathways known to regulate muscle biology. We developed a dedicated pipeline to identify translation initiation sites (TISs) and discovered 5333 unannotated TISs, providing a catalog of upstream and alternative open reading frames used during myogenesis. We identified 298 transcripts with a significant switch in TIS usage during myogenesis, which was not explained by alternative promoter usage, as profiled by DeepCAGE. Also these transcripts were enriched for ribosomal protein genes. This study demonstrates that differential mRNA translation controls protein expression of specific subsets of genes during myogenesis. Experimental protocols, analytical workflows, tools and data are available through public repositories (http://lumc.github.io/ribosome-profiling-analysis-framework/). PMID:25873627

  4. Role of ribosomes in Semliki Forest virus nucleocapsid uncoating.

    PubMed Central

    Singh, I; Helenius, A

    1992-01-01

    The mechanism by which Semliki Forest virus nucleocapsids are uncoated was analyzed in living cells and in vitro. In BHK-21 cells, uncoating occurred with virtually complete efficiency within 1 to 2 min after the nucleocapsids entered the cytoplasm. It was inhibited by monensin, which blocks nucleocapsid penetration from endosomes. As previously shown for Sindbis virus (G. Wengler and G. Wengler, Virology 134:435-442, 1984), the capsid proteins from incoming nucleocapsids became associated with ribosomes. The ribosome-bound capsid proteins were distributed throughout the cytoplasm, while the viral RNA remained associated with vacuolar membranes. Using purified nucleocapsids and ribosomes in vitro, we established that ribosomes alone were sufficient for uncoating. Their role was to release the capsid proteins from nucleocapsids and irreversibly sequester them, in a process independent of energy and translation. The process was stoichiometric rather than catalytic, with a maximum of three to six capsid proteins bound to each ribosome. More than 80% of the capsid proteins could thus be removed from the viral RNA, resulting in the formation of nucleocapsid remnants whose sedimentation coefficients progressively decreased from 140S to 80S as uncoating proceeded. Images PMID:1433506

  5. ABC-F Proteins Mediate Antibiotic Resistance through Ribosomal Protection

    PubMed Central

    Sharkey, Liam K. R.; Edwards, Thomas A.

    2016-01-01

    ABSTRACT Members of the ABC-F subfamily of ATP-binding cassette proteins mediate resistance to a broad array of clinically important antibiotic classes that target the ribosome of Gram-positive pathogens. The mechanism by which these proteins act has been a subject of long-standing controversy, with two competing hypotheses each having gained considerable support: antibiotic efflux versus ribosomal protection. Here, we report on studies employing a combination of bacteriological and biochemical techniques to unravel the mechanism of resistance of these proteins, and provide several lines of evidence that together offer clear support to the ribosomal protection hypothesis. Of particular note, we show that addition of purified ABC-F proteins to an in vitro translation assay prompts dose-dependent rescue of translation, and demonstrate that such proteins are capable of displacing antibiotic from the ribosome in vitro. To our knowledge, these experiments constitute the first direct evidence that ABC-F proteins mediate antibiotic resistance through ribosomal protection. PMID:27006457

  6. Cyclic nucleotide-independent protein kinases from ribosomes and phosphorylation of a single 40S ribosomal subunit protein in zoospores of Blastocladiella emersonii.

    PubMed

    Bonato, M C; da Costa Maia, J C; Juliani, M H

    1983-06-01

    Cyclic nucleotide-independent protein kinase (EC 2.7.1.37) activity was found in the nuclear cap organelle, within which ribosomes of zoospores of Blastocladiella emersonii are sequestered. Two protein kinase activities were resolved from the high-salt wash fraction of zoospore ribosomes by selective adsorption to DEAE-cellulose. Both enzymes phosphorylated in vitro a 32,000 Mr protein of the 40S ribosomal subunit. Phosphorylation of this ribosomal protein, which exhibits electrophoretic properties similar to those of mammalian ribosomal protein S6, was also observed in vivo in 32P-labeled zoospores. PMID:6853450

  7. Ribosome. The complete structure of the 55S mammalian mitochondrial ribosome.

    PubMed

    Greber, Basil J; Bieri, Philipp; Leibundgut, Marc; Leitner, Alexander; Aebersold, Ruedi; Boehringer, Daniel; Ban, Nenad

    2015-04-17

    Mammalian mitochondrial ribosomes (mitoribosomes) synthesize mitochondrially encoded membrane proteins that are critical for mitochondrial function. Here we present the complete atomic structure of the porcine 55S mitoribosome at 3.8 angstrom resolution by cryo-electron microscopy and chemical cross-linking/mass spectrometry. The structure of the 28S subunit in the complex was resolved at 3.6 angstrom resolution by focused alignment, which allowed building of a detailed atomic structure including all of its 15 mitoribosomal-specific proteins. The structure reveals the intersubunit contacts in the 55S mitoribosome, the molecular architecture of the mitoribosomal messenger RNA (mRNA) binding channel and its interaction with transfer RNAs, and provides insight into the highly specialized mechanism of mRNA recruitment to the 28S subunit. Furthermore, the structure contributes to a mechanistic understanding of aminoglycoside ototoxicity. PMID:25837512

  8. Furnace assembly

    DOEpatents

    Panayotou, Nicholas F.; Green, Donald R.; Price, Larry S.

    1985-01-01

    A method of and apparatus for heating test specimens to desired elevated temperatures for irradiation by a high energy neutron source. A furnace assembly is provided for heating two separate groups of specimens to substantially different, elevated, isothermal temperatures in a high vacuum environment while positioning the two specimen groups symmetrically at equivalent neutron irradiating positions.

  9. Furnace assembly

    DOEpatents

    Panayotou, N.F.; Green, D.R.; Price, L.S.

    A method of and apparatus for heating test specimens to desired elevated temperatures for irradiation by a high energy neutron source. A furnace assembly is provided for heating two separate groups of specimens to substantially different, elevated, isothermal temperatures in a high vacuum environment while positioning the two specimen groups symmetrically at equivalent neutron irradiating positions.

  10. Stability of the inner structure constituting a 'kernel' in ribosomal cores probed by dielectric spectroscopy

    NASA Astrophysics Data System (ADS)

    Blasi, M.; Bonincontro, A.; Calandrini, V.; Onori, G.; Risuleo, G.

    2001-05-01

    In this communication we present an investigation on ribosomal cores, i.e. ribosomes deprived of a select group of ribosomal proteins by LiCl treatment. This study was conducted by dielectric spectroscopy technique. The aim was to elucidate the role of ribosomal proteins in the stabilization of a very stable structural nucleus previously observed within the ribosome. The results show that this structure withstands relatively high concentrations of LiCl and is demolished within a limited range of salt concentration. The data discussed here corroborate the idea that this structure constitutes the ribosomal kernel.

  11. Concerted removal of the Erb1–Ytm1 complex in ribosome biogenesis relies on an elaborate interface

    PubMed Central

    Thoms, Matthias; Ahmed, Yasar Luqman; Maddi, Karthik; Hurt, Ed; Sinning, Irmgard

    2016-01-01

    The complicated process of eukaryotic ribosome biogenesis involves about 200 assembly factors that transiently associate with the nascent pre-ribosome in a spatiotemporally ordered way. During the early steps of 60S subunit formation, several proteins, collectively called A3 cluster factors, participate in the removal of the internal transcribed spacer 1 (ITS1) from 27SA3 pre-rRNA. Among these factors is the conserved hetero-trimeric Nop7–Erb1–Ytm1 complex (or human Pes1–Bop1–Wdr12), which is removed from the evolving pre-60S particle by the AAA ATPase Rea1 to allow progression in the pathway. Here, we clarify how Ytm1 and Erb1 interact, which has implications for the release mechanism of both factors from the pre-ribosome. Biochemical studies show that Ytm1 and Erb1 bind each other via their ß-propeller domains. The crystal structure of the Erb1–Ytm1 heterodimer determined at 2.67Å resolution reveals an extended interaction surface between the propellers in a rarely observed binding mode. Structure-based mutations in the interface that impair the Erb1–Ytm1 interaction do not support growth, with specific defects in 60S subunit synthesis. Under these mutant conditions, it becomes clear that an intact Erb1–Ytm1 complex is required for 60S maturation and that loss of this stable interaction prevents ribosome production. PMID:26657628

  12. RNA structures regulating ribosomal protein biosynthesis in bacilli.

    PubMed

    Deiorio-Haggar, Kaila; Anthony, Jon; Meyer, Michelle M

    2013-07-01

    In Bacilli, there are three experimentally validated ribosomal-protein autogenous regulatory RNAs that are not shared with E. coli. Each of these RNAs forms a unique secondary structure that interacts with a ribosomal protein encoded by a downstream gene, namely S4, S15, and L20. Only one of these RNAs that interacts with L20 is currently found in the RNA Families Database. We created, or modified, existing structural alignments for these three RNAs and used them to perform homology searches. We have determined that each structure exhibits a narrow phylogenetic distribution, mostly relegated to the Firmicute class Bacilli. This work, in conjunction with other similar work, demonstrates that there are most likely many non-homologous RNA regulatory elements regulating ribosomal protein biosynthesis that still await discovery and characterization in other bacterial species. PMID:23611891

  13. Identification of Two Distinct Hybrid State Intermediates On the Ribosome

    PubMed Central

    Munro, James B.; Altman, Roger B.; O’Connor, Nathan; Blanchard, Scott C.

    2007-01-01

    SUMMARY High-spatial and –time resolution single-molecule fluorescence resonance energy transfer measurements have been used to probe the structural and kinetic parameters of transfer RNA (tRNA) movements within the aminoacyl (A) and peptidyl (P) sites of the ribosome. Our investigation of tRNA motions, quantified on wild-type, mutant, and L1-depleted ribosome complexes, reveals a dynamic exchange between three metastable tRNA configurations, one of which is a previously unidentified hybrid state in which only deacylated-tRNA adopts its hybrid (P/E) configuration. These new dynamic information suggests a framework in which the formation of intermediate states in the translocation process is achieved through global conformational rearrangements of the ribosome particle. PMID:17317624

  14. [Mechanism of tRNA translocation on the ribosome].

    PubMed

    Rodnina, M V; Semenkov, Iu P; Savelsbergh, A; Katunin, V I; Peske, F; Wilden, B; Wintermeyer, W

    2001-01-01

    During the translocation step of the elongation cycle of peptide synthesis two tRNAs together with the mRNA move synchronously and rapidly on the ribosome. Translocation is catalyzed by the elongation factor G (EF-G) and requires GTP hydrolysis. The fundamental biochemical features of the process were worked out in the 1970-80s, to a large part by A.S. Spirin and his colleagues. Recent results from pre-steady-state kinetic analysis and cryoelectron microscopy suggest that translocation is a multistep dynamic process that entails large-scale structural rearrangements of both ribosome and EF-G. Kinetic and thermodynamic data, together with the structural information on the conformational changes of the ribosome and of EF-G, provide a detailed mechanistic model of translocation and suggest a mechanism of translocation catalysis by EF-G. PMID:11524952

  15. RNA structures regulating ribosomal protein biosynthesis in bacilli

    PubMed Central

    Deiorio-Haggar, Kaila; Anthony, Jon; Meyer, Michelle M.

    2013-01-01

    In Bacilli, there are three experimentally validated ribosomal-protein autogenous regulatory RNAs that are not shared with E. coli. Each of these RNAs forms a unique secondary structure that interacts with a ribosomal protein encoded by a downstream gene, namely S4, S15, and L20. Only one of these RNAs that interacts with L20 is currently found in the RNA Families Database. We created, or modified, existing structural alignments for these three RNAs and used them to perform homology searches. We have determined that each structure exhibits a narrow phylogenetic distribution, mostly relegated to the Firmicute class Bacilli. This work, in conjunction with other similar work, demonstrates that there are most likely many non-homologous RNA regulatory elements regulating ribosomal protein biosynthesis that still await discovery and characterization in other bacterial species. PMID:23611891

  16. The bacterial translocon SecYEG opens upon ribosome binding.

    PubMed

    Knyazev, Denis G; Lents, Alexander; Krause, Eberhard; Ollinger, Nicole; Siligan, Christine; Papinski, Daniel; Winter, Lukas; Horner, Andreas; Pohl, Peter

    2013-06-21

    In co-translational translocation, the ribosome funnel and the channel of the protein translocation complex SecYEG are aligned. For the nascent chain to enter the channel immediately after synthesis, a yet unidentified signal triggers displacement of the SecYEG sealing plug from the pore. Here, we show that ribosome binding to the resting SecYEG channel triggers this conformational transition. The purified and reconstituted SecYEG channel opens to form a large ion-conducting channel, which has the conductivity of the plug deletion mutant. The number of ion-conducting channels inserted into the planar bilayer per fusion event roughly equals the number of SecYEG channels counted by fluorescence correlation spectroscopy in a single proteoliposome. Thus, the open probability of the channel must be close to unity. To prevent the otherwise lethal proton leak, a closed post-translational conformation of the SecYEG complex bound to a ribosome must exist. PMID:23645666

  17. A Ribosome Flow Model for Analyzing Translation Elongation

    NASA Astrophysics Data System (ADS)

    Reuveni, Shlomi; Meilijson, Isaac; Kupiec, Martin; Ruppin, Eytan; Tuller, Tamir

    We describe the first genome wide analysis of translation based on a model aimed at capturing the physical and dynamical aspects of this process. The Ribosomal Flow Model (RFM) is a computationally efficient approximation of the Totally Asymmetric Exclusion Process (TASEP) model (e.g. see [1]). The RFM is sensitive to the order of codons in the coding sequence, the tRNA pool of the organism, interactions between ribosomes and their size (see Figure [1]). The RFM predicts fundamental outcomes of the translation process, including translation rates, protein abundance and ribosomal densities [2] and the relation between all these variables, better than alternative ('non-physical') approaches (e.g. see [3,4]). In addition, we show that the RFM model can be used for accurate inference of initiation rates, the effect of codon order on protein abundance and the cost of translation. All these variables could not be inferred by previous predictors.

  18. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    PubMed

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-01

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. PMID:26490961

  19. Small protein domains fold inside the ribosome exit tunnel.

    PubMed

    Marino, Jacopo; von Heijne, Gunnar; Beckmann, Roland

    2016-03-01

    Cotranslational folding of small protein domains within the ribosome exit tunnel may be an important cellular strategy to avoid protein misfolding. However, the pathway of cotranslational folding has so far been described only for a few proteins, and therefore, it is unclear whether folding in the ribosome exit tunnel is a common feature for small protein domains. Here, we have analyzed nine small protein domains and determined at which point during translation their folding generates sufficient force on the nascent chain to release translational arrest by the SecM arrest peptide, both in vitro and in live E. coli cells. We find that all nine protein domains initiate folding while still located well within the ribosome exit tunnel. PMID:26879042

  20. Imprints of the genetic code in the ribosome

    PubMed Central

    Johnson, David B. F.; Wang, Lei

    2010-01-01

    The establishment of the genetic code remains elusive nearly five decades after the code was elucidated. The stereochemical hypothesis postulates that the code developed from interactions between nucleotides and amino acids, yet supporting evidence in a biological context is lacking. We show here that anticodons are selectively enriched near their respective amino acids in the ribosome, and that such enrichment is significantly correlated with the canonical code over random codes. Ribosomal anticodon-amino acid enrichment further reveals that specific codons were reassigned during code evolution, and that the code evolved through a two-stage transition from ancient amino acids without anticodon interaction to newer additions with anticodon interaction. The ribosome thus serves as a molecular fossil, preserving biological evidence that anticodon-amino acid interactions shaped the evolution of the genetic code. PMID:20385807

  1. Molecular profiling of activated neurons by phosphorylated ribosome capture.

    PubMed

    Knight, Zachary A; Tan, Keith; Birsoy, Kivanc; Schmidt, Sarah; Garrison, Jennifer L; Wysocki, Robert W; Emiliano, Ana; Ekstrand, Mats I; Friedman, Jeffrey M

    2012-11-21

    The mammalian brain is composed of thousands of interacting neural cell types. Systematic approaches to establish the molecular identity of functional populations of neurons would advance our understanding of neural mechanisms controlling behavior. Here, we show that ribosomal protein S6, a structural component of the ribosome, becomes phosphorylated in neurons activated by a wide range of stimuli. We show that these phosphorylated ribosomes can be captured from mouse brain homogenates, thereby enriching directly for the mRNAs expressed in discrete subpopulations of activated cells. We use this approach to identify neurons in the hypothalamus regulated by changes in salt balance or food availability. We show that galanin neurons are activated by fasting and that prodynorphin neurons restrain food intake during scheduled feeding. These studies identify elements of the neural circuit that controls food intake and illustrate how the activity-dependent capture of cell-type-specific transcripts can elucidate the functional organization of a complex tissue. PMID:23178128

  2. The Bacterial Translocon SecYEG Opens upon Ribosome Binding*

    PubMed Central

    Knyazev, Denis G.; Lents, Alexander; Krause, Eberhard; Ollinger, Nicole; Siligan, Christine; Papinski, Daniel; Winter, Lukas; Horner, Andreas; Pohl, Peter

    2013-01-01

    In co-translational translocation, the ribosome funnel and the channel of the protein translocation complex SecYEG are aligned. For the nascent chain to enter the channel immediately after synthesis, a yet unidentified signal triggers displacement of the SecYEG sealing plug from the pore. Here, we show that ribosome binding to the resting SecYEG channel triggers this conformational transition. The purified and reconstituted SecYEG channel opens to form a large ion-conducting channel, which has the conductivity of the plug deletion mutant. The number of ion-conducting channels inserted into the planar bilayer per fusion event roughly equals the number of SecYEG channels counted by fluorescence correlation spectroscopy in a single proteoliposome. Thus, the open probability of the channel must be close to unity. To prevent the otherwise lethal proton leak, a closed post-translational conformation of the SecYEG complex bound to a ribosome must exist. PMID:23645666

  3. 5SRNAdb: an information resource for 5S ribosomal RNAs

    PubMed Central

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A.; Karlowski, Wojciech M.

    2016-01-01

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA–protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. PMID:26490961

  4. Ribosomal RNAs in translation termination: facts and hypotheses.

    PubMed

    Arkov, A L; Murgola, E J

    1999-12-01

    It is now well established that ribosomal RNAs (rRNAs) play an active role in every aspect of translation. This review focuses on recent evidence for the involvement of rRNAs from both subunits of the ribosome in translation termination. This evidence comprises data obtained with rRNA mutants both in vivo and in vitro. In particular, mutations in specific regions of rRNAs caused readthrough of nonsense codons in vivo. Consistent with their in vivo characteristics, the mutations decreased the productive association of the ribosome with release factor 2 (RF2) and the efficiency of catalysis of peptidyl-tRNA hydrolysis in the presence of RF2 in realistic in vitro termination systems. It is now evident that genetic selections for termination-defective mutants in vivo and their characterization in realistic in vitro termination assays will rapidly advance our understanding of the mechanism of termination. PMID:10648958

  5. Time-resolved binding of azithromycin to Escherichia coli ribosomes.

    PubMed

    Petropoulos, Alexandros D; Kouvela, Ekaterini C; Starosta, Agata L; Wilson, Daniel N; Dinos, George P; Kalpaxis, Dimitrios L

    2009-01-30

    Azithromycin is a semisynthetic derivative of erythromycin that inhibits bacterial protein synthesis by binding within the peptide exit tunnel of the 50S ribosomal subunit. Nevertheless, there is still debate over what localization is primarily responsible for azithromycin binding and as to how many molecules of the drug actually bind per ribosome. In the present study, kinetic methods and footprinting analysis are coupled together to provide time-resolved details of the azithromycin binding process. It is shown that azithromycin binds to Escherichia coli ribosomes in a two-step process: The first-step involves recognition of azithromycin by the ribosomal machinery and places the drug in a low-affinity site located in the upper part of the exit tunnel. The second step corresponds to the slow formation of a final complex that is both much tighter and more potent in hindering the progression of the nascent peptide through the exit tunnel. Substitution of uracil by cytosine at nucleoside 2609 of 23S rRNA, a base implicated in the high-affinity site, facilitates the shift of azithromycin to this site. In contrast, mutation U754A hardly affects the binding process. Binding of azithromycin to both sites is hindered by high concentrations of Mg(2+) ions. Unlike Mg(2+) ions, polyamines do not significantly affect drug binding to the low-affinity site but attenuate the formation of the final complex. The low- and high-affinity sites of azithromycin binding are mutually exclusive, which means that one molecule of the drug binds per E. coli ribosome at a time. In contrast, kinetic and binding data indicate that in Deinococcus radiodurans, two molecules of azithromycin bind cooperatively to the ribosome. This finding confirms previous crystallographic results and supports the notion that species-specific structural differences may primarily account for the apparent discrepancies between the antibiotic binding modes obtained for different organisms. PMID:19071138

  6. Synthesis of Amplified DNA That Codes for Ribosomal RNA

    PubMed Central

    Crippa, Marco; Tocchini-Valentini, Glauco P.

    1971-01-01

    During the amplification stage in ovaries, the complete repetitive unit of the DNA that codes for ribosomal RNA in Xenopus appears to be transcribed. This large RNA transcript is found in a complex with DNA. Substitution experiments with 5-bromodeoxyuridine do not show any evidence that a complete amplified cistron is used as a template for further amplification. A derivative of rifampicin, 2′,5′-dimethyl-N(4′)benzyl-N(4′)[desmethyl] rifampicin, preferentially inhibits the DNA synthesis responsible for ribosomal gene amplification. These results are consistent with the hypothesis that RNA-dependent DNA synthesis is involved in gene amplification. PMID:5288254

  7. Ribosomal Translocation: One Step Closer to the Molecular Mechanism

    PubMed Central

    Shoji, Shinichiro; Walker, Sarah E.; Fredrick, Kurt

    2010-01-01

    Protein synthesis occurs in ribosomes, the targets of numerous antibiotics. How these large and complex machines read and move along mRNA have proven to be challenging questions. In this Review, we focus on translocation, the last step of the elongation cycle in which movement of tRNA and mRNA is catalyzed by elongation factor G. Translocation entails large-scale movements of the tRNAs and conformational changes in the ribosome that require numerous tertiary contacts to be disrupted and reformed. We highlight recent progress toward elucidating the molecular basis of translocation and how various antibiotics influence tRNA–mRNA movement. PMID:19173642

  8. Ribosome Dwell Times and the Protein Copy Number Distribution

    NASA Astrophysics Data System (ADS)

    Gorissen, Mieke; Vanderzande, Carlo

    2012-09-01

    Translation is the cellular process in which ribosomes make proteins from information encoded on messenger RNA (mRNA). We model translation with an exclusion process taking into account the experimentally determined, non-exponential, waiting time between steps of a ribosome. From numerical simulations using realistic parameter values, we determine the distribution P( E) of the number of proteins E produced by one mRNA. We find that for small E this distribution is not geometric. We present a simplified and analytically solvable model that relates P( E) to the distributions of the times to produce the first E proteins.

  9. Ribosomal crystallography: from crystal growth to initial phasing

    NASA Astrophysics Data System (ADS)

    Thygesen, J.; Krumbholz, S.; Levin, I.; Zaytzev-Bashan, A.; Harms, J.; Bartels, H.; Schlünzen, F.; Hansen, H. A. S.; Bennett, W. S.; Volkmann, N.; Agmon, I.; Eisenstein, M.; Dribin, A.; Maltz, E.; Sagi, I.; Morlang, S.; Fua, M.; Franceschi, F.; Weinstein, S.; Böddeker, N.; Sharon, R.; Anagnostopoulos, K.; Peretz, M.; Geva, M.; Berkovitch-Yellin, Z.; Yonath, A.

    1996-10-01

    Preliminary phases were determined by the application of the isomorphous replacement method at low and intermediate resolution for structure factor amplitudes collected from crystals of large and small ribosomal subunits from halophilic and thermophilic bacteria. Derivatization was performed with dense heavy atom clusters, either by soaking or by specific covalent binding prior to the crystallization. The resulting initial electron density maps contain features comparable in size to those expected for the corresponding particles. The packing arrangements of these maps have been compared with motifs observed by electron microscopy in positively stained thin sections of embedded three-dimensional crystals, as well as with phase sets obtained by ab-initio computations. Aimed at higher resolution phasing, procedures are being developed for multi-site binding of relatively small dense metal clusters at selected locations. Potential sites are being inserted either by mutagenesis or by chemical modifications to facilitate cluster binding to the large halophilic and the small thermophilic ribosomal subunits which yield crystals diffracting to the highest resolution obtained so far for ribosomes, 2.9 and 7.3 Å, respectively. For this purpose the surfaces of these ribosomal particles have been characterized and conditions for quantitative reversible detachment of selected ribosomal proteins have been found. The corresponding genes are being cloned, sequenced, mutated to introduce the reactive side-groups (mainly cysteines) and overexpressed. To assist the interpretation of the anticipated electron density maps, sub-ribosomal stable complexes were isolated from H50S. One of these complexes is composed of two proteins and the other is made of a stretch of the rRNA and a protein. For exploiting the exposed parts of the surface of these complexes for heavy atom binding and for attempting the determination of their three-dimensional structure, their components are being produced

  10. Eukaryotic ribosomes that lack a 5.8S RNA

    NASA Technical Reports Server (NTRS)

    Vossbrinck, C. R.; Woese, C. R.

    1986-01-01

    The 5.8S ribosomal RNA is believed to be a universal eukaryotic characteristic. It has no (size) counterpart among the prokaryotes, although its sequence is homologous with the first 150 or so nucleotides of the prokaryotic large subunit (23S) ribosomal RNA. An exception to this rule is reported here. The microsporidian Vairimorpha necatrix is a eukaryote that has no 5.8S rRNA. As in the prokaryotes, it has a single large subunit rRNA, whose 5-prime region corresponds to the 5.8S rRNA.

  11. Mycobacterial toxin MazF-mt6 inhibits translation through cleavage of 23S rRNA at the ribosomal A site.

    PubMed

    Schifano, Jason M; Edifor, Regina; Sharp, Jared D; Ouyang, Ming; Konkimalla, Arvind; Husson, Robert N; Woychik, Nancy A

    2013-05-21

    The Mycobacterium tuberculosis genome contains an unusually high number of toxin-antitoxin modules, some of which have been suggested to play a role in the establishment and maintenance of latent tuberculosis. Nine of these toxin-antitoxin loci belong to the mazEF family, encoding the intracellular toxin MazF and its antitoxin inhibitor MazE. Nearly every MazF ortholog recognizes a unique three- or five-base RNA sequence and cleaves mRNA. As a result, these toxins selectively target a subset of the transcriptome for degradation and are known as "mRNA interferases." Here we demonstrate that a MazF family member from M. tuberculosis, MazF-mt6, has an additional role--inhibiting translation through targeted cleavage of 23S rRNA in the evolutionarily conserved helix/loop 70. We first determined that MazF-mt6 cleaves mRNA at (5')UU↓CCU(3') sequences. We then discovered that MazF-mt6 also cleaves M. tuberculosis 23S rRNA at a single UUCCU in the ribosomal A site that contacts tRNA and ribosome recycling factor. To gain further mechanistic insight, we demonstrated that MazF-mt6-mediated cleavage of rRNA can inhibit protein synthesis in the absence of mRNA cleavage. Finally, consistent with the position of 23S rRNA cleavage, MazF-mt6 destabilized 50S-30S ribosomal subunit association. Collectively, these results show that MazF toxins do not universally act as mRNA interferases, because MazF-mt6 inhibits protein synthesis by cleaving 23S rRNA in the ribosome active center. PMID:23650345

  12. FRET Characterization of Complex Conformational Changes in a Large 16S Ribosomal RNA Fragment Site-Specifically Labeled Using Unnatural Base Pairs.

    PubMed

    Lavergne, Thomas; Lamichhane, Rajan; Malyshev, Denis A; Li, Zhengtao; Li, Lingjun; Sperling, Edit; Williamson, James R; Millar, David P; Romesberg, Floyd E

    2016-05-20

    Ribosome assembly has been studied intensively using Förster resonance energy transfer (FRET) with fluorophore-labeled fragments of RNA produced by chemical synthesis. However, these studies are limited by the size of the accessible RNA fragments. We have developed a replicable unnatural base pair (UBP) formed between (d)5SICS and (d)MMO2 or (d)NaM, which efficiently directs the transcription of RNA containing unnatural nucleotides. We now report the synthesis and evaluation of several of the corresponding ribotriphosphates bearing linkers that enable the chemoselective attachment of different functionalities. We found that the RNA polymerase from T7 bacteriophage does not incorporate NaM derivatives but does efficiently incorporate 5SICS(CO), whose linker enables functional group conjugation via Click chemistry, and when combined with the previously identified MMO2(A), whose amine side chains permits conjugation via NHS coupling chemistry, enables site-specific double labeling of transcribed RNA. To study ribosome assembly, we transcribed RNA corresponding to a 243-nt fragment of the central domain of Thermus thermophilus 16S rRNA containing 5SICS(CO) and MMO2(A) at defined locations and then site-specifically attached the fluorophores Cy3 and Cy5. FRET was characterized using single-molecule total internal reflection fluorescence (smTIRF) microscopy in the presence of various combinations of added ribosomal proteins. We demonstrate that each of the fragment's two three-helix junctions exist in open and closed states, with the latter favored by sequential protein binding. These results elucidate early and previously uncharacterized folding events underlying ribosome assembly and demonstrate the applicability of UBPs for biochemical, structural, and functional studies of RNAs. PMID:26942998

  13. Identification by affinity chromatography of the eukaryotic ribosomal proteins that bind to 5.8 S ribosomal ribonucleic acid.

    PubMed

    Ulbrich, N; Lin, A; Wool, I G

    1979-09-10

    The proteins that bind to rat liver 5.8 S ribosomal ribonucleic acid were identified by affinity chromatography. The nucleic acid was oxidized with periodate and coupled by its 3'-terminus to Sepharose 4B through and adipic acid dihydrazide spacer. The ribosomal proteins that associate with the immobilized 5.8 S rRNA were identified by polyacrylamide gel electrophoresiss: they were L19, L8, and L6 from the 60 S subunit; and S13 and S9 from the small subparticle. Small amounts of L14, L17', L18, L27/L27', and L35', and of S11, S15, S23/S24, and S26 also were bound to the affinity column, but whether they associate directly and specifically with 5.8 S rRNA is not known. Escherichia coli ribosomal proteins did not bind to the rat liver 5.8 S rRNA affinity column. PMID:468846

  14. Cartwheel assembly

    PubMed Central

    Hirono, Masafumi

    2014-01-01

    The cartwheel is a subcentriolar structure consisting of a central hub and nine radially arranged spokes, located at the proximal end of the centriole. It appears at the initial stage of the centriole assembly process as the first ninefold symmetrical structure. The cartwheel was first described more than 50 years ago, but it is only recently that its pivotal role in establishing the ninefold symmetry of the centriole was demonstrated. Significant progress has since been made in understanding its fine structure and assembly mechanism. Most importantly, the central part of the cartwheel, from which the ninefold symmetry originates, is shown to form by self-association of nine dimers of the protein SAS-6. This finding, together with emerging data on other components of the cartwheel, has opened new avenues in centrosome biology. PMID:25047612

  15. Mutation in mitochondrial ribosomal protein S7 (MRPS7) causes congenital sensorineural deafness, progressive hepatic and renal failure and lactic acidemia.

    PubMed

    Menezes, Minal J; Guo, Yiran; Zhang, Jianguo; Riley, Lisa G; Cooper, Sandra T; Thorburn, David R; Li, Jiankang; Dong, Daoyuan; Li, Zhijun; Glessner, Joseph; Davis, Ryan L; Sue, Carolyn M; Alexander, Stephen I; Arbuckle, Susan; Kirwan, Paul; Keating, Brendan J; Xu, Xun; Hakonarson, Hakon; Christodoulou, John

    2015-04-15

    Functional defects of the mitochondrial translation machinery, as a result of mutations in nuclear-encoded genes, have been associated with combined oxidative phosphorylation (OXPHOS) deficiencies. We report siblings with congenital sensorineural deafness and lactic acidemia in association with combined respiratory chain (RC) deficiencies of complexes I, III and IV observed in fibroblasts and liver. One of the siblings had a more severe phenotype showing progressive hepatic and renal failure. Whole-exome sequencing revealed a homozygous mutation in the gene encoding mitochondrial ribosomal protein S7 (MRPS7), a c.550A>G transition that encodes a substitution of valine for a highly conserved methionine (p.Met184Val) in both affected siblings. MRPS7 is a 12S ribosomal RNA-binding subunit of the small mitochondrial ribosomal subunit, and is required for the assembly of the small ribosomal subunit. Pulse labeling of mitochondrial protein synthesis products revealed impaired mitochondrial protein synthesis in patient fibroblasts. Exogenous expression of wild-type MRPS7 in patient fibroblasts rescued complexes I and IV activities, demonstrating the deleterious effect of the mutation on RC function. Moreover, reduced 12S rRNA transcript levels observed in the patient's fibroblasts were also restored to normal levels by exogenous expression of wild-type MRPS7. Our data demonstrate the pathogenicity of the identified MRPS7 mutation as a novel cause of mitochondrial RC dysfunction, congenital sensorineural deafness and progressive hepatic and renal failure. PMID:25556185

  16. gar2 is a nucleolar protein from Schizosaccharomyces pombe required for 18S rRNA and 40S ribosomal subunit accumulation.

    PubMed Central

    Gulli, M P; Girard, J P; Zabetakis, D; Lapeyre, B; Melese, T; Caizergues-Ferrer, M

    1995-01-01

    Several nucleolar proteins, such as nucleolin, NOP1/fibrillarin, SSB1, NSR1 and GAR1 share a common glycine and arginine rich structural motif called the GAR domain. To identify novel nucleolar proteins from fission yeast we screened Schizosaccharomyces pombe genomic DNA libraries with a probe encompassing the GAR structural motif. Here we report the identification and characterization of a S.pombe gene coding for a novel nucleolar protein, designated gar2. The structure of the fission yeast gar2 is reminiscent of that of nucleolin from vertebrates and NSR1 from Saccharomyces cerevisiae. In addition, like these proteins, gar2 has a nucleolar localisation. The disruption of the gar2+ gene affects normal cell growth, leads to an accumulation of 35S pre-rRNA and a decrease of mature 18S rRNA steady state levels. Moreover, ribosomal profiles of the mutant show an increase of free 60S ribosomal subunits and an absence of free 40S ribosomal subunits. gar2 is able to rescue a S.cerevisiae mutant lacking NSR1, thus establishing gar2 as a functional homolog of NSR1. We propose that gar2 helps the assembly of pre-ribosomal particles containing 18S rRNA. Images PMID:7596817

  17. Sensor assembly

    DOEpatents

    Bennett, Thomas E.; Nelson, Drew V.

    2004-04-13

    A ribbon-like sensor assembly is described wherein a length of an optical fiber embedded within a similar lengths of a prepreg tow. The fiber is ""sandwiched"" by two layers of the prepreg tow which are merged to form a single consolidated ribbon. The consolidated ribbon achieving a generally uniform distribution of composite filaments near the embedded fiber such that excess resin does not ""pool"" around the periphery of the embedded fiber.

  18. Modeling the Overproduction of Ribosomes when Antibacterial Drugs Act on Cells.

    PubMed

    Maitra, Arijit; Dill, Ken A

    2016-02-01

    Bacteria that are subjected to ribosome-inhibiting antibiotic drugs show an interesting behavior: Although the drug slows down cell growth, it also paradoxically increases the cell's concentration of ribosomes. We combine our earlier nonlinear model of the energy-biomass balance in undrugged Escherichia coli cells with Michaelis-Menten binding of drugs that inactivate ribosomes. Predictions are in good agreement with experiments on ribosomal concentrations and synthesis rates versus drug concentrations and growth rates. The model indicates that the added drug drives the cell to overproduce ribosomes, keeping roughly constant the level of ribosomes producing ribosomal proteins, an important quantity for cell growth. The model also predicts that ribosomal production rates should increase and then decrease with added drug. This model gives insights into the driving forces in cells and suggests new experiments. PMID:26840738

  19. Does Blood of Healthy Subjects Contain Bacterial Ribosomal DNA?

    PubMed Central

    Nikkari, Simo; McLaughlin, Ian J.; Bi, Wanli; Dodge, Deborah E.; Relman, David A.

    2001-01-01

    Real-time PCR methods with primers and a probe targeting conserved regions of the bacterial 16S ribosomal DNA (rDNA) revealed a larger amount of rDNA in blood specimens from healthy individuals than in matched reagent controls. However, the origins and identities of these blood-associated bacterial rDNA sequences remain obscure. PMID:11326021

  20. Exploring Internal Ribosome Entry Sites as Therapeutic Targets

    PubMed Central

    Komar, Anton A.; Hatzoglou, Maria

    2015-01-01

    Initiation of eukaryotic mRNA translation may proceed via several different routes, each requiring a different subset of factors and relying on different and specific interactions between the mRNA and the ribosome. Two modes predominate: (i) so-called cap-dependent initiation, which requires all canonical initiation factors and is responsible for about 95–97% of all initiation events in eukaryotic cells; and (ii) cap-independent internal initiation, which requires a reduced subset of initiation factors and accounts for up to 5% of the remaining initiation events. Internal initiation relies on the presence of so-called internal ribosome entry site (IRES) elements in the 5′ UTRs of some viral and cellular mRNAs. These elements (often possessing complex secondary and tertiary structures) promote efficient interaction of the mRNA with the 40S ribosome and allow for internal ribosome entry. Internal initiation of translation of specific mRNAs may contribute to development of severe disease and pathological states, such as hepatitis C and cancer. Therefore, this cellular mechanism represents an attractive target for pharmacological modulation. The purpose of this review is to provide insight into current strategies used to target viral and cellular IRESs and discuss the physiological consequences (and potential therapeutic implications) of abrogation/modulation of IRES-mediated translation. PMID:26539410