Sample records for a1555g 12s rrna

  1. The coexistence of mitochondrial ND6 T14484C and 12S rRNA A1555G mutations in a Chinese family with Leber's hereditary optic neuropathy and hearing loss

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wei Qiping; Zhou Xiangtian; Yang Li

    2007-06-15

    We report here the clinical, genetic and molecular characterization of one three-generation Han Chinese family with Leber's hereditary optic neuropathy (LHON) and hearing loss. Four of 14 matrilineal relatives exhibited the moderate central vision loss at the average age of 12.5 years. Of these, one subject exhibited both LHON and mild hearing impairment. Sequence analysis of the complete mitochondrial genomes in the pedigree showed the presence of homoplasmic LHON-associated ND6 T14484C mutation, deafness-associated 12S rRNA A1555 mutation and 47 other variants belonging to Eastern Asian haplogroup H2. None of other mitochondrial variants was evolutionarily conserved and functional significance. Therefore, themore » coexistence of the A1555G mutation and T14484C mutations in this Chinese family indicate that the A1555G mutation may play a synergistic role in the phenotypic manifestation of LHON associated ND6 T14484C mutation. However, the incomplete penetrance of vision and hearing loss suggests the involvement of nuclear modifier genes and environmental factors in the phenotypic expression of these mtDNA mutations.« less

  2. Prevalence of Mitochondrial 12S rRNA Mutations Associated with Aminoglycoside Ototoxicity

    ERIC Educational Resources Information Center

    Guan, Min-Xin

    2005-01-01

    The mitochondrial DNA (mtDNA) 12S rRNA is a hot spot for mutations associated with both aminoglycoside-induced and nonsyndromic hearing loss. Of those, the homoplasmic A1555G and C1494T mutations at a highly conserved decoding region of the 12S rRNA have been associated with hearing loss. These two mutations account for a significant number of…

  3. Co-occurrence of m.1555A>G and m.11778G>A mitochondrial DNA mutations in two Indian families with strikingly different clinical penetrance of Leber hereditary optic neuropathy

    PubMed Central

    Khan, Nahid Akhtar; Govindaraj, Periyasamy; Jyothi, Vuskamalla; Meena, Angamuthu K

    2013-01-01

    Background Mitochondrial DNA (mtDNA) mutations are known to cause Leber hereditary optic neuropathy (LHON). However, the co-occurrence of double pathogenic mutations with different pathological significance in pedigrees is a rare event. Methods Detailed clinical investigation and complete mtDNA sequencing analysis was performed for two Indian families with LHON. The haplogroup was constructed based on evolutionarily important mtDNA variants. Results We observed the existence of double pathogenic mutations (m.11778G>A and m.1555A>G) in two Indian LHON families, who are from different haplogroup backgrounds (M5a and U2e1), with different clinical penetrance of the disease (visual impairment). The m.11778G>A mutation in the MT-ND4 gene is associated primarily with LHON; whereas, m.1555A>G in the 12S rRNA gene has been reported with aminoglycoside-induced non-syndromic hearing loss. Conclusions The absence of hearing abnormality and widely varying clinical expression of LHON suggest additional nuclear modifier genes, environmental factors, and population heterogeneity might play an important role in the expression of visual impairment in these families. PMID:23805034

  4. [Analysis of mitochondrial 12S rRNA and tRNA(Ser(UCN)) genes in patients with nonsyndromic sensorineural hearing loss from various regions of Russia].

    PubMed

    Dzhemileva, L U; Posukh, O L; Tazetdinov, A M; Barashkov, N A; Zhuravskiĭ, S G; Ponidelko, S N; Markova, T G; Tadinova, V N; Fedorova, S A; Maksimova, N R; Khusnutdinova, E K

    2009-07-01

    Mitochondrial DNA (mtDNA) mutations play an important role in etiology of hereditary hearing loss. In various regions of the world, patients suffer from nonsyndromic sensorineural hearing loss initiated by aminoglycoside antibiotics. Mutations that had been shown as pathogenetically important for hearing function disturbance were identified in mitochondrial 12S rRNA and tRNA(Ser(UCN)) genes while pathogenic role of several DNA sequences requires additional studies. This work presents the results of studying the spectrum of mutations and polymorphic variations in mtDNA genes 12S rRNA and tRNA(Ser(UGN)) in 410 patients with nonsyndromal sensoneural hearing impairment/loss from the Volga Ural region, St Petersburg, Yakutia, and Altai and in 520 individuals with normal hearing, which represent several ethnic groups (Russians, Tatars, Bashkirs, Yakuts, Altaians) residing in the Russian Federation. Pathogenetically significant mutation A1555G (12S rRNA) was found in two families (from Yakutia and St Peresburg) with hearing loss, probably caused by treatment with aminoglucosides, and in the population sample of Yakuts with a frequency of 0.83%. Further research is needed to confirm the role in hearing impairment of mutations 961insC, 961insC(n), 961delTinsC(n), T961G, T1095C (12S rRNA) and G7444A, A7445C (tRNA(Ser(UGN revealed in the patients. In addition, in the patients and the population groups, polymorphic mt DNA variants were detected, which are characteristic also of other Eurasian populations both in spectrum and frequency.

  5. Nuclear modifier MTO2 modulates the aminoglycoside-sensitivity of mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae.

    PubMed

    He, Xiangyu; Zhu, Xiaoyu; Wang, Xuexiang; Wang, Wei; Dai, Yu; Yan, Qingfeng

    2013-01-01

    The phenotypic manifestations of mitochondrial DNA (mtDNA) mutations are modulated by mitochondrial DNA haplotypes, nuclear modifier genes and environmental factors. The yeast mitochondrial 15S rRNA C1477G (P(R) or P(R) 454) mutation corresponds to the human 12S rRNA C1494T and A1555G mutations, which are well known as primary factors for aminoglycoside-induced nonsyndromic deafness. Here we report that the deletion of the nuclear modifier gene MTO2 suppressed the aminoglycoside-sensitivity of mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae. First, the strain with a single mtDNA C1477G mutation exhibited hypersensitivity to neomycin. Functional assays indicated that the steady-state transcription level of mitochondrial DNA, the mitochondrial respiratory rate, and the membrane potential decreased significantly after neomycin treatment. The impaired mitochondria could not produce sufficient energy to maintain cell viability. Second, when the mto2 null and the mitochondrial C1477G mutations co-existed (mto2(P(R))), the oxygen consumption rate in the double mutant decreased markedly compared to that of the control strains (MTO2(P(S)), mto2(P(S)) and MTO2(P(R))). The expression levels of the key glycolytic genes HXK2, PFK1 and PYK1 in the mto2(P(R)) strain were stimulated by neomycin and up-regulated by 89%, 112% and 55%, respectively. The enhanced glycolysis compensated for the respiratory energy deficits, and could be inhibited by the glycolytic enzyme inhibitor. Our findings in yeast will provide a new insight into the pathogenesis of human deafness.

  6. Mitochondrial mutation m.1555A>G as a risk factor for failed newborn hearing screening in a large cohort of preterm infants.

    PubMed

    Göpel, Wolfgang; Berkowski, Sandra; Preuss, Michael; Ziegler, Andreas; Küster, Helmut; Felderhoff-Müser, Ursula; Gortner, Ludwig; Mögel, Michael; Härtel, Christoph; Herting, Egbert

    2014-08-26

    The mitochondrial m.1555A>G mutation is associated with a high rate of permanent hearing loss, if aminoglycosides are given. Preterm infants have an increased risk of permanent hearing loss and are frequently treated with aminoglycoside antibiotics. We genotyped preterm infants with a birth weight below 1500 grams who were prospectively enrolled in a large cohort study for the m.1555A>G mutation. Treatment with aminoglycoside antibiotics in combination with mitochondrial m.1555A>G mutation was tested as a predictor for failed hearing screening at discharge in a multivariate logistic regression analysis. 7056 infants were genotyped and analysed. Low birth weight was the most significant predictor of failed hearing screening (p = 7.3 × 10-10). 12 infants (0.2%) had the m.1555A>G-mutation. In a multivariable logistic regression analysis, the combination of aminoglycoside treatment with m.1555A>G-carrier status was associated with failed hearing screening (p = 0.0058). However, only 3 out of 10 preterm m.1555A>G-carriers who were exposed to aminoglycosides failed hearing screening. The m.1555A>G-mutation was detected in all mothers of m.1555A>G-positive children, but in none of 2993 maternal DNA-samples of m.1555A>G-negative infants. Antenatal screening for the m.1555A>G mutation by maternal genotyping of pregnant women with preterm labour might be a reasonable approach to identify infants who are at increased risk for permanent hearing loss. Additional studies are needed to estimate the relevance of cofactors like aminoglycoside plasma levels and birth weight and the amount of preterm m.1555A>G-carriers with permanent hearing loss.

  7. Mitochondrial mutation m.1555A>G as a risk factor for failed newborn hearing screening in a large cohort of preterm infants

    PubMed Central

    2014-01-01

    Background The mitochondrial m.1555A>G mutation is associated with a high rate of permanent hearing loss, if aminoglycosides are given. Preterm infants have an increased risk of permanent hearing loss and are frequently treated with aminoglycoside antibiotics. Methods We genotyped preterm infants with a birth weight below 1500 grams who were prospectively enrolled in a large cohort study for the m.1555A>G mutation. Treatment with aminoglycoside antibiotics in combination with mitochondrial m.1555A>G mutation was tested as a predictor for failed hearing screening at discharge in a multivariate logistic regression analysis. Results 7056 infants were genotyped and analysed. Low birth weight was the most significant predictor of failed hearing screening (p = 7.3 × 10-10). 12 infants (0.2%) had the m.1555A>G-mutation. In a multivariable logistic regression analysis, the combination of aminoglycoside treatment with m.1555A>G-carrier status was associated with failed hearing screening (p = 0.0058). However, only 3 out of 10 preterm m.1555A>G-carriers who were exposed to aminoglycosides failed hearing screening. The m.1555A>G-mutation was detected in all mothers of m.1555A>G-positive children, but in none of 2993 maternal DNA-samples of m.1555A>G-negative infants. Conclusion Antenatal screening for the m.1555A>G mutation by maternal genotyping of pregnant women with preterm labour might be a reasonable approach to identify infants who are at increased risk for permanent hearing loss. Additional studies are needed to estimate the relevance of cofactors like aminoglycoside plasma levels and birth weight and the amount of preterm m.1555A>G-carriers with permanent hearing loss. PMID:25155176

  8. Mechanistic study on the nuclear modifier gene MSS1 mutation suppressing neomycin sensitivity of the mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae.

    PubMed

    Zhou, Qiyin; Wang, Wei; He, Xiangyu; Zhu, Xiaoyu; Shen, Yaoyao; Yu, Zhe; Wang, Xuexiang; Qi, Xuchen; Zhang, Xuan; Fan, Mingjie; Dai, Yu; Yang, Shuxu; Yan, Qingfeng

    2014-01-01

    The phenotypic manifestation of mitochondrial DNA (mtDNA) mutations can be modulated by nuclear genes and environmental factors. However, neither the interaction among these factors nor their underlying mechanisms are well understood. The yeast Saccharomyces cerevisiae mtDNA 15S rRNA C1477G mutation (PR) corresponds to the human 12S rRNA A1555G mutation. Here we report that a nuclear modifier gene mss1 mutation suppresses the neomycin-sensitivity phenotype of a yeast C1477G mutant in fermentable YPD medium. Functional assays show that the mitochondrial function of the yeast C1477G mutant was impaired severely in YPD medium with neomycin. Moreover, the mss1 mutation led to a significant increase in the steady-state level of HAP5 (heme activated protein), which greatly up-regulated the expression of glycolytic transcription factors RAP1, GCR1, and GCR2 and thus stimulated glycolysis. Furthermore, the high expression of the key glycolytic enzyme genes HXK2, PFK1 and PYK1 indicated that enhanced glycolysis not only compensated for the ATP reduction from oxidative phosphorylation (OXPHOS) in mitochondria, but also ensured the growth of the mss1(PR) mutant in YPD medium with neomycin. This study advances our understanding of the phenotypic manifestation of mtDNA mutations.

  9. Molecular evolution of the mitochondrial 12S rRNA in Ungulata (mammalia).

    PubMed

    Douzery, E; Catzeflis, F M

    1995-11-01

    The complete 12S rRNA gene has been sequenced in 4 Ungulata (hoofed eutherians) and 1 marsupial and compared to 38 available mammalian sequences in order to investigate the molecular evolution of the mitochondrial small-subunit ribosomal RNA molecule. Ungulata were represented by one artiodactyl (the collared peccary, Tayassu tajacu, suborder Suiformes), two perissodactyls (the Grevy's zebra, Equus grevyi, suborder Hippomorpha; the white rhinoceros, Ceratotherium simum, suborder Ceratomorpha), and one hyracoid (the tree hyrax, Dendrohyrax dorsalis). The fifth species was a marsupial, the eastern gray kangaroo (Macropus giganteus). Several transition/transversion biases characterized the pattern of changes between mammalian 12S rRNA molecules. A bias toward transitions was found among 12S rRNA sequences of Ungulata, illustrating the general bias exhibited by ribosomal and protein-encoding genes of the mitochondrial genome. The derivation of a mammalian 12S rRNA secondary structure model from the comparison of 43 eutherian and marsupial sequences evidenced a pronounced bias against transversions in stems. Moreover, transversional compensatory changes were rare events within double-stranded regions of the ribosomal RNA. Evolutionary characteristics of the 12S rRNA were compared with those of the nuclear 18S and 28S rRNAs. From a phylogenetic point of view, transitions, transversions and indels in stems as well as transversional and indels events in loops gave congruent results for comparisons within orders. Some compensatory changes in double-stranded regions and some indels in single-stranded regions also constituted diagnostic events. The 12S rRNA molecule confirmed the monophyly of infraorder Pecora and order Cetacea and demonstrated the monophyly of the suborder Ruminantia was not supported and the branching pattern between Cetacea and the artiodacytyl suborders Ruminantia and Suiformes was not established. The monophyly of the order Perissodactyla was evidenced

  10. Growth properties associated with A-U replacement of specific G-C base pairs in 16S rRNA from Escherichia coli.

    PubMed Central

    Triman, K L

    1995-01-01

    Mutations that disrupt each of seven specific G-C base pairs in 16S rRNA from Escherichia coli confer loss of expression of a plasmid-encoded 16S rRNA selectable marker (spectinomycin resistance). However, A-U replacement of G-C base pairs at nucleotides 359/52 or 1292/1245 in 16S rRNA permits normal expression of the marker. By contrast, A-U replacements at 146/176, 153/168, 350/339, or 1293/1244 are associated with loss of expression of the marker. These genetic studies are designed to determine the importance of specific base pairs by assessment of the structural and functional impairments of 16S rRNA molecules resulting from expression of base pair substitutions at these positions. PMID:7543481

  11. Protein-RNA crosslinking in Escherichia coli 30S ribosomal subunits. Identification of a 16S rRNA fragment crosslinked to protein S12 by the use of the chemical crosslinking reagent 1-ethyl-3-dimethyl-aminopropylcarbodiimide.

    PubMed Central

    Chiaruttini, C; Expert-Bezançon, A; Hayes, D; Ehresmann, B

    1982-01-01

    1-ethyl-3-dimethyl aminopropylcarbodiimide (EDC) was used to cross-link 30S ribosomal proteins to 16S rRNA within the E. coli 3OS ribosomal subunit. Covalently linked complexes containing 30S proteins and 16S rRNA, isolated by sedimentation of dissociated crosslinked 30S subunits through SDS containing sucrose gradients, were digested with RNase T1, and the resulting oligonucleotide-protein complexes were fractionated on SDS containing polyacrylamide gels. Eluted complexes containing 30S proteins S9 and S12 linked to oligonucleotides were obtained in pure form. Oligonucleotide 5'terminal labelling was successful in the case of S12 containing but not of the S9 containing complex and led to identification of the S12 bound oligonucleotide as CAACUCG which is located at positions 1316-1322 in the 16S rRNA sequence. Protein S12 is crosslinked to the terminal G of this heptanucleotide. Images PMID:6760129

  12. Nuclear counterparts of the cytoplasmic mitochondrial 12S rRNA gene: a problem of ancient DNA and molecular phylogenies.

    PubMed

    van der Kuyl, A C; Kuiken, C L; Dekker, J T; Perizonius, W R; Goudsmit, J

    1995-06-01

    Monkey mummy bones and teeth originating from the North Saqqara Baboon Galleries (Egypt), soft tissue from a mummified baboon in a museum collection, and nineteenth/twentieth-century skin fragments from mangabeys were used for DNA extraction and PCR amplification of part of the mitochondrial 12S rRNA gene. Sequences aligning with the 12S rRNA gene were recovered but were only distantly related to contemporary monkey mitochondrial 12S rRNA sequences. However, many of these sequences were identical or closely related to human nuclear DNA sequences resembling mitochondrial 12S rRNA (isolated from a cell line depleted in mitochondria) and therefore have to be considered contamination. Subsequently in a separate study we were able to recover genuine mitochondrial 12S rRNA sequences from many extant species of nonhuman Old World primates and sequences closely resembling the human nuclear integrations. Analysis of all sequences by the neighbor-joining (NJ) method indicated that mitochondrial DNA sequences and their nuclear counterparts can be divided into two distinct clusters. One cluster contained all temporary cytoplasmic mitochondrial DNA sequences and approximately half of the monkey nuclear mitochondriallike sequences. A second cluster contained most human nuclear sequences and the other half of monkey nuclear sequences with a separate branch leading to human and gorilla mitochondrial and nuclear sequences. Sequences recovered from ancient materials were equally divided between the two clusters. These results constitute a warning for when working with ancient DNA or performing phylogenetic analysis using mitochondrial DNA as a target sequence: Nuclear counterparts of mitochondrial genes may lead to faulty interpretation of results.

  13. Heterozygous SSBP1 start loss mutation co-segregates with hearing loss and the m.1555A>G mtDNA variant in a large multigenerational family.

    PubMed

    Kullar, Peter J; Gomez-Duran, Aurora; Gammage, Payam A; Garone, Caterina; Minczuk, Michal; Golder, Zoe; Wilson, Janet; Montoya, Julio; Häkli, Sanna; Kärppä, Mikko; Horvath, Rita; Majamaa, Kari; Chinnery, Patrick F

    2018-01-01

    The m.1555A>G mtDNA variant causes maternally inherited deafness, but the reasons for the highly variable clinical penetrance are not known. Exome sequencing identified a heterozygous start loss mutation in SSBP1, encoding the single stranded binding protein 1 (SSBP1), segregating with hearing loss in a multi-generational family transmitting m.1555A>G, associated with mtDNA depletion and multiple deletions in skeletal muscle. The SSBP1 mutation reduced steady state SSBP1 levels leading to a perturbation of mtDNA metabolism, likely compounding the intra-mitochondrial translation defect due to m.1555A>G in a tissue-specific manner. This family demonstrates the importance of rare trans-acting genetic nuclear modifiers in the clinical expression of mtDNA disease. © The Author (2017). Published by Oxford University Press on behalf of the Guarantors of Brain.

  14. Methylation of 23S rRNA nucleotide G748 by RlmAII methyltransferase renders Streptococcus pneumoniae telithromycin susceptible.

    PubMed

    Takaya, Akiko; Sato, Yoshiharu; Shoji, Tatsuma; Yamamoto, Tomoko

    2013-08-01

    Several posttranscriptional modifications of bacterial rRNAs are important in determining antibiotic resistance or sensitivity. In all Gram-positive bacteria, dimethylation of nucleotide A2058, located in domain V of 23S rRNA, by the dimethyltransferase Erm(B) results in low susceptibility and resistance to telithromycin (TEL). However, this is insufficient to produce high-level resistance to TEL in Streptococcus pneumoniae. Inactivation of the methyltransferase RlmA(II), which methylates the N-1 position of nucleotide G748, located in hairpin 35 of domain II of 23S rRNA, results in increased resistance to TEL in erm(B)-carrying S. pneumoniae. Sixteen TEL-resistant mutants (MICs, 16 to 32 μg/ml) were obtained from a clinically isolated S. pneumoniae strain showing low TEL susceptibility (MIC, 2 μg/ml), with mutation resulting in constitutive dimethylation of A2058 because of nucleotide differences in the regulatory region of erm(B) mRNA. Primer extension analysis showed that the degree of methylation at G748 in all TEL-resistant mutants was significantly reduced by a mutation in the gene encoding RlmA(II) to create a stop codon or change an amino acid residue. Furthermore, RNA footprinting with dimethyl sulfate and a molecular modeling study suggested that methylation of G748 may contribute to the stable interaction of TEL with domain II of 23S rRNA, even after dimethylation of A2058 by Erm(B). This novel finding shows that methylation of G748 by RlmA(II) renders S. pneumoniae TEL susceptible.

  15. Methylation of 23S rRNA Nucleotide G748 by RlmAII Methyltransferase Renders Streptococcus pneumoniae Telithromycin Susceptible

    PubMed Central

    Sato, Yoshiharu; Shoji, Tatsuma; Yamamoto, Tomoko

    2013-01-01

    Several posttranscriptional modifications of bacterial rRNAs are important in determining antibiotic resistance or sensitivity. In all Gram-positive bacteria, dimethylation of nucleotide A2058, located in domain V of 23S rRNA, by the dimethyltransferase Erm(B) results in low susceptibility and resistance to telithromycin (TEL). However, this is insufficient to produce high-level resistance to TEL in Streptococcus pneumoniae. Inactivation of the methyltransferase RlmAII, which methylates the N-1 position of nucleotide G748, located in hairpin 35 of domain II of 23S rRNA, results in increased resistance to TEL in erm(B)-carrying S. pneumoniae. Sixteen TEL-resistant mutants (MICs, 16 to 32 μg/ml) were obtained from a clinically isolated S. pneumoniae strain showing low TEL susceptibility (MIC, 2 μg/ml), with mutation resulting in constitutive dimethylation of A2058 because of nucleotide differences in the regulatory region of erm(B) mRNA. Primer extension analysis showed that the degree of methylation at G748 in all TEL-resistant mutants was significantly reduced by a mutation in the gene encoding RlmAII to create a stop codon or change an amino acid residue. Furthermore, RNA footprinting with dimethyl sulfate and a molecular modeling study suggested that methylation of G748 may contribute to the stable interaction of TEL with domain II of 23S rRNA, even after dimethylation of A2058 by Erm(B). This novel finding shows that methylation of G748 by RlmAII renders S. pneumoniae TEL susceptible. PMID:23716046

  16. RlmCD-mediated U747 methylation promotes efficient G748 methylation by methyltransferase RlmAII in 23S rRNA in Streptococcus pneumoniae; interplay between two rRNA methylations responsible for telithromycin susceptibility

    PubMed Central

    Shoji, Tatsuma; Takaya, Akiko; Sato, Yoshiharu; Kimura, Satoshi; Suzuki, Tsutomu; Yamamoto, Tomoko

    2015-01-01

    Adenine at position 752 in a loop of helix 35 from positions 745 to 752 in domain II of 23S rRNA is involved in binding to the ribosome of telithromycin (TEL), a member of ketolides. Methylation of guanine at position 748 by the intrinsic methyltransferase RlmAII enhances binding of telithromycin (TEL) to A752 in Streptococcus pneumoniae. We have found that another intrinsic methylation of the adjacent uridine at position 747 enhances G748 methylation by RlmAII, rendering TEL susceptibility. U747 and another nucleotide, U1939, were methylated by the dual-specific methyltransferase RlmCD encoded by SP_1029 in S. pneumoniae. Inactivation of RlmCD reduced N1-methylated level of G748 by RlmAII in vivo, leading to TEL resistance when the nucleotide A2058, located in domain V of 23S rRNA, was dimethylated by the dimethyltransferase Erm(B). In vitro methylation of rRNA showed that RlmAII activity was significantly enhanced by RlmCD-mediated pre-methylation of 23S rRNA. These results suggest that RlmCD-mediated U747 methylation promotes efficient G748 methylation by RlmAII, thereby facilitating TEL binding to the ribosome. PMID:26365244

  17. RlmCD-mediated U747 methylation promotes efficient G748 methylation by methyltransferase RlmAII in 23S rRNA in Streptococcus pneumoniae; interplay between two rRNA methylations responsible for telithromycin susceptibility.

    PubMed

    Shoji, Tatsuma; Takaya, Akiko; Sato, Yoshiharu; Kimura, Satoshi; Suzuki, Tsutomu; Yamamoto, Tomoko

    2015-10-15

    Adenine at position 752 in a loop of helix 35 from positions 745 to 752 in domain II of 23S rRNA is involved in binding to the ribosome of telithromycin (TEL), a member of ketolides. Methylation of guanine at position 748 by the intrinsic methyltransferase RlmA(II) enhances binding of telithromycin (TEL) to A752 in Streptococcus pneumoniae. We have found that another intrinsic methylation of the adjacent uridine at position 747 enhances G748 methylation by RlmA(II), rendering TEL susceptibility. U747 and another nucleotide, U1939, were methylated by the dual-specific methyltransferase RlmCD encoded by SP_1029 in S. pneumoniae. Inactivation of RlmCD reduced N1-methylated level of G748 by RlmA(II) in vivo, leading to TEL resistance when the nucleotide A2058, located in domain V of 23S rRNA, was dimethylated by the dimethyltransferase Erm(B). In vitro methylation of rRNA showed that RlmA(II) activity was significantly enhanced by RlmCD-mediated pre-methylation of 23S rRNA. These results suggest that RlmCD-mediated U747 methylation promotes efficient G748 methylation by RlmA(II), thereby facilitating TEL binding to the ribosome. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Crystal structure of RlmAI: Implications for understanding the 23S rRNA G745/G748-methylation at the macrolide antibiotic-binding site

    PubMed Central

    Das, Kalyan; Acton, Thomas; Chiang, Yiwen; Shih, Lydia; Arnold, Eddy; Montelione, Gaetano T.

    2004-01-01

    The RlmA class of enzymes (RlmAI and RlmAII) catalyzes N1-methylation of a guanine base (G745 in Gram-negative and G748 in Gram-positive bacteria) of hairpin 35 of 23S rRNA. We have determined the crystal structure of Escherichia coli RlmAI at 2.8-Å resolution, providing 3D structure information for the RlmA class of RNA methyltransferases. The dimeric protein structure exhibits features that provide new insights into its molecular function. Each RlmAI molecule has a Zn-binding domain, responsible for specific recognition and binding of its rRNA substrate, and a methyltransferase domain. The asymmetric RlmAI dimer observed in the crystal structure has a well defined W-shaped RNA-binding cleft. Two S-adenosyl-l-methionine substrate molecules are located at the two valleys of the W-shaped RNA-binding cleft. The unique shape of the RNA-binding cleft, different from that of known RNA-binding proteins, is highly specific and structurally complements the 3D structure of hairpin 35 of bacterial 23S rRNA. Apart from the hairpin 35, parts of hairpins 33 and 34 also interact with the RlmAI dimer. PMID:14999102

  19. Punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori in Colombian populations

    PubMed Central

    Matta, Andrés Jenuer; Zambrano, Diana Carolina; Pazos, Alvaro Jairo

    2018-01-01

    AIM To characterize punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori (H. pylori) and determine their association with therapeutic failure. METHODS PCR products of 23S rRNA gene V domain of 74 H. pylori isolates; 34 resistant to clarithromycin (29 from a low-risk gastric cancer (GC) population: Tumaco-Colombia, and 5 from a high-risk population: Tuquerres-Colombia) and 40 from a susceptible population (28 from Tumaco and 12 from Túquerres) were sequenced using capillary electrophoresis. The concordance between mutations of V domain 23S rRNA gene of H. pylori and therapeutic failure was determined using the Kappa coefficient and McNemar’s test was performed to determine the relationship between H. pylori mutations and clarithromycin resistance. RESULTS 23S rRNA gene from H. pylori was amplified in 56/74 isolates, of which 25 were resistant to clarithromycin (20 from Tumaco and 5 from Túquerres, respectively). In 17 resistant isolates (13 from Tumaco and 4 from Túquerres) the following mutations were found: A1593T1, A1653G2, C1770T, C1954T1, and G1827C in isolates from Tumaco, and A2144G from Túquerres. The mutations T2183C, A2144G and C2196T in H. pylori isolates resistant to clarithromycin from Colombia are reported for the first time. No association between the H. pylori mutations and in vitro clarithromycin resistance was found. However, therapeutic failure of eradication treatment was associated with mutations of 23S rRNA gene in clarithromycin-resistant H. pylori (κ = 0.71). CONCLUSION The therapeutic failure of eradication treatment in the two populations from Colombia was associated with mutations of the 23S rRNA gene in clarithromycin-resistant H. pylori. PMID:29662291

  20. Punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori in Colombian populations.

    PubMed

    Matta, Andrés Jenuer; Zambrano, Diana Carolina; Pazos, Alvaro Jairo

    2018-04-14

    To characterize punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori ( H. pylori ) and determine their association with therapeutic failure. PCR products of 23S rRNA gene V domain of 74 H. pylori isolates; 34 resistant to clarithromycin (29 from a low-risk gastric cancer (GC) population: Tumaco-Colombia, and 5 from a high-risk population: Tuquerres-Colombia) and 40 from a susceptible population (28 from Tumaco and 12 from Túquerres) were sequenced using capillary electrophoresis. The concordance between mutations of V domain 23S rRNA gene of H. pylori and therapeutic failure was determined using the Kappa coefficient and McNemar's test was performed to determine the relationship between H. pylori mutations and clarithromycin resistance. 23S rRNA gene from H. pylori was amplified in 56/74 isolates, of which 25 were resistant to clarithromycin (20 from Tumaco and 5 from Túquerres, respectively). In 17 resistant isolates (13 from Tumaco and 4 from Túquerres) the following mutations were found: A1593T1, A1653G2, C1770T, C1954T1, and G1827C in isolates from Tumaco, and A2144G from Túquerres. The mutations T2183C, A2144G and C2196T in H. pylori isolates resistant to clarithromycin from Colombia are reported for the first time. No association between the H. pylori mutations and in vitro clarithromycin resistance was found. However, therapeutic failure of eradication treatment was associated with mutations of 23S rRNA gene in clarithromycin-resistant H. pylori ( κ = 0.71). The therapeutic failure of eradication treatment in the two populations from Colombia was associated with mutations of the 23S rRNA gene in clarithromycin-resistant H. pylori .

  1. Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

    NASA Astrophysics Data System (ADS)

    Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

    2018-01-01

    Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

  2. 21 CFR 184.1555 - Rapeseed oil.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Rapeseed oil. 184.1555 Section 184.1555 Food and....1555 Rapeseed oil. (a) Fully hydrogenated rapeseed oil. (1) Fully hydrogenated rapeseed oil is a... occurring in natural rapeseed oil. The rapeseed oil is obtained from the napus and campestris varieties of...

  3. 21 CFR 184.1555 - Rapeseed oil.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Rapeseed oil. 184.1555 Section 184.1555 Food and... Substances Affirmed as GRAS § 184.1555 Rapeseed oil. (a) Fully hydrogenated rapeseed oil. (1) Fully hydrogenated rapeseed oil is a mixture of triglycerides in which the fatty acid composition is a mixture of...

  4. 21 CFR 184.1555 - Rapeseed oil.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Rapeseed oil. 184.1555 Section 184.1555 Food and... Substances Affirmed as GRAS § 184.1555 Rapeseed oil. (a) Fully hydrogenated rapeseed oil. (1) Fully hydrogenated rapeseed oil is a mixture of triglycerides in which the fatty acid composition is a mixture of...

  5. 14 CFR 29.1555 - Control markings.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ....1555 Control markings. (a) Each cockpit control, other than primary flight controls or control whose... 14 Aeronautics and Space 1 2014-01-01 2014-01-01 false Control markings. 29.1555 Section 29.1555... fuel controls— (1) Each fuel tank selector valve control must be marked to indicate the position...

  6. 14 CFR 29.1555 - Control markings.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ....1555 Control markings. (a) Each cockpit control, other than primary flight controls or control whose... 14 Aeronautics and Space 1 2012-01-01 2012-01-01 false Control markings. 29.1555 Section 29.1555... fuel controls— (1) Each fuel tank selector valve control must be marked to indicate the position...

  7. 14 CFR 29.1555 - Control markings.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ....1555 Control markings. (a) Each cockpit control, other than primary flight controls or control whose... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Control markings. 29.1555 Section 29.1555... fuel controls— (1) Each fuel tank selector valve control must be marked to indicate the position...

  8. 14 CFR 29.1555 - Control markings.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ....1555 Control markings. (a) Each cockpit control, other than primary flight controls or control whose... 14 Aeronautics and Space 1 2011-01-01 2011-01-01 false Control markings. 29.1555 Section 29.1555... fuel controls— (1) Each fuel tank selector valve control must be marked to indicate the position...

  9. 14 CFR 29.1555 - Control markings.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ....1555 Control markings. (a) Each cockpit control, other than primary flight controls or control whose... 14 Aeronautics and Space 1 2013-01-01 2013-01-01 false Control markings. 29.1555 Section 29.1555... fuel controls— (1) Each fuel tank selector valve control must be marked to indicate the position...

  10. 14 CFR 23.1555 - Control markings.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... Markings and Placards § 23.1555 Control markings. (a) Each cockpit control, other than primary flight controls and simple push button type starter switches, must be plainly marked as to its function and method... 14 Aeronautics and Space 1 2014-01-01 2014-01-01 false Control markings. 23.1555 Section 23.1555...

  11. 14 CFR 23.1555 - Control markings.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... Markings and Placards § 23.1555 Control markings. (a) Each cockpit control, other than primary flight controls and simple push button type starter switches, must be plainly marked as to its function and method... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Control markings. 23.1555 Section 23.1555...

  12. 14 CFR 23.1555 - Control markings.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... Markings and Placards § 23.1555 Control markings. (a) Each cockpit control, other than primary flight controls and simple push button type starter switches, must be plainly marked as to its function and method... 14 Aeronautics and Space 1 2013-01-01 2013-01-01 false Control markings. 23.1555 Section 23.1555...

  13. 14 CFR 23.1555 - Control markings.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 14 Aeronautics and Space 1 2011-01-01 2011-01-01 false Control markings. 23.1555 Section 23.1555... Markings and Placards § 23.1555 Control markings. (a) Each cockpit control, other than primary flight controls and simple push button type starter switches, must be plainly marked as to its function and method...

  14. 14 CFR 25.1555 - Control markings.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ....1555 Control markings. (a) Each cockpit control, other than primary flight controls and controls whose... 14 Aeronautics and Space 1 2013-01-01 2013-01-01 false Control markings. 25.1555 Section 25.1555... aerodynamic control must be marked under the requirements of §§ 25.677 and 25.699. (c) For powerplant fuel...

  15. 14 CFR 25.1555 - Control markings.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ....1555 Control markings. (a) Each cockpit control, other than primary flight controls and controls whose... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Control markings. 25.1555 Section 25.1555... aerodynamic control must be marked under the requirements of §§ 25.677 and 25.699. (c) For powerplant fuel...

  16. 14 CFR 25.1555 - Control markings.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ....1555 Control markings. (a) Each cockpit control, other than primary flight controls and controls whose... 14 Aeronautics and Space 1 2014-01-01 2014-01-01 false Control markings. 25.1555 Section 25.1555... aerodynamic control must be marked under the requirements of §§ 25.677 and 25.699. (c) For powerplant fuel...

  17. 14 CFR 23.1555 - Control markings.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 14 Aeronautics and Space 1 2012-01-01 2012-01-01 false Control markings. 23.1555 Section 23.1555... Markings and Placards § 23.1555 Control markings. Link to an amendment published at 76 FR 75763, December 2, 2011. (a) Each cockpit control, other than primary flight controls and simple push button type starter...

  18. 14 CFR 25.1555 - Control markings.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 14 Aeronautics and Space 1 2011-01-01 2011-01-01 false Control markings. 25.1555 Section 25.1555....1555 Control markings. (a) Each cockpit control, other than primary flight controls and controls whose... aerodynamic control must be marked under the requirements of §§ 25.677 and 25.699. (c) For powerplant fuel...

  19. 14 CFR 25.1555 - Control markings.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 14 Aeronautics and Space 1 2012-01-01 2012-01-01 false Control markings. 25.1555 Section 25.1555....1555 Control markings. (a) Each cockpit control, other than primary flight controls and controls whose... aerodynamic control must be marked under the requirements of §§ 25.677 and 25.699. (c) For powerplant fuel...

  20. A novel RNase G mutant that is defective in degradation of adhE mRNA but proficient in the processing of 16S rRNA precursor.

    PubMed

    Wachi, M; Kaga, N; Umitsuki, G; Clark, D P; Nagai, K

    2001-12-21

    Escherichia coli RNase G, encoded by the rng gene, is involved in both the processing of 16S rRNA precursor and the degradation of adhE mRNA. Consequently, defects in RNase G result in elevation of AdhE levels. Furthermore, the adhR430 mutant strain, DC430, is reported to overproduce the AdhE protein in a manner dependent on the adhC81 mutation. We found that overproduction of AdhE by DC430 was reversed to wild-type levels by introduction of a plasmid carrying the wild-type allele of rng. Mapping by P1-phage-mediated transduction also indicated that a mutation involved in AdhE overproduction was located around the rng region in DC430. DNA sequencing of the rng region revealed that DC430 indeed had a mutation in the rng gene: a G1022 to A transition that caused substitution of Gly341 with Ser and which was named rng430. This lies in the highly conserved region of the RNase E/RNase G family, called high similarity region 2 (HSR2). However, very interestingly, rng430 mutant strains did not accumulate the 16.3S precursor of 16S rRNA unlike rng::cat mutants. We also found that the Rng1 mutant protein, which is truncated in its C-terminal domain encompassing HSR2, exhibited a residual processing activity against the 16S rRNA precursor, when overproduced. These results indicate that the HSR2 of RNase G plays an important role in substrate recognition and/or ribonucleolytic action.

  1. 21 CFR 186.1555 - Japan wax.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Japan wax. 186.1555 Section 186.1555 Food and Drugs... Substances Affirmed as GRAS § 186.1555 Japan wax. (a) Japan wax (CAS Reg. No. 8001-39-6), also known as Japan... fruits of the oriental sumac, Rhus succedanea (Japan, Taiwan, and Indo-China), R. vernicifera (Japan...

  2. 5S rRNA and ribosome.

    PubMed

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  3. Methyltransferase that modifies guanine 966 of the 16 S rRNA: functional identification and tertiary structure.

    PubMed

    Lesnyak, Dmitry V; Osipiuk, Jerzy; Skarina, Tatiana; Sergiev, Petr V; Bogdanov, Alexey A; Edwards, Aled; Savchenko, Alexei; Joachimiak, Andrzej; Dontsova, Olga A

    2007-02-23

    N(2)-Methylguanine 966 is located in the loop of Escherichia coli 16 S rRNA helix 31, forming a part of the P-site tRNA-binding pocket. We found yhhF to be a gene encoding for m(2)G966 specific 16 S rRNA methyltransferase. Disruption of the yhhF gene by kanamycin resistance marker leads to a loss of modification at G966. The modification could be rescued by expression of recombinant protein from the plasmid carrying the yhhF gene. Moreover, purified m(2)G966 methyltransferase, in the presence of S-adenosylomethionine (AdoMet), is able to methylate 30 S ribosomal subunits that were purified from yhhF knock-out strain in vitro. The methylation is specific for G966 base of the 16 S rRNA. The m(2)G966 methyltransferase was crystallized, and its structure has been determined and refined to 2.05A(.) The structure closely resembles RsmC rRNA methyltransferase, specific for m(2)G1207 of the 16 S rRNA. Structural comparisons and analysis of the enzyme active site suggest modes for binding AdoMet and rRNA to m(2)G966 methyltransferase. Based on the experimental data and current nomenclature the protein expressed from the yhhF gene was renamed to RsmD. A model for interaction of RsmD with ribosome has been proposed.

  4. Methyltransferase That Modifies Guanine 966 of the 16 S rRNA: FUNCTIONAL IDENTIFICATION AND TERTIARY STRUCTURE*

    PubMed Central

    Lesnyak, Dmitry V.; Osipiuk, Jerzy; Skarina, Tatiana; Sergiev, Petr V.; Bogdanov, Alexey A.; Edwards, Aled; Savchenko, Alexei; Joachimiak, Andrzej; Dontsova, Olga A.

    2010-01-01

    N2-Methylguanine 966 is located in the loop of Escherichia coli 16 S rRNA helix 31, forming a part of the P-site tRNA-binding pocket. We found yhhF to be a gene encoding for m2G966 specific 16 S rRNA methyltransferase. Disruption of the yhhF gene by kanamycin resistance marker leads to a loss of modification at G966. The modification could be rescued by expression of recombinant protein from the plasmid carrying the yhhF gene. Moreover, purified m2G966 methyltransferase, in the presence of S-adenosylomethionine (AdoMet), is able to methylate 30 S ribosomal subunits that were purified from yhhF knock-out strain in vitro. The methylation is specific for G966 base of the 16 S rRNA. The m2G966 methyltransferase was crystallized, and its structure has been determined and refined to 2.05 Å. The structure closely resembles RsmC rRNA methyltransferase, specific for m2G1207 of the 16 S rRNA. Structural comparisons and analysis of the enzyme active site suggest modes for binding AdoMet and rRNA to m2G966 methyltransferase. Based on the experimental data and current nomenclature the protein expressed from the yhhF gene was renamed to RsmD. A model for interaction of RsmD with ribosome has been proposed. PMID:17189261

  5. Expression stability of two housekeeping genes (18S rRNA and G3PDH) during in vitro maturation of follicular oocytes in buffalo (Bubalus bubalis).

    PubMed

    Aswal, Ajay Pal Singh; Raghav, Sarvesh; De, Sachinandan; Thakur, Manish; Goswami, Surender Lal; Datta, Tirtha Kumar

    2008-01-15

    The present study was undertaken to evaluate the expression stability of two housekeeping genes (HKGs), 18S rRNA and G3PDH during in vitro maturation (IVM) of oocytes in buffalo, which qualifies their use as internal controls for valid qRT-PCR estimation of other oocyte transcripts. A semi quantitative RT-PCR system was used with optimised qRT-PCR parameters at exponential PCR cycle for evaluation of temporal expression pattern of these genes over 24 h of IVM. 18S rRNA was found more stable in its expression pattern than G3PDH.

  6. 20 CFR 416.1555 - Withdrawing charges against a representative.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Withdrawing charges against a representative. 416.1555 Section 416.1555 Employees' Benefits SOCIAL SECURITY ADMINISTRATION SUPPLEMENTAL SECURITY... Commissioner, or his or her designee, regarding withdrawal of charges is solely that of the Deputy Commissioner...

  7. 7 CFR 51.1555 - Fairly well matured.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Fairly well matured. 51.1555 Section 51.1555 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards....1555 Fairly well matured. Fairly well matured means that the skins of the potatoes are generally fairly...

  8. 7 CFR 51.1555 - Fairly well matured.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Fairly well matured. 51.1555 Section 51.1555 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards....1555 Fairly well matured. Fairly well matured means that the skins of the potatoes are generally fairly...

  9. Lessons from an evolving rRNA: 16S and 23S rRNA structures from a comparative perspective

    NASA Technical Reports Server (NTRS)

    Gutell, R. R.; Larsen, N.; Woese, C. R.

    1994-01-01

    The 16S and 23S rRNA higher-order structures inferred from comparative analysis are now quite refined. The models presented here differ from their immediate predecessors only in minor detail. Thus, it is safe to assert that all of the standard secondary-structure elements in (prokaryotic) rRNAs have been identified, with approximately 90% of the individual base pairs in each molecule having independent comparative support, and that at least some of the tertiary interactions have been revealed. It is interesting to compare the rRNAs in this respect with tRNA, whose higher-order structure is known in detail from its crystal structure (36) (Table 2). It can be seen that rRNAs have as great a fraction of their sequence in established secondary-structure elements as does tRNA. However, the fact that the former show a much lower fraction of identified tertiary interactions and a greater fraction of unpaired nucleotides than the latter implies that many of the rRNA tertiary interactions remain to be located. (Alternatively, the ribosome might involve protein-rRNA rather than intramolecular rRNA interactions to stabilize three-dimensional structure.) Experimental studies on rRNA are consistent to a first approximation with the structures proposed here, confirming the basic assumption of comparative analysis, i.e., that bases whose compositions strictly covary are physically interacting. In the exhaustive study of Moazed et al. (45) on protection of the bases in the small-subunit rRNA against chemical modification, the vast majority of bases inferred to pair by covariation are found to be protected from chemical modification, both in isolated small-subunit rRNA and in the 30S subunit. The majority of the tertiary interactions are reflected in the chemical protection data as well (45). On the other hand, many of the bases not shown as paired in Fig. 1 are accessible to chemical attack (45). However, in this case a sizeable fraction of them are also protected against chemical

  10. 32 CFR 155.5 - Responsibilities.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 32 National Defense 1 2013-07-01 2013-07-01 false Responsibilities. 155.5 Section 155.5 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE SECURITY DEFENSE INDUSTRIAL PERSONNEL... as needed. (b) The General Counsel of the Department of Defense shall: (1) Establish guidance and...

  11. 32 CFR 155.5 - Responsibilities.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 32 National Defense 1 2010-07-01 2010-07-01 false Responsibilities. 155.5 Section 155.5 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE SECURITY DEFENSE INDUSTRIAL PERSONNEL... as needed. (b) The General Counsel of the Department of Defense shall: (1) Establish guidance and...

  12. 32 CFR 155.5 - Responsibilities.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 32 National Defense 1 2011-07-01 2011-07-01 false Responsibilities. 155.5 Section 155.5 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE SECURITY DEFENSE INDUSTRIAL PERSONNEL... as needed. (b) The General Counsel of the Department of Defense shall: (1) Establish guidance and...

  13. 32 CFR 155.5 - Responsibilities.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 32 National Defense 1 2012-07-01 2012-07-01 false Responsibilities. 155.5 Section 155.5 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE SECURITY DEFENSE INDUSTRIAL PERSONNEL... as needed. (b) The General Counsel of the Department of Defense shall: (1) Establish guidance and...

  14. 7 CFR 51.1555 - Fairly well matured.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Fairly well matured. 51.1555 Section 51.1555... STANDARDS) United States Standards for Grades of Potatoes 1 Definitions § 51.1555 Fairly well matured. Fairly well matured means that the skins of the potatoes are generally fairly firmly set and not more...

  15. 7 CFR 51.1555 - Fairly well matured.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Fairly well matured. 51.1555 Section 51.1555... STANDARDS) United States Standards for Grades of Potatoes 1 Definitions § 51.1555 Fairly well matured. Fairly well matured means that the skins of the potatoes are generally fairly firmly set and not more...

  16. Increased 5S rRNA oxidation in Alzheimer's disease.

    PubMed

    Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R

    2012-01-01

    It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.

  17. First Report of the 23S rRNA Gene A2058G Point Mutation Associated With Macrolide Resistance in Treponema pallidum From Syphilis Patients in Cuba.

    PubMed

    Noda, Angel A; Matos, Nelvis; Blanco, Orestes; Rodríguez, Islay; Stamm, Lola Virginia

    2016-05-01

    This study aimed to assess the presence of macrolide-resistant Treponema pallidum subtypes in Havana, Cuba. Samples from 41 syphilis patients were tested for T. pallidum 23S rRNA gene mutations. Twenty-five patients (61%) harbored T. pallidum with the A2058G mutation, which was present in all 8 subtypes that were identified. The A2059G mutation was not detected.

  18. Molecular phylogeny of mitochondrial cytochrome b and 12S rRNA sequences in the Felidae: ocelot and domestic cat lineages.

    PubMed

    Masuda, R; Lopez, J V; Slattery, J P; Yuhki, N; O'Brien, S J

    1996-12-01

    Molecular phylogeny of the cat family Felidae is derived using two mitochondrial genes, cytochrome b and 12S rRNA. Phylogenetic methods of weighted maximum parsimony and minimum evolution estimated by neighbor-joining are employed to reconstruct topologies among 20 extant felid species. Sequence analyses of 363 bp of cytochrome b and 376 bp of the 12S rRNA genes yielded average pair-wise similarity values between felids ranging from 94 to 99% and from 85 to 99%, respectively. Phylogenetic reconstruction supports more recent, intralineage associations but fails to completely resolve interlineage relationships. Both genes produce a monophyletic group of Felis species but vary in the placement of the pallas cat. The ocelot lineage represents an early divergence within the Felidae, with strong associations between ocelot and margay, Geoffroy's cat and kodkod, and pampas cat and tigrina. Implications of the relative recency of felid evolution, presence of ancestral polymorphisms, and influence of outgroups in placement of the topological root are discussed.

  19. 14 CFR 27.1555 - Control markings.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... Control markings. (a) Each cockpit control, other than primary flight controls or control whose function... 14 Aeronautics and Space 1 2011-01-01 2011-01-01 false Control markings. 27.1555 Section 27.1555... fuel controls— (1) Each fuel tank selector control must be marked to indicate the position...

  20. 14 CFR 27.1555 - Control markings.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... Control markings. (a) Each cockpit control, other than primary flight controls or control whose function... 14 Aeronautics and Space 1 2014-01-01 2014-01-01 false Control markings. 27.1555 Section 27.1555... fuel controls— (1) Each fuel tank selector control must be marked to indicate the position...

  1. 14 CFR 27.1555 - Control markings.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... Control markings. (a) Each cockpit control, other than primary flight controls or control whose function... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Control markings. 27.1555 Section 27.1555... fuel controls— (1) Each fuel tank selector control must be marked to indicate the position...

  2. 14 CFR 27.1555 - Control markings.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... Control markings. (a) Each cockpit control, other than primary flight controls or control whose function... 14 Aeronautics and Space 1 2013-01-01 2013-01-01 false Control markings. 27.1555 Section 27.1555... fuel controls— (1) Each fuel tank selector control must be marked to indicate the position...

  3. 14 CFR 27.1555 - Control markings.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 14 Aeronautics and Space 1 2012-01-01 2012-01-01 false Control markings. 27.1555 Section 27.1555... Control markings. (a) Each cockpit control, other than primary flight controls or control whose function... fuel controls— (1) Each fuel tank selector control must be marked to indicate the position...

  4. Isolation of temperature-sensitive mutants of 16 S rRNA in Escherichia coli.

    PubMed

    Triman, K; Becker, E; Dammel, C; Katz, J; Mori, H; Douthwaite, S; Yapijakis, C; Yoast, S; Noller, H F

    1989-10-20

    Temperature-sensitive mutants have been isolated following hydroxylamine mutagenesis of a plasmid containing Escherichia coli rRNA genes carrying selectable markers for spectinomycin resistance (U1192 in 16 S rRNA) and erythromycin resistance (G2058 in 23 S rRNA). These antibiotic resistance alleles, originally identified by Morgan and co-workers, enable us to follow expression of cloned rRNA genes in vivo. Recessive mutations causing the loss of expression of the cloned 16 S rRNA gene were identified by the loss of the ability of cells to survive on media containing spectinomycin. The mutations were localized by in vitro restriction fragment replacement followed by in vivo marker rescue and were identified by DNA sequence analysis. We report here seven single-base alterations in 16 S rRNA (A146, U153, A350, A359, A538, A1292 and U1293), five of which produce temperature-sensitive spectinomycin resistance and two that produce unconditional loss of resistance. In each case, loss of ribosomal function can be accounted for by disruption of base-pairing in the secondary structure of 16 S rRNA. For the temperature-sensitive mutants, there is a lag period of about two generations between a shift to the restrictive temperature and cessation of growth, implying that the structural defects cause impairment of ribosome assembly.

  5. 21 CFR 186.1555 - Japan wax.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... ingredient is used as a constituent of cotton and cotton fabrics used for dry food packaging. (2) The... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Japan wax. 186.1555 Section 186.1555 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) INDIRECT FOOD...

  6. 21 CFR 184.1555 - Rapeseed oil.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 3 2011-04-01 2011-04-01 false Rapeseed oil. 184.1555 Section 184.1555 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) DIRECT FOOD SUBSTANCES AFFIRMED AS GENERALLY RECOGNIZED AS SAFE Listing of Specific...

  7. The nucleotide sequence of the intergenic region between the 5.8S and 26S rRNA genes of the yeast ribosomal RNA operon. Possible implications for the interaction between 5.8S and 26S rRNA and the processing of the primary transcript.

    PubMed Central

    Veldman, G M; Klootwijk, J; van Heerikhuizen, H; Planta, R J

    1981-01-01

    We have determined the nucleotide sequence of part of a cloned yeast ribosomal RNA operon extending from the 5.8S RNA gene downstream into the 5' -terminal region of the 26S RNA gene. We mapped the pertinent processing sites, viz. the 5' end of 26S rRNA and the 3'ends of 5.8S rRNA and its immediate precursor, 7S RNA. At the 3' end of 7S RNA we find the sequence UCGUUU which is very similar to the type I consensus sequence UCAUUA/U present at the 3' ends of 17S, 5.8S and 26S rRNA as well as 18S precursor rRNA in yeast. At the 5' end of the 26S RNA gene we find a sequence of thirteen nucleotides which is homologous to the type II sequence present at the 5' termini of both the 17S and the 5.8S RNA gene. These findings further support the suggestion put forward earlier (G.M. Veldman et al. (1980) Nucl. Acids Res. 8, 2907-2920) that both consensus sequences are involved in the recognition of precursor rRNA by the processing nuclease(s). We discuss a model for the processing of yeast rRNA in which a processing enzyme sequentially recognizes several combinations of a type I and a type II consensus sequence. We also describe the existence of a significant base complementarity between sequences in the 5' -terminal region of 26S rRNA and the 3' -terminal region of 5.8S rRNA. We suggest that base pairing between these sequences contributes to the binding between 5.8S and 26S rRNA. Images PMID:7312619

  8. Detection and characterization of Pasteuria 16S rRNA gene sequences from nematodes and soils.

    PubMed

    Duan, Y P; Castro, H F; Hewlett, T E; White, J H; Ogram, A V

    2003-01-01

    Various bacterial species in the genus Pasteuria have great potential as biocontrol agents against plant-parasitic nematodes, although study of this important genus is hampered by the current inability to cultivate Pasteuria species outside their host. To aid in the study of this genus, an extensive 16S rRNA gene sequence phylogeny was constructed and this information was used to develop cultivation-independent methods for detection of Pasteuria in soils and nematodes. Thirty new clones of Pasteuria 16S rRNA genes were obtained directly from nematodes and soil samples. These were sequenced and used to construct an extensive phylogeny of this genus. These sequences were divided into two deeply branching clades within the low-G + C, Gram-positive division; some sequences appear to represent novel species within the genus Pasteuria. In addition, a surprising degree of 16S rRNA gene sequence diversity was observed within what had previously been designated a single strain of Pasteuria penetrans (P-20). PCR primers specific to Pasteuria 16S rRNA for detection of Pasteuria in soils were also designed and evaluated. Detection limits for soil DNA were 100-10,000 Pasteuria endospores (g soil)(-1).

  9. Cyanobacterial endobionts within a major marine planktonic calcifier (Globigerina bulloides, Foraminifera) revealed by 16S rRNA metabarcoding

    NASA Astrophysics Data System (ADS)

    Bird, Clare; Darling, Kate F.; Russell, Ann D.; Davis, Catherine V.; Fehrenbacher, Jennifer; Free, Andrew; Wyman, Michael; Ngwenya, Bryne T.

    2017-02-01

    We investigated the possibility of bacterial symbiosis in Globigerina bulloides, a palaeoceanographically important, planktonic foraminifer. This marine protist is commonly used in micropalaeontological investigations of climatically sensitive subpolar and temperate water masses as well as wind-driven upwelling regions of the world's oceans. G. bulloides is unusual because it lacks the protist algal symbionts that are often found in other spinose species. In addition, it has a large offset in its stable carbon and oxygen isotopic compositions compared to other planktonic foraminifer species, and also that predicted from seawater equilibrium. This is suggestive of novel differences in ecology and life history of G. bulloides, making it a good candidate for investigating the potential for bacterial symbiosis as a contributory factor influencing shell calcification. Such information is essential to evaluate fully the potential response of G. bulloides to ocean acidification and climate change. To investigate possible ecological interactions between G. bulloides and marine bacteria, 18S rRNA gene sequencing, fluorescence microscopy, 16S rRNA gene metabarcoding and transmission electron microscopy (TEM) were performed on individual specimens of G. bulloides (type IId) collected from two locations in the California Current. Intracellular DNA extracted from five G. bulloides specimens was subjected to 16S rRNA gene metabarcoding and, remarkably, 37-87 % of all 16S rRNA gene sequences recovered were assigned to operational taxonomic units (OTUs) from the picocyanobacterium Synechococcus. This finding was supported by TEM observations of intact Synechococcus cells in both the cytoplasm and vacuoles of G. bulloides. Their concentrations were up to 4 orders of magnitude greater inside the foraminifera than those reported for the California Current water column and approximately 5 % of the intracellular Synechococcus cells observed were undergoing cell division. This suggests

  10. 21 CFR 862.1555 - Phenylalanine test system.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... measure free phenylalanine (an amino acid) in serum, plasma, and urine. Measurements of phenylalanine are... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Phenylalanine test system. 862.1555 Section 862.1555 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED...

  11. 21 CFR 862.1555 - Phenylalanine test system.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... measure free phenylalanine (an amino acid) in serum, plasma, and urine. Measurements of phenylalanine are... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Phenylalanine test system. 862.1555 Section 862.1555 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED...

  12. 21 CFR 862.1555 - Phenylalanine test system.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Phenylalanine test system. 862.1555 Section 862.1555 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems § 862...

  13. Leuconostoc pseudomesenteroides WCFur3 partial 16S rRNA gene

    USDA-ARS?s Scientific Manuscript database

    This study used a partial 535 base pair 16S rRNA gene sequence to identify a bacterial isolate. Fatty acid profiles are consistent with the 16S rRNA gene sequence identification of this bacterium. The isolate was obtained from a compost bin in Fort Collins, Colorado, USA. The 16S rRNA gene sequen...

  14. Analysis of the function of E. coli 23S rRNA helix-loop 69 by mutagenesis

    PubMed Central

    Liiv, Aivar; Karitkina, Diana; Maiväli, Ülo; Remme, Jaanus

    2005-01-01

    Background The ribosome is a two-subunit enzyme known to exhibit structural dynamism during protein synthesis. The intersubunit bridges have been proposed to play important roles in decoding, translocation, and the peptidyl transferase reaction; yet the physical nature of their contributions is ill understood. An intriguing intersubunit bridge, B2a, which contains 23S rRNA helix 69 as a major component, has been implicated by proximity in a number of catalytically important regions. In addition to contacting the small ribosomal subunit, helix 69 contacts both the A and P site tRNAs and several translation factors. Results We scanned the loop of helix 69 by mutagenesis and analyzed the mutant ribosomes using a plasmid-borne IPTG-inducible expression system. We assayed the effects of 23S rRNA mutations on cell growth, contribution of mutant ribosomes to cellular polysome pools and the ability of mutant ribosomes to function in cell-free translation. Mutations A1912G, and A1919G have very strong growth phenotypes, are inactive during in vitro protein synthesis, and under-represented in the polysomes. Mutation Ψ1917C has a very strong growth phenotype and leads to a general depletion of the cellular polysome pool. Mutation A1916G, having a modest growth phenotype, is apparently defective in the assembly of the 70S ribosome. Conclusion Mutations A1912G, A1919G, and Ψ1917C of 23S rRNA strongly inhibit translation. Mutation A1916G causes a defect in the 50S subunit or 70S formation. Mutations Ψ1911C, A1913G, C1914A, Ψ1915C, and A1918G lack clear phenotypes. PMID:16053518

  15. A critical role for noncoding 5S rRNA in regulating Mdmx stability.

    PubMed

    Li, Muyang; Gu, Wei

    2011-09-16

    Both p53 and Mdmx are ubiquitinated and degraded by the same E3 ligase Mdm2; interestingly, however, while p53 is rapidly degraded by Mdm2, Mdmx is a stable protein in most cancer cells. Thus, the mechanism by which Mdmx is degraded by Mdm2 needs further elucidation. Here, we identified the noncoding 5S rRNA as a major component of Mdmx-associated complexes from human cells. We show that 5S rRNA acts as a natural inhibitor of Mdmx degradation by Mdm2. RNAi-mediated knockdown of endogenous 5S rRNA, while not affecting p53 levels, significantly induces Mdmx degradation and, subsequently, activates p53-dependent growth arrest. Notably, 5S rRNA binds the RING domain of Mdmx and blocks its ubiquitination by Mdm2, whereas Mdm2-mediated p53 ubiquitination remains intact. These results provide insights into the differential effects on p53 and Mdmx by Mdm2 in vivo and reveal a critical role for noncoding 5S rRNA in modulating the p53-Mdmx axis. Copyright © 2011 Elsevier Inc. All rights reserved.

  16. Characteristics of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) rRNA genes of Apis mellifera (Insecta: Hymenoptera): structure, organization, and retrotransposable elements

    PubMed Central

    Gillespie, J J; Johnston, J S; Cannone, J J; Gutell, R R

    2006-01-01

    As an accompanying manuscript to the release of the honey bee genome, we report the entire sequence of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) ribosomal RNA (rRNA)-encoding gene sequences (rDNA) and related internally and externally transcribed spacer regions of Apis mellifera (Insecta: Hymenoptera: Apocrita). Additionally, we predict secondary structures for the mature rRNA molecules based on comparative sequence analyses with other arthropod taxa and reference to recently published crystal structures of the ribosome. In general, the structures of honey bee rRNAs are in agreement with previously predicted rRNA models from other arthropods in core regions of the rRNA, with little additional expansion in non-conserved regions. Our multiple sequence alignments are made available on several public databases and provide a preliminary establishment of a global structural model of all rRNAs from the insects. Additionally, we provide conserved stretches of sequences flanking the rDNA cistrons that comprise the externally transcribed spacer regions (ETS) and part of the intergenic spacer region (IGS), including several repetitive motifs. Finally, we report the occurrence of retrotransposition in the nuclear large subunit rDNA, as R2 elements are present in the usual insertion points found in other arthropods. Interestingly, functional R1 elements usually present in the genomes of insects were not detected in the honey bee rRNA genes. The reverse transcriptase products of the R2 elements are deduced from their putative open reading frames and structurally aligned with those from another hymenopteran insect, the jewel wasp Nasonia (Pteromalidae). Stretches of conserved amino acids shared between Apis and Nasonia are illustrated and serve as potential sites for primer design, as target amplicons within these R2 elements may serve as novel phylogenetic markers for Hymenoptera. Given the impending completion of the sequencing of the Nasonia genome

  17. Characterization of 16S rRNA Processing with Pre-30S Subunit Assembly Intermediates from E. coli.

    PubMed

    Smith, Brian A; Gupta, Neha; Denny, Kevin; Culver, Gloria M

    2018-06-08

    Ribosomal RNA (rRNA) is a major component of ribosomes and is fundamental to the process of translation. In bacteria, 16S rRNA is a component of the small ribosomal subunit and plays a critical role in mRNA decoding. rRNA maturation entails the removal of intervening spacer sequences contained within the pre-rRNA transcript by nucleolytic enzymes. Enzymatic activities involved in maturation of the 5'-end of 16S rRNA have been identified, but those involved in 3'-end maturation of 16S rRNA are more enigmatic. Here, we investigate molecular details of 16S rRNA maturation using purified in vivo-formed small subunit (SSU) assembly intermediates (pre-SSUs) from wild-type Escherichia coli that contain precursor 16S rRNA (17S rRNA). Upon incubation of pre-SSUs with E. coli S100 cell extracts or purified enzymes implicated in 16S rRNA processing, the 17S rRNA is processed into additional intermediates and mature 16S rRNA. These results illustrate that exonucleases RNase R, RNase II, PNPase, and RNase PH can process the 3'-end of pre-SSUs in vitro. However, the endonuclease YbeY did not exhibit nucleolytic activity with pre-SSUs under these conditions. Furthermore, these data demonstrate that multiple pathways facilitate 16S rRNA maturation with pre-SSUs in vitro, with the dominant pathways entailing complete processing of the 5'-end of 17S rRNA prior to 3'-end maturation or partial processing of the 5'-end with concomitant processing of the 3'-end. These results reveal the multifaceted nature of SSU biogenesis and suggest that E. coli may be able to escape inactivation of any one enzyme by using an existing complementary pathway. Copyright © 2018 Elsevier Ltd. All rights reserved.

  18. Specific recognition of rpsO mRNA and 16S rRNA by Escherichia coli ribosomal protein S15 relies on both mimicry and site differentiation.

    PubMed

    Mathy, Nathalie; Pellegrini, Olivier; Serganov, Alexander; Patel, Dinshaw J; Ehresmann, Chantal; Portier, Claude

    2004-05-01

    The ribosomal protein S15 binds to 16S rRNA, during ribosome assembly, and to its own mRNA (rpsO mRNA), affecting autocontrol of its expression. In both cases, the RNA binding site is bipartite with a common subsite consisting of a G*U/G-C motif. The second subsite is located in a three-way junction in 16S rRNA and in the distal part of a stem forming a pseudoknot in Escherichia coli rpsO mRNA. To determine the extent of mimicry between these two RNA targets, we determined which amino acids interact with rpsO mRNA. A plasmid carrying rpsO (the S15 gene) was mutagenized and introduced into a strain lacking S15 and harbouring an rpsO-lacZ translational fusion. Analysis of deregulated mutants shows that each subsite of rpsO mRNA is recognized by a set of amino acids known to interact with 16S rRNA. In addition to the G*U/G-C motif, which is recognized by the same amino acids in both targets, the other subsite interacts with amino acids also involved in contacts with helix H22 of 16S rRNA, in the region adjacent to the three-way junction. However, specific S15-rpsO mRNA interactions can also be found, probably with A(-46) in loop L1 of the pseudoknot, demonstrating that mimicry between the two targets is limited.

  19. Insights into the phylogenetic positions of photosynthetic bacteria obtained from 5S rRNA and 16S rRNA sequence data

    NASA Technical Reports Server (NTRS)

    Fox, G. E.

    1985-01-01

    Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.

  20. Eukaryotic 5S rRNA biogenesis

    PubMed Central

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041

  1. Pre-45s rRNA promotes colon cancer and is associated with poor survival of CRC patients.

    PubMed

    Tsoi, H; Lam, K C; Dong, Y; Zhang, X; Lee, C K; Zhang, J; Ng, S C; Ng, S S M; Zheng, S; Chen, Y; Fang, J; Yu, J

    2017-11-02

    One characteristic of cancer cells is the abnormally high rate of cell metabolism to sustain their enhanced proliferation. However, the behind mechanism of this phenomenon is still elusive. Here we find that enhanced precursor 45s ribosomal RNA (pre-45s rRNA) is one of the core mechanisms in promoting the pathogenesis of colorectal cancer (CRC). Pre-45s rRNA expression is significantly higher in primary CRC tumor tissues samples and cancer cell lines compared with the non-tumorous colon tissues, and is associated with tumor sizes. Knockdown of pre-45s rRNA inhibits G1/S cell-cycle transition by stabilizing p53 through inducing murine double minute 2 (MDM2) and ribosomal protein L11 (RpL11) interaction. In addition, we revealed that high rate of cancer cell metabolism triggers the passive release of calcium ion from endoplasmic reticulum to the cytoplasm. The elevated calcium ion in the cytoplasm activates the signaling cascade of calcium/calmodulin-dependent protein kinase II, ribosomal S6 kinase (S6K) and ribosomal S6K (CaMKII-S6K-UBF). The activated UBF promotes the transcription of rDNA, which therefore increases pre-45s rRNA. Disruption of CaMKII-S6K-UBF axis by either RNAi or pharmaceutical approaches leads to reduction of pre-45s rRNA expression, which subsequently suppresses cell proliferation in colon cancer cells by causing cell-cycle arrest. Knockdown of APC activates CaMKII-S6K-UBF cascade and thus enhances pre-45s rRNA expression. Moreover, the high expression level of pre-45s rRNA is associated with poor survival of CRC patients in two independent cohorts. Our study identifies a novel mechanism in CRC pathogenesis mediated by pre-45s rRNA and a prognostic factor of pre-45s rRNA in CRC patients.

  2. An intergenic non-coding rRNA correlated with expression of the rRNA and frequency of an rRNA single nucleotide polymorphism in lung cancer cells.

    PubMed

    Shiao, Yih-Horng; Lupascu, Sorin T; Gu, Yuhan D; Kasprzak, Wojciech; Hwang, Christopher J; Fields, Janet R; Leighty, Robert M; Quiñones, Octavio; Shapiro, Bruce A; Alvord, W Gregory; Anderson, Lucy M

    2009-10-19

    Ribosomal RNA (rRNA) is a central regulator of cell growth and may control cancer development. A cis noncoding rRNA (nc-rRNA) upstream from the 45S rRNA transcription start site has recently been implicated in control of rRNA transcription in mouse fibroblasts. We investigated whether a similar nc-rRNA might be expressed in human cancer epithelial cells, and related to any genomic characteristics. Using quantitative rRNA measurement, we demonstrated that a nc-rRNA is transcribed in human lung epithelial and lung cancer cells, starting from approximately -1000 nucleotides upstream of the rRNA transcription start site (+1) and extending at least to +203. This nc-rRNA was significantly more abundant in the majority of lung cancer cell lines, relative to a nontransformed lung epithelial cell line. Its abundance correlated negatively with total 45S rRNA in 12 of 13 cell lines (P = 0.014). During sequence analysis from -388 to +306, we observed diverse, frequent intercopy single nucleotide polymorphisms (SNPs) in rRNA, with a frequency greater than predicted by chance at 12 sites. A SNP at +139 (U/C) in the 5' leader sequence varied among the cell lines and correlated negatively with level of the nc-rRNA (P = 0.014). Modelling of the secondary structure of the rRNA 5'-leader sequence indicated a small increase in structural stability due to the +139 U/C SNP and a minor shift in local configuration occurrences. The results demonstrate occurrence of a sense nc-rRNA in human lung epithelial and cancer cells, and imply a role in regulation of the rRNA gene, which may be affected by a +139 SNP in the 5' leader sequence of the primary rRNA transcript.

  3. Saturation Mutagenesis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Smith, Maria W.; Meskauskas, Arturas; Wang, Pinger; Sergiev, Petr V.; Dinman, Jonathan D.

    2001-01-01

    rRNAs are the central players in the reactions catalyzed by ribosomes, and the individual rRNAs are actively involved in different ribosome functions. Our previous demonstration that yeast 5S rRNA mutants (called mof9) can impact translational reading frame maintenance showed an unexpected function for this ubiquitous biomolecule. At the time, however, the highly repetitive nature of the genes encoding rRNAs precluded more detailed genetic and molecular analyses. A new genetic system allows all 5S rRNAs in the cell to be transcribed from a small, easily manipulated plasmid. The system is also amenable for the study of the other rRNAs, and provides an ideal genetic platform for detailed structural and functional studies. Saturation mutagenesis reveals regions of 5S rRNA that are required for cell viability, translational accuracy, and virus propagation. Unexpectedly, very few lethal alleles were identified, demonstrating the resilience of this molecule. Superimposition of genetic phenotypes on a physical map of 5S rRNA reveals the existence of phenotypic clusters of mutants, suggesting that specific regions of 5S rRNA are important for specific functions. Mapping these mutants onto the Haloarcula marismortui large subunit reveals that these clusters occur at important points of physical interaction between 5S rRNA and the different functional centers of the ribosome. Our analyses lead us to propose that one of the major functions of 5S rRNA may be to enhance translational fidelity by acting as a physical transducer of information between all of the different functional centers of the ribosome. PMID:11713264

  4. The E. coli 16S rRNA binding site of ribosomal protein S15: higher-order structure in the absence and in the presence of the protein.

    PubMed Central

    Mougel, M; Philippe, C; Ebel, J P; Ehresmann, B; Ehresmann, C

    1988-01-01

    We have investigated in detail the secondary and tertiary structures of E. coli 16S rRNA binding site of protein S15 using a variety of enzymatic and chemical probes. RNase T1 and nuclease S1 were used to probe unpaired nucleotides and RNase V1 to monitor base-paired or stacked nucleotides. Bases were probed with dimethylsulfate (at A(N-1), C(N-3) and G(N-7)), with 1-cyclohexyl-3 (2-(1-methylmorpholino)-ethyl)-carboiimide-p- toluenesulfonate (at U(N-3) and G(N-1)) and with diethylpyrocarbonate (at A(N-7)). The RNA region corresponding to nucleotides 652 to 753 was tested within: (1) the complete 16S rRNA molecule; (2) a 16S rRNA fragment corresponding to nucleotides 578 to 756 obtained by transcription in vitro; (3) the S15-16S rRNA complex; (4) the S15-fragment complex. Cleavage and modification sites were detected by primer extension with reverse transcriptase. Our results show that: (1) The synthetized fragment folds into the same overall secondary structure as in the complete 16S rRNA, with the exception of the large asymmetrical internal loop (nucleotides 673-676/714-733) which is fully accessible in the fragment while it appears conformationally heterogeneous in the 16S rRNA; (2) the reactivity patterns of the S15-16S rRNA and S15-fragment complexes are identical; (3) the protein protects defined RNA regions, located in the large interior loop and in the 3'-end strand of helix [655-672]-[734-751]; (4) the protein also causes enhanced chemical reactivity and enzyme accessibility interpreted as resulting from a local conformational rearrangement, induced by S15 binding. Images PMID:2453025

  5. Overaccumulation of the chloroplast antisense RNA AS5 is correlated with decreased abundance of 5S rRNA in vivo and inefficient 5S rRNA maturation in vitro

    PubMed Central

    Sharwood, Robert E.; Hotto, Amber M.; Bollenbach, Thomas J.; Stern, David B.

    2011-01-01

    Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3′-to-5′ exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNAArg, raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S–AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1. PMID:21148395

  6. Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Kiparisov, S.; Sergiev, P. V.; Dontsova, O. A.; Petrov, A.; Meskauskas, A.; Dinman, J. D.

    2005-01-01

    5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semidominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression. PMID:16047201

  7. 5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

    PubMed

    Drouin, Guy; Tsang, Corey

    2012-06-01

    Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

  8. 40 CFR 721.1555 - Substituted phenyl azo substituted benzenediazonium salt.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Substituted phenyl azo substituted benzenediazonium salt. 721.1555 Section 721.1555 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) TOXIC SUBSTANCES CONTROL ACT SIGNIFICANT NEW USES OF CHEMICAL SUBSTANCES Significant New Uses for Specific Chemical Substances §...

  9. Ribosomal proteins S12 and S13 function as control elements for translocation of the mRNA:tRNA complex.

    PubMed

    Cukras, Anthony R; Southworth, Daniel R; Brunelle, Julie L; Culver, Gloria M; Green, Rachel

    2003-08-01

    Translocation of the mRNA:tRNA complex through the ribosome is promoted by elongation factor G (EF-G) during the translation cycle. Previous studies established that modification of ribosomal proteins with thiol-specific reagents promotes this event in the absence of EF-G. Here we identify two small subunit interface proteins S12 and S13 that are essential for maintenance of a pretranslocation state. Omission of these proteins using in vitro reconstitution procedures yields ribosomal particles that translate in the absence of enzymatic factors. Conversely, replacement of cysteine residues in these two proteins yields ribosomal particles that are refractive to stimulation with thiol-modifying reagents. These data support a model where S12 and S13 function as control elements for the more ancient rRNA- and tRNA-driven movements of translocation.

  10. Taxonomic resolutions based on 18S rRNA genes: a case study of subclass copepoda.

    PubMed

    Wu, Shu; Xiong, Jie; Yu, Yuhe

    2015-01-01

    Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1-9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy.

  11. Taxonomic Resolutions Based on 18S rRNA Genes: A Case Study of Subclass Copepoda

    PubMed Central

    Wu, Shu; Xiong, Jie; Yu, Yuhe

    2015-01-01

    Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1–9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy. PMID:26107258

  12. Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons

    PubMed Central

    Pagano, Johanna F.B.; Ensink, Wim A.; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P.; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J.; Dekker, Rob J.

    2017-01-01

    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. PMID:28003516

  13. Variable Copy Number, Intra-Genomic Heterogeneities and Lateral Transfers of the 16S rRNA Gene in Pseudomonas

    PubMed Central

    Bodilis, Josselin; Nsigue-Meilo, Sandrine; Besaury, Ludovic; Quillet, Laurent

    2012-01-01

    Even though the 16S rRNA gene is the most commonly used taxonomic marker in microbial ecology, its poor resolution is still not fully understood at the intra-genus level. In this work, the number of rRNA gene operons, intra-genomic heterogeneities and lateral transfers were investigated at a fine-scale resolution, throughout the Pseudomonas genus. In addition to nineteen sequenced Pseudomonas strains, we determined the 16S rRNA copy number in four other Pseudomonas strains by Southern hybridization and Pulsed-Field Gel Electrophoresis, and studied the intra-genomic heterogeneities by Denaturing Gradient Gel Electrophoresis and sequencing. Although the variable copy number (from four to seven) seems to be correlated with the evolutionary distance, some close strains in the P. fluorescens lineage showed a different number of 16S rRNA genes, whereas all the strains in the P. aeruginosa lineage displayed the same number of genes (four copies). Further study of the intra-genomic heterogeneities revealed that most of the Pseudomonas strains (15 out of 19 strains) had at least two different 16S rRNA alleles. A great difference (5 or 19 nucleotides, essentially grouped near the V1 hypervariable region) was observed only in two sequenced strains. In one of our strains studied (MFY30 strain), we found a difference of 12 nucleotides (grouped in the V3 hypervariable region) between copies of the 16S rRNA gene. Finally, occurrence of partial lateral transfers of the 16S rRNA gene was further investigated in 1803 full-length sequences of Pseudomonas available in the databases. Remarkably, we found that the two most variable regions (the V1 and V3 hypervariable regions) had probably been laterally transferred from another evolutionary distant Pseudomonas strain for at least 48.3 and 41.6% of the 16S rRNA sequences, respectively. In conclusion, we strongly recommend removing these regions of the 16S rRNA gene during the intra-genus diversity studies. PMID:22545126

  14. Selective phylogenetic analysis targeting 16S rRNA genes of hyperthermophilic archaea in the deep-subsurface hot biosphere.

    PubMed

    Kimura, Hiroyuki; Ishibashi, Jun-Ichiro; Masuda, Harue; Kato, Kenji; Hanada, Satoshi

    2007-04-01

    International drilling projects for the study of microbial communities in the deep-subsurface hot biosphere have been expanded. Core samples obtained by deep drilling are commonly contaminated with mesophilic microorganisms in the drilling fluid, making it difficult to examine the microbial community by 16S rRNA gene clone library analysis. To eliminate mesophilic organism contamination, we previously developed a new method (selective phylogenetic analysis [SePA]) based on the strong correlation between the guanine-plus-cytosine (G+C) contents of the 16S rRNA genes and the optimal growth temperatures of prokaryotes, and we verified the method's effectiveness (H. Kimura, M. Sugihara, K. Kato, and S. Hanada, Appl. Environ. Microbiol. 72:21-27, 2006). In the present study we ascertained SePA's ability to eliminate contamination by archaeal rRNA genes, using deep-sea hydrothermal fluid (117 degrees C) and surface seawater (29.9 degrees C) as substitutes for deep-subsurface geothermal samples and drilling fluid, respectively. Archaeal 16S rRNA gene fragments, PCR amplified from the surface seawater, were denatured at 82 degrees C and completely digested with exonuclease I (Exo I), while gene fragments from the deep-sea hydrothermal fluid remained intact after denaturation at 84 degrees C because of their high G+C contents. An examination using mixtures of DNAs from the two environmental samples showed that denaturation at 84 degrees C and digestion with Exo I completely eliminated archaeal 16S rRNA genes from the surface seawater. Our method was quite useful for culture-independent community analysis of hyperthermophilic archaea in core samples recovered from deep-subsurface geothermal environments.

  15. Optimisation of 16S rRNA gut microbiota profiling of extremely low birth weight infants.

    PubMed

    Alcon-Giner, Cristina; Caim, Shabhonam; Mitra, Suparna; Ketskemety, Jennifer; Wegmann, Udo; Wain, John; Belteki, Gusztav; Clarke, Paul; Hall, Lindsay J

    2017-11-02

    Infants born prematurely, particularly extremely low birth weight infants (ELBW) have altered gut microbial communities. Factors such as maternal health, gut immaturity, delivery mode, and antibiotic treatments are associated with microbiota disturbances, and are linked to an increased risk of certain diseases such as necrotising enterocolitis. Therefore, there is a requirement to optimally characterise microbial profiles in this at-risk cohort, via standardisation of methods, particularly for studying the influence of microbiota therapies (e.g. probiotic supplementation) on community profiles and health outcomes. Profiling of faecal samples using the 16S rRNA gene is a cost-efficient method for large-scale clinical studies to gain insights into the gut microbiota and additionally allows characterisation of cohorts were sample quantities are compromised (e.g. ELBW infants). However, DNA extraction method, and the 16S rRNA region targeted can significantly change bacterial community profiles obtained, and so confound comparisons between studies. Thus, we sought to optimise a 16S rRNA profiling protocol to allow standardisation for studying ELBW infant faecal samples, with or without probiotic supplementation. Using ELBW faecal samples, we compared three different DNA extraction methods, and subsequently PCR amplified and sequenced three hypervariable regions of the 16S rRNA gene (V1 + V2 + V3), (V4 + V5) and (V6 + V7 + V8), and compared two bioinformatics approaches to analyse results (OTU and paired end). Paired shotgun metagenomics was used as a 'gold-standard'. Results indicated a longer bead-beating step was required for optimal bacterial DNA extraction and that sequencing regions (V1 + V2 + V3) and (V6 + V7 + V8) provided the most representative taxonomic profiles, which was confirmed via shotgun analysis. Samples sequenced using the (V4 + V5) region were found to be underrepresented in specific taxa including Bifidobacterium, and had

  16. Selective Phylogenetic Analysis Targeted at 16S rRNA Genes of Thermophiles and Hyperthermophiles in Deep-Subsurface Geothermal Environments

    PubMed Central

    Kimura, Hiroyuki; Sugihara, Maki; Kato, Kenji; Hanada, Satoshi

    2006-01-01

    Deep-subsurface samples obtained by deep drilling are likely to be contaminated with mesophilic microorganisms in the drilling fluid, and this could affect determination of the community structure of the geothermal microflora using 16S rRNA gene clone library analysis. To eliminate possible contamination by PCR-amplified 16S rRNA genes from mesophiles, a combined thermal denaturation and enzyme digestion method, based on a strong correlation between the G+C content of the 16S rRNA gene and the optimum growth temperatures of most known prokaryotic cultures, was used prior to clone library construction. To validate this technique, hot spring fluid (76°C) and river water (14°C) were used to mimic a deep-subsurface sample contaminated with drilling fluid. After DNA extraction and PCR amplification of the 16S rRNA genes from individual samples separately, the amplified products from river water were observed to be denatured at 82°C and completely digested by exonuclease I (Exo I), while the amplified products from hot spring fluid remained intact after denaturation at 84°C and enzyme digestion with Exo I. DNAs extracted from the two samples were mixed and used as a template for amplification of the 16S rRNA genes. The amplified rRNA genes were denatured at 84°C and digested with Exo I before clone library construction. The results indicated that the 16S rRNA gene sequences from the river water were almost completely eliminated, whereas those from the hot spring fluid remained. PMID:16391020

  17. Prevalence of 16S rRNA methylase genes among β-lactamase-producing Enterobacteriaceae clinical isolates in Saudi Arabia

    PubMed Central

    Al Sheikh, Yazeed A.; Marie, Mohammed Ali M.; John, James; Krishnappa, Lakshmana Gowda; Dabwab, Khaled Homoud M.

    2014-01-01

    Background Co production of 16S rRNA methylases gene and β-Lactamase gene among Enterobacteriaceae isolates conferring resistance to both therapeutic options has serious implications for clinicians worldwide. Methods To study co existence of 16S rRNA methylases (armA, rmtA, rmtB, rmtC, rmtD, and npmA) and β-Lactamase (blaTEM-1, blaSHV-12, blaCTX-M-14) genes, we screened all phenotypic positive β-Lactamase producing enterobacteriaceae by polymerase chain reaction (PCR) targeting above genes. A total of 330 enterobacteriaceae strains were collected during study period out of that 218 isolates were identified phenotypically as β-Lactamase producers, which include 50 (22.9%) Escherichia coli; 92 (42.2%) Klebsiella pneumoniae, 44 (20.2%), Citrobactor freundii and 32 (14.7%) Enterobacter spp. Results Among this 218, only 188 isolates harbored the resistant gene for β-Lactamase production. Major β-Lactamase producing isolates were bla TEM-1 type. 122 (56 %) isolates were found to produce any one of the 16S rRNA methylase genes. A total of 116 isolates co produced β-Lactamase and at least one 16S rRNA methylases gene Co production of armA gene was found in 26 isolates with rmtB and in 4 isolates with rmtC. The rmtA and rmtD genes were not detected in any of the tested isolates. Six isolates were positive for a 16S rRNA methylase gene alone. Conclusion β-Lactamase producing isolates appears to coexist with 16S rRNA methylase predominantly armA and rmtB genes in the same isolate. We conclude the major β-Lactamase and 16S rRNA methylases co-producer was K. pneumoniae followed by E. coli. We suggest further work on evaluating other β-lactamases types and novel antibiotic resistance mechanisms among Enterobacteriaceae. PMID:25005152

  18. Comparative analysis of the 5S rRNA and its associated proteins reveals unique primitive rather than parasitic features in Giardia lamblia.

    PubMed

    Feng, Jin-Mei; Sun, Jun; Xin, De-Dong; Wen, Jian-Fan

    2012-01-01

    5S rRNA is a highly conserved ribosomal component. Eukaryotic 5S rRNA and its associated proteins (5S rRNA system) have become very well understood. Giardia lamblia was thought by some researchers to be the most primitive extant eukaryote while others considered it a highly evolved parasite. Previous reports have indicated that some aspects of its 5S rRNA system are simpler than that of common eukaryotes. We here explore whether this is true to its entire system, and whether this simplicity is a primitive or parasitic feature. By collecting and confirming pre-existing data and identifying new data, we obtained almost complete datasets of the system of three isolates of G. lamblia, two other parasitic excavates (Trichomonas vaginalis, Trypanosoma cruzi), and one free-living one (Naegleria gruberi). After comprehensively comparing each aspect of the system among these excavates and also with those of archaea and common eukaryotes, we found all the three Giardia isolates to harbor a same simplified 5S rRNA system, which is not only much simpler than that of common eukaryotes but also the simplest one among those of these excavates, and is surprisingly very similar to that of archaea; we also found among these excavates the system in parasitic species is not necessarily simpler than that in free-living species, conversely, the system of free-living species is even simpler in some respects than those of parasitic ones. The simplicity of Giardia 5S rRNA system should be considered a primitive rather than parasitically-degenerated feature. Therefore, Giardia 5S rRNA system might be a primitive system that is intermediate between that of archaea and the common eukaryotic model system, and it may reflect the evolutionary history of the eukaryotic 5S rRNA system from the archaeal form. Our results also imply G. lamblia might be a primitive eukaryote with secondary parasitically-degenerated features.

  19. Comparative Analysis of the 5S rRNA and Its Associated Proteins Reveals Unique Primitive Rather Than Parasitic Features in Giardia lamblia

    PubMed Central

    Xin, De-Dong; Wen, Jian-Fan

    2012-01-01

    Background 5S rRNA is a highly conserved ribosomal component. Eukaryotic 5S rRNA and its associated proteins (5S rRNA system) have become very well understood. Giardia lamblia was thought by some researchers to be the most primitive extant eukaryote while others considered it a highly evolved parasite. Previous reports have indicated that some aspects of its 5S rRNA system are simpler than that of common eukaryotes. We here explore whether this is true to its entire system, and whether this simplicity is a primitive or parasitic feature. Methodology/Principal Findings By collecting and confirming pre-existing data and identifying new data, we obtained almost complete datasets of the system of three isolates of G. lamblia, two other parasitic excavates (Trichomonas vaginalis, Trypanosoma cruzi), and one free-living one (Naegleria gruberi). After comprehensively comparing each aspect of the system among these excavates and also with those of archaea and common eukaryotes, we found all the three Giardia isolates to harbor a same simplified 5S rRNA system, which is not only much simpler than that of common eukaryotes but also the simplest one among those of these excavates, and is surprisingly very similar to that of archaea; we also found among these excavates the system in parasitic species is not necessarily simpler than that in free-living species, conversely, the system of free-living species is even simpler in some respects than those of parasitic ones. Conclusion/Significance The simplicity of Giardia 5S rRNA system should be considered a primitive rather than parasitically-degenerated feature. Therefore, Giardia 5S rRNA system might be a primitive system that is intermediate between that of archaea and the common eukaryotic model system, and it may reflect the evolutionary history of the eukaryotic 5S rRNA system from the archaeal form. Our results also imply G. lamblia might be a primitive eukaryote with secondary parasitically-degenerated features. PMID

  20. Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons.

    PubMed

    Locati, Mauro D; Pagano, Johanna F B; Ensink, Wim A; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J; Dekker, Rob J; Breit, Timo M

    2017-04-01

    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. © 2017 Locati et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  1. Detection of Verrucomicrobia in a Pasture Soil by PCR-Mediated Amplification of 16S rRNA Genes

    PubMed Central

    O’Farrell, Katrina A.; Janssen, Peter H.

    1999-01-01

    Oligonucleotide primers were designed and used to amplify, by PCR, partial 16S rRNA genes of members of the bacterial division Verrucomicrobia in DNA extracted from a pasture soil. By applying most-probable-number theory to the assay, verrucomicrobia appeared to contribute some 0.2% of the soil DNA. Amplified ribosomal DNA restriction analysis of 53 cloned PCR-amplified partial 16S rRNA gene fragments and comparative sequence analysis of 21 nonchimeric partial 16S rRNA genes showed that these primers amplified only 16S rRNA genes of members of the Verrucomicrobia in DNA extracted from the soil. PMID:10473454

  2. The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

    PubMed Central

    Hori, H; Osawa, S; Iwabuchi, M

    1980-01-01

    The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%). Images PMID:7465421

  3. Specific recognition of rpsO mRNA and 16S rRNA by Escherichia coli ribosomal protein S15 relies on both mimicry and site differentiation

    PubMed Central

    Mathy, Nathalie; Pellegrini, Olivier; Serganov, Alexander; Patel, Dinshaw J.; Ehresmann, Chantal; Portier, Claude

    2015-01-01

    Summary The ribosomal protein S15 binds to 16S rRNA, during ribosome assembly, and to its own mRNA (rpsO mRNA), affecting autocontrol of its expression. In both cases, the RNA binding site is bipartite with a common subsite consisting of a G•U/G-C motif. The second subsite is located in a three-way junction in 16S rRNA and in the distal part of a stem forming a pseudoknot in Escherichia coli rpsO mRNA. To determine the extent of mimicry between these two RNA targets, we determined which amino acids interact with rpsO mRNA. A plasmid carrying rpsO (the S15 gene) was mutagenized and introduced into a strain lacking S15 and harbouring an rpsO–lacZ translational fusion. Analysis of deregulated mutants shows that each subsite of rpsO mRNA is recognized by a set of amino acids known to interact with 16S rRNA. In addition to the G•U/G-C motif, which is recognized by the same amino acids in both targets, the other subsite interacts with amino acids also involved in contacts with helix H22 of 16S rRNA, in the region adjacent to the three-way junction. However, specific S15–rpsO mRNA interactions can also be found, probably with A(−46) in loop L1 of the pseudoknot, demonstrating that mimicry between the two targets is limited. PMID:15101974

  4. High frequency of the 23S rRNA A2058G mutation of Treponema pallidum in Shanghai is associated with a current strategy for the treatment of syphilis.

    PubMed

    Lu, Haikong; Li, Kang; Gong, Weimin; Yan, Limeng; Gu, Xin; Chai, Ze; Guan, Zhifang; Zhou, Pingyu

    2015-02-01

    The preferred drugs for the treatment of syphilis, benzathine and procaine penicillin, have not been available in Shanghai for many years, and currently, the incidence of syphilis is increasing. Alternative antibiotics for patients with syphilis during the benzathine and procaine penicillin shortage include macrolides. The failure of macrolide treatment in syphilis patients has been reported in Shanghai, but the reason for this treatment failure remains unclear. We used polymerase chain reaction technology to detect a 23S rRNA A2058G mutation in Treponema pallidum in 109 specimens from syphilis patients. The use of azithromycin/erythromycin in the syphilis patients and the physicians' prescription habits were also assessed based on two questionnaires regarding the use of macrolides. A total of 104 specimens (95.4%) were positive for the A2058G mutation in both copies of the 23S rRNA gene, indicating macrolide resistance. A questionnaire provided to 122 dermatologists showed that during the penicillin shortage, they prescribed erythromycin and azithromycin for 8.24±13.95% and 3.21±6.37% of their patients, respectively, and in the case of penicillin allergy, erythromycin and azithromycin were prescribed 15.24±22.89% and 7.23±16.60% of the time, respectively. A second questionnaire provided to the syphilis patients showed that 150 (33.7%), 106 (23.8%) and 34 (7.6%) individuals had used azithromycin, erythromycin or both, respectively, although the majority did not use the drugs for syphilis treatment. Our findings suggest that macrolide resistance in Treponema pallidum is widespread in Shanghai. More than half of the syphilis patients had a history of macrolide use for other treatment purposes, which may have led to the high prevalence of macrolide resistance. Physicians in China are advised to not use azithromycin for early syphilis.

  5. Phytoplasma phylogenetics based on analysis of secA and 23S rRNA gene sequences for improved resolution of candidate species of 'Candidatus Phytoplasma'.

    PubMed

    Hodgetts, Jennifer; Boonham, Neil; Mumford, Rick; Harrison, Nigel; Dickinson, Matthew

    2008-08-01

    Phytoplasma phylogenetics has focused primarily on sequences of the non-coding 16S rRNA gene and the 16S-23S rRNA intergenic spacer region (16-23S ISR), and primers that enable amplification of these regions from all phytoplasmas by PCR are well established. In this study, primers based on the secA gene have been developed into a semi-nested PCR assay that results in a sequence of the expected size (about 480 bp) from all 34 phytoplasmas examined, including strains representative of 12 16Sr groups. Phylogenetic analysis of secA gene sequences showed similar clustering of phytoplasmas when compared with clusters resolved by similar sequence analyses of a 16-23S ISR-23S rRNA gene contig or of the 16S rRNA gene alone. The main differences between trees were in the branch lengths, which were elongated in the 16-23S ISR-23S rRNA gene tree when compared with the 16S rRNA gene tree and elongated still further in the secA gene tree, despite this being a shorter sequence. The improved resolution in the secA gene-derived phylogenetic tree resulted in the 16SrII group splitting into two distinct clusters, while phytoplasmas associated with coconut lethal yellowing-type diseases split into three distinct groups, thereby supporting past proposals that they represent different candidate species within 'Candidatus Phytoplasma'. The ability to differentiate 16Sr groups and subgroups by virtual RFLP analysis of secA gene sequences suggests that this gene may provide an informative alternative molecular marker for pathogen identification and diagnosis of phytoplasma diseases.

  6. FISH and AgNor mapping of the 45S and 5S rRNA genes in wild and cultivated species of Capsicum (Solananceae).

    PubMed

    Scaldaferro, Marisel A; da Cruz, M Victoria Romero; Cecchini, Nicolás M; Moscone, Eduardo A

    2016-02-01

    Chromosome number and position of rDNA were studied in 12 wild and cultivated species of the genus Capsicum with chromosome numbers x = 12 and x = 13 (22 samples). For the first time in these species, the 5S and 45S rRNA loci were localized and physically mapped using two-color fluorescence in situ hybridization and AgNOR banding. We focused on the comparison of the results obtained with both methods with the aim of accurately revealing the real functional rRNA genes. The analyzes were based on a previous work that reported that the 18S-5.8S-25S loci mostly coincide with GC-rich heterochromatic regions and likely have given rise to satellite DNAs, which are not active genes. These data show the variability of rDNA within karyotypes of the genus Capsicum, providing anchor points for (comparative) genetic maps. In addition, the obtained information might be useful for studies on evolution of repetitive DNA.

  7. Linezolid-resistant Staphylococcus haemolyticus and Staphylococcus hominis: single and double mutations at the domain V of 23S rRNA among isolates from a Rio de Janeiro hospital.

    PubMed

    Chamon, Raiane Cardoso; Iorio, Natalia Lopes Pontes; Cavalcante, Fernanda Sampaio; Teodoro, Cristiane R S; de Oliveira, Ana Paula Chaves; Maia, Fernanda; dos Santos, Kátia Regina Netto

    2014-12-01

    In this work, the molecular and phenotypic antimicrobial resistance and clonal diversity of 10 linezolid-resistant Staphylococcus spp. isolates were investigated. The 7 Staphylococcus haemolyticus isolates presented Staphylococcal cassete chromosome mec (SCCmec) V and belonged to the same pulsed-field gel electrophoresis pulsotype. Their MICs for oxacillin, vancomycin, and linezolid were ≥ 256 μg/mL, 1-4 μg/mL, and 8-16 μg/mL, respectively. The 3 S. hominis presented MIC values 32 to >256 μg/mL, 2-4 μg/mL, and 12-24 μg/mL, and all carried the nontypeable SCCmec (ccr1 + mecA class) and belonged to 2 different genotypes. The cfr gene was not found, but the mutation G2603T was detected in S. haemolyticus and C2190T and G2603T in Staphylococcus hominis in 23S rRNA. This study demonstrates the spread of a linezolid-resistant S. haemolyticus genotype and, for the first time, describes the mutation C2190T among S. hominis isolates with a double mutation in Brazil. Copyright © 2014 Elsevier Inc. All rights reserved.

  8. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    NASA Technical Reports Server (NTRS)

    Yang, Y.; Fox, G. E.

    1996-01-01

    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  9. The role of the mitochondrial ribosome in human disease: searching for mutations in 12S mitochondrial rRNA with high disruptive potential

    PubMed Central

    Smith, Paul M.; Elson, Joanna L.; Greaves, Laura C.; Wortmann, Saskia B.; Rodenburg, Richard J.T.; Lightowlers, Robert N.; Chrzanowska-Lightowlers, Zofia M.A.; Taylor, Robert W.; Vila-Sanjurjo, Antón

    2014-01-01

    Mutations of mitochondrial DNA are linked to many human diseases. Despite the identification of a large number of variants in the mitochondrially encoded rRNA (mt-rRNA) genes, the evidence supporting their pathogenicity is, at best, circumstantial. Establishing the pathogenicity of these variations is of major diagnostic importance. Here, we aim to estimate the disruptive effect of mt-rRNA variations on the function of the mitochondrial ribosome. In the absence of direct biochemical methods to study the effect of mt-rRNA variations, we relied on the universal conservation of the rRNA fold to infer their disruptive potential. Our method, named heterologous inferential analysis or HIA, combines conservational information with functional and structural data obtained from heterologous ribosomal sources. Thus, HIA's predictive power is superior to the traditional reliance on simple conservation indexes. By using HIA, we have been able to evaluate the disruptive potential for a subset of uncharacterized 12S mt-rRNA variations. Our analysis revealed the existence of variations in the rRNA component of the human mitoribosome with different degrees of disruptive power. In cases where sufficient information regarding the genetic and pathological manifestation of the mitochondrial phenotype is available, HIA data can be used to predict the pathogenicity of mt-rRNA mutations. In other cases, HIA analysis will allow the prioritization of variants for additional investigation. Eventually, HIA-inspired analysis of potentially pathogenic mt-rRNA variations, in the context of a scoring system specifically designed for these variants, could lead to a powerful diagnostic tool. PMID:24092330

  10. Identification of nucleotides in E. coli 16S rRNA essential for ribosome subunit association.

    PubMed

    Pulk, Arto; Maiväli, Ulo; Remme, Jaanus

    2006-05-01

    The ribosome consists of two unequal subunits, which associate via numerous intersubunit contacts. Medium-resolution structural studies have led to grouping of the intersubunit contacts into 12 directly visualizable intersubunit bridges. Most of the intersubunit interactions involve RNA. We have used an RNA modification interference approach to determine Escherichia coli 16S rRNA positions that are essential for the association of functionally active 70S ribosomes. Modification of the N1 position of A702, A1418, and A1483 with DMS, and of the N3 position of U793, U1414, and U1495 with CMCT in 30S subunits strongly interferes with 70S ribosome formation. Five of these positions localize into previously recognized intersubunit bridges, namely, B2a (U1495), B2b (U793), B3 (A1483), B5 (A1418), and B7a (A702). The remaining position displaying interference, U1414, forms a base pair with G1486, which is a part of bridge B3. We contend that these five intersubunit bridges are essential for reassociation of the 70S ribosome, thus forming the functional core of the intersubunit contacts.

  11. Identification of nucleotides in E. coli 16S rRNA essential for ribosome subunit association

    PubMed Central

    Pulk, Arto; Maiväli, Ülo; Remme, Jaanus

    2006-01-01

    The ribosome consists of two unequal subunits, which associate via numerous intersubunit contacts. Medium-resolution structural studies have led to grouping of the intersubunit contacts into 12 directly visualizable intersubunit bridges. Most of the intersubunit interactions involve RNA. We have used an RNA modification interference approach to determine Escherichia coli 16S rRNA positions that are essential for the association of functionally active 70S ribosomes. Modification of the N1 position of A702, A1418, and A1483 with DMS, and of the N3 position of U793, U1414, and U1495 with CMCT in 30S subunits strongly interferes with 70S ribosome formation. Five of these positions localize into previously recognized intersubunit bridges, namely, B2a (U1495), B2b (U793), B3 (A1483), B5 (A1418), and B7a (A702). The remaining position displaying interference, U1414, forms a base pair with G1486, which is a part of bridge B3. We contend that these five intersubunit bridges are essential for reassociation of the 70S ribosome, thus forming the functional core of the intersubunit contacts. PMID:16556933

  12. Characterization of a Novel Association between Two Trypanosome-Specific Proteins and 5S rRNA

    PubMed Central

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are essential and are involved in ribosome biogenesis. Here, we show that these proteins interact in vitro with the 5S rRNA with nearly identical binding characteristics in the absence of other cellular factors. The T. brucei 5S rRNA has a complex secondary structure and presents four accessible loops (A to D) for interactions with RNA-binding proteins. In other eukaryotes, loop C is bound by the L5 ribosomal protein and loop A mainly by TFIIIA. The binding of P34 and P37 to T. brucei 5S rRNA involves the LoopA region of the RNA, but these proteins also protect the L5 binding site located on LoopC. PMID:22253864

  13. Neighborhood of 16S rRNA nucleotides U788/U789 in the 30S ribosomal subunit determined by site-directed crosslinking.

    PubMed

    Mundus, D; Wollenzien, P

    1998-11-01

    Site-specific photo crosslinking has been used to investigate the RNA neighborhood of 16S rRNA positions U788/ U789 in Escherichia coli 30S subunits. For these studies, site-specific psoralen (SSP) which contains a sulfhydryl group on a 17 A side chain was first added to nucleotides U788/U789 using a complementary guide DNA by annealing and phototransfer. Modified RNA was purified from the DNA and unmodified RNA. For some experiments, the SSP, which normally crosslinks at an 8 A distance, was derivitized with azidophenacylbromide (APAB) resulting in the photoreactive azido moiety at a maximum of 25 A from the 4' position on psoralen (SSP25APA). 16S rRNA containing SSP, SSP25APA or control 16S rRNA were reconstituted and 30S particles were isolated. The reconstituted subunits containing SSP or SSP25APA had normal protein composition, were active in tRNA binding and had the usual pattern of chemical reactivity except for increased kethoxal reactivity at G791 and modest changes in four other regions. Irradiation of the derivatized 30S subunits in activation buffer produced several intramolecular RNA crosslinks that were visualized and separated by gel electrophoresis and characterized by primer extension. Four major crosslink sites made by the SSP reagent were identified at positions U561/U562, U920/U921, C866 and U723; a fifth major crosslink at G693 was identified when the SSP25APA reagent was used. A number of additional crosslinks of lower frequency were seen, particularly with the APA reagent. These data indicate a central location close to the decoding region and central pseudoknot for nucleotides U788/U789 in the activated 30S subunit.

  14. Binding of the 3' terminus of tRNA to 23S rRNA in the ribosomal exit site actively promotes translocation.

    PubMed Central

    Lill, R; Robertson, J M; Wintermeyer, W

    1989-01-01

    A key event in ribosomal protein synthesis is the translocation of deacylated tRNA, peptidyl tRNA and mRNA, which is catalyzed by elongation factor G (EF-G) and requires GTP. To address the molecular mechanism of the reaction we have studied the functional role of a tRNA exit site (E site) for tRNA release during translocation. We show that modifications of the 3' end of tRNAPhe, which considerably decrease the affinity of E-site binding, lower the translocation rate up to 40-fold. Furthermore, 3'-end modifications lower or abolish the stimulation by P site-bound tRNA of the GTPase activity of EF-G on the ribosome. The results suggest that a hydrogen-bonding interaction of the 3'-terminal adenine of the leaving tRNA in the E site, most likely base-pairing with 23S rRNA, is essential for the translocation reaction. Furthermore, this interaction stimulates the GTP hydrolyzing activity of EF-G on the ribosome. We propose the following molecular model of translocation: after the binding of EF-G.GTP, the P site-bound tRNA, by a movement of the 3'-terminal single-stranded ACCA tail, establishes an interaction with 23S rRNA in the adjacent E site, thereby initiating the tRNA transfer from the P site to the E site and promoting GTP hydrolysis. The co-operative interaction between the E site and the EF-G binding site, which are distantly located on the 50S ribosomal subunit, is probably mediated by a conformational change of 23S rRNA. PMID:2583120

  15. Sequence heterogeneity in the two 16S rRNA genes of Phormium yellow leaf phytoplasma.

    PubMed Central

    Liefting, L W; Andersen, M T; Beever, R E; Gardner, R C; Forster, R L

    1996-01-01

    Phormium yellow leaf (PYL) phytoplasma causes a lethal disease of the monocotyledon, New Zealand flax (Phormium tenax). The 16S rRNA genes of PYL phytoplasma were amplified from infected flax by PCR and cloned, and the nucleotide sequences were determined. DNA sequencing and Southern hybridization analysis of genomic DNA indicated the presence of two copies of the 16S rRNA gene. The two 16S rRNA genes exhibited sequence heterogeneity in 4 nucleotide positions and could be distinguished by the restriction enzymes BpmI and BsrI. This is the first record in which sequence heterogeneity in the 16S rRNA genes of a phytoplasma has been determined by sequence analysis. A phylogenetic tree based on 16S rRNA gene sequences showed that PYL phytoplasma is most closely related to the stolbur and German grapevine yellows phytoplasmas, which form the stolbur subgroup of the aster yellows group. This phylogenetic position of PYL phytoplasma was supported by 16S/23S spacer region sequence data. PMID:8795200

  16. Alternative splicing of anciently exonized 5S rRNA regulates plant transcription factor TFIIIA

    PubMed Central

    Fu, Yan; Bannach, Oliver; Chen, Hao; Teune, Jan-Hendrik; Schmitz, Axel; Steger, Gerhard; Xiong, Liming; Barbazuk, W. Brad

    2009-01-01

    Identifying conserved alternative splicing (AS) events among evolutionarily distant species can prioritize AS events for functional characterization and help uncover relevant cis- and trans-regulatory factors. A genome-wide search for conserved cassette exon AS events in higher plants revealed the exonization of 5S ribosomal RNA (5S rRNA) within the gene of its own transcription regulator, TFIIIA (transcription factor for polymerase III A). The 5S rRNA-derived exon in TFIIIA gene exists in all representative land plant species but not in green algae and nonplant species, suggesting it is specific to land plants. TFIIIA is essential for RNA polymerase III-based transcription of 5S rRNA in eukaryotes. Integrating comparative genomics and molecular biology revealed that the conserved cassette exon derived from 5S rRNA is coupled with nonsense-mediated mRNA decay. Utilizing multiple independent Arabidopsis overexpressing TFIIIA transgenic lines under osmotic and salt stress, strong accordance between phenotypic and molecular evidence reveals the biological relevance of AS of the exonized 5S rRNA in quantitative autoregulation of TFIIIA homeostasis. Most significantly, this study provides the first evidence of ancient exaptation of 5S rRNA in plants, suggesting a novel gene regulation model mediated by the AS of an anciently exonized noncoding element. PMID:19211543

  17. Characterization of hydrocortisone biometabolites and 18S rRNA gene in Chlamydomonas reinhardtii cultures.

    PubMed

    Ghasemi, Younes; Rasoul-Amini, Sara; Morowvat, Mohammad Hossein; Raee, Mohammad Javad; Ghoshoon, Mohammad Bagher; Nouri, Fatemeh; Negintaji, Narges; Parvizi, Rezvan; Mosavi-Azam, Seyed Bagher

    2008-10-31

    A unicellular microalga, Chlamydomonas reinhardtii, was isolated from rice paddy-field soil and water samples and used in the biotransformation of hydrocortisone (1). This strain has not been previously tested for steroid bioconversion. Fermentation was carried out in BG-11 medium supplemented with 0.05% substrate at 25 degrees C for 14 days of incubation. The products obtained were chromatographically purified and characterized using spectroscopic methods. 11b,17 beta-Dihydroxyandrost-4-en-3-one (2), 11 beta-hydroxyandrost-4-en-3,17-dione (3), 11 beta,17 alpha,20 beta,21-tetrahydroxypregn-4-en-3-one (4) and prednisolone (5) were the main products of the bioconversion. The observed bioreaction features were the side chain degradation of the substrate to give compounds 2 and 3 and the 20-ketone reduction and 1,2-dehydrogenation affording compounds 4 and 5, respectively. A time course study showed the accumulation of product 2 from the second day of the fermentation and of compounds 3, 4 and 5 from the third day. All the metabolites reached their maximum concentration in seven days. Microalgal 18S rRNA gene was also amplified by PCR. PCR products were sequenced to confirm their authenticity as 18S rRNA gene of microalgae. The result of PCR blasted with other sequenced microalgae in NCBI showed 100% homology to the 18S small subunit rRNA of two Chlamydomonas reinhardtii spp.

  18. Enzymic colorimetry-based DNA chip: a rapid and accurate assay for detecting mutations for clarithromycin resistance in the 23S rRNA gene of Helicobacter pylori.

    PubMed

    Xuan, Shi-Hai; Zhou, Yu-Gui; Shao, Bo; Cui, Ya-Lin; Li, Jian; Yin, Hong-Bo; Song, Xiao-Ping; Cong, Hui; Jing, Feng-Xiang; Jin, Qing-Hui; Wang, Hui-Min; Zhou, Jie

    2009-11-01

    Macrolide drugs, such as clarithromycin (CAM), are a key component of many combination therapies used to eradicate Helicobacter pylori. However, resistance to CAM is increasing in H. pylori and is becoming a serious problem in H. pylori eradication therapy. CAM resistance in H. pylori is mostly due to point mutations (A2142G/C, A2143G) in the peptidyltransferase-encoding region of the 23S rRNA gene. In this study an enzymic colorimetry-based DNA chip was developed to analyse single-nucleotide polymorphisms of the 23S rRNA gene to determine the prevalence of mutations in CAM-related resistance in H. pylori-positive patients. The results of the colorimetric DNA chip were confirmed by direct DNA sequencing. In 63 samples, the incidence of the A2143G mutation was 17.46 % (11/63). The results of the colorimetric DNA chip were concordant with DNA sequencing in 96.83 % of results (61/63). The colorimetric DNA chip could detect wild-type and mutant signals at every site, even at a DNA concentration of 1.53 x 10(2) copies microl(-1). Thus, the colorimetric DNA chip is a reliable assay for rapid and accurate detection of mutations in the 23S rRNA gene of H. pylori that lead to CAM-related resistance, directly from gastric tissues.

  19. Novel variants of the 5S rRNA genes in Eruca sativa.

    PubMed

    Singh, K; Bhatia, S; Lakshmikumaran, M

    1994-02-01

    The 5S ribosomal RNA (rRNA) genes of Eruca sativa were cloned and characterized. They are organized into clusters of tandemly repeated units. Each repeat unit consists of a 119-bp coding region followed by a noncoding spacer region that separates it from the coding region of the next repeat unit. Our study reports novel gene variants of the 5S rRNA genes in plants. Two families of the 5S rDNA, the 0.5-kb size family and the 1-kb size family, coexist in the E. sativa genome. The 0.5-kb size family consists of the 5S rRNA genes (S4) that have coding regions similar to those of other reported plant 5S rDNA sequences, whereas the 1-kb size family consists of the 5S rRNA gene variants (S1) that exist as 1-kb BamHI tandem repeats. S1 is made up of two variant units (V1 and V2) of 5S rDNA where the BamHI site between the two units is mutated. Sequence heterogeneity among S4, V1, and V2 units exists throughout the sequence and is not limited to the noncoding spacer region only. The coding regions of V1 and V2 show approximately 20% dissimilarity to the coding regions of S4 and other reported plant 5S rDNA sequences. Such a large variation in the coding regions of the 5S rDNA units within the same plant species has been observed for the first time. Restriction site variation is observed between the two size classes of 5S rDNA in E. sativa.(ABSTRACT TRUNCATED AT 250 WORDS)

  20. Phylogenetic Network Analysis Revealed the Occurrence of Horizontal Gene Transfer of 16S rRNA in the Genus Enterobacter

    PubMed Central

    Sato, Mitsuharu; Miyazaki, Kentaro

    2017-01-01

    Horizontal gene transfer (HGT) is a ubiquitous genetic event in bacterial evolution, but it seldom occurs for genes involved in highly complex supramolecules (or biosystems), which consist of many gene products. The ribosome is one such supramolecule, but several bacteria harbor dissimilar and/or chimeric 16S rRNAs in their genomes, suggesting the occurrence of HGT of this gene. However, we know little about whether the genes actually experience HGT and, if so, the frequency of such a transfer. This is primarily because the methods currently employed for phylogenetic analysis (e.g., neighbor-joining, maximum likelihood, and maximum parsimony) of 16S rRNA genes assume point mutation-driven tree-shape evolution as an evolutionary model, which is intrinsically inappropriate to decipher the evolutionary history for genes driven by recombination. To address this issue, we applied a phylogenetic network analysis, which has been used previously for detection of genetic recombination in homologous alleles, to the 16S rRNA gene. We focused on the genus Enterobacter, whose phylogenetic relationships inferred by multi-locus sequence alignment analysis and 16S rRNA sequences are incompatible. All 10 complete genomic sequences were retrieved from the NCBI database, in which 71 16S rRNA genes were included. Neighbor-joining analysis demonstrated that the genes residing in the same genomes clustered, indicating the occurrence of intragenomic recombination. However, as suggested by the low bootstrap values, evolutionary relationships between the clusters were uncertain. We then applied phylogenetic network analysis to representative sequences from each cluster. We found three ancestral 16S rRNA groups; the others were likely created through recursive recombination between the ancestors and chimeric descendants. Despite the large sequence changes caused by the recombination events, the RNA secondary structures were conserved. Successive intergenomic and intragenomic recombination

  1. Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

    PubMed

    Beauparlant, Marc A; Drouin, Guy

    2014-02-01

    Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

  2. RNase MRP is required for entry of 35S precursor rRNA into the canonical processing pathway.

    PubMed

    Lindahl, Lasse; Bommankanti, Ananth; Li, Xing; Hayden, Lauren; Jones, Adrienne; Khan, Miriam; Oni, Tolulope; Zengel, Janice M

    2009-07-01

    RNase MRP is a nucleolar RNA-protein enzyme that participates in the processing of rRNA during ribosome biogenesis. Previous experiments suggested that RNase MRP makes a nonessential cleavage in the first internal transcribed spacer. Here we report experiments with new temperature-sensitive RNase MRP mutants in Saccharomyces cerevisiae that show that the abundance of all early intermediates in the processing pathway is severely reduced upon inactivation of RNase MRP. Transcription of rRNA continues unabated as determined by RNA polymerase run-on transcription, but the precursor rRNA transcript does not accumulate, and appears to be unstable. Taken together, these observations suggest that inactivation of RNase MRP blocks cleavage at sites A0, A1, A2, and A3, which in turn, prevents precursor rRNA from entering the canonical processing pathway (35S > 20S + 27S > 18S + 25S + 5.8S rRNA). Nevertheless, at least some cleavage at the processing site in the second internal transcribed spacer takes place to form an unusual 24S intermediate, suggesting that cleavage at C2 is not blocked. Furthermore, the long form of 5.8S rRNA is made in the absence of RNase MRP activity, but only in the presence of Xrn1p (exonuclease 1), an enzyme not required for the canonical pathway. We conclude that RNase MRP is a key enzyme for initiating the canonical processing of precursor rRNA transcripts, but alternative pathway(s) might provide a backup for production of small amounts of rRNA.

  3. A Novel Association between Two Trypanosome-Specific Factors and the Conserved L5-5S rRNA Complex

    PubMed Central

    Ciganda, Martin; Prohaska, Kimberly; Hellman, Kristina; Williams, Noreen

    2012-01-01

    P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are involved in and essential for ribosome biogenesis. The proteins interact with the 5S rRNA with nearly identical binding characteristics. We have shown that this interaction is achieved mainly through the LoopA region of the RNA, but P34 and P37 also protect the L5 binding site located on LoopC. We now provide evidence to show that these factors form a novel pre-ribosomal particle through interactions with both 5S rRNA and the L5 ribosomal protein. Further in silico and in vitro analysis of T. brucei L5 indicates a lower affinity for 5S rRNA than expected, based on other eukaryotic L5 proteins. We hypothesize that P34 and P37 complement L5 and bridge the interaction with 5S rRNA, stabilizing it and aiding in the early steps of ribosome biogenesis. PMID:22859981

  4. Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18

    PubMed Central

    Smirnov, Alexandre; Entelis, Nina; Martin, Robert P.; Tarassov, Ivan

    2011-01-01

    5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes. PMID:21685364

  5. [Investigation into the relationship between mitochondrial 12 S rRNA gene, tRNA gene and cytochrome oxidase Ⅱ gene variations and the risk of noise-induced hearing loss].

    PubMed

    Jiao, J; Gu, G Z; Chen, G S; Li, Y H; Zhang, H L; Yang, Q Y; Xu, X R; Zhou, W H; Wu, H; He, L H; Zheng, Y X; Yu, S F

    2017-01-06

    Objective: To explore the relationship between mitochondrial 12 S rRNA gene variation, tRNA gene variation and cytochrome oxidase Ⅱ gene point mutations and the risk of noise-induced hearing loss (NIHL). Methods: A nested case-control study was performed that followed a cohort of 7 445 noise-exposed workers in a steel factory in Henan province, China, from January 1, 2006 to December 31, 2015. Subjects whose average hearing threshold was more than 40 dB(A) in high frequency were defined as the case group, and subjects whose average hearing threshold was less than 35 dB(A) in high frequency and less than 25 dB (A) in speech frequency were defined as the control group. Subjects was recruited into the case group ( n =286) and the control group ( n= 286) according to gender, age, job category and time of exposure to noise, and a 1∶1 case-control study was carried out. We genotyped eight single nucleotide polymorphisms in the mitochondrial 12 S rRNA gene, the mitochondrial tRNA gene and the mitochondrial cytochrome oxidase Ⅱ gene using SNPscan high-throughput genotyping technology from the recruited subjects. The relationship between polymorphic sites and NIHL, adjusted for covariates, was analyzed using conditional logistic regression analysis, as were the subgroup data. Results: The average age of the recruited subjects was (40.3±8.1) years and the length of service exposure to noise was (18.6±8.9) years. The range of noise exposed levels and cumulative noise exposure (CNE) was 80.1- 93.4 dB (A) and 86.8- 107.9 dB (A) · year, respectively. For workers exposed to noise at a CNE level<98 dB (A) · year, smokers showed an increased risk of NIHL of 1.88 (1.16-3.05) compared with non-smokers; for workers exposed to noise at a CNE level ≥98 dB(A) · year, smokers showed an increased risk of NIHL of 2.53 (1.49- 4.30) compared with non-smokers. For workers exposed to noise at a CNE level<98 dB (A) · year, the results of univariate analysis and multifactor analysis

  6. Cordblood-Based High-Throughput Screening for Deafness Gene of 646 Newborns in Jinan Area of China

    PubMed Central

    Li, Shou-Xia; Chen, Ding-Li; Zhao, Su-Bin; Guo, Li-Li; Feng, Hai-Qin; Zhang, Xiao-Fang; Ping, Li-Li; Yang, Zhi-Ming; Sun, Cai-Xia

    2015-01-01

    Objectives Infants with slight/mild or late-onset hearing impairment might be missed in universal newborn hearing screening (UNHS). We identified the mutation hot spot of common deaf gene in the newborns in Jinan area population by screening the mutation spot with neonate cord blood, in order to make clear whether the neonate cord blood for screening is feasible. Methods Six hundred and forty-six newborns were subjected to both UNHS and genetic screening for deafness by using neonate cord blood. The newborn genetic screening targeted four deafness-associated genes, which were commonly found in the Chinese population including gap junction beta-2 protein (GJB2), gap junction beta-3 protein (GJB3), solute carrier family 26 member 4 (SLC26A4), and mtDNA 12S rRNA. The most common 20 spot mutations in 4 deaf genes were detected by MassARRAY iPLEX platform and mitochondrial 12S rRNA A1555G and C1494T mutations were sequenced using Sanger sequencing. Results Among the 646 newborns, 635 cases passed the UNHS and the other 11 cases (1.7%) did not. Of the 11 failures, two cases were found to carry homozygous GJB2 p.R143W pathogenic mutation, one case was found to have heterozygous GJB2 235delC mutation, and another one case carried heterozygous GJB3 p.R180X pathogenic mutation. Six hundred and thirty-five babies passed the newborn hearing screening, in which 25 babies were identified to carry pathogenic mutations, including 12 heterozygotes (1.9%) for GJB2 235delC, eight heterozygotes (1.3%) for SLC26A4 IVS7-2A>G, one heterozygote (0.2%) for p.R409H, two homozygotes (0.3%) for m.1494C>T, and two homozygotes (0.3%) for m.1555A>G. Conclusion Newborn genetic screening through the umbilical cord blood for common deafness-associated mutations may identify carriers sensitive to aminoglycoside antibiotic, and can effectively prevent or delay hearing loss occurs. PMID:26330914

  7. Quantitative Detection of the nosZ Gene, Encoding Nitrous Oxide Reductase, and Comparison of the Abundances of 16S rRNA, narG, nirK, and nosZ Genes in Soils

    PubMed Central

    Henry, S.; Bru, D.; Stres, B.; Hallet, S.; Philippot, L.

    2006-01-01

    Nitrous oxide (N2O) is an important greenhouse gas in the troposphere controlling ozone concentration in the stratosphere through nitric oxide production. In order to quantify bacteria capable of N2O reduction, we developed a SYBR green quantitative real-time PCR assay targeting the nosZ gene encoding the catalytic subunit of the nitrous oxide reductase. Two independent sets of nosZ primers flanking the nosZ fragment previously used in diversity studies were designed and tested (K. Kloos, A. Mergel, C. Rösch, and H. Bothe, Aust. J. Plant Physiol. 28:991-998, 2001). The utility of these real-time PCR assays was demonstrated by quantifying the nosZ gene present in six different soils. Detection limits were between 101 and 102 target molecules per reaction for all assays. Sequence analysis of 128 cloned quantitative PCR products confirmed the specificity of the designed primers. The abundance of nosZ genes ranged from 105 to 107 target copies g−1 of dry soil, whereas genes for 16S rRNA were found at 108 to 109 target copies g−1 of dry soil. The abundance of narG and nirK genes was within the upper and lower limits of the 16S rRNA and nosZ gene copy numbers. The two sets of nosZ primers gave similar gene copy numbers for all tested soils. The maximum abundance of nosZ and nirK relative to 16S rRNA was 5 to 6%, confirming the low proportion of denitrifiers to total bacteria in soils. PMID:16885263

  8. Identification of an Alternative rRNA Post-transcriptional Maturation of 26S rRNA in the Kingdom Fungi.

    PubMed

    Navarro-Ródenas, Alfonso; Carra, Andrea; Morte, Asunción

    2018-01-01

    Despite of the integrity of their RNA, some desert truffles present a non-canonical profile of rRNA where 3.3 kb is absent, 1.8 kb is clear and a band of 1.6 kb is observed. A similar rRNA profile was identified in organisms belonging to different life kingdoms, with the exception of the Kingdom Fungi, as a result of a split LSU rRNA called hidden gap . rRNA profiles of desert truffles were analyzed to verify the presence of the non-canonical profile. The RNA of desert truffles and yeast were blotted and hybridized with probes complementary to LSU extremes. RACE of LSU rRNA was carried out to determine the LSU rRNA breakage point. LSU rRNA of desert truffles presents a post-transcriptional cleavage of five nucleotides that generates a hidden gap located in domain D7. LSU splits into two molecules of 1.6 and 1.8 kb. Similar to other organisms, a UAAU tract, downstream of the breakage point, was identified. Phylogenetic comparison suggests that during fungi evolution mutations were introduced in the hypervariable D7 domain, resulting in a sequence that is specifically post-transcriptionally cleaved in some desert truffles.

  9. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    NASA Technical Reports Server (NTRS)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

    2003-01-01

    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  10. Detection of a mixed infection in a culture-negative brain abscess by broad-spectrum bacterial 16S rRNA gene PCR.

    PubMed

    Keller, Peter M; Rampini, Silvana K; Bloemberg, Guido V

    2010-06-01

    We describe the identification of two bacterial pathogens from a culture-negative brain abscess by the use of broad-spectrum 16S rRNA gene PCR. Simultaneous detection of Fusobacterium nucleatum and Porphyromonas endodontalis was possible due to a 24-bp length difference of their partially amplified 16S rRNA genes, which allowed separation by high-resolution polyacrylamide gel electrophoresis.

  11. SOT1, a pentatricopeptide repeat protein with a small MutS-related domain, is required for correct processing of plastid 23S-4.5S rRNA precursors in Arabidopsis thaliana.

    PubMed

    Wu, Wenjuan; Liu, Sheng; Ruwe, Hannes; Zhang, Delin; Melonek, Joanna; Zhu, Yajuan; Hu, Xupeng; Gusewski, Sandra; Yin, Ping; Small, Ian D; Howell, Katharine A; Huang, Jirong

    2016-03-01

    Ribosomal RNA processing is essential for plastid ribosome biogenesis, but is still poorly understood in higher plants. Here, we show that SUPPRESSOR OF THYLAKOID FORMATION1 (SOT1), a plastid-localized pentatricopeptide repeat (PPR) protein with a small MutS-related domain, is required for maturation of the 23S-4.5S rRNA dicistron. Loss of SOT1 function leads to slower chloroplast development, suppression of leaf variegation, and abnormal 23S and 4.5S processing. Predictions based on the PPR motif sequences identified the 5' end of the 23S-4.5S rRNA dicistronic precursor as a putative SOT1 binding site. This was confirmed by electrophoretic mobility shift assay, and by loss of the abundant small RNA 'footprint' associated with this site in sot1 mutants. We found that more than half of the 23S-4.5S rRNA dicistrons in sot1 mutants contain eroded and/or unprocessed 5' and 3' ends, and that the endonucleolytic cleavage product normally released from the 5' end of the precursor is absent in a sot1 null mutant. We postulate that SOT1 binding protects the 5' extremity of the 23S-4.5S rRNA dicistron from exonucleolytic attack, and favours formation of the RNA structure that allows endonucleolytic processing of its 5' and 3' ends. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

  12. The avilamycin resistance determinants AviRa and AviRb methylate 23S rRNA at the guanosine 2535 base and the uridine 2479 ribose.

    PubMed

    Treede, Irina; Jakobsen, Lene; Kirpekar, Finn; Vester, Birte; Weitnauer, Gabriele; Bechthold, Andreas; Douthwaite, Stephen

    2003-07-01

    Avilamycin is an orthosomycin antibiotic that has shown considerable potential for clinical use, although it is presently used as a growth promoter in animal feed. Avilamycin inhibits bacterial protein synthesis by binding to the 50S ribosomal subunit. The ribosomes of the producer strain, Streptomyces viridochromogenes Tü57, are protected from the drug by the action of three resistance factors located in the avilamycin biosynthetic gene cluster. Two of the resistance factors, aviRa and aviRb, encode rRNA methyltransferases that specifically target 23S rRNA. Recombinant AviRa and AviRb proteins retain their activity after purification, and both specifically methylate in vitro transcripts of 23S rRNA domain V. Reverse transcriptase primer extension indicated that AviRa is an N-methyltransferase that targets G2535 within helix 91 of the rRNA, whereas AviRb modified the 2'-O-ribose position of nucleotide U2479 within helix 89. MALDI mass spectrometry confirmed the exact positions of each of these modifications, and additionally established that a single methyl group is added at each nucleotide. Neither of these two nucleotides have previously been described as a target for enzymatic methylation. Molecular models of the 50S subunit crystal structure show that the N-1 of the G2535 base and the 2'-hydroxyl of U2479 are separated by approximately 10 A, a distance that can be spanned by avilamycin. In addition to defining new resistance mechanisms, these data refine our understanding of the probable ribosome contacts made by orthosomycins and of how these antibiotics inhibit protein synthesis.

  13. Horizontal Transfer of Segments of the 16S rRNA Genes between Species of the Streptococcus anginosus Group

    PubMed Central

    Schouls, Leo M.; Schot, Corrie S.; Jacobs, Jan A.

    2003-01-01

    The nature in variation of the 16S rRNA gene of members of the Streptococcus anginosus group was investigated by hybridization and DNA sequencing. A collection of 708 strains was analyzed by reverse line blot hybridization. This revealed the presence of distinct reaction patterns representing 11 different hybridization groups. The 16S rRNA genes of two strains of each hybridization group were sequenced to near-completion, and the sequence data confirmed the reverse line blot hybridization results. Closer inspection of the sequences revealed mosaic-like structures, strongly suggesting horizontal transfer of segments of the 16S rRNA gene between different species belonging to the Streptococcus anginosus group. Southern blot hybridization further showed that within a single strain all copies of the 16S rRNA gene had the same composition, indicating that the apparent mosaic structures were not PCR-induced artifacts. These findings indicate that the highly conserved rRNA genes are also subject to recombination and that these events may be fixed in the population. Such recombination may lead to the construction of incorrect phylogenetic trees based on the 16S rRNA genes. PMID:14645285

  14. Detection of bacterial 16S rRNA using a molecular beacon-based X sensor

    PubMed Central

    Gerasimova, Yulia V.; Kolpashchikov, Dmitry M.

    2012-01-01

    We demonstrate how a long structurally constrained RNA can be analyzed in homogeneous solution at ambient temperatures with high specificity using a sophisticated biosensor. The sensor consists of a molecular beacon probe as a signal reporter and two DNA adaptor strands, which have fragments complementary to the reporter and to the analyzed RNA. One adaptor strand uses its long RNA-binding arm to unwind the RNA secondary structure. Second adaptor strand with a short RNA-binding arm hybridizes only to a fully complementary site, thus providing high recognition specificity. Overall the three-component sensor and the target RNA form a four-stranded DNA crossover (X) structure. Using this sensor, E.coli 16S rRNA was detected in real time with the detection limit of ~ 0.17 nM. The high specificity of the analysis was proven by differentiating B.subtilus from E.coli 16S rRNA sequences. The sensor responds to the presence of the analyte within seconds. PMID:23021850

  15. Overexpression of a natural chloroplast-encoded antisense RNA in tobacco destabilizes 5S rRNA and retards plant growth.

    PubMed

    Hotto, Amber M; Huston, Zoe E; Stern, David B

    2010-09-29

    The roles of non-coding RNAs in regulating gene expression have been extensively studied in both prokaryotes and eukaryotes, however few reports exist as to their roles in organellar gene regulation. Evidence for accumulation of natural antisense RNAs (asRNAs) in chloroplasts comes from the expressed sequence tag database and cDNA libraries, while functional data have been largely obtained from artificial asRNAs. In this study, we used Nicotiana tabacum to investigate the effect on sense strand transcripts of overexpressing a natural chloroplast asRNA, AS5, which is complementary to the region which encodes the 5S rRNA and tRNAArg. AS5-overexpressing (AS5ox) plants obtained by chloroplast transformation exhibited slower growth and slightly pale green leaves. Analysis of AS5 transcripts revealed four distinct species in wild-type (WT) and AS5ox plants, and additional AS5ox-specific products. Of the corresponding sense strand transcripts, tRNAArg overaccumulated several-fold in transgenic plants whereas 5S rRNA was unaffected. However, run-on transcription showed that the 5S-trnR region was transcribed four-fold more in the AS5ox plants compared to WT, indicating that overexpression of AS5 was associated with decreased stability of 5S rRNA. In addition, polysome analysis of the transformants showed less 5S rRNA and rbcL mRNA associated with ribosomes. Our results suggest that AS5 can modulate 5S rRNA levels, giving it the potential to affect Chloroplast translation and plant growth. More globally, overexpression of asRNAs via chloroplast transformation may be a useful strategy for defining their functions.

  16. A comparative study of COI and 16 S rRNA genes for DNA barcoding of cultivable carps in India.

    PubMed

    Mohanty, Mausumee; Jayasankar, Pallipuram; Sahoo, Lakshman; Das, Paramananda

    2015-02-01

    The 5' region of the mitochondrial DNA gene cytochrome c oxidase subunit I (COI) is the standard marker for DNA barcoding. However, 16 S rRNA has also been advocated for DNA barcoding in many animal species. Herein, we directly compare the usefulness of COI and 16 S rRNA in discriminating six cultivable carp species: Labeo rohita, Catla catla, Cirrhinus mrigala, Labeo fimbriatus, Labeo bata and Cirrhinus reba from India. Analysis of partial sequences of these two gene fragments from 171 individuals indicated close genetic relationship between Catla catla and Labeo rohita. The results of the present study indicated COI to be more useful than 16 S rRNA for DNA barcoding of Indian carps.

  17. Acquisition of 16S rRNA methylase gene in Pseudomonas aeruginosa.

    PubMed

    Yokoyama, Keiko; Doi, Yohei; Yamane, Kunikazu; Kurokawa, Hiroshi; Shibata, Naohiro; Shibayama, Keigo; Yagi, Tetsuya; Kato, Haru; Arakawa, Yoshichika

    2003-12-06

    Bacteria develop resistance to aminoglycosides by producing aminoglycoside-modifying enzymes such as acetyltransferase, phosphorylase, and adenyltransferase. These enzymes, however, cannot confer consistent resistance to various aminoglycosides because of their substrate specificity. Notwithstanding, a Pseudomonas aeruginosa strain AR-2 showing high-level resistance (minimum inhibitory concentration >1024 mg/L) to various aminoglycosides was isolated clinically. We aimed to clone and characterise the genetic determinant of this resistance. We used conventional methods for DNA manipulation, susceptibility testing, and gene analyses to clone and characterise the genetic determinant of the resistance seen. PCR detection of the gene was also done on a stock of P aeruginosa strains that were isolated clinically since 1997. An aminoglycoside-resistance gene, designated rmtA, was identified in P aeruginosa AR-2. The Escherichia coli transformant and transconjugant harbouring the rmtA gene showed very high-level resistance to various aminoglycosides, including amikacin, tobramycin, isepamicin, arbekacin, kanamycin, and gentamicin. The 756-bp nucleotide rmtA gene encoded a protein, RmtA. This protein showed considerable similarity to the 16S rRNA methylases of aminoglycoside-producing actinomycetes, which protect bacterial 16S rRNA from intrinsic aminoglycosides by methylation. Incorporation of radiolabelled methyl groups into the 30S ribosome was detected in the presence of RmtA. Of 1113 clinically isolated P aeruginosa strains, nine carried the rmtA gene, as shown by PCR analyses. Our findings strongly suggest intergeneric lateral gene transfer of 16S rRNA methylase gene from some aminoglycoside-producing microorganisms to P aeruginosa. Further dissemination of the rmtA gene in nosocomial bacteria could be a matter of concern in the future.

  18. Comparative analysis of bacteria associated with different mosses by 16S rRNA and 16S rDNA sequencing.

    PubMed

    Tian, Yang; Li, Yan Hong

    2017-01-01

    To understand the differences of the bacteria associated with different mosses, a phylogenetic study of bacterial communities in three mosses was carried out based on 16S rDNA and 16S rRNA sequencing. The mosses used were Hygroamblystegium noterophilum, Entodon compressus and Grimmia montana, representing hygrophyte, shady plant and xerophyte, respectively. In total, the operational taxonomic units (OTUs), richness and diversity were different regardless of the moss species and the library level. All the examined 1183 clones were assigned to 248 OTUs, 56 genera were assigned in rDNA libraries and 23 genera were determined at the rRNA level. Proteobacteria and Bacteroidetes were considered as the most dominant phyla in all the libraries, whereas abundant Actinobacteria and Acidobacteria were detected in the rDNA library of Entodon compressus and approximately 24.7% clones were assigned to Candidate division TM7 in Grimmia montana at rRNA level. The heatmap showed the bacterial profiles derived from rRNA and rDNA were partly overlapping. However, the principle component analysis of all the profiles derived from rDNA showed sharper differences between the different mosses than that of rRNA-based profiles. This suggests that the metabolically active bacterial compositions in different mosses were more phylogenetically similar and the differences of the bacteria associated with different mosses were mainly detected at the rDNA level. Obtained results clearly demonstrate that combination of 16S rDNA and 16S rRNA sequencing is preferred approach to have a good understanding on the constitution of the microbial communities in mosses. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Synthetic spike-in standards for high-throughput 16S rRNA gene amplicon sequencing

    PubMed Central

    Tourlousse, Dieter M.; Yoshiike, Satowa; Ohashi, Akiko; Matsukura, Satoko; Noda, Naohiro

    2017-01-01

    Abstract High-throughput sequencing of 16S rRNA gene amplicons (16S-seq) has become a widely deployed method for profiling complex microbial communities but technical pitfalls related to data reliability and quantification remain to be fully addressed. In this work, we have developed and implemented a set of synthetic 16S rRNA genes to serve as universal spike-in standards for 16S-seq experiments. The spike-ins represent full-length 16S rRNA genes containing artificial variable regions with negligible identity to known nucleotide sequences, permitting unambiguous identification of spike-in sequences in 16S-seq read data from any microbiome sample. Using defined mock communities and environmental microbiota, we characterized the performance of the spike-in standards and demonstrated their utility for evaluating data quality on a per-sample basis. Further, we showed that staggered spike-in mixtures added at the point of DNA extraction enable concurrent estimation of absolute microbial abundances suitable for comparative analysis. Results also underscored that template-specific Illumina sequencing artifacts may lead to biases in the perceived abundance of certain taxa. Taken together, the spike-in standards represent a novel bioanalytical tool that can substantially improve 16S-seq-based microbiome studies by enabling comprehensive quality control along with absolute quantification. PMID:27980100

  20. Transcript levels, alternative splicing and proteolytic cleavage of TFIIIA control 5S rRNA accumulation during Arabidopsis thaliana development.

    PubMed

    Layat, Elodie; Cotterell, Sylviane; Vaillant, Isabelle; Yukawa, Yasushi; Tutois, Sylvie; Tourmente, Sylvette

    2012-07-01

    Ribosome biogenesis is critical for eukaryotic cells and requires coordinated synthesis of the protein and rRNA moieties of the ribosome, which are therefore highly regulated. 5S ribosomal RNA, an essential component of the large ribosomal subunit, is transcribed by RNA polymerase III and specifically requires transcription factor IIIA (TFIIIA). To obtain insight into the regulation of 5S rRNA transcription, we have investigated the expression of 5S rRNA and the exon-skipped (ES) and exon-including (EI) TFIIIA transcripts, two transcript isoforms that result from alternative splicing of the TFIIIA gene, and TFIIIA protein amounts with respect to requirements for 5S rRNA during development. We show that 5S rRNA quantities are regulated through distinct but complementary mechanisms operating through transcriptional and post-transcriptional control of TFIIIA transcripts as well as at the post-translational level through proteolytic cleavage of the TFIIIA protein. During the reproductive phase, high expression of the TFIIIA gene together with low proteolytic cleavage contributes to accumulation of functional, full-length TFIIIA protein, and results in 5S rRNA accumulation in the seed. In contrast, just after germination, the levels of TFIIIA-encoding transcripts are low and stable. Full-length TFIIIA protein is undetectable, and the level of 5S rRNA stored in the embryo progressively decreases. After day 4, in correlation with the reorganization of 5S rDNA chromatin to a mature state, full-length TFIIIA protein with transcriptional activity accumulates and permits de novo transcription of 5S rRNA. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

  1. Development of a simple and practical method of discrimination between Vibrio furnissii and V. fluvialis based on single-nucleotide polymorphisms of 16S rRNA genes observed in V. furnissii but not in V. fluvialis.

    PubMed

    Takajo, Ichiro; Yamada, Akiteru; Umeki, Kazumi; Saeki, Yuji; Hashikura, Yuuki; Yamamoto, Ikuo; Umekita, Kunihiko; Urayama-Kawano, Midori; Yamasaki, Shogo; Taniguchi, Takako; Misawa, Naoaki; Okayama, Akihiko

    2018-01-01

    Vibrio furnissii and V. fluvialis are closely related, the discrimination of which by conventional biochemical assay remains a challenge. Investigation of the sequence of the 16S rRNA genes in a clinical isolate of V. furnissii by visual inspection of a sequencing electropherogram revealed two sites of single-nucleotide polymorphisms (SNPs; positions 460 A/G and 1261 A/G) in these genes. A test of 12 strains each of V. fluvialis and V. furnissii revealed these SNPs to be common in V. furnissii but not in V. fluvialis. Divergence of SNP frequency was observed among the strains of V. furnissii tested. Because the SNPs described in V. furnissii produce a difference in the target sequence of restriction enzymes, a combination of polymerase chain reaction (PCR) of the 16S rRNA genes using conventional primers and restriction fragment length polymorphism analysis using Eco RV and Eae I was shown to discriminate between V. fluvialis and V. furnissii. This method is simple and alleviates the need for expensive equipment or primer sets specific to these bacteria. Therefore, we believe that this method can be useful, alongside specific PCR and mass spectrometry, when there is a need to discriminate between V. fluvialis and V. furnissii. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Discrimination of Bacillus anthracis from closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microchips

    DOEpatents

    Bavykin, Sergei G.; Mirzabekova, legal representative, Natalia V.; Mirzabekov, deceased, Andrei D.

    2007-12-04

    The present invention relates to methods and compositions for using nucleotide sequence variations of 16S and 23S rRNA within the B. cereus group to discriminate a highly infectious bacterium B. anthracis from closely related microorganisms. Sequence variations in the 16S and 23S rRNA of the B. cereus subgroup including B. anthracis are utilized to construct an array that can detect these sequence variations through selective hybridizations and discriminate B. cereus group that includes B. anthracis. Discrimination of single base differences in rRNA was achieved with a microchip during analysis of B. cereus group isolates from both single and in mixed samples, as well as identification of polymorphic sites. Successful use of a microchip to determine the appropriate subgroup classification using eight reference microorganisms from the B. cereus group as a study set, was demonstrated.

  3. 16S rRNA Gene Sequence Analysis of Drinking Water Using RNA and DNA Extracts as Targets for Clone Library Development

    EPA Science Inventory

    The bacterial composition of chlorinated drinking water was analyzed using 16S rRNA gene clone libraries derived from DNA extracts of 12 samples and compared to clone libraries previously generated using RNA extracts from the same samples. Phylogenetic analysis of 761 DNA-based ...

  4. Rapid identification of probiotic Lactobacillus species by multiplex PCR using species-specific primers based on the region extending from 16S rRNA through 23S rRNA.

    PubMed

    Kwon, Hyuk-Sang; Yang, Eun-Hee; Yeon, Seung-Woo; Kang, Byoung-Hwa; Kim, Tae-Yong

    2004-10-15

    This study aimed to develop a novel multiplex polymerase chain reaction (PCR) primer set for the identification of seven probiotic Lactobacillus species such as Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus rhamnosus. The primer set, comprising of seven specific and two conserved primers, was derived from the integrated sequences of 16S and 23S rRNA genes and their rRNA intergenic spacer region of each species. It was able to identify the seven target species with 93.6% accuracy, which exceeds that of the general biochemical methods. The phylogenetic analyses, using 16S rDNA sequences of the probiotic isolates, also provided further support that the results from the multiplex PCR assay were trustworthy. Taken together, we suggest that the multiplex primer set is an efficient tool for simple, rapid and reliable identification of seven Lactobacillus species.

  5. 17 CFR 240.12g-1 - Exemption from section 12(g).

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... pursuant to section 12(g)(1) if on the last day of its most recent fiscal year the issuer had total assets...). 240.12g-1 Section 240.12g-1 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION... Securities Exchange Act of 1934 Extensions and Temporary Exemptions; Definitions § 240.12g-1 Exemption from...

  6. 17 CFR 240.12g-1 - Exemption from section 12(g).

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... pursuant to section 12(g)(1) if on the last day of its most recent fiscal year the issuer had total assets...). 240.12g-1 Section 240.12g-1 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION... Securities Exchange Act of 1934 Extensions and Temporary Exemptions; Definitions § 240.12g-1 Exemption from...

  7. 17 CFR 240.12g-1 - Exemption from section 12(g).

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... pursuant to section 12(g)(1) if on the last day of its most recent fiscal year the issuer had total assets...). 240.12g-1 Section 240.12g-1 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION... Securities Exchange Act of 1934 Extensions and Temporary Exemptions; Definitions § 240.12g-1 Exemption from...

  8. 17 CFR 240.12g-1 - Exemption from section 12(g).

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... pursuant to section 12(g)(1) if on the last day of its most recent fiscal year the issuer had total assets...). 240.12g-1 Section 240.12g-1 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION... Securities Exchange Act of 1934 Extensions and Temporary Exemptions; Definitions § 240.12g-1 Exemption from...

  9. 17 CFR 240.12g-1 - Exemption from section 12(g).

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... pursuant to section 12(g)(1) if on the last day of its most recent fiscal year the issuer had total assets...). 240.12g-1 Section 240.12g-1 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION... Securities Exchange Act of 1934 Extensions and Temporary Exemptions; Definitions § 240.12g-1 Exemption from...

  10. Directed hydroxyl radical probing of the rRNA neighborhood of ribosomal protein S13 using tethered Fe(II).

    PubMed Central

    Heilek, G M; Noller, H F

    1996-01-01

    Directed hydroxyl radical probing was used to probe the rRNA neighborhood around protein S13 in the 30S ribosomal subunit. The unique cysteine at position 84 of S13 served as a tethering site for attachment of Fe(II)-1-(p-bromoacetamidobenzyl)-EDTA. Derivatized S13 (Fe-C84-S13) was then assembled into 30S ribosomal subunits by in vitro reconstitution with 16S rRNA and a mixture of the remaining 30S subunit proteins. Hydroxyl radicals generated from the tethered Fe(II) resulted in cleavage of the RNA backbone in two localized regions of the 3' major domain of 16S rRNA. One region spans nt 1308-1333 and is close to a site previously crosslinked to S13. A second set of cleavages is found in the 950/1230 helix. Both regions have been implicated in binding of S13 by previous chemical footprinting studies using base-specific chemical probes and solution-based hydroxyl radical probing. These results place both regions of 16S rRNA in proximity to position C84 of S13 in the three-dimensional structure of the 30S ribosomal subunit. PMID:8718688

  11. Rifaximin Reduces Markers of Inflammation and Bacterial 16S rRNA in Zambian Adults with Hepatosplenic Schistosomiasis: A Randomized Control Trial.

    PubMed

    Sinkala, Edford; Zyambo, Kanekwa; Besa, Ellen; Kaonga, Patrick; Nsokolo, Bright; Kayamba, Violet; Vinikoor, Michael; Zulu, Rabison; Bwalya, Martin; Foster, Graham R; Kelly, Paul

    2018-04-01

    Cirrhosis is the dominant cause of portal hypertension globally but may be overshadowed by hepatosplenic schistosomiasis (HSS) in the tropics. In Zambia, schistosomiasis seroprevalence can reach 88% in endemic areas. Bacterial translocation (BT) drives portal hypertension in cirrhosis contributing to mortality but remains unexplored in HSS. Rifaximin, a non-absorbable antibiotic may reduce BT. We aimed to explore the influence of rifaximin on BT, inflammation, and fibrosis in HSS. In this phase II open-label trial (ISRCTN67590499), 186 patients with HSS in Zambia were evaluated and 85 were randomized to standard care with or without rifaximin for 42 days. Changes in markers of inflammation, BT, and fibrosis were the primary outcomes. BT was measured using plasma 16S rRNA, lipopolysaccharide-binding protein, and lipopolysaccharide, whereas hyaluronan was used to measure fibrosis. Tumor necrosis factor receptor 1 (TNFR1) and soluble cluster of differentiation 14 (sCD14) assessed inflammation. 16S rRNA reduced from baseline (median 146 copies/µL, interquartile range [IQR] 9, 537) to day 42 in the rifaximin group (median 63 copies/µL, IQR 12, 196), P < 0.01. The rise in sCD14 was lower ( P < 0.01) in the rifaximin group (median rise 122 ng/mL, IQR-184, 783) than in the non-rifaximin group (median rise 832 ng/mL, IQR 530, 967). TNFR1 decreased ( P < 0.01) in the rifaximin group (median -39 ng/mL IQR-306, 563) but increased in the non-rifaximin group (median 166 ng/mL, IQR 3, 337). Other markers remained unaffected. Rifaximin led to a reduction of inflammatory markers and bacterial 16S rRNA which may implicate BT in the inflammation in HSS.

  12. Rifaximin Reduces Markers of Inflammation and Bacterial 16S rRNA in Zambian Adults with Hepatosplenic Schistosomiasis: A Randomized Control Trial

    PubMed Central

    Sinkala, Edford; Zyambo, Kanekwa; Besa, Ellen; Kaonga, Patrick; Nsokolo, Bright; Kayamba, Violet; Vinikoor, Michael; Zulu, Rabison; Bwalya, Martin; Foster, Graham R.; Kelly, Paul

    2018-01-01

    Abstract. Cirrhosis is the dominant cause of portal hypertension globally but may be overshadowed by hepatosplenic schistosomiasis (HSS) in the tropics. In Zambia, schistosomiasis seroprevalence can reach 88% in endemic areas. Bacterial translocation (BT) drives portal hypertension in cirrhosis contributing to mortality but remains unexplored in HSS. Rifaximin, a non-absorbable antibiotic may reduce BT. We aimed to explore the influence of rifaximin on BT, inflammation, and fibrosis in HSS. In this phase II open-label trial (ISRCTN67590499), 186 patients with HSS in Zambia were evaluated and 85 were randomized to standard care with or without rifaximin for 42 days. Changes in markers of inflammation, BT, and fibrosis were the primary outcomes. BT was measured using plasma 16S rRNA, lipopolysaccharide-binding protein, and lipopolysaccharide, whereas hyaluronan was used to measure fibrosis. Tumor necrosis factor receptor 1 (TNFR1) and soluble cluster of differentiation 14 (sCD14) assessed inflammation. 16S rRNA reduced from baseline (median 146 copies/µL, interquartile range [IQR] 9, 537) to day 42 in the rifaximin group (median 63 copies/µL, IQR 12, 196), P < 0.01. The rise in sCD14 was lower (P < 0.01) in the rifaximin group (median rise 122 ng/mL, IQR-184, 783) than in the non-rifaximin group (median rise 832 ng/mL, IQR 530, 967). TNFR1 decreased (P < 0.01) in the rifaximin group (median -39 ng/mL IQR-306, 563) but increased in the non-rifaximin group (median 166 ng/mL, IQR 3, 337). Other markers remained unaffected. Rifaximin led to a reduction of inflammatory markers and bacterial 16S rRNA which may implicate BT in the inflammation in HSS. PMID:29436337

  13. A framework for establishing predictive relationships between specific bacterial 16S rRNA sequence abundances and biotransformation rates.

    PubMed

    Helbling, Damian E; Johnson, David R; Lee, Tae Kwon; Scheidegger, Andreas; Fenner, Kathrin

    2015-03-01

    The rates at which wastewater treatment plant (WWTP) microbial communities biotransform specific substrates can differ by orders of magnitude among WWTP communities. Differences in taxonomic compositions among WWTP communities may predict differences in the rates of some types of biotransformations. In this work, we present a novel framework for establishing predictive relationships between specific bacterial 16S rRNA sequence abundances and biotransformation rates. We selected ten WWTPs with substantial variation in their environmental and operational metrics and measured the in situ ammonia biotransformation rate constants in nine of them. We isolated total RNA from samples from each WWTP and analyzed 16S rRNA sequence reads. We then developed multivariate models between the measured abundances of specific bacterial 16S rRNA sequence reads and the ammonia biotransformation rate constants. We constructed model scenarios that systematically explored the effects of model regularization, model linearity and non-linearity, and aggregation of 16S rRNA sequences into operational taxonomic units (OTUs) as a function of sequence dissimilarity threshold (SDT). A large percentage (greater than 80%) of model scenarios resulted in well-performing and significant models at intermediate SDTs of 0.13-0.14 and 0.26. The 16S rRNA sequences consistently selected into the well-performing and significant models at those SDTs were classified as Nitrosomonas and Nitrospira groups. We then extend the framework by applying it to the biotransformation rate constants of ten micropollutants measured in batch reactors seeded with the ten WWTP communities. We identified phylogenetic groups that were robustly selected into all well-performing and significant models constructed with biotransformation rates of isoproturon, propachlor, ranitidine, and venlafaxine. These phylogenetic groups can be used as predictive biomarkers of WWTP microbial community activity towards these specific

  14. IMNGS: A comprehensive open resource of processed 16S rRNA microbial profiles for ecology and diversity studies.

    PubMed

    Lagkouvardos, Ilias; Joseph, Divya; Kapfhammer, Martin; Giritli, Sabahattin; Horn, Matthias; Haller, Dirk; Clavel, Thomas

    2016-09-23

    The SRA (Sequence Read Archive) serves as primary depository for massive amounts of Next Generation Sequencing data, and currently host over 100,000 16S rRNA gene amplicon-based microbial profiles from various host habitats and environments. This number is increasing rapidly and there is a dire need for approaches to utilize this pool of knowledge. Here we created IMNGS (Integrated Microbial Next Generation Sequencing), an innovative platform that uniformly and systematically screens for and processes all prokaryotic 16S rRNA gene amplicon datasets available in SRA and uses them to build sample-specific sequence databases and OTU-based profiles. Via a web interface, this integrative sequence resource can easily be queried by users. We show examples of how the approach allows testing the ecological importance of specific microorganisms in different hosts or ecosystems, and performing targeted diversity studies for selected taxonomic groups. The platform also offers a complete workflow for de novo analysis of users' own raw 16S rRNA gene amplicon datasets for the sake of comparison with existing data. IMNGS can be accessed at www.imngs.org.

  15. Synthetic spike-in standards for high-throughput 16S rRNA gene amplicon sequencing.

    PubMed

    Tourlousse, Dieter M; Yoshiike, Satowa; Ohashi, Akiko; Matsukura, Satoko; Noda, Naohiro; Sekiguchi, Yuji

    2017-02-28

    High-throughput sequencing of 16S rRNA gene amplicons (16S-seq) has become a widely deployed method for profiling complex microbial communities but technical pitfalls related to data reliability and quantification remain to be fully addressed. In this work, we have developed and implemented a set of synthetic 16S rRNA genes to serve as universal spike-in standards for 16S-seq experiments. The spike-ins represent full-length 16S rRNA genes containing artificial variable regions with negligible identity to known nucleotide sequences, permitting unambiguous identification of spike-in sequences in 16S-seq read data from any microbiome sample. Using defined mock communities and environmental microbiota, we characterized the performance of the spike-in standards and demonstrated their utility for evaluating data quality on a per-sample basis. Further, we showed that staggered spike-in mixtures added at the point of DNA extraction enable concurrent estimation of absolute microbial abundances suitable for comparative analysis. Results also underscored that template-specific Illumina sequencing artifacts may lead to biases in the perceived abundance of certain taxa. Taken together, the spike-in standards represent a novel bioanalytical tool that can substantially improve 16S-seq-based microbiome studies by enabling comprehensive quality control along with absolute quantification. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. 16S rRNA beacons for bacterial monitoring during human space missions.

    PubMed

    Larios-Sanz, Maia; Kourentzi, Katerina D; Warmflash, David; Jones, Jeffrey; Pierson, Duane L; Willson, Richard C; Fox, George E

    2007-04-01

    Microorganisms are unavoidable in space environments and their presence has, at times, been a source of problems. Concerns about disease during human space missions are particularly important considering the significant changes the immune system incurs during spaceflight and the history of microbial contamination aboard the Mir space station. Additionally, these contaminants may have adverse effects on instrumentation and life-support systems. A sensitive, highly specific system to detect, characterize, and monitor these microbial populations is essential. Herein we describe a monitoring approach that uses 16S rRNA targeted molecular beacons to successfully detect several specific bacterial groupings. This methodology will greatly simplify in-flight monitoring by minimizing sample handling and processing. We also address and provide solutions to target accessibility problems encountered in hybridizations that target 16S rRNA.

  17. Development of an Analysis Pipeline Characterizing Multiple Hypervariable Regions of 16S rRNA Using Mock Samples.

    PubMed

    Barb, Jennifer J; Oler, Andrew J; Kim, Hyung-Suk; Chalmers, Natalia; Wallen, Gwenyth R; Cashion, Ann; Munson, Peter J; Ames, Nancy J

    2016-01-01

    There is much speculation on which hypervariable region provides the highest bacterial specificity in 16S rRNA sequencing. The optimum solution to prevent bias and to obtain a comprehensive view of complex bacterial communities would be to sequence the entire 16S rRNA gene; however, this is not possible with second generation standard library design and short-read next-generation sequencing technology. This paper examines a new process using seven hypervariable or V regions of the 16S rRNA (six amplicons: V2, V3, V4, V6-7, V8, and V9) processed simultaneously on the Ion Torrent Personal Genome Machine (Life Technologies, Grand Island, NY). Four mock samples were amplified using the 16S Ion Metagenomics Kit™ (Life Technologies) and their sequencing data is subjected to a novel analytical pipeline. Results are presented at family and genus level. The Kullback-Leibler divergence (DKL), a measure of the departure of the computed from the nominal bacterial distribution in the mock samples, was used to infer which region performed best at the family and genus levels. Three different hypervariable regions, V2, V4, and V6-7, produced the lowest divergence compared to the known mock sample. The V9 region gave the highest (worst) average DKL while the V4 gave the lowest (best) average DKL. In addition to having a high DKL, the V9 region in both the forward and reverse directions performed the worst finding only 17% and 53% of the known family level and 12% and 47% of the genus level bacteria, while results from the forward and reverse V4 region identified all 17 family level bacteria. The results of our analysis have shown that our sequencing methods using 6 hypervariable regions of the 16S rRNA and subsequent analysis is valid. This method also allowed for the assessment of how well each of the variable regions might perform simultaneously. Our findings will provide the basis for future work intended to assess microbial abundance at different time points throughout a

  18. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

    PubMed Central

    Olson, Nathan D.; Lund, Steven P.; Zook, Justin M.; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S.; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B.

    2015-01-01

    This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030

  19. Vesalius Revised. His Annotations to the 1555 Fabrica1

    PubMed Central

    Nutton, Vivian

    2012-01-01

    The De humani corporis fabrica [The Fabric of the Human Body], Basle, 1543, of Andreas Vesalius is deservedly famous as the first modern book of anatomy. A second edition was published in Basle in 1555, but little is known of Vesalius’ activities after that date. This article discusses a recent find: Vesalius’ own copy of the 1555 edition, heavily annotated in preparation for a never published third edition. Vesalius made hundreds of changes to the second edition, the great majority being stylistic, altering the Latin words but not the overall meaning. There are also changes to the plates to give greater clarity or to correct mistakes by the original block-cutter. There is little new anatomical material, although Vesalius continued to meditate about what he had earlier discovered. He shows no sign of being acquainted with the findings of others, like Colombo or Falloppia, that were published after he had moved his residence from Brussels to Spain in summer 1559, perhaps leaving this volume behind. The number of annotations shows Vesalius’ passionate concern not only for accuracy but also for the most effective way of proclaiming his new anatomical message. PMID:23112379

  20. Phylogenetic relatedness determined between antibiotic resistance and 16S rRNA genes in actinobacteria.

    PubMed

    Sagova-Mareckova, Marketa; Ulanova, Dana; Sanderova, Petra; Omelka, Marek; Kamenik, Zdenek; Olsovska, Jana; Kopecky, Jan

    2015-04-01

    Distribution and evolutionary history of resistance genes in environmental actinobacteria provide information on intensity of antibiosis and evolution of specific secondary metabolic pathways at a given site. To this day, actinobacteria producing biologically active compounds were isolated mostly from soil but only a limited range of soil environments were commonly sampled. Consequently, soil remains an unexplored environment in search for novel producers and related evolutionary questions. Ninety actinobacteria strains isolated at contrasting soil sites were characterized phylogenetically by 16S rRNA gene, for presence of erm and ABC transporter resistance genes and antibiotic production. An analogous analysis was performed in silico with 246 and 31 strains from Integrated Microbial Genomes (JGI_IMG) database selected by the presence of ABC transporter genes and erm genes, respectively. In the isolates, distances of erm gene sequences were significantly correlated to phylogenetic distances based on 16S rRNA genes, while ABC transporter gene distances were not. The phylogenetic distance of isolates was significantly correlated to soil pH and organic matter content of isolation sites. In the analysis of JGI_IMG datasets the correlation between phylogeny of resistance genes and the strain phylogeny based on 16S rRNA genes or five housekeeping genes was observed for both the erm genes and ABC transporter genes in both actinobacteria and streptomycetes. However, in the analysis of sequences from genomes where both resistance genes occurred together the correlation was observed for both ABC transporter and erm genes in actinobacteria but in streptomycetes only in the erm gene. The type of erm resistance gene sequences was influenced by linkage to 16S rRNA gene sequences and site characteristics. The phylogeny of ABC transporter gene was correlated to 16S rRNA genes mainly above the genus level. The results support the concept of new specific secondary metabolite

  1. The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition.

    PubMed

    Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

    2017-01-17

    Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.

  2. Detection of a Mixed Infection in a Culture-Negative Brain Abscess by Broad-Spectrum Bacterial 16S rRNA Gene PCR ▿ †

    PubMed Central

    Keller, Peter M.; Rampini, Silvana K.; Bloemberg, Guido V.

    2010-01-01

    We describe the identification of two bacterial pathogens from a culture-negative brain abscess by the use of broad-spectrum 16S rRNA gene PCR. Simultaneous detection of Fusobacterium nucleatum and Porphyromonas endodontalis was possible due to a 24-bp length difference of their partially amplified 16S rRNA genes, which allowed separation by high-resolution polyacrylamide gel electrophoresis. PMID:20392909

  3. Complete mitochondrial genome of freshwater shark Wallago attu (Bloch & Schneider) from Indus River Sindh, Pakistan.

    PubMed

    Laghari, Muhammad Younis; Lashari, Punhal; Xu, Peng; Zhao, Zixia; Jiang, Li; Narejo, Naeem Tariq; Xin, Baoping; Sun, Xiaowen; Zhang, Yan

    2016-01-01

    Complete mitochondrial genome of fresh water giant catfish, Wallago attu, was isolated by LA PCR (TakaRa LAtaq, Dalian, China); and sequenced by Sanger's method to obtain the complete mitochondrial genome. The complete mitogenome was 15,639 bp in length and contains 13 typical vertebrate protein-coding genes, 2 rRNA and 22 tRNA genes. The whole genome base composition was estimated to be 31.17% A, 28.15% C, 15.55% G and 25.12% T. The complete mitochondrial genome of catfish, W. attu, provides the fundamental tools for genetic breeding.

  4. Phylogenetic position of the enigmatic clawless eutardigrade genus Apodibius Dastych, 1983 (Tardigrada), based on 18S and 28S rRNA sequence data from its type species A. confusus.

    PubMed

    Dabert, Miroslawa; Dastych, Hieronymus; Hohberg, Karin; Dabert, Jacek

    2014-01-01

    The systematics of Eutardigrada, the largest lineage among the three classes of the phylum Tardigrada, is based mainly on the morphology of the leg claws and of the buccal apparatus. However, three members of the rarely recorded and poorly known limno-terrestrial eutardigrade genus Apodibius have no claws on their strongly reduced legs, a unique character among all tardigrades. This absence of all claws makes the systematic position of Apodibius one of the most enigmatic among the whole class. Until now all known associates of the genus Apodibius have been located in the incertae sedis species group or, quite recently, included into the Necopinatidae family. In the present study, phylogenetic analyses of 18S and 28S rRNA sequence data from 31 tardigrade species representing four parachelan superfamilies (Isohypsibioidea, Hypsibioidea, Macrobiotoidea, Eohypsibioidea), the apochelan Milnesium tardigradum, and the type species of the genus Apodibius, A. confusus, indicated close relationship of the Apodibius with tardigrade species recently included in the superfamily Isohypsibioidea. This result was well-supported and consistent across all markers (separate 18S rRNA, 28S rRNA, and combined 18S rRNA+28S rRNA datasets) and methods (MP, ML) applied. Copyright © 2013 Elsevier Inc. All rights reserved.

  5. Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification.

    PubMed

    Ziesemer, Kirsten A; Mann, Allison E; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T; Brandt, Bernd W; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A; MacDonald, Sandy J; Thomas, Gavin H; Collins, Matthew J; Lewis, Cecil M; Hofman, Corinne; Warinner, Christina

    2015-11-13

    To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341-534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions.

  6. Sequence of the chloroplast 16S rRNA gene and its surrounding regions of Chlamydomonas reinhardii.

    PubMed Central

    Dron, M; Rahire, M; Rochaix, J D

    1982-01-01

    The sequence of a 2 kb DNA fragment containing the chloroplast 16S ribosomal RNA gene from Chlamydomonas reinhardii and its flanking regions has been determined. The algal 16S rRNA sequence (1475 nucleotides) and secondary structure are highly related to those found in bacteria and in the chloroplasts of higher plants. In contrast, the flanking regions are very different. In C. reinhardii the 16S rRNA gene is surrounded by AT rich segments of about 180 bases, which are followed by a long stretch of complementary bases separated from each other by 1833 nucleotides. It is likely that these structures play an important role in the folding and processing of the precursor of 16S rRNA. The primary and secondary structures of the binding sites of two ribosomal proteins in the 16SrRNAs of E. coli and C. reinhardii are considerably related. Images PMID:6296784

  7. Tomato (Solanum lycopersicum) variety discrimination and hybridization analysis based on the 5S rRNA region.

    PubMed

    Sun, Yan-Lin; Kang, Ho-Min; Kim, Young-Sik; Baek, Jun-Pill; Zheng, Shi-Lin; Xiang, Jin-Jun; Hong, Soon-Kwan

    2014-05-04

    The tomato ( Solanum lycopersicum ) is a major vegetable crop worldwide. To satisfy popular demand, more than 500 tomato varieties have been bred. However, a clear variety identification has not been found. Thorough understanding of the phylogenetic relationship and hybridization information of tomato varieties is very important for further variety breeding. Thus, in this study, we collected 26 tomato varieties and attempted to distinguish them based on the 5S rRNA region, which is widely used in the determination of phylogenetic relations. Sequence analysis of the 5S rRNA region suggested that a large number of nucleotide variations exist among tomato varieties. These variable nucleotide sites were also informative regarding hybridization. Chromas sequencing of Yellow Mountain View and Seuwiteuking varieties indicated three and one variable nucleotide sites in the non-transcribed spacer (NTS) of the 5S rRNA region showing hybridization, respectively. Based on a phylogenetic tree constructed using the 5S rRNA sequences, we observed that 16 tomato varieties were divided into three groups at 95% similarity. Rubiking and Sseommeoking, Lang Selection Procedure and Seuwiteuking, and Acorn Gold and Yellow Mountain View exhibited very high identity with their partners. This work will aid variety authentication and provides a basis for further tomato variety breeding.

  8. 16S rRNA partial gene sequencing for the differentiation and molecular subtyping of Listeria species.

    PubMed

    Hellberg, Rosalee S; Martin, Keely G; Keys, Ashley L; Haney, Christopher J; Shen, Yuelian; Smiley, R Derike

    2013-12-01

    Use of 16S rRNA partial gene sequencing within the regulatory workflow could greatly reduce the time and labor needed for confirmation and subtyping of Listeria monocytogenes. The goal of this study was to build a 16S rRNA partial gene reference library for Listeria spp. and investigate the potential for 16S rRNA molecular subtyping. A total of 86 isolates of Listeria representing L. innocua, L. seeligeri, L. welshimeri, and L. monocytogenes were obtained for use in building the custom library. Seven non-Listeria species and three additional strains of Listeria were obtained for use in exclusivity and food spiking tests. Isolates were sequenced for the partial 16S rRNA gene using the MicroSeq ID 500 Bacterial Identification Kit (Applied Biosystems). High-quality sequences were obtained for 84 of the custom library isolates and 23 unique 16S sequence types were discovered for use in molecular subtyping. All of the exclusivity strains were negative for Listeria and the three Listeria strains used in food spiking were consistently recovered and correctly identified at the species level. The spiking results also allowed for differentiation beyond the species level, as 87% of replicates for one strain and 100% of replicates for the other two strains consistently matched the same 16S type. Copyright © 2013 Elsevier Ltd. All rights reserved.

  9. The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition

    PubMed Central

    Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

    2017-01-01

    Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA. PMID:28032591

  10. 5S rRNA and accompanying proteins in gonads: powerful markers to identify sex and reproductive endocrine disruption in fish.

    PubMed

    Diaz de Cerio, Oihane; Rojo-Bartolomé, Iratxe; Bizarro, Cristina; Ortiz-Zarragoitia, Maren; Cancio, Ibon

    2012-07-17

    In anuran ovaries, 5S rDNA is regulated transcriptionally by transcription factor IIIA (TFIIIA), which upon transcription, binds 5S rRNA, forming 7S RNP. 5S rRNA can be stockpiled also in the form of 42S RNP bound to 42sp43. The aim of the present study was to assess the differential transcriptional regulation of 5S rRNA and associated proteins in thicklip gray mullet (Chelon labrosus) gonads. Up to 75% of the total RNA from mullet ovaries was 5S rRNA. qPCR quantification of 5S rRNA expression, in gonads of histologically sexed individuals from different geographical areas, successfully sexed animals. All males had expression levels that were orders of magnitude below expression levels in females, throughout an annual reproductive cycle, with the exception of two individuals: one in November and one in December. Moreover, intersex mullets from a polluted harbor had expression levels between both sexes. TFIIIA and 42sp43 were also very active transcriptionally in gonads of female and intersex mullets, in comparison to males. Nucleocytoplasmatic transport is important in this context and we also analyzed transcriptional levels of importins-α1, -α2, and -β2 and different exportins. Importin-αs behaved similarly to 5S rRNA. Thus, 5S rRNA and associated proteins constitute very powerful molecular markers of sex and effects of xenosterogens in fish gonads, with potential technological applications in the analysis of fish stock dynamics and reproduction as well as in environmental health assessment.

  11. Experimental demonstration of 1535-1555-nm simultaneous optical wavelength interchange with a nonlinear photonic crystal.

    PubMed

    Chowdhury, A; Staus, C; Boland, B F; Kuech, T F; McCaughan, L

    2001-09-01

    We present results of what is to our knowledge the first experimental demonstration of simultaneous optical wavelength interchange by use of a two-dimensional second-order nonlinear photonic crystal. Fabrication and performance parameters of a 1535-1555-nm wavelength interchange nonlinear photonic crystal fabricated in lithium niobate are discussed.

  12. Technologically important extremophile 16S rRNA sequence Shannon entropy and fractal property comparison with long term dormant microbes

    NASA Astrophysics Data System (ADS)

    Holden, Todd; Gadura, N.; Dehipawala, S.; Cheung, E.; Tuffour, M.; Schneider, P.; Tremberger, G., Jr.; Lieberman, D.; Cheung, T.

    2011-10-01

    Technologically important extremophiles including oil eating microbes, uranium and rocket fuel perchlorate reduction microbes, electron producing microbes and electrode electrons feeding microbes were compared in terms of their 16S rRNA sequences, a standard targeted sequence in comparative phylogeny studies. Microbes that were reported to have survived a prolonged dormant duration were also studied. Examples included the recently discovered microbe that survives after 34,000 years in a salty environment while feeding off organic compounds from other trapped dead microbes. Shannon entropy of the 16S rRNA nucleotide composition and fractal dimension of the nucleotide sequence in terms of its atomic number fluctuation analyses suggest a selected range for these extremophiles as compared to other microbes; consistent with the experience of relatively mild evolutionary pressure. However, most of the microbes that have been reported to survive in prolonged dormant duration carry sequences with fractal dimension between 1.995 and 2.005 (N = 10 out of 13). Similar results are observed for halophiles, red-shifted chlorophyll and radiation resistant microbes. The results suggest that prolonged dormant duration, in analogous to high salty or radiation environment, would select high fractal 16S rRNA sequences. Path analysis in structural equation modeling supports a causal relation between entropy and fractal dimension for the studied 16S rRNA sequences (N = 7). Candidate choices for high fractal 16S rRNA microbes could offer protection for prolonged spaceflights. BioBrick gene network manipulation could include extremophile 16S rRNA sequences in synthetic biology and shed more light on exobiology and future colonization in shielded spaceflights. Whether the high fractal 16S rRNA sequences contain an asteroidlike extra-terrestrial source could be speculative but interesting.

  13. A Simple Method to Decode the Complete 18-5.8-28S rRNA Repeated Units of Green Algae by Genome Skimming.

    PubMed

    Lin, Geng-Ming; Lai, Yu-Heng; Audira, Gilbert; Hsiao, Chung-Der

    2017-11-06

    Green algae, Chlorella ellipsoidea , Haematococcus pluvialis and Aegagropila linnaei (Phylum Chlorophyta) were simultaneously decoded by a genomic skimming approach within 18-5.8-28S rRNA region. Whole genomic DNAs were isolated from green algae and directly subjected to low coverage genome skimming sequencing. After de novo assembly and mapping, the size of complete 18-5.8-28S rRNA repeated units for three green algae were ranged from 5785 to 6028 bp, which showed high nucleotide diversity (π is around 0.5-0.6) within ITS1 and ITS2 (Internal Transcribed Spacer) regions. Previously, the evolutional diversity of algae has been difficult to decode due to the inability design universal primers that amplify specific marker genes across diverse algal species. In this study, our method provided a rapid and universal approach to decode the 18-5.8-28S rRNA repeat unit in three green algal species. In addition, the completely sequenced 18-5.8-28S rRNA repeated units provided a solid nuclear marker for phylogenetic and evolutionary analysis for green algae for the first time.

  14. The Era GTPase recognizes the GAUCACCUCC sequence and binds helix 45 near the 3; end of 16S rRNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tu, Chao; Zhou, Xiaomei; Tarasov, Sergey G.

    2012-03-26

    Era, composed of a GTPase domain and a K homology domain, is essential for bacterial cell viability. It is required for the maturation of 16S rRNA and assembly of the 30S ribosomal subunit. We showed previously that the protein recognizes nine nucleotides (1531{sup AUCACCUCC}1539) near the 3{prime} end of 16S rRNA, and that this recognition stimulates GTP-hydrolyzing activity of Era. In all three kingdoms of life, the 1530{sup GAUCA}1534 sequence and helix 45 (h45) (nucleotides 1506-1529) are highly conserved. It has been shown that the 1530{sup GA}1531 to 1530{sup AG}1531 double mutation severely affects the viability of bacteria. However, whethermore » Era interacts with G1530 and/or h45 and whether such interactions (if any) contribute to the stimulation of Era's GTPase activity were not known. Here, we report two RNA structures that contain nucleotides 1506-1542 (RNA301), one in complex with Era and GDPNP (GNP), a nonhydrolysable GTP-analogue, and the other in complex with Era, GNP, and the KsgA methyltransferase. The structures show that Era recognizes 10 nucleotides, including G1530, and that Era also binds h45. Moreover, GTPase assay experiments show that G1530 does not stimulate Era's GTPase activity. Rather, A1531 and A1534 are most important for stimulation and h45 further contributes to the stimulation. Although G1530 does not contribute to the intrinsic GTPase activity of Era, its interaction with Era is important for binding and is essential for the protein to function, leading to the discovery of a new cold-sensitive phenotype of Era.« less

  15. The Role of 16S rRNA Gene Sequencing in Identification of Microorganisms Misidentified by Conventional Methods

    PubMed Central

    Petti, C. A.; Polage, C. R.; Schreckenberger, P.

    2005-01-01

    Traditional methods for microbial identification require the recognition of differences in morphology, growth, enzymatic activity, and metabolism to define genera and species. Full and partial 16S rRNA gene sequencing methods have emerged as useful tools for identifying phenotypically aberrant microorganisms. We report on three bacterial blood isolates from three different College of American Pathologists-certified laboratories that were referred to ARUP Laboratories for definitive identification. Because phenotypic identification suggested unusual organisms not typically associated with the submitted clinical diagnosis, consultation with the Medical Director was sought and further testing was performed including partial 16S rRNA gene sequencing. All three patients had endocarditis, and conventional methods identified isolates from patients A, B, and C as a Facklamia sp., Eubacterium tenue, and a Bifidobacterium sp. 16S rRNA gene sequencing identified the isolates as Enterococcus faecalis, Cardiobacterium valvarum, and Streptococcus mutans, respectively. We conclude that the initial identifications of these three isolates were erroneous, may have misled clinicians, and potentially impacted patient care. 16S rRNA gene sequencing is a more objective identification tool, unaffected by phenotypic variation or technologist bias, and has the potential to reduce laboratory errors. PMID:16333109

  16. [Identification of Hydrocarbon-Oxidizing Dietzia Bacteria from Petroleum Reservoirs Based on Phenotypic Properties and Analysis of the 16S rRNA and gyrB Genes].

    PubMed

    Nazina, T N; Shumkova, E S; Sokolova, D Sh; Babich, T L; Zhurina, M V; Xue, Yan-Fen; Osipov, G A; Poltaraus, A B; Tourova, T P

    2015-01-01

    The taxonomic position of hydrocarbon-oxidizing bacterial strains 263 and 32d isolated from formation water of the Daqing petroleum reservoir (PRC) was determined by polyphasic taxonomy techniques, including analysis of the 16S rRNA and the gyrB genes. The major chemotaxonomic characteristics of both strains, including the IV type cell wall, composition of cell wall fatty acids, mycolic acids, and menaquinones, agreed with those typical of Dietzia strains. The DNA G+C content of strains 263 and 32d were 67.8 and 67.6 mol%, respectively. Phylogenetic analysis of the 16S rRNA gene of strain 32d revealed 99.7% similarity to the gene of D. maris, making it possible to identify strain 32d as belonging to this species. The 16S rRNA gene sequence of strain 263 exhibited 99.7 and 99.9% similarity to those of D. natronolimnaea and D. cercidiphylli YIM65002(T), respectively. Analysis of the gyrB genes of the subterranean isolates and of a number of Dietzia type strains confirmed classiffication of strain 32d as a D. maris strain and of strain 263, as a D. natronolimnaea strain. A conclusion was made concerning higher resolving power of phylogenetic analysis of the gyrB gene compared to the 16S rRNA gene analysis in the case of determination of the species position of Dietzia isolates.

  17. Intra-Genomic Heterogeneity in 16S rRNA Genes in Strictly Anaerobic Clinical Isolates from Periodontal Abscesses.

    PubMed

    Chen, Jiazhen; Miao, Xinyu; Xu, Meng; He, Junlin; Xie, Yi; Wu, Xingwen; Chen, Gang; Yu, Liying; Zhang, Wenhong

    2015-01-01

    Members of the genera Prevotella, Veillonella and Fusobacterium are the predominant culturable obligate anaerobic bacteria isolated from periodontal abscesses. When determining the cumulative number of clinical anaerobic isolates from periodontal abscesses, ambiguous or overlapping signals were frequently encountered in 16S rRNA gene sequencing chromatograms, resulting in ambiguous identifications. With the exception of the genus Veillonella, the high intra-chromosomal heterogeneity of rrs genes has not been reported. The 16S rRNA genes of 138 clinical, strictly anaerobic isolates and one reference strain were directly sequenced, and the chromatograms were carefully examined. Gene cloning was performed for 22 typical isolates with doublet sequencing signals for the 16S rRNA genes, and four copies of the rrs-ITS genes of 9 Prevotella intermedia isolates were separately amplified by PCR, sequenced and compared. Five conserved housekeeping genes, hsp60, recA, dnaJ, gyrB1 and rpoB from 89 clinical isolates of Prevotella were also amplified by PCR and sequenced for identification and phylogenetic analysis along with 18 Prevotella reference strains. Heterogeneity of 16S rRNA genes was apparent in clinical, strictly anaerobic oral bacteria, particularly in the genera Prevotella and Veillonella. One hundred out of 138 anaerobic strains (72%) had intragenomic nucleotide polymorphisms (SNPs) in multiple locations, and 13 strains (9.4%) had intragenomic insertions or deletions in the 16S rRNA gene. In the genera Prevotella and Veillonella, 75% (67/89) and 100% (19/19) of the strains had SNPs in the 16S rRNA gene, respectively. Gene cloning and separate amplifications of four copies of the rrs-ITS genes confirmed that 2 to 4 heterogeneous 16S rRNA copies existed. Sequence alignment of five housekeeping genes revealed that intra-species nucleotide similarities were very high in the genera Prevotella, ranging from 94.3-100%. However, the inter-species similarities were

  18. Intra-Genomic Heterogeneity in 16S rRNA Genes in Strictly Anaerobic Clinical Isolates from Periodontal Abscesses

    PubMed Central

    Chen, Jiazhen; Miao, Xinyu; Xu, Meng; He, Junlin; Xie, Yi; Wu, Xingwen; Chen, Gang; Yu, Liying; Zhang, Wenhong

    2015-01-01

    Background Members of the genera Prevotella, Veillonella and Fusobacterium are the predominant culturable obligate anaerobic bacteria isolated from periodontal abscesses. When determining the cumulative number of clinical anaerobic isolates from periodontal abscesses, ambiguous or overlapping signals were frequently encountered in 16S rRNA gene sequencing chromatograms, resulting in ambiguous identifications. With the exception of the genus Veillonella, the high intra-chromosomal heterogeneity of rrs genes has not been reported. Methods The 16S rRNA genes of 138 clinical, strictly anaerobic isolates and one reference strain were directly sequenced, and the chromatograms were carefully examined. Gene cloning was performed for 22 typical isolates with doublet sequencing signals for the 16S rRNA genes, and four copies of the rrs-ITS genes of 9 Prevotella intermedia isolates were separately amplified by PCR, sequenced and compared. Five conserved housekeeping genes, hsp60, recA, dnaJ, gyrB1 and rpoB from 89 clinical isolates of Prevotella were also amplified by PCR and sequenced for identification and phylogenetic analysis along with 18 Prevotella reference strains. Results Heterogeneity of 16S rRNA genes was apparent in clinical, strictly anaerobic oral bacteria, particularly in the genera Prevotella and Veillonella. One hundred out of 138 anaerobic strains (72%) had intragenomic nucleotide polymorphisms (SNPs) in multiple locations, and 13 strains (9.4%) had intragenomic insertions or deletions in the 16S rRNA gene. In the genera Prevotella and Veillonella, 75% (67/89) and 100% (19/19) of the strains had SNPs in the 16S rRNA gene, respectively. Gene cloning and separate amplifications of four copies of the rrs-ITS genes confirmed that 2 to 4 heterogeneous 16S rRNA copies existed. Conclusion Sequence alignment of five housekeeping genes revealed that intra-species nucleotide similarities were very high in the genera Prevotella, ranging from 94.3–100%. However, the

  19. Ethanol production using whole plant biomass of Jerusalem artichoke by Kluyveromyces marxianus CBS1555.

    PubMed

    Kim, Seonghun; Park, Jang Min; Kim, Chul Ho

    2013-03-01

    Jerusalem artichoke is a low-requirement sugar crop containing cellulose and hemicellulose in the stalk and a high content of inulin in the tuber. However, the lignocellulosic component in Jerusalem artichoke stalk reduces the fermentability of the whole plant for efficient bioethanol production. In this study, Jerusalem artichoke stalk was pretreated sequentially with dilute acid and alkali, and then hydrolyzed enzymatically. During enzymatic hydrolysis, approximately 88 % of the glucan and xylan were converted to glucose and xylose, respectively. Batch and fed-batch simultaneous saccharification and fermentation of both pretreated stalk and tuber by Kluyveromyces marxianus CBS1555 were effectively performed, yielding 29.1 and 70.2 g/L ethanol, respectively. In fed-batch fermentation, ethanol productivity was 0.255 g ethanol per gram of dry Jerusalem artichoke biomass, or 0.361 g ethanol per gram of glucose, with a 0.924 g/L/h ethanol productivity. These results show that combining the tuber and the stalk hydrolysate is a useful strategy for whole biomass utilization in effective bioethanol fermentation from Jerusalem artichoke.

  20. Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification

    PubMed Central

    Ziesemer, Kirsten A.; Mann, Allison E.; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T.; Brandt, Bernd W.; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C.; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A.; MacDonald, Sandy J.; Thomas, Gavin H.; Collins, Matthew J.; Lewis, Cecil M.; Hofman, Corinne; Warinner, Christina

    2015-01-01

    To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341–534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions. PMID:26563586

  1. Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

    PubMed

    Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

    2002-12-01

    The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit.

  2. Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

    PubMed Central

    Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

    2002-01-01

    The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit. PMID:12515387

  3. Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

    NASA Astrophysics Data System (ADS)

    Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B.

    2011-07-01

    Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Å resolution.

  4. A Bayesian taxonomic classification method for 16S rRNA gene sequences with improved species-level accuracy.

    PubMed

    Gao, Xiang; Lin, Huaiying; Revanna, Kashi; Dong, Qunfeng

    2017-05-10

    Species-level classification for 16S rRNA gene sequences remains a serious challenge for microbiome researchers, because existing taxonomic classification tools for 16S rRNA gene sequences either do not provide species-level classification, or their classification results are unreliable. The unreliable results are due to the limitations in the existing methods which either lack solid probabilistic-based criteria to evaluate the confidence of their taxonomic assignments, or use nucleotide k-mer frequency as the proxy for sequence similarity measurement. We have developed a method that shows significantly improved species-level classification results over existing methods. Our method calculates true sequence similarity between query sequences and database hits using pairwise sequence alignment. Taxonomic classifications are assigned from the species to the phylum levels based on the lowest common ancestors of multiple database hits for each query sequence, and further classification reliabilities are evaluated by bootstrap confidence scores. The novelty of our method is that the contribution of each database hit to the taxonomic assignment of the query sequence is weighted by a Bayesian posterior probability based upon the degree of sequence similarity of the database hit to the query sequence. Our method does not need any training datasets specific for different taxonomic groups. Instead only a reference database is required for aligning to the query sequences, making our method easily applicable for different regions of the 16S rRNA gene or other phylogenetic marker genes. Reliable species-level classification for 16S rRNA or other phylogenetic marker genes is critical for microbiome research. Our software shows significantly higher classification accuracy than the existing tools and we provide probabilistic-based confidence scores to evaluate the reliability of our taxonomic classification assignments based on multiple database matches to query sequences. Despite

  5. How close is close: 16S rRNA sequence identity may not be sufficient to guarantee species identity

    NASA Technical Reports Server (NTRS)

    Fox, G. E.; Wisotzkey, J. D.; Jurtshuk, P. Jr

    1992-01-01

    16S rRNA (genes coding for rRNA) sequence comparisons were conducted with the following three psychrophilic strains: Bacillus globisporus W25T (T = type strain) and Bacillus psychrophilus W16AT, and W5. These strains exhibited more than 99.5% sequence identity and within experimental uncertainty could be regarded as identical. Their close taxonomic relationship was further documented by phenotypic similarities. In contrast, previously published DNA-DNA hybridization results have convincingly established that these strains do not belong to the same species if current standards are used. These results emphasize the important point that effective identity of 16S rRNA sequences is not necessarily a sufficient criterion to guarantee species identity. Thus, although 16S rRNA sequences can be used routinely to distinguish and establish relationships between genera and well-resolved species, very recently diverged species may not be recognizable.

  6. The essential nature of YqfG, a YbeY homologue required for 3' maturation of Bacillus subtilis 16S ribosomal RNA is suppressed by deletion of RNase R.

    PubMed

    Baumgardt, Kathrin; Gilet, Laetitia; Figaro, Sabine; Condon, Ciarán

    2018-06-05

    Ribosomal RNAs are processed from primary transcripts containing 16S, 23S and 5S rRNAs in most bacteria. Maturation generally occurs in a two-step process, consisting of a first crude separation of the major species by RNase III during transcription, followed by precise trimming of 5' and 3' extensions on each species upon accurate completion of subunit assembly. The various endo- and exoribonucleases involved in the final processing reactions are strikingly different in Escherichia coli and Bacillus subtilis, the two best studied representatives of Gram-negative and Gram-positive bacteria, respectively. Here, we show that the one exception to this rule is the protein involved in the maturation of the 3' end of 16S rRNA. Cells depleted for the essential B. subtilis YqfG protein, a homologue of E. coli YbeY, specifically accumulate 16S rRNA precursors bearing 3' extensions. Remarkably, the essential nature of YqfG can be suppressed by deleting the ribosomal RNA degrading enzyme RNase R, i.e. a ΔyqfG Δrnr mutant is viable. Our data suggest that 70S ribosomes containing 30S subunits with 3' extensions of 16S rRNA are functional to a degree, but become substrates for degradation by RNase R and are eliminated.

  7. Distribution of 16S rRNA Methylases Among Different Species of Aminoglycoside-Resistant Enterobacteriaceae in a Tertiary Care Hospital in Poland.

    PubMed

    Piekarska, Katarzyna; Zacharczuk, Katarzyna; Wołkowicz, Tomasz; Rzeczkowska, Magdalena; Bareja, Elżbieta; Olak, Monika; Gierczyński, Rafał

    2016-01-01

    Aminoglycosides are a group of antimicrobial agents still the most commonly used in the treatment of life-threatening bacterial infections in human and animals. The emergence and spread of 16S rRNA methylases, which confer high-level resistance to the majority of clinically relevant aminoglycosides, constitute a major public health concern. Our goal was to evaluate the distribution of 16S rRNA methylases among different species of Enterobacteriaceae during a five month-long survey in a tertiary hospital in Warszawa, Poland. In the survey, a total of 1770 non-duplicate clinical isolates were collected from all hospital wards in a tertiary hospital in Warszawa, Poland. The survey was conducted between 19 April and 19 September 2010. The ability to produce 16S rRNA methylase was examined by determining MICs for gentamicin, kanamycin, amikacin by means of the agar dilution method. The isolates resistant to high concentration of aminoglycosides were PCR tested for genes: armA, rmtA, rmtB and rmtC. PCR products were subjected to DNA sequencing by the Sanger method. The genetic similarity of the ArmA-producing isolates was analysed by pulsed-filed gel electrophoresis (PFGE). ArmA was the only 16S rRNA methylase detected in 20 of 1770 tested isolates. The overall prevalence rate of ArmA was 1.13%. In K. pneumoniae (n = 742), P. mirabilis (n = 130), and E. cloacae (n = 253) collected in the survey, the prevalence of ArmA was 0.4%, 0.8% and 5.9%, respectively. The PFGE revealed both horizontal and clonal spread of the armA gene in the hospital. The prevalence of 16S rRNA methylase ArmA reported in this study is significantly higher than observed in other countries in Europe.

  8. Anti-replicative recombinant 5S rRNA molecules can modulate the mtDNA heteroplasmy in a glucose-dependent manner.

    PubMed

    Loutre, Romuald; Heckel, Anne-Marie; Jeandard, Damien; Tarassov, Ivan; Entelis, Nina

    2018-01-01

    Mutations in mitochondrial DNA are an important source of severe and incurable human diseases. The vast majority of these mutations are heteroplasmic, meaning that mutant and wild-type genomes are present simultaneously in the same cell. Only a very high proportion of mutant mitochondrial DNA (heteroplasmy level) leads to pathological consequences. We previously demonstrated that mitochondrial targeting of small RNAs designed to anneal with mutant mtDNA can decrease the heteroplasmy level by specific inhibition of mutant mtDNA replication, thus representing a potential therapy. We have also shown that 5S ribosomal RNA, partially imported into human mitochondria, can be used as a vector to deliver anti-replicative oligoribonucleotides into human mitochondria. So far, the efficiency of cellular expression of recombinant 5S rRNA molecules bearing therapeutic insertions remained very low. In the present study, we designed new versions of anti-replicative recombinant 5S rRNA targeting a large deletion in mitochondrial DNA which causes the KSS syndrome, analyzed their specific annealing to KSS mitochondrial DNA and demonstrated their import into mitochondria of cultured human cells. To obtain an increased level of the recombinant 5S rRNA stable expression, we created transmitochondrial cybrid cell line bearing a site for Flp-recombinase and used this system for the recombinase-mediated integration of genes coding for the anti-replicative recombinant 5S rRNAs into nuclear genome. We demonstrated that stable expression of anti-replicative 5S rRNA versions in human transmitochondrial cybrid cells can induce a shift in heteroplasmy level of KSS mutation in mtDNA. This shift was directly dependent on the level of the recombinant 5S rRNA expression and the sequence of the anti-replicative insertion. Quantification of mtDNA copy number in transfected cells revealed the absence of a non-specific effect on wild type mtDNA replication, indicating that the decreased proportion

  9. How Much Do rRNA Gene Surveys Underestimate Extant Bacterial Diversity?

    PubMed

    Rodriguez-R, Luis M; Castro, Juan C; Kyrpides, Nikos C; Cole, James R; Tiedje, James M; Konstantinidis, Konstantinos T

    2018-03-15

    The most common practice in studying and cataloguing prokaryotic diversity involves the grouping of sequences into operational taxonomic units (OTUs) at the 97% 16S rRNA gene sequence identity level, often using partial gene sequences, such as PCR-generated amplicons. Due to the high sequence conservation of rRNA genes, organisms belonging to closely related yet distinct species may be grouped under the same OTU. However, it remains unclear how much diversity has been underestimated by this practice. To address this question, we compared the OTUs of genomes defined at the 97% or 98.5% 16S rRNA gene identity level against OTUs of the same genomes defined at the 95% whole-genome average nucleotide identity (ANI), which is a much more accurate proxy for species. Our results show that OTUs resulting from a 98.5% 16S rRNA gene identity cutoff are more accurate than 97% compared to 95% ANI (90.5% versus 89.9% accuracy) but indistinguishable from any other threshold in the 98.29 to 98.78% range. Even with the more stringent thresholds, however, the 16S rRNA gene-based approach commonly underestimates the number of OTUs by ∼12%, on average, compared to the ANI-based approach (∼14% underestimation when using the 97% identity threshold). More importantly, the degree of underestimation can become 50% or more for certain taxa, such as the genera Pseudomonas , Burkholderia , Escherichia , Campylobacter , and Citrobacter These results provide a quantitative view of the degree of underestimation of extant prokaryotic diversity by 16S rRNA gene-defined OTUs and suggest that genomic resolution is often necessary. IMPORTANCE Species diversity is one of the most fundamental pieces of information for community ecology and conservational biology. Therefore, employing accurate proxies for what a species or the unit of diversity is are cornerstones for a large set of microbial ecology and diversity studies. The most common proxies currently used rely on the clustering of 16S rRNA

  10. The Human Microbiome and Understanding the 16S rRNA Gene in Translational Nursing Science.

    PubMed

    Ames, Nancy J; Ranucci, Alexandra; Moriyama, Brad; Wallen, Gwenyth R

    As more is understood regarding the human microbiome, it is increasingly important for nurse scientists and healthcare practitioners to analyze these microbial communities and their role in health and disease. 16S rRNA sequencing is a key methodology in identifying these bacterial populations that has recently transitioned from use primarily in research to having increased utility in clinical settings. The objectives of this review are to (a) describe 16S rRNA sequencing and its role in answering research questions important to nursing science; (b) provide an overview of the oral, lung, and gut microbiomes and relevant research; and (c) identify future implications for microbiome research and 16S sequencing in translational nursing science. Sequencing using the 16S rRNA gene has revolutionized research and allowed scientists to easily and reliably characterize complex bacterial communities. This type of research has recently entered the clinical setting, one of the best examples involving the use of 16S sequencing to identify resistant pathogens, thereby improving the accuracy of bacterial identification in infection control. Clinical microbiota research and related requisite methods are of particular relevance to nurse scientists-individuals uniquely positioned to utilize these techniques in future studies in clinical settings.

  11. The Human Microbiome and Understanding the 16S rRNA Gene in Translational Nursing Science

    PubMed Central

    Ames, Nancy J.; Ranucci, Alexandra; Moriyama, Brad; Wallen, Gwenyth R.

    2017-01-01

    Background As more is understood regarding the human microbiome, it is increasingly important for nurse scientists and health care practitioners to analyze these microbial communities and their role in health and disease.16S rRNA sequencing is a key methodology in identifying these bacterial populations that has recently transitioned from use primarily in research to having increased utility in clinical settings. Objectives The objectives of this review are to: (a) describe 16S rRNA sequencing and its role in answering research questions important to nursing science; (b) provide an overview of the oral, lung and gut microbiomes and relevant research; and (c) identify future implications for microbiome research and 16S sequencing in translational nursing science. Discussion Sequencing using the 16S rRNA gene has revolutionized research and allowed scientists to easily and reliably characterize complex bacterial communities. This type of research has recently entered the clinical setting, one of the best examples involving the use of 16S sequencing to identify resistant pathogens, thereby improving the accuracy of bacterial identification in infection control. Clinical microbiota research and related requisite methods are of particular relevance to nurse scientists—individuals uniquely positioned to utilize these techniques in future studies in clinical settings. PMID:28252578

  12. Automated Identification of Medically Important Bacteria by 16S rRNA Gene Sequencing Using a Novel Comprehensive Database, 16SpathDB▿

    PubMed Central

    Woo, Patrick C. Y.; Teng, Jade L. L.; Yeung, Juilian M. Y.; Tse, Herman; Lau, Susanna K. P.; Yuen, Kwok-Yung

    2011-01-01

    Despite the increasing use of 16S rRNA gene sequencing, interpretation of 16S rRNA gene sequence results is one of the most difficult problems faced by clinical microbiologists and technicians. To overcome the problems we encountered in the existing databases during 16S rRNA gene sequence interpretation, we built a comprehensive database, 16SpathDB (http://147.8.74.24/16SpathDB) based on the 16S rRNA gene sequences of all medically important bacteria listed in the Manual of Clinical Microbiology and evaluated its use for automated identification of these bacteria. Among 91 nonduplicated bacterial isolates collected in our clinical microbiology laboratory, 71 (78%) were reported by 16SpathDB as a single bacterial species having >98.0% nucleotide identity with the query sequence, 19 (20.9%) were reported as more than one bacterial species having >98.0% nucleotide identity with the query sequence, and 1 (1.1%) was reported as no match. For the 71 bacterial isolates reported as a single bacterial species, all results were identical to their true identities as determined by a polyphasic approach. For the 19 bacterial isolates reported as more than one bacterial species, all results contained their true identities as determined by a polyphasic approach and all of them had their true identities as the “best match in 16SpathDB.” For the isolate (Gordonibacter pamelaeae) reported as no match, the bacterium has never been reported to be associated with human disease and was not included in the Manual of Clinical Microbiology. 16SpathDB is an automated, user-friendly, efficient, accurate, and regularly updated database for 16S rRNA gene sequence interpretation in clinical microbiology laboratories. PMID:21389154

  13. Nucleotides in 16S rRNA that are required in unmodified form for features recognized by ribosomal protein S8.

    PubMed Central

    Thurlow, D L; Ehresmann, C; Ehresmann, B

    1983-01-01

    Nucleotides in 16S rRNA which are required in unmodified form for specific recognition of ribosomal protein S8 from Escherichia coli were identified using a damage-selection experimental approach. Prior to complex formation with S8, 16S rRNA was treated under fully denaturing conditions with either diethyl pyrocarbonate or 25% hydrazine. Following separation of bound from unbound fragments of RNA, those associated with S8 were analyzed for their content of modified bases by treatment with aniline. Nucleotides found to be consistently unmodified in such fragments were located near the base of a stable helix (encompassing bases 581-656) or near the apex of the helix on the 3' proximal side. A minor S8 ribonucleoprotein particle was found to contain fragments which extended in the 3' direction to position 671. Images PMID:6356037

  14. Comparison of 16S rRNA sequencing with biochemical testing for species-level identification of clinical isolates of Neisseria spp.

    PubMed

    Mechergui, Arij; Achour, Wafa; Ben Hassen, Assia

    2014-08-01

    We aimed to compare accuracy of genus and species level identification of Neisseria spp. using biochemical testing and 16S rRNA sequence analysis. These methods were evaluated using 85 Neisseria spp. clinical isolates initially identified to the genus level by conventional biochemical tests and API NH system (Bio-Mérieux(®)). In 34 % (29/85), more than one possibility was given by 16S rRNA sequence analysis. In 6 % (5/85), one of the possibilities offered by 16S rRNA gene sequencing, agreed with the result given by biochemical testing. In 4 % (3/85), the same species was given by both methods. 16S rRNA gene sequencing results did not correlate well with biochemical tests.

  15. Target research on tumor biology characteristics of mir-155-5p regulation on gastric cancer cell.

    PubMed

    Feng, Jun-an

    2016-03-01

    After the mir-155-5p over expressed in gastric cancer cells, the expression profile chip was adopted to screen its target genes. Some of the intersection of target genes were selected based on the bioinformatics prediction, in order to study the mechanism of its function and role of research. Affymetrix eukaryotic gene expression spectrum was conducted to screen mir-155-5p regulated genetic experiment. Western blot technique was employed to detect and screen the protein expression of target genes. Mimics was transfected in BGC-823 of gastric cancer cells. Compared with mimics-nc group and mock group, the mRNA expression quantities of SMAD1, STAT1, CAB39, CXCR4 and CA9 were significantly lower. After the gastric cancer cells BGC-823 and MKN-45 had been transfected by mimics, compared with mimics-nc (MNC) group and mock (MOCK) group, it was decreased for the protein expression of SMAD1, STAT1 and CAB39 in mimics (MIMICS) group. The verification of qRT-PCR demonstrated that SMAD1, STAT1, CAB39, CXCR4 and CA9 were the predicted target genes and target proteins of mir-155-5p, the over expression of mir-155-5p could enable the decreasing of its expression level in gastric cancer cells MKN-45 and BGC-823.

  16. Apoptosis-like programmed cell death induces antisense ribosomal RNA (rRNA) fragmentation and rRNA degradation in Leishmania.

    PubMed

    Padmanabhan, P K; Samant, M; Cloutier, S; Simard, M J; Papadopoulou, B

    2012-12-01

    Few natural antisense (as) RNAs have been reported as yet in the unicellular protozoan Leishmania. Here, we describe that Leishmania produces natural asRNAs complementary to all ribosomal RNA (rRNA) species. Interestingly, we show that drug-induced apoptosis-like programmed cell death triggers fragmentation of asRNA complementary to the large subunit gamma (LSU-γ) rRNA, one of the six 28S rRNA processed fragments in Leishmania. Heat and oxidative stress also induce fragmentation of asrRNA, but to a lesser extent. Extensive asrRNA cleavage correlates with rRNA breakdown and translation inhibition. Indeed, overexpression of asLSU-γ rRNA accelerates rRNA degradation upon induction of apoptosis. In addition, we provide mechanistic insight into the regulation of apoptosis-induced asrRNA fragmentation by a 67 kDa ATP-dependent RNA helicase of the DEAD-box subfamily. This helicase binds both sense (s)LSU-γ and asLSU-γ rRNAs, and appears to have a key role in protecting rRNA from degradation by preventing asrRNA cleavage and thus cell death. Remarkably, the asrRNA fragmentation process operates not only in trypanosomatid protozoa but also in mammals. Our findings uncover a novel mechanism of regulation involving asrRNA fragmentation and rRNA breakdown, that is triggered by apoptosis and conditions of reduced translation under stress, and seems to be evolutionary conserved.

  17. Apoptosis-like programmed cell death induces antisense ribosomal RNA (rRNA) fragmentation and rRNA degradation in Leishmania

    PubMed Central

    Padmanabhan, P K; Samant, M; Cloutier, S; Simard, M J; Papadopoulou, B

    2012-01-01

    Few natural antisense (as) RNAs have been reported as yet in the unicellular protozoan Leishmania. Here, we describe that Leishmania produces natural asRNAs complementary to all ribosomal RNA (rRNA) species. Interestingly, we show that drug-induced apoptosis-like programmed cell death triggers fragmentation of asRNA complementary to the large subunit gamma (LSU-γ) rRNA, one of the six 28S rRNA processed fragments in Leishmania. Heat and oxidative stress also induce fragmentation of asrRNA, but to a lesser extent. Extensive asrRNA cleavage correlates with rRNA breakdown and translation inhibition. Indeed, overexpression of asLSU-γ rRNA accelerates rRNA degradation upon induction of apoptosis. In addition, we provide mechanistic insight into the regulation of apoptosis-induced asrRNA fragmentation by a 67 kDa ATP-dependent RNA helicase of the DEAD-box subfamily. This helicase binds both sense (s)LSU-γ and asLSU-γ rRNAs, and appears to have a key role in protecting rRNA from degradation by preventing asrRNA cleavage and thus cell death. Remarkably, the asrRNA fragmentation process operates not only in trypanosomatid protozoa but also in mammals. Our findings uncover a novel mechanism of regulation involving asrRNA fragmentation and rRNA breakdown, that is triggered by apoptosis and conditions of reduced translation under stress, and seems to be evolutionary conserved. PMID:22767185

  18. Molecular phylogeny of the Cricetinae subfamily based on the mitochondrial cytochrome b and 12S rRNA genes and the nuclear vWF gene.

    PubMed

    Neumann, Karsten; Michaux, Johan; Lebedev, Vladimir; Yigit, Nuri; Colak, Ercument; Ivanova, Natalia; Poltoraus, Andrey; Surov, Alexei; Markov, Georgi; Maak, Steffen; Neumann, Sabine; Gattermann, Rolf

    2006-04-01

    Despite some popularity of hamsters as pets and laboratory animals there is no reliable phylogeny of the subfamily Cricetinae available so far. Contradicting views exist not only about the actual number of species but also concerning the validity of several genera. We used partial DNA sequences of two mitochondrial (cytochrome b, 12S rRNA) and one partial nuclear gene (von Willebrand Factor exon 28) to provide a first gene tree of the Cricetinae based on 15 taxa comprising six genera. According to our data, Palaearctic hamsters fall into three distinct phylogenetic groups: Phodopus, Mesocricetus, and Cricetus-related species which evolved during the late Miocene about 7-12MY ago. Surprisingly, the genus Phodopus, which was previously thought to have appeared during the Pleistocene, forms the oldest clade. The largest number of extant hamster genera is found in a group of Cricetus-related hamsters. The genus Cricetulus itself proved to be not truly monophyletic with Cricetulus migratorius appearing more closely related to Tscherskia, Cricetus, and Allocricetulus. We propose to place the species within a new monotypic genus. Molecular clock calculations are not always in line with the dating of fossil records. DNA based divergence time estimates as well as taxonomic relationships demand a reevaluation of morphological characters previously used to identify fossils and extant hamsters.

  19. Pyrosequencing of mcrA and Archaeal 16S rRNA Genes Reveals Diversity and Substrate Preferences of Methanogen Communities in Anaerobic Digesters

    PubMed Central

    Wilkins, David; Lu, Xiao-Ying; Shen, Zhiyong; Chen, Jiapeng

    2014-01-01

    Methanogenic archaea play a key role in biogas-producing anaerobic digestion and yet remain poorly taxonomically characterized. This is in part due to the limitations of low-throughput Sanger sequencing of a single (16S rRNA) gene, which in the past may have undersampled methanogen diversity. In this study, archaeal communities from three sludge digesters in Hong Kong and one wastewater digester in China were examined using high-throughput pyrosequencing of the methyl coenzyme M reductase (mcrA) and 16S rRNA genes. Methanobacteriales, Methanomicrobiales, and Methanosarcinales were detected in each digester, indicating that both hydrogenotrophic and acetoclastic methanogenesis was occurring. Two sludge digesters had similar community structures, likely due to their similar design and feedstock. Taxonomic classification of the mcrA genes suggested that these digesters were dominated by acetoclastic methanogens, particularly Methanosarcinales, while the other digesters were dominated by hydrogenotrophic Methanomicrobiales. The proposed euryarchaeotal order Methanomassiliicoccales and the uncultured WSA2 group were detected with the 16S rRNA gene, and potential mcrA genes for these groups were identified. 16S rRNA gene sequencing also recovered several crenarchaeotal groups potentially involved in the initial anaerobic digestion processes. Overall, the two genes produced different taxonomic profiles for the digesters, while greater methanogen richness was detected using the mcrA gene, supporting the use of this functional gene as a complement to the 16S rRNA gene to better assess methanogen diversity. A significant positive correlation was detected between methane production and the abundance of mcrA transcripts in digesters treating sludge and wastewater samples, supporting the mcrA gene as a biomarker for methane yield. PMID:25381241

  20. Detecting 16S rRNA Methyltransferases in Enterobacteriaceae by Use of Arbekacin

    PubMed Central

    Chahine, Sarah; Okafor, Darius; Ong, Ana C.; Maybank, Rosslyn; Kwak, Yoon I.; Wilson, Kerry; Zapor, Michael; Lesho, Emil; Hinkle, Mary

    2015-01-01

    16S rRNA methyltransferases confer resistance to most aminoglycosides, but discriminating their activity from that of aminoglycoside-modifying enzymes (AMEs) is challenging using phenotypic methods. We demonstrate that arbekacin, an aminoglycoside refractory to most AMEs, can rapidly detect 16S methyltransferase activity in Enterobacteriaceae with high specificity using the standard disk susceptibility test. PMID:26537447

  1. [Value of pre-gestational deafness-related mutation screening for the prevention and intervention of congenital deafness].

    PubMed

    Sun, Xuejing; Xing, Xinli; He, Qingqing; Zhou, Lin; Zhang, Jing; Zhao, Qing; Hou, Huili; Xi, Zuoming

    2017-10-10

    To assess the value of pre-gestational deafness-related mutation screening for the prevention and intervention of congenital deafness. In this study, 2168 couples with normal hearing were screened for common mutations associated with congenital deafness using real-time fluorescence quantitative PCR. The mutations have included GJB2 c.235delC and c.299_300delAT, SLC26A4 c.2168A>G and c.IVS7-2A>G, and mtDNA 12SrRNA c.1494C>T and c.1555A>G. For couples who have both carried heterozygous mutations of the same gene, genetic counseling and prenatal diagnosis were provided. Among of the 4 336 individuals, 178 (4.06%) were found to carry a mutation. Mutation rate for c.235delC and c.299_300delAT of GJB2 gene, c.IVS7-2 A>G and c.2168 A>G of SLC26A4 gene, c.1555 A>G and c.1494 C>T of DNA 12S rRNA gene were 0.91%, 0.20%, 0.68%, 0.11%, 0.1% and 0.01%, respectively. For six couples who have both carried mutations of the same gene, all fetuses showed a normal karyotype, while DNA sequencing indicated that two fetuses have carried homozygous c.235delC mutation of the GJB2 gene, one carried a heterozygous c.235delC mutation of the GJB2 gene, one carried heterozygous mutation of GJB2 gene (c.299_300delAT), and two have carried a heterozygous mutation of c.IVS7-2A>G of the SLC26A4 gene. Pre-gestational screening for deafness gene mutation can facilitate avoidance the birth of affected children and has a great clinical value for the prevention and intervention of birth defect.

  2. Exploring internal features of 16S rRNA gene for identification of clinically relevant species of the genus Streptococcus

    PubMed Central

    2011-01-01

    Background Streptococcus is an economically important genus as a number of species belonging to this genus are human and animal pathogens. The genus has been divided into different groups based on 16S rRNA gene sequence similarity. The variability observed among the members of these groups is low and it is difficult to distinguish them. The present study was taken up to explore 16S rRNA gene sequence to develop methods that can be used for preliminary identification and can supplement the existing methods for identification of clinically-relevant isolates of the genus Streptococcus. Methods 16S rRNA gene sequences belonging to the isolates of S. dysgalactiae, S. equi, S. pyogenes, S. agalactiae, S. bovis, S. gallolyticus, S. mutans, S. sobrinus, S. mitis, S. pneumoniae, S. thermophilus and S. anginosus were analyzed with the purpose to define genetic variability within each species to generate a phylogenetic framework, to identify species-specific signatures and in-silico restriction enzyme analysis. Results The framework based analysis was used to segregate Streptococcus spp. previously identified upto genus level. This segregation was validated using species-specific signatures and in-silico restriction enzyme analysis. 43 uncharacterized Streptococcus spp. could be identified using this approach. Conclusions The markers generated exploring 16S rRNA gene sequences provided useful tool that can be further used for identification of different species of the genus Streptococcus. PMID:21702978

  3. 12 CFR 563g.12 - Securities sale report.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 12 Banks and Banking 5 2010-01-01 2010-01-01 false Securities sale report. 563g.12 Section 563g.12....12 Securities sale report. (a) Within 30 days after the first sale of the securities, every six... application of the proceeds, which shall include all of the information required by Form G-12 set forth at...

  4. rRNA fragmentation induced by a yeast killer toxin.

    PubMed

    Kast, Alene; Klassen, Roland; Meinhardt, Friedhelm

    2014-02-01

    Virus like dsDNA elements (VLE) in yeast were previously shown to encode the killer toxins PaT and zymocin, which target distinct tRNA species via specific anticodon nuclease (ACNase) activities. Here, we characterize a third member of the VLE-encoded toxins, PiT from Pichia inositovora, and identify PiOrf4 as the cytotoxic subunit by conditional expression in Saccharomyces cerevisiae. In contrast to the tRNA targeting toxins, however, neither a change of the wobble uridine modification status by introduction of elp3 or trm9 mutations nor tRNA overexpression rescued from PiOrf4 toxicity. Consistent with a distinct RNA target, expression of PiOrf4 causes specific fragmentation of the 25S and 18S rRNA. A stable cleavage product comprising the first ∼ 130 nucleotides of the 18S rRNA was purified and characterized by linker ligation and subsequent reverse transcription; 3'-termini were mapped to nucleotide 131 and 132 of the 18S rRNA sequence, a region showing some similarity to the anticodon loop of tRNA(Glu)(UUC), the zymocin target. PiOrf4 residues Glu9 and His214, corresponding to catalytic sites Glu9 and His209 in the ACNase subunit of zymocin are essential for in vivo toxicity and rRNA fragmentation, raising the possibility of functionally conserved RNase modules in both proteins. © 2013 John Wiley & Sons Ltd.

  5. New observation and combined analysis of the Cs{sub 2} 0{sub g}{sup −}, 0{sub u}{sup +}, and 1{sub g} states at the asymptotes 6S{sub 1/2} + 6P{sub 1/2} and 6S{sub 1/2} + 6P{sub 3/2}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ma, Jie; Liu, Wenliang; Wu, Jizhou

    2014-12-28

    We report on new observations of the photoassociation spectroscopy of ultracold cesium molecules using a highly sensitive detection technique and a combined analysis with all observed electronic states. The technique is achieved by directly modulating the frequency of the trapping lasers of a magneto-optical trap. New observations of the Cs{sub 2}0{sub g}{sup −}, 0{sub u}{sup +}, and 1{sub g} states at the asymptotes 6S{sub 1/2} + 6P{sub 1/2} and 6S{sub 1/2} + 6P{sub 3/2} are reported. The spectral range is extended to the red detuning of 112 cm{sup −1} below the 6S{sub 1/2} + 6P{sub 3/2} dissociation limit. Dozens ofmore » vibrational levels of the ultracold Cs{sub 2}0{sub g}{sup −}, 0{sub u}{sup +}, and 1{sub g} states are observed for the first time. The available experimental binding energies of these states are analyzed simultaneously in a framework of the generalized LeRoy–Bernstein theory and the almost degenerate perturbation theory by Marinescu and Dalgarno [Phys. Rev. A: At., Mol., Opt. Phys. 52, 311 (1995)]. The unique atomic-related parameter c{sub 3} governing the dispersion forces of all the molecular states is estimated as (10.29 ± 0.05) a.u.« less

  6. Identification of a novel 16S rRNA gene variant of Actinomyces funkei from six patients with purulent infections.

    PubMed

    Hinić, V; Straub, C; Schultheiss, E; Kaempfer, P; Frei, R; Goldenberger, D

    2013-07-01

    Little is known about the clinical significance and laboratory diagnosis of Actinomyces funkei. In this report we describe six clinical cases where A. funkei was isolated from purulent, polymicrobial infections. Conventional identification procedures were compared with molecular methods including matrix-assisted laser desorption/ionization time-of-flight mass spectrometry technique. Analysis of the full 16S rRNA gene sequence of the six investigated strains revealed differences from the A. funkei type strain. DNA-DNA hybridization showed that the clinical strains represent a novel 16S rRNA gene variant within the species of A. funkei. © 2013 The Authors Clinical Microbiology and Infection © 2013 European Society of Clinical Microbiology and Infectious Diseases.

  7. Unusual intraindividual variation of the nuclear 18S rRNA gene is widespread within the Acipenseridae.

    PubMed

    Krieger, Jeannette; Hett, Anne Kathrin; Fuerst, Paul A; Birstein, Vadim J; Ludwig, Arne

    2006-01-01

    Significant intraindividual variation in the sequence of the 18S rRNA gene is unusual in animal genomes. In a previous study, multiple 18S rRNA gene sequences were observed within individuals of eight species of sturgeon from North America but not in the North American paddlefish, Polyodon spathula, in two species of Polypterus (Polypterus delhezi and Polypterus senegalus), in other primitive fishes (Erpetoichthys calabaricus, Lepisosteus osseus, Amia calva) or in a lungfish (Protopterus sp.). These observations led to the hypothesis that this unusual genetic characteristic arose within the Acipenseriformes after the presumed divergence of the sturgeon and paddlefish families. In the present study, a survey of nearly all Eurasian acipenseriform species was conducted to examine 18S rDNA variation. Intraindividual variation was not found in the polyodontid species, the Chinese paddlefish, Psephurus gladius, but variation was detected in all Eurasian acipenserid species. The comparison of sequences from two major segments of the 18S rRNA gene and identification of sites where insertion/deletion events have occurred are placed in the context of evolutionary relationships within the Acipenseriformes and the evolution of rDNA variation in this group.

  8. Detection and identification of bacteria in clinical samples by 16S rRNA gene sequencing: comparison of two different approaches in clinical practice.

    PubMed

    Jenkins, Claire; Ling, Clare L; Ciesielczuk, Holly L; Lockwood, Julianne; Hopkins, Susan; McHugh, Timothy D; Gillespie, Stephen H; Kibbler, Christopher C

    2012-04-01

    Amplification and sequence analysis of the 16S rRNA gene can be applied to detect and identify bacteria in clinical samples. We examined 75 clinical samples (17 culture-positive, 58 culture-negative) prospectively by two different PCR protocols, amplifying either a single fragment (1343 bp) or two fragments (762/598 bp) of the 16S rRNA gene. The 1343 bp PCR and 762/598 bp PCRs detected and identified the bacterial 16S rRNA gene in 23 (31 %) and 38 (51 %) of the 75 samples, respectively. The 1343 bp PCR identified 19 of 23 (83 %) PCR-positive samples to species level while the 762/598 bp PCR identified 14 of 38 (37 %) bacterial 16S rRNA gene fragments to species level and 24 to the genus level only. Amplification of shorter fragments of the bacterial 16S rRNA gene (762 and 598 bp) resulted in a more sensitive assay; however, analysis of a large fragment (1343 bp) improved species discrimination. Although not statistically significant, the 762/598 bp PCR detected the bacterial 16S rRNA gene in more samples than the 1343 bp PCR, making it more likely to be a more suitable method for the primary detection of the bacterial 16S rRNA gene in the clinical setting. The 1343 bp PCR may be used in combination with the 762/598 bp PCR when identification of the bacterial rRNA gene to species level is required.

  9. Combined Analyses of the ITS Loci and the Corresponding 16S rRNA Genes Reveal High Micro- and Macrodiversity of SAR11 Populations in the Red Sea

    PubMed Central

    Ngugi, David Kamanda; Stingl, Ulrich

    2012-01-01

    Bacteria belonging to the SAR11 clade are among the most abundant prokaryotes in the pelagic zone of the ocean. 16S rRNA gene-based analyses indicate that they constitute up to 60% of the bacterioplankton community in the surface waters of the Red Sea. This extremely oligotrophic water body is further characterized by an epipelagic zone, which has a temperature above 24°C throughout the year, and a remarkable uniform temperature (∼22°C) and salinity (∼41 psu) from the mixed layer (∼200 m) to the bottom at over 2000 m depth. Despite these conditions that set it apart from other marine environments, the microbiology of this ecosystem is still vastly understudied. Prompted by the limited phylogenetic resolution of the 16S rRNA gene, we extended our previous study by sequencing the internal transcribed spacer (ITS) region of SAR11 in different depths of the Red Sea’s water column together with the respective 16S fragment. The overall diversity captured by the ITS loci was ten times higher than that of the corresponding 16S rRNA genes. Moreover, species estimates based on the ITS showed a highly diverse population of SAR11 in the mixed layer that became diminished in deep isothermal waters, which was in contrast to results of the related 16S rRNA genes. While the 16S rRNA gene-based sequences clustered into three phylogenetic subgroups, the related ITS fragments fell into several phylotypes that showed clear depth-dependent shifts in relative abundances. Blast-based analyses not only documented the observed vertical partitioning and universal co-occurrence of specific phylotypes in five other distinct oceanic provinces, but also highlighted the influence of ecosystem-specific traits (e.g., temperature, nutrient availability, and concentration of dissolved oxygen) on the population dynamics of this ubiquitous marine bacterium. PMID:23185592

  10. Species-specific identification of Dekkera/Brettanomyces yeasts by fluorescently labeled DNA probes targeting the 26S rRNA.

    PubMed

    Röder, Christoph; König, Helmut; Fröhlich, Jürgen

    2007-09-01

    Sequencing of the complete 26S rRNA genes of all Dekkera/Brettanomyces species colonizing different beverages revealed the potential for a specific primer and probe design to support diagnostic PCR approaches and FISH. By analysis of the complete 26S rRNA genes of all five currently known Dekkera/Brettanomyces species (Dekkera bruxellensis, D. anomala, Brettanomyces custersianus, B. nanus and B. naardenensis), several regions with high nucleotide sequence variability yet distinct from the D1/D2 domains were identified. FISH species-specific probes targeting the 26S rRNA gene's most variable regions were designed. Accessibility of probe targets for hybridization was facilitated by the construction of partially complementary 'side'-labeled probes, based on secondary structure models of the rRNA sequences. The specificity and routine applicability of the FISH-based method for yeast identification were tested by analyzing different wine isolates. Investigation of the prevalence of Dekkera/Brettanomyces yeasts in the German viticultural regions Wonnegau, Nierstein and Bingen (Rhinehesse, Rhineland-Palatinate) resulted in the isolation of 37 D. bruxellensis strains from 291 wine samples.

  11. Simultaneous separation of five major ribonucleic acids by capillary electrophoresis with laser-induced fluorescence in the presence of electroosmotic flow: application to the rapid screening of 5S rRNA from ovarian cancer cells.

    PubMed

    Shih, Ya-Chu; Liao, Ching-Ru; Chung, I-Che; Chang, Yu-Sun; Chang, Po-Ling

    2014-10-17

    RNA integrity is important in RNA studies because poor RNA quality may impact downstream methodologies. This study proposes a rapid and cost-effective method for the determination of RNA integrity based on CE-LIF in the presence of electroosmotic flow. The proposed method uses poly(ethylene) oxide (Mavg=4,000,000 Da) as a sieving matrix for total RNA separation. Ethidium bromide (μg mL(-1)) was dissolved in a polymer solution as an interchelating dye for on-column fluorescent labeling. The 28S rRNA, 18S rRNA, 5.8S rRNA, 5S rRNA and tRNA from the total human RNA extracted from the cells were fully separated using the proposed method. The lowest detectable concentration of total RNA achieved was 100 pg μL(-1) with a 6 min sample injection followed by on-column concentration. In addition, the temperature-induced degradation of total RNA was observed by CE-LIF. The electropherograms revealed more fragmentation of 28S and 18S rRNAs by temperature-induced hydrolysis compared with the 5.8S rRNA, 5S rRNA and tRNA. Therefore, the results indicated that RNA degradation should be considered for long-term, high-temperature incubations in RNA-related experiments involving RNA hybridization. The proposed method is furthermore, applied to the determination of 5S rRNA overexpressed in ovarian cancer cells as compared to the cervical cancer cells. Overall, CE-LIF is highly promising for rapid screening of ovarian cancers without tedious pre-amplification steps. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Identification of Bacillus Probiotics Isolated from Soil Rhizosphere Using 16S rRNA, recA, rpoB Gene Sequencing and RAPD-PCR.

    PubMed

    Mohkam, Milad; Nezafat, Navid; Berenjian, Aydin; Mobasher, Mohammad Ali; Ghasemi, Younes

    2016-03-01

    Some Bacillus species, especially Bacillus subtilis and Bacillus pumilus groups, have highly similar 16S rRNA gene sequences, which are hard to identify based on 16S rDNA sequence analysis. To conquer this drawback, rpoB, recA sequence analysis along with randomly amplified polymorphic (RAPD) fingerprinting was examined as an alternative method for differentiating Bacillus species. The 16S rRNA, rpoB and recA genes were amplified via a polymerase chain reaction using their specific primers. The resulted PCR amplicons were sequenced, and phylogenetic analysis was employed by MEGA 6 software. Identification based on 16S rRNA gene sequencing was underpinned by rpoB and recA gene sequencing as well as RAPD-PCR technique. Subsequently, concatenation and phylogenetic analysis showed that extent of diversity and similarity were better obtained by rpoB and recA primers, which are also reinforced by RAPD-PCR methods. However, in one case, these approaches failed to identify one isolate, which in combination with the phenotypical method offsets this issue. Overall, RAPD fingerprinting, rpoB and recA along with concatenated genes sequence analysis discriminated closely related Bacillus species, which highlights the significance of the multigenic method in more precisely distinguishing Bacillus strains. This research emphasizes the benefit of RAPD fingerprinting, rpoB and recA sequence analysis superior to 16S rRNA gene sequence analysis for suitable and effective identification of Bacillus species as recommended for probiotic products.

  13. Characterization of Mycobacterium leprae Genotypes in China--Identification of a New Polymorphism C251T in the 16S rRNA Gene.

    PubMed

    Yuan, Youhua; Wen, Yan; You, Yuangang; Xing, Yan; Li, Huanying; Weng, Xiaoman; Wu, Nan; Liu, Shuang; Zhang, Shanshan; Zhang, Wenhong; Zhang, Ying

    2015-01-01

    Leprosy continues to be prevalent in some mountainous regions of China, and genotypes of leprosy strains endemic to the country are not known. Mycobacterium lepromatosis is a new species that was discovered in Mexico in 2008, and it remains unclear whether this species exists in China. Here, we conducted PCR- restriction fragment length polymorphism (RFLP) analysis to classify genotypes of 85 DNA samples collected from patients from 18 different provinces. All 171 DNA samples from skin biopsies of leprosy patients were tested for the presence of Mycobacterium leprae and Mycobacterium lepromatosis by amplifying the 16S rRNA gene using nested PCR, followed by DNA sequencing. The new species M. lepromatosis was not found among the 171 specimens from leprosy patients in 22 provinces in China. However, we found three SNP genotypes among 85 leprosy patients. A mutation at C251T in the 16S rRNA gene was found in 76% of the strains. We also found that the strains that showed the 16S rRNA C251T mutation belonged to SNP type 3, whereas strains without the point mutation belonged to SNP type 1. The SNP type 3 leprosy strains were observed in patients from both the inner and coastal regions of China, but the SNP type 1 strains were focused only in the coastal region. This indicated that the SNP type 3 leprosy strains were more prevalent than the SNP type 1 strains in China. In addition, the 16S rRNA gene sequence mutation at C251T also indicated a difference in the geographical distribution of the strains. To our knowledge, this is the first report of a new polymorphism in 16S rRNA gene in M. leprae in China. Our findings shed light on the prevalent genotypes and provide insight about leprosy transmission that are important for leprosy control in China.

  14. Detecting 16S rRNA Methyltransferases in Enterobacteriaceae by Use of Arbekacin.

    PubMed

    McGann, Patrick; Chahine, Sarah; Okafor, Darius; Ong, Ana C; Maybank, Rosslyn; Kwak, Yoon I; Wilson, Kerry; Zapor, Michael; Lesho, Emil; Hinkle, Mary

    2016-01-01

    16S rRNA methyltransferases confer resistance to most aminoglycosides, but discriminating their activity from that of aminoglycoside-modifying enzymes (AMEs) is challenging using phenotypic methods. We demonstrate that arbekacin, an aminoglycoside refractory to most AMEs, can rapidly detect 16S methyltransferase activity in Enterobacteriaceae with high specificity using the standard disk susceptibility test. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  15. Diversity of thermophiles in a Malaysian hot spring determined using 16S rRNA and shotgun metagenome sequencing.

    PubMed

    Chan, Chia Sing; Chan, Kok-Gan; Tay, Yea-Ling; Chua, Yi-Heng; Goh, Kian Mau

    2015-01-01

    The Sungai Klah (SK) hot spring is the second hottest geothermal spring in Malaysia. This hot spring is a shallow, 150-m-long, fast-flowing stream, with temperatures varying from 50 to 110°C and a pH range of 7.0-9.0. Hidden within a wooded area, the SK hot spring is continually fed by plant litter, resulting in a relatively high degree of total organic content (TOC). In this study, a sample taken from the middle of the stream was analyzed at the 16S rRNA V3-V4 region by amplicon metagenome sequencing. Over 35 phyla were detected by analyzing the 16S rRNA data. Firmicutes and Proteobacteria represented approximately 57% of the microbiome. Approximately 70% of the detected thermophiles were strict anaerobes; however, Hydrogenobacter spp., obligate chemolithotrophic thermophiles, represented one of the major taxa. Several thermophilic photosynthetic microorganisms and acidothermophiles were also detected. Most of the phyla identified by 16S rRNA were also found using the shotgun metagenome approaches. The carbon, sulfur, and nitrogen metabolism within the SK hot spring community were evaluated by shotgun metagenome sequencing, and the data revealed diversity in terms of metabolic activity and dynamics. This hot spring has a rich diversified phylogenetic community partly due to its natural environment (plant litter, high TOC, and a shallow stream) and geochemical parameters (broad temperature and pH range). It is speculated that symbiotic relationships occur between the members of the community.

  16. The methyltransferase YfgB/RlmN is responsible for modification of adenosine 2503 in 23S rRNA

    PubMed Central

    Toh, Seok-Ming; Xiong, Liqun; Bae, Taeok; Mankin, Alexander S.

    2008-01-01

    A2503 in 23S rRNA of the Gram-negative bacterium Escherichia coli is located in a functionally important region of the ribosome, at the entrance to the nascent peptide exit tunnel. In E. coli, and likely in other species, this adenosine residue is post-transcriptionally modified to m2A. The enzyme responsible for this modification was previously unknown. We identified E. coli protein YfgB, which belongs to the radical SAM enzyme superfamily, as the methyltransferase that modifies A2503 of 23S rRNA to m2A. Inactivation of the yfgB gene in E. coli led to the loss of modification at nucleotide A2503 of 23S rRNA as revealed by primer extension analysis and thin layer chromatography. The A2503 modification was restored when YfgB protein was expressed in the yfgB knockout strain. A similar protein was shown to catalyze post-transcriptional modification of A2503 in 23S rRNA in Gram-positive Staphylococcus aureus. The yfgB knockout strain loses in competition with wild type in a co-growth experiment, indicating functional importance of A2503 modification. The location of A2503 in the exit tunnel suggests its possible involvement in interaction with the nascent peptide and raises the possibility that its post-transcriptional modification may influence such an interaction. PMID:18025251

  17. Resistance mechanisms of linezolid-nonsusceptible enterococci in Korea: low rate of 23S rRNA mutations in Enterococcus faecium.

    PubMed

    Lee, Sae-Mi; Huh, Hee Jae; Song, Dong Joon; Shim, Hyang Jin; Park, Kyung Sun; Kang, Cheol-In; Ki, Chang-Seok; Lee, Nam Yong

    2017-12-01

    To investigate linezolid-resistance mechanisms in linezolid-nonsusceptible enterococci (LNSE) isolated from a tertiary hospital in Korea. Enterococcal isolates exhibiting linezolid MICs ≥4 mg l -1 that were isolated between December 2011 and May 2016 were investigated by PCR and sequencing for mutations in 23S rRNA or ribosomal proteins (L3, L4 and L22) and for the presence of cfr, cfr(B) and optrA genes.Results/Key findings. Among 135 LNSE (87 Enterococcus faecium and 48 Enterococcus faecalis isolates), 39.1 % (34/87) of E. faecium and 18.8 % (9/48) of E. faecalis isolates were linezolid-resistant. The optrA carriage was the dominant mechanism in E. faecalis: 13 isolates, including 10 E. faecalis [70 % (7/10) linezolid-resistant and 30 % (3/10) linezolid-intermediate] and three E. faecium [33.3 % (1/3) linezolid-resistant and 66.7 % (2/3) linezolid-intermediate], contained the optrA gene. G2576T mutations in the 23S rRNA gene were detected only in E. faecium [14 isolates; 71.4 % (10/14) linezolid-resistant and 28.6 % (4/14) linezolid-intermediate]. One linezolid-intermediate E. faecium harboured a L22 protein alteration (Ser77Thr). No isolates contained cfr or cfr(B) genes and any L3 or L4 protein alterations. No genetic mechanism of resistance was identified for 67.6 % (23/34) of linezolid-resistant E. faecium. A low rate of 23S rRNA mutations and the absence of known linezolid-resistance mechanisms in the majority of E. faecium isolates suggest regional differences in the mechanisms of linezolid resistance and the possibility of additional mechanisms.

  18. A nested array of rRNA targeted probes for the detection and identification of enterococci by reverse hybridization.

    PubMed

    Behr, T; Koob, C; Schedl, M; Mehlen, A; Meier, H; Knopp, D; Frahm, E; Obst, U; Schleifer, K; Niessner, R; Ludwig, W

    2000-12-01

    Complete 23S and almost complete 16S rRNA gene sequences were determined for the type strains of the validly described Enterococcus species, Melissococcus pluton and Tetragenococcus halophilus. A comprehensive set of rRNA targeted specific oligonucleotide hybridization probes was designed according to the multiple probe concept. In silico probe design and evaluation was performed using the respective tools of the ARB program package in combination with the ARB databases comprising the currently available 16S as well as 23S rRNA primary structures. The probes were optimized with respect to their application for reverse hybridization in microplate format. The target comprising 16S and 23S rDNA was amplified and labeled by PCR (polymerase chain reaction) using general primers targeting a wide spectrum of bacteria. Alternatively, amplification of two adjacent rDNA fragments of enterococci was performed by using specific primers. In vitro evaluation of the probe set was done including all Enterococcus type strains, and a selection of other representatives of the gram-positive bacteria with a low genomic DNA G+C content. The optimized probe set was used to analyze enriched drinking water samples as well as original samples from waste water treatment plants.

  19. Phylogenetic analysis of Fusobacterium prausnitzii based upon the 16S rRNA gene sequence and PCR confirmation.

    PubMed

    Wang, R F; Cao, W W; Cerniglia, C E

    1996-01-01

    In order to develop a PCR method to detect Fusobacterium prausnitzii in human feces and to clarify the phylogenetic position of this species, its 16S rRNA gene sequence was determined. The sequence described in this paper is different from the 16S rRNA gene sequence is specific for F. prausnitzii, and the results of this assay confirmed that F. prausnitzii is the most common species in human feces. However, a PCR assay based on the original GenBank sequence was negative when it was performed with two strains of F. prausnitzii obtained from the American Type Culture Collection. A phylogenetic tree based on the new 16S rRNA gene sequence was constructed. On this tree F. prausnitzii was not a member of the Fusobacterium group but was closer to some Eubacterium spp. and located between Clostridium "clusters III and IV" (M.D. Collins, P.A. Lawson, A. Willems, J.J. Cordoba, J. Fernandez-Garayzabal, P. Garcia, J. Cai, H. Hippe, and J.A.E. Farrow, Int. J. Syst. Bacteriol. 44:812-826, 1994).

  20. Salinity inhibits post transcriptional processing of chloroplast 16S rRNA in shoot cultures of jojoba (Simmondsia chinesis).

    PubMed

    Mizrahi-Aviv, Ela; Mills, David; Benzioni, Aliza; Bar-Zvi, Dudy

    2005-03-01

    Chloroplast metabolism is rapidly affected by salt stress. Photosynthesis is one of the first processes known to be affected by salinity. Here, we report that salinity inhibits chloroplast post-transcriptional RNA processing. A differentially expressed 680-bp cDNA, containing the 3' sequence of 16S rRNA, transcribed intergenic spacer, exon 1 and intron of tRNA(Ile), was isolated by differential display reverse transcriptase PCR from salt-grown jojoba (Simmondsia chinesis) shoot cultures. Northern blot analysis indicated that although most rRNA appears to be fully processed, partially processed chloroplast 16S rRNA accumulates in salt-grown cultures. Thus, salinity appears to decrease the processing of the rrn transcript. The possible effect of this decreased processing on physiological processes is, as yet, unknown.

  1. Prevalence of 16S rRNA Methylase Gene rmtB Among Escherichia coli Isolated from Bovine Mastitis in Ningxia, China.

    PubMed

    Yu, Ting; He, Tao; Yao, Hong; Zhang, Jin-Bao; Li, Xiao-Na; Zhang, Rong-Ming; Wang, Gui-Qin

    2015-09-01

    The aim of this study is to understand the prevalence and molecular characterization of 16S rRNA methylase gene, rmtB, among Escherichia coli strains isolated from bovine mastitis in China. A total of 245 E. coli isolates were collected from bovine mastitis in China between 2013 and 2014 and were screened for 16S rRNA methylase genes (armA, rmtA, rmtB, rmtC, rmtD, rmtE, and npmA) by polymerase chain reaction. About 5.3% (13/245) of the isolates carried the rmtB gene; the isolates were highly resistant to amikacin. Thirteen rmtB-positive strains were analyzed for the presence of extended-spectrum β-lactamase genes (bla(TEM), bla(CTX-M), bla(OXA), and bla(SHV)). All the isolates harbored both bla(TEM-1) and bla(CTX-M-15) genes and two of the isolates were also positive for bla(OXA-1). Pulsed-field gel electrophoresis (PFGE) analysis indicated that the nine rmtB-positive strains belonging to ST10 from one farm showed the similar PFGE pattern, indicating a clonal expansion in this farm. S1-PFGE and Southern blotting showed that 12 isolates harbored the rmtB gene in plasmids of two different sizes (≈45 kb [n=10] and ≈48 kb [n=2]), while only 1 strain harbored the rmtB gene in the chromosome. These plasmids were transferable by conjugation studies, and two isolates from two respective farms carried the same size of plasmid, suggesting that the horizontal transmission of plasmids also contributed to the spread of rmtB gene. This is the first report of prevalence of the 16S rRNA methylase gene rmtB among E. coli isolated from bovine mastitis in China, and rmtB-carrying E. coli may pose a threat to the treatment of bovine mastitis.

  2. Characterization of copy numbers of 16S rDNA and 16S rRNA of Candidatus Liberibacter asiaticus and the implication in detection in planta using quantitative PCR.

    PubMed

    Kim, Jeong-Soon; Wang, Nian

    2009-03-06

    Citrus Huanglongbing (HLB) is one of the most devastating diseases on citrus and is associated with Candidatus Liberibacter spp.. The pathogens are phloem limited and have not been cultured in vitro. The current management strategy of HLB is to remove infected citrus trees and reduce psyllid populations with insecticides to prevent the spreading. This strategy requires sensitive and reliable diagnostic methods for early detection. We investigated the copy numbers of the 16S rDNA and 16S rRNA of the HLB pathogen and the implication of improving the diagnosis of HLB for early detection using Quantitative PCR. We compared the detection of HLB with different Quantitative PCR based methods with primers/probe targeting either 16S rDNA, beta-operon DNA, 16S rRNA, or beta-operon RNA. The 16S rDNA copy number of Ca. Liberibacter asiaticus was estimated to be three times of that of the beta-operon region, thus allowing detection of lower titer of Ca. L. asiaticus. Quantitative reverse transcriptional PCR (QRT-PCR) indicated that the 16S rRNA averaged 7.83 times more than that of 16S rDNA for the same samples. Dilution analysis also indicates that QRT-PCR targeting 16S rRNA is 10 time more sensitive than QPCR targeting 16S rDNA. Thus QRT-PCR was able to increase the sensitivity of detection by targeting 16S rRNA. Our result indicates that Candidatus Liberibacter asiaticus contains three copies of 16S rDNA. The copy number of 16S rRNA of Ca. L. asiaticus in planta averaged about 7.8 times of 16S rDNA for the same set of samples tested in this study. Detection sensitivity of HLB could be improved through the following approaches: using 16S rDNA based primers/probe in the QPCR assays; and using QRT-PCR assays targeting 16S rRNA.

  3. Diversity of thermophiles in a Malaysian hot spring determined using 16S rRNA and shotgun metagenome sequencing

    PubMed Central

    Chan, Chia Sing; Chan, Kok-Gan; Tay, Yea-Ling; Chua, Yi-Heng; Goh, Kian Mau

    2015-01-01

    The Sungai Klah (SK) hot spring is the second hottest geothermal spring in Malaysia. This hot spring is a shallow, 150-m-long, fast-flowing stream, with temperatures varying from 50 to 110°C and a pH range of 7.0–9.0. Hidden within a wooded area, the SK hot spring is continually fed by plant litter, resulting in a relatively high degree of total organic content (TOC). In this study, a sample taken from the middle of the stream was analyzed at the 16S rRNA V3-V4 region by amplicon metagenome sequencing. Over 35 phyla were detected by analyzing the 16S rRNA data. Firmicutes and Proteobacteria represented approximately 57% of the microbiome. Approximately 70% of the detected thermophiles were strict anaerobes; however, Hydrogenobacter spp., obligate chemolithotrophic thermophiles, represented one of the major taxa. Several thermophilic photosynthetic microorganisms and acidothermophiles were also detected. Most of the phyla identified by 16S rRNA were also found using the shotgun metagenome approaches. The carbon, sulfur, and nitrogen metabolism within the SK hot spring community were evaluated by shotgun metagenome sequencing, and the data revealed diversity in terms of metabolic activity and dynamics. This hot spring has a rich diversified phylogenetic community partly due to its natural environment (plant litter, high TOC, and a shallow stream) and geochemical parameters (broad temperature and pH range). It is speculated that symbiotic relationships occur between the members of the community. PMID:25798135

  4. A mitochondrial DNA (mtDNA) mutation associated with maternally inherited Parkinson`s disease (PD) and deafness

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shoffner, J.M.; Brown, M.; Huoponen, K.

    1994-09-01

    A pedigree was characterized in which PD and deafness is expressed along the maternal lineage. The proband is 74 years old and has PD. Her mother and 3 of 7 siblings have PD and a maternal lineage cousin may have early signs of PD. The proband`s mother, a sibling, and all four of her daughters have premature deafness. Since manifestations of PD begin after 50 years of age, the 30-40 year old daughters have not reached an age where extrapyramidal symptoms are likely to appear. Although all 4 daughters have premature deafness, one daughter experienced a rapid reduction of hermore » hearing after receiving a short course during childhood of the aminoglycoside streptomycin. Muscle biopsies from the proband who has PD and 3 daughters with deafness revealed normal histology. Oxidative phosphorylation biochemistry showed Complex I and IV defects in the proband and 2 daughters and a Complex I defect in the other daughter. The proband`s mtDNA was sequenced. Of the nucleotide variants observed, the only significant nucleotide change was a homoplasmic A-to-G point mutation in the 12S rRNA gene at position 1555 of the mtDNA. This site is homologous to the E. coli aminoglycoside binding site and has been found in a large Arab-Israeli pedigree with spontaneously occurring deafness and three Chinese pedigrees with aminoglycoside-induced deafness. Hence, this family shows a direct link between PD, deafness, Complex I and IV defects, and a mutation in a gene that functions in mitochondrial protein synthesis. Furthermore, the interaction between aminoglycosides and the mtDNA in a manner that augments the pathogenic effects of this mutation provides an excellent example of how environmental toxins and mtDNA mutations can interact to give a spectrum of clinical presentations.« less

  5. Use of 16S-23S rRNA spacer-region (SR)-PCR for identification of intestinal clostridia.

    PubMed

    Song, Yuli; Liu, Chengxu; Molitoris, Denise; Tomzynski, Thomas J; Mc Teague, Maureen; Read, Erik; Finegold, Sydney M

    2002-12-01

    The suitability of a species identification technique based on PCR analysis of 16S-23S rRNA spacer region (SR) polymorphism for human intestinal Clostridium species was evaluated. This SR-PCR based technique is highly reproducible and successfully differentiated the strains tested, which included 17 ATCC type strains of Clostridium and 152 human stool Clostridium isolates, at the species or intraspecies level. Ninety-eight of 152 stool isolates, including C. bifermentans, C. butyricum, C. cadaveris, C. orbiscindens, C. paraputrificum, C. pefringens, C. ramosum, C. scindens, C. spiroforme, C. symbiosum and C. tertium, were identified to species level by SR-PCR patterns that were identical to those of their corresponding ATCC type strains. The other 54 stool isolates distributed among ten SR-PCR patterns that are unique and possibly represent ten novel Clostridium species or subspecies. The species identification obtained by SR-PCR pattern analysis completely agreed with that obtained by 16S rRNA sequencing, and led to identification that clearly differed from that obtained by cellular fatty acid analysis for 23/152 strains (15%). These results indicate that SR-PCR provides an accurate and rapid molecular method for the identification of human intestinal Clostridium species.

  6. Three Cases of Anaerobiospirillum succiniciproducens Bacteremia Confirmed by 16S rRNA Gene Sequencing

    PubMed Central

    Tee, Wee; Korman, Tony M.; Waters, Mary Jo; Macphee, Andrew; Jenney, Adam; Joyce, Linda; Dyall-Smith, Michael L.

    1998-01-01

    We describe three cases of Anaerobiospirillum succiniciproducens bacteremia from Australia. We believe one of these cases represents the first report of A. succiniciproducens bacteremia in a human immunodeficiency virus (HIV)-infected individual. The other two patients had an underlying disorder (one patient had bleeding esophageal varices complicating alcohol liver disease and one patient had non-Hodgkin’s lymphoma). A motile, gram-negative, spiral anaerobe was isolated by culturing blood from all patients. Electron microscopy showed a curved bacterium with bipolar tufts of flagella resembling Anaerobiospirillum spp. Sequencing of the 16S rRNA genes of the isolates revealed no close relatives (organisms likely to be in the same genus) in the sequence databases, nor were any sequence data available for A. succiniciproducens. This report presents for the first time the 16S rRNA gene sequence of the type strain of A. succiniciproducens, strain ATCC 29305. Two of the three clinical isolates have sequences identical to that of the type strain, while the sequence of the other strain differs from that of the type strain at 4 nucleotides. PMID:9574678

  7. Alternative reverse genetics system for influenza viruses based on a synthesized swine 45S rRNA promoter.

    PubMed

    Wang, Kai; Huang, Qi; Yang, Zhiwei; Qi, Kezong; Liu, Hongmei; Chen, Hongjun

    2017-08-01

    We generated an alternative reverse genetics (RG) system based on a synthesized swine 45S rRNA promoter to rescue the H3N2 subtype swine influenza virus. All eight flanking segment cassettes of A/swine/Henan/7/2010 (H3N2) were amplified with ambisense expression elements from RG plasmids. All segments were then recombined with the pHC2014 vector, which contained the synthesized swine 45S rRNA promoter (spol1) and its terminal sequence (t1) in a pcDNA3 backbone. As a result, we obtained a set of RG plasmids carrying the corresponding eight-segment cassettes. We efficiently generated the H3N2 virus after transfection into 293T/PK15, PK15, and 293T cells. The efficiency of spol1-driven influenza virus rescue in PK15 cells was similar to that in 293T cells by titration using the human pol1 RG system. Our approach suggests that an alternative spol1-based RG system can produce influenza viruses.

  8. Comprehensive Analysis of Bacterial Flora in Postoperative Maxillary Cyst Fluid by 16S rRNA Gene and Culture Methods

    PubMed Central

    Sano, Naoto; Yamashita, Yoshio; Fukuda, Kazumasa; Taniguchi, Hatsumi; Goto, Masaaki; Miyamoto, Hiroshi

    2012-01-01

    Intracystic fluid was aseptically collected from 11 patients with postoperative maxillary cyst (POMC), and DNA was extracted from the POMC fluid. Bacterial species were identified by sequencing after cloning of approximately 580 bp of the 16S rRNA gene. Identification of pathogenic bacteria was also performed by culture methods. The phylogenetic identity was determined by sequencing 517–596 bp in each of the 1139 16S rRNA gene clones. A total of 1114 clones were classified while the remaining 25 clones were unclassified. A total of 103 bacterial species belonging to 42 genera were identified in POMC fluid samples by 16S rRNA gene analysis. Species of Prevotella (91%), Neisseria (73%), Fusobacterium (73%), Porphyromonas (73%), and Propionibacterium (73%) were found to be highly prevalent in all patients. Streptococcus mitis (64%), Fusobacterium nucleatum (55%), Propionibacterium acnes (55%), Staphylococcus capitis (55%), and Streptococcus salivarius (55%) were detected in more than 6 of the 11 patients. The results obtained by the culture method were different from those obtained by 16S rRNA gene analysis, but both approaches may be necessary for the identification of pathogens, especially of bacteria that are difficult to detect by culture methods, and the development of rational treatments for patients with POMC. PMID:22685668

  9. 12 CFR 563g.12 - Securities sale report.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 12 Banks and Banking 6 2012-01-01 2012-01-01 false Securities sale report. 563g.12 Section 563g.12....12 Securities sale report. (a) Within 30 days after the first sale of the securities, every six months after such 30 day period and not later than 30 days after the later of the last sale of securities...

  10. Nucleosome Translational Position, Not Histone Acetylation, Determines TFIIIA Binding to Nucleosomal Xenopus laevis 5S rRNA Genes

    PubMed Central

    Howe, LeAnn; Ausió, Juan

    1998-01-01

    We sought to study the binding constraints placed on the nine-zinc-finger protein transcription factor IIIA (TFIIIA) by a histone octamer. To this end, five overlapping fragments of the Xenopus laevis oocyte and somatic 5S rRNA genes were reconstituted into nucleosomes, and it was subsequently shown that nucleosome translational positioning is a major determinant of the binding of TFIIIA to the 5S rRNA genes. Furthermore, it was found that histone acetylation cannot override the TFIIIA binding constraints imposed by unfavorable translational positions. PMID:9488430

  11. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation.

    PubMed

    Garcia, S; Kovařík, A

    2013-07-01

    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S-5.8S-26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S-18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S-5.8S-26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants.

  12. Evaluating the Detection of Hydrocarbon-Degrading Bacteria in 16S rRNA Gene Sequencing Surveys

    PubMed Central

    Berry, David; Gutierrez, Tony

    2017-01-01

    Hydrocarbonoclastic bacteria (HCB) play a key role in the biodegradation of oil hydrocarbons in marine and other environments. A small number of taxa have been identified as obligate HCB, notably the Gammaproteobacterial genera Alcanivorax, Cycloclasticus, Marinobacter, Neptumonas, Oleiphilus, Oleispira, and Thalassolituus, as well as the Alphaproteobacterial genus Thalassospira. Detection of HCB in amplicon-based sequencing surveys relies on high coverage by PCR primers and accurate taxonomic classification. In this study, we performed a phylogenetic analysis to identify 16S rRNA gene sequence regions that represent the breadth of sequence diversity within these taxa. Using validated sequences, we evaluated 449 universal 16S rRNA gene-targeted bacterial PCR primer pairs for their coverage of these taxa. The results of this analysis provide a practical framework for selection of suitable primer sets for optimal detection of HCB in sequencing surveys. PMID:28567035

  13. Evaluating the Detection of Hydrocarbon-Degrading Bacteria in 16S rRNA Gene Sequencing Surveys.

    PubMed

    Berry, David; Gutierrez, Tony

    2017-01-01

    Hydrocarbonoclastic bacteria (HCB) play a key role in the biodegradation of oil hydrocarbons in marine and other environments. A small number of taxa have been identified as obligate HCB, notably the Gammaproteobacterial genera Alcanivorax, Cycloclasticus, Marinobacter, Neptumonas, Oleiphilus, Oleispira , and Thalassolituus , as well as the Alphaproteobacterial genus Thalassospira . Detection of HCB in amplicon-based sequencing surveys relies on high coverage by PCR primers and accurate taxonomic classification. In this study, we performed a phylogenetic analysis to identify 16S rRNA gene sequence regions that represent the breadth of sequence diversity within these taxa. Using validated sequences, we evaluated 449 universal 16S rRNA gene-targeted bacterial PCR primer pairs for their coverage of these taxa. The results of this analysis provide a practical framework for selection of suitable primer sets for optimal detection of HCB in sequencing surveys.

  14. Rapid in situ hybridization technique using 16S rRNA segments for detecting and differentiating the closely related gram-positive organisms Bacillus polymyxa and Bacillus macerans

    NASA Technical Reports Server (NTRS)

    Jurtshuk, R. J.; Blick, M.; Bresser, J.; Fox, G. E.; Jurtshuk, P. Jr

    1992-01-01

    A rapid, sensitive, inexpensive in situ hybridization technique, using 30-mer 16S rRNA probes, can specifically differentiate two closely related Bacillus spp., B. polymyxa and B. macerans. The 16S rRNA probes were labeled with a rhodamine derivative (Texas Red), and quantitative fluorescence measurements were made on individual bacterial cells. The microscopic fields analyzed were selected by phase-contrast microscopy, and the fluorescence imaging analyses were performed on 16 to 67 individual cells. The labeled 16S rRNA probe, POL, whose sequence was a 100% match with B. polymyxa 16S rRNA but only a 60% match with B. macerans 16S rRNA, gave quantitative fluorescence ratio measurements that were 34.8-fold higher for B. polymyxa cells than for B. macerans cells. Conversely, the labeled probe, MAC, which matched B. polymyxa 16S rRNA in 86.6% of its positions and B. macerans 16S rRNA in 100% of its positions, gave quantitative fluorescence measurements that were 59.3-fold higher in B. macerans cells than in B. polymyxa cells. Control probes, whose 16S rRNA sequence segment (P-M) was present in both B. polymyxa and B. macerans as well as a panprokaryotic probe (16S), having a 100% match with all known bacteria, hybridized equally well with both organisms. These latter hybridizations generated very high fluorescence signals, but their comparative fluorescence ratios (the differences between two organisms) were low. The control paneukaryotic probe (28S), which had less than 30% identity for both B. macerans and B. polymyxa, did not hybridize with either organism.

  15. 16S rRNA gene-based phylogenetic microarray for simultaneous identification of members of the genus Burkholderia.

    PubMed

    Schönmann, Susan; Loy, Alexander; Wimmersberger, Céline; Sobek, Jens; Aquino, Catharine; Vandamme, Peter; Frey, Beat; Rehrauer, Hubert; Eberl, Leo

    2009-04-01

    For cultivation-independent and highly parallel analysis of members of the genus Burkholderia, an oligonucleotide microarray (phylochip) consisting of 131 hierarchically nested 16S rRNA gene-targeted oligonucleotide probes was developed. A novel primer pair was designed for selective amplification of a 1.3 kb 16S rRNA gene fragment of Burkholderia species prior to microarray analysis. The diagnostic performance of the microarray for identification and differentiation of Burkholderia species was tested with 44 reference strains of the genera Burkholderia, Pandoraea, Ralstonia and Limnobacter. Hybridization patterns based on presence/absence of probe signals were interpreted semi-automatically using the novel likelihood-based strategy of the web-tool Phylo- Detect. Eighty-eight per cent of the reference strains were correctly identified at the species level. The evaluated microarray was applied to investigate shifts in the Burkholderia community structure in acidic forest soil upon addition of cadmium, a condition that selected for Burkholderia species. The microarray results were in agreement with those obtained from phylogenetic analysis of Burkholderia 16S rRNA gene sequences recovered from the same cadmiumcontaminated soil, demonstrating the value of the Burkholderia phylochip for determinative and environmental studies.

  16. The nucleotide sequence of the entire ribosomal DNA operon and the structure of the large subunit rRNA of Giardia muris.

    PubMed

    van Keulen, H; Gutell, R R; Campbell, S R; Erlandsen, S L; Jarroll, E L

    1992-10-01

    The total nucleotide sequence of the rDNA of Giardia muris, an intestinal protozoan parasite of rodents, has been determined. The repeat unit is 7668 basepairs (bp) in size and consists of a spacer of 3314 bp, a small-subunit rRNA (SSU-rRNA) gene of 1429, and a large-subunit rRNA (LSU-rRNA) gene of 2698 bp. The spacer contains long direct repeats and is heterogeneous in size. The LSU-rRNA of G. muris was compared to that of the human intestinal parasite Giardia duodenalis, to the bird parasite Giardia ardeae, and to that of Escherichia coli. The LSU-rRNA has a size comparable to the 23S rRNA of E. coli but shows structural features typical for eukaryotes. Some variable regions are typically small and account for the overall smaller size of this rRNA. The structure of the G. muris LSU-rRNA is similar to that of the other Giardia rRNA, but each rRNA has characteristic features residing in a number of variable regions.

  17. Rapid identification of 11 human intestinal Lactobacillus species by multiplex PCR assays using group- and species-specific primers derived from the 16S-23S rRNA intergenic spacer region and its flanking 23S rRNA.

    PubMed

    Song, Y; Kato, N; Liu, C; Matsumiya, Y; Kato, H; Watanabe, K

    2000-06-15

    Rapid and reliable two-step multiplex polymerase chain reaction (PCR) assays were established to identify human intestinal lactobacilli; a multiplex PCR was used for grouping of lactobacilli with a mixture of group-specific primers followed by four multiplex PCR assays with four sorts of species-specific primer mixtures for identification at the species level. Primers used were designed from nucleotide sequences of the 16S-23S rRNA intergenic spacer region and its flanking 23S rRNA gene of members of the genus Lactobacillus which are commonly isolated from human stool specimens: Lactobacillus acidophilus, Lactobacillus crispatus, Lactobacillus delbrueckii (ssp. bulgaricus and ssp. lactis), Lactobacillus fermentum, Lactobacillus gasseri, Lactobacillus jensenii, Lactobacillus paracasei (ssp. paracasei and ssp. tolerans), Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus rhamnosus and Lactobacillus salivarius (ssp. salicinius and ssp. salivarius). The established two-step multiplex PCR assays were applied to the identification of 84 Lactobacillus strains isolated from human stool specimens and the PCR results were consistent with the results from the DNA-DNA hybridization assay. These results suggest that the multiplex PCR system established in this study is a simple, rapid and reliable method for the identification of common Lactobacillus isolates from human stool samples.

  18. Plastid 16S rRNA gene diversity among eukaryotic picophytoplankton sorted by flow cytometry from the South Pacific Ocean.

    PubMed

    Shi, Xiao Li; Lepère, Cécile; Scanlan, David J; Vaulot, Daniel

    2011-04-28

    The genetic diversity of photosynthetic picoeukaryotes was investigated in the South East Pacific Ocean. Genetic libraries of the plastid 16S rRNA gene were constructed on picoeukaryote populations sorted by flow cytometry, using two different primer sets, OXY107F/OXY1313R commonly used to amplify oxygenic organisms, and PLA491F/OXY1313R, biased towards plastids of marine algae. Surprisingly, the two sets revealed quite different photosynthetic picoeukaryote diversity patterns, which were moreover different from what we previously reported using the 18S rRNA nuclear gene as a marker. The first 16S primer set revealed many sequences related to Pelagophyceae and Dictyochophyceae, the second 16S primer set was heavily biased toward Prymnesiophyceae, while 18S sequences were dominated by Prasinophyceae, Chrysophyceae and Haptophyta. Primer mismatches with major algal lineages is probably one reason behind this discrepancy. However, other reasons, such as DNA accessibility or gene copy numbers, may be also critical. Based on plastid 16S rRNA gene sequences, the structure of photosynthetic picoeukaryotes varied along the BIOSOPE transect vertically and horizontally. In oligotrophic regions, Pelagophyceae, Chrysophyceae, and Prymnesiophyceae dominated. Pelagophyceae were prevalent at the DCM depth and Chrysophyceae at the surface. In mesotrophic regions Pelagophyceae were still important but Chlorophyta contribution increased. Phylogenetic analysis revealed a new clade of Prasinophyceae (clade 16S-IX), which seems to be restricted to hyper-oligotrophic stations. Our data suggest that a single gene marker, even as widely used as 18S rRNA, provides a biased view of eukaryotic communities and that the use of several markers is necessary to obtain a complete image.

  19. Changes in the Composition of Drinking Water Bacterial Clone Libraries Introduced by Using Two Different 16S rRna Gene PCR Primers

    EPA Science Inventory

    Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...

  20. Changes in the Composition of Drinking Water Bacterial Clone Libraries Introduced by Using Two Different 16S rRNA Gene PCR Primers

    EPA Science Inventory

    Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...

  1. Segal's Law, 16S rRNA gene sequencing, and the perils of foodborne pathogen detection within the American Gut Project.

    PubMed

    Pettengill, James B; Rand, Hugh

    2017-01-01

    Obtaining human population level estimates of the prevalence of foodborne pathogens is critical for understanding outbreaks and ameliorating such threats to public health. Estimates are difficult to obtain due to logistic and financial constraints, but citizen science initiatives like that of the American Gut Project (AGP) represent a potential source of information concerning enteric pathogens. With an emphasis on genera Listeria and Salmonella , we sought to document the prevalence of those two taxa within the AGP samples. The results provided by AGP suggest a surprising 14% and 2% of samples contained Salmonella and Listeria , respectively. However, a reanalysis of those AGP sequences described here indicated that results depend greatly on the algorithm for assigning taxonomy and differences persisted across both a range of parameter settings and different reference databases (i.e., Greengenes and HITdb). These results are perhaps to be expected given that AGP sequenced the V4 region of 16S rRNA gene, which may not provide good resolution at the lower taxonomic levels (e.g., species), but it was surprising how often methods differ in classifying reads-even at higher taxonomic ranks (e.g., family). This highlights the misleading conclusions that can be reached when relying on a single method that is not a gold standard; this is the essence of Segal's Law: an individual with one watch knows what time it is but an individual with two is never sure. Our results point to the need for an appropriate molecular marker for the taxonomic resolution of interest, and calls for the development of more conservative classification methods that are fit for purpose. Thus, with 16S rRNA gene datasets, one must be cautious regarding the detection of taxonomic groups of public health interest (e.g., culture independent identification of foodborne pathogens or taxa associated with a given phenotype).

  2. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation

    PubMed Central

    Garcia, S; Kovařík, A

    2013-01-01

    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S–5.8S–26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S–18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S–5.8S–26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants. PMID:23512008

  3. Verification of clinical samples, positive in AMPLICOR Neisseria gonorrhoeae polymerase chain reaction, by 16S rRNA and gyrA compared with culture.

    PubMed

    Airell, Asa; Lindbäck, Emma; Ataker, Ferda; Pörnull, Kirsti Jalakas; Wretlind, Bengt

    2005-06-01

    We compared 956 samples for AMPLICOR Neisseria gonorrhoeae polymerase chain reaction (PCR) (Roche) with species verification using the 16S rRNA gene to verification using gyrA gene. Control was the culture method. The gyrA verification uses pyrosequencing of the quinolone resistance-determining region of gyrA. Of 52 samples with optical density >/=0.2 in PCR, 27 were negative in culture, two samples from pharynx were false negative in culture and four samples from pharynx were false positives in verification with 16S rRNA. Twenty-five samples showed growth of gonococci, 18 of the corresponding PCR samples were verified by both methods; three urine samples were positive only in gyrA ; and one pharynx specimen was positive only in 16S rRNA. Three samples were lost. We conclude that AMPLICOR N. gonorrhoeae PCR with verification in gyrA gene can be considered as a diagnostic tool in populations with low prevalence of gonorrhoea and that pharynx specimens should not be analysed by PCR.

  4. 16S rRNA Gene-Based Metagenomic Analysis of Ozark Cave Bacteria.

    PubMed

    Oliveira, Cássia; Gunderman, Lauren; Coles, Cathryn A; Lochmann, Jason; Parks, Megan; Ballard, Ethan; Glazko, Galina; Rahmatallah, Yasir; Tackett, Alan J; Thomas, David J

    2017-09-01

    The microbial diversity within cave ecosystems is largely unknown. Ozark caves maintain a year-round stable temperature (12-14 °C), but most parts of the caves experience complete darkness. The lack of sunlight and geological isolation from surface-energy inputs generate nutrient-poor conditions that may limit species diversity in such environments. Although microorganisms play a crucial role in sustaining life on Earth and impacting human health, little is known about their diversity, ecology, and evolution in community structures. We used five Ozark region caves as test sites for exploring bacterial diversity and monitoring long-term biodiversity. Illumina MiSeq sequencing of five cave soil samples and a control sample revealed a total of 49 bacterial phyla, with seven major phyla: Proteobacteria, Acidobacteria, Actinobacteria, Firmicutes, Chloroflexi, Bacteroidetes, and Nitrospirae. Variation in bacterial composition was observed among the five caves studied. Sandtown Cave had the lowest richness and most divergent community composition. 16S rRNA gene-based metagenomic analysis of cave-dwelling microbial communities in the Ozark caves revealed that species abundance and diversity are vast and included ecologically, agriculturally, and economically relevant taxa.

  5. 16S rRNA Gene-Based Metagenomic Analysis of Ozark Cave Bacteria

    PubMed Central

    Oliveira, Cássia; Gunderman, Lauren; Coles, Cathryn A.; Lochmann, Jason; Parks, Megan; Ballard, Ethan; Glazko, Galina; Rahmatallah, Yasir; Tackett, Alan J.; Thomas, David J.

    2018-01-01

    The microbial diversity within cave ecosystems is largely unknown. Ozark caves maintain a year-round stable temperature (12–14 °C), but most parts of the caves experience complete darkness. The lack of sunlight and geological isolation from surface-energy inputs generate nutrient-poor conditions that may limit species diversity in such environments. Although microorganisms play a crucial role in sustaining life on Earth and impacting human health, little is known about their diversity, ecology, and evolution in community structures. We used five Ozark region caves as test sites for exploring bacterial diversity and monitoring long-term biodiversity. Illumina MiSeq sequencing of five cave soil samples and a control sample revealed a total of 49 bacterial phyla, with seven major phyla: Proteobacteria, Acidobacteria, Actinobacteria, Firmicutes, Chloroflexi, Bacteroidetes, and Nitrospirae. Variation in bacterial composition was observed among the five caves studied. Sandtown Cave had the lowest richness and most divergent community composition. 16S rRNA gene-based metagenomic analysis of cave-dwelling microbial communities in the Ozark caves revealed that species abundance and diversity are vast and included ecologically, agriculturally, and economically relevant taxa. PMID:29551950

  6. The Deinococcus-Thermus phylum and the effect of rRNA composition on phylogenetic tree construction

    NASA Technical Reports Server (NTRS)

    Weisburg, W. G.; Giovannoni, S. J.; Woese, C. R.

    1989-01-01

    Through comparative analysis of 16S ribosomal RNA sequences, it can be shown that two seemingly dissimilar types of eubacteria Deinococcus and the ubiquitous hot spring organism Thermus are distantly but specifically related to one another. This confirms an earlier report based upon 16S rRNA oligonucleotide cataloging studies (Hensel et al., 1986). Their two lineages form a distinctive grouping within the eubacteria that deserved the taxonomic status of a phylum. The (partial) sequence of T. aquaticus rRNA appears relatively close to those of other thermophilic eubacteria. e.g. Thermotoga maritima and Thermomicrobium roseum. However, this closeness does not reflect a true evolutionary closeness; rather it is due to a "thermophilic convergence", the result of unusually high G+C composition in the rRNAs of thermophilic bacteria. Unless such compositional biases are taken into account, the branching order and root of phylogenetic trees can be incorrectly inferred.

  7. [Phylogeny of protostome moulting animals (Ecdysozoa) inferred from 18 and 28S rRNA gene sequences].

    PubMed

    Petrov, N B; Vladychenskaia, N S

    2005-01-01

    Reliability of reconstruction of phylogenetic relationships within a group of protostome moulting animals was evaluated by means of comparison of 18 and 28S rRNA gene sequences sets both taken separately and combined. Reliability of reconstructions was evaluated by values of the bootstrap support of major phylogenetic tree nodes and by degree of congruence of phylogenetic trees inferred by various methods. By both criteria, phylogenetic trees reconstructed from the combined 18 and 28S rRNA gene sequences were better than those inferred from 18 and 28S sequences taken separately. Results obtained are consistent with phylogenetic hypothesis separating protostome animals into two major clades, moulting Ecdysozoa (Priapulida + Kinorhyncha, Nematoda + Nematomorpha, Onychophora + Tardigrada, Myriapoda + Chelicerata, Crustacea + Hexapoda) and unmoulting Lophotrochozoa (Plathelminthes, Nemertini, Annelida, Mollusca, Echiura, Sipuncula). Clade Cephalorhyncha does not include nematomorphs (Nematomorpha). Conclusion was taken that it is necessary to use combined 18 and 28S data in phylogenetic studies.

  8. Prevalence of 16S rRNA methylase genes in Klebsiella pneumoniae isolates from a Chinese teaching hospital: coexistence of rmtB and armA genes in the same isolate.

    PubMed

    Yu, Fangyou; Wang, Liangxing; Pan, Jingye; Yao, Dan; Chen, Chan; Zhu, Tao; Lou, Qiang; Hu, Jian; Wu, Yang; Zhang, Xueqing; Chen, Zengqiang; Qu, Di

    2009-05-01

    16S rRNA methylase-mediated high-level resistance to aminoglycosides has been reported recently in clinical isolates of Gram-negative bacilli from several countries. Twenty-one (6.2%, 21/337) of 337 isolates of Klebsiella pneumoniae from a teaching hospital in Wenzhou, China, were positive for 16S rRNA methylase genes (3 for armA, 13 for rmtB, 5 for both armA and rmtB) and highly resistant to gentamicin, amikacin, and tobramycin (MICs, > or =256 microg/mL). Nineteen of 21 isolates harboring 16S rRNA methyalse genes were extended-spectrum beta-lactamase (ESBL) producers. The plasmids harboring 16S rRNA methylase genes from 14 of 21 donors were transferred into the recipients, Escherichia coli J53. The armA and the rmtB usually coexisted with ESBL genes in the same isolate in clinical isolates and cotransferred with ESBL genes on a self-transmissible conjugative plasmid to the recipients. Among 5 isolates harboring both armA and rmtB, the armA genes were located on the chromosomes, and the rmtB genes were located on the plasmids, as determined by Southern hybridization. The result of pulsed-field gel electrophoresis showed that horizontal gene transfer and clonal spread were responsible for the dissemination of the rmtB and the armA genes. 16S rRNA methylase-producing isolates of Klebsiella pneumoniae were commonly identified in the Chinese teaching hospital with coexistence of rmtB and armA genes in the same isolate.

  9. Relative expression of rRNA transcripts and 45S rDNA promoter methylation status are dysregulated in tumors in comparison with matched-normal tissues in breast cancer.

    PubMed

    Karahan, Gurbet; Sayar, Nilufer; Gozum, Gokcen; Bozkurt, Betul; Konu, Ozlen; Yulug, Isik G

    2015-06-01

    Ribosomal RNA (rRNA) expression, one of the most important factors regulating ribosome production, is primarily controlled by a CG-rich 45 S rDNA promoter. However, the DNA methylation state of the 45 S rDNA promoter, as well as its effect on rRNA gene expression in types of human cancers is controversial. In the present study we analyzed the methylation status of the rDNA promoter (-380 to +53 bp) as well as associated rRNA expression levels in breast cancer cell lines and breast tumor-normal tissue pairs. We found that the aforementioned regulatory region was extensively methylated (74-96%) in all cell lines and in 68% (13/19 tumor-normal pairs) of the tumors. Expression levels of rRNA transcripts 18 S, 28 S, 5.8 S and 45 S external transcribed spacer (45 S ETS) greatly varied in the breast cancer cell lines regardless of their methylation status. Analyses of rRNA transcript expression levels in the breast tumor and normal matched tissues showed no significant difference when normalized with TBP. On the other hand, using the geometric mean of the rRNA expression values (GM-rRNA) as reference enabled us to identify significant changes in the relative expression of rRNAs in the tissue samples. We propose GM-rRNA normalization as a novel strategy to analyze expression differences between rRNA transcripts. Accordingly, the 18S rRNA/GM-rRNA ratio was significantly higher whereas the 5.8S rRNA/GM-rRNA ratio was significantly lower in breast tumor samples than this ratio in the matched normal samples. Moreover, the 18S rRNA/GM-rRNA ratio was negatively correlated with the 45 S rDNA promoter methylation level in the normal breast tissue samples, yet not in the breast tumors. Significant correlations observed between the expression levels of rRNA transcripts in the normal samples were lost in the tumor samples. We showed that the expression of rRNA transcripts may not be based solely on promoter methylation. Carcinogenesis may cause dysregulation of the correlation

  10. Discrimination of Bacillus anthracis from closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microchips

    DOEpatents

    Bavykin, Sergei G.; Mirzabekov, Andrei D.

    2007-10-30

    The present invention is directed to a novel method of discriminating a highly infectious bacterium Bacillus anthracis from a group of closely related microorganisms. Sequence variations in the 16S and 23S rRNA of the B. cereus subgroup including B. anthracis are utilized to construct an array that can detect these sequence variations through selective hybridizations. The identification and analysis of these sequence variations enables positive discrimination of isolates of the B. cereus group that includes B. anthracis. Discrimination of single base differences in rRNA was achieved with a microchip during analysis of B. cereus group isolates from both single and in mixed probes, as well as identification of polymorphic sites. Successful use of a microchip to determine the appropriate subgroup classification using eight reference microorganisms from the B. cereus group as a study set, was demonstrated.

  11. Assessing hog lagoon waste contamination in the Cape Fear Watershed using Bacteroidetes 16S rRNA gene pyrosequencing.

    PubMed

    Arfken, Ann M; Song, Bongkeun; Mallin, Michael A

    2015-09-01

    Hog lagoons can be major sources of waste and nutrient contamination to watersheds adjacent to pig farms. Fecal source tracking methods targeting Bacteroidetes 16S rRNA genes in pig fecal matter may underestimate or fail to detect hog lagoon contamination in riverine environments. In order to detect hog lagoon wastewater contamination in the Cape Fear Watershed, where a large number of hog farms are present, we conducted pyrosequencing analyses of Bacteroidetes 16S rRNA genes in hog lagoon waste and identified new hog lagoon-specific marker sequences. Additional pyrosequencing analyses of Bacteroidetes 16S rRNA genes were conducted with surface water samples collected at 4 sites during 5 months in the Cape Fear Watershed. Using an operational taxonomic unit (OTU) identity cutoff value of 97 %, these newly identified hog lagoon markers were found in 3 of the river samples, while only 1 sample contained the pig fecal marker. In the sample containing the pig fecal marker, there was a relatively high percentage (14.1 %) of the hog lagoon markers and a low pig fecal marker relative abundance of 0.4 % in the Bacteroidetes 16S rRNA gene sequences. This suggests that hog lagoon contamination must be somewhat significant in order for pig fecal markers to be detected, and low levels of hog lagoon contamination cannot be detected targeting only pig-specific fecal markers. Thus, new hog lagoon markers have a better detection capacity for lagoon waste contamination, and in conjunction with a pig fecal marker, provide a more comprehensive and accurate detection of hog lagoon waste contamination in susceptible watersheds.

  12. Physical Localization and DNA Methylation of 45S rRNA Gene Loci in Jatropha curcas L.

    PubMed Central

    Gong, Zhiyun; Xue, Chao; Zhang, Mingliang; Guo, Rui; Zhou, Yong; Shi, Guoxin

    2013-01-01

    In eukaryotes, 45S rRNA genes are arranged in tandem arrays of repeat units, and not all copies are transcribed during mitosis. DNA methylation is considered to be an epigenetic marker for rDNA activation. Here, we established a clear and accurate karyogram for Jatropha curcas L. The chromosomal formula was found to be 2n = 2x = 22 = 12m+10sm. We found that the 45S rDNA loci were located at the termini of chromosomes 7 and 9 in J. curcas. The distribution of 45S rDNA has no significant difference in J. curcas from different sources. Based on the hybridization signal patterns, there were two forms of rDNA - dispersed and condensed. The dispersed type of signals appeared during interphase and prophase, while the condensed types appeared during different stages of mitosis. DNA methylation analysis showed that when 45S rDNA stronger signals were dispersed and connected to the nucleolus, DNA methylation levels were lower at interphase and prophase. However, when the 45S rDNA loci were condensed, especially during metaphase, they showed different forms of DNA methylation. PMID:24386362

  13. Cloning and recombinant expression of a cellulase from the cellulolytic strain Streptomyces sp. G12 isolated from compost

    PubMed Central

    2012-01-01

    Background The use of lignocellulosic materials for second generation ethanol production would give several advantages such as minimizing the conflict between land use for food and fuel production, providing less expensive raw materials than conventional agricultural feedstock, allowing lower greenhouse gas emissions than those of first generation ethanol. However, cellulosic biofuels are not produced at a competitive level yet, mainly because of the high production costs of the cellulolytic enzymes. Therefore, this study was aimed at discovering new cellulolytic microorganisms and enzymes. Results Different bacteria isolated from raw composting materials obtained from vegetable processing industry wastes were screened for their cellulolytic activity on solid medium containing carboxymethylcellulose. Four strains belonging to the actinomycetes group were selected on the basis of their phenotypic traits and cellulolytic activity on solid medium containing carboxymethylcellulose. The strain showing the highest cellulolytic activity was identified by 16S rRNA sequencing as belonging to Streptomyces genus and it was designated as Streptomyces sp. strain G12. Investigating the enzymes responsible for cellulase activity produced by Streptomyces G12 by proteomic analyses, two endoglucanases were identified. Gene coding for one of these enzymes, named CelStrep, was cloned and sequenced. Molecular analysis showed that the celstrep gene has an open reading frame encoding a protein of 379 amino acid residues, including a signal peptide of 37 amino acid residues. Comparison of deduced aminoacidic sequence to the other cellulases indicated that the enzyme CelStrep can be classified as a family 12 glycoside hydrolase. Heterologous recombinant expression of CelStrep was carried out in Escherichia coli, and the active recombinant enzyme was purified from culture supernatant and characterized. It catalyzes the hydrolysis of carboxymethylcellulose following a Michaelis

  14. Transoceanic migration by a 12 g songbird.

    PubMed

    DeLuca, William V; Woodworth, Bradley K; Rimmer, Christopher C; Marra, Peter P; Taylor, Philip D; McFarland, Kent P; Mackenzie, Stuart A; Norris, D Ryan

    2015-04-01

    Many fundamental aspects of migration remain a mystery, largely due to our inability to follow small animals over vast spatial areas. For more than 50 years, it has been hypothesized that, during autumn migration, blackpoll warblers (Setophaga striata) depart northeastern North America and undertake a non-stop flight over the Atlantic Ocean to either the Greater Antilles or the northeastern coast of South America. Using miniaturized light-level geolocators, we provide the first irrefutable evidence that the blackpoll warbler, a 12 g boreal forest songbird, completes an autumn transoceanic migration ranging from 2270 to 2770 km (mean ± s.d.: 2540 ± 257) and requiring up to 3 days (62 h ± 10) of non-stop flight. This is one of the longest non-stop overwater flights recorded for a songbird and confirms what has long been believed to be one of the most extraordinary migratory feats on the planet. © 2015 The Author(s) Published by the Royal Society. All rights reserved.

  15. Identification of Actinomyces meyeri actinomycosis in middle ear and mastoid by 16S rRNA analysis.

    PubMed

    Kakuta, Risako; Hidaka, Hiroshi; Yano, Hisakazu; Miyazaki, Hiromitsu; Suzaki, Hiroshi; Nakamura, Yasuhiro; Kanamori, Hajime; Endo, Shiro; Hirakata, Yoichi; Kaku, Mitsuo; Kobayashi, Toshimitsu

    2013-08-01

    Actinomycosis of the middle ear and mastoid is extremely rare. Here, we report a unique case of actinomycosis of the middle ear and mastoid caused by Actinomyces meyeri diagnosed by 16S rRNA gene sequence analysis.

  16. Rrp6p, the yeast homologue of the human PM-Scl 100-kDa autoantigen, is essential for efficient 5.8 S rRNA 3' end formation.

    PubMed

    Briggs, M W; Burkard, K T; Butler, J S

    1998-05-22

    The eukaryotic 25 S, 18 S, and 5.8 S rRNAs are synthesized as a single transcript with two internal transcribed spacers (ITS1 and ITS2), which are removed by endo- and exoribonucleolytic steps to produce mature rRNA. Genetic selection for suppressors of a polyadenylation defect yielded two cold-sensitive alleles of a gene that we named RRP6 (ribosomal RNA processing). Molecular cloning of RRP6 revealed its homology to a 100-kDa human, nucleolar PM-Scl autoantigen and to Escherichia coli RNase D, a 3'-5' exoribonuclease. Recessive mutations in rrp6 result in the accumulation of a novel 5. 8 S rRNA processing intermediate, called 5.8 S*, which has normal 5' ends, but retains approximately 30 nucleotides of ITS2. Pulse-chase analysis of 5.8 S rRNA processing in an rrp6- strain revealed a precursor-product relationship between 5.8 S* and 5.8 S rRNAs, suggesting that Rrp6p plays a role in the removal of the last 30 nucleotides of ITS2 from 5.8 S precursors. A portion of 5.8 S* rRNA assembles into 60 S ribosomes which form polyribosomes, suggesting that they function in protein synthesis. These findings indicate that Rrp6p plays a role in 5.8 S rRNA 3' end formation, and they identify a functional intermediate in the rRNA processing pathway.

  17. The role of mmu-miR-155-5p-NF-κB signaling in the education of bone marrow-derived mesenchymal stem cells by gastric cancer cells.

    PubMed

    Wang, Mei; Yang, Fang; Qiu, Rong; Zhu, Mengchu; Zhang, Huiling; Xu, Wenrong; Shen, Bo; Zhu, Wei

    2018-03-01

    Bone marrow-derived mesenchymal stem cells (BM-MSCs) are important precursors of tumor stromal cells. Previously, we have demonstrated that miR-155-5p inhibition directly induced transition of BM-MSCs into gastric cancer-associated MSCs. Whether miR-155-5p is involved in the education of BM-MSCs by gastric cancer cells has not been established. Murine BM-MSCs (mMSCs) were isolated and grown in conditioned medium derived from gastric cancer cell line MFC (MFC-CM). The tumor-promoting phenotype and function of mMSCs were detected by immunofluorescence staining, quantitative reverse transcription-polymerase chain reaction (qRT-PCR), cell colony formation assay, transwell migration, and invasion assays. Luciferase reporter assays and western blot analyses were conducted to reveal the relationship between nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) p65 and mmu-miR-155-5p. miRNA mimics, inhibitor, and the NF-κB inhibitor pyrrolidine dithiocarbamic acid (PDTC) were used to evaluate the role of miR-155-5p-NF-κB signaling in the education of mMSCs by MFC-CM. We successfully established the education model of mMSCs by MFC-CM and found that mmu-miR-155-5p expression levels were reduced in mMSCs. Mimicking this deregulation by transfecting miRNA inhibitor into mMSCs produced a similar effect as that of MFC-CM on mMSCs. NF-κB p65 was validated as a target of mmu-miR-155-5p, which also negatively regulated NF-κB activation. Inhibition of NF-κB activation by PDTC abolished the effect of the miRNA inhibitor on mMSCs. mmu-miR-155-5p overexpression partially blocked the effect of MFC-CM in educating mMSCs, while PDTC treatment completely eliminated MFC-CM activity. These results indicate that miR-155-5p is not the sole miRNA mediating the education of BM-MSCs by gastric cancer cells, but downstream NF-κB signaling is indispensable for this process. © 2018 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  18. N6-Methylation Assessment in Escherichia coli 23S rRNA Utilizing a Bulge Loop in an RNA-DNA Hybrid.

    PubMed

    Yoshioka, Kyoko; Kurita, Ryoji

    2018-06-07

    We propose a sequence-selective assay of N6-methyl-adenosine (m6A) in RNA without PCR or reverse transcription, by employing a hybridization assay with a DNA probe designed to form a bulge loop at the position of a target modified nucleotide. The m6A in the bulge in the RNA-DNA hybrid was assumed to be sufficiently mobile to be selectively recognized by an anti-m6A antibody with a high affinity. By employing a surface-plasmon-resonance measurement or using a microtiter-plate immunoassay method, a specific m6A in the Escherichia coli 23S rRNA sequence could be detected at the nanomolar level when synthesized and purified oligo-RNA fragments were used for measurement. We have successfully achieved the first selective detection of m6A 2030 specifically in 23S rRNA from real samples of E. coli total RNA by using our immunochemical approach.

  19. Stimulation of Pol III-dependent 5S rRNA and U6 snRNA gene expression by AP-1 transcription factors.

    PubMed

    Ahuja, Richa; Kumar, Vijay

    2017-07-01

    RNA polymerase III transcribes structurally diverse group of essential noncoding RNAs including 5S ribosomal RNA (5SrRNA) and U6 snRNA. These noncoding RNAs are involved in RNA processing and ribosome biogenesis, thus, coupling Pol III activity to the rate of protein synthesis, cell growth, and proliferation. Even though a few Pol II-associated transcription factors have been reported to participate in Pol III-dependent transcription, its activation by activator protein 1 (AP-1) factors, c-Fos and c-Jun, has remained unexplored. Here, we show that c-Fos and c-Jun bind to specific sites in the regulatory regions of 5S rRNA (type I) and U6 snRNA (type III) gene promoters and stimulate their transcription. Our chromatin immunoprecipitation studies suggested that endogenous AP-1 factors bind to their cognate promoter elements during the G1/S transition of cell cycle apparently synchronous with Pol III transcriptional activity. Furthermore, the interaction of c-Jun with histone acetyltransferase p300 promoted the recruitment of p300/CBP complex on the promoters and facilitated the occupancy of Pol III transcriptional machinery via histone acetylation and chromatin remodeling. The findings of our study, together, suggest that AP-1 factors are novel regulators of Pol III-driven 5S rRNA and U6 snRNA expression with a potential role in cell proliferation. © 2017 Federation of European Biochemical Societies.

  20. Mapping of chloroplast mutations conferring resistance to antibiotics in Chlamydomonas: evidence for a novel site of streptomycin resistance in the small subunit rRNA.

    PubMed

    Gauthier, A; Turmel, M; Lemieux, C

    1988-10-01

    A major obstacle to our understanding of the mechanisms governing the inheritance, recombination and segregation of chloroplast genes in Chlamydomonas is that the majority of antibiotic resistance mutations that have been used to gain insights into such mechanisms have not been physically localized on the chloroplast genome. We report here the physical mapping of two chloroplast antibiotic resistance mutations: one conferring cross-resistance to erythromycin and spiramycin in Chlamydomonas moewusii (er-nM1) and the other conferring resistance to streptomycin in the interfertile species C. eugametos (sr-2). The er-nM1 mutation results from a C to G transversion at a well-known site of macrolide resistance within the peptidyl transferase loop region of the large subunit rRNA gene. This locus, designated rib-2 in yeast mitochondrial DNA, corresponds to residue C-2611 in the 23 S rRNA of Escherichia coli. The sr-2 locus maps within the small subunit (SSU) rRNA gene at a site that has not been described previously. The mutation results from an A to C transversion at a position equivalent to residue A-523 in the E. coli 16 S rRNA. Although this region of the E. coli SSU rRNA has no binding affinity for streptomycin, it binds to ribosomal protein S4, a protein that has long been associated with the response of bacterial cells to this antibiotic. We propose that the sr-2 mutation indirectly affects the nearest streptomycin binding site through an altered interaction between a ribosomal protein and the SSU rRNA.

  1. Investigation of histone H4 hyperacetylation dynamics in the 5S rRNA genes family by chromatin immunoprecipitation assay.

    PubMed

    Burlibașa, Liliana; Suciu, Ilinca

    2015-12-01

    Oogenesis is a critical event in the formation of female gamete, whose role in development is to transfer genomic information to the next generation. During this process, the gene expression pattern changes dramatically concomitant with genome remodelling, while genomic information is stably maintained. The aim of the present study was to investigate the presence of H4 acetylation of the oocyte and somatic 5S rRNA genes in Triturus cristatus, using chromatin immunoprecipitation assay (ChIP). Our findings suggest that some epigenetic mechanisms such as histone acetylation could be involved in the transcriptional regulation of 5S rRNA gene families.

  2. Benchmarking taxonomic assignments based on 16S rRNA gene profiling of the microbiota from commonly sampled environments.

    PubMed

    Almeida, Alexandre; Mitchell, Alex L; Tarkowska, Aleksandra; Finn, Robert D

    2018-05-01

    Taxonomic profiling of ribosomal RNA (rRNA) sequences has been the accepted norm for inferring the composition of complex microbial ecosystems. Quantitative Insights Into Microbial Ecology (QIIME) and mothur have been the most widely used taxonomic analysis tools for this purpose, with MAPseq and QIIME 2 being two recently released alternatives. However, no independent and direct comparison between these four main tools has been performed. Here, we compared the default classifiers of MAPseq, mothur, QIIME, and QIIME 2 using synthetic simulated datasets comprised of some of the most abundant genera found in the human gut, ocean, and soil environments. We evaluate their accuracy when paired with both different reference databases and variable sub-regions of the 16S rRNA gene. We show that QIIME 2 provided the best recall and F-scores at genus and family levels, together with the lowest distance estimates between the observed and simulated samples. However, MAPseq showed the highest precision, with miscall rates consistently <2%. Notably, QIIME 2 was the most computationally expensive tool, with CPU time and memory usage almost 2 and 30 times higher than MAPseq, respectively. Using the SILVA database generally yielded a higher recall than using Greengenes, while assignment results of different 16S rRNA variable sub-regions varied up to 40% between samples analysed with the same pipeline. Our results support the use of either QIIME 2 or MAPseq for optimal 16S rRNA gene profiling, and we suggest that the choice between the two should be based on the level of recall, precision, and/or computational performance required.

  3. Requirement of ClC-3 in G0/G1 to S Phase Transition Induced by IGF-1 via ERK1/2-Cyclins Cascade in Multiple Myeloma Cells.

    PubMed

    Du, Yu; Tu, Yong-Sheng; Tang, Yong-Bo; Huang, Yun-Ying; Zhou, Fang-Min; Tian, Tian; Li, Xiao-Yan

    2018-06-01

    ClC-3 is involved in the proliferation and migration of several cancer cells. However, ClC-3 expression and its role of cell-cycle control in multiple myeloma (MM) has not yet been investigated. MM cells were treated with different concentrations of IGF (30, 100, 300 ng/mL), and their proliferation was examined by CCK-8. The effects of ClC-3 on cell cycle progression was detected by flow cytometry. Western blot was used to analyze the relative levels of ClC3, CD138, P21, P27, CDK, p-Erk1/2, and t-Erk1/2 protein expression. Transfection of RPMI8226 with gpClC-3 cDNA and siRNA alters the expression of ClC-3. We compared the expression of ClC-3 in primary myeloma cells and in MM cell lines (U266 and RPMI8266) with that in normal plasma cells (PCs) from normal subjects and found that myeloma cells from patients and MM cell lines had significantly higher expression of ClC-3. Additionally, silencing of ClC-3 with the small interfering RNA (siRNA) that targets human ClC-3 decreased proliferation of RPMI8226 after IGF-1 treatment and slowed cell cycle progression from G0/G1 to S phase, which was associated with diminished phosphorylation of ERK1/2, down-expression of cyclin E, cyclin D1 and up-regulation of p27 and p21. By contrast, overexpression of ClC-3 potentiated cell proliferation induced by IGF-1, raised the percentage of S phase cells, enhanced phosphorylation of ERK1/2, downregulated p27 and p21 and upregulated cyclin E and cyclin D1. ClC-3 accelerated G0/G1 to S phase transition in the cell cycle by modulating ERK1/2 kinase activity and expression of G1/S transition related proteins, making ClC-3 an attractive therapeutic target in MM.

  4. Comparison of gull-specific assays targeting 16S rRNA gene of Catellicoccus marimammalium and Streptococcus spp.

    EPA Science Inventory

    Gulls have been implicated as a source of fecal contamination in inland and coastal waters. Only one gull-specific assay is currently available (i.e., gull2 qPCR assay). This assay is based on the 16S rRNA gene of Catellicocclls marimammalium and has showed a high level of host-s...

  5. Complex community of nitrite-dependent anaerobic methane oxidation bacteria in coastal sediments of the Mai Po wetland by PCR amplification of both 16S rRNA and pmoA genes.

    PubMed

    Chen, Jing; Zhou, Zhichao; Gu, Ji-Dong

    2015-02-01

    In the present work, both 16S rRNA and pmoA gene-based PCR primers were employed successfully to study the diversity and distribution of n-damo bacteria in the surface and lower layer sediments at the coastal Mai Po wetland. The occurrence of n-damo bacteria in both the surface and subsurface sediments with high diversity was confirmed in this study. Unlike the two other known n-damo communities from coastal areas, the pmoA gene-amplified sequences in the present work clustered not only with some freshwater subclusters but also within three newly erected marine subclusters mostly, indicating the unique niche specificity of n-damo bacteria in this wetland. Results suggested vegetation affected the distribution and community structures of n-damo bacteria in the sediments and n-damo could coexist with sulfate-reducing methanotrophs in the coastal ecosystem. Community structures of the Mai Po n-damo bacteria based on 16S rRNA gene were different from those of either the freshwater or the marine. In contrast, structures of the Mai Po n-damo communities based on pmoA gene grouped with the marine ones and were clearly distinguished from the freshwater ones. The abundance of n-damo bacteria at this wetland was quantified using 16S rRNA gene PCR primers to be 2.65-6.71 × 10(5) copies/g dry sediment. Ammonium and nitrite strongly affected the community structures and distribution of n-damo bacteria in the coastal Mai Po wetland sediments.

  6. Elevated levels of Era GTPase improve growth, 16S rRNA processing, and 70S ribosome assembly of Escherichia coli lacking highly conserved multifunctional YbeY endoribonuclease.

    PubMed

    Ghosal, Anubrata; Babu, Vignesh M P; Walker, Graham C

    2018-06-18

    YbeY is a highly conserved, multifunctional endoribonuclease that plays a significant role in ribosome biogenesis and has several additional roles. Here, we show in Escherichia coli that overexpressing the conserved GTPase, Era, partially suppresses the growth defect of a ΔybeY strain while improving 16S rRNA processing and 70S ribosome assembly. This suppression requires both Era's ability to hydrolyze GTP and the function of three exoribonucleases, RNase II, RNase R and RNase PH, suggesting a model for Era's action. Overexpressing Vibrio cholerae Era similarly partially suppresses the defects of an E. coli ΔybeY strain indicating this property of Era is conserved in bacteria other than E. coli Importance This work provides additional insights into the critical, but still incompletely understood, mechanism of the processing of the E. coli 16S rRNA 3'-terminus. The highly conserved GTPase, Era, is known to bind to the precursor of the 16S rRNA near its 3-end. Both the endoribonuclease YbeY, which binds to Era, and four exoribonucleases have been implicated in this 3'-end processing. Results reported here offer additional insights into the role of Era in 16S rRNA 3'-maturation and into the relationship between the action of the endoribonuclease YbeY and the four exoribonucleases. This study also hints at why YbeY is only essential in some bacteria and suggests that the YbeY could be a target for a new class of antibiotic in these bacteria. Copyright © 2018 American Society for Microbiology.

  7. Accuracy of taxonomy prediction for 16S rRNA and fungal ITS sequences

    PubMed Central

    2018-01-01

    Prediction of taxonomy for marker gene sequences such as 16S ribosomal RNA (rRNA) is a fundamental task in microbiology. Most experimentally observed sequences are diverged from reference sequences of authoritatively named organisms, creating a challenge for prediction methods. I assessed the accuracy of several algorithms using cross-validation by identity, a new benchmark strategy which explicitly models the variation in distances between query sequences and the closest entry in a reference database. When the accuracy of genus predictions was averaged over a representative range of identities with the reference database (100%, 99%, 97%, 95% and 90%), all tested methods had ≤50% accuracy on the currently-popular V4 region of 16S rRNA. Accuracy was found to fall rapidly with identity; for example, better methods were found to have V4 genus prediction accuracy of ∼100% at 100% identity but ∼50% at 97% identity. The relationship between identity and taxonomy was quantified as the probability that a rank is the lowest shared by a pair of sequences with a given pair-wise identity. With the V4 region, 95% identity was found to be a twilight zone where taxonomy is highly ambiguous because the probabilities that the lowest shared rank between pairs of sequences is genus, family, order or class are approximately equal. PMID:29682424

  8. An MRPS12 mutation modifies aminoglycoside sensitivity caused by 12S rRNA mutations

    PubMed Central

    Emperador, Sonia; Pacheu-Grau, David; Bayona-Bafaluy, M. Pilar; Garrido-Pérez, Nuria; Martín-Navarro, Antonio; López-Pérez, Manuel J.; Montoya, Julio; Ruiz-Pesini, Eduardo

    2015-01-01

    Several homoplasmic pathologic mutations in mitochondrial DNA, such as those causing Leber hereditary optic neuropathy or non-syndromic hearing loss, show incomplete penetrance. Therefore, other elements must modify their pathogenicity. Discovery of these modifying factors is not an easy task because in multifactorial diseases conventional genetic approaches may not always be informative. Here, we have taken an evolutionary approach to unmask putative modifying factors for a particular homoplasmic pathologic mutation causing aminoglycoside-induced and non-syndromic hearing loss, the m.1494C>T transition in the mitochondrial DNA. The mutation is located in the decoding site of the mitochondrial ribosomal RNA. We first looked at mammalian species that had fixed the human pathologic mutation. These mutations are called compensated pathogenic deviations because an organism carrying one must also have another that suppresses the deleterious effect of the first. We found that species from the primate family Cercopithecidae (old world monkeys) harbor the m.1494T allele even if their auditory function is normal. In humans the m.1494T allele increases the susceptibility to aminoglycosides. However, in primary fibroblasts from a Cercopithecidae species, aminoglycosides do not impair cell growth, respiratory complex IV activity and quantity or the mitochondrial protein synthesis. Interestingly, this species also carries a fixed mutation in the mitochondrial ribosomal protein S12. We show that the expression of this variant in a human m.1494T cell line reduces its susceptibility to aminoglycosides. Because several mutations in this human protein have been described, they may possibly explain the absence of pathologic phenotype in some pedigree members with the most frequent pathologic mutations in mitochondrial ribosomal RNA. PMID:25642242

  9. Arabidopsis Chloroplast Mini-Ribonuclease III Participates in rRNA Maturation and Intron Recycling

    PubMed Central

    Hotto, Amber M.; Castandet, Benoît; Gilet, Laetitia; Higdon, Andrea; Condon, Ciarán; Stern, David B.

    2015-01-01

    RNase III proteins recognize double-stranded RNA structures and catalyze endoribonucleolytic cleavages that often regulate gene expression. Here, we characterize the functions of RNC3 and RNC4, two Arabidopsis thaliana chloroplast Mini-RNase III-like enzymes sharing 75% amino acid sequence identity. Whereas rnc3 and rnc4 null mutants have no visible phenotype, rnc3/rnc4 (rnc3/4) double mutants are slightly smaller and chlorotic compared with the wild type. In Bacillus subtilis, the RNase Mini-III is integral to 23S rRNA maturation. In Arabidopsis, we observed imprecise maturation of 23S rRNA in the rnc3/4 double mutant, suggesting that exoribonucleases generated staggered ends in the absence of specific Mini-III-catalyzed cleavages. A similar phenotype was found at the 3′ end of the 16S rRNA, and the primary 4.5S rRNA transcript contained 3′ extensions, suggesting that Mini-III catalyzes several processing events of the polycistronic rRNA precursor. The rnc3/4 mutant showed overaccumulation of a noncoding RNA complementary to the 4.5S-5S rRNA intergenic region, and its presence correlated with that of the extended 4.5S rRNA precursor. Finally, we found rnc3/4-specific intron degradation intermediates that are probable substrates for Mini-III and show that B. subtilis Mini-III is also involved in intron regulation. Overall, this study extends our knowledge of the key role of Mini-III in intron and noncoding RNA regulation and provides important insight into plastid rRNA maturation. PMID:25724636

  10. Analysis of 16S-23S rRNA intergenic spacer regions of Vibrio cholerae and Vibrio mimicus.

    PubMed

    Chun, J; Huq, A; Colwell, R R

    1999-05-01

    Vibrio cholerae identification based on molecular sequence data has been hampered by a lack of sequence variation from the closely related Vibrio mimicus. The two species share many genes coding for proteins, such as ctxAB, and show almost identical 16S DNA coding for rRNA (rDNA) sequences. Primers targeting conserved sequences flanking the 3' end of the 16S and the 5' end of the 23S rDNAs were used to amplify the 16S-23S rRNA intergenic spacer regions of V. cholerae and V. mimicus. Two major (ca. 580 and 500 bp) and one minor (ca. 750 bp) amplicons were consistently generated for both species, and their sequences were determined. The largest fragment contains three tRNA genes (tDNAs) coding for tRNAGlu, tRNALys, and tRNAVal, which has not previously been found in bacteria examined to date. The 580-bp amplicon contained tDNAIle and tDNAAla, whereas the 500-bp fragment had single tDNA coding either tRNAGlu or tRNAAla. Little variation, i.e., 0 to 0.4%, was found among V. cholerae O1 classical, O1 El Tor, and O139 epidemic strains. Slightly more variation was found against the non-O1/non-O139 serotypes (ca. 1% difference) and V. mimicus (2 to 3% difference). A pair of oligonucleotide primers were designed, based on the region differentiating all of V. cholerae strains from V. mimicus. The PCR system developed was subsequently evaluated by using representatives of V. cholerae from environmental and clinical sources, and of other taxa, including V. mimicus. This study provides the first molecular tool for identifying the species V. cholerae.

  11. The novel mitochondrial 16S rRNA 2336T>C mutation is associated with hypertrophic cardiomyopathy

    PubMed Central

    Liu, Zhong; Song, Yanrui; Li, Dan; He, Xiangyu; Li, Shishi; Wu, Bifeng; Wang, Wei; Gu, Shulian; Zhu, Xiaoyu; Wang, Xuexiang; Zhou, Qiyin; Dai, Yu; Yan, Qingfeng

    2014-01-01

    Background Hypertrophic cardiomyopathy (HCM) is a primary disorder characterised by asymmetric thickening of septum and left ventricular wall, with a prevalence of 0.2% in the general population. Objective To describe a novel mitochondrial DNA mutation and its association with the pathogenesis of HCM. Methods and results All maternal members of a Chinese family with maternally transmitted HCM exhibited variable severity and age at onset, and were implanted permanent pacemakers due to complete atrioventricular block (AVB). Nuclear gene screening (MYH7, MYBPC3, TNNT2 and TNNI3) was performed, and no potential pathogenic mutation was identified. Mitochondrial DNA sequencing analysis identified a novel homoplasmic 16S rRNA 2336T>C mutation. This mutation was exclusively present in maternal members and absent in non-maternal members. Conservation index by comparison to 16 other vertebrates was 94.1%. This mutation disturbs the 2336U-A2438 base pair in the stem–loop structure of 16S rRNA domain III, which is involved in the assembly of mitochondrial ribosome. Oxygen consumption rate of the lymphoblastoid cells carrying 2336T>C mutation had decreased by 37% compared with controls. A reduction in mitochondrial ATP synthesis and an increase in reactive oxidative species production were also observed. Electron microscopic analysis indicated elongated mitochondria and abnormal mitochondrial cristae shape in mutant cells. Conclusions It is suggested that the 2336T>C mutation is one of pathogenic mutations of HCM. This is the first report of mitochondrial 16S rRNA 2336T>C mutation and an association with maternally inherited HCM combined with AVB. Our findings provide a new insight into the pathogenesis of HCM. PMID:24367055

  12. Development of an oligonucleotide probe for Aureobasidium pullulans based on the small-subunit rRNA gene.

    PubMed Central

    Li, S; Cullen, D; Hjort, M; Spear, R; Andrews, J H

    1996-01-01

    Aureobasidium pullulans, a cosmopolitan yeast-like fungus, colonizes leaf surfaces and has potential as a biocontrol agent of pathogens. To assess the feasibility of rRNA as a target for A. pullulans-specific oligonucleotide probes, we compared the nucleotide sequences of the small-subunit rRNA (18S) genes of 12 geographically diverse A. pullulans strains. Extreme sequence conservation was observed. The consensus A. pullulans sequence was compared with other fungal sequences to identify potential probes. A 21-mer probe which hybridized to the 12 A. pullulans strains but not to 98 other fungi, including 82 isolates from the phylloplane, was identified. A 17-mer highly specific for Cladosporium herbarum was also identified. These probes have potential in monitoring and quantifying fungi in leaf surface and other microbial communities. PMID:8633850

  13. Use of 16S rRNA Sequencing for Identification of Actinobacillus ureae Isolated from a Cerebrospinal Fluid Sample

    PubMed Central

    Whitelaw, A. C.; Shankland, I. M.; Elisha, B. G.

    2002-01-01

    Actinobacillus ureae, previously Pasteurella ureae, has on rare occasions been described as a cause of human infection. Owing to its rarity, it may not be easily identified in clinical microbiology laboratories by standard tests. This report describes a patient with acute bacterial meningitis due to A. ureae. The identity of the isolate was determined by means of DNA sequence analysis of a portion of the 16S rRNA gene. PMID:11825992

  14. Use of 16S rRNA Gene for Identification of a Broad Range of Clinically Relevant Bacterial Pathogens

    PubMed Central

    Srinivasan, Ramya; Karaoz, Ulas; Volegova, Marina; MacKichan, Joanna; Kato-Maeda, Midori; Miller, Steve; Nadarajan, Rohan; Brodie, Eoin L.; Lynch, Susan V.

    2015-01-01

    According to World Health Organization statistics of 2011, infectious diseases remain in the top five causes of mortality worldwide. However, despite sophisticated research tools for microbial detection, rapid and accurate molecular diagnostics for identification of infection in humans have not been extensively adopted. Time-consuming culture-based methods remain to the forefront of clinical microbial detection. The 16S rRNA gene, a molecular marker for identification of bacterial species, is ubiquitous to members of this domain and, thanks to ever-expanding databases of sequence information, a useful tool for bacterial identification. In this study, we assembled an extensive repository of clinical isolates (n = 617), representing 30 medically important pathogenic species and originally identified using traditional culture-based or non-16S molecular methods. This strain repository was used to systematically evaluate the ability of 16S rRNA for species level identification. To enable the most accurate species level classification based on the paucity of sequence data accumulated in public databases, we built a Naïve Bayes classifier representing a diverse set of high-quality sequences from medically important bacterial organisms. We show that for species identification, a model-based approach is superior to an alignment based method. Overall, between 16S gene based and clinical identities, our study shows a genus-level concordance rate of 96% and a species-level concordance rate of 87.5%. We point to multiple cases of probable clinical misidentification with traditional culture based identification across a wide range of gram-negative rods and gram-positive cocci as well as common gram-negative cocci. PMID:25658760

  15. Identification by 16S rRNA gene sequencing of an Actinomyces hongkongensis isolate recovered from a patient with pelvic actinomycosis.

    PubMed

    Flynn, A N; Lyndon, C A; Church, D L

    2013-08-01

    A case of Actinomyces hongkongensis pelvic actinomycosis in an adult woman is described. Conventional phenotypic tests failed to identify the Gram-positive bacillus isolated from a fluid aspirate of a pelvic abscess. The bacterium was identified by 16S rRNA gene sequencing and analysis using the SmartGene Integrated Database Network System software.

  16. Microbial Contaminants of Cord Blood Units Identified by 16S rRNA Sequencing and by API Test System, and Antibiotic Sensitivity Profiling

    PubMed Central

    França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S.

    2015-01-01

    Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs) assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes. PMID:26512991

  17. Microbial Contaminants of Cord Blood Units Identified by 16S rRNA Sequencing and by API Test System, and Antibiotic Sensitivity Profiling.

    PubMed

    França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S

    2015-01-01

    Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs) assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes.

  18. Vertical Distribution of Bacterial Communities in the Indian Ocean as Revealed by Analyses of 16S rRNA and nasA Genes.

    PubMed

    Jiang, Xuexia; Jiao, Nianzhi

    2016-09-01

    Bacteria play an important role in the marine biogeochemical cycles. However, research on the bacterial community structure of the Indian Ocean is scarce, particularly within the vertical dimension. In this study, we investigated the bacterial diversity of the pelagic, mesopelagic and bathypelagic zones of the southwestern Indian Ocean (50.46°E, 37.71°S). The clone libraries constructed by 16S rRNA gene sequence revealed that most phylotypes retrieved from the Indian Ocean were highly divergent from those retrieved from other oceans. Vertical differences were observed based on the analysis of natural bacterial community populations derived from the 16S rRNA gene sequences. Based on the analysis of the nasA gene sequences from GenBank database, a pair of general primers was developed and used to amplify the bacterial nitrate-assimilating populations. Environmental factors play an important role in mediating the bacterial communities in the Indian Ocean revealed by canonical correlation analysis.

  19. Functional genetic selection of Helix 66 in Escherichia coli 23S rRNA identified the eukaryotic-binding sequence for ribosomal protein L2

    PubMed Central

    Kitahara, Kei; Kajiura, Akimasa; Sato, Neuza Satomi; Suzuki, Tsutomu

    2007-01-01

    Ribosomal protein L2 is a highly conserved primary 23S rRNA-binding protein. L2 specifically recognizes the internal bulge sequence in Helix 66 (H66) of 23S rRNA and is localized to the intersubunit space through formation of bridge B7b with 16S rRNA. The L2-binding site in H66 is highly conserved in prokaryotic ribosomes, whereas the corresponding site in eukaryotic ribosomes has evolved into distinct classes of sequences. We performed a systematic genetic selection of randomized rRNA sequences in Escherichia coli, and isolated 20 functional variants of the L2-binding site. The isolated variants consisted of eukaryotic sequences, in addition to prokaryotic sequences. These results suggest that L2/L8e does not recognize a specific base sequence of H66, but rather a characteristic architecture of H66. The growth phenotype of the isolated variants correlated well with their ability of subunit association. Upon continuous cultivation of a deleterious variant, we isolated two spontaneous mutations within domain IV of 23S rRNA that compensated for its weak subunit association, and alleviated its growth defect, implying that functional interactions between intersubunit bridges compensate ribosomal function. PMID:17553838

  20. Nested PCR Biases in Interpreting Microbial Community Structure in 16S rRNA Gene Sequence Datasets

    PubMed Central

    Yu, Guoqin; Fadrosh, Doug; Goedert, James J.; Ravel, Jacques; Goldstein, Alisa M.

    2015-01-01

    Background Sequencing of the PCR-amplified 16S rRNA gene has become a common approach to microbial community investigations in the fields of human health and environmental sciences. This approach, however, is difficult when the amount of DNA is too low to be amplified by standard PCR. Nested PCR can be employed as it can amplify samples with DNA concentration several-fold lower than standard PCR. However, potential biases with nested PCRs that could affect measurement of community structure have received little attention. Results In this study, we used 17 DNAs extracted from vaginal swabs and 12 DNAs extracted from stool samples to study the influence of nested PCR amplification of the 16S rRNA gene on the estimation of microbial community structure using Illumina MiSeq sequencing. Nested and standard PCR methods were compared on alpha- and beta-diversity metrics and relative abundances of bacterial genera. The effects of number of cycles in the first round of PCR (10 vs. 20) and microbial diversity (relatively low in vagina vs. high in stool) were also investigated. Vaginal swab samples showed no significant difference in alpha diversity or community structure between nested PCR and standard PCR (one round of 40 cycles). Stool samples showed significant differences in alpha diversity (except Shannon’s index) and relative abundance of 13 genera between nested PCR with 20 cycles in the first round and standard PCR (P<0.01), but not between nested PCR with 10 cycles in the first round and standard PCR. Operational taxonomic units (OTUs) that had low relative abundance (sum of relative abundance <0.167) accounted for most of the distortion (>27% of total OTUs in stool). Conclusions Nested PCR introduced bias in estimated diversity and community structure. The bias was more significant for communities with relatively higher diversity and when more cycles were applied in the first round of PCR. We conclude that nested PCR could be used when standard PCR does not work

  1. Diagnosis and follow-up of Whipple's disease by amplification of the 16S rRNA gene of Tropheryma whippelii.

    PubMed

    Pron, B; Poyart, C; Abachin, E; Fest, T; Belanger, C; Bonnet, C; Capelle, P; Bretagne, J F; Fabianek, A; Girard, L; Hagège, H; Berche, P

    1999-01-01

    Amplification of the 16S rRNA gene of Tropheryma whippelii was performed in eight patients with Whipple's disease and 34 control patients to confirm a diagnosis of Whipple's disease and to monitor the course of disease. Polymerase chain reaction (PCR) tests were positive before treatment in 13 of 15 tissue samples from Whipple's disease patients (gut 8/8; lymph nodes 2/2; bone marrow 1/2; peripheral blood 2/3), in contrast to none of 54 tissue samples from controls. PCR tests converted to negative within 4-6 months in six of the Whipple's disease patients undergoing therapy. These results show that PCR is a reliable and useful tool for diagnosis of Whipple's disease and for monitoring bacterial elimination during antibiotic therapy.

  2. Impact of training sets on classification of high-throughput bacterial 16s rRNA gene surveys

    PubMed Central

    Werner, Jeffrey J; Koren, Omry; Hugenholtz, Philip; DeSantis, Todd Z; Walters, William A; Caporaso, J Gregory; Angenent, Largus T; Knight, Rob; Ley, Ruth E

    2012-01-01

    Taxonomic classification of the thousands–millions of 16S rRNA gene sequences generated in microbiome studies is often achieved using a naïve Bayesian classifier (for example, the Ribosomal Database Project II (RDP) classifier), due to favorable trade-offs among automation, speed and accuracy. The resulting classification depends on the reference sequences and taxonomic hierarchy used to train the model; although the influence of primer sets and classification algorithms have been explored in detail, the influence of training set has not been characterized. We compared classification results obtained using three different publicly available databases as training sets, applied to five different bacterial 16S rRNA gene pyrosequencing data sets generated (from human body, mouse gut, python gut, soil and anaerobic digester samples). We observed numerous advantages to using the largest, most diverse training set available, that we constructed from the Greengenes (GG) bacterial/archaeal 16S rRNA gene sequence database and the latest GG taxonomy. Phylogenetic clusters of previously unclassified experimental sequences were identified with notable improvements (for example, 50% reduction in reads unclassified at the phylum level in mouse gut, soil and anaerobic digester samples), especially for phylotypes belonging to specific phyla (Tenericutes, Chloroflexi, Synergistetes and Candidate phyla TM6, TM7). Trimming the reference sequences to the primer region resulted in systematic improvements in classification depth, and greatest gains at higher confidence thresholds. Phylotypes unclassified at the genus level represented a greater proportion of the total community variation than classified operational taxonomic units in mouse gut and anaerobic digester samples, underscoring the need for greater diversity in existing reference databases. PMID:21716311

  3. Whole Genomic Analysis of Human G12P[6] and G12P[8] Rotavirus Strains that Have Emerged in Myanmar

    PubMed Central

    Ide, Tomihiko; Komoto, Satoshi; Higo-Moriguchi, Kyoko; Htun, Khaing Win; Myint, Yi Yi; Myat, Theingi Win; Thant, Kyaw Zin; Thu, Hlaing Myat; Win, Mo Mo; Oo, Htun Naing; Htut, Than; Wakuda, Mitsutaka; Dennis, Francis Ekow; Haga, Kei; Fujii, Yoshiki; Katayama, Kazuhiko; Rahman, Shofiqur; Nguyen, Sa Van; Umeda, Kouji; Oguma, Keiji; Tsuji, Takao; Taniguchi, Koki

    2015-01-01

    G12 rotaviruses are emerging rotavirus strains causing severe diarrhea in infants and young children worldwide. However, the whole genomes of only a few G12 strains have been fully sequenced and analyzed. In this study, we sequenced and characterized the complete genomes of six G12 strains (RVA/Human-tc/MMR/A14/2011/G12P[8], RVA/Human-tc/MMR/A23/2011/G12P[6], RVA/Human-tc/MMR/A25/2011/G12P[8], RVA/Human-tc/MMR/P02/2011/G12P[8], RVA/Human-tc/MMR/P39/2011/G12P[8], and RVA/Human-tc/MMR/P43/2011/G12P[8]) detected in six stool samples from children with acute gastroenteritis in Myanmar. On whole genomic analysis, all six Myanmarese G12 strains were found to have a Wa-like genetic backbone: G12-P[8]-I1-R1-C1-M1-A1-N1-T1-E1-H1 for strains A14, A25, P02, P39, and P43, and G12-P[6]-I1-R1-C1-M1-A1-N1-T1-E1-H1 for strain A23. Phylogenetic analysis showed that most genes of the six strains examined in this study were genetically related to globally circulating human G1, G3, G9, and G12 strains. Of note is that the NSP4 gene of strain A23 exhibited the closest relationship with the cognate genes of human-like bovine strains as well as human strains, suggesting the occurrence of reassortment between human and bovine strains. Furthermore, strains A14, A25, P02, P39, and P43 were very closely related to one another in all the 11 gene segments, indicating derivation of the five strains from a common origin. On the other hand, strain A23 consistently formed distinct clusters as to all the 11 gene segments, indicating a distinct origin of strain A23 from that of strains A14, A25, P02, P39, and P43. To our knowledge, this is the first report on whole genome-based characterization of G12 strains that have emerged in Myanmar. Our observations will provide important insights into the evolutionary dynamics of spreading G12 rotaviruses in Asia. PMID:25938434

  4. Sequence variation identified in the 18S rRNA gene of Theileria mutans and Theileria velifera from the African buffalo (Syncerus caffer).

    PubMed

    Chaisi, Mamohale E; Collins, Nicola E; Potgieter, Fred T; Oosthuizen, Marinda C

    2013-01-16

    The African buffalo (Syncerus caffer) is a natural reservoir host for both pathogenic and non-pathogenic Theileria species. These often occur naturally as mixed infections in buffalo. Although the benign and mildly pathogenic forms do not have any significant economic importance, their presence could complicate the interpretation of diagnostic test results aimed at the specific diagnosis of the pathogenic Theileria parva in cattle and buffalo in South Africa. The 18S rRNA gene has been used as the target in a quantitative real-time PCR (qPCR) assay for the detection of T. parva infections. However, the extent of sequence variation within this gene in the non-pathogenic Theileria spp. of the Africa buffalo is not well known. The aim of this study was, therefore, to characterise the full-length 18S rRNA genes of Theileria mutans, Theileria sp. (strain MSD) and T. velifera and to determine the possible influence of any sequence variation on the specific detection of T. parva using the 18S rRNA qPCR. The reverse line blot (RLB) hybridization assay was used to select samples which either tested positive for several different Theileria spp., or which hybridised only with the Babesia/Theileria genus-specific probe and not with any of the Babesia or Theileria species-specific probes. The full-length 18S rRNA genes from 14 samples, originating from 13 buffalo and one bovine from different localities in South Africa, were amplified, cloned and the resulting recombinants sequenced. Variations in the 18S rRNA gene sequences were identified in T. mutans, Theileria sp. (strain MSD) and T. velifera, with the greatest diversity observed amongst the T. mutans variants. This variation possibly explained why the RLB hybridization assay failed to detect T. mutans and T. velifera in some of the analysed samples. Copyright © 2012 Elsevier B.V. All rights reserved.

  5. Identification by 16S rRNA Gene Sequencing of an Actinomyces hongkongensis Isolate Recovered from a Patient with Pelvic Actinomycosis

    PubMed Central

    Flynn, A. N.; Lyndon, C. A.

    2013-01-01

    A case of Actinomyces hongkongensis pelvic actinomycosis in an adult woman is described. Conventional phenotypic tests failed to identify the Gram-positive bacillus isolated from a fluid aspirate of a pelvic abscess. The bacterium was identified by 16S rRNA gene sequencing and analysis using the SmartGene Integrated Database Network System software. PMID:23698532

  6. Anaplasma phagocytophilum in questing Ixodes ricinus ticks: comparison of prevalences and partial 16S rRNA gene variants in urban, pasture, and natural habitats.

    PubMed

    Overzier, Evelyn; Pfister, Kurt; Thiel, Claudia; Herb, Ingrid; Mahling, Monia; Silaghi, Cornelia

    2013-03-01

    Urban, natural, and pasture areas were investigated for prevalences and 16S rRNA gene variants of Anaplasma phagocytophilum in questing Ixodes ricinus ticks. The prevalences differed significantly between habitat types, and year-to-year variations in prevalence and habitat-dependent occurrence of 16S rRNA gene variants were detected.

  7. PICT-1 triggers a pro-death autophagy through inhibiting rRNA transcription and AKT/mTOR/p70S6K signaling pathway.

    PubMed

    Chen, Hongbo; Duo, Yanhong; Hu, Bo; Wang, Zhiwei; Zhang, Fang; Tsai, Hsiangi; Zhang, Jianping; Zhou, Lanzhen; Wang, Lijun; Wang, Xinyu; Huang, Laiqiang

    2016-11-29

    PICT-1 was originally identified as a tumor suppressor. Here, we found that PICT-1 overexpression triggered pro-death autophagy without nucleolar disruption or p53 accumulation in U251 and MCF7 cells. Truncated PICT-1 fragments 181-346 and 1-346, which partly or totally lack nucleolar localization, showed weaker autophagy-inducing effects than full-length PICT-1 and a well-defined nucleolar mutant (181-479). Furthermore, PICT-1 partly localizes to the nucleolar fibrillar center (FC) and directly binds to ribosomal DNA (rDNA) gene loci, where it interacts with upstream binding factor (UBF). Overexpression of PICT-1 or the 181-479 mutant, but not the 1-346 or 181-346 mutants, markedly inhibited the phosphorylation of UBF and the recruitment of rRNA polymerase I (Pol I) to the rDNA promoter in response to serum stimulation, thereby suppressing rRNA transcription, suggesting that rRNA transcription inhibition might be an important contributor to PICT-1-induced autophagy. This is supported by the finding that CX-5461, a specific Pol I inhibitor, also induced autophagy. In addition, both CX-5461 and PICT-1, but not the 1-346 or 181-346 mutants, significantly suppressed the activation of the Akt/mTOR/p70S6K signaling pathway. Our data show that PICT-1 triggers pro-death autophagy through inhibition of rRNA transcription and the inactivation of AKT/mTOR/p70S6K pathway, independent of nucleolar disruption and p53 activation.

  8. Analysis of 16S-23S intergenic spacer regions of the rRNA operons in Edwardsiella ictaluri and Edwardsiella tarda isolates from fish.

    PubMed

    Panangala, V S; van Santen, V L; Shoemaker, C A; Klesius, P H

    2005-01-01

    To analyse interspecies and intraspecies differences based on the 16S-23S rRNA intergenic spacer region (ISR) sequences of the fish pathogens Edwardsiella ictaluri and Edwardsiella tarda. The 16S-23S rRNA spacer regions of 19 Edw. ictaluri and four Edw. tarda isolates from four geographical regions were amplified by PCR with primers complementary to conserved sequences within the flanking 16S-23S rRNA coding sequences. Two products were generated from all isolates, without interspecies or intraspecific size polymorphisms. Sequence analysis of the amplified fragments revealed a smaller ISR of 350 bp, which contained a gene for tRNA(Glu), and a larger ISR of 441 bp, which contained genes for tRNA(Ile) and tRNA(Ala). The sequences of the smaller ISR of different Edw. ictaluri isolates were essentially identical to each other. Partial sequences of larger ISR from several Edw. ictaluri isolates also revealed no differences from the one complete Edw. ictaluri large ISR sequence obtained. The sequences of the smaller ISR of Edw. tarda were 97% identical to the Edw. ictaluri smaller ISR and the larger ISR were 96-98% identical to the Edw. ictaluri larger ISR sequence. The Edw. tarda isolates displayed limited ISR sequence heterogeneity, with > or =97% sequence identity among isolates for both small and large ISR. There is a high degree of size and sequence similarity of 16S-23S ISR both among isolates within Edw. ictaluri and Edw. tarda species and between the two species. Our results confirm a close genetic relationship between Edw. ictaluri and Edw. tarda and the relative homogeneity of Edw. ictaluri isolates compared with Edw. tarda isolates. Because no differences were found in ISR sequences among Edw. ictaluri isolates, sequence analysis of the ISR will not be useful to distinguish isolates of Edw. ictaluri. However, we identified restriction sites that differ between ISR sequences of Edw. ictaluri and Edw. tarda, which will be useful in distinguishing the two species.

  9. Microbial profiles of a drinking water resource based on different 16S rRNA V regions during a heavy cyanobacterial bloom in Lake Taihu, China.

    PubMed

    Zhang, Junyi; Zhu, Congming; Guan, Rui; Xiong, Zhipeng; Zhang, Wen; Shi, Junzhe; Sheng, Yi; Zhu, Bingchuan; Tu, Jing; Ge, Qinyu; Chen, Ting; Lu, Zuhong

    2017-05-01

    Understanding of the bacterial community structure in drinking water resources helps to enhance the security of municipal water supplies. In this study, bacterial communities were surveyed in water and sediment during a heavy cyanobacterial bloom in a drinking water resource of Lake Taihu, China. A total of 325,317 high-quality sequences were obtained from different 16S ribosomal RNA (rRNA) regions (V3, V4, and V6) using the Miseq sequencing platform. A notable difference was shown between the water and sediment samples, as predominated by Cyanobacteria, Proteobacteria, and Actinobacteria in the water and Proteobacteria, Chloroflexi, and Verrucomicrobia in the sediment, respectively. The LD12 family dominated the water surface and was tightly associated with related indicators of cyanobacterial propagation, indicating involvement in the massive proliferation of cyanobacterial blooms. Alternatively, the genus Nitrospira dominated the sediment samples, which indicates that nitrite oxidation was very active in the sediment. Although pathogenic bacteria were not detected in a large amount, some genera such as Mycobacterium, Acinetobacter, and Legionella were still identified but in very low abundance. In addition, the effects of different V regions on bacterial diversity survey were evaluated. Overall, V4 and V3 were proven to be more promising V regions for bacterial diversity survey in water and sediment samples during heavy water blooms in Lake Taihu, respectively. As longer, cheaper, and faster DNA sequencing technologies become more accessible, we expect that bacterial community structures based on 16S rRNA amplicons as an indicator could be used alongside with physical and chemical indicators, to conduct comprehensive assessments for drinking water resource management.

  10. Comparison of Sanger and next generation sequencing performance for genotyping Cryptosporidium isolates at the 18S rRNA and actin loci.

    PubMed

    Paparini, Andrea; Gofton, Alexander; Yang, Rongchang; White, Nicole; Bunce, Michael; Ryan, Una M

    2015-01-01

    Cryptosporidium is an important enteric pathogen that infects a wide range of humans and animals. Rapid and reliable detection and characterisation methods are essential for understanding the transmission dynamics of the parasite. Sanger sequencing, and high-throughput sequencing (HTS) on an Ion Torrent platform, were compared with each other for their sensitivity and accuracy in detecting and characterising 25 Cryptosporidium-positive human and animal faecal samples. Ion Torrent reads (n = 123,857) were obtained at both 18S rRNA and actin loci for 21 of the 25 samples. Of these, one isolate at the actin locus (Cattle 05) and three at the 18S rRNA locus (HTS 10, HTS 11 and HTS 12), suffered PCR drop-out (i.e. PCR failures) when using fusion-tagged PCR. Sanger sequences were obtained for both loci for 23 of the 25 samples and showed good agreement with Ion Torrent-based genotyping. Two samples both from pythons (SK 02 and SK 05) produced mixed 18S and actin chromatograms by Sanger sequencing but were clearly identified by Ion Torrent sequencing as C. muris. One isolate (SK 03) was typed as C. muris by Sanger sequencing but was identified as a mixed C. muris and C. tyzzeri infection by HTS. 18S rRNA Type B sequences were identified in 4/6 C. parvum isolates when deep sequenced but were undetected in Sanger sequencing. Sanger was cheaper than Ion Torrent when sequencing a small numbers of samples, but when larger numbers of samples are considered (n = 60), the costs were comparative. Fusion-tagged amplicon based approaches are a powerful way of approaching mixtures, the only draw-back being the loss of PCR efficiency on low-template samples when using primers coupled to MID tags and adaptors. Taken together these data show that HTS has excellent potential for revealing the "true" composition of species/types in a Cryptosporidium infection, but that HTS workflows need to be carefully developed to ensure sensitivity, accuracy and contamination are

  11. Pseudomonas sp. strain CA5 (a selenite-reducing bacterium) 16S rRNA gene complete sequence. National Institute of Health, National Center for Biotechnology Information, GenBank sequence. Accession FJ422810.1.

    USDA-ARS?s Scientific Manuscript database

    This study used 1321 base pair 16S rRNA gene sequence methods to confirm the phylogenetic position of a soil isolate as a bacterium belonging to the genus Pesudomonas sp. Morphological, biochemical characteristics, and fatty acid profiles are consistent with the 16S rRNA gene sequence identification...

  12. Excitation of O 2(ag, b 1Σ g+) and I( 2P 1/2) by energy transfer from I 2(A, A' 3Π 1,2u) in solid rare gases

    NASA Astrophysics Data System (ADS)

    Böhling, R.; Becker, A. C.; Minaev, B. F.; Seranski, K.; Schurath, U.

    1990-04-01

    O 2ag, b 1Σ g+ → X 3Σ g- and I 2P 1/2→ 2P 3/4 fluorescence occurs in I 2/O 2-doped rare gas matrices when I 2 is excited with visible laser light. O 2(ag) and I( 2P 1/2) are populated independently by near-resonant energy transfer from the metastable triplet states of I 2. The doublet splitting of the O 2a→X band, which peaks at 7879 and 7863 cm -1 in argon, is interpreted as sensitized emission from O 2 trapped in distinct nearest neighbour positions of the donor 3I 2. Annealing reverses the intensity of the doublet, showing that the sites can be interconverted. It is suggested that the a→X emission rate is enhanced by the sensitizer, causing a lifetime reduction of the ag state from 79 s in pure argon to 21 and 3±1 s next to I 2. The long-lived O 2(ag) state is the precursor of I 2-sensitized emission from O 2(b 1Σ g+). The lifetime of O 2(b 1Σ g+) is reduced from 24.5 ms in pure argon to 17±1 ms in the presence of I 2.

  13. Recognition of Potentially Novel Human Disease-Associated Pathogens by Implementation of Systematic 16S rRNA Gene Sequencing in the Diagnostic Laboratory▿ †

    PubMed Central

    Keller, Peter M.; Rampini, Silvana K.; Büchler, Andrea C.; Eich, Gerhard; Wanner, Roger M.; Speck, Roberto F.; Böttger, Erik C.; Bloemberg, Guido V.

    2010-01-01

    Clinical isolates that are difficult to identify by conventional means form a valuable source of novel human pathogens. We report on a 5-year study based on systematic 16S rRNA gene sequence analysis. We found 60 previously unknown 16S rRNA sequences corresponding to potentially novel bacterial taxa. For 30 of 60 isolates, clinical relevance was evaluated; 18 of the 30 isolates analyzed were considered to be associated with human disease. PMID:20631113

  14. Use of 16S rRNA gene for identification of a broad range of clinically relevant bacterial pathogens

    DOE PAGES

    Srinivasan, Ramya; Karaoz, Ulas; Volegova, Marina; ...

    2015-02-06

    According to World Health Organization statistics of 2011, infectious diseases remain in the top five causes of mortality worldwide. However, despite sophisticated research tools for microbial detection, rapid and accurate molecular diagnostics for identification of infection in humans have not been extensively adopted. Time-consuming culture-based methods remain to the forefront of clinical microbial detection. The 16S rRNA gene, a molecular marker for identification of bacterial species, is ubiquitous to members of this domain and, thanks to ever-expanding databases of sequence information, a useful tool for bacterial identification. In this study, we assembled an extensive repository of clinical isolates (n =more » 617), representing 30 medically important pathogenic species and originally identified using traditional culture-based or non-16S molecular methods. This strain repository was used to systematically evaluate the ability of 16S rRNA for species level identification. To enable the most accurate species level classification based on the paucity of sequence data accumulated in public databases, we built a Naïve Bayes classifier representing a diverse set of high-quality sequences from medically important bacterial organisms. We show that for species identification, a model-based approach is superior to an alignment based method. Overall, between 16S gene based and clinical identities, our study shows a genus-level concordance rate of 96% and a species-level concordance rate of 87.5%. We point to multiple cases of probable clinical misidentification with traditional culture based identification across a wide range of gram-negative rods and gram-positive cocci as well as common gram-negative cocci.« less

  15. Development and evaluation of a 28S rRNA gene-based nested PCR assay for P. falciparum and P. vivax

    PubMed Central

    Pakalapati, Deepak; Garg, Shilpi; Middha, Sheetal; Acharya, Jyoti; Subudhi, Amit K; Boopathi, Arunachalam P; Saxena, Vishal; Kochar, Sanjay K; Kochar, Dhanpat K; Das, Ashis

    2013-01-01

    The 28S rRNA gene was amplified and sequenced from P. falciparum and P. vivax isolates collected from northwest India. Based upon the sequence diversity of the Plasmodium 28SrRNA gene in comparison with its human counterpart, various nested polymerase chain reaction (PCR) primers were designed from the 3R region of the 28SrRNA gene and evaluated on field isolates. This is the first report demonstrating the utility of this gene for species-specific diagnosis of malaria for these two species, prevalent in India. The initial evaluation on 363 clinical isolates indicated that, in comparison with microscopy, which showed sensitivity and specificity of 85.39% and 100% respectively, the sensitivity and specificity of the nested PCR assay was found to be 99.08% and 100% respectively. This assay was also successful in detecting mixed infections that are undetected by microscopy. Our results demonstrate the utility of the 28S rRNA gene as a diagnostic target for the detection of the major plasmodial species infecting humans. PMID:23816509

  16. Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

    PubMed

    Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

    2001-05-01

    Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic representation suggest that the concave surface and loop regions are involved in 5S rRNA binding. To identify amino acid residues responsible for 5S rRNA binding, we made use of Ala-scanning mutagenesis of evolutionarily conserved amino acids occurring in the beta-strands and loop regions. The mutations of Asn37 at the beta1-strand and Gln63 at the loop between helix 2 and beta3-strand as well as that of Phe77 at the tip of the loop structure between the beta2- and beta3-strands caused a significant reduction in 5S rRNA binding. In addition, the mutations of Thr90 on the beta3-strand and Ile141 and Asp144 at the loop between beta4- and beta5-strands moderately reduced the 5S rRNA-binding affinity. Comparison of these results with the more recently analyzed structure of the 50S subunit from Haloarcula marismortui suggests that there are significant differences in the structure at N- and C-terminal regions and probably in the 5S rRNA binding.

  17. Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

    PubMed Central

    Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

    2001-01-01

    Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic representation suggest that the concave surface and loop regions are involved in 5S rRNA binding. To identify amino acid residues responsible for 5S rRNA binding, we made use of Ala-scanning mutagenesis of evolutionarily conserved amino acids occurring in the beta-strands and loop regions. The mutations of Asn37 at the beta1-strand and Gln63 at the loop between helix 2 and beta3-strand as well as that of Phe77 at the tip of the loop structure between the beta2- and beta3-strands caused a significant reduction in 5S rRNA binding. In addition, the mutations of Thr90 on the beta3-strand and Ile141 and Asp144 at the loop between beta4- and beta5-strands moderately reduced the 5S rRNA-binding affinity. Comparison of these results with the more recently analyzed structure of the 50S subunit from Haloarcula marismortui suggests that there are significant differences in the structure at N- and C-terminal regions and probably in the 5S rRNA binding. PMID:11350033

  18. Phylogenetic diversity in the genus Bacillus as seen by 16S rRNA sequencing studies

    NASA Technical Reports Server (NTRS)

    Rossler, D.; Ludwig, W.; Schleifer, K. H.; Lin, C.; McGill, T. J.; Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.

    1991-01-01

    Comparative sequence analysis of 16S ribosomal (r)RNAs or DNAs of Bacillus alvei, B. laterosporus, B. macerans, B. macquariensis, B. polymyxa and B. stearothermophilus revealed the phylogenetic diversity of the genus Bacillus. Based on the presently available data set of 16S rRNA sequences from bacilli and relatives at least four major "Bacillus clusters" can be defined: a "Bacillus subtilis cluster" including B. stearothermophilus, a "B. brevis cluster" including B. laterosporus, a "B. alvei cluster" including B. macerans, B. maquariensis and B. polymyxa and a "B. cycloheptanicus branch".

  19. 16S rRNA Gene Sequencing for Deciphering the Colorectal Cancer Gut Microbiome: Current Protocols and Workflows.

    PubMed

    Osman, Muhammad-Afiq; Neoh, Hui-Min; Ab Mutalib, Nurul-Syakima; Chin, Siok-Fong; Jamal, Rahman

    2018-01-01

    The human gut holds the densest microbiome ecosystem essential in maintaining a healthy host physiology, whereby disruption of this ecosystem has been linked to the development of colorectal cancer (CRC). The advent of next-generation sequencing technologies such as the 16S rRNA gene sequencing has enabled characterization of the CRC gut microbiome architecture in an affordable and culture-free approach. Nevertheless, the lack of standardization in handling and storage of biospecimens, nucleic acid extraction, 16S rRNA gene primer selection, length, and depth of sequencing and bioinformatics analyses have contributed to discrepancies found in various published studies of this field. Accurate characterization of the CRC microbiome found in different stages of CRC has the potential to be developed into a screening tool in the clinical setting. This mini review aims to concisely compile all available CRC microbiome studies performed till end of 2016 and to suggest standardized protocols that are crucial in developing a gut microbiome screening panel for CRC.

  20. Base Pairing between U3 Small Nucleolar RNA and the 5′ End of 18S rRNA Is Required for Pre-rRNA Processing

    PubMed Central

    Sharma, Kishor; Tollervey, David

    1999-01-01

    The loop of a stem structure close to the 5′ end of the 18S rRNA is complementary to the box A region of the U3 small nucleolar RNA (snoRNA). Substitution of the 18S loop nucleotides inhibited pre-rRNA cleavage at site A1, the 5′ end of the 18S rRNA, and at site A2, located 1.9 kb away in internal transcribed spacer 1. This inhibition was largely suppressed by a compensatory mutation in U3, demonstrating functional base pairing. The U3–pre-rRNA base pairing is incompatible with the structure that forms in the mature 18S rRNA and may prevent premature folding of the pre-rRNA. In the Escherichia coli pre-rRNA the homologous region of the 16S rRNA is also sequestered, in that case by base pairing to the 5′ external transcribed spacer (5′ ETS). Cleavage at site A0 in the yeast 5′ ETS strictly requires base pairing between U3 and a sequence within the 5′ ETS. In contrast, the U3-18S interaction is not required for A0 cleavage. U3 therefore carries out at least two functionally distinct base pair interactions with the pre-rRNA. The nucleotide at the site of A1 cleavage was shown to be specified by two distinct signals; one of these is the stem-loop structure within the 18S rRNA. However, in contrast to the efficiency of cleavage, the position of A1 cleavage is not dependent on the U3-loop interaction. We conclude that the 18S stem-loop structure is recognized at least twice during pre-rRNA processing. PMID:10454548

  1. Characterization of the two intra-individual sequence variants in the 18S rRNA gene in the plant parasitic nematode, Rotylenchulus reniformis.

    PubMed

    Nyaku, Seloame T; Sripathi, Venkateswara R; Kantety, Ramesh V; Gu, Yong Q; Lawrence, Kathy; Sharma, Govind C

    2013-01-01

    The 18S rRNA gene is fundamental to cellular and organismal protein synthesis and because of its stable persistence through generations it is also used in phylogenetic analysis among taxa. Sequence variation in this gene within a single species is rare, but it has been observed in few metazoan organisms. More frequently it has mostly been reported in the non-transcribed spacer region. Here, we have identified two sequence variants within the near full coding region of 18S rRNA gene from a single reniform nematode (RN) Rotylenchulus reniformis labeled as reniform nematode variant 1 (RN_VAR1) and variant 2 (RN_VAR2). All sequences from three of the four isolates had both RN variants in their sequences; however, isolate 13B had only RN variant 2 sequence. Specific variable base sites (96 or 5.5%) were found within the 18S rRNA gene that can clearly distinguish the two 18S rDNA variants of RN, in 11 (25.0%) and 33 (75.0%) of the 44 RN clones, for RN_VAR1 and RN_VAR2, respectively. Neighbor-joining trees show that the RN_VAR1 is very similar to the previously existing R. reniformis sequence in GenBank, while the RN_VAR2 sequence is more divergent. This is the first report of the identification of two major variants of the 18S rRNA gene in the same single RN, and documents the specific base variation between the two variants, and hypothesizes on simultaneous co-existence of these two variants for this gene.

  2. Characterization of the Two Intra-Individual Sequence Variants in the 18S rRNA Gene in the Plant Parasitic Nematode, Rotylenchulus reniformis

    PubMed Central

    Nyaku, Seloame T.; Sripathi, Venkateswara R.; Kantety, Ramesh V.; Gu, Yong Q.; Lawrence, Kathy; Sharma, Govind C.

    2013-01-01

    The 18S rRNA gene is fundamental to cellular and organismal protein synthesis and because of its stable persistence through generations it is also used in phylogenetic analysis among taxa. Sequence variation in this gene within a single species is rare, but it has been observed in few metazoan organisms. More frequently it has mostly been reported in the non-transcribed spacer region. Here, we have identified two sequence variants within the near full coding region of 18S rRNA gene from a single reniform nematode (RN) Rotylenchulus reniformis labeled as reniform nematode variant 1 (RN_VAR1) and variant 2 (RN_VAR2). All sequences from three of the four isolates had both RN variants in their sequences; however, isolate 13B had only RN variant 2 sequence. Specific variable base sites (96 or 5.5%) were found within the 18S rRNA gene that can clearly distinguish the two 18S rDNA variants of RN, in 11 (25.0%) and 33 (75.0%) of the 44 RN clones, for RN_VAR1 and RN_VAR2, respectively. Neighbor-joining trees show that the RN_VAR1 is very similar to the previously existing R. reniformis sequence in GenBank, while the RN_VAR2 sequence is more divergent. This is the first report of the identification of two major variants of the 18S rRNA gene in the same single RN, and documents the specific base variation between the two variants, and hypothesizes on simultaneous co-existence of these two variants for this gene. PMID:23593343

  3. Prediction of functional profiles of gut microbiota from 16S rRNA metagenomic data provides a more robust evaluation of gut dysbiosis occurring in Japanese type 2 diabetic patients.

    PubMed

    Inoue, Ryo; Ohue-Kitano, Ryuji; Tsukahara, Takamitsu; Tanaka, Masashi; Masuda, Shinya; Inoue, Takayuki; Yamakage, Hajime; Kusakabe, Toru; Hasegawa, Koji; Shimatsu, Akira; Satoh-Asahara, Noriko

    2017-11-01

    We assessed whether gut microbial functional profiles predicted from 16S rRNA metagenomics differed in Japanese type 2 diabetic patients. A total of 22 Japanese subjects were recruited from our outpatient clinic in an observational study. Fecal samples were obtained from 12 control and 10 type 2 diabetic subjects. 16S rRNA metagenomic data were generated and functional profiles predicted using "Phylogenetic Investigation of Communities by Reconstruction of Unobserved States" software. We measured the parameters of glucose metabolism, gut bacterial taxonomy and functional profile, and examined the associations in a cross-sectional manner. Eleven of 288 "Kyoto Encyclopedia of Genes and Genomes" pathways were significantly enriched in diabetic patients compared with control subjects ( p <0.05, q<0.1). The relative abundance of almost all pathways, including the Insulin signaling pathway and Glycolysis/Gluconeogenesis , showed strong, positive correlations with hemoglobin A 1c (HbA 1c ) and fasting plasma glucose (FPG) levels. Bacterial taxonomic analysis showed that genus Blautia significantly differed between groups and had negative correlations with HbA 1c and FPG levels. Our findings suggest a novel pathophysiological relationship between gut microbial communities and diabetes, further highlighting the significance and utility of combining prediction of functional profiles with ordinal bacterial taxonomic analysis (UMIN Clinical Trails Registry number: UMIN000026592).

  4. Microbial community in persistent apical periodontitis: a 16S rRNA gene clone library analysis.

    PubMed

    Zakaria, M N; Takeshita, T; Shibata, Y; Maeda, H; Wada, N; Akamine, A; Yamashita, Y

    2015-08-01

    To characterize the microbial composition of persistent periapical lesions of root filled teeth using a molecular genetics approach. Apical lesion samples were collected from 12 patients (23-80 years old) who visited the Kyushu University Hospital for apicectomy with persistent periapical lesions associated with root filled teeth. DNA was directly extracted from each sample and the microbial composition was comprehensively analysed using clone library analysis of the 16S rRNA gene. Enterococcus faecalis, Candida albicans and specific fimA genotypes of Porphyromonas gingivalis were confirmed using polymerase chain reaction (PCR) analysis with specific primers. Bacteria were detected in all samples, and the dominant findings were P. gingivalis (19.9%), Fusobacterium nucleatum (11.2%) and Propionibacterium acnes (9%). Bacterial diversity was greater in symptomatic lesions than in asymptomatic ones. In addition, the following bacteria or bacterial combinations were characteristic to symptomatic lesions: Prevotella spp., Treponema spp., Peptostreptococcaceae sp. HOT-113, Olsenella uli, Slackia exigua, Selemonas infelix, P. gingivalis with type IV fimA, and a combination of P. gingivalis, F. nucleatum, and Peptostreptococcaceae sp. HOT-113 and predominance of Streptococcus spp. On the other hand, neither Enterococcus faecalis nor C. albicans were detected in any of the samples. Whilst a diverse bacterial species were observed in the persistent apical lesions, some characteristic patterns of bacterial community were found in the symptomatic lesions. The diverse variation of community indicates that bacterial combinations as a community may cause persistent inflammation in periapical tissues rather than specific bacterial species. © 2014 International Endodontic Journal. Published by John Wiley & Sons Ltd.

  5. Comparison of PCR-Electrospray Ionization Mass Spectrometry with 16S rRNA PCR and Amplicon Sequencing for Detection of Bacteria in Excised Heart Valves

    PubMed Central

    Peeters, Bart; Herijgers, Paul; Beuselinck, Kurt; Peetermans, Willy E.; Herregods, Marie-Christin

    2016-01-01

    Identification of the causative pathogen of infective endocarditis (IE) is crucial for adequate management and therapy. A broad-range PCR-electrospray ionization mass spectrometry (PCR-ESI-MS) technique was compared with broad-spectrum 16S rRNA PCR and amplicon sequencing (16S rRNA PCR) for the detection of bacterial pathogens in 40 heart valves obtained from 34 definite infective endocarditis patients according to the modified Duke criteria and six nonendocarditis patients. Concordance between the two molecular techniques was 98% for being positive or negative, 97% for concordant identification up to the genus level, and 77% for concordant identification up to the species level. Sensitivity for detecting the causative pathogen (up to the genus level) in excised heart valves was 88% for 16S rRNA PCR and 85% for PCR-ESI-MS; the specificity was 83% for both methods. The two molecular techniques were significantly more sensitive than valve culture (18%) and accurately identified bacteria in excised heart valves. In eight patients with culture-negative IE, the following results were obtained: concordant detection of Coxiella burnetii (n = 2), Streptococcus gallolyticus (n = 1), Propionibacterium acnes (n = 1), and viridans group streptococci (n = 1) by both molecular tests, detection of P. acnes by PCR-ESI-MS whereas the 16S rRNA PCR was negative (n = 1), and a false-negative result by both molecular techniques (n = 2). In one case of IE caused by viridans streptococci, PCR-ESI-MS was positive for Enterococcus spp. The advantages of PCR-ESI-MS compared to 16S rRNA PCR are its automated workflow and shorter turnaround times. PMID:27629895

  6. Mutant forms of Escherichia coli protein L25 unable to bind to 5S rRNA are incorporated efficiently into the ribosome in vivo.

    PubMed

    Anikaev, A Y; Korepanov, A P; Korobeinikova, A V; Kljashtorny, V G; Piendl, W; Nikonov, S V; Garber, M B; Gongadze, G M

    2014-08-01

    5S rRNA-binding ribosomal proteins of the L25 family are an evolutional acquisition of bacteria. Earlier we showed that (i) single replacements in the RNA-binding module of the protein of this family result in destabilization or complete impossibility to form a complex with 5S rRNA in vitro; (ii) ΔL25 ribosomes of Escherichia coli are less efficient in protein synthesis in vivo than the control ribosomes. In the present work, the efficiency of incorporation of the E. coli protein L25 with mutations in the 5S rRNA-binding region into the ribosome in vivo was studied. It was found that the mutations in L25 that abolish its ability to form the complex with free 5S rRNA do not prevent its correct and efficient incorporation into the ribosome. This is supported by the fact that even the presence of a very weakly retained mutant form of the protein in the ribosome has a positive effect on the activity of the translational machinery in vivo. All this suggests the existence of an alternative incorporation pathway for this protein into the ribosome, excluding the preliminary formation of the complex with 5S rRNA. At the same time, the stable L25-5S rRNA contact is important for the retention of the protein within the ribosome, and the conservative amino acid residues of the RNA-binding module play a key role in this.

  7. 16S-23S rRNA gene internal transcribed spacer sequences for analysis of the phylogenetic relationships among species of the genus Porphyromonas.

    PubMed

    Conrads, Georg; Citron, Diane M; Tyrrell, Kerin L; Horz, Hans-Peter; Goldstein, Ellie J C

    2005-03-01

    The 16S-23S rRNA gene internal transcribed spacer (ITS) regions of 11 reference strains of Porphyromonas species, together with Bacteroides distasonis and Tannerella forsythensis, were analysed to examine interspecies relationships. Compared with the phylogenetic tree generated using 16S rRNA gene sequences, the resolution of the ITS sequence-based tree was higher, but species positioning and clustering were similar with both approaches. The recent separation of Porphyromonas gulae and Porphyromonas gingivalis into distinct species was confirmed by the ITS data. In addition, analysis of the ITS sequences of 24 clinical isolates of Porphyromonas asaccharolytica plus the type strain ATCC 25260(T) divided the sequences into two clusters, of which one was alpha-fucosidase-positive (like the type strain) while the other was alpha-fucosidase-negative. The latter resembled the previously studied unusual extra-oral isolates of 'Porphyromonas endodontalis-like organisms' (PELOs) which could therefore be called 'Porphyromonas asaccharolytica-like organisms' (PALOs), based on the genetic identification. Moreover, the proposal of alpha-fucosidase-negative P. asaccharolytica strains as a new species should also be considered.

  8. Rhea: a transparent and modular R pipeline for microbial profiling based on 16S rRNA gene amplicons

    PubMed Central

    Fischer, Sandra; Kumar, Neeraj

    2017-01-01

    The importance of 16S rRNA gene amplicon profiles for understanding the influence of microbes in a variety of environments coupled with the steep reduction in sequencing costs led to a surge of microbial sequencing projects. The expanding crowd of scientists and clinicians wanting to make use of sequencing datasets can choose among a range of multipurpose software platforms, the use of which can be intimidating for non-expert users. Among available pipeline options for high-throughput 16S rRNA gene analysis, the R programming language and software environment for statistical computing stands out for its power and increased flexibility, and the possibility to adhere to most recent best practices and to adjust to individual project needs. Here we present the Rhea pipeline, a set of R scripts that encode a series of well-documented choices for the downstream analysis of Operational Taxonomic Units (OTUs) tables, including normalization steps, alpha- and beta-diversity analysis, taxonomic composition, statistical comparisons, and calculation of correlations. Rhea is primarily a straightforward starting point for beginners, but can also be a framework for advanced users who can modify and expand the tool. As the community standards evolve, Rhea will adapt to always represent the current state-of-the-art in microbial profiles analysis in the clear and comprehensive way allowed by the R language. Rhea scripts and documentation are freely available at https://lagkouvardos.github.io/Rhea. PMID:28097056

  9. Rhea: a transparent and modular R pipeline for microbial profiling based on 16S rRNA gene amplicons.

    PubMed

    Lagkouvardos, Ilias; Fischer, Sandra; Kumar, Neeraj; Clavel, Thomas

    2017-01-01

    The importance of 16S rRNA gene amplicon profiles for understanding the influence of microbes in a variety of environments coupled with the steep reduction in sequencing costs led to a surge of microbial sequencing projects. The expanding crowd of scientists and clinicians wanting to make use of sequencing datasets can choose among a range of multipurpose software platforms, the use of which can be intimidating for non-expert users. Among available pipeline options for high-throughput 16S rRNA gene analysis, the R programming language and software environment for statistical computing stands out for its power and increased flexibility, and the possibility to adhere to most recent best practices and to adjust to individual project needs. Here we present the Rhea pipeline, a set of R scripts that encode a series of well-documented choices for the downstream analysis of Operational Taxonomic Units (OTUs) tables, including normalization steps, alpha - and beta -diversity analysis, taxonomic composition, statistical comparisons, and calculation of correlations. Rhea is primarily a straightforward starting point for beginners, but can also be a framework for advanced users who can modify and expand the tool. As the community standards evolve, Rhea will adapt to always represent the current state-of-the-art in microbial profiles analysis in the clear and comprehensive way allowed by the R language. Rhea scripts and documentation are freely available at https://lagkouvardos.github.io/Rhea.

  10. Using DGGE and 16S rRNA gene sequence analysis to evaluate changes in oral bacterial composition.

    PubMed

    Chen, Zhou; Trivedi, Harsh M; Chhun, Nok; Barnes, Virginia M; Saxena, Deepak; Xu, Tao; Li, Yihong

    2011-01-01

    To investigate whether a standard dental prophylaxis followed by tooth brushing with an antibacterial dentifrice will affect the oral bacterial community, as determined by denaturing gradient gel electrophoresis (DGGE) combined with 16S rRNA gene sequence analysis. Twenty-four healthy adults were instructed to brush their teeth using commercial dentifrice for 1 week during a washout period. An initial set of pooled supragingival plaque samples was collected from each participant at baseline (0 h) before prophylaxis treatment. The subjects were given a clinical examination and dental prophylaxis and asked to brush for 1 min with a dentifrice containing 0.3% triclosan, 2.0% PVM/MA copolymer and 0.243% sodium fluoride (Colgate Total). On the following day, a second set of pooled supragingival plaque samples (24 h) was collected. Total bacterial genomic DNA was isolated from the samples. Differences in the microbial composition before and after the prophylactic procedure and tooth brushing were assessed by comparing the DGGE profiles and 16S rRNA gene segments sequence analysis. Two distinct clusters of DGGE profiles were found, suggesting that a shift in the microbial composition had occurred 24 h after the prophylaxis and brushing. A detailed sequencing analysis of 16S rRNA gene segments further identified 6 phyla and 29 genera, including known and unknown bacterial species. Importantly, an increase in bacterial diversity was observed after 24 h, including members of the Streptococcaceae family, Prevotella, Corynebacterium, TM7 and other commensal bacteria. The results suggest that the use of a standard prophylaxis followed by the use of the dentifrice containing 0.3% triclosan, 2.0% PVM/MA copolymer and 0.243% sodium fluoride may promote a healthier composition within the oral bacterial community.

  11. The Human RNA Polymerase I Transcription Terminator Complex Acts as a Replication Fork Barrier That Coordinates the Progress of Replication with rRNA Transcription Activity.

    PubMed

    Akamatsu, Yufuko; Kobayashi, Takehiko

    2015-05-01

    In S phase, the replication and transcription of genomic DNA need to accommodate each other, otherwise their machineries collide, with chromosomal instability as a possible consequence. Here, we characterized the human replication fork barrier (RFB) that is present downstream from the 47S pre-rRNA gene (ribosomal DNA [rDNA]). We found that the most proximal transcription terminator, Sal box T1, acts as a polar RFB, while the other, Sal box T4/T5, arrests replication forks bidirectionally. The fork-arresting activity at these sites depends on polymerase I (Pol I) transcription termination factor 1 (TTF-1) and a replisome component, TIMELESS (TIM). We also found that the RFB activity was linked to rDNA copies with hypomethylated CpG and coincided with the time that actively transcribed rRNA genes are replicated. Failed fork arrest at RFB sites led to a slowdown of fork progression moving in the opposite direction to rRNA transcription. Chemical inhibition of transcription counteracted this deceleration of forks, indicating that rRNA transcription impedes replication in the absence of RFB activity. Thus, our results reveal a role of RFB for coordinating the progression of replication and transcription activity in highly transcribed rRNA genes. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  12. Specific detection and identification of [Actinobacillus] muris by PCR using primers targeting the 16S-23S rRNA internal transcribed spacer regions.

    PubMed

    Benga, Laurentiu; Benten, W Peter M; Engelhardt, Eva; Gougoula, Christina; Sager, Martin

    2013-08-01

    [Actinobacillus] muris represents along with [Pasteurella] pneumotropica the most prevalent Pasteurellaceae species isolated from the laboratory mouse. Despite the biological and economic importance of Pasteurellaceae in relation to experimental animals, no molecular based methods for the identification of [A.] muris are available. The aim of the present investigation was to develop a PCR method allowing detection and identification of [A.] muris. In this assay, a Pasteurellaceae common forward primer based on a conserved region of the 16S rRNA gene was used in conjunction with two different reverse primers specific for [A.] muris, targeting the 16S-23S internal transcribed spacer sequences. The specificity of the assay was tested against 78 reference and clinical isolates of Pasteurellaceae, including 37 strains of [A.] muris. In addition, eight other mice associated bacterial species which could pose a diagnostic problem were included. The assay showed 100% sensitivity and 97.95% specificity. Identification of the clinical isolates was validated by ITS profiling and when necessary by 16S rRNA sequencing. This multiplex PCR represents the first molecular tool able to detect [A.] muris and may become a reliable alternative to the present diagnostic methods. Copyright © 2013 Elsevier B.V. All rights reserved.

  13. Nested PCR Biases in Interpreting Microbial Community Structure in 16S rRNA Gene Sequence Datasets.

    PubMed

    Yu, Guoqin; Fadrosh, Doug; Goedert, James J; Ravel, Jacques; Goldstein, Alisa M

    2015-01-01

    Sequencing of the PCR-amplified 16S rRNA gene has become a common approach to microbial community investigations in the fields of human health and environmental sciences. This approach, however, is difficult when the amount of DNA is too low to be amplified by standard PCR. Nested PCR can be employed as it can amplify samples with DNA concentration several-fold lower than standard PCR. However, potential biases with nested PCRs that could affect measurement of community structure have received little attention. In this study, we used 17 DNAs extracted from vaginal swabs and 12 DNAs extracted from stool samples to study the influence of nested PCR amplification of the 16S rRNA gene on the estimation of microbial community structure using Illumina MiSeq sequencing. Nested and standard PCR methods were compared on alpha- and beta-diversity metrics and relative abundances of bacterial genera. The effects of number of cycles in the first round of PCR (10 vs. 20) and microbial diversity (relatively low in vagina vs. high in stool) were also investigated. Vaginal swab samples showed no significant difference in alpha diversity or community structure between nested PCR and standard PCR (one round of 40 cycles). Stool samples showed significant differences in alpha diversity (except Shannon's index) and relative abundance of 13 genera between nested PCR with 20 cycles in the first round and standard PCR (P<0.01), but not between nested PCR with 10 cycles in the first round and standard PCR. Operational taxonomic units (OTUs) that had low relative abundance (sum of relative abundance <0.167) accounted for most of the distortion (>27% of total OTUs in stool). Nested PCR introduced bias in estimated diversity and community structure. The bias was more significant for communities with relatively higher diversity and when more cycles were applied in the first round of PCR. We conclude that nested PCR could be used when standard PCR does not work. However, rare taxa detected by

  14. Small RNA populations revealed by blocking rRNA fragments in Drosophila melanogaster reproductive tissues

    PubMed Central

    Dalmay, Tamas

    2018-01-01

    RNA interference (RNAi) is a complex and highly conserved regulatory mechanism mediated via small RNAs (sRNAs). Recent technical advances in high throughput sequencing have enabled an increasingly detailed analysis of sRNA abundances and profiles in specific body parts and tissues. This enables investigations of the localized roles of microRNAs (miRNAs) and small interfering RNAs (siRNAs). However, variation in the proportions of non-coding RNAs in the samples being compared can hinder these analyses. Specific tissues may vary significantly in the proportions of fragments of longer non-coding RNAs (such as ribosomal RNA or transfer RNA) present, potentially reflecting tissue-specific differences in biological functions. For example, in Drosophila, some tissues contain a highly abundant 30nt rRNA fragment (the 2S rRNA) as well as abundant 5’ and 3’ terminal rRNA fragments. These can pose difficulties for the construction of sRNA libraries as they can swamp the sequencing space and obscure sRNA abundances. Here we addressed this problem and present a modified “rRNA blocking” protocol for the construction of high-definition (HD) adapter sRNA libraries, in D. melanogaster reproductive tissues. The results showed that 2S rRNAs targeted by blocking oligos were reduced from >80% to < 0.01% total reads. In addition, the use of multiple rRNA blocking oligos to bind the most abundant rRNA fragments allowed us to reveal the underlying sRNA populations at increased resolution. Side-by-side comparisons of sequencing libraries of blocked and non-blocked samples revealed that rRNA blocking did not change the miRNA populations present, but instead enhanced their abundances. We suggest that this rRNA blocking procedure offers the potential to improve the in-depth analysis of differentially expressed sRNAs within and across different tissues. PMID:29474379

  15. Expansion of the aminoglycoside-resistance 16S rRNA (m(1)A1408) methyltransferase family: expression and functional characterization of four hypothetical enzymes of diverse bacterial origin.

    PubMed

    Witek, Marta A; Conn, Graeme L

    2014-09-01

    The global dissemination, potential activity in diverse species and broad resistance spectrum conferred by the aminoglycoside-resistance ribosomal RNA methyltransferases make them a significant potential new threat to the efficacy of aminoglycoside antibiotics in the treatment of serious bacterial infections. The N1 methylation of adenosine 1408 (m(1)A1408) confers resistance to structurally diverse aminoglycosides, including kanamycin, neomycin and apramycin. The limited analyses to date of the enzymes responsible have identified common features but also potential differences in their molecular details of action. Therefore, with the goal of expanding the known 16S rRNA (m(1)A1408) methyltransferase family as a platform for developing a more complete mechanistic understanding, we report here the cloning, expression and functional analyses of four hypothetical aminoglycoside-resistance rRNA methyltransferases from recent genome sequences of diverse bacterial species. Each of the genes produced a soluble, folded protein with a secondary structure, as determined from circular dichroism (CD) spectra, consistent with enzymes for which high-resolution structures are available. For each enzyme, antibiotic minimum inhibitory concentration (MIC) assays revealed a resistance spectrum characteristic of the known 16S rRNA (m(1)A1408) methyltransferases and the modified nucleotide was confirmed by reverse transcription as A1408. In common with other family members, higher binding affinity for the methylation reaction by-product S-adenosylhomocysteine (SAH) than the cosubstrate S-adenosyl-L-methionine (SAM) was observed for three methyltransferases, while one unexpectedly showed no measurable affinity for SAH. Collectively, these results confirm that each hypothetical enzyme is a functional 16S rRNA (m(1)A1408) methyltransferase but also point to further potential mechanistic variation within this enzyme family. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. MetaDP: a comprehensive web server for disease prediction of 16S rRNA metagenomic datasets.

    PubMed

    Xu, Xilin; Wu, Aiping; Zhang, Xinlei; Su, Mingming; Jiang, Taijiao; Yuan, Zhe-Ming

    2016-01-01

    High-throughput sequencing-based metagenomics has garnered considerable interest in recent years. Numerous methods and tools have been developed for the analysis of metagenomic data. However, it is still a daunting task to install a large number of tools and complete a complicated analysis, especially for researchers with minimal bioinformatics backgrounds. To address this problem, we constructed an automated software named MetaDP for 16S rRNA sequencing data analysis, including data quality control, operational taxonomic unit clustering, diversity analysis, and disease risk prediction modeling. Furthermore, a support vector machine-based prediction model for intestinal bowel syndrome (IBS) was built by applying MetaDP to microbial 16S sequencing data from 108 children. The success of the IBS prediction model suggests that the platform may also be applied to other diseases related to gut microbes, such as obesity, metabolic syndrome, or intestinal cancer, among others (http://metadp.cn:7001/).

  17. Analysis of 16S rRNA gene lactic acid bacteria (LAB) isolate from Markisa fruit (Passiflora sp.) as a producer of protease enzyme and probiotics

    NASA Astrophysics Data System (ADS)

    Hidayat, Habibi

    2017-03-01

    16S rRNA gene analysis of bacteria lactic acid (LAB) isolate from Markisa Kuning Fruit (Passiflora edulis var. flavicarpa) as a producer of protease enzyme and probiotics has been done. The aim of the study is to determine the protease enzyme activity and 16S rRNA gene amplification using PCR. The calculation procedure was done to M4 isolate bacteria lactic acid (LAB) Isolate which has been resistant to acids with pH 2.0 in the manner of screening protease enzyme activity test result 6.5 to clear zone is 13 mm againts colony diametre is 2 mm. The results of study enzyme activity used spectrophotometer UV-Vis obtainable the regression equation Y=0.02983+0.001312X, with levels of protein M4 isolate is 0.6594 mg/mL and enzyme activity of obtainable is 0.8626 unit/ml while the spesific enzyme activity produced is 1.308 unit/mg. Then, 16S rRNA gene amplificatiom and DNA sequencing has been done. The results of study showed that the bacteria species contained from M4 bacteria lactic acid (LAB) isolate is Weisella cibiria strain II-I-59. Weisella cibiria strain II-I-59 is one of bacteria could be utilized in the digestive tract.

  18. hUTP24 is essential for processing of the human rRNA precursor at site A1, but not at site A0

    PubMed Central

    Tomecki, Rafal; Labno, Anna; Drazkowska, Karolina; Cysewski, Dominik; Dziembowski, Andrzej

    2015-01-01

    Production of ribosomes relies on more than 200 accessory factors to ensure the proper sequence of steps and faultless assembly of ribonucleoprotein machinery. Among trans-acting factors are numerous enzymes, including ribonucleases responsible for processing the large rRNA precursor synthesized by RNA polymerase I that encompasses sequences corresponding to mature 18S, 5.8S, and 25/28S rRNA. In humans, the identity of most enzymes responsible for individual processing steps, including endoribonucleases that cleave pre-rRNA at specific sites within regions flanking and separating mature rRNA, remains largely unknown. Here, we investigated the role of hUTP24 in rRNA maturation in human cells. hUTP24 is a human homolog of the Saccharomyces cerevisiae putative PIN domain-containing endoribonuclease Utp24 (yUtp24), which was suggested to participate in the U3 snoRNA-dependent processing of yeast pre-rRNA at sites A0, A1, and A2. We demonstrate that hUTP24 interacts to some extent with proteins homologous to the components of the yeast small subunit (SSU) processome. Moreover, mutation in the putative catalytic site of hUTP24 results in slowed growth of cells and reduced metabolic activity. These effects are associated with a defect in biogenesis of the 40S ribosomal subunit, which results from decreased amounts of 18S rRNA as a consequence of inaccurate pre-rRNA processing at the 5′-end of the 18S rRNA segment (site A1). Interestingly, and in contrast to yeast, site A0 located upstream of A1 is efficiently processed upon UTP24 dysfunction. Finally, hUTP24 inactivation leads to aberrant processing of 18S rRNA 2 nucleotides downstream of the normal A1 cleavage site. PMID:26237581

  19. [Application of MALDI-TOF-MS in gene testing for non-syndromic hearing loss].

    PubMed

    Zeng, Yun; Jiang, Dan; Feng, Da-fei; Jin, Dong-dong; Wu, Xiao-hui; Ding, Yan-li; Zou, Jing

    2013-12-01

    To investigate the feasibility of Matrix-Assisted Laser Desorption-Ionization Time of Flight Mass Spectrometry (MALDI-TOF-MS) , according to the genetic test of non-syndromic hearing loss (NSHL), and check using the direct sequencing. Peripheral blood was collected from 454 NSHL patients. DNA samples were extracted and 20 loci of the four common disease-causing genes were analysed by MALDI-TOF-MS, including GJB2 (35delG, 167delT, 176_191del16, 235delC, 299_300delAT ), GJB3 (538C→T, 547G→A), SLC26A4 (281C→T, 589G→A, IVS7-2A→G, 1174A→T, 1226G→A, 1229C→T, IVS15+5G→A, 1975G→C, 2027T→A, 2162C→T, 2168A→G), and mitochondrial 12S rRNA (1494C→T, 1555A→G). Direct sequencing was also used to analyse the aforementioned 20 loci in order to validate the accuracy of MALDI-TOF-MS. Among the 454 patients, 166 cases (36.56%) of disease-causing mutations were detected, which included 69 cases (21.15%) of GJB2 gene mutation, four cases (0.88%) of GJB3 gene mutation, 64 cases (14.10%) of SLC26A4 gene mutation, and three cases (0.66%) of mitochondrial 12S rRNA gene mutation. Moreover, the results obtained from direct sequencing and MALDI-TOF-MS were consistent, and the results showed that the two methods were consistent. The MALDI-TOF-MS detection method was designed based on the hearing loss-related mutation hotspots seen in the Chinese population, and it has a high detection rate for NSHL related mutations. In comparison to the conventional detection methods, MALDI-TOF-MS has the following advantages: more detection sites, greater coverage, accurate, high throughput and low cost. Therefore, this method is capable of satisfying the needs of clinical detection for hearing impairment and it is suitable for large-scale implementation.

  20. [18S-25S rDNA variation in tissue culture of some Gentiana L. species].

    PubMed

    Mel'nyk, V M; Andrieiev, I O; Spiridonova, K V; Strashniuk, N M; Kunakh, V A

    2007-01-01

    18S-25S rDNA of intact plants and tissue cultures of G. acaulis, G. punctata and G. lutea have been investigated by using blot-hybridization. The decrease of rDNA amount was found in the callus cultures as compared with the plants. In contrast to other species, G. lutea showed intragenome heterogeneity of rRNA genes as well as qualitative rDNA changes in tissue culture, in particular appearance of altered repeats. The relationship between the peculiarities of rRNA gene structure and their rearrangements in in vitro culture was suggested.

  1. Accuracy of Conventional PCR Targeting the 16S rRNA Gene with the Ot-16sRF1 and Ot-16sRR1 Primers for Diagnosis of Scrub Typhus: a Case-Control Study

    PubMed Central

    Kim, Choon-Mee; Cho, Min Keun; Yun, Na-Ra; Kim, Seok Won; Jang, Sook Jin; Ahn, Young-Joon; Lim, Donghoon

    2015-01-01

    We retrospectively evaluated the accuracy of conventional PCR targeting the 16S rRNA gene (16S C-PCR) using the Ot-16sRF1/Ot-16sRR1 primers for diagnosing scrub typhus. The diagnosis of Orientia tsutsugamushi infection by 16S C-PCR presented an increased sensitivity of 87.0% and specificity of 100% compared with those obtained with other targets and is thus a simple and clinically useful method with good diagnostic accuracy. PMID:26491185

  2. Multiple Origins of a Mitochondrial Mutation Conferring Deafness

    PubMed Central

    Hutchin, T. P.; Cortopassi, G. A.

    1997-01-01

    A point mutation (1555G) in the smaller ribosomal subunit of the mitochondrial DNA (mtDNA) has been associated with maternally inherited traits of hypersensitivity to streptomycin and sensorineural deafness in a number of families from China, Japan, Israel, and Africa. To determine whether this distribution was the result of a single or multiple mutational events, we carried out genetic distance analysis and phylogenetic analysis of 10 independent mtDNA D-loop sequences from Africa and Asia. The mtDNA sequence diversity was high (2.21%). Phylogenetic analysis assigned 1555G-bearing haplotypes at very divergent points in the human mtDNA evolutionary tree, and the 1555G mutations occur in many cases on race-specific mtDNA haplotypes, both facts are inconsistent with a recent introgression of the mutation into these races. The simplest interpretation of the available data is that there have been multiple origins of the 1555G mutation. The genetic distance among mtDNAs bearing the pathogenic 1555G mutation is much larger than among mtDNAs bearing either evolutionarily neutral or weakly deleterious nucleotide substitutions (such as the 4336G mutation). These results are consistent with the view that pathogenic mtDNA haplotypes such as 1555G arise on disparate mtDNA lineages which because of negative natural selection leave relatively few related descendants. The co-existence of the same mutation with deafness in individuals with very different nuclear and mitochondrial genetic backgrounds confirms the pathogenicity of the 1555G mutation. PMID:9055086

  3. Oxidative damage of 18S and 5S ribosomal RNA in digestive gland of mussels exposed to trace metals.

    PubMed

    Kournoutou, Georgia G; Giannopoulou, Panagiota C; Sazakli, Eleni; Leotsinidis, Michel; Kalpaxis, Dimitrios L

    2017-11-01

    Numerous studies have shown the ability of trace metals to accumulate in marine organisms and cause oxidative stress that leads to perturbations in many important intracellular processes, including protein synthesis. This study is mainly focused on the exploration of structural changes, like base modifications, scissions, and conformational changes, caused in 18S and 5S ribosomal RNA (rRNA) isolated from the mussel Mytilus galloprovincialis exposed to 40μg/L Cu, 30μg/L Hg, or 100μg/L Cd, for 5 or 15days. 18S rRNA and 5S rRNA are components of the small and large ribosomal subunit, respectively, found in complex with ribosomal proteins, translation factors and other auxiliary components (metal ions, toxins etc). 18S rRNA plays crucial roles in all stages of protein synthesis, while 5S rRNA serves as a master signal transducer between several functional regions of 28S rRNA. Therefore, structural changes in these ribosomal constituents could affect the basic functions of ribosomes and hence the normal metabolism of cells. Especially, 18S rRNA along with ribosomal proteins forms the decoding centre that ensures the correct codon-anticodon pairing. As exemplified by ELISA, primer extension analysis and DMS footprinting analysis, each metal caused oxidative damage to rRNA, depending on the nature of metal ion and the duration of exposure. Interestingly, exposure of mussels to Cu or Hg caused structural alterations in 5S rRNA, localized in paired regions and within loops A, B, C, and E, leading to a continuous progressive loss of the 5S RNA structural integrity. In contrast, structural impairments of 5S rRNA in mussels exposed to Cd were accumulating for the initial 5days, and then progressively decreased to almost the normal level by day 15, probably due to the parallel elevation of metallothionein content that depletes the pools of free Cd. Regions of interest in 18S rRNA, such as the decoding centre, sites implicated in the binding of tRNAs (A- and P-sites) or

  4. Diversity and distribution of 16S rRNA and phenol monooxygenase genes in the rhizosphere and endophytic bacteria isolated from PAH-contaminated sites

    NASA Astrophysics Data System (ADS)

    Peng, Anping; Liu, Juan; Ling, Wanting; Chen, Zeyou; Gao, Yanzheng

    2015-07-01

    This is the first investigation of the diversity and distribution of 16S rRNA and phenol monooxygenase (PHE) genes in endophytic and rhizosphere bacteria of plants at sites contaminated with different levels of PAHs. Ten PAHs at concentrations from 34.22 to 55.29 and 45.79 to 97.81 mg·kg-1 were measured in rhizosphere soils of Alopecurus aequalis Sobol and Oxalis corniculata L., respectively. The diversity of 16S rRNA and PHE genes in rhizosphere soils or plants changed with varying PAH pollution levels, as shown based on PCR-DGGE data. Generally, higher Shannon-Weiner indexes were found in mild or moderate contaminated areas. A total of 82 different bacterial 16S rRNA gene sequences belonging to five phyla; namely, Acfinobacteria, Proteobacteria, Chloroflexi, Cyanophyta, and Bacteroidetes, were obtained from rhizosphere soils. For the 57 identified PHE gene sequences, 18 were excised from rhizosphere bacteria and 39 from endophytic bacteria. The copy numbers of 16S rRNA and PHE genes in rhizosphere and endophytic bacteria varied from 3.83 × 103 to 2.28 × 106 and 4.17 × 102 to 1.99 × 105, respectively. The copy numbers of PHE genes in rhizosphere bacteria were significantly higher than in endophytic bacteria. Results increase our understanding of the diversity of rhizosphere and endophytic bacteria from plants grown in PAH-contaminated sites.

  5. Primer selection impacts specific population abundances but not community dynamics in a monthly time-series 16S rRNA gene amplicon analysis of coastal marine bacterioplankton.

    PubMed

    Wear, Emma K; Wilbanks, Elizabeth G; Nelson, Craig E; Carlson, Craig A

    2018-03-09

    Primers targeting the 16S small subunit ribosomal RNA marker gene, used to characterize bacterial and archaeal communities, have recently been re-evaluated for marine planktonic habitats. To investigate whether primer selection affects the ecological interpretation of bacterioplankton populations and community dynamics, amplicon sequencing with four primer sets targeting several hypervariable regions of the 16S rRNA gene was conducted on both mock communities constructed from cloned 16S rRNA genes and a time-series of DNA samples from the temperate coastal Santa Barbara Channel. Ecological interpretations of community structure (delineation of depth and seasonality, correlations with environmental factors) were similar across primer sets, while population dynamics varied. We observed substantial differences in relative abundances of taxa known to be poorly resolved by some primer sets, such as Thaumarchaeota and SAR11, and unexpected taxa including Roseobacter clades. Though the magnitude of relative abundances of common OTUs differed between primer sets, the relative abundances of the OTUs were nonetheless strongly correlated. We do not endorse one primer set but rather enumerate strengths and weaknesses to facilitate selection appropriate to a system or experimental goal. While 16S rRNA gene primer bias suggests caution in assessing quantitative population dynamics, community dynamics appear robust across studies using different primers. © 2018 The Authors. Environmental Microbiology published by Society for Applied Microbiology and John Wiley & Sons Ltd.

  6. Phylogenetic Analysis of Bacteroidales 16S rRNA Genes Unveils Sequences Specific to Diverse Swine Fecal Sources

    EPA Science Inventory

    Two of the currently available methods to assess swine fecal pollution (Bac1 and PF163) target Bacteroidales 16S rRNA genes. However, these assays have been shown to exhibit poor host-specificity and low detection limits in environmental waters, in part due to the limited number...

  7. CLUSTOM-CLOUD: In-Memory Data Grid-Based Software for Clustering 16S rRNA Sequence Data in the Cloud Environment.

    PubMed

    Oh, Jeongsu; Choi, Chi-Hwan; Park, Min-Kyu; Kim, Byung Kwon; Hwang, Kyuin; Lee, Sang-Heon; Hong, Soon Gyu; Nasir, Arshan; Cho, Wan-Sup; Kim, Kyung Mo

    2016-01-01

    High-throughput sequencing can produce hundreds of thousands of 16S rRNA sequence reads corresponding to different organisms present in the environmental samples. Typically, analysis of microbial diversity in bioinformatics starts from pre-processing followed by clustering 16S rRNA reads into relatively fewer operational taxonomic units (OTUs). The OTUs are reliable indicators of microbial diversity and greatly accelerate the downstream analysis time. However, existing hierarchical clustering algorithms that are generally more accurate than greedy heuristic algorithms struggle with large sequence datasets. To keep pace with the rapid rise in sequencing data, we present CLUSTOM-CLOUD, which is the first distributed sequence clustering program based on In-Memory Data Grid (IMDG) technology-a distributed data structure to store all data in the main memory of multiple computing nodes. The IMDG technology helps CLUSTOM-CLOUD to enhance both its capability of handling larger datasets and its computational scalability better than its ancestor, CLUSTOM, while maintaining high accuracy. Clustering speed of CLUSTOM-CLOUD was evaluated on published 16S rRNA human microbiome sequence datasets using the small laboratory cluster (10 nodes) and under the Amazon EC2 cloud-computing environments. Under the laboratory environment, it required only ~3 hours to process dataset of size 200 K reads regardless of the complexity of the human microbiome data. In turn, one million reads were processed in approximately 20, 14, and 11 hours when utilizing 20, 30, and 40 nodes on the Amazon EC2 cloud-computing environment. The running time evaluation indicates that CLUSTOM-CLOUD can handle much larger sequence datasets than CLUSTOM and is also a scalable distributed processing system. The comparative accuracy test using 16S rRNA pyrosequences of a mock community shows that CLUSTOM-CLOUD achieves higher accuracy than DOTUR, mothur, ESPRIT-Tree, UCLUST and Swarm. CLUSTOM-CLOUD is written in JAVA

  8. CLUSTOM-CLOUD: In-Memory Data Grid-Based Software for Clustering 16S rRNA Sequence Data in the Cloud Environment

    PubMed Central

    Park, Min-Kyu; Kim, Byung Kwon; Hwang, Kyuin; Lee, Sang-Heon; Hong, Soon Gyu; Nasir, Arshan; Cho, Wan-Sup; Kim, Kyung Mo

    2016-01-01

    High-throughput sequencing can produce hundreds of thousands of 16S rRNA sequence reads corresponding to different organisms present in the environmental samples. Typically, analysis of microbial diversity in bioinformatics starts from pre-processing followed by clustering 16S rRNA reads into relatively fewer operational taxonomic units (OTUs). The OTUs are reliable indicators of microbial diversity and greatly accelerate the downstream analysis time. However, existing hierarchical clustering algorithms that are generally more accurate than greedy heuristic algorithms struggle with large sequence datasets. To keep pace with the rapid rise in sequencing data, we present CLUSTOM-CLOUD, which is the first distributed sequence clustering program based on In-Memory Data Grid (IMDG) technology–a distributed data structure to store all data in the main memory of multiple computing nodes. The IMDG technology helps CLUSTOM-CLOUD to enhance both its capability of handling larger datasets and its computational scalability better than its ancestor, CLUSTOM, while maintaining high accuracy. Clustering speed of CLUSTOM-CLOUD was evaluated on published 16S rRNA human microbiome sequence datasets using the small laboratory cluster (10 nodes) and under the Amazon EC2 cloud-computing environments. Under the laboratory environment, it required only ~3 hours to process dataset of size 200 K reads regardless of the complexity of the human microbiome data. In turn, one million reads were processed in approximately 20, 14, and 11 hours when utilizing 20, 30, and 40 nodes on the Amazon EC2 cloud-computing environment. The running time evaluation indicates that CLUSTOM-CLOUD can handle much larger sequence datasets than CLUSTOM and is also a scalable distributed processing system. The comparative accuracy test using 16S rRNA pyrosequences of a mock community shows that CLUSTOM-CLOUD achieves higher accuracy than DOTUR, mothur, ESPRIT-Tree, UCLUST and Swarm. CLUSTOM-CLOUD is written in

  9. Terminator oligo blocking efficiently eliminates rRNA from Drosophila small RNA sequencing libraries.

    PubMed

    Wickersheim, Michelle L; Blumenstiel, Justin P

    2013-11-01

    A large number of methods are available to deplete ribosomal RNA reads from high-throughput RNA sequencing experiments. Such methods are critical for sequencing Drosophila small RNAs between 20 and 30 nucleotides because size selection is not typically sufficient to exclude the highly abundant class of 30 nucleotide 2S rRNA. Here we demonstrate that pre-annealing terminator oligos complimentary to Drosophila 2S rRNA prior to 5' adapter ligation and reverse transcription efficiently depletes 2S rRNA sequences from the sequencing reaction in a simple and inexpensive way. This depletion is highly specific and is achieved with minimal perturbation of miRNA and piRNA profiles.

  10. Validation of an enzyme-linked immunosorbent assay (ELISA) for the measurement of canine S100A12.

    PubMed

    Heilmann, Romy M; Cranford, Shannon M; Ambrus, Andy; Grützner, Niels; Schellenberg, Stefan; Ruaux, Craig G; Suchodolski, Jan S; Steiner, Jörg M

    2016-03-01

    Canine S100 calcium-binding protein A12 (cS100A12) shows promise as biomarker of inflammation in dogs. A previously developed cS100A12-radioimmunoassay (RIA) requires radioactive tracers and is not sensitive enough for fecal cS100A12 concentrations in 79% of tested healthy dogs. An ELISA assay may be more sensitive than RIA and does not require radioactive tracers. The purpose of the study was to establish a sandwich ELISA for serum and fecal cS100A12, and to establish reference intervals (RI) for normal healthy canine serum and feces. Polyclonal rabbit anti-cS100A12 antibodies were generated and tested by Western blotting and immunohistochemistry. A sandwich ELISA was developed and validated, including accuracy and precision, and agreement with cS100A12-RIA. The RI, stability, and biologic variation in fecal cS100A12, and the effect of corticosteroids on serum cS100A12 were evaluated. Lower detection limits were 5 μg/L (serum) and 1 ng/g (fecal), respectively. Intra- and inter-assay coefficients of variation were ≤ 4.4% and ≤ 10.9%, respectively. Observed-to-expected ratios for linearity and spiking recovery were 98.2 ± 9.8% (mean ± SD) and 93.0 ± 6.1%, respectively. There was a significant bias between the ELISA and the RIA. The RI was 49-320 μg/L for serum and 2-484 ng/g for fecal cS100A12. Fecal cS100A12 was stable for 7 days at 23, 4, -20, and -80°C; biologic variation was negligible but variation within one fecal sample was significant. Corticosteroid treatment had no clinically significant effect on serum cS100A12 concentrations. The cS100A12-ELISA is a precise and accurate assay for serum and fecal cS100A12 in dogs. © 2016 American Society for Veterinary Clinical Pathology.

  11. Hot topic: 16S rRNA gene sequencing reveals the microbiome of the virgin and pregnant bovine uterus.

    PubMed

    Moore, S G; Ericsson, A C; Poock, S E; Melendez, P; Lucy, M C

    2017-06-01

    We tested the hypothesis that the uterus of virgin heifers and pregnant cows possessed a resident microbiome by 16S rRNA gene sequencing of the virgin and pregnant bovine uterus. The endometrium of 10 virgin heifers in estrus and the amniotic fluid, placentome, intercotyledonary placenta, cervical lumen, and external cervix surface (control) of 5 pregnant cows were sampled using aseptic techniques. The DNA was extracted, the V4 hypervariable region of the 16S rRNA gene was amplified, and amplicons were sequenced using Illumina MiSeq technology (Illumina Inc., San Diego, CA). Operational taxonomic units (OTU) were generated from the sequences using Qiime v1.8 software, and taxonomy was assigned using the Greengenes database. The effect of tissue on the microbial composition within the pregnant uterus was tested using univariate (mixed model) and multivariate (permutational multivariate ANOVA) procedures. Amplicons of 16S rRNA gene were generated in all samples, supporting the contention that the uterus of virgin heifers and pregnant cows contained a microbiome. On average, 53, 199, 380, 382, 525, and 13,589 reads annotated as 16, 35, 43, 63, 48, and 176 OTU in the placentome, virgin endometrium, amniotic fluid, cervical lumen, intercotyledonary placenta, and external surface of the cervix, respectively, were generated. The 3 most abundant phyla in the uterus of the virgin heifers and pregnant cows were Firmicutes, Bacteroidetes, and Proteobacteria, and they accounted for approximately 40, 35, and 10% of the sequences, respectively. Phyla abundance was similar between the tissues of the pregnant uterus. Principal component analysis, one-way PERMANOVA analysis of the Bray-Curtis similarity index, and mixed model analysis of the Shannon diversity index and Chao1 index demonstrated that the microbiome of the control tissue (external surface of the cervix) was significantly different from that of the amniotic fluid, intercotyledonary placenta, and placentome tissues

  12. Temporal dissection of K-ras(G12D) mutant in vitro and in vivo using a regulatable K-ras(G12D) mouse allele.

    PubMed

    Wang, Zuoyun; Feng, Yan; Bardeesy, Nabeel; Bardessy, Nabeel; Wong, Kwok-Kin; Liu, Xin-Yuan; Ji, Hongbin

    2012-01-01

    Animal models which allow the temporal regulation of gene activities are valuable for dissecting gene function in tumorigenesis. Here we have constructed a conditional inducible estrogen receptor-K-ras(G12D) (ER-K-ras(G12D)) knock-in mice allele that allows us to temporally switch on or off the activity of K-ras oncogenic mutant through tamoxifen administration. In vitro studies using mice embryonic fibroblast (MEF) showed that a dose of tamoxifen at 0.05 µM works optimally for activation of ER-K-ras(G12D) independent of the gender status. Furthermore, tamoxifen-inducible activation of K-ras(G12D) promotes cell proliferation, anchor-independent growth, transformation as well as invasion, potentially via activation of downstream MAPK pathway and cell cycle progression. Continuous activation of K-ras(G12D) in vivo by tamoxifen treatment is sufficient to drive the neoplastic transformation of normal lung epithelial cells in mice. Tamoxifen withdrawal after the tumor formation results in apoptosis and tumor regression in mouse lungs. Taken together, these data have convincingly demonstrated that K-ras mutant is essential for neoplastic transformation and this animal model may provide an ideal platform for further detailed characterization of the role of K-ras oncogenic mutant during different stages of lung tumorigenesis.

  13. Investigating the diversity of the 18S SSU rRNA hyper-variable region of Theileria in cattle and Cape buffalo (Syncerus caffer) from southern Africa using a next generation sequencing approach.

    PubMed

    Mans, Ben J; Pienaar, Ronel; Ratabane, John; Pule, Boitumelo; Latif, Abdalla A

    2016-07-01

    Molecular classification and systematics of the Theileria is based on the analysis of the 18S rRNA gene. Reverse line blot or conventional sequencing approaches have disadvantages in the study of 18S rRNA diversity and a next-generation 454 sequencing approach was investigated. The 18S rRNA gene was amplified using RLB primers coupled to 96 unique sequence identifiers (MIDs). Theileria positive samples from African buffalo (672) and cattle (480) from southern Africa were combined in batches of 96 and sequenced using the GS Junior 454 sequencer to produce 825711 informative sequences. Sequences were extracted based on MIDs and analysed to identify Theileria genotypes. Genotypes observed in buffalo and cattle were confirmed in the current study, while no new genotypes were discovered. Genotypes showed specific geographic distributions, most probably linked with vector distributions. Host specificity of buffalo and cattle specific genotypes were confirmed and prevalence data as well as relative parasitemia trends indicate preference for different hosts. Mixed infections are common with African buffalo carrying more genotypes compared to cattle. Associative or exclusion co-infection profiles were observed between genotypes that may have implications for speciation and systematics: specifically that more Theileria species may exist in cattle and buffalo than currently recognized. Analysis of primers used for Theileria parva diagnostics indicate that no new genotypes will be amplified by the current primer sets confirming their specificity. T. parva SNP variants that occur in the 18S rRNA hypervariable region were confirmed. A next generation sequencing approach is useful in obtaining comprehensive knowledge regarding 18S rRNA diversity and prevalence for the Theileria, allowing for the assessment of systematics and diagnostic assays based on the 18S gene. Copyright © 2016 Elsevier GmbH. All rights reserved.

  14. Mycobacterial RNA isolation optimized for non-coding RNA: high fidelity isolation of 5S rRNA from Mycobacterium bovis BCG reveals novel post-transcriptional processing and a complete spectrum of modified ribonucleosides.

    PubMed

    Hia, Fabian; Chionh, Yok Hian; Pang, Yan Ling Joy; DeMott, Michael S; McBee, Megan E; Dedon, Peter C

    2015-03-11

    A major challenge in the study of mycobacterial RNA biology is the lack of a comprehensive RNA isolation method that overcomes the unusual cell wall to faithfully yield the full spectrum of non-coding RNA (ncRNA) species. Here, we describe a simple and robust procedure optimized for the isolation of total ncRNA, including 5S, 16S and 23S ribosomal RNA (rRNA) and tRNA, from mycobacteria, using Mycobacterium bovis BCG to illustrate the method. Based on a combination of mechanical disruption and liquid and solid-phase technologies, the method produces all major species of ncRNA in high yield and with high integrity, enabling direct chemical and sequence analysis of the ncRNA species. The reproducibility of the method with BCG was evident in bioanalyzer electrophoretic analysis of isolated RNA, which revealed quantitatively significant differences in the ncRNA profiles of exponentially growing and non-replicating hypoxic bacilli. The method also overcame an historical inconsistency in 5S rRNA isolation, with direct sequencing revealing a novel post-transcriptional processing of 5S rRNA to its functional form and with chemical analysis revealing seven post-transcriptional ribonucleoside modifications in the 5S rRNA. This optimized RNA isolation procedure thus provides a means to more rigorously explore the biology of ncRNA species in mycobacteria. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. Nuclease digestion and mass spectrometric characterization of oligodeoxyribonucleotides containing 1,2-GpG, 1,2-ApG, and 1,3-GpXpG cisplatin intrastrand cross-links.

    PubMed

    Williams, Renee T; Nalbandian, Jenifer N; Tu, Audrey; Wang, Yinsheng

    2013-05-01

    The primary mode of action for cis-diamminedichloroplatinum (II), referred to as cisplatin, toward the treatment of solid malignancies is through formation of cross-links with DNA at purine sites, especially guanines. We prepared oligodeoxyribonucleotides (ODNs) containing a 1,2-GpG, 1,2-ApG, or 1,3-GpXpG cisplatin intrastrand cross-link and the corresponding ODNs modified with (15)N2-labeled cisplatin, and characterized these ODNs with electrospray ionization mass spectrometry (ESI-MS) and tandem MS (MS/MS). We also employed LC-MS/MS to characterize the digestion products of these ODNs after treatment with a cocktail of 4 enzymes (nuclease P1, phosphodiesterases I and II, and alkaline phosphatase). 1,2-GpG was released from the ODNs as a dinucleoside monophosphate or a dinucleotide. Analyses of the digestion products of ODNs containing a 1,2-GpG cross-link on the 5' or 3' terminus revealed that the dinucleotide carries a terminal 5' phosphate. On the other hand, digestion of the 1,3-GpXpG intrastrand cross-link yielded 3 dinucleoside products with 0, 1, or 2 phosphate groups. The availability of the ODNs carrying the stable isotope-labeled lesions, MS/MS analyses of the cisplatin-modified ODNs, and the characterization of the enzymatic digestion products of these ODNs set the stage for the future LC-MS/MS quantification of the 1,2-GpG, 1,2-ApG, and 1,3-GpXpG lesions in cellular DNA. Copyright © 2012 Elsevier B.V. All rights reserved.

  16. Nuclease Digestion and Mass Spectrometric Characterization of Oligodeoxyribonucleotides Containing 1,2-GpG, 1,2-ApG, and 1,3-GpXpG Cisplatin Intrastrand Cross-links

    PubMed Central

    Williams, Renee T.; Nalbandian, Jenifer; Tu, Audrey; Wang, Yinsheng

    2013-01-01

    Background The primary mode of action for cis-diamminedichloroplatinum (II), referred to as cisplatin, towards the treatment of solid malignancies is through formation of cross-links with DNA at purine sites, especially guanines. Methods We prepared oligodeoxyribonucleotides (ODNs) containing a 1,2-GpG, 1,2-ApG, or 1,3-GpXpG cisplatin intrastrand cross-link and the corresponding ODNs modified with 15N2-labeled cisplatin, and characterized these ODNs with electrospray ionization mass spectrometry (ESI-MS) and tandem MS (MS/MS). We also employed LC-MS/MS to characterize the digestion products of these ODNs after treatment with a cocktail of 4 enzymes (nuclease P1, phosphodiesterases I and II, and alkaline phosphatase). Results 1,2-GpG was released from the ODNs as a dinucleoside monophosphate or a dinucleotide. Analyses of the digestion products of ODNs containing a 1,2-GpG cross-link on the 5′ or 3′ terminus revealed that the dinucleotide carries a terminal 5′ phosphate. On the other hand, digestion of the 1,3-GpXpG intrastrand cross-link yielded 3 dinucleoside products with 0, 1, or 2 phosphate groups. Results The availability of the ODNs carrying the stable isotope-labeled lesions, MS/MS analyses of the cisplatin-modified ODNs, and the characterization of the enzymatic digestion products of these ODNs set the stage for the future LC-MS/MS quantification of the 1,2-GpG, 1,2-ApG, and 1,3-GpXpG lesions in cellular DNA. PMID:23266768

  17. Panel of 23S rRNA Gene-Based Real-Time PCR Assays for Improved Universal and Group-Specific Detection of Phytoplasmas▿ †

    PubMed Central

    Hodgetts, Jennifer; Boonham, Neil; Mumford, Rick; Dickinson, Matthew

    2009-01-01

    Primers and probes based on the 23S rRNA gene have been utilized to design a range of real-time PCR assays for routine phytoplasma diagnostics. These assays have been authenticated as phytoplasma specific and shown to be at least as sensitive as nested PCR. A universal assay to detect all phytoplasmas has been developed, along with a multiplex assay to discriminate 16SrI group phytoplasmas from members of all of the other 16Sr groups. Assays for the 16SrII, 16SrIV, and 16SrXII groups have also been developed to confirm that the 23S rRNA gene can be used to design group-specific assays. PMID:19270148

  18. Type 1 ribosome-inactivating proteins depurinate plant 25S rRNA without species specificity.

    PubMed Central

    Prestle, J; Schönfelder, M; Adam, G; Mundry, K W

    1992-01-01

    Four different type 1 ribosome-inactivating proteins (RIPs) with RNA N-glycosidase activity were tested for their ability to attack the large rRNA of plant ribosomes derived from tobacco plants, as well as from the plant species from which the particular RIP had been isolated. Incubation of tobacco ribosomes with RIPs isolated from either Phytolacca americana L. (pokeweed), Dianthus barbatus L. (carnation), Spinacia oleracea L. (spinach) or Chenopodium amaranthicolor Coste and Reyn. (chenopodium) rendered the 25S rRNA sensitive to aniline-catalyzed hydrolysis, generating a single rRNA-fragment of about 350 nucleotides. The same fragment was generated when rRNAs from pokeweed, carnation, spinach or chenopodium ribosomes were aniline-treated without any deliberate treatment of the ribosomes with the respective RIP. This indicated that ribosomes from all RIP-producing plants were already inactivated by their own RIPs during preparation. These results demonstrate that plant ribosomes are generally susceptible to RIP attack, including modification by their own RIPs. Direct sequencing of the newly generated fragments revealed that a single N-glycosidic bond at an adenosine residue within the highly conserved sequence 5'-AGUACGAGAGGA-3' was cleaved by all of the RIPs investigated, a situation also found in animal, yeast and Escherichia coli ribosomes. Images PMID:1620614

  19. 16S rRNA Amplicon Sequencing for Epidemiological Surveys of Bacteria in Wildlife

    PubMed Central

    Razzauti, Maria; Bard, Emilie; Bernard, Maria; Brouat, Carine; Charbonnel, Nathalie; Dehne-Garcia, Alexandre; Loiseau, Anne; Tatard, Caroline; Tamisier, Lucie; Vayssier-Taussat, Muriel; Vignes, Helene

    2016-01-01

    ABSTRACT The human impact on natural habitats is increasing the complexity of human-wildlife interactions and leading to the emergence of infectious diseases worldwide. Highly successful synanthropic wildlife species, such as rodents, will undoubtedly play an increasingly important role in transmitting zoonotic diseases. We investigated the potential for recent developments in 16S rRNA amplicon sequencing to facilitate the multiplexing of the large numbers of samples needed to improve our understanding of the risk of zoonotic disease transmission posed by urban rodents in West Africa. In addition to listing pathogenic bacteria in wild populations, as in other high-throughput sequencing (HTS) studies, our approach can estimate essential parameters for studies of zoonotic risk, such as prevalence and patterns of coinfection within individual hosts. However, the estimation of these parameters requires cleaning of the raw data to mitigate the biases generated by HTS methods. We present here an extensive review of these biases and of their consequences, and we propose a comprehensive trimming strategy for managing these biases. We demonstrated the application of this strategy using 711 commensal rodents, including 208 Mus musculus domesticus, 189 Rattus rattus, 93 Mastomys natalensis, and 221 Mastomys erythroleucus, collected from 24 villages in Senegal. Seven major genera of pathogenic bacteria were detected in their spleens: Borrelia, Bartonella, Mycoplasma, Ehrlichia, Rickettsia, Streptobacillus, and Orientia. Mycoplasma, Ehrlichia, Rickettsia, Streptobacillus, and Orientia have never before been detected in West African rodents. Bacterial prevalence ranged from 0% to 90% of individuals per site, depending on the bacterial taxon, rodent species, and site considered, and 26% of rodents displayed coinfection. The 16S rRNA amplicon sequencing strategy presented here has the advantage over other molecular surveillance tools of dealing with a large spectrum of bacterial

  20. Phytoplasma-specific PCR primers based on sequences of the 16S-23S rRNA spacer region.

    PubMed Central

    Smart, C D; Schneider, B; Blomquist, C L; Guerra, L J; Harrison, N A; Ahrens, U; Lorenz, K H; Seemüller, E; Kirkpatrick, B C

    1996-01-01

    In order to develop a diagnostic tool to identify phytoplasmas and classify them according to their phylogenetic group, we took advantage of the sequence diversity of the 16S-23S intergenic spacer regions (SRs) of phytoplasmas. Ten PCR primers were developed from the SR sequences and were shown to amplify in a group-specific fashion. For some groups of phytoplasmas, such as elm yellows, ash yellows, and pear decline, the SR primer was paired with a specific primer from within the 16S rRNA gene. Each of these primer pairs was specific for a specific phytoplasma group, and they did not produce PCR products of the correct size from any other phytoplasma group. One primer was designed to anneal within the conserved tRNA(Ile) and, when paired with a universal primer, amplified all phytoplasmas tested. None of the primers produced PCR amplification products of the correct size from healthy plant DNA. These primers can serve as effective tools for identifying particular phytoplasmas in field samples. PMID:8702291

  1. Use of rpoB gene analysis for identification of nitrogen-fixing Paenibacillus species as an alternative to the 16S rRNA gene.

    PubMed

    da Mota, F F; Gomes, E A; Paiva, E; Rosado, A S; Seldin, L

    2004-01-01

    To avoid the limitations of 16S rRNA-based phylogenetic analysis for Paenibacillus species, the usefulness of the RNA polymerase beta-subunit encoding gene (rpoB) was investigated as an alternative to the 16S rRNA gene for taxonomic studies. Partial rpoB sequences were generated for the type strains of eight nitrogen-fixing Paenibacillus species. The presence of only one copy of rpoB in the genome of P. graminis strain RSA19(T) was demonstrated by denaturing gradient gel electrophoresis and hybridization assays. A comparative analysis of the sequences of the 16S rRNA and rpoB genes was performed and the eight species showed between 91.6-99.1% (16S rRNA) and 77.9-97.3% (rpoB) similarity, allowing a more accurate discrimination between the different species using the rpoB gene. Finally, 24 isolates from the rhizosphere of different cultivars of maize previously identified as Paenibacillus spp. were assigned correctly to one of the nitrogen-fixing species. The data obtained in this study indicate that rpoB is a powerful identification tool, which can be used for the correct discrimination of the nitrogen-fixing species of agricultural and industrial importance within the genus Paenibacillus.

  2. 12 CFR 563g.14 - Waiver.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 12 Banks and Banking 5 2010-01-01 2010-01-01 false Waiver. 563g.14 Section 563g.14 Banks and Banking OFFICE OF THRIFT SUPERVISION, DEPARTMENT OF THE TREASURY SECURITIES OFFERINGS § 563g.14 Waiver. (a) The Office may waive any requirement of this part, or any required information: (1) Determined to be...

  3. Hearing-loss-associated gene detection in neonatal intensive care unit.

    PubMed

    Yang, S M; Liu, Ying; Liu, C; Yin, A H; Wu, Y F; Zheng, X E; Yang, H M; Yang, J

    2018-02-01

    To investigate the frequency and mutation spectrum of hearing loss-associated gene mutation in Neonatal Intensive Care Unit (NICU). Neonates (n=2305) admitted to NICU were enrolled in this study. Nine prominent hearing loss-associated genes, GJB2 (35 del G, 176 del 16,235 del C, 299 del AT), GJB3 (538 C > T), SLC26A4 (IVS7-2A > G, 2168 A > G) and mtDNA 12S rRNA(1555 A > G, 1494 C > T), were detected. There were 73 cases hearing-loss-associated gene mutation among 2305 cases, the mutation frequency was 3.1%, with 40 cases GJB2 (235del C) mutation (54.8%), 6 cases GJB2 (299 del AT) mutation (8.2%), 21 cases SLC26A4 (IVS 7-2 A > G) mutation (28.7%), 4 cases SLC26A4 (2168 A > G) mutation (5.5%), 2 cases of GJB2 (235del C) combined SLC26A4 (IVS 7-2 A > G, 2168 A > G) mutation (2.8%). Among 73 gene mutation cases, preterm neonates presented in 18 cases, accounting for 24.7% (18/73); hyperbilirubinemia in 13 cases, accounting for 17.8% (13/73); Torch Syndrome in 15 cases, with 12 cases CMV, 2 cases rubella, 1 case toxoplasm, respectively, totally accounting for 20.54% (15/73); neonatal pneumonia in 12 cases, accounting for 16.4% (12/73); birth asphyxia in 5 cases, accounting for 6.9% (5/73); sepsis in 5 cases, accounting for 6.9% (5/73); others in 5 cases, accounting for 6.8% (5/73) . The frequency of hearing loss-associated gene mutation was higher in NICU.There were hearing loss-associated gene mutations in the NICU, suggesting this mutation may complicate with perinatal high-risk factors.

  4. Bacillus nanhaiisediminis sp. nov., an alkalitolerant member of Bacillus rRNA group 6.

    PubMed

    Zhang, Jianli; Wang, Jiewei; Song, Fei; Fang, Caiyuan; Xin, Yuhua; Zhang, Yabo

    2011-05-01

    A Gram-stain-positive, rod-shaped bacterium, designated strain NH3(T), was isolated from a sediment sample from the South China Sea and was subjected to a polyphasic taxonomic study. The isolate grew optimally at 37 °C and pH 9. Strain NH3(T) had cell-wall peptidoglycan based on meso-diaminopimelic acid and MK-7 as the predominant menaquinone. The cellular fatty acid profile included significant amounts of iso-C(15 : 0) and iso-C(14 : 0). The major polar lipids were phosphatidylethanolamine, phosphatidylglycerol and diphosphatidylglycerol. The DNA G+C content of strain NH3(T) was 40.3 mol%. Phylogenetic analysis of the 16S rRNA gene sequence revealed that strain NH3(T) was a member of rRNA group 6 of the genus Bacillus, which includes alkalitolerant, alkaliphilic and halotolerant species. The closest phylogenetic relatives were Bacillus akibai 1139(T) (96.82 % 16S rRNA gene sequence similarity), B. pseudofirmus DSM 8715(T) (96.76 %), B. okhensis Kh10-101(T) (96.76 %) and B. alkalidiazotrophicus MS 6(T) (96.47 %). Strain NH3(T) could be distinguished from these phylogenetically close neighbours based on a number of phenotypic properties. On the basis of phenotypic and chemotaxonomic characteristics and phylogenetic data, we conclude that strain NH3(T) ( = CGMCC 1.10116(T)  = JCM 16507(T)) merits classification as the type strain of a novel species, for which the name Bacillus nanhaiisediminis sp. nov. is proposed.

  5. Comparison of Gull Feces-specific Assays Targeting the 16S rRNA Gene of Catellicoccus Marimammalium and Streptococcus spp.

    EPA Science Inventory

    Two novel gull-specific qPCR assays were developed using 16S rRNA gene sequences from gull fecal clone libraries: a SYBR-green-based assay targeting Streptococcus spp. (i.e., gull3) and a TaqMan qPCR assay targeting Catellicoccus marimammalium (i.e., gull4). The main objectives ...

  6. 12 CFR 563g.3 - Exemptions.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 12 Banks and Banking 5 2010-01-01 2010-01-01 false Exemptions. 563g.3 Section 563g.3 Banks and Banking OFFICE OF THRIFT SUPERVISION, DEPARTMENT OF THE TREASURY SECURITIES OFFERINGS § 563g.3 Exemptions... non-public offering which satisfies the requirements of § 563g.4 of this part; (e) That are debt...

  7. Comparative sequence analyses on the 16S rRNA (rDNA) of Bacillus acidocaldarius, Bacillus acidoterrestris, and Bacillus cycloheptanicus and proposal for creation of a new genus, Alicyclobacillus gen. nov

    NASA Technical Reports Server (NTRS)

    Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.; Deinhard, G.; Poralla, K.

    1992-01-01

    Comparative 16S rRNA (rDNA) sequence analyses performed on the thermophilic Bacillus species Bacillus acidocaldarius, Bacillus acidoterrestris, and Bacillus cycloheptanicus revealed that these organisms are sufficiently different from the traditional Bacillus species to warrant reclassification in a new genus, Alicyclobacillus gen. nov. An analysis of 16S rRNA sequences established that these three thermoacidophiles cluster in a group that differs markedly from both the obligately thermophilic organisms Bacillus stearothermophilus and the facultatively thermophilic organism Bacillus coagulans, as well as many other common mesophilic and thermophilic Bacillus species. The thermoacidophilic Bacillus species B. acidocaldarius, B. acidoterrestris, and B. cycloheptanicus also are unique in that they possess omega-alicylic fatty acid as the major natural membranous lipid component, which is a rare phenotype that has not been found in any other Bacillus species characterized to date. This phenotype, along with the 16S rRNA sequence data, suggests that these thermoacidophiles are biochemically and genetically unique and supports the proposal that they should be reclassified in the new genus Alicyclobacillus.

  8. Comparison of potential diatom 'barcode' genes (the 18S rRNA gene and ITS, COI, rbcL) and their effectiveness in discriminating and determining species taxonomy in the Bacillariophyta.

    PubMed

    Guo, Liliang; Sui, Zhenghong; Zhang, Shu; Ren, Yuanyuan; Liu, Yuan

    2015-04-01

    Diatoms form an enormous group of photoautotrophic micro-eukaryotes and play a crucial role in marine ecology. In this study, we evaluated typical genes to determine whether they were effective at different levels of diatom clustering analysis to assess the potential of these regions for barcoding taxa. Our test genes included nuclear rRNA genes (the nuclear small-subunit rRNA gene and the 5.8S rRNA gene+ITS-2), a mitochondrial gene (cytochrome c-oxidase subunit 1, COI), a chloroplast gene [ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL)] and the universal plastid amplicon (UPA). Calculated genetic divergence was highest for the internal transcribed spacer (ITS; 5.8S+ITS-2) (p-distance of 1.569, 85.84% parsimony-informative sites) and COI (6.084, 82.14%), followed by the 18S rRNA gene (0.139, 57.69%), rbcL (0.120, 42.01%) and UPA (0.050, 14.97%), which indicated that ITS and COI were highly divergent compared with the other tested genes, and that their nucleotide compositions were variable within the whole group of diatoms. Bayesian inference (BI) analysis showed that the phylogenetic trees generated from each gene clustered diatoms at different phylogenetic levels. The 18S rRNA gene was better than the other genes in clustering higher diatom taxa, and both the 18S rRNA gene and rbcL performed well in clustering some lower taxa. The COI region was able to barcode species of some genera within the Bacillariophyceae. ITS was a potential marker for DNA based-taxonomy and DNA barcoding of Thalassiosirales, while species of Cyclotella, Skeletonema and Stephanodiscus gathered in separate clades, and were paraphyletic with those of Thalassiosira. Finally, UPA was too conserved to serve as a diatom barcode. © 2015 IUMS.

  9. Biphasic Study to Characterize Agricultural Biogas Plants by High-Throughput 16S rRNA Gene Amplicon Sequencing and Microscopic Analysis.

    PubMed

    Maus, Irena; Kim, Yong Sung; Wibberg, Daniel; Stolze, Yvonne; Off, Sandra; Antonczyk, Sebastian; Pühler, Alfred; Scherer, Paul; Schlüter, Andreas

    2017-02-28

    Process surveillance within agricultural biogas plants (BGPs) was concurrently studied by high-throughput 16S rRNA gene amplicon sequencing and an optimized quantitative microscopic fingerprinting (QMF) technique. In contrast to 16S rRNA gene amplicons, digitalized microscopy is a rapid and cost-effective method that facilitates enumeration and morphological differentiation of the most significant groups of methanogens regarding their shape and characteristic autofluorescent factor 420. Moreover, the fluorescence signal mirrors cell vitality. In this study, four different BGPs were investigated. The results indicated stable process performance in the mesophilic BGPs and in the thermophilic reactor. Bacterial subcommunity characterization revealed significant differences between the four BGPs. Most remarkably, the genera Defluviitoga and Halocella dominated the thermophilic bacterial subcommunity, whereas members of another taxon, Syntrophaceticus , were found to be abundant in the mesophilic BGP. The domain Archaea was dominated by the genus Methanoculleus in all four BGPs, followed by Methanosaeta in BGP1 and BGP3. In contrast, Methanothermobacter members were highly abundant in the thermophilic BGP4. Furthermore, a high consistency between the sequencing approach and the QMF method was shown, especially for the thermophilic BGP. The differences elucidated that using this biphasic approach for mesophilic BGPs provided novel insights regarding disaggregated single cells of Methanosarcina and Methanosaeta species. Both dominated the archaeal subcommunity and replaced coccoid Methanoculleus members belonging to the same group of Methanomicrobiales that have been frequently observed in similar BGPs. This work demonstrates that combining QMF and 16S rRNA gene amplicon sequencing is a complementary strategy to describe archaeal community structures within biogas processes.

  10. Analysis of 16S rRNA and mxaF genes revealing insights into Methylobacterium niche-specific plant association

    PubMed Central

    Dourado, Manuella Nóbrega; Andreote, Fernando Dini; Dini-Andreote, Francisco; Conti, Raphael; Araújo, Janete Magali; Araújo, Welington Luiz

    2012-01-01

    The genus Methylobacterium comprises pink-pigmented facultative methylotrophic (PPFM) bacteria, known to be an important plant-associated bacterial group. Species of this group, described as plant-nodulating, have the dual capacity of producing cytokinin and enzymes, such as pectinase and cellulase, involved in systemic resistance induction and nitrogen fixation under specific plant environmental conditions. The aim hereby was to evaluate the phylogenetic distribution of Methylobacterium spp. isolates from different host plants. Thus, a comparative analysis between sequences from structural (16S rRNA) and functional mxaF (which codifies for a subunit of the enzyme methanol dehydrogenase) ubiquitous genes, was undertaken. Notably, some Methylobacterium spp. isolates are generalists through colonizing more than one host plant, whereas others are exclusively found in certain specific plant-species. Congruency between phylogeny and specific host inhabitance was higher in the mxaF gene than in the 16S rRNA, a possible indication of function-based selection in this niche. Therefore, in a first stage, plant colonization by Methylobacterium spp. could represent generalist behavior, possibly related to microbial competition and adaptation to a plant environment. Otherwise, niche-specific colonization is apparently impelled by the host plant. PMID:22481887

  11. Analysis of 16S rRNA and mxaF genes revealing insights into Methylobacterium niche-specific plant association.

    PubMed

    Dourado, Manuella Nóbrega; Andreote, Fernando Dini; Dini-Andreote, Francisco; Conti, Raphael; Araújo, Janete Magali; Araújo, Welington Luiz

    2012-01-01

    The genus Methylobacterium comprises pink-pigmented facultative methylotrophic (PPFM) bacteria, known to be an important plant-associated bacterial group. Species of this group, described as plant-nodulating, have the dual capacity of producing cytokinin and enzymes, such as pectinase and cellulase, involved in systemic resistance induction and nitrogen fixation under specific plant environmental conditions. The aim hereby was to evaluate the phylogenetic distribution of Methylobacterium spp. isolates from different host plants. Thus, a comparative analysis between sequences from structural (16S rRNA) and functional mxaF (which codifies for a subunit of the enzyme methanol dehydrogenase) ubiquitous genes, was undertaken. Notably, some Methylobacterium spp. isolates are generalists through colonizing more than one host plant, whereas others are exclusively found in certain specific plant-species. Congruency between phylogeny and specific host inhabitance was higher in the mxaF gene than in the 16S rRNA, a possible indication of function-based selection in this niche. Therefore, in a first stage, plant colonization by Methylobacterium spp. could represent generalist behavior, possibly related to microbial competition and adaptation to a plant environment. Otherwise, niche-specific colonization is apparently impelled by the host plant.

  12. Intracellular diversity of the V4 and V9 regions of the 18S rRNA in marine protists (radiolarians) assessed by high-throughput sequencing.

    PubMed

    Decelle, Johan; Romac, Sarah; Sasaki, Eriko; Not, Fabrice; Mahé, Frédéric

    2014-01-01

    Metabarcoding is a powerful tool for exploring microbial diversity in the environment, but its accurate interpretation is impeded by diverse technical (e.g. PCR and sequencing errors) and biological biases (e.g. intra-individual polymorphism) that remain poorly understood. To help interpret environmental metabarcoding datasets, we investigated the intracellular diversity of the V4 and V9 regions of the 18S rRNA gene from Acantharia and Nassellaria (radiolarians) using 454 pyrosequencing. Individual cells of radiolarians were isolated, and PCRs were performed with generalist primers to amplify the V4 and V9 regions. Different denoising procedures were employed to filter the pyrosequenced raw amplicons (Acacia, AmpliconNoise, Linkage method). For each of the six isolated cells, an average of 541 V4 and 562 V9 amplicons assigned to radiolarians were obtained, from which one numerically dominant sequence and several minor variants were found. At the 97% identity, a diversity metrics commonly used in environmental surveys, up to 5 distinct OTUs were detected in a single cell. However, most amplicons grouped within a single OTU whereas other OTUs contained very few amplicons. Different analytical methods provided evidence that most minor variants forming different OTUs correspond to PCR and sequencing artifacts. Duplicate PCR and sequencing from the same DNA extract of a single cell had only 9 to 16% of unique amplicons in common, and alignment visualization of V4 and V9 amplicons showed that most minor variants contained substitutions in highly-conserved regions. We conclude that intracellular variability of the 18S rRNA in radiolarians is very limited despite its multi-copy nature and the existence of multiple nuclei in these protists. Our study recommends some technical guidelines to conservatively discard artificial amplicons from metabarcoding datasets, and thus properly assess the diversity and richness of protists in the environment.

  13. Electrochemical detection of synthetic DNA and native 16S rRNA fragments on a microarray using a biotinylated intercalator as coupling site for an enzyme label.

    PubMed

    Zimdars, Andreas; Gebala, Magdalena; Hartwich, Gerhard; Neugebauer, Sebastian; Schuhmann, Wolfgang

    2015-10-01

    The direct electrochemical detection of synthetic DNA and native 16S rRNA fragments isolated from Escherichia coli is described. Oligonucleotides are detected via selective post-labeling of double stranded DNA and DNA-RNA duplexes with a biotinylated intercalator that enables high-specific binding of a streptavidin/alkaline phosphatase conjugate. The alkaline phosphatase catalyzes formation of p-aminophenol that is subsequently oxidized at the underlying gold electrode and hence enables the detection of complementary hybridization of the DNA capture strands due to the enzymatic signal amplification. The hybridization assay was performed on microarrays consisting of 32 individually addressable gold microelectrodes. Synthetic DNA strands with sequences representing six different pathogens which are important for the diagnosis of urinary tract infections could be detected at concentrations of 60 nM. Native 16S rRNA isolated from the different pathogens could be detected at a concentration of 30 fM. Optimization of the sensing surface is described and influences on the assay performance are discussed. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Comparative analysis of 16S rRNA and amoA genes from archaea selected with organic and inorganic amendments in enrichment culture.

    PubMed

    Xu, Mouzhong; Schnorr, Jon; Keibler, Brandon; Simon, Holly M

    2012-04-01

    We took advantage of a plant-root enrichment culture system to characterize mesophilic soil archaea selected through the use of organic and inorganic amendments. Comparative analysis of 16S rRNA and amoA genes indicated that specific archaeal clades were selected under different conditions. Three amoA sequence clades were identified, while for a fourth group, identified by 16S rRNA gene analysis alone and referred to as the "root" clade, we detected no corresponding amoA gene. The amoA-containing archaea were present in media with either organic or inorganic amendments, whereas archaea representing the root clade were present only when organic amendment was used. Analysis of amoA gene abundance and expression, together with nitrification-coupled growth assays, indicated potential growth by autotrophic ammonia oxidation for members of two group 1.1b clades. Increased abundance of one of these clades, however, also occurred upon the addition of organic amendment. Finally, although amoA-containing group 1.1a archaea were present in enrichments, we detected neither expression of amoA genes nor evidence for nitrification-coupled growth of these organisms. These data support a model of a diverse metabolic community in mesophilic soil archaea that is just beginning to be characterized.

  15. Occurrence of Acquired 16S rRNA Methyltransferase-Mediated Aminoglycoside Resistance in Clinical Isolates of Enterobacteriaceae within a Tertiary Referral Hospital of Northeast India

    PubMed Central

    Wangkheimayum, Jayalaxmi; Paul, Deepjyoti; Dhar, Debadatta; Nepram, Rajlakshmi; Chetri, Shiela; Bhowmik, Deepshikha; Chakravarty, Atanu

    2017-01-01

    ABSTRACT The methylation of a ribosomal target leads to a high level of resistance to all clinically relevant aminoglycoside antibiotics, so early detection of these resistance determinants will help to reduce the incidence of treatment failures as well as lessen the dissemination rate. Here, we characterized different 16S rRNA methyltransferases responsible for aminoglycoside resistance and their epidemiological background in clinical isolates of Enterobacteriaceae in a tertiary referral hospital in India. All aminoglycoside-resistant isolates were screened for different 16S rRNA methyltransferases by PCR assay, and incompatibility typing of the conjugable plasmid harboring resistance genes was performed by PCR-based replicon typing. An assay for the stability and elimination of these resistance plasmids was performed. The coexistence of extended-spectrum β-lactamases and metallo-β-lactamases was also detected, and the heterogeneity of these isolates was determined by enterobacterial repetitive intergenic consensus PCR. The PCR assay revealed the presence of armA, rmtA, rmtB, rmtC, and rmtD in single and multiple combinations, and these were carried by a diverse group of Inc plasmids. Plasmids harboring these resistance determinants were highly stable and maintained until the 55th serial passage, but SDS treatment could easily eliminate the plasmids harboring the resistance determinants. The coexistence of blaTEM, blaPER, blaGES, and blaSHV, as well as blaVIM and blaNDM, within these isolates was also detected. Strains with different clonal patterns of aminoglycoside resistance were found to spread in this hospital setting. We observed that the 16S rRNA methyltransferase genes were encoded within different Inc plasmid types, suggesting diverse origins and sources of acquisition. Therefore, the present study is of epidemiological importance and can have a role in infection control policy in hospital settings. PMID:28320725

  16. Fastidious Gram-Negatives: Identification by the Vitek 2 Neisseria-Haemophilus Card and by Partial 16S rRNA Gene Sequencing Analysis.

    PubMed

    Sönksen, Ute Wolff; Christensen, Jens Jørgen; Nielsen, Lisbeth; Hesselbjerg, Annemarie; Hansen, Dennis Schrøder; Bruun, Brita

    2010-12-31

    Taxonomy and identification of fastidious Gram negatives are evolving and challenging. We compared identifications achieved with the Vitek 2 Neisseria-Haemophilus (NH) card and partial 16S rRNA gene sequence (526 bp stretch) analysis with identifications obtained with extensive phenotypic characterization using 100 fastidious Gram negative bacteria. Seventy-five strains represented 21 of the 26 taxa included in the Vitek 2 NH database and 25 strains represented related species not included in the database. Of the 100 strains, 31 were the type strains of the species. Vitek 2 NH identification results: 48 of 75 database strains were correctly identified, 11 strains gave `low discrimination´, seven strains were unidentified, and nine strains were misidentified. Identification of 25 non-database strains resulted in 14 strains incorrectly identified as belonging to species in the database. Partial 16S rRNA gene sequence analysis results: For 76 strains phenotypic and sequencing identifications were identical, for 23 strains the sequencing identifications were either probable or possible, and for one strain only the genus was confirmed. Thus, the Vitek 2 NH system identifies most of the commonly occurring species included in the database. Some strains of rarely occurring species and strains of non-database species closely related to database species cause problems. Partial 16S rRNA gene sequence analysis performs well, but does not always suffice, additional phenotypical characterization being useful for final identification.

  17. Defective mitochondrial rRNA methyltransferase MRM2 causes MELAS-like clinical syndrome

    PubMed Central

    Garone, Caterina; D’Souza, Aaron R; Dallabona, Cristina; Lodi, Tiziana; Rebelo-Guiomar, Pedro; Rorbach, Joanna; Donati, Maria Alice; Procopio, Elena; Montomoli, Martino; Guerrini, Renzo; Zeviani, Massimo; Calvo, Sarah E; Mootha, Vamsi K; DiMauro, Salvatore; Ferrero, Ileana; Minczuk, Michal

    2017-01-01

    Abstract Defects in nuclear-encoded proteins of the mitochondrial translation machinery cause early-onset and tissue-specific deficiency of one or more OXPHOS complexes. Here, we report a 7-year-old Italian boy with childhood-onset rapidly progressive encephalomyopathy and stroke-like episodes. Multiple OXPHOS defects and decreased mtDNA copy number (40%) were detected in muscle homogenate. Clinical features combined with low level of plasma citrulline were highly suggestive of mitochondrial encephalopathy, lactic acidosis and stroke-like episodes (MELAS) syndrome, however, the common m.3243 A > G mutation was excluded. Targeted exome sequencing of genes encoding the mitochondrial proteome identified a damaging mutation, c.567 G > A, affecting a highly conserved amino acid residue (p.Gly189Arg) of the MRM2 protein. MRM2 has never before been linked to a human disease and encodes an enzyme responsible for 2’-O-methyl modification at position U1369 in the human mitochondrial 16S rRNA. We generated a knockout yeast model for the orthologous gene that showed a defect in respiration and the reduction of the 2’-O-methyl modification at the equivalent position (U2791) in the yeast mitochondrial 21S rRNA. Complementation with the mrm2 allele carrying the equivalent yeast mutation failed to rescue the respiratory phenotype, which was instead completely rescued by expressing the wild-type allele. Our findings establish that defective MRM2 causes a MELAS-like phenotype, and suggests the genetic screening of the MRM2 gene in patients with a m.3243 A > G negative MELAS-like presentation. PMID:28973171

  18. Defective mitochondrial rRNA methyltransferase MRM2 causes MELAS-like clinical syndrome.

    PubMed

    Garone, Caterina; D'Souza, Aaron R; Dallabona, Cristina; Lodi, Tiziana; Rebelo-Guiomar, Pedro; Rorbach, Joanna; Donati, Maria Alice; Procopio, Elena; Montomoli, Martino; Guerrini, Renzo; Zeviani, Massimo; Calvo, Sarah E; Mootha, Vamsi K; DiMauro, Salvatore; Ferrero, Ileana; Minczuk, Michal

    2017-11-01

    Defects in nuclear-encoded proteins of the mitochondrial translation machinery cause early-onset and tissue-specific deficiency of one or more OXPHOS complexes. Here, we report a 7-year-old Italian boy with childhood-onset rapidly progressive encephalomyopathy and stroke-like episodes. Multiple OXPHOS defects and decreased mtDNA copy number (40%) were detected in muscle homogenate. Clinical features combined with low level of plasma citrulline were highly suggestive of mitochondrial encephalopathy, lactic acidosis and stroke-like episodes (MELAS) syndrome, however, the common m.3243 A > G mutation was excluded. Targeted exome sequencing of genes encoding the mitochondrial proteome identified a damaging mutation, c.567 G > A, affecting a highly conserved amino acid residue (p.Gly189Arg) of the MRM2 protein. MRM2 has never before been linked to a human disease and encodes an enzyme responsible for 2'-O-methyl modification at position U1369 in the human mitochondrial 16S rRNA. We generated a knockout yeast model for the orthologous gene that showed a defect in respiration and the reduction of the 2'-O-methyl modification at the equivalent position (U2791) in the yeast mitochondrial 21S rRNA. Complementation with the mrm2 allele carrying the equivalent yeast mutation failed to rescue the respiratory phenotype, which was instead completely rescued by expressing the wild-type allele. Our findings establish that defective MRM2 causes a MELAS-like phenotype, and suggests the genetic screening of the MRM2 gene in patients with a m.3243 A > G negative MELAS-like presentation. © The Author 2017. Published by Oxford University Press.

  19. Clonal Spread of 16S rRNA Methyltransferase-Producing Klebsiella pneumoniae ST37 with High Prevalence of ESBLs from Companion Animals in China

    PubMed Central

    Xia, Jing; Fang, Liang-Xing; Cheng, Ke; Xu, Guo-Hao; Wang, Xi-Ran; Liao, Xiao-Ping; Liu, Ya-Hong; Sun, Jian

    2017-01-01

    We screened 30 Klebsiella pneumoniae isolates from dogs and cats at a single animal hospital in Guangdong Province, China. Among them, 12 K. pneumoniae strains possessed high-level resistance to amikacin and gentamicin and these were screened for 16S rRNA methyltransferase (16S-RMTase) genes. And then the genes positive isolates were detected for ESBLs (extended spectrum β-lactamases) and analyzed by pulsed-field gel electrophoresis, multilocus sequence typing, PCR-based replicon typing and plasmid analysis. The genetic profiles of rmtB were also determined by PCR mapping. The twelve 16S-RMTase gene-positive isolates were rmtB (11/30) and armA (2/30) with one isolate carrying both genes. Extended spectrum β-lactamases genes were represented by blaCTX-M-55 (9/12), blaCTX-M-27 (2/12) and blaCTX-M-14 (1/12). The twelve 16S-RMTase containing strains were grouped into five clonal patterns and ST37 was the most prevalent sequence type. Ten rmtB-bearing plasmids conjugated successfully and all belonged to IncN and IncF (F33:A-:B-) incompatibility groups. Nine of the transconjugants carried a 97 kb plasmid and the other harbored both ∼60 and ∼200 kb plasmids. rmtB and blaCTX-M-55 were present on the same plasmid and indicated the co-transfer of these two genes, with the rmtB gene showing highly relevant relationships with IS26 and Tn3. Our findings suggested a high prevalence of 16S-RMTase genes in K. pneumonia ST37 from dogs and cats. Additional studies are needed to trace the evolutionary path of this type of resistance among the K. pneumonia isolates, and to determine whether they have been transferred to humans. PMID:28446899

  20. Design and Evaluation of Illumina MiSeq-Compatible, 18S rRNA Gene-Specific Primers for Improved Characterization of Mixed Phototrophic Communities.

    PubMed

    Bradley, Ian M; Pinto, Ameet J; Guest, Jeremy S

    2016-10-01

    The use of high-throughput sequencing technologies with the 16S rRNA gene for characterization of bacterial and archaeal communities has become routine. However, the adoption of sequencing methods for eukaryotes has been slow, despite their significance to natural and engineered systems. There are large variations among the target genes used for amplicon sequencing, and for the 18S rRNA gene, there is no consensus on which hypervariable region provides the most suitable representation of diversity. Additionally, it is unclear how much PCR/sequencing bias affects the depiction of community structure using current primers. The present study amplified the V4 and V8-V9 regions from seven microalgal mock communities as well as eukaryotic communities from freshwater, coastal, and wastewater samples to examine the effect of PCR/sequencing bias on community structure and membership. We found that degeneracies on the 3' end of the current V4-specific primers impact read length and mean relative abundance. Furthermore, the PCR/sequencing error is markedly higher for GC-rich members than for communities with balanced GC content. Importantly, the V4 region failed to reliably capture 2 of the 12 mock community members, and the V8-V9 hypervariable region more accurately represents mean relative abundance and alpha and beta diversity. Overall, the V4 and V8-V9 regions show similar community representations over freshwater, coastal, and wastewater environments, but specific samples show markedly different communities. These results indicate that multiple primer sets may be advantageous for gaining a more complete understanding of community structure and highlight the importance of including mock communities composed of species of interest. The quantification of error associated with community representation by amplicon sequencing is a critical challenge that is often ignored. When target genes are amplified using currently available primers, differential amplification efficiencies

  1. In brown adipocytes, adrenergically induced β{sub 1}-/β{sub 3}-(G{sub s})-, α{sub 2}-(G{sub i})- and α{sub 1}-(G{sub q})-signalling to Erk1/2 activation is not mediated via EGF receptor transactivation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Yanling; Fälting, Johanna M.; Mattsson, Charlotte L.

    2013-10-15

    Brown adipose tissue is unusual in that the neurotransmitter norepinephrine influences cell destiny in ways generally associated with effects of classical growth factors: regulation of cell proliferation, of apoptosis, and progression of differentiation. The norepinephrine effects are mediated through G-protein-coupled receptors; further mediation of such stimulation to e.g. Erk1/2 activation is in cell biology in general accepted to occur through transactivation of the EGF receptor (by external or internal pathways). We have examined here the significance of such transactivation in brown adipocytes. Stimulation of mature brown adipocytes with cirazoline (α{sub 1}-adrenoceptor coupled via G{sub q}), clonidine (α{sub 2} via G{submore » i}) or CL316243 (β{sub 3} via G{sub s}) or via β{sub 1}-receptors significantly activated Erk1/2. Pretreatment with the EGF receptor kinase inhibitor AG1478 had, remarkably, no significant effect on Erk1/2 activation induced by any of these adrenergic agonists (although it fully abolished EGF-induced Erk1/2 activation), demonstrating absence of EGF receptor-mediated transactivation. Results with brown preadipocytes (cells in more proliferative states) were not qualitatively different. Joint stimulation of all adrenoceptors with norepinephrine did not result in synergism on Erk1/2 activation. AG1478 action on EGF-stimulated Erk1/2 phosphorylation showed a sharp concentration–response relationship (IC{sub 50} 0.3 µM); a minor apparent effect of AG1478 on norepinephrine-stimulated Erk1/2 phosphorylation showed nonspecific kinetics, implying caution in interpretation of partial effects of AG1478 as reported in other systems. Transactivation of the EGF receptor is clearly not a universal prerequisite for coupling of G-protein coupled receptors to Erk1/2 signalling cascades. - Highlights: • In brown adipocytes, norepinephrine regulates proliferation, apoptosis, differentiation. • EGF receptor transactivation is supposed to

  2. Application of Stochastic Labeling with Random-Sequence Barcodes for Simultaneous Quantification and Sequencing of Environmental 16S rRNA Genes.

    PubMed

    Hoshino, Tatsuhiko; Inagaki, Fumio

    2017-01-01

    Next-generation sequencing (NGS) is a powerful tool for analyzing environmental DNA and provides the comprehensive molecular view of microbial communities. For obtaining the copy number of particular sequences in the NGS library, however, additional quantitative analysis as quantitative PCR (qPCR) or digital PCR (dPCR) is required. Furthermore, number of sequences in a sequence library does not always reflect the original copy number of a target gene because of biases caused by PCR amplification, making it difficult to convert the proportion of particular sequences in the NGS library to the copy number using the mass of input DNA. To address this issue, we applied stochastic labeling approach with random-tag sequences and developed a NGS-based quantification protocol, which enables simultaneous sequencing and quantification of the targeted DNA. This quantitative sequencing (qSeq) is initiated from single-primer extension (SPE) using a primer with random tag adjacent to the 5' end of target-specific sequence. During SPE, each DNA molecule is stochastically labeled with the random tag. Subsequently, first-round PCR is conducted, specifically targeting the SPE product, followed by second-round PCR to index for NGS. The number of random tags is only determined during the SPE step and is therefore not affected by the two rounds of PCR that may introduce amplification biases. In the case of 16S rRNA genes, after NGS sequencing and taxonomic classification, the absolute number of target phylotypes 16S rRNA gene can be estimated by Poisson statistics by counting random tags incorporated at the end of sequence. To test the feasibility of this approach, the 16S rRNA gene of Sulfolobus tokodaii was subjected to qSeq, which resulted in accurate quantification of 5.0 × 103 to 5.0 × 104 copies of the 16S rRNA gene. Furthermore, qSeq was applied to mock microbial communities and environmental samples, and the results were comparable to those obtained using digital PCR and

  3. Complete chloroplast genome and 45S nrDNA sequences of the medicinal plant species Glycyrrhiza glabra and Glycyrrhiza uralensis.

    PubMed

    Kang, Sang-Ho; Lee, Jeong-Hoon; Lee, Hyun Oh; Ahn, Byoung Ohg; Won, So Youn; Sohn, Seong-Han; Kim, Jung Sun

    2017-10-06

    Glycyrrhiza uralensis and G. glabra, members of the Fabaceae, are medicinally important species that are native to Asia and Europe. Extracts from these plants are widely used as natural sweeteners because of their much greater sweetness than sucrose. In this study, the three complete chloroplast genomes and five 45S nuclear ribosomal (nr)DNA sequences of these two licorice species and an interspecific hybrid are presented. The chloroplast genomes of G. glabra, G. uralensis and G. glabra × G. uralensis were 127,895 bp, 127,716 bp and 127,939 bp, respectively. The three chloroplast genomes harbored 110 annotated genes, including 76 protein-coding genes, 30 tRNA genes and 4 rRNA genes. The 45S nrDNA sequences were either 5,947 or 5,948 bp in length. Glycyrrhiza glabra and G. glabra × G. uralensis showed two types of nrDNA, while G. uralensis contained a single type. The complete 45S nrDNA sequence unit contains 18S rRNA, ITS1, 5.8S rRNA, ITS2 and 26S rRNA. We identified simple sequence repeat and tandem repeat sequences. We also developed four reliable markers for analysis of Glycyrrhiza diversity authentication.

  4. Identification of culturable stream water bacteria from urban, agricultural, and forested watersheds using 16S rRNA gene sequencing

    Treesearch

    Kenneth T. Belt; Christina Hohn; Aiah Gbakima; James A. Higgins

    2007-01-01

    Bacteria present in water samples taken on a weekly basis, from June 2004 through June 2005, from three streams, were cultured on Coliscan® Easygel® agar plates. Colonies representative of a variety of colors and morphologies were subjected to amplification and sequencing of a 1000-1100 nt portion of the 16S rRNA gene. A total of 528 colonies were...

  5. Nucleotide sequence of an exceptionally long 5.8S ribosomal RNA from Crithidia fasciculata.

    PubMed Central

    Schnare, M N; Gray, M W

    1982-01-01

    In Crithidia fasciculata, a trypanosomatid protozoan, the large ribosomal subunit contains five small RNA species (e, f, g, i, j) in addition to 5S rRNA [Gray, M.W. (1981) Mol. Cell. Biol. 1, 347-357]. The complete primary sequence of species i is shown here to be pAACGUGUmCGCGAUGGAUGACUUGGCUUCCUAUCUCGUUGA ... AGAmACGCAGUAAAGUGCGAUAAGUGGUApsiCAAUUGmCAGAAUCAUUCAAUUACCGAAUCUUUGAACGAAACGG ... CGCAUGGGAGAAGCUCUUUUGAGUCAUCCCCGUGCAUGCCAUAUUCUCCAmGUGUCGAA(C)OH. This sequence establishes that species i is a 5.8S rRNA, despite its exceptional length (171-172 nucleotides). The extra nucleotides in C. fasciculata 5.8S rRNA are located in a region whose primary sequence and length are highly variable among 5.8S rRNAs, but which is capable of forming a stable hairpin loop structure (the "G+C-rich hairpin"). The sequence of C. fasciculata 5.8S rRNA is no more closely related to that of another protozoan, Acanthamoeba castellanii, than it is to representative 5.8S rRNA sequences from the other eukaryotic kingdoms, emphasizing the deep phylogenetic divisions that seem to exist within the Kingdom Protista. Images PMID:7079176

  6. Microbial community profiling of fresh basil and pitfalls in taxonomic assignment of enterobacterial pathogenic species based upon 16S rRNA amplicon sequencing.

    PubMed

    Ceuppens, Siele; De Coninck, Dieter; Bottledoorn, Nadine; Van Nieuwerburgh, Filip; Uyttendaele, Mieke

    2017-09-18

    Application of 16S rRNA (gene) amplicon sequencing on food samples is increasingly applied for assessing microbial diversity but may as unintended advantage also enable simultaneous detection of any human pathogens without a priori definition. In the present study high-throughput next-generation sequencing (NGS) of the V1-V2-V3 regions of the 16S rRNA gene was applied to identify the bacteria present on fresh basil leaves. However, results were strongly impacted by variations in the bioinformatics analysis pipelines (MEGAN, SILVAngs, QIIME and MG-RAST), including the database choice (Greengenes, RDP and M5RNA) and the annotation algorithm (best hit, representative hit and lowest common ancestor). The use of pipelines with default parameters will lead to discrepancies. The estimate of microbial diversity of fresh basil using 16S rRNA (gene) amplicon sequencing is thus indicative but subject to biases. Salmonella enterica was detected at low frequencies, between 0.1% and 0.4% of bacterial sequences, corresponding with 37 to 166 reads. However, this result was dependent upon the pipeline used: Salmonella was detected by MEGAN, SILVAngs and MG-RAST, but not by QIIME. Confirmation of Salmonella sequences by real-time PCR was unsuccessful. It was shown that taxonomic resolution obtained from the short (500bp) sequence reads of the 16S rRNA gene containing the hypervariable regions V1-V3 cannot allow distinction of Salmonella with closely related enterobacterial species. In conclusion 16S amplicon sequencing, getting the status of standard method in microbial ecology studies of foods, needs expertise on both bioinformatics and microbiology for analysis of results. It is a powerful tool to estimate bacterial diversity but amenable to biases. Limitations concerning taxonomic resolution for some bacterial species or its inability to detect sub-dominant (pathogenic) species should be acknowledged in order to avoid overinterpretation of results. Copyright © 2017 Elsevier B

  7. Structural insight into the rearrangement of the switch I region in GTP-bound G12A K-Ras.

    PubMed

    Xu, Shenyuan; Long, Brian N; Boris, Gabriel H; Chen, Anqi; Ni, Shuisong; Kennedy, Michael A

    2017-12-01

    K-Ras, a molecular switch that regulates cell growth, apoptosis and metabolism, is activated when it undergoes a conformation change upon binding GTP and is deactivated following the hydrolysis of GTP to GDP. Hydrolysis of GTP in water is accelerated by coordination to K-Ras, where GTP adopts a high-energy conformation approaching the transition state. The G12A mutation reduces intrinsic K-Ras GTP hydrolysis by an unexplained mechanism. Here, crystal structures of G12A K-Ras in complex with GDP, GTP, GTPγS and GppNHp, and of Q61A K-Ras in complex with GDP, are reported. In the G12A K-Ras-GTP complex, the switch I region undergoes a significant reorganization such that the Tyr32 side chain points towards the GTP-binding pocket and forms a hydrogen bond to the GTP γ-phosphate, effectively stabilizing GTP in its precatalytic state, increasing the activation energy required to reach the transition state and contributing to the reduced intrinsic GTPase activity of G12A K-Ras mutants.

  8. Whole mitochondrial genome screening in maternally inherited non-syndromic hearing impairment using a microarray resequencing mitochondrial DNA chip.

    PubMed

    Lévêque, Marianne; Marlin, Sandrine; Jonard, Laurence; Procaccio, Vincent; Reynier, Pascal; Amati-Bonneau, Patrizia; Baulande, Sylvain; Pierron, Denis; Lacombe, Didier; Duriez, Françoise; Francannet, Christine; Mom, Thierry; Journel, Hubert; Catros, Hélène; Drouin-Garraud, Valérie; Obstoy, Marie-Françoise; Dollfus, Hélène; Eliot, Marie-Madeleine; Faivre, Laurence; Duvillard, Christian; Couderc, Remy; Garabedian, Eréa-Noël; Petit, Christine; Feldmann, Delphine; Denoyelle, Françoise

    2007-11-01

    Mitochondrial DNA (mtDNA) mutations have been implicated in non-syndromic hearing loss either as primary or as predisposing factors. As only a part of the mitochondrial genome is usually explored in deafness, its prevalence is probably under-estimated. Among 1350 families with non-syndromic sensorineural hearing loss collected through a French collaborative network, we selected 29 large families with a clear maternal lineage and screened them for known mtDNA mutations in 12S rRNA, tRNASer(UCN) and tRNALeu(UUR) genes. When no mutation could be identified, a whole mitochondrial genome screening was performed, using a microarray resequencing chip: the MitoChip version 2.0 developed by Affymetrix Inc. Known mtDNA mutations was found in nine of the 29 families, which are described in the article: five with A1555G, two with the T7511C, one with 7472insC and one with A3243G mutation. In the remaining 20 families, the resequencing Mitochip detected 258 mitochondrial homoplasmic variants and 107 potentially heteroplasmic variants. Controls were made by direct sequencing on selected fragments and showed a high sensibility of the MitoChip but a low specificity, especially for heteroplasmic variations. An original analysis on the basis of species conservation, frequency and phylogenetic investigation was performed to select the more probably pathogenic variants. The entire genome analysis allowed us to identify five additional families with a putatively pathogenic mitochondrial variant: T669C, C1537T, G8078A, G12236A and G15077A. These results indicate that the new MitoChip platform is a rapid and valuable tool for identification of new mtDNA mutations in deafness.

  9. Structural insight into the rearrangement of the switch I region in GTP-bound G12A K-Ras

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xu, Shenyuan; Long, Brian N.; Boris, Gabriel H.

    K-Ras, a molecular switch that regulates cell growth, apoptosis and metabolism, is activated when it undergoes a conformation change upon binding GTP and is deactivated following the hydrolysis of GTP to GDP. Hydrolysis of GTP in water is accelerated by coordination to K-Ras, where GTP adopts a high-energy conformation approaching the transition state. The G12A mutation reduces intrinsic K-Ras GTP hydrolysis by an unexplained mechanism. Here, crystal structures of G12A K-Ras in complex with GDP, GTP, GTPγS and GppNHp, and of Q61A K-Ras in complex with GDP, are reported. In the G12A K-Ras–GTP complex, the switch I region undergoes amore » significant reorganization such that the Tyr32 side chain points towards the GTP-binding pocket and forms a hydrogen bond to the GTP γ-phosphate, effectively stabilizing GTP in its precatalytic state, increasing the activation energy required to reach the transition state and contributing to the reduced intrinsic GTPase activity of G12A K-Ras mutants.« less

  10. Combining flow cytometry and 16S rRNA gene pyrosequencing: a promising approach for drinking water monitoring and characterization.

    PubMed

    Prest, E I; El-Chakhtoura, J; Hammes, F; Saikaly, P E; van Loosdrecht, M C M; Vrouwenvelder, J S

    2014-10-15

    The combination of flow cytometry (FCM) and 16S rRNA gene pyrosequencing data was investigated for the purpose of monitoring and characterizing microbial changes in drinking water distribution systems. High frequency sampling (5 min intervals for 1 h) was performed at the outlet of a treatment plant and at one location in the full-scale distribution network. In total, 52 bulk water samples were analysed with FCM, pyrosequencing and conventional methods (adenosine-triphosphate, ATP; heterotrophic plate count, HPC). FCM and pyrosequencing results individually showed that changes in the microbial community occurred in the water distribution system, which was not detected with conventional monitoring. FCM data showed an increase in the total bacterial cell concentrations (from 345 ± 15 × 10(3) to 425 ± 35 × 10(3) cells mL(-1)) and in the percentage of intact bacterial cells (from 39 ± 3.5% to 53 ± 4.4%) during water distribution. This shift was also observed in the FCM fluorescence fingerprints, which are characteristic of each water sample. A similar shift was detected in the microbial community composition as characterized with pyrosequencing, showing that FCM and genetic fingerprints are congruent. FCM and pyrosequencing data were subsequently combined for the calculation of cell concentration changes for each bacterial phylum. The results revealed an increase in cell concentrations of specific bacterial phyla (e.g., Proteobacteria), along with a decrease in other phyla (e.g., Actinobacteria), which could not be concluded from the two methods individually. The combination of FCM and pyrosequencing methods is a promising approach for future drinking water quality monitoring and for advanced studies on drinking water distribution pipeline ecology. Copyright © 2014 Elsevier Ltd. All rights reserved.

  11. Identification of Group G Streptococcal Isolates from Companion Animals in Japan and Their Antimicrobial Resistance Patterns.

    PubMed

    Tsuyuki, Yuzo; Kurita, Goro; Murata, Yoshiteru; Goto, Mieko; Takahashi, Takashi

    2017-07-24

    In this study, we conducted a species-level identification of group G streptococcal (GGS) isolates from companion animals in Japan and analyzed antimicrobial resistance (AMR) patterns. Strains were isolated from sterile and non-sterile specimens collected from 72 animals with clinical signs or symptoms in April-May, 2015. We identified the strain by 16S rRNA sequencing, mass spectrometry (MS), and an automated method based on their biochemical properties. Antimicrobial susceptibility was determined using the broth microdilution method and E-test. AMR determinants (erm(A), erm(B), mef(A), tet(M), tet(O), tet(K), tet(L), and tet(S)) in corresponding resistant isolates were amplified by PCR. The 16S rRNA sequencing identified the GGS species as Streptococcus canis (n = 68), Streptococcus dysgalactiae subsp. equisimilis (n = 3), and S. dysgalactiae subsp. dysgalactiae (n = 1). However, there were discrepancies between the sequencing data and both the MS and automated identification data. MS and the automated biochemical technique identified 18 and 37 of the 68 sequencing-identified S. canis strains, respectively. The AMR rates were 20.8% for tetracycline and 5.6% for clarithromycin, with minimum inhibitory concentrations (MIC) 50 -MIC 90 of 2-64 and ≤ 0.12-0.25μg/mL, respectively. AMR genotyping showed single or combined genotypes: erm(B) or tet(M)-tet(O)-tet(S). Our findings show the unique characteristics of GGS isolates from companion animals in Japan in terms of species-level identification and AMR patterns.

  12. Chromosomal Organization of Rrna Operons in Bacillus Subtilis

    PubMed Central

    Jarvis, E. D.; Widom, R. L.; LaFauci, G.; Setoguchi, Y.; Richter, I. R.; Rudner, R.

    1988-01-01

    Integrative mapping with vectors containing ribosomal DNA sequences were used to complete the mapping of the 10 rRNA gene sets in the endospore forming bacterium Bacillus subtilis. Southern hybridizations allowed the assignment of nine operons to distinct BclI restriction fragments and their genetic locus identified by transductional crosses. Nine of the ten rRNA gene sets are located between 0 and 70° on the genomic map. In the region surrounding cysA14, two sets of closely spaced tandem clusters are present. The first (rrnJ and rrnW) is located between purA16 and cysA14 closely linked to the latter; the second (rrnI, rrnH and rrnG) previously mapped within this area is located between attSPO2 and glpT6. The operons at or near the origin of replication (rrnO,rrnA and rrnJ,rrnW) represent ``hot spots'' of plasmid insertion. PMID:2465199

  13. 12 CFR 563g.9 - Escrow requirement.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 12 Banks and Banking 5 2010-01-01 2010-01-01 false Escrow requirement. 563g.9 Section 563g.9 Banks and Banking OFFICE OF THRIFT SUPERVISION, DEPARTMENT OF THE TREASURY SECURITIES OFFERINGS § 563g.9 Escrow requirement. (a) Any funds received in an offering which is offered and sold on a best efforts all...

  14. 12 CFR 563g.6 - Effective date.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 12 Banks and Banking 5 2010-01-01 2010-01-01 false Effective date. 563g.6 Section 563g.6 Banks and Banking OFFICE OF THRIFT SUPERVISION, DEPARTMENT OF THE TREASURY SECURITIES OFFERINGS § 563g.6 Effective date. (a) Except as provided for in paragraph (d) of this section, an offering circular filed by a...

  15. The rRNA evolution and procaryotic phylogeny

    NASA Technical Reports Server (NTRS)

    Fox, G. E.

    1986-01-01

    Studies of ribosomal RNA primary structure allow reconstruction of phylogenetic trees for prokaryotic organisms. Such studies reveal major dichotomy among the bacteria that separates them into eubacteria and archaebacteria. Both groupings are further segmented into several major divisions. The results obtained from 5S rRNA sequences are essentially the same as those obtained with the 16S rRNA data. In the case of Gram negative bacteria the ribosomal RNA sequencing results can also be directly compared with hybridization studies and cytochrome c sequencing studies. There is again excellent agreement among the several methods. It seems likely then that the overall picture of microbial phylogeny that is emerging from the RNA sequence studies is a good approximation of the true history of these organisms. The RNA data allow examination of the evolutionary process in a semi-quantitative way. The secondary structures of these RNAs are largely established. As a result it is possible to recognize examples of local structural evolution. Evolutionary pathways accounting for these events can be proposed and their probability can be assessed.

  16. 17 CFR 240.12g-3 - Registration of securities of successor issuers under section 12(b) or 12(g).

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ...(g). (a) Where in connection with a succession by merger, consolidation, exchange of securities... 12 of the Act unless upon consummation of the succession: (1) Such class is exempt from such... persons; or (3) The securities issued in connection with the succession were registered on Form F-8 or...

  17. 17 CFR 240.12g-3 - Registration of securities of successor issuers under section 12(b) or 12(g).

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ...(g). (a) Where in connection with a succession by merger, consolidation, exchange of securities... 12 of the Act unless upon consummation of the succession: (1) Such class is exempt from such... persons; or (3) The securities issued in connection with the succession were registered on Form F-8 or...

  18. 17 CFR 240.12g-3 - Registration of securities of successor issuers under section 12(b) or 12(g).

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ...(g). (a) Where in connection with a succession by merger, consolidation, exchange of securities... 12 of the Act unless upon consummation of the succession: (1) Such class is exempt from such... persons; or (3) The securities issued in connection with the succession were registered on Form F-8 or...

  19. 17 CFR 240.12g-3 - Registration of securities of successor issuers under section 12(b) or 12(g).

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ...(g). (a) Where in connection with a succession by merger, consolidation, exchange of securities... 12 of the Act unless upon consummation of the succession: (1) Such class is exempt from such... persons; or (3) The securities issued in connection with the succession were registered on Form F-8 or...

  20. 17 CFR 240.12g-3 - Registration of securities of successor issuers under section 12(b) or 12(g).

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ...(g). (a) Where in connection with a succession by merger, consolidation, exchange of securities... 12 of the Act unless upon consummation of the succession: (1) Such class is exempt from such... persons; or (3) The securities issued in connection with the succession were registered on Form F-8 or...

  1. Combined Use of 16S Ribosomal DNA and 16S rRNA To Study the Bacterial Community of Polychlorinated Biphenyl-Polluted Soil

    PubMed Central

    Nogales, Balbina; Moore, Edward R. B.; Llobet-Brossa, Enrique; Rossello-Mora, Ramon; Amann, Rudolf; Timmis, Kenneth N.

    2001-01-01

    The bacterial diversity assessed from clone libraries prepared from rRNA (two libraries) and ribosomal DNA (rDNA) (one library) from polychlorinated biphenyl (PCB)-polluted soil has been analyzed. A good correspondence of the community composition found in the two types of library was observed. Nearly 29% of the cloned sequences in the rDNA library were identical to sequences in the rRNA libraries. More than 60% of the total cloned sequence types analyzed were grouped in phylogenetic groups (a clone group with sequence similarity higher than 97% [98% for Burkholderia and Pseudomonas-type clones]) represented in both types of libraries. Some of those phylogenetic groups, mostly represented by a single (or pair) of cloned sequence type(s), were observed in only one of the types of library. An important difference between the libraries was the lack of clones representative of the Actinobacteria in the rDNA library. The PCB-polluted soil exhibited a high bacterial diversity which included representatives of two novel lineages. The apparent abundance of bacteria affiliated to the beta-subclass of the Proteobacteria, and to the genus Burkholderia in particular, was confirmed by fluorescence in situ hybridization analysis. The possible influence on apparent diversity of low template concentrations was assessed by dilution of the RNA template prior to amplification by reverse transcription-PCR. Although differences in the composition of the two rRNA libraries obtained from high and low RNA concentrations were observed, the main components of the bacterial community were represented in both libraries, and therefore their detection was not compromised by the lower concentrations of template used in this study. PMID:11282645

  2. 5S rRNA Promoter for Guide RNA Expression Enabled Highly Efficient CRISPR/Cas9 Genome Editing in Aspergillus niger.

    PubMed

    Zheng, Xiaomei; Zheng, Ping; Zhang, Kun; Cairns, Timothy C; Meyer, Vera; Sun, Jibin; Ma, Yanhe

    2018-04-30

    The CRISPR/Cas9 system is a revolutionary genome editing tool. However, in eukaryotes, search and optimization of a suitable promoter for guide RNA expression is a significant technical challenge. Here we used the industrially important fungus, Aspergillus niger, to demonstrate that the 5S rRNA gene, which is both highly conserved and efficiently expressed in eukaryotes, can be used as a guide RNA promoter. The gene editing system was established with 100% rates of precision gene modifications among dozens of transformants using short (40-bp) homologous donor DNA. This system was also applicable for generation of designer chromosomes, as evidenced by deletion of a 48 kb gene cluster required for biosynthesis of the mycotoxin fumonisin B1. Moreover, this system also facilitated simultaneous mutagenesis of multiple genes in A. niger. We anticipate that the use of the 5S rRNA gene as guide RNA promoter can broadly be applied for engineering highly efficient eukaryotic CRISPR/Cas9 toolkits. Additionally, the system reported here will enable development of designer chromosomes in model and industrially important fungi.

  3. Identification of the Microbiota in Carious Dentin Lesions Using 16S rRNA Gene Sequencing

    PubMed Central

    Obata, Junko; Takeshita, Toru; Shibata, Yukie; Yamanaka, Wataru; Unemori, Masako; Akamine, Akifumi; Yamashita, Yoshihisa

    2014-01-01

    While mutans streptococci have long been assumed to be the specific pathogen responsible for human dental caries, the concept of a complex dental caries-associated microbiota has received significant attention in recent years. Molecular analyses revealed the complexity of the microbiota with the predominance of Lactobacillus and Prevotella in carious dentine lesions. However, characterization of the dentin caries-associated microbiota has not been extensively explored in different ethnicities and races. In the present study, the bacterial communities in the carious dentin of Japanese subjects were analyzed comprehensively with molecular approaches using the16S rRNA gene. Carious dentin lesion samples were collected from 32 subjects aged 4–76 years, and the 16S rRNA genes, amplified from the extracted DNA with universal primers, were sequenced with a pyrosequencer. The bacterial composition was classified into clusters I, II, and III according to the relative abundance (high, middle, low) of Lactobacillus. The bacterial composition in cluster II was composed of relatively high proportions of Olsenella and Propionibacterium or subdominated by heterogeneous genera. The bacterial communities in cluster III were characterized by the predominance of Atopobium, Prevotella, or Propionibacterium with Streptococcus or Actinomyces. Some samples in clusters II and III, mainly related to Atopobium and Propionibacterium, were novel combinations of microbiota in carious dentin lesions and may be characteristic of the Japanese population. Clone library analysis revealed that Atopobium sp. HOT-416 and P. acidifaciens were specific species associated with dentinal caries among these genera in a Japanese population. We summarized the bacterial composition of dentinal carious lesions in a Japanese population using next-generation sequencing and found typical Japanese types with Atopobium or Propionibacterium predominating. PMID:25083880

  4. Identification of the microbiota in carious dentin lesions using 16S rRNA gene sequencing.

    PubMed

    Obata, Junko; Takeshita, Toru; Shibata, Yukie; Yamanaka, Wataru; Unemori, Masako; Akamine, Akifumi; Yamashita, Yoshihisa

    2014-01-01

    While mutans streptococci have long been assumed to be the specific pathogen responsible for human dental caries, the concept of a complex dental caries-associated microbiota has received significant attention in recent years. Molecular analyses revealed the complexity of the microbiota with the predominance of Lactobacillus and Prevotella in carious dentine lesions. However, characterization of the dentin caries-associated microbiota has not been extensively explored in different ethnicities and races. In the present study, the bacterial communities in the carious dentin of Japanese subjects were analyzed comprehensively with molecular approaches using the16S rRNA gene. Carious dentin lesion samples were collected from 32 subjects aged 4-76 years, and the 16S rRNA genes, amplified from the extracted DNA with universal primers, were sequenced with a pyrosequencer. The bacterial composition was classified into clusters I, II, and III according to the relative abundance (high, middle, low) of Lactobacillus. The bacterial composition in cluster II was composed of relatively high proportions of Olsenella and Propionibacterium or subdominated by heterogeneous genera. The bacterial communities in cluster III were characterized by the predominance of Atopobium, Prevotella, or Propionibacterium with Streptococcus or Actinomyces. Some samples in clusters II and III, mainly related to Atopobium and Propionibacterium, were novel combinations of microbiota in carious dentin lesions and may be characteristic of the Japanese population. Clone library analysis revealed that Atopobium sp. HOT-416 and P. acidifaciens were specific species associated with dentinal caries among these genera in a Japanese population. We summarized the bacterial composition of dentinal carious lesions in a Japanese population using next-generation sequencing and found typical Japanese types with Atopobium or Propionibacterium predominating.

  5. Purpura fulminans mimicking toxic epidermal necrolysis - additional value of 16S rRNA sequencing and skin biopsy.

    PubMed

    Dautzenberg, K H W; Polderman, F N; van Suylen, R J; Moviat, M A M

    2017-05-01

    Both purpura fulminans and toxic epidermal necrolysis (TEN) are rare and life-threatening disorders with a high mortality. We present a case of suspected rapidly progressive, severe pneumococcal sepsis-induced purpura fulminans complicated by multiple organ failure, severe epidermolysis and cutaneous necrosis. We show the diagnostic challenge to differentiate between purpura fulminans and TEN, as the extensive epidermolysis in purpura fulminans may mimic TEN and we highlight the additional value of repeated skin biopsies and 16S rRNA gene sequencing.

  6. Peroxygenase-Catalyzed Fatty Acid Epoxidation in Cereal Seeds (Sequential Oxidation of Linoleic Acid into 9(S),12(S),13(S)-Trihydroxy-10(E)-Octadecenoic Acid).

    PubMed Central

    Hamberg, M.; Hamberg, G.

    1996-01-01

    Peroxygenase-catalyzed epoxidation of oleic acid in preparations of cereal seeds was investigated. The 105,000g particle fraction of oat (Avena sativa) seed homogenate showed high peroxygenase activity, i.e. 3034 [plus or minus] 288 and 2441 [plus or minus] 168 nmol (10 min)-1 mg-1 protein in two cultivars, whereas the corresponding fraction obtained from barley (Hordeum vulgare and Hordeum distichum), rye (Secale cereale), and wheat (Triticum aestivum) showed only weak activity, i.e. 13 to 138 nmol (10 min)-1 mg-1 protein. In subcellular fractions of oat seed homogenate, peroxygenase specific activity was highest in the 105,000g particle fraction, whereas lipoxygenase activity was more evenly distributed and highest in the 105,000g supernatant fraction. Incubation of [1-14C]linoleic acid with the 105,000g supernatant of oat seed homogenate led to the formation of several metabolites, i.e. in order of decreasing abundance, 9(S)-hydroxy-10(E),12(Z)-octadecadienoic acid, 9(S),12(S),13(S)-trihydroxy-10(E)-octadecenoic acid, cis-9,10-epoxy-12(Z)-octadecenoic acid [mainly the 9(R),10(S) enantiomer], cis-12,13-epoxy-9(Z)-octadecenoic acid [mainly the 12(R),13(S) enantiomer], threo-12,13-dihydroxy-9(Z)-octadecenoic acid, and 12(R),13(S)-epoxy-9(S)-hydroxy-10(E)-octadecenoic acid. Incubation of linoleic acid with the 105,000g particle fraction gave a similar, but not identical, pattern of metabolites. Conversion of linoleic acid into 9(S),12(S),13(S)-trihydroxy-10(E)-octadecenoic acid, a naturally occurring oxylipin with antifungal properties, took place by a pathway involving sequential catalysis by lipoxygenase, peroxygenase, and epoxide hydrolase. PMID:12226220

  7. Fastidious Gram-Negatives: Identification by the Vitek 2 Neisseria-Haemophilus Card and by Partial 16S rRNA Gene Sequencing Analysis

    PubMed Central

    Sönksen, Ute Wolff; Christensen, Jens Jørgen; Nielsen, Lisbeth; Hesselbjerg, Annemarie; Hansen, Dennis Schrøder; Bruun, Brita

    2010-01-01

    Taxonomy and identification of fastidious Gram negatives are evolving and challenging. We compared identifications achieved with the Vitek 2 Neisseria-Haemophilus (NH) card and partial 16S rRNA gene sequence (526 bp stretch) analysis with identifications obtained with extensive phenotypic characterization using 100 fastidious Gram negative bacteria. Seventy-five strains represented 21 of the 26 taxa included in the Vitek 2 NH database and 25 strains represented related species not included in the database. Of the 100 strains, 31 were the type strains of the species. Vitek 2 NH identification results: 48 of 75 database strains were correctly identified, 11 strains gave `low discrimination´, seven strains were unidentified, and nine strains were misidentified. Identification of 25 non-database strains resulted in 14 strains incorrectly identified as belonging to species in the database. Partial 16S rRNA gene sequence analysis results: For 76 strains phenotypic and sequencing identifications were identical, for 23 strains the sequencing identifications were either probable or possible, and for one strain only the genus was confirmed. Thus, the Vitek 2 NH system identifies most of the commonly occurring species included in the database. Some strains of rarely occurring species and strains of non-database species closely related to database species cause problems. Partial 16S rRNA gene sequence analysis performs well, but does not always suffice, additional phenotypical characterization being useful for final identification. PMID:21347215

  8. Functional Characterization of G12, a Gene Required for Mitotic Progression during Gastrulation in Zebrafish

    NASA Technical Reports Server (NTRS)

    Reinsch, Sigrid; Conway, Gregory; Dalton, Bonnie P. (Technical Monitor)

    2002-01-01

    In a differential RNA display screen we have isolated a zebrafish gene, G12, for which homologs can only be found in DNA databases for vertebrates, but not invertebrates. This suggests that this is a gene required specifically in vertebrates. G12 expression is upregulated at mid-blastula transition (MBT). Morpholino inactivation of this gene by injection into 1-cell embryos results in mitotic defects and apoptosis shortly after MBT. Nuclei in morpholino treated embryos also display segregation defects. We have characterized the localization of this gene as a GFP fusion in live and fixed embryos. Overexpression of G12-GFP is non-toxic. Animals retain GFP expression for at least 7 days with no developmental defects, Interestingly in these animals G12-GFP is never detectable in blood cells though blood is present. In the deep cells of early embryos, G 12GFP is localized to nuclei and cytoskeletal elements in interphase and to the centrosome and spindle apparatus during mitosis. In the EVL, G12-GFP shows additional localization to the cell periphery, especially in mitosis. In the yolk syncytium, G12-GFP again localizes to nuclei and strongly to cytoplasmic microtubules of migrating nuclei at the YSL margin. Morpholinc, injection specifically into the YSL after cellularization blocks epiboly and nuclei of the YSL show mitotic defects while deep cells show no mitotic defects and continue to divide. Rescue experiments in which morpholino and G12-GFP RNA are co-injected indicate partial rescue by the G12-GFP. The rescue is cell autonomous; that is, regions of the embryo with higher G12-GFP expression show fewer mitotic defects. Spot 14, the human bomolog of G12, has been shown to be amplified in aggressive breast tumors. This finding, along with our functional and morphological data suggest that G12 and spot 14 are vertebrate-specific and may function either as mitotic checkpoints or as structural components of the spindle apparatus.

  9. New clades of euthyneuran gastropods (Mollusca) from 28S rRNA sequences.

    PubMed

    Dayrat, B; Tillier, A; Lecointre, G; Tillier, S

    2001-05-01

    Recent morphological and molecular results on phylogeny of euthyneuran gastropods, which include opisthobranchs and pulmonates, have greatly diminished previous supposed resolution of their phylogenetic relationships. In addition to recent morphological results, sequences of the D1 and D2 domains of the 28S rRNA are here analyzed by parsimony for 31 euthyneuran species. The molecular and previous morphological data sets were not congruent according to an ILD test, and morphological and molecular data could not be analyzed simultaneously. Consequently Bremer's Combinable Component Consensus was used to obtain a new tree, with the following supported molecular results: monophyly of a new clade of opisthobranchs including actively swimming Euthyneura, i.e., pelagic Gymnosomata and Thecosomata plus benthic Anaspidea; first molecular confirmation of monophylies of Hygrophila, including Chilina, Acteonoidea, and Sacoglossa, which include both shell-bearing species and slugs; and new confirmation of the monophyly of Stylommatophora. Morphological characters which support the new clades obtained here are discussed. Copyright 2001 Academic Press.

  10. From learning taxonomies to phylogenetic learning: integration of 16S rRNA gene data into FAME-based bacterial classification.

    PubMed

    Slabbinck, Bram; Waegeman, Willem; Dawyndt, Peter; De Vos, Paul; De Baets, Bernard

    2010-01-30

    Machine learning techniques have shown to improve bacterial species classification based on fatty acid methyl ester (FAME) data. Nonetheless, FAME analysis has a limited resolution for discrimination of bacteria at the species level. In this paper, we approach the species classification problem from a taxonomic point of view. Such a taxonomy or tree is typically obtained by applying clustering algorithms on FAME data or on 16S rRNA gene data. The knowledge gained from the tree can then be used to evaluate FAME-based classifiers, resulting in a novel framework for bacterial species classification. In view of learning in a taxonomic framework, we consider two types of trees. First, a FAME tree is constructed with a supervised divisive clustering algorithm. Subsequently, based on 16S rRNA gene sequence analysis, phylogenetic trees are inferred by the NJ and UPGMA methods. In this second approach, the species classification problem is based on the combination of two different types of data. Herein, 16S rRNA gene sequence data is used for phylogenetic tree inference and the corresponding binary tree splits are learned based on FAME data. We call this learning approach 'phylogenetic learning'. Supervised Random Forest models are developed to train the classification tasks in a stratified cross-validation setting. In this way, better classification results are obtained for species that are typically hard to distinguish by a single or flat multi-class classification model. FAME-based bacterial species classification is successfully evaluated in a taxonomic framework. Although the proposed approach does not improve the overall accuracy compared to flat multi-class classification, it has some distinct advantages. First, it has better capabilities for distinguishing species on which flat multi-class classification fails. Secondly, the hierarchical classification structure allows to easily evaluate and visualize the resolution of FAME data for the discrimination of bacterial

  11. From learning taxonomies to phylogenetic learning: Integration of 16S rRNA gene data into FAME-based bacterial classification

    PubMed Central

    2010-01-01

    Background Machine learning techniques have shown to improve bacterial species classification based on fatty acid methyl ester (FAME) data. Nonetheless, FAME analysis has a limited resolution for discrimination of bacteria at the species level. In this paper, we approach the species classification problem from a taxonomic point of view. Such a taxonomy or tree is typically obtained by applying clustering algorithms on FAME data or on 16S rRNA gene data. The knowledge gained from the tree can then be used to evaluate FAME-based classifiers, resulting in a novel framework for bacterial species classification. Results In view of learning in a taxonomic framework, we consider two types of trees. First, a FAME tree is constructed with a supervised divisive clustering algorithm. Subsequently, based on 16S rRNA gene sequence analysis, phylogenetic trees are inferred by the NJ and UPGMA methods. In this second approach, the species classification problem is based on the combination of two different types of data. Herein, 16S rRNA gene sequence data is used for phylogenetic tree inference and the corresponding binary tree splits are learned based on FAME data. We call this learning approach 'phylogenetic learning'. Supervised Random Forest models are developed to train the classification tasks in a stratified cross-validation setting. In this way, better classification results are obtained for species that are typically hard to distinguish by a single or flat multi-class classification model. Conclusions FAME-based bacterial species classification is successfully evaluated in a taxonomic framework. Although the proposed approach does not improve the overall accuracy compared to flat multi-class classification, it has some distinct advantages. First, it has better capabilities for distinguishing species on which flat multi-class classification fails. Secondly, the hierarchical classification structure allows to easily evaluate and visualize the resolution of FAME data for

  12. Identification of Entamoeba polecki with Unique 18S rRNA Gene Sequences from Celebes Crested Macaques and Pigs in Tangkoko Nature Reserve, North Sulawesi, Indonesia.

    PubMed

    Tuda, Josef; Feng, Meng; Imada, Mihoko; Kobayashi, Seiki; Cheng, Xunjia; Tachibana, Hiroshi

    2016-09-01

    Unique species of macaques are distributed across Sulawesi Island, Indonesia, and the details of Entamoeba infections in these macaques are unknown. A total of 77 stool samples from Celebes crested macaques (Macaca nigra) and 14 stool samples from pigs were collected in Tangkoko Nature Reserve, North Sulawesi, and the prevalence of Entamoeba infection was examined by PCR. Entamoeba polecki was detected in 97% of the macaques and all of the pigs, but no other Entamoeba species were found. The nucleotide sequence of the 18S rRNA gene in E. polecki from M. nigra was unique and showed highest similarity with E. polecki subtype (ST) 4. This is the first case of identification of E. polecki ST4 from wild nonhuman primates. The sequence of the 18S rRNA gene in E. polecki from pigs was also unique and showed highest similarity with E. polecki ST1. These results suggest that the diversity of the 18S rRNA gene in E. polecki is associated with differences in host species and geographic localization, and that there has been no transmission of E. polecki between macaques and pigs in the study area. © 2016 The Author(s) Journal of Eukaryotic Microbiology © 2016 International Society of Protistologists.

  13. Identification and phylogeny of Arabian snakes: Comparison of venom chromatographic profiles versus 16S rRNA gene sequences.

    PubMed

    Al Asmari, Abdulrahman; Manthiri, Rajamohammed Abbas; Khan, Haseeb Ahmad

    2014-11-01

    Identification of snake species is important for various reasons including the emergency treatment of snake bite victims. We present a simple method for identification of six snake species using the gel filtration chromatographic profiles of their venoms. The venoms of Echis coloratus, Echis pyramidum, Cerastes gasperettii, Bitis arietans, Naja arabica, and Walterinnesia aegyptia were milked, lyophilized, diluted and centrifuged to separate the mucus from the venom. The clear supernatants were filtered and chromatographed on fast protein liquid chromatography (FPLC). We obtained the 16S rRNA gene sequences of the above species and performed phylogenetic analysis using the neighbor-joining method. The chromatograms of venoms from different snake species showed peculiar patterns based on the number and location of peaks. The dendrograms generated from similarity matrix based on the presence/absence of particular chromatographic peaks clearly differentiated Elapids from Viperids. Molecular cladistics using 16S rRNA gene sequences resulted in jumping clades while separating the members of these two families. These findings suggest that chromatographic profiles of snake venoms may provide a simple and reproducible chemical fingerprinting method for quick identification of snake species. However, the validation of this methodology requires further studies on large number of specimens from within and across species.

  14. The selenium content of U.S.G.S. standard rocks

    USGS Publications Warehouse

    Schnepfe, M.M.; Flanagan, F.J.

    1973-01-01

    Selenium was determined in duplicate portions from three bottles of six U.S.G.S. standard rocks by a spect rofluorimetric procedure. The following averages, as p.p.m. Se, were obtained: PCC-1, 0.031; GSP-1, 0.088; BCR-1, 0.12; SCo-1, 0.91; MAG-1, 1.3; and SGR-1, 3.7. One-way analysis of variance of the several sets of data showed no significant differences in the selenium content among bottles of any specific rock; these samples may be accepted as homogeneous for their selenium contents by this analytical method. ?? 1973.

  15. Analysis of the 16S–23S rRNA Gene Internal Transcribed Spacer Region in Klebsiella Species▿

    PubMed Central

    Wang, Min; Cao, Boyang; Yu, Qunfang; Liu, Lei; Gao, Qili; Wang, Lei; Feng, Lu

    2008-01-01

    The 16S-23S rRNA gene internal transcribed spacer (ITS) regions of Klebsiella spp., including Klebsiella pneumoniae subsp. pneumoniae, Klebsiella pneumoniae subsp. ozaenae, Klebsiella pneumoniae subsp. rhinoscleromatis, Klebsiella oxytoca, Klebsiella planticola, Klebsiella terrigena, and Klebsiella ornithinolytica, were characterized, and the feasibility of using ITS sequences to discriminate Klebsiella species and subspecies was explored. A total of 336 ITS sequences from 21 representative strains and 11 clinical isolates of Klebsiella were sequenced and analyzed. Three distinct ITS types—ITSnone (without tRNA genes), ITSglu [with a tRNAGlu (UUC) gene], and ITSile+ala [with tRNAIle (GAU) and tRNAAla (UGC) genes]—were detected in all species except for K. pneumoniae subsp. rhinoscleromatis, which has only ITSglu and ITSile+ala. The presence of ITSnone in Enterobacteriaceae had never been reported before. Both the length and the sequence of each ITS type are highly conserved within the species, with identity levels from 0.961 to 1.000 for ITSnone, from 0.967 to 1.000 for ITSglu, and from 0.968 to 1.000 for ITSile+ala. Interspecies sequence identities range from 0.775 to 0.989 for ITSnone, from 0.798 to 0.997 for ITSglu, and from 0.712 to 0.985 for ITSile+ala. Regions with significant interspecies variations but low intraspecies polymorphisms were identified; these may be targeted in the design of probes for the identification of Klebsiella to the species level. Phylogenetic analysis based on ITS regions reveals the relationships among Klebsiella species similarly to that based on 16S rRNA genes. PMID:18753345

  16. An evolutionary conserved pattern of 18S rRNA sequence complementarity to mRNA 5′ UTRs and its implications for eukaryotic gene translation regulation

    PubMed Central

    Pánek, Josef; Kolář, Michal; Vohradský, Jiří; Shivaya Valášek, Leoš

    2013-01-01

    There are several key mechanisms regulating eukaryotic gene expression at the level of protein synthesis. Interestingly, the least explored mechanisms of translational control are those that involve the translating ribosome per se, mediated for example via predicted interactions between the ribosomal RNAs (rRNAs) and mRNAs. Here, we took advantage of robustly growing large-scale data sets of mRNA sequences for numerous organisms, solved ribosomal structures and computational power to computationally explore the mRNA–rRNA complementarity that is statistically significant across the species. Our predictions reveal highly specific sequence complementarity of 18S rRNA sequences with mRNA 5′ untranslated regions (UTRs) forming a well-defined 3D pattern on the rRNA sequence of the 40S subunit. Broader evolutionary conservation of this pattern may imply that 5′ UTRs of eukaryotic mRNAs, which have already emerged from the mRNA-binding channel, may contact several complementary spots on 18S rRNA situated near the exit of the mRNA binding channel and on the middle-to-lower body of the solvent-exposed 40S ribosome including its left foot. We discuss physiological significance of this structurally conserved pattern and, in the context of previously published experimental results, propose that it modulates scanning of the 40S subunit through 5′ UTRs of mRNAs. PMID:23804757

  17. Furosemide loading test in a case of homozygous solute carrier family 12, member 1 (SLC12A1) mutation (g.62382825G>A, p.Pro372Leu) in Japanese Black cattle.

    PubMed

    Hasegawa, Kiyotoshi; Sasaki, Shinji; Sakamoto, Yoichi; Takano, Akifumi; Takayama, Megumi; Higashi, Tomoko; Sugimoto, Yoshikazu; Yasuda, Yasuaki

    2017-10-01

    Hydrallantois is the excessive accumulation of fluid in the allantoic cavity in a pregnant animal and is associated with fetal death. We recently identified a recessive missense mutation in the solute carrier family 12, member 1 (SLC12A1) gene (g.62382825G>A, p.Pro372Leu) that is associated with hydrallantois in Japanese Black cattle. Unexpectedly, we found a case of the homozygous risk-allele for SLC12A1 in a calf, using a PCR-based direct DNA sequencing test. The homozygote was outwardly healthy up to 3 months of age and the mother did not exhibit any clinical symptoms of hydrallantois. In order to validate these observations, we performed confirmation tests for the genotype and a diuretic loading test using furosemide, which inhibits the transporter activity of the SLC12A1 protein. The results showed that the calf was really homozygous for the risk-allele. In the homozygous calf, administration of furosemide did not alter urinary Na + or Cl - levels, in contrast to the heterozygote and wild-type calves in which these were significantly increased. These results demonstrate that the SLC12A1 (g.62382825G>A, p.Pro372Leu) is a hypomorphic or loss-of-function mutation and the hydrallantois with this mutation shows incomplete penetrance in Japanese Black cattle. © 2017 Japanese Society of Animal Science.

  18. Comparison between rpoB and 16S rRNA Gene Sequencing for Molecular Identification of 168 Clinical Isolates of Corynebacterium

    PubMed Central

    Khamis, Atieh; Raoult, Didier; La Scola, Bernard

    2005-01-01

    Higher proportions (91%) of 168 corynebacterial isolates were positively identified by partial rpoB gene determination than by that based on 16S rRNA gene sequences. This method is thus a simple, molecular-analysis-based method for identification of corynebacteria, but it should be used in conjunction with other tests for definitive identification. PMID:15815024

  19. Bacterial Population Changes in a Membrane Bioreactor for Graywater Treatment Monitored by Denaturing Gradient Gel Electrophoretic Analysis of 16S rRNA Gene Fragments

    PubMed Central

    Stamper, David M.; Walch, Marianne; Jacobs, Rachel N.

    2003-01-01

    The bacterial population of a graywater treatment system was monitored over the course of 100 days, along with several wastewater biochemical parameters. The graywater treatment system employed an 1,800-liter membrane bioreactor (MBR) to process the waste, with essentially 100% recycling of the biomass. Graywater feed consisting of 10% galley water and 90% laundry water, selected to approximate the graywater composition on board U.S. Navy ships, was collected offsite. Five-day biological oxygen demand (BOD5), oils and greases (O/G), nitrogen, and phosphorus were monitored in the feed and were found to vary greatly day to day. Changes in the bacterial population were monitored by PCR amplification of region 332 to 518 (Escherichia coli numbering) of the 16S rRNA gene and denaturing gradient gel electrophoresis (DGGE) analysis of the resultant PCR products. DGGE analysis indicated a diverse and unstable bacterial population throughout the 100-day period, with spikes in feed strength causing significant changes in community structure. Long-term similarity between the communities was 0 to 25%, depending on the method of analysis. In spite of the unstable bacterial population, the MBR system was able to meet effluent quality parameters approximately 90% of the time. PMID:12571004

  20. Bacterial population changes in a membrane bioreactor for graywater treatment monitored by denaturing gradient gel electrophoretic analysis of 16S rRNA gene fragments.

    PubMed

    Stamper, David M; Walch, Marianne; Jacobs, Rachel N

    2003-02-01

    The bacterial population of a graywater treatment system was monitored over the course of 100 days, along with several wastewater biochemical parameters. The graywater treatment system employed an 1,800-liter membrane bioreactor (MBR) to process the waste, with essentially 100% recycling of the biomass. Graywater feed consisting of 10% galley water and 90% laundry water, selected to approximate the graywater composition on board U.S. Navy ships, was collected offsite. Five-day biological oxygen demand (BOD(5)), oils and greases (O/G), nitrogen, and phosphorus were monitored in the feed and were found to vary greatly day to day. Changes in the bacterial population were monitored by PCR amplification of region 332 to 518 (Escherichia coli numbering) of the 16S rRNA gene and denaturing gradient gel electrophoresis (DGGE) analysis of the resultant PCR products. DGGE analysis indicated a diverse and unstable bacterial population throughout the 100-day period, with spikes in feed strength causing significant changes in community structure. Long-term similarity between the communities was 0 to 25%, depending on the method of analysis. In spite of the unstable bacterial population, the MBR system was able to meet effluent quality parameters approximately 90% of the time.

  1. Quantitation of base substitutions in eukaryotic 5S rRNA: selection for the maintenance of RNA secondary structure.

    PubMed

    Curtiss, W C; Vournakis, J N

    1984-01-01

    Eukaryotic 5S rRNA sequences from 34 diverse species were compared by the following method: (1) The sequences were aligned; (2) the positions of substitutions were located by comparison of all possible pairs of sequences; (3) the substitution sites were mapped to an assumed general base pairing model; and (4) the R-Y model of base stacking was used to study stacking pattern relationships in the structure. An analysis of the sequence and structure variability in each region of the molecule is presented. It was found that the degree of base substitution varies over a wide range, from absolute conservation to occurrence of over 90% of the possible observable substitutions. The substitutions are located primarily in stem regions of the 5S rRNA secondary structure. More than 88% of the substitutions in helical regions maintain base pairing. The disruptive substitutions are primarily located at the edges of helical regions, resulting in shortening of the helical regions and lengthening of the adjacent nonpaired regions. Base stacking patterns determined by the R-Y model are mapped onto the general secondary structure. Intrastrand and interstrand stacking could stabilize alternative coaxial structures and limit the conformational flexibility of nonpaired regions. Two short contiguous regions are 100% conserved in all species. This may reflect evolutionary constraints imposed at the DNA level by the requirement for binding of a 5S gene transcription initiation factor during gene expression.

  2. An ATP-Binding Cassette Transporter and Two rRNA Methyltransferases Are Involved in Resistance to Avilamycin in the Producer Organism Streptomyces viridochromogenes Tü57

    PubMed Central

    Weitnauer, Gabriele; Gaisser, Sibylle; Trefzer, Axel; Stockert, Sigrid; Westrich, Lucy; Quiros, Luis M.; Mendez, Carmen; Salas, Jose A.; Bechthold, Andreas

    2001-01-01

    Three different resistance factors from the avilamycin biosynthetic gene cluster of Streptomyces viridochromogenes Tü57, which confer avilamycin resistance when expressed in Streptomyces lividans TK66, were isolated. Analysis of the deduced amino acid sequences showed that AviABC1 is similar to a large family of ATP-binding transporter proteins and that AviABC2 resembles hydrophobic transmembrane proteins known to act jointly with the ATP-binding proteins. The deduced amino acid sequence of aviRb showed similarity to those of other rRNA methyltransferases, and AviRa did not resemble any protein in the databases. Independent expression in S. lividans TK66 of aviABC1 plus aviABC2, aviRa, or aviRb conferred different levels of resistance to avilamycin: 5, 10, or 250 μg/ml, respectively. When either aviRa plus aviRb or aviRa plus aviRb plus aviABC1 plus aviABC2 was coexpressed in S. lividans TK66, avilamycin resistance levels reached more than 250 μg/ml. Avilamycin A inhibited poly(U)-directed polyphenylalanine synthesis in an in vitro system using ribosomes of S. lividans TK66(pUWL201) (GWO), S. lividans TK66(pUWL201-Ra) (GWRa), or S. lividans TK66(pUWL201-Rb) (GWRb), whereas ribosomes of S. lividans TK66 containing pUWL201-Ra+Rb (GWRaRb) were highly resistant. aviRa and aviRb were expressed in Escherichia coli, and both enzymes were purified as fusion proteins to near homogeneity. Both enzymes showed rRNA methyltransferase activity using a mixture of 16S and 23S rRNAs from E. coli as the substrate. Coincubation experiments revealed that the enzymes methylate different positions of rRNA. PMID:11181344

  3. Phylogenetic position of Loricifera inferred from nearly complete 18S and 28S rRNA gene sequences.

    PubMed

    Yamasaki, Hiroshi; Fujimoto, Shinta; Miyazaki, Katsumi

    2015-01-01

    Loricifera is an enigmatic metazoan phylum; its morphology appeared to place it with Priapulida and Kinorhyncha in the group Scalidophora which, along with Nematoida (Nematoda and Nematomorpha), comprised the group Cycloneuralia. Scarce molecular data have suggested an alternative phylogenetic hypothesis, that the phylum Loricifera is a sister taxon to Nematomorpha, although the actual phylogenetic position of the phylum remains unclear. Ecdysozoan phylogeny was reconstructed through maximum-likelihood (ML) and Bayesian inference (BI) analyses of nuclear 18S and 28S rRNA gene sequences from 60 species representing all eight ecdysozoan phyla, and including a newly collected loriciferan species. Ecdysozoa comprised two clades with high support values in both the ML and BI trees. One consisted of Priapulida and Kinorhyncha, and the other of Loricifera, Nematoida, and Panarthropoda (Tardigrada, Onychophora, and Arthropoda). The relationships between Loricifera, Nematoida, and Panarthropoda were not well resolved. Loricifera appears to be closely related to Nematoida and Panarthropoda, rather than grouping with Priapulida and Kinorhyncha, as had been suggested by previous studies. Thus, both Scalidophora and Cycloneuralia are a polyphyletic or paraphyletic groups. In addition, Loricifera and Nematomorpha did not emerge as sister groups.

  4. Microbial diversity and activity in the Nematostella vectensis holobiont: insights from 16S rRNA gene sequencing, isolate genomes, and a pilot-scale survey of gene expression.

    PubMed

    Har, Jia Y; Helbig, Tim; Lim, Ju H; Fernando, Samodha C; Reitzel, Adam M; Penn, Kevin; Thompson, Janelle R

    2015-01-01

    We have characterized the molecular and genomic diversity of the microbiota of the starlet sea anemone Nematostella vectensis, a cnidarian model for comparative developmental and functional biology and a year-round inhabitant of temperate salt marshes. Molecular phylogenetic analysis of 16S rRNA gene clone libraries revealed four ribotypes associated with N. vectensis at multiple locations and times. These associates include two novel ribotypes within the ε-Proteobacterial order Campylobacterales and the Spirochetes, respectively, each sharing <85% identity with cultivated strains, and two γ-Proteobacterial ribotypes sharing >99% 16S rRNA identity with Endozoicomonas elysicola and Pseudomonas oleovorans, respectively. Species-specific PCR revealed that these populations persisted in N. vectensis asexually propagated under laboratory conditions. cDNA indicated expression of the Campylobacterales and Endozoicomonas 16S rRNA in anemones from Sippewissett Marsh, MA. A collection of bacteria from laboratory raised N. vectensis was dominated by isolates from P. oleovorans and Rhizobium radiobacter. Isolates from field-collected anemones revealed an association with Limnobacter and Stappia isolates. Genomic DNA sequencing was carried out on 10 cultured bacterial isolates representing field- and laboratory-associates, i.e., Limnobacter spp., Stappia spp., P. oleovorans and R. radiobacter. Genomes contained multiple genes identified as virulence (host-association) factors while S. stellulata and L. thiooxidans genomes revealed pathways for mixotrophic sulfur oxidation. A pilot metatranscriptome of laboratory-raised N. vectensis was compared to the isolate genomes and indicated expression of ORFs from L. thiooxidans with predicted functions of motility, nutrient scavenging (Fe and P), polyhydroxyalkanoate synthesis for carbon storage, and selective permeability (porins). We hypothesize that such activities may mediate acclimation and persistence of bacteria in a N

  5. Microbial diversity and activity in the Nematostella vectensis holobiont: insights from 16S rRNA gene sequencing, isolate genomes, and a pilot-scale survey of gene expression

    PubMed Central

    Har, Jia Y.; Helbig, Tim; Lim, Ju H.; Fernando, Samodha C.; Reitzel, Adam M.; Penn, Kevin; Thompson, Janelle R.

    2015-01-01

    We have characterized the molecular and genomic diversity of the microbiota of the starlet sea anemone Nematostella vectensis, a cnidarian model for comparative developmental and functional biology and a year-round inhabitant of temperate salt marshes. Molecular phylogenetic analysis of 16S rRNA gene clone libraries revealed four ribotypes associated with N. vectensis at multiple locations and times. These associates include two novel ribotypes within the ε-Proteobacterial order Campylobacterales and the Spirochetes, respectively, each sharing <85% identity with cultivated strains, and two γ-Proteobacterial ribotypes sharing >99% 16S rRNA identity with Endozoicomonas elysicola and Pseudomonas oleovorans, respectively. Species-specific PCR revealed that these populations persisted in N. vectensis asexually propagated under laboratory conditions. cDNA indicated expression of the Campylobacterales and Endozoicomonas 16S rRNA in anemones from Sippewissett Marsh, MA. A collection of bacteria from laboratory raised N. vectensis was dominated by isolates from P. oleovorans and Rhizobium radiobacter. Isolates from field-collected anemones revealed an association with Limnobacter and Stappia isolates. Genomic DNA sequencing was carried out on 10 cultured bacterial isolates representing field- and laboratory-associates, i.e., Limnobacter spp., Stappia spp., P. oleovorans and R. radiobacter. Genomes contained multiple genes identified as virulence (host-association) factors while S. stellulata and L. thiooxidans genomes revealed pathways for mixotrophic sulfur oxidation. A pilot metatranscriptome of laboratory-raised N. vectensis was compared to the isolate genomes and indicated expression of ORFs from L. thiooxidans with predicted functions of motility, nutrient scavenging (Fe and P), polyhydroxyalkanoate synthesis for carbon storage, and selective permeability (porins). We hypothesize that such activities may mediate acclimation and persistence of bacteria in a N

  6. Primers to block the amplification of symbiotic apostome ciliate 18S rRNA gene in a PCR-based copepod diet study

    NASA Astrophysics Data System (ADS)

    Yi, Xiaoyan; Zhang, Huan; Liu, Guangxing

    2014-05-01

    Pelagic copepods play an important role in the marine food web. However, a full understanding of the ecological status of this zooplankton group depends on the careful study of their natural diets. In previous PCR-based copepod diet studies, we found many apostome ciliates that live symbiotically under the exoskeleton of the copepods, and their sequences were often over-represented in the 18S rRNA gene (18S rDNA) libraries. As a first step to address this issue, we designed three apostome ciliate 18S rDNA blocking primers, and tested their blocking efficiency against apostome ciliate 18s rDNA under various PCR conditions. Using a semi-quantitative PCR method, we optimized the conditions to efficiently amplify the 18S rDNA of the prey while simultaneously excluding the symbiotic apostome ciliates. This technique will facilitate PCR-based diet studies of copepods and other zooplankton in their natural environments.

  7. Down-regulation of 5S rRNA by miR-150 and miR-383 enhances c-Myc-rpL11 interaction and inhibits proliferation of esophageal squamous carcinoma cells.

    PubMed

    Wang, Xinyu; Ren, Yanli; Wang, Zhiqiong; Xiong, Xiangyu; Han, Sichong; Pan, Wenting; Chen, Hongwei; Zhou, Liqing; Zhou, Changchun; Yuan, Qipeng; Yang, Ming

    2015-12-21

    5S rRNA plays an important part in ribosome biology and is over-expression in multiple cancers. In this study, we found that 5S rRNA is a direct target of miR-150 and miR-383 in esophageal squamous cell carcinoma (ESCC). Overexpression of miR-150 and miR-383 inhibited ESCC cell proliferation in vitro and in vivo. Moreover, 5S rRNA silencing by miR-150 and miR-383 might intensify rpL11-c-Myc interaction, which attenuated role of c-Myc as an oncogenic transcriptional factor and dysregulation of multiple c-Myc target genes. Taken together, our results highlight the involvement of miRNAs in ribosomal regulation during tumorigenesis. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  8. Evaluation of 16S Rrna amplicon sequencing using two next-generation sequencing technologies for phylogenetic analysis of the rumen bacterial community in steers

    USDA-ARS?s Scientific Manuscript database

    Next generation sequencing technologies have vastly changed the approach of sequencing of the 16S rRNA gene for studies in microbial ecology. Three distinct technologies are available for large-scale 16S sequencing. All three are subject to biases introduced by sequencing error rates, amplificatio...

  9. Optimization of intracerebral tumour protection by active-specific immunization against murine melanoma B16/G3.12.

    PubMed

    Staib, L; Harel, W; Mitchell, M S

    2001-08-01

    Development of brain metastases despite extracerebral response to systemic immunotherapy is a common problem in melanoma patients. We have previously described a murine melanoma vaccine of interferon-gamma (IFNgamma)-treated, irradiated syngeneic B16/G3.12 and allogeneic (Cloudman) melanoma cells, plus the adjuvant DETOX, that is protective against subcutaneous (93%) or intracerebral (69%) syngeneic challenge. This study aimed to optimize this vaccine. Groups of nine or 10 mice were immunized five times in 5 weeks with: (i) complete vaccine +/- IFNgamma (VAC+, VAC-); (ii) syngeneic 2 x 106 G3.12 cells plus DETOX (Syn+D), (iii) 2 x 106 allogeneic Cloudman cells plus DETOX (Allo+D); (iv) VAC+ without DETOX (no DETOX); (v) DETOX alone (DETOX); or (vi) phosphate buffered saline (PBS). Mice were challenged subcutaneously with 104 viable G3.12 (or Cloudman cells) and after 35 days intracerebrally with 104 G3.12 cells. Expression of H-2 antigens (measured using fluorescence-activated cell sorting), splenocyte cytotoxicity (measured using 51Cr release) and median overall survival (OAS) were analysed using the log-rank test. VAC+, VAC- and G3.12 mice were equally protected from subcutaneous (s.c.) and intracerebral (i.c.) melanoma challenge (OAS 65 days for s.c., 30 days for i.c.). Protection was less (P < 0.05) in DETOX mice (48 days for s.c.), PBS mice (47 days for s.c., 21 days for i.c.) or no DETOX mice (51 days for s.c.). Allo+D mice showed s.c. (59 days) but not i.c. protection (20 days). IFNgamma incubation did not increase the effect in either the challenge cells or the vaccine cells (P > 0.05). Specific cytotoxicity was seen with G3.12 targets in VAC+ (27%) but not PBS (2%; P < 0.05) mice with equal NK (YAC-1) lysis (10% versus 7%; P< 0.05). Optimal protection against s.c./i.c. experimental murine melanoma was yielded by irradiated syngeneic cells plus DETOX. DETOX alone was not active. Upregulation of H-2 antigens with IFNgamma under these conditions does not

  10. 16S rRNA Gene Sequence Analysis of Drinking Water Using RNA and DNA Extracts as Targets for Clone Library Development

    EPA Science Inventory

    We examined the bacterial composition of chlorinated drinking water using 16S rRNA gene clone libraries derived from RNA and DNA extracted from twelve water samples collected in three different months (June, August, and September of 2007). Phylogenetic analysis of 1234 and 1117 ...

  11. [Positioning of mRNA 3' of the a site bound codon on the human 80S ribosome].

    PubMed

    Molotkov, M V; Graĭfer, D M; Demeshkina, N A; Repkova, M N; Ven'iaminova, A G; Karpova, G G

    2005-01-01

    Short mRNA analogues carrying a UUU triplet at the 5'-termini and a perfluorophenylazide group at either the N7 atom of the guanosine or the C5 atom of the uridine 3' of the triplet were applied to study positioning of mRNA 3' of the A site codon. Complexes of 80S ribosomes with the mRNA analogues were obtained in the presence of tRNAPhe that directed UUU codon to the P site and consequently provided placement of the nucleotide with cross-linker in positions +9 or +12 with respect to the first nucleotide of the P site bound codon. Both types mRNA analogues cross-linked to the 18S rRNA and 40S proteins under mild UV-irradiation. Cross-linking patterns in the complexes where modified nucleotides of the mRNA analogues were in position +7 were analyzed for comparison (cross-linking to the 18S rRNA in such complexes has been studied previously). The efficiency of cross-linking to the ribosomal components depended on the nature of the modified nucleotide in the mRNA analogue and its position on the ribosome, extent of cross-linking to the 18S rRNA being decreased drastically when the modified nucleotide was moved from position +7 to position +12. The nucleotides of 18S rRNA cross-linked to mRNA analogues were determined. Modified nucleotides in positions +9 and +12 cross-linked to the invariant dinucleotide A1824/A1825 and to variable A1823 in the 3'-minidomain of 18S rRNA as well as to protein S15. The same ribosomal components have been found earlier to cross-link to modified mRNA nucleotides in positions from +4 to +7. Besides, all mRNA analogues cross-linked to the invariant nucleotide c1698 in the 3'-minidomain and to and the conserved region 605-620 closing helix 18 in the 5'-domain.

  12. [Phylogenetic and diversity analysis of Acidithiobacillus spp. based on 16S rRNA and RubisCO genes homologues].

    PubMed

    Liu, Minrui; Lin, Pengwu; Qi, Xing'e; Ni, Yongqing

    2016-04-14

    The purpose of the study was to reveal geographic region-related Acidithiobacillus spp. distribution and allopatric speciation. Phylogenetic and diversity analysis was done to expand our knowledge on microbial phylogeography, diversity-maintaining mechanisms and molecular biogeography. We amplified 16S rRNA gene and RubisCO genes to construct corresponding phylogenetic trees based on the sequence homology and analyzed genetic diversity of Acidithiobacillus spp.. Thirty-five strains were isolated from three different regions in China (Yunnan, Hubei, Xinjiang). The whole isolates were classified into five groups. Four strains were identified as A. ferrivorans, six as A. ferridurans, YNTR4-15 Leptspirillum ferrooxidans and HBDY3-31 as Leptospirillum ferrodiazotrophum. The remaining strains were identified as A. ferrooxidans. Analysis of cbbL and cbbM genes sequences of representative 26 strains indicated that cbbL gene of 19 were two copies (cbbL1 and cbbL2) and 7 possessed only cbbL1. cbbM gene was single copy. In nucleotide-based trees, cbbL1 gene sequences of strains were separated into three sequence types, and the cbbL2 was similar to cbbL1 with three types. Codon bias of RubisCO genes was not obvious in Acidithiobacillus spp.. Strains isolated from three different regions in China indicated a great genetic diversity in Acidithiobacillus spp. and their 16S rRNA/RubisCO genes sequence was of significant difference. Phylogenetic tree based on 16S rRNA genes and RubisCO genes was different in Acidithiobacillus spp..

  13. 16S rRNA PCR-Denaturing Gradient Gel Electrophoresis of Oral Lactobacillus casei Group and Their Phenotypic Appearances.

    PubMed

    Piwat, S; Teanpaisan, R

    2013-01-01

    This study aimed to develop a 16S rRNA PCR-denaturing gradient gel electrophoresis (DGGE) to identify the species level of Lactobacillus casei group and to investigate their characteristics of acid production and inhibitory effect. PCR-DGGE has been developed based on the 16S rRNA gene, and a set of HDA-1-GC and HDA-2, designed at V2-V3 region, and another set of CARP-1-GC and CARP-2, designed at V1 region, have been used. The bacterial strains included L. casei ATCC 393, L. paracasei CCUG 32212, L. rhamnosus ATCC 7469, L. zeae CCUG 35515, and 46 clinical strains of L. casei/paracasei/rhamnosus. Inhibitory effect against Streptococcus mutans and acid production were examined. Results revealed that each type species strain and identified clinical isolate showed its own unique DGGE pattern using CARP1-GC and CARP2 primers. HDA1-GC and HDA2 primers could distinguish the strains of L. paracasei from L. casei. It was found that inhibitory effect of L. paracasei was stronger than L. casei and L. rhamnosus. The acid production of L. paracasei was lower than L. casei and L. rhamnosus. In conclusion, the technique has been proven to be able to differentiate between closely related species in L. casei group and thus provide reliable information of their phenotypic appearances.

  14. 16S rRNA PCR-Denaturing Gradient Gel Electrophoresis of Oral Lactobacillus casei Group and Their Phenotypic Appearances

    PubMed Central

    Piwat, S.; Teanpaisan, R.

    2013-01-01

    This study aimed to develop a 16S rRNA PCR-denaturing gradient gel electrophoresis (DGGE) to identify the species level of Lactobacillus casei group and to investigate their characteristics of acid production and inhibitory effect. PCR-DGGE has been developed based on the 16S rRNA gene, and a set of HDA-1-GC and HDA-2, designed at V2-V3 region, and another set of CARP-1-GC and CARP-2, designed at V1 region, have been used. The bacterial strains included L. casei ATCC 393, L. paracasei CCUG 32212, L. rhamnosus ATCC 7469, L. zeae CCUG 35515, and 46 clinical strains of L. casei/paracasei/rhamnosus. Inhibitory effect against Streptococcus mutans and acid production were examined. Results revealed that each type species strain and identified clinical isolate showed its own unique DGGE pattern using CARP1-GC and CARP2 primers. HDA1-GC and HDA2 primers could distinguish the strains of L. paracasei from L. casei. It was found that inhibitory effect of L. paracasei was stronger than L. casei and L. rhamnosus. The acid production of L. paracasei was lower than L. casei and L. rhamnosus. In conclusion, the technique has been proven to be able to differentiate between closely related species in L. casei group and thus provide reliable information of their phenotypic appearances. PMID:24191230

  15. TeV γ-ray observations of the young synchrotron-dominated SNRs G1.9+0.3 and G330.2+1.0 with H.E.S.S.

    NASA Astrophysics Data System (ADS)

    H.E.S.S. Collaboration; Abramowski, A.; Aharonian, F.; Benkhali, F. Ait; Akhperjanian, A. G.; Angüner, E.; Anton, G.; Balenderan, S.; Balzer, A.; Barnacka, A.; Becherini, Y.; Becker Tjus, J.; Bernlöhr, K.; Birsin, E.; Bissaldi, E.; Biteau, J.; Böttcher, M.; Boisson, C.; Bolmont, J.; Bordas, P.; Brucker, J.; Brun, F.; Brun, P.; Bulik, T.; Carrigan, S.; Casanova, S.; Cerruti, M.; Chadwick, P. M.; Chalme-Calvet, R.; Chaves, R. C. G.; Cheesebrough, A.; Chrétien, M.; Colafrancesco, S.; Cologna, G.; Conrad, J.; Couturier, C.; Cui, Y.; Dalton, M.; Daniel, M. K.; Davids, I. D.; Degrange, B.; Deil, C.; deWilt, P.; Dickinson, H. J.; Djannati-Ataï, A.; Domainko, W.; O'C. Drury, L.; Dubus, G.; Dutson, K.; Dyks, J.; Dyrda, M.; Edwards, T.; Egberts, K.; Eger, P.; Espigat, P.; Farnier, C.; Fegan, S.; Feinstein, F.; Fernandes, M. V.; Fernandez, D.; Fiasson, A.; Fontaine, G.; Förster, A.; Füßling, M.; Gajdus, M.; Gallant, Y. A.; Garrigoux, T.; Giavitto, G.; Giebels, B.; Glicenstein, J. F.; Grondin, M.-H.; Grudzińska, M.; Häffner, S.; Hahn, J.; Harris, J.; Heinzelmann, G.; Henri, G.; Hermann, G.; Hervet, O.; Hillert, A.; Hinton, J. A.; Hofmann, W.; Hofverberg, P.; Holler, M.; Horns, D.; Jacholkowska, A.; Jahn, C.; Jamrozy, M.; Janiak, M.; Jankowsky, F.; Jung, I.; Kastendieck, M. A.; Katarzyński, K.; Katz, U.; Kaufmann, S.; Khélifi, B.; Kieffer, M.; Klepser, S.; Klochkov, D.; Kluźniak, W.; Kneiske, T.; Kolitzus, D.; Komin, Nu.; Kosack, K.; Krakau, S.; Krayzel, F.; Krüger, P. P.; Laffon, H.; Lamanna, G.; Lefaucheur, J.; Lemière, A.; Lemoine-Goumard, M.; Lenain, J.-P.; Lennarz, D.; Lohse, T.; Lopatin, A.; Lu, C.-C.; Marandon, V.; Marcowith, A.; Marx, R.; Maurin, G.; Maxted, N.; Mayer, M.; McComb, T. J. L.; Méhault, J.; Meintjes, P. J.; Menzler, U.; Meyer, M.; Moderski, R.; Mohamed, M.; Moulin, E.; Murach, T.; Naumann, C. L.; de Naurois, M.; Niemiec, J.; Nolan, S. J.; Oakes, L.; Ohm, S.; Wilhelmi, E. de Oña; Opitz, B.; Ostrowski, M.; Oya, I.; Panter, M.; Parsons, R. D.; Arribas, M. Paz; Pekeur, N. W.; Pelletier, G.; Perez, J.; Petrucci, P.-O.; Peyaud, B.; Pita, S.; Poon, H.; Pühlhofer, G.; Punch, M.; Quirrenbach, A.; Raab, S.; Raue, M.; Reimer, A.; Reimer, O.; Renaud, M.; Reyes, R. de los; Rieger, F.; Rob, L.; Romoli, C.; Rosier-Lees, S.; Rowell, G.; Rudak, B.; Rulten, C. B.; Sahakian, V.; Sanchez, D. A.; Santangelo, A.; Schlickeiser, R.; Schüssler, F.; Schulz, A.; Schwanke, U.; Schwarzburg, S.; Schwemmer, S.; Sol, H.; Spengler, G.; Spies, F.; Stawarz, Ł.; Steenkamp, R.; Stegmann, C.; Stinzing, F.; Stycz, K.; Sushch, I.; Szostek, A.; Tavernet, J.-P.; Tavernier, T.; Taylor, A. M.; Terrier, R.; Tluczykont, M.; Trichard, C.; Valerius, K.; van Eldik, C.; van Soelen, B.; Vasileiadis, G.; Venter, C.; Viana, A.; Vincent, P.; Völk, H. J.; Volpe, F.; Vorster, M.; Vuillaume, T.; Wagner, S. J.; Wagner, P.; Ward, M.; Weidinger, M.; Weitzel, Q.; White, R.; Wierzcholska, A.; Willmann, P.; Wörnlein, A.; Wouters, D.; Zabalza, V.; Zacharias, M.; Zajczyk, A.; Zdziarski, A. A.; Zech, A.; Zechlin, H.-S.

    2014-06-01

    The non-thermal nature of the X-ray emission from the shell-type supernova remnants (SNRs) G1.9+0.3 and G330.2+1.0 is an indication of intense particle acceleration in the shock fronts of both objects. This suggests that the SNRs are prime candidates for very-high-energy (VHE; E > 0.1 TeV) γ-ray observations. G1.9+0.3, recently established as the youngest known SNR in the Galaxy, also offers a unique opportunity to study the earliest stages of SNR evolution in the VHE domain. The purpose of this work is to probe the level of VHE γ-ray emission from both SNRs and use this to constrain their physical properties. Observations were conducted with the H.E.S.S. (High Energy Stereoscopic System) Cherenkov Telescope Array over a more than six-year period spanning 2004-2010. The obtained data have effective livetimes of 67 h for G1.9+0.3 and 16 h for G330.2+1.0. The data are analysed in the context of the multiwavelength observations currently available and in the framework of both leptonic and hadronic particle acceleration scenarios. No significant γ-ray signal from G1.9+0.3 or G330.2+1.0 was detected. Upper limits (99 per cent confidence level) to the TeV flux from G1.9+0.3 and G330.2+1.0 for the assumed spectral index Γ = 2.5 were set at 5.6 × 10-13 cm-2 s-1 above 0.26 TeV and 3.2 × 10-12 cm-2 s-1 above 0.38 TeV, respectively. In a one-zone leptonic scenario, these upper limits imply lower limits on the interior magnetic field to BG1.9 ≳ 12 μG for G1.9+0.3 and to BG330 ≳ 8 μG for G330.2+1.0. In a hadronic scenario, the low ambient densities and the large distances to the SNRs result in very low predicted fluxes, for which the H.E.S.S. upper limits are not constraining.

  16. Microbial composition analyses by 16S rRNA sequencing: A proof of concept approach to provenance determination of archaeological ochre.

    PubMed

    Lenehan, Claire E; Tobe, Shanan S; Smith, Renee J; Popelka-Filcoff, Rachel S

    2017-01-01

    Many archaeological science studies use the concept of "provenance", where the origins of cultural material can be determined through physical or chemical properties that relate back to the origins of the material. Recent studies using DNA profiling of bacteria have been used for the forensic determination of soils, towards determination of geographic origin. This manuscript presents a novel approach to the provenance of archaeological minerals and related materials through the use of 16S rRNA sequencing analysis of microbial DNA. Through the microbial DNA characterization from ochre and multivariate statistics, we have demonstrated the clear discrimination between four distinct Australian cultural ochre sites.

  17. A one-step reaction for the rapid identification of Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti using oligonucleotide primers designed from the 16S-23S rRNA intergenic sequences.

    PubMed

    Ferchichi, M; Valcheva, R; Prévost, H; Onno, B; Dousset, X

    2008-06-01

    Species-specific primers targeting the 16S-23S ribosomal DNA (rDNA) intergenic spacer region (ISR) were designed to rapidly discriminate between Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti species recently isolated from French sourdough. The 16S-23S ISRs were amplified using primers 16S/p2 and 23S/p7, which anneal to positions 1388-1406 of the 16S rRNA gene and to positions 207-189 of the 23S rRNA gene respectively, Escherichia coli numbering (GenBank accession number V00331). Clone libraries of the resulting amplicons were constructed using a pCR2.1 TA cloning kit and sequenced. Species-specific primers were designed based on the sequences obtained and were used to amplify the 16S-23S ISR in the Lactobacillus species considered. For all of them, two PCR amplicons, designated as small ISR (S-ISR) and large ISR (L-ISR), were obtained. The L-ISR is composed of the corresponding S-ISR, interrupted by a sequence containing tRNA(Ile) and tRNA(Ala) genes. Based on these sequences, species-specific primers were designed and proved to identify accurately the species considered among 30 reference Lactobacillus species tested. Designed species-specific primers enable a rapid and accurate identification of L. mindensis, L. paralimentarius, L. panis, L. pontis and L. frumenti species among other lactobacilli. The proposed method provides a powerful and convenient means of rapidly identifying some sourdough lactobacilli, which could be of help in large starter culture surveys.

  18. Effect of condensed tannins on bovine rumen protist diversity based on 18S rRNA gene sequences.

    PubMed

    Tan, Hui Yin; Sieo, Chin Chin; Abdullah, Norhani; Liang, Juan Boo; Huang, Xiao Dan; Ho, Yin Wan

    2013-01-01

    Molecular diversity of protists from bovine rumen fluid incubated with condensed tannins of Leucaena leucocephala hybrid-Rendang at 20 mg/500 mg dry matter (treatment) or without condensed tannins (control) was investigated using 18S rRNA gene library. Clones from the control library were distributed within nine genera, but clones from the condensed tannin treatment clone library were related to only six genera. Diversity estimators such as abundance-based coverage estimation and Chao1 showed significant differences between the two libraries, although no differences were found based on Shannon-Weaver index and Libshuff. © 2012 The Author(s) Journal of Eukaryotic Microbiology © 2012 International Society of Protistologists.

  19. Fecal S100A12 concentration predicts a lack of response to treatment in dogs affected with chronic enteropathy.

    PubMed

    Heilmann, Romy M; Volkmann, Maria; Otoni, Cristiane C; Grützner, Niels; Kohn, Barbara; Jergens, Albert E; Steiner, Jörg M

    2016-09-01

    S100A12 is a potential biomarker of gastrointestinal inflammation in dogs and fecal S100A12 concentrations are correlated with disease severity and outcome. The aim of the present study was to investigate whether there was any association between pre-treatment fecal S100A12 concentrations in dogs affected with chronic enteropathy (CE) and the response to treatment. Dogs affected with CE were recruited into the study and were classified as antibiotic-responsive diarrhea (ARD; n = 9), food-responsive diarrhea (FRD; n = 30) or idiopathic inflammatory bowel disease (IBD; n = 25). They were also grouped based on their response to treatment as complete remission (n = 35), partial response (n = 25) or no response (n = 4). Fecal S100A12 concentrations, measured by ELISA, were elevated in dogs affected with IBD compared with those from dogs affected with FRD (P = 0.010) or ARD (P = 0.025). Dogs with IBD that did not respond to treatment (n = 4) had significantly greater fecal S100A12 concentrations than dogs in complete remission (P = 0.009). Measurement of fecal S100A12 at the time of diagnosis discriminated between dogs with IBD that were refractory to therapy (≥2700 ng/g fecal S100A12) from those with at least a partial response (<2700 ng/g fecal S100A12), with a sensitivity of 100% and a specificity of 76%. These preliminary results suggest that testing of fecal S100A12 may be useful for predicting the lack of response to treatment in dogs affected with CE. The utility of serial fecal S100A12 measurements for monitoring dogs undergoing treatment for CE warrants further investigation. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Whole-Exome Sequencing to Decipher the Genetic Heterogeneity of Hearing Loss in a Chinese Family with Deaf by Deaf Mating

    PubMed Central

    Qing, Jie; Yan, Denise; Zhou, Yuan; Liu, Qiong; Wu, Weijing; Xiao, Zian; Liu, Yuyuan; Liu, Jia; Du, Lilin; Xie, Dinghua; Liu, Xue Zhong

    2014-01-01

    Inherited deafness has been shown to have high genetic heterogeneity. For many decades, linkage analysis and candidate gene approaches have been the main tools to elucidate the genetics of hearing loss. However, this associated study design is costly, time-consuming, and unsuitable for small families. This is mainly due to the inadequate numbers of available affected individuals, locus heterogeneity, and assortative mating. Exome sequencing has now become technically feasible and a cost-effective method for detection of disease variants underlying Mendelian disorders due to the recent advances in next-generation sequencing (NGS) technologies. In the present study, we have combined both the Deafness Gene Mutation Detection Array and exome sequencing to identify deafness causative variants in a large Chinese composite family with deaf by deaf mating. The simultaneous screening of the 9 common deafness mutations using the allele-specific PCR based universal array, resulted in the identification of the 1555A>G in the mitochondrial DNA (mtDNA) 12S rRNA in affected individuals in one branch of the family. We then subjected the mutation-negative cases to exome sequencing and identified novel causative variants in the MYH14 and WFS1 genes. This report confirms the effective use of a NGS technique to detect pathogenic mutations in affected individuals who were not candidates for classical genetic studies. PMID:25289672

  1. 12 CFR 563g.6 - Effective date.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 12 Banks and Banking 5 2011-01-01 2011-01-01 false Effective date. 563g.6 Section 563g.6 Banks and... date. (a) Except as provided for in paragraph (d) of this section, an offering circular filed by a... day after filing or on such earlier date as the Office may determine for good cause shown. (b) If any...

  2. 12 CFR 563g.2 - Offering circular requirement.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 12 Banks and Banking 5 2010-01-01 2010-01-01 false Offering circular requirement. 563g.2 Section 563g.2 Banks and Banking OFFICE OF THRIFT SUPERVISION, DEPARTMENT OF THE TREASURY SECURITIES OFFERINGS § 563g.2 Offering circular requirement. (a) General. No savings association shall offer or sell, directly...

  3. 12 CFR 563g.11 - Withdrawal or abandonment.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 12 Banks and Banking 5 2010-01-01 2010-01-01 false Withdrawal or abandonment. 563g.11 Section 563g.11 Banks and Banking OFFICE OF THRIFT SUPERVISION, DEPARTMENT OF THE TREASURY SECURITIES OFFERINGS § 563g.11 Withdrawal or abandonment. (a) Any offering circular, amendment, or exhibit may be withdrawn...

  4. Investigation of Microbial Diversity in Geothermal Hot Springs in Unkeshwar, India, Based on 16S rRNA Amplicon Metagenome Sequencing

    PubMed Central

    Mehetre, Gajanan T.; Paranjpe, Aditi; Dastager, Syed G.

    2016-01-01

    Microbial diversity in geothermal waters of the Unkeshwar hot springs in Maharashtra, India, was studied using 16S rRNA amplicon metagenomic sequencing. Taxonomic analysis revealed the presence of Bacteroidetes, Proteobacteria, Cyanobacteria, Actinobacteria, Archeae, and OD1 phyla. Metabolic function prediction analysis indicated a battery of biological information systems indicating rich and novel microbial diversity, with potential biotechnological applications in this niche. PMID:26950332

  5. Oligonucleotide Microarray for 16S rRNA Gene-Based Detection of All Recognized Lineages of Sulfate-Reducing Prokaryotes in the Environment

    PubMed Central

    Loy, Alexander; Lehner, Angelika; Lee, Natuschka; Adamczyk, Justyna; Meier, Harald; Ernst, Jens; Schleifer, Karl-Heinz; Wagner, Michael

    2002-01-01

    For cultivation-independent detection of sulfate-reducing prokaryotes (SRPs) an oligonucleotide microarray consisting of 132 16S rRNA gene-targeted oligonucleotide probes (18-mers) having hierarchical and parallel (identical) specificity for the detection of all known lineages of sulfate-reducing prokaryotes (SRP-PhyloChip) was designed and subsequently evaluated with 41 suitable pure cultures of SRPs. The applicability of SRP-PhyloChip for diversity screening of SRPs in environmental and clinical samples was tested by using samples from periodontal tooth pockets and from the chemocline of a hypersaline cyanobacterial mat from Solar Lake (Sinai, Egypt). Consistent with previous studies, SRP-PhyloChip indicated the occurrence of Desulfomicrobium spp. in the tooth pockets and the presence of Desulfonema- and Desulfomonile-like SRPs (together with other SRPs) in the chemocline of the mat. The SRP-PhyloChip results were confirmed by several DNA microarray-independent techniques, including specific PCR amplification, cloning, and sequencing of SRP 16S rRNA genes and the genes encoding the dissimilatory (bi)sulfite reductase (dsrAB). PMID:12324358

  6. Analysis of common deafness gene mutations in deaf people from unique ethnic groups in Gansu Province, China.

    PubMed

    Xu, Bai-Cheng; Bian, Pan-Pan; Liu, Xiao-Wen; Zhu, Yi-Ming; Yang, Xiao-Long; Ma, Jian-Li; Chen, Xing-Jian; Wang, Yan-Li; Guo, Yu-Fen

    2014-09-01

    The GJB2 gene mutation characteristic of Dongxiang was the interaction result of ethnic background and geographical environment, and Yugur exhibited the typical founder effect. The SLC26A4 gene mutation characteristic of Dongxiang was related to caucasian backgrounds and selection of purpose exons, i.e. ethnic background and the penetrance of ethnic specificity caused the low mtDNA1555A>G mutation frequency in Dongxiang. To determine the prevalence of GJB2 and SLC26A4 genes and mtDNA1555A>G mutations and analyze the ethnic specificity in the non-syndromic sensorineural hearing loss (NSHL) of unique ethnic groups in Gansu Province. Peripheral blood samples were obtained from Dongxiang, Yugur, Bonan, and ethnic Han groups with moderately severe to profound NSHL in Gansu Province. Bidirectional sequencing (or enzyme digestion) was applied to identify the sequence variations. The pathogenic allele frequency of the three gene mutations was different. The frequency of the GJB2 gene among the Dongxiang, Yugur, Bonan, and ethnic Han groups was 9.03%, 12.5%, 5.88%, and 12.17%, respectively. No difference was found between the ethnic groups. The frequencies of the SLC26A4 genes were 3.23%, 8.33%, 0%, and 9.81%, respectively. The mutation frequency of mtDNA1555A>G was 0%, 0%, 0%, and 6.03%, respectively. No difference was found between the ethnic groups, except for the Dongxiang and ethnic Han groups, both in SLC26A4 gene and mtDNA1555A>G.

  7. Assessment of fecal pollution sources in a small northern-plains watershed using PCR and phylogenetic analyses of Bacteroidetes 16S rRNA gene

    USGS Publications Warehouse

    Lamendella, R.; Domingo, J.W.S.; Oerther, D.B.; Vogel, J.R.; Stoeckel, D.M.

    2007-01-01

    We evaluated the efficacy, sensitivity, host-specificity, and spatial/temporal dynamics of human- and ruminant-specific 16S rRNA gene Bacteroidetes markers used to assess the sources of fecal pollution in a fecally impacted watershed. Phylogenetic analyses of 1271 fecal and environmental 16S rRNA gene clones were also performed to study the diversity of Bacteroidetes in this watershed. The host-specific assays indicated that ruminant feces were present in 28-54% of the water samples and in all sampling seasons, with increasing frequency in downstream sites. The human-targeted assays indicated that only 3-5% of the water samples were positive for human fecal signals, although a higher percentage of human-associated signals (19-24%) were detected in sediment samples. Phylogenetic analysis indicated that 57% of all water clones clustered with yet-to-be-cultured Bacteroidetes species associated with sequences obtained from ruminant feces, further supporting the prevalence of ruminant contamination in this watershed. However, since several clusters contained sequences from multiple sources, future studies need to consider the potential cosmopolitan nature of these bacterial populations when assessing fecal pollution sources using Bacteroidetes markers. Moreover, additional data is needed in order to understand the distribution of Bacteroidetes host-specific markers and their relationship to water quality regulatory standards. ?? 2006 Federation of European Microbiological Societies.

  8. Primer and platform effects on 16S rRNA tag sequencing

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tremblay, Julien; Singh, Kanwar; Fern, Alison

    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

  9. Primer and platform effects on 16S rRNA tag sequencing

    DOE PAGES

    Tremblay, Julien; Singh, Kanwar; Fern, Alison; ...

    2015-08-04

    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

  10. Microbial Diversity in Commercial Bee Pollen from Europe, Chile, and Mexico, Based on 16S rRNA Gene Amplicon Metagenome Sequencing

    PubMed Central

    Moreno Andrade, Vicente D.; Saldaña Gutiérrez, Carlos; Calvillo Medina, Rosa P.; Cruz Hérnandez, Andrés; Vázquez Cruz, Moisés A.; Torres Ruíz, Alfonso; Romero Gómez, Sergio; Ramos López, Miguel A.; Álvarez-Hidalgo, Erika; López-Gaytan, Silvia B.; Ramírez, Natanahel Salvador; Jones, George H.

    2018-01-01

    ABSTRACT Bee pollen is a highly nutritive natural foodstuff. Because of its use as a comestible, the association of bacteria with bee pollen is commercially and biologically important. We report here the bacterial diversity of seven bee pollen samples (five from Europe, one from Chile, and one from Mexico) based on 16S rRNA gene amplicon metagenome sequencing. PMID:29773615

  11. Evaluation of 16S rRNA amplicon sequencing using two next-generation sequencing technologies for phylogenetic analysis of the rumen bacterial community in steers

    USDA-ARS?s Scientific Manuscript database

    Next generation sequencing technologies have vastly changed the approach of sequencing of the 16S rRNA gene for studies in microbial ecology. Three distinct technologies are available for large-scale 16S sequencing. All three are subject to biases introduced by sequencing error rates, amplificatio...

  12. Metagenomic and near full-length 16S rRNA sequence data in support of the phylogenetic analysis of the rumen bacterial community in steers

    USDA-ARS?s Scientific Manuscript database

    Next generation sequencing technologies have vastly changed the approach of sequencing of the 16S rRNA gene for studies in microbial ecology. Three distinct technologies are available for large-scale 16S sequencing. All three are subject to biases introduced by sequencing error rates, amplificatio...

  13. The Structural Basis of Oncogenic Mutations G12, G13 and Q61 in Small GTPase K-Ras4B

    NASA Astrophysics Data System (ADS)

    Lu, Shaoyong; Jang, Hyunbum; Nussinov, Ruth; Zhang, Jian

    2016-02-01

    Ras mediates cell proliferation, survival and differentiation. Mutations in K-Ras4B are predominant at residues G12, G13 and Q61. Even though all impair GAP-assisted GTP → GDP hydrolysis, the mutation frequencies of K-Ras4B in human cancers vary. Here we aim to figure out their mechanisms and differential oncogenicity. In total, we performed 6.4 μs molecular dynamics simulations on the wild-type K-Ras4B (K-Ras4BWT-GTP/GDP) catalytic domain, the K-Ras4BWT-GTP-GAP complex, and the mutants (K-Ras4BG12C/G12D/G12V-GTP/GDP, K-Ras4BG13D-GTP/GDP, K-Ras4BQ61H-GTP/GDP) and their complexes with GAP. In addition, we simulated ‘exchanged’ nucleotide states. These comprehensive simulations reveal that in solution K-Ras4BWT-GTP exists in two, active and inactive, conformations. Oncogenic mutations differentially elicit an inactive-to-active conformational transition in K-Ras4B-GTP; in K-Ras4BG12C/G12D-GDP they expose the bound nucleotide which facilitates the GDP-to-GTP exchange. These mechanisms may help elucidate the differential mutational statistics in K-Ras4B-driven cancers. Exchanged nucleotide simulations reveal that the conformational transition is more accessible in the GTP-to-GDP than in the GDP-to-GTP exchange. Importantly, GAP not only donates its R789 arginine finger, but stabilizes the catalytically-competent conformation and pre-organizes catalytic residue Q61; mutations disturb the R789/Q61 organization, impairing GAP-mediated GTP hydrolysis. Together, our simulations help provide a mechanistic explanation of key mutational events in one of the most oncogenic proteins in cancer.

  14. Degradation of a Polyadenylated rRNA Maturation By-Product Involves One of the Three RRP6-Like Proteins in Arabidopsis thaliana▿

    PubMed Central

    Lange, Heike; Holec, Sarah; Cognat, Valérie; Pieuchot, Laurent; Le Ret, Monique; Canaday, Jean; Gagliardi, Dominique

    2008-01-01

    Yeast Rrp6p and its human counterpart, PM/Scl100, are exosome-associated proteins involved in the degradation of aberrant transcripts and processing of precursors to stable RNAs, such as the 5.8S rRNA, snRNAs, and snoRNAs. The activity of yeast Rrp6p is stimulated by the polyadenylation of its RNA substrates. We identified three RRP6-like proteins in Arabidopsis thaliana: AtRRP6L3 is restricted to the cytoplasm, whereas AtRRP6L1 and -2 have different intranuclear localizations. Both nuclear RRP6L proteins are functional, since AtRRP6L1 complements the temperature-sensitive phenotype of a yeast rrp6Δ strain and mutation of AtRRP6L2 leads to accumulation of an rRNA maturation by-product. This by-product corresponds to the excised 5′ part of the 18S-5.8S-25S rRNA precursor and accumulates as a polyadenylated transcript, suggesting that RRP6L2 is involved in poly(A)-mediated RNA degradation in plant nuclei. Interestingly, the rRNA maturation by-product is a substrate of AtRRP6L2 but not of AtRRP6L1. This result and the distinctive subcellular distribution of AtRRP6L1 to -3 indicate a specialization of RRP6-like proteins in Arabidopsis. PMID:18285452

  15. Differentiation of Shewanella putrefaciens and Shewanella alga on the basis of whole-cell protein profiles, ribotyping, phenotypic characterization, and 16S rRNA gene sequence analysis.

    PubMed Central

    Vogel, B F; Jørgensen, K; Christensen, H; Olsen, J E; Gram, L

    1997-01-01

    Seventy-six presumed Shewanella putrefaciens isolates from fish, oil drillings, and clinical specimens, the type strain of Shewanella putrefaciens (ATCC 8071), the type strain of Shewanella alga (IAM 14159), and the type strain of Shewanella hanedai (ATCC 33224) were compared by several typing methods. Numerical analysis of sodium dodecyl sulfate-polyacrylamide gel electrophoresis of whole-cell protein and ribotyping patterns showed that the strains were separated into two distinct clusters with 56% +/- 10% and 40% +/- 14% similarity for whole-cell protein profiling and ribotyping, respectively. One cluster consisted of 26 isolates with 52 to 55 mol% G + C and included 15 human isolates, mostly clinical specimens, 8 isolates from marine waters, and the type strain of S. alga. This homogeneous cluster of mesophilic, halotolerant strains was by all analyses identical to the recently defined species S. alga (U. Simidu et al., Int. J. Syst. Bacteriol, 40:331-336, 1990). Fifty-two typically psychrotolerant strains formed the other, more heterogeneous major cluster, with 43 to 47 mol% G + C. The type strain of S. putrefaciens was included in this group. The two groups were confirmed by 16S rRNA gene sequence analysis. It is concluded that the isolates must be considered two different species, S. alga and S. putrefaciens, and that most mesophilic isolates formerly identified as S. putrefaciens belong to S. alga. The ecological role and potential pathogenicity of S. alga can be evaluated only if the organism is correctly identified. PMID:9172338

  16. Phylogenetic Analysis of Pasteuria penetrans by 16S rRNA Gene Cloning and Sequencing.

    PubMed

    Anderson, J M; Preston, J F; Dickson, D W; Hewlett, T E; Williams, N H; Maruniak, J E

    1999-09-01

    Pasteuria penetrans is an endospore-forming bacterial parasite of Meloidogyne spp. This organism is among the most promising agents for the biological control of root-knot nematodes. In order to establish the phylogenetic position of this species relative to other endospore-forming bacteria, the 16S ribosomal genes from two isolates of P. penetrans, P-20, which preferentially infects M. arenaria race 1, and P-100, which preferentially infects M. incognita and M. javanica, were PCR-amplified from a purified endospore extraction. Universal primers for the 16S rRNA gene were used to amplify DNA which was cloned, and a nucleotide sequence was obtained for 92% of the gene (1,390 base pairs) encoding the 16S rDNA from each isolate. Comparison of both isolates showed identical sequences that were compared to 16S rDNA sequences of 30 other endospore-forming bacteria obtained from GenBank. Parsimony analyses indicated that P. penetrans is a species within a clade that includes Alicyclobacillus acidocaldarius, A. cycloheptanicus, Sulfobacillus sp., Bacillus tusciae, B. schlegelii, and P. ramosa. Its closest neighbor is P. ramosa, a parasite of Daphnia spp. (water fleas). This study provided a genomic basis for the relationship of species assigned to the genus Pasteuria, and for comparison of species that are parasites of different phytopathogenic nematodes.

  17. Identification of virulence factors in 16S-23S rRNA intergenic spacer genotyped Staphylococcus aureus isolated from water buffaloes and small ruminants.

    PubMed

    Cremonesi, P; Zottola, T; Locatelli, C; Pollera, C; Castiglioni, B; Scaccabarozzi, L; Moroni, P

    2013-01-01

    Staphylococcus aureus is an important human and animal pathogen, and is regarded as an important cause of intramammary infection (IMI) in ruminants. Staphylococcus aureus genetic variability and virulence factors have been well studied in veterinary medicine, especially in cows as support for control and management of IMI. The aim of the present study was to genotype 71 Staph. aureus isolates from the bulk tank and foremilk of water buffaloes (n=40) and from udder tissue (n=7) and foremilk (n=24) from small ruminants. The method used was previously applied to bovine Staph. aureus and is based on the amplification of the 16S-23S rRNA intergenic spacer region. The technique applied was able to identify different Staph. aureus genotypes isolated from dairy species other than the bovine species, and cluster the genotypes according to species and herds. Virulence gene distribution was consistent with genotype differentiation. The isolates were also characterized through determination of the presence of 19 virulence-associated genes by specific PCR. Enterotoxins A, C, D, G, I, J, and L were associated with Staph. aureus isolates from buffaloes, whereas enterotoxins C and L were linked to small ruminants. Genes coding for methicillin resistance, Panton-Valentine leukocidin, exfoliative toxins A and B, and enterotoxins B, E, and H were undetected. These findings indicate that RNA template-specific PCR is a valid technique for typing Staph. aureus from buffaloes and small ruminants and is a useful tool for understanding udder infection epidemiology. Copyright © 2013 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  18. Detection and characterization of a dehalogenating microorganism by terminal restriction fragment length polymorphism fingerprinting of 16S rRNA in a sulfidogenic, 2-bromophenol-utilizing enrichment.

    PubMed

    Fennell, Donna E; Rhee, Sung-Keun; Ahn, Young-Beom; Häggblom, Max M; Kerkhof, Lee J

    2004-02-01

    Terminal restriction fragment length polymorphism analysis of reverse-transcribed 16S rRNA during periods of community flux was used as a tool to delineate the roles of the members of a 2-bromophenol-degrading, sulfate-reducing consortium. Starved, washed cultures were amended with 2-bromophenol plus sulfate, 2-bromophenol plus hydrogen, phenol plus sulfate, or phenol with no electron acceptor and were monitored for substrate use. In the presence of sulfate, 2-bromophenol and phenol were completely degraded. In the absence of sulfate, 2-bromophenol was dehalogenated and phenol accumulated. Direct terminal restriction fragment length polymorphism fingerprinting of the 16S rRNA in the various subcultures indicated that phylotype 2BP-48 (a Desulfovibrio-like sequence) was responsible for the dehalogenation of 2-bromophenol. A stable coculture was established which contained predominantly 2BP-48 and a second Desulfovibrio-like bacterium (designated BP212 based on terminal restriction fragment length polymorphism fingerprinting) that was capable of dehalogenating 2-bromophenol to phenol. Strain 2BP-48 in the coculture could couple reductive dehalogenation to growth with 2-bromophenol, 2,6-dibromophenol, or 2-iodophenol and lactate or formate as the electron donor. In addition to halophenols, strain 2BP-48 appears to use sulfate, sulfite, and thiosulfate as electron acceptors and is capable of simultaneous sulfidogenesis and reductive dehalogenation in the presence of sulfate.

  19. Detection and Characterization of a Dehalogenating Microorganism by Terminal Restriction Fragment Length Polymorphism Fingerprinting of 16S rRNA in a Sulfidogenic, 2-Bromophenol-Utilizing Enrichment

    PubMed Central

    Fennell, Donna E.; Rhee, Sung-Keun; Ahn, Young-Beom; Häggblom, Max M.; Kerkhof, Lee J.

    2004-01-01

    Terminal restriction fragment length polymorphism analysis of reverse-transcribed 16S rRNA during periods of community flux was used as a tool to delineate the roles of the members of a 2-bromophenol-degrading, sulfate-reducing consortium. Starved, washed cultures were amended with 2-bromophenol plus sulfate, 2-bromophenol plus hydrogen, phenol plus sulfate, or phenol with no electron acceptor and were monitored for substrate use. In the presence of sulfate, 2-bromophenol and phenol were completely degraded. In the absence of sulfate, 2-bromophenol was dehalogenated and phenol accumulated. Direct terminal restriction fragment length polymorphism fingerprinting of the 16S rRNA in the various subcultures indicated that phylotype 2BP-48 (a Desulfovibrio-like sequence) was responsible for the dehalogenation of 2-bromophenol. A stable coculture was established which contained predominantly 2BP-48 and a second Desulfovibrio-like bacterium (designated BP212 based on terminal restriction fragment length polymorphism fingerprinting) that was capable of dehalogenating 2-bromophenol to phenol. Strain 2BP-48 in the coculture could couple reductive dehalogenation to growth with 2-bromophenol, 2,6-dibromophenol, or 2-iodophenol and lactate or formate as the electron donor. In addition to halophenols, strain 2BP-48 appears to use sulfate, sulfite, and thiosulfate as electron acceptors and is capable of simultaneous sulfidogenesis and reductive dehalogenation in the presence of sulfate. PMID:14766602

  20. Denitrification potential of the eastern oyster microbiome using a 16S rRNA gene based metabolic inference approach

    PubMed Central

    Bowman, Jeff S.; Piehler, Michael

    2017-01-01

    The eastern oyster (Crassostrea virginica) is a foundation species providing significant ecosystem services. However, the roles of oyster microbiomes have not been integrated into any of the services, particularly nitrogen removal through denitrification. We investigated the composition and denitrification potential of oyster microbiomes with an approach that combined 16S rRNA gene analysis, metabolic inference, qPCR of the nitrous oxide reductase gene (nosZ), and N2 flux measurements. Microbiomes of the oyster digestive gland, the oyster shell, and sediments adjacent to the oyster reef were examined based on next generation sequencing (NGS) of 16S rRNA gene amplicons. Denitrification potentials of the microbiomes were determined by metabolic inferences using a customized denitrification gene and genome database with the paprica (PAthway PRediction by phylogenetIC plAcement) bioinformatics pipeline. Denitrification genes examined included nitrite reductase (nirS and nirK) and nitrous oxide reductase (nosZ), which was further subdivided by genotype into clade I (nosZI) or clade II (nosZII). Continuous flow through experiments measuring N2 fluxes were conducted with the oysters, shells, and sediments to compare denitrification activities. Paprica properly classified the composition of microbiomes, showing similar classification results from Silva, Greengenes and RDP databases. Microbiomes of the oyster digestive glands and shells were quite different from each other and from the sediments. The relative abundance of denitrifying bacteria inferred by paprica was higher in oysters and shells than in sediments suggesting that oysters act as hotspots for denitrification in the marine environment. Similarly, the inferred nosZI gene abundances were also higher in the oyster and shell microbiomes than in the sediment microbiome. Gene abundances for nosZI were verified with qPCR of nosZI genes, which showed a significant positive correlation (F1,7 = 14.7, p = 6.0x10-3, R2 = 0

  1. Denitrification potential of the eastern oyster microbiome using a 16S rRNA gene based metabolic inference approach.

    PubMed

    Arfken, Ann; Song, Bongkeun; Bowman, Jeff S; Piehler, Michael

    2017-01-01

    The eastern oyster (Crassostrea virginica) is a foundation species providing significant ecosystem services. However, the roles of oyster microbiomes have not been integrated into any of the services, particularly nitrogen removal through denitrification. We investigated the composition and denitrification potential of oyster microbiomes with an approach that combined 16S rRNA gene analysis, metabolic inference, qPCR of the nitrous oxide reductase gene (nosZ), and N2 flux measurements. Microbiomes of the oyster digestive gland, the oyster shell, and sediments adjacent to the oyster reef were examined based on next generation sequencing (NGS) of 16S rRNA gene amplicons. Denitrification potentials of the microbiomes were determined by metabolic inferences using a customized denitrification gene and genome database with the paprica (PAthway PRediction by phylogenetIC plAcement) bioinformatics pipeline. Denitrification genes examined included nitrite reductase (nirS and nirK) and nitrous oxide reductase (nosZ), which was further subdivided by genotype into clade I (nosZI) or clade II (nosZII). Continuous flow through experiments measuring N2 fluxes were conducted with the oysters, shells, and sediments to compare denitrification activities. Paprica properly classified the composition of microbiomes, showing similar classification results from Silva, Greengenes and RDP databases. Microbiomes of the oyster digestive glands and shells were quite different from each other and from the sediments. The relative abundance of denitrifying bacteria inferred by paprica was higher in oysters and shells than in sediments suggesting that oysters act as hotspots for denitrification in the marine environment. Similarly, the inferred nosZI gene abundances were also higher in the oyster and shell microbiomes than in the sediment microbiome. Gene abundances for nosZI were verified with qPCR of nosZI genes, which showed a significant positive correlation (F1,7 = 14.7, p = 6.0x10-3, R2 = 0

  2. Nop9 is a PUF-like protein that prevents premature cleavage to correctly process pre-18S rRNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Jun; McCann, Kathleen L.; Qiu, Chen

    Numerous factors direct eukaryotic ribosome biogenesis, and defects in a single ribosome assembly factor may be lethal or produce tissue-specific human ribosomopathies. Pre-ribosomal RNAs (pre-rRNAs) must be processed stepwise and at the correct subcellular locations to produce the mature rRNAs. Nop9 is a conserved small ribosomal subunit biogenesis factor, essential in yeast. Here we report a 2.1-Å crystal structure of Nop9 and a small-angle X-ray-scattering model of a Nop9:RNA complex that reveals a ‘C’-shaped fold formed from 11 Pumilio repeats. We show that Nop9 recognizes sequence and structural features of the 20S pre-rRNA near the cleavage site of the nuclease,more » Nob1. We further demonstrate that Nop9 inhibits Nob1 cleavage, the final processing step to produce mature small ribosomal subunit 18S rRNA. Together, our results suggest that Nop9 is critical for timely cleavage of the 20S pre-rRNA. Moreover, the Nop9 structure exemplifies a new class of Pumilio repeat proteins.« less

  3. Potent and Selective Covalent Quinazoline Inhibitors of KRAS G12C

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zeng, Mei; Lu, Jia; Li, Lianbo

    Targeted covalent small molecules have shown promise for cancers driven by KRAS G12C. Allosteric compounds that access an inducible pocket formed by movement of a dynamic structural element in KRAS, switch II, have been reported, but these compounds require further optimization to enable their advancement into clinical development. We demonstrate that covalent quinazoline-based switch II pocket (SIIP) compounds effectively suppress GTP loading of KRAS G12C, MAPK phosphorylation, and the growth of cancer cells harboring G12C. Notably we find that adding an amide substituent to the quinazoline scaffold allows additional interactions with KRAS G12C, and remarkably increases the labeling efficiency, potency,more » and selectivity of KRAS G12C inhibitors. Structural studies using X-ray crystallography reveal a new conformation of SIIP and key interactions made by substituents located at the quinazoline 2-, 4-, and 7-positions. Optimized lead compounds in the quinazoline series selectively inhibit KRAS G12C-dependent signaling and cancer cell growth at sub-micromolar concentrations.« less

  4. 16S rRNA Gene Sequence Analysis of Drinking Water Using RNA and DNA Extracts as Targets for Clone Library Development - Poster

    EPA Science Inventory

    We examined the bacterial composition of chlorinated drinking water using 16S rRNA gene clone libraries derived from RNA and DNA extracted from twelve water samples collected in three different months (June, August, and September of 2007). Phylogenetic analysis of 1234 and 1117 ...

  5. Effect of Field Inoculation with Sinorhizobium meliloti L33 on the Composition of Bacterial Communities in Rhizospheres of a Target Plant (Medicago sativa) and a Non-Target Plant (Chenopodium album)—Linking of 16S rRNA Gene-Based Single-Strand Conformation Polymorphism Community Profiles to the Diversity of Cultivated Bacteria

    PubMed Central

    Schwieger, Frank; Tebbe, Christoph C.

    2000-01-01

    Fourteen weeks after field release of luciferase gene-tagged Sinorhizobium meliloti L33 in field plots seeded with Medicago sativa, we found that the inoculant also occurred in bulk soil from noninoculated control plots. In rhizospheres of M. sativa plants, S. meliloti L33 could be detected in noninoculated plots 12 weeks after inoculation, indicating that growth in the rhizosphere preceded spread into bulk soil. To determine whether inoculation affected bacterial diversity, 1,119 bacteria were isolated from the rhizospheres of M. sativa and Chenopodium album, which was the dominant weed in the field plots. Amplified ribosomal DNA restriction analysis (ARDRA) revealed plant-specific fragment size frequencies. Dominant ARDRA groups were identified by 16S rRNA gene nucleotide sequencing. Database comparisons indicated that the rhizospheres contained members of the Proteobacteria (α, β, and γ subgroups), members of the Cytophaga-Flavobacterium group, and gram-positive bacteria with high G+C DNA contents. The levels of many groups were affected by the plant species and, in the case of M. sativa, by inoculation. The most abundant isolates were related to Variovorax sp., Arthrobacter ramosus, and Acinetobacter calcoaceticus. In the rhizosphere of M. sativa, inoculation reduced the numbers of cells of A. calcoaceticus and members of the genus Pseudomonas and increased the number of rhizobia. Cultivation-independent PCR–single-strand conformation polymorphism (SSCP) profiles of a 16S rRNA gene region confirmed the existence of plant-specific rhizosphere communities and the effect of the inoculant. All dominant ARDRA groups except Variovorax species could be detected. On the other hand, the SSCP profiles revealed products which could not be assigned to the dominant cultured isolates, indicating that the bacterial diversity was greater than the diversity suggested by cultivation. PMID:10919821

  6. Seasonal and regional diversity of maple sap microbiota revealed using community PCR fingerprinting and 16S rRNA gene clone libraries.

    PubMed

    Filteau, Marie; Lagacé, Luc; LaPointe, Gisèle; Roy, Denis

    2010-04-01

    An arbitrary primed community PCR fingerprinting technique based on capillary electrophoresis was developed to study maple sap microbial community characteristics among 19 production sites in Québec over the tapping season. Presumptive fragment identification was made with corresponding fingerprint profiles of bacterial isolate cultures. Maple sap microbial communities were subsequently compared using a representative subset of 13 16S rRNA gene clone libraries followed by gene sequence analysis. Results from both methods indicated that all maple sap production sites and flow periods shared common microbiota members, but distinctive features also existed. Changes over the season in relative abundance of predominant populations showed evidence of a common pattern. Pseudomonas (64%) and Rahnella (8%) were the most abundantly and frequently represented genera of the 2239 sequences analyzed. Janthinobacterium, Leuconostoc, Lactococcus, Weissella, Epilithonimonas and Sphingomonas were revealed as occasional contaminants in maple sap. Maple sap microbiota showed a low level of deep diversity along with a high variation of similar 16S rRNA gene sequences within the Pseudomonas genus. Predominance of Pseudomonas is suggested as a typical feature of maple sap microbiota across geographical regions, production sites, and sap flow periods.

  7. Prokaryotic community profiling of local algae wastewaters using advanced 16S rRNA gene sequencing.

    PubMed

    Limayem, Alya; Micciche, Andrew; Nayak, Bina; Mohapatra, Shyam

    2018-01-01

    Algae biomass-fed wastewaters are a promising source of lipid and bioenergy manufacture, revealing substantial end-product investment returns. However, wastewaters would contain lytic pathogens carrying drug resistance detrimental to algae yield and environmental safety. This study was conducted to simultaneously decipher through high-throughput advanced Illumina 16S ribosomal RNA (rRNA) gene sequencing, the cultivable and uncultivable bacterial community profile found in a single sample that was directly recovered from the local wastewater systems. Samples were collected from two previously documented sources including anaerobically digested (AD) municipal wastewater and swine wastewater with algae namely Chlorella spp. in addition to control samples, swine wastewater, and municipal wastewater without algae. Results indicated the presence of a significant level of Bacteria in all samples with an average of approximately 95.49% followed by Archaea 2.34%, in local wastewaters designed for algae cultivation. Taxonomic genus identification indicated the presence of Calothrix, Pseudomonas, and Clostridium as the most prevalent strains in both local municipal and swine wastewater samples containing algae with an average of 17.37, 12.19, and 7.84%, respectively. Interestingly, swine wastewater without algae displayed the lowest level of Pseudomonas strains < 0.1%. The abundance of some Pseudomonas species in wastewaters containing algae indicates potential coexistence between these strains and algae microenvironment, suggesting further investigations. This finding was particularly relevant for the earlier documented adverse effects of some nosocomial Pseudomonas strains on algae growth and their multidrug resistance potential, requiring the development of targeted bioremediation with regard to the beneficial flora.

  8. Multiplex sequence analysis demonstrates the competitive growth advantage of the A-to-G mutants of clarithromycin-resistant Helicobacter pylori.

    PubMed

    Wang, G; Rahman, M S; Humayun, M Z; Taylor, D E

    1999-03-01

    Clarithromycin resistance in Helicobacter pylori is due to point mutation within the 23S rRNA. We examined the growth rates of different types of site-directed mutants and demonstrated quantitatively the competitive growth advantage of A-to-G mutants over other types of mutants by a multiplex sequencing assay. The results provide a rational explanation of why A-to-G mutants are predominantly observed among clarithromycin-resistant clinical isolates.

  9. Investigation of Microbial Diversity in Geothermal Hot Springs in Unkeshwar, India, Based on 16S rRNA Amplicon Metagenome Sequencing.

    PubMed

    Mehetre, Gajanan T; Paranjpe, Aditi; Dastager, Syed G; Dharne, Mahesh S

    2016-02-25

    Microbial diversity in geothermal waters of the Unkeshwar hot springs in Maharashtra, India, was studied using 16S rRNA amplicon metagenomic sequencing. Taxonomic analysis revealed the presence of Bacteroidetes, Proteobacteria, Cyanobacteria, Actinobacteria, Archeae, and OD1 phyla. Metabolic function prediction analysis indicated a battery of biological information systems indicating rich and novel microbial diversity, with potential biotechnological applications in this niche. Copyright © 2016 Mehetre et al.

  10. Elucidating the 16S rRNA 3' boundaries and defining optimal SD/aSD pairing in Escherichia coli and Bacillus subtilis using RNA-Seq data.

    PubMed

    Wei, Yulong; Silke, Jordan R; Xia, Xuhua

    2017-12-15

    Bacterial translation initiation is influenced by base pairing between the Shine-Dalgarno (SD) sequence in the 5' UTR of mRNA and the anti-SD (aSD) sequence at the free 3' end of the 16S rRNA (3' TAIL) due to: 1) the SD/aSD sequence binding location and 2) SD/aSD binding affinity. In order to understand what makes an SD/aSD interaction optimal, we must define: 1) terminus of the 3' TAIL and 2) extent of the core aSD sequence within the 3' TAIL. Our approach to characterize these components in Escherichia coli and Bacillus subtilis involves 1) mapping the 3' boundary of the mature 16S rRNA using high-throughput RNA sequencing (RNA-Seq), and 2) identifying the segment within the 3' TAIL that is strongly preferred in SD/aSD pairing. Using RNA-Seq data, we resolve previous discrepancies in the reported 3' TAIL in B. subtilis and recovered the established 3' TAIL in E. coli. Furthermore, we extend previous studies to suggest that both highly and lowly expressed genes favor SD sequences with intermediate binding affinity, but this trend is exclusive to SD sequences that complement the core aSD sequences defined herein.

  11. Partial 16S rRNA primary structure of five Actinomyces species: phylogenetic implications and development of an Actinomyces israelii-specific oligonucleotide probe.

    PubMed

    Stackebrandt, E; Charfreitag, O

    1990-01-01

    The intra- and intergeneric relationships of the genus Actinomyces were determined by comparing long 16S rRNA sequences, generated by reverse transcriptase. All species formed a phylogenetically coherent cluster in which Actinomyces bovis, A. viscosus, A. naeslundii, A. odontolyticus and A. israelii constituted genetically well defined species. A. israelii DSM 43322 (serotype 2) was not closely related to three other strains of this species (serotype 1) and, as judged from phylogenetic distances, could be accommodated within A. naeslundii, or represent a new species. In contrast to previous findings, members of the genus Actinomyces appear to be related to Bifidobacterium bifidum. Sequence information was used to develop an oligonucleotide probe for the A. israelii serotype 1 strains, which did not react with the serotype 2 strain or with rRNA from strains of eight Actinomyces species.

  12. Infective Endocarditis: Identification of Catalase-Negative, Gram-Positive Cocci from Blood Cultures by Partial 16S rRNA Gene Analysis and by Vitek 2 Examination.

    PubMed

    Abdul-Redha, Rawaa Jalil; Kemp, Michael; Bangsborg, Jette M; Arpi, Magnus; Christensen, Jens Jørgen

    2010-01-01

    Streptococci, enterococci and Streptococcus-like bacteria are frequent etiologic agents of infective endocarditis and correct species identification can be a laboratory challenge. Viridans streptococci (VS) not seldomly cause contamination of blood cultures. Vitek 2 and partial sequencing of the 16S rRNA gene were applied in order to compare the results of both methods. STRAINS ORIGINATED FROM TWO GROUPS OF PATIENTS: 149 strains from patients with infective endocarditis and 181 strains assessed as blood culture contaminants. Of the 330 strains, based on partial 16S rRNA gene sequencing results, 251 (76%) were VS strains, 10 (3%) were pyogenic streptococcal strains, 54 (16%) were E. faecalis strains and 15 (5%) strains belonged to a group of miscellaneous catalase-negative, Gram-positive cocci. Among VS strains, respectively, 220 (87,6%) and 31 (12,3%) obtained agreeing and non-agreeing identifications with the two methods with respect to allocation to the same VS group. Non-agreeing species identification mostly occurred among strains in the contaminant group, while for endocarditis strains notably fewer disagreeing results were observed.Only 67 of 150 strains in the mitis group strains obtained identical species identifications by the two methods. Most VS strains belonging to the groups of salivarius, anginosus, and mutans obtained agreeing species identifications with the two methods, while this only was the case for 13 of the 21 bovis strains. Pyogenic strains (n=10), Enterococcus faecalis strains (n=54) and a miscellaneous group of catalase-negative, Gram-positive cocci (n=15) seemed well identified by both methods, except that disagreements in identifications in the miscellaneous group of strains occurred for 6 of 15 strains.

  13. Nucleolar Targeting by Platinum: p53-Independent Apoptosis Follows rRNA Inhibition, Cell-Cycle Arrest, and DNA Compaction

    PubMed Central

    2015-01-01

    TriplatinNC is a highly positively charged, substitution-inert derivative of the phase II clinical anticancer drug, BBR3464. Such substitution-inert complexes form a distinct subset of polynuclear platinum complexes (PPCs) interacting with DNA and other biomolecules through noncovalent interactions. Rapid cellular entry is facilitated via interaction with cell surface glycosoaminoglycans and is a mechanism unique to PPCs. Nanoscale secondary ion mass spectrometry (nanoSIMS) showed rapid distribution within cytoplasmic and nucleolar compartments, but not the nucleus. In this article, the downstream effects of nucleolar localization are described. In human colon carcinoma cells, HCT116, the production rate of 47S rRNA precursor transcripts was dramatically reduced as an early event after drug treatment. Transcriptional inhibition of rRNA was followed by a robust G1 arrest, and activation of apoptotic proteins caspase-8, -9, and -3 and PARP-1 in a p53-independent manner. Using cell synchronization and flow cytometry, it was determined that cells treated while in G1 arrest immediately, but cells treated in S or G2 successfully complete mitosis. Twenty-four hours after treatment, the majority of cells finally arrest in G1, but nearly one-third contained highly compacted DNA; a distinct biological feature that cannot be associated with mitosis, senescence, or apoptosis. This unique effect mirrored the efficient condensation of tRNA and DNA in cell-free systems. The combination of DNA compaction and apoptosis by TriplatinNC treatment conferred striking activity in platinum-resistant and/or p53 mutant or null cell lines. Taken together, our results support that the biological activity of TriplatinNC reflects reduced metabolic deactivation (substitution-inert compound not reactive to sulfur nucleophiles), high cellular accumulation, and novel consequences of high-affinity noncovalent DNA binding, producing a new profile and a further shift in the structure

  14. La Deletion from Mouse Brain Alters Pre-tRNA Metabolism and Accumulation of Pre-5.8S rRNA, with Neuron Death and Reactive Astrocytosis

    PubMed Central

    Blewett, Nathan H.; Iben, James R.; Gaidamakov, Sergei

    2017-01-01

    ABSTRACT Human La antigen (Sjögren's syndrome antigen B [SSB]) is an abundant multifunctional RNA-binding protein. In the nucleoplasm, La binds to and protects from 3′ exonucleases, the ends of precursor tRNAs, and other transcripts synthesized by RNA polymerase III and facilitates their maturation, while a nucleolar isoform has been implicated in rRNA biogenesis by multiple independent lines of evidence. We showed previously that conditional La knockout (La cKO) from mouse cortex neurons results in defective tRNA processing, although the pathway(s) involved in neuronal loss thereafter was unknown. Here, we demonstrate that La is stably associated with a spliced pre-tRNA intermediate. Microscopic evidence of aberrant nuclear accumulation of 5.8S rRNA in La cKO is supported by a 10-fold increase in a pre-5.8S rRNA intermediate. To identify pathways involved in subsequent neurodegeneration and loss of brain mass in the cKO cortex, we employed mRNA sequencing (mRNA-Seq), immunohistochemistry, and other approaches. This revealed robust enrichment of immune and astrocyte reactivity in La cKO cortex. Immunohistochemistry, including temporal analyses, demonstrated neurodegeneration, followed by astrocyte invasion associated with immune response and decreasing cKO cortex size over time. Thus, deletion of La from postmitotic neurons results in defective pre-tRNA and pre-rRNA processing and progressive neurodegeneration with loss of cortical brain mass. PMID:28223366

  15. Microbial Diversity in Commercial Bee Pollen from Europe, Chile, and Mexico, Based on 16S rRNA Gene Amplicon Metagenome Sequencing.

    PubMed

    Moreno Andrade, Vicente D; Saldaña Gutiérrez, Carlos; Calvillo Medina, Rosa P; Cruz Hérnandez, Andrés; Vázquez Cruz, Moisés A; Torres Ruíz, Alfonso; Romero Gómez, Sergio; Ramos López, Miguel A; Álvarez-Hidalgo, Erika; López-Gaytan, Silvia B; Ramírez, Natanahel Salvador; Jones, George H; Hernandez-Flores, Jose Luis; Campos-Guillén, Juan

    2018-05-17

    Bee pollen is a highly nutritive natural foodstuff. Because of its use as a comestible, the association of bacteria with bee pollen is commercially and biologically important. We report here the bacterial diversity of seven bee pollen samples (five from Europe, one from Chile, and one from Mexico) based on 16S rRNA gene amplicon metagenome sequencing. Copyright © 2018 Moreno Andrade et al.

  16. Evolution of green plants as deduced from 5S rRNA sequences.

    PubMed

    Hori, H; Lim, B L; Osawa, S

    1985-02-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other.

  17. Evolution of green plants as deduced from 5S rRNA sequences

    PubMed Central

    Hori, Hiroshi; Lim, Byung-Lak; Osawa, Syozo

    1985-01-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other. PMID:16593540

  18. Sequence heterogeneity in the 18S rRNA gene in Theileria equi from horses presented in Switzerland.

    PubMed

    Liu, Qin; Meli, Marina L; Zhang, Yi; Meili, Theres; Stirn, Martina; Riond, Barbara; Weibel, Beatrice; Hofmann-Lehmann, Regina

    2016-05-15

    A reverse line blot (RLB) hybridization assay was adapted and applied for equine blood samples collected at the animal hospital of the University of Zurich to determine the presence of piroplasms in horses in Switzerland. A total of 100 equine blood samples were included in the study. The V4 hypervariable region of the 18S rRNA gene was amplified by polymerase chain reaction and analyzed using the RLB assay. Samples from seven horses hybridized to a Theileria/Babesia genus-specific and a Theileria genus-specific probe. Of these, two hybridized also to the Theileria equi-specific probe. The other five positive samples did not hybridize to any of the species-specific probes, suggesting the presence of unrecognized Theileria variants or genotypes. The 18S rRNA gene of the latter five samples were sequenced and found to be closely related to T. equi isolated from horses in Spain (AY534822) and China (KF559357) (≥98.4% identity). Four of the seven horses that tested positive had a documented travel history (France, Italy, and Spain) or lived abroad (Hungary). The present study adds new insight into the presence and sequence heterogeneity of T. equi in Switzerland. The results prompt that species-specific probes must be designed in regions of the gene unique to T. equi. Of note, none of the seven positive horses were suspected of having Theileria infection at the time of presentation to the clinic. Clinicians should be aware of the possibility of equine piroplasma infections outside of endemic areas and in horses without signs of piroplasmosis. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Identification by 16S rRNA Gene Sequencing of Lactobacillus salivarius Bacteremic Cholecystitis

    PubMed Central

    Woo, Patrick C. Y.; Fung, Ami M. Y.; Lau, Susanna K. P.; Yuen, Kwok-Yung

    2002-01-01

    An anaerobic, nonsporulating, gram-positive bacterium was isolated from blood and bile pus cultures of a 70-year-old man with bacteremic acute cholecystitis. The API 20A system showed that it was 70% Actinomyces naeslundii and 30% Bifidobacterium species, whereas the Vitek ANI system and the ATB ID32A Expression system showed that it was “unidentified.” The 16S rRNA gene of the strain was amplified and sequenced. There were 3 base differences between the nucleotide sequence of the isolate and that of Lactobacillus salivarius subsp. salivarius or L. salivarius subsp. salicinius, indicating that the isolate was a strain of L. salivarius. The patient responded to cholecystectomy and a 2-week course of antibiotic treatment. Identification of the organism in the present study was important because the duration of antibiotic therapy would have been entirely different depending on the organism. If the bacterium had been identified as Actinomyces, penicillin for 6 months would have been the regimen of choice. However, it was Lactobacillus, and a 2-week course of antibiotic was sufficient. PMID:11773128

  20. 12 CFR Appendix G to Part 225 - [Reserved

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 12 Banks and Banking 3 2014-01-01 2014-01-01 false [Reserved] G Appendix G to Part 225 Banks and Banking FEDERAL RESERVE SYSTEM (CONTINUED) BOARD OF GOVERNORS OF THE FEDERAL RESERVE SYSTEM (CONTINUED) BANK HOLDING COMPANIES AND CHANGE IN BANK CONTROL (REGULATION Y) Appendix G to Part 225 [Reserved] ...

  1. Seasonal diversity of planktonic protists in Southwestern Alberta rivers over a 1-year period as revealed by terminal restriction fragment length polymorphism and 18S rRNA gene library analyses.

    PubMed

    Thomas, Matthew C; Selinger, L Brent; Inglis, G Douglas

    2012-08-01

    The temporal dynamics of planktonic protists in river water have received limited attention despite their ecological significance and recent studies linking phagotrophic protists to the persistence of human-pathogenic bacteria. Using molecular-based techniques targeting the 18S rRNA gene, we studied the seasonal diversity of planktonic protists in Southwestern Alberta rivers (Oldman River Basin) over a 1-year period. Nonmetric multidimensional scaling analysis of terminal restriction fragment length polymorphism (T-RFLP) data revealed distinct shifts in protistan community profiles that corresponded to season rather than geographical location. Community structures were examined by using clone library analysis; HaeIII restriction profiles of 18S rRNA gene amplicons were used to remove prevalent solanaceous plant clones prior to sequencing. Sanger sequencing of the V1-to-V3 region of the 18S rRNA gene libraries from spring, summer, fall, and winter supported the T-RFLP results and showed marked seasonal differences in the protistan community structure. The spring library was dominated by Chloroplastidae (29.8%), Centrohelida (28.1%), and Alveolata (25.5%), while the summer and fall libraries contained primarily fungal clones (83.0% and 88.0%, respectively). Alveolata (35.6%), Euglenozoa (24.4%), Chloroplastida (15.6%), and Fungi (15.6%) dominated the winter library. These data demonstrate that planktonic protists, including protozoa, are abundant in river water in Southwestern Alberta and that conspicuous seasonal shifts occur in the community structure.

  2. Seasonal Diversity of Planktonic Protists in Southwestern Alberta Rivers over a 1-Year Period as Revealed by Terminal Restriction Fragment Length Polymorphism and 18S rRNA Gene Library Analyses

    PubMed Central

    Thomas, Matthew C.; Selinger, L. Brent

    2012-01-01

    The temporal dynamics of planktonic protists in river water have received limited attention despite their ecological significance and recent studies linking phagotrophic protists to the persistence of human-pathogenic bacteria. Using molecular-based techniques targeting the 18S rRNA gene, we studied the seasonal diversity of planktonic protists in Southwestern Alberta rivers (Oldman River Basin) over a 1-year period. Nonmetric multidimensional scaling analysis of terminal restriction fragment length polymorphism (T-RFLP) data revealed distinct shifts in protistan community profiles that corresponded to season rather than geographical location. Community structures were examined by using clone library analysis; HaeIII restriction profiles of 18S rRNA gene amplicons were used to remove prevalent solanaceous plant clones prior to sequencing. Sanger sequencing of the V1-to-V3 region of the 18S rRNA gene libraries from spring, summer, fall, and winter supported the T-RFLP results and showed marked seasonal differences in the protistan community structure. The spring library was dominated by Chloroplastidae (29.8%), Centrohelida (28.1%), and Alveolata (25.5%), while the summer and fall libraries contained primarily fungal clones (83.0% and 88.0%, respectively). Alveolata (35.6%), Euglenozoa (24.4%), Chloroplastida (15.6%), and Fungi (15.6%) dominated the winter library. These data demonstrate that planktonic protists, including protozoa, are abundant in river water in Southwestern Alberta and that conspicuous seasonal shifts occur in the community structure. PMID:22685143

  3. [Ultrastructural observation on nymphal Armillifer sp. by scanning electron microscopy and phylogenetic analysis based on 18S rRNA].

    PubMed

    Li, Jian; Shi, Yun-Liang; Shi, Wei; Fang, Fang; Zhou, Qing-An; Li, Wen-Wen; He, Guo-Sheng; Huang, Wei-Yi

    2012-04-30

    To observe the ultrastructure of nymphal Armillifer sp. isolated from Macaca fascicularis by using scanning electron microscope (SEM), and analyze the phylogenetic relationships based on 18S rRNA gene sequences. The parasite samples stored in 70% alcohol were fixed by glutaraldehyde and osmium peroxide. Ultrastructural characters of those samples were observed under SEM. Amplification and sequencing of the 18S rRNA gene were performed following the extraction of total genome DNA. Sequence analysis was performed based on multiple alignment using ClustalX1.83, while phylogenetic analysis was made by Neighbor-Joining method using MEGA4.0. The nymphs were in cylindrical shape, the body slightly claviform tapering to posterior end. Abdominal annuli were gradually widened from anterior to posterior parts, the 12th-13th abdominal annuli of which were similar in width. The annuli ranged closer in the front half body, whereas in the latter part there were certain gaps between them. The circular-shaped mouth located in the middle of head ventrally. Folds were seen in inner margin of the mouth with a pair of curved hooks on both sides above it which practically disposed in a straight line. Two pairs of large sensory papillae were observed symmetrically over the last thoracic annulus of cephalothoraxs lying below the outer hook, and the first abdominal annulus was near the median ventral line. The number of abdominal annuli was 29, not including 2 incomplete terminal annuli. Rounded sensory papillae were fully distributed on the body surface, except the dorsal side of head and the ventral part of the terminal annulus. Agglomerate-like anus opening was observed at the end of ventral abdominal annuli and distinctly sub-terminal. These morphological features demonstrated that the nymphs were highly similar with that of Armillifer moniliformis Diesing, 1835. A fragment of 18SrRNA gene (1 836 bp) sequences was obtained by PCR combined with sequencing, and was registered to the Gene

  4. NMR structure and Mg2+ binding of an RNA segment that underlies the L7/L12 stalk in the E.coli 50S ribosomal subunit

    PubMed Central

    Zhao, Qin; Nagaswamy, Uma; Lee, Hunjoong; Xia, Youlin; Huang, Hung-Chung; Gao, Xiaolian; Fox, George E.

    2005-01-01

    Helix 42 of Domain II of Escherichia coli 23S ribosomal RNA underlies the L7/L12 stalk in the ribosome and may be significant in positioning this feature relative to the rest of the 50S ribosomal subunit. Unlike the Haloarcula marismortui and Deinococcus radiodurans examples, the lower portion of helix 42 in E.coli contains two consecutive G•A oppositions with both adenines on the same side of the stem. Herein, the structure of an analog of positions 1037–1043 and 1112–1118 in the helix 42 region is reported. NMR spectra and structure calculations support a cis Watson–Crick/Watson–Crick (cis W.C.) G•A conformation for the tandem (G•A)2 in the analog and a minimally perturbed helical duplex stem. Mg2+ titration studies imply that the cis W.C. geometry of the tandem (G•A)2 probably allows O6 of G20 and N1 of A4 to coordinate with a Mg2+ ion as indicated by the largest chemical shift changes associated with the imino group of G20 and the H8 of G20 and A4. A cross-strand bridging Mg2+ coordination has also been found in a different sequence context in the crystal structure of H.marismortui 23S rRNA, and therefore it may be a rare but general motif in Mg2+ coordination. PMID:15939932

  5. Multiplex Sequence Analysis Demonstrates the Competitive Growth Advantage of the A-to-G Mutants of Clarithromycin-Resistant Helicobacter pylori

    PubMed Central

    Wang, Ge; Rahman, M. Sayeedur; Humayun, M. Zafri; Taylor, Diane E.

    1999-01-01

    Clarithromycin resistance in Helicobacter pylori is due to point mutation within the 23S rRNA. We examined the growth rates of different types of site-directed mutants and demonstrated quantitatively the competitive growth advantage of A-to-G mutants over other types of mutants by a multiplex sequencing assay. The results provide a rational explanation of why A-to-G mutants are predominantly observed among clarithromycin-resistant clinical isolates. PMID:10049289

  6. Activation of farnesoid X receptor promotes triglycerides lowering by suppressing phospholipase A2 G12B expression.

    PubMed

    Liu, Qingli; Yang, Meng; Fu, Xuekun; Liu, Renzhong; Sun, Caijun; Pan, Haobo; Wong, Chi-Wai; Guan, Min

    2016-11-15

    As a novel mediator of hepatic very low-density lipoproteins (VLDL) secretion, phospholipase A2 G12B (PLA2G12B) is transcriptionally regulated by hepatocyte nuclear factor-4 alpha (HNF-4α). Farnesoid X receptor (FXR) plays a critical role in maintaining bile acids and triglycerides (TG) homeostasis. Here we report that FXR regulates serum TG level in part through PLA2G12B. Activation of FXR by chenodeoxycholic acid (CDCA) or GW4064 significantly decreased PLA2G12B expression in HepG2 cells. PLA2G12B expression was transcriptionally repressed due to an FXR-mediated up-regulation of small heterodimer partner (SHP) which functionally suppresses HNF-4α activity. We found that hepatic PLA2G12B expression was suppressed and serum TG level reduced in high fat diet mice treated with CDCA. Concurrently, CDCA treatment lowered hepatic VLDL-TG secretion. Our data demonstrate that activation of FXR promotes TG lowering, not only by decreasing de novo lipogenesis but also reducing hepatic secretion of TG-rich VLDL particles in part through suppressing PLA2G12B expression. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  7. Nucleolar TRF2 attenuated nucleolus stress-induced HCC cell-cycle arrest by altering rRNA synthesis.

    PubMed

    Yuan, Fuwen; Xu, Chenzhong; Li, Guodong; Tong, Tanjun

    2018-05-03

    The nucleolus is an important organelle that is responsible for the biogenesis of ribosome RNA (rRNA) and ribosomal subunits assembly. It is also deemed to be the center of metabolic control, considering the critical role of ribosomes in protein translation. Perturbations of rRNA synthesis are closely related to cell proliferation and tumor progression. Telomeric repeat-binding factor 2 (TRF2) is a member of shelterin complex that is responsible for telomere DNA protection. Interestingly, it was recently reported to localize in the nucleolus of human cells in a cell-cycle-dependent manner, while the underlying mechanism and its role on the nucleolus remained unclear. In this study, we found that nucleolar and coiled-body phosphoprotein 1 (NOLC1), a nucleolar protein that is responsible for the nucleolus construction and rRNA synthesis, interacted with TRF2 and mediated the shuttle of TRF2 between the nucleolus and nucleus. Abating the expression of NOLC1 decreased the nucleolar-resident TRF2. Besides, the nucleolar TRF2 could bind rDNA and promoted rRNA transcription. Furthermore, in hepatocellular carcinoma (HCC) cell lines HepG2 and SMMC7721, TRF2 overexpression participated in the nucleolus stress-induced rRNA inhibition and cell-cycle arrest.

  8. Diagnostic accuracy of a standardized scheme for identification of Streptococcus uberis in quarter milk samples: A comparison between conventional bacteriological examination, modified Rambach agar medium culturing, and 16S rRNA gene sequencing.

    PubMed

    Wald, Regina; Baumgartner, Martina; Urbantke, Verena; Stessl, Beatrix; Wittek, Thomas

    2017-02-01

    Bacteriological examination of milk samples is a prerequisite for pathogen-specific therapy and aids in limiting antimicrobial resistance. The aims of this study were to establish a standardized scheme for reliable Streptococcus uberis identification in routine diagnosis and to evaluate the accuracy of conventional tests and growing patterns of Strep. uberis on a selective medium (modified Rambach agar medium, MRAM) using 16S rRNA gene sequencing analysis as a reference method. We obtained isolates of presumptive Strep. uberis (n = 336) from quarter milk samples of dairy cows with intramammary infections and classified the isolates into 2 clusters using biochemical characterization. In cluster 1 (n = 280), cocci grew as non-hemolytic colonies, hydrolyzing esculin, carrying no Lancefield antigen (A/B/C/D/G) or Christie Atkins Munch-Petersen factor, and their growth was inhibited on an Enterococcus agar. Production of β-d-galactosidase on MRAM was shown by 257 of the cluster 1 isolates (91.79%), and 16S rRNA gene sequencing verified 271 (96.79%) of the isolates to be Strep. uberis. In 264 isolates (94.29%), MRAM agreed with the sequencing results. In cluster 2 (n = 56), isolates showed different characteristics: 37 (66.07%) were β-d-galactosidase-positive, and based on 16S sequencing results, 36 (64.29%) were identified correctly as Strep. uberis using biochemical methods. Identification success in this group differed significantly between routine diagnosis and MRAM application: MRAM agreed with sequencing results in 47 isolates (83.93%). To identify Strep. uberis and differentiate it from other lactic acid bacteria in routine diagnosis, we suggest using catalase reaction, hemolysis, esculin hydrolysis, and growth on enterococci agar. Isolates that show a typical biochemical profile can be identified satisfactorily with these tests. For Strep. uberis isolates with divergent patterns, application of MRAM as a follow-up test increased the diagnostic accuracy to 94

  9. Multiple identification of most important waterborne protozoa in surface water used for irrigation purposes by 18S rRNA amplicon-based metagenomics.

    PubMed

    Moreno, Y; Moreno-Mesonero, L; Amorós, I; Pérez, R; Morillo, J A; Alonso, J L

    2018-01-01

    Understanding waterborne protozoan parasites (WPPs) diversity has important implications in public health. In this study, we evaluated a NGS-based method as a detection approach to identify simultaneously most important WPPs using 18S rRNA high-throughput sequencing. A set of primers to target the V4 18S rRNA region of WPPs such as Cryptosporidium spp., Giardia sp., Blastocystis sp., Entamoeba spp, Toxoplasma sp. and free-living amoebae (FLA) was designed. In order to optimize PCR conditions before sequencing, both a mock community with a defined composition of representative WPPs and a real water sample inoculated with specific WPPs DNA were prepared. Using the method proposed in this study, we have detected the presence of Giardia intestinalis, Acanthamoeba castellanii, Toxoplasma gondii, Entamoeba histolytica and Blastocystis sp. at species level in real irrigation water samples. Our results showed that untreated surface irrigation water in open fields can provide an important source of WPPs. Therefore, the methodology proposed in this study can establish a basis for an accurate and effective diagnostic of WPPs to provide a better understanding of the risk associated to irrigation water. Copyright © 2017 The Authors. Published by Elsevier GmbH.. All rights reserved.

  10. [Archaeal diversity in permafrost deposits of Bunger Hills Oasis and King George Island (Antarctica) according to the 16S rRNA gene sequencing].

    PubMed

    Karaevskaia, E S; Demchenko, L S; Demidov, N É; Rivkina, E M; Bulat, S A; Gilichinskiĭ, D A

    2014-01-01

    Archaeal communities of permafrost deposits of King George Island and Bunger Hills Oasis (Antarctica) differing in the content of biogenic methane were analyzed using clone libraries of two 16S rRNA gene regions. Phylotypes belonging to methanogenic archaea were identified in all horizons.

  11. Crystal Structure of the Escherichia coli 23S rRNA: m{5}C Methyltransferase RlmI (YccW) Reveals Evolutionary Links Between RNA Modification Enzymes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sunita, S.; Tkaczuk, K; Purta, E

    2008-01-01

    Methylation is the most common RNA modification in the three domains of life. Transfer of the methyl group from S-adenosyl-l-methionine (AdoMet) to specific atoms of RNA nucleotides is catalyzed by methyltransferase (MTase) enzymes. The rRNA MTase RlmI (rRNA large subunit methyltransferase gene I; previously known as YccW) specifically modifies Escherichia coli 23S rRNA at nucleotide C1962 to form 5-methylcytosine. Here, we report the crystal structure of RlmI refined at 2 {angstrom} to a final R-factor of 0.194 (R{sub free} = 0.242). The RlmI molecule comprises three domains: the N-terminal PUA domain; the central domain, which resembles a domain previously foundmore » in RNA:5-methyluridine MTases; and the C-terminal catalytic domain, which contains the AdoMet-binding site. The central and C-terminal domains are linked by a {Beta}-hairpin structure that has previously been observed in several MTases acting on nucleic acids or proteins. Based on bioinformatics analyses, we propose a model for the RlmI-AdoMet-RNA complex. Comparative structural analyses of RlmI and its homologs provide insight into the potential function of several structures that have been solved by structural genomics groups and furthermore indicate that the evolutionary paths of RNA and DNA 5-methyluridine and 5-methylcytosine MTases have been closely intertwined.« less

  12. Domain organization and crystal structure of the catalytic domain of E.coli RluF, a pseudouridine synthase that acts on 23S rRNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sunita,S.; Zhenxing, H.; Swaathi, J.

    2006-01-01

    Pseudouridine synthases catalyze the isomerization of uridine to pseudouridine ({psi}) in rRNA and tRNA. The pseudouridine synthase RluF from Escherichia coli (E.C. 4.2.1.70) modifies U2604 in 23S rRNA, and belongs to a large family of pseudouridine synthases present in all kingdoms of life. Here we report the domain architecture and crystal structure of the catalytic domain of E. coli RluF at 2.6 Angstroms resolution. Limited proteolysis, mass spectrometry and N-terminal sequencing indicate that RluF has a distinct domain architecture, with the catalytic domain flanked at the N and C termini by additional domains connected to it by flexible linkers. Themore » structure of the catalytic domain of RluF is similar to those of RsuA and TruB. RluF is a member of the RsuA sequence family of {psi}-synthases, along with RluB and RluE. Structural comparison of RluF with its closest structural homologues, RsuA and TruB, suggests possible functional roles for the N-terminal and C-terminal domains of RluF.« less

  13. 23S rRNA gene-based enterococci community signatures in Lake Pontchartrain, Louisiana, USA, following urban runoff inputs after Hurricane Katrina.

    PubMed

    Bae, Hee-Sung; Hou, Aixin

    2013-02-01

    Little is known about the impacts of fecal polluted urban runoff inputs on the structure of enterococci communities in estuarine waters. This study employed a 23S rRNA gene-based polymerase chain reaction (PCR) assay with newly designed genus-specific primers, Ent127F-Ent907R, to determine the possible impacts of Hurricane Katrina floodwaters via the 17th Street Canal discharge on the community structure of enterococci in Lake Pontchartrain. A total of 94 phylotypes were identified through the restriction fragment length polymorphism (RFLP) screening of 494 clones while only 8 phylotypes occurred among 88 cultivated isolates. Sequence analyses of representative phylotypes and their temporal and spatial distribution in the lake and the canal indicated the Katrina floodwater input introduced a large portion of Enterococcus flavescens, Enterococcus casseliflavus, and Enterococcus dispar into the lake; typical fecal groups Enterococcus faecium, Enterococcus durans, Enterococcus hirae, and Enterococcus mundtii were detected primarily in the floodwater-impacted waters. This study provides a global picture of enterococci in estuarine waters impacted by Hurricane Katrina-derived urban runoff. It also demonstrates the culture-independent PCR approach using 23S rRNA gene as a molecular marker could be a good alternative in ecological studies of enterococci in natural environments to overcome the limitation of conventional cultivation methods.

  14. 16S rRNA Gene Sequencing, Multilocus Sequence Analysis, and Mass Spectrometry Identification of the Proposed New Species “Clostridium neonatale”

    PubMed Central

    Bouvet, Philippe; Ferraris, Laurent; Dauphin, Brunhilde; Popoff, Michel-Robert; Butel, Marie Jose

    2014-01-01

    In 2002, an outbreak of necrotizing enterocolitis in a Canadian neonatal intensive care unit was associated with a proposed novel species of Clostridium, “Clostridium neonatale.” To date, there are no data about the isolation, identification, or clinical significance of this species. Additionally, C. neonatale has not been formally classified as a new species, rendering its identification challenging. Indeed, the C. neonatale 16S rRNA gene sequence shows high similarity to another Clostridium species involved in neonatal necrotizing enterocolitis, Clostridium butyricum. By performing a polyphasic study combining phylogenetic analysis (16S rRNA gene sequencing and multilocus sequence analysis) and phenotypic characterization with mass spectrometry, we demonstrated that C. neonatale is a new species within the Clostridium genus sensu stricto, for which we propose the name Clostridium neonatale sp. nov. Now that the status of C. neonatale has been clarified, matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS) can be used for better differential identification of C. neonatale and C. butyricum clinical isolates. This is necessary to precisely define the role and clinical significance of C. neonatale, a species that may have been misidentified and underrepresented during previous neonatal necrotizing enterocolitis studies. PMID:25232167

  15. Rapid identification of Campylobacter, Arcobacter, and Helicobacter isolates by PCR-restriction fragment length polymorphism analysis of the 16S rRNA gene.

    PubMed

    Marshall, S M; Melito, P L; Woodward, D L; Johnson, W M; Rodgers, F G; Mulvey, M R

    1999-12-01

    A rapid two-step identification scheme based on PCR-restriction fragment length polymorphism (PCR-RFLP) analysis of the 16S rRNA gene was developed in order to differentiate isolates belonging to the Campylobacter, Arcobacter, and Helicobacter genera. For 158 isolates (26 reference cultures and 132 clinical isolates), specific RFLP patterns were obtained and species were successfully identified by this assay.

  16. Forensically informative nucleotide sequencing (FINS) for the first time authentication of Indian Varanus species: implication in wildlife forensics and conservation.

    PubMed

    Rajpoot, Ankita; Kumar, Ved Prakash; Bahuguna, Archana; Kumar, Dhyanendra

    2017-11-01

    Monitor lizards are Varanus species widely distributed, endangered reptile in the IUCN red data list. In India, based on the morphological and ecological characteristic, it is divided into four species viz. Bengal monitor lizard, Yellow monitor lizard, Desert monitor lizard and Water monitor lizard. These four species listed as Schedule I species in Indian Wildlife (Protection) Act 1972. This paper first attempt to present Forensically Informative Nucleotide Sequencing (FINS) for the Indian Varanus based on three mitochondrial genes. The molecular framework will be useful for the identification of Indian Varanus species and trade products derived from monitors and as such, have important applications for wildlife management and conservation. Here, we used known 14 individual skin pieces of four species of monitor lizards; the partial fragment of three mitochondrial genes (Cyt b, 12S rRNA, and 16S rRNA) were amplified for genetic study. In Cyt b, 12S rRNA and 16s rRNA, we observed, 5, 5 and 4 Haplotypes; 71, 69, and 43 Variables sites; 90, 89, and 50 Parsimony Informative sites within four species of Indian monitor lizards, respectively. Despite it, the nucleotide composition was T 26.4, C 32.8, A 29.2 and G11.6; T 18.8, C 29.7, A 34.0 and G 17.5; T 21.7, C 27.3, A 32.5 and G 18.5 in Cyt b, 12S rRNA and 16S rRNA, respectively. The neighbor joining phylogenetic tree and maximum parsimony tree of three mitochondrial genes, showed similar results and reveal that, there are two major clades are present in Indian monitor lizards.

  17. Linear programming model to construct phylogenetic network for 16S rRNA sequences of photosynthetic organisms and influenza viruses.

    PubMed

    Mathur, Rinku; Adlakha, Neeru

    2014-06-01

    Phylogenetic trees give the information about the vertical relationships of ancestors and descendants but phylogenetic networks are used to visualize the horizontal relationships among the different organisms. In order to predict reticulate events there is a need to construct phylogenetic networks. Here, a Linear Programming (LP) model has been developed for the construction of phylogenetic network. The model is validated by using data sets of chloroplast of 16S rRNA sequences of photosynthetic organisms and Influenza A/H5N1 viruses. Results obtained are in agreement with those obtained by earlier researchers.

  18. 18S rRNA data indicate that Aschelminthes are polyphyletic in origin and consist of at least three distinct clades.

    PubMed

    Winnepenninckx, B; Backeljau, T; Mackey, L Y; Brooks, J M; De Wachter, R; Kumar, S; Garey, J R

    1995-11-01

    The Aschelminthes is a collection of at least eight animal phyla, historically grouped together because the absence of a true body cavity was perceived as a pseudocoelom. Analyses of 18S rRNA sequences from six Aschelminth phyla (including four previously unpublished sequences) support polyphyly for the Aschelminthes. At least three distinct groups of Aschelminthes were detected: the Priapulida among the protostomes, the Rotifera-Acanthocephala as a sister group to the protostomes, and the Nematoda as a basal group to the triploblastic Eumetazoa.

  19. Investigation of postpartum dairy cows' uterine microbial diversity using metagenomic pyrosequencing of the 16S rRNA gene.

    PubMed

    Machado, V S; Oikonomou, G; Bicalho, M L S; Knauer, W A; Gilbert, R; Bicalho, R C

    2012-10-12

    The objective of this study was the use of metagenomic pyrosequencing of the 16S rRNA gene for the investigation of postpartum dairy cows' uterine bacterial diversity. The effect of subcutaneous supplementation of a trace mineral supplement containing Zn, Mn, Se, and Cu (Multimin North America, Inc., Fort Collins, CO) at 230 days of gestation and 260 days of gestation on dairy cows' uterine microbiota was also evaluated. Uterine lavage samples were collected at 35 DIM and were visually scored for the presence of purulent or mucopurulent secretion. The same samples were also used for the acquisition of bacterial DNA. The 16S rRNA genes were individually amplified from each sample. Pyrosequencing of the samples was carried at the Cornell University Life Sciences Core Laboratories Center using Roche 454 GS-FLX System Titanium Chemistry. The Ribosomal Database Project online tools were used for the analysis of the obtained sequences library. Bacteroides spp., Ureaplasma spp., Fusobacterium spp., Peptostreptococcus spp., Sneathia spp., Prevotella spp. and Arcanobacterium spp. prevalence was significantly (P<0.05) higher in samples derived from cows that had a higher uterine lavage sample score. Bacteroides spp., Ureaplasma spp., Fusobacterium spp., and Arcanobacterium spp. prevalence was significantly (P<0.05) higher in samples derived from cows that were not pregnant by 200 DIM. Anaerococcus spp., Peptostreptococcus spp., Parabacteroides spp., and Propionibacterium spp. prevalence was significantly (P<0.05) lower in samples derived from cows that were trace mineral supplemented. Copyright © 2012 Elsevier B.V. All rights reserved.

  20. Chimeric 16S rRNA sequence formation and detection in Sanger and 454-pyrosequenced PCR amplicons

    PubMed Central

    Haas, Brian J.; Gevers, Dirk; Earl, Ashlee M.; Feldgarden, Mike; Ward, Doyle V.; Giannoukos, Georgia; Ciulla, Dawn; Tabbaa, Diana; Highlander, Sarah K.; Sodergren, Erica; Methé, Barbara; DeSantis, Todd Z.; Petrosino, Joseph F.; Knight, Rob; Birren, Bruce W.

    2011-01-01

    Bacterial diversity among environmental samples is commonly assessed with PCR-amplified 16S rRNA gene (16S) sequences. Perceived diversity, however, can be influenced by sample preparation, primer selection, and formation of chimeric 16S amplification products. Chimeras are hybrid products between multiple parent sequences that can be falsely interpreted as novel organisms, thus inflating apparent diversity. We developed a new chimera detection tool called Chimera Slayer (CS). CS detects chimeras with greater sensitivity than previous methods, performs well on short sequences such as those produced by the 454 Life Sciences (Roche) Genome Sequencer, and can scale to large data sets. By benchmarking CS performance against sequences derived from a controlled DNA mixture of known organisms and a simulated chimera set, we provide insights into the factors that affect chimera formation such as sequence abundance, the extent of similarity between 16S genes, and PCR conditions. Chimeras were found to reproducibly form among independent amplifications and contributed to false perceptions of sample diversity and the false identification of novel taxa, with less-abundant species exhibiting chimera rates exceeding 70%. Shotgun metagenomic sequences of our mock community appear to be devoid of 16S chimeras, supporting a role for shotgun metagenomics in validating novel organisms discovered in targeted sequence surveys. PMID:21212162

  1. Prevalence of Corynebacterial 16S rRNA Sequences in Patients with Bacterial and “Nonbacterial” Prostatitis

    PubMed Central

    Tanner, Michael A.; Shoskes, Daniel; Shahed, Asha; Pace, Norman R.

    1999-01-01

    The etiology of chronic prostatitis syndromes in men is controversial, particularly when positive cultures for established uropathogens are lacking. Although identification of bacteria in prostatic fluid has relied on cultivation and microscopy, most microorganisms in the environment, including some human pathogens, are resistant to cultivation. We report here on an rRNA-based molecular phylogenetic approach to the identification of bacteria in prostate fluid from prostatitis patients. Positive bacterial signals were seen for 65% of patients with chronic prostatitis overall. Seven of 11 patients with bacterial signals but none of 6 patients without bacterial signals were cured with antibiotic-based therapy. Results indicate the occurrence in the prostate fluid of a wide spectrum of bacterial species representing several genera. Most rRNA genes were closely related to those of species belonging to the genera Corynebacterium, Staphylococcus, Peptostreptococcus, Streptococcus, and Escherichia. Unexpectedly, a wide diversity of Corynebacterium species was found in high proportion compared to the proportions of other bacterial species found. A subset of these 16S rRNA sequences represent those of undescribed species on the basis of their positions in phylogenetic trees. These uncharacterized organisms were not detected in control samples, suggesting that the organisms have a role in the disease or are the consequence of the disease. These studies show that microorganisms associated with prostatitis generally occur as complex microbial communities that differ between patients. The results also indicate that microbial communities distinct from those associated with prostatitis may occur at low levels in normal prostatic fluid. PMID:10325338

  2. 12 CFR 563g.18 - Current and periodic reports.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 12 Banks and Banking 5 2010-01-01 2010-01-01 false Current and periodic reports. 563g.18 Section 563g.18 Banks and Banking OFFICE OF THRIFT SUPERVISION, DEPARTMENT OF THE TREASURY SECURITIES OFFERINGS § 563g.18 Current and periodic reports. (a) Each savings association which files an offering circular...

  3. Characterization of bovine ruminal epithelial bacterial communities using 16S rRNA sequencing, PCR-DGGE, and qRT-PCR analysis.

    PubMed

    Li, Meiju; Zhou, Mi; Adamowicz, Elizabeth; Basarab, John A; Guan, Le Luo

    2012-02-24

    Currently, knowledge regarding the ecology and function of bacteria attached to the epithelial tissue of the rumen wall is limited. In this study, the diversity of the bacterial community attached to the rumen epithelial tissue was compared to the rumen content bacterial community using 16S rRNA gene sequencing, PCR-DGGE, and qRT-PCR analysis. Sequence analysis of 2785 randomly selected clones from six 16S rDNA (∼1.4kb) libraries showed that the community structures of three rumen content libraries clustered together and were separated from the rumen tissue libraries. The diversity index of each library revealed that ruminal content bacterial communities (4.12/4.42/4.88) were higher than ruminal tissue communities (2.90/2.73/3.23), based on 97% similarity. The phylum Firmicutes was predominant in the ruminal tissue communities, while the phylum Bacteroidetes was predominant in the ruminal content communities. The phyla Fibrobacteres, Planctomycetes, and Verrucomicrobia were only detected in the ruminal content communities. PCR-DGGE analysis of the bacterial profiles of the rumen content and ruminal epithelial tissue samples from 22 steers further confirmed that there is a distinct bacterial community that inhibits the rumen epithelium. The distinctive epimural bacterial communities suggest that Firmicutes, together with other epithelial-specific species, may have additional functions other than food digestion. Copyright © 2011 Elsevier B.V. All rights reserved.

  4. 12 CFR 563g.19 - Approval of the security.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 12 Banks and Banking 5 2010-01-01 2010-01-01 false Approval of the security. 563g.19 Section 563g.19 Banks and Banking OFFICE OF THRIFT SUPERVISION, DEPARTMENT OF THE TREASURY SECURITIES OFFERINGS § 563g.19 Approval of the security. Any securities of a savings association which are not exempt under...

  5. 12 CFR 563g.10 - Unsafe or unsound practices.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 12 Banks and Banking 5 2010-01-01 2010-01-01 false Unsafe or unsound practices. 563g.10 Section 563g.10 Banks and Banking OFFICE OF THRIFT SUPERVISION, DEPARTMENT OF THE TREASURY SECURITIES OFFERINGS § 563g.10 Unsafe or unsound practices. (a) No person shall directly or indirectly, (1) Employ any device...

  6. Rapid differentiation of Francisella species and subspecies by fluorescent in situ hybridization targeting the 23S rRNA

    PubMed Central

    2010-01-01

    Background Francisella (F.) tularensis is the causative agent of tularemia. Due to its low infectious dose, ease of dissemination and high case fatality rate, F. tularensis was the subject in diverse biological weapons programs and is among the top six agents with high potential if misused in bioterrorism. Microbiological diagnosis is cumbersome and time-consuming. Methods for the direct detection of the pathogen (immunofluorescence, PCR) have been developed but are restricted to reference laboratories. Results The complete 23S rRNA genes of representative strains of F. philomiragia and all subspecies of F. tularensis were sequenced. Single nucleotide polymorphisms on species and subspecies level were confirmed by partial amplification and sequencing of 24 additional strains. Fluorescent In Situ Hybridization (FISH) assays were established using species- and subspecies-specific probes. Different FISH protocols allowed the positive identification of all 4 F. philomiragia strains, and more than 40 F. tularensis strains tested. By combination of different probes, it was possible to differentiate the F. tularensis subspecies holarctica, tularensis, mediasiatica and novicida. No cross reactivity with strains of 71 clinically relevant bacterial species was observed. FISH was also successfully applied to detect different F. tularensis strains in infected cells or tissue samples. In blood culture systems spiked with F. tularensis, bacterial cells of different subspecies could be separated within single samples. Conclusion We could show that FISH targeting the 23S rRNA gene is a rapid and versatile method for the identification and differentiation of F. tularensis isolates from both laboratory cultures and clinical samples. PMID:20205957

  7. Direct Analysis of Genes Encoding 16S rRNA from Complex Communities Reveals Many Novel Molecular Species within the Human Gut

    PubMed Central

    Suau, Antonia; Bonnet, Régis; Sutren, Malène; Godon, Jean-Jacques; Gibson, Glenn R.; Collins, Matthew D.; Doré, Joel

    1999-01-01

    The human intestinal tract harbors a complex microbial ecosystem which plays a key role in nutrition and health. Although this microbiota has been studied in great detail by culture techniques, microscopic counts on human feces suggest that 60 to 80% of the observable bacteria cannot be cultivated. Using comparative analysis of cloned 16S rRNA gene (rDNA) sequences, we have investigated the bacterial diversity (both cultivated and noncultivated bacteria) within an adult-male fecal sample. The 284 clones obtained from 10-cycle PCR were classified into 82 molecular species (at least 98% similarity). Three phylogenetic groups contained 95% of the clones: the Bacteroides group, the Clostridium coccoides group, and the Clostridium leptum subgroup. The remaining clones were distributed among a variety of phylogenetic clusters. Only 24% of the molecular species recovered corresponded to described organisms (those whose sequences were available in public databases), and all of these were established members of the dominant human fecal flora (e.g., Bacteroides thetaiotaomicron, Fusobacterium prausnitzii, and Eubacterium rectale). However, the majority of generated rDNA sequences (76%) did not correspond to known organisms and clearly derived from hitherto unknown species within this human gut microflora. PMID:10543789

  8. A novel RT-PCR for the detection of Helicobacter pylori and identification of clarithromycin resistance mediated by mutations in the 23S rRNA gene.

    PubMed

    Redondo, Javier Jareño; Keller, Peter M; Zbinden, Reinhard; Wagner, Karoline

    2018-01-01

    In this study we evaluated the commercially available LightMix® RT-PCR assay for Helicobacter pylori detection and identification of clarithromycin (CLR) resistance in culture and clinical specimens (gastric biopsies and stool). The H. pylori LightMix® RT-PCR detects a 97bp long fragment of the 23S rRNA gene and allows the identification of 3 distinct point mutations conferring CLR resistance via melting curve analysis. The performance of the H. pylori LightMix® RT-PCR was evaluated using a set of 60 H. pylori strains showing phenotypical CLR susceptibility or CLR resistance (Minimum inhibitory concentrations from 0.016 to 256mg/L). We found high concordance (95%) between phenotypical CLR resistance screening by E-Test® and the Lightmix® RT-PCR. Discrepant results were verified by sequencing of the 23S rRNA gene that always confirmed the results obtained by Lightmix® RT-PCR. Furthermore, H. pylori was detected in clinical biopsy and stool specimens by Lightmix® RT-PCR that identified the correct H. pylori genotype. The LightMix® RT-PCR is an accurate, sensitive and easy to use test for H. pylori and CLR resistance detection and can therefore be readily implemented in any diagnostic laboratory. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  9. KSC-02pd1555

    NASA Image and Video Library

    2002-10-16

    KENNEDY SPACE CENTER, FLA. -- Expedition 6 crew member Nikolai Budarin stands ready for a practice drive in an M-113 armored personnel carrier during emergency egress training at the pad, one of the Terminal Countdown Demonstration Test activities in preparation for launch. The TCDT also includes a simulated launch countdown. The Expedition 6 crew will travel on Space Shuttle Endeavour to the International Space Station to replace Expedition 5, returning to Earth after 4 months. The primary payloads on mission STS-113 are the first port truss segment, P1, and the Crew and Equipment Translation Aid (CETA) Cart B. Once delivered, the P1 truss will remain stowed until flight 12A.1 in 2003 when it will be attached to the central truss segment, S0, on the Space Station. Launch is scheduled for Nov. 10, 2002.

  10. Comparison of reduced metagenome and 16S rRNA gene sequencing for determination of genetic diversity and mother-child overlap of the gut associated microbiota.

    PubMed

    Ravi, Anuradha; Avershina, Ekaterina; Angell, Inga Leena; Ludvigsen, Jane; Manohar, Prasanth; Padmanaban, Sumathi; Nachimuthu, Ramesh; Snipen, Lars; Rudi, Knut

    2018-06-01

    Use of the 16S rRNA gene in microbiota studies is limited by the lack of taxonomic and functional resolution. High resolution analyses are particularly important for understanding transmission and persistence of bacteria. The aim of our work was therefore to compare a novel reduced metagenome sequencing (RMS) approach with 16S rRNA gene sequencing to determine both the metagenome genetic diversity and the mother-to-child sharing of the microbiota in a cohort of 17 mother-child pairs. We found that although both approaches gave comparable results with respect to sample separation and taxonomy, RMS gave higher resolution and the potential for genomic-/functional assignment. Using RMS we estimated that the metagenome size increased from about 60 Mbp for 4-day-old children to about 225 Mbp for mothers. The 4-day-old children shared 7% of the metagenome sequences with the mothers, while the metagenome sequence sharing was >30% among the mothers. We found 15 genomes shared across >50% of the mothers, of which 10 belonged to Clostridia. Only Bacteroides showed a direct mother-child association, with B. vulgatus being abundant in both 4-day-old children and mothers. For the functional assignments, we identified a significant association between antibiotic usage during labor, and quantity of Fosfomycin resistance genes. In conclusion, our results show a higher functional and taxonomic resolution for RMS compared to 16S rRNA gene sequencing, where RMS enabled a detailed description of mother to child gut microbiota transmission - supporting a late recruitment of most gut bacteria and an effect of antibiotic treatment during labor on infant antibiotic resistance gene patterns. Copyright © 2018. Published by Elsevier B.V.

  11. Identification of Clinical Coryneform Bacterial Isolates: Comparison of Biochemical Methods and Sequence Analysis of 16S rRNA and rpoB Genes▿

    PubMed Central

    Adderson, Elisabeth E.; Boudreaux, Jan W.; Cummings, Jessica R.; Pounds, Stanley; Wilson, Deborah A.; Procop, Gary W.; Hayden, Randall T.

    2008-01-01

    We compared the relative levels of effectiveness of three commercial identification kits and three nucleic acid amplification tests for the identification of coryneform bacteria by testing 50 diverse isolates, including 12 well-characterized control strains and 38 organisms obtained from pediatric oncology patients at our institution. Between 33.3 and 75.0% of control strains were correctly identified to the species level by phenotypic systems or nucleic acid amplification assays. The most sensitive tests were the API Coryne system and amplification and sequencing of the 16S rRNA gene using primers optimized for coryneform bacteria, which correctly identified 9 of 12 control isolates to the species level, and all strains with a high-confidence call were correctly identified. Organisms not correctly identified were species not included in the test kit databases or not producing a pattern of reactions included in kit databases or which could not be differentiated among several genospecies based on reaction patterns. Nucleic acid amplification assays had limited abilities to identify some bacteria to the species level, and comparison of sequence homologies was complicated by the inclusion of allele sequences obtained from uncultivated and uncharacterized strains in databases. The utility of rpoB genotyping was limited by the small number of representative gene sequences that are currently available for comparison. The correlation between identifications produced by different classification systems was poor, particularly for clinical isolates. PMID:18160450

  12. Deciphering chicken gut microbial dynamics based on high-throughput 16S rRNA metagenomics analyses.

    PubMed

    Mohd Shaufi, Mohd Asrore; Sieo, Chin Chin; Chong, Chun Wie; Gan, Han Ming; Ho, Yin Wan

    2015-01-01

    Chicken gut microbiota has paramount roles in host performance, health and immunity. Understanding the topological difference in gut microbial community composition is crucial to provide knowledge on the functions of each members of microbiota to the physiological maintenance of the host. The gut microbiota profiling of the chicken was commonly performed previously using culture-dependent and early culture-independent methods which had limited coverage and accuracy. Advances in technology based on next-generation sequencing (NGS), offers unparalleled coverage and depth in determining microbial gut dynamics. Thus, the aim of this study was to investigate the ileal and caecal microbiota development as chicken aged, which is important for future effective gut modulation. Ileal and caecal contents of broiler chicken were extracted from 7, 14, 21 and 42-day old chicken. Genomic DNA was then extracted and amplified based on V3 hyper-variable region of 16S rRNA. Bioinformatics, ecological and statistical analyses such as Principal Coordinate Analysis (PCoA) was performed in mothur software and plotted using PRIMER 6. Additional analyses for predicted metagenomes were performed through PICRUSt and STAMP software package based on Greengenes databases. A distinctive difference in bacterial communities was observed between ilea and caeca as the chicken aged (P < 0.001). The microbial communities in the caeca were more diverse in comparison to the ilea communities. The potentially pathogenic bacteria such as Clostridium were elevated as the chicken aged and the population of beneficial microbe such as Lactobacillus was low at all intervals. On the other hand, based on predicted metagenomes analysed, clear distinction in functions and roles of gut microbiota such as gene pathways related to nutrient absorption (e.g. sugar and amino acid metabolism), and bacterial proliferation and colonization (e.g. bacterial motility proteins, two-component system and bacterial secretion

  13. Control of rRNA transcription in Escherichia coli.

    PubMed Central

    Condon, C; Squires, C; Squires, C L

    1995-01-01

    The control of rRNA synthesis in response to both extra- and intracellular signals has been a subject of interest to microbial physiologists for nearly four decades, beginning with the observations that Salmonella typhimurium cells grown on rich medium are larger and contain more RNA than those grown on poor medium. This was followed shortly by the discovery of the stringent response in Escherichia coli, which has continued to be the organism of choice for the study of rRNA synthesis. In this review, we summarize four general areas of E. coli rRNA transcription control: stringent control, growth rate regulation, upstream activation, and anti-termination. We also cite similar mechanisms in other bacteria and eukaryotes. The separation of growth rate-dependent control of rRNA synthesis from stringent control continues to be a subject of controversy. One model holds that the nucleotide ppGpp is the key effector for both mechanisms, while another school holds that it is unlikely that ppGpp or any other single effector is solely responsible for growth rate-dependent control. Recent studies on activation of rRNA synthesis by cis-acting upstream sequences has led to the discovery of a new class of promoters that make contact with RNA polymerase at a third position, called the UP element, in addition to the well-known -10 and -35 regions. Lastly, clues as to the role of antitermination in rRNA operons have begun to appear. Transcription complexes modified at the antiterminator site appear to elongate faster and are resistant to the inhibitory effects of ppGpp during the stringent response. PMID:8531889

  14. The Expansion Segments of 28S Ribosomal RNA Extensively Match Human Messenger RNAs

    PubMed Central

    Parker, Michael S.; Balasubramaniam, Ambikaipakan; Sallee, Floyd R.; Parker, Steven L.

    2018-01-01

    Eukaryote ribosomal RNAs (rRNAs) have expanded in the course of phylogeny by addition of nucleotides in specific insertion areas, the expansion segments. These number about 40 in the larger (25–28S) rRNA (up to 2,400 nucleotides), and about 12 in the smaller (18S) rRNA (<700 nucleotides). Expansion of the larger rRNA shows a clear phylogenetic increase, with a dramatic rise in mammals and especially in hominids. Substantial portions of expansion segments in this RNA are not bound to ribosomal proteins, and may engage extraneous interactants, including messenger RNAs (mRNAs). Studies on the ribosome-mRNA interaction have focused on proteins of the smaller ribosomal subunit, with some examination of 18S rRNA. However, the expansion segments of human 28S rRNA show much higher density and numbers of mRNA matches than those of 18S rRNA, and also a higher density and match numbers than its own core parts. We have studied that with frequent and potentially stable matches containing 7–15 nucleotides. The expansion segments of 28S rRNA average more than 50 matches per mRNA even assuming only 5% of their sequence as available for such interaction. Large expansion segments 7, 15, and 27 of 28S rRNA also have copious long (≥10-nucleotide) matches to most human mRNAs, with frequencies much higher than in other 28S rRNA parts. Expansion segments 7 and 27 and especially segment 15 of 28S rRNA show large size increase in mammals compared to other metazoans, which could reflect a gain of function related to interaction with non-ribosomal partners. The 28S rRNA expansion segment 15 shows very high increments in size, guanosine, and cytidine nucleotide content and mRNA matching in mammals, and especially in hominids. With these segments (but not with other 28S rRNA or any 18S rRNA expansion segments) the density and number of matches are much higher in 5′-terminal than in 3′-terminal untranslated mRNA regions, which may relate to mRNA mobilization via 5′ termini. Matches

  15. Identification and Characterization of a Pesticide Degrading Flavobacterium Species EMBS0145 by 16S rRNA Gene Sequencing.

    PubMed

    Nayarisseri, Anuraj; Suppahia, Anjana; Nadh, Anuroopa G; Nair, Achuthsankar S

    2015-06-01

    Organophosphates like chlorpyrifos, diazinon, or malathion have become most common and indisputably most toxic pest control agents that adversely affects the human nervous system even at low levels of exposure. Because of their relatively low cost and ability to be applied on a wide range of target insects and crop, organophosphorus pesticides account for a large share of all insecticides used in India, and this in turn raises severe health concerns. In this view, the present investigation was aimed to identify novel species of Flavobacterium bacteria which is bestowed with the capacity to degrade pesticides like chlorpyrifos, diazinon, or malathion. The bacterium was isolated from agricultural soil collected from Guntur District, Andhra Pradesh, India. The samples were serially diluted, and the aliquots were incubated for a suitable time following which the suspected colony was subjected to 16S rRNA gene sequencing. The sequence thus obtained was aligned pairwise against Flavobacterium species, which resulted in identification of novel species of Flavobacterium later which was named as EMBS0145 and sequence was deposited in GenBank with Accession Number: JN794045.

  16. Identification and characterization of a pesticide degrading flavobacterium species EMBS0145 by 16S rRNA gene sequencing.

    PubMed

    Nayarisseri, Anuraj; Suppahia, Anjana; Nadh, Anuroopa G; Nair, Achuthsankar S

    2014-08-09

    Organophosphates (OPs) like chlorpyrifos, diazinon, or malathion have become most common and indisputably most toxic pest-control agents that adversely affects the human nervous system even at low levels of exposure. Because of their relatively low cost and ability to be applied on a wide range of target insects and crop, organophosphorus pesticides account for a large share of all insecticides used in India, this in turn raises severe health concerns. In this view, the present investigation was aimed to identify novel species of Flavobacterium bacteria which is bestowed with the capacity to degrade pesticides like chlorpyrifos, diazinon or malathion. The bacterium was isolated from agricultural soil collected from Guntur District, Andhra Pradesh, India. The samples were serially diluted and the aliquots were incubated for a suitable time following which the suspected colony was subjected to 16S rRNA gene sequencing. The sequence thus obtained was aligned pairwise against Flavobacterium species, which resulted in identification of novel species of Flavobacterium later which was named as EMBS0145 and sequence was deposited in GenBank with accession number JN794045.

  17. Application of DNA probes for rRNA and vanA genes to investigation of a nosocomial cluster of vancomycin-resistant enterococci.

    PubMed Central

    Woodford, N; Morrison, D; Johnson, A P; Briant, V; George, R C; Cookson, B

    1993-01-01

    DNA probes specific for genes encoding rRNA and the glycopeptide resistance gene vanA were used to investigate a cluster of vancomycin-resistant (MICs, > 512 mg/liter) Enterococcus faecalis and Enterococcus faecium isolated from separate patients in a renal unit in a London hospital. When digested with BamHI, 12 of 13 vancomycin-resistant E. faecalis isolates exhibited a common restriction fragment length polymorphism pattern of rRNA genes (ribotype). A vanA probe hybridized with chromosomal DNA in these 12 isolates. The other isolate of vancomycin-resistant E. faecalis had a different ribotype and the vanA gene was located on plasmid DNA. These data suggest that cross-infection with a single strain of vancomycin-resistant E. faecalis occurred in most instances. In contrast, 23 vancomycin-resistant E. faecium isolates showed greater heterogeneity, comprising 8 ribotypes, suggesting that multiple strains were present in the unit. Twenty-one of these 23 isolates harbored a 24-MDa plasmid which hybridized with the vanA probe, implying that interstrain dissemination of a vancomycin resistance plasmid may have occurred among E. faecium isolates in the renal unit. Images PMID:8096216

  18. Role of conserved nucleotides in building the 16S rRNA binding site of E. coli ribosomal protein S8.

    PubMed Central

    Allmang, C; Mougel, M; Westhof, E; Ehresmann, B; Ehresmann, C

    1994-01-01

    Ribosomal protein S8 specifically recognizes a helical and irregular region of 16S rRNA that is highly evolutionary constrained. Despite its restricted size, the precise conformation of this region remains a question of debate. Here, we used chemical probing to analyze the structural consequences of mutations in this RNA region. These data, combined with computer modelling and previously published data on protein binding were used to investigate the conformation of the RNA binding site. The experimental data confirm the model in which adenines A595, A640 and A642 bulge out in the deep groove. In addition to the already proposed non canonical U598-U641 interaction, the structure is stabilized by stacking interactions (between A595 and A640) and an array of hydrogen bonds involving bases and the sugar phosphate backbone. Mutations that alter the ability to form these interdependent interactions result in a local destabilization or reorganization. The specificity of recognition by protein S8 is provided by the irregular and distorted backbone and the two bulged adenines 640 and 642 in the deep groove. The third adenine (A595) is not a direct recognition site but must adopt a bulged position. The U598-U641 pair should not be directly in contact with the protein. Images PMID:7937081

  19. Sulfur-inhibited Thermosphaera aggregans sp. nov., a new genus of hyperthermophilic archaea isolated after its prediction from environmentally derived 16S rRNA sequences.

    PubMed

    Huber, R; Dyba, D; Huber, H; Burggraf, S; Rachel, R

    1998-01-01

    Recently, a new procedure was developed which allowed for the first time the isolation of a hyperthermophilic archaeum tracked by 165 rRNA analysis from a terrestrial hot solfataric spring ('Obsidian Pool', Yellowstone National Park, WY, USA). This novel isolate is characterized here. Cells are round cocci with a diameter of 0.2-0.8 micron, occurring singly, in pairs, short chains and in grape-like aggregates. The aggregates exhibit a weak bluish-green fluorescence under UV radiation at 420 nm. The new isolate is an anaerobic obligate heterotroph, using preferentially yeast extract for growth. The metabolic products include CO2, H2, acetate and isovalerate. Growth is observed between 65 and 90 degrees C (optimum: 85 degrees C), from pH 5.0 to 7.0 (optimum: 6.5) and up to 0.7% NaCl. The apparent activation energy for growth is about 149 kJ mol-1. Elemental sulfur or hydrogen inhibits growth. The core lipids consist mainly of acyclic and cyclic glycerol diphytanyl tetraethers. The cell envelope contains a cytoplasmic membrane covered by an amorphous layer of unknown composition; there is no evidence for a regularly arrayed surface-layer protein. The G + C content is 46 mol%. On the basis of 165 rRNA sequence comparisons in combination with morphological, physiological and biochemical properties, the isolate represents a new genus within the Desulfurococcaceae, which has been named Thermosphaera. The type species is Thermosphaera aggregans, the type strain is isolate M11TLT (= DSM 11486T).

  20. Evidence of birth-and-death evolution of 5S rRNA gene in Channa species (Teleostei, Perciformes).

    PubMed

    Barman, Anindya Sundar; Singh, Mamta; Singh, Rajeev Kumar; Lal, Kuldeep Kumar

    2016-12-01

    In higher eukaryotes, minor rDNA family codes for 5S rRNA that is arranged in tandem arrays and comprises of a highly conserved 120 bp long coding sequence with a variable non-transcribed spacer (NTS). Initially the 5S rDNA repeats are considered to be evolved by the process of concerted evolution. But some recent reports, including teleost fishes suggested that evolution of 5S rDNA repeat does not fit into the concerted evolution model and evolution of 5S rDNA family may be explained by a birth-and-death evolution model. In order to study the mode of evolution of 5S rDNA repeats in Perciformes fish species, nucleotide sequence and molecular organization of five species of genus Channa were analyzed in the present study. Molecular analyses revealed several variants of 5S rDNA repeats (four types of NTS) and networks created by a neighbor net algorithm for each type of sequences (I, II, III and IV) did not show a clear clustering in species specific manner. The stable secondary structure is predicted and upstream and downstream conserved regulatory elements were characterized. Sequence analyses also shown the presence of two putative pseudogenes in Channa marulius. Present study supported that 5S rDNA repeats in genus Channa were evolved under the process of birth-and-death.