Sample records for a3243g trnaleuuur mutation

  1. MELAS syndrome with mitochondrial tRNA(Leu(UUR)) gene mutation in a Chinese family.

    PubMed Central

    Huang, C C; Chen, R S; Chen, C M; Wang, H S; Lee, C C; Pang, C Y; Hsu, H S; Lee, H C; Wei, Y H

    1994-01-01

    The clinical features of a patient in a Chinese family with mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS syndrome) are reported. The study revealed that hearing and visual impairments and miscarriages may be early clinical presentations in MELAS. A heteroplasmic A to G transition in the tRNA(Leu(UUR)) gene was noted at the nucleotide pair 3243 in the mitochondrial DNA of muscle, blood, and hair follicles of the proband and his maternal relatives. Quantitative analysis of the mutated mitochondrial DNA revealed variable proportions in different tissues and subjects of maternal lineage in the family. Muscle tissue contained a higher proportion of the mutant mitochondria than other tissues examined. The function of the reproductive system of the proband seems to be impaired. In one clinically healthy sibling, the 3243rd point mutation was found in sperm mitochondrial DNA, although sperm motility was not affected. It seems that biochemical defects in mitochondrial respiration and oxidative phosphorylation are tissue specific expressions of the 3243rd point mutation in the mitochondrial DNA of the affected target tissues. Images PMID:8201329

  2. [Identification of an ideal noninvasive method to detect A3243G gene mutation in MELAS syndrome].

    PubMed

    Ma, Yi-nan; Fang, Fang; Yang, Yan-ling; Zhang, Ying; Wang, Song-tao; Xu, Yu-feng; Pei, Pei; Yuan, Yun; Bu, Ding-fang; Qi, Yu

    2008-12-16

    To identify a better non-invasive method to detect the carrier of mitochondrial A3243G mutation, a cause of mitochondrial encephalopathy-lactic acidosis-stroke like episode (MELAS) syndrome. DNA was extracted from the peripheral blood, urine, hair follicle, and saliva of 25 MELAS syndrome patients carrying A3243G mutation and their mothers and other maternal relatives, 33 persons in number, and the muscle tissues from 5 patients obtained by biopsy. A3243G mutation was detected by PCR-RFLP method, and the A3243G mutation ratio was identified by measuring the density of each band and calculation with the software AlphaEase 5.0. A3243G mutations were detected in all tissues of the 25 MELAS patients. The A3243G mutation ratio in urine was 62% +/- 9%, significantly higher than that in the blood [(36% +/- 10%), t = -11.13, P < 0.01]. A3243G mutations were detected in at least one tissue of the 28 maternal relatives. The A3243G mutation rates in their urine samples was 33.0% (5.0% - 70.4%), significantly higher than that in their blood samples [8.0% (0 - 33.3%), z = -4.197, P < 0.01]. There was no significant difference in A3243G mutation ratio among the samples of hair follicle, saliva, and blood. The A3243G mutation ratio in urine is significantly higher than those in blood samples of the patients and their maternal relatives. A noninvasive method, A3243G mutation ratio analysis of urine is superior to that in blood.

  3. Correction of the consequences of mitochondrial 3243A>G mutation in the MT-TL1 gene causing the MELAS syndrome by tRNA import into mitochondria

    PubMed Central

    Karicheva, Olga Z.; Kolesnikova, Olga A.; Schirtz, Tom; Vysokikh, Mikhail Y.; Mager-Heckel, Anne-Marie; Lombès, Anne; Boucheham, Abdeldjalil; Krasheninnikov, Igor A.; Martin, Robert P.; Entelis, Nina; Tarassov, Ivan

    2011-01-01

    Mutations in human mitochondrial DNA are often associated with incurable human neuromuscular diseases. Among these mutations, an important number have been identified in tRNA genes, including 29 in the gene MT-TL1 coding for the tRNALeu(UUR). The m.3243A>G mutation was described as the major cause of the MELAS syndrome (mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes). This mutation was reported to reduce tRNALeu(UUR) aminoacylation and modification of its anti-codon wobble position, which results in a defective mitochondrial protein synthesis and reduced activities of respiratory chain complexes. In the present study, we have tested whether the mitochondrial targeting of recombinant tRNAs bearing the identity elements for human mitochondrial leucyl-tRNA synthetase can rescue the phenotype caused by MELAS mutation in human transmitochondrial cybrid cells. We demonstrate that nuclear expression and mitochondrial targeting of specifically designed transgenic tRNAs results in an improvement of mitochondrial translation, increased levels of mitochondrial DNA-encoded respiratory complexes subunits, and significant rescue of respiration. These findings prove the possibility to direct tRNAs with changed aminoacylation specificities into mitochondria, thus extending the potential therapeutic strategy of allotopic expression to address mitochondrial disorders. PMID:21724600

  4. Correction of the consequences of mitochondrial 3243A>G mutation in the MT-TL1 gene causing the MELAS syndrome by tRNA import into mitochondria.

    PubMed

    Karicheva, Olga Z; Kolesnikova, Olga A; Schirtz, Tom; Vysokikh, Mikhail Y; Mager-Heckel, Anne-Marie; Lombès, Anne; Boucheham, Abdeldjalil; Krasheninnikov, Igor A; Martin, Robert P; Entelis, Nina; Tarassov, Ivan

    2011-10-01

    Mutations in human mitochondrial DNA are often associated with incurable human neuromuscular diseases. Among these mutations, an important number have been identified in tRNA genes, including 29 in the gene MT-TL1 coding for the tRNA(Leu(UUR)). The m.3243A>G mutation was described as the major cause of the MELAS syndrome (mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes). This mutation was reported to reduce tRNA(Leu(UUR)) aminoacylation and modification of its anti-codon wobble position, which results in a defective mitochondrial protein synthesis and reduced activities of respiratory chain complexes. In the present study, we have tested whether the mitochondrial targeting of recombinant tRNAs bearing the identity elements for human mitochondrial leucyl-tRNA synthetase can rescue the phenotype caused by MELAS mutation in human transmitochondrial cybrid cells. We demonstrate that nuclear expression and mitochondrial targeting of specifically designed transgenic tRNAs results in an improvement of mitochondrial translation, increased levels of mitochondrial DNA-encoded respiratory complexes subunits, and significant rescue of respiration. These findings prove the possibility to direct tRNAs with changed aminoacylation specificities into mitochondria, thus extending the potential therapeutic strategy of allotopic expression to address mitochondrial disorders.

  5. Cardiac abnormalities in patients with mitochondrial DNA mutation 3243A>G.

    PubMed

    Majamaa-Voltti, Kirsi; Peuhkurinen, Keijo; Kortelainen, Marja-Leena; Hassinen, Ilmo E; Majamaa, Kari

    2002-08-01

    Tissues that depend on aerobic energy metabolism suffer most in diseases caused by mutations in mitochondrial DNA (mtDNA). Cardiac abnormalities have been described in many cases, but their frequency and clinical spectrum among patients with mtDNA mutations is unknown. Thirty-nine patients with the 3243A>G mtDNA mutation were examined, methods used included clinical evaluation, electrocardiogram, Holter recording and echocardiography. Autopsy reports on 17 deceased subjects were also reviewed. The degree of 3243A>G mutation heteroplasmy was determined using an Apa I restriction fragment analysis. Better hearing level (BEHL0.5-4 kHz) was used as a measure of the clinical severity of disease. Left ventricular hypertrophy (LVH) was diagnosed in 19 patients (56%) by echocardiography and in six controls (15%) giving an odds ratio of 7.5 (95% confidence interval; 1.74-67). The dimensions of the left ventricle suggested a concentric hypertrophy. Left ventricular systolic or diastolic dysfunction was observed in 11 patients. Holter recording revealed frequent ventricular extrasystoles (>10/h) in five patients. Patients with LVH differed significantly from those without LVH in BEHL0.5-4 kHz, whereas the contribution of age or the degree of the mutant heteroplasmy in skeletal muscle to the risk of LVH was less remarkable. Structural and functional abnormalities of the heart were common in patients with 3243A>G. The risk of LVH was related to the clinical severity of the phenotype, and to a lesser degree to age, suggesting that patients presenting with any symptoms from the mutation should also be evaluated for cardiac abnormalities.

  6. Cardiac abnormalities in patients with mitochondrial DNA mutation 3243A>G

    PubMed Central

    Majamaa-Voltti, Kirsi; Peuhkurinen, Keijo; Kortelainen, Marja-Leena; Hassinen, Ilmo E; Majamaa, Kari

    2002-01-01

    Background Tissues that depend on aerobic energy metabolism suffer most in diseases caused by mutations in mitochondrial DNA (mtDNA). Cardiac abnormalities have been described in many cases, but their frequency and clinical spectrum among patients with mtDNA mutations is unknown. Methods Thirty-nine patients with the 3243A>G mtDNA mutation were examined, methods used included clinical evaluation, electrocardiogram, Holter recording and echocardiography. Autopsy reports on 17 deceased subjects were also reviewed. The degree of 3243A>G mutation heteroplasmy was determined using an Apa I restriction fragment analysis. Better hearing level (BEHL0.5–4 kHz) was used as a measure of the clinical severity of disease. Results Left ventricular hypertrophy (LVH) was diagnosed in 19 patients (56%) by echocardiography and in six controls (15%) giving an odds ratio of 7.5 (95% confidence interval; 1.74–67). The dimensions of the left ventricle suggested a concentric hypertrophy. Left ventricular systolic or diastolic dysfunction was observed in 11 patients. Holter recording revealed frequent ventricular extrasystoles (>10/h) in five patients. Patients with LVH differed significantly from those without LVH in BEHL0.5–4 kHz, whereas the contribution of age or the degree of the mutant heteroplasmy in skeletal muscle to the risk of LVH was less remarkable. Conclusions Structural and functional abnormalities of the heart were common in patients with 3243A>G. The risk of LVH was related to the clinical severity of the phenotype, and to a lesser degree to age, suggesting that patients presenting with any symptoms from the mutation should also be evaluated for cardiac abnormalities. PMID:12150714

  7. Cerebral metabolic abnormalities in A3243G mitochondrial DNA mutation carriers

    PubMed Central

    Weiduschat, Nora; Kaufmann, Petra; Mao, Xiangling; Engelstad, Kristin Marie; Hinton, Veronica; DiMauro, Salvatore; De Vivo, Darryl

    2014-01-01

    Objective: To establish cerebral metabolic features associated with the A3243G mitochondrial DNA mutation with proton magnetic resonance spectroscopic imaging (1H MRSI) and to assess their potential as prognostic biomarkers. Methods: In this prospective cohort study, we investigated 135 clinically heterogeneous A3243G mutation carriers and 30 healthy volunteers (HVs) with 1H MRSI. Mutation carriers included 45 patients with mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes (MELAS); 11 participants who would develop the MELAS syndrome during follow-up (converters); and 79 participants who would not develop the MELAS syndrome during follow-up (nonconverters). The groups were compared with respect to MRSI metabolic indices of 1) anaerobic energy metabolism (lactate), 2) neuronal integrity (N-acetyl-l-aspartate [NAA]), 3) mitochondrial function (NAA; lactate), 4) cell energetics (total creatine), and 5) membrane biosynthesis and turnover (total choline [tCho]). Results: Consistent with prior studies, the patients with MELAS had higher lactate (p < 0.001) and lower NAA levels (p = 0.01) than HVs. Unexpectedly, converters showed higher NAA (p = 0.042), tCho (p = 0.004), and total creatine (p = 0.002), in addition to higher lactate levels (p = 0.032), compared with HVs. Compared with nonconverters, converters had higher tCho (p = 0.015). Clinically, converters and nonconverters did not differ at baseline. Lactate and tCho levels were reliable biomarkers for predicting the risk of individual mutation carriers to develop the MELAS phenotype. Conclusions: 1H MRSI assessment of cerebral metabolism in A3243G mutation carriers shows promise in identifying disease biomarkers as well as individuals at risk of developing the MELAS phenotype. PMID:24477106

  8. Anatomic & metabolic brain markers of the m.3243A>G mutation: A multi-parametric 7T MRI study.

    PubMed

    Haast, Roy A M; Ivanov, Dimo; IJsselstein, Rutger J T; Sallevelt, Suzanne C E H; Jansen, Jacobus F A; Smeets, Hubert J M; de Coo, Irenaeus F M; Formisano, Elia; Uludağ, Kâmil

    2018-01-01

    One of the most common mitochondrial DNA (mtDNA) mutations, the A to G transition at base pair 3243, has been linked to changes in the brain, in addition to commonly observed hearing problems, diabetes and myopathy. However, a detailed quantitative description of m.3243A>G patients' brains has not been provided so far. In this study, ultra-high field MRI at 7T and volume- and surface-based data analyses approaches were used to highlight morphology (i.e. atrophy)-, microstructure (i.e. myelin and iron concentration)- and metabolism (i.e. cerebral blood flow)-related differences between patients (N = 22) and healthy controls (N = 15). The use of quantitative MRI at 7T allowed us to detect subtle changes of biophysical processes in the brain with high accuracy and sensitivity, in addition to typically assessed lesions and atrophy. Furthermore, the effect of m.3243A>G mutation load in blood and urine epithelial cells on these MRI measures was assessed within the patient population and revealed that blood levels were most indicative of the brain's state and disease severity, based on MRI as well as on neuropsychological data. Morphometry MRI data showed a wide-spread reduction of cortical, subcortical and cerebellar gray matter volume, in addition to significantly enlarged ventricles. Moreover, surface-based analyses revealed brain area-specific changes in cortical thickness (e.g. of the auditory cortex), and in T 1 , T 2 * and cerebral blood flow as a function of mutation load, which can be linked to typically m.3243A>G-related clinical symptoms (e.g. hearing impairment). In addition, several regions linked to attentional control (e.g. middle frontal gyrus), the sensorimotor network (e.g. banks of central sulcus) and the default mode network (e.g. precuneus) were characterized by alterations in cortical thickness, T 1 , T 2 * and/or cerebral blood flow, which has not been described in previous MRI studies. Finally, several hypotheses, based either on vascular

  9. [Diabetes mellitus associated with the mitochondrial mutation A3243G: frequency and clinical presentation].

    PubMed

    Salles, João Eduardo N; Kalinin, Larissa Bresgunov; Ferreira, Sandra Roberta G; Kasamatsu, Teresa; Moisés, Regina S

    2007-06-01

    Maternal inherited diabetes and deafness (MIDD) has been related to an A to G transition in the mitochondrial RNA Leu (UUR) at base pair 3243. The prevalence of MIDD in the diabetes population ranges between 0.5-3.0% depending on the ethnic background. To examine the frequency and clinical features of diabetes associated with this mutation in Brazilian patients with glucose intolerance. The study population comprised: 78 type 1 diabetic subjects (group I), 148 patients with type 2 diabetes (group II), 15 patients with either type 1 or type 2 diabetes and hearing loss (group III) and 492 Japanese Brazilians with varying degrees of glucose intolerance. DNA was extracted from peripheral blood leucocytes and the A3243G mutation was determined by PCR amplification and Apa 1 digestion. In some individuals DNA was also extracted from buccal mucosa and hair follicles. The 3243 bp mutation was found in three individuals, all from group III, resulting in a prevalence of 0.4%. These subjects had an early age of diagnosis of diabetes, low or normal body mass index and requirement of insulin therapy. In conclusion MIDD is rare in our population and should be investigate in patients with diabetes and deafness.

  10. MELAS syndrome associated with both A3243G-tRNALeu mutation and multiple mitochondrial DNA deletions.

    PubMed

    Aharoni, Sharon; Traves, Teres A; Melamed, Eldad; Cohen, Sarit; Silver, Esther Leshinsky

    2010-09-15

    The syndrome of mitochondrial encephalopathy, lactic acidosis, and stroke-like episode (MELAS) is characterized clinically by recurrent focal neurological deficits, epilepsy, and short stature. The phenotypic spectrum is extremely diverse, with multisystemic organ involvement leading to isolated diabetes, deafness, renal tubulopathy, hypertrophic cardiomyopathy, and retinitis pigmentosa. In 80% of cases, the syndrome is associated with an AG transmission mutation (A3243G) in the tRNALeu gene of the mitochondrial DNA (mtDNA). We describe a woman with a unique combination of the MELAS A3243G mutation and multiple mtDNA deletions with normal POLG sequence. The patient presented with diabetes mellitus, sensorineural deafness, short stature, and mental disorientation. All her three children died in early adolescence. 2010 Elsevier B.V. All rights reserved.

  11. Mitochondrial DNA mutations in diabetes mellitus patients in Chinese Han population.

    PubMed

    Wang, Suijun; Wu, Songhua; Zheng, Taishan; Yang, Zhen; Ma, Xiaojing; Jia, Weiping; Xiang, Kunsan

    2013-12-01

    Mutations of mitochondrial DNA are associated with diabetes mellitus (DM). The present case-control study aimed to investigate the mutations of mitochondrial DNA in DM patients of Chinese Han ethnicity. A total of 770 DM patients and 309 healthy control individuals were enrolled. The mitochondrial DNA was extracted from blood cells and analyzed by the polymerase chain reaction-restriction fragment length polymorphism assay. In the diabetes group, there were 13 (1.69%) individuals carrying the mt3243 AG mutation while none of the healthy control had this mutation. Though the 14709, 3316, 3394, and 12026 mutation variants were identified in 9, 17, 18 and 28 in DM patients respectively, there were no significant differences compared with control group. And the 3256, 8296, 8344, 8363, 3426 and 12258 mutations were not detected in either group. In the diabetes group, two double mutations were identified: A3243G+T3394C and A3243G+A12026G. Our data suggested that mitochondrial gene tRNA(Leu(UUR)) 3243 AG mutation may be one risk of prevalence of DM and associated with worse clinical status in Chinese Han population. © 2013 Elsevier B.V. All rights reserved.

  12. The UK MRC Mitochondrial Disease Patient Cohort Study: clinical phenotypes associated with the m.3243A>G mutation--implications for diagnosis and management.

    PubMed

    Nesbitt, Victoria; Pitceathly, Robert D S; Turnbull, Doug M; Taylor, Robert W; Sweeney, Mary G; Mudanohwo, Ese E; Rahman, Shamima; Hanna, Michael G; McFarland, Robert

    2013-08-01

    Population-based studies suggest the m.3243A>G mutation in MTTL1 is the most common disease-causing mtDNA mutation, with a carrier rate of 1 in 400 people. The m.3243A>G mutation is associated with several clinical syndromes including mitochondrial encephalopathy lactic acidosis and stroke-like episodes (MELAS), maternally inherited deafness and diabetes (MIDD) and progressive external ophthalmoplegia (PEO). Many patients affected by this mutation exhibit a clinical phenotype that does not fall within accepted criteria for the currently recognised classical mitochondrial syndromes. We have defined the phenotypic spectrum associated with the m.3243A>G mtDNA mutation in 129 patients, from 83 unrelated families, recruited to the Mitochondrial Disease Patient Cohort Study UK. 10% of patients exhibited a classical MELAS phenotype, 30% had MIDD, 6% MELAS/MIDD, 2% MELAS/chronic PEO (CPEO) and 5% MIDD/CPEO overlap syndromes. 6% had PEO and other features of mitochondrial disease not consistent with another recognised syndrome. Isolated sensorineural hearing loss occurred in 3%. 28% of patients demonstrated a panoply of clinical features, which were not consistent with any of the classical syndromes associated with the m.3243A>G mutation. 9% of individuals harbouring the mutation were clinically asymptomatic. Following this study we propose guidelines for screening and for the management of confirmed cases.

  13. A pilot study of mitochondrial DNA point mutation A3243G in a sample of Croatian patients having type 2 diabetes mellitus associated with maternal inheritance.

    PubMed

    Martin-Kleiner, I; Pape-Medvidović, E; Pavlić-Renar, I; Metelko, Z; Kusec, R; Gabrilovac, J; Boranić, M

    2004-12-01

    In this work, patients having type 2 diabetes mellitus and diabetic mothers were tested for the presence of mitochondrial DNA point mutation A3243G. This mutation is associated with the MELAS syndrome (mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes), diabetes and deafness. Twenty-two diabetic persons were screened. DNA was isolated from peripheral blood lymphocytes and from swabs of oral mucosa. The mitochondrial DNA point mutation A3243G was detected using PCR-RFLP test. The mutation was detected in oral mucosal DNA of two patients (but not from lymphocyte DNA). One patient was a man with hearing and visual impairments and proteinuria; the other was a woman having proteinuria but no hearing impairment. The mutation was not detectable in oral mucosal DNA from the control persons: 20 diabetic patients having diabetic fathers and 22 healthy, nondiabetic volunteers. The incidence of mitochondrial DNA point mutation A3243G in this study of Croatian diabetic patients is in line with data in the literature.

  14. Evaluation of systemic redox states in patients carrying the MELAS A3243G mutation in mitochondrial DNA.

    PubMed

    Ikawa, Masamichi; Arakawa, Kenichiro; Hamano, Tadanori; Nagata, Miwako; Nakamoto, Yasunari; Kuriyama, Masaru; Koga, Yasutoshi; Yoneda, Makoto

    2012-01-01

    To clarify the change of systemic redox states in patients carrying the A3243G mutation in mitochondrial DNA (A3243G), we evaluated oxidative stress and antioxidant activity in the serum of patients. Oxidative stress and antioxidant activity in the serum samples obtained from 14 patients carrying A3243G and from 34 healthy controls were analyzed using the diacron-reactive oxygen metabolites (d-ROMs) and biological antioxidant potential (BAP) tests, respectively. The mean d-ROMs level of all patients was significantly greater than that of the controls (p < 0.005), and the mean BAP/d-ROMs ratio of all patients was significantly lower than that of the controls (p < 0.02). In the patients with a history of stroke-like episodes (n = 10), both mean d-ROMs and BAP levels were increased compared with those of the controls (both p < 0.01). The mean BAP level of the patients without a history of stroke-like episodes (n = 4) was significantly decreased compared with that of the controls (p < 0.001), but the mean d-ROMs levels were not significantly different. d-ROMs and BAP tests indicated that patients carrying A3243G are always exposed to underlying oxidative stress, even at a remission state of stroke-like episodes. Copyright © 2012 S. Karger AG, Basel.

  15. Sudden adult death syndrome in m.3243A>G-related mitochondrial disease: an unrecognized clinical entity in young, asymptomatic adults.

    PubMed

    Ng, Yi Shiau; Grady, John P; Lax, Nichola Z; Bourke, John P; Alston, Charlotte L; Hardy, Steven A; Falkous, Gavin; Schaefer, Andrew G; Radunovic, Aleksandar; Mohiddin, Saidi A; Ralph, Matilda; Alhakim, Ali; Taylor, Robert W; McFarland, Robert; Turnbull, Douglass M; Gorman, Gráinne S

    2016-08-21

    To provide insight into the mechanism of sudden adult death syndrome (SADS) and to give new clinical guidelines for the cardiac management of patients with the most common mitochondrial DNA mutation, m.3243A>G. These studies were initiated after two young, asymptomatic adults harbouring the m.3243A>G mutation died suddenly and unexpectedly. The m.3243A>G mutation is present in ∼1 in 400 of the population, although the recognized incidence of mitochondrial DNA (mtDNA) disease is ∼1 in 5000. Pathological studies including histochemistry and molecular genetic analyses performed on various post-mortem samples including cardiac tissues (atrium and ventricles) showed marked respiratory chain deficiency and high levels of the m.3243A>G mutation. Systematic review of cause of death in our m.3243A>G patient cohort showed the person-time incidence rate of sudden adult death is 2.4 per 1000 person-years. A further six cases of sudden death among extended family members have been identified from interrogation of family pedigrees. Our findings suggest that SADS is an important cause of death in patients with m.3243A>G and likely to be due to widespread respiratory chain deficiency in cardiac muscle. The involvement of asymptomatic relatives highlights the importance of family tracing in patients with m.3243A>G and the need for specific cardiac arrhythmia surveillance in the management of this common genetic disease. In addition, these findings have prompted the derivation of cardiac guidelines specific to patients with m.3243A>G-related mitochondrial disease. Finally, due to the prevalence of this mtDNA point mutation, we recommend inclusion of testing for m.3243A>G mutations in the genetic autopsy of all unexplained cases of SADS. © The Author 2015. Published by Oxford University Press on behalf of the European Society of Cardiology.

  16. Valproic acid aggravates epilepsy due to MELAS in a patient with an A3243G mutation of mitochondrial DNA.

    PubMed

    Lin, Chih-Ming; Thajeb, Peterus

    2007-03-01

    Epilepsy is one of the most common presentations of patients with mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS). MELAS is typically caused by an A-to-G substitution at nucleotide position 3243 of mitochondrial DNA. Valproic acid, a common anticonvulsant, can actually increase the frequency of seizures in individuals with MELAS. Here, we report a single case-study of a 38-year-old man who presented with focal seizures and had MELAS Syndrome due to the A3243G mitochondrial DNA mutation. Manifestation of epilepsia partialis continua was aggravated by use of valproic acid. Convulsions abated after discontinuation of valproic acid. Our experience suggests that valproic acid should be avoided for the treatment of epilepsy in individuals with mitochondrial disease.

  17. Dysphagia, malnutrition and gastrointestinal problems in patients with mitochondrial disease caused by the m3243A>G mutation.

    PubMed

    de Laat, P; Zweers, H E E; Knuijt, S; Smeitink, J A M; Wanten, G J A; Janssen, M C H

    2015-01-01

    Previous research has shown that dysphagia and gastrointestinal problems occur frequently in carriers of the m.3243A>G mutation; however, the exact frequency and severity have not been determined. We hypothesise that adult carriers have an increased risk for malnutrition. In this observational study we evaluated the presence of gastrointestinal problems and dysphagia in 92 carriers of the m.3243A>G mutation. The severity of the general disease involvement was classified using the Newcastle Mitochondrial Disease Adult Scale (NMDAS). Gastrointestinal involvement, dysphagia and the risk for malnutrition were scored using the Gastrointestinal Symptoms Questionnaire and the Malnutrition Universal Screening Tool. Gastrointestinal symptoms and anthropometrics were compared with healthy controls. Our results show that the height, weight and body mass index (BMI) of these carriers were lower than the national average (p < 0.05). Seventy-nine carriers (86%) suffered from at least one gastrointestinal symptom, mainly flatulence or hard stools. Both frequency and severity of symptoms were significantly increased compared with reference data of healthy Dutch adults. Of the carriers, 45% reported (mostly mild) dysphagia. Solid foods cause more problems than liquids. A negative correlation between BMI and heteroplasmy levels in urinary epithelial cells (UEC) was present (Spearman correlation coefficient = - 0.319, p = 0.003). Dysphagia and gastrointestinal problems, especially constipation, are common symptoms in the total m.3243A>G carriers cohort and are not related to heteroplasmy levels in UEC or disease severity. The severity of gastrointestinal problems as well as overall disease severity is associated with an increased risk for malnutrition.

  18. Pigmentary retinopathy associated with the mitochondrial DNA 3243 point mutation.

    PubMed

    Sue, C M; Mitchell, P; Crimmins, D S; Moshegov, C; Byrne, E; Morris, J G

    1997-10-01

    Fourteen patients from four unrelated families were studied to determine the prevalence of retinal pigmentary abnormalities associated with the MELAS A to G 3243 point mutation. Neurologic and ophthalmic examinations, retinal photography, pattern shift visual evoked potentials, and electroretinography were performed in all patients. Eight of the 14 patients had retinal pigmentary abnormalities characterized by symmetric areas of depigmentation involving predominantly the posterior pole and midperipheral retina. None of the patients had optic atrophy and only one patient with pigmentary retinal abnormalities had impaired visual acuity. None of the diabetic subjects (n = 6) had signs of diabetic retinopathy. Fluorescein angiography demonstrated mottled hyper- and hypofluorescent areas indicating multiple window defects in the retinal pigmentary epithelium. Visual evoked potentials showed delayed P100 responses in four of the eight patients with retinal pigmentary abnormalities. We conclude that there is a high prevalence of retinal pigmentary abnormalities in patients with MELAS A to G 3243 point mutation. These abnormalities are usually asymptomatic and best detected by retinal photography.

  19. Hearing loss caused by a P2RX2 mutation identified in a MELAS family with a coexisting mitochondrial 3243AG mutation

    PubMed Central

    Moteki, Hideaki; Azaiez, Hela; Booth, Kevin T; Hattori, Mitsuru; Sato, Ai; Sato, Yoshihiko; Motobayashi, Mitsuo; Sloan, Christina M; Kolbe, Diana L; Shearer, A Eliot; Smith, Richard J H; Usami, Shin-ichi

    2015-01-01

    Objective We present a family with a mitochondrial DNA 3243A>G mutation resulting in MELAS, of which some members have hearing loss where a novel mutation in the P2RX2 gene was identified. Methods One hundred ninety-four (194) Japanese subjects from unrelated families were enrolled in the study. Targeted genomic enrichment and massively parallel sequencing of all known non-syndromic hearing loss genes were performed to identify the genetic causes of hearing loss. Results A novel mutation in the P2RX2 gene, that corresponded to c.601G>A (p.Asp201Tyr) was identified. Two patients carried the mutation, and had severe SNHL, while other members with MELAS (who did not carry the P2RX2 mutation) had normal hearing. Conclusion This is the first case report of a diagnosis of hearing loss caused by P2RX2 mutation in patients with MELAS. A potential explanation is that decreasing ATP production due to MELAS with mitochondrial 3243A>G mutation might suppress activation of P2X2 receptors. We also suggest that hearing loss caused by the P2RX2 mutation might be influenced by the decrease in ATP production due to MELAS, and that nuclear genetic factors may play a modifying role in mitochondrial dysfunction. PMID:25788561

  20. Prediction of long-term prognosis by heteroplasmy levels of the m.3243A>G mutation in patients with the mitochondrial encephalomyopathy, lactic acidosis and stroke-like episodes syndrome.

    PubMed

    Fayssoil, A; Laforêt, P; Bougouin, W; Jardel, C; Lombès, A; Bécane, H M; Berber, N; Stojkovic, T; Béhin, A; Eymard, B; Duboc, D; Wahbi, K

    2017-02-01

    Our aim was to determine the prognostic value of urine and blood heteroplasmy in patients with the m.3243A>G mutation. Adults with the m.3243A>G mutation referred to our institution between January 2000 and May 2014 were retrospectively included. The relationship between their baseline clinical characteristics, their mutation load in urine and blood, and major adverse events (MAEs) during follow-up, defined as medical complications requiring a hospitalization or complicated by death, was studied. Of the 43 patients (age 45.6 ± 13.3 years) included in the study, 36 patients were symptomatic, including nine with evidence of focal brain involvement, and seven were asymptomatic. Over a 5.5 ± 4.0 year mean follow-up duration, 14 patients (33%) developed MAEs. Patients with MAEs had a higher mutation load than others in urine (60.1% ± 13.8% vs. 40.6% ± 26.2%, P = 0.01) and in blood (26.9% ± 18.4% vs. 16.0% ± 12.1%, P = 0.03). Optimal cutoff values for the prediction of MAEs were 45% for urine and 35% for blood. In multivariate analysis, mutation load in urine ≥45% [odds ratio 25.3; 95% confidence interval (CI) 1.1-567.8; P = 0.04], left ventricular hypertrophy (odds ratio 16.7; 95% CI 1.3- 222.5; P = 0.03) and seizures (odds ratio 48.3; 95% CI 2.5-933; P = 0.01) were associated with MAEs. Patients with the m.3243A>G mutation are at high risk of MAEs, which can be independently predicted by mutation load in urine ≥45%, a personal history of seizures, and left ventricular hypertrophy. © 2016 EAN.

  1. Segregation of mtDNA Throughout Human Embryofetal Development: m.3243A > G as a Model System

    PubMed Central

    Monnot, Sophie; Gigarel, Nadine; Samuels, David C; Burlet, Philippe; Hesters, Laetitia; Frydman, Nelly; Frydman, René; Kerbrat, Violaine; Funalot, Benoit; Martinovic, Jelena; Benachi, Alexandra; Feingold, Josué; Munnich, Arnold; Bonnefont, Jean-Paul; Steffann, Julie

    2011-01-01

    Mitochondrial DNA (mtDNA) mutations cause a wide range of serious diseases with high transmission risk and maternal inheritance. Tissue heterogeneity of the heteroplasmy rate (“mutant load”) accounts for the wide phenotypic spectrum observed in carriers. Owing to the absence of therapy, couples at risk to transmit such disorders commonly ask for prenatal (PND) or preimplantation diagnosis (PGD). The lack of data regarding heteroplasmy distribution throughout intrauterine development, however, hampers the implementation of such procedures. We tracked the segregation of the m.3243A > G mutation (MT-TL1 gene) responsible for the MELAS syndrome in the developing embryo/fetus, using tissues and cells from eight carrier females, their 38 embryos and 12 fetuses. Mutant mtDNA segregation was found to be governed by random genetic drift, during oogenesis and somatic tissue development. The size of the bottleneck operating for m.3243A > G during oogenesis was shown to be individual-dependent. Comparison with data we achieved for the m.8993T > G mutation (MT-ATP6 gene), responsible for the NARP/Leigh syndrome, indicates that these mutations differentially influence mtDNA segregation during oogenesis, while their impact is similar in developing somatic tissues. These data have major consequences for PND and PGD procedures in mtDNA inherited disorders. Hum Mutat 32:116–125, 2011. © 2010 Wiley-Liss, Inc. PMID:21120938

  2. Is 2D speckle tracking echocardiography useful for detecting and monitoring myocardial dysfunction in adult m.3243A>G carriers? - a retrospective pilot study.

    PubMed

    Koene, S; Timmermans, J; Weijers, G; de Laat, P; de Korte, C L; Smeitink, J A M; Janssen, M C H; Kapusta, L

    2017-03-01

    Cardiomyopathy is a common complication of mitochondrial disorders, associated with increased mortality. Two dimensional speckle tracking echocardiography (2DSTE) can be used to quantify myocardial deformation. Here, we aimed to determine the usefulness of 2DSTE in detecting and monitoring subtle changes in myocardial dysfunction in carriers of the 3243A>G mutation in mitochondrial DNA. In this retrospective pilot study, 30 symptomatic and asymptomatic carriers of the mitochondrial 3243A>G mutation of whom two subsequent echocardiograms were available were included. We measured longitudinal, circumferential and radial strain using 2DSTE. Results were compared to published reference values. Speckle tracking was feasible in 90 % of the patients for longitudinal strain. Circumferential and radial strain showed low face validity (low number of images with sufficient quality; suboptimal tracking) and were therefore rejected for further analysis. Global longitudinal strain showed good face validity, and was abnormal in 56-70 % (depending on reference values used) of the carriers (n = 27). Reproducibility was good (mean difference of 0.83 for inter- and 0.40 for intra-rater reproducibility; ICC 0.78 and 0.89, respectively). The difference between the first and the second measurement exceeded the measurement variance in 39 % of the cases (n = 23; feasibility of follow-up 77 %). Even in data collected as part of clinical care, two-dimensional strain echocardiography seems a feasible method to detect and monitor subtle changes in longitudinal myocardial deformation in adult carriers of the mitochondrial 3243A>G mutation. Based on our data and the reported accuracy of global longitudinal strain in other studies, we suggest the use of global longitudinal strain in a prospective follow-up or intervention study.

  3. Mitochondrial diabetes: molecular mechanisms and clinical presentation.

    PubMed

    Maassen, J Antonie; 'T Hart, Leen M; Van Essen, Einar; Heine, Rob J; Nijpels, Giel; Jahangir Tafrechi, Roshan S; Raap, Anton K; Janssen, George M C; Lemkes, Herman H P J

    2004-02-01

    Mutations in mitochondrial DNA (mtDNA) associate with various disease states. A few mtDNA mutations strongly associate with diabetes, with the most common mutation being the A3243G mutation in the mitochondrial DNA-encoded tRNA(Leu,UUR) gene. This article describes clinical characteristics of mitochondrial diabetes and its molecular diagnosis. Furthermore, it outlines recent developments in the pathophysiological and molecular mechanisms leading to a diabetic state. A gradual development of pancreatic beta-cell dysfunction upon aging, rather than insulin resistance, is the main mechanism in developing glucose intolerance. Carriers of the A3243G mutation show during a hyperglycemic clamp at 10 mmol/l glucose a marked reduction in first- and second-phase insulin secretion compared with noncarriers. The molecular mechanism by which the A3243G mutation affects insulin secretion may involve an attenuation of cytosolic ADP/ATP levels leading to a resetting of the glucose sensor in the pancreatic beta-cell, such as in maturity-onset diabetes of the young (MODY)-2 patients with mutations in glucokinase. Unlike in MODY2, which is a nonprogressive form of diabetes, mitochondrial diabetes does show a pronounced age-dependent deterioration of pancreatic function indicating involvement of additional processes. Furthermore, one would expect that all mtDNA mutations that affect ATP synthesis lead to diabetes. This is in contrast to clinical observations. The origin of the age-dependent deterioration of pancreatic function in carriers of the A3243G mutation and the contribution of ATP and other mitochondrion-derived factors such as reactive oxygen species to the development of diabetes is discussed.

  4. Tissue- and cell-type–specific manifestations of heteroplasmic mtDNA 3243A>G mutation in human induced pluripotent stem cell-derived disease model

    PubMed Central

    Hämäläinen, Riikka H.; Manninen, Tuula; Koivumäki, Hanna; Kislin, Mikhail; Otonkoski, Timo; Suomalainen, Anu

    2013-01-01

    Mitochondrial DNA (mtDNA) mutations manifest with vast clinical heterogeneity. The molecular basis of this variability is mostly unknown because the lack of model systems has hampered mechanistic studies. We generated induced pluripotent stem cells from patients carrying the most common human disease mutation in mtDNA, m.3243A>G, underlying mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes (MELAS) syndrome. During reprogramming, heteroplasmic mtDNA showed bimodal segregation toward homoplasmy, with concomitant changes in mtDNA organization, mimicking mtDNA bottleneck during epiblast specification. Induced pluripotent stem cell–derived neurons and various tissues derived from teratomas manifested cell-type specific respiratory chain (RC) deficiency patterns. Similar to MELAS patient tissues, complex I defect predominated. Upon neuronal differentiation, complex I specifically was sequestered in perinuclear PTEN-induced putative kinase 1 (PINK1) and Parkin-positive autophagosomes, suggesting active degradation through mitophagy. Other RC enzymes showed normal mitochondrial network distribution. Our data show that cellular context actively modifies RC deficiency manifestation in MELAS and that autophagy is a significant component of neuronal MELAS pathogenesis. PMID:24003133

  5. Decrease of 3243 A→G mtDNA Mutation from Blood in MELAS Syndrome: A Longitudinal Study

    PubMed Central

    Rahman, S.; Poulton, J.; Marchington, D.; Suomalainen, A.

    2001-01-01

    It is widely held that changes in the distribution of mutant mtDNAs underlie the progressive nature of mtDNA diseases, but there are few data documenting such changes. We compared the levels of 3243 A→G mutant mtDNA in blood at birth from Guthrie cards and at the time of diagnosis in a blood DNA sample from patients with mitochondrial encephalopathy, lactic acidosis, and strokelike episodes (MELAS) syndrome. Paired blood DNA samples separated by 9–19 years were obtained from six patients with MELAS. Quantification of mutant load, by means of a solid-phase minisequencing technique, demonstrated a decline (range 12%–29%) in the proportion of mutant mtDNA in all cases (P=.0015, paired t-test). These results suggest that mutant mtDNA is slowly selected from rapidly dividing blood cells in MELAS. PMID:11085913

  6. The clinical characteristics of patients with mitochondrial tRNA Leu(UUR)m.3243A > G mutation: Compared with type 1 diabetes and early onset type 2 diabetes.

    PubMed

    Zhu, Jie; Yang, Peng; Liu, Xiang; Yan, Li; Rampersad, Sharvan; Li, Feng; Li, Hong; Sheng, Chunjun; Cheng, Xiaoyun; Zhang, Manna; Qu, Shen

    2017-08-01

    This study presents nine patients with mitochondrial tRNA Leu (UUR) m.3243A>G mutation and compares the clinical characteristics and diabetes complications with type 1 diabetes (T1DM) or early onset type 2 diabetes (T2DM). The study covers 9 patients with MIDD, 33 patients with T1DM and 86 patients (age of onset ≤35years) with early onset T2DM, matched for sex, age at onset of diabetes, duration of diabetes. All patients with MIDD were confirmed as carrying the m.3243A>G mitochondrial DNA mutation. Serum HbA1c, beta-cell function, retinal and renal complications of diabetes, bone metabolic markers, lumbar spine and femoral neck BMD bone mineral density were compared to characterize the clinical features of all patients. Nine patients were from five unrelated families, and the mean (SD) onset age of those patients was 31.2±7.2year. Two patients required insulin at presentation, and six patients progressed to insulin requirement after a mean of 7.2years. β-Cell function in the MIDD group was intermediate between T1DM and early-onset T2DM. In MIDD, four patients were diagnosed as diabetic retinopathy (4/9) and five patients (5/9) had macroalbuminuria. The number of patients with diabetic retinopathy and macroalbuminuria in the MIDD group was comparable to T1DM or early-onset T2DM. The rate of osteoporosis (BMD T-score<-2.5 SD) in the patient with MIDD was higher than the T1DM or early-onset T2DM group. Our study indicates that of the nine subjects with MIDD, three patients (1-II-1, 1-II-3, 1-II-4) who came from the same family had a history of acute pancreatitis. Compared with T1DM or early-onset T2DM matched for sex, age, duration of diabetes, MIDD patients had the highest rate of osteoporosis. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. A Wide Range of 3243A>G/tRNALeu(UUR) (MELAS) Mutation Loads May Segregate in Offspring through the Female Germline Bottleneck

    PubMed Central

    Pallotti, Francesco; Binelli, Giorgio; Fabbri, Raffaella; Valentino, Maria L.; Vicenti, Rossella; Macciocca, Maria; Cevoli, Sabina; Baruzzi, Agostino; DiMauro, Salvatore; Carelli, Valerio

    2014-01-01

    Segregation of mutant mtDNA in human tissues and through the germline is debated, with no consensus about the nature and size of the bottleneck hypothesized to explain rapid generational shifts in mutant loads. We investigated two maternal lineages with an apparently different inheritance pattern of the same pathogenic mtDNA 3243A>G/tRNALeu(UUR) (MELAS) mutation. We collected blood cells, muscle biopsies, urinary epithelium and hair follicles from 20 individuals, as well as oocytes and an ovarian biopsy from one female mutation carrier, all belonging to the two maternal lineages to assess mutant mtDNA load, and calculated the theoretical germline bottleneck size (number of segregating units). We also evaluated “mother-to-offspring” segregations from the literature, for which heteroplasmy assessment was available in at least three siblings besides the proband. Our results showed that mutation load was prevalent in skeletal muscle and urinary epithelium, whereas in blood cells there was an inverse correlation with age, as previously reported. The histoenzymatic staining of the ovarian biopsy failed to show any cytochrome-c-oxidase defective oocyte. Analysis of four oocytes and one offspring from the same unaffected mother of the first family showed intermediate heteroplasmic mutant loads (10% to 75%), whereas very skewed loads of mutant mtDNA (0% or 81%) were detected in five offspring of another unaffected mother from the second family. Bottleneck size was 89 segregating units for the first mother and 84 for the second. This was remarkably close to 88, the number of “segregating units” in the “mother-to-offspring” segregations retrieved from literature. In conclusion, a wide range of mutant loads may be found in offspring tissues and oocytes, resulting from a similar theoretical bottleneck size. PMID:24805791

  8. The expanding clinical phenotype of the tRNA{sup Leu(UUR)} A{r_arrow}G mutation at np 3243 of mitochondrial DNA: Diabetic embryopathy associated with mitochondrial cytopathy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Feigenbaum, A.; Chitayat, D.; Robinson, B.

    1996-04-24

    We describe a family which demonstrates and expands the extreme clinical variability now known to be associated with the A{r_arrow}G transition at nucleotide position 3243 of the mitochondrial DNA. The propositus presented at birth with clinical manifestations consistent with diabetic embryopathy including anal atresia, caudal dysgenesis, and multicystic dysplastic kidneys. His co-twin was normal at birth, but at 3 months of life, presented with intractable seizures later associated with developmental delay. The twins` mother developed diabetes mellitus type I at the age of 20 years and gastrointestinal problems at 22 years. Since age 19 years, the maternal aunt has hadmore » recurrent strokes, seizures, mental deterioration and deafness, later diagnosed as MELAS syndrome due to the tRNA{sup Leu(UUR)} A{r_arrow}G mutation. A maternal uncle had diabetes mellitus type I, deafness, and normal intellect, and died at 35 years after recurrent strokes. This pedigree expands the known clinical phenotype associated with tRNA{sup Leu(UUR)} A{r_arrow}G mutation and raises the possibility that, in some cases, diabetic embryopathy may be due to a mitochondrial cytopathy that affects both the mother`s pancreas (and results in diabetes mellitus and the metabolic dysfunction associated with it) and the embryonic/fetal and placental tissues which make the embryo more vulnerable to this insult. 33 refs., 1 tab.« less

  9. Pathology of mitochondria in MELAS syndrome: an ultrastructural study.

    PubMed

    Felczak, Paulina; Lewandowska, Eliza; Stępniak, Iwona; Ołdak, Monika; Pollak, Agnieszka; Lechowicz, Urszula; Pasennik, Elżbieta; Stępień, Tomasz; Wierzba-Bobrowicz, Teresa

    Ultrastructural changes in skeletal muscle biopsy in a 24-year-old female patient with clinically suspected mitochondrial encephalomyopathy lactic acidosis and stroke-like episodes (MELAS) syndrome are presented. We observed proliferation and/or pleomorphism of mitochondria in skeletal muscle and smooth muscle cells of arterioles, as well as in pericytes of capillaries. Paracrystalline inclusions were found only in damaged mitochondria of skeletal muscle. Genetic testing revealed a point mutation in A3243G tRNALeu(UUR) typical for MELAS syndrome. We conclude that differentiated pathological changes of mitochondria in the studied types of cells may be associated with the different energy requirements of these cells.

  10. The effects of coenzyme Q10 treatment on maternally inherited diabetes mellitus and deafness, and mitochondrial DNA 3243 (A to G) mutation.

    PubMed

    Suzuki, S; Hinokio, Y; Ohtomo, M; Hirai, M; Hirai, A; Chiba, M; Kasuga, S; Satoh, Y; Akai, H; Toyota, T

    1998-05-01

    The characteristic clinical features of diabetes mellitus with mitochondrial DNA (mtDNA) 3243(A-G) mutation are progressive insulin secretory defect, neurosensory deafness and maternal inheritance, referred to as maternally inherited diabetes mellitus and deafness (MIDD). A treatment for MIDD to improve insulin secretory defects and reduce deafness has not been established. The effects of coenzyme Q10 (CoQ10) treatment on insulin secretory response, hearing capacity and clinical symptoms of MIDD were investigated. 28 MIDD patients (CoQ10-DM), 7 mutant subjects with impaired glucose tolerance (IGT), and 15 mutant subjects with normal glucose tolerance (NGT) were treated daily with oral administration of 150 mg of CoQ10 for 3 years. Insulin secretory response, blood lactate after exercise, hearing capacity and other laboratory examinations were investigated every year. In the same way we evaluated 16 MIDD patients (control-DM), 5 mutant IGT and 5 mutant NGT subjects in yearly examinations. The insulin secretory response assessed by glucagon-induced C-peptide secretion and 24 h urinary C-peptide excretion after 3 years in the CoQ10-DM group was significantly higher than that in the control-DM group. CoQ10 therapy prevented progressive hearing loss and improved blood lactate after exercise in the MIDD patients. CoQ10 treatment did not affect the diabetic complications or other clinical symptoms of MIDD patients. CoQ10 treatment did not affect the insulin secretory capacity of the mutant IGT and NGT subjects. There were no side effects during therapy. This is the first report demonstrating the therapeutic usefulness of CoQ10 on MIDD.

  11. 32 CFR 32.43 - Competition.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... NON-PROFIT ORGANIZATIONS Post-Award Requirements Procurement Standards § 32.43 Competition. All... 32 National Defense 1 2010-07-01 2010-07-01 false Competition. 32.43 Section 32.43 National... free competition. The recipient shall be alert to organizational conflicts of interest as well as...

  12. Screening of effective pharmacological treatments for MELAS syndrome using yeasts, fibroblasts and cybrid models of the disease.

    PubMed

    Garrido-Maraver, Juan; Cordero, Mario D; Moñino, Irene Domínguez; Pereira-Arenas, Sheila; Lechuga-Vieco, Ana V; Cotán, David; De la Mata, Mario; Oropesa-Ávila, Manuel; De Miguel, Manuel; Bautista Lorite, Juan; Rivas Infante, Eloy; Alvarez-Dolado, Manuel; Navas, Plácido; Jackson, Sandra; Francisci, Silvia; Sánchez-Alcázar, José A

    2012-11-01

    MELAS (mitochondrial encephalomyopathy, lactic acidosis and stroke-like episodes) is a mitochondrial disease most usually caused by point mutations in tRNA genes encoded by mitochondrial DNA (mtDNA). Approximately 80% of cases of MELAS syndrome are associated with a m.3243A > G mutation in the MT-TL1 gene, which encodes the mitochondrial tRNALeu (UUR). Currently, no effective treatments are available for this chronic progressive disorder. Treatment strategies in MELAS and other mitochondrial diseases consist of several drugs that diminish the deleterious effects of the abnormal respiratory chain function, reduce the presence of toxic agents or correct deficiencies in essential cofactors. We evaluated the effectiveness of some common pharmacological agents that have been utilized in the treatment of MELAS, in yeast, fibroblast and cybrid models of the disease. The yeast model harbouring the A14G mutation in the mitochondrial tRNALeu(UUR) gene, which is equivalent to the A3243G mutation in humans, was used in the initial screening. Next, the most effective drugs that were able to rescue the respiratory deficiency in MELAS yeast mutants were tested in fibroblasts and cybrid models of MELAS disease. According to our results, supplementation with riboflavin or coenzyme Q(10) effectively reversed the respiratory defect in MELAS yeast and improved the pathologic alterations in MELAS fibroblast and cybrid cell models. Our results indicate that cell models have great potential for screening and validating the effects of novel drug candidates for MELAS treatment and presumably also for other diseases with mitochondrial impairment. © 2012 The Authors. British Journal of Pharmacology © 2012 The British Pharmacological Society.

  13. Screening of effective pharmacological treatments for MELAS syndrome using yeasts, fibroblasts and cybrid models of the disease

    PubMed Central

    Garrido-Maraver, Juan; Cordero, Mario D; Moñino, Irene Domínguez; Pereira-Arenas, Sheila; Lechuga-Vieco, Ana V; Cotán, David; De la Mata, Mario; Oropesa-Ávila, Manuel; De Miguel, Manuel; Bautista Lorite, Juan; Rivas Infante, Eloy; Álvarez-Dolado, Manuel; Navas, Plácido; Jackson, Sandra; Francisci, Silvia; Sánchez-Alcázar, José A

    2012-01-01

    BACKGROUND AND PURPOSE MELAS (mitochondrial encephalomyopathy, lactic acidosis and stroke-like episodes) is a mitochondrial disease most usually caused by point mutations in tRNA genes encoded by mitochondrial DNA (mtDNA). Approximately 80% of cases of MELAS syndrome are associated with a m.3243A > G mutation in the MT-TL1 gene, which encodes the mitochondrial tRNALeu (UUR). Currently, no effective treatments are available for this chronic progressive disorder. Treatment strategies in MELAS and other mitochondrial diseases consist of several drugs that diminish the deleterious effects of the abnormal respiratory chain function, reduce the presence of toxic agents or correct deficiencies in essential cofactors. EXPERIMENTAL APPROACH We evaluated the effectiveness of some common pharmacological agents that have been utilized in the treatment of MELAS, in yeast, fibroblast and cybrid models of the disease. The yeast model harbouring the A14G mutation in the mitochondrial tRNALeu(UUR) gene, which is equivalent to the A3243G mutation in humans, was used in the initial screening. Next, the most effective drugs that were able to rescue the respiratory deficiency in MELAS yeast mutants were tested in fibroblasts and cybrid models of MELAS disease. KEY RESULTS According to our results, supplementation with riboflavin or coenzyme Q10 effectively reversed the respiratory defect in MELAS yeast and improved the pathologic alterations in MELAS fibroblast and cybrid cell models. CONCLUSIONS AND IMPLICATIONS Our results indicate that cell models have great potential for screening and validating the effects of novel drug candidates for MELAS treatment and presumably also for other diseases with mitochondrial impairment. PMID:22747838

  14. Mitochondrial DNA 3243A>G heteroplasmy is associated with changes in cytoskeletal protein expression and cell mechanics.

    PubMed

    Kandel, Judith; Picard, Martin; Wallace, Douglas C; Eckmann, David M

    2017-06-01

    Mitochondrial and mechanical alterations in cells have both been shown to be hallmarks of human disease. However, little research has endeavoured to establish connections between these two essential features of cells in both functional and dysfunctional situations. In this work, we hypothesized that a specific genetic alteration in mitochondrial function known to cause human disease would trigger changes in cell mechanics. Using a previously characterized set of mitochondrial cybrid cell lines, we examined the relationship between heteroplasmy for the mitochondrial DNA (mtDNA) 3243A>G mutation, the cell cytoskeleton, and resulting cellular mechanical properties. We found that cells with increasing mitochondrial dysfunction markedly differed from one another in gene expression and protein production of various co-regulated cytoskeletal elements. The intracellular positioning and organization of actin also differed across cell lines. To explore the relationship between these changes and cell mechanics, we then measured cellular mechanical properties using atomic force microscopy and found that cell stiffness correlated with gene expression data for known determinants of cell mechanics, γ-actin, α-actinin and filamin A. This work points towards a mechanism linking mitochondrial genetics to single-cell mechanical properties. The transcriptional and structural regulation of cytoskeletal components by mitochondrial function may explain why energetic and mechanical alterations often coexist in clinical conditions. © 2017 The Author(s).

  15. When should MELAS (Mitochondrial myopathy, Encephalopathy, Lactic Acidosis, and Stroke-like episodes) be the diagnosis?

    PubMed

    Lorenzoni, Paulo José; Werneck, Lineu Cesar; Kay, Cláudia Suemi Kamoi; Silvado, Carlos Eduardo Soares; Scola, Rosana Herminia

    2015-11-01

    Mitochondrial myopathy, Encephalopathy, Lactic Acidosis, and Stroke-like episodes (MELAS) is a rare mitochondrial disorder. Diagnostic criteria for MELAS include typical manifestations of the disease: stroke-like episodes, encephalopathy, evidence of mitochondrial dysfunction (laboratorial or histological) and known mitochondrial DNA gene mutations. Clinical features of MELAS are not necessarily uniform in the early stages of the disease, and correlations between clinical manifestations and physiopathology have not been fully elucidated. It is estimated that point mutations in the tRNALeu(UUR) gene of the DNAmt, mainly A3243G, are responsible for more of 80% of MELAS cases. Morphological changes seen upon muscle biopsy in MELAS include a substantive proportion of ragged red fibers (RRF) and the presence of vessels with a strong reaction for succinate dehydrogenase. In this review, we discuss mainly diagnostic criterion, clinical and laboratory manifestations, brain images, histology and molecular findings as well as some differential diagnoses and current treatments.

  16. Retrospective assessment of the most common mitochondrial DNA mutations in a large Hungarian cohort of suspect mitochondrial cases.

    PubMed

    Remenyi, Viktoria; Inczedy-Farkas, Gabriella; Komlosi, Katalin; Horvath, Rita; Maasz, Anita; Janicsek, Ingrid; Pentelenyi, Klara; Gal, Aniko; Karcagi, Veronika; Melegh, Bela; Molnar, Maria Judit

    2015-08-01

    Prevalence estimations for mitochondrial disorders still vary widely and only few epidemiologic studies have been carried out so far. With the present work we aim to give a comprehensive overview about frequencies of the most common mitochondrial mutations in Hungarian patients. A total of 1328 patients were tested between 1999 and 2012. Among them, 882 were screened for the m.3243A > G, m.8344A > G, m.8993T > C/G mutations and deletions, 446 for LHON primary mutations. The mutation frequency in our cohort was 2.61% for the m.3243A > G, 1.47% for the m.8344A > G, 17.94% for Leber's Hereditary Optic Neuropathy (m.3460G > A, m.11778G > A, m.14484T > C) and 0.45% for the m.8993T > C/G substitutions. Single mtDNA deletions were detected in 14.97%, while multiple deletions in 6.01% of the cases. The mutation frequency in Hungarian patients suggestive of mitochondrial disease was similar to other Caucasian populations. Further retrospective studies of different populations are needed in order to accurately assess the importance of mitochondrial diseases and manage these patients.

  17. Mitochondrial DNA sequence context in the penetrance of mitochondrial t-RNA mutations: A study across multiple lineages with diagnostic implications

    PubMed Central

    Queen, Rachel A.; Steyn, Jannetta S.; Lord, Phillip

    2017-01-01

    Mitochondrial DNA (mtDNA) mutations are well recognized as an important cause of inherited disease. Diseases caused by mtDNA mutations exhibit a high degree of clinical heterogeneity with a complex genotype-phenotype relationship, with many such mutations exhibiting incomplete penetrance. There is evidence that the spectrum of mutations causing mitochondrial disease might differ between different mitochondrial lineages (haplogroups) seen in different global populations. This would point to the importance of sequence context in the expression of mutations. To explore this possibility, we looked for mutations which are known to cause disease in humans, in animals of other species unaffected by mtDNA disease. The mt-tRNA genes are the location of many pathogenic mutations, with the m.3243A>G mutation on the mt-tRNA-Leu(UUR) being the most frequently seen mutation in humans. This study looked for the presence of m.3243A>G in 2784 sequences from 33 species, as well as any of the other mutations reported in association with disease located on mt-tRNA-Leu(UUR). We report a number of disease associated variations found on mt-tRNA-Leu(UUR) in other chordates, as the major population variant, with m.3243A>G being seen in 6 species. In these, we also found a number of mutations which appear compensatory and which could prevent the pathogenicity associated with this change in humans. This work has important implications for the discovery and diagnosis of mtDNA mutations in non-European populations. In addition, it might provide a partial explanation for the conflicting results in the literature that examines the role of mtDNA variants in complex traits. PMID:29161289

  18. MELAS syndrome: Clinical manifestations, pathogenesis, and treatment options.

    PubMed

    El-Hattab, Ayman W; Adesina, Adekunle M; Jones, Jeremy; Scaglia, Fernando

    2015-01-01

    Mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes (MELAS) syndrome is one of the most frequent maternally inherited mitochondrial disorders. MELAS syndrome is a multi-organ disease with broad manifestations including stroke-like episodes, dementia, epilepsy, lactic acidemia, myopathy, recurrent headaches, hearing impairment, diabetes, and short stature. The most common mutation associated with MELAS syndrome is the m.3243A>G mutation in the MT-TL1 gene encoding the mitochondrial tRNA(Leu(UUR)). The m.3243A>G mutation results in impaired mitochondrial translation and protein synthesis including the mitochondrial electron transport chain complex subunits leading to impaired mitochondrial energy production. The inability of dysfunctional mitochondria to generate sufficient energy to meet the needs of various organs results in the multi-organ dysfunction observed in MELAS syndrome. Energy deficiency can also stimulate mitochondrial proliferation in the smooth muscle and endothelial cells of small blood vessels leading to angiopathy and impaired blood perfusion in the microvasculature of several organs. These events will contribute to the complications observed in MELAS syndrome particularly the stroke-like episodes. In addition, nitric oxide deficiency occurs in MELAS syndrome and can contribute to its complications. There is no specific consensus approach for treating MELAS syndrome. Management is largely symptomatic and should involve a multidisciplinary team. Unblinded studies showed that l-arginine therapy improves stroke-like episode symptoms and decreases the frequency and severity of these episodes. Additionally, carnitine and coenzyme Q10 are commonly used in MELAS syndrome without proven efficacy. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. Whole mitochondrial genome screening in maternally inherited non-syndromic hearing impairment using a microarray resequencing mitochondrial DNA chip.

    PubMed

    Lévêque, Marianne; Marlin, Sandrine; Jonard, Laurence; Procaccio, Vincent; Reynier, Pascal; Amati-Bonneau, Patrizia; Baulande, Sylvain; Pierron, Denis; Lacombe, Didier; Duriez, Françoise; Francannet, Christine; Mom, Thierry; Journel, Hubert; Catros, Hélène; Drouin-Garraud, Valérie; Obstoy, Marie-Françoise; Dollfus, Hélène; Eliot, Marie-Madeleine; Faivre, Laurence; Duvillard, Christian; Couderc, Remy; Garabedian, Eréa-Noël; Petit, Christine; Feldmann, Delphine; Denoyelle, Françoise

    2007-11-01

    Mitochondrial DNA (mtDNA) mutations have been implicated in non-syndromic hearing loss either as primary or as predisposing factors. As only a part of the mitochondrial genome is usually explored in deafness, its prevalence is probably under-estimated. Among 1350 families with non-syndromic sensorineural hearing loss collected through a French collaborative network, we selected 29 large families with a clear maternal lineage and screened them for known mtDNA mutations in 12S rRNA, tRNASer(UCN) and tRNALeu(UUR) genes. When no mutation could be identified, a whole mitochondrial genome screening was performed, using a microarray resequencing chip: the MitoChip version 2.0 developed by Affymetrix Inc. Known mtDNA mutations was found in nine of the 29 families, which are described in the article: five with A1555G, two with the T7511C, one with 7472insC and one with A3243G mutation. In the remaining 20 families, the resequencing Mitochip detected 258 mitochondrial homoplasmic variants and 107 potentially heteroplasmic variants. Controls were made by direct sequencing on selected fragments and showed a high sensibility of the MitoChip but a low specificity, especially for heteroplasmic variations. An original analysis on the basis of species conservation, frequency and phylogenetic investigation was performed to select the more probably pathogenic variants. The entire genome analysis allowed us to identify five additional families with a putatively pathogenic mitochondrial variant: T669C, C1537T, G8078A, G12236A and G15077A. These results indicate that the new MitoChip platform is a rapid and valuable tool for identification of new mtDNA mutations in deafness.

  20. AB036. Analysis of human mitochondrial genome mutations of Vietnamese patients tentatively diagnosed with encephalomyopathy

    PubMed Central

    Nghia, Phan Tuan; Thai, Trinh Hong; Hue, Truong Thi; Van Minh, Nguyen; Khanh, Phung Bao; Hiep, Tran Duc; Anh, Tran Kieu; Loan, Nguyen Thi Hong; Van, Nguyen Thi Hong; Anh, Pham Van; Hung, Cao Vu; Anh, Le Ngoc

    2015-01-01

    Human mitochondrial genome consists of 16,569 bp, and replicates independently from the nuclear genome. Mutations in mitochondrial genome are usually causative factors of various metabolic disorders, especially those of encephalomyopathy. DNA analysis is the most reliable method for detection of mitochondrial genome mutations, and accordingly an excellent diagnostic tool for mitochondrial mutation-related diseases. In this study, 19 different mitochondrial genome mutations including A3243G, A3251G, T3271C and T3291C (MELAS); A8344G, T8356C and G8363A (MERRF); G3460A, G11778A and T14484C (LHON); T8993G/C and T9176G (Leigh); A1555G (deafness) and A4225G, G4298A, T10010C, T14727C, T14728C, T14709C (encephalomyopathy in general) were analyzed using PCR-RFLP in combination with DNA sequencing. In addition, a real-time PCR method using locked nucleic acid (LNA) Taqman probe was set up for heteroplasmy determination. Screening of 283 tentatively diagnosed encephalomyopathy patients revealed 7 cases of A3243G, 1 case of G11778A, 1 case of A1555G, 1 case of A4225G, 1 case G4298A, and 1 case of 6 bp (ACTCCT/CTCCTA) deletion. Using the LNA Taqman probe real-time PCR, the heteroplasmy of some point mutations was determined and the results support a potential relationship between heteroplasmy level and severity of the disease.

  1. 28 CFR 32.43 - Appointment and assignment of Hearing Officers.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 28 Judicial Administration 1 2010-07-01 2010-07-01 false Appointment and assignment of Hearing Officers. 32.43 Section 32.43 Judicial Administration DEPARTMENT OF JUSTICE PUBLIC SAFETY OFFICERS' DEATH, DISABILITY, AND EDUCATIONAL ASSISTANCE BENEFIT CLAIMS Hearing Officer Determinations § 32.43 Appointment and...

  2. 28 CFR 32.43 - Appointment and assignment of Hearing Officers.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 28 Judicial Administration 1 2011-07-01 2011-07-01 false Appointment and assignment of Hearing Officers. 32.43 Section 32.43 Judicial Administration DEPARTMENT OF JUSTICE PUBLIC SAFETY OFFICERS' DEATH, DISABILITY, AND EDUCATIONAL ASSISTANCE BENEFIT CLAIMS Hearing Officer Determinations § 32.43 Appointment and...

  3. Frequency of MELAS main mutation in a phenotype-targeted young ischemic stroke patient population.

    PubMed

    Tatlisumak, Turgut; Putaala, Jukka; Innilä, Markus; Enzinger, Christian; Metso, Tiina M; Curtze, Sami; von Sarnowski, Bettina; Amaral-Silva, Alexandre; Jungehulsing, Gerhard Jan; Tanislav, Christian; Thijs, Vincent; Rolfs, Arndt; Norrving, Bo; Fazekas, Franz; Suomalainen, Anu; Kolodny, Edwin H

    2016-02-01

    Mitochondrial diseases, predominantly mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes (MELAS), may occasionally underlie or coincide with ischemic stroke (IS) in young and middle-aged individuals. We searched for undiagnosed patients with MELAS in a target subpopulation of unselected young IS patients enrolled in the Stroke in Young Fabry Patients study (sifap1). Among the 3291 IS patients aged 18-55 years recruited to the sifap1 study at 47 centers across 14 European countries, we identified potential MELAS patients with the following phenotypic features: (a) diagnosed cardiomyopathy or (b) presence of two of the three following findings: migraine, short stature (≤165 cm for males; ≤155 cm for females), and diabetes. Identified patients' blood samples underwent analysis of the common MELAS mutation, m.3243A>G in the MTTL1 gene of mitochondrial DNA. Clinical and cerebral MRI features of the mutation carriers were reviewed. We analyzed blood samples of 238 patients (177 with cardiomyopathy) leading to identification of four previously unrecognized MELAS main mutation carrier-patients. Their clinical and MRI characteristics were within the expectation for common IS patients except for severe hearing loss in one patient and hyperintensity of the pulvinar thalami on T1-weighted MRI in another one. Genetic testing for the m.3243A>G MELAS mutation in young patients with IS based on phenotypes suggestive of mitochondrial disease identifies previously unrecognized carriers of MELAS main mutation, but does not prove MELAS as the putative cause.

  4. The role of MiR-324-3p in polycystic ovary syndrome (PCOS) via targeting WNT2B.

    PubMed

    Jiang, Y-C; Ma, J-X

    2018-06-01

    To investigate the expression of microRNA-324-3p (miR-324-3p) in polycystic ovary syndrome (PCOS) and its effects on the proliferation and apoptosis of ovarian granulosa cells. A total of 60 Sprague-Dawley (SD) rats were randomly divided into normal group (n=30) and experimental group (n=30). Rats in the experimental group were intramuscularly injected with dehydroepiandrosterone (DHEA) (6 mg/100 g of body weight) and 0.2 mL oil for injection, while those in normal group were intramuscularly injected with 0.2 mL oil for injection. The ovarian tissues of PCOS model rats were removed to extract the total ribose nucleic acid (RNA). The expression of miR-324-3p was detected via reverse transcription-polymerase chain reaction (RT-PCR). Primary ovarian granulosa cells were isolated and cultured, and NC-miRNA and miR-324-3p mimic were transfected into cells. After 48 h, cell proliferation and apoptosis were detected via cell counting kit 8 (CCK-8) and flow cytometry assay, respectively. The targeted molecule of miR-324-3p was explored using bioinformatics, and dual-luciferase assay was performed to verify the effect of miR-324-3p on WNT2B expression. Granulosa cells were co-transfected with WNT2B-small-interfering RNA (siRNA) and miR-324-3p mimic, and then cell proliferation and apoptosis were detected via CCK-8 and flow cytometry assay, respectively. The expression of miR-324-3p in ovarian tissues of PCOS group was significantly lower than that of normal group (p < 0.01). After transfection with miR-324-3p mimic into granulosa cells, cell proliferation was significantly inhibited and cell apoptosis was promoted (p < 0.01). MiR-324-3p exerted its effect on granulosa cells by directly targeting WNT2B. Silencing WNT2B expression could reverse the effects of miR-324-3p on proliferation and apoptosis of granulosa cells (p < 0.05). The expression of miR-324-3p in the ovary of PCOS rats is decreased significantly. Overexpression of miR-324-3p can reduce the proliferation and

  5. Mitochondrial tRNALeu(UUR) C3275T, tRNAGln T4363C and tRNALys A8343G mutations may be associated with PCOS and metabolic syndrome.

    PubMed

    Ding, Yu; Xia, Bo-Hou; Zhang, Cai-Juan; Zhuo, Guang-Chao

    2018-02-05

    Polycystic ovary syndrome (PCOS) is a very prevalent endocrine disease affecting reproductive women. Clinically, patients with this disorder are more vulnerable to develop type 2 diabetes mellitus (T2DM), cardiovascular events, as well as metabolic syndrome (MetS). To date, the molecular mechanism underlying PCOS remains largely unknown. Previously, we showed that mitochondrial dysfunction caused by mitochondrial DNA (mtDNA) mutation was an important cause for PCOS. In the current study, we described the clinical and biochemical features of a three-generation pedigree with maternally transmitted MetS, combined with PCOS. A total of three matrilineal relatives exhibited MetS including obesity, high triglyceride (TG) and Hemoglobin A1c (HbA1c) levels, and hypertension. Whereas one patient from the third generation manifestated PCOS. Mutational analysis of the whole mitochondrial genes from the affected individuals identified a set of genetic variations belonging to East Asia haplogroup B4b1c. Among these variants, the homoplasmic C3275T mutation disrupted a highly evolutionary conserved base-pairing (28A-46C) on the variable region of tRNA Leu(UUR) , whereas the T4363C mutation created a new base-pairing (31T-37A) in the anticodon stem of tRNA Gln , furthermore, the A8343G mutation occurred at the very conserved position of tRNA Lys and may result the failure in mitochondrial tRNAs (mt-tRNAs) metabolism. Biochemical analysis revealed the deficiency in mitochondrial functions including lower levels of mitochondrial membrane potential (MMP), ATP production and mtDNA copy number, while a significantly increased reactive oxygen species (ROS) generation was observed in polymononuclear leukocytes (PMNs) from the individuals carrying these mt-tRNA mutations, suggesting that these mutations may cause mitochondrial dysfunction that was responsible for the clinical phenotypes. Taken together, our data indicated that mt-tRNA mutations were associated with MetS and PCOS in this

  6. A whole mitochondrial genome screening in a MELAS patient: A novel mitochondrial tRNA{sup Val} mutation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mezghani, Najla; Mnif, Mouna; Kacem, Maha

    2011-04-22

    Highlights: {yields} We report a young Tunisian patient with clinical features of MELAS syndrome. {yields} Reported mitochondrial mutations were absent after a mutational screening of the whole mtDNA. {yields} We described a novel m.1640A>G mutation in the tRNA{sup Val} gene which was absent in 150 controls. {yields} Mitochondrial deletions and POLG1 gene mutations were absent. {yields} The m.1640A>G mutation could be associated to MELAS syndrome. -- Abstract: Mitochondrial encephalopathy, lactic acidosis and strokelike episodes (MELAS) syndrome is a mitochondrial disorder characterized by a wide variety of clinical presentations and a multisystemic organ involvement. In this study, we report a Tunisianmore » girl with clinical features of MELAS syndrome who was negative for the common m.3243A>G mutation, but also for the reported mitochondrial DNA (mtDNA) mutations and deletions. Screening of the entire mtDNA genome showed several known mitochondrial variants besides to a novel transition m.1640A>G affecting a wobble adenine in the anticodon stem region of the tRNA{sup Val}. This nucleotide was conserved and it was absent in 150 controls suggesting its pathogenicity. In addition, no mutations were found in the nuclear polymerase gamma-1 gene (POLG1). These results suggest further investigation nuclear genes encoding proteins responsible for stability and structural components of the mtDNA or to the oxidative phosphorylation machinery to explain the phenotypic variability in the studied family.« less

  7. Respiratory chain complex III deficiency in patients with tRNA-leu mutation.

    PubMed

    Jiang, J; Wang, X L; Ma, Y Y

    2015-12-29

    The aim of this study was to investigate the clinical and genetic profiles of mitochondrial disease resulting from deficiencies in the respiratory chain complex III. Three patients, aged between 8 months and 12 years, were recruited for this study. The activities of mitochondrial respiratory chain complexes in the peripheral leucocytes were spectrophotometrically measured. The entire mitochondrial DNA (mtDNA) sequence was analyzed. Samples obtained from the three patients and their families were subjected to restriction fragment length polymorphism and gene sequencing analyses. mtDNA copy numbers of all patients and their mothers were analyzed. The patients displayed nervous system impairment, including motor and mental developmental delay, hypotonia, and motor regression. Two patients also suffered from Leigh syndrome. Assay of the mitochondrial respiratory chain enzymes revealed an isolated complex III deficiency in the three patients. The m.3243 A>G mutation was detected in all patients and their mothers. The mutation loads were 48.3, 57.2, and 45.5% in the patients, and 20.5, 16.4, and 23.6% in their respective mothers. The leukocyte mtDNA copy numbers of the patients and their mothers were within the control range. The clinical manifestation and genetics were observed to be very heterogeneous. Patient carrying an m.3243 A>G mutation may biochemically display a deficiency in the mitochondrial respiratory chain complex III.

  8. miR-324-3p promotes gastric cancer development by activating Smad4-mediated Wnt/beta-catenin signaling pathway.

    PubMed

    Sun, Guang-Li; Li, Zheng; Wang, Wei-Zhi; Chen, Zheng; Zhang, Lei; Li, Qing; Wei, Song; Li, Bo-Wen; Xu, Jiang-Hao; Chen, Liang; He, Zhong-Yuan; Ying, Kai; Zhang, Xuan; Xu, Hao; Zhang, Dian-Cai; Xu, Ze-Kuan

    2018-06-01

    Emerging evidence suggested that miRNAs can function as oncogenes or tumor suppressors by regulating downstream target genes. miR-324-3p has been reported to function in several carcinomas, but its role in gastric cancer (GC) is still unknown. This study aims to explore the effects of miR-324-3p on the development of GC. Expression of miR-324-3p was examined in GC cells and tissues by qRT-PCR. Effects of miR-324-3p on GC cells were evaluated by cell vitality assay, colony formation assay, cell migration assay, and flow cytometric assay. The dual luciferase assay was used to verify whether miR-324-3p could interact with the potential target genes. Western blot was used to assess the expression level of Smad4 and beta-catenin. Intracellular ATP level was also examined. The tumor xenografts were established using nude mice. A gastric organoid model was made from fresh stomach tissue. miR-324-3p was expressed at higher levels in the tumor tissues compared with adjacent normal tissues. Overexpression of miR-324-3p promoted cell growth, migration, and decreased apoptosis. miR-324-3p repressed the expression of Smad4, and loss of Smad4 activated the Wnt/beta-catenin signaling pathway. Overexpression of Smad4 rescued the effects of miR-324-3p on GC cells. The intracellular ATP level was upregulated with overexpression of miR-324-3p. miR-324-3p facilitated tumor cell colonization and growth in vivo and contributed to the growth of gastric organoids. The results suggested that miR-324-3p promoted GC through activating the Smad4-mediated Wnt/beta-catenin signaling pathway. The miR-324-3p/Smad4/Wnt signaling axis may be a potential therapeutic target to prevent GC progression.

  9. Two new mutations in the MT-TW gene leading to the disruption of the secondary structure of the tRNA(Trp) in patients with Leigh syndrome.

    PubMed

    Mkaouar-Rebai, Emna; Chamkha, Imen; Kammoun, Fatma; Kammoun, Thouraya; Aloulou, Hajer; Hachicha, Mongia; Triki, Chahnez; Fakhfakh, Faiza

    2009-07-01

    Leigh syndrome is a progressive neurodegenerative disorder occurring in infancy and childhood characterized in most cases by a psychomotor retardation, optic atrophy, ataxia, dystonia, failure to thrive, seizures and respiratory failure. In this study, we performed a systematic sequence analysis of mitochondrial genes associated with LS in Tunisian patients. We sequenced the encoded complex I units: ND2, ND3, ND4, ND5 and ND6 genes and the mitochondrial ATPase 6, tRNA(Val), tRNA(Leu(UUR)), tRNA(Trp) and tRNA(Lys) genes in 10 unrelated patients with Leigh syndrome. We revealed the presence of 34 reported polymorphisms, nine novel nucleotide variants and two new mutations (T5523G and A5559G) in the tested patients. These two mutations were localized in two conserved regions of the tRNA(Trp) and affect, respectively, the D-stem and the T-stem of the mitochondrial tRNA leading to a disruption of the secondary structure of this tRNA. SSP-PCR analysis showed that the T5523G and A5559G mutations were present with respective heteroplasmic rates of 66% and 43 %. We report here the first mutational screening of mitochondrial mutations in Tunisian patients with Leigh syndrome which described two novel mutations associated with this disorder.

  10. Beta-cell function in individuals carrying the mitochondrial tRNA leu (UUR) mutation.

    PubMed

    Salles, João Eduardo; Kasamatsu, Teresa S; Dib, Sérgio A; Moisés, Regina S

    2007-01-01

    To assess the beta-cell function in individuals with mitochondrial DNA A3243G mutation with normal glucose tolerance (NGT) or diabetes mellitus (DM). Furthermore, in diabetic individuals, we evaluated the effect of coenzyme Q10 supplementation on insulin secretory response. Eight mutation-positive individuals with NGT (n = 4) or DM (n = 4) were studied. beta-Cell function was evaluated by C-peptide levels before and after a mixed liquid meal (Sustacal) challenge and by first-phase insulin response. Fasting and Sustacal-stimulated C-peptide levels were significantly lower in diabetic patients than that in controls (area under the curve: 104.1 +/- 75.7 vs 520.8 +/- 173.8, P = 0.001), whereas in individuals with NGT, this response was preserved (area under the curve: 537.8 +/- 74.3 vs 520.8 +/- 179.8, P = 0.87). The duration of diabetes was negatively correlated with fasting C-peptide levels (r = -0.961, P = 0.038). Among the 3 patients with residual insulin secretion, the short-term treatment with coenzyme Q10 (3 months) improved C-peptide levels in 2 of them. The first-phase insulin response was diminished in 2 individuals with NGT, the oldest ones. We showed an impaired insulin secretory capacity in individuals carrying the A3243G mutation, this possibly being the primary defect contributing to the development of DM. In addition, our data suggest that this could be a functional defect.

  11. Kidney involvement in MELAS syndrome: Description of 2 cases.

    PubMed

    Alcubilla-Prats, Pau; Solé, Manel; Botey, Albert; Grau, Josep Maria; Garrabou, Glòria; Poch, Esteban

    2017-04-21

    MELAS syndrome -myopathy, encephalopathy, lactic acidosis and stroke-like episodes- is a maternally-inherited mitochondrial cytopathy related to several mitochondrial DNA mutations, with the A3243G mutation in tRNA Leu gene being the most frequent of them. Apart from its typical symptomatology, patients usually exhibit a maternally-inherited history of neurosensory deafness and insulin-dependent type 2 diabetes mellitus (T2DM). Recent studies have shown that few patients carrying a A3243G mutation also suffer from renal dysfunction, usually in form of focal segmental glomerulosclerosis (FSGS). In this study we examine kidney involvement in 2 unrelated patients with a A3243G mutation by genetic testing. Both have a maternally-inherited neurosensory deafness and insulin-dependent T2DM. A renal biopsy was performed in both patients. One patient developed nephrotic proteinuria and renal insufficiency, with FSGS findings being observed in the kidney biopsy, whereas the other suffered from mild proteinuria and renal insufficiency, with non-specific glomerular changes. The presence of FSGS or other kidney involvement accompanied by hereditary neurosensory deafness and T2DM could be suggestive of a A3243G tRNA Leu mutation and should prompt a genetic testing and an evaluation of potential extrarenal involvement. Copyright © 2017 Elsevier España, S.L.U. All rights reserved.

  12. Renal involvement in MELAS syndrome - a series of 5 cases and review of the literature.

    PubMed

    Seidowsky, Alexandre; Hoffmann, Maxime; Glowacki, François; Dhaenens, Claire-Marie; Devaux, Jean-Philippe; de Sainte Foy, Celia Lessore; Provot, François; Gheerbrant, Jean-Dominique; Hummel, Aurelie; Hazzan, Marc; Dracon, Michel; Dieux-Coeslier, Anne; Copin, Marie-Christine; Noël, Christian; Buob, David

    2013-12-01

    Renal dysfunction is increasingly recognized as a potential clinical feature of mitochondrial cytopathies such as mitochondrial encephalomyopathy, lacticacidosis and stroke-like episodes (MELAS) syndrome. Five cases of MELAS syndrome with renal involvement from 4 unrelated families are presented in this case series. Three of the 5 patients had a history of maternally-inherited diabetes and/or deafness. Focal and segmental glomerulosclerosis and arteriolar hyaline thickening were the most striking findings on renal biopsy. In addition to clinical presentation with the typical symptoms of MELAS syndrome, genetic testing in these patients identified the A3243G point mutation in the tRNALeu gene of the mitochondrial DNA (mtDNA). The diagnosis of MELAS syndrome was thus considered to be unequivocal. The incidence of kidney disease in MELAS syndrome may be underestimated although a study is required to investigate this hypothesis. As the A3243G mtDNA mutation leads to a progressive adult-onset form of focal segmental glomerulosclerosis (FSGS), screening for the MELAS A3243G mtDNA mutation should therefore be performed especially in patients with maternally-inherited diabetes or hearing loss presenting with FSGS.

  13. Unusual occurrence of intestinal pseudo obstruction in a patient with maternally inherited diabetes and deafness (MIDD) and favorable outcome with coenzyme Q10.

    PubMed

    Bergamin, Carla S; Rolim, Luiz Clemente; Dib, Sergio A; Moisés, Regina S

    2008-11-01

    Maternally inherited diabetes and deafness (MIDD) has been related to an A to G transition in the mitochondrial tRNA Leu (UUR) gene at the base pair 3243. This subtype of diabetes is characterized by maternal transmission, young age at onset and bilateral hearing impairment. Besides diabetes and deafness, the main diagnostic features, a wide range of multisystemic symptoms may be associated with the A3243G mutation. Organs that are most metabolically active, such as muscles, myocardium, retina, cochlea, kidney and brain are frequently affected. Gastrointestinal tract symptoms are also common in patients with mitochondrial disease and constipation and diarrhea are the most frequent manifestations. However, there are few prior reports of intestinal pseudo obstruction in MIDD patients. Here we report the case of a patient with MIDD associated with the mtDNA A3243G mutation who developed chronic intestinal pseudo obstruction, and the introduction of Coenzyme Q10 as adjunctive therapy led to a solution of the pseudo obstruction.

  14. Wolff-Parkinson-White syndrome in Patients With MELAS.

    PubMed

    Sproule, Douglas M; Kaufmann, Petra; Engelstad, Kristen; Starc, Thomas J; Hordof, Allan J; De Vivo, Darryl C

    2007-11-01

    Tissues with high energy demands, such as the heart, are susceptible to the effects of mitochondrial DNA point mutations. To investigate the frequency of Wolff-Parkinson-White (WPW) syndrome among a phenotypically and genotypically homogeneous cohort of patients with MELAS (mitochondrial encephalopathy, lactic acidosis, and strokelike episodes) and the A3243G mutation most commonly associated with MELAS syndrome. Survey. The Pediatric Neuromuscular Disease Center at Columbia University. Patients Thirty patients with the A3243G mutation and MELAS syndrome enrolled in a clinical trial to assess the effect of dichloroacetate on neurologic symptoms. Medical histories and electrocardiograms were reviewed and DNA samples from fibroblasts, urine and cheek epithelial cells, leukocytes, and hair were analyzed to determine mitochondrial mutation abundance and estimate total mutation burden. Four of 30 patients (13%) had a clinical history of, or electrocardiographic findings consistent with, WPW syndrome. In 2 patients, WPW syndrome preceded MELAS syndrome by 15 and 21 years. The tissue burden of mutant mitochondria was similar in patients with (49.4%) and without (39.1%) WPW syndrome. The prevalence of WPW syndrome among patients with MELAS syndrome and the A3243G mutation appears much higher than in the normal population and may become manifest earlier than neurologic symptoms. Patients with WPW syndrome and neurologic abnormalities consistent with MELAS syndrome, such as seizures, deafness, short stature, and stroke, should be screened for the A3243G mutation. Moreover, patients with MELAS syndrome should be monitored for cardiac anomalies including cardiomyopathy and WPW syndrome.

  15. Epilepsy in adults with mitochondrial disease: A cohort study.

    PubMed

    Whittaker, Roger G; Devine, Helen E; Gorman, Grainne S; Schaefer, Andrew M; Horvath, Rita; Ng, Yi; Nesbitt, Victoria; Lax, Nichola Z; McFarland, Robert; Cunningham, Mark O; Taylor, Robert W; Turnbull, Douglass M

    2015-12-01

    The aim of this work was to determine the prevalence and progression of epilepsy in adult patients with mitochondrial disease. We prospectively recruited a cohort of 182 consecutive adult patients attending a specialized mitochondrial disease clinic in Newcastle upon Tyne between January 1, 2005 and January 1, 2008. We then followed this cohort over a 7-year period, recording primary outcome measures of occurrence of first seizure, status epilepticus, stroke-like episode, and death. Overall prevalence of epilepsy in the cohort was 23.1%. Mean age of epilepsy onset was 29.4 years. Prevalence varied widely between genotypes, with several genotypes having no cases of epilepsy, a prevalence of 34.9% in the most common genotype (m.3243A>G mutation), and 92.3% in the m.8344A>G mutation. Among the cohort as a whole, focal seizures, with or without progression to bilateral convulsive seizures, was the most common seizure type. Conversely, all of the patients with the m.8344A>G mutation and epilepsy experienced myoclonic seizures. Patients with the m.3243A>G mutation remain at high risk of developing stroke-like episodes (1.16% per year). However, although the standardized mortality ratio for the entire cohort was high (2.86), this ratio did not differ significantly between patients with epilepsy (2.96) and those without (2.83). Epilepsy is a common manifestation of mitochondrial disease. It develops early in the disease and, in the case of the m.3243A>G mutation, often presents in the context of a stroke-like episode or status epilepticus. However, epilepsy does not itself appear to contribute to the increased mortality in mitochondrial disease. © 2015 The Authors. Annals of Neurology published by Wiley Periodicals, Inc. on behalf of American Neurological Association.

  16. Adult onset Leigh syndrome with mitochondrial DNA 8344 A>G mutation.

    PubMed

    Han, Jee-Young; Sung, Jung-Joon; Park, Hong-Kyun; Yoon, Byung-Nam; Lee, Kwang-Woo

    2014-11-01

    We report a pedigree of adult-onset Leigh syndrome (LS) with mitochondrial mutation 8344 A>G. A 38-year-old woman presented with optic neuropathy, weakness and cognitive impairment. Family history of optic neuropathy and systemic involvement was suggestive of mitochondrial encephalopathy. Genetic and radiologic studies showed m.8344 A>G mutation with characteristics of LS. To our knowledge this is the first case of adult-onset LS demonstrating the m.8344 A>G mutation. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. Carnitine-acylcarnitine translocase deficiency with c.199-10 T>G and novel c.1A>G mutation

    PubMed Central

    Yan, Hui-ming; Hu, Hao; Ahmed, Aisha; Feng, Bing-bing; Liu, Jing; Jia, Zheng-jun; Wang, Hua

    2017-01-01

    Abstract Rationale: Carnitine-acylcarnitine translocate deficiency (CACTD) is a rare and life-threatening, autosomal recessive disorder of fatty acid β-oxidation characterized by hypoketotic hypoglycemia, hyperammonemia, cardiomyopathy, liver dysfunction, and muscle weakness; culminating in early death. To date, CACTD cases screened from the Chinese mainland population, especially patient with compound heterozygote with c.199-10T>G and a novel c.1A>G mutation in the SLC25A20 gene has never been described. Patient concerns: Herein, we report 2 neonatal cases of CACTD identified from the mainland China. These 2 patients were presented with severe metabolic crisis and their clinical conditions deteriorate rapidly and both died of cardiorespiratory collapse in the first week of life. We present the clinical and biochemical features of 2 probands and a brief literature review of previously reported CACTD cases with the c.199-10T>G mutation. Diagnoses: The acylcarnitine profiles by tandem-mass-spectrometry and the mutation analysis of SLC25A20 gene confirmed the diagnosis of CACTD in both patients. Mutation analysis demonstrated that patient No. 1 was homozygous for c.199-10T>G mutation, while patient No. 2 was a compound heterozygote for 2 mutations, a maternally-inherited c.199-10T>G and a paternally-inherited, novel c.1A>G mutation. Interventions: Both patients were treated with an aggressive treatment regimen include high glucose and arginine infusion, respiratory, and circulatory support. Outcomes: The first proband died 3 days after delivery due to sudden cardiac arrest. The second patient's clinical condition, at one time, was improved by high glucose infusion, intravenous arginine, and circulatory support. However, the patient failed to wean from mechanical ventilation. Unfortunately, her parents refused further treatment due to fear of financial burdens. The patient died of congestive heart failure in the 6th day of life. Lessons: We report the first 2 cases of

  18. Oligonucleotide gap-fill ligation for mutation detection and sequencing in situ

    PubMed Central

    Mignardi, Marco; Mezger, Anja; Qian, Xiaoyan; La Fleur, Linnea; Botling, Johan; Larsson, Chatarina; Nilsson, Mats

    2015-01-01

    In clinical diagnostics a great need exists for targeted in situ multiplex nucleic acid analysis as the mutational status can offer guidance for effective treatment. One well-established method uses padlock probes for mutation detection and multiplex expression analysis directly in cells and tissues. Here, we use oligonucleotide gap-fill ligation to further increase specificity and to capture molecular substrates for in situ sequencing. Short oligonucleotides are joined at both ends of a padlock gap probe by two ligation events and are then locally amplified by target-primed rolling circle amplification (RCA) preserving spatial information. We demonstrate the specific detection of the A3243G mutation of mitochondrial DNA and we successfully characterize a single nucleotide variant in the ACTB mRNA in cells by in situ sequencing of RCA products generated by padlock gap-fill ligation. To demonstrate the clinical applicability of our assay, we show specific detection of a point mutation in the EGFR gene in fresh frozen and formalin-fixed, paraffin-embedded (FFPE) lung cancer samples and confirm the detected mutation by in situ sequencing. This approach presents several advantages over conventional padlock probes allowing simpler assay design for multiplexed mutation detection to screen for the presence of mutations in clinically relevant mutational hotspots directly in situ. PMID:26240388

  19. G20210A prothrombin gene mutation identified in patients with venous leg ulcers.

    PubMed

    Jebeleanu, G; Procopciuc, L

    2001-01-01

    The G20210A mutation variant of prothrombin gene is the second most frequent mutation identified in patients with deep venous thrombosis, after factor V Leiden. The risk for developing deep venous thrombosis is high in patients identified as heterozygous for G20210A mutation. In order to identify this polymorphism in the gene coding prothrombin, the 345bp fragment in the 3'- untranslated region of the prothrombin gene was amplified using amplification by polymerase chain reaction and enzymatic digestion by HindIII (restriction endonuclease enzyme). The products of amplification and enzymatic's digestion were analized using agarose gel electrophoresis. We investigated 20 patients with venous leg ulcers and we found 2 heterozygous (10%) for G20210A mutation. None of the patients in the control group had G20210A mutation. Our study confirms the presence of G20210A mutation in the Romanian population. Our study also shows the link between venous leg ulcers and this polymorphism in the prothrombin gene.

  20. Computational Analysis of KRAS Mutations: Implications for Different Effects on the KRAS p.G12D and p.G13D Mutations

    PubMed Central

    Liu, Yen-Yi; Hwang, Jenn-Kang; Barrio, Maria Jesus; Rodrigo, Maximiliano; Garcia-Toro, Enrique; Herreros-Villanueva, Marta

    2013-01-01

    Background The issue of whether patients diagnosed with metastatic colorectal cancer who harbor KRAS codon 13 mutations could benefit from the addition of anti-epidermal growth factor receptor therapy remains under debate. The aim of the current study was to perform computational analysis to investigate the structural implications of the underlying mutations caused by c.38G>A (p.G13D) on protein conformation. Methods Molecular dynamics (MD) simulations were performed to understand the plausible structural and dynamical implications caused by c.35G>A (p.G12D) and c.38G>A (p.G13D). The potential of mean force (PMF) simulations were carried out to determine the free energy profiles of the binding processes of GTP interacting with wild-type (WT) KRAS and its mutants (MT). Results Using MD simulations, we observed that the root mean square deviation (RMSD) increased as a function of time for the MT c.35G>A (p.G12D) and MT c.38G>A (p.G13D) when compared with the WT. We also observed that the GTP-binding pocket in the c.35G>A (p.G12D) mutant is more open than that of the WT and the c.38G>A (p.G13D) proteins. Intriguingly, the analysis of atomic fluctuations and free energy profiles revealed that the mutation of c.35G>A (p.G12D) may induce additional fluctuations in the sensitive sites (P-loop, switch I and II regions). Such fluctuations may promote instability in these protein regions and hamper GTP binding. Conclusions Taken together with the results obtained from MD and PMF simulations, the present findings implicate fluctuations at the sensitive sites (P-loop, switch I and II regions). Our findings revealed that KRAS mutations in codon 13 have similar behavior as KRAS WT. To gain a better insight into why patients with metastatic colorectal cancer (mCRC) and the KRAS c.38G>A (p.G13D) mutation appear to benefit from anti-EGFR therapy, the role of the KRAS c.38G>A (p.G13D) mutation in mCRC needs to be further investigated. PMID:23437064

  1. Effect of the G375C and G346E achondroplasia mutations on FGFR3 activation.

    PubMed

    He, Lijuan; Serrano, Christopher; Niphadkar, Nitish; Shobnam, Nadia; Hristova, Kalina

    2012-01-01

    Two mutations in FGFR3, G380R and G375C are known to cause achondroplasia, the most common form of human dwarfism. The G380R mutation accounts for 98% of the achondroplasia cases, and thus has been studied extensively. Here we study the effect of the G375C mutation on the phosphorylation and the cross-linking propensity of full-length FGFR3 in HEK 293 cells, and we compare the results to previously published results for the G380R mutant. We observe identical behavior of the two achondroplasia mutants in these experiments, a finding which supports a direct link between the severity of dwarfism phenotypes and the level and mechanism of FGFR3 over-activation. The mutations do not increase the cross-linking propensity of FGFR3, contrary to previous expectations that the achondroplasia mutations stabilize the FGFR3 dimers. Instead, the phosphorylation efficiency within un-liganded FGFR3 dimers is increased, and this increase is likely the underlying cause for pathogenesis in achondroplasia. We further investigate the G346E mutation, which has been reported to cause achondroplasia in one case. We find that this mutation does not increase FGFR3 phosphorylation and decreases FGFR3 cross-linking propensity, a finding which raises questions whether this mutation is indeed a genetic cause for human dwarfism.

  2. Effect of the G375C and G346E Achondroplasia Mutations on FGFR3 Activation

    PubMed Central

    He, Lijuan; Serrano, Christopher; Niphadkar, Nitish; Shobnam, Nadia; Hristova, Kalina

    2012-01-01

    Two mutations in FGFR3, G380R and G375C are known to cause achondroplasia, the most common form of human dwarfism. The G380R mutation accounts for 98% of the achondroplasia cases, and thus has been studied extensively. Here we study the effect of the G375C mutation on the phosphorylation and the cross-linking propensity of full-length FGFR3 in HEK 293 cells, and we compare the results to previously published results for the G380R mutant. We observe identical behavior of the two achondroplasia mutants in these experiments, a finding which supports a direct link between the severity of dwarfism phenotypes and the level and mechanism of FGFR3 over-activation. The mutations do not increase the cross-linking propensity of FGFR3, contrary to previous expectations that the achondroplasia mutations stabilize the FGFR3 dimers. Instead, the phosphorylation efficiency within un-liganded FGFR3 dimers is increased, and this increase is likely the underlying cause for pathogenesis in achondroplasia. We further investigate the G346E mutation, which has been reported to cause achondroplasia in one case. We find that this mutation does not increase FGFR3 phosphorylation and decreases FGFR3 cross-linking propensity, a finding which raises questions whether this mutation is indeed a genetic cause for human dwarfism. PMID:22529939

  3. [Leigh syndrome resulting from a de novo mitochondrial DNA mutation (T8993G)].

    PubMed

    Playán, A; Solano-Palacios, A; González de la Rosa, J B; Merino-Arribas, J M; Andreu, A L; López-Pérez, M; Montoya, J

    Several degenerative neurological diseases are caused by mutations in the mitochondrial gene coding for subunit 6 of the ATPase. Thus, NARP (neurogenic weakness, ataxia, and retinitis pigmentosa) and Leigh syndromes are associated to a T8993G mutation when the percentage of mutant mitochondrial DNA is low (60 90%) or high (>90%), respectively. Leigh syndrome is also caused by a second mutation in the same position T8993C. The patient, a boy that died at 6 months, had generalized hypotonia, psychomotor delay, hepatomegaly, choreic movements and hyporreflexia. MRI showed hypodensities in the basal ganglia and brain stem as well as hyperlactacidemia. Molecular genetic analysis of the mitochondrial DNA showed that the patient had the T8993G mutation in a percentage higher than 95%. No mutated DNA was detected in blood of the proband s mother, maternal aunt and grandmother. The point mutation T8993G may occur de novo, at high levels, causing neurodegenerative diseases.

  4. Surveyor nuclease detection of mutations and polymorphisms of mtDNA in children.

    PubMed

    Pilch, Jacek; Asman, Marek; Jamroz, Ewa; Kajor, Maciej; Kotrys-Puchalska, Elżbieta; Goss, Małgorzata; Krzak, Maria; Witecka, Joanna; Gmiński, Jan; Sieroń, Aleksander L

    2010-11-01

    Mitochondrial encephalomyopathies are complex disorders with wide range of clinical manifestations. Particularly time-consuming is the identification of mutations in mitochondrial DNA. A group of 20 children with clinical manifestations of mitochondrial encephalomyopathies was selected for molecular studies. The aims were (a) to identify mutations in mtDNA isolated from muscle and (b) to verify detected mutations in DNA isolated from blood, in order to assess the utility of a Surveyor nuclease assay kit for patient screening. The most common changes found were polymorphisms, including a few missense mutations altering the amino acid sequence of mitochondrial proteins. In two boys with MELAS (i.e., mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes), a mutation A→G3243 was detected in the tRNALeu gene of mtDNA isolated from muscle and blood. In one boy, the carrier status of his mother was confirmed, based on molecular analysis of DNA isolated from blood. A method using Surveyor nuclease allows systematic screening for small mutations in mtDNA, using as its source blood of the patients and asymptomatic carriers. The method still requires confirmation studying a larger group. In some patients, the use of this method should precede and might limit indications for traumatic muscle and skin biopsy. Copyright © 2010 Elsevier Inc. All rights reserved.

  5. Antitumor activity of alectinib, a selective ALK inhibitor, in an ALK-positive NSCLC cell line harboring G1269A mutation: Efficacy of alectinib against ALK G1269A mutated cells.

    PubMed

    Yoshimura, Yasushi; Kurasawa, Mitsue; Yorozu, Keigo; Puig, Oscar; Bordogna, Walter; Harada, Naoki

    2016-03-01

    Alectinib is a highly selective next-generation anaplastic lymphoma kinase (ALK) inhibitor. Although alectinib shows inhibitory activity against various crizotinib-resistant ALK mutations in studies using cell-free kinase assays and Ba/F3 cell-based assays, it has not been tested for efficacy against non-small cell lung cancer (NSCLC) with the ALK mutations. We conducted in vitro and in vivo investigations into the antitumor activity of alectinib against an ALK-positive NSCLC cell line, SNU-2535, which harbors an ALK G1269A mutation. The clinical efficacy of alectinib against a NSCLC patient harboring ALK G1269A mutation was evaluated in the phase I part of the North American study. Alectinib exhibited antiproliferative activity against SNU-2535 cells in vitro with IC50 of 33.1 nM. Alectinib strongly inhibited phosphorylation of ALK and its downstream signaling molecules ERK1/2, AKT, and STAT3. In a mouse xenograft model, once-daily oral administration of alectinib for 21 days resulted in strong tumor regression. In addition, administration of alectinib for 100 days achieved continuous tumor regression without tumor regrowth in all mice. Notably, eradication of tumor cells was observed in half of the mice. In the clinical study, a patient with ALK G1269A mutation showed partial response to alectinib with a duration of response of 84 days. These results indicated that alectinib has potent antitumor activity against NSCLC cells harboring the crizotinib-resistant mutation ALK G1269A. It is expected that alectinib would provide a valuable therapeutic option for patients with NSCLC having not only native ALK but also crizotinib-resistant ALK mutations.

  6. G6PDdb, an integrated database of glucose-6-phosphate dehydrogenase (G6PD) mutations.

    PubMed

    Kwok, Colin J; Martin, Andrew C R; Au, Shannon W N; Lam, Veronica M S

    2002-03-01

    G6PDdb (http://www.rubic.rdg.ac.uk/g6pd/ or http://www.bioinf.org.uk/g6pd/) is a newly created web-accessible locus-specific mutation database for the human Glucose-6-phosphate dehydrogenase (G6PD) gene. The relational database integrates up-to-date mutational and structural data from various databanks (GenBank, Protein Data Bank, etc.) with biochemically characterized variants and their associated phenotypes obtained from published literature and the Favism website. An automated analysis of the mutations likely to have a significant impact on the structure of the protein has been performed using a recently developed procedure. The database may be queried online and the full results of the analysis of the structural impact of mutations are available. The web page provides a form for submitting additional mutation data and is linked to resources such as the Favism website, OMIM, HGMD, HGVBASE, and the PDB. This database provides insights into the molecular aspects and clinical significance of G6PD deficiency for researchers and clinicians and the web page functions as a knowledge base relevant to the understanding of G6PD deficiency and its management. Copyright 2002 Wiley-Liss, Inc.

  7. A G542X cystic fibrosis mouse model for examining nonsense mutation directed therapies.

    PubMed

    McHugh, Daniel R; Steele, Miarasa S; Valerio, Dana M; Miron, Alexander; Mann, Rachel J; LePage, David F; Conlon, Ronald A; Cotton, Calvin U; Drumm, Mitchell L; Hodges, Craig A

    2018-01-01

    Nonsense mutations are present in 10% of patients with CF, produce a premature termination codon in CFTR mRNA causing early termination of translation, and lead to lack of CFTR function. There are no currently available animal models which contain a nonsense mutation in the endogenous Cftr locus that can be utilized to test nonsense mutation therapies. In this study, we create a CF mouse model carrying the G542X nonsense mutation in Cftr using CRISPR/Cas9 gene editing. The G542X mouse model has reduced Cftr mRNA levels, demonstrates absence of CFTR function, and displays characteristic manifestations of CF mice such as reduced growth and intestinal obstruction. Importantly, CFTR restoration is observed in G542X intestinal organoids treated with G418, an aminoglycoside with translational readthrough capabilities. The G542X mouse model provides an invaluable resource for the identification of potential therapies of CF nonsense mutations as well as the assessment of in vivo effectiveness of these potential therapies targeting nonsense mutations.

  8. A multiplex method for detection of glucose-6-phosphate dehydrogenase (G6PD) gene mutations.

    PubMed

    Zhang, L; Yang, Y; Liu, R; Li, Q; Yang, F; Ma, L; Liu, H; Chen, X; Yang, Z; Cui, L; He, Y

    2015-12-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common human enzyme defect caused by G6PD gene mutations. This study aimed to develop a cost-effective, multiplex, genotyping method for detecting common mutations in the G6PD gene. We used a SNaPshot approach to genotype multiple G6PD mutations that are common to human populations in South-East Asia. This assay is based on multiplex PCR coupled with primer extension reactions. Different G6PD gene mutations were determined by peak retention time and colors of the primer extension products. We designed PCR primers for multiplex amplification of the G6PD gene fragments and for primer extension reactions to genotype 11 G6PD mutations. DNA samples from a total of 120 unrelated G6PD-deficient individuals from the China-Myanmar border area were used to establish and validate this method. Direct sequencing of the PCR products demonstrated 100% concordance between the SNaPshot and the sequencing results. The SNaPshot method offers a specific and sensitive alternative for simultaneously interrogating multiple G6PD mutations. © 2015 John Wiley & Sons Ltd.

  9. [Leigh syndrome caused by the mitochondrial DNA G14459A mutation in a Mexican family].

    PubMed

    Gutiérrez, A; Saldaña-Martínez, A; García-Ramírez, R; Rayo-Mares, D; Carreras, M; López-Pérez, M J; Ruiz-Pesini, E; Montoya, J; Montiel-Sosa, J F

    Leigh syndrome is a neurodegenerative and progressive disease that appears usually in childhood due to defects in nuclear or mitochondrial genome. The mutation G14459A in mitochondrial DNA has been associated previously to Leber hereditary optic neuropathy and recently to Leigh syndrome. A 10 months-old Mexican girl diagnosed of Leigh syndrome. Molecular-genetic studies detected the mutation G14459A in a percentage close to homoplasmy and in low heteroplasmy in her mother. The rest of the maternally related family members analyzed were negative. The G14459A mutation, although not very frequently associated to Leigh syndrome, should be analyzed in patients that do not present the most common point mutations.

  10. MELAS syndrome, cardiomyopathy, rhabdomyolysis, and autism associated with the A3260G mitochondrial DNA mutation.

    PubMed

    Connolly, Barbara S; Feigenbaum, Annette S J; Robinson, Brian H; Dipchand, Anne I; Simon, David K; Tarnopolsky, Mark A

    2010-11-12

    The A to G transition mutation at position 3260 of the mitochondrial genome is usually associated with cardiomyopathy and myopathy. One Japanese kindred reported the phenotype of mitochondrial encephalomyopathy, lactic acidosis and stroke-like episodes (MELAS syndrome) in association with the A3260G mtDNA mutation. We describe the first Caucasian cases of MELAS syndrome associated with the A3260G mutation. Furthermore, this mutation was associated with exercise-induced rhabdomyolysis, hearing loss, seizures, cardiomyopathy, and autism in the large kindred. We conclude that the A3260G mtDNA mutation is associated with wide phenotypic heterogeneity with MELAS and other "classical" mitochondrial phenotypes being manifestations. Copyright © 2010 Elsevier Inc. All rights reserved.

  11. The urinary proteome and metabonome differ from normal in adults with mitochondrial disease.

    PubMed

    Hall, Andrew M; Vilasi, Annalisa; Garcia-Perez, Isabel; Lapsley, Marta; Alston, Charlotte L; Pitceathly, Robert D S; McFarland, Robert; Schaefer, Andrew M; Turnbull, Doug M; Beaumont, Nick J; Hsuan, Justin J; Cutillas, Pedro R; Lindon, John C; Holmes, Elaine; Unwin, Robert J; Taylor, Robert W; Gorman, Grainne S; Rahman, Shamima; Hanna, Michael G

    2015-03-01

    We studied the extent and nature of renal involvement in a cohort of 117 adult patients with mitochondrial disease, by measuring urinary retinol-binding protein (RBP) and albumin; established markers of tubular and glomerular dysfunction, respectively. Seventy-five patients had the m.3243A>G mutation and the most frequent phenotypes within the entire cohort were 14 with MELAS, 33 with MIDD, and 17 with MERRF. Urinary RBP was increased in 29 of 75 of m.3243A>G patients, whereas albumin was increased in 23 of the 75. The corresponding numbers were 16 and 14, respectively, in the 42 non-m.3243A>G patients. RBP and albumin were higher in diabetic m.3243A>G patients than in nondiabetics, but there were no significant differences across the three major clinical phenotypes. The urine proteome (mass spectrometry) and metabonome (nuclear magnetic resonance) in a subset of the m.3243A>G patients were markedly different from controls, with the most significant alterations occurring in lysosomal proteins, calcium-binding proteins, and antioxidant defenses. Differences were also found between asymptomatic m.3243A>G carriers and controls. No patients had an elevated serum creatinine level, but 14% had hyponatremia, 10% had hypophosphatemia, and 14% had hypomagnesemia. Thus, abnormalities in kidney function are common in adults with mitochondrial disease, exist in the absence of elevated serum creatinine, and are not solely explained by diabetes.

  12. A novel mutation MT-COIII m.9267G>C and MT-COI m.5913G>A mutation in mitochondrial genes in a Tunisian family with maternally inherited diabetes and deafness (MIDD) associated with sever nephropathy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tabebi, Mouna, E-mail: mouna.biologiste@yahoo.com; Mkaouar-Rebai, Emna; Mnif, Mouna

    Mitochondrial diabetes (MD) is a heterogeneous disorder characterized by a chronic hyperglycemia, maternal transmission and its association with a bilateral hearing impairment. Several studies reported mutations in mitochondrial genes as potentially pathogenic for diabetes, since mitochondrial oxidative phosphorylation plays an important role in glucose-stimulated insulin secretion from beta cells. In the present report, we studied a Tunisian family with mitochondrial diabetes (MD) and deafness associated with nephropathy. The mutational analysis screening revealed the presence of a novel heteroplasmic mutation m.9276G>C in the mitochondrial COIII gene, detected in mtDNA extracted from leukocytes of a mother and her two daughters indicating thatmore » this mutation is maternally transmitted and suggest its implication in the observed phenotype. Bioinformatic tools showed that m.9267G>C mutation (p.A21P) is « deleterious » and it can modify the function and the stability of the MT-COIII protein by affecting the assembly of mitochondrial COX subunits and the translocation of protons then reducing the activity of the respective OXPHOS complexes of ATP synthesis. The nonsynonymous mutation (p.A21P) has not been reported before, it is the first mutation described in the COXIII gene which is related to insulin dependent mitochondrial diabetes and deafness and could be specific to the Tunisian population. The m.9267G>C mutation was present with a nonsynonymous inherited mitochondrial homoplasmic variation MT-COI m.5913 G>A (D4N) responsible of high blood pressure, a clinical feature detected in all explored patients. - Highlights: • MT-COX3 m.9267G>C (p.A21P), heteroplasmic substitution, is not reported in any database. • m.9267G>C can be responsible of the MIDD associated with nephropaty. • This substitution can modify the function and the stability of the MT-CO3 protein. • This substitution can modify MT-CO3 structure (2D and 3D). • MT-COX3 m.9267G>C is

  13. Base substitution mutations in uridinediphosphate-dependent glycosyltransferase 76G1 gene of Stevia rebaudiana causes the low levels of rebaudioside A: mutations in UGT76G1, a key gene of steviol glycosides synthesis.

    PubMed

    Yang, Yong-Heng; Huang, Su-Zhen; Han, Yu-Lin; Yuan, Hai-Yan; Gu, Chun-Sun; Zhao, Yan-Hai

    2014-07-01

    Steviol glycosides, extracted from the leaves of Stevia rebaudiana (Bert) Bertoni, are calorie-free sugar substitute of natural origin with intensely sweet (Boileau et al., 2012). Stevioside and rebaudioside A are the two main kinds of the diterpenic glycosides. We analyzed the concentration of stevioside and rebaudioside A in Stevia leaves of about 500 samples (hybrid progenies) and discovered a mutation plant "Z05" with very low levels of rebaudioside A. Because UGT76G1, a uridinediphosphate-dependent glycosyltransferases, is responsible for the conversion from stevioside to rebaudioside A (Richman et al., 2005), so mutation identification was done by sequencing the candidate gene, UGT76G1. In this study molecular analysis of two strains revealed a heterozygotic nonsense mutation of c.389T > G (p.L121X) in UGT76G1. Meanwhile, we found some amino acid substitutions significant change the protein structure. And the difference of enzyme activity between two strains proved the lack of functionality of UGT76G1 of the mutation "Z05". So the nonsense mutation and amino acid substitution mutation resulted in the low levels of rebaudioside A. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  14. The G matrix under fluctuating correlational mutation and selection.

    PubMed

    Revell, Liam J

    2007-08-01

    Theoretical quantitative genetics provides a framework for reconstructing past selection and predicting future patterns of phenotypic differentiation. However, the usefulness of the equations of quantitative genetics for evolutionary inference relies on the evolutionary stability of the additive genetic variance-covariance matrix (G matrix). A fruitful new approach for exploring the evolutionary dynamics of G involves the use of individual-based computer simulations. Previous studies have focused on the evolution of the eigenstructure of G. An alternative approach employed in this paper uses the multivariate response-to-selection equation to evaluate the stability of G. In this approach, I measure similarity by the correlation between response-to-selection vectors due to random selection gradients. I analyze the dynamics of G under several conditions of correlational mutation and selection. As found in a previous study, the eigenstructure of G is stabilized by correlational mutation and selection. However, over broad conditions, instability of G did not result in a decreased consistency of the response to selection. I also analyze the stability of G when the correlation coefficients of correlational mutation and selection and the effective population size change through time. To my knowledge, no prior study has used computer simulations to investigate the stability of G when correlational mutation and selection fluctuate. Under these conditions, the eigenstructure of G is unstable under some simulation conditions. Different results are obtained if G matrix stability is assessed by eigenanalysis or by the response to random selection gradients. In this case, the response to selection is most consistent when certain aspects of the eigenstructure of G are least stable and vice versa.

  15. Molecular dynamics simulations and principal component analysis on human laforin mutation W32G and W32G/K87A.

    PubMed

    Srikumar, P S; Rohini, K; Rajesh, Perumbilavil Kaithamanakallam

    2014-06-01

    Mutations in human laforin lead to an autosomal neurodegenerative disorder Lafora disease. In N-terminal carbohydrate binding domain of laforin, two mutations W32G and K87A are reported as highly disease causing laforin mutants. Experimental studies reported that mutations are responsible for the abolishment of glycogen binding which is a critical function of laforin. Our current computational study focused on the role of conformational changes in human laforin structure due to existing single mutation W32G and prepared double mutation W32G/K87A related to loss of glycogen binding. We performed 10 ns molecular dynamics (MD) simulation studies in the Gromacs package for both mutations and analyzed the trajectories. From the results, the global properties like root mean square deviation, root mean square fluctuation, radius of gyration, solvent accessible surface area and hydrogen bonds showed structural changes in atomic level observed in W32G and W32G/K87A laforin mutants. The conformational change induced by mutants influenced the loss of the overall stability of the native laforin. Moreover, the change in overall motion of protein was analyzed by principal component analysis and results showed protein clusters expanded more than native and also change in direction in case of double mutant in conformational space. Overall, our report provides theoretical information on loss of structure-function relationship due to flexible nature of laforin mutants. In conclusion, comparative MD simulation studies support the experimental data on W32G and W32G/K87A related to the lafora disease mechanism on glycogen binding.

  16. Factor V Leiden G1691A and prothrombin G20210A mutations among Palestinian patients with sickle cell disease.

    PubMed

    Samarah, Fekri; Srour, Mahmoud A

    2018-01-01

    Vascular thrombosis is an important pathophysiological aspect of sickle cell disease (SCD). This study aimed to investigate the prevalence and clinical impact of factor V Leiden G1691A (FVL) and prothrombin G20210A mutations among Palestinian sickle cell disease (SCD) patients. A total of 117 SCD patients, including 59 patients with sickle cell anemia (SS), 33 patients with sickle β-thalassemia and 25 individuals with sickle cell trait (AS) were studied. The control group consisted of 118 healthy individuals. FVL and prothrombin G20210A mutations were determined by RFLP PCR. Analysis of the clinical history of SCD patients revealed that seven patients have had vascular complications such as ischemic stroke or deep vein thrombosis. In SCD patients, the inheritance of the FVL mutation showed a significantly higher incidence of pain in joints, chest and abdomen as well as regular dependence on blood transfusion compared to SCD with the wild type. Age- and sex-adjusted logistic regression analysis revealed a significant association between FVL and sickle cell anemia with an odds ratio (OR) of 5.6 (95% confidence intervals [CI] of 1.91-39.4, P  = 0.039) in SS patients. However, increased prevalence of the FVL in AS subjects and sickle β-thalassemia patients was not statistically significant compared to controls (OR 3.97, 95% CI 0.51-28.6, P  = 0.17 and OR 3.59, 95% CI 0.35-41.6, P  = 0.26, respectively). The distribution of prothrombin G20210A mutation among SCD patients compared to controls was not significantly different, thus our findings do not support an association of this mutation with SCD. FVL was more prevalent among SS patients compared to controls and it was associated with higher incidence of disease complications among SCD patients.

  17. A novel mutation MT-COIII m.9267G>C and MT-COI m.5913G>A mutation in mitochondrial genes in a Tunisian family with maternally inherited diabetes and deafness (MIDD) associated with severe nephropathy.

    PubMed

    Tabebi, Mouna; Mkaouar-Rebai, Emna; Mnif, Mouna; Kallabi, Fakhri; Ben Mahmoud, Afif; Ben Saad, Wafa; Charfi, Nadia; Keskes-Ammar, Leila; Kamoun, Hassen; Abid, Mohamed; Fakhfakh, Faiza

    2015-04-10

    Mitochondrial diabetes (MD) is a heterogeneous disorder characterized by a chronic hyperglycemia, maternal transmission and its association with a bilateral hearing impairment. Several studies reported mutations in mitochondrial genes as potentially pathogenic for diabetes, since mitochondrial oxidative phosphorylation plays an important role in glucose-stimulated insulin secretion from beta cells. In the present report, we studied a Tunisian family with mitochondrial diabetes (MD) and deafness associated with nephropathy. The mutational analysis screening revealed the presence of a novel heteroplasmic mutation m.9276G>C in the mitochondrial COIII gene, detected in mtDNA extracted from leukocytes of a mother and her two daughters indicating that this mutation is maternally transmitted and suggest its implication in the observed phenotype. Bioinformatic tools showed that m.9267G>C mutation (p.A21P) is « deleterious » and it can modify the function and the stability of the MT-COIII protein by affecting the assembly of mitochondrial COX subunits and the translocation of protons then reducing the activity of the respective OXPHOS complexes of ATP synthesis. The nonsynonymous mutation (p.A21P) has not been reported before, it is the first mutation described in the COXIII gene which is related to insulin dependent mitochondrial diabetes and deafness and could be specific to the Tunisian population. The m.9267G>C mutation was present with a nonsynonymous inherited mitochondrial homoplasmic variation MT-COI m.5913 G>A (D4N) responsible of high blood pressure, a clinical feature detected in all explored patients. Copyright © 2015. Published by Elsevier Inc.

  18. Prevalence of 1691G>A FV mutation in females from Bosnia and Herzegovina - a preliminary report

    PubMed Central

    Yaljevac, Amina; Mehić, Bakir; Kiseljaković, Emina; Ibrulj, Slavka; Garstka, Agnieszka; Adler, Grazyna

    2013-01-01

    Factor V is the liver-synthesized multidomain glycoprotein encoded by a gene localised on chromosome 1q23. The point mutation 1691G>A in this gene results in formation of an altered protein of V Factor resistant to activated protein C (APC) cleavage. This mutation alone is the most frequent cause of inborn thrombophilia and the most widely acknowledged genetic risk factor for venous thrombosis in a Caucasian population. This study was designed to provide the first estimate of the frequency of the allele 1691A FV in the Bosnian female population. The 1691G>A FV mutation was examined by polymerase chain reaction-restriction fragment length polymorphism, in a group of 67 women, mean age of 58.6 years with no history of cardiovascural incident. Our findings revealed an absence of the mutated allele 1691A FV in the studied group. This is the first report on the 1691G>A FV mutation in a population from Bosnia and Herzegovina. Further research is needed to establish prevalence of the mutated allele in the population from Bosnia and Herzegovina. PMID:23448608

  19. A Novel MAPT Mutation, G55R, in a Frontotemporal Dementia Patient Leads to Altered Tau Function

    PubMed Central

    Guzman, Elmer; Barczak, Anna; Chodakowska-Żebrowska, Małgorzata; Barcikowska, Maria; Feinstein, Stuart

    2013-01-01

    Over two dozen mutations in the gene encoding the microtubule associated protein tau cause a variety of neurodegenerative dementias known as tauopathies, including frontotemporal dementia (FTD), PSP, CBD and Pick's disease. The vast majority of these mutations map to the C-terminal region of tau possessing microtubule assembly and microtubule dynamics regulatory activities as well as the ability to promote pathological tau aggregation. Here, we describe a novel and non-conservative tau mutation (G55R) mapping to an alternatively spliced exon encoding part of the N-terminal region of the protein in a patient with the behavioral variant of FTD. Although less well understood than the C-terminal region of tau, the N-terminal region can influence both MT mediated effects as well as tau aggregation. The mutation changes an uncharged glycine to a basic arginine in the midst of a highly conserved and very acidic region. In vitro, 4-repeat G55R tau nucleates microtubule assembly more effectively than wild-type 4-repeat tau; surprisingly, this effect is tau isoform specific and is not observed in a 3-repeat G55R tau versus 3-repeat wild-type tau comparison. In contrast, the G55R mutation has no effect upon the abilities of tau to regulate MT growing and shortening dynamics or to aggregate. Additionally, the mutation has no effect upon kinesin translocation in a microtubule gliding assay. Together, (i) we have identified a novel tau mutation mapping to a mutation deficient region of the protein in a bvFTD patient, and (ii) the G55R mutation affects the ability of tau to nucleate microtubule assembly in vitro in a 4-repeat tau isoform specific manner. This altered capability could markedly affect in vivo microtubule function and neuronal cell biology. We consider G55R to be a candidate mutation for bvFTD since additional criteria required to establish causality are not yet available for assessment. PMID:24086739

  20. Mitochondrial tRNA(Thr) A15951G mutation may not be associated with Leber's Hereditary Optic Neuropathy.

    PubMed

    Zhang, Xi; Yu, Shuaishuai; Tu, Yunhai; Huang, Wenjie

    2016-07-01

    Mutation in mitochondrial DNA (mtDNA) has been found to play an important role in the pathogenesis of Leber's Hereditary Optic Neuropathy (LHON). Three primary mutations, the ND4 G11778A, ND6 T14484C, and ND1 G3460A, have been found to account more than 90% of LHON patients in many families worldwide. In addition to the mutations in genes encoding the respiratory chain complex I, reports concerning the mt-tRNA gene mutations associated with LHON have increased, some pathogenic mutations caused the failure in mt-tRNA metabolism, thereby worsened the mitochondrial dysfunction that is responsible for LHON. Recently, the A15951G mutation in mt-tRNA(Thr) gene has been reported to be a "modified" factor in increasing the penetrance and expressivity of LHON-associated ND4 G11778A mutation in three Chinese families. However, evolutionary conservation analysis of this mutation suggested a poor conservation index and the pathogenicity scoring system showed that this mutation was a neutral polymorphism.

  1. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

    PubMed

    Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

    2017-10-01

    Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

  2. Association of breast-fed neonatal hyperbilirubinemia with UGT1A1 polymorphisms: 211G>A (G71R) mutation becomes a risk factor under inadequate feeding.

    PubMed

    Sato, Hiroko; Uchida, Toshihiko; Toyota, Kentaro; Kanno, Miyako; Hashimoto, Taeko; Watanabe, Masashi; Nakamura, Tomohiro; Tamiya, Gen; Aoki, Kuraaki; Hayasaka, Kiyoshi

    2013-01-01

    Breastfeeding jaundice is a well-known phenomenon, but its pathogenesis is still unclear. Increased production of bilirubin, impaired hepatic uptake and metabolism of bilirubin, and increased enterohepatic circulation of bilirubin account for most cases of pathological neonatal hyperbilirubinemia. We previously reported that 211G>A (G71R) mutation of the UGT1A1 gene is prevalent in East Asians and is associated with the development of neonatal hyperbilirubinemia. Recently, significant association of G71R mutation with hyperbilirubinemia in breast-fed neonates was reported. We enrolled 401 full-term Japanese infants, who were exclusively breast-fed without supplementation of formula before developing hyperbilirubinemia, and classified them into two groups based on the degree of maximal body weight loss during the neonatal period. We analyzed the sex, gestational age, delivery mode, body weight at birth, maximal body weight loss and genotypes of G71R and (TA)(7) polymorphic mutations of UGT1A1. Statistical analysis revealed that maximal body weight loss during the neonatal period is the only independent risk factor for the development of neonatal hyperbilirubinemia. The effect of G71R mutation on neonatal hyperbilirubinemia is significant in neonates with 5% or greater maximal body weight loss and its influence increases in parallel with the degree of maximal body weight loss. Our study indicates that G71R mutation is a risk factor for neonatal hyperbilirubinemia only in infants with inadequate breastfeeding and suggests that adequate breastfeeding may overcome the genetic predisposing factor, G71R mutation, for the development of neonatal hyperbilirubinemia.

  3. Leigh Syndrome and the Mitochondrial m.13513G>A Mutation: Expanding the Clinical Spectrum.

    PubMed

    Monlleo-Neila, Laura; Toro, Mireia Del; Bornstein, Belen; Garcia-Arumi, Elena; Sarrias, Axel; Roig-Quilis, Manuel; Munell, Francina

    2013-11-01

    The mitochondrial DNA m.13513G>A mutation in the ND5 subunit gene is a frequent cause of Leigh syndrome. Patients harboring this mutation typically present with ptosis and cardiac conduction abnormalities, particularly Wolff-Parkinson-White syndrome, and have a late clinical onset, which contrasts with the typical infantile form. The authors describe a patient presenting with intrauterine growth retardation and visual impairment at 3 months of age, followed by infantile spasms, severe gastrointestinal dysmotility, and neurological regression. The patient had hyperlactacidemia and bilateral basal ganglia and brainstem lesions on MRI. Although he did not present cardiac conduction abnormalities, his mother had been diagnosed with Wolff-Parkinson-White syndrome. The m.13513G>A mutation was found in the patient's muscle and in several tissues of his mother. The present results expand the phenotype of Leigh syndrome associated with the m.13513G>A mutation, which should be suspected in patients with early-onset mitochondrial encephalopathy with infantile spasms or prominent gastrointestinal smooth muscle involvement.

  4. A systematic comparison of all mutations in hereditary sensory neuropathy type I (HSAN I) reveals that the G387A mutation is not disease associated.

    PubMed

    Hornemann, Thorsten; Penno, Anke; Richard, Stephane; Nicholson, Garth; van Dijk, Fleur S; Rotthier, Annelies; Timmerman, Vincent; von Eckardstein, Arnold

    2009-04-01

    Hereditary sensory neuropathy type 1 (HSAN I) is an autosomal dominant inherited neurodegenerative disorder of the peripheral nervous system associated with mutations in the SPTLC1 subunit of the serine palmitoyltransferase (SPT). Four missense mutations (C133W, C133Y, V144D and G387A) in SPTLC1 were reported to cause HSAN I. SPT catalyses the condensation of Serine and Palmitoyl-CoA, which is the first and rate-limiting step in the de novo synthesis of ceramides. Earlier studies showed that C133W and C133Y mutants have a reduced activity, whereas the impact of the V144D and G387A mutations on the human enzyme was not tested yet. In this paper, we show that none of the HSAN I mutations interferes with SPT complex formation. We demonstrate that also V144D has a reduced SPT activity, however to a lower extent than C133W and C133Y. In contrast, the G387A mutation showed no influence on SPT activity. Furthermore, the growth phenotype of LY-B cells--a SPTLC1 deficient CHO cell line--could be reversed by expressing either the wild-type SPTLC1 or the G387A mutant, but not the C133W mutant. This indicates that the G387A mutation is most likely not directly associated with HSAN I. These findings were genetically confirmed by the identification of a nuclear HSAN family which showed segregation of the G387A variant as a non-synonymous SNP.

  5. Genetics Home Reference: maternally inherited diabetes and deafness

    MedlinePlus

    ... Maassen JA. Mutation in mitochondrial tRNA(Leu)(UUR) gene in a large pedigree with maternally transmitted type II diabetes mellitus ... are genome editing and CRISPR-Cas9? What is precision medicine? What ...

  6. Amylin S20G mutation in Mexican population.

    PubMed

    Garcia-Gonzalez, Claudia Lorena; Montoya-Fuentes, Hector; Padilla-Rosas, Miguel; Sanchez-Corona, Jose

    2007-04-01

    Diabetes Mellitus type 2 (DM2) is a group of metabolic disorders characterized by defective insulin action or secretion or both with a 10.6% incidence in Mexican Mestizo population, DM2 is also classified within the localized misfolding diseases due to the amyloid pancreatic deposits found in 90% of the DM2 necropsies. The pancreatic amyloid main component is a protein known as human islet amyloid polypeptide (hIAPP) or amylin, the most common mutation is the S20G in Asian population with a polymorphic frequency in DM2 Asian patients. The aim of this study was to search this mutation in Mexican Mestizo general population (104) and DM2 patients (100). This is the first molecular study of hIAPP gene in Mexican population and in which we developed an alternative more effective antisense primer for the analysis of the NFGAILSS region in hIAPP exon 3 critical for the amyloid beta structure formation. We did not find the mutation in any of the 204 analyzed samples, thus the findings show that S20G is not a common mutation in Mexican Mestizo population.

  7. Detection of KatG/inhA Mutation to Guide Isoniazid and Ethionamide Use for Drug-resistant Tuberculosis

    PubMed Central

    Namburete, Evangelina

    2017-01-01

    Abstract Background Both Mozambique and Brazil are countries with a high burden of tuberculosis. Isoniazid (INH) is one of the cornerstones of tuberculosis treatment and, depending on the mutated gene (katG or inhA), the organism may be susceptible to high doses of INH (inhA mutation) or to ethionamide (-Eth-KatG mutation). Methods To analyze isoniazid genotypic resistance profile in Mycobacterium tuberculosis to guide decision making about management of resistant tuberculosis. Descriptive study of 311 M. tuberculosis isolated from Ribeirão Preto, Brazil (2011–2014) and 155 isolates from Beira, Mozambique (2014–2015). Drug resistance patterns and the specific genes mutations were determined using Genotype MTBDRplus (Hain Lifescience GmbH, Germany). Results Mutations in katG gene were detected in 13/22 (59%) of Brazilian and in 32/38 (84.2%) of Mozambican isolates. Unique inhA mutations were observed in 8/22 (36%) isolates in Brazil and 4/38 (10.5%) in Mozambique. Both katG and inhA mutations where detected in 1/22 (5%) and 2/38(5.2%), respectively. katG mutations were more frequent among INH previously treated patients. Conclusion There is a geographical variation of INH mutations and the new molecular tests can be used to guide and accelerate decision making towards the use of ETH or high doses of INH based on detected mutations. Disclosures All authors: No reported disclosures.

  8. Glucose-6-phosphate dehydrogenase (G6PD) mutations database: review of the "old" and update of the new mutations.

    PubMed

    Minucci, Angelo; Moradkhani, Kamran; Hwang, Ming Jing; Zuppi, Cecilia; Giardina, Bruno; Capoluongo, Ettore

    2012-03-15

    In the present paper we have updated the G6PD mutations database, including all the last discovered G6PD genetic variants. We underline that the last database has been published by Vulliamy et al. [1] who analytically reported 140 G6PD mutations: along with Vulliamy's database, there are two main sites, such as http://202.120.189.88/mutdb/ and www.LOVD.nl/MR, where almost all G6PD mutations can be found. Compared to the previous mutation reports, in our paper we have included for each mutation some additional information, such as: the secondary structure and the enzyme 3D position involving by mutation, the creation or abolition of a restriction site (with the enzyme involved) and the conservation score associated with each amino acid position. The mutations reported in the present tab have been divided according to the gene's region involved (coding and non-coding) and mutations affecting the coding region in: single, multiple (at least with two bases involved) and deletion. We underline that for the listed mutations, reported in italic, literature doesn't provide all the biochemical or bio-molecular information or the research data. Finally, for the "old" mutations, we tried to verify features previously reported and, when subsequently modified, we updated the specific information using the latest literature data. Copyright © 2012 Elsevier Inc. All rights reserved.

  9. Mutations in the G6PC3 gene cause Dursun syndrome.

    PubMed

    Banka, Siddharth; Newman, William G; Ozgül, R Koksal; Dursun, Ali

    2010-10-01

    Dursun syndrome is a triad of familial primary pulmonary hypertension, leucopenia, and atrial septal defect. Here we demonstrate that mutations in G6PC3 cause Dursun syndrome. Mutations in G6PC3 are known to also cause severe congenital neutropenia type 4. Identification of the genetic basis of Dursun syndrome expands the pre-existing knowledge about the phenotypic effects of mutations in G6PC3. We propose that Dursun syndrome should now be considered as a subset of severe congenital neutropenia type 4 with pulmonary hypertension as an important clinical feature. Copyright © 2010 Wiley-Liss, Inc.

  10. Carnitine-acylcarnitine translocase deficiency with c.199-10 T>G and novel c.1A>G mutation: Two case reports and brief literature review.

    PubMed

    Yan, Hui-Ming; Hu, Hao; Ahmed, Aisha; Feng, Bing-Bing; Liu, Jing; Jia, Zheng-Jun; Wang, Hua

    2017-11-01

    Carnitine-acylcarnitine translocate deficiency (CACTD) is a rare and life-threatening, autosomal recessive disorder of fatty acid β-oxidation characterized by hypoketotic hypoglycemia, hyperammonemia, cardiomyopathy, liver dysfunction, and muscle weakness; culminating in early death. To date, CACTD cases screened from the Chinese mainland population, especially patient with compound heterozygote with c.199-10T>G and a novel c.1A>G mutation in the SLC25A20 gene has never been described. Herein, we report 2 neonatal cases of CACTD identified from the mainland China. These 2 patients were presented with severe metabolic crisis and their clinical conditions deteriorate rapidly and both died of cardiorespiratory collapse in the first week of life. We present the clinical and biochemical features of 2 probands and a brief literature review of previously reported CACTD cases with the c.199-10T>G mutation. The acylcarnitine profiles by tandem-mass-spectrometry and the mutation analysis of SLC25A20 gene confirmed the diagnosis of CACTD in both patients. Mutation analysis demonstrated that patient No. 1 was homozygous for c.199-10T>G mutation, while patient No. 2 was a compound heterozygote for 2 mutations, a maternally-inherited c.199-10T>G and a paternally-inherited, novel c.1A>G mutation. Both patients were treated with an aggressive treatment regimen include high glucose and arginine infusion, respiratory, and circulatory support. The first proband died 3 days after delivery due to sudden cardiac arrest. The second patient's clinical condition, at one time, was improved by high glucose infusion, intravenous arginine, and circulatory support. However, the patient failed to wean from mechanical ventilation. Unfortunately, her parents refused further treatment due to fear of financial burdens. The patient died of congestive heart failure in the 6th day of life. We report the first 2 cases of CACTD identified from the mainland China. Apart from a founder mutation c.199-10T>G

  11. High prevalence of factor V Leiden and prothrombin G20101A mutations in Kashmiri patients with venous thromboembolism.

    PubMed

    Shafia, Syed; Zargar, Mahrukh H; Khan, Nabeela; Ahmad, Rehana; Shah, Zafar Amin; Asimi, Ravouf

    2018-05-15

    The genetic variants of the factor V (G1691A), prothrombin (G20210A) and MTHFR (C677T) genes have been widely implicated as inherited risk factors for developing venous thrombosis. This study was undertaken to reveal the frequency of these mutations in Kashmiri patients with venous thromboembolism. A case-control study was designed with 250 VTE patients and 250 healthy controls. The mutations were analysed using ARMS-PCR and PCR-RFLP approach. The factor V Leiden G1691A mutation was found in 17/250 (6.8%) VTE patients and prothrombin G20210A mutation was found in 7/250 (2.8%) VTE patients while no mutation was found in any of the healthy controls. Both the mutations were found to be significantly associated with the increased risk of VTE (p = 0.0001 and 0.0150 respectively) while no association of VTE risk with MTHFR C677T polymorphism was found (p = 0.53). The increased frequency of factor V Leiden G1691A and prothrombin G20210A mutation in VTE patients indicates a significant role of these mutations in the development of VTE in our population. We therefore suggest the routine screening of these two mutations as thrombophilic markers in Kashmiri patients with venous thromboembolism. Copyright © 2018 Elsevier B.V. All rights reserved.

  12. TRPC6 G757D Loss-of-Function Mutation Associates with FSGS

    PubMed Central

    Riehle, Marc; Büscher, Anja K.; Gohlke, Björn-Oliver; Kaßmann, Mario; Kolatsi-Joannou, Maria; Bräsen, Jan H.; Nagel, Mato; Becker, Jan U.; Winyard, Paul; Hoyer, Peter F.; Preissner, Robert; Krautwurst, Dietmar; Gollasch, Maik

    2016-01-01

    FSGS is a CKD with heavy proteinuria that eventually progresses to ESRD. Hereditary forms of FSGS have been linked to mutations in the transient receptor potential cation channel, subfamily C, member 6 (TRPC6) gene encoding a nonselective cation channel. Most of these TRPC6 mutations cause a gain-of-function phenotype, leading to calcium–triggered podocyte cell death, but the underlying molecular mechanisms are unclear. We studied the molecular effect of disease-related mutations using tridimensional in silico modeling of tetrameric TRPC6. Our results indicated that G757 is localized in a domain forming a TRPC6-TRPC6 interface and predicted that the amino acid exchange G757D causes local steric hindrance and disruption of the channel complex. Notably, functional characterization of model interface domain mutants suggested a loss-of-function phenotype. We then characterized 19 human FSGS–related TRPC6 mutations, the majority of which caused gain-of-function mutations. However, five mutations (N125S, L395A, G757D, L780P, and R895L) caused a loss-of-function phenotype. Coexpression of wild-type TRPC6 and TRPC6 G757D, mimicking heterozygosity observed in patients, revealed a dominant negative effect of TRPC6 G757D. Our comprehensive analysis of human disease–causing TRPC6 mutations reveals loss of TRPC6 function as an additional concept of hereditary FSGS and provides molecular insights into the mechanism responsible for the loss-of-function phenotype of TRPC6 G757D in humans. PMID:26892346

  13. Mitochondrial DNA sequence characteristics modulate the size of the genetic bottleneck.

    PubMed

    Wilson, Ian J; Carling, Phillipa J; Alston, Charlotte L; Floros, Vasileios I; Pyle, Angela; Hudson, Gavin; Sallevelt, Suzanne C E H; Lamperti, Costanza; Carelli, Valerio; Bindoff, Laurence A; Samuels, David C; Wonnapinij, Passorn; Zeviani, Massimo; Taylor, Robert W; Smeets, Hubert J M; Horvath, Rita; Chinnery, Patrick F

    2016-03-01

    With a combined carrier frequency of 1:200, heteroplasmic mitochondrial DNA (mtDNA) mutations cause human disease in ∼1:5000 of the population. Rapid shifts in the level of heteroplasmy seen within a single generation contribute to the wide range in the severity of clinical phenotypes seen in families transmitting mtDNA disease, consistent with a genetic bottleneck during transmission. Although preliminary evidence from human pedigrees points towards a random drift process underlying the shifting heteroplasmy, some reports describe differences in segregation pattern between different mtDNA mutations. However, based on limited observations and with no direct comparisons, it is not clear whether these observations simply reflect pedigree ascertainment and publication bias. To address this issue, we studied 577 mother-child pairs transmitting the m.11778G>A, m.3460G>A, m.8344A>G, m.8993T>G/C and m.3243A>G mtDNA mutations. Our analysis controlled for inter-assay differences, inter-laboratory variation and ascertainment bias. We found no evidence of selection during transmission but show that different mtDNA mutations segregate at different rates in human pedigrees. m.8993T>G/C segregated significantly faster than m.11778G>A, m.8344A>G and m.3243A>G, consistent with a tighter mtDNA genetic bottleneck in m.8993T>G/C pedigrees. Our observations support the existence of different genetic bottlenecks primarily determined by the underlying mtDNA mutation, explaining the different inheritance patterns observed in human pedigrees transmitting pathogenic mtDNA mutations. © The Author 2016. Published by Oxford University Press.

  14. Novel PSEN1 G209A mutation in early-onset Alzheimer dementia supported by structural prediction.

    PubMed

    An, Seong Soo A; Bagyinszky, Eva; Kim, Hye Ryoun; Seok, Ju-Won; Shin, Hae-Won; Bae, SeunOh; Kim, SangYun; Youn, Young Chul

    2016-05-20

    Three main genes are described as causative genes for early-onset Alzheimer dementia (EOAD): APP, PSEN1 and PSEN2. We describe a woman with EOAD had a novel PSEN1 mutation. A 54-year-old right-handed woman presented 12-year history of progressive memory decline. She was clinically diagnosed as familial Alzheimer's disease due to a PSEN1 mutation. One of two daughters also has the same mutation, G209A in the TM-IV of PS1 protein. Her mother had unspecified dementia that began at the age of 40s. PolyPhen2 and SIFT prediction suggested that G209A might be a damaging variant with high scores. 3D modeling revealed that G209A exchange could result significant changes in the PS1 protein. We report a case of EOAD having probable novel PSEN1 (G209A) mutation verified with structural prediction.

  15. Glycogen storage disease type 1a in three siblings with the G270V mutation.

    PubMed

    Parvari, R; Isam, J; Moses, S W

    1999-04-01

    Glycogen storage disease type 1a (von Gierke disease, GSD1a) is caused by the deficiency of microsomal glucose-6-phosphatase (G6Pase) activity. The cloning of G6Pase cDNA and characterization of the human G6Pase gene enabled the identification of the mutations causing GSD1a. Here we report on the clinical and biochemical features of three GSD1a siblings of a Muslin Arab family with a G270V mutation. Two older patients presented with an unusually mild clinical and biochemical course.

  16. Detection of katG and inhA mutations to guide isoniazid and ethionamide use for drug-resistant tuberculosis.

    PubMed

    Bollela, V R; Namburete, E I; Feliciano, C S; Macheque, D; Harrison, L H; Caminero, J A

    2016-08-01

    Depending on the presence of mutations that determine isoniazid (INH) susceptibility (katG and inhA), Mycobacterium tuberculosis may be susceptible to high doses of INH or ethionamide (ETH). To describe the INH resistance profile and association of katG mutation with previous INH treatment and level of drug resistance based on rapid molecular drug susceptibility testing (DST) in southern Brazil and central Mozambique. Descriptive study of 311 isolates from Ribeirão Preto, São Paulo, Brazil (2011-2014) and 155 isolates from Beira, Mozambique (2014-2015). Drug resistance patterns and specific gene mutations were determined using GenoType(®) MTBDRplus. katG gene mutations were detected in 12/22 (54.5%) Brazilian and 32/38 (84.2%) Mozambican isolates. inhA mutations were observed in 9/22 (40.9%) isolates in Brazil and in 4/38 (10.5%) in Mozambique. Both katG and inhA mutations were detected in respectively 1/22 (5%) and 2/38 (5.2%). The difference in the frequency of katG mutations in Brazil and Mozambique was statistically significant (P = 0.04). katG mutations were present in 68.8% (33/48) of patients previously treated with INH and 31.2% (15/48) of patients without previous INH. This difference was not statistically significant (P = 0.223). INH mutations varied geographically; molecular DST can be used to guide and accelerate decision making in the use of ETH or high doses of INH.

  17. Surveyor Nuclease: a new strategy for a rapid identification of heteroplasmic mitochondrial DNA mutations in patients with respiratory chain defects.

    PubMed

    Bannwarth, Sylvie; Procaccio, Vincent; Paquis-Flucklinger, Veronique

    2005-06-01

    Molecular analysis of mitochondrial DNA (mtDNA) is a critical step in diagnosis and genetic counseling of respiratory chain defects. No fast method is currently available for the identification of unknown mtDNA point mutations. We have developed a new strategy based on complete mtDNA PCR amplification followed by digestion with a mismatch-specific DNA endonuclease, Surveyor Nuclease. This enzyme, a member of the CEL nuclease family of plant DNA endonucleases, cleaves double-strand DNA at any mismatch site including base substitutions and small insertions/deletions. After digestion, cleavage products are separated and analyzed by agarose gel electrophoresis. The size of the digestion products indicates the location of the mutation, which is then confirmed and characterized by sequencing. Although this method allows the analysis of 2 kb mtDNA amplicons and the detection of multiple mutations within the same fragment, it does not lead to the identification of homoplasmic base substitutions. Homoplasmic pathogenic mutations have been described. Nevertheless, most homoplasmic base substitutions are neutral polymorphisms while deleterious mutations are typically heteroplasmic. Here, we report that this method can be used to detect mtDNA mutations such as m.3243A>G tRNA(Leu) and m.14709T>C tRNA(Glu) even when they are present at levels as low as 3% in DNA samples derived from patients with respiratory chain defects. Then, we tested five patients suffering from a mitochondrial respiratory chain defect and we identified a variant (m.16189T>C) in two of them, which was previously associated with susceptibility to diabetes and cardiomyopathy. In conclusion, this method can be effectively used to rapidly and completely screen the entire human mitochondrial genome for heteroplasmic mutations and in this context represents an important advance for the diagnosis of mitochondrial diseases.

  18. Cysteine Supplementation May be Beneficial in a Subgroup of Mitochondrial Translation Deficiencies.

    PubMed

    Bartsakoulia, Marina; Mϋller, Juliane S; Gomez-Duran, Aurora; Yu-Wai-Man, Patrick; Boczonadi, Veronika; Horvath, Rita

    2016-08-30

    Mitochondrial encephalomyopathies are severe, relentlessly progressive conditions and there are very few effective therapies available to date. We have previously suggested that in two rare forms of reversible mitochondrial disease (reversible infantile respiratory chain deficiency and reversible infantile hepatopathy) supplementation with L-cysteine can improve mitochondrial protein synthesis, since cysteine is required for the 2-thiomodification of mitochondrial tRNAs. We studied whether supplementation with L-cysteine or N-acetyl-cysteine (NAC) results in any improvement of the mitochondrial function in vitro in fibroblasts of patients with different genetic forms of abnormal mitochondrial translation. We studied in vitro in fibroblasts of patients carrying the common m.3243A>G and m.8344A>G mutations or autosomal recessive mutations in genes affecting mitochondrial translation, whether L-cysteine or N-acetyl-cysteine supplementation have an effect on mitochondrial respiratory chain function. Here we show that supplementation with L-cysteine, but not with N-acetyl-cysteine partially rescues the mitochondrial translation defect in vitro in fibroblasts of patients carrying the m.3243A>G and m.8344A>G mutations. In contrast, N-acetyl-cysteine had a beneficial effect on mitochondrial translation in TRMU and MTO1 deficient fibroblasts. Our results suggest that L-cysteine or N-acetyl-cysteine supplementation may be a potential treatment for selected subgroups of patients with mitochondrial translation deficiencies. Further studies are needed to explore the full potential of cysteine supplementation as a treatment for patients with mitochondrial disease.

  19. The mutY gene: a mutator locus in Escherichia coli that generates G.C----T.A transversions.

    PubMed Central

    Nghiem, Y; Cabrera, M; Cupples, C G; Miller, J H

    1988-01-01

    We have used a strain with an altered lacZ gene, which reverts to wild type via only certain transversions, to detect transversion-specific mutators in Escherichia coli. Detection relied on a papillation technique that uses a combination of beta-galactosides to reveal blue Lac+ papillae. One class of mutators is specific for the G.C----T.A transversion as determined by the reversion pattern of a set of lacZ mutations and by the distribution of forward nonsense mutations in the lacI gene. The locus responsible for the mutator phenotype is designated mutY and maps near 64 min on the genetic map of E. coli. The mutY locus may act in a similar but reciprocal fashion to the previously characterized mutT locus, which results in A.T----C.G transversions. Images PMID:3128795

  20. A novel mutation of the ACADM gene (c.145C>G) associated with the common c.985A>G mutation on the other ACADM allele causes mild MCAD deficiency: a case report

    PubMed Central

    2010-01-01

    A female patient, with normal familial history, developed at the age of 30 months an episode of diarrhoea, vomiting and lethargy which resolved spontaneously. At the age of 3 years, the patient re-iterated vomiting, was sub-febrile and hypoglycemic, fell into coma, developed seizures and sequels involving right hemi-body. Urinary excretion of hexanoylglycine and suberylglycine was low during this metabolic decompensation. A study of pre- and post-prandial blood glucose and ketones over a period of 24 hours showed a normal glycaemic cycle but a failure to form ketones after 12 hours fasting, suggesting a mitochondrial β-oxidation defect. Total blood carnitine was lowered with unesterified carnitine being half of the lowest control value. A diagnosis of mild MCAD deficiency (MCADD) was based on rates of 1-14C-octanoate and 9, 10-3H-myristate oxidation and of octanoyl-CoA dehydrogenase being reduced to 25% of control values. Other mitochondrial fatty acid oxidation proteins were functionally normal. De novo acylcarnitine synthesis in whole blood samples incubated with deuterated palmitate was also typical of MCADD. Genetic studies showed that the patient was compound heterozygous with a sequence variation in both of the two ACADM alleles; one had the common c.985A>G mutation and the other had a novel c.145C>G mutation. This is the first report for the ACADM gene c.145C>G mutation: it is located in exon 3 and causes a replacement of glutamine to glutamate at position 24 of the mature protein (Q24E). Associated with heterozygosity for c.985A>G mutation, this mutation is responsible for a mild MCADD phenotype along with a clinical story corroborating the emerging literature view that patients with genotypes representing mild MCADD (high residual enzyme activity and low urinary levels of glycine conjugates), similar to some of the mild MCADDs detected by MS/MS newborn screening, may be at risk for disease presentation. PMID:20923556

  1. Detection of katG and inhA mutations to guide isoniazid and ethionamide use for drug-resistant tuberculosis

    PubMed Central

    Bollela, V. R.; Namburete, E. I.; Feliciano, C. S.; Macheque, D.; Harrison, L. H.; Caminero, J. A.

    2017-01-01

    SUMMARY BACKGROUND Depending on the presence of mutations that determine isoniazid (INH) susceptibility (katG and inhA), Mycobacterium tuberculosis may be susceptible to high doses of INH or ethionamide (ETH). OBJECTIVE To describe the INH resistance profile and association of katG mutation with previous INH treatment and level of drug resistance based on rapid molecular drug susceptibility testing (DST) in southern Brazil and central Mozambique. DESIGN Descriptive study of 311 isolates from Ribeirão Preto, São Paulo, Brazil (2011–2014) and 155 isolates from Beira, Mozambique (2014–2015). Drug resistance patterns and specific gene mutations were determined using GenoType® MTBDRplus. RESULTS katG gene mutations were detected in 12/22 (54.5%) Brazilian and 32/38 (84.2%) Mozambican isolates. inhA mutations were observed in 9/22 (40.9%) isolates in Brazil and in 4/38 (10.5%) in Mozambique. Both katG and inhA mutations were detected in respectively 1/22 (5%) and 2/38 (5.2%). The difference in the frequency of katG mutations in Brazil and Mozambique was statistically significant (P = 0.04). katG mutations were present in 68.8% (33/48) of patients previously treated with INH and 31.2% (15/48) of patients without previous INH. This difference was not statistically significant (P = 0.223). CONCLUSION INH mutations varied geographically; molecular DST can be used to guide and accelerate decision making in the use of ETH or high doses of INH. PMID:27393546

  2. A rare mutation in AgRP, +79G>A, affects promoter activity.

    PubMed

    Sözen, M A; de Jonge, L H M; Greenway, F; Ravussin, E; Smith, S R; Argyropoulos, G

    2007-06-01

    The agouti-related protein is a powerful orexigenic peptide. A rare mutation, +79G>A, was identified in its minimal promoter in two white carriers. Comparison of the 45-year-old male proband, who was also a carrier of the common Ala67Thr polymorphism, with an age- and weight-matching wild-type population showed marginal differences for resting metabolic rate (RMR) and body mass index. The second carrier however was an obese 57-year-old female with reduced RMR. Functional analysis in hypothalamus- and periphery-derived cell lines showed reduced promoter activity for the +79A allele in the adrenocortical cells only, suggesting that it could affect the peripheral expression levels of AgRP. The +79G>A mutation could predispose to body weight gain (as suggested by the phenotype of the second carrier), but it could only affect the proband at an older age as he may be protected by the Ala67Thr polymorphism that is associated with resistance to late-onset fatness.

  3. A novel homozygous no-stop mutation in G6PC gene from a Chinese patient with glycogen storage disease type Ia.

    PubMed

    Gu, Lei-Lei; Li, Xin-Hua; Han, Yue; Zhang, Dong-Hua; Gong, Qi-Ming; Zhang, Xin-Xin

    2014-02-25

    Glycogen storage disease type Ia (GSD-Ia) is an autosomal recessive genetic disorder resulting in hypoglycemia, hepatomegaly and growth retardation. It is caused by mutations in the G6PC gene encoding Glucose-6-phosphatase. To date, over 80 mutations have been identified in the G6PC gene. Here we reported a novel mutation found in a Chinese patient with abnormal transaminases, hypoglycemia, hepatomegaly and short stature. Direct sequencing of the coding region and splicing-sites in the G6PC gene revealed a novel no-stop mutation, p.*358Yext*43, leading to a 43 amino-acid extension of G6Pase. The expression level of mutant G6Pase transcripts was only 7.8% relative to wild-type transcripts. This mutation was not found in 120 chromosomes from 60 unrelated healthy control subjects using direct sequencing, and was further confirmed by digestion with Rsa I restriction endonuclease. In conclusion, we revealed a novel no-stop mutation in this study which expands the spectrum of mutations in the G6PC gene. The molecular genetic analysis was indispensable to the diagnosis of GSD-Ia for the patient. Copyright © 2013 Elsevier B.V. All rights reserved.

  4. Analysis of fluG mutations that affect light-dependent conidiation in Aspergillus nidulans.

    PubMed Central

    Yager, L N; Lee, H O; Nagle, D L; Zimmerman, J E

    1998-01-01

    Conidiation in Aspergillus nidulans is induced by exposure to red light but can also be induced by blue light in certain mutant strains. We have isolated a mutation in the fluG gene that abolishes responsiveness to red light but does not affect the response to blue light. It has been shown that the veA1 (velvet) mutation allows conidiation to occur in the absence of light. We have identified three other fluG mutations that suppress the veA1 phenotype; these double mutants do not conidiate in the dark. The mutations described here define two new phenotypic classes of fluG alleles that display abnormal responses to light. We have characterized these mutations with respect to their molecular identity and to their effect on fluG transcription. Although it has been shown that fluG is required for the synthesis of an extracellular factor that directs conidiation, we do not detect this factor under conditions that promote conidiation in the veA1 suppressors. Furthermore, extracellular rescue is not observed in fluG deletion strains containing the wild-type veA allele. We propose that a genetic interaction between fluG and veA influences the production of the extracellular signal and regulates the initiation of conidiation. PMID:9691036

  5. Mitochondrial Diabetes in Children: Seek and You Will Find It

    PubMed Central

    Liguori, Rosario; Ferrigno, Maddalena; Galderisi, Alfonso; Vitale, Domenico; Simonelli, Francesca; Landolfo, Paolo; Prisco, Francesco; Masullo, Mariorosario; Sacchetti, Lucia

    2012-01-01

    Maternally Inherited Diabetes and Deafness (MIDD) is a rare form of diabetes due to defects in mitochondrial DNA (mtDNA). 3243 A>G is the mutation most frequently associated with this condition, but other mtDNA variants have been linked with a diabetic phenotype suggestive of MIDD. From 1989 to 2009, we clinically diagnosed mitochondrial diabetes in 11 diabetic children. Diagnosis was based on the presence of one or more of the following criteria: 1) maculopathy; 2) hearing impairment; 3) maternal heritability of diabetes/impaired fasting glucose and/or hearing impairment and/or maculopathy in three consecutive generations (or in two generations if 2 or 3 members of a family were affected). We sequenced the mtDNA in the 11 probands, in their mothers and in 80 controls. We identified 33 diabetes-suspected mutations, 1/33 was 3243A>G. Most patients (91%) and their mothers had mutations in complex I and/or IV of the respiratory chain. We measured the activity of these two enzymes and found that they were less active in mutated patients and their mothers than in the healthy control pool. The prevalence of hearing loss (36% vs 75–98%) and macular dystrophy (54% vs 86%) was lower in our mitochondrial diabetic adolescents than reported in adults. Moreover, we found a hitherto unknown association between mitochondrial diabetes and celiac disease. In conclusion, mitochondrial diabetes should be considered a complex syndrome with several phenotypic variants. Moreover, deafness is not an essential component of the disease in children. The whole mtDNA should be screened because the 3243A>G variant is not as frequent in children as in adults. In fact, 91% of our patients were mutated in the complex I and/or IV genes. The enzymatic assay may be a useful tool with which to confirm the pathogenic significance of detected variants. PMID:22536343

  6. MELAS syndrome associated with a new mitochondrial tRNA-Val gene mutation (m.1616A>G).

    PubMed

    Toyoshima, Yuka; Tanaka, Yuji; Satomi, Kazuo

    2017-09-11

    We describe the case of a 40-year-old-man with mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes (MELAS) syndrome, with cardiomyopathy and severe heart failure. He had a mitochondrial transfer RNA (tRNA) mutation (m.1616A>G) of the (tRNA-Val) gene, and it was not found in MELAS syndrome ever before. The presence of this newly observed tRNA-Val mutation (m.1616A>G) may induce multiple respiratory chain enzyme deficiencies and contribute to MELAS syndrome symptoms that are associated with mitochondrial DNA (mtDNA) mutations. We report that the pathognomonic symptom in MELAS syndrome caused by this newly observed mtDNA mutation may be rapid progression of cardiomyopathy and severe heart failure. © BMJ Publishing Group Ltd (unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  7. Dramatic effect of single-base mutation on the conformational dynamics of human telomeric G-quadruplex

    PubMed Central

    Lee, Ja Yil; Kim, D. S.

    2009-01-01

    Guanine-rich DNA sequences can form G-quadruplexes. These four-stranded structures are known to form in several genomic regions and to influence certain biological activities. Sometimes, the instability of G-quadruplexes causes the abnormal biological processes. Mutation is a culprit for the destabilization of G-quadruplexes, but the details of mutated G-quadruplexes are poorly understood. In this article, we investigated the conformational dynamics of single-base mutated human telomeric G-quadruplexes in the presence of K+ with single-molecule FRET spectroscopy. We observed that the replacement of single guanine by thymine in a G-track induces various folded structures, i.e. structural polymorphism. Moreover, direct observation of their dynamics revealed that a single-base mutation causes fast unfolding of folded states under physiological conditions. Furthermore, we found that the degree of destabilization varies according to mutation positions. When the central guanine of a G-track is replaced, the G-quadruplexes unfold quickly at any K+ concentrations and temperature. Meanwhile, outer-quartet mutated G-quadruplexes have heterogeneous dynamics at intermediate K+ concentrations and longstanding folded states at high K+ concentrations. Several factors such as base-stacking interaction and K+ coordination are responsible for the different dynamics according to the mutation position. PMID:19359361

  8. The mitochondrial 13513G>A mutation is associated with Leigh disease phenotypes independent of complex I deficiency in muscle.

    PubMed

    Brautbar, Ariel; Wang, Jing; Abdenur, Jose E; Chang, Richard C; Thomas, Janet A; Grebe, Theresa A; Lim, Cynthia; Weng, Shao-Wen; Graham, Brett H; Wong, Lee-Jun

    2008-08-01

    The mitochondrial 13513G>A (D393N) mutation in the ND5 subunit of the respiratory chain complex I was initially described in association with MELAS syndrome. Recent observations have linked this mutation to Leigh disease. We screened for the 13513G>A mutation in a cohort of 265 patients with Leigh and Leigh-like disease. The mutation was found in a total of 5 patients. An additional patient who had clinical presentation consistent with a Leigh-like phenotype but with a normal brain MRI was added to the cohort. None of an additional 88 patients meeting MELAS disease criteria, nor 56 patients with respiratory chain deficiency screened for the 13513G>A were found positive for the mutation. The most frequent clinical manifestations in our patients were hypotonia, ocular and cerebellar involvement. Low mutation heteroplasmy in the range of 20-40% was observed in all 6 patients. This observation is consistent with the previously reported low heteroplasmy of this mutation in some patients with the 13513G>A mutation and complex I deficiency. However, normal complex I activity was observed in two patients in our cohort. As most patients with Leigh-like disease and the 13513G>A mutation have been described with complex I deficiency, this report adds to the previously reported subset of patients with normal respiratory complex function. We conclude that in any patient with Leigh or Leigh-like disease, testing for the 13513G>A mutation is clinically relevant and low mutant loads in blood or muscle may be considered pathogenic, in the presence of normal respiratory chain enzyme activities.

  9. Leber's hereditary optic neuropathy is associated with the mitochondrial ND4 G11696A mutation in five Chinese families

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhou Xiangtian; Wei Qiping; Yang Li

    2006-02-03

    We report here the clinical, genetic, and molecular characterization of five Chinese families with Leber's hereditary optic neuropathy (LHON). Clinical and genetic evaluations revealed the variable severity and age-of-onset in visual impairment in these families. Strikingly, there were extremely low penetrances of visual impairment in these Chinese families. Sequence analysis of the complete mitochondrial genomes in these pedigrees showed the distinct sets of mtDNA polymorphism, in addition to the identical ND4 G11696A mutation associated with LHON. Indeed, this mutation is present in homoplasmy only in the maternal lineage of those pedigrees but not other members of these families. In fact,more » the occurrence of the G11696A mutation in these several genetically unrelated subjects affected by visual impairment strongly indicates that this mutation is involved in the pathogenesis of visual impairment. Furthermore, the N405D in the ND5 and G5820A in the tRNA{sup Cys}, showing high evolutional conservation, may contribute to the phenotypic expression of G11696A mutation in the WZ10 pedigree. However, there was the absence of functionally significant mtDNA mutations in other four Chinese pedigrees carrying the G11696A mutation. Therefore, nuclear modifier gene(s) or environmental factor(s) may play a role in the phenotypic expression of the LHON-associated G11696A mutation in these Chinese pedigrees.« less

  10. MELAS Syndrome and Kidney Disease Without Fanconi Syndrome or Proteinuria: A Case Report.

    PubMed

    Rudnicki, Michael; Mayr, Johannes A; Zschocke, Johannes; Antretter, Herwig; Regele, Heinz; Feichtinger, René G; Windpessl, Martin; Mayer, Gert; Pölzl, Gerhard

    2016-12-01

    Mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes (MELAS syndrome) represents one of the most frequent mitochondrial disorders. The majority of MELAS cases are caused by m.3243A>G mutation in the mitochondrial MT-TL1 gene, which encodes the mitochondrial tRNA Leu(UUR) . Kidney involvement usually manifests as Fanconi syndrome or focal segmental glomerulosclerosis. We describe a patient with MELAS mutation, cardiomyopathy, and chronic kidney disease without Fanconi syndrome, proteinuria, or hematuria. While the patient was waitlisted for heart transplantation, her kidney function deteriorated from an estimated glomerular filtration rate of 33 to 20mL/min/1.73m 2 within several months. Kidney biopsy was performed to distinguish decreased kidney perfusion from intrinsic kidney pathology. Histologic examination of the biopsy specimen showed only a moderate degree of tubular atrophy and interstitial fibrosis, but quantitative analysis of the m.3243A>G mitochondrial DNA mutation revealed high heteroplasmy levels of 89% in the kidney. Functional assessment showed reduced activity of mitochondrial enzymes in kidney tissue, which was confirmed by immunohistology. In conclusion, we describe an unusual case of MELAS syndrome with chronic kidney disease without apparent proteinuria or tubular disorders associated with Fanconi syndrome, but widespread interstitial fibrosis and a high degree of heteroplasmy of the MELAS specific mutation and low mitochondrial activity in the kidney. Copyright © 2016 National Kidney Foundation, Inc. Published by Elsevier Inc. All rights reserved.

  11. Mitochondrial mutation m.1555A>G as a risk factor for failed newborn hearing screening in a large cohort of preterm infants.

    PubMed

    Göpel, Wolfgang; Berkowski, Sandra; Preuss, Michael; Ziegler, Andreas; Küster, Helmut; Felderhoff-Müser, Ursula; Gortner, Ludwig; Mögel, Michael; Härtel, Christoph; Herting, Egbert

    2014-08-26

    The mitochondrial m.1555A>G mutation is associated with a high rate of permanent hearing loss, if aminoglycosides are given. Preterm infants have an increased risk of permanent hearing loss and are frequently treated with aminoglycoside antibiotics. We genotyped preterm infants with a birth weight below 1500 grams who were prospectively enrolled in a large cohort study for the m.1555A>G mutation. Treatment with aminoglycoside antibiotics in combination with mitochondrial m.1555A>G mutation was tested as a predictor for failed hearing screening at discharge in a multivariate logistic regression analysis. 7056 infants were genotyped and analysed. Low birth weight was the most significant predictor of failed hearing screening (p = 7.3 × 10-10). 12 infants (0.2%) had the m.1555A>G-mutation. In a multivariable logistic regression analysis, the combination of aminoglycoside treatment with m.1555A>G-carrier status was associated with failed hearing screening (p = 0.0058). However, only 3 out of 10 preterm m.1555A>G-carriers who were exposed to aminoglycosides failed hearing screening. The m.1555A>G-mutation was detected in all mothers of m.1555A>G-positive children, but in none of 2993 maternal DNA-samples of m.1555A>G-negative infants. Antenatal screening for the m.1555A>G mutation by maternal genotyping of pregnant women with preterm labour might be a reasonable approach to identify infants who are at increased risk for permanent hearing loss. Additional studies are needed to estimate the relevance of cofactors like aminoglycoside plasma levels and birth weight and the amount of preterm m.1555A>G-carriers with permanent hearing loss.

  12. Mutations in a gene encoding the. cap alpha. subunit of a Saccharomyces cerevisiae G protein indicate a role in mating pheromone signaling

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jahng, K.Y.; Ferguson, J.; Reed, S.I.

    1988-06-01

    Mutations which allowed conjugation by Saccharomyces cerevisiae cells lacking a mating pheromone receptor gene were selected. One of the genes defined by such mutations was isolated from a yeast genomic library by complementation of a temperature-sensitive mutation and is identically to the gene GPA1 (also known as SCG1), recently shown to be highly homologous to gene encoding the ..cap alpha.. subunits of mammalian G proteins. Physiological analysis of temperature-sensitive gpal mutations suggests that the encoded G protein is involved in signaling in response to mating pheromones. Mutational disruption of G-protein activity causes cell-cycle arrest in G/sub 1/, deposition of mating-specificmore » cell surface aggultinins, and induction of pheromone-specific mRNa, all of which are responses to pheromone in wild-type cells. In addition, mutants can conjugate without the benefit of mating pheromone or pheromone receptor. A model is presented where the activated G protein has a negative impact on a constitutive signal which normally keeps the pheromone response repressed.« less

  13. Mitochondrial mutation m.1555A>G as a risk factor for failed newborn hearing screening in a large cohort of preterm infants

    PubMed Central

    2014-01-01

    Background The mitochondrial m.1555A>G mutation is associated with a high rate of permanent hearing loss, if aminoglycosides are given. Preterm infants have an increased risk of permanent hearing loss and are frequently treated with aminoglycoside antibiotics. Methods We genotyped preterm infants with a birth weight below 1500 grams who were prospectively enrolled in a large cohort study for the m.1555A>G mutation. Treatment with aminoglycoside antibiotics in combination with mitochondrial m.1555A>G mutation was tested as a predictor for failed hearing screening at discharge in a multivariate logistic regression analysis. Results 7056 infants were genotyped and analysed. Low birth weight was the most significant predictor of failed hearing screening (p = 7.3 × 10-10). 12 infants (0.2%) had the m.1555A>G-mutation. In a multivariable logistic regression analysis, the combination of aminoglycoside treatment with m.1555A>G-carrier status was associated with failed hearing screening (p = 0.0058). However, only 3 out of 10 preterm m.1555A>G-carriers who were exposed to aminoglycosides failed hearing screening. The m.1555A>G-mutation was detected in all mothers of m.1555A>G-positive children, but in none of 2993 maternal DNA-samples of m.1555A>G-negative infants. Conclusion Antenatal screening for the m.1555A>G mutation by maternal genotyping of pregnant women with preterm labour might be a reasonable approach to identify infants who are at increased risk for permanent hearing loss. Additional studies are needed to estimate the relevance of cofactors like aminoglycoside plasma levels and birth weight and the amount of preterm m.1555A>G-carriers with permanent hearing loss. PMID:25155176

  14. A novel WFS1 mutation in a family with dominant low frequency sensorineural hearing loss with normal VEMP and EcochG findings

    PubMed Central

    Bramhall, Naomi F; Kallman, Jeremy C; Verrall, Aimee M; Street, Valerie A

    2008-01-01

    Background Low frequency sensorineural hearing loss (LFSNHL) is an uncommon clinical finding. Mutations within three different identified genes (DIAPH1, MYO7A, and WFS1) are known to cause LFSNHL. The majority of hereditary LFSNHL is associated with heterozygous mutations in the WFS1 gene (wolframin protein). The goal of this study was to use genetic analysis to determine if a small American family's hereditary LFSNHL is linked to a mutation in the WFS1 gene and to use VEMP and EcochG testing to further characterize the family's audiovestibular phenotype. Methods The clinical phenotype of the American family was characterized by audiologic testing, vestibular evoked myogenic potentials (VEMP), and electrocochleography (EcochG) evaluation. Genetic characterization was performed by microsatellite analysis and direct sequencing of WFS1 for mutation detection. Results Sequence analysis of the WFS1 gene revealed a novel heterozygous mutation at c.2054G>C predicting a p.R685P amino acid substitution in wolframin. The c.2054G>C mutation segregates faithfully with hearing loss in the family and is absent in 230 control chromosomes. The p.R685 residue is located within the hydrophilic C-terminus of wolframin and is conserved across species. The VEMP and EcochG findings were normal in individuals segregating the WFS1 c.2054G>C mutation. Conclusion We discovered a novel heterozygous missense mutation in exon 8 of WFS1 predicting a p.R685P amino acid substitution that is likely to underlie the LFSNHL phenotype in the American family. For the first time, we describe VEMP and EcochG findings for individuals segregating a heterozygous WFS1 mutation. PMID:18518985

  15. A novel WFS1 mutation in a family with dominant low frequency sensorineural hearing loss with normal VEMP and EcochG findings.

    PubMed

    Bramhall, Naomi F; Kallman, Jeremy C; Verrall, Aimee M; Street, Valerie A

    2008-06-02

    Low frequency sensorineural hearing loss (LFSNHL) is an uncommon clinical finding. Mutations within three different identified genes (DIAPH1, MYO7A, and WFS1) are known to cause LFSNHL. The majority of hereditary LFSNHL is associated with heterozygous mutations in the WFS1 gene (wolframin protein). The goal of this study was to use genetic analysis to determine if a small American family's hereditary LFSNHL is linked to a mutation in the WFS1 gene and to use VEMP and EcochG testing to further characterize the family's audiovestibular phenotype. The clinical phenotype of the American family was characterized by audiologic testing, vestibular evoked myogenic potentials (VEMP), and electrocochleography (EcochG) evaluation. Genetic characterization was performed by microsatellite analysis and direct sequencing of WFS1 for mutation detection. Sequence analysis of the WFS1 gene revealed a novel heterozygous mutation at c.2054G>C predicting a p.R685P amino acid substitution in wolframin. The c.2054G>C mutation segregates faithfully with hearing loss in the family and is absent in 230 control chromosomes. The p.R685 residue is located within the hydrophilic C-terminus of wolframin and is conserved across species. The VEMP and EcochG findings were normal in individuals segregating the WFS1 c.2054G>C mutation. We discovered a novel heterozygous missense mutation in exon 8 of WFS1 predicting a p.R685P amino acid substitution that is likely to underlie the LFSNHL phenotype in the American family. For the first time, we describe VEMP and EcochG findings for individuals segregating a heterozygous WFS1 mutation.

  16. Application of molecular imaging combined with genetic screening in diagnosing MELAS, diabetes and recurrent pancreatitis.

    PubMed

    Zhiping, W; Quwen, L; Hai, Z; Jian, Z; Peiyi, G

    2016-01-01

    We report molecular imaging combined with gene diagnosis in a family with 7 members who carried an A3243G mutation in mitochondrial tRNA and p.Thr 137 Met in cationic trypsinogen (PRSS1) gene presented with mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes (MELAS), diabetes, and recurrent pancreatitis. DNA sequencing was used to detect and validate mitochondrial DNA and PRSS1. We also verified that mitochondrial heterozygous mutations and c.410 C>T mutation causing p.Thr 137 Met could be detected in oral epithelial cells or in urine sediment cells. In addition, molecular imaging was carried out in the affected family members. In this pedigree, MELAS syndrome accompanied by pancreatitis was an important clinical feature, followed by diabetes. Heteroplasmy of the mtDNA A3243G and c.410 C>T mutation of PRSS1 was found in all tissue samples of these patients, but no mutations were found in 520 normal control and normal individuals of the family. However, based on molecular imaging observations, patients with relatively higher lactate/pyruvate levels had more typical and more severe symptoms, particularly those of pancreatic disease (diabetes or pancreatitis). MELAS syndrome may be associated with pancreatitis. For the diagnosis, it is more reasonable to perform molecular imaging combined with gene diagnosis.

  17. G protein-coupled receptor mutations and human genetic disease.

    PubMed

    Thompson, Miles D; Hendy, Geoffrey N; Percy, Maire E; Bichet, Daniel G; Cole, David E C

    2014-01-01

    Genetic variations in G protein-coupled receptor genes (GPCRs) disrupt GPCR function in a wide variety of human genetic diseases. In vitro strategies and animal models have been used to identify the molecular pathologies underlying naturally occurring GPCR mutations. Inactive, overactive, or constitutively active receptors have been identified that result in pathology. These receptor variants may alter ligand binding, G protein coupling, receptor desensitization and receptor recycling. Receptor systems discussed include rhodopsin, thyrotropin, parathyroid hormone, melanocortin, follicle-stimulating hormone (FSH), luteinizing hormone, gonadotropin-releasing hormone (GNRHR), adrenocorticotropic hormone, vasopressin, endothelin-β, purinergic, and the G protein associated with asthma (GPRA or neuropeptide S receptor 1 (NPSR1)). The role of activating and inactivating calcium-sensing receptor (CaSR) mutations is discussed in detail with respect to familial hypocalciuric hypercalcemia (FHH) and autosomal dominant hypocalemia (ADH). The CASR mutations have been associated with epilepsy. Diseases caused by the genetic disruption of GPCR functions are discussed in the context of their potential to be selectively targeted by drugs that rescue altered receptors. Examples of drugs developed as a result of targeting GPCRs mutated in disease include: calcimimetics and calcilytics, therapeutics targeting melanocortin receptors in obesity, interventions that alter GNRHR loss from the cell surface in idiopathic hypogonadotropic hypogonadism and novel drugs that might rescue the P2RY12 receptor congenital bleeding phenotype. De-orphanization projects have identified novel disease-associated receptors, such as NPSR1 and GPR35. The identification of variants in these receptors provides genetic reagents useful in drug screens. Discussion of the variety of GPCRs that are disrupted in monogenic Mendelian disorders provides the basis for examining the significance of common

  18. Disease-associated extracellular loop mutations in the adhesion G protein-coupled receptor G1 (ADGRG1; GPR56) differentially regulate downstream signaling.

    PubMed

    Kishore, Ayush; Hall, Randy A

    2017-06-09

    Mutations to the adhesion G protein-coupled receptor ADGRG1 (G1; also known as GPR56) underlie the neurological disorder bilateral frontoparietal polymicrogyria. Disease-associated mutations in G1 studied to date are believed to induce complete loss of receptor function through disruption of either receptor trafficking or signaling activity. Given that N-terminal truncation of G1 and other adhesion G protein-coupled receptors has been shown to significantly increase the receptors' constitutive signaling, we examined two different bilateral frontoparietal polymicrogyria-inducing extracellular loop mutations (R565W and L640R) in the context of both full-length and N-terminally truncated (ΔNT) G1. Interestingly, we found that these mutations reduced surface expression of full-length G1 but not G1-ΔNT in HEK-293 cells. Moreover, the mutations ablated receptor-mediated activation of serum response factor luciferase, a classic measure of Gα 12/13 -mediated signaling, but had no effect on G1-mediated signaling to nuclear factor of activated T cells (NFAT) luciferase. Given these differential signaling results, we sought to further elucidate the pathway by which G1 can activate NFAT luciferase. We found no evidence that ΔNT activation of NFAT is dependent on Gα q/11 -mediated or β-arrestin-mediated signaling but rather involves liberation of Gβγ subunits and activation of calcium channels. These findings reveal that disease-associated mutations to the extracellular loops of G1 differentially alter receptor trafficking, depending on the presence of the N terminus, and differentially alter signaling to distinct downstream pathways. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  19. A Mitochondrial DNA A8701G Mutation Associated with Maternally Inherited Hypertension and Dilated Cardiomyopathy in a Chinese Pedigree of a Consanguineous Marriage

    PubMed Central

    Zhu, Ye; Gu, Xiang; Xu, Chao

    2016-01-01

    Background: Cardiovascular diseases, including dilated cardiomyopathy (DCM) and hypertension, are the leading cause of death worldwide. The role of mitochondrial DNA (mtDNA) in the pathogenesis of these diseases has not been completely clarified. In this study, we evaluate whether A8701G mutation is associated with maternally inherited hypertension and DCM in a Chinese pedigree of a consanguineous marriage. Methods: Fourteen subjects in a three-generation Han Chinese family with hypertension and DCM, in which consanguineous marriage was present in the parental generation, were interviewed. We divided all the family members into case (7 maternal members) and control group (7 nonmaternal members) for comparison. Clinical evaluations and sequence analysis of mtDNA were obtained from all participants. Frequency differences between maternal and nonmaternal members were tested to locate the disease-associated mutations. Results: The majority of the family members presented with a maternal inheritance of hypertension and DCM. Sequence analysis of mtDNA in this pedigree identified eight mtDNA mutations. Among the mutations identified, there was only one significant mutation: A8701G (P = 0.005), which is a homoplasmic mitochondrial missense mutation in all the matrilineal relatives. There was no clear evidence for any synergistic effects between A8701G and other mutations. Conclusions: A8701G mutation may act as an inherited risk factor for the matrilineal transmission of hypertension and DCM in conjunction with genetic disorders caused by consanguineous marriage. PMID:26831225

  20. Adrenal insufficiency in a child with MELAS syndrome.

    PubMed

    Afroze, Bushra; Amjad, Nida; Ibrahim, Shahnaz H; Humayun, Khadija Nuzhat; Yakob, Yusnita

    2014-11-01

    Mitochondrial encephalomyopathy, lactic acidosis and stroke-like episodes (MELAS) are established subgroups of mitochondrial encephalomyopathy. m.3243A>G a common point mutation is detected in tRNA in majority of patients with MELAS phenotype whereas m.8344A>G point mutation in tRNA is observed, in MERRF phenotype. Adrenal insufficiency has not been reported in mitochondrial disease, except in Kearns-Sayre Syndrome (KSS), which is a mitochondrial deletion syndrome. We report an unusual presentation in a five year old boy who presented with clinical phenotype of MELAS and was found to have m.8344A>G mutation in tRNA. Addison disease was identified due to hyperpigmentation of lips and gums present from early childhood. This is the first report describing adrenal insufficiency in a child with MELAS phenotype. Copyright © 2014 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

  1. Altered Pre-mRNA Splicing Caused by a Novel Intronic Mutation c.1443+5G>A in the Dihydropyrimidinase (DPYS) Gene.

    PubMed

    Nakajima, Yoko; Meijer, Judith; Zhang, Chunhua; Wang, Xu; Kondo, Tomomi; Ito, Tetsuya; Dobritzsch, Doreen; Van Kuilenburg, André B P

    2016-01-12

    Dihydropyrimidinase (DHP) deficiency is an autosomal recessive disease caused by mutations in the DPYS gene. Patients present with highly elevated levels of dihydrouracil and dihydrothymine in their urine, blood and cerebrospinal fluid. The analysis of the effect of mutations in DPYS on pre-mRNA splicing is hampered by the fact that DHP is primarily expressed in liver and kidney cells. The minigene approach can detect mRNA splicing aberrations using cells that do not express the endogenous mRNA. We have used a minigene-based approach to analyze the effects of a presumptive pre-mRNA splicing mutation in two newly identified Chinese pediatric patients with DHP deficiency. Mutation analysis of DPYS showed that both patients were compound heterozygous for a novel intronic mutation c.1443+5G>A in intron 8 and a previously described missense mutation c.1001A>G (p.Q334R) in exon 6. Wild-type and the mutated minigene constructs, containing exons 7, 8 and 9 of DPYS, yielded different splicing products after expression in HEK293 cells. The c.1443+5G>A mutation resulted in altered pre-mRNA splicing of the DPYS minigene construct with full skipping of exon 8. Analysis of the DHP crystal structure showed that the deletion of exon 8 severely affects folding, stability and homooligomerization of the enzyme as well as disruption of the catalytic site. Thus, the analysis suggests that the c.1443+5G>A mutation results in aberrant splicing of the pre-mRNA encoding DHP, underlying the DHP deficiency in two unrelated Chinese patients.

  2. Ivacaftor treatment of cystic fibrosis patients with the G551D mutation: a review of the evidence.

    PubMed

    Kotha, Kavitha; Clancy, John P

    2013-10-01

    Cystic fibrosis (CF) is a recessive disorder caused by mutations in the gene that encodes the CF transmembrane conductance regulator (CFTR) protein. CFTR protein is a chloride and bicarbonate channel that is critical for normal epithelial ion transport and hydration of epithelial surfaces. Current CF care is supportive, but recent breakthroughs have occurred with the advent of novel therapeutic strategies that assist the function of mutant CFTR proteins. The development and key clinical trial results of ivacaftor, a small molecule that targets gating defects in disease-causing CFTR mutations including G551D CFTR, are summarized in this review. The G551D mutation is reasonably common in the CF patient population and produces a CFTR protein that localizes normally to the plasma membrane, but fails to open in response to cellular cues. Ivacaftor treatment produces dramatic improvements in lung function, weight, lung disease stability, patient-reported outcomes, and CFTR biomarkers in patients with CF harboring the G551D CFTR mutation compared with placebo controls and patients with two copies of the common F508del CFTR mutation. The unprecedented success of ivacaftor treatment for the G551D CF patient population has generated excitement in the CF care community regarding the expansion of its use to other CF patient populations with primary or secondary gating defects.

  3. Cerebral infarction and femoral venous thrombosis detected in a patient with diabetic ketoacidosis and heterozygous factor V Leiden G1691A and PAI-1 4G/5G mutations.

    PubMed

    Yaroglu Kazanci, Selcen; Yesilbas, Osman; Ersoy, Melike; Kihtir, Hasan Serdar; Yildirim, Hamdi Murat; Sevketoglu, Esra

    2015-09-01

    Cerebral infarction is one of the serious neurological complications of diabetic ketoacidosis (DKA). Especially in patients who are genetically prone to thrombosis, cerebral infarction may develop due to inflammation, dehydration, and hyperviscocity secondary to DKA. A 6-year-old child with DKA is diagnosed with cerebral infarction after respiratory insufficiency, convulsion, and altered level of consciousness. Femoral and external iliac venous thrombosis also developed in a few hours after central femoral catheter had been inserted. Heterozygous type of factor V Leiden and PAI-14G/5G mutation were detected. In patients with DKA, cerebral infarction may be suspected other than cerebral edema when altered level of consciousness, convulsion, and respiratory insufficiency develop and once cerebral infarction occurs the patients should also be evaluated for factor V Leiden and PAI-14G/5G mutation analysis in addition to the other prothrombotic risk factors.

  4. EGFR G796D mutation mediates resistance to osimertinib.

    PubMed

    Zheng, Di; Hu, Min; Bai, Yu; Zhu, Xuehua; Lu, Xuesong; Wu, Chunyan; Wang, Jiying; Liu, Li; Wang, Zheng; Ni, Jian; Yang, Zhenfan; Xu, Jianfang

    2017-07-25

    Osimertinib is an effective third-generation epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor (TKI) approved in multiple countries and regions for patients with EGFR T790M mutation-positive non-small cell lung cancer (NSCLC). Despite impressive initial tumor responses, development of drug resistance ultimately limits the benefit of this compound. Mechanisms of resistance to osimertinib are just beginning to emerge, such as EGFR C797S and L718Q mutations, BRAF V600E and PIK3CA E545K mutations, as well as ERBB2 and MET amplification. However, a comprehensive view is still missing. In this study, we presented the first case of Chinese NSCLC patient who developed resistance to osimertinib, and discovered de novo EGFR G796D mutation as a potential mechanism. Our findings provided insights into mechanisms of resistance to osimertinib and highlighted tumor heterogeneity and clonal evolution during the development of drug resistance.

  5. EGFR G796D mutation mediates resistance to osimertinib

    PubMed Central

    Bai, Yu; Zhu, Xuehua; Lu, Xuesong; Wu, Chunyan; Wang, Jiying; Liu, Li; Wang, Zheng; Ni, Jian; Yang, Zhenfan; Xu, Jianfang

    2017-01-01

    Osimertinib is an effective third-generation epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor (TKI) approved in multiple countries and regions for patients with EGFR T790M mutation-positive non-small cell lung cancer (NSCLC). Despite impressive initial tumor responses, development of drug resistance ultimately limits the benefit of this compound. Mechanisms of resistance to osimertinib are just beginning to emerge, such as EGFR C797S and L718Q mutations, BRAF V600E and PIK3CA E545K mutations, as well as ERBB2 and MET amplification. However, a comprehensive view is still missing. In this study, we presented the first case of Chinese NSCLC patient who developed resistance to osimertinib, and discovered de novo EGFR G796D mutation as a potential mechanism. Our findings provided insights into mechanisms of resistance to osimertinib and highlighted tumor heterogeneity and clonal evolution during the development of drug resistance. PMID:28572531

  6. Cetuximab treatment for metastatic colorectal cancer with KRAS p.G13D mutations improves progression-free survival

    PubMed Central

    OSUMI, HIROKI; SHINOZAKI, EIJI; OSAKO, MASAHIKO; KAWAZOE, YOSHIMASA; OBA, MASARU; MISAKA, TAKAHARU; GOTO, TAKASHI; KAMO, HITOMI; SUENAGA, MITSUKUNI; KUMEKAWA, YOSUKE; OGURA, MARIKO; OZAKA, MASATO; MATSUSAKA, SATOSHI; CHIN, KEISHO; HATAKE, KIYOHIKO; MIZUNUMA, NOBUYUKI

    2015-01-01

    A number of previous studies have reported that 30–50% of patients with colorectal cancer (CRC) harbor Kirsten rat sarcoma viral oncogene homolog (KRAS) mutations, which is a major predictive biomarker of resistance to epidermal growth factor (EGFR)-targeted therapy. Treatment with an anti-EGFR inhibitor is recommended for patients with KRAS wild-type metastatic colorectal cancer (mCRC). A recent retrospective study of cetuximab reported that patients with KRAS p.G13D mutations had better outcomes compared with those with other mutations. The aim of this retrospective study was to assess the prevalence of KRAS p.G13D mutations and evaluate the effectiveness of cetuximab in mCRC patients with KRAS p.G13D or other KRAS mutations. We reviewed the clinical records of 98 mCRC patients with KRAS mutations who were treated between August, 2004 and January, 2011 in four hospitals located in Tokyo and Kyushu Island. We also investigated KRAS mutation subtypes and patient characteristics. In the patients who received cetuximab, univariate and multivariate analyses were performed to assess the effect of KRAS p.G13D mutations on progression-free survival (PFS) and overall survival (OS). Of the 98 patients, 23 (23.5%) had KRAS p.G13D-mutated tumors, whereas 75 (76.5%) had tumors harboring other mutations. Of the 31 patients who received cetuximab, 9 (29.0%) had KRAS p.G13D mutations and 22 (71.0%) had other mutations. There were no significant differences in age, gender, primary site, pathological type, history of chemotherapy, or the combined use of irinotecan between either of the patient subgroups. The univariate analysis revealed no significant difference in PFS or OS between the patients with KRAS p.G13D mutations and those with other mutations (median PFS, 4.5 vs. 2.8 months, respectively; P=0.65; and median OS, 15.3 vs. 8.9 months, respectively; P=0.51). However, the multivariate analysis revealed a trend toward better PFS among patients harboring p.G13D mutations (PFS

  7. In vivo levels of S-adenosylmethionine modulate C:G to T:A mutations associated with repeat-induced point mutation in Neurospora crassa.

    PubMed

    Rosa, Alberto Luis; Folco, Hernán Diego; Mautino, Mario Ricardo

    2004-04-14

    In Neurospora crassa, the mutagenic process termed repeat-induced point mutation (RIP) inactivates duplicated DNA sequences during the sexual cycle by the introduction of C:G to T:A transition mutations. In this work, we have used a collection of N. crassa strains exhibiting a wide range of cellular levels of S-adenosylmethionine (AdoMet), the universal donor of methyl groups, to explore whether frequencies of RIP are dependent on the cellular levels of this metabolite. Mutant strains met-7 and eth-1 carry mutations in genes of the AdoMet pathway and have low levels of AdoMet. Wild type strains with high levels of AdoMet were constructed by introducing a chimeric transgene of the AdoMet synthetase (AdoMet-S) gene fused to the constitutive promoter trpC from Aspergillus nidulans. Crosses of these strains against tester duplications of the pan-2 and am genes showed that frequencies of RIP, as well as the total number of C:G to T:A transition mutations found in randomly selected am(RIP) alleles, are inversely correlated to the cellular level of AdoMet. These results indicate that AdoMet modulates the biochemical pathway leading to RIP.

  8. Altered Pre-mRNA Splicing Caused by a Novel Intronic Mutation c.1443+5G>A in the Dihydropyrimidinase (DPYS) Gene

    PubMed Central

    Nakajima, Yoko; Meijer, Judith; Zhang, Chunhua; Wang, Xu; Kondo, Tomomi; Ito, Tetsuya; Dobritzsch, Doreen; Van Kuilenburg, André B. P.

    2016-01-01

    Dihydropyrimidinase (DHP) deficiency is an autosomal recessive disease caused by mutations in the DPYS gene. Patients present with highly elevated levels of dihydrouracil and dihydrothymine in their urine, blood and cerebrospinal fluid. The analysis of the effect of mutations in DPYS on pre-mRNA splicing is hampered by the fact that DHP is primarily expressed in liver and kidney cells. The minigene approach can detect mRNA splicing aberrations using cells that do not express the endogenous mRNA. We have used a minigene-based approach to analyze the effects of a presumptive pre-mRNA splicing mutation in two newly identified Chinese pediatric patients with DHP deficiency. Mutation analysis of DPYS showed that both patients were compound heterozygous for a novel intronic mutation c.1443+5G>A in intron 8 and a previously described missense mutation c.1001A>G (p.Q334R) in exon 6. Wild-type and the mutated minigene constructs, containing exons 7, 8 and 9 of DPYS, yielded different splicing products after expression in HEK293 cells. The c.1443+5G>A mutation resulted in altered pre-mRNA splicing of the DPYS minigene construct with full skipping of exon 8. Analysis of the DHP crystal structure showed that the deletion of exon 8 severely affects folding, stability and homooligomerization of the enzyme as well as disruption of the catalytic site. Thus, the analysis suggests that the c.1443+5G>A mutation results in aberrant splicing of the pre-mRNA encoding DHP, underlying the DHP deficiency in two unrelated Chinese patients. PMID:26771602

  9. Isolated case of mental retardation and ataxia due to a de novo mitochondrial T8993G mutation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    De Coo, I.F.M.; Smeets, H.J.M.; Oost, B.A. van

    1996-03-01

    Neurogenic muscle weakness, ataxia, and retinitis pigmentosa (NARP) and subacute necrotizing encephalomyelopathy (Leigh disease) are both associated with an alteration of nt 8993 in the mitochondrial ATPase 6 gene. In NARP, the T-to-G transversion at that position changes leucine into arginine. In Leigh syndrome, the same mutation can be found, as can a T-to-C transition, which changes this leucine into proline. Clinical manifestations occur for NARP when {approximately}60%-90% mutated mtDNA is present. In case of Leigh, these percentages usually exceed 95%. It is known that this mutation can segregate very rapidly within pedigrees. Here we report on a sporadic casemore » with mental retardation and ataxia without retinitis pigmentosa in which the T8993G mutation was found. 13 refs., 1 fig.« less

  10. [Recurrent vascular access trombosis associated with the prothrombin mutation G20210A in a adult patient in haemodialysis].

    PubMed

    Quintana, L F; Coll, E; Monteagudo, I; Collado, S; López-Pedret, J; Cases, A

    2005-01-01

    Vascular access-related complications are a frequent cause of morbidity in haemodialysis patients and generate high costs. We present the case of an adult patient with end-stage renal disease and recurrent vascular access thrombosis associated with the prothrombin mutation G20210A and renal graft intolerance. The clinical expression of this heterozygous gene mutation may have been favoured by inflammatory state, frequent in dialysis patients. In this patient, the inflammatory response associated with the renal graft intolerance would have favored the development of recurrent vascular access thrombosis in a adult heterozygous for prothrombin mutation G20210A. In the case of early dysfunction of haemodialysis vascular access and after ruling out technical problems, it is convenient to carry out a screening for thrombophilia.

  11. Association of The IDH1 C.395G>A (R132H) Mutation with Histological Type in Malay Brain Tumors

    PubMed

    Mohamed Yusoff, Abdul Aziz; Zulfakhar, Fatin Najwa; Sul’ain, Mohd Dasuki; Idris, Zamzuri; Abdullah, Jafri Malin

    2016-12-01

    Background: Brain tumors, constituting one of the most deadly forms of cancer worldwide, result from the accumulation of multiple genetic and epigenetic alterations in genes and signaling pathways. Isocitrate dehydrogenase enzyme isoform 1 (IDH1) mutations are frequently identified in primary brain tumors and acute myeloid leukemia. Studies on IDH1 gene mutations have been extensively performed in various populations worldwide but not in Malaysia. This work was conducted to study the prevalence of IDH1 c.395G>A (R132H) hotspot mutations in a group of Malaysian patients with brain tumors in order to gain local data for the IDH1 mutation profile in our population. Methods: Mutation analysis of c.395G>A (R132H) of IDH1 was performed in 40 brain tumor specimens by the polymerase chain reaction-restriction fragment length polymorphism method (PCR-RFLP) and then verified by direct sequencing. Associations between the IDH1 c.395G>A (R132H) mutation and clinicopathologic characteristics were also analyzed. Results: The IDH1 c.395G>A (R132H) mutation was detected in 14/40 patients (35%). A significant association was found with histological tumor types, but not with age, gender and race. Conclusions: IDH1 is frequently mutated and associated with histological subtypes in Malay brain tumors. Creative Commons Attribution License

  12. Association of The IDH1 C.395G>A (R132H) Mutation with Histological Type in Malay Brain Tumors

    PubMed Central

    Yusoff, Abdul Aziz Mohamed; Zulfakhar, Fatin Najwa; Sul’ain, Mohd Dasuki; Idris, Zamzuri; Abdullah, Jafri Malin

    2016-01-01

    Background: Brain tumors, constituting one of the most deadly forms of cancer worldwide, result from the accumulation of multiple genetic and epigenetic alterations in genes and signaling pathways. Isocitrate dehydrogenase enzyme isoform 1 (IDH1) mutations are frequently identified in primary brain tumors and acute myeloid leukemia. Studies on IDH1 gene mutations have been extensively performed in various populations worldwide but not in Malaysia. This work was conducted to study the prevalence of IDH1 c.395G>A (R132H) hotspot mutations in a group of Malaysian patients with brain tumors in order to gain local data for the IDH1 mutation profile in our population. Methods: Mutation analysis of c.395G>A (R132H) of IDH1 was performed in 40 brain tumor specimens by the polymerase chain reaction-restriction fragment length polymorphism method (PCR-RFLP) and then verified by direct sequencing. Associations between the IDH1 c.395G>A (R132H) mutation and clinicopathologic characteristics were also analyzed. Results: The IDH1 c.395G>A (R132H) mutation was detected in 14/40 patients (35%). A significant association was found with histological tumor types, but not with age, gender and race. Conclusions: IDH1 is frequently mutated and associated with histological subtypes in Malay brain tumors. PMID:28125199

  13. Insights into the pathogenesis of dominant retinitis pigmentosa associated with a D477G mutation in RPE65.

    PubMed

    Choi, Elliot H; Suh, Susie; Sander, Christopher L; Hernandez, Christian J Ortiz; Bulman, Elizabeth R; Khadka, Nimesh; Dong, Zhiqian; Shi, Wuxian; Palczewski, Krzysztof; Kiser, Philip D

    2018-04-12

    RPE65 is the essential trans-cis isomerase of the classical retinoid (visual) cycle. Mutations in RPE65 give rise to severe retinal dystrophies, most of which are associated with loss of protein function and recessive inheritance. The only known exception is a c.1430G>A (D477G) mutation that gives rise to dominant retinitis pigmentosa with delayed onset and choroidal and macular involvement. Position 477 is distant from functionally critical regions of RPE65. Hence, the mechanism of D477G pathogenicity remains unclear, although protein misfolding and aggregation mechanisms have been suggested. We characterized a D477G knock-in mouse model which exhibited mild age-dependent changes in retinal structure and function. Immunoblot analysis of protein extracts from the eyes of the knock-in mice demonstrated the presence of ubiquitinated RPE65 and reduced RPE65 expression. We observed an accumulation of retinyl esters in the knock-in mice as well as a delay in rhodopsin regeneration kinetics and diminished electroretinography responses, indicative of RPE65 functional impairment induced by the D477G mutation in vivo. However, a cell line expressing D477G RPE65 revealed protein expression levels, cellular localization, and retinoid isomerase activity comparable to cells expressing wild-type protein. Structural analysis of an RPE65 chimera suggested that the D477G mutation does not perturb protein folding or tertiary structure. Instead, the mutation generates an aggregation-prone surface that could induce cellular toxicity through abnormal complex formation as suggested by crystal packing analysis. These results indicate that a toxic gain-of-function induced by the D477G RPE65 substitution may play a role in the pathogenesis of this form of dominant retinitis pigmentosa.

  14. Metastatic melanoma cells with BRAF G469A mutation: nab-paclitaxel better than vemurafenib?

    PubMed

    Porcelli, Letizia; Guida, Gabriella; Tommasi, Stefania; Guida, Michele; Azzariti, Amalia

    2015-08-01

    BRAF G469A is a missense mutation within exon 11 of the BRAF gene resulting in a constitutively activated enzyme frequently associated with MAP kinase cascade signaling activation. No evidence currently exists about its role in determining sensitivity/resistance to BRAF inhibitors, utilized in the treatment of patients carrying BRAF V600 mutations, and to chemotherapy. The newly established metastatic melanoma (MM) cell line MO-1 was characterized for its sensitivity to vemurafenib and nab-paclitaxel, both already utilized for the treatment of MM. All analyses were carried out by comparing results with those found in MM cells wild type for BRAF or mutated in V600. In addition, cellular effectors were investigated by ELISA kits, western blotting and flow cytometry. The exposure to vemurafenib inhibited MO-1 cell proliferation at concentrations similar to those obtained in vemurafenib-resistant melanoma models, and an explanation of this sensitivity is the strong activation of Erk1/2 and the low expression of MITF. Nab-paclitaxel strongly reduced proliferation of MO-1 cells perhaps for the very low expression level of PMEL17, transcriptionally regulated by MITF and negatively involved in determining sensitivity to taxanes. Thus, the mutation BRAF G469A in MM might be related to a weak effectiveness of therapy with BRAF inhibitors and a promising therapeutic approach may be with nab-paclitaxel.

  15. Identification of ALK germline mutation (3605delG) in pediatric anaplastic medulloblastoma.

    PubMed

    Coco, Simona; De Mariano, Marilena; Valdora, Francesca; Servidei, Tiziana; Ridola, Vita; Andolfo, Immacolata; Oberthuer, André; Tonini, Gian Paolo; Longo, Luca

    2012-10-01

    The anaplastic lymphoma kinase (ALK) gene has been found either rearranged or mutated in several neoplasms such as anaplastic large-cell lymphoma, non-small-cell lung cancer, neuroblastoma and anaplastic thyroid cancer. Medulloblastoma (MB) is an embryonic pediatric cancer arising from nervous system, a tissue in which ALK is expressed during embryonic development. We performed an ALK mutation screening in 52 MBs and we found a novel heterozygous germline deletion of a single base in exon 23 (3605delG) in a case with marked anaplasia. This G deletion results in a frameshift mutation producing a premature stop codon in exon 25 of ALK tyrosine kinase domain. We also screened three human MB cell lines without finding any mutation of ALK gene. Quantitative expression analysis of 16 out of 52 samples showed overexpression of ALK mRNA in three MBs. In the present study, we report the first mutation of ALK found in MB. Moreover, a deletion of ALK gene producing a stop codon has not been detected in human tumors up to now. Further investigations are now required to elucidate whether the truncated form of ALK may have a role in signal transduction.

  16. Acute quadriplegia in a young man secondary to prothrombin G20210A mutation.

    PubMed

    Sawaya, R; Diken, Z; Mahfouz, R

    2011-08-01

    We present the case of an 18-year-old man, previously healthy, who presented with acute quadriplegia and respiratory failure. Physical examination was compatible with a high cervical anterior spinal cord lesion. We plan to evaluate the cause of such a neurological presentation in a healthy young man. American University Medical Center, Beirut, Lebanon. The patient underwent routine blood hematological and chemistry work-up, hypercoagulable profile studies, genetic profile for thrombophelias, radiographic studies of the brain and cervical cord, cerebrospinal analysis and extensive electrophyisological studies. Magnetic resonance imaging and magnetic resonance angiogram of the brain, carotid and intracranial vessels were normal. Cerebral angiography was normal. Magnetic resonance imaging of the cervical cord revealed lesion of the anterior segment of the cervical cord between C2 and C5 levels. Hypercoagulable profile studies were normal. Electrophysiological studies confirmed an isolated lesion of the descending cortico-spinal tracts. DNA analysis revealed the presence of a G20210A mutation-causing hyperprothrombinemia. We conclude that a G20210A mutation causing-hyperprothrombinemia can cause anterior spinal artery thrombosis and anterior spinal cord infarction with the resultant neurological deficits in otherwise healthy patients.

  17. The Structural Basis of Oncogenic Mutations G12, G13 and Q61 in Small GTPase K-Ras4B

    NASA Astrophysics Data System (ADS)

    Lu, Shaoyong; Jang, Hyunbum; Nussinov, Ruth; Zhang, Jian

    2016-02-01

    Ras mediates cell proliferation, survival and differentiation. Mutations in K-Ras4B are predominant at residues G12, G13 and Q61. Even though all impair GAP-assisted GTP → GDP hydrolysis, the mutation frequencies of K-Ras4B in human cancers vary. Here we aim to figure out their mechanisms and differential oncogenicity. In total, we performed 6.4 μs molecular dynamics simulations on the wild-type K-Ras4B (K-Ras4BWT-GTP/GDP) catalytic domain, the K-Ras4BWT-GTP-GAP complex, and the mutants (K-Ras4BG12C/G12D/G12V-GTP/GDP, K-Ras4BG13D-GTP/GDP, K-Ras4BQ61H-GTP/GDP) and their complexes with GAP. In addition, we simulated ‘exchanged’ nucleotide states. These comprehensive simulations reveal that in solution K-Ras4BWT-GTP exists in two, active and inactive, conformations. Oncogenic mutations differentially elicit an inactive-to-active conformational transition in K-Ras4B-GTP; in K-Ras4BG12C/G12D-GDP they expose the bound nucleotide which facilitates the GDP-to-GTP exchange. These mechanisms may help elucidate the differential mutational statistics in K-Ras4B-driven cancers. Exchanged nucleotide simulations reveal that the conformational transition is more accessible in the GTP-to-GDP than in the GDP-to-GTP exchange. Importantly, GAP not only donates its R789 arginine finger, but stabilizes the catalytically-competent conformation and pre-organizes catalytic residue Q61; mutations disturb the R789/Q61 organization, impairing GAP-mediated GTP hydrolysis. Together, our simulations help provide a mechanistic explanation of key mutational events in one of the most oncogenic proteins in cancer.

  18. Retroviral mutation rates and A-to-G hypermutations during different stages of retroviral replication.

    PubMed Central

    Kim, T; Mudry, R A; Rexrode, C A; Pathak, V K

    1996-01-01

    Retroviruses mutate at a high rate in vivo during viral replication. Mutations may occur during proviral transcription by RNA polymerase II, during minus-strand DNA synthesis (RNA template) by viral reverse transcriptase, or during plus-strand DNA synthesis (DNA template) by reverse transcriptase. To determine the contributions of different stages of replication to the retroviral mutation rates, we developed a spleen necrosis virus-based in vivo system to selectively identify mutations occurring during the early stage (RNA transcription plus minus-strand synthesis) and the late stage (plus-strand synthesis plus DNA repair). A lacZalpha reporter gene was inserted into the long terminal repeat (LTR) of a spleen necrosis virus shuttle vector, and proviruses were recovered from infected cells as plasmids containing either one or both LTRs. Plasmids containing both LTRs generated a mutant phenotype only if the lacZalpha genes in both LTRs were mutated, which is most likely to occur during the early stage. Mutant phenotypes were identified from plasmids containing one LTR regardless of the stage at which the mutations occurred. Thus, mutant frequencies obtained after recovery of plasmids containing both LTRs or one LTR provided early-stage and total mutation rates, respectively. Analysis of 56,409 proviruses suggested that the retroviral mutation rates during the early and late stages of replication were equal or within twofold of each other. In addition, two mutants with A-to-G hypermutations were discovered, suggesting a role for mammalian double-stranded RNA adenosine deaminase enzyme in retroviral mutations. These experiments provide a system to selectively identify mutations in the early stage of retroviral replication and to provide upper and lower limits to the in vivo mutation rates during minus-strand and plus-strand synthesis, respectively. PMID:8892879

  19. ABCG5/G8 gene is associated with hypercholesterolemias without mutation in candidate genes and noncholesterol sterols.

    PubMed

    Lamiquiz-Moneo, Itziar; Baila-Rueda, Lucía; Bea, Ana M; Mateo-Gallego, Rocío; Pérez-Calahorra, Sofía; Marco-Benedí, Victoria; Martín-Navarro, Antonio; Ros, Emilio; Cofán, Montserrat; Rodríguez-Rey, José Carlos; Pocovi, Miguel; Cenarro, Ana; Civeira, Fernando

    Approximately 20% to 40% of clinically defined familial hypercholesterolemia (FH) cases do not show a causative mutation in candidate genes (mutation-negative FH), and some of them may have a polygenic origin. The aim of this work was to study the prevalence of ABCG5/G8 genetic variants in mutation-negative FH, as defects in these genes relate to intestinal hyperabsorption of cholesterol and thus ABCG5/G8 variants could explain in part the mechanism of hypercholesterolemia. We sequenced the ABCG5/G8 genes in 214 mutation-negative FH and 97 controls. Surrogate markers of cholesterol absorption (5α-cholestanol, β-sitosterol, campesterol, stigmasterol, and sitostanol) were quantified by high-performance liquid chromatography-tandem mass spectrometry in both studied groups. We found 8 mutation-negative FH patients (3.73%) with a pathogenic mutation in ABCG5/G8 genes. We observed significantly higher concentration of surrogate markers of cholesterol absorption in mutation-negative FH than in controls. In addition, we found significantly higher concentrations of cholesterol absorption markers in mutation-negative FH with ABCG5/G8 defects than in mutation-negative, ABCG5/G8-negative FH. A gene score reflecting the number of common single nucleotide variants associated with hypercholesterolemia was significantly higher in cases than in controls (P = .032). Subjects with a gene score above the mean had significantly higher 5α-cholestanol and stigmasterol than those with a lower gene score. Mutation-negative FH subjects accumulate an excess of rare and common gene variations in ABCG5/G8 genes. This variation is associated with increased intestinal absorption of cholesterol, as determined by surrogate makers, suggesting that these loci contribute to hypercholesterolemia by enhancing intestinal cholesterol absorption. Copyright © 2017 National Lipid Association. Published by Elsevier Inc. All rights reserved.

  20. Co-occurrence of m.1555A>G and m.11778G>A mitochondrial DNA mutations in two Indian families with strikingly different clinical penetrance of Leber hereditary optic neuropathy

    PubMed Central

    Khan, Nahid Akhtar; Govindaraj, Periyasamy; Jyothi, Vuskamalla; Meena, Angamuthu K

    2013-01-01

    Background Mitochondrial DNA (mtDNA) mutations are known to cause Leber hereditary optic neuropathy (LHON). However, the co-occurrence of double pathogenic mutations with different pathological significance in pedigrees is a rare event. Methods Detailed clinical investigation and complete mtDNA sequencing analysis was performed for two Indian families with LHON. The haplogroup was constructed based on evolutionarily important mtDNA variants. Results We observed the existence of double pathogenic mutations (m.11778G>A and m.1555A>G) in two Indian LHON families, who are from different haplogroup backgrounds (M5a and U2e1), with different clinical penetrance of the disease (visual impairment). The m.11778G>A mutation in the MT-ND4 gene is associated primarily with LHON; whereas, m.1555A>G in the 12S rRNA gene has been reported with aminoglycoside-induced non-syndromic hearing loss. Conclusions The absence of hearing abnormality and widely varying clinical expression of LHON suggest additional nuclear modifier genes, environmental factors, and population heterogeneity might play an important role in the expression of visual impairment in these families. PMID:23805034

  1. Mutated form (G52E) of inactive diphtheria toxin CRM197: molecular simulations clearly display effect of the mutation to NAD binding.

    PubMed

    Salmas, Ramin Ekhteiari; Mestanoglu, Mert; Unlu, Ayhan; Yurtsever, Mine; Durdagi, Serdar

    2016-11-01

    Mutated form (G52E) of diphtheria toxin (DT) CRM197 is an inactive and nontoxic enzyme. Here, we provided a molecular insight using comparative molecular dynamics (MD) simulations to clarify the influence of a single point mutation on overall protein and active-site loop. Post-processing MD analysis (i.e. stability, principal component analysis, hydrogen-bond occupancy, etc.) is carried out on both wild and mutated targets to investigate and to better understand the mechanistic differences of structural and dynamical properties on an atomic scale especially at nicotinamide adenine dinucleotide (NAD) binding site when a single mutation (G52E) happens at the DT. In addition, a docking simulation is performed for wild and mutated forms. The docking scoring analysis and docking poses results revealed that mutant form is not able to properly accommodate the NAD molecule.

  2. Mutations Affecting G-Protein Subunit α11 in Hypercalcemia and Hypocalcemia

    PubMed Central

    Babinsky, Valerie N.; Head, Rosie A.; Cranston, Treena; Rust, Nigel; Hobbs, Maurine R.; Heath, Hunter; Thakker, Rajesh V.

    2013-01-01

    BACKGROUND Familial hypocalciuric hypercalcemia is a genetically heterogeneous disorder with three variants: types 1, 2, and 3. Type 1 is due to loss-of-function mutations of the calcium-sensing receptor, a guanine nucleotide–binding protein (G-protein)–coupled receptor that signals through the G-protein subunit α11 (Gα11). Type 3 is associated with adaptor-related protein complex 2, sigma 1 subunit (AP2S1) mutations, which result in altered calcium-sensing receptor endocytosis. We hypothesized that type 2 is due to mutations effecting Gα11 loss of function, since Gα11 is involved in calcium-sensing receptor signaling, and its gene (GNA11) and the type 2 locus are colocalized on chromosome 19p13.3. We also postulated that mutations effecting Gα11 gain of function, like the mutations effecting calcium-sensing receptor gain of function that cause autosomal dominant hypocalcemia type 1, may lead to hypocalcemia. METHODS We performed GNA11 mutational analysis in a kindred with familial hypocalciuric hypercalcemia type 2 and in nine unrelated patients with familial hypocalciuric hypercalcemia who did not have mutations in the gene encoding the calcium-sensing receptor (CASR) or AP2S1. We also performed this analysis in eight unrelated patients with hypocalcemia who did not have CASR mutations. In addition, we studied the effects of GNA11 mutations on Gα11 protein structure and calcium-sensing receptor signaling in human embryonic kidney 293 (HEK293) cells. RESULTS The kindred with familial hypocalciuric hypercalcemia type 2 had an in-frame deletion of a conserved Gα11 isoleucine (Ile200del), and one of the nine unrelated patients with familial hypocalciuric hypercalcemia had a missense GNA11 mutation (Leu135Gln). Missense GNA11 mutations (Arg181Gln and Phe341Leu) were detected in two unrelated patients with hypocalcemia; they were therefore identified as having autosomal dominant hypocalcemia type 2. All four GNA11 mutations predicted disrupted protein

  3. Distinct clinical and neuropathological features of G51D SNCA mutation cases compared with SNCA duplication and H50Q mutation.

    PubMed

    Kiely, Aoife P; Ling, Helen; Asi, Yasmine T; Kara, Eleanna; Proukakis, Christos; Schapira, Anthony H; Morris, Huw R; Roberts, Helen C; Lubbe, Steven; Limousin, Patricia; Lewis, Patrick A; Lees, Andrew J; Quinn, Niall; Hardy, John; Love, Seth; Revesz, Tamas; Houlden, Henry; Holton, Janice L

    2015-08-27

    We and others have described the neurodegenerative disorder caused by G51D SNCA mutation which shares characteristics of Parkinson's disease (PD) and multiple system atrophy (MSA). The objective of this investigation was to extend the description of the clinical and neuropathological hallmarks of G51D mutant SNCA-associated disease by the study of two additional cases from a further G51D SNCA kindred and to compare the features of this group with a SNCA duplication case and a H50Q SNCA mutation case. All three G51D patients were clinically characterised by parkinsonism, dementia, visual hallucinations, autonomic dysfunction and pyramidal signs with variable age at disease onset and levodopa response. The H50Q SNCA mutation case had a clinical picture that mimicked late-onset idiopathic PD with a good and sustained levodopa response. The SNCA duplication case presented with a clinical phenotype of frontotemporal dementia with marked behavioural changes, pyramidal signs, postural hypotension and transiently levodopa responsive parkinsonism. Detailed post-mortem neuropathological analysis was performed in all cases. All three G51D cases had abundant α-synuclein pathology with characteristics of both PD and MSA. These included widespread cortical and subcortical neuronal α-synuclein inclusions together with small numbers of inclusions resembling glial cytoplasmic inclusions (GCIs) in oligodendrocytes. In contrast the H50Q and SNCA duplication cases, had α-synuclein pathology resembling idiopathic PD without GCIs. Phosphorylated α-synuclein was present in all inclusions types in G51D cases but was more restricted in SNCA duplication and H50Q mutation. Inclusions were also immunoreactive for the 5G4 antibody indicating their highly aggregated and likely fibrillar state. Our characterisation of the clinical and neuropathological features of the present small series of G51D SNCA mutation cases should aid the recognition of this clinico-pathological entity. The

  4. Rapid detection of G6PD mutations by multicolor melting curve analysis.

    PubMed

    Xia, Zhongmin; Chen, Ping; Tang, Ning; Yan, Tizhen; Zhou, Yuqiu; Xiao, Qizhi; Huang, Qiuying; Li, Qingge

    2016-09-01

    The MeltPro G6PD assay is the first commercial genetic test for glucose-6-phosphate dehydrogenase (G6PD) deficiency. This multicolor melting curve analysis-based real-time PCR assay is designed to genotype 16 G6PD mutations prevalent in the Chinese population. We comprehensively evaluated both the analytical and clinical performances of this assay. All 16 mutations were accurately genotyped, and the standard deviation of the measured Tm was <0.3°C. The limit of detection was 1.0ng/μL human genomic DNA. The assay could be run on four mainstream models of real-time PCR machines. The shortest running time (150min) was obtained with LightCycler 480 II. A clinical study using 763 samples collected from three hospitals indicated that, of 433 samples with reduced G6PD activity, the MeltPro assay identified 423 samples as mutant, yielding a clinical sensitivity of 97.7% (423/433). Of the 117 male samples with normal G6PD activity, the MeltPro assay confirmed that 116 samples were wild type, yielding a clinical specificity of 99.1% (116/117). Moreover, the MeltPro assay demonstrated 100% concordance with DNA sequencing for all targeted mutations. We concluded that the MeltPro G6PD assay is useful as a diagnostic or screening tool for G6PD deficiency in clinical settings. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Lower cognitive performance in healthy G2019S LRRK2 mutation carriers

    PubMed Central

    Thaler, Avner; Mirelman, Anat; Gurevich, Tanya; Simon, Ely; Orr-Urtreger, Avi; Marder, Karen; Bressman, Susan

    2012-01-01

    Objective: To assess cognitive abilities of healthy first-degree relatives of Ashkenazi patients with Parkinson disease (PD), carriers of the G2019S mutation in the LRRK2 gene. Methods: In this observational study, 60 consecutive healthy first-degree relatives (aged 50.9 ± 6.2 years; 48% male; 30 G2019S carriers) were assessed using a computerized cognitive program, the Montreal Cognitive Assessment questionnaire, the Unified Parkinson's Disease Rating Scale Part III, and the Geriatric Depression Scale. Results: G2019S carriers scored significantly lower on the computerized executive function index (p = 0.04) and on specific executive function tasks (Stroop test, p = 0.007). Conclusion: Carrying the LRRK2 G2019S mutation was associated with lower executive performance in a population at risk for PD. PMID:22914834

  6. The mitochondrial DNA 10197 G > A mutation causes MELAS/Leigh overlap syndrome presenting with acute auditory agnosia.

    PubMed

    Leng, Yinglin; Liu, Yuhe; Fang, Xiaojing; Li, Yao; Yu, Lei; Yuan, Yun; Wang, Zhaoxia

    2015-04-01

    Mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes/Leigh (MELAS/LS) overlap syndrome is a mitochondrial disorder subtype with clinical and magnetic resonance imaging (MRI) features that are characteristic of both MELAS and Leigh syndrome (LS). Here, we report an MELAS/LS case presenting with cortical deafness and seizures. Cranial MRI revealed multiple lesions involving bilateral temporal lobes, the basal ganglia and the brainstem, which conformed to neuroimaging features of both MELAS and LS. Whole mitochondrial DNA (mtDNA) sequencing and PCR-RFLP revealed a de novo heteroplasmic m.10197 G > A mutation in the NADH dehydrogenase subunit 3 gene (ND3), which was predicted to cause an alanine to threonine substitution at amino acid 47. Although the mtDNA m.10197 G > A mutation has been reported in association with LS, Leber hereditary optic neuropathy and dystonia, it has never been linked with MELAS/LS overlap syndrome. Our patient therefore expands the phenotypic spectrum of the mtDNA m.10197 G > A mutation.

  7. Cerebral hyperperfusion and decreased cerebrovascular reactivity correlate with neurologic disease severity in MELAS.

    PubMed

    Rodan, L H; Poublanc, J; Fisher, J A; Sobczyk, O; Wong, T; Hlasny, E; Mikulis, D; Tein, I

    2015-05-01

    To study the mechanisms underlying stroke-like episodes (SLEs) in MELAS syndrome. We performed a case control study in 3 siblings with MELAS syndrome (m.3243A>G tRNA(Leu(UUR))) with variable % mutant mtDNA in blood (35 to 59%) to evaluate regional cerebral blood flow (CBF) and arterial cerebrovascular reactivity (CVR) compared to age- and sex-matched healthy study controls and a healthy control population. Subjects were studied at 3T MRI using arterial spin labeling (ASL) to measure CBF; CVR was measured as a change in % Blood Oxygen Level Dependent signal (as a surrogate of CBF) to repeated 10 mmHg step increase in arterial partial pressure of CO2 (PaCO2). MELAS siblings had decreased CVR (p ≤ 0.002) and increased CBF (p < 0.0026) compared to controls; changes correlated with disease severity and % mutant mtDNA (inversely for CVR: r = -0.82 frontal, r = -0.91 occipital cortex; directly for CBF: r = +0.85 frontal, not for occipital infarct penumbra). Mean CVR was reduced more in frontal (p < 0.001) versus occipital cortex (p = 0.002); mean CBF was increased more in occipital (p = 0.001) than frontal (p = 0.0026) cortices compared to controls. CBF correlated inversely with CVR (r = -0.99 in frontal; not in occipital infarct penumbra) suggesting that increased frontal resting flows are at the expense of flow reserve. MELAS disease severity and mutation load were inversely correlated with Interictal CVR and directly correlated with frontal CBF. These metrics offer further insight into the cerebrovascular hemodynamics in MELAS syndrome and may serve as noninvasive prognostic markers to stratify risk for SLEs. Class III. Copyright © 2015 © Elsevier B.V. and Mitochondria Research Society. Published by Elsevier B.V. All rights reserved.

  8. DNA polymerase θ contributes to the generation of C/G mutations during somatic hypermutation of Ig genes

    PubMed Central

    Masuda, Keiji; Ouchida, Rika; Takeuchi, Arata; Saito, Takashi; Koseki, Haruhiko; Kawamura, Kiyoko; Tagawa, Masatoshi; Tokuhisa, Takeshi; Azuma, Takachika; O-Wang, Jiyang

    2005-01-01

    Somatic hypermutation of Ig variable region genes is initiated by activation-induced cytidine deaminase; however, the activity of multiple DNA polymerases is required to ultimately introduce mutations. DNA polymerase η (Polη) has been implicated in mutations at A/T, but polymerases involved in C/G mutations have not been identified. We have generated mutant mice expressing DNA polymerase (Polθ) specifically devoid of polymerase activity. Compared with WT mice, Polq-inactive (Polq, the gene encoding Polθ) mice exhibited a reduced level of serum IgM and IgG1. The mutant mice mounted relatively normal primary and secondary immune responses to a T-dependent antigen, but the production of high-affinity specific antibodies was partially impaired. Analysis of the JH4 intronic sequences revealed a slight reduction in the overall mutation frequency in Polq-inactive mice. Remarkably, although mutations at A/T were unaffected, mutations at C/G were significantly decreased, indicating an important, albeit not exclusive, role for Polθ activity. The reduction of C/G mutations was particularly focused on the intrinsic somatic hypermutation hotspots and both transitions and transversions were similarly reduced. These findings, together with the recent observation that Polθ efficiently catalyzes the bypass of abasic sites, lead us to propose that Polθ introduces mutations at C/G by replicating over abasic sites generated via uracil-DNA glycosylase. PMID:16172387

  9. Small fibre neuropathy in mitochondrial diseases explored with sudoscan.

    PubMed

    Luigetti, Marco; Primiano, Guido; Cuccagna, Cristina; Bernardo, Daniela; Sauchelli, Donato; Vollono, Catello; Servidei, Serenella

    2018-06-01

    Polyneuropathy in mitochondrial diseases (MDs) is relatively common and widely investigated, but few data are instead reported about small fibres involvement. In order to investigate the involvement of small fibres in MDs we performed extensive neurophysiological test (nerve conduction studies; sympathetic skin response; sudoscan) in 27 patients with genetic diagnosis of MD (7 m.3243A > G; 4 m.8344A > G; 9 single mtDNA deletion; 7 multiple mtDNA deletions). NCS showed a polyneuropathy in 11/27 cases (41%). The incidence was very high in POLG1 (100%), m.8344A > G (75%) and m.3243A > G (43%), while only 11% of patients with single deletion had evidence of large fibres involvement. Sympathetic skin response was abnormal only in three patients (one progressive external ophthalmoplegia with single mtDNA deletion; one patient with m.3243A > G mutation; one patient with POLG1 mutation). Sudoscan revealed the presence of an autonomic small fibres dysfunction in 9/27 cases (33%), most of them (7/9) carrying a single mtDNA deletion. Sudoscan data were also confirmed in a sub-group of patients by laser evoked potentials study. Considering only patients with single mtDNA deletion 7/9 (78%) showed abnormal results at sudoscan. Small fibre neuropathy is another feature to investigate in mitochondrial diseases and seems specifically associated with the presence of single mtDNA deletion. The correct identification through specific neurophysiological tests of small fibres involvement in MDs represents another tile in this challenging diagnosis. Copyright © 2018 International Federation of Clinical Neurophysiology. Published by Elsevier B.V. All rights reserved.

  10. Identification of a novel COL1A1 frameshift mutation, c.700delG, in a Chinese osteogenesis imperfecta family

    PubMed Central

    Wang, Xiran; Pei, Yu; Dou, Jingtao; Lu, Juming; Li, Jian; Lv, Zhaohui

    2015-01-01

    Osteogenesis imperfecta (OI) is a family of genetic disorders associated with bone loss and fragility. Mutations associated with OI have been found in genes encoding the type I collagen chains. People with OI type I often produce insufficient α1-chain type I collagen because of frameshift, nonsense, or splice site mutations in COL1A1 or COL1A2. This report is of a Chinese daughter and mother who had both experienced two bone fractures. Because skeletal fragility is predominantly inherited, we focused on identifying mutations in COL1A1 and COL1A2 genes. A novel mutation in COL1A1, c.700delG, was detected by genomic DNA sequencing in the mother and daughter, but not in their relatives. The identification of this mutation led to the conclusion that they were affected by mild OI type I. Open reading frame analysis indicated that this frameshift mutation would truncate α1-chain type I collagen at residue p263 (p.E234KfsX264), while the wild-type protein would contain 1,464 residues. The clinical data were consistent with the patients’ diagnosis of mild OI type I caused by haploinsufficiency of α1-chain type I collagen. Combined with previous reports, identification of the novel mutation COL1A1-c.700delG in these patients suggests that additional genetic and environmental factors may influence the severity of OI. PMID:25983617

  11. Characterization of the mutations in the glucose-6-phosphatase gene in Israeli patients with glycogen storage disease type 1a: R83C in six Jews and a novel V166G mutation in a Muslim Arab.

    PubMed

    Parvari, R; Moses, S; Hershkovitz, E; Carmi, R; Bashan, N

    1995-01-01

    Glycogen storage disease type 1a (GSD 1a), an autosomal recessive disease, is caused by the inactivity of glucose-6-phosphatase, the gene of which has been recently cloned. We report on the missense mutation C-->T at nucleotide 326 of the G6Pase gene, causing the change of the Arg codon at position 83 into a Cys codon, as the single mutation detected in six Jewish patients. This finding suggests that this mutation might be prevalent among the Jewish population. A new missense mutation T-->G at nucleotide 576 resulting in V166G was found in an Arab Muslim patient. These families may benefit now from pre- and postnatal diagnosis by analysis of DNA from blood and amniotic fluid or chorionic villus cells rather than liver biopsy. No mutations in the G6Pase gene were detected in two GSD 1b patients.

  12. The 95ΔG mutation in the 5'untranslated region of the norA gene increases efflux activity in Staphylococcus epidermidis isolates.

    PubMed

    García-Gómez, Elizabeth; Jaso-Vera, Marcos E; Juárez-Verdayes, Marco A; Alcántar-Curiel, María D; Zenteno, Juan C; Betanzos-Cabrera, Gabriel; Peralta, Humberto; Rodríguez-Martínez, Sandra; Cancino-Díaz, Mario E; Jan-Roblero, Janet; Cancino-Diaz, Juan C

    2017-02-01

    In the Staphylococcus aureus ATCC25923 strain, the flqB mutation in the 5'untranslated region (5'UTR) of the norA gene causes increased norA mRNA expression and high efflux activity (HEA). The involvement of the norA gene 5'UTR in HEA has not been explored in S. epidermidis; therefore, we examined the function of this region in S. epidermidis clinical isolates. The selection of isolates with HEA was performed based on ethidium bromide (EtBr) MIC values and efflux efficiency (EF) using the semi-automated fluorometric method. The function of the 5'UTR was studied by quantifying the levels of norA expression (RT-qPCR) and by identifying 5'UTR mutations by sequence analysis. Only 10 isolates from a total of 165 (6.1%) had HEA (EtBr MIC = 300 μg/ml and EF ranged from 48.4 to 97.2%). Eight of 10 isolates with HEA had the 5'UTR 95 Δ G mutation. Isolates carrying the 95 Δ G mutation had higher levels of norA expression compared with those that did not. To corroborate that the 95 Δ G mutation is involved in HEA, a strain adapted to EtBr was obtained in vitro. This strain also presented the 95 Δ G mutation and had a high level of norA expression and EF, indicating that the 95 Δ G mutation is important for the HEA phenotype. The 95 Δ G mutation produces a different structure in the Shine-Dalgarno region, which may promote better translation of norA mRNA. To our knowledge, this is the first report to demonstrate the participation of the 5'UTR 95 Δ G mutation of the norA gene in the HEA phenotype of S. epidermidis isolates. Here, we propose that the efflux of EtBr is caused by an increment in the transcription and/or translation of the norA gene. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Confirmation of the pathogenicity of a mutation p.G337C in the COL1A2 gene associated with osteogenesis imperfecta

    PubMed Central

    Jia, Mingrui; Shi, Ranran; Zhao, Xuli; Fu, Zhijian; Bai, Zhijing; Sun, Tao; Zhao, Xuejun; Wang, Wenbo; Xu, Chao; Yan, Fang

    2017-01-01

    Abstract Mutation analysis as the gold standard is particularly important in diagnosis of osteogenesis imperfecta (OI) and it may be preventable upon early diagnosis. In this study, we aimed to analyze the clinical and genetic materials of an OI pedigree as well as to confirm the deleterious property of the mutation. A pedigree with OI was identified. All family members received careful clinical examinations and blood was drawn for genetic analyses. Genes implicated in OI were screened for mutation. The function and structure of the mutant protein were predicted using bioinformatics analysis. The proband, a 9-month fetus, showed abnormal sonographic images. Disproportionately short and triangular face with blue sclera was noticed at birth. She can barely walk and suffered multiple fractures till 2-year old. Her mother appeared small stature, frequent fractures, blue sclera, and deformity of extremities. A heterozygous missense mutation c.1009G>T (p.G337C) in the COL1A2 gene was identified in her mother and her. Bioinformatics analysis showed p.G337 was well-conserved among multiple species and the mutation probably changed the structure and damaged the function of collagen. We suggest that the mutation p.G337C in the COL1A2 gene is pathogenic for OI by affecting the protein structure and the function of collagen. PMID:28953610

  14. A Novel de novo Mutation in the G6PD Gene in a Korean Boy with Glucose-6-phosphate Dehydrogenase Deficiency: Case Report.

    PubMed

    Jang, Mi-Ae; Kim, Ji-Yoon; Lee, Ki-O; Kim, Sun-Hee; Koo, Hong Hoe; Kim, Hee-Jin

    2015-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is an X-linked recessive hemolytic anemia caused by a mutation in the G6PD gene on Xq28. Herein, we describe a Korean boy with G6PD deficiency resulting from a novel mutation in G6PD. A 20-month-old boy with hemolytic anemia was referred for molecular diagnosis. He had no relevant family history. The G6PD activity was severely decreased at 0.2 U/g Hb (severe deficiency). Direct sequencing analyses on the G6PD gene revealed that he was hemizygous for a novel missense variant, c.1187C>G (p.Pro396Arg), in exon 10 of G6PD. Family study involving his parents revealed the de novo occurrence of the mutation. This is the first report of genetically confirmed G6PD deficiency in Korea. © 2015 by the Association of Clinical Scientists, Inc.

  15. A familial case of Keratitis-Ichthyosis-Deafness (KID) syndrome with the GJB2 mutation G45E.

    PubMed

    Jonard, Laurence; Feldmann, Delphine; Parsy, Christophe; Freitag, Sylvie; Sinico, Martine; Koval, Céleste; Grati, Mhamed; Couderc, Remy; Denoyelle, Françoise; Bodemer, Christine; Marlin, Sandrine; Hadj-Rabia, Smail

    2008-01-01

    Keratitis-Ichthyosis-Deafness (KID) syndrome (OMIM 148210) is a congenital ectodermal defect. KID consists of an atypical ichthyosiform erythroderma associated with congenital sensorineural deafness. A rare form of the KID syndrome is a fatal course in the first year of life due to severe skin lesion infections and septicaemia. KID appears to be genetically heterogeneous and may be caused by mutations in connexin 26 or connexin 30 genes. GJB2 mutations in the connexin 26 gene are the main cause of the disease. Most of the cases caused by GJB2 mutations are sporadic, but dominant transmission has also been described. To date, the rare lethal form of the disease has been only observed in two Caucasian sporadic patients with the GJB2 mutation, with the p.Gly45Glu (G45E) arising de novo. We have reported an African family with dizygotic twins suffering from a lethal form of KID. The dizygosity of the twins was confirmed by microsatellite markers. The two patients were heterozygous for the G45E mutation of GJB2, whereas the mutation was not detected in the two parents. The unusual transmission of the disease observed in this family could be explained by the occurrence of a somatic or more probably a germinal mosaic in one of the parents.

  16. An intronic mutation c.6430-3C>G in the F8 gene causes splicing efficiency and premature termination in hemophilia A.

    PubMed

    Xia, Zunjing; Lin, Jie; Lu, Lingping; Kim, Chol; Yu, Ping; Qi, Ming

    2018-06-01

    : Hemophilia A is a bleeding disorder caused by coagulation factor VIII protein deficiency or dysfunction, which is classified into severe, moderate, and mild according to factor clotting activity. An overwhelming majority of missense and nonsense mutations occur in exons of F8 gene, whereas mutations in introns can also be pathogenic. This study aimed to investigate the effect of an intronic mutation, c.6430-3C>G (IVS22-3C>G), on pre-mRNA splicing of the F8 gene. We applied DNA and cDNA sequencing in a Chinese boy with hemophilia A to search if any pathogenic mutation in the F8 gene. Functional analysis was performed to investigate the effect of an intronic mutation at the transcriptional level. Human Splicing Finder and PyMol were also used to predict its effect. We found the mutation c.6430-3C>G (IVS22-3C>G) in the F8 gene in the affected boy, with his mother being a carrier. cDNA from the mother and pSPL3 splicing assay showed that the mutation IVS22-3C>G results in a two-nucleotide AG inclusion at the 3' end of intron 22 and leads to a truncated coagulation factor VIII protein, with partial loss of the C1 domain and complete loss of the C2 domain. The in-silico tool predicted that the mutation induces altered pre-mRNA splicing by using a cryptic acceptor site in intron 22. The IVS22-3C>G mutation was confirmed to affect pre-mRNA splicing and produce a truncated protein, which reduces the stability of binding between the F8 protein and von Willebrand factor carrier protein due to the loss of an interaction domain.

  17. A clinical and molecular review of ubiquitous glucose-6-phosphatase deficiency caused by G6PC3 mutations

    PubMed Central

    2013-01-01

    The G6PC3 gene encodes the ubiquitously expressed glucose-6-phosphatase enzyme (G-6-Pase β or G-6-Pase 3 or G6PC3). Bi-allelic G6PC3 mutations cause a multi-system autosomal recessive disorder of G6PC3 deficiency (also called severe congenital neutropenia type 4, MIM 612541). To date, at least 57 patients with G6PC3 deficiency have been described in the literature. G6PC3 deficiency is characterized by severe congenital neutropenia, recurrent bacterial infections, intermittent thrombocytopenia in many patients, a prominent superficial venous pattern and a high incidence of congenital cardiac defects and uro-genital anomalies. The phenotypic spectrum of the condition is wide and includes rare manifestations such as maturation arrest of the myeloid lineage, a normocellular bone marrow, myelokathexis, lymphopaenia, thymic hypoplasia, inflammatory bowel disease, primary pulmonary hypertension, endocrine abnormalities, growth retardation, minor facial dysmorphism, skeletal and integument anomalies amongst others. Dursun syndrome is part of this extended spectrum. G6PC3 deficiency can also result in isolated non-syndromic severe neutropenia. G6PC3 mutations in result in reduced enzyme activity, endoplasmic reticulum stress response, increased rates of apoptosis of affected cells and dysfunction of neutrophil activity. In this review we demonstrate that loss of function in missense G6PC3 mutations likely results from decreased enzyme stability. The condition can be diagnosed by sequencing the G6PC3 gene. A number of G6PC3 founder mutations are known in various populations and a possible genotype-phenotype relationship also exists. G6PC3 deficiency should be considered as part of the differential diagnoses in any patient with unexplained congenital neutropenia. Treatment with G-CSF leads to improvement in neutrophil numbers, prevents infections and improves quality of life. Mildly affected patients can be managed with prophylactic antibiotics. Untreated G6PC3 deficiency

  18. Identification of katG Mutations Associated with High-Level Isoniazid Resistance in Mycobacterium tuberculosis▿ †

    PubMed Central

    Ando, Hiroki; Kondo, Yuji; Suetake, Toshinori; Toyota, Emiko; Kato, Seiya; Mori, Toru; Kirikae, Teruo

    2010-01-01

    Isoniazid (INH) is an effective first-line antituberculosis drug. KatG, a catalase-peroxidase, converts INH to an active form in Mycobacterium tuberculosis, and katG mutations are major causes of INH resistance. In the present study, we sequenced katG of 108 INH-resistant M. tuberculosis clinical isolates. Consequently, 9 novel KatG mutants with a single-amino-acid substitution were found. All of these mutants had significantly lower INH oxidase activities than the wild type, and each mutant showed various levels of activity. Isolates having mutations with relatively low activities showed high-level INH resistance. On the basis of our results and known mutations associated with INH resistance, we developed a new hybridization-based line probe assay for rapid detection of INH-resistant M. tuberculosis isolates. PMID:20211896

  19. Novel mutations of MYO7A and USH1G in Israeli Arab families with Usher syndrome type 1.

    PubMed

    Rizel, Leah; Safieh, Christine; Shalev, Stavit A; Mezer, Eedy; Jabaly-Habib, Haneen; Ben-Neriah, Ziva; Chervinsky, Elena; Briscoe, Daniel; Ben-Yosef, Tamar

    2011-01-01

    This study investigated the genetic basis for Usher syndrome type 1 (USH1) in four consanguineous Israeli Arab families. Haplotype analysis for all known USH1 loci was performed in each family. In families for which haplotype analysis was inconclusive, we performed genome-wide homozygosity mapping using a single nucleotide polymorphism (SNP) array. For mutation analysis, specific primers were used to PCR amplify the coding exons of the MYO7A, USH1C, and USH1G genes including intron-exon boundaries. Mutation screening was performed with direct sequencing. A combination of haplotype analysis and genome-wide homozygosity mapping indicated linkage to the USH1B locus in two families, USH1C in one family and USH1G in another family. Sequence analysis of the relevant genes (MYO7A, USH1C, and USH1G) led to the identification of pathogenic mutations in all families. Two of the identified mutations are novel (c.1135-1147dup in MYO7A and c.206-207insC in USH1G). USH1 is a genetically heterogenous condition. Of the five USH1 genes identified to date, USH1C and USH1G are the rarest contributors to USH1 etiology worldwide. It is therefore interesting that two of the four Israeli Arab families reported here have mutations in these two genes. This finding further demonstrates the unique genetic structure of the Israeli population in general, and the Israeli Arab population in particular, which due to high rates of consanguinity segregates many rare autosomal recessive genetic conditions.

  20. A novel mouse model of Niemann-Pick type C disease carrying a D1005G-Npc1 mutation comparable to commonly observed human mutations.

    PubMed

    Maue, Robert A; Burgess, Robert W; Wang, Bing; Wooley, Christine M; Seburn, Kevin L; Vanier, Marie T; Rogers, Maximillian A; Chang, Catherine C; Chang, Ta-Yuan; Harris, Brent T; Graber, David J; Penatti, Carlos A A; Porter, Donna M; Szwergold, Benjamin S; Henderson, Leslie P; Totenhagen, John W; Trouard, Theodore P; Borbon, Ivan A; Erickson, Robert P

    2012-02-15

    We have identified a point mutation in Npc1 that creates a novel mouse model (Npc1(nmf164)) of Niemann-Pick type C1 (NPC) disease: a single nucleotide change (A to G at cDNA bp 3163) that results in an aspartate to glycine change at position 1005 (D1005G). This change is in the cysteine-rich luminal loop of the NPC1 protein and is highly similar to commonly occurring human mutations. Genetic and molecular biological analyses, including sequencing the Npc1(spm) allele and identifying a truncating mutation, confirm that the mutation in Npc1(nmf164) mice is distinct from those in other existing mouse models of NPC disease (Npc1(nih), Npc1(spm)). Analyses of lifespan, body and spleen weight, gait and other motor activities, as well as acoustic startle responses all reveal a more slowly developing phenotype in Npc1(nmf164) mutant mice than in mice with the null mutations (Npc1(nih), Npc1(spm)). Although Npc1 mRNA levels appear relatively normal, Npc1(nmf164) brain and liver display dramatic reductions in Npc1 protein, as well as abnormal cholesterol metabolism and altered glycolipid expression. Furthermore, histological analyses of liver, spleen, hippocampus, cortex and cerebellum reveal abnormal cholesterol accumulation, glial activation and Purkinje cell loss at a slower rate than in the Npc1(nih) mouse model. Magnetic resonance imaging studies also reveal significantly less demyelination/dysmyelination than in the null alleles. Thus, although prior mouse models may correspond to the severe infantile onset forms of NPC disease, Npc1(nmf164) mice offer many advantages as a model for the late-onset, more slowly progressing forms of NPC disease that comprise the large majority of human cases.

  1. A novel mouse model of Niemann–Pick type C disease carrying a D1005G-Npc1 mutation comparable to commonly observed human mutations

    PubMed Central

    Maue, Robert A.; Burgess, Robert W.; Wang, Bing; Wooley, Christine M.; Seburn, Kevin L.; Vanier, Marie T.; Rogers, Maximillian A.; Chang, Catherine C.; Chang, Ta-Yuan; Harris, Brent T.; Graber, David J.; Penatti, Carlos A.A.; Porter, Donna M.; Szwergold, Benjamin S.; Henderson, Leslie P.; Totenhagen, John W.; Trouard, Theodore P.; Borbon, Ivan A.; Erickson, Robert P.

    2012-01-01

    We have identified a point mutation in Npc1 that creates a novel mouse model (Npc1nmf164) of Niemann–Pick type C1 (NPC) disease: a single nucleotide change (A to G at cDNA bp 3163) that results in an aspartate to glycine change at position 1005 (D1005G). This change is in the cysteine-rich luminal loop of the NPC1 protein and is highly similar to commonly occurring human mutations. Genetic and molecular biological analyses, including sequencing the Npc1spm allele and identifying a truncating mutation, confirm that the mutation in Npc1nmf164 mice is distinct from those in other existing mouse models of NPC disease (Npc1nih, Npc1spm). Analyses of lifespan, body and spleen weight, gait and other motor activities, as well as acoustic startle responses all reveal a more slowly developing phenotype in Npc1nmf164 mutant mice than in mice with the null mutations (Npc1nih, Npc1spm). Although Npc1 mRNA levels appear relatively normal, Npc1nmf164 brain and liver display dramatic reductions in Npc1 protein, as well as abnormal cholesterol metabolism and altered glycolipid expression. Furthermore, histological analyses of liver, spleen, hippocampus, cortex and cerebellum reveal abnormal cholesterol accumulation, glial activation and Purkinje cell loss at a slower rate than in the Npc1nih mouse model. Magnetic resonance imaging studies also reveal significantly less demyelination/dysmyelination than in the null alleles. Thus, although prior mouse models may correspond to the severe infantile onset forms of NPC disease, Npc1nmf164 mice offer many advantages as a model for the late-onset, more slowly progressing forms of NPC disease that comprise the large majority of human cases. PMID:22048958

  2. KRAS mutation testing in colorectal cancer: comparison of the results obtained using 3 different methods for the analysis of codons G12 and G13.

    PubMed

    Bihl, Michel P; Hoeller, Sylvia; Andreozzi, Maria Carla; Foerster, Anja; Rufle, Alexander; Tornillo, Luigi; Terracciano, Luigi

    2012-03-01

    Targeting the epidermal growth factor receptor (EGFR) is a new therapeutic option for patients with metastatic colorectal or lung carcinoma. However, the therapy efficiency highly depends on the KRAS mutation status in the given tumour. Therefore a reliable and secure KRAS mutation testing is crucial. Here we investigated 100 colorectal carcinoma samples with known KRAS mutation status (62 mutated cases and 38 wild type cases) in a comparative manner with three different KRAS mutation testing techniques (Pyrosequencing, Dideoxysequencing and INFINITI) in order to test their reliability and sensitivity. For the large majority of samples (96/100, 96%), the KRAS mutation status obtained by all three methods was the same. Only two cases with clear discrepancies were observed. One case was reported as wild type by the INFINITI method while the two other methods detected a G13C mutation. In the second case the mutation could be detected by the Pyrosequencing and INFINITI method (15% and 15%), while no signal for mutation could be observed with the Dideoxysequencing method. Additional two unclear results were due to a detection of a G12V with the INFINITI method, which was below cut-off when repeated and which was not detectable by the other two methods and very weak signals in a G12V mutated case with the Dideoxy- and Pyroseqencing method compared to the INFINITI method, respectively. In summary all three methods are reliable and robust methods in detecting KRAS mutations. INFINITI, however seems to be slightly more sensitive compared to Dideoxy- and Pyrosequencing.

  3. The novel Tau mutation G335S: clinical, neuropathological and molecular characterization.

    PubMed

    Spina, Salvatore; Murrell, Jill R; Yoshida, Hirotaka; Ghetti, Bernardino; Bermingham, Niamh; Sweeney, Brian; Dlouhy, Stephen R; Crowther, R Anthony; Goedert, Michel; Keohane, Catherine

    2007-04-01

    Mutations in Tau cause the inherited neurodegenerative disease, frontotemporal dementia and Parkinsonism linked to chromosome 17 (FTDP-17). Known coding region mutations cluster in the microtubule-binding region, where they alter the ability of tau to promote microtubule assembly. Depending on the tau isoforms, this region consists of three or four imperfect repeats of 31 or 32 amino acids, each of which contains a characteristic and invariant PGGG motif. Here, we report the novel G335S mutation, which changes the PGGG motif of the third tau repeat to PGGS, in an individual who developed social withdrawal, emotional bluntness and stereotypic behavior at age 22, followed by disinhibition, hyperorality and ideomotor apraxia. Abundant tau-positive inclusions were present in neurons and glia in the frontotemporal cortex, hippocampus and brainstem. Sarkosyl-insoluble tau showed paired helical and straight filaments, as well as more irregular rope-like filaments. The pattern of pathological tau bands was like that of Alzheimer disease. Experimentally, the G335S mutation resulted in a greatly reduced ability of tau to promote microtubule assembly, while having no significant effect on heparin-induced assembly of recombinant tau into filaments.

  4. Determining mutations in G6PC and SLC37A4 genes in a sample of Brazilian patients with glycogen storage disease types Ia and Ib.

    PubMed

    Carlin, Marcelo Paschoalete; Scherrer, Daniel Zanetti; De Tommaso, Adriana Maria Alves; Bertuzzo, Carmen Silvia; Steiner, Carlos Eduardo

    2013-12-01

    Glycogen storage disease (GSD) comprises a group of autosomal recessive disorders characterized by deficiency of the enzymes that regulate the synthesis or degradation of glycogen. Types Ia and Ib are the most prevalent; while the former is caused by deficiency of glucose-6-phosphatase (G6Pase), the latter is associated with impaired glucose-6-phosphate transporter, where the catalytic unit of G6Pase is located. Over 85 mutations have been reported since the cloning of G6PC and SLC37A4 genes. In this study, twelve unrelated patients with clinical symptoms suggestive of GSDIa and Ib were investigated by using genetic sequencing of G6PC and SLC37A4 genes, being three confirmed as having GSD Ia, and two with GSD Ib. In seven of these patients no mutations were detected in any of the genes. Five changes were detected in G6PC, including three known point mutations (p.G68R, p.R83C and p.Q347X) and two neutral mutations (c.432G > A and c.1176T > C). Four changes were found in SLC37A4: a known point mutation (p.G149E), a novel frameshift insertion (c.1338_1339insT), and two neutral mutations (c.1287G > A and c.1076-28C > T). The frequency of mutations in our population was similar to that observed in the literature, in which the mutation p.R83C is also the most frequent one. Analysis of both genes should be considered in the investigation of this condition. An alternative explanation to the negative results in this molecular study is the possibility of a misdiagnosis. Even with a careful evaluation based on laboratory and clinical findings, overlap with other types of GSD is possible, and further molecular studies should be indicated.

  5. Evidence for prehistoric origins of the G2019S mutation in the North African Berber population.

    PubMed

    Ben El Haj, Rafiqua; Salmi, Ayyoub; Regragui, Wafa; Moussa, Ahmed; Bouslam, Naima; Tibar, Houyam; Benomar, Ali; Yahyaoui, Mohamed; Bouhouche, Ahmed

    2017-01-01

    The most common cause of the monogenic form of Parkinson's disease known so far is the G2019S mutation of the leucine-rich repeat kinase 2 (LRRK2) gene. Its frequency varies greatly among ethnic groups and geographic regions ranging from less than 0.1% in Asia to 40% in North Africa. This mutation has three distinct haplotypes; haplotype 1 being the oldest and most common. Recent studies have dated haplotype 1 of the G2019S mutation to about 4000 years ago, but it remains controversial whether the mutation has a Near-Eastern or Moroccan-Berber ancestral origin. To decipher this evolutionary history, we genotyped 10 microsatellite markers spanning a region of 11.27 Mb in a total of 57 unrelated Moroccan PD patients carrying the G2019S mutation for which the Berber or Arab origin was established over 3 generations based on spoken language. We estimated the age of the most recent common ancestor for the 36 Arab-speaking and the 15 Berber-speaking G2019S carriers using the likelihood-based method with a mutation rate of 10-4. Data analysis suggests that the shortest haplotype originated in a patient of Berber ethnicity. The common founder was estimated to have lived 159 generations ago (95% CI 116-224) for Arab patients, and 200 generations ago (95% CI 123-348) for Berber patients. Then, 29 native North African males carrying the mutation were assessed for specific uniparental markers by sequencing the Y-chromosome (E-M81, E-M78, and M-267) and mitochondrial DNA (mtDNA) hypervariable regions (HV1 and HV2) to examine paternal and maternal contributions, respectively. Results showed that the autochthonous genetic component reached 76% for mtDNA (Eurasian and north African haplogroups) and 59% for the Y-chromosome (E-M81 and E-M78), suggesting that the G2019S mutation may have arisen in an autochthonous DNA pool. Therefore, we conclude that LRRK2 G2019S mutation most likely originated in a Berber founder who lived at least 5000 years ago (95% CI 3075-8700).

  6. Right ventricular outflow tract tachycardia due to a somatic cell mutation in G protein subunitalphai2.

    PubMed Central

    Lerman, B B; Dong, B; Stein, K M; Markowitz, S M; Linden, J; Catanzaro, D F

    1998-01-01

    Idiopathic ventricular tachycardia is a generic term that describes the various forms of ventricular arrhythmias that occur in patients without structural heart disease and in the absence of the long QT syndrome. Many of these tachycardias are focal in origin, localize to the right ventricular outflow tract (RVOT), terminate in response to beta blockers, verapamil, vagal maneuvers, and adenosine, and are thought to result from cAMP-mediated triggered activity. DNA was prepared from biopsy samples obtained from myocardial tissue from a patient with adenosine-insensitive idiopathic ventricular tachycardia arising from the RVOT. Genomic sequences of the inhibitory G protein Galphai2 were determined after amplification by PCR and subcloning. A point mutation (F200L) in the GTP binding domain of the inhibitory G protein Galphai2 was identified in a biopsy sample from the arrhythmogenic focus. This mutation was shown to increase intracellular cAMP concentration and inhibit suppression of cAMP by adenosine. No mutations were detected in Galphai2 sequences from myocardial tissue sampled from regions remote from the origin of tachycardia, or from peripheral lymphocytes. These findings suggest that somatic cell mutations in the cAMP-dependent signal transduction pathway occurring during myocardial development may be responsible for some forms of idiopathic ventricular tachycardia. PMID:9637720

  7. The LRRK2 G2019S mutation in a series of Argentinean patients with Parkinson's disease: clinical and demographic characteristics.

    PubMed

    Gatto, Emilia Mabel; Parisi, Virginia; Converso, Daniela Paola; Poderoso, Juan José; Carreras, María Cecilia; Martí-Massó, José Felix; Paisán-Ruiz, Coro

    2013-03-14

    To determine clinical characteristics and frequency of leucine-rich repeat kinase 2 gene (LRRK2) mutations in a cohort of patients with Parkinson's disease (PD) from Argentina. Variation in the LRRK2 gene represents the most common genetic determinant of PD, only few data are available from Latin-America. Informed consent was obtained and all studies were approved by the Institutional Review Boards. Fifty five consecutive PD patients were recruited. A structured interview and neurological examination were used to collect demographic and clinical information. Blood samples were obtained and DNA extracted from patient venous blood. All LRRK2 exons from 25 exon to 51 exon were screened in all patients. Clinical and molecular data of 55 patients with PD were analyzed. Mean age was 68.8±10.6 years. Jewish and Basque ancestries were found positive in 9 and 7 patients, respectively; family history of PD was identified in 16 patients. The G2019S mutation was present in 3 Ashkenazi Jewish subjects (5.45%); all of them reported family history of PD in first-degree relatives. Although Argentina possesses one of the most important Basque communities outside Spain, non R1414G mutation was identified in this cohort. Eleven single polymorphisms (SNP) were identified in this cohort. The mean age at onset was higher in G2019S mutation carriers than non-carriers (66.67 vs 58.78 years). Asymmetrical tremor as initial symptom and non-motor symptoms occurred at similar frequencies in both groups. The G2019S mutation carriers showed a non significant increase in dyskinesias, and 2/3 developed Dopamine Dysregulation Syndrome and visual hallucinations. Systemic disorder identified in G2019S mutation carriers included: celiac disease, hypothyroidism, Hashimoto's Thyroiditis and arterial hypertension. The prevalence of LRRK2 G2019S mutation in this Argentinean cohort was similar to other international series, with a higher prevalence in Ashkenazi Jewish. The phenotype was indistinguishable

  8. Three new mutations account for the prevalence of glucose 6 phosphate deshydrogenase (G6PD) deficiency in Tunisia.

    PubMed

    Bendaoud, B; Hosni, I; Mosbahi, I; Hafsia, R; Prehu, C; Abbes, S

    2013-04-01

    A previous study on G6PD deficiency carried out on Tunisian population, led to the finding of seven different mutations with the prevalence of G6PD A- variant. This present study reports 23 new unrelated deficient subjects studied at the molecular level to determine the mutation that causes G6PD deficiency. Using PCR-SSCP of coding regions followed by direct sequencing of abnormal pattern, three new mutations were detected. Two of them are polymorphic intronic mutations. The first is IVS-V 655C-->C/T, found in four female subjects with mild deficiency of class III variant. The second is IVS-VIII 43 G-->A, found in three male subjects with mild deficiency of class III variant. The third mutation is in the exon region so that it changes the primary structure of the molecule. It is cited for the first time and named G6PD Tunisia. This variant affects the exon 7 of the gene at genomic position 15435 G→T. Its cDNA position is 93 G→G/T, it changes arg 246 to leu. This mutation was found in one heterozygote female with deficiency of class II who have had hemolytic anemia due to ingestion of fava beans. Finally, G6PD Med variant, reported before in three cases, was also found in five other cases (four heterozygote females and one male hemizygote). These findings first enlarge the spectre of mutations to be ten variant mutations, characterizing the Tunisian population and also contribute with hemoglobin gene research in our laboratory to trace the whole genetic map of Tunisian population. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  9. Decreased mutation frequencies among immunoglobulin G variable region genes during viremic HIV-1 infection.

    PubMed

    Bowers, Elisabeth; Scamurra, Ronald W; Asrani, Anil; Beniguel, Lydie; MaWhinney, Samantha; Keays, Kathryne M; Thurn, Joseph R; Janoff, Edward N

    2014-01-01

    HIV-1 infection is complicated by high rates of opportunistic infections against which specific antibodies contribute to immune defense. Antibody function depends on somatic hypermutation (SHM) of variable regions of immunoglobulin heavy chain genes (VH-D-J). We characterized the frequency of SHM in expressed IgG mRNA immunoglobulin transcripts from control and HIV-1-infected patients. We compared utilization of genes in the most prominent VH family (VH3) and mutation frequencies and patterns of cDNA from VH3-IgG genes from 10 seronegative control subjects and 21 patients with HIV-1 infection (6 without and 15 patients with detectable plasma viremia). Unique IgG VH3 family cDNA sequences (n = 1,565) were PCR amplified, cloned, and sequenced from blood. Sequences were analyzed using online (Vbase) and in-house immunoglobulin alignment resources. Mutation frequencies in the antigen-binding hypervariable complementarity determining regions (CDR1/2) of IgG class-switched B cells were lower among viremic HIV-1-infected patients vs. controls for nucleotides (CDR1/2: 10±5% vs. 13.5±6%, p = 0.03) and amino acids (CDR: 20%±10 vs. 25%±12, p = 0.02) and in structural framework regions. Mutation patterns were similar among groups. The most common VH3 gene, VH3-23, was utilized less frequently among viremic HIV-1-infected patients (p = 0.03), and overall, mutation frequencies were decreased in nearly all VH3 genes compared with controls. B cells from HIV-1-infected patients show decreased mutation frequencies, especially in antigen-binding VH3 CDR genes, and selective defects in gene utilization. Similar mutation patterns suggest defects in the quantity, but not quality, of mutator activity. Lower levels of SHM in IgG class-switched B cells from HIV-1-infected patients may contribute to the increased risk of opportunistic infections and impaired humoral responses to preventative vaccines.

  10. Insight into a novel p53 single point mutation (G389E) by Molecular Dynamics Simulations.

    PubMed

    Pirolli, Davide; Carelli Alinovi, Cristiana; Capoluongo, Ettore; Satta, Maria Antonia; Concolino, Paola; Giardina, Bruno; De Rosa, Maria Cristina

    2010-12-30

    The majority of inactivating mutations of p53 reside in the central core DNA binding domain of the protein. In this computational study, we investigated the structural effects of a novel p53 mutation (G389E), identified in a patient with congenital adrenal hyperplasia, which is located within the extreme C-terminal domain (CTD) of p53, an unstructured, flexible region (residues 367-393) of major importance for the regulation of the protein. Based on the three-dimensional structure of a carboxyl-terminal peptide of p53 in complex with the S100B protein, which is involved in regulation of the tumor suppressor activity, a model of wild type (WT) and mutant extreme CTD was developed by molecular modeling and molecular dynamics simulation. It was found that the G389E amino acid replacement has negligible effects on free p53 in solution whereas it significantly affects the interactions of p53 with the S100B protein. The results suggest that the observed mutation may interfere with p53 transcription activation and provide useful information for site-directed mutagenesis experiments.

  11. A novel cell line generated using the CRISPR/Cas9 technology as universal quality control material for KRAS G12V mutation testing.

    PubMed

    Jia, Shiyu; Zhang, Rui; Lin, Guigao; Peng, Rongxue; Gao, Peng; Han, Yanxi; Fu, Yu; Ding, Jiansheng; Wu, Qisheng; Zhang, Kuo; Xie, Jiehong; Li, Jinming

    2018-06-01

    KRAS mutations are the key indicator for EGFR monoclonal antibody-targeted therapy and acquired drug resistance, and their accurate detection is critical to the clinical decision-making of colorectal cancer. However, no proper quality control material is available for the current detection methods, particularly next-generation sequencing (NGS). The ideal quality control material for NGS needs to provide both the tumor mutation gene and the matched background genomic DNA, which is uncataloged in public databases, to accurately distinguish germline polymorphisms and somatic mutations. We developed a novel KRAS G12V mutant cell line using the clustered regularly interspaced short palindromic repeat (CRISPR)/CRISPR-associated protein 9 (Cas9) technique to make up for the deficiencies in existing quality control material and further validated the feasibility of the cell line as quality control material by amplification refractory mutation system (ARMS), Sanger sequencing, digital PCR (dPCR), and NGS. We verified that the edited cell line specifically had the G12V mutation, and the validation results presented a high consistency among the four methods of detection. The three cell lines screened contained the G12V mutation and the mutation allele fractions of G12V-1, G12V-2, and G12V-3 were 52.01%, 82.06%, and 17.29%, respectively. The novel KRAS G12V cell line generated using the CRISPR/Cas9 gene editing system is suitable as a quality control material for all current detection methods and provides a new direction in the development of quality control material. © 2018 Wiley Periodicals, Inc.

  12. Plasma fibrin clot properties in the G20210A prothrombin mutation carriers following venous thromboembolism: the effect of rivaroxaban.

    PubMed

    Janion-Sadowska, Agnieszka; Natorska, Joanna; Siudut, Jakub; Ząbczyk, Michal; Stanisz, Andrzej; Undas, Anetta

    2017-08-30

    We sought to investigate whether the G20210A prothrombin mutation modifies plasma fibrin clot properties in patients after venous thromboembolism (VTE) and how rivaroxaban treatment affects these alterations. We studied 34 prothrombin mutation heterozygous carriers and sex- and age-matched 34 non-carriers, all at least three months since the first VTE episode, before and during treatment with rivaroxaban. Clot permeability (K s ) and clot lysis time (CLT) with or without elimination of thrombin activatable fibrinolysis inhibitor (TAFI) were assessed at baseline, 2-6 hours (h) after and 20-25 h after intake of rivaroxaban (20 mg/day). At baseline, the prothrombin mutation group formed denser clots (K s -12 %, p=0.0006) and had impaired fibrinolysis (CLT +14 %, p=0.004, and CLT-TAFI +13 %, p=0.03) compared with the no mutation group and were similar to those observed in 15 healthy unrelated prothrombin mutation carriers. The G20210A prothrombin mutation was the independent predictor for K s and CLT before rivaroxaban intake. At 2-6 h after rivaroxaban intake, clot properties improved in both G20210A carriers and non-carriers (K s +38 %, and +37 %, CLT -25 % and -25 %, CLT-TAFI -20 % and -24 %, respectively, all p<0.001), but those parameters were worse in the prothrombin mutation group (K s -12.8 %, CLT +17 %, CLT-TAFI +13 %, all p<0.001). Rivaroxaban concentration correlated with fibrin clot properties. After 20-25 h since rivaroxaban intake most clot properties returned to baseline. Rivaroxaban-related differences in clot structure were confirmed by scanning electron microscopy images. In conclusion, rivaroxaban treatment, though improves fibrin clot properties, cannot abolish more prothrombotic fibrin clot phenotype observed in prothrombin mutation carriers following VTE.

  13. Meningocerebrovascular amyloidosis associated with a novel transthyretin mis-sense mutation at codon 18 (TTRD 18G)

    PubMed Central

    Vidal, R.; Garzuly, F.; Budka, H.; Lalowski, M.; Linke, R. P.; Brittig, F.; Frangione, B.; Wisniewski, T.

    1996-01-01

    We describe a novel transthyretin mutation at codon 18 where Asp is replaced by Gly (D18G) in a Hungarian kindred. This mutation is associated with meningocerebrovascular amyloidosis, producing dementia, ataxia, and spasticity. Fifty different transthyretin mutations are related to amyloid deposition, typically producing a peripheral neuropathy or cardiac dysfunction. These symptoms are absent in this family. Up to now, amyloid-beta (A beta), cystatin C, and prion proteins have been known to be deposited as amyloid in the brain, leading to stroke or dementia. With this report we establish that transthyretin amyloid deposition can also produce central nervous system dysfunction as the major clinical symptom. Images Figure 2 Figure 4 PMID:8579098

  14. Disease-Causing Mutations in the G Protein Gαs Subvert the Roles of GDP and GTP.

    PubMed

    Hu, Qi; Shokat, Kevan M

    2018-05-17

    The single most frequent cancer-causing mutation across all heterotrimeric G proteins is R201C in Gαs. The current model explaining the gain-of-function activity of the R201 mutations is through the loss of GTPase activity and resulting inability to switch off to the GDP state. Here, we find that the R201C mutation can bypass the need for GTP binding by directly activating GDP-bound Gαs through stabilization of an intramolecular hydrogen bond network. Having found that a gain-of-function mutation can convert GDP into an activator, we postulated that a reciprocal mutation might disrupt the normal role of GTP. Indeed, we found R228C, a loss-of-function mutation in Gαs that causes pseudohypoparathyroidism type 1a (PHP-Ia), compromised the adenylyl cyclase-activating activity of Gαs bound to a non-hydrolyzable GTP analog. These findings show that disease-causing mutations in Gαs can subvert the canonical roles of GDP and GTP, providing new insights into the regulation mechanism of G proteins. Copyright © 2018 Elsevier Inc. All rights reserved.

  15. Novel Compound Heterozygous CLCNKB Gene Mutations (c.1755A>G/ c.848_850delTCT) Cause Classic Bartter Syndrome.

    PubMed

    Wang, Chunli; Chen, Ying; Zheng, Bixia; Zhu, Mengshu; Fan, Jia; Wang, Juejin; Jia, Zhanjun; Huang, Songming; Zhang, Aihua

    2018-02-14

    Inactivated variants in CLCNKB gene encoding the basolateral chloride channel ClC-Kb cause classic Bartter syndrome characterized by hypokalemic metabolic alkalosis and hyperreninemic hyperaldosteronism. Here we identified two cBS siblings presenting hypokalemia in a Chinese family due to novel compound heterozygous CLCNKB mutations (c.848_850delTCT/c.1755A>G). Compound heterozygosity was confirmed by amplifying and sequencing the patient's genomic DNA. The synonymous mutation c.1755A>G (Thr585Thr) was located at +2bp from the 5' splice donor site in exon 15, further transcript analysis demonstrated that this single nucleotide mutation causes exclusion of exon 15 in the cDNA from the proband and his mother. Furthermore, we investigated the expression and protein trafficking change of c.848_850delTCT (TCT) and exon 15 deletion(E15)mutation in vitro. The E15 mutation markedly decreased the expression of ClC-Kb and resulted in a low-molecular-weight band (~55kD) trapping in the endoplasmic reticulum, while the TCT mutant only decreased the total and plasma membrane ClC-Kb protein expression but did not affect the subcellular localization. Finally, we studied the physiological functions of mutations by using whole-cell patch clamp and found that E15 or TCT mutation decreased the current of ClC-Kb/barttin channel. These results suggested that the compound defective mutations of CLCNKB gene are the molecular mechanism of the two cBS siblings.

  16. KRAS-G12C mutation is associated with poor outcome in surgically resected lung adenocarcinoma.

    PubMed

    Nadal, Ernest; Chen, Guoan; Prensner, John R; Shiratsuchi, Hiroe; Sam, Christine; Zhao, Lili; Kalemkerian, Gregory P; Brenner, Dean; Lin, Jules; Reddy, Rishindra M; Chang, Andrew C; Capellà, Gabriel; Cardenal, Felipe; Beer, David G; Ramnath, Nithya

    2014-10-01

    The aim of this study was to examine the effects of KRAS mutant subtypes on the outcome of patients with resected lung adenocarcinoma (AC). Using clinical and sequencing data, we identified 179 patients with resected lung AC for whom KRAS mutational status was determined. A multivariate Cox model was used to identify factors associated with disease-free survival (DFS) and overall survival (OS). Publicly available mutation and gene-expression data from lung cancer cell lines and lung AC were used to assess whether distinct KRAS mutant variants have a different profile. Patients with KRAS mutation had a significantly shorter DFS compared with those with KRAS wild-type (p = 0.009). Patients with KRAS-G12C mutant tumors had significantly shorter DFS compared with other KRAS mutants and KRAS wild-type tumors (p < 0.001). In the multivariate Cox model, KRAS-G12C remained as an independent prognostic marker for DFS (Hazard ratio = 2.46, 95% confidence interval 1.51-4.00, p < 0.001) and for OS (Hazard ratio = 2.35, 95% confidence interval 1.35-4.10, p = 0.003). No genes were statistically significant when comparing the mutational or transcriptional profile of lung cancer cell lines and lung AC harboring KRAS-G12C with other KRAS mutant subtypes. Gene set enrichment analysis revealed that KRAS-G12C mutants overexpressed epithelial to mesenchymal transition genes and expressed lower levels of genes predicting KRAS dependency. KRAS-G12C mutation is associated with worse DFS and OS in resected lung AC. Gene-expression profiles in lung cancer cell lines and surgically resected lung AC revealed that KRAS-G12C mutants had an epithelial to mesenchymal transition and a KRAS-independent phenotype.

  17. Mitochondrial DNA 8993T>G mutation in a child with ornithine transcarbamylase deficiency and leigh syndrome: an unexpected association.

    PubMed

    Henriques, Margarida; Diogo, Luísa; Garcia, Paula; Pratas, João; Simões, Marta; Grazina, Manuela

    2012-08-01

    MC, female, is the third child of a nonconsanguineous Portuguese couple, born after an uneventful pregnancy and delivery. A positive family history of ornithine transcarbamylase deficiency, associated with the IVS8+1 G>A mutation in the ornithine transcarbamylase gene, prompted prenatal diagnosis with identification of the same mutation in the proband. During an episode of Klebsiella pneumoniae sepsis at 1.5 months of age, lactic acidosis and moderate hyperammonemia were noticed. After a short asymptomatic period, progressive neurologic symptoms, with normal ammonemia, persistent hyperlactacidemia, and typical lesions in brain computed tomography (CT) scan led to a diagnosis of Leigh syndrome. Mitochondrial respiratory chain complex V was reduced in the liver. The mtDNA 8993T>G mutation was identified in the liver, muscle, and blood (82%-87% heteroplasmy). She died at 6 months of age. This case represents a benign phenotype of ornithine transcarbamylase deficiency, associated with a severe mitochondrial respiratory chain disorder due to an mtDNA pathogenic mutation.

  18. Effectiveness of ivacaftor in cystic fibrosis patients with non-G551D gating mutations.

    PubMed

    Guimbellot, Jennifer; Solomon, George M; Baines, Arthur; Heltshe, Sonya L; VanDalfsen, Jill; Joseloff, Elizabeth; Sagel, Scott D; Rowe, Steven M

    2018-04-20

    The cystic fibrosis transmembrane conductance regulator (CFTR) potentiator ivacaftor is approved for patients with CF with gating and residual function CFTR mutations. We report the results of an observational study investigating its effects in CF patients with non-G551D gating mutations. Patients with non-G551D gating mutations were recruited to an open-label study evaluating ivacaftor. Primary outcomes included: lung function, sweat chloride, weight gain, and quality of life scores. Twenty-one subjects were enrolled and completed 6 months follow-up on ivacaftor; mean age was 25.6 years with 52% <18. Baseline ppFEV 1 was 68% and mean sweat chloride 89.6 mEq/L. Participants experienced significant improvements in ppFEV 1 (mean absolute increase of 10.9% 95% CI = [2.6,19.3], p = 0.0134), sweat chloride (-48.6 95% CI = [-67.4,-29.9], p < 0.0001), and weight (5.1 kg, 95% CI = [2.8, 7.3], p = 0.0002). Patients with non-G551D gating mutations experienced improved lung function, nutritional status, and quality of life. This study supports ongoing use of ivacaftor for patients with these mutations. Copyright © 2018. Published by Elsevier B.V.

  19. Mechanistic study on the nuclear modifier gene MSS1 mutation suppressing neomycin sensitivity of the mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae.

    PubMed

    Zhou, Qiyin; Wang, Wei; He, Xiangyu; Zhu, Xiaoyu; Shen, Yaoyao; Yu, Zhe; Wang, Xuexiang; Qi, Xuchen; Zhang, Xuan; Fan, Mingjie; Dai, Yu; Yang, Shuxu; Yan, Qingfeng

    2014-01-01

    The phenotypic manifestation of mitochondrial DNA (mtDNA) mutations can be modulated by nuclear genes and environmental factors. However, neither the interaction among these factors nor their underlying mechanisms are well understood. The yeast Saccharomyces cerevisiae mtDNA 15S rRNA C1477G mutation (PR) corresponds to the human 12S rRNA A1555G mutation. Here we report that a nuclear modifier gene mss1 mutation suppresses the neomycin-sensitivity phenotype of a yeast C1477G mutant in fermentable YPD medium. Functional assays show that the mitochondrial function of the yeast C1477G mutant was impaired severely in YPD medium with neomycin. Moreover, the mss1 mutation led to a significant increase in the steady-state level of HAP5 (heme activated protein), which greatly up-regulated the expression of glycolytic transcription factors RAP1, GCR1, and GCR2 and thus stimulated glycolysis. Furthermore, the high expression of the key glycolytic enzyme genes HXK2, PFK1 and PYK1 indicated that enhanced glycolysis not only compensated for the ATP reduction from oxidative phosphorylation (OXPHOS) in mitochondria, but also ensured the growth of the mss1(PR) mutant in YPD medium with neomycin. This study advances our understanding of the phenotypic manifestation of mtDNA mutations.

  20. ALS-associated mutation SOD1G93A leads to abnormal mitochondrial dynamics in osteocytes.

    PubMed

    Wang, Huan; Yi, Jianxun; Li, Xuejun; Xiao, Yajuan; Dhakal, Kamal; Zhou, Jingsong

    2018-01-01

    While the death of motor neuron is a pathological hallmark of amyotrophic lateral sclerosis (ALS), defects in other cell types or organs may also actively contribute to ALS disease progression. ALS patients experience progressive skeletal muscle wasting that may not only exacerbate neuronal degeneration, but likely has a significant impact on bone function. In our previous published study, we have discovered severe bone loss in an ALS mouse model with overexpression of ALS-associated mutation SOD1 G93A (G93A). Here we further provide a mechanistic understanding of the bone loss in ALS animal and cellular models. Combining mitochondrial fluorescent indicators and confocal live cell imaging, we discovered abnormalities in mitochondrial network and dynamics in primary osteocytes derived from the same ALS mouse model G93A. Those mitochondrial defects occur in ALS mice after the onset of neuromuscular symptoms, indicating that mitochondria in bone cells respond to muscle atrophy during ALS disease progression. To examine whether ALS mutation has a direct contribution to mitochondrial dysfunction independent of muscle atrophy, we evaluated mitochondrial morphology and motility in cultured osteocytes (MLO-Y4) with overexpression of mitochondrial targeted SOD1 G93A . Compared with osteocytes overexpressing the wild type SOD1 as a control, the SOD1 G93A osteocytes showed similar defects in mitochondrial network and dynamic as that of the primary osteocytes derived from the ALS mouse model. In addition, we further discovered that overexpression of SOD1 G93A enhanced the expression level of dynamin-related protein 1 (Drp1), a key protein promoting mitochondrial fission activity, and reduced the expression level of optic atrophy protein 1 (OPA1), a key protein related to mitochondrial fusion. A specific mitochondrial fission inhibitor (Mdivi-1) partially reversed the effect of SOD1 G93A on mitochondrial network and dynamics, indicating that SOD1 G93A likely promotes

  1. The USH2A c.2299delG mutation: dating its common origin in a Southern European population

    PubMed Central

    Aller, Elena; Larrieu, Lise; Jaijo, Teresa; Baux, David; Espinós, Carmen; González-Candelas, Fernando; Nájera, Carmen; Palau, Francesc; Claustres, Mireille; Roux, Anne-Françoise; Millán, José M

    2010-01-01

    Usher syndrome type II is the most common form of Usher syndrome. USH2A is the main responsible gene of the three known to be disease causing. It encodes two isoforms of the protein usherin. This protein is part of an interactome that has an essential role in the development and function of inner ear hair cells and photoreceptors. The gene contains 72 exons spanning over a region of 800 kb. Although numerous mutations have been described, the c.2299delG mutation is the most prevalent in several populations. Its ancestral origin was previously suggested after the identification of a common core haplotype restricted to 250 kb in the 5′ region that encodes the short usherin isoform. By extending the haplotype analysis over the 800 kb region of the USH2A gene with a total of 14 intragenic single nucleotide polymorphisms, we have been able to define 10 different c.2299delG haplotypes, showing high variability but preserving the previously described core haplotype. An exhaustive c.2299delG/control haplotype study suggests that the major source of variability in the USH2A gene is recombination. Furthermore, we have evidenced twice the amount of recombination hotspots located in the 500 kb region that covers the 3′ end of the gene, explaining the higher variability observed in this region when compared with the 250 kb of the 5′ region. Our data confirm the common ancestral origin of the c.2299delG mutation. PMID:20145675

  2. Prevalence of 2314delG mutation in Spanish patients with Usher syndrome type II (USH2).

    PubMed

    Beneyto, M M; Cuevas, J M; Millán, J M; Espinós, C; Mateu, E; González-Cabo, P; Baiget, M; Doménech, M; Bernal, S; Ayuso, C; García-Sandoval, B; Trujillo, M J; Borrego, S; Antiñolo, G; Carballo, M; Nájera, C

    2000-06-01

    The Usher syndrome (USH) is a group of autosomal recessive diseases characterized by congenital sensorineural hearing loss and retinitis pigmentosa. Three clinically distinct forms of Usher syndrome have so far been recognized and can be distinguished from one another by assessing auditory and vestibular function. Usher syndrome type II (USH2) patients have congenital moderate-to-severe nonprogressive hearing loss, retinitis pigmentosa, and normal vestibular function. Genetic linkage studies have revealed genetic heterogeneity among the three types of USH, with the majority of USH2 families showing linkage to the USH2A locus in 1q41. The USH2A gene (MIM 276901) has been identified: three mutations, 2314delG, 2913delG, and 4353-54delC, were initially reported in USH2A patients, the most frequent of which is the 2314delG mutation. It has been reported that this mutation can give rise to typical and atypical USH2 phenotypes. USH2 cases represent 62% of all USH cases in the Spanish population, and 95% of these cases have provided evidence of linkage to the USH2A locus. In the present study, the three reported mutations were analyzed in 59 Spanish families with a diagnosis of USH type II. The 2314delG was the only mutation identified in our population: it was detected in 25% of families and 16% of USH2 chromosomes analyzed. This study attempts to estimate the prevalence of this common mutation in a homogeneous Spanish population.

  3. Fabry disease: Evidence for a regional founder effect of the GLA gene mutation 30delG in Brazilian patients.

    PubMed

    de Alencar, Dayse Oliveira; Netto, Cristina; Ashton-Prolla, Patricia; Giugliani, Roberto; Ribeiro-Dos-Santos, Ândrea; Pereira, Fernanda; Matte, Ursula; Santos, Ney; Santos, Sidney

    2014-01-01

    The Fabry disease is caused by mutations in the gene ( GLA ) that encodes the enzyme α-galactosidase A (α-Gal A). More than 500 pathologic variants of GLA have already been described, most of them are family-specific. In southern Brazil, a frequent single-base deletion ( GLA 30delG) was identified among four families that do not recognize any common ancestral. In order to investigate the history of this mutation (investigate the founder effect, estimate the mutation age and the most likely source), six gene-flanking microsatellite markers of the X chromosome on the mutation carriers and their parents, 150 individuals from the same population and 300 individuals that compose the Brazilian parental populations (Europeans, Africans and Native Americans) were genotyped. A common haplotype to the four families was identified and characterized as founder. The age was estimated with two statistics software (DMLE 2.2 and ESTIAGE) that agreed with 11 to 12 generations old. This result indicates that the mutation GLA 30delG was originated from a single event on the X chromosome of a European immigrant, during the southern Brazil colonization between 1710 and 1740.

  4. Homozygous G320V mutation in the HJV gene causing juvenile hereditary haemochromatosis type A. A case report.

    PubMed

    Militaru, Mariela S; Popp, Radu A; Trifa, Adrian P

    2010-06-01

    While classical hereditary haemochromatosis, usually associated with mutations in the HFE gene, has an adult age onset and a long, progressive evolution, juvenile haemochromatosis, most often associated with mutations in the HJV gene, is a more severe, rapidly progressive condition and has an onset before the age of 30. We report a 26-year old woman with a severe iron overload, affected by hypogonadotropic hypogonadism and moderate dilative cardiomyopathy, in whom the molecular analysis revealed a homozygous genotype for G320V mutation in the HJV gene. As juvenile haemochromatosis is a severe disease, death usually occurring from cardiac involvement, an efficient iron removal from the body strategy should be started as soon as possible, in order to prevent irreversible damage.

  5. Endometrial cancer and somatic G>T KRAS transversion in patients with constitutional MUTYH biallelic mutations.

    PubMed

    Tricarico, Rossella; Bet, Paola; Ciambotti, Benedetta; Di Gregorio, Carmela; Gatteschi, Beatrice; Gismondi, Viviana; Toschi, Benedetta; Tonelli, Francesco; Varesco, Liliana; Genuardi, Maurizio

    2009-02-18

    MUTYH-associated polyposis (MAP) is an autosomal recessive condition predisposing to colorectal cancer, caused by constitutional biallelic mutations in the base excision repair (BER) gene MUTYH. Colorectal tumours from MAP patients display an excess of somatic G>T mutations in the APC and KRAS genes due to defective BER function. To date, few extracolonic manifestations have been observed in MAP patients, and the clinical spectrum of this condition is not yet fully established. Recently, one patient with a diagnosis of endometrial cancer and biallelic MUTYH mutations has been described. We here report on two additional unrelated MAP patients with biallelic MUTYH germline mutations who developed endometrioid endometrial carcinoma. The endometrial tumours were evaluated for PTEN, PIK3CA, KRAS, BRAF and CTNNB1 mutations. A G>T transversion at codon 12 of the KRAS gene was observed in one tumour. A single 1bp frameshift deletion of PTEN was observed in the same sample. Overall, these findings suggest that endometrial carcinoma is a phenotypic manifestations of MAP and that inefficient repair of oxidative damage can be involved in its pathogenesis.

  6. Proteomics screen to reveal molecular changes mediated by C722G missense mutation in CHRM2 gene.

    PubMed

    Hou, Dongyan; Chen, Ying; Liu, Jiamei; Xu, Lin; Zhang, Zhiyong; Zhang, Juan; Wang, Hua; Wang, Xin; Chen, Jin; Zhao, Rongrui; Hu, Aihua; Hakonarson, Hakon; Zhang, Lin; Shen, Yan

    2013-08-26

    Previously, we reported a missense mutation (C722G) in the M2-muscarinic acetylcholine receptor (CHRM2) gene associated with familial dilated cardiomyopathy. However, the exact molecular mechanisms by the related protein changes of CHRM2-C722G mutation induced are still unclear. CHRM2 and CHRM2-C722G lentiviral vector was infected to CHO cells. Proteomic analysis by label-free shotgun strategy and the STRING 9.0 software were performed. A total of 102 proteins with at least 2-fold change in the CHRM2-C722G group were identified, 42 proteins were up-regulated, whereas 57 were down-regulated. These altered proteins belong to three broad functional categories: (i) metabolic (e.g. Cytosolic acyl coenzyme A thioester hydrolase, Malate dehydrogenase); (ii) cytoskeletal (e.g. Actin-related protein, Myosin light polypeptide 6 and Alpha-actinin-1) and (iii) stress response (e.g. heat shock protein 70, Ras-related protein Rab-10). Interestingly, the marked differences in the expression of selected eight proteins (change >4.0-fold), were connected with many proteins related to apoptosis and immune/inflammatory response such as: FOS, BAX, MYC, TP53 and IL6. This novel study demonstrated for the first time a full-scale screening of the proteomics research by CHRM2-C722G mutation and profiled 102 changed proteins, of which, eight might be critical in cardiac dysfunction for future mapping. It was a full-scale screening of the proteomics research by CHRM2-C722G mutation. These proteins might serve as valuable biomarkers that could predict the presence of a precursor field. These proteins might serve to further explore the pathophysiological mechanisms in familial DCM patients with C176W mutation. Copyright © 2013 Elsevier B.V. All rights reserved.

  7. 8 CFR 324.3 - Women, citizens of the United States at birth, who lost or are believed to have lost citizenship...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Women, citizens of the United States at... SPECIAL CLASSES OF PERSONS WHO MAY BE NATURALlZED: WOMEN WHO HAVE LOST UNITED STATES CITIZENSHIP BY MARRIAGE AND FORMER CITIZENS WHOSE NATURALIZATION IS AUTHORIZED BY PRlVATE LAW § 324.3 Women, citizens of...

  8. Changing phenotypic expression in a patient with a mitochondrial encephalopathy due to 13042G>A de novo mutation--a 5 year follow up.

    PubMed

    Schinwelski, M; Kierdaszuk, B; Dulski, J; Tońska, K; Kodroń, A; Sitek, E J; Bartnik, E; Kamińska, A; Kwieciński, H; Sławek, J

    2015-08-01

    Mutations in NADH dehydrogenase (ND) subunits of complex I lead to mitochondrial encephalomyopathies associated with various phenotypes. This report aims to present the patient's clinical symptomatology in the context of a very rare 13042G>A de novo mutation and with an emphasis on changing phenotypic expression and pronounced, long-standing response to levetiracetam.

  9. [A study on the relationship between point mutation in pre-core region G1896A of hepatitis B virus and safety of breast feeding].

    PubMed

    Lu, Yin-ping; Cao, Wei; Hong, Mei; Zhu, Jian-fang; Liu, Zhao; Yang, Dong-liang

    2008-10-01

    To investigate the relationship between pre-core G1896A point mutation of hepatitis B virus (HBV) and safety of breast feeding. Serum and breast milk samples were collected from 62 pregnant women of HBV DNA positive/HBeAg negative. PCR-solid phase hybridization was used to detect the point mutation in pre-core region G1896A of HBV from pregnant women, and HBV DNA loads in sera and breast milk were determined by fluorescence quantitative PCR (FQ-PCR). The prevalence of point mutation was 61.3% (38/62) in 62 pregnant women with HBsAg positive/HBeAg negative. The positive rate of HBV DNA in breast milk of group with point mutation (28.9%) was similar to that of group without mutation (29.2%, chi2=0.0003, P>0.05). However, The positive rate of HBV DNA in breast milk of group with high HBV loads (56.0%) was significantly higher than that of group with low HBV loads (10.8%, chi2=14.79, P<0.01). The point mutation in pre-core region G1896A of HBV dose not affect the positive rate of HBV DNA in breast milk and higher HBV DNA loads in serum of pregnant women might increase the risk of mother-infant transmission.

  10. Herpes Simplex Virus Type 2 Glycoprotein G-Negative Clinical Isolates Are Generated by Single Frameshift Mutations

    PubMed Central

    Liljeqvist, Jan-Åke; Svennerholm, Bo; Bergström, Tomas

    1999-01-01

    Herpes simplex virus (HSV) codes for several envelope glycoproteins, including glycoprotein G-2 (gG-2) of HSV type 2 (HSV-2), which are dispensable for replication in cell culture. However, clinical isolates which are deficient in such proteins occur rarely. We describe here five clinical HSV-2 isolates which were found to be unreactive to a panel of anti-gG-2 monoclonal antibodies and therefore considered phenotypically gG-2 negative. These isolates were further examined for expression of the secreted amino-terminal and cell-associated carboxy-terminal portions of gG-2 by immunoblotting and radioimmunoprecipitation. The gG-2 gene was completely inactivated in four isolates, with no expression of the two protein products. For one isolate a normally produced secreted portion and a truncated carboxy-terminal portion of gG-2 were detected in virus-infected cell medium. Sequencing of the complete gG-2 gene identified a single insertion or deletion of guanine or cytosine nucleotides in all five strains, resulting in a premature termination codon. The frameshift mutations were localized within runs of five or more guanine or cytosine nucleotides and were dispersed throughout the gene. For the isolate for which a partially inactivated gG-2 gene was detected, the frameshift mutation was localized upstream of but adjacent to the nucleotides coding for the transmembranous region. Thus, this study demonstrates the existence of clinical HSV-2 isolates which do not express an envelope glycoprotein and identifies the underlying molecular mechanism to be a single frameshift mutation. PMID:10559290

  11. [Mutism and acute behavioral disorders revealing MELAS syndrome].

    PubMed

    Coomans, H; Barroso, B; Bertandeau, E; Bonnan, M; Dakar, A; Demasles, S; Garraud, S; Krim, E; Martin-Négrier, M-L

    2011-11-01

    MELAS syndrome (mitochondrial encephalomyopathy, lactic acidosis and stroke-like episodes) is a rare genetic mitochondrial disease which can cause cerebral (cerebrovascular accident, migraine, mental deterioration..), sensorial (bilateral symmetrical deafness) and peripheral (muscular involvement, neuropathy) disorders potentially associated with diabetes, renal or cardiac disorders, or growth retardation. Eighty percent of the patients have the 3243 A>G mutation in the leucine RNA transfer gene. Clinical manifestations leading to discovery of the mutation can be extremely varied, affecting patients of different age groups. We report the case of a 49-year-old man who presented acute fits of confusion followed by mutism and praxic disorders. History taking revealed recently diagnosed type 2 diabetes, axonal neuropathy, and bilateral symmetrical deafness requiring hearing aids. The initial MRI showed FLAIR sequences with bi-parietal abnormalities, no signs of recent stroke on the DW/B10000 sequences, and basal ganglia calcifications. Blood tests and morphological findings ruled out a vascular origin. Search for lactic acidosis remained constantly negative in blood samples despite positive cerebrospinal fluid samples (N×3). The 3243 A>G mitochondrial DNA mutation was identified. The neuropsychological evaluation revealed a serious dysexecutive syndrome with a major impact on the patient's self sufficiency. Neurocognitive disorders are not common in MELAS syndrome. Brain MRI results and the presence of extra-neurological signs can be helpful for diagnosis. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

  12. Furosemide loading test in a case of homozygous solute carrier family 12, member 1 (SLC12A1) mutation (g.62382825G>A, p.Pro372Leu) in Japanese Black cattle.

    PubMed

    Hasegawa, Kiyotoshi; Sasaki, Shinji; Sakamoto, Yoichi; Takano, Akifumi; Takayama, Megumi; Higashi, Tomoko; Sugimoto, Yoshikazu; Yasuda, Yasuaki

    2017-10-01

    Hydrallantois is the excessive accumulation of fluid in the allantoic cavity in a pregnant animal and is associated with fetal death. We recently identified a recessive missense mutation in the solute carrier family 12, member 1 (SLC12A1) gene (g.62382825G>A, p.Pro372Leu) that is associated with hydrallantois in Japanese Black cattle. Unexpectedly, we found a case of the homozygous risk-allele for SLC12A1 in a calf, using a PCR-based direct DNA sequencing test. The homozygote was outwardly healthy up to 3 months of age and the mother did not exhibit any clinical symptoms of hydrallantois. In order to validate these observations, we performed confirmation tests for the genotype and a diuretic loading test using furosemide, which inhibits the transporter activity of the SLC12A1 protein. The results showed that the calf was really homozygous for the risk-allele. In the homozygous calf, administration of furosemide did not alter urinary Na + or Cl - levels, in contrast to the heterozygote and wild-type calves in which these were significantly increased. These results demonstrate that the SLC12A1 (g.62382825G>A, p.Pro372Leu) is a hypomorphic or loss-of-function mutation and the hydrallantois with this mutation shows incomplete penetrance in Japanese Black cattle. © 2017 Japanese Society of Animal Science.

  13. The mitochondrial calcium uniporter is involved in mitochondrial calcium cycle dysfunction: Underlying mechanism of hypertension associated with mitochondrial tRNA(Ile) A4263G mutation.

    PubMed

    Chen, Xi; Zhang, Yu; Xu, Bin; Cai, Zhongqi; Wang, Lin; Tian, Jinwen; Liu, Yuqi; Li, Yang

    2016-09-01

    Recent studies have shown that the mitochondrial DNA mutations are involved in the pathogenesis of hypertension. Our previous study identified mitochondrial tRNA(Ile) A4263G mutation in a large Chinese Han family with maternally-inherited hypertension. This mutation may contribute to mitochondrial Ca(2+) cycling dysfuntion, but the mechanism is unclear. Lymphoblastoid cell lines were derived from hypertensive and normotensive individuals, either with or without tRNA(Ile) A4263G mutation. The mitochondrial calcium ([Ca(2+)]m) in cells from hypertensive subjects with the tRNA(Ile) A4263G mutation, was lower than in cells from normotension or hypertension without mutation, or normotension with mutation (P<0.05). Meanwhile, cytosolic calcium ([Ca(2+)]c) in hypertensive with mutation cells was higher than another three groups. After exposure to caffeine, which could increase the [Ca(2+)]c by activating ryanodine receptor on endoplasmic reticulum, [Ca(2+)]c/[Ca(2+)]m increased higher than in hypertensive with mutation cells from another three groups. Moreover, MCU expression was decreased in hypertensive with mutation cells compared with in another three groups (P<0.05). [Ca(2+)]c increased and [Ca(2+)]m decreased after treatment with Ru360 (an inhibitor of MCU) or an siRNA against MCU. In this study we found decreased MCU expression in hypertensive with mutation cells contributed to dysregulated Ca(2+) uptake into the mitochondria, and cytoplasmic Ca(2+) overload. This abnormality might be involved in the underlying mechanisms of maternally inherited hypertension in subjects carrying the mitochondrial tRNA(Ile) A4263G mutation. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. R248G cystic fibrosis transmembrane conductance regulator mutation in three siblings presenting with recurrent acute pancreatitis and reproductive issues: a case series.

    PubMed

    Villalona, Seiichi; Glover-López, Guillermo; Ortega-García, Juan Antonio; Moya-Quiles, Rosa; Mondejar-López, Pedro; Martínez-Romero, Maria C; Rigabert-Montiel, Mariano; Pastor-Vivero, María D; Sánchez-Solís, Manuel

    2017-02-15

    Mutational combinations of the cystic fibrosis transmembrane conductance regulator, CFTR, gene have different phenotypic manifestations at the molecular level with varying clinical consequences for individuals possessing such mutations. Reporting cystic fibrosis transmembrane conductance regulator mutations is important in understanding the genotype-phenotype correlations and associated clinical presentations in patients with cystic fibrosis. Understanding the effects of mutations is critical in developing appropriate treatments for individuals affected with cystic fibrosis, non-classic cystic fibrosis, or cystic fibrosis transmembrane conductance regulator-related disorders. This is the first report of related individuals possessing the R248G missense cystic fibrosis transmembrane conductance regulator mutation and we present their associated clinical histories. All three patients are of Spanish descent. Deoxyribonucleic acid analysis revealed that all three siblings possessed a novel c.742A>G mutation, resulting in a p.Arg248Gly (R248G) amino acid change in exon 6 in trans with the known N1303K mutant allele. Case 1 patient is a 39-year-old infertile man presenting with congenital unilateral absence of the vas deferens and recurrent episodes of epigastric pain. Case 2 patient is a 32-year-old woman presenting with periods of infertility, two previous spontaneous abortions, recurrent epigastric pain, and recurrent pancreatitis. Case 3 patient is a 29-year-old woman presenting with recurrent pancreatitis and epigastric pain. We report the genotype-phenotype correlations and clinical manifestations of a novel R248G cystic fibrosis transmembrane conductance regulator mutation: congenital unilateral absence of the vas deferens in males, reduced female fertility, and recurrent acute pancreatitis. In addition, we discuss the possible functional consequences of the mutations at the molecular level.

  15. Metabolically induced heteroplasmy shifting and L-arginine treatment reduce the energetic defect in a neuronal-like model of MELAS

    PubMed Central

    Desquiret-Dumas, Valerie; Gueguen, Naig; Barth, Magalie; Chevrollier, Arnaud; Hancock, Saege; Wallace, Douglas C; Amati-Bonneau, Patrizia; Henrion, Daniel; Bonneau, Dominique; Reynier, Pascal; Procaccio, Vincent

    2012-01-01

    The m.3243A>G variant in the mitochondrial tRNALeu (UUR) gene is a common mitochondrial DNA (mtDNA) mutation. Phenotypic manifestations depend mainly on the heteroplasmy, i.e. the ratio of mutant to normal mtDNA copies. A high percentage of mutant mtDNA is associated with a severe, life-threatening neurological syndrome known as MELAS (mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes). MELAS is described as a neurovascular disorder primarily affecting the brain and blood vessels, but the pathophysiology of the disease is poorly understood. We developed a series of cybrid cell lines at two different mutant loads: 70% and 100% in the nuclear background of a neuroblastoma cell line (SH-SY5Y). We investigated the impact of the mutation on the metabolism and mitochondrial respiratory chain activity of the cybrids. The m.3243A>G mitochondrial mutation induced a metabolic switch towards glycolysis in the neuronal cells and produced severe defects in respiratory chain assembly and activity. We used two strategies to compensate for the biochemical defects in the mutant cells: one consisted of lowering the glucose content in the culture medium, and the other involved the addition of L-arginine. The reduction of glucose significantly shifted the 100% mutant cells towards the wild-type, reaching a 90% mutant level and restoring respiratory chain complex assembly. The addition of L-arginine, a nitric oxide (NO) donor, improved complex I activity in the mutant cells in which the defective NO metabolism had led to a relative shortage of NO. Thus, metabolically induced heteroplasmy shifting and L-arginine therapy may constitute promising therapeutic strategies against MELAS. PMID:22306605

  16. High prevalence of exon 8 G533C mutation in apparently sporadic medullary thyroid carcinoma in Greece.

    PubMed

    Sarika, H L; Papathoma, A; Garofalaki, M; Vasileiou, V; Vlassopoulou, B; Anastasiou, E; Alevizaki, M

    2012-12-01

    Genetic screening for ret mutation has become routine practice in the evaluation of medullary thyroid carcinoma (MTC). Approximately 25% of these tumours are familial, and they occur as components of the multiple endocrine neoplasia type 2 syndromes (MEN 2A and 2B) or familial MTC. In familial cases, the majority of mutations are found in exons 10, 11, 13, 14 or 15 of the ret gene. A rare mutation involving exon 8 (G533C) has recently been reported in familial cases of MTC in Brazil and Greece; some of these cases were originally thought to be sporadic. The aim of this study was to re-evaluate a series of sporadic cases of MTC, with negative family history, and screen them for germline mutations in exon 8. Genomic DNA was extracted from peripheral lymphocytes in 129 unrelated individuals who had previously been characterized as 'sporadic' based on the negative family history and negative screening for ret gene mutations. Samples were analysed in Applied Biosystems 7500 real-time PCR and confirmed by sequencing. The G533C exon 8 mutation was identified in 10 of 129 patients with sporadic MTC. Asymptomatic gene carriers were subsequently identified in other family members. In our study, we found that 7·75% patients with apparently sporadic MTC do carry G533C mutation involving exon 8 of ret. We feel that there is now a need to include exon 8 mutation screening in all patients diagnosed as sporadic MTC, in Greece. © 2012 Blackwell Publishing Ltd.

  17. Clinical and laboratory survey of 65 Chinese patients with Leigh syndrome.

    PubMed

    Yang, Yan-ling; Sun, Fang; Zhang, Yao; Qian, Ning; Yuan, Yun; Wang, Zhao-xia; Qi, Yu; Xiao, Jiang-xi; Wang, Xiao-ying; Qi, Zhao-yue; Zhang, Yue-hua; Jiang, Yu-wu; Bao, Xin-hua; Qin, Jiong; Wu, Xi-ru

    2006-03-05

    Leigh syndrome is an inherited neurodegenerative disease that emerges in infancy and childhood and presents with a clinically heterogeneous variety of neuromuscular and non-neuromuscular disorders. It can result from the inheritance of mutations in either nuclear or mitochondrial DNA. In the current study, we performed a retrospective study in 65 patients in order to investigate the clinical and genetic characteristics of Leigh syndrome in Chinese patients. Sixty-five unrelated cases (35 men and 30 women) who were hospitalized in the past 12 years were reviewed. Diagnosis was based on both the clinical presentation and the characteristic neuropathologic findings of bilateral symmetric necrotizing lesions in the basal ganglia and brain stem as detected using cranial computed tomography (CT) scan or magnetic resonance imaging (MRI). The differential diagnosis of organic acidurias and fatty acid beta-oxidation defects were performed. Specific point mutations and deletions in mitochondrial DNA (T8993G, T8993C, T9176C, A8344G, A3243G) were screened by PCR-restriction analysis and Southern blot. The SURF1 gene was sequenced. Skeletal muscle biopsies were performed in 17 (26.2%) of the patients. The diagnosis was confirmed by autopsy in 6 (9.2%) patients. The patients had various forms of metabolic encephalomyopathy. Fifty-nine (90.8%) of the patients had the typical neuroradiological features of Leigh syndrome, including symmetrical necrotizing lesions scattered within the basal ganglia, thalamus and brain stem. Twenty (30.8%) patients were confirmed by genetic, biochemical analysis and autopsy. Specific point mutations in mitochondrial DNA were found in 5 cases (7.7%). Of these, the A8344G mutation was detected in 2 patients. The T8993G, T8993C, and A3243G point mutations were identified in 3 other patients, respectively. SURF1 mutations associated with cytochrome c oxidase deficiency were identified in 8 (12.3%) families by DNA sequencing. A G604C mutation was

  18. Expression of G(alpha)(s) proteins and TSH receptor signalling in hyperfunctioning thyroid nodules with TSH receptor mutations.

    PubMed

    Holzapfel, Hans-Peter; Bergner, Beate; Wonerow, Peter; Paschke, Ralf

    2002-07-01

    Constitutively activating mutations of the thyrotrophin receptor (TSHR) are the main molecular cause of hyperfunctioning thyroid nodules (HTNs). The G protein coupling is an important and critical step in the TSHR signalling which mainly includes G(alpha)(s), G(alpha)(i) and G(alpha)(q)/11 proteins. We investigated the in vitro consequences of overexpressing G(alpha) proteins on signalling of the wild-type (WT) or mutated TSHR. Moreover, we investigated whether changes in G(alpha) protein expression are pathophysiologically relevant in HTNs or cold thyroid nodules (CTNs). Wild-type TSH receptor and mutated TSH receptors were coexpressed with G(alpha)(s), G(alpha)(i) or G(alpha)(q)/11, and cAMP and inositol phosphate (IP) production was measured after stimulation with TSH. The expression of G(alpha)(s), G(alpha)(i) and G(alpha)(q)/11 proteins was examined by Western blotting in 28 HTNs and 14 CTNs. Coexpression of G(alpha)(s) with the WT TSH receptor in COS 7 cells significantly increased the basal and TSH-stimulated cAMP accumulation while coexpression of the G(alpha)(q) or G(alpha)11 protein significantly increased the production of cAMP and inositol triphosphate (IP(3)). The coexpression of the TSH receptor mutants (I486F, DEL613-621), known to couple constitutively to G(alpha)(s) and G(alpha)(q) with G(alpha)(s) and G(alpha)(q)/11, significantly increased the basal and stimulated cAMP and IP(3) accumulation. Coexpression of the TSH receptor mutant V556F with G(alpha)(s) only increased the basal and stimulated cAMP production while its coexpression with G(alpha)(q)/11 increased the basal and stimulated IP(3) signalling. The expression of G(alpha)(s) protein subunits determined by Western blotting was significantly decreased in 14 HTNs with a constitutively activating TSH receptor mutation in comparison with the corresponding surrounding tissue, while in 14 HTNs without TSH receptor or G(alpha)(s) protein mutation and in 14 CTNs the expression of G

  19. Identification of the PLA2G6 c.1579G>A Missense Mutation in Papillon Dog Neuroaxonal Dystrophy Using Whole Exome Sequencing Analysis

    PubMed Central

    Tsuboi, Masaya; Watanabe, Manabu; Nibe, Kazumi; Yoshimi, Natsuko; Kato, Akihisa; Sakaguchi, Masahiro; Yamato, Osamu; Tanaka, Miyuu; Kuwamura, Mitsuru; Kushida, Kazuya; Harada, Tomoyuki; Chambers, James Kenn; Sugano, Sumio; Uchida, Kazuyuki; Nakayama, Hiroyuki

    2017-01-01

    Whole exome sequencing (WES) has become a common tool for identifying genetic causes of human inherited disorders, and it has also recently been applied to canine genome research. We conducted WES analysis of neuroaxonal dystrophy (NAD), a neurodegenerative disease that sporadically occurs worldwide in Papillon dogs. The disease is considered an autosomal recessive monogenic disease, which is histopathologically characterized by severe axonal swelling, known as “spheroids,” throughout the nervous system. By sequencing all eleven DNA samples from one NAD-affected Papillon dog and her parents, two unrelated NAD-affected Papillon dogs, and six unaffected control Papillon dogs, we identified 10 candidate mutations. Among them, three candidates were determined to be “deleterious” by in silico pathogenesis evaluation. By subsequent massive screening by TaqMan genotyping analysis, only the PLA2G6 c.1579G>A mutation had an association with the presence or absence of the disease, suggesting that it may be a causal mutation of canine NAD. As a human homologue of this gene is a causative gene for infantile neuroaxonal dystrophy, this canine phenotype may serve as a good animal model for human disease. The results of this study also indicate that WES analysis is a powerful tool for exploring canine hereditary diseases, especially in rare monogenic hereditary diseases. PMID:28107443

  20. Exploring the effect of D61G mutation on SHP2 cause gain of function activity by a molecular dynamics study.

    PubMed

    Li, Hong-Lian; Ma, Ying; Zheng, Chang-Jie; Jin, Wen-Yan; Liu, Wen-Shan; Wang, Run-Ling

    2017-11-24

    Noonan syndrome (NS) is a common autosomal dominant congenital disorder which could cause the congenital cardiopathy and cancer predisposition. Previous studies reported that the knock-in mouse models of the mutant D61G of SHP2 exhibited the major features of NS, which demonstrated that the mutation D61G of SHP2 could cause NS. To explore the effect of D61G mutation on SHP2 and explain the high activity of the mutant, molecular dynamic simulations were performed on wild type (WT) of SHP2 and the mutated SHP2-D61G, respectively. The principal component analysis and dynamic cross-correlation mapping, associated with secondary structure, showed that the D61G mutation affected the motions of two regions (residues Asn 58-Thr 59 and Val 460-His 462) in SHP2 from β to turn. Moreover, the residue interaction networks analysis, the hydrogen bond occupancy analysis and the binding free energies were calculated to gain detailed insight into the influence of the mutant D61G on the two regions, revealing that the major differences between SHP2-WT and SHP2-D61G were the different interactions between Gly 61 and Gly 462, Gly 61 and Ala 461, Gln 506 and Ile 463, Gly 61 and Asn 58, Ile 463 and Thr 466, Gly 462 and Cys 459. Consequently, our findings here may provide knowledge to understand the increased activity of SHP2 caused by the mutant D61G.

  1. Age at cancer onset in germline TP53 mutation carriers: association with polymorphisms in predicted G-quadruplex structures

    PubMed Central

    Hainaut, Pierre

    2014-01-01

    Germline TP53 mutations predispose to multiple cancers defining Li-Fraumeni/Li-Fraumeni-like syndrome (LFS/LFL), a disease with large individual disparities in cancer profiles and age of onset. G-quadruplexes (G4s) are secondary structural motifs occurring in guanine tracks, with regulatory effects on DNA and RNA. We analyzed 85 polymorphisms within or near five predicted G4s in TP53 in search of modifiers of penetrance of LFS/LFL in Brazilian cancer families with (n = 35) or without (n = 110) TP53 mutations. Statistical analyses stratified on family structure showed that cancer tended to occur ~15 years later in mutation carriers who also carried the variant alleles of two polymorphisms within predicted G4-forming regions, rs17878362 (TP53 PIN3, 16 bp duplication in intron 3; P = 0.082) and rs17880560 (6 bp duplication in 3′ flanking region; P = 0.067). Haplotype analysis showed that this inverse association was driven by the polymorphic status of the remaining wild-type (WT) haplotype in mutation carriers: in carriers with a WT haplotype containing at least one variant allele of rs17878362 or rs17880560, cancer occurred ~15 years later than in carriers with other WT haplotypes (P = 0.019). No effect on age of cancer onset was observed in subjects without a TP53 mutation. The G4 in intron 3 has been shown to regulate alternative p53 messenger RNA splicing, whereas the biological roles of predicted G4s in the 3′ flanking region remain to be elucidated. In conclusion, this study demonstrates that G4 polymorphisms in haplotypes of the WT TP53 allele have an impact on LFS/LFL penetrance in germline TP53 mutation carriers. PMID:24336192

  2. Detection of c. -32T>G (IVS1-13T>G) mutation of Pompe disease by real-time PCR in dried blood spot specimen.

    PubMed

    Bobillo Lobato, Joaquin; Sánchez Peral, Blas A; Durán Parejo, Pilar; Jiménez Jiménez, Luis M

    2013-03-15

    Pompe disease, or acid maltase deficiency, is a genetic muscle disorder caused by mutations in the gene encoding the acid alpha-glucosidase (GAA) enzyme, which is essential for the degradation of glycogen to glucose in lysosomes. The wide clinical variability is resulted from genetic heterogeneity, and many different mutations of the GAA gene have been reported. Some of these mutations are associated with specific phenotypes, such as the c. -32T>G (IVS1-13T>G) mutation seen in late-onset Pompe disease. We used a real-time PCR, after genomic DNA extraction isolated from DBS (dried blood spots) and PCR amplification. Our results successfully detected in controls and patients have been 100% concordant with sequencing results. This assay combines simple sample processing and rapid analysis and it allows to detect the patients with a milder form and slower progression of this disease with a high reliability. Copyright © 2013 Elsevier B.V. All rights reserved.

  3. Familial hypertrophic cardiomyopathy: functional effects of myosin mutation R723G in cardiomyocytes.

    PubMed

    Kraft, Theresia; Witjas-Paalberends, E Rosalie; Boontje, Nicky M; Tripathi, Snigdha; Brandis, Almuth; Montag, Judith; Hodgkinson, Julie L; Francino, Antonio; Navarro-Lopez, Francisco; Brenner, Bernhard; Stienen, Ger J M; van der Velden, Jolanda

    2013-04-01

    Familial Hypertrophic Cardiomyopathy (FHC) is frequently caused by mutations in the β-cardiac myosin heavy chain (β-MyHC). To identify changes in sarcomeric function triggered by such mutations, distinguishing mutation effects from other functional alterations of the myocardium is essential. We previously identified a direct effect of mutation R723G (MyHC723) on myosin function in slow Musculus soleus fibers. Here we investigate contractile features of left ventricular cardiomyocytes of FHC-patients with the same MyHC723-mutation and compare these to the soleus data. In mechanically isolated, triton-permeabilized MyHC723-cardiomyocytes, maximum force was significantly lower but calcium-sensitivity was unchanged compared to donor. Conversely, MyHC723-soleus fibers showed significantly higher maximum force and reduced calcium-sensitivity compared to controls. Protein phosphorylation, a potential myocardium specific modifying mechanism, might account for differences compared to soleus fibers. Analysis revealed reduced phosphorylation of troponin I and T, myosin-binding-protein C, and myosin-light-chain 2 in MyHC723-myocardium compared to donor. Saturation of protein-kinaseA phospho-sites led to comparable, i.e., reduced MyHC723-calcium-sensitivity in cardiomyocytes as in M. soleus fibers, while maximum force remained reduced. Myofibrillar disarray and lower density of myofibrils, however, largely account for reduced maximum force in MyHC723-cardiomyocytes. The changes seen when phosphorylation of sarcomeric proteins in myocardium of affected patients is matched to control tissue suggest that the R723G mutation causes reduced Ca(++)-sensitivity in both cardiomyocytes and M. soleus fibers. In MyHC723-myocardium, however, hypophosphorylation can compensate for the reduced calcium-sensitivity, while maximum force generation, lowered by myofibrillar deficiency and disarray, remains impaired, and may only be compensated by hypertrophy. Copyright © 2013 Elsevier Ltd. All

  4. Identification of a novel PMS2 alteration c.505C>G (R169G) in trans with a PMS2 pathogenic mutation in a patient with constitutional mismatch repair deficiency.

    PubMed

    Mork, Maureen E; Borras, Ester; Taggart, Melissa W; Cuddy, Amanda; Bannon, Sarah A; You, Y Nancy; Lynch, Patrick M; Ramirez, Pedro T; Rodriguez-Bigas, Miguel A; Vilar, Eduardo

    2016-10-01

    Constitutional mismatch repair deficiency syndrome (CMMRD) is a rare autosomal recessive predisposition to colorectal polyposis and other malignancies, often childhood-onset, that is caused by biallelic inheritance of mutations in the same mismatch repair gene. Here, we describe a patient with a clinical diagnosis of CMMRD based on colorectal polyposis and young-onset endometrial cancer who was identified to have two alterations in trans in PMS2: one known pathogenic mutation (c.1831insA; p.Ile611Asnfs*2) and one novel variant of uncertain significance (c.505C>G; p.Arg169Glu), a missense alteration. We describe the clinical and molecular features in the patient harboring this novel alteration c.505C>G, who meets clinical criteria for CMMRD and exhibits molecular evidence supporting a diagnosis of CMMRD. Although experimental validation is needed to confirm its pathogenicity, PMS2 c.505C>G likely has functional consequences that contributes to our patient's phenotype based on the patient's clinical presentation, tumor studies, and bioinformatics analysis.

  5. Large cohort screening of G6PD deficiency and the mutational spectrum in the Dongguan District in Southern China.

    PubMed

    Peng, Qi; Li, Siping; Ma, Keze; Li, Wenrui; Ma, Qiang; He, Xiaoguang; He, Yuejing; He, Ting; Lu, Xiaomei

    2015-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a common enzymatic disorder of the erythrocytes that affects 400 million people worldwide. We developed a PCR-reverse dot blot (RDB) assay to screen twenty genotypes of seventeen Chinese G6PD mutations and investigate the spectrum of G6PD deficiency mutations in Dongguan District, Guangdong Province, in southern China. The PCR-RDB assay consists of multiplex PCR amplification of seven fragments in the G6PD target sequence of wild-type and mutant genomic DNA samples followed by hybridization to a test strip containing allele-specific oligonucleotide probes. A total of 16,464 individuals were analyzed by a combination of phenotypic screening and genotypic detection using the PCR-RDB assay and DNA sequence analysis. The PCR-RDB assay had a detection rate of 98.1%, which was validated by direct sequencing in a blind study with 100% concordance. The G6PD deficiency incidence rate in Dongguan District is 4.08%. Thirty-two genotypes from 469 individuals were found. The two most common variants were c.1376G>T and c.1388G>A, followed by c.95A>G, c.871G>A, c.392G>T, and c.1024 C>T. In addition, two rare mutations (c.703C>A and c.406C>T) were detected by DNA sequencing analysis. In our study, 65 cases harbored the C1311T/IVS polymorphism and 67 cases were homozygote. The PCR-RDB assay we established is a reliable and effective method for screening G6PD mutations in the Chinese population. Data on the spectrum of mutations in the Dongguan District is beneficial to the clinical diagnosis and prevention of G6PD deficiency.

  6. Large Cohort Screening of G6PD Deficiency and the Mutational Spectrum in the Dongguan District in Southern China

    PubMed Central

    Ma, Keze; Li, Wenrui; Ma, Qiang; He, Xiaoguang; He, Yuejing; He, Ting; Lu, Xiaomei

    2015-01-01

    Background Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a common enzymatic disorder of the erythrocytes that affects 400 million people worldwide. We developed a PCR-reverse dot blot (RDB) assay to screen twenty genotypes of seventeen Chinese G6PD mutations and investigate the spectrum of G6PD deficiency mutations in Dongguan District, Guangdong Province, in southern China. Method The PCR-RDB assay consists of multiplex PCR amplification of seven fragments in the G6PD target sequence of wild-type and mutant genomic DNA samples followed by hybridization to a test strip containing allele-specific oligonucleotide probes. A total of 16,464 individuals were analyzed by a combination of phenotypic screening and genotypic detection using the PCR-RDB assay and DNA sequence analysis. Results The PCR-RDB assay had a detection rate of 98.1%, which was validated by direct sequencing in a blind study with 100% concordance. The G6PD deficiency incidence rate in Dongguan District is 4.08%. Thirty-two genotypes from 469 individuals were found. The two most common variants were c.1376G>T and c.1388G>A, followed by c.95A>G, c.871G>A, c.392G>T, and c.1024 C>T. In addition, two rare mutations (c.703C>A and c.406C>T) were detected by DNA sequencing analysis. In our study, 65 cases harbored the C1311T/IVS polymorphism and 67 cases were homozygote. Conclusion The PCR-RDB assay we established is a reliable and effective method for screening G6PD mutations in the Chinese population. Data on the spectrum of mutations in the Dongguan District is beneficial to the clinical diagnosis and prevention of G6PD deficiency. PMID:25775246

  7. The syndromic deafness mutation G12R impairs fast and slow gating in Cx26 hemichannels.

    PubMed

    García, Isaac E; Villanelo, Felipe; Contreras, Gustavo F; Pupo, Amaury; Pinto, Bernardo I; Contreras, Jorge E; Pérez-Acle, Tomás; Alvarez, Osvaldo; Latorre, Ramon; Martínez, Agustín D; González, Carlos

    2018-05-07

    Mutations in connexin 26 (Cx26) hemichannels can lead to syndromic deafness that affects the cochlea and skin. These mutations lead to gain-of-function hemichannel phenotypes by unknown molecular mechanisms. In this study, we investigate the biophysical properties of the syndromic mutant Cx26G12R (G12R). Unlike wild-type Cx26, G12R macroscopic hemichannel currents do not saturate upon depolarization, and deactivation is faster during hyperpolarization, suggesting that these channels have impaired fast and slow gating. Single G12R hemichannels show a large increase in open probability, and transitions to the subconductance state are rare and short-lived, demonstrating an inoperative fast gating mechanism. Molecular dynamics simulations indicate that G12R causes a displacement of the N terminus toward the cytoplasm, favoring an interaction between R12 in the N terminus and R99 in the intracellular loop. Disruption of this interaction recovers the fast and slow voltage-dependent gating mechanisms. These results suggest that the mechanisms of fast and slow gating in connexin hemichannels are coupled and provide a molecular mechanism for the gain-of-function phenotype displayed by the syndromic G12R mutation. © 2018 García et al.

  8. Stroke due to mitochondrial disorders in Saudi children.

    PubMed

    Salih, Mustafa A; Abdel-Gader, Abdel-Galil M; Zahraa, Jihad N; Al-Rayess, Molham M; Alorainy, Ibrahim A; Hassan, Hamdy H; Ruitenbeek, Wim; Zeviani, Massimo

    2006-03-01

    cerebrospinal fluid lactate but no ragged red fibers on muscle histochemistry. Biochemical assay of muscle homogenate showed reduction in respiratory chain complexes I, III and IV. Mutation screening of mtDNA at nucleotides 3243 (tRNA(Leu(UUR))) and 8344 (tRNA(Lys)) was negative. Mitochondrial disorders constitute a risk factor for stroke in Saudi children. However, demanding and highly specialized investigations are needed to confirm the diagnosis. These are better performed at supraregional centers where facilities for clinical, biochemical and molecular work-up are available.

  9. The ABCA4 2588G>C Stargardt mutation: single origin and increasing frequency from South-West to North-East Europe.

    PubMed

    Maugeri, Alessandra; Flothmann, Kris; Hemmrich, Nadine; Ingvast, Sofie; Jorge, Paula; Paloma, Eva; Patel, Reshma; Rozet, Jean-Michel; Tammur, Jaana; Testa, Francesco; Balcells, Susana; Bird, Alan C; Brunner, Han G; Hoyng, Carel B; Metspalu, Andres; Simonelli, Francesca; Allikmets, Rando; Bhattacharya, Shomi S; D'Urso, Michele; Gonzàlez-Duarte, Roser; Kaplan, Josseline; te Meerman, Gerard J; Santos, Rosário; Schwartz, Marianne; Van Camp, Guy; Wadelius, Claes; Weber, Bernhard H F; Cremers, Frans P M

    2002-03-01

    Inherited retinal dystrophies represent the most important cause of vision impairment in adolescence, affecting approximately 1 out of 3000 individuals. Mutations of the photoreceptor-specific gene ABCA4 (ABCR) are a common cause of retinal dystrophy. A number of mutations have been repeatedly reported for this gene, notably the 2588G>C mutation which is frequent in both patients and controls. Here we ascertained the frequency of the 2588G>C mutation in a total of 2343 unrelated random control individuals from 11 European countries and 241 control individuals from the US, as well as in 614 patients with STGD both from Europe and the US. We found an overall carrier frequency of 1 out of 54 in Europe, compared with 1 out of 121 in the US, confirming that the 2588G>C ABCA4 mutation is one of the most frequent autosomal recessive mutations in the European population. Carrier frequencies show an increasing gradient in Europe from South-West to North-East. The lowest carrier frequency, 0 out of 199 (0%), was found in Portugal; the highest, 11 out of 197 (5.5%), was found in Sweden. Haplotype analysis in 16 families segregating the 2588G>C mutation showed four intragenic polymorphisms invariably present in all 16 disease chromosomes and sharing of the same allele for several markers flanking the ABCA4 locus in most of the disease chromosomes. These results indicate a single origin of the 2588G>C mutation which, to our best estimate, occurred between 2400 and 3000 years ago.

  10. Discovery of inhibitors that overcome the G1202R ALK Resistance Mutation

    PubMed Central

    Choi, Hwan Geun; Gao, Yang; Sim, Taebo; George, Rani; Jänne, Pasi A.; Gray, Nathanael S.

    2016-01-01

    The treatment of patients with advanced non-small cell lung cancer (NSCLC) harboring chromosomal rearrangements of anaplastic lymphoma kinase (ALK) has been revolutionized by the development of crizotinib, a small molecule inhibitor of ALK, ROS1, and MET. However, resistance to crizotinib inevitably develops through a variety of mechanisms leading to relapse both systemically and in the central nervous system (CNS). This has motivated the development of ‘second generation’ ALK inhibitors, including alectinib and ceritinib that overcome some of the mutations leading to resistance. However, most of the reported ALK inhibitors do not show inhibition of the G1202R mutant, which is one of the most common mutations. Herein, we report the development of a structural analogue of alectinib (JH-VIII-157-02) that is potent against the G1202R mutant as well as a variety of other frequently observed mutants. In addition, JH-VIII-157-02 is capable of penetrating the CNS of mice following oral dosing. PMID:26568289

  11. Mitochondrial G8292A and C8794T mutations in patients with Niemann-Pick disease type C.

    PubMed

    Masserrat, Abbas; Sharifpanah, Fatemeh; Akbari, Leila; Tonekaboni, Seyed Hasan; Karimzadeh, Parvaneh; Asharafi, Mahmood Reza; Mazouei, Safoura; Sauer, Heinrich; Houshmand, Massoud

    2018-07-01

    Niemann-Pick disease type C (NP-C) is a neurovisceral lipid storage disorder. At the cellular level, the disorder is characterized by accumulation of unesterified cholesterol and glycolipids in the lysosomal/late endosomal system. NP-C is transmitted in an autosomal recessive manner and is caused by mutations in either the NPC1 (95% of families) or NPC2 gene. The estimated disease incidence is 1 in 120,000 live births, but this likely represents an underestimate, as the disease may be under-diagnosed due to its highly heterogeneous presentation. Variants of adenosine triphosphatase (ATPase) subunit 6 and ATPase subunit 8 ( ATPase6/8 ) in mitochondrial DNA (mtDNA) have been reported in different types of genetic diseases including NP-C. In the present study, the blood samples of 22 Iranian patients with NP-C and 150 healthy subjects as a control group were analyzed. The DNA of the blood samples was extracted by the salting out method and analyzed for ATPase6/8 mutations using polymerase chain reaction sequencing. Sequence variations in mitochondrial genome samples were determined via the Mitomap database. Analysis of sequencing data confirmed the existence of 11 different single nucleotide polymorphisms (SNPs) in patients with NP-C1. One of the most prevalent polymorphisms was the A8860G variant, which was observed in both affected and non-affected groups and determined to have no significant association with NP-C incidence. Amongst the 11 polymorphisms, only one was identified in the ATPase8 gene, while 9 including A8860G were observed in the ATPase6 gene. Furthermore, two SNPs, G8292A and C8792A, located in the non-coding region of mtDNA and the ATPase6 gene, respectively, exhibited significantly higher prevalence rates in NP-C1 patients compared with the control group (P<0.01). The present study suggests that there may be an association between mitochondrial ATPase6/8 mutations and the incidence of NP-C disease. In addition, the mitochondrial SNPs identified

  12. G6PC3 mutations are associated with a major defect of glycosylation: a novel mechanism for neutrophil dysfunction

    PubMed Central

    Hayee, Bu'Hussain; Antonopoulos, Aristotelis; Murphy, Emma J; Rahman, Farooq Z; Sewell, Gavin; Smith, Bradley N; McCartney, Sara; Furman, Mark; Hall, Georgina; Bloom, Stuart L; Haslam, Stuart M; Morris, Howard R; Boztug, Kaan; Klein, Christoph; Winchester, Bryan; Pick, Edgar; Linch, David C; Gale, Rosemary E; Smith, Andrew M; Dell, Anne; Segal, Anthony W

    2011-01-01

    Glucose-6-phosphatase, an enzyme localized in the endoplasmic reticulum (ER), catalyzes the hydrolysis of glucose-6-phosphate (G6P) to glucose and inorganic phosphate. In humans, there are three differentially expressed glucose-6-phosphatase catabolic genes (G6PC1–3). Recently, it has been shown that mutations in the G6PC3 gene result in a syndrome associating congenital neutropenia and various organ malformations. The enzymatic function of G6PC3 is dependent on G6P transport into the ER, mediated by G6P translocase (G6PT). Mutations in the gene encoding G6PT result in glycogen storage disease type-1b (GSD-1b). Interestingly, GSD-1b patients exhibit a similar neutrophil dysfunction to that observed in G6PC3-deficient patients. To better understand the causes of neutrophil dysfunction in both diseases, we have studied the neutrophil nicotinamide adenine dinucleotide phosphate (NADPH) oxidase of patients with G6PC3 and G6PT syndromes. Unexpectedly, sodium dodecyl sulfate–polyacrylamide gel electrophoresis experiments indicated hypo-glycosylation of gp91phox, the electron-transporting component of the NADPH oxidase, in all of these patients. Rigorous mass spectrometric glycomic profiling showed that most of the complex-type antennae which characterize the neutrophil N-glycome of healthy individuals were severely truncated in the patients' neutrophils. A comparable truncation of the core 2 antenna of the O-glycans was also observed. This aberrant neutrophil glycosylation is predicted to have profound effects on the neutrophil function and merit designation of both syndromes as a new class of congenital disorders of glycosylation. PMID:21385794

  13. Citrullinemia type I, classical variant. Identification of ASS-p~G390R (c.1168G>A) mutation in families of a limited geographic area of Argentina: a possible population cluster.

    PubMed

    Laróvere, Laura E; Angaroni, Celia J; Antonozzi, Sandra L; Bezard, Miriam B; Shimohama, Mariko; de Kremer, Raquel Dodelson

    2009-07-01

    Citrullinemia type I (CTLN1) is an urea cycle defect caused by mutations in the argininosuccinate synthetase gene. We report the first identification in Argentina of patients with CTLN1 in a limited geographic area. Molecular analysis in patient/relatives included PCR, sequencing and restriction enzyme assay. The studied families showed the same mutation: ASS~p.G390R, associated with the early-onset/severe phenotype. We postulate a possible population cluster. A program to know the carrier frequency in that population is in progress.

  14. Compound Heterozygosity for Hb Alperton (HBB: c.407C>T) and IVS-I-5 (G>C) (HBB: c.92+5G>C) Mutations Presenting as a Moderate Anemia in an Indian Family.

    PubMed

    Godbole, Koumudi G; Ramachandran, Angelina; Karkamkar, Ashwini S; Dalal, Ashwin B

    2018-04-13

    While knowledge of HBB gene mutations is necessary for offering prenatal diagnosis (PND) of β-thalassemia (β-thal), a genotype-phenotype correlation may not always be available for rare variants. We present for the first time, genotype-phenotype correlation for a compound heterozygous status with IVS-I-5 (G>C) (HBB: c.92+5G>C) and HBB: c.407C>T (Hb Alperton) mutations on the HBB gene in an Indian family. Hb Alperton is a very rare hemoglobin (Hb) variant with scant published information about its clinical presentation, especially when accompanied with another HBB gene mutation. Here we provide biochemical as well as clinical details of this variant.

  15. Corin mutations K317E and S472G from preeclamptic patients alter zymogen activation and cell surface targeting. [Corrected].

    PubMed

    Dong, Ningzheng; Zhou, Tiantian; Zhang, Yue; Liu, Meng; Li, Hui; Huang, Xiaoyi; Liu, Zhenzhen; Wu, Yi; Fukuda, Koichi; Qin, Jun; Wu, Qingyu

    2014-06-20

    Corin is a membrane-bound serine protease that acts as the atrial natriuretic peptide (ANP) convertase in the heart. Recent studies show that corin also activates ANP in the pregnant uterus to promote spiral artery remodeling and prevent pregnancy-induced hypertension. Two CORIN gene mutations, K317E and S472G, were identified in preeclamptic patients and shown to have reduced activity in vitro. In this study, we carried out molecular modeling and biochemical experiments to understand how these mutations impair corin function. By molecular modeling, the mutation K317E was predicted to alter corin LDL receptor-2 module conformation. Western blot analysis of K317E mutant in HEK293 cells showed that the mutation did not block corin expression on the cell surface but inhibited corin zymogen activation. In contrast, the mutation S472G was predicted to abolish a β-sheet critical for corin frizzled-2 module structure. In Western blot analysis and flow cytometry, S472G mutant was not detected on the cell surface in transfected HEK293 cells. By immunostaining, the S472G mutant was found in the ER, indicating that the mutation S472G disrupted the β-sheet, causing corin misfolding and ER retention. Thus, these results show that mutations in the CORIN gene may impair corin function by entirely different mechanisms. Together, our data provide important insights into the molecular basis underlying corin mutations that may contribute to preeclampsia in patients. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. High MACC1 expression in combination with mutated KRAS G13 indicates poor survival of colorectal cancer patients.

    PubMed

    Ilm, Katharina; Kemmner, Wolfgang; Osterland, Marc; Burock, Susen; Koch, Gudrun; Herrmann, Pia; Schlag, Peter M; Stein, Ulrike

    2015-02-14

    The metastasis-associated in colon cancer 1 (MACC1) gene has been identified as prognostic biomarker for colorectal cancer (CRC). Here, we aimed at the refinement of risk assessment by separate and combined survival analyses of MACC1 expression with any of the markers KRAS mutated in codon 12 (KRAS G12) or codon 13 (KRAS G13), BRAF V600 mutation and MSI status in a retrospective study of 99 CRC patients with tumors UICC staged I, II and III. We showed that only high MACC1 expression (HR: 6.09, 95% CI: 2.50-14.85, P < 0.001) and KRAS G13 mutation (HR: 5.19, 95% CI: 1.06-25.45, P = 0.042) were independent prognostic markers for shorter metastasis-free survival (MFS). Accordingly, Cox regression analysis revealed that patients with high MACC1 expression and KRAS G13 mutation exhibited the worst prognosis (HR: 14.48, 95% CI: 3.37-62.18, P < 0.001). Patients were classified based on their molecular characteristics into four clusters with significant differences in MFS (P = 0.003) by using the SPSS 2-step cluster function and Kaplan-Meier survival analysis. According to our results, patients with high MACC1 expression and mutated KRAS G13 exhibited the highest risk for metachronous metastases formation. Moreover, we demonstrated that the "Traditional pathway" with an intermediate risk for metastasis formation can be further subdivided by assessing MACC1 expression into a low and high risk group with regard to MFS prognosis. This is the first report showing that identification of CRC patients at high risk for metastasis is possible by assessing MACC1 expression in combination with KRAS G13 mutation.

  17. An activating G{sub s}{alpha} mutation is present in fibrous dysplasia of bone in the McCune-Albright syndrome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shenker, A.; Weinstein, L.S.; Spiegel, A.M.

    1994-09-01

    McCune-Albright syndrome (MAS) is a sporadic disease characterized by polyostotic fibrous dysplasia, cafe-au-lait spots, and multiple endocrinopathies. The etiology of fibrous dysplasia is unknown. Activating mutations of codon 201 in the gene encoding the {alpha}-subunit of G{sub s}, the G-protein that stimulates adenylyl cyclase, have been found in all affected MAS tissues that have been studied. Initial attempts to amplify DNA from decalcified paraffin-embedded bone specimens from frozen surgical bone specimens from five MAS patients using polymerase chain reaction and allele-specific oligonucleotide hybridization. Most of the cells in four specimens of dysplastic bone contained a heterozygous mutation encoding substitution ofmore » Arg{sup 201} of G{sub s}{alpha} with His, but the mutation was barely detectable in peripheral blood specimens from the patients. Only a small amount of mutant allele was detected in a specimen of normal cortical bone from the fifth patient, although this patients had a high proportion of mutation in other, affected tissues. The mosaic distribution of mutant alleles is consistent with an embryological somatic cell mutation of the G{sub s}{alpha} gene in MAS. The presence of an activating mutation of G{sub s}{alpha} in osteoblastic progenitor cells may cause them to exhibit increased proliferation and abnormal differentiation, thereby producing the lesions of fibrous dysplasia. 43 refs., 2 figs.« less

  18. Glucose-6-Phosphate Dehydrogenase (G6PD) deficiency in Greek newborns: the Mediterranean C563T mutation screening.

    PubMed

    Molou, Elina; Schulpis, Kleopatra H; Thodi, Georgia; Georgiou, Vassiliki; Dotsikas, Yannis; Papadopoulos, Konstantinos; Biti, Sofia; Loukas, Yannis L

    2014-04-01

    Glucose-6-Phosphate Dehydrogenase (G6PD) gene is located at the X-chromosome at Xq28 and the disease is recessively inherited predominantly in males. More than 400 variants have been proposed based on clinical and enzymatic studies. The aim of the current study was to identify C563T mutation in G6PD-deficient newborns and to correlate the enzyme residual activity with the presence of the mutation. Some 1189 full-term neonates aged 3-5 days old were tested for G6PD activity in dried blood spots from Guthrie cards using a commercial kit. DNA extraction from Guthrie cards and mutation identification among the deficient samples were performed with current techniques. A total of 92 (7.7%) newborns were G6PD-deficient. In 46 (50%), the mutation C563T was identified. The residual activity in C563T hemizygote males (n = 28) was statistically significantly lower (1.23 ± 0.93 U/g Hb) than that in non-C563T G6PD-deficient males (n = 25) (4.01 ± 1.20 U/g Hb, p < 0.0001) and in controls (13.6 ± 2.9 U/g Hb, p < 0.0001). In C563T heterozygote females, the estimated enzyme activity was lower than that determined in non-C563T females. Male C563T hemizygotes suffer from G6PD deficiency and severe neonatal jaundice. G6PD activity showed statistically significant correlation with total bilirubin blood levels.

  19. First Report of the 23S rRNA Gene A2058G Point Mutation Associated With Macrolide Resistance in Treponema pallidum From Syphilis Patients in Cuba.

    PubMed

    Noda, Angel A; Matos, Nelvis; Blanco, Orestes; Rodríguez, Islay; Stamm, Lola Virginia

    2016-05-01

    This study aimed to assess the presence of macrolide-resistant Treponema pallidum subtypes in Havana, Cuba. Samples from 41 syphilis patients were tested for T. pallidum 23S rRNA gene mutations. Twenty-five patients (61%) harbored T. pallidum with the A2058G mutation, which was present in all 8 subtypes that were identified. The A2059G mutation was not detected.

  20. Juvenile parkinsonism, hypogonadism and Leigh-like MRI changes in a patient with m.4296G>A mutation in mitochondrial DNA.

    PubMed

    Martikainen, Mika H; Kytövuori, Laura; Majamaa, Kari

    2013-03-01

    Leigh syndrome is a mitochondrial disease with considerable clinical and genetic variation. We present a 16-year-old boy with Leigh-like syndrome and broad developmental retardation, parkinsonism and hypogonadism. Sequencing of the entire mitochondrial DNA from blood revealed the m.4296G>A mutation in the MT-TI gene. The mutation was heteroplasmic with a 95% proportion of the mutant genome, while the proportion was 58% in the blood of the patient's clinically healthy mother. Our results suggest that m.4296G>A is pathogenic in humans, and that the phenotype related to this change includes Leigh-like syndrome in adolescence with parkinsonism and hypogonadism, in addition to the previously reported early infantile Leigh syndrome. Copyright © 2013 Elsevier B.V. and Mitochondria Research Society. All rights reserved.

  1. A single-residue mutation, G203E, causes 3-hydroxy-3-methylglutaric aciduria by occluding the substrate channel in the 3D structural model of HMG-CoA lyase.

    PubMed

    Mir, C; Lopez-Viñas, E; Aledo, R; Puisac, B; Rizzo, C; Dionisi-Vici, C; Deodato, F; Pié, J; Gomez-Puertas, P; Hegardt, F G; Casals, N

    2006-02-01

    3-Hydroxy-3-methylglutaric aciduria is a rare autosomal recessive genetic disorder that affects ketogenesis and leucine metabolism. The disease is caused by mutations in the gene coding for 3-hydroxy-3-methylglutaryl-coenzyme A lyase (HL). To date 26 different mutations have been described. A (betaalpha)(8) TIM barrel structure has been proposed for the protein, and almost all missense mutations identified so far localize in the beta sheets that define the inside cavity. We report an Italian patient who bears homozygously a novel HL mutation, c.608G > A (p. G203E) in beta sheet six. A structural model of the mutated protein suggests that glutamic acid 203 impedes catalysis by blocking the entrance to the inner cavity of the enzyme. Loss of functionality has been confirmed in expression studies in E. coli, which demonstrate that the G203E mutation completely abolishes enzyme activity. Beta sheet six and beta sheet two are the two protein regions that accumulate most missense mutations, indicating their importance in enzyme functionality. A model for the mechanism of enzyme function is proposed.

  2. What affects the predictability of evolutionary constraints using a G-matrix? The relative effects of modular pleiotropy and mutational correlation.

    PubMed

    Chebib, Jobran; Guillaume, Frédéric

    2017-10-01

    Phenotypic traits do not always respond to selection independently from each other and often show correlated responses to selection. The structure of a genotype-phenotype map (GP map) determines trait covariation, which involves variation in the degree and strength of the pleiotropic effects of the underlying genes. It is still unclear, and debated, how much of that structure can be deduced from variational properties of quantitative traits that are inferred from their genetic (co) variance matrix (G-matrix). Here we aim to clarify how the extent of pleiotropy and the correlation among the pleiotropic effects of mutations differentially affect the structure of a G-matrix and our ability to detect genetic constraints from its eigen decomposition. We show that the eigenvectors of a G-matrix can be predictive of evolutionary constraints when they map to underlying pleiotropic modules with correlated mutational effects. Without mutational correlation, evolutionary constraints caused by the fitness costs associated with increased pleiotropy are harder to infer from evolutionary metrics based on a G-matrix's geometric properties because uncorrelated pleiotropic effects do not affect traits' genetic correlations. Correlational selection induces much weaker modular partitioning of traits' genetic correlations in absence then in presence of underlying modular pleiotropy. © 2017 The Author(s). Evolution © 2017 The Society for the Study of Evolution.

  3. Identification of a Novel PMS2 Alteration c.505C>G (R169G) In Trans with a PMS2 Pathogenic Mutation in a Patient with Constitutional Mismatch Repair Deficiency

    PubMed Central

    Mork, Maureen E.; Borras, Ester; Taggart, Melissa W.; Cuddy, Amanda; Bannon, Sarah A.; You, Y. Nancy; Lynch, Patrick M.; Ramirez, Pedro T.; Rodriguez-Bigas, Miguel A.; Vilar, Eduardo

    2016-01-01

    Constitutional mismatch repair deficiency syndrome (CMMRD) is a rare autosomal recessive predisposition to colorectal polyposis and other malignancies, often childhood-onset, that is caused by biallelic inheritance of mutations in the same mismatch repair gene. Here, we describe a patient with a clinical diagnosis of CMMRD based on colorectal polyposis and young-onset endometrial cancer who was identified to have two alterations in trans in PMS2: one known pathogenic mutation (c.1831insA; p.Ile611Asnfs*2) and one novel variant of uncertain significance (c.505C>G; p.Arg169Glu), a missense alteration. We describe the clinical and molecular features in the patient harboring this novel alteration c.505C>G, who meets clinical criteria for CMMRD and exhibits molecular evidence supporting a diagnosis of CMMRD. Although experimental validation is needed to confirm its pathogenicity, PMS2 c.505C>G likely has functional consequences that contributes to our patient's phenotype based on the patient's clinical presentation, tumor studies, and bioinformatics analysis. PMID:27017610

  4. Characterization of Ribozymes Targeting a Congenital Night Blindness Mutation in Rhodopsin Mutation.

    PubMed

    Conley, Shannon M; Whalen, Patrick; Lewin, Alfred S; Naash, Muna I

    2016-01-01

    The G90D mutation in the rhodopsin gene leads to autosomal dominant congenital stationary night blindness (CSNB) in patients. This occurs because the G90D mutant protein cannot efficiently bind chromophore and is constitutively active. To combat this mutation, we designed and characterized two different hammerhead ribozymes to cleave G90D transcript. In vitro testing showed that the G90D1 ribozyme efficiently and specifically cleaved the mutant transcript while G90D2 cleaved both WT and mutant transcript. AAV-mediated delivery of G90D1 under the control of the mouse opsin promoter (MOP500) to G90D transgenic eyes showed that the ribozyme partially retarded the functional degeneration (as measured by electroretinography [ERG]) associated with this mutation. These results suggest that with additional optimization, ribozymes may be a useful part of the gene therapy knockdown strategy for dominant retinal disease.

  5. Nav1.7-A1632G Mutation from a Family with Inherited Erythromelalgia: Enhanced Firing of Dorsal Root Ganglia Neurons Evoked by Thermal Stimuli.

    PubMed

    Yang, Yang; Huang, Jianying; Mis, Malgorzata A; Estacion, Mark; Macala, Lawrence; Shah, Palak; Schulman, Betsy R; Horton, Daniel B; Dib-Hajj, Sulayman D; Waxman, Stephen G

    2016-07-13

    Voltage-gated sodium channel Nav1.7 is a central player in human pain. Mutations in Nav1.7 produce several pain syndromes, including inherited erythromelalgia (IEM), a disorder in which gain-of-function mutations render dorsal root ganglia (DRG) neurons hyperexcitable. Although patients with IEM suffer from episodes of intense burning pain triggered by warmth, the effects of increased temperature on DRG neurons expressing mutant Nav1.7 channels have not been well documented. Here, using structural modeling, voltage-clamp, current-clamp, and multielectrode array recordings, we have studied a newly identified Nav1.7 mutation, Ala1632Gly, from a multigeneration family with IEM. Structural modeling suggests that Ala1632 is a molecular hinge and that the Ala1632Gly mutation may affect channel gating. Voltage-clamp recordings revealed that the Nav1.7-A1632G mutation hyperpolarizes activation and depolarizes fast-inactivation, both gain-of-function attributes at the channel level. Whole-cell current-clamp recordings demonstrated increased spontaneous firing, lower current threshold, and enhanced evoked firing in rat DRG neurons expressing Nav1.7-A1632G mutant channels. Multielectrode array recordings further revealed that intact rat DRG neurons expressing Nav1.7-A1632G mutant channels are more active than those expressing Nav1.7 WT channels. We also showed that physiologically relevant thermal stimuli markedly increase the mean firing frequencies and the number of active rat DRG neurons expressing Nav1.7-A1632G mutant channels, whereas the same thermal stimuli only increase these parameters slightly in rat DRG neurons expressing Nav1.7 WT channels. The response of DRG neurons expressing Nav1.7-A1632G mutant channels upon increase in temperature suggests a cellular basis for warmth-triggered pain in IEM. Inherited erythromelalgia (IEM), a severe pain syndrome characterized by episodes of intense burning pain triggered by warmth, is caused by mutations in sodium channel Nav

  6. A CpG island methylator phenotype in acute myeloid leukemia independent of IDH mutations and associated with a favorable outcome

    PubMed Central

    Kelly, Andrew D.; Kroeger, Heike; Yamazaki, Jumpei; Taby, Rodolphe; Neumann, Frank; Yu, Sijia; Lee, Justin T.; Patel, Bela; Li, Yuesheng; He, Rong; Liang, Shoudan; Lu, Yue; Cesaroni, Matteo; Pierce, Sherry A.; Kornblau, Steven M.; Bueso-Ramos, Carlos E.; Ravandi, Farhad; Kantarjian, Hagop M.; Jelinek, Jaroslav; Issa, Jean-Pierre J.

    2016-01-01

    Genetic changes are infrequent in acute myeloid leukemia (AML) compared to other malignancies and often involve epigenetic regulators, suggesting that an altered epigenome may underlie AML biology and outcomes. In 96 AML cases including 65 pilot samples selected for cured/not-cured, we found higher CpG island (CGI) promoter methylation in cured patients. Expanded genome-wide digital restriction enzyme analysis of methylation (DREAM) data revealed a CGI methylator phenotype independent of IDH1/2 mutations we term AML-CIMP (A-CIMP+). A-CIMP was associated with longer overall survival (OS) in this dataset (median OS, years: A-CIMP+ = Not reached, A-CIMP− =1.17; P=0.08). For validation we used 194 samples from The Cancer Genome Atlas interrogated with Illumina 450k methylation arrays where we confirmed longer OS in A-CIMP (median OS, years: A-CIMP+ =2.34, A-CIMP− =1.00; P=0.01). Hypermethylation in A-CIMP favored CGIs (OR: CGI/non-CGI=5.21), and while A-CIMP was enriched in CEBPA (P=0.002) and WT1 mutations (P=0.02), 70% of cases lacked either mutation. Hypermethylated genes in A-CIMP function in pluripotency maintenance, and a gene expression signature of A-CIMP was associated with outcomes in multiple datasets. We conclude that CIMP in AML cannot be explained solely by gene mutations (e.g. IDH1/2, TET2), and that curability in A-CIMP+ AML should be validated prospectively. PMID:28074068

  7. The G209A mutation in the alpha-synuclein gene is not detected in familial cases of Parkinson disease in non-Greek and/or Italian populations.

    PubMed

    Wang, W W; Khajavi, M; Patel, B J; Beach, J; Jankovic, J; Ashizawa, T

    1998-12-01

    To determine whether the G-to-A substitution at nucleotide 209 (G209A) mutation in the alpha-synuclein gene is responsible for familial Parkinson disease (PD) in the US population. Polymerase chain reaction-based DNA analysis of consecutive patients with PD and family history of PD. A university-affiliated movement disorder clinic and a Veterans Affairs clinical research laboratory. Forty-four patients with PD and family history of PD and 29 patients with sporadic PD, all with no known Greek and/or Italian background. None of the DNA samples showed the G209A mutation. The G209A mutation is rare in US patients with familial PD.

  8. Mutational analysis of the transcriptional activator VirG of Agrobacterium tumefaciens.

    PubMed Central

    Scheeren-Groot, E P; Rodenburg, K W; den Dulk-Ras, A; Turk, S C; Hooykaas, P J

    1994-01-01

    To find VirG proteins with altered properties, the virG gene was mutagenized. Random chemical mutagenesis of single-stranded DNA containing the Agrobacterium tumefaciens virG gene led with high frequency to the inactivation of the gene. Sequence analysis showed that 29% of the mutants contained a virG gene with one single-base-pair substitution somewhere in the open reading frame. Thirty-nine different mutations that rendered the VirG protein inactive were mapped. Besides these inactive mutants, two mutants in which the vir genes were active even in the absence of acetosyringone were found on indicator plates. A VirG protein with an N54D substitution turned out to be able to induce a virB-lacZ reporter gene to a high level even in the absence of the inducer acetosyringone. A VirG protein with an I77V substitution exhibited almost no induction in the absence of acetosyringone but showed a maximum induction level already at low concentrations of acetosyringone. Images PMID:7961391

  9. Parkinson Disease Phenotype in Ashkenazi Jews with and without LRRK2 G2019S mutations

    PubMed Central

    Alcalay, Roy N.; Mirelman, Anat; Saunders-Pullman, Rachel; Tang, Ming-X; Santana, Helen Mejia; Raymond, Deborah; Roos, Ernest; Orbe-Reilly, Martha; Gurevich, Tanya; Shira, Anat Bar; Weisz, Mali Gana; Yasinovsky, Kira; Zalis, Maayan; Thaler, Avner; Deik, Andres; Barrett, Matthew James; Cabassa, Jose; Groves, Mark; Hunt, Ann L.; Lubarr, Naomi; Luciano, Marta San; Miravite, Joan; Palmese, Christina; Sachdev, Rivka; Sarva, Harini; Severt, Lawrence; Shanker, Vicki; Swan, Matthew Carrington; Soto-Valencia, Jeannie; Johannes, Brooke; Ortega, Robert; Fahn, Stanley; Cote, Lucien; Waters, Cheryl; Mazzoni, Pietro; Ford, Blair; Louis, Elan; Levy, Oren; Rosado, Llency; Ruiz, Diana; Dorovski, Tsvyatko; Pauciulo, Michael; Nichols, William; Orr-Urtreger, Avi; Ozelius, Laurie; Clark, Lorraine; Giladi, Nir; Bressman, Susan; Marder, Karen S

    2013-01-01

    Background The phenotype of Parkinson disease (PD) patients with and without LRRK2 G2019S mutations is reported to be similar; however large uniformly evaluated series are lacking. Objective To characterize the clinical phenotype of Ashkenazi Jewish (AJ) PD carriers of the LRRK2 G2019S mutation. Methods We studied 553 AJ PD patients, including 65 patients who were previously reported, from three sites (two in New York and one in Tel-Aviv). GBA mutation carriers were excluded. Evaluations included the Montreal Cognitive Assessment (MoCA), the Unified Parkinson's Disease Rating Scale (UPDRS), the geriatric depression scale (GDS) and the non-motor symptoms (NMS) questionnaire. Regression models were constructed to test the association between clinical and demographic features and LRRK2 status (outcome) in 488 newly recruited participants. Results LRRK2 G2019S carriers (n=97) and non-carriers (n=391) were similar in age and age-at-onset of PD. Carriers had longer disease duration (8.6years versus 6.1years, p<0.001), were more likely to be women (51.5% versus 37.9%, p=0.015) and more often reported first symptoms in lower extremities (40.0% versus 19.2%, p<0.001). In logistic models adjusted for age, disease duration, gender, education, and site, carriers were more likely to have lower extremity onset (p<0.001), postural instability gait difficulty (PIGD, p=0.043) and persistent levodopa response for>5 years (p=0.042). Performance on UPDRS, MoCA, GDS and NMS did not differ by mutation status. Conclusion PD in AJ-LRRK2 G2019S mutation carriers is similar to idiopathic PD, but characterized by more frequent lower extremity involvement at onset and PIGD without the associated cognitive impairment. PMID:24243757

  10. [A case of Leigh syndrome associated with respiratory chain complex I deficiency due to mitochondrial gene 13513G>A mutation].

    PubMed

    Wei, Xiao-Qiong; Kong, Qing-Peng; Zhang, Yao; Yang, Yan-Ling; Chang, Xing-Zhi; Qi, Yu; Qi, Zhao-Yue; Xiao, Jiang-Xi; Qin, Jiong; Wu, Xi-Ru

    2009-05-01

    Leigh syndrome is a genetically heterogeneous disease caused by defects in enzymes involved in aerobic energy metabolism and the Krebs', cycle. Mitonchondrial complex I deficiency is a main cause of Leigh syndrome. In this study, a Chinese child with Leigh syndrome caused by 13513G>A mutation was reported. The proband was the first child of his parents. The previously healthy boy presented with generalized epilepsy at 12 years of age. When he visited Peking University First Hospital at 13 years of age, he had subacute loss of vision in two eyes and temporal defect of visual field in the left eye. He walked with a spastic gait. His blood lactate and pyruvate levels were elevated. Muscle biopsy showed mild lipid accumulation in muscle fiber. An electrocardiogram showed incomplete right bundle branch block. Brain magnetic resonance imaging showed bilateral, symmetrical lesions in the basal ganglia, supporting the diagnosis of Leigh syndrome. 13513G>A mutation was identified by gene analysis in the patient, which led to mitochondrial respiratory chain complex I deficiency. Multivitamins and L-carnitine were administered. At present, the patient is 16 years old and has progressive deterioration with significant muscle weakness and body weight loss. He is absent from school. He has no obvious retardation in intelligence. 13513G>A mutation was first identified by gene analysis in Chinese population with Leigh syndrome. This may be helpful in genetic counseling.

  11. Multiple Origins of a Mitochondrial Mutation Conferring Deafness

    PubMed Central

    Hutchin, T. P.; Cortopassi, G. A.

    1997-01-01

    A point mutation (1555G) in the smaller ribosomal subunit of the mitochondrial DNA (mtDNA) has been associated with maternally inherited traits of hypersensitivity to streptomycin and sensorineural deafness in a number of families from China, Japan, Israel, and Africa. To determine whether this distribution was the result of a single or multiple mutational events, we carried out genetic distance analysis and phylogenetic analysis of 10 independent mtDNA D-loop sequences from Africa and Asia. The mtDNA sequence diversity was high (2.21%). Phylogenetic analysis assigned 1555G-bearing haplotypes at very divergent points in the human mtDNA evolutionary tree, and the 1555G mutations occur in many cases on race-specific mtDNA haplotypes, both facts are inconsistent with a recent introgression of the mutation into these races. The simplest interpretation of the available data is that there have been multiple origins of the 1555G mutation. The genetic distance among mtDNAs bearing the pathogenic 1555G mutation is much larger than among mtDNAs bearing either evolutionarily neutral or weakly deleterious nucleotide substitutions (such as the 4336G mutation). These results are consistent with the view that pathogenic mtDNA haplotypes such as 1555G arise on disparate mtDNA lineages which because of negative natural selection leave relatively few related descendants. The co-existence of the same mutation with deafness in individuals with very different nuclear and mitochondrial genetic backgrounds confirms the pathogenicity of the 1555G mutation. PMID:9055086

  12. Mutating the CX3C Motif in the G Protein Should Make a Live Respiratory Syncytial Virus Vaccine Safer and More Effective.

    PubMed

    Boyoglu-Barnum, S; Todd, S O; Meng, J; Barnum, T R; Chirkova, T; Haynes, L M; Jadhao, S J; Tripp, R A; Oomens, A G; Moore, M L; Anderson, L J

    2017-05-15

    Respiratory syncytial virus (RSV) belongs to the family Paramyxoviridae and is the single most important cause of serious lower respiratory tract infections in young children, yet no highly effective treatment or vaccine is available. Through a CX3C chemokine motif ( 182 CWAIC 186 ) in the G protein, RSV binds to the corresponding chemokine receptor, CX3CR1. Since RSV binding to CX3CR1 contributes to disease pathogenesis, we investigated whether a mutation in the CX3C motif by insertion of an alanine, A 186 , within the CX3C motif, mutating it to CX4C ( 182 CWAIAC 187 ), which is known to block binding to CX3CR1, might decrease disease. We studied the effect of the CX4C mutation in two strains of RSV (A2 and r19F) in a mouse challenge model. We included RSV r19F because it induces mucus production and airway resistance, two manifestations of RSV infection in humans, in mice. Compared to wild-type (wt) virus, mice infected with CX4C had a 0.7 to 1.2 log 10 -fold lower virus titer in the lung at 5 days postinfection (p.i.) and had markedly reduced weight loss, pulmonary inflammatory cell infiltration, mucus production, and airway resistance after challenge. This decrease in disease was not dependent on decrease in virus replication but did correspond to a decrease in pulmonary Th2 and inflammatory cytokines. Mice infected with CX4C viruses also had higher antibody titers and a Th1-biased T cell memory response at 75 days p.i. These results suggest that the CX4C mutation in the G protein could improve the safety and efficacy of a live attenuated RSV vaccine. IMPORTANCE RSV binds to the corresponding chemokine receptor, CX3CR1, through a CX3C chemokine motif ( 182 CWAIC 186 ) in the G protein. RSV binding to CX3CR1 contributes to disease pathogenesis; therefore, we investigated whether a mutation in the CX3C motif by insertion of an alanine, A 186 , within the CX3C motif, mutating it to CX4C ( 182 CWAIAC 187 ), known to block binding to CX3CR1, might decrease disease

  13. Mild clinical manifestation and unusual recovery upon coenzyme Q₁₀ treatment in the first Chinese Leigh syndrome pedigree with mutation m.10197 G>A.

    PubMed

    Chen, Zhiting; Zhao, Zhenhua; Ye, Qinyong; Chen, Ying; Pan, Xiaodong; Sun, Bin; Huang, Huapin; Zheng, An

    2015-03-01

    The Leigh syndrome (LS), characterized by psychomotor retardation, seizures, nystagmus, ophthalmoparesis, optic atrophy, ataxia, dystonia, or respiratory failure, is one of the most severe mitochondrial diseases. In the majority of cases, the disease is fatal and patients die before age 5. Mutation m.10197 G>A was found to relate to the severe phenotype of the Leigh syndrome. Here, we describe the first Chinese Leigh syndrome pedigree with this mutation. The proband had the characteristic brain lesions of the Leigh syndrome and presented a decrease in exercise tolerance and mild face paralysis. Sequencing the NADH dehydrogenase, subunit 3 (ND3) gene in the pedigree, revealed that the proband, as well as her unaffected brother, have a high mutant load in the ND3 gene, compared to their mother. Following one‑year treatment with the coenzyme Q10, an obvious improvement in clinical features was observed by magnetic resonance imaging (MRI) in the proband. Our study and previous reports highlight the variability of phenotypic expression of the m.10197 G>A mutation, and suggest that pathogenesis of the syndrome may be affected by a number of factors. This is the first report on successful treatment of an LS patient carrying the mutation m.10197 G>A with the coenzyme Q10, indicating that Q10 may attenuate the mitochondrial dysfunctions caused by the m.10197 G>A mutation.

  14. Skewed segregation of the mtDNA nt 8993 (T-->G) mutation in human oocytes.

    PubMed Central

    Blok, R B; Gook, D A; Thorburn, D R; Dahl, H H

    1997-01-01

    Rapid changes in mtDNA variants between generations have led to the bottleneck theory, which proposes a dramatic reduction in mtDNA numbers during early oogenesis. We studied oocytes from a woman with heteroplasmic expression of the mtDNA nt 8993 (T-->G) mutation. Of seven oocytes analyzed, one showed no evidence of the mutation, and the remaining six had a mutant load > 95%. This skewed expression of the mutation in oocytes is not compatible with the conventional bottleneck theory. A possible explanation is that, during amplification of mtDNA in the developing oocyte, mtDNA from one mitochondrion is preferentially amplified. Thus, subsequent mature oocytes may contain predominantly wild-type or mutant mitochondrial genomes. Images Figure 2 Figure 3 PMID:9199572

  15. A novel autosomal partially dominant mutation designated G476D in the keratin 5 gene causing epidermolysis bullosa simplex Weber-Cockayne type: a family study with a genetic twist.

    PubMed

    Kowalewski, Cezary; Hamada, Takahiro; Wozniak, Katarzyna; Kawano, Yuko; Szczecinska, Weronika; Yasumoto, Shinichiro; Schwartz, Robert A; Hashimoto, Takashi

    2007-07-01

    Epidermolysis bullosa simplex Weber-Cockayne type (EBS-WC) is a genetically inherited skin disease characterized by blistering restricted to the palms and soles. Its inheritance in nearly all kindreds is caused by a dominant-negative mutation in either KRT5 or KRT14, the genes encoding keratin 5 and keratin 14 proteins, respectively. Rarely, recessive mutations have also been found. We described a family with EBS-WC caused by a novel autosomal dominant mutation (G476D) in the keratin 5 gene. One family member was first seen with mucosal erosions and generalized blisters localized on the anogenital area, trunk, face and sites of mechanical trauma. Molecular analysis in this patient showed the presence of an additional mutation, an autosomal recessive (G183E) one, in the same gene. This observation suggests an additional effect of a recessively inherited mutation modulating the phenotypic expression of EBS caused by a partially dominant mutation and is important for accurate genetic counseling.

  16. [Molecular characterization of glucose-6-phosphate dehydrogenase deficiency in the Han and Li nationalities in Hainan, China and identification of a new mutation in human G6PD gene].

    PubMed

    Cai, W; Filosa, S; Martini, G; Zhou, Y; Zhou, D; Cai, L; Kuang, Y

    2001-04-01

    To elucidate the molecular basis of G6PD deficiency in the Han and Li nationalities in Hainan, China. Polymerase chain reaction and restriction enzyme digestion were used to screen the mutations 1388G-->A, 1360C-->T, 1024C-->T, 592C-->T, 517T-->C, 493A-->G, 487G-->A, 392G-->T and 95A-->G. Single strand conformation polymorphism analysis was used to screen the other mutations followed by DNA sequencing to characterize the mutations of the samples with abnormal SSCP bands. Of the fifty-nine Han cases with G6PD deficiency, fourteen with 1388G-->A (23.7%), three with 871G-->A(5.1%), one with 835A-->T(1.7%), one with 517T-->C (1.7%), three with 392G-->T(5.1%), and four with 95A-->G(6.8%) were found. Of the thirty-two Li cases with G6PD deficiency, six with 1388G-->A(18.8%), three with 871G-->A(9.4%), and two with 95A-->G(6.3%) were found. A new mutation 835A-->G which causes the substitution of Ala for Thr at 279 in a Han case was identified and named as G6PD Haikou. The enzyme activity of the variant is about 10% of the normal and lower than the activity of the variant 835A-->T with about 40% of the normal. Analysis of the 3D model of human G6PD has revealed that the hydroxyl group of Thr at 279 is a group in maintaining the interaction of the G6PD subunits. The most common mutations of G6PD deficiency in Han and Li nationalities in Hainan are similar. Compared with the mutation spectrum of G6PD gene in the populations in other regions of China, the results indicate that some G6PD gene mutations are widespread in the populations of different regions in the southern part of China. The hydroxyl group of the Thr at 279 of human G6PD may be a necessary group for maintaining the interaction of the G6PD subunits and the enzyme activity.

  17. Leigh syndrome caused by a novel m.4296G>A mutation in mitochondrial tRNA isoleucine.

    PubMed

    Cox, Rachel; Platt, Julia; Chen, Li Chieh; Tang, Sha; Wong, Lee-Jun; Enns, Gregory M

    2012-03-01

    Leigh syndrome is a severe neurodegenerative disease with heterogeneous genetic etiology. We report a novel m.4296G>A variant in the mitochondrial tRNA isoleucine gene in a child with Leigh syndrome, mitochondrial proliferation, lactic acidosis, and abnormal respiratory chain enzymology. The variant is present at >75% heteroplasmy in blood and cultured fibroblasts from the proband, <5% in asymptomatic maternal relatives, and is absent in 3000 controls. It is located in the highly conserved anticodon region of tRNA(Ile) where three other pathogenic changes have been described. We conclude that there is strong evidence to classify m.4296G>A as a pathogenic mutation causing Leigh syndrome. Copyright © 2011 Elsevier B.V. and Mitochondria Research Society. All rights reserved.

  18. Identification of Novel Compound Mutations in PLA2G6-Associated Neurodegeneration Patient with Characteristic MRI Imaging.

    PubMed

    Guo, Sen; Yang, Liu; Liu, Huijie; Chen, Wei; Li, Jinchen; Yu, Ping; Sun, Zhong Sheng; Chen, Xiang; Du, Jie; Cai, Tao

    2017-08-01

    Neurodegeneration with brain iron accumulation comprises a heterogeneous group of disorders characterized clinically by progressive motor dysfunction. Accurate identification of de novo and rare inherited mutations is important for determining causative genes of undiagnosed neurological diseases. In the present study, we report a unique case with cerebellar ataxia symptoms and social communication difficulties in an intermarriage family. MRI showed a marked cerebellar atrophy and the "eye-of-the-tiger"-like sign in the medial globus pallidus. Potential genetic defects were screened by whole-exome sequencing (WES) for the patient and four additional family members. A previously undescribed de novo missense mutation (c.1634A>G, p.K545R) in the exon 12 of the PLA2G6 gene was identified. A second rare variant c.1077G>A at the end of exon 7 was also identified, which was inherited from the mother, and resulted in a frame-shift mutation (c.1074_1077del.GTCG) due to an alternative splicing. In conclusion, the identification of the "eye-of-the-tiger"-like sign in the globus pallidus of the patient expands the phenotypic spectrum of PLA2G6-associated disorders and reveals its value in differential diagnosis of PLA2G6-associated disorders.

  19. Inactivation of the DNA repair gene O6-methylguanine-DNA methyltransferase by promoter hypermethylation is associated with G to A mutations in K-ras in colorectal tumorigenesis.

    PubMed

    Esteller, M; Toyota, M; Sanchez-Cespedes, M; Capella, G; Peinado, M A; Watkins, D N; Issa, J P; Sidransky, D; Baylin, S B; Herman, J G

    2000-05-01

    O6-methylguanine DNA methyltransferase (MGMT) is a DNA repair protein that removes mutagenic and cytotoxic adducts from the O6 position of guanine. O6-methylguanine mispairs with thymine during replication, and if the adduct is not removed, this results in conversion from a guanine-cytosine pair to an adenine-thymine pair. In vitro assays show that MGMT expression avoids G to A mutations and MGMT transgenic mice are protected against G to A transitions at ras genes. We have recently demonstrated that the MGMT gene is silenced by promoter methylation in many human tumors, including colorectal carcinomas. To study the relevance of defective MGMT function by aberrant methylation in relation to the presence of K-ras mutations, we studied 244 colorectal tumor samples for MGMT promoter hypermethylation and K-ras mutational status. Our results show a clear association between the inactivation of MGMT by promoter hypermethylation and the appearance of G to A mutations at K-ras: 71% (36 of 51) of the tumors displaying this particular type of mutation had abnormal MGMT methylation, whereas only 32% (12 of 37) of those with other K-ras mutations not involving G to A transitions and 35% (55 of 156) of the tumors without K-ras mutations demonstrated MGMT methylation (P = 0.002). In addition, MGMT loss associated with hypermethylation was observed in the small adenomas, including those that do not yet contain K-ras mutations. Hypermethylation of other genes such as p16INK4a and p14ARF was not associated with either MGMT hypermethylation or K-ras mutation. Our data suggest that epigenetic silencing of MGMT by promoter hypermethylation may lead to a particular genetic change in human cancer, specifically G to A transitions in the K-ras oncogene.

  20. A Recurrent Mutation in CACNA1G Alters Cav3.1 T-Type Calcium-Channel Conduction and Causes Autosomal-Dominant Cerebellar Ataxia

    PubMed Central

    Coutelier, Marie; Blesneac, Iulia; Monteil, Arnaud; Monin, Marie-Lorraine; Ando, Kunie; Mundwiller, Emeline; Brusco, Alfredo; Le Ber, Isabelle; Anheim, Mathieu; Castrioto, Anna; Duyckaerts, Charles; Brice, Alexis; Durr, Alexandra; Lory, Philippe; Stevanin, Giovanni

    2015-01-01

    Hereditary cerebellar ataxias (CAs) are neurodegenerative disorders clinically characterized by a cerebellar syndrome, often accompanied by other neurological or non-neurological signs. All transmission modes have been described. In autosomal-dominant CA (ADCA), mutations in more than 30 genes are implicated, but the molecular diagnosis remains unknown in about 40% of cases. Implication of ion channels has long been an ongoing topic in the genetics of CA, and mutations in several channel genes have been recently connected to ADCA. In a large family affected by ADCA and mild pyramidal signs, we searched for the causative variant by combining linkage analysis and whole-exome sequencing. In CACNA1G, we identified a c.5144G>A mutation, causing an arginine-to-histidine (p.Arg1715His) change in the voltage sensor S4 segment of the T-type channel protein Cav3.1. Two out of 479 index subjects screened subsequently harbored the same mutation. We performed electrophysiological experiments in HEK293T cells to compare the properties of the p.Arg1715His and wild-type Cav3.1 channels. The current-voltage and the steady-state activation curves of the p.Arg1715His channel were shifted positively, whereas the inactivation curve had a higher slope factor. Computer modeling in deep cerebellar nuclei (DCN) neurons suggested that the mutation results in decreased neuronal excitability. Taken together, these data establish CACNA1G, which is highly expressed in the cerebellum, as a gene whose mutations can cause ADCA. This is consistent with the neuropathological examination, which showed severe Purkinje cell loss. Our study further extends our knowledge of the link between calcium channelopathies and CAs. PMID:26456284

  1. Rapid detection of common Chinese glucose-6-phosphate dehydrogenase (G6PD) mutations by denaturing gradient gel electrophoresis (DGGE).

    PubMed

    Lam, V M; Huang, W; Lam, S T; Yeung, C Y; Johnson, P H

    1996-03-01

    We describe here the use of denaturing gradient gel electrophoresis (DGGE) to detect the most common Chinese glucose-6-phosphate dehydrogenase (G6PD) variants, which are the single point mutations: G-->T at nt 1376, G-->A at 1388 both in exon 12 and A-->G at nt 95 in exon 02. In each case, the mutant allele resolves well from the normal allele(s). The distinct heteroduplex bands are characteristic of a particular genotype suggesting that this feature is very useful for identifying all heterozygous carriers for this and other X-linked diseases. When the analysis is extended to other exons, DGGE scans the gene and coupled with direct sequencing, it leads to the identification of new G6PD variation(s). With this approach, we identified a mutation in exon 9 which had not been reported in Hong Kong. Since DGGE can rapidly screen many unknown samples in one gel, this approach could be used to diagnose these G6PD mutations and to identify the at-risk for counselling.

  2. Renal dysfunction and barttin expression in Bartter syndrome Type IV associated with a G47R mutation in BSND in a family.

    PubMed

    Park, C W; Lim, J H; Youn, D-Y; Chung, S; Lim, M-H; Kim, Y K; Chang, Y S; Lee, J-H

    2011-02-01

    Bartter syndrome (BS) Type IV, associated with a G47R mutation in the BSND gene, is known to result in a mild renal phenotype. However, we report here on three brothers with varying degrees of renal dysfunction from mild to end-stage renal disease associated with renal barttin and ClC-K expression. The brothers had histories of polyhydramnios, prematurity, polyuria, deafness, and small body size. Laboratory findings showed hypokalemic metabolic alkalosis, normotensive hyperreninemic hyperaldosteronism, and an increased urinary excretion of sodium, potassium and chloride, consistent with BS Type IV. Microscopic examination of renal tissue showed hyperplasia of cells at the juxtaglomerular apparatus with dilated atrophic tubules and tubulointerstitial fibrosis. A weak barttin signal related to CIC-K expression in the cytoplasm of tubule cells, but not the basement membrane, was noted. A sequence analysis of the BSND gene showed that the affected males were homozygous for a missense G47R mutation in exon 1 of BSND. These findings suggest that the G47R mutation results in a dramatic decrease in barttin expression, which appears to be related to the location of CIC-K being changed from the basement membrane to the cytoplasm in the tubule and might have varying effects on renal function associated with factors other than this gene.

  3. CHEK2 1100delC, IVS2+1G>A and I157T mutations are not present in colorectal cancer cases from Turkish population.

    PubMed

    Bayram, Süleyman; Topaktaş, Mehmet; Akkız, Hikmet; Bekar, Aynur; Akgöllü, Ersin

    2012-10-01

    The cell cycle checkpoint kinase 2 (CHEK2) protein participates in the DNA damage response in many cell types. Germline mutations in CHEK2 (1100delC, IVS2+1G>A and I157T) have been impaired serine/threonine kinase activity and associated with a range of cancer types. This hospital-based case-control study aimed to investigate whether CHEK2 1100delC, IVS2+1G>A and I157T mutations play an important role in the development of colorectal cancer (CRC) in Turkish population. A total of 210 CRC cases and 446 cancer-free controls were genotyped for CHEK2 mutations by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and allele specific-polymerase chain reaction (AS-PCR) methods. We did not find the CHEK2 1100delC, IVS2+1G>A and I157T mutations in any of the Turkish subjects. Our result demonstrate for the first time that CHEK2 1100delC, IVS2+1G>A and I157T mutations have not been agenetic susceptibility factor for CRC in the Turkish population. Overall, our data suggest that genotyping of CHEK2 mutations in clinical settings in the Turkish population should not be recommended. However, independent studies are need to validate our findings in a larger series, as well as in patients of different ethnic origins. Copyright © 2012 Elsevier Ltd. All rights reserved.

  4. Mutation of katG in a clinical isolate of Mycobacterium tuberculosis: effects on catalase-peroxidase for isoniazid activation.

    PubMed

    Purkan; Ihsanawati; Natalia, D; Syah, Y M; Retnoningrum, D S; Kusuma, H S

    2016-01-01

    Mutations in katG gene are often associated with isoniazid (INH) resistance in Mycobacterium tuberculosis strain. This research was perfomed to identify the katG mutation in clinical isolate (L8) that is resistant to INH at 1 μg/ml. In addition to characterize the catalase-peroxidase of KatG L8 and perform the ab initio structural study of the protein to get a more complete understanding in drug activation and the resistan­ce mechanism. The katG gene was cloned and expressed in Escherichia coli, then followed by characterization of catalase-peroxidase of KatG. The structure modelling was performed to know a basis of alterations in enzyme activity. A substitution of A713G that correspond to Asn238Ser replacement was found in the L8 katG. The Asn238Ser modification leads to a decline in the activity of catalase-peroxidase and INH oxidation of the L8 KatG protein. The catalytic efficiency (Kcat/KM) of mutant KatGAsn238Ser respectively decreases to 41 and 52% for catalase and peroxidase. The mutant KatGAsn238Ser also shows a decrease of 62% in INH oxidation if compared to a wild type KatG (KatGwt). The mutant Asn238Ser might cause instability in the substrate binding­ site of KatG, because of removal of a salt bridge connecting the amine group of Asn238 to the carbo­xyl group of Glu233, which presents in KatGwt. The lost of the salt bridge in the substrate binding site in mutant KatGAsn238Ser created changes unfavorable for enzyme activities, which in turn emerge as INH resistan­ce in the L8 isolate of M. tuberculosis.

  5. Strong association between a splice mutation (IVS12+5G{r_arrow}A) and haplotype 6 in hereditary tyrosinemia type I

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tanguay, R.M.; St-Louis, M.; Gibson, K.

    1994-09-01

    Hereditary tyrosinemia type I (HT I; McKusick 276700) is a severe inborn error of tyrosine catabolism pathway caused by a deficiency of fumarylacetoacetate hydrolase (FAH). The highest frequency reported is the one in Saguenay-Lac St-Jean (Quebec, Canada) where 1:1,846 births are affected. The FAH gene has been cloned and several mutations have been described. Allele specific oligonucleotide (ASO) hybridization was used to examine the frequency of a splice (IVS12-5G{r_arrow}A) mutation recently reported and RFLP analysis was done to identify haplotypes related to HT I. The splice mutation was found on 45/50 alleles (90%) in patients from SLSJ and 12/66 (18%)more » alleles from patients world-wide. All 25 patients from the SLSJ region were positive with 20 being homozygous, indicating that this mutation is the major cause of HT I in French Canada. Of these 25 patients, 96% were positive for one haplotype called no 6 which is these 25 patients, 96% were positive for one haplotype called no 6 which is identified by TaqI, RsaI, BglII, MspI and KpnI digestions. These data show a really strong association between the mutation (IVS12+5G{r_arrow}A) and haplotype 6. Among our patients from around the world, {approximately}52% were positive for haplotype 6 indicating its strong relation with HT I. These results provide the rationale for DNA-based carrier testing for HT I in the F-C population at risk as well as in HT I patients in general.« less

  6. An Upstream Truncation of the furA-katG Operon Confers High-Level Isoniazid Resistance in a Mycobacterium tuberculosis Clinical Isolate with No Known Resistance-Associated Mutations

    PubMed Central

    Yam, Wing Cheong; Zhang, Ying; Kao, Richard Y. T.

    2014-01-01

    Although the major causes of isoniazid (INH) resistance in Mycobacterium tuberculosis are confined to structural mutations in katG and promoter mutations in the mabA-inhA operon, a significant proportion of INH-resistant strains have unknown resistance mechanisms. Recently, we identified a high-level INH-resistant M. tuberculosis clinical isolate, GB005, with no known resistance-associated mutations. A comprehensive study was performed to investigate the molecular basis of drug resistance in this strain. Although no mutations were found throughout the katG and furA-katG intergenic region, the katG expression and the catalase activity were greatly diminished compared to those in H37Rv (P < 0.01). Northern blotting revealed that the katG transcript from the isolate was smaller than that of H37Rv. Sequencing analysis of furA and upstream genes discovered a 7.2-kb truncation extended from the 96th base preceding the initiation codon of katG. Complementation of the M. tuberculosis Δ(furA-katG) strain with katG and different portions of the truncated region identified a 134-bp upstream fragment of furA that was essential for full catalase activity and INH susceptibility in M. tuberculosis. The promoter activity of this fragment was also shown to be stronger than that of the furA-katG intergenic region (P < 0.01). Collectively, these findings demonstrate that deletion of the 134-bp furA upstream fragment is responsible for the reduction in katG expression, resulting in INH resistance in GB005. To our knowledge, this is the first report showing that deletion of the upstream region preceding the furA-katG operon causes high-level INH resistance in a clinical isolate of M. tuberculosis. PMID:25092698

  7. Clinical and genetic investigation of a Japanese family with cardiac fabry disease. Identification of a novel α-galactosidase A missense mutation (G195V).

    PubMed

    Nakagawa, Naoki; Maruyama, Hiroki; Ishihara, Takayuki; Seino, Utako; Kawabe, Jun-ichi; Takahashi, Fumihiko; Kobayashi, Motoi; Yamauchi, Atsushi; Sasaki, Yukie; Sakamoto, Naka; Ota, Hisanobu; Tanabe, Yasuko; Takeuchi, Toshiharu; Takenaka, Toshihiro; Kikuchi, Kenjiro; Hasebe, Naoyuki

    2011-01-01

    Fabry disease is an X-linked lysosomal storage disorder caused by mutations of the α-galactosidase A gene (GLA), and the disease is a relatively prevalent cause of left ventricular hypertrophy mimicking idiopathic hypertrophic cardiomyopathy. We assessed clinically 5 patients of a three-generation family and also searched for GLA mutations in 10 family members. The proband had left ventricular hypertrophy with localized thinning in the basal posterior wall and late gadolinium enhancement (LGE) in the near-circumferential wall in cardiovascular magnetic resonance images and her sister had vasospastic angina pectoris without organic stenosis of the coronary arteries. LGE notably appeared in parallel with decreased α-galactosidase A activity and increased NT-pro BNP in our patients. We detected a new GLA missense mutation (G195V) in exon 4, resulting in a glycine-to-valine substitution. Of the 10 family members, 5 family members each were positive and negative for this mutation. These new data extend our clinical and molecular knowledge of GLA gene mutations and confirm that a novel missense mutation in the GLA gene is important not only for a precise diagnosis of heterozygous status, but also for confirming relatives who are negative for this mutation.

  8. Mutation in WDR4 impairs tRNA m(7)G46 methylation and causes a distinct form of microcephalic primordial dwarfism.

    PubMed

    Shaheen, Ranad; Abdel-Salam, Ghada M H; Guy, Michael P; Alomar, Rana; Abdel-Hamid, Mohamed S; Afifi, Hanan H; Ismail, Samira I; Emam, Bayoumi A; Phizicky, Eric M; Alkuraya, Fowzan S

    2015-09-28

    Primordial dwarfism is a state of extreme prenatal and postnatal growth deficiency, and is characterized by marked clinical and genetic heterogeneity. Two presumably unrelated consanguineous families presented with an apparently novel form of primordial dwarfism in which severe growth deficiency is accompanied by distinct facial dysmorphism, brain malformation (microcephaly, agenesis of corpus callosum, and simplified gyration), and severe encephalopathy with seizures. Combined autozygome/exome analysis revealed a novel missense mutation in WDR4 as the likely causal variant. WDR4 is the human ortholog of the yeast Trm82, an essential component of the Trm8/Trm82 holoenzyme that effects a highly conserved and specific (m(7)G46) methylation of tRNA. The human mutation and the corresponding yeast mutation result in a significant reduction of m(7)G46 methylation of specific tRNA species, which provides a potential mechanism for primordial dwarfism associated with this lesion, since reduced m(7)G46 modification causes a growth deficiency phenotype in yeast. Our study expands the number of biological pathways underlying primordial dwarfism and adds to a growing list of human diseases linked to abnormal tRNA modification.

  9. A novel homozygous mutation IVS6+5G>T in CYP11B1 gene in a Vietnamese patient with 11β-hydroxylase deficiency.

    PubMed

    Nguyen, Thi Phuong Mai; Nguyen, Thu Hien; Ngo, Diem Ngoc; Vu, Chi Dung; Nguyen, Thi Kim Lien; Nong, Van Hai; Nguyen, Huy Hoang

    2015-07-10

    Congenital adrenal hyperplasia (CAH) is an autosomal recessive disease which is characterized by a deficiency of one of the enzymes involved in the synthesis of cortisol from cholesterol by the adrenal cortex. CAH cases arising from impaired 11β-hydroxylase are the second most common form. Mutations in the CYP11B1 gene are the cause of 11β-hydroxylase deficiency. This study was performed on a patient with congenital adrenal hyperplasia and with premature development such as enlarged penis, muscle development, high blood pressure, and bone age equivalent of 5 years old at 2 years of chronological age. Biochemical tests for steroids confirmed the diagnosis of CAH. We used PCR and sequencing to screen for mutations in CYP11B1 gene. Results showed that the patient has a novel homozygous mutation of guanine (G) to thymine (T) in intron 6 (IVS6+5G>T). The analysis of this mutation by MaxEntScan boundary software indicated that this mutant could affect the gene splicing during transcription. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. Is the c.3G>C mutation in the succinate dehydrogenase subunit D (SDHD) gene due to a founder effect in Chinese head and neck paraganglioma patients?

    PubMed

    Zha, Yang; Chen, Xing-ming; Lam, Ching-wan; Lee, Soo-chin; Tong, Sui-fan; Gao, Zhi-qiang

    2011-08-01

    Three Chinese patients with head and neck paragangliomas have been reported to carry the c.3G>C mutation in the succinate dehydrogenase subunit D (SDHD) gene. In addition, in our hospital, two further patients were identified who have the same mutation. It is unclear whether the c.3G>C mutation in Chinese patients is a recurrent mutation or if it is due to a founder effect. We conducted haplotype analysis on these patients to answer this question. Individual case-control study. Germ-line mutations were confirmed in the patients and their families examined in this study using direct sequencing. We also constructed and analyzed haplotypes in four Chinese families. Genotype frequencies were compared to the control group. Three of four families shared the same haplotype, which rarely occurred in the control group. The last family shared a very short area on the physical map with the other three families. There is a founder effect in Chinese head and neck paraganglioma patients carrying the SDHD c.3G>C mutation. Copyright © 2011 The American Laryngological, Rhinological, and Otological Society, Inc.

  11. Screening for duplications, deletions and a common intronic mutation detects 35% of second mutations in patients with USH2A monoallelic mutations on Sanger sequencing.

    PubMed

    Steele-Stallard, Heather B; Le Quesne Stabej, Polona; Lenassi, Eva; Luxon, Linda M; Claustres, Mireille; Roux, Anne-Francoise; Webster, Andrew R; Bitner-Glindzicz, Maria

    2013-08-08

    Usher Syndrome is the leading cause of inherited deaf-blindness. It is divided into three subtypes, of which the most common is Usher type 2, and the USH2A gene accounts for 75-80% of cases. Despite recent sequencing strategies, in our cohort a significant proportion of individuals with Usher type 2 have just one heterozygous disease-causing mutation in USH2A, or no convincing disease-causing mutations across nine Usher genes. The purpose of this study was to improve the molecular diagnosis in these families by screening USH2A for duplications, heterozygous deletions and a common pathogenic deep intronic variant USH2A: c.7595-2144A>G. Forty-nine Usher type 2 or atypical Usher families who had missing mutations (mono-allelic USH2A or no mutations following Sanger sequencing of nine Usher genes) were screened for duplications/deletions using the USH2A SALSA MLPA reagent kit (MRC-Holland). Identification of USH2A: c.7595-2144A>G was achieved by Sanger sequencing. Mutations were confirmed by a combination of reverse transcription PCR using RNA extracted from nasal epithelial cells or fibroblasts, and by array comparative genomic hybridisation with sequencing across the genomic breakpoints. Eight mutations were identified in 23 Usher type 2 families (35%) with one previously identified heterozygous disease-causing mutation in USH2A. These consisted of five heterozygous deletions, one duplication, and two heterozygous instances of the pathogenic variant USH2A: c.7595-2144A>G. No variants were found in the 15 Usher type 2 families with no previously identified disease-causing mutations. In 11 atypical families, none of whom had any previously identified convincing disease-causing mutations, the mutation USH2A: c.7595-2144A>G was identified in a heterozygous state in one family. All five deletions and the heterozygous duplication we report here are novel. This is the first time that a duplication in USH2A has been reported as a cause of Usher syndrome. We found that 8 of

  12. A novel mutation in the TG gene (G2322S) causing congenital hypothyroidism in a Sudanese family: a case report.

    PubMed

    Watanabe, Y; Sharwood, E; Goodwin, B; Creech, M K; Hassan, H Y; Netea, M G; Jaeger, M; Dumitrescu, A; Refetoff, S; Huynh, T; Weiss, R E

    2018-05-02

    Congenital hypothyroidism (CH) has an incidence of approximately 1:3000, but only 15% have mutations in the thyroid hormone synthesis pathways. Genetic analysis allows for the precise diagnosis. A 3-week old girl presented with a large goiter, serum TSH > 100 mIU/L (reference range: 0.7-5.9 mIU/L); free T 4  < 3.2 pmol/L (reference range: 8.7-16 pmol/L); thyroglobulin (TG) 101 μg/L. Thyroid Tc-99 m scan showed increased radiotracer uptake. One brother had CH and both affected siblings have been clinically and biochemically euthyroid on levothyroxine replacement. Another sibling had normal thyroid function. Both Sudanese parents reported non-consanguinity. Peripheral blood DNA from the proposita was subjected to whole exome sequencing (WES). WES identified a novel homozygous missense mutation of the TG gene: c.7021G > A, p.Gly2322Ser, which was subsequently confirmed by Sanger sequencing and present in one allele of both parents. DNA samples from 354 alleles in four Sudanese ethnic groups (Nilotes, Darfurians, Nuba, and Halfawien) failed to demonstrate the presence of the mutant allele. Haplotyping showed a 1.71 centiMorgans stretch of homozygosity in the TG locus suggesting that this mutation occurred identical by descent and the possibility of common ancestry of the parents. The mutation is located in the cholinesterase-like (ChEL) domain of TG. A novel rare missense mutation in the TG gene was identified. The ChEL domain is critical for protein folding and patients with CH due to misfolded TG may present without low serum TG despite the TG gene mutations.

  13. Novel compound heterozygous Thyroglobulin mutations c.745+1G>A/c.7036+2T>A associated with congenital goiter and hypothyroidism in a Vietnamese family. Identification of a new cryptic 5' splice site in the exon 6.

    PubMed

    Citterio, Cintia E; Morales, Cecilia M; Bouhours-Nouet, Natacha; Machiavelli, Gloria A; Bueno, Elena; Gatelais, Frédérique; Coutant, Regis; González-Sarmiento, Rogelio; Rivolta, Carina M; Targovnik, Héctor M

    2015-03-15

    Several patients were identified with dyshormonogenesis caused by mutations in the thyroglobulin (TG) gene. These defects are inherited in an autosomal recessive manner and affected individuals are either homozygous or compound heterozygous for the mutations. The aim of the present study was to identify new TG mutations in a patient of Vietnamese origin affected by congenital hypothyroidism, goiter and low levels of serum TG. DNA sequencing identified the presence of compound heterozygous mutations in the TG gene: the maternal mutation consists of a novel c.745+1G>A (g.IVS6 + 1G>A), whereas the hypothetical paternal mutation consists of a novel c.7036+2T>A (g.IVS40 + 2T>A). The father was not available for segregation analysis. Ex-vivo splicing assays and subsequent RT-PCR analyses were performed on mRNA isolated from the eukaryotic-cells transfected with normal and mutant expression vectors. Minigene analysis of the c.745+1G>A mutant showed that the exon 6 is skipped during pre-mRNA splicing or partially included by use of a cryptic 5' splice site located to 55 nucleotides upstream of the authentic exon 6/intron 6 junction site. The functional analysis of c.7036+2T>A mutation showed a complete skipping of exon 40. The theoretical consequences of splice site mutations, predicted with the bioinformatics tool NNSplice, Fsplice, SPL, SPLM and MaxEntScan programs were investigated and evaluated in relation with the experimental evidence. These analyses predicted that both mutant alleles would result in the abolition of the authentic splice donor sites. The c.745+1G>A mutation originates two putative truncated proteins of 200 and 1142 amino acids, whereas c.7036+2T>A mutation results in a putative truncated protein of 2277 amino acids. In conclusion, we show that the c.745+1G>A mutation promotes the activation of a new cryptic donor splice site in the exon 6 of the TG gene. The functional consequences of these mutations could be structural changes in the protein

  14. Late onset MELAS with m.3243A > G mutation and its association with aneurysm formation.

    PubMed

    Zhu, Kun; Li, Shuang; Chen, Huan; Wang, Yao; Yu, Miao; Wang, Hongyan; Zhao, Weijie; Cao, Yunpeng

    2017-08-01

    We reported a 53-year-old with late-onset mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes (MELAS) accompanied by aneurysm and large vessel dilations. Most studies have focused on microangiopathy causing stroke-like episodes. We report a case to describe large vessel involvement in clinical considerations, and possible mechanisms of aneurysm formation. We recommended regular angiographic examination for patients with MELAS.

  15. G12V Kras mutations in cervical cancer under virtual microscope of molecular dynamics simulations.

    PubMed

    Chen, X P; Xu, W H; Xu, D F; Fu, S M; Ma, Z C

    2016-01-01

    Kras mutations and cancers are common and their role in the progression of cancer is well known and elucidated. The present work is searching for the most deleterious mutation of the four found at codon 12 and 13 of Kras in cervical cancers using prediction servers; different servers were used to look into different factors that govern the protein function. The in silico results predicted G12V to be the most devastating; this particular mutation was then subjected to molecular dynamics simulation (MDS) for further analysis. The authors' approach of MDSs helped them to place the native and mutant structure under virtual microscope and observe their dynamics over time. The results generated are enlightening the effect of G12V variation on the dynamics of Kras. The structural variation between the native and mutant Kras over 50 nanoseconds (ns) run varied at every parameter checked and the results are in excellent agreement with the available experimental data.

  16. The effect of the common c.2299delG mutation in USH2A on RNA splicing.

    PubMed

    Lenassi, Eva; Saihan, Zubin; Bitner-Glindzicz, Maria; Webster, Andrew R

    2014-05-01

    Recessive variants in the USH2A gene are an important cause of both Usher syndrome and nonsyndromic retinitis pigmentosa. A single base-pair deletion in exon 13 (c.2299delG, p.Glu767Serfs*21) is considered the most frequent mutation of USH2A. It is predicted to generate a premature termination codon and is presumed to lead to nonsense mediated decay. However the effect of this variant on RNA has not been formally investigated. It is not uncommon for exonic sequence alterations to cause aberrant splicing and the aim of the present report is to evaluate the effect of c.2299delG on USH2A transcripts. Nasal cells represent the simplest available tissue to study splicing defects in USH2A. Nasal brushing, RNA extraction from nasal epithelial cells and reverse transcription PCR were performed in five Usher syndrome patients who were homozygous for c.2299delG, two unaffected c.2299delG heterozygotes and seven control individuals. Primers to amplify between exons 12 and 15 and exons 10 and 14 were utilised. Significant variability was observed between different RT-PCR experiments. Importantly, in controls, PCR product of the expected size were amplified on all occasions (13/13 experiments); for patients this was true in only 4/14 experiments (Fisher exact test p = 0.0002). Bioinformatics tools predict the c.2299delG change to disrupt an exonic splicing enhancer and to create an exonic splicing silencer within exon 13. Here, we report an effect of the common c.2299delG mutation on splicing of exons 12 and 13 of USH2A. Future studies are expected to provide important insights into the contribution of this effect on the phenotype. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. A nicotinic acetylcholine receptor transmembrane point mutation (G275E) associated with resistance to spinosad in Frankliniella occidentalis

    PubMed Central

    Puinean, Alin M; Lansdell, Stuart J; Collins, Toby; Bielza, Pablo; Millar, Neil S

    2013-01-01

    High levels of resistance to spinosad, a macrocyclic lactone insecticide, have been reported previously in western flower thrips, Frankliniella occidentalis, an economically important insect pest of vegetables, fruit and ornamental crops. We have cloned the nicotinic acetylcholine receptor (nAChR) α6 subunit from F. occidentalis (Foα6) and compared the nucleotide sequence of Foα6 from susceptible and spinosad-resistant insect populations (MLFOM and R1S respectively). A single nucleotide change has been identified in Foα6, resulting in the replacement of a glycine (G) residue in susceptible insects with a glutamic acid (E) in resistant insects. The resistance-associated mutation (G275E) is predicted to lie at the top of the third α-helical transmembrane domain of Foα6. Although there is no direct evidence identifying the location of the spinosad binding site, the analogous amino acid in the C. elegans glutamate-gated chloride channel lies in close proximity (4.4 Å) to the known binding site of ivermectin, another macrocyclic lactone pesticide. The functional consequences of the resistance-associated mutation have been examined in the human nAChR α7 subunit. Introduction of an analogous (A272E) mutation in α7 abolishes the modulatory effects of spinosad whilst having no significant effect upon activation by acetylcholine, consistent with spinosad having an allosteric mechanism of action. PMID:23016960

  18. A Novel Splice-Site Mutation in Angiotensin I-Converting Enzyme (ACE) Gene, c.3691+1G>A (IVS25+1G>A), Causes a Dramatic Increase in Circulating ACE through Deletion of the Transmembrane Anchor

    PubMed Central

    Persu, Alexandre; Lambert, Michel; Deinum, Jaap; Cossu, Marta; de Visscher, Nathalie; Irenge, Leonid; Ambroise, Jerôme; Minon, Jean-Marc; Nesterovitch, Andrew B.; Churbanov, Alexander; Popova, Isolda A.; Danilov, Sergei M.; Danser, A. H. Jan; Gala, Jean-Luc

    2013-01-01

    Background Angiotensin-converting enzyme (ACE) (EC 4.15.1) metabolizes many biologically active peptides and plays a key role in blood pressure regulation and vascular remodeling. Elevated ACE levels are associated with different cardiovascular and respiratory diseases. Methods and Results Two Belgian families with a 8-16-fold increase in blood ACE level were incidentally identified. A novel heterozygous splice site mutation of intron 25 - IVS25+1G>A (c.3691+1G>A) - cosegregating with elevated plasma ACE was identified in both pedigrees. Messenger RNA analysis revealed that the mutation led to the retention of intron 25 and Premature Termination Codon generation. Subjects harboring the mutation were mostly normotensive, had no left ventricular hypertrophy or cardiovascular disease. The levels of renin-angiotensin-aldosterone system components in the mutated cases and wild-type controls were similar, both at baseline and after 50 mg captopril. Compared with non-affected members, quantification of ACE surface expression and shedding using flow cytometry assay of dendritic cells derived from peripheral blood monocytes of affected members, demonstrated a 50% decrease and 3-fold increase, respectively. Together with a dramatic increase in circulating ACE levels, these findings argue in favor of deletion of transmembrane anchor, leading to direct secretion of ACE out of cells. Conclusions We describe a novel mutation of the ACE gene associated with a major familial elevation of circulating ACE, without evidence of activation of the renin-angiotensin system, target organ damage or cardiovascular complications. These data are consistent with the hypothesis that membrane-bound ACE, rather than circulating ACE, is responsible for Angiotensin II generation and its cardiovascular consequences. PMID:23560051

  19. Promoter hypermethylation of the DNA repair gene O(6)-methylguanine-DNA methyltransferase is associated with the presence of G:C to A:T transition mutations in p53 in human colorectal tumorigenesis.

    PubMed

    Esteller, M; Risques, R A; Toyota, M; Capella, G; Moreno, V; Peinado, M A; Baylin, S B; Herman, J G

    2001-06-15

    Defects in DNA repair may be responsible for the genesis of mutations in key genes in cancer cells. The tumor suppressor gene p53 is commonly mutated in human cancer by missense point mutations, most of them G:C to A:T transitions. A recognized cause for this type of change is spontaneous deamination of the methylcytosine. However, the persistence of a premutagenic O(6)-methylguanine can also be invoked. This last lesion is removed in the normal cell by the DNA repair enzyme O(6)-methylguanine-DNA methyltransferase (MGMT). In many tumor types, epigenetic silencing of MGMT by promoter hypermethylation has been demonstrated and linked to the appearance of G to A mutations in the K-ras oncogene in colorectal tumors. To study the relevance of defective MGMT function by aberrant methylation in relation to the presence of p53 mutations, we studied 314 colorectal tumors for MGMT promoter hypermethylation and p53 mutational spectrum. Inactivation of MGMT by aberrant methylation was associated with the appearance of G:C to A:T transition mutations at p53 (Fischer's exact test, two-tailed; P = 0.01). Overall, MGMT methylated tumors displayed p53 transition mutations in 43 of 126 (34%) cases, whereas MGMT unmethylated tumors only showed G:C to A:T changes in 37 of 188 (19%) tumors. A more striking association was found in G:C to A:T transitions in non-CpG dinucleotides; 71% (12 of 17) of the total non-CpG transition mutations in p53 were observed in MGMT aberrantly methylated tumors (Fischer's exact test, two-tailed; P = 0.008). Our data suggest that epigenetic silencing of MGMT by promoter hypermethylation may lead to G:C to A:T transition mutations in p53.

  20. The Arrhythmogenic Calmodulin Mutation D129G Dysregulates Cell Growth, Calmodulin-dependent Kinase II Activity, and Cardiac Function in Zebrafish*

    PubMed Central

    Zacharias, Triantafyllos; Kulej, Katarzyna; Wang, Kevin; Torggler, Raffaela; la Cour, Jonas M.

    2016-01-01

    Calmodulin (CaM) is a Ca2+ binding protein modulating multiple targets, several of which are associated with cardiac pathophysiology. Recently, CaM mutations were linked to heart arrhythmia. CaM is crucial for cell growth and viability, yet the effect of the arrhythmogenic CaM mutations on cell viability, as well as heart rhythm, remains unknown, and only a few targets with relevance for heart physiology have been analyzed for their response to mutant CaM. We show that the arrhythmia-associated CaM mutants support growth and viability of DT40 cells in the absence of WT CaM except for the long QT syndrome mutant CaM D129G. Of the six CaM mutants tested (N53I, F89L, D95V, N97S, D129G, and F141L), three showed a decreased activation of Ca2+/CaM-dependent kinase II, most prominently the D129G CaM mutation, which was incapable of stimulating Thr286 autophosphorylation. Furthermore, the CaM D129G mutation led to bradycardia in zebrafish and an arrhythmic phenotype in a subset of the analyzed zebrafish. PMID:27815504

  1. Complete mtDNA sequencing reveals mutations m.9185T>C and m.13513G>A in three patients with Leigh syndrome.

    PubMed

    Pelnena, Dita; Burnyte, Birute; Jankevics, Eriks; Lace, Baiba; Dagyte, Evelina; Grigalioniene, Kristina; Utkus, Algirdas; Krumina, Zita; Rozentale, Jolanta; Adomaitiene, Irina; Stavusis, Janis; Pliss, Liana; Inashkina, Inna

    2017-12-12

    The most common mitochondrial disorder in children is Leigh syndrome, which is a progressive and genetically heterogeneous neurodegenerative disorder caused by mutations in nuclear genes or mitochondrial DNA (mtDNA). In the present study, a novel and robust method of complete mtDNA sequencing, which allows amplification of the whole mitochondrial genome, was tested. Complete mtDNA sequencing was performed in a cohort of patients with suspected mitochondrial mutations. Patients from Latvia and Lithuania (n = 92 and n = 57, respectively) referred by clinical geneticists were included. The de novo point mutations m.9185T>C and m.13513G>A, respectively, were detected in two patients with lactic acidosis and neurodegenerative lesions. In one patient with neurodegenerative lesions, the mutation m.9185T>C was identified. These mutations are associated with Leigh syndrome. The present data suggest that full-length mtDNA sequencing is recommended as a supplement to nuclear gene testing and enzymatic assays to enhance mitochondrial disease diagnostics.

  2. [Morphological signs of mitochondrial cytopathy in skeletal muscles and micro-vessel walls in a patient with cerebral artery dissection associated with MELAS syndrome].

    PubMed

    Sakharova, A V; Kalashnikova, L A; Chaĭkovskaia, R P; Mir-Kasimov, M F; Nazarova, M A; Pykhtina, T N; Dobrynina, L A; Patrusheva, N L; Patrushev, L I; Protskiĭ, S V

    2012-01-01

    Skin and muscles biopsy specimens of a patient harboring A3243G mutation in mitochondrial DNA, with dissection of internal carotid and vertebral arteries, associated with MELAS were studied using histochemical and electron-microscopy techniques. Ragged red fibers, regional variability of SDH histochemical reaction, two types of morphologically atypical mitochondria and their aggregation were found in muscle. There was correlation between SDH histochemical staining and number of mitochondria revealed by electron microscopy in muscle tissue. Similar mitochondrial abnormality, their distribution and cell lesions followed by extra-cellular matrix mineralization were found in the blood vessel walls. In line with generalization of cytopathy process caused by gene mutation it can be supposed that changes found in skin and muscle microvessels also exist in large cerebral vessels causing the vessel wall "weakness", predisposing them to dissection.

  3. Insight into resistance mechanism of anaplastic lymphoma kinase to alectinib and JH-VIII-157-02 caused by G1202R solvent front mutation.

    PubMed

    Wang, Han; Wang, Yao; Guo, Wentao; Du, Bin; Huang, Xiaobing; Wu, Riping; Yang, Baoyu; Lin, Xiaoyan; Wu, Yilan

    2018-01-01

    Mutated anaplastic lymphoma kinase (ALK) drives the development of advanced non-small cell lung cancer (NSCLC). Most reported small-molecule inhibitors targeting the ALK domain do not display good inhibition of the G1202R solvent front mutation. The solvent front mutation was assumed to hinder drug binding. However, a different fact could be uncovered by the simulations reported in this study through a structural analog of alectinib (JH-VIII-157-02), which demonstrated potent effects against the G1202R mutation. Molecular docking, conventional molecular dynamics (MD) simulations, free energy calculations, and umbrella sampling (US) simulations were carried out to make clear the principles of the binding preferences of alectinib and JH-VIII-157-02 toward ALK WT and the ALK G1202R (ALK G1202R ) mutation. JH-VIII-157-02 has similar binding affinities to both ALK WT and ALK G1202R whereas it has has a much lower binding affinity for alectinib to ALK G1202R . Analysis of individual energy terms indicate the major variation involves the van der Waals and entropy terms. Structural analysis reveals that the conformational change of the ATP-binding glycine-rich loop was primarily responsible for the alectinib resistance, not JH-VIII-157-02. In addition, US simulations prove JH-VIII-157-02 has similar dissociative processes from both ALK WT and ALK G1202R , while alectinib is more easily dissociated from ALK G1202R than from ALK WT , thus indicating lesser residence time. Both the binding affinity and the drug residence time should be emphasized in rational drug design to overcome the G1202R solvent front mutation in ALK resistance.

  4. Audiological manifestations in mitochondrial encephalomyopathy lactic acidosis and stroke like episodes (MELAS) syndrome.

    PubMed

    Vandana, V P; Bindu, Parayil Sankaran; Sonam, Kothari; Govindaraj, Periyasamy; Taly, Arun B; Gayathri, Narayanappa; Chiplunkar, Shwetha; Govindaraju, Chikkanna; Arvinda, H R; Nagappa, Madhu; Sinha, Sanjib; Thangaraj, Kumarasamy

    2016-09-01

    Reports of audiological manifestations in specific subgroups of mitochondrial disorders are limited. This study aims to describe the audiological findings in patients with MELAS syndrome and m.3243A>G mutation. Audiological evaluation was carried out in eight patients with confirmed MELAS syndrome and m.3243A>G mutation. The evaluation included a complete neurological evaluation, pure tone audiometry (n=8), otoacoustic emissions (n=8) and brainstem evoked response audiometry (n=6), magnetic resonance imaging (n=8) and muscle biospy (n=6). Eight patients (Age range: 5-45 years; M:F-1:3) including six children and two adults underwent formal audiological evaluation. Five patients had hearing loss; of these two had "subclinical hearing loss", one had moderate and two had severe hearing loss. The abnormalities included abnormal audiometry (n=5), otoacoustic emission testing (n=7) and absent brainstem auditory evoked responses (n=1). The findings were suggestive of cochlear involvement in four and retrocochlear in one. This study shows that hearing loss of both cochlear and retrocochlear origin occurs in patients with MELAS and may be subclinical. Early referrals for audiological evaluation is warranted to recognize the subclinical hearing loss in these patients. The therapeutic implications include early interventions in the form of hearing aids, cochlear implants and cautioning the physicians for avoidance of aminoglycosides. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Efficacy Outcome Measures for Clinical Trials of USH2A caused by the Common c.2299delG Mutation.

    PubMed

    Calzetti, Giacomo; Levy, Richard A; Cideciyan, Artur V; Garafalo, Alexandra V; Roman, Alejandro J; Sumaroka, Alexander; Charng, Jason; Heon, Elise; Jacobson, Samuel G

    2018-06-25

    To determine the change in vision and retinal structure in patients with the common c.2299delG mutation in the USH2A gene in anticipation of clinical trials of therapy. Retrospective observational case series. Eighteen patients, homozygotes or compound heterozygotes with the c.2299delG mutation in USH2A, were studied with visual acuity, kinetic perimetry, dark- and light-adapted two-color static perimetry, optical coherence tomography (OCT) and autofluorescence (AF) imaging. Serial data were available for at least half of the patients depending on the parameter analyzed. The kinetics of disease progression in this specific molecular form of USH2A differed between the measured parameters. Visual acuity could remain normal for decades. Kinetic and light-adapted static perimetry across the entire visual field had similar rates of decline that were slower than those of rod-based perimetry. Horizontal OCT scans through the macula showed that IS/OS line width had a similar rate of constriction as co-localized AF imaging and cone-based light-adapted sensitivity extent. The rate of constriction of rod-based sensitivity extent across this same region was twice as rapid as that of cones. In patients with the c.2299delG mutation in USH2A, rod photoreceptors are the cells that express disease early and more aggressively than cones. Rod-based vision measurements in central or extracentral-peripheral retinal regions warrant monitoring in order to complete a clinical trial in a timely manner. Copyright © 2018. Published by Elsevier Inc.

  6. The Prothrombin G20210A Mutation is Associated with Young-Onset Stroke: The Genetics of Early Onset Stroke Study and Meta-Analysis

    PubMed Central

    Jiang, Baijia; Ryan, Kathleen A.; Hamedani, Ali; Cheng, Yuching; Sparks, Mary J.; Koontz, Deborah; Bean, Christopher J.; Gallagher, Margaret; Hooper, W. Craig; McArdle, Patrick F.; O'Connell, Jeffrey R.; Stine, O. Colin; Wozniak, Marcella A.; Stern, Barney J.; Mitchell, Braxton D.; Kittner, Steven J.; Cole, John W.

    2014-01-01

    Background and Purpose Although the prothrombin G20210A mutation has been implicated as a risk factor for venous thrombosis, its role in arterial ischemic stroke is unclear, particularly among young-adults. To address this issue, we examined the association between prothrombin G20210A and ischemic stroke in a Caucasian case-control population and additionally performed a meta-analysis Methods From the population-based Genetics of Early Onset Stroke (GEOS) study we identified 397 individuals of European ancestry aged 15-49 years with first-ever ischemic stroke and 426 matched-controls. Logistic regression was used to calculate odds ratios in the entire population and for subgroups stratified by gender, age, oral contraceptive use, migraine and smoking status. A meta-analysis of 17 case-control studies (n=2305 cases <55 years) was also performed with and without GEOS data. Results Within GEOS, the association of the prothrombin G20210A mutation with ischemic stroke did not achieve statistical significance (OR=2.5,95%CI=0.9-6.5,p=0.07). However, among adults aged 15-42 (younger than median age), cases were significantly more likely than controls to have the mutation (OR=5.9,95%CI=1.2-28.1,p=0.03), whereas adults ages 42-49 were not (OR=1.4,95%CI=0.4-5.1,p=0.94). In our meta-analysis, the mutation was associated with significantly increased stroke risk in adults <=55 years (OR=1.4;95%CI=1.1-1.9;p=0.02) with significance increasing with addition of the GEOS results (OR=1.5;95%CI=1.1-2.0;p=0.005). Conclusions The prothrombin G20210A mutation is associated with ischemic stroke in young-adults and may have an even stronger association among those with earlier onset strokes. Our finding of a stronger association in the younger-young adult population requires replication. PMID:24619398

  7. The somatic FAH C.1061C>A change counteracts the frequent FAH c.1062+5G>A mutation and permits U1snRNA-based splicing correction.

    PubMed

    Scalet, Daniela; Sacchetto, Claudia; Bernardi, Francesco; Pinotti, Mirko; van de Graaf, Stan F J; Balestra, Dario

    2018-05-01

    In tyrosinaemia type 1(HT1), a mosaic pattern of fumarylacetoacetase (FAH) immunopositive or immunonegative nodules in liver tissue has been reported in many patients. This aspect is generally explained by a spontaneous reversion of the mutation into a normal genotype. In one HT1 patient carrying the frequent FAH c.1062+5G>A mutation, a second somatic change (c.1061C>A) has been reported in the same allele, and found in immunopositive nodules. Here, we demonstrated that the c.1062+5G>A prevents usage of the exon 12 5' splice site (ss), even when forced by an engineered U1snRNA specifically designed on the FAH 5'ss to strengthen its recognition. Noticeably the new somatic c.1061C>A change, in linkage with the c.1062+5G>A mutation, partially rescues the defective 5'ss and is associated to trace level (~5%) of correct transcripts. Interestingly, this combined genetic condition strongly favored the rescue by the engineered U1snRNA, with correct transcripts reaching up to 60%. Altogether, these findings elucidate the molecular basis of HT1 caused by the frequent FAH c.1062+5G>A mutation, and demonstrate the compensatory effect of the c.1061C>A change in promoting exon definition, thus unraveling a rare mechanism leading to FAH immune-reactive mosaicism.

  8. Molecular survey of a prevalent mutation, 985A-to-G transition, and identification of five infrequent mutations in the medium-chain Acyl-CoA dehydrogenase (MCAD) gene in 55 patients with MCAD deficiency.

    PubMed Central

    Yokota, I; Coates, P M; Hale, D E; Rinaldo, P; Tanaka, K

    1991-01-01

    Medium-chain acyl-CoA dehydrogenase (MCAD) deficiency is an inborn error of fatty-acid oxidation that is characterized by fasting intolerance and recurrent episodes of hypoglycemic coma which can be fatal. Its incidence is one of the highest among genetic metabolic disorders. Using a modified PCR and NcoI digestion method, we have surveyed 46 additional, unrelated MCAD-deficient patients for a prevalent mutation, an 985A-to-G transition (985A----G), that we previously identified in nine MCAD-deficient patients. Among the total of 55 studied, 44 were homozygous and 10 were heterozygous for the 985G allele, whereas one did not carry this mutant allele, indicating that the prevalence of the 985G allele is 89.1%. Furthermore, we identified five other types of mutation: one each in three of the compound heterozygotes and two in the single non-985G patient. An RFLP study of 12 985G-homozygotes showed that all 24 alleles fell into a single haplotype. A questionnaire regarding the ethnic and national origin of their patients was sent to all referring investigators. All 41 patients for whom this information was provided were Caucasians. Of 29 patients whose country of origin was specified, 19 and five were from the British Isles and Germany, respectively. These data suggest that 985A----G may have occurred in a single person in an ancient Germanic tribe. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 PMID:1684086

  9. DNA hypermethylation and X chromosome inactivation are major determinants of phenotypic variation in women heterozygous for G6PD mutations.

    PubMed

    Wang, Jin; Xiao, Qi-Zhi; Chen, You-Ming; Yi, Sheng; Liu, Dun; Liu, Yan-Hui; Zhang, Cui-Mei; Wei, Xiao-Feng; Zhou, Yu-Qiu; Zhong, Xing-Ming; Zhao, Cun-You; Xiong, Fu; Wei, Xiang-Cai; Xu, Xiang-Min

    2014-12-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is an X-linked incompletely dominant enzyme deficiency that results from G6PD gene mutations. Women heterozygous for G6PD mutations exhibit variation in the loss of enzyme activity but the cause of this phenotypic variation is unclear. We determined DNA methylation and X-inactivation patterns in 71 G6PD-deficient female heterozygotes and 68 G6PD non-deficient controls with the same missense mutations (G6PD Canton c.1376G>T or Kaiping c.1388G>A) to correlate determinants with variable phenotypes. Specific CpG methylations within the G6PD promoter were significantly higher in G6PD-deficient heterozygotes than in controls. Preferential X-inactivation of the G6PD wild-type allele was determined in heterozygotes. The incidence of preferential X-inactivation was 86.2% in the deficient heterozygote group and 31.7% in the non-deficient heterozygote group. A significant negative correlation was observed between X-inactivation ratios of the wild-type allele and G6PD/6-phosphogluconate dehydrogenase (6PGD) ratios in heterozygous G6PD Canton (r=-0.657, p<0.001) or Kaiping (r=-0.668, p<0.001). Multivariate logistic regression indicated that heterozygotes with hypermethylation of specific CpG sites in the G6PD promoter and preferential X-inactivation of the wild-type allele were at risk of enzyme deficiency. Copyright © 2014 Elsevier Inc. All rights reserved.

  10. Nuclear modifier MTO2 modulates the aminoglycoside-sensitivity of mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae.

    PubMed

    He, Xiangyu; Zhu, Xiaoyu; Wang, Xuexiang; Wang, Wei; Dai, Yu; Yan, Qingfeng

    2013-01-01

    The phenotypic manifestations of mitochondrial DNA (mtDNA) mutations are modulated by mitochondrial DNA haplotypes, nuclear modifier genes and environmental factors. The yeast mitochondrial 15S rRNA C1477G (P(R) or P(R) 454) mutation corresponds to the human 12S rRNA C1494T and A1555G mutations, which are well known as primary factors for aminoglycoside-induced nonsyndromic deafness. Here we report that the deletion of the nuclear modifier gene MTO2 suppressed the aminoglycoside-sensitivity of mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae. First, the strain with a single mtDNA C1477G mutation exhibited hypersensitivity to neomycin. Functional assays indicated that the steady-state transcription level of mitochondrial DNA, the mitochondrial respiratory rate, and the membrane potential decreased significantly after neomycin treatment. The impaired mitochondria could not produce sufficient energy to maintain cell viability. Second, when the mto2 null and the mitochondrial C1477G mutations co-existed (mto2(P(R))), the oxygen consumption rate in the double mutant decreased markedly compared to that of the control strains (MTO2(P(S)), mto2(P(S)) and MTO2(P(R))). The expression levels of the key glycolytic genes HXK2, PFK1 and PYK1 in the mto2(P(R)) strain were stimulated by neomycin and up-regulated by 89%, 112% and 55%, respectively. The enhanced glycolysis compensated for the respiratory energy deficits, and could be inhibited by the glycolytic enzyme inhibitor. Our findings in yeast will provide a new insight into the pathogenesis of human deafness.

  11. A nicotinic acetylcholine receptor transmembrane point mutation (G275E) associated with resistance to spinosad in Frankliniella occidentalis.

    PubMed

    Puinean, Alin M; Lansdell, Stuart J; Collins, Toby; Bielza, Pablo; Millar, Neil S

    2013-03-01

    High levels of resistance to spinosad, a macrocyclic lactone insecticide, have been reported previously in western flower thrips, Frankliniella occidentalis, an economically important insect pest of vegetables, fruit and ornamental crops. We have cloned the nicotinic acetylcholine receptor (nAChR) α6 subunit from F. occidentalis (Foα6) and compared the nucleotide sequence of Foα6 from susceptible and spinosad-resistant insect populations (MLFOM and R1S respectively). A single nucleotide change has been identified in Foα6, resulting in the replacement of a glycine (G) residue in susceptible insects with a glutamic acid (E) in resistant insects. The resistance-associated mutation (G275E) is predicted to lie at the top of the third α-helical transmembrane domain of Foα6. Although there is no direct evidence identifying the location of the spinosad binding site, the analogous amino acid in the C. elegans glutamate-gated chloride channel lies in close proximity (4.4 Å) to the known binding site of ivermectin, another macrocyclic lactone pesticide. The functional consequences of the resistance-associated mutation have been examined in the human nAChR α7 subunit. Introduction of an analogous (A272E) mutation in α7 abolishes the modulatory effects of spinosad whilst having no significant effect upon activation by acetylcholine, consistent with spinosad having an allosteric mechanism of action. © 2012 International Society for Neurochemistry.

  12. Structural signature of the G719S-T790M double mutation in the EGFR kinase domain and its response to inhibitors

    PubMed Central

    C., George Priya Doss; B., Rajith; Chakraborty, Chiranjib; N., NagaSundaram; Ali, Shabana Kouser; Zhu, Hailong

    2014-01-01

    Some individuals with non-small-cell lung cancer (NSCLC) benefit from therapies targeting epidermal growth factor receptor (EGFR), and the characterization of a new mechanism of resistance to the EGFR-specific antibody gefitinib will provide valuable insight into how therapeutic strategies might be designed to overcome this particular resistance mechanism. The G719S and T790M mutations and their combination were involved in causing different conformational redistribution of EGFR. In the present computational study, we analyzed the impact and structural influence of G719S/T790M double mutation (DM) in EGFR with ligand (gefitinib) through molecular dynamic simulation (50 ns) and docking analysis. We observed the escalation in distance between the functional loop and activation loop with respect to T790M mutation compared to the G719S mutation. Furthermore, we confirmed that the G719S mutation causes the ligand to move closer to the hinge region, whereas T790M makes the ligand escape from the binding pocket. Obtained results provide with an explanation for the resistance induced by T790M and a vital clue for the design of drugs to combat gefitinib resistance. PMID:25091415

  13. Discovery of 2,4-diarylaminopyrimidines bearing a resorcinol motif as novel ALK inhibitors to overcome the G1202R resistant mutation.

    PubMed

    Geng, Kaijun; Xia, Zongjun; Ji, Yinchun; Zhang, Ruisi Ruthy; Sun, Deqiao; Ai, Jing; Song, Zilan; Geng, Meiyu; Zhang, Ao

    2018-01-20

    To address drug resistance caused by ALK kinase mutations, especially the most refractory and predominant mutation G1202R for the second-generation ALK inhibitor, a series of new diarylaminopyrimidine analogues were designed by incorporating a resorcinol moiety (A-ring) to interact the ALK kinase domain where the G1202R is located. Compound 12d turns out as the most potent with IC 50 values of 1.7, 3.5, and 1.8 nM against ALK wild type, gatekeeper mutant L1196M, and the G1202R mutant, respectively. More importantly, compound 12d has excellent inhibitory effects against the proliferation of BaF3 cells specifically expressing ALK wild type, gatekeeper L1196M, and the most challenging mutant G1202R, with IC 50 values all less than 1.5 nM. Collectively, compound 12d is worthy of further investigation as a new more potent third-generation ALK inhibitor to circumvent drug resistance of both the first-generation and the second-generation inhibitors. Copyright © 2017. Published by Elsevier Masson SAS.

  14. A new mutation in MT-ND1 m.3928G>C p.V208L causes Leigh disease with infantile spasms.

    PubMed

    Wray, Carter D; Friederich, Marisa W; du Sart, Desiree; Pantaleo, Sarah; Smet, Joél; Kucera, Cathlin; Fenton, Laura; Scharer, Gunter; Van Coster, Rudy; Van Hove, Johan L K

    2013-11-01

    New mutations in mitochondrial DNA encoded genes of complex I are rarely reported. An infant developed Leigh disease with infantile spasms. Complex I enzyme activity was deficient and response to increasing coenzyme Q concentrations was reduced. Complex I assembly was intact. A new mutation in MT-ND1 m.3928G>C p.V208L, affecting a conserved amino acid in a critical domain, part of the coenzyme Q binding pocket, was present at high heteroplasmy. The unaffected mother did not carry measurable mutant mitochondrial DNA, but concern remained for gonadal mosaicism. Prenatal testing was possible for a subsequent sibling. The ND1 p.V208L mutation causes Leigh disease. © 2013.

  15. The Presence of Multiple Cellular Defects Associated with a Novel G50E Iron-Sulfur Cluster Scaffold Protein (ISCU) Mutation Leads to Development of Mitochondrial Myopathy*

    PubMed Central

    Saha, Prasenjit Prasad; Kumar, S. K. Praveen; Srivastava, Shubhi; Sinha, Devanjan; Pareek, Gautam; D'Silva, Patrick

    2014-01-01

    Iron-sulfur (Fe-S) clusters are versatile cofactors involved in regulating multiple physiological activities, including energy generation through cellular respiration. Initially, the Fe-S clusters are assembled on a conserved scaffold protein, iron-sulfur cluster scaffold protein (ISCU), in coordination with iron and sulfur donor proteins in human mitochondria. Loss of ISCU function leads to myopathy, characterized by muscle wasting and cardiac hypertrophy. In addition to the homozygous ISCU mutation (g.7044G→C), compound heterozygous patients with severe myopathy have been identified to carry the c.149G→A missense mutation converting the glycine 50 residue to glutamate. However, the physiological defects and molecular mechanism associated with G50E mutation have not been elucidated. In this report, we uncover mechanistic insights concerning how the G50E ISCU mutation in humans leads to the development of severe ISCU myopathy, using a human cell line and yeast as the model systems. The biochemical results highlight that the G50E mutation results in compromised interaction with the sulfur donor NFS1 and the J-protein HSCB, thus impairing the rate of Fe-S cluster synthesis. As a result, electron transport chain complexes show significant reduction in their redox properties, leading to loss of cellular respiration. Furthermore, the G50E mutant mitochondria display enhancement in iron level and reactive oxygen species, thereby causing oxidative stress leading to impairment in the mitochondrial functions. Thus, our findings provide compelling evidence that the respiration defect due to impaired biogenesis of Fe-S clusters in myopathy patients leads to manifestation of complex clinical symptoms. PMID:24573684

  16. Electrically evoked reticular lamina and basilar membrane vibrations in mice with alpha tectorin C1509G mutation

    NASA Astrophysics Data System (ADS)

    Ren, Tianying; He, Wenxuan

    2015-12-01

    Mechanical coupling between the tectorial membrane and the hair bundles of outer hair cells is crucial for stimulating mechanoelectrical transduction channels, which convert sound-induced vibrations into electrical signal, and for transmitting outer hair cell-generated force back to the basilar membrane to boost hearing sensitivity. It has been demonstrated that the detached tectorial membrane in mice with C1509G alpha tectorin mutation caused hearing loss, but enhanced electrically evoked otoacoustic emissions. To understand how the mutated cochlea emits sounds, the reticular lamina and basilar membrane vibrations were measured in the electrically stimulated cochlea in this study. The results showed that the electrically evoked basilar membrane vibration decreased dramatically while the reticular lamina vibration and otoacoustic emissions exhibited no significant change in C1509G mutation mice. This result indicates that a functional cochlear amplifier and a normal basilar membrane vibration are not required for the outer hair cell-generated sound to exit the cochlea.

  17. The insulin-like growth factor 2 (IGF2) gene intron3-g.3072G>A polymorphism is not the only Sus scrofa chromosome 2p mutation affecting meat production and carcass traits in pigs: evidence from the effects of a cathepsin D (CTSD) gene polymorphism.

    PubMed

    Fontanesi, L; Speroni, C; Buttazzoni, L; Scotti, E; Dall'Olio, S; Nanni Costa, L; Davoli, R; Russo, V

    2010-07-01

    The objective of this study was to evaluate the effects of mutations in 2 genes [IGF2 and cathepsin D (CTSD)] that map on the telomeric end of the p arm of SSC2. In this region, an imprinted QTL affecting muscle mass and fat deposition was reported, and the IGF2 intron3-g.3072G>A substitution was identified as the causative mutation. In the same chromosome region, we assigned, by linkage mapping, the CTSD gene, a lysosomal proteinase, for which we previously identified an SNP in the 3'-untranslated region (AM933484, g.70G>A). We have already shown strong effects of this CTSD mutation on several production traits in Italian Large White pigs, suggesting a possible independent role of this marker in fatness and meat deposition in pigs. To evaluate this hypothesis, after having refined the map position of the CTSD gene by radiation hybrid mapping, we analyzed the IGF2 and the CTSD polymorphisms in 270 Italian Large White and 311 Italian Duroc pigs, for which EBV and random residuals from fixed models were calculated for several traits. Different association analyses were carried out to distinguish the effects of the 2 close markers. In the Italian Large White pigs, the results for IGF2 were highly significant for all traits when using either EBV or random residuals (e.g., using EBV: lean cuts, P = 2.2 x 10(-18); ADG, P = 2.6 x 10(-16); backfat thickness, P = 2.2 x 10(-9); feed:gain ratio, P = 2.3 x 10(-9); ham weight, P = 1.5 x 10(-6)). No effect was observed for meat quality traits. The IGF2 intron3-g.3072G>A mutation did not show any association in the Italian Duroc pigs, probably because of the small variability at this polymorphic site for this breed. However, a significant association was evident for the CTSD marker (P < 0.001) with EBV of all carcass and production traits in Italian Duroc pigs (lean content, ADG, backfat thickness, feed:gain ratio) after excluding possible confounding effects of the IGF2 mutation. The effects of the CTSD g.70G>A mutation were

  18. A novel homozygous mutation in G6PC3 presenting as cyclic neutropenia and severe congenital neutropenia in the same family.

    PubMed

    Alangari, Abdullah A; Alsultan, Abdulrahman; Osman, Mohamed Elfaki; Anazi, Shamsa; Alkuraya, Fowzan S

    2013-11-01

    Patients with autosomal recessive cyclic neutropenia have no known causative genetic defect yet. Autozygosity mapping on two branches of an extended multiplex consanguineous family presenting with cyclic neutropenia or severe congenital neutropenia to look for candidate gene, followed by candidate gene selection and sequencing. A single autozygous interval on Chr17:33,901,938-45,675,414 that is exclusively shared by the affected members was identified. This interval spans 11.8 Mb and contains 30 genes. Review of these genes highlighted G6PC3 as the most likely candidate given its known role in neutrophil biology. Direct sequencing revealed a novel homozygous mutation (NM_138387.3, c.974T > G, p.Leu325Arg). Two of our patients had associated congenital defects that are known to occur in patients with G6PC3 mutations, including congenital heart disease and intermittent thrombocytopenia. Biallelic G6PC3 defects should be considered in patients with autosomal recessive cyclic neutropenia, especially those with typical associated congenital defects.

  19. A novel germline mutation (c.A527G) in STK11 gene causes Peutz–Jeghers syndrome in a Chinese girl

    PubMed Central

    Zhao, Zi-Ye; Jiang, Yu-Liang; Li, Bai-Rong; Yang, Fu; Li, Jing; Jin, Xiao-Wei; Sun, Shu-Han; Ning, Shou-Bin

    2017-01-01

    Abstract Rationale: Peutz–Jeghers syndrome (PJS) is a Mendelian autosomal dominant disease caused by mutations in the tumor suppressor gene, serine/threonine kinase 11 (STK11). The features of this syndrome include gastrointestinal (GI) hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing cancer. Early onset of disease is often characterized by mucocutaneous pigmentation and intussusception due to GI polyps in childhood. Patient concerns: A girl with a positive family history grew oral pigmentation at 1 and got intussusception by small bowel hamartomas at 5. Diagnoses: She was diagnosed with PJS based on oral pigmentation and a positive family history of PJS. Interventions: Enteroscopy was employed to treat the GI polyps. Sanger sequencing was used to investigate STK11 mutation in this family. Outcomes: A large jejunal polyp together with other smaller ones was resected, and the girl recovered uneventfully. We discovered a heterozygous substitution in STK11, c.A527G in exon 4, in the girl and her father who was also a PJS patient, and the amine acid change was an aspartic acid-glycine substitution in codon 176. This mutation was not found in other healthy family members and 50 unrelated non-PJS controls, and it is not recorded in databases, which prove it a novel mutation. Evolutionary conservation analysis of amino acid residues showed this aspartic acid is a conserved one between species, and protein structure prediction by SWISS-MODEL indicated an obvious change in local structure. In addition, PolyPhen-2 score for this mutation is 1, which indicates it probably damaging. Lessons: PJS can cause severe complication like intussusception in young children, and early screening for small bowel may be beneficial for these patients. The mutation of STK11 found in this girl is a novel one, which enlarges the spectrum of STK11. Our analysis supported it a causative one in PJS. PMID:29245219

  20. CHCHD10 mutations p.R15L and p.G66V cause motoneuron disease by haploinsufficiency.

    PubMed

    Brockmann, Sarah J; Freischmidt, Axel; Oeckl, Patrick; Müller, Kathrin; Ponna, Srinivas K; Helferich, Anika M; Paone, Christoph; Reinders, Jörg; Kojer, Kerstin; Orth, Michael; Jokela, Manu; Auranen, Mari; Udd, Bjarne; Hermann, Andreas; Danzer, Karin M; Lichtner, Peter; Walther, Paul; Ludolph, Albert C; Andersen, Peter M; Otto, Markus; Kursula, Petri; Just, Steffen; Weishaupt, Jochen H

    2018-02-15

    Mutations in the mitochondrially located protein CHCHD10 cause motoneuron disease by an unknown mechanism. In this study, we investigate the mutations p.R15L and p.G66V in comparison to wild-type CHCHD10 and the non-pathogenic variant p.P34S in vitro, in patient cells as well as in the vertebrate in vivo model zebrafish. We demonstrate a reduction of CHCHD10 protein levels in p.R15L and p.G66V mutant patient cells to approximately 50%. Quantitative real-time PCR revealed that expression of CHCHD10 p.R15L, but not of CHCHD10 p.G66V, is already abrogated at the mRNA level. Altered secondary structure and rapid protein degradation are observed with regard to the CHCHD10 p.G66V mutant. In contrast, no significant differences in expression, degradation rate or secondary structure of non-pathogenic CHCHD10 p.P34S are detected when compared with wild-type protein. Knockdown of CHCHD10 expression in zebrafish to about 50% causes motoneuron pathology, abnormal myofibrillar structure and motility deficits in vivo. Thus, our data show that the CHCHD10 mutations p.R15L and p.G66V cause motoneuron disease primarily based on haploinsufficiency of CHCHD10. © The Author(s) 2018. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  1. Rapid screening of rpoB and katG mutations in Mycobacterium tuberculosis isolates by high-resolution melting curve analysis.

    PubMed

    Haeili, M; Fooladi, A I; Bostanabad, S Z; Sarokhalil, D D; Siavoshi, F; Feizabadi, M M

    2014-01-01

    Early detection of multidrug-resistant tuberculosis (MDR-TB) is essential to prevent its transmission in the community and initiate effective anti-TB treatment regimen. High-resolution melting curve (HRM) analysis was evaluated for rapid detection of resistance conferring mutations in rpoB and katG genes. We screened 95 Mycobacterium tuberculosis clinical isolates including 20 rifampin resistant (RIF-R), 21 isoniazid resistant (INH-R) and 54 fully susceptible (S) isolates determined by proportion method of drug susceptibility testing. Nineteen M. tuberculosis isolates with known drug susceptibility genotypes were used as references for the assay validation. The nucleotide sequences of the target regions rpoB and katG genes were determined to investigate the frequency and type of mutations and to confirm HRM results. HRM analysis of a 129-bp fragment of rpoB allowed correct identification of 19 of the 20 phenotypically RIF-R and all RIF-S isolates. All INH-S isolates generated wild-type HRM curves and 18 out of 21 INH-R isolates harboured any mutation in 109-bp fragment of katG exhibited mutant type HRM curves. However, 1 RIF-R and 3 INH-R isolates were falsely identified as susceptible which were confirmed for having no mutation in their target regions by sequencing. The main mutations involved in RIF and INH resistance were found at codons rpoB531 (60% of RIF-R isolates) and katG315 (85.7% of INH-R isolates), respectively. HRM was found to be a reliable, rapid and low cost method to characterise drug susceptibility of clinical TB isolates in resource-limited settings.

  2. Acquired resistance to an epidermal growth factor receptor-tyrosine kinase inhibitor (EGFR-TKI) in an uncommon G719S EGFR mutation.

    PubMed

    Osoegawa, Atsushi; Hashimoto, Takafumi; Takumi, Yohei; Abe, Miyuki; Yamada, Tomonori; Kobayashi, Ryoji; Miyawaki, Michiyo; Takeuchi, Hideya; Okamoto, Tatsuro; Sugio, Kenji

    2018-03-28

    Background Acquired resistance (AR) to an epidermal growth factor receptor-tyrosine kinase inhibitor (EGFR-TKI) is a common event, and several underlying mechanisms, including T790 M, MET amplification and PTEN downregulation, have been reported for the common EGFR mutations. EGFR G719X is an uncommon mutation that has been reported to show sensitivity to EGFR-TKIs. However, no established cell lines harboring the EGFR G719X have been reported in the literature. Materials and Methods G719S-GR cells were established from malignant pleural effusion of a patient whose tumor developed AR from gefitinib treatment. G719S-GR cells were then genotyped and tested for drug sensitivities. Multiplex ligation-dependent probe amplification (MLPA) was used to compare the clinical tumor samples with G719S-GR. Results G719S-GR cells were resistant to EGFR-TKIs with an LC50 of around 10 μM. A genomic analysis showed that G719S-GR cells harbor the EGFR G719S mutation as well as the amplification of EGFR locus. The homozygous deletion of CDKN2A and the loss of PTEN and TSC1 were also detected. On comparing the copy number of tumor suppressor genes using MLPA, G719S-GR cells were found to lack one copy of PTEN, which was not observed in a tumor obtained before gefitinib treatment. Loss of PTEN may result in AKT activation. The mTORC1/2 inhibitor Torin-1 was able to inhibit the downstream signaling when combined with osimertinib. Discussion The newly established G719S-GR cell line may be useful for investigating the mechanism underlying the development of AR in the G719X mutation; the loss of PTEN may be one such mechanism.

  3. The accumulation of assembly intermediates of the mitochondrial complex I matrix arm is reduced by limiting glucose uptake in a neuronal-like model of MELAS syndrome.

    PubMed

    Geffroy, Guillaume; Benyahia, Rayane; Frey, Samuel; Desquiret-Dumas, Valerie; Gueguen, Naig; Bris, Celine; Belal, Sophie; Inisan, Aurore; Renaud, Aurelie; Chevrollier, Arnaud; Henrion, Daniel; Bonneau, Dominique; Letournel, Franck; Lenaers, Guy; Reynier, Pascal; Procaccio, Vincent

    2018-05-01

    Ketogenic diet (KD) which combined carbohydrate restriction and the addition of ketone bodies has emerged as an alternative metabolic intervention used as an anticonvulsant therapy or to treat different types of neurological or mitochondrial disorders including MELAS syndrome. MELAS syndrome is a severe mitochondrial disease mainly due to the m.3243A > G mitochondrial DNA mutation. The broad success of KD is due to multiple beneficial mechanisms with distinct effects of very low carbohydrates and ketones. To evaluate the metabolic part of carbohydrate restriction, transmitochondrial neuronal-like cybrid cells carrying the m.3243A > G mutation, shown to be associated with a severe complex I deficiency was exposed during 3 weeks to glucose restriction. Mitochondrial enzyme defects were combined with an accumulation of complex I (CI) matrix intermediates in the untreated mutant cells, leading to a drastic reduction in CI driven respiration. The severe reduction of CI was also paralleled in post-mortem brain tissue of a MELAS patient carrying high mutant load. Importantly, lowering significantly glucose concentration in cell culture improved CI assembly with a significant reduction of matrix assembly intermediates and respiration capacities were restored in a sequential manner. In addition, OXPHOS protein expression and mitochondrial DNA copy number were significantly increased in mutant cells exposed to glucose restriction. The accumulation of CI matrix intermediates appeared as a hallmark of MELAS pathophysiology highlighting a critical pathophysiological mechanism involving CI disassembly, which can be alleviated by lowering glucose fuelling and the induction of mitochondrial biogenesis, emphasizing the usefulness of metabolic interventions in MELAS syndrome. Copyright © 2018 Elsevier B.V. All rights reserved.

  4. Heterozygous SSBP1 start loss mutation co-segregates with hearing loss and the m.1555A>G mtDNA variant in a large multigenerational family.

    PubMed

    Kullar, Peter J; Gomez-Duran, Aurora; Gammage, Payam A; Garone, Caterina; Minczuk, Michal; Golder, Zoe; Wilson, Janet; Montoya, Julio; Häkli, Sanna; Kärppä, Mikko; Horvath, Rita; Majamaa, Kari; Chinnery, Patrick F

    2018-01-01

    The m.1555A>G mtDNA variant causes maternally inherited deafness, but the reasons for the highly variable clinical penetrance are not known. Exome sequencing identified a heterozygous start loss mutation in SSBP1, encoding the single stranded binding protein 1 (SSBP1), segregating with hearing loss in a multi-generational family transmitting m.1555A>G, associated with mtDNA depletion and multiple deletions in skeletal muscle. The SSBP1 mutation reduced steady state SSBP1 levels leading to a perturbation of mtDNA metabolism, likely compounding the intra-mitochondrial translation defect due to m.1555A>G in a tissue-specific manner. This family demonstrates the importance of rare trans-acting genetic nuclear modifiers in the clinical expression of mtDNA disease. © The Author (2017). Published by Oxford University Press on behalf of the Guarantors of Brain.

  5. PREVALENCE OF MUTATIONS IN ELANE, GFI1, HAX1, SBDS, WAS, AND G6PC3 IN PATIENTS WITH SEVERE CONGENITAL NEUTROPENIA

    PubMed Central

    Xia, Jun; Bolyard, Audrey Anna; Rodger, Elin; Stein, Steve; Aprikyan, Andrew A.; Dale, David C.; Link, Daniel C.

    2009-01-01

    SUMMARY Severe congenital neutropenia (SCN) is a genetically heterogeneous syndrome associated with mutations of ELANE (ELA2), HAX1, GFI1, WAS, CSF3R or G6PC3. We investigated the prevalence of mutations of ELANE in a cohort of 162 SCN patients for whom blood or bone marrow samples were submitted to the North American Severe Chronic Neutropenia Tissue Repository. Mutations of ELANE were found in 90 of 162 patients (55.6%). Subsequently, we conducted an analysis of a subset of 73 of these cases utilizing a high throughput sequencing approach to determine the prevalence of other mutations associated with SCN. Among the 73 patients, mutations of ELANE were detected in 28. In the remaining 45 patients with wild type ELANE alleles, 5 patients had mutations: GFI1 (1), SBDS (1), WAS (1) and G6PC3 (2); no mutations of HAX1 were detected. In approximately 40% of our cases, the genetic basis of SCN remains unknown. These data suggest that for genetic diagnosis of SCN, ELANE genotyping should first be performed. In patients without ELANE mutations, other known SCN-associated gene mutations will be found rarely and genotyping can be guided by the clinical features of each patient. PMID:19775295

  6. Cerebral Venous Thrombosis and Pulmonary Embolism with Prothrombin G20210A Gene Mutation.

    PubMed

    Dagli, Canan Eren; Koksal, Nurhan; Guler, Selma; Gelen, Mehmet Emin; Atilla, Nurhan; Tuncel, Deniz

    2010-04-01

    A 25-year-old man presented with symptoms of syncope, cough, headache and hemoptysis. Cranial MR and venography showed thrombus formation in the right transverse sinus and superior sagittal sinus. Computed tomographic pulmonary angiography (CTPA) showed an embolic thrombus in the right pulmonary truncus and lung abscess. The patient was young, and there were no signs of lower extremity deep venous thrombosis or other major risk factors for pulmonary embolism (PE) including cardiac anomaly. The only risk factor we were able to identify was the presence of the prothrombin G20210A gene mutation. Anticoagulant treatment with oral warfarin (10 mg daily) and imipenem (4X500 mg) was started. The patient was hospitalized for antibiotic and anticoagulation therapies for three weeks and was discharged on lifelong treatment with warfarin (5 mg daily).

  7. A novel mutation m.8561C>G in MT-ATP6/8 causing a mitochondrial syndrome with ataxia, peripheral neuropathy, diabetes mellitus, and hypergonadotropic hypogonadism.

    PubMed

    Kytövuori, Laura; Lipponen, Joonas; Rusanen, Harri; Komulainen, Tuomas; Martikainen, Mika H; Majamaa, Kari

    2016-11-01

    Defects in the respiratory chain or mitochondrial ATP synthase (complex V) result in mitochondrial dysfunction that is an important cause of inherited neurological disease. Two of the subunits of complex V are encoded by MT-ATP6 and MT-ATP8 in the mitochondrial genome. Pathogenic mutations in MT-ATP6 are associated with the Leigh syndrome, the syndrome of neuropathy, ataxia, and retinitis pigmentosa (NARP), as well as with non-classical phenotypes, while MT-ATP8 is less frequently mutated in patients with mitochondrial disease. We investigated two adult siblings presenting with features of cerebellar ataxia, peripheral neuropathy, diabetes mellitus, sensorineural hearing impairment, and hypergonadotropic hypogonadism. As the phenotype was suggestive of mitochondrial disease, mitochondrial DNA was sequenced and a novel heteroplasmic mutation m.8561C>G in the overlapping region of the MT-ATP6 and MT-ATP8 was found. The mutation changed amino acids in both subunits. Mutation heteroplasmy correlated with the disease phenotype in five family members. An additional assembly intermediate of complex V and increased amount of subcomplex F 1 were observed in myoblasts of the two patients, but the total amount of complex V was unaffected. Furthermore, intracellular ATP concentration was lower in patient myoblasts indicating defective energy production. We suggest that the m.8561C>G mutation in MT-ATP6/8 is pathogenic, leads biochemically to impaired assembly and decreased ATP production of complex V, and results clinically in a phenotype with the core features of cerebellar ataxia, peripheral neuropathy, diabetes mellitus, and hypergonadotropic hypogonadism.

  8. Gaucher disease: A G[sup +1][yields]A[sup +1] IVS2 splice donor site mutation causing exon 2 skipping in the acid [beta]-glucosidase mRNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    He, Guo-Shun; Grabowski, G.A.

    1992-10-01

    Gaucher disease is the most frequent lysosomal storage disease and the most prevalent Jewish genetic disease. About 30 identified missense mutations are causal to the defective activity of acid [beta]-glucosidase in this disease. cDNAs were characterized from a moderately affected 9-year-old Ashkenazi Jewish Gaucher disease type 1 patient whose 80-years-old, enzyme-deficient, 1226G (Asn[sup 370][yields]Ser [N370S]) homozygous grandfather was nearly asymptomatic. Sequence analyses revealed four populations of cDNAs with either the 1226G mutation, an exact exon 2 ([Delta] EX2) deletion, a deletion of exon 2 and the first 115 bp of exon 3 ([Delta] EX2-3), or a completely normal sequence. Aboutmore » 50% of the cDNAs were the [Delta] EX2, the [Delta] EX2-3, and the normal cDNAs, in a ratio of 6:3:1. Specific amplification and characterization of exon 2 and 5[prime] and 3[prime] intronic flanking sequences from the structural gene demonstrated clones with either the normal sequence or with a G[sup +1][yields]A[sup +1] transition at the exon 2/intron 2 boundary. This mutation destroyed the splice donor consensus site (U1 binding site) for mRNA processing. This transition also was present at the corresponding exon/intron boundary of the highly homologous pseudogene. This new mutation, termed [open quotes]IVS2 G[sup +1],[close quotes] is the first in the Ashkenazi Jewish population. The occurrence of this [open quotes]pseudogene[close quotes]-type mutation in the structural gene indicates the role of acid [beta]-glucosidase pseudogene and structural gene rearrangements in the pathogenesis of this disease. 33 refs., 8 figs., 1 tab.« less

  9. The coexistence of mitochondrial ND6 T14484C and 12S rRNA A1555G mutations in a Chinese family with Leber's hereditary optic neuropathy and hearing loss

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wei Qiping; Zhou Xiangtian; Yang Li

    2007-06-15

    We report here the clinical, genetic and molecular characterization of one three-generation Han Chinese family with Leber's hereditary optic neuropathy (LHON) and hearing loss. Four of 14 matrilineal relatives exhibited the moderate central vision loss at the average age of 12.5 years. Of these, one subject exhibited both LHON and mild hearing impairment. Sequence analysis of the complete mitochondrial genomes in the pedigree showed the presence of homoplasmic LHON-associated ND6 T14484C mutation, deafness-associated 12S rRNA A1555 mutation and 47 other variants belonging to Eastern Asian haplogroup H2. None of other mitochondrial variants was evolutionarily conserved and functional significance. Therefore, themore » coexistence of the A1555G mutation and T14484C mutations in this Chinese family indicate that the A1555G mutation may play a synergistic role in the phenotypic manifestation of LHON associated ND6 T14484C mutation. However, the incomplete penetrance of vision and hearing loss suggests the involvement of nuclear modifier genes and environmental factors in the phenotypic expression of these mtDNA mutations.« less

  10. Genome-Wide Estimates of Mutation Rates and Spectrum in Schizosaccharomyces pombe Indicate CpG Sites are Highly Mutagenic Despite the Absence of DNA Methylation

    PubMed Central

    Behringer, Megan G.; Hall, David W.

    2015-01-01

    We accumulated mutations for 1952 generations in 79 initially identical, haploid lines of the fission yeast Schizosaccharomyces pombe, and then performed whole-genome sequencing to determine the mutation rates and spectrum. We captured 696 spontaneous mutations across the 79 mutation accumulation (MA) lines. We compared the mutation spectrum and rate to a recently published equivalent experiment on the same species, and to another model ascomycetous yeast, the budding yeast Saccharomyces cerevisiae. While the two species are approximately 600 million years diverged from each other, they share similar life histories, genome size and genomic G/C content. We found that Sc. pombe and S. cerevisiae have similar mutation rates, but Sc. pombe exhibits a stronger insertion bias. Intriguingly, we observed an increased mutation rate at cytosine nucleotides, specifically CpG nucleotides, which is also seen in S. cerevisiae. However, the absence of methylation in Sc. pombe and the pattern of mutation at these sites, primarily C → A as opposed to C → T, strongly suggest that the increased mutation rate is not caused by deamination of methylated cytosines. This result implies that the high mutability of CpG dinucleotides in other species may be caused in part by a methylation-independent mechanism. Many of our findings mirror those seen in the recent study, despite the use of different passaging conditions, indicating that MA is a reliable method for estimating mutation rates and spectra. PMID:26564949

  11. Hemolysis and Mediterranean G6PD mutation (c.563 C>T) and c.1311 C>T polymorphism among Palestinians at Gaza Strip.

    PubMed

    Sirdah, Mahmoud; Reading, N Scott; Perkins, Sherrie L; Shubair, Mohammad; Aboud, Lina; Prchal, Josef T

    2012-04-15

    The G6PD c.563 C>T deficient mutation is endemic among Mediterranean populations but its clinical significance is not well delineated. We set up to estimate the proportion of G6PD deficient children presenting with hemolytic anemia at Al Nasser Pediatric Hospital at Gaza Strip, Palestine. We then established the prevalence of c.563T Mediterranean mutation and its linkage to c.1311 C>T polymorphism in this population. G6PD deficiency was identified in children presenting with hemolytic anemia at Al Nasser Pediatric Hospital by spectrophotometric measurement of G6PD activity. G6PD exon 6 and exon 11 were amplified from genomic DNA and evaluated for c.563T mutation by sequencing and the c.1311T polymorphism by restriction fragment analysis. Seventy X-chromosomes (60 males and 5 females) from G6PD deficient patients and 40 X-chromosomes from a control group known to be not G6PD deficient were tested. Over 80% of these children presenting with hemolytic anemia were G6PD deficient and 34% of these had the Mediterranean G6PD deficient variant. The allelic frequencies of Mediterranean c.563T and c.1311T polymorphisms among G6PD deficient patients were 0.33 and 0.38 respectively. The c.1311T polymorphism was linked in 95.2% of patients with the Mediterranean mutation, an allele frequency of 0.87, compared to the control non-G6PD deficient group with an allele frequency of 0.18. We conclude that G6PD deficiency accounts for majority of hemolytic anemia encountered in Gaza children treated at Al Nasser Pediatric Hospital Emergency department. The Mediterranean mutation c.563T, while not accounting for a majority of G6PD deficiency, is common among G6PD deficient Gaza Strip Palestinians and is frequently, but not always, linked to the c.1311T polymorphism. This work provides a foundation for the population screening of Palestinians for G6PD deficiency and for investigations of ancestral origin of the Mediterranean variant in world populations. Copyright © 2012 Elsevier Inc

  12. Case report of a novel homozygous splice site mutation in PLA2G6 gene causing infantile neuroaxonal dystrophy in a Sudanese family.

    PubMed

    Elsayed, Liena E O; Mohammed, Inaam N; Hamed, Ahlam A A; Elseed, Maha A; Salih, Mustafa A M; Yahia, Ashraf; Siddig, Rayan A; Amin, Mutaz; Koko, Mahmoud; Elbashir, Mustafa I; Ibrahim, Muntaser E; Brice, Alexis; Ahmed, Ammar E; Stevanin, Giovanni

    2018-05-08

    Infantile neuroaxonal dystrophy (INAD) is a rare hereditary neurological disorder caused by mutations in PLA2G6. The disease commonly affects children below 3 years of age and presents with delay in motor skills, optic atrophy and progressive spastic tetraparesis. Studies of INAD in Africa are extremely rare, and genetic studies from Sub Saharan Africa are almost non-existent. Two Sudanese siblings presented, at ages 18 and 24 months, with regression in both motor milestones and speech development and hyper-reflexia. Brain MRI showed bilateral and symmetrical T2/FLAIR hyperintense signal changes in periventricular areas and basal ganglia and mild cerebellar atrophy. Whole exome sequencing with confirmatory Sanger sequencing were performed for the two patients and healthy family members. A novel variant (NM_003560.2 c.1427 + 2 T > C) acting on a splice donor site and predicted to lead to skipping of exon 10 was found in PLA2G6. It was found in a homozygous state in the two patients and homozygous reference or heterozygous in five healthy family members. This variant has one very strong (loss of function mutation) and three supporting evidences for its pathogenicity (segregation with the disease, multiple computational evidence and specific patients' phenotype). Therefore this variant can be currently annotated as "pathogenic". This is the first study to report mutations in PLA2G6 gene in patients from Sudan.

  13. Targeted next-generation sequencing extends the phenotypic and mutational spectrums for EYS mutations

    PubMed Central

    Gu, Shun; Tian, Yuanyuan; Chen, Xue

    2016-01-01

    Purpose We aim to determine genetic lesions with a phenotypic correlation in four Chinese families with autosomal recessive retinitis pigmentosa (RP). Methods Medical histories were carefully reviewed. All patients received comprehensive ophthalmic evaluations. The next-generation sequencing (NGS) approach targeting a panel of 205 retinal disease–relevant genes and 15 candidate genes was selectively performed on probands from the four recruited families for mutation detection. Online predictive software and crystal structure modeling were also applied to test the potential pathogenic effects of identified mutations. Results Of the four families, two were diagnosed with RP sino pigmento (RPSP). Patients with RPSP claimed to have earlier RP age of onset but slower disease progression. Five mutations in the eyes shut homolog (EYS) gene, involving two novel (c.7228+1G>A and c.9248G>A) and three recurrent mutations (c.4957dupA, c.6416G>A and c.6557G>A), were found as RP causative in the four families. The missense variant c.5093T>C was determined to be a variant of unknown significance (VUS) due to the variant’s colocalization in the same allele with the reported pathogenic mutation c.6416G>A. The two novel variants were further confirmed absent in 100 unrelated healthy controls. Online predictive software indicated potential pathogenicity of the three missense mutations. Further, crystal structural modeling suggested generation of two abnormal hydrogen bonds by the missense mutation p.G2186E (c.6557G>A) and elongation of its neighboring β-sheet induced by p.G3083D (c.9248G>A), which could alter the tertiary structure of the eys protein and thus interrupt its physicochemical properties. Conclusions Taken together, with the targeted NGS approach, we reveal novel EYS mutations and prove the efficiency of targeted NGS in the genetic diagnoses of RP. We also first report the correlation between EYS mutations and RPSP. The genotypic-phenotypic relationship in all

  14. Targeted next-generation sequencing extends the phenotypic and mutational spectrums for EYS mutations.

    PubMed

    Gu, Shun; Tian, Yuanyuan; Chen, Xue; Zhao, Chen

    2016-01-01

    We aim to determine genetic lesions with a phenotypic correlation in four Chinese families with autosomal recessive retinitis pigmentosa (RP). Medical histories were carefully reviewed. All patients received comprehensive ophthalmic evaluations. The next-generation sequencing (NGS) approach targeting a panel of 205 retinal disease-relevant genes and 15 candidate genes was selectively performed on probands from the four recruited families for mutation detection. Online predictive software and crystal structure modeling were also applied to test the potential pathogenic effects of identified mutations. Of the four families, two were diagnosed with RP sino pigmento (RPSP). Patients with RPSP claimed to have earlier RP age of onset but slower disease progression. Five mutations in the eyes shut homolog (EYS) gene, involving two novel (c.7228+1G>A and c.9248G>A) and three recurrent mutations (c.4957dupA, c.6416G>A and c.6557G>A), were found as RP causative in the four families. The missense variant c.5093T>C was determined to be a variant of unknown significance (VUS) due to the variant's colocalization in the same allele with the reported pathogenic mutation c.6416G>A. The two novel variants were further confirmed absent in 100 unrelated healthy controls. Online predictive software indicated potential pathogenicity of the three missense mutations. Further, crystal structural modeling suggested generation of two abnormal hydrogen bonds by the missense mutation p.G2186E (c.6557G>A) and elongation of its neighboring β-sheet induced by p.G3083D (c.9248G>A), which could alter the tertiary structure of the eys protein and thus interrupt its physicochemical properties. Taken together, with the targeted NGS approach, we reveal novel EYS mutations and prove the efficiency of targeted NGS in the genetic diagnoses of RP. We also first report the correlation between EYS mutations and RPSP. The genotypic-phenotypic relationship in all Chinese patients carrying mutations in the EYS

  15. The mitochondrial DNA G13513A MELAS mutation in the NADH dehydrogenase 5 gene is a frequent cause of Leigh-like syndrome with isolated complex I deficiency.

    PubMed

    Chol, M; Lebon, S; Bénit, P; Chretien, D; de Lonlay, P; Goldenberg, A; Odent, S; Hertz-Pannier, L; Vincent-Delorme, C; Cormier-Daire, V; Rustin, P; Rötig, A; Munnich, A

    2003-03-01

    Leigh syndrome is a subacute necrotising encephalomyopathy frequently ascribed to mitochondrial respiratory chain deficiency. This condition is genetically heterogeneous, as mutations in both mitochondrial (mt) and nuclear genes have been reported. Here, we report the G13513A transition in the ND5 mtDNA gene in three unrelated children with complex I deficiency and a peculiar MRI aspect distinct from typical Leigh syndrome. Brain MRI consistently showed a specific involvement of the substantia nigra and medulla oblongata sparing the basal ganglia. Variable degrees of heteroplasmy were found in all tissues tested and a high percentage of mutant mtDNA was observed in muscle. The asymptomatic mothers presented low levels of mutant mtDNA in blood leucocytes. This mutation, which affects an evolutionary conserved amino acid (D393N), has been previously reported in adult patients with MELAS or LHON/MELAS syndromes, emphasising the clinical heterogeneity of mitochondrial DNA mutations. Since the G13513A mutation was found in 21% of our patients with Leigh syndrome and complex I deficiency (3/14), it appears that this mutation represents a frequent cause of Leigh-like syndrome, which should be systematically tested for molecular diagnosis in affected children and for genetic counselling in their maternal relatives.

  16. Role of mutations G-480 and C-6203 in the attenuation phenotype of Sabin type 1 poliovirus.

    PubMed

    McGoldrick, A; Macadam, A J; Dunn, G; Rowe, A; Burlison, J; Minor, P D; Meredith, J; Evans, D J; Almond, J W

    1995-12-01

    Of the 55 point mutations which distinguish the type 1 poliovirus vaccine strain (Sabin 1) from its neurovirulent progenitor (P1/Mahoney), two have been strongly implicated by previous studies as determinants of the attenuation phenotype. A change of an A to a G at position 480, located within the 5' noncoding region, has been suggested to be the major attenuating mutation, analogous to the mutations at positions 481 and 472 in poliovirus types 2 and 3, respectively. In addition, the change of a U to a C at position 6203, resulting in an amino acid change in the polymerase protein 3D, has also been implicated as a determinant of attenuation, albeit to a lesser extent. To assess the contributions of these mutations to attenuation and temperature sensitivity, reciprocal changes were generated at these positions in infectious cDNA clones of Sabin 1 and P1/Mahoney. Assays in tissue culture and primates indicated that the two mutations make some contribution to the temperature sensitivity of the Sabin 1 strain but that neither is a strong determinant of attenuation.

  17. Defective mitochondrial rRNA methyltransferase MRM2 causes MELAS-like clinical syndrome

    PubMed Central

    Garone, Caterina; D’Souza, Aaron R; Dallabona, Cristina; Lodi, Tiziana; Rebelo-Guiomar, Pedro; Rorbach, Joanna; Donati, Maria Alice; Procopio, Elena; Montomoli, Martino; Guerrini, Renzo; Zeviani, Massimo; Calvo, Sarah E; Mootha, Vamsi K; DiMauro, Salvatore; Ferrero, Ileana; Minczuk, Michal

    2017-01-01

    Abstract Defects in nuclear-encoded proteins of the mitochondrial translation machinery cause early-onset and tissue-specific deficiency of one or more OXPHOS complexes. Here, we report a 7-year-old Italian boy with childhood-onset rapidly progressive encephalomyopathy and stroke-like episodes. Multiple OXPHOS defects and decreased mtDNA copy number (40%) were detected in muscle homogenate. Clinical features combined with low level of plasma citrulline were highly suggestive of mitochondrial encephalopathy, lactic acidosis and stroke-like episodes (MELAS) syndrome, however, the common m.3243 A > G mutation was excluded. Targeted exome sequencing of genes encoding the mitochondrial proteome identified a damaging mutation, c.567 G > A, affecting a highly conserved amino acid residue (p.Gly189Arg) of the MRM2 protein. MRM2 has never before been linked to a human disease and encodes an enzyme responsible for 2’-O-methyl modification at position U1369 in the human mitochondrial 16S rRNA. We generated a knockout yeast model for the orthologous gene that showed a defect in respiration and the reduction of the 2’-O-methyl modification at the equivalent position (U2791) in the yeast mitochondrial 21S rRNA. Complementation with the mrm2 allele carrying the equivalent yeast mutation failed to rescue the respiratory phenotype, which was instead completely rescued by expressing the wild-type allele. Our findings establish that defective MRM2 causes a MELAS-like phenotype, and suggests the genetic screening of the MRM2 gene in patients with a m.3243 A > G negative MELAS-like presentation. PMID:28973171

  18. Defective mitochondrial rRNA methyltransferase MRM2 causes MELAS-like clinical syndrome.

    PubMed

    Garone, Caterina; D'Souza, Aaron R; Dallabona, Cristina; Lodi, Tiziana; Rebelo-Guiomar, Pedro; Rorbach, Joanna; Donati, Maria Alice; Procopio, Elena; Montomoli, Martino; Guerrini, Renzo; Zeviani, Massimo; Calvo, Sarah E; Mootha, Vamsi K; DiMauro, Salvatore; Ferrero, Ileana; Minczuk, Michal

    2017-11-01

    Defects in nuclear-encoded proteins of the mitochondrial translation machinery cause early-onset and tissue-specific deficiency of one or more OXPHOS complexes. Here, we report a 7-year-old Italian boy with childhood-onset rapidly progressive encephalomyopathy and stroke-like episodes. Multiple OXPHOS defects and decreased mtDNA copy number (40%) were detected in muscle homogenate. Clinical features combined with low level of plasma citrulline were highly suggestive of mitochondrial encephalopathy, lactic acidosis and stroke-like episodes (MELAS) syndrome, however, the common m.3243 A > G mutation was excluded. Targeted exome sequencing of genes encoding the mitochondrial proteome identified a damaging mutation, c.567 G > A, affecting a highly conserved amino acid residue (p.Gly189Arg) of the MRM2 protein. MRM2 has never before been linked to a human disease and encodes an enzyme responsible for 2'-O-methyl modification at position U1369 in the human mitochondrial 16S rRNA. We generated a knockout yeast model for the orthologous gene that showed a defect in respiration and the reduction of the 2'-O-methyl modification at the equivalent position (U2791) in the yeast mitochondrial 21S rRNA. Complementation with the mrm2 allele carrying the equivalent yeast mutation failed to rescue the respiratory phenotype, which was instead completely rescued by expressing the wild-type allele. Our findings establish that defective MRM2 causes a MELAS-like phenotype, and suggests the genetic screening of the MRM2 gene in patients with a m.3243 A > G negative MELAS-like presentation. © The Author 2017. Published by Oxford University Press.

  19. Prothrombin polymorphism A19911G, factor V HR2 haplotype A4070G, and plasminogen activator-inhibitor-1 polymorphism 4G/5G and the risk of retinal vein occlusion.

    PubMed

    Kuhli-Hattenbach, Claudia; Hellstern, Peter; Nägler, Dorit Karin; Kohnen, Thomas; Hattenbach, Lars-Olof

    2017-01-01

    Thus far, no data has become available to evaluate systematically the prevalences of prothrombin polymorphism A19911G (PT A19911G), factor V HR2 haplotype A4070G (FV A4070G), or plasminogen activator-inhibitor-1 polymorphism 4G/5G (PAI-1 4G/5G) in patients who develop retinal vein occlusion (RVO) without cardiovascular risk factors. We retrospectively evaluated comprehensive thrombophilia data from 42 preselected RVO patients without cardiovascular risk factors. The prevalences of different gene mutations and polymorphisms including factor V Leiden mutation G1691A (FVL), FV A4070G, prothrombin mutation G20210A, PT A19911G, and PAI-1 4G/5G were compared with 241 healthy controls matched for age and sex. A total of 20 patients (47.7%) were found to carry thrombophilic gene polymorphisms including FVL, FV A4070G, and homozygous PT A19911G compared with 72 of 241 controls (29.9%; p = 0.03). Subgroup analysis of patients with a significant personal or family history of thromboembolism revealed a high prevalence of FVL, FV A4070G, and homozygous PT A19911G (p = 0.005). FV A4070G was found to be significantly associated with at least two other heterozygous or one homozygous gene polymorphisms (p = 0.02). Multivariate analysis revealed the presence of FVL (p = 0.0017) and homozygous PT A19911G (p = 0.03) polymorphism as independent risk factors for the development of RVO. Our results indicate that in selected RVO patients screening for thrombophilic gene polymorphisms including FVL, FV A4070G and homozygous PT G19911A may be helpful in a high percentage of cases. Our findings suggest that hereditary thrombophilia associated with RVO is more likely to be multigenic than caused by any single risk factor.

  20. A novel germline mutation (c.A527G) in STK11 gene causes Peutz-Jeghers syndrome in a Chinese girl: A case report.

    PubMed

    Zhao, Zi-Ye; Jiang, Yu-Liang; Li, Bai-Rong; Yang, Fu; Li, Jing; Jin, Xiao-Wei; Sun, Shu-Han; Ning, Shou-Bin

    2017-12-01

    Peutz-Jeghers syndrome (PJS) is a Mendelian autosomal dominant disease caused by mutations in the tumor suppressor gene, serine/threonine kinase 11 (STK11). The features of this syndrome include gastrointestinal (GI) hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing cancer. Early onset of disease is often characterized by mucocutaneous pigmentation and intussusception due to GI polyps in childhood. A girl with a positive family history grew oral pigmentation at 1 and got intussusception by small bowel hamartomas at 5. She was diagnosed with PJS based on oral pigmentation and a positive family history of PJS. Enteroscopy was employed to treat the GI polyps. Sanger sequencing was used to investigate STK11 mutation in this family. A large jejunal polyp together with other smaller ones was resected, and the girl recovered uneventfully. We discovered a heterozygous substitution in STK11, c.A527G in exon 4, in the girl and her father who was also a PJS patient, and the amine acid change was an aspartic acid-glycine substitution in codon 176. This mutation was not found in other healthy family members and 50 unrelated non-PJS controls, and it is not recorded in databases, which prove it a novel mutation. Evolutionary conservation analysis of amino acid residues showed this aspartic acid is a conserved one between species, and protein structure prediction by SWISS-MODEL indicated an obvious change in local structure. In addition, PolyPhen-2 score for this mutation is 1, which indicates it probably damaging. PJS can cause severe complication like intussusception in young children, and early screening for small bowel may be beneficial for these patients. The mutation of STK11 found in this girl is a novel one, which enlarges the spectrum of STK11. Our analysis supported it a causative one in PJS.

  1. A CpG island methylator phenotype in acute myeloid leukemia independent of IDH mutations and associated with a favorable outcome.

    PubMed

    Kelly, A D; Kroeger, H; Yamazaki, J; Taby, R; Neumann, F; Yu, S; Lee, J T; Patel, B; Li, Y; He, R; Liang, S; Lu, Y; Cesaroni, M; Pierce, S A; Kornblau, S M; Bueso-Ramos, C E; Ravandi, F; Kantarjian, H M; Jelinek, J; Issa, J-Pj

    2017-10-01

    Genetic changes are infrequent in acute myeloid leukemia (AML) compared with other malignancies and often involve epigenetic regulators, suggesting that an altered epigenome may underlie AML biology and outcomes. In 96 AML cases including 65 pilot samples selected for cured/not-cured, we found higher CpG island (CGI) promoter methylation in cured patients. Expanded genome-wide digital restriction enzyme analysis of methylation data revealed a CGI methylator phenotype independent of IDH1/2 mutations we term AML-CGI methylator phenotype (CIMP) (A-CIMP + ). A-CIMP was associated with longer overall survival (OS) in this data set (median OS, years: A-CIMP + =not reached, CIMP - =1.17; P=0.08). For validation we used 194 samples from The Cancer Genome Atlas interrogated with Illumina 450k methylation arrays where we confirmed longer OS in A-CIMP (median OS, years: A-CIMP + =2.34, A-CIMP - =1.00; P=0.01). Hypermethylation in A-CIMP + favored CGIs (OR: CGI/non-CGI=5.21), and while A-CIMP + was enriched in CEBPA (P=0.002) and WT1 mutations (P=0.02), 70% of cases lacked either mutation. Hypermethylated genes in A-CIMP + function in pluripotency maintenance, and a gene expression signature of A-CIMP was associated with outcomes in multiple data sets. We conclude that CIMP in AML cannot be explained solely by gene mutations (for example, IDH1/2, TET2), and that curability in A-CIMP + AML should be validated prospectively.

  2. An exonic missense mutation c.28G>A is associated with weak B blood group by affecting RNA splicing of the ABO gene.

    PubMed

    Cai, Xiaohong; Qian, Chengrui; Wu, Wenman; Lei, Hang; Ding, Qiulan; Zou, Wei; Xiang, Dong; Wang, Xuefeng

    2017-09-01

    The amino acid substitutions caused by ABO gene mutations are usually predicted to impact glycosyltransferase's function or its biosynthesis. Here we report an ABO exonic missense mutation that affects B-antigen expression by decreasing the mRNA level of the ABO gene rather than the amino acid change. Serologic studies including plasma total GTB transfer capacity were performed. The exon sequences of the ABO gene were analyzed by Sanger sequencing. B 310 cDNA with c.28G>A (p.G10R) mutation was expressed in HeLa cells and total GTB transfer capacity in cell supernatant was measured. Flow cytometry was performed on these HeLa cells after transfection, and agglutination of Hela-B weak cells was also examined. The mRNA of the ABO gene was analyzed by direct sequencing and real-time reverse transcriptase-polymerase chain reaction. A minigene construct was prepared to evaluate the potential of splicing. While plasma total GTB transfer capacity was undetectable in this B 3 -like individual, the relative percentage of antigen-expressing cells and mean fluorescence index of the B weak red blood cells (RBCs) were 19 and 14% of normal B RBCs, respectively. There was no significant difference of total GTB transfer capacity in cell supernatant and B-antigen expression on cell surfaces between HeLa cells transfected with B 310 cDNA and B cDNA. The mRNA expression level of B 310 in peripheral whole blood was significantly reduced. The amount of splicing is significantly lower in c.28G>A construct compared to that in wild-type construct after transfection in K562 cells. ABO c.28G>A mutation may cause B 3 -like subgroup by affecting RNA splicing of the ABO gene. © 2017 AABB.

  3. The mitochondrial ND1 m.3337G>A mutation associated to multiple mitochondrial DNA deletions in a patient with Wolfram syndrome and cardiomyopathy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mezghani, Najla; Mnif, Mouna; Mkaouar-Rebai, Emna, E-mail: emna_mkaouar@mail2world.com

    Highlights: {yields} We reported a patient with Wolfram syndrome and dilated cardiomyopathy. {yields} We detected the ND1 mitochondrial m.3337G>A mutation in 3 tested tissues (blood leukocytes, buccal mucosa and skeletal muscle). {yields} Long-range PCR amplification revealed the presence of multiple mitochondrial deletions in the skeletal muscle. {yields} The deletions remove several tRNA and protein-coding genes. -- Abstract: Wolfram syndrome (WFS) is a rare hereditary disorder also known as DIDMOAD (diabetes insipidus, diabetes mellitus, optic atrophy, and deafness). It is a heterogeneous disease and full characterization of all clinical and biological features of this disorder is difficult. The wide spectrum ofmore » clinical expression, affecting several organs and tissues, and the similarity in phenotype between patients with Wolfram syndrome and those with certain types of respiratory chain diseases suggests mitochondrial DNA (mtDNA) involvement in Wolfram syndrome patients. We report a Tunisian patient with clinical features of moderate Wolfram syndrome including diabetes, dilated cardiomyopathy and neurological complications. The results showed the presence of the mitochondrial ND1 m.3337G>A mutation in almost homoplasmic form in 3 tested tissues of the proband (blood leukocytes, buccal mucosa and skeletal muscle). In addition, the long-range PCR amplifications revealed the presence of multiple deletions of the mitochondrial DNA extracted from the patient's skeletal muscle removing several tRNA and protein-coding genes. Our study reported a Tunisian patient with clinical features of moderate Wolfram syndrome associated with cardiomyopathy, in whom we detected the ND1 m.3337G>A mutation with mitochondrial multiple deletions.« less

  4. The HOXB13 G84E Mutation Is Associated with an Increased Risk for Prostate Cancer and Other Malignancies.

    PubMed

    Beebe-Dimmer, Jennifer L; Hathcock, Matthew; Yee, Cecilia; Okoth, Linda A; Ewing, Charles M; Isaacs, William B; Cooney, Kathleen A; Thibodeau, Stephen N

    2015-09-01

    A rare nonconservative substitution (G84E) in the HOXB13 gene has been shown to be associated with risk of prostate cancer. DNA samples from male patients included in the Mayo Clinic Biobank (MCB) were genotyped to determine the frequency of the G84E mutation and its association with various cancers. Subjects were genotyped using a custom TaqMan (Applied Biosystems) assay for G84E (rs138213197). In addition to donating a blood specimen, all MCB participants completed a baseline questionnaire to collect information on medical history and family history of cancer. Forty-nine of 9,012 male patients were carriers of G84E (0.5%). Thirty-one percent (n = 2,595) of participants had been diagnosed with cancer, including 51.1% of G84E carriers compared with just 30.6% of noncarriers (P = 0.004). G84E was most frequently observed among men with prostate cancer compared with men without cancer (P < 0.0001). However, the mutation was also more commonly observed in men with bladder cancer (P = 0.06) and leukemia (P = 0.01). G84E carriers were more likely to have a positive family history of prostate cancer in a first-degree relative compared to noncarriers (36.2% vs. 16.0%, P = 0.0003). Our study confirms the association between the HOXB13 G84E variant and prostate cancer and suggests a novel association between G84E and leukemia and a suggestive association with bladder cancer. Future investigation is warranted to confirm these associations in order to improve our understanding of the role of germline HOXB13 mutations in human cancer. The associations between HOXB13 and prostate, leukemia, and bladder suggest that this gene is important in carcinogenesis. ©2015 American Association for Cancer Research.

  5. Novel USH2A mutations in Japanese Usher syndrome type 2 patients: marked differences in the mutation spectrum between the Japanese and other populations.

    PubMed

    Nakanishi, Hiroshi; Ohtsubo, Masafumi; Iwasaki, Satoshi; Hotta, Yoshihiro; Usami, Shin-Ichi; Mizuta, Kunihiro; Mineta, Hiroyuki; Minoshima, Shinsei

    2011-07-01

    Usher syndrome (USH) is an autosomal recessive disorder characterized by retinitis pigmentosa and hearing loss. USH type 2 (USH2) is the most common type of USH and is frequently caused by mutations in USH2A. In a recent mutation screening of USH2A in Japanese USH2 patients, we identified 11 novel mutations in 10 patients and found the possible frequent mutation c.8559-2A>G in 4 of 10 patients. To obtain a more precise mutation spectrum, we analyzed further nine Japanese patients in this study. We identified nine mutations, of which eight were novel. This result indicates that the mutation spectrum for USH2A among Japanese patients largely differs from Caucasian, Jewish and Palestinian patients. Meanwhile, we did not find the c.8559-2A>G in this study. Haplotype analysis of the c.8559-2G (mutated) alleles using 23 single nucleotide polymorphisms surrounding the mutation revealed an identical haplotype pattern of at least 635 kb in length, strongly suggesting that the mutation originated from a common ancestor. The fact that all patients carrying c.8559-2A>G came from western Japan suggests that the mutation is mainly distributed in that area; indeed, most of the patients involved in this study came from eastern Japan, which contributed to the absence of c.8559-2A>G.

  6. Expanding the clinical and genetic spectrum of G6PD deficiency: The occurrence of BCGitis and novel missense mutation.

    PubMed

    Khan, Taj Ali; Mazhar, Humaira; Nawaz, Mehboob; Kalsoom, Kalsoom; Ishfaq, Muhammad; Asif, Huma; Rahman, Hazir; Qasim, Muhammad; Naz, Farkhanda; Hussain, Mubashir; Khattak, Baharullah; Ullah, Waheed; Cabral-Marques, Otavio; Butt, Jawad; Iqbal, Asif

    2017-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) is a key enzyme in the pentose phosphate pathway that ensures sufficient production of coenzyme nicotinamide adenine dinucleotide phosphate (NADPH) by catalyzing the reduction of NADP+ to NADPH. Noteworthy, the latter mediates the production of reactive oxygen species (ROS) by phagocytic cells such as neutrophils and monocytes. Therefore, patients with severe forms of G6PD deficiency may present impaired NADPH oxidase activity and become susceptible to recurrent infections. This fact, highlights the importance to characterize the immunopathologic mechanisms underlying the susceptibility to infections in patients with G6PD deficiency. Here we report the first two cases of G6PD deficiency with Bacille Calmette-Guérin (BCG) adverse effect, besides jaundice, hemolytic anemia and recurrent infections caused by Staphylococcus aureus. The qualitative G6PD screening was performed and followed by oxidative burst analysis using flow cytometry. Genetic and in silico analyses were carried out by Sanger sequencing and mutation pathogenicity predicted using bioinformatics tools, respectively. Activated neutrophils and monocytes from patients displayed impaired oxidative burst. The genetic analysis revealed the novel missense mutation c.1157T>A/p.L386Q in G6PD. In addition, in silico analysis indicated that this mutation is pathogenic, thereby hampering the oxidative burst of neutrophils and monocytes from patients. Our data expand the clinical and genetic spectrum of G6PD deficiency, and suggest that impaired oxidative burst in this severe primary immune deficiency is an underlying immunopathologic mechanism that predisposes to mycobacterial infections. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. A G-to-A mutation in IVS-3 of the human gamma fibrinogen gene causing afibrinogenemia due to abnormal RNA splicing.

    PubMed

    Margaglione, M; Santacroce, R; Colaizzo, D; Seripa, D; Vecchione, G; Lupone, M R; De Lucia, D; Fortina, P; Grandone, E; Perricone, C; Di Minno, G

    2000-10-01

    Congenital afibrinogenemia is a rare autosomal recessive disorder characterized by a hemorrhagic diathesis of variable severity. Although more than 100 families with this disorder have been described, genetic defects have been characterized in few cases. An investigation of a young propositus, offspring of a consanguineous marriage, with undetectable levels of functional and quantitative fibrinogen, was conducted. Sequence analysis of the fibrinogen genes showed a homozygous G-to-A mutation at the fifth nucleotide (nt 2395) of the third intervening sequence (IVS) of the gamma-chain gene. Her first-degree relatives, who had approximately half the normal fibrinogen values and showed concordance between functional and immunologic levels, were heterozygtes. The G-to-A change predicts the disappearance of a donor splice site. After transfection with a construct, containing either the wild-type or the mutated sequence, cells with the mutant construct showed an aberrant messenger RNA (mRNA), consistent with skipping of exon 3, but not the expected mRNA. Sequencing of the abnormal mRNA showed the complete absence of exon 3. Skipping of exon 3 predicts the deletion of amino acid sequence from residue 16 to residue 75 and shifting of reading frame at amino acid 76 with a premature stop codon within exon 4 at position 77. Thus, the truncated gamma-chain gene product would not interact with other chains to form the mature fibrinogen molecule. The current findings show that mutations within highly conserved IVS regions of fibrinogen genes could affect the efficiency of normal splicing, giving rise to congenital afibrinogenemia.

  8. The LRRK2 G2385R variant is a partial loss-of-function mutation that affects synaptic vesicle trafficking through altered protein interactions.

    PubMed

    Carrion, Maria Dolores Perez; Marsicano, Silvia; Daniele, Federica; Marte, Antonella; Pischedda, Francesca; Di Cairano, Eliana; Piovesana, Ester; von Zweydorf, Felix; Kremmer, Elisabeth; Gloeckner, Christian Johannes; Onofri, Franco; Perego, Carla; Piccoli, Giovanni

    2017-07-14

    Mutations in the Leucine-rich repeat kinase 2 gene (LRRK2) are associated with familial Parkinson's disease (PD). LRRK2 protein contains several functional domains, including protein-protein interaction domains at its N- and C-termini. In this study, we analyzed the functional features attributed to LRRK2 by its N- and C-terminal domains. We combined TIRF microscopy and synaptopHluorin assay to visualize synaptic vesicle trafficking. We found that N- and C-terminal domains have opposite impact on synaptic vesicle dynamics. Biochemical analysis demonstrated that different proteins are bound at the two extremities, namely β3-Cav2.1 at N-terminus part and β-Actin and Synapsin I at C-terminus domain. A sequence variant (G2385R) harboured within the C-terminal WD40 domain increases the risk for PD. Complementary biochemical and imaging approaches revealed that the G2385R variant alters strength and quality of LRRK2 interactions and increases fusion of synaptic vesicles. Our data suggest that the G2385R variant behaves like a loss-of-function mutation that mimics activity-driven events. Impaired scaffolding capabilities of mutant LRRK2 resulting in perturbed vesicular trafficking may arise as a common pathophysiological denominator through which different LRRK2 pathological mutations cause disease.

  9. Prevalence of 845G>A HFE mutation in Slavic populations: an east-west linear gradient in South Slavs.

    PubMed

    Adler, Grazyna; Clark, Jeremy S; Łoniewska, Beata; Ciechanowicz, Andrzej

    2011-06-01

    To compare A allele frequencies of the 845G>A mutation of 10 Slavic populations in central, eastern, and southern Europe between each other and with other European populations. The 845G>A mutation from the DNA of 400 Polish neonates collected in 2005-2006 was analyzed by polymerase chain reaction-restriction fragment length polymorphism. The data were compared with reports from other countries. We identified 381 GG homozygotes, 18 GA heterozygotes, and 1 AA homozygote. The 845A allele frequency was 2.5%, which makes the summary figure for Poland from this and previous studies 3.5%. The average prevalence for Poland and other West Slavic countries was 3.6%, similar to Russia (inhabited by the East Slavs, 3.5%). The average prevalence in South Slavic countries was 2.2%, gradually decreasing from 3.6% in Slovenia to 0% in Bulgaria, with a longitudinal linear gradient (adjusted R(2)=0.976, P<0.001). The West and East Slavs, together with Finland, Estonia, Germany, Austria, Hungary, Slovenia, and Croatia, form a group with 845A allele frequencies between 3% and 4%. In the South Slavs, there is a gradual decline in the prevalence of 845A allele from northwest to southeast, with a surprisingly exact east-west linear gradient.

  10. Autism-Associated Insertion Mutation (InsG) of Shank3 Exon 21 Causes Impaired Synaptic Transmission and Behavioral Deficits

    PubMed Central

    Speed, Haley E.; Kouser, Mehreen; Xuan, Zhong; Reimers, Jeremy M.; Ochoa, Christine F.; Gupta, Natasha; Liu, Shunan

    2015-01-01

    SHANK3 (also known as PROSAP2) is a postsynaptic scaffolding protein at excitatory synapses in which mutations and deletions have been implicated in patients with idiopathic autism, Phelan–McDermid (aka 22q13 microdeletion) syndrome, and other neuropsychiatric disorders. In this study, we have created a novel mouse model of human autism caused by the insertion of a single guanine nucleotide into exon 21 (Shank3G). The resulting frameshift causes a premature STOP codon and loss of major higher molecular weight Shank3 isoforms at the synapse. Shank3G/G mice exhibit deficits in hippocampus-dependent spatial learning, impaired motor coordination, altered response to novelty, and sensory processing deficits. At the cellular level, Shank3G/G mice also exhibit impaired hippocampal excitatory transmission and plasticity as well as changes in baseline NMDA receptor-mediated synaptic responses. This work identifies clear alterations in synaptic function and behavior in a novel, genetically accurate mouse model of autism mimicking an autism-associated insertion mutation. Furthermore, these findings lay the foundation for future studies aimed to validate and study region-selective and temporally selective genetic reversal studies in the Shank3G/G mouse that was engineered with such future experiments in mind. PMID:26134648

  11. Importance of Highly Conserved Peptide Sites of Human Cytomegalovirus gO for Formation of the gH/gL/gO Complex

    PubMed Central

    Stegmann, Cora; Abdellatif, Mohamed E. A.; Laib Sampaio, Kerstin; Walther, Paul

    2016-01-01

    ABSTRACT The glycoprotein O (gO) is betaherpesvirus specific. Together with the viral glycoproteins H and L, gO forms a covalent trimeric complex that is part of the viral envelope. This trimer is crucial for cell-free infectivity of human cytomegalovirus (HCMV) but dispensable for cell-associated spread. We hypothesized that the amino acids that are conserved among gOs of different cytomegaloviruses are important for the formation of the trimeric complex and hence for efficient virus spread. In a mutational approach, nine peptide sites, containing all 13 highly conserved amino acids, were analyzed in the context of HCMV strain TB40-BAC4 with regard to infection efficiency and formation of the gH/gL/gO complex. Mutation of amino acids (aa) 181 to 186 or aa 193 to 198 resulted in the loss of the trimer and a complete small-plaque phenotype, whereas mutation of aa 108 or aa 249 to 254 caused an intermediate phenotype. While individual mutations of the five conserved cysteines had little impact, their relevance was revealed in a combined mutation, which abrogated both complex formation and cell-free infectivity. C343 was unique, as it was sufficient and necessary for covalent binding of gO to gH/gL. Remarkably, however, C218 together with C167 rescued infectivity in the absence of detectable covalent complex formation. We conclude that all highly conserved amino acids contribute to the function of gO to some extent but that aa 181 to 198 and cysteines 343, 218, and 167 are particularly relevant. Surprisingly, covalent binding of gO to gH/gL is required neither for its incorporation into virions nor for proper function in cell-free infection. IMPORTANCE Like all herpesviruses, the widespread human pathogen HCMV depends on glycoproteins gB, gH, and gL for entry into target cells. Additionally, gH and gL have to bind gO in a trimeric complex for efficient cell-free infection. Homologs of gO are shared by all cytomegaloviruses, with 13 amino acids being highly conserved

  12. Novel mutation in forkhead box G1 (FOXG1) gene in an Indian patient with Rett syndrome.

    PubMed

    Das, Dhanjit Kumar; Jadhav, Vaishali; Ghattargi, Vikas C; Udani, Vrajesh

    2014-03-15

    Rett syndrome (RTT) is a severe neurodevelopmental disorder characterized by the progressive loss of intellectual functioning, fine and gross motor skills and communicative abilities, deceleration of head growth, and the development of stereotypic hand movements, occurring after a period of normal development. The classic form of RTT involves mutation in MECP2 while the involvement of CDKL5 and FOXG1 genes has been identified in atypical RTT phenotype. FOXG1 gene encodes for a fork-head box protein G1, a transcription factor acting primarily as transcriptional repressor through DNA binding in the embryonic telencephalon as well as a number of other neurodevelopmental processes. In this report we have described the molecular analysis of FOXG1 gene in Indian patients with Rett syndrome. FOXG1 gene mutation analysis was done in a cohort of 34 MECP2/CDKL5 mutation negative RTT patients. We have identified a novel mutation (p. D263VfsX190) in FOXG1 gene in a patient with congenital variant of Rett syndrome. This mutation resulted into a frameshift, thereby causing an alteration in the reading frames of the entire coding sequence downstream of the mutation. The start position of the frameshift (Asp263) and amino acid towards the carboxyl terminal end of the protein was found to be well conserved across species using multiple sequence alignment. Since the mutation is located at forkhead binding domain, the resultant mutation disrupts the secondary structure of the protein making it non-functional. This is the first report from India showing mutation in FOXG1 gene in Rett syndrome. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. A Novel c.125 T>G (p.Val42Gly) Mutation in The Human INS Gene Leads to Neonatal Diabetes Mellitus via a Decrease in Insulin Synthesis.

    PubMed

    Sun, Fei; Du, Wenhua; Ma, Junhua; Gu, Mingjun; Wang, Jingnan; Zhu, Hongling; Song, Huaidong; Gao, Guanqi

    2018-06-11

    Neonatal diabetes mellitus is likely caused by monogenic mutations, several of which have been identified. INS mutations have a broad spectrum of clinical presentations, ranging from severe neonatal onset to mild adult onset, which suggests that the products of different mutant INS alleles behave differently and utilize distinct mechanisms to induce diabetes. In this study, a neonatal diabetes mellitus patient's INS gene was sequenced, and functional experiments were conducted. The neonatal diabetes mellitus patient's genomic DNA was extracted, and the patient's KCNJ11, ABCC8, and INS genes were sequenced. A novel mutation was identified in INS, and the open reading frame of this human mutant INS gene was inserted into the pMSCV-PIG plasmid. The constructed pMSCV-PIG plasmid was combined with VSV-g and Gag-pol and transfected into 293T cells to package the lentivirus. To stably overexpress the mutant gene, INS-1 cells were infected with the virus. The levels of insulin in the cell culture medium and cytoplasm were determined by ELISA and immunocytochemistry, respectively. A heterozygous mutation, c.125T>G (p. Val42Gly), was identified in a neonatal diabetes mellitus patient's INS gene. The human mutant INS open reading frame was overexpressed in INS-1 cells, and the mutant insulin was undetectable in the cell culture medium and cytoplasm. The novel heterozygous activating mutation c.125 T>G (p.Val42Gly) impairs the synthesis of insulin by pancreatic beta cells, resulting in diabetes. © Georg Thieme Verlag KG Stuttgart · New York.

  14. Emergence of novel and dominant acquired EGFR solvent-front mutations at Gly796 (G796S/R) together with C797S/R and L792F/H mutations in one EGFR (L858R/T790M) NSCLC patient who progressed on osimertinib.

    PubMed

    Ou, Sai-Hong Ignatius; Cui, Jean; Schrock, Alexa B; Goldberg, Michael E; Zhu, Viola W; Albacker, Lee; Stephens, Philip J; Miller, Vincent A; Ali, Siraj M

    2017-06-01

    Acquired epidermal growth factor receptor (EGFR) resistance mutations to osimertinib are common, including the EGFR C797S that abolishes the covalent binding of osimertinib to EGFR. Here we report the emergence of novel EGFR solvent front mutations at Gly796 (G796S/R) in addition to a hinge pocket L792F/H mutations, and C797S/G all in cis with T790M in a single patient on progression on osimertinib as detected by plasma circulating tumor DNA (ctDNA) assay in the course of clinical care. A 69-year-old Caucasian female former light-smoker presented with stage IV EGFR L858R positive adenocarcinoma who developed EGFR T790M mutation after 8 month treatment of erlotinib. The patient was initiated on osimertinib with disease shrinkage after 2 months, but tumor regrowth was observed after 5 months of osimertinib treatment. Assay of plasma ctDNA at this time revealed these different secondary resistance mutations all in trans with each other including distinct mutations at the same codon producing different amino acid changes: G796S/R (mutant allele frequency [MAF]; 14.4%), C797S/G (MAF: 2.26%), L792F/H (MAF: 0.36%), and V802F (MAF: 0.40%), in addition to the pre-existing L858R (MAF:17.9%) and T790M (MAF:18.2%) but all in cis with T790M. The G796S/R mutations are homologous with known reported solvent front mutations in ALK G1202R, ROS1 G2032R, TrkA G595R and TrkC G623R, all of which are associated with acquired resistance to type I TKIs. In silico modeling revealed mutation at G796 interferes with osimertinib binding to the EGFR kinase domain at the phenyl aromatic ring position as this residue forms a narrow "hydrophobic sandwich" with L718, while L792F/H mutation interferes with osimertinib binding at the methoxyl group on the phenyl ring. Multiple resistance mutations at differing allele frequencies including novel EGFR solvent front mutations can emerge in a single patient with progression on osimertinib potentially due to tumor hetereogeneity and definitely present a

  15. Effects of HCM cTnI Mutation R145G on Troponin Structure and Modulation by PKA Phosphorylation Elucidated by Molecular Dynamics Simulations

    PubMed Central

    Lindert, Steffen; Cheng, Yuanhua; Kekenes-Huskey, Peter; Regnier, Michael; McCammon, J. Andrew

    2015-01-01

    Cardiac troponin (cTn) is a key molecule in the regulation of human cardiac muscle contraction. The N-terminal cardiac-specific peptide of the inhibitory subunit of troponin, cTnI (cTnI1-39), is a target for phosphorylation by protein kinase A (PKA) during β-adrenergic stimulation. We recently presented evidence indicating that this peptide interacts with the inhibitory peptide (cTnl137–147) when S23 and S24 are phosphorylated. The inhibitory peptide is also the target of the point mutation cTnI-R145G, which is associated with hypertrophic cardiomyopathy (HCM), a disease associated with sudden death in apparently healthy young adults. It has been shown that both phosphorylation and this mutation alter the cTnC-cTnI (C-I) interaction, which plays a crucial role in modulating contractile activation. However, little is known about the molecular-level events underlying this modulation. Here, we computationally investigated the effects of the cTnI-R145G mutation on the dynamics of cTn, cTnC Ca2+ handling, and the C-I interaction. Comparisons were made with the cTnI-R145G/S23D/S24D phosphomimic mutation, which has been used both experimentally and computationally to study the cTnI N-terminal specific effects of PKA phosphorylation. Additional comparisons between the phosphomimic mutations and the real phosphorylations were made. For this purpose, we ran triplicate 150 ns molecular dynamics simulations of cTnI-R145G Ca2+-bound cTnC1-161-cTnI1-172-cTnT236-285, cTnI-R145G/S23D/S24D Ca2+-bound cTnC1-161-cTnI1-172-cTnT236-285, and cTnI-R145G/PS23/PS24 Ca2+-bound cTnC1-161-cTnI1-172-cTnT236-285, respectively. We found that the cTnI-R145G mutation did not impact the overall dynamics of cTn, but stabilized crucial Ca2+-coordinating interactions. However, the phosphomimic mutations increased overall cTn fluctuations and destabilized Ca2+ coordination. Interestingly, cTnI-R145G blunted the intrasubunit interactions between the cTnI N-terminal extension and the cTnI inhibitory

  16. Effects of HCM cTnI mutation R145G on troponin structure and modulation by PKA phosphorylation elucidated by molecular dynamics simulations.

    PubMed

    Lindert, Steffen; Cheng, Yuanhua; Kekenes-Huskey, Peter; Regnier, Michael; McCammon, J Andrew

    2015-01-20

    Cardiac troponin (cTn) is a key molecule in the regulation of human cardiac muscle contraction. The N-terminal cardiac-specific peptide of the inhibitory subunit of troponin, cTnI (cTnI(1-39)), is a target for phosphorylation by protein kinase A (PKA) during β-adrenergic stimulation. We recently presented evidence indicating that this peptide interacts with the inhibitory peptide (cTnl(137-147)) when S23 and S24 are phosphorylated. The inhibitory peptide is also the target of the point mutation cTnI-R145G, which is associated with hypertrophic cardiomyopathy (HCM), a disease associated with sudden death in apparently healthy young adults. It has been shown that both phosphorylation and this mutation alter the cTnC-cTnI (C-I) interaction, which plays a crucial role in modulating contractile activation. However, little is known about the molecular-level events underlying this modulation. Here, we computationally investigated the effects of the cTnI-R145G mutation on the dynamics of cTn, cTnC Ca(2+) handling, and the C-I interaction. Comparisons were made with the cTnI-R145G/S23D/S24D phosphomimic mutation, which has been used both experimentally and computationally to study the cTnI N-terminal specific effects of PKA phosphorylation. Additional comparisons between the phosphomimic mutations and the real phosphorylations were made. For this purpose, we ran triplicate 150 ns molecular dynamics simulations of cTnI-R145G Ca(2+)-bound cTnC(1-161)-cTnI(1-172)-cTnT(236-285), cTnI-R145G/S23D/S24D Ca(2+)-bound cTnC(1-161)-cTnI(1-172)-cTnT(236-285), and cTnI-R145G/PS23/PS24 Ca(2+)-bound cTnC(1-161)-cTnI(1-172)-cTnT(236-285), respectively. We found that the cTnI-R145G mutation did not impact the overall dynamics of cTn, but stabilized crucial Ca(2+)-coordinating interactions. However, the phosphomimic mutations increased overall cTn fluctuations and destabilized Ca(2+) coordination. Interestingly, cTnI-R145G blunted the intrasubunit interactions between the cTnI N

  17. G1738R is a BRCA1 founder mutation in Greek breast/ovarian cancer patients: evaluation of its pathogenicity and inferences on its genealogical history.

    PubMed

    Anagnostopoulos, Theodore; Pertesi, Maroulio; Konstantopoulou, Irene; Armaou, Sofia; Kamakari, Smaragda; Nasioulas, George; Athanasiou, Athanassios; Dobrovic, Alex; Young, Mary-Anne; Goldgar, David; Fountzilas, George; Yannoukakos, Drakoulis

    2008-07-01

    We have performed screening in 287 breast/ovarian cancer families in Greece which has revealed that approximately 12% (8/65) of all index patients-carriers of a deleterious mutation in BRCA1 and BRCA2 genes, contain the base substitution G to A at position 5331 of BRCA1 gene. This generates the amino acid change G1738R for which based on a combination of genetic, in silico and histopathological analysis there are strong suggestions that it is a causative mutation. In this paper, we present further evidence suggesting the pathogenicity of this variant. Forty breast/ovarian cancer patients were reported in 11 Greek families: the above eight living in Greece, two living in Australia and one in USA, all containing G1738R. Twenty of these patients were screened and were all found to be carriers of the same base substitution. In addition, we have detected the same base change in five breast/ovarian cancer patients after screening 475 unselected patient samples with no apparent family history. The mean age of onset for all the above patients was 39.4 and 53.6 years for breast and ovarian cancer cases, respectively. A multi-factorial likelihood model for classification of unclassified variants in BRCA1 and BRCA2 developed previously was applied on G1738R and the odds of it being a deleterious mutation was estimated to be 11470:1. In order to explain the prevalence of this mutation mainly in the Greek population, its genealogical history was examined. DNA samples were collected from 11 carrier families living in Greece, Australia and USA. Screening of eight intragenic SNPs, three intragenic and seven extragenic microsatellite markers and comparison with control individuals, suggested a common origin for the mutation while the time to its most recent common ancestor was estimated to be 11 generations (about 275 years assuming a generational interval of 25 years) with a 1-lod support interval of 4-24 generations (100-600 years). Considering the large degree of genetic

  18. The RET p.G533C mutation confers predisposition to multiple endocrine neoplasia type 2A in a Brazilian kindred and is able to induce a malignant phenotype in vitro and in vivo.

    PubMed

    Oliveira, Mariana N L; Hemerly, Jefferson P; Bastos, André U; Tamanaha, Rosana; Latini, Flavia R M; Camacho, Cléber P; Impellizzeri, Anelise; Maciel, Rui M B; Cerutti, Janete M

    2011-09-01

    We have previously described a p.G533C substitution in the rearranged during transfection (RET) oncogene in a large family with medullary thyroid carcinoma. Here, we explore the functional transforming potential of RET p.G533C mutation. Plasmids expressing RET mutants (p.G533C and p.C634Y) and RET wild type were stable transfected into a rat thyroid cell line (PCCL3). Biological and biochemical effects of RET p.G533C were investigated both in vitro and in vivo. Moreover, we report the first case of pheochromocytoma among the RET p.G533C-carriers in this Brazilian family and explore the RET mutational status in DNA isolated from pheochromocytoma. Ectopic expression of RET p.G533C and p.C634Y activates RET/MAPK/ERK pathway at similar levels and significantly increased cell proliferation, compared with RET wild type. We additionally show that p.G533C increased cell viability, anchorage-independent growth, and micronuclei formation while reducing apoptosis, hallmarks of the malignant phenotype. RET p.G533C down-regulates the expression of thyroid specific genes in PCCL3. Moreover, RET p.G533C-expressing cells were able to induce liver metastasis in nude mice. Finally, we described two novel RET variants (G548V and S556T) in the DNA isolated from pheochromocytoma while they were absent in the DNA isolated from blood. Our in vitro and in vivo analysis indicates that this mutation confers a malignant phenotype to PCCL3 cells. These findings, in association with the report of first case of pheochromocytoma in the Brazilian kindred, suggest that this noncysteine mutation may be more aggressive than was initially considered.

  19. Similar Mutation Rates but Highly Diverse Mutation Spectra in Ascomycete and Basidiomycete Yeasts.

    PubMed

    Long, Hongan; Behringer, Megan G; Williams, Emily; Te, Ronald; Lynch, Michael

    2016-12-01

    Yeast species are extremely diverse and not monophyletic. Because the majority of yeast research focuses on ascomycetes, the mutational determinants of genetic diversity across yeast species are not well understood. By combining mutation-accumulation techniques with whole-genome sequencing, we resolved the genomic mutation rate and spectrum of the oleaginous (oil-producing) ‘red yeast’ Rhodotorula toruloides, the first such study in the fungal phylum Basidiomycota. We find that the mutation spectrum is quite different from what has been observed in all other studied unicellular eukaryotes, but similar to that in most bacteria—a predominance of transitions relative to transversions. Rhodotorula toruloides has a significantly higher A:T→G:C transition rate—possibly elevated by the abundant flanking G/C nucleotides in the GC-rich genome, as well as a much lower G:C→T:A transversion rate. In spite of these striking differences, there are substantial consistencies between R. toruloides and the ascomycete model yeasts: a spontaneous base-substitution mutation rate of 1.90 × 10 −10 per site per cell division as well as an elevated mutation rate at non-methylated 5'CpG3' sites. These results imply the evolution of variable mutation spectra in the face of similar mutation rates in yeasts.

  20. [Infantile hypophosphatasia caused by a novel compound heterozygous mutation: a case report and pedigree analysis].

    PubMed

    Li, Deng-Feng; Lan, Dan; Zhong, Jing-Zi; Dewan, Roma Kajal; Xie, Yan-Shu; Yang, Ying

    2017-05-01

    This article reported the clinical features of one child with infantile hypophosphatasia (HPP) and his pedigree information. The proband was a 5-month-old boy with multiple skeletal dysplasia (koilosternia, bending deformity of both radii, and knock-knee deformity of both knees), feeding difficulty, reduction in body weight, developmental delay, recurrent pneumonia and respiratory failure, and a significant reduction in blood alkaline phosphatase. Among his parents, sister, uncle, and aunt (other family members did not cooperate with us in the examination), his parents and aunt had a slight reduction in alkaline phosphatase and his aunt had scoliosis; there were no other clinical phenotypes or abnormal laboratory testing results. His ALPL gene mutation came from c.228delG mutation in his mother and c.407G>A compound heterozygous mutation in his father. His aunt carried c.228delG mutation. The c.407G>A mutation had been reported as the pathogenic mutation of HPP, and c.228delG mutation was a novel pathogenic mutation. Hypophosphatasia is caused by ALPL gene mutation, and ALPL gene detection is an effective diagnostic method. This study expands the mutation spectrum of ALPL gene and provides a theoretical basis for genetic diagnosis of this disease.

  1. A multiplex PCR for detection of knockdown resistance mutations, V1016G and F1534C, in pyrethroid-resistant Aedes aegypti.

    PubMed

    Saingamsook, Jassada; Saeung, Atiporn; Yanola, Jintana; Lumjuan, Nongkran; Walton, Catherine; Somboon, Pradya

    2017-10-10

    Mutation of the voltage-gated sodium channel (VGSC) gene, or knockdown resistance (kdr) gene, is an important resistance mechanism of the dengue vector Aedes aegypti mosquitoes against pyrethroids. In many countries in Asia, a valine to glycine substitution (V1016G) and a phenylalanine to cysteine substitution (F1534C) are common in Ae. aegypti populations. The G1016 and C1534 allele frequencies have been increasing in recent years, and hence there is a need to have a simple and inexpensive tool to monitor the alleles in large scale. A multiplex PCR to detect V1016G and F1534C mutations has been developed in the current study. This study utilized primers from previous studies for detecting the mutation at position 1016 and newly designed primers to detect variants at position 1534. The PCR conditions were validated and compared with DNA sequencing using known kdr mutant laboratory strains and field collected mosquitoes. The efficacy of this method was also compared with allele-specific PCR (AS-PCR). The results of our multiplex PCR were in complete agreement with sequencing data and better than the AS-PCR. In addition, the efficiency of two non-toxic DNA staining dyes, Ultrapower™ and RedSafe™, were evaluated by comparing with ethidium bromide (EtBr) and the results were satisfactory. Our multiplex PCR method is highly reliable and useful for implementing vector surveillance in locations where the two alleles co-occur.

  2. Rb Loss and KRAS Mutation Are Predictors of the Response to Platinum-Based Chemotherapy in Pancreatic Neuroendocrine Neoplasm with Grade 3: A Japanese Multicenter Pancreatic NEN-G3 Study.

    PubMed

    Hijioka, Susumu; Hosoda, Waki; Matsuo, Keitaro; Ueno, Makoto; Furukawa, Masayuki; Yoshitomi, Hideyuki; Kobayashi, Noritoshi; Ikeda, Masafumi; Ito, Tetsuhide; Nakamori, Shoji; Ishii, Hiroshi; Kodama, Yuzo; Morizane, Chigusa; Okusaka, Takuji; Yanagimoto, Hiroaki; Notohara, Kenji; Taguchi, Hiroki; Kitano, Masayuki; Yane, Kei; Maguchi, Hiroyuki; Tsuchiya, Yoshiaki; Komoto, Izumi; Tanaka, Hiroki; Tsuji, Akihito; Hashigo, Syunpei; Kawaguchi, Yoshiaki; Mine, Tetsuya; Kanno, Atsushi; Murohisa, Go; Miyabe, Katsuyuki; Takagi, Tadayuki; Matayoshi, Nobutaka; Yoshida, Tsukasa; Hara, Kazuo; Imamura, Masayuki; Furuse, Junji; Yatabe, Yasushi; Mizuno, Nobumasa

    2017-08-15

    Purpose: Patients with pancreatic neuroendocrine neoplasm grade-3 (PanNEN-G3) show variable responses to platinum-based chemotherapy. Recent studies indicated that PanNEN-G3 includes well-differentiated neuroendocrine tumor with G3 (NET-G3). Here, we examined the clinicopathologic and molecular features of PanNEN-G3 and assessed the responsiveness to chemotherapy and survival. Experimental Design: A total of 100 patients with PanNEN-G3 were collected from 31 institutions, and after central review characteristics of each histologic subtype [NET-G3 vs. pancreatic neuroendocrine carcinoma (NEC-G3)] were analyzed, including clinical, radiological, and molecular features. Factors that correlate with response to chemotherapy and survival were assessed. Results: Seventy patients analyzed included 21 NETs-G3 (30%) and 49 NECs-G3 (70%). NET-G3 showed lower Ki67-labeling index (LI; median 28.5%), no abnormal Rb expression (0%), and no mutated KRAS (0%), whereas NEC-G3 showed higher Ki67-LI (median 80.0%), Rb loss (54.5%), and KRAS mutations (48.7%). Chemotherapy response rate (RR), platinum-based chemotherapy RR, and prognosis differed significantly between NET-G3 and NEC-G3. Chemotherapeutic outcomes were worse in NET-G3 ( P < 0.001). When we stratified PanNEN-G3 with Rb and KRAS , PanNENs-G3 with Rb loss and those with mutated KRAS showed significantly higher RRs to platinum-based chemotherapy than those without (Rb loss, 80% vs. normal Rb, 24%, P = 0.006; mutated KRAS , 77% versus wild type, 23%, P = 0.023). Rb was a predictive marker of response to platinum-based chemotherapy even in NEC-G3 ( P = 0.035). Conclusions: NET-G3 and NEC-G3 showed distinct clinicopathologic characteristics. Notably, NET-G3 does not respond to platinum-based chemotherapy. Rb and KRAS are promising predictors of response to platinum-based chemotherapy for PanNEN-G3, and Rb for NEC-G3. Clin Cancer Res; 23(16); 4625-32. ©2017 AACR . ©2017 American Association for Cancer Research.

  3. Novel USH2A compound heterozygous mutations cause RP/USH2 in a Chinese family.

    PubMed

    Liu, Xiaowen; Tang, Zhaohui; Li, Chang; Yang, Kangjuan; Gan, Guanqi; Zhang, Zibo; Liu, Jingyu; Jiang, Fagang; Wang, Qing; Liu, Mugen

    2010-03-17

    To identify the disease-causing gene in a four-generation Chinese family affected with retinitis pigmentosa (RP). Linkage analysis was performed with a panel of microsatellite markers flanking the candidate genetic loci of RP. These loci included 38 known RP genes. The complete coding region and exon-intron boundaries of Usher syndrome 2A (USH2A) were sequenced with the proband DNA to screen the disease-causing gene mutation. Restriction fragment length polymorphism (RFLP) analysis and direct DNA sequence analysis were done to demonstrate co-segregation of the USH2A mutations with the family disease. One hundred normal controls were used without the mutations. The disease-causing gene in this Chinese family was linked to the USH2A locus on chromosome 1q41. Direct DNA sequence analysis of USH2A identified two novel mutations in the patients: one missense mutation p.G1734R in exon 26 and a splice site mutation, IVS32+1G>A, which was found in the donor site of intron 32 of USH2A. Neither the p.G1734R nor the IVS32+1G>A mutation was found in the unaffected family members or the 100 normal controls. One patient with a homozygous mutation displayed only RP symptoms until now, while three patients with compound heterozygous mutations in the family of study showed both RP and hearing impairment. This study identified two novel mutations: p.G1734R and IVS32+1G>A of USH2A in a four-generation Chinese RP family. In this study, the heterozygous mutation and the homozygous mutation in USH2A may cause Usher syndrome Type II or RP, respectively. These two mutations expand the mutant spectrum of USH2A.

  4. Novel mutations and mutation combinations of ryanodine receptor in a chlorantraniliprole resistant population of Plutella xylostella (L.)

    PubMed Central

    Guo, Lei; Liang, Pei; Zhou, Xuguo; Gao, Xiwu

    2014-01-01

    A previous study documented a glycine to glutamic acid mutation (G4946E) in ryanodine receptor (RyR) was highly correlated to diamide insecticide resistance in field populations of Plutella xylostella (Lepidoptera: Plutellidae). In this study, a field population collected in Yunnan province, China, exhibited a 2128-fold resistance to chlorantraniliprole. Sequence comparison between resistant and susceptible P. xylostella revealed three novel mutations including a glutamic acid to valine substitution (E1338D), a glutamine to leucine substitution (Q4594L) and an isoleucine to methionine substitution (I4790M) in highly conserved regions of RyR. Frequency analysis of all four mutations in this field population showed that the three new mutations showed a high frequency of 100%, while the G4946E had a frequency of 20%. Furthermore, the florescent ligand binding assay revealed that the RyR containing multiple mutations displayed a significantly lower affinity to the chlorantraniliprole. The combined results suggested that the co-existence of different combinations of the four mutations was involved in the chlorantraniliprole resistance. An allele-specific PCR based method was developed for the diagnosis of the four mutations in the field populations of P. xylostella. PMID:25377064

  5. Analysis of mutational characteristics of the drug-resistant gene katG in multi-drug resistant Mycobacterium tuberculosis L-form among patients with pneumoconiosis complicated with tuberculosis.

    PubMed

    Lu, Jun; Jiang, Shan; Liu, Qian-Ying; Ma, Shuai; Li, Ying; Li, Chao-Pin

    2014-05-01

    The aim of the present study was to investigate the mutational characteristics of drug‑resistant genetic mutations in the katG gene to isoniazid (INH) in multi‑drug resistant Mycobacterium tuberculosis (MTB) L‑form among patients with pneumoconiosis complicated with tuberculosis (TB), in order to reduce the occurrence of drug resistance in patients, and gain further insight into the mechanisms underlying drug resistance in MDR‑TB L‑form. A total of 114 clinically isolated strains of MTB L‑forms were collected. The MDR‑TB L‑forms were identified using a conventional antimicrobial susceptibility test (AST). The DNA genomes were extracted, the target genes were amplified by polymerase chain reaction technology and the hotspot mutational regions in the katG gene were analyzed by direct sequencing. The results of AST analysis demonstrated that there were 31 strains of MDR‑TB L‑forms in 114 clinical isolates. The mutation rate of katG was 61.29% (19/31) in INH‑resistant isolates, mainly concentrated in codon 315 (Ser315Thr, 48.39% and Ser315Asn, 9.68%) and 431 (Ala431Val, 3.23%). Base substitutions were identified, however, no multisite mutations were found. No mutations in katG were identified in 10 INH‑sensitive strains that were randomly selected. INH‑resistance was more severe in MDR‑TB L‑form isolates among patients with pneumoconiosis complicated with TB. The substitution of highly conserved amino acids encoded by the katG gene resulted in the molecular mechanisms responsible for INH resistance in MDR‑TB L‑form isolates. It was also verified that the katG gene was in diversiform. The katG Ser315Thr mutation is one of the main causes of resistance to INH in MDR‑TB L-form isolates.

  6. Investigation of prolific sheep from UK and Ireland for evidence on origin of the mutations in BMP15 (FecX(G), FecX(B)) and GDF9 (FecG(H)) in Belclare and Cambridge sheep.

    PubMed

    Mullen, Michael P; Hanrahan, James P; Howard, Dawn J; Powell, Richard

    2013-01-01

    This paper concerns the likely origin of three mutations with large effects on ovulation rate identified in the Belclare and Cambridge sheep breeds; two in the BMP15 gene (FecX(G) and FecX(B)) and the third (FecG(H)) in GDF9. All three mutations segregate in Belclare sheep while one, FecX(B), has not been found in the Cambridge. Both Belclare and Cambridge breeds are relatively recently developed composites that have common ancestry through the use of genetic material from the Finnish Landrace and Lleyn breeds. The development of both composites also involved major contributions from exceptionally prolific ewes screened from flocks in Ireland (Belclare) and Britain (Cambridge) during the 1960s. The objective of the current study was to establish the likely origin of the mutations (FecX(G), FecX(B) and FecG(H)) through analysis of DNA from Finnish Landrace and Lleyn sheep, and Galway and Texel breeds which contributed to the development of the Belclare breed. Ewes with exceptionally high prolificacy (hyper-prolific ewes) in current flocks on Irish farms were identified to simulate the screening of ewes from Irish flocks in the 1960s. DNA was obtained from: prolific ewes in extant flocks of Lleyn sheep (n = 44) on the Lleyn peninsula in Wales; hyper-prolific ewes (n = 41); prolific Galway (n = 41) ewes; Finnish Landrace (n = 124) and Texel (n = 19) ewes. The FecX(G) mutation was identified in Lleyn but not in Finnish Landrace, Galway or Texel sheep; FecX(B) was only found among the hyper-prolific ewes. The FecG(H) mutation was identified in the sample of Lleyn sheep. It was concluded from these findings that the Lleyn breed was the most likely source of the FecX(G) and FecG(H) mutations in Belclare and Cambridge sheep and that the FecX(B) mutation came from the High Fertility line that was developed using prolific ewes selected from commercial flocks in Ireland in the 1960's and subsequently used in the genesis of the Belclare.

  7. The hepcidin gene promoter nc.-1010C > T; -582A > G haplotype modulates serum ferritin in individuals carrying the common H63D mutation in HFE gene.

    PubMed

    Silva, Bruno; Pita, Lina; Gomes, Susana; Gonçalves, João; Faustino, Paula

    2014-12-01

    Hereditary hemochromatosis is an autosomal recessive disorder characterized by severe iron overload. It is usually associated with homozygosity for the HFE gene mutation c.845G > A; p.C282Y. However, in some cases, another HFE mutation (c.187C > G; p.H63D) seems to be associated with the disease. Its penetrance is very low, suggesting the possibility of other iron genetic modulators being involved. In this work, we have screened for HAMP promoter polymorphisms in 409 individuals presenting normal or increased serum ferritin levels together with normal or H63D-mutated HFE genotypes. Our results show that the hepcidin gene promoter TG haplotype, originated by linkage of the nc.-1010C > T and nc.-582A > G polymorphisms, is more frequent in the HFE_H63D individuals presenting serum ferritin levels higher than 300 μg/L than in those presenting the HFE_H63D mutation but with normal serum ferritin levels or in the normal control group.Moreover, it was observed that the TG haplotype was associated to increased serum ferritin levels in the overall pool of HFE_H63D individuals. Thus, our data suggest that screening for these polymorphisms could be of interest in order to explain the phenotype. However, this genetic condition seems to have no clinical significance.

  8. Autism-Associated Insertion Mutation (InsG) of Shank3 Exon 21 Causes Impaired Synaptic Transmission and Behavioral Deficits.

    PubMed

    Speed, Haley E; Kouser, Mehreen; Xuan, Zhong; Reimers, Jeremy M; Ochoa, Christine F; Gupta, Natasha; Liu, Shunan; Powell, Craig M

    2015-07-01

    SHANK3 (also known as PROSAP2) is a postsynaptic scaffolding protein at excitatory synapses in which mutations and deletions have been implicated in patients with idiopathic autism, Phelan-McDermid (aka 22q13 microdeletion) syndrome, and other neuropsychiatric disorders. In this study, we have created a novel mouse model of human autism caused by the insertion of a single guanine nucleotide into exon 21 (Shank3(G)). The resulting frameshift causes a premature STOP codon and loss of major higher molecular weight Shank3 isoforms at the synapse. Shank3(G/G) mice exhibit deficits in hippocampus-dependent spatial learning, impaired motor coordination, altered response to novelty, and sensory processing deficits. At the cellular level, Shank3(G/G) mice also exhibit impaired hippocampal excitatory transmission and plasticity as well as changes in baseline NMDA receptor-mediated synaptic responses. This work identifies clear alterations in synaptic function and behavior in a novel, genetically accurate mouse model of autism mimicking an autism-associated insertion mutation. Furthermore, these findings lay the foundation for future studies aimed to validate and study region-selective and temporally selective genetic reversal studies in the Shank3(G/G) mouse that was engineered with such future experiments in mind. Copyright © 2015 the authors 0270-6474/15/359648-18$15.00/0.

  9. A novel c.1037C > G (p.Ala346Gly) mutation in TP63 as cause of the ectrodactyly-ectodermal dysplasia and cleft lip/palate (EEC) syndrome

    PubMed Central

    Alves, Leandro Ucela; Pardono, Eliete; Otto, Paulo A.; Mingroni Netto, Regina Célia

    2015-01-01

    Ectrodactyly – ectodermal dysplasia and cleft lip/palate (EEC) syndrome (OMIM 604292) is a rare disorder determined by mutations in the TP63 gene. Most cases of EEC syndrome are associated to mutations in the DNA binding domain (DBD) region of the p63 protein. Here we report on a three-generation Brazilian family with three individuals (mother, son and grandfather) affected by EEC syndrome, determined by a novel mutation c.1037C > G (p.Ala346Gly). The disorder in this family exhibits a broad spectrum of phenotypes: two individuals were personally examined, one presenting the complete constellation of EEC syndrome manifestations and the other presenting an intermediate phenotype; the third affected, a deceased individual not examined personally and referred to by his daughter, exhibited only the split-hand/foot malformation (SHFM). Our findings contribute to elucidate the complex phenotype-genotype correlations in EEC syndrome and other related TP63-mutation syndromes. The possibility of the mutation c.1037C > G being related both to acro-dermato-ungual-lacrimal-tooth (ADULT) syndrome and SHFM is also raised by the findings here reported. PMID:25983622

  10. Prevalence of 845G>A HFE mutation in Slavic populations: an east-west linear gradient in South Slavs

    PubMed Central

    Adler, Grażyna; Clark, Jeremy S; Łoniewska, Beata; Ciechanowicz, Andrzej

    2011-01-01

    Aim To compare A allele frequencies of the 845G>A mutation of 10 Slavic populations in central, eastern, and southern Europe between each other and with other European populations. Methods The 845G>A mutation from the DNA of 400 Polish neonates collected in 2005-2006 was analyzed by polymerase chain reaction-restriction fragment length polymorphism. The data were compared with reports from other countries. Results We identified 381 GG homozygotes, 18 GA heterozygotes, and 1 AA homozygote. The 845A allele frequency was 2.5%, which makes the summary figure for Poland from this and previous studies 3.5%. The average prevalence for Poland and other West Slavic countries was 3.6%, similar to Russia (inhabited by the East Slavs, 3.5%). The average prevalence in South Slavic countries was 2.2%, gradually decreasing from 3.6% in Slovenia to 0% in Bulgaria, with a longitudinal linear gradient (adjusted R2 = 0.976, P < 0.001). Conclusions The West and East Slavs, together with Finland, Estonia, Germany, Austria, Hungary, Slovenia, and Croatia, form a group with 845A allele frequencies between 3% and 4%. In the South Slavs, there is a gradual decline in the prevalence of 845A allele from northwest to southeast, with a surprisingly exact east-west linear gradient. PMID:21674831

  11. Antisense Oligonucleotide-Based Splicing Correction in Individuals with Leber Congenital Amaurosis due to Compound Heterozygosity for the c.2991+1655A>G Mutation in CEP290.

    PubMed

    Duijkers, Lonneke; van den Born, L Ingeborgh; Neidhardt, John; Bax, Nathalie M; Pierrache, Laurence H M; Klevering, B Jeroen; Collin, Rob W J; Garanto, Alejandro

    2018-03-07

    Leber congenital amaurosis (LCA) is a rare inherited retinal disorder affecting approximately 1:50,000 people worldwide. So far, mutations in 25 genes have been associated with LCA, with CEP290 (encoding the Centrosomal protein of 290 kDa) being the most frequently mutated gene. The most recurrent LCA-causing CEP290 mutation, c.2991+1655A>G, causes the insertion of a pseudoexon into a variable proportion of CEP290 transcripts. We previously demonstrated that antisense oligonucleotides (AONs) have a high therapeutic potential for patients homozygously harbouring this mutation, although to date, it is unclear whether rescuing one single allele is enough to restore CEP290 function. Here, we assessed the AON efficacy at RNA, protein and cellular levels in samples that are compound heterozygous for this mutation, together with a protein-truncating mutation in CEP290 . We demonstrate that AONs can efficiently restore splicing and increase protein levels. However, due to a high variability in ciliation among the patient-derived cell lines, the efficacy of the AONs was more difficult to assess at the cellular level. This observation points towards the importance of the severity of the second allele and possibly other genetic variants present in each individual. Overall, AONs seem to be a promising tool to treat CEP290 -associated LCA, not only in homozygous but also in compound heterozygous carriers of the c.2991+1655A>G variant.

  12. [Epigenome: what we learned from Rett syndrome, a neurological disease caused by mutation of a methyl-CpG binding protein].

    PubMed

    Kubota, Takeo

    2013-01-01

    Epigenome is defined as DNA and histone modification-dependent gene regulation system. Abnormalities in this system are known to cause various neuro-developmental diseases. We recently reported that neurological symptoms of Rett syndrome, which is an autistic disorder caused by mutations in methyl-CpG binding protein 2 (MeCP2), was associated with failure of epigenomic gene regulation in neuronal cells, and that clinical differences in the identical twins with Rett syndrome in the differences in DNA methylation in neuronal genes, but not caused by DNA sequence differences. Since central nervus system requires precise gene regulation, neurological diseases including Alzheimer and Parkinson diseases may be caused by acquired DNA modification (epigenomic) changes that results in aberrant gene regulation as well as DNA sequence changes congenitally occurred (mutation).

  13. Insight into resistance mechanism of anaplastic lymphoma kinase to alectinib and JH-VIII-157-02 caused by G1202R solvent front mutation

    PubMed Central

    Wang, Han; Wang, Yao; Guo, Wentao; Du, Bin; Huang, Xiaobing; Wu, Riping; Yang, Baoyu; Lin, Xiaoyan; Wu, Yilan

    2018-01-01

    Background Mutated anaplastic lymphoma kinase (ALK) drives the development of advanced non-small cell lung cancer (NSCLC). Most reported small-molecule inhibitors targeting the ALK domain do not display good inhibition of the G1202R solvent front mutation. The solvent front mutation was assumed to hinder drug binding. However, a different fact could be uncovered by the simulations reported in this study through a structural analog of alectinib (JH-VIII-157-02), which demonstrated potent effects against the G1202R mutation. Methods Molecular docking, conventional molecular dynamics (MD) simulations, free energy calculations, and umbrella sampling (US) simulations were carried out to make clear the principles of the binding preferences of alectinib and JH-VIII-157-02 toward ALKWT and the ALK G1202R (ALKG1202R) mutation. Results JH-VIII-157-02 has similar binding affinities to both ALKWT and ALKG1202R whereas it has has a much lower binding affinity for alectinib to ALKG1202R. Analysis of individual energy terms indicate the major variation involves the van der Waals and entropy terms. Structural analysis reveals that the conformational change of the ATP-binding glycine-rich loop was primarily responsible for the alectinib resistance, not JH-VIII-157-02. In addition, US simulations prove JH-VIII-157-02 has similar dissociative processes from both ALKWT and ALKG1202R, while alectinib is more easily dissociated from ALKG1202R than from ALKWT, thus indicating lesser residence time. Conclusion Both the binding affinity and the drug residence time should be emphasized in rational drug design to overcome the G1202R solvent front mutation in ALK resistance. PMID:29785088

  14. CpG Island Methylator Phenotype-Low (CIMP-Low) in Colorectal Cancer: Possible Associations with Male Sex and KRAS Mutations

    PubMed Central

    Ogino, Shuji; Kawasaki, Takako; Kirkner, Gregory J.; Loda, Massimo; Fuchs, Charles S.

    2006-01-01

    The CpG island methylator phenotype (CIMP or CIMP-high) with extensive promoter methylation seems to be a distinct epigenotype of colorectal cancer. However, no study has comprehensively examined features of colorectal cancer with less extensive promoter methylation (designated as “CIMP-low”). Using real-time polymerase chain reaction (MethyLight), we quantified DNA methylation in five CIMP-specific gene promoters [CACNA1G, CDKN2A (p16), CRABP1, MLH1, and NEUROG1] in 840 relatively unbiased, population-based colorectal cancer samples, obtained from two large prospective cohort studies. CIMP-low (defined as 1/5 to 3/5 methylated promoters) colorectal cancers were significantly more common among men (38 versus 30% in women, P = 0.01) and among KRAS-mutated tumors (44 versus 30% in KRAS/BRAF wild-type tumors, P = 0.0003; 19% in BRAF-mutated tumors, P < 0.0001). In addition, KRAS mutations were significantly more common in CIMP-low tumors (47%) than in CIMP-high tumors (with ≥4/5 methylated promoters, 12%, P < 0.0001) and CIMP-0 tumors (with 0/5 methylated promoters, 37%, P = 0.007). The associations of CIMP-low tumors with male sex and KRAS mutations still existed after tumors were stratified by microsatellite instability status. In conclusion, CIMP-low colorectal cancer is associated with male sex and KRAS mutations. The hypothesis that CIMP-low tumors are different from CIMP-high and CIMP-0 tumors needs to be tested further. PMID:17065427

  15. CpG island methylator phenotype-low (CIMP-low) in colorectal cancer: possible associations with male sex and KRAS mutations.

    PubMed

    Ogino, Shuji; Kawasaki, Takako; Kirkner, Gregory J; Loda, Massimo; Fuchs, Charles S

    2006-11-01

    The CpG island methylator phenotype (CIMP or CIMP-high) with extensive promoter methylation seems to be a distinct epigenotype of colorectal cancer. However, no study has comprehensively examined features of colorectal cancer with less extensive promoter methylation (designated as "CIMP-low"). Using real-time polymerase chain reaction (MethyLight), we quantified DNA methylation in five CIMP-specific gene promoters [CACNA1G, CDKN2A (p16), CRABP1, MLH1, and NEUROG1] in 840 relatively unbiased, population-based colorectal cancer samples, obtained from two large prospective cohort studies. CIMP-low (defined as 1/5 to 3/5 methylated promoters) colorectal cancers were significantly more common among men (38 versus 30% in women, P = 0.01) and among KRAS-mutated tumors (44 versus 30% in KRAS/BRAF wild-type tumors, P = 0.0003; 19% in BRAF-mutated tumors, P < 0.0001). In addition, KRAS mutations were significantly more common in CIMP-low tumors (47%) than in CIMP-high tumors (with > or =4/5 methylated promoters, 12%, P < 0.0001) and CIMP-0 tumors (with 0/5 methylated promoters, 37%, P = 0.007). The associations of CIMP-low tumors with male sex and KRAS mutations still existed after tumors were stratified by microsatellite instability status. In conclusion, CIMP-low colorectal cancer is associated with male sex and KRAS mutations. The hypothesis that CIMP-low tumors are different from CIMP-high and CIMP-0 tumors needs to be tested further.

  16. Observation of c.260A > G mutation in superoxide dismutase 1 that causes p.Asn86Ser in Iranian amyotrophic lateral sclerosis patient and absence of genotype/phenotype correlation.

    PubMed

    Khani, Marzieh; Alavi, Afagh; Nafissi, Shahriar; Elahi, Elahe

    2015-07-06

    Amyotrophic lateral sclerosis (ALS) is the most common motor neuron disorder in European populations. ALS can be sporadic ALS (SALS) or familial ALS (FALS). Among 20 known ALS genes, mutations in C9orf72 and superoxide dismutase 1 (SOD1) are the most common genetic causes of the disease. Whereas C9orf72 mutations are more common in Western populations, the contribution of SOD1 to ALS in Iran is more than C9orf72. At present, a clear genotype/phenotype correlation for ALS has not been identified. We aimed to perform mutation screening of SOD1 in a newly identified Iranian FALS patient and to assess whether a genotype/phenotype correlation for the identified mutation exists. The five exons of SOD1 and flanking intronic sequences of a FALS proband were screened for mutations by direct sequencing. The clinical features of the proband were assessed by a neuromuscular specialist (SN). The phenotypic presentations were compared to previously reported patients with the same mutation. Heterozygous c.260A > G mutation in SOD1 that causes Asn86Ser was identified in the proband. Age at onset was 34 years and site of the first presentation was in the lower extremities. Comparisons of clinical features of different ALS patients with the same mutation evidenced variable presentations. The c.260A > G mutation in SOD1 that causes Asn86Ser appears to cause ALS with variable clinical presentations.

  17. Magnetic resonance spectroscopy and molecular studies in ornithine transcarbamylase deficiency novel mutation c.802A>G in exon 8 (p.Met268Val).

    PubMed

    Jamroz, E; Paprocka, J; Sokół, M; Popowska, E; Ciara, E

    2013-01-01

    Ornithine transcarbamylase (OTC) deficiency, an X-linked, semidominant disorder, is the most common inherited de-fect in ureagenesis, resulting in hyperammonaemia type II. The OTC gene, localised on chromosome X, has been mapp-ed to band Xp21.1, proximate to the Duchenne muscular dystrophy (DMD) gene. More than 350 different mutations, including missense, nonsense, splice-site changes, small de-letions or insertions and gross deletions, have been describ-ed so far. Almost all mutations in consensus splicing sites confer a neonatal phenotype. Most mutations in the OTC gene are 'private' and are distributed throughout the gene with a paucity of mutation in the sequence encoding the leader peptide (exon 1 and beginning of exon 2) and in exon 7. They have familial origin or occur de novo. Even with sequencing of the entire reading frame and exon/intron boundaries, only about 80% of the mutations are detected in patients with proven OTC deficiency. The remainder probably occur within the introns or in regulatory domains. The authors present a 4-year-old boy with the unreported missense mutation c.802A>G. The nucleotide transition leads to amino acid substitution Met to Val at codon 268 of the OTC protein.

  18. Mutation Analysis in Classical Phenylketonuria Patients Followed by Detecting Haplotypes Linked to Some PAH Mutations.

    PubMed

    Dehghanian, Fatemeh; Silawi, Mohammad; Tabei, Seyed M B

    2017-02-01

    Deficiency of phenylalanine hydroxylase (PAH) enzyme and elevation of phenylalanine in body fluids cause phenylketonuria (PKU). The gold standard for confirming PKU and PAH deficiency is detecting causal mutations by direct sequencing of the coding exons and splicing involved sequences of the PAH gene. Furthermore, haplotype analysis could be considered as an auxiliary approach for detecting PKU causative mutations before direct sequencing of the PAH gene by making comparisons between prior detected mutation linked-haplotypes and new PKU case haplotypes with undetermined mutations. In this study, 13 unrelated classical PKU patients took part in the study detecting causative mutations. Mutations were identified by polymerase chain reaction (PCR) and direct sequencing in all patients. After that, haplotype analysis was performed by studying VNTR and PAHSTR markers (linked genetic markers of the PAH gene) through application of PCR and capillary electrophoresis (CE). Mutation analysis was performed successfully and the detected mutations were as follows: c.782G>A, c.754C>T, c.842C>G, c.113-115delTCT, c.688G>A, and c.696A>G. Additionally, PAHSTR/VNTR haplotypes were detected to discover haplotypes linked to each mutation. Mutation detection is the best approach for confirming PAH enzyme deficiency in PKU patients. Due to the relatively large size of the PAH gene and high cost of the direct sequencing in developing countries, haplotype analysis could be used before DNA sequencing and mutation detection for a faster and cheaper way via identifying probable mutated exons.

  19. Pyruvate Kinase Deficiency in Sub-Saharan Africa: Identification of a Highly Frequent Missense Mutation (G829A;Glu277Lys) and Association with Malaria

    PubMed Central

    Machado, Patrícia; Manco, Licínio; Gomes, Cláudia; Mendes, Cristina; Fernandes, Natércia; Salomé, Graça; Sitoe, Luis; Chibute, Sérgio; Langa, José; Ribeiro, Letícia; Miranda, Juliana; Cano, Jorge; Pinto, João; Amorim, António; do Rosário, Virgílio E.; Arez, Ana Paula

    2012-01-01

    Background Pyruvate kinase (PK) deficiency, causing hemolytic anemia, has been associated to malaria protection and its prevalence in sub-Saharan Africa is not known so far. This work shows the results of a study undertaken to determine PK deficiency occurrence in some sub-Saharan African countries, as well as finding a prevalent PK variant underlying this deficiency. Materials and Methods Blood samples of individuals from four malaria endemic countries (Mozambique, Angola, Equatorial Guinea and Sao Tome and Principe) were analyzed in order to determine PK deficiency occurrence and detect any possible high frequent PK variant mutation. The association between this mutation and malaria was ascertained through association studies involving sample groups from individuals showing different malaria infection and outcome status. Results The percentage of individuals showing a reduced PK activity in Maputo was 4.1% and the missense mutation G829A (Glu277Lys) in the PKLR gene (only identified in three individuals worldwide to date) was identified in a high frequency. Heterozygous carrier frequency was between 6.7% and 2.6%. A significant association was not detected between either PK reduced activity or allele 829A frequency and malaria infection and outcome, although the variant was more frequent among individuals with uncomplicated malaria. Conclusions This was the first study on the occurrence of PK deficiency in several areas of Africa. A common PKLR mutation G829A (Glu277Lys) was identified. A global geographical co-distribution between malaria and high frequency of PK deficiency seems to occur suggesting that malaria may be a selective force raising the frequency of this 277Lys variant. PMID:23082140

  20. Patient derived mutation W257G of PPP2R1A enhances cancer cell migration through SRC-JNK-c-Jun pathway

    PubMed Central

    Jeong, Ae Lee; Han, Sora; Lee, Sunyi; Su Park, Jeong; Lu, Yiling; Yu, Shuangxing; Li, Jane; Chun, Kyung-Hee; Mills, Gordon B.; Yang, Young

    2016-01-01

    Mutation of PPP2R1A has been observed at high frequency in endometrial serous carcinomas but at low frequency in ovarian clear cell carcinoma. However, the biological role of mutation of PPP2R1A in ovarian and endometrial cancer progression remains unclear. In this study, we found that PPP2R1A expression is elevated in high-grade primary tumor patients with papillary serous tumors of the ovary. To determine whether increased levels or mutation of PPP2R1A might contribute to cancer progression, the effects of overexpression or mutation of PPP2R1A on cell proliferation, migration, and PP2A phosphatase activity were investigated using ovarian and endometrial cancer cell lines. Among the mutations, PPP2R1A-W257G enhanced cell migration in vitro through activating SRC-JNK-c-Jun pathway. Overexpression of wild type (WT) PPP2R1A increased its binding ability with B56 regulatory subunits, whereas PPP2R1A-mutations lost the ability to bind to most B56 subunits except B56δ. Total PP2A activity and PPP2R1A-associated PP2Ac activity were significantly increased in cells overexpressing PPP2R1A-WT. In addition, overexpression of PPP2R1A-WT increased cell proliferation in vitro and tumor growth in vivo. PMID:27272709

  1. Multiplex KRASG12/G13 mutation testing of unamplified cell-free DNA from the plasma of patients with advanced cancers using droplet digital polymerase chain reaction.

    PubMed

    Janku, F; Huang, H J; Fujii, T; Shelton, D N; Madwani, K; Fu, S; Tsimberidou, A M; Piha-Paul, S A; Wheler, J J; Zinner, R G; Naing, A; Hong, D S; Karp, D D; Cabrilo, G; Kopetz, E S; Subbiah, V; Luthra, R; Kee, B K; Eng, C; Morris, V K; Karlin-Neumann, G A; Meric-Bernstam, F

    2017-03-01

    Cell-free DNA (cfDNA) from plasma offers easily obtainable material for KRAS mutation analysis. Novel, multiplex, and accurate diagnostic systems using small amounts of DNA are needed to further the use of plasma cfDNA testing in personalized therapy. Samples of 16 ng of unamplified plasma cfDNA from 121 patients with diverse progressing advanced cancers were tested with a KRASG12/G13 multiplex assay to detect the seven most common mutations in the hotspot of exon 2 using droplet digital polymerase chain reaction (ddPCR). The results were retrospectively compared to mutation analysis of archival primary or metastatic tumor tissue obtained at different points of clinical care. Eighty-eight patients (73%) had KRASG12/G13 mutations in archival tumor specimens collected on average 18.5 months before plasma analysis, and 78 patients (64%) had KRASG12/G13 mutations in plasma cfDNA samples. The two methods had initial overall agreement in 103 (85%) patients (kappa, 0.66; ddPCR sensitivity, 84%; ddPCR specificity, 88%). Of the 18 discordant cases, 12 (67%) were resolved by increasing the amount of cfDNA, using mutation-specific probes, or re-testing the tumor tissue, yielding overall agreement in 115 patients (95%; kappa 0.87; ddPCR sensitivity, 96%; ddPCR specificity, 94%). The presence of ≥ 6.2% of KRASG12/G13 cfDNA in the wild-type background was associated with shorter survival (P = 0.001). Multiplex detection of KRASG12/G13 mutations in a small amount of unamplified plasma cfDNA using ddPCR has good sensitivity and specificity and good concordance with conventional clinical mutation testing of archival specimens. A higher percentage of mutant KRASG12/G13 in cfDNA corresponded with shorter survival. © The Author 2016. Published by Oxford University Press on behalf of the European Society for Medical Oncology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  2. Tricho-odonto-onycho-dermal dysplasia and WNT10A mutations.

    PubMed

    Kantaputra, P; Kaewgahya, M; Jotikasthira, D; Kantaputra, W

    2014-04-01

    We report on three novel (IVS2+1G>A splice site, c.1066G>T, and c.1039G>T, and one previously reported (c.637G>A) WNT10A mutations in three patients affected with odonto-onycho-dermal dysplasia (OODD; OMIM 275980). OODD is a rare form of autosomal recessive ectodermal dysplasia involving hair, teeth, nails, and skin, characterized by hypodontia (tooth agenesis), smooth tongue with marked reduction of filiform and fungiform papillae, nail dysplasia, dry skin, palmoplantar keratoderma, and hyperhidrosis of palms and soles. The novel IVS+1G>A splice site mutation is predicted to cause significant protein alteration. The other novel mutations we found including c.1066G>T and c.1039G>T are predicted to cause p.Gly356Cys and p.Glu347X, respectively. Barrel-shaped mandibular incisors and severe hypodontia appear to be associated with homozygous or compound heterozygous mutations of WNT10A. The name "tricho-odonto-onycho-dermal dysplasia" is suggested to replace "odonto-onycho-dermal dysplasia" because hair anomalies including hypotrichosis and slow-growing hair have been reported in numerous reported patients with this syndrome. © 2014 Wiley Periodicals, Inc.

  3. Analysis of alkaptonuria (AKU) mutations and polymorphisms reveals that the CCC sequence motif is a mutational hot spot in the homogentisate 1,2 dioxygenase gene (HGO).

    PubMed Central

    Beltrán-Valero de Bernabé, D; Jimenez, F J; Aquaron, R; Rodríguez de Córdoba, S

    1999-01-01

    We recently showed that alkaptonuria (AKU) is caused by loss-of-function mutations in the homogentisate 1,2 dioxygenase gene (HGO). Herein we describe haplotype and mutational analyses of HGO in seven new AKU pedigrees. These analyses identified two novel single-nucleotide polymorphisms (INV4+31A-->G and INV11+18A-->G) and six novel AKU mutations (INV1-1G-->A, W60G, Y62C, A122D, P230T, and D291E), which further illustrates the remarkable allelic heterogeneity found in AKU. Reexamination of all 29 mutations and polymorphisms thus far described in HGO shows that these nucleotide changes are not randomly distributed; the CCC sequence motif and its inverted complement, GGG, are preferentially mutated. These analyses also demonstrated that the nucleotide substitutions in HGO do not involve CpG dinucleotides, which illustrates important differences between HGO and other genes for the occurrence of mutation at specific short-sequence motifs. Because the CCC sequence motifs comprise a significant proportion (34.5%) of all mutated bases that have been observed in HGO, we conclude that the CCC triplet is a mutational hot spot in HGO. PMID:10205262

  4. Novel mutations in MYO7A and USH2A in Usher syndrome.

    PubMed

    Maubaret, Cécilia; Griffoin, Jean-Michel; Arnaud, Bernard; Hamel, Christian

    2005-03-01

    Usher syndrome is an autosomal recessive disease associating retinitis pigmentosa and neurosensory deafness. Three clinical types (USH1, USH2, USH3) and 11 mutated genes or loci have been described. Mutations in MYO7A and USH2A are responsible for about 40% and 60% of Usher syndromes type 1 and 2, respectively. These genes were screened in a series of patients suffering from Usher syndrome. We performed SSCP screening of MYO7A in 12 unrelated patients suffering from Usher syndrome type 1 (USH1) and USH2A in 28 unrelated patients affected by Usher syndrome type 2 (USH2). Six mutations in MYO7A were found in five patients, including two novel mutations c.397C > G (His133Asp) and 1244-2A > G (Glu459Stop), accounting for 42% of our USH1 patients. Twelve mutations in USH2A were found in 11 patients, including four new mutations c.850delGA, c.1841-2A > G, c.3129insT, and c.3920C > G (Ser1307Stop), accounting for 39% of our USH2 patients

  5. Identification of Mediterranean mutation in Egyptian favism patients.

    PubMed

    Osman, H G; Zahran, F M; El-Sokkary, A M A; El-Said, A; Sabry, A M

    2014-10-01

    Identify and screen the G6PD Mediterranean mutation in favism patients by applying a Amplification Refractory Mutation System Polymerase Chain Reaction (ARMS-PCR). A total of 114 unrelated Egyptians patients were included in the present study; their ages ranged between (2-9) years with male to female ratio 4.5:1. G6PD activity was determined qualitatively from red cell hemolysate during attack. The G6PD Mediterranean mutation in patients has been identified by ARMS-PCR. G6PD deficiency was detected in 87.7%, (n=100). The frequency of G6PD Mediterranean mutation was (94.7%), (n=108). The association between G6PD deficiency and Mediterranean mutation was a highly significant. Glucose-6-phosphate dehydrogenase Mediterranean mutation is one of the most common mutations causing G6PD deficiency among Egyptian children with favism.

  6. Mutation du gène NOD2 chez les patients marocains atteints de la maladie de Crohn: prévalence, étude génotypique et corrélation au phénotype de la maladie

    PubMed Central

    Tamzaourte, Mouna; Errabih, Ikram; Krami, Hayat; Maha, Fadlouallah; Maria, Lahmiri; Benzzoubeir, Nadia; Ouazzani, Laaziza; Sefiani, Ahmed; Ouazzani, Houria

    2017-01-01

    L'objectif était de déterminer la prévalence des mutations du gène NOD2/CARD15 dans un groupe de patients Marocains atteint de Maladie de Crohn et étudier sa corrélation génotype-expression phénotypique. Etude transversale cas témoin menée sur une durée de 16 mois. Ont été inclus 101 patients atteints de la maladie de Crohn, entre Janvier 2012 et Avril 2013 ainsi qu'un groupe contrôle de 107 patients. L'analyse génétique a consisté à rechercher 3 variants du gène NOD2: p.Arg702Trp, p.Gly908Arg et p.Leu1007fsins. Puis une étude de corrélation génotype-expression phénotypique a été menée. L'analyse génétique des patients atteint de maladie de crohn a mis en évidence la présence de la mutation NOD2 chez 14 patients (13,77%) contre 7 patients (6,53%) du groupe témoin. L'étude de la fréquence des différents allèles a retrouvé la mutation de p.Gly908Arg dans 6,43%, p.Leu1007fsins dans 0,99% et p.Arg702Trp dans 0,49% contre respectivement 2,80%, 0% et 0,46% dans le groupe témoin. L'étude de la corrélation génotype, expression phénotypique a démontré que la mutation CARD15 est corrélée à une localisation iléo-caecale de la maladie, à une présentation fistulisante et sténosante ainsi qu'à une évolution sévère avec recours fréquent à la chirurgie et aux immunosuppresseurs. La prévalence de la mutation NOD2/ CARD15 dans notre série est faible. Cette mutation est corrélée à une forme grave de la maladie. PMID:28819537

  7. Type 2 diabetes is associated with a common mitochondrial variant: evidence from a population-based case-control study.

    PubMed

    Poulton, Joanna; Luan, Jian'an; Macaulay, Vincent; Hennings, Susie; Mitchell, Jo; Wareham, Nicholas J

    2002-06-15

    Variants in mitochondrial DNA (mtDNA) could be associated with type 2 diabetes because ATP plays a critical role in the production and release of insulin. Diabetes can be precipitated both by mtDNA mutations and by exposure to mitochondrial poisons. The risk of inheriting diabetes from an affected mother is greater than that from an affected father, but this is not explained by maternally inherited diabetes and/or deafness (MIDD) caused by the 3243G : C mtDNA point mutation, which accounts for less than 0.5% of cases of diabetes. A common mtDNA variant (the 16189 variant) is positively correlated with blood fasting insulin, but there are no definitive studies demonstrating that it is associated with diabetes. We demonstrated a significant association between the 16189 variant and type 2 diabetes in a population-based case-control study in Cambridgeshire, UK (n=932, odds ratio=1.61 (1.0-2.7, P=0.048), which was greatly magnified in individuals with a family history of diabetes from the father's side (odds ratio=infinity; P<0.001).

  8. Long-term vemurafenib treatment drives inhibitor resistance through a spontaneous KRAS G12D mutation in a BRAF V600E papillary thyroid carcinoma model

    PubMed Central

    Danysh, Brian P.; Rieger, Erin Y.; Sinha, Deepankar K.; Evers, Caitlin V.; Cote, Gilbert J.; Cabanillas, Maria E.; Hofmann, Marie-Claude

    2016-01-01

    The BRAF V600E mutation is commonly observed in papillary thyroid cancer (PTC) and predominantly activates the MAPK pathway. Presence of BRAF V600E predicts increasing risk of recurrence and higher mortality rate, and treatment options for such patients are limited. Vemurafenib, a BRAF V600E inhibitor, is initially effective, but cells inevitably develop alternative mechanisms of pathway activation. Mechanisms of primary resistance have been described in short-term cultures of PTC cells; however, mechanisms of acquired resistance have not. In the present study, we investigated possible adaptive mechanisms of BRAF V600E inhibitor resistance in KTC1 thyroid cancer cells following long-term vemurafenib exposure. We found that a subpopulation of KTC1 cells acquired resistance to vemurafenib following 5 months of treatment with the inhibitor. Resistance coincided with the spontaneous acquisition of a KRAS G12D activating mutation. Increases in activated AKT, ERK1/2, and EGFR were observed in these cells. In addition, the resistant cells were less sensitive to combinations of vemurafenib and MEK1 inhibitor or AKT inhibitor. These results support the KRAS G12D mutation as a genetic mechanism of spontaneously acquired secondary BRAF inhibitor resistance in BRAF V600E thyroid cancer cells. PMID:27127178

  9. Consequences of missense mutations for dimerization and turnover of alanine:glyoxylate aminotransferase: study of a spectrum of mutations.

    PubMed

    Coulter-Mackie, M B; Lian, Q

    2006-12-01

    Alanine:glyoxylate aminotransferase (AGT) is a liver peroxisomal enzyme, deficiency of which results in primary hyperoxaluria type 1 (PH1). More than 65 PH1-related mutations are now documented in the AGT gene (AGXT), of which about 50% are missense. We have generated a spectrum of 15 missense changes including the most common PH1 mutation, G170R, and expressed them on the appropriate background of the major or minor allele, in an Escherichia coli overexpression system and in a rabbit reticulocyte transcription/translation system. We have investigated their effects on enzyme activity, dimerization, aggregation, and turnover. The effect of pyridoxal phosphate (PLP) on dimerization and stability was also investigated. Although all 15 mutant AGTs were expressed as intact proteins in E. coli, only three: G41R and G41V on the major allele, and the common mutation G170R, resulted in significant amounts of enzymatic activity. Dimerization failure was a frequent observation (13/15) except for G41V and D183N. Dimerization was poor with S187F but was substantially improved with PLP. Proteasome-mediated protein degradation was observed for all the mutations except G41R on the major allele, G41V, D183N, G170R, and S218L. Increases in the stability of the mutant enzymes in the presence of PLP were small; however, G41R on the minor allele showed a direct relationship between its half life and the concentration of PLP. The minor allele AGT product and many of the mutants were subject to a limited non-proteasomal proteolytic cleavage when ATP was depleted.

  10. Mitochondrial myopathy, lactic acidosis, and sideroblastic anemia (MLASA) plus associated with a novel de novo mutation (m.8969G>A) in the mitochondrial encoded ATP6 gene.

    PubMed

    Burrage, Lindsay C; Tang, Sha; Wang, Jing; Donti, Taraka R; Walkiewicz, Magdalena; Luchak, J Michael; Chen, Li-Chieh; Schmitt, Eric S; Niu, Zhiyv; Erana, Rodrigo; Hunter, Jill V; Graham, Brett H; Wong, Lee-Jun; Scaglia, Fernando

    2014-11-01

    Mitochondrial myopathy, lactic acidosis and sideroblastic anemia (MLASA) is a rare mitochondrial disorder that has previously been associated with mutations in PUS1 and YARS2. In the present report, we describe a 6-year old male with an MLASA plus phenotype. This patient had features of MLASA in the setting of developmental delay, sensorineural hearing loss, epilepsy, agenesis of the corpus callosum, failure to thrive, and stroke-like episodes. Sequencing of the mitochondrial genome identified a novel de novo, heteroplasmic mutation in the mitochondrial DNA (mtDNA) encoded ATP6 gene (m.8969G>A, p.S148N). Whole exome sequencing did not identify mutations or variants in PUS1 or YARS2 or any known nuclear genes that could affect mitochondrial function and explain this phenotype. Studies of fibroblasts derived from the patient revealed a decrease in oligomycin-sensitive respiration, a finding which is consistent with a complex V defect. Thus, this mutation in MT-ATP6 may represent the first mtDNA point mutation associated with the MLASA phenotype. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. GH-releasing hormone receptor gene: a novel splice-disrupting mutation and study of founder effects.

    PubMed

    Marui, Suemi; Trarbach, Ericka B; Boguszewski, Margaret C S; França, Marcela M; Jorge, Alexander A L; Inoue, Hiroshi; Nishi, Mirian Y; de Lacerda Filho, Luiz; Aguiar-Oliveira, Manuel H; Mendonca, Berenice B; Arnhold, Ivo J P

    2012-01-01

    Mutations in GH-releasing hormone receptor gene (GHRHR) are emerging as the most common cause of autosomal recessive isolated GH deficiency (IGHD). To search for GHRHR mutations in patients with familial or sporadic IGHD and to investigate founder effects in recurring mutations. The coding region of GHRHR was entirely amplified and sequenced from DNA of 18 patients with IGHD (16 unrelated) with topic posterior pituitary lobe on MRI. Haplotypes containing promoter SNPs and microsatellites flanking GHRHR were analyzed in patients with c.57+1G>A (IVS1+1G>A) mutation of our previously published kindred and also a Brazilian patient and 2 previously reported Japanese sisters with c.1146G>A (p.E382E) mutation. A novel homozygous intronic GHRHR c.752-1G>A (IVS7-1G>A) mutation, predicting loss of the constitutive splice acceptor site, was identified in two siblings with IGHD. A compound heterozygous c.[57+1G>A];[1146G>A] and a heterozygous c.527C>T (p.A176V) were found in two sporadic cases. Haplotype analysis provided evidence for a founder effect for the c.57+1G>A mutation and independent recurrence for the c.1146G>A mutation. We report a novel splice-disrupting mutation in GHRHR in 2 siblings and provide evidence that all c.57+1G>A (IVS1+1G>A) mutant chromosomes have the same haplotype ancestor, indicating the occurrence of a founder effect in Brazilian patients with IGHD. Copyright © 2012 S. Karger AG, Basel.

  12. Exploring the common molecular basis for the universal DNA mutation bias: Revival of Loewdin mutation model

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fu, Liang-Yu; Center for Bioinformatics, Huazhong Agricultural University, Wuhan 430070; Wang, Guang-Zhong

    2011-06-10

    Highlights: {yields} There exists a universal G:C {yields} A:T mutation bias in three domains of life. {yields} This universal mutation bias has not been sufficiently explained. {yields} A DNA mutation model proposed by Loewdin 40 years ago offers a common explanation. -- Abstract: Recently, numerous genome analyses revealed the existence of a universal G:C {yields} A:T mutation bias in bacteria, fungi, plants and animals. To explore the molecular basis for this mutation bias, we examined the three well-known DNA mutation models, i.e., oxidative damage model, UV-radiation damage model and CpG hypermutation model. It was revealed that these models cannot providemore » a sufficient explanation to the universal mutation bias. Therefore, we resorted to a DNA mutation model proposed by Loewdin 40 years ago, which was based on inter-base double proton transfers (DPT). Since DPT is a fundamental and spontaneous chemical process and occurs much more frequently within GC pairs than AT pairs, Loewdin model offers a common explanation for the observed universal mutation bias and thus has broad biological implications.« less

  13. CpG island methylator phenotype identifies high risk patients among microsatellite stable BRAF mutated colorectal cancers

    PubMed Central

    Vedeld, Hege Marie; Merok, Marianne; Jeanmougin, Marine; Danielsen, Stine A.; Honne, Hilde; Presthus, Gro Kummeneje; Svindland, Aud; Sjo, Ole H.; Hektoen, Merete; Eknæs, Mette; Nesbakken, Arild; Lothe, Ragnhild A.

    2017-01-01

    The prognostic value of CpG island methylator phenotype (CIMP) in colorectal cancer remains unsettled. We aimed to assess the prognostic value of this phenotype analyzing a total of 1126 tumor samples obtained from two Norwegian consecutive colorectal cancer series. CIMP status was determined by analyzing the 5‐markers CAGNA1G, IGF2, NEUROG1, RUNX3 and SOCS1 by quantitative methylation specific PCR (qMSP). The effect of CIMP on time to recurrence (TTR) and overall survival (OS) were determined by uni‐ and multivariate analyses. Subgroup analyses were conducted according to MSI and BRAF mutation status, disease stage, and also age at time of diagnosis (<60, 60‐74, ≥75 years). Patients with CIMP positive tumors demonstrated significantly shorter TTR and worse OS compared to those with CIMP negative tumors (multivariate hazard ratio [95% CI] 1.86 [1.31‐2.63] and 1.89 [1.34‐2.65], respectively). In stratified analyses, CIMP tumors showed significantly worse outcome among patients with microsatellite stable (MSS, P < 0.001), and MSS BRAF mutated tumors (P < 0.001), a finding that persisted in patients with stage II, III or IV disease, and that remained significant in multivariate analysis (P < 0.01). Consistent results were found for all three age groups. To conclude, CIMP is significantly associated with inferior outcome for colorectal cancer patients, and can stratify the poor prognostic patients with MSS BRAF mutated tumors. PMID:28542846

  14. Hereditary fructose intolerance: frequency and spectrum mutations of the aldolase B gene in a large patients cohort from France--identification of eight new mutations.

    PubMed

    Davit-Spraul, Anne; Costa, Catherine; Zater, Mokhtar; Habes, Dalila; Berthelot, Jacques; Broué, Pierre; Feillet, François; Bernard, Olivier; Labrune, Philippe; Baussan, Christiane

    2008-08-01

    We investigated the molecular basis of hereditary fructose intolerance (HFI) in 160 patients from 92 families by means of a PCR-based mutation screening strategy, consisting of restriction enzyme digestion and direct sequencing. Sixteen different mutations of the aldolase B (ALDOB) gene were identified in HFI patients. As in previous studies, p.A150P (64%), p.A175D (16%) and p.N335K (5%) were the most common mutated alleles, followed by p.R60X, p.A338V, c.360_363delCAAA (p.N120KfsX30), c.324G>A (p.K108K) and c.625-1G>A. Eight novel mutations were also identified in 10 families with HFI: a one-base deletion (c.146delT (p.V49GfsX27)), a small deletion (c.953del42bp), a small insertion (c.689ins TGCTAA (p.K230MfsX136)), one splice site mutation (c.112+1G>A), one nonsense mutation (c.444G>A (p.W148X)), and three missense mutations (c.170G>C (p.R57P), c.839C>A (p.A280P) and c.932T>C (p.L311P)). Our strategy allows to diagnose 75% of HFI patients using restriction enzymatic analysis and to enlarge the diagnosis to 97% of HFI patients when associated with direct sequencing.

  15. Identification of a founder BRCA1 mutation in the Moroccan population.

    PubMed

    Quiles, F; Teulé, À; Martinussen Tandstad, N; Feliubadaló, L; Tornero, E; Del Valle, J; Menéndez, M; Salinas, M; Wethe Rognlien, V; Velasco, A; Izquierdo, A; Capellá, G; Brunet, J; Lázaro, C

    2016-10-01

    Breast cancer (BC) is the most frequent cancer among women in Morocco. However, the role of the most prevalent BC-predisposing genes, BRCA1 and BRCA2, has been largely unexplored. To help define the role of BRCA1 in BC in Morocco, we characterized the first potential BRCA1 founder mutation in this population. Genetic testing of BRCA1 and BRCA2 in BC high-risk families identified mutation BRCA1 c.5309G>T, p.(Gly1770Val) or G1770V in five independent families from Morocco, suggesting a founder effect. To confirm this hypothesis, haplotype construction was performed using seven intragenic and flanking BRCA1 microsatellite markers. Clinical data were also compiled. Clinical data from carriers of mutation G1770V correspond to data from carriers of BRCA1 pathogenic mutations. Microsatellite analysis showed a common haplotype for the five families in a region comprising 1.54 Mb, confirming G1770V as the first specific founder BRCA1 mutation in the Moroccan population. Our findings contribute to a better understanding of BC genetics in the Moroccan population. Nevertheless, comprehensive studies of mutation G1770V in large series of BC patients from Morocco are needed to assess the real prevalence of this mutation and to improve genetic testing and risk assessment in this population. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  16. Homozygosity Mapping and Whole Exome Sequencing to Detect SLC45A2 and G6PC3 Mutations in a Single Patient with Oculocutaneous Albinism and Neutropenia

    PubMed Central

    Cullinane, Andrew R.; Vilboux, Thierry; O’Brien, Kevin; Curry, James A.; Maynard, Dawn M.; Carlson-Donohoe, Hannah; Ciccone, Carla; Markello, Thomas C.; Gunay-Aygun, Meral; Huizing, Marjan; Gahl, William A.

    2011-01-01

    We evaluated a 32 year-old woman whose oculocutaneous albinism, bleeding diathesis, neutropenia, and history of recurrent infections prompted consideration of the diagnosis of Hermansky-Pudlak syndrome type 2 (HPS-2). This was ruled out due to the presence of platelet delta granules and absence of AP3B1 mutations. Since parental consanguinity suggested an autosomal recessive mode of inheritance, we employed homozygosity mapping, followed by whole exome sequencing, to identify two candidate disease-causing genes, SLC45A2 and G6PC3. Conventional di-deoxy sequencing confirmed pathogenic mutations in SLC45A2, associated with oculocutaneous albinism type 4 (OCA-4), and G6PC3, associated with neutropenia. The substantial reduction of SLC45A2 protein in the patient’s melanocytes caused the mis-localization of tyrosinase from melanosomes to the plasma membrane and also led to the incorporation of tyrosinase into exosomes and secretion into the culture medium, explaining the hypopigmentation in OCA-4. Our patient’s G6PC3 mRNA expression level was also reduced, leading to increased apoptosis of her fibroblasts under ER stress. This report describes the first North American patient with OCA-4, the first culture of human OCA-4 melanocytes, and the use of homozygosity mapping followed by whole exome sequencing to identify disease-causing mutations in multiple genes in a single affected individual. PMID:21677667

  17. Degenerative myelopathy in German Shepherd Dog: comparison of two molecular assays for the identification of the SOD1:c.118G>A mutation.

    PubMed

    Capucchio, Maria Teresa; Spalenza, Veronica; Biasibetti, Elena; Bottero, Maria Teresa; Rasero, Roberto; Dalmasso, Alessandra; Sacchi, Paola

    2014-02-01

    Degenerative myelopathy (DM) is a late-onset, slowly progressive degeneration of spinal cord white matter which is reported primarily in large breed dogs. The missense mutation SOD1:c.118G>A is associated with this pathology in several dog breeds, including the German Shepherd Dog (GSD). The aims of the present study were to develop a tool for the rapid screening of the SOD1 mutation site in dogs and to evaluate the association of the polymorphism with DM in the German Shepherd breed. Two different techniques were compared: a minisequencing test and a real-time pcr allelic discrimination assay. Both approaches resulted effective and efficient. A sample of 47 dogs were examined. Ten subjects presented the symptoms of the illness; for one of them the diagnosis was confirmed by postmortem investigations and it resulted to be an A/A homozygote. In another clinically suspected dog, heterozygote A/G, the histopathological examination of the medulla showed moderate axon and myelin degenerative changes. GSD shows a frequency of the mutant allele equal to 0.17, quite high being a high-risk allele. Because canine DM has a late onset in adulthood and homozygous mutant dogs are likely as fertile as other genotypes, the natural selection is mild and the mutant allele may reach high frequencies. A diagnostic test, easy to implement, may contribute to control the gene diffusion in populations. The SOD1:c.118G>A mutation could be a useful marker for breeding strategies intending to reduce the incidence of DM.

  18. Factor V Leiden 1691G/A and prothrombin gene 20210G/A polymorphisms as prothrombotic markers in adult Egyptian acute leukemia patients.

    PubMed

    El Sissy, Azza Hamdy; El Sissy, Maha H; Elmoamly, Shereef

    2014-11-01

    Factor V Leiden 1691G/A and prothrombin gene 20210G/A mutations are the most common genetic defects leading to thrombosis. This work aimed to study the FV Leiden and the prothrombin gene polymorphism in adult Egyptian patients with acute leukemia and their importance in thrombophilia screening. The study included 76 patients with acute leukemia and 100 healthy controls. Genotyping was done by real-time polymerase chain reaction technique. For factor V Leiden, the frequency of G/A mutation conferred more than 2.5-fold of increased risk of (OR 2.639 95 % CI 1.045-6.669). The frequency of factor V Leiden combined (G/A + A/A) genotypes conferred 2.83-fold of increased risk (OR 2.828, CI 1.13-7.075), The A allele conferred almost threefold increased risk (OR 2.824, 95 % CI 1.175-6.785). Despite higher frequency in patients compared to controls, there was no risk of association between prothrombin gene mutation and acute leukemia in adult Egyptians nor was there between combined genotypes of prothrombin gene mutation and factor V Leiden.

  19. Hot-Spot Residues to be Mutated Common in G Protein-Coupled Receptors of Class A: Identification of Thermostabilizing Mutations Followed by Determination of Three-Dimensional Structures for Two Example Receptors.

    PubMed

    Yasuda, Satoshi; Kajiwara, Yuta; Toyoda, Yosuke; Morimoto, Kazushi; Suno, Ryoji; Iwata, So; Kobayashi, Takuya; Murata, Takeshi; Kinoshita, Masahiro

    2017-07-06

    G protein-coupled receptors (GPCRs), which are indispensable to life and also implicated in a number of diseases, construct important drug targets. For the efficient structure-guided drug design, however, their structural stabilities must be enhanced. An amino-acid mutation is known to possibly lead to the enhancement, but currently available experimental and theoretical methods for identifying stabilizing mutations suffer such drawbacks as the incapability of exploring the whole mutational space with minor effort and the unambiguous physical origin of the enhanced or lowered stability. In general, after the identification is successfully made for a GPCR, the whole procedure must be followed all over again for the identification for another GPCR. Here we report a theoretical strategy by which many different GPCRs can be considered at the same time. The strategy is illustrated for three GPCRs of Class A in the inactive state. We argue that a mutation of the residue at a position of N BW = 3.39 (N BW is the Ballesteros-Weinstein number), a hot-spot residue, leads to substantially higher stability for significantly many GPCRs of Class A in the inactive state. The most stabilizing mutations of the residues with N BW = 3.39 are then identified for two of the three GPCRs, using the improved version of our free-energy function. These identifications are experimentally corroborated, which is followed by the determination of new three-dimensional (3D) structures for the two GPCRs. We expect that on the basis of the strategy, the 3D structures of many GPCRs of Class A can be solved for the first time in succession.

  20. Novel mutations in PANK2 and PLA2G6 genes in patients with neurodegenerative disorders: two case reports.

    PubMed

    Dastsooz, Hassan; Nemati, Hamid; Fard, Mohammad Ali Farazi; Fardaei, Majid; Faghihi, Mohammad Ali

    2017-08-18

    Neurodegeneration with brain iron accumulation (NBIA) is a genetically heterogeneous group of disorders associated with progressive impairment of movement, vision, and cognition. The disease is initially diagnosed on the basis of changes in brain magnetic resonance imaging which indicate an abnormal brain iron accumulation in the basal ganglia. However, the diagnosis of specific types should be based on both clinical findings and molecular genetic testing for genes associated with different types of NBIA, including PANK2, PLA2G6, C19orf12, FA2H, ATP13A2, WDR45, COASY, FTL, CP, and DCAF17. The purpose of this study was to investigate disease-causing mutations in two patients with distinct NBIA disorders. Whole Exome sequencing using Next Generation Illumina Sequencing was used to enrich all exons of protein-coding genes as well as some other important genomic regions in these two affected patients. A deleterious homozygous four-nucleotide deletion causing frameshift deletion in PANK2 gene (c.1426_1429delATGA, p.M476 fs) was identified in an 8 years old girl with dystonia, bone fracture, muscle rigidity, abnormal movement, lack of coordination and chorea. In addition, our study revealed a novel missense mutation in PLA2G6 gene (c.3G > T:p.M1I) in one and half-year-old boy with muscle weakness and neurodevelopmental regression (speech, motor and cognition). The novel mutations were also confirmed by Sanger sequencing in the proband and their parents. Current study uncovered two rare novel mutations in PANK2 and PLA2G6 genes in patients with NBIA disorder and such studies may help to conduct genetic counseling and prenatal diagnosis more accurately for individuals at the high risk of these types of disorders.

  1. [Mutation analysis for a pedigree affected with keratitis-ichthyosis-deafness syndrome].

    PubMed

    Li, Lulu; Li, Yuan; Lin, Wei; Zhao, Xiuli

    2017-10-10

    To identify mutation of GJB2 gene and provide genetic counseling for a family affected with keratitis-ichthyosis-deafness (KID) syndrome. Genomic DNA was extracted from peripheral blood samples with a standard phenol-chloroform method. PCR and Sanger sequencing were used to analyze potential mutation in the proband. Suspected mutation was verified with a PCR-high-resolution melting (PCR-HRM) method. T-clone sequencing was applied to determine the parental origin of the mutation. A heterozygous mutation, c.148G>A (p.Asp50Asn), which is located in the exon 1 of the GJB2 gene, was found in the proband. The results was confirmed by HRM analysis. Cloning sequencing suggested that the mutation was derived from the father's germline. The hot-spot mutation c.148G>A (p.Asp50Asn) in the GJB2 gene probably underlies the KID syndrome in this Chinese family. A PCR-HRM method has been established to rapidly detect common mutations associated with this disease.

  2. Effect of the R119G mutation on human P5CR structure and its interactions with NAD: Insights derived from molecular dynamics simulation and free energy analysis.

    PubMed

    Sang, Peng; Xie, Yue-Hui; Li, Lin-Hua; Ye, Yu-Jia; Hu, Wei; Wang, Jing; Wan, Wen; Li, Rui; Li, Long-Jun; Ma, Lin-Ling; Li, Zhi; Liu, Shu-Qun; Meng, Zhao-Hui

    2017-04-01

    Pyrroline-5-carboxylate reductase (P5CR), an enzyme with conserved housekeeping roles, is involved in the etiology of cutis laxa. While previous work has shown that the R119G point mutation in the P5CR protein is involved, the structural mechanism behind the pathology remains to be elucidated. In order to probe the role of the R119G mutation in cutis laxa, we performed molecular dynamics (MD) simulations, essential dynamics (ED) analysis, and Molecular mechanics Poisson-Boltzmann surface area (MM-PBSA) binding free energy calculations on wild type (WT) and mutant P5CR-NAD complex. These MD simulations and ED analyses suggest that the R119G mutation decreases the flexibility of P5CR, specifically in the substrate binding pocket, which could decrease the kinetics of the cofactor entrance and egress. Furthermore, the MM-PBSA calculations suggest the R119G mutant has a lower cofactor binding affinity for NAD than WT. Our study provides insight into the possible role of the R119G mutation during interactions between P5CR and NAD, thus bettering our understanding of how the mutation promotes cutis laxa. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Functional studies of p.R132C, p.R149C, p.M283V, p.E431K, and a novel c.652-2A>G mutations of the CYP21A2 gene.

    PubMed

    Taboas, Melisa; Gómez Acuña, Luciana; Scaia, María Florencia; Bruque, Carlos D; Buzzalino, Noemí; Stivel, Mirta; Ceballos, Nora R; Dain, Liliana

    2014-01-01

    Congenital adrenal hyperplasia (CAH) due to 21-hydroxylase deficiency is the most frequent inborn error of metabolism and accounts for 90-95% of CAH cases. In the present work, we analyzed the functional consequence of four novel previously reported point CYP21A2 mutations -p.R132C, p.R149C, p.M283V, p.E431K- found in Argentinean 21-hydroxylase deficient patients. In addition, we report an acceptor splice site novel point mutation, c.652-2A>G, found in a classical patient in compound heterozygosity with the rare p.R483Q mutation. We performed bioinformatic and functional assays to evaluate the biological implication of the novel mutation. Our analyses revealed that the residual enzymatic activity of the isolated mutants coding for CYP21A2 aminoacidic substitutions was reduced to a lesser than 50% of the wild type with both progesterone and 17-OH progesterone as substrates. Accordingly, all the variants would predict mild non-classical alleles. In one non-classical patient, the p.E431K mutation was found in cis with the p.D322G one. The highest decrease in enzyme activity was obtained when both mutations were assayed in the same construction, with a residual activity most likely related to the simple virilizing form of the disease. For the c.652-2A>G mutation, bioinformatic tools predicted the putative use of two different cryptic splicing sites. Nevertheless, functional analyses revealed the use of only one cryptic splice acceptor site located within exon 6, leading to the appearance of an mRNA with a 16 nt deletion. A severe allele is strongly suggested due to the presence of a premature stop codon in the protein only 12 nt downstream.

  4. Functional Studies of p.R132C, p.R149C, p.M283V, p.E431K, and a Novel c.652-2A>G Mutations of the CYP21A2 Gene

    PubMed Central

    Taboas, Melisa; Gómez Acuña, Luciana; Scaia, María Florencia; Bruque, Carlos D.; Buzzalino, Noemí; Stivel, Mirta

    2014-01-01

    Congenital adrenal hyperplasia (CAH) due to 21-hydroxylase deficiency is the most frequent inborn error of metabolism and accounts for 90–95% of CAH cases. In the present work, we analyzed the functional consequence of four novel previously reported point CYP21A2 mutations -p.R132C, p.R149C, p.M283V, p.E431K- found in Argentinean 21-hydroxylase deficient patients. In addition, we report an acceptor splice site novel point mutation, c.652-2A>G, found in a classical patient in compound heterozygosity with the rare p.R483Q mutation. We performed bioinformatic and functional assays to evaluate the biological implication of the novel mutation. Our analyses revealed that the residual enzymatic activity of the isolated mutants coding for CYP21A2 aminoacidic substitutions was reduced to a lesser than 50% of the wild type with both progesterone and 17-OH progesterone as substrates. Accordingly, all the variants would predict mild non-classical alleles. In one non-classical patient, the p.E431K mutation was found in cis with the p.D322G one. The highest decrease in enzyme activity was obtained when both mutations were assayed in the same construction, with a residual activity most likely related to the simple virilizing form of the disease. For the c.652-2A>G mutation, bioinformatic tools predicted the putative use of two different cryptic splicing sites. Nevertheless, functional analyses revealed the use of only one cryptic splice acceptor site located within exon 6, leading to the appearance of an mRNA with a 16 nt deletion. A severe allele is strongly suggested due to the presence of a premature stop codon in the protein only 12 nt downstream. PMID:24667412

  5. Identification of Bangladeshi domestic cats with GM1 gangliosidosis caused by the c.1448G>C mutation of the feline GLB1 gene: case study.

    PubMed

    Uddin, Mohammad Mejbah; Hossain, Mohammad Alamgir; Rahman, Mohammad Mahbubur; Chowdhury, Morshedul Alam; Tanimoto, Takeshi; Yabuki, Akira; Mizukami, Keijiro; Chang, Hye-Sook; Yamato, Osamu

    2013-01-01

    GM1 gangliosidosis is a fatal, progressive neurodegenerative lysosomal storage disease caused by mutations in the β-galactosidase (GLB1) gene. In feline GM1 gangliosidosis, a pathogenic mutation (c.1448G>C) in the feline GLB1 gene was identified in Siamese cats in the United States and Japan and in Korat cats in Western countries. The present study found the homozygous c.1448G>C mutation in 2 apparent littermate native kittens in Bangladesh that were exhibiting neurological signs. This is the first identification of GM1 gangliosidosis in native domestic cats in Southeast Asia. This pathogenic mutation seems to have been present in the domestic cat population in the Siamese region and may have been transferred to pure breeds such as Siamese and Korat cats originating in this region.

  6. Computational design of thermostabilizing point mutations for G protein-coupled receptors

    PubMed Central

    Popov, Petr; Peng, Yao; Shen, Ling; Stevens, Raymond C; Cherezov, Vadim; Liu, Zhi-Jie

    2018-01-01

    Engineering of GPCR constructs with improved thermostability is a key for successful structural and biochemical studies of this transmembrane protein family, targeted by 40% of all therapeutic drugs. Here we introduce a comprehensive computational approach to effective prediction of stabilizing mutations in GPCRs, named CompoMug, which employs sequence-based analysis, structural information, and a derived machine learning predictor. Tested experimentally on the serotonin 5-HT2C receptor target, CompoMug predictions resulted in 10 new stabilizing mutations, with an apparent thermostability gain ~8.8°C for the best single mutation and ~13°C for a triple mutant. Binding of antagonists confers further stabilization for the triple mutant receptor, with total gains of ~21°C as compared to wild type apo 5-HT2C. The predicted mutations enabled crystallization and structure determination for the 5-HT2C receptor complexes in inactive and active-like states. While CompoMug already shows high 25% hit rate and utility in GPCR structural studies, further improvements are expected with accumulation of structural and mutation data. PMID:29927385

  7. G119S ace-1 mutation conferring insecticide resistance detected in the Culex pipiens complex in Morocco.

    PubMed

    Bkhache, Meriem; Tmimi, Fatim-Zohra; Charafeddine, Omar; Benabdelkrim Filali, Oumama; Lemrani, Meryem; Labbé, Pierrick; Sarih, M'hammed

    2018-06-09

    Arboviruses are controlled through insecticide control of their mosquito vector. However, inconsiderate use of insecticides often results in the selection of resistance in treated populations, so that monitoring is required to optimize their usage. Here, Culex pipiens (West Nile and Rift Valley Fever virus vector) specimens were collected from four Moroccan cities. Levels of susceptibility to the organophosphate (OP) insecticide malathion were assessed using WHO-recommended bioassays. Individual mosquitoes were tested for the presence of the G119S mutation in the ace-1 gene, the main OP-target resistance mutation. Bioassays showed that mosquitoes from Mohammedia were significantly more resistant to malathion than those from Marrakech. Analyzing the ace-1 genotypes in dead and surviving individuals suggested that other resistance mechanisms may be present in Mohammedia. The ace-1 resistance allele frequencies were relatively moderate (<0.4). Their analyses in three Moroccan cities (Tangier, Casablanca and Marrakech) however showed disparities between two coexisting Cx. pipiens forms and revealed that the G119S mutation tends to be more frequent in urban than in rural collections sites. These findings provide a reference assessment of OP resistance in Morocco and should help the health authorities to develop informed and sustainable vector control programs. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  8. Colorectal Carcinomas With CpG Island Methylator Phenotype 1 Frequently Contain Mutations in Chromatin Regulators

    PubMed Central

    Tahara, Tomomitsu; Yamamoto, Eiichiro; Madireddi, Priyanka; Suzuki, Hiromu; Maruyama, Reo; Chung, Woonbok; Garriga, Judith; Jelinek, Jaroslav; Yamano, Hiro-o; Sugai, Tamotsu; Kondo, Yutaka; Toyota, Minoru; Issa, Jean-Pierre J.; Estécio, Marcos R. H.

    2014-01-01

    BACKGROUND & AIMS Subgroups of colorectal carcinomas (CRCs) characterized by DNA methylation anomalies are termed CpG island methylator phenotype (CIMP)1, CIMP2, or CIMP-negative. The pathogenesis of CIMP1 colorectal carcinomas, and their effects on patients’ prognoses and responses to treatment, differ from those of other CRCs. We sought to identify genetic somatic alterations associated with CIMP1 CRCs. METHODS We examined genomic DNA samples from 100 primary CRCs, 10 adenomas, and adjacent normal-appearing mucosae from patients undergoing surgery or colonoscopy at 3 tertiary medical centers. We performed exome sequencing of 16 colorectal tumors and their adjacent normal tissues. Extensive comparison with known somatic alterations in CRCs allowed segregation of CIMP1-exclusive alterations. The prevalence of mutations in selected genes was determined from an independent cohort. RESULTS We found that genes that regulate chromatin were mutated in CIMP1 CRCs; the highest rates of mutation were observed in CHD7 and CHD8, which encode members of the chromodomain helicase/adenosine triphosphate—dependent chromatin remodeling family. Somaticmutations in these 2 genes were detected in 5 of 9 CIMP1 CRCs. A prevalence screen showed that nonsilencing mutations in CHD7 and CHD8 occurred significantly more frequently in CIMP1 tumors (18 of 42 [43%]) than in CIMP2 (3 of 34 [9%]; P < .01) or CIMP-negative tumors (2 of 34 [6%]; P < .001). CIMP1 markers had increased binding by CHD7, compared with all genes. Genes altered in patients with CHARGE syndrome (congenital malformations involving the central nervous system, eye, ear, nose, and mediastinal organs) who had CHD7 mutations were also altered in CRCs with mutations in CHD7. CONCLUSIONS Aberrations in chromatin remodeling could contribute to the development of CIMP1 CRCs. A better understanding of the biological determinants of CRCs can be achieved when these tumors are categorized according to their epigenetic status. PMID

  9. Remarkable stabilization of a psychrotrophic RNase HI by a combination of thermostabilizing mutations identified by the suppressor mutation method.

    PubMed

    Tadokoro, Takashi; Matsushita, Kyoko; Abe, Yumi; Rohman, Muhammad Saifur; Koga, Yuichi; Takano, Kazufumi; Kanaya, Shigenori

    2008-08-05

    Ribonuclease HI from the psychrotrophic bacterium Shewanella oneidensis MR-1 (So-RNase HI) is much less stable than Escherichia coli RNase HI (Ec-RNase HI) by 22.4 degrees C in T m and 12.5 kJ mol (-1) in Delta G(H 2O), despite their high degrees of structural and functional similarity. To examine whether the stability of So-RNase HI increases to a level similar to that of Ec-RNase HI via introduction of several mutations, the mutations that stabilize So-RNase HI were identified by the suppressor mutation method and combined. So-RNase HI and its variant with a C-terminal four-residue truncation (154-RNase HI) complemented the RNase H-dependent temperature-sensitive (ts) growth phenotype of E. coli strain MIC3001, while 153-RNase HI with a five-residue truncation could not. Analyses of the activity and stability of these truncated proteins suggest that 153-RNase HI is nonfunctional in vivo because of a great decrease in stability. Random mutagenesis of 153-RNase HI using error-prone PCR, followed by screening for the revertants, allowed us to identify six single suppressor mutations that make 153-RNase HI functional in vivo. Four of them markedly increased the stability of the wild-type protein by 3.6-6.7 degrees C in T m and 1.7-5.2 kJ mol (-1) in Delta G(H 2O). The effects of these mutations were nearly additive, and combination of these mutations increased protein stability by 18.7 degrees C in T m and 12.2 kJ mol (-1) in Delta G(H 2O). These results suggest that several residues are not optimal for the stability of So-RNase HI, and their replacement with other residues strikingly increases it to a level similar to that of the mesophilic counterpart.

  10. hOGG1 Ser326Cys polymorphism and G:C-to-T:A mutations: no evidence for a role in tobacco-related non small cell lung cancer.

    PubMed

    Hu, Ying Chuan; Ahrendt, Steven A

    2005-04-10

    Human 8-oxoguanine DNA glycosylase 1 (hOGG1) plays a major role in the repair of 8-hydroxyguanine, one of the major forms of DNA damage generated by reactive oxygen species in tobacco smoke. If left unrepaired by hOGG1, 8-hydroxyguanine can produce G:C-to-T:A transversions. Recent studies have suggested that the hOGG1 Ser326Cys polymorphism is associated with both a decrease in enzyme activity and an increased risk of lung cancer. To define the interaction between tobacco carcinogens, hOGG1-mediated DNA repair and DNA damage, we examined the role of the hOGG1 Ser326Cys polymorphism in mutation of the p53 gene in non small cell lung cancer (NSCLC). Tumor and nonneoplastic DNA were collected from 141 cigarette smokers with NSCLC. p53 mutations were detected by direct dideoxy sequencing and/or the GeneChip p53 assay in 74 of the 141 (52%) tumors. hOGG1 codon 326 polymorphisms were identified by polymerase chain reaction-restriction fragment length polymorphism analysis. The distribution of hOGG1 codon 326 genotypes was Ser/Ser, 90 of 141 (64%); Ser/Cys, 45 of 141 (32%); and Cys/Cys, 6 of 141 (4%). p53 mutations were significantly (p = 0.04) less common in NSCLC from patients with codon 326 Ser/Cys or Cys/Cys genotypes (21 of 51; 41%) than in NSCLC from Ser/Ser homozygotes (53 of 90; 59%). The decrease in p53 mutation frequency among carriers of the Cys allele was more evident in lung squamous cell cancer [7 of 17 (41%) for Cys/Cys and Ser/Cys vs. 27 of 38 (71%) for Ser/Ser; p = 0.04] than in nonbronchoalveolar adenocarcinoma [11 of 26 (42%) for Cys/Cys and Ser/Cys vs. 20 of 35 (57%) for Ser/Ser; p = 0.25]. The prevalence of G:C-to-T:A transversions was similar among hOGG1 codon 326 genotypes. In summary, the hOGG1 codon 326 Cys allele was associated with a decrease in p53 mutations and no effect on G:C-to-T:A transversions in NSCLC. This decrease in p53 mutations in vivo is not consistent with a decrease in the repair of 8-hydroxyguanine among carriers of the hOGG1

  11. Emergence of EGFR G724S mutation in EGFR-mutant lung adenocarcinoma post progression on osimertinib.

    PubMed

    Oztan, A; Fischer, S; Schrock, A B; Erlich, R L; Lovly, C M; Stephens, P J; Ross, J S; Miller, V; Ali, S M; Ou, S-H I; Raez, L E

    2017-09-01

    Mutations in the epidermal growth factor receptor (EGFR) are drivers for a subset of lung cancers. Osimertinib is a third-generation tyrosine kinase inhibitor (TKI) recently approved for the treatment of T790M-positive non-small cell lung cancer (NSCLC); however, acquired resistance to osimertinib is evident and resistance mechanisms remain incompletely defined. The EGFR G724S mutation was detected using hybrid-capture based comprehensive genomic profiling (CGP) and a hybrid-capture based circulating tumor DNA (ctDNA) assays in two cases of EGFR-driven lung adenocarcinoma in patients who had progressed on osimertinib treatment. This study demonstrates the importance of both tissue and blood based hybrid-capture based genomic profiling at disease progression to identifying novel resistance mechanisms in the clinic. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. CpG island methylator phenotype identifies high risk patients among microsatellite stable BRAF mutated colorectal cancers.

    PubMed

    Vedeld, Hege Marie; Merok, Marianne; Jeanmougin, Marine; Danielsen, Stine A; Honne, Hilde; Presthus, Gro Kummeneje; Svindland, Aud; Sjo, Ole H; Hektoen, Merete; Eknaes, Mette; Nesbakken, Arild; Lothe, Ragnhild A; Lind, Guro E

    2017-09-01

    The prognostic value of CpG island methylator phenotype (CIMP) in colorectal cancer remains unsettled. We aimed to assess the prognostic value of this phenotype analyzing a total of 1126 tumor samples obtained from two Norwegian consecutive colorectal cancer series. CIMP status was determined by analyzing the 5-markers CAGNA1G, IGF2, NEUROG1, RUNX3 and SOCS1 by quantitative methylation specific PCR (qMSP). The effect of CIMP on time to recurrence (TTR) and overall survival (OS) were determined by uni- and multivariate analyses. Subgroup analyses were conducted according to MSI and BRAF mutation status, disease stage, and also age at time of diagnosis (<60, 60-74, ≥75 years). Patients with CIMP positive tumors demonstrated significantly shorter TTR and worse OS compared to those with CIMP negative tumors (multivariate hazard ratio [95% CI] 1.86 [1.31-2.63] and 1.89 [1.34-2.65], respectively). In stratified analyses, CIMP tumors showed significantly worse outcome among patients with microsatellite stable (MSS, P < 0.001), and MSS BRAF mutated tumors (P < 0.001), a finding that persisted in patients with stage II, III or IV disease, and that remained significant in multivariate analysis (P < 0.01). Consistent results were found for all three age groups. To conclude, CIMP is significantly associated with inferior outcome for colorectal cancer patients, and can stratify the poor prognostic patients with MSS BRAF mutated tumors. © 2017 The Authors International Journal of Cancer published by John Wiley & Sons Ltd on behalf of UICC.

  13. Spectrum of cisplatin-induced mutations in Escherichia coli

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Burnouf, D.; Duane, M.; Fuchs, R.P.

    1987-06-01

    Using a forward-mutation assay based on the inactivation of the tetracycline-resistance gene located on plasmid pBR322, we have determined the mutation spectrum induced in Escherichia coli by cisplatin (cis-diamminedichloroplatinum(II)), a widely used antitumor drug. Cisplatin is known to form mainly intrastrand diadducts at ApG and GpG sites. We found that cisplatin efficiently induces mutations in an SOS-dependent way (i.e., dependent upon UV irradiation of the host bacteria). More than 90% of the mutations are single-base-pair substitutions occurring at the potential sites of cisplatin adducts (ApG and GpG). Taking into account the relative proportions of ApG and GpG adducts, we foundmore » that the ApG adducts are at least 5 times more mutagenic than the GpG adducts. Moreover, a strong mutation specificity was seen at the 5' side of the ApG adducts (A X T----T X A transversions). The observation that most mutations occur at the 5' end of the adduct at both ApG and GpG sites is discussed in relation to recent structural data.« less

  14. Glycogen storage disease type 1a in Israel: biochemical, clinical, and mutational studies.

    PubMed

    Parvari, R; Lei, K J; Bashan, N; Hershkovitz, E; Korman, S H; Barash, V; Lerman-Sagie, T; Mandel, H; Chou, J Y; Moses, S W

    1997-10-31

    Glycogen storage disease type 1a (von Gierke disease, GSD 1a) is caused by the deficiency of microsomal glucose-6-phosphatase (G6Pase) activity which catalyzes the final common step of glycogenolysis and gluconeogenesis. The recent cloning of the G6Pase cDNA and characterization of the human G6Pase gene enabled the characterization of the mutations causing GSD 1a. This, in turn, allows the introduction of a noninvasive DNA-based diagnosis that provides reliable carrier testing and prenatal diagnosis. In this study, we report the biochemical and clinical characteristics as well as mutational analyses of 12 Israeli GSD 1a patients of different families, who represent most GSD 1a patients in Israel. The mutations, G6Pase activity, and glycogen content of 7 of these patients were reported previously. The biochemical data and clinical findings of all patients were similar and compatible with those described in other reports. All 9 Jewish patients, as well as one Muslim Arab patient, presented the R83C mutation. Two Muslim Arab patients had the V166G mutation which was not found in other patients' populations. The V166G mutation, which was introduced into the G6Pase cDNA by site-directed mutagenesis following transient expression in COS-1 cells, was shown to cause complete inactivation of the G6Pase. The characterization of all GSD 1a mutations in the Israeli population lends itself to carrier testing in these families as well as to prenatal diagnosis, which was carried out in 2 families. Since all Ashkenzai Jewish patients harbor the same mutation, our study suggests that DNA-based diagnosis may be used as an initial diagnostic step in Ashkenazi Jews suspected of having GSD 1a, thereby avoiding liver biopsy.

  15. Variability of sweat chloride concentration in subjects with cystic fibrosis and G551D mutations.

    PubMed

    Vermeulen, F; Le Camus, C; Davies, J C; Bilton, D; Milenković, D; De Boeck, K

    2017-01-01

    Sweat chloride concentration, a biomarker of CFTR function, is an appropriate outcome parameter in clinical trials aimed at correcting the basic CF defect. Although there is consensus on a cut-off value to diagnose CF, we have only limited information on the within subject variability of sweat chloride over time. Such information would be useful for sample size calculations in clinical trials. Therefore, we retrospectively analyzed repeated sweat chloride values obtained in patients with G551D mutation(s) assigned to placebo in an ivacaftor interventional trial. In subjects with G551D at least 12years of age, a pilocarpine sweat test using Macroduct collector was taken on both arms at 8 time points over 48weeks. We explored 1062 pilocarpine sweat test values obtained in 78 placebo patients of the VX08-770-102 trial. Mean overall sweat chloride value (all patients, all tests, n=1062) was 100.8mmol/L (SD 12.7mmol/L). Using a multilevel mixed model, the between-subject standard deviation (SD) for sweat chloride was 8.9mmol/L (95% CI 7.4-10.6) and within-subject SD was 8.1mmol/L (95% CI 7.5-8.7). Limits of repeatability for repeat measurements were -19.7 to +21.6mmol/L using values from one arm, and -13.3 to 11.8mmol/L using mean of values obtained at 4 test occasions. Sample size calculations showed that the minimal treatment effect on sweat chloride concentration that can be demonstrated for a group of 5 patients is around 15mmol/L, using a cross-over design and combinations of 4 tests for each phase of the trial. Although the sweat test is considered a robust measure, sweat chloride measurements in patients with CF and a G551D mutation had an inherent biological variability that is higher than commonly considered. Further analyses of placebo group data are crucial to learn more about the natural variability of this outcome parameter. Copyright © 2016 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.

  16. Next-generation sequencing reveals a Novel NSCLC ALK F1174V mutation and confirms ALK G1202R mutation confers high-level resistance to alectinib (CH5424802/RO5424802) in ALK-rearranged NSCLC patients who progressed on crizotinib.

    PubMed

    Ignatius Ou, Sai-Hong; Azada, Michele; Hsiang, David J; Herman, June M; Kain, Tatiana S; Siwak-Tapp, Christina; Casey, Cameron; He, Jie; Ali, Siraj M; Klempner, Samuel J; Miller, Vincent A

    2014-04-01

    Acquired secondary mutations in the anaplastic lymphoma kinase (ALK) gene have been identified in ALK-rearranged (ALK+) non-small-cell lung cancer (NSCLC) patients who developed disease progression while on crizotinib treatment. Here, we identified a novel secondary acquired NSCLC ALK F1174V mutation by comprehensive next-generation sequencing in one ALK+ NSCLC patient who progressed on crizotinib after a prolonged partial response to crizotinib. In a second case, we identified a secondary acquired ALK G1202R, which also confers resistance to alectinib (CH5424802/RO5424802), a second-generation ALK inhibitor that can inhibit ALK gatekeeper L1196M mutation in vitro. ALK G1202R is located at the solvent front of the ALK kinase domain and exhibits a high level of resistance to all other ALK inhibitors currently in clinical development in vitro. Comprehensive genomic profiling of resistant tumor is increasingly important in tailoring treatment decisions after disease progression on crizotinib in ALK+ NSCLC given the promise of second-generation ALK inhibitors and other therapeutic strategies.

  17. P-loop conformation governed crizotinib resistance in G2032R-mutated ROS1 tyrosine kinase: clues from free energy landscape.

    PubMed

    Sun, Huiyong; Li, Youyong; Tian, Sheng; Wang, Junmei; Hou, Tingjun

    2014-07-01

    Tyrosine kinases are regarded as excellent targets for chemical drug therapy of carcinomas. However, under strong purifying selection, drug resistance usually occurs in the cancer cells within a short term. Many cases of drug resistance have been found to be associated with secondary mutations in drug target, which lead to the attenuated drug-target interactions. For example, recently, an acquired secondary mutation, G2032R, has been detected in the drug target, ROS1 tyrosine kinase, from a crizotinib-resistant patient, who responded poorly to crizotinib within a very short therapeutic term. It was supposed that the mutation was located at the solvent front and might hinder the drug binding. However, a different fact could be uncovered by the simulations reported in this study. Here, free energy surfaces were characterized by the drug-target distance and the phosphate-binding loop (P-loop) conformational change of the crizotinib-ROS1 complex through advanced molecular dynamics techniques, and it was revealed that the more rigid P-loop region in the G2032R-mutated ROS1 was primarily responsible for the crizotinib resistance, which on one hand, impaired the binding of crizotinib directly, and on the other hand, shortened the residence time induced by the flattened free energy surface. Therefore, both of the binding affinity and the drug residence time should be emphasized in rational drug design to overcome the kinase resistance.

  18. Identification of novel mutations in the α-galactosidase A gene in patients with Fabry disease: pitfalls of mutation analyses in patients with low α-galactosidase A activity.

    PubMed

    Yoshimitsu, Makoto; Higuchi, Koji; Miyata, Masaaki; Devine, Sean; Mattman, Andre; Sirrs, Sandra; Medin, Jeffrey A; Tei, Chuwa; Takenaka, Toshihiro

    2011-05-01

    Fabry disease is an X-linked lysosomal storage disorder caused by mutations of the α-galactosidase A (GLA) gene, and the disease is a relatively prevalent cause of left ventricular hypertrophy followed by conduction abnormalities and arrhythmias. Mutation analysis of the GLA gene is a valuable tool for accurate diagnosis of affected families. In this study, we carried out molecular studies of 10 unrelated families diagnosed with Fabry disease. Genetic analysis of the GLA gene using conventional genomic sequencing was performed in 9 hemizygous males and 6 heterozygous females. In patients with no mutations in coding DNA sequence, multiplex ligation-dependent probe amplification (MLPA) and/or cDNA sequencing were performed. We identified a novel exon 2 deletion (IVS1_IVS2) in a heterozygous female by MLPA, which was undetectable by conventional sequencing methods. In addition, the g.9331G>A mutation that has previously been found only in patients with cardiac Fabry disease was found in 3 unrelated, newly-diagnosed, cardiac Fabry patients by sequencing GLA genomic DNA and cDNA. Two other novel mutations, g.8319A>G and 832delA were also found in addition to 4 previously reported mutations (R112C, C142Y, M296I, and G373D) in 6 other families. We could identify GLA gene mutations in all hemizygotes and heterozygotes from 10 families with Fabry disease. Mutations in 4 out of 10 families could not be identified by classical genomic analysis, which focuses on exons and the flanking region. Instead, these data suggest that MLPA analysis and cDNA sequence should be considered in genetic testing surveys of patients with Fabry disease. Copyright © 2011 Japanese College of Cardiology. Published by Elsevier Ltd. All rights reserved.

  19. Cataracts and Microphthalmia Caused by a Gja8 Mutation in Extracellular Loop 2

    PubMed Central

    Cheng, Catherine; White, Thomas W.; Gong, Xiaohua

    2012-01-01

    The mouse semi-dominant Nm2249 mutation displays variable cataracts in heterozygous mice and smaller lenses with severe cataracts in homozygous mice. This mutation is caused by a Gja8R205G point mutation in the second extracellular loop of the Cx50 (or α8 connexin) protein. Immunohistological data reveal that Cx50-R205G mutant proteins and endogenous wild-type Cx46 (or α3 connexin) proteins form diffuse tiny spots rather than typical punctate signals of normal gap junctions in the lens. The level of phosphorylated Cx46 proteins is decreased in Gja8R205G/R205G mutant lenses. Genetic analysis reveals that the Cx50-R205G mutation needs the presence of wild-type Cx46 to disrupt lens peripheral fibers and epithelial cells. Electrophysiological data in Xenopus oocytes reveal that Cx50-R205G mutant proteins block channel function of gap junctions composed of wild-type Cx50, but only affect the gating of wild-type Cx46 channels. Both genetic and electrophysiological results suggest that Cx50-R205G mutant proteins alone are unable to form functional channels. These findings imply that the Gja8R205G mutation differentially impairs the functions of Cx50 and Cx46 to cause cataracts, small lenses and microphthalmia. The Gja8R205G mutation occurs at the same conserved residue as the human GJA8R198W mutation. This work provides molecular insights to understand the cataract and microphthalmia/microcornea phenotype caused by Gja8 mutations in mice and humans. PMID:23300808

  20. Mutation screening of the HGD gene identifies a novel alkaptonuria mutation with significant founder effect and high prevalence.

    PubMed

    Sakthivel, Srinivasan; Zatkova, Andrea; Nemethova, Martina; Surovy, Milan; Kadasi, Ludevit; Saravanan, Madurai P

    2014-05-01

    Alkaptonuria (AKU) is an autosomal recessive disorder; caused by the mutations in the homogentisate 1, 2-dioxygenase (HGD) gene located on Chromosome 3q13.33. AKU is a rare disorder with an incidence of 1: 250,000 to 1: 1,000,000, but Slovakia and the Dominican Republic have a relatively higher incidence of 1: 19,000. Our study focused on studying the frequency of AKU and identification of HGD gene mutations in nomads. HGD gene sequencing was used to identify the mutations in alkaptonurics. For the past four years, from subjects suspected to be clinically affected, we found 16 positive cases among a randomly selected cohort of 41 Indian nomads (Narikuravar) settled in the specific area of Tamil Nadu, India. HGD gene mutation analysis showed that 11 of these patients carry the same homozygous splicing mutation c.87 + 1G > A; in five cases, this mutation was found to be heterozygous, while the second AKU-causing mutation was not identified in these patients. This result indicates that the founder effect and high degree of consanguineous marriages have contributed to AKU among nomads. Eleven positive samples were homozygous for a novel mutation c.87 + 1G > A, that abolishes an intron 2 donor splice site and most likely causes skipping of exon 2. The prevalence of AKU observed earlier seems to be highly increased in people of nomadic origin. © 2014 John Wiley & Sons Ltd/University College London.

  1. [Two novel pathogenic mutations of GAN gene identified in a patient with giant axonal neuropathy].

    PubMed

    Wang, Juan; Ma, Qingwen; Cai, Qin; Liu, Yanna; Wang, Wei; Ren, Zhaorui

    2016-06-01

    To explore the disease-causing mutations in a patient suspected for giant axonal neuropathy(GAN). Target sequence capture sequencing was used to screen potential mutations in genomic DNA extracted from peripheral blood sample of the patient. Sanger sequencing was applied to confirm the detected mutation. The mutation was verified among 400 GAN alleles from 200 healthy individuals by Sanger sequencing. The function of the mutations was predicted by bioinformatics analysis. The patient was identified as a compound heterozygote carrying two novel pathogenic GAN mutations, i.e., c.778G>T (p.Glu260Ter) and c.277G>A (p.Gly93Arg). Sanger sequencing confirmed that the c.778G>T (p.Glu260Ter) mutation was inherited from his father, while c.277G>A (p.Gly93Arg) was inherited from his mother. The same mutations was not found in the 200 healthy individuals. Bioinformatics analysis predicted that the two mutations probably caused functional abnormality of gigaxonin. Two novel GAN mutations were detected in a patient with GAN. Both mutations are pathogenic and can cause abnormalities of gigaxonin structure and function, leading to pathogenesis of GAN. The results may also offer valuable information for similar diseases.

  2. GNAQ mutation in a patient with metastatic mucosal melanoma.

    PubMed

    Kim, Chung-Young; Kim, Dae Won; Kim, Kevin; Curry, Jonathan; Torres-Cabala, Carlos; Patel, Sapna

    2014-07-16

    Mucosal melanomas represent about 1% of all melanoma cases and classically have a worse prognosis than cutaneous melanomas. Due to the rarity of mucosal melanomas, only limited clinical studies with metastatic mucosal melanoma are available. Mucosal melanomas most commonly contain mutations in the gene CKIT, and treatments have been investigated using targeted therapy for this gene. Mutations in mucosal melanoma are less common than in cutaneous or uveal melanomas and occur in descending order of frequency as: CKIT (20%), NRAS (5%) or BRAF (3%). Mutations in G-alpha proteins, which are associated with activation of the mitogen-activated protein kinase pathway, have not been reported in mucosal melanomas. These G-alpha protein mutations occur in the genes GNAQ and GNA11 and are seen at a high frequency in uveal melanomas, those melanomas that begin in the eye. A 59-year old Caucasian male was diagnosed with a mucosal melanoma after evaluation for what was thought to be a hemorrhoid. Molecular analysis of the tumor revealed a GNAQ mutation. Ophthalmologic exam did not disclose a uveal melanoma. Here we report, to our knowledge, the first known case of GNAQ mutation in a patient with metastatic mucosal melanoma.

  3. A Mayan founder mutation is a common cause of deafness in Guatemala.

    PubMed

    Carranza, C; Menendez, I; Herrera, M; Castellanos, P; Amado, C; Maldonado, F; Rosales, L; Escobar, N; Guerra, M; Alvarez, D; Foster, J; Guo, S; Blanton, S H; Bademci, G; Tekin, M

    2015-09-08

    Over 5% of the world's population has varying degrees of hearing loss. Mutations in GJB2 are the most common cause of autosomal recessive non-syndromic hearing loss (ARNHL) in many populations. The frequency and type of mutations are influenced by ethnicity. Guatemala is a multi-ethnic country with four major populations: Maya, Ladino, Xinca, and Garifuna. To determine the mutation profile of GJB2 in a ARNHL population from Guatemala, we sequenced both exons of GJB2 in 133 unrelated families. A total of six pathogenic variants were detected. The most frequent pathogenic variant is c.131G>A (p.Trp44*) detected in 21 of 266 alleles. We show that c.131G>A is associated with a conserved haplotype in Guatemala suggesting a single founder. The majority of Mayan population lives in the west region of the country from where all c.131G>A carriers originated. Further analysis of genome-wide variation of individuals carrying the c.131G>A mutation compared with those of Native American, European, and African populations shows a close match with the Mayan population. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  4. A MAYAN FOUNDER MUTATION IS A COMMON CAUSE OF DEAFNESS IN GUATEMALA

    PubMed Central

    Carranza, Claudia; Menendez, Ibis; Herrera, Mariana; Castellanos, Patricia; Amado, Carlos; Maldonado, Fabiola; Rosales, Luisa; Escobar, Nancy; Guerra, Mariela; Alvarez, Darwin; Foster, Joseph; Guo, Shengru; Blanton, Susan H.; Bademci, Guney; Tekin, Mustafa

    2017-01-01

    SUMMARY Over 5% of the world population have varying degrees of hearing loss. Mutations in GJB2 are the most common cause of autosomal recessive non-syndromic hearing loss (NSHL) in many populations. The frequency and type of mutations are influenced by ethnicity. Guatemala is a multi-ethnic country with four major populations: Maya, Ladino, Xinca, and Garifuna. To determine the mutation profile of GJB2 in a NSHL population from Guatemala, we sequenced both exons of GJB2 in 133 unrelated families. A total of six pathogenic variants were detected. The most frequent pathogenic variant is c.131G>A (p.Trp44*) detected in 21 of 266 alleles. We show that c.131G>A is associated with a conserved haplotype in Guatemala suggesting a single founder. The majority of Mayan population lives in the west region of the country from where all c.131G>A carriers originated. Further analysis of genome-wide variation of individuals carrying the c.131G>A mutation compared to those of Native American, European, and African populations shows a close match with the Mayan population. PMID:26346709

  5. Evaluation of Factor V G1691A, prothrombin G20210A, Factor XIII V34L, MTHFR A1298C, MTHFR C677T and PAI-1 4G/5G genotype frequencies of patients subjected to cardiovascular disease (CVD) panel in south-east region of Turkey.

    PubMed

    Oztuzcu, Serdar; Ergun, Sercan; Ulaşlı, Mustafa; Nacarkahya, Gülper; Iğci, Yusuf Ziya; Iğci, Mehri; Bayraktar, Recep; Tamer, Ali; Çakmak, Ecir Ali; Arslan, Ahmet

    2014-06-01

    Cardiovascular disease (CVD) risk factors, such as arterial hypertension, obesity, dyslipidemia or diabetes mellitus, as well as CVDs, including myocardial infarction, coronary artery disease or stroke, are the most prevalent diseases and account for the major causes of death worldwide. In the present study, 4,709 unrelated patients subjected to CVD panel in south-east part of Turkey between the years 2010 and 2013 were enrolled and DNA was isolated from the blood samples of these patients. Mutation analyses were conducted using the real-time polymerase chain reaction method to screen six common mutations (Factor V G1691A, PT G20210A, Factor XIII V34L, MTHFR A1298C and C677T and PAI-1 -675 4G/5G) found in CVD panel. The prevalence of these mutations were 0.57, 0.25, 2.61, 13.78, 9.34 and 24.27 % in homozygous form, respectively. Similarly, the mutation percent of them in heterozygous form were 7.43, 3.44, 24.91, 44.94, 41.09 and 45.66%, respectively. No mutation was detected in 92 (1.95%) patients in total. Because of the fact that this is the first study to screen six common mutations in CVD panel in south-east region of Turkey, it has a considerable value on the diagnosis and treatment of these diseases. Upon the results of the present and previous studied a careful examination for these genetic variants should be carried out in thrombophilia screening programs, particularly in Turkish population.

  6. Computed tomography correlates with improvement with ivacaftor in cystic fibrosis patients with G551D mutation.

    PubMed

    Sheikh, Shahid I; Long, Frederick R; McCoy, Karen S; Johnson, Terri; Ryan-Wenger, Nancy A; Hayes, Don

    2015-01-01

    Ivacaftor corrects the cystic fibrosis transmembrane conductance regulator (CFTR) gating defect associated with G551D mutation and is quickly becoming an important treatment in patients with cystic fibrosis (CF) due to this genetic mutation. A single-center study was performed in CF patients receiving ivacaftor to evaluate the usefulness of high resolution computed tomography (HRCT) of the chest as a way to gauge response to ivacaftor therapy. Ten patients with CF were enrolled for at least one year before and after starting ivacaftor. At time of enrollment, mean age was 20.9 ± 10.8 (range 10-44) years. There were significant improvements from baseline to 6 months in mean %FVC (93 ± 16 to 99 ± 16) and %FEV1 (79 ± 26 to 87 ± 28) but reverted to baseline at one year. Mean sweat chloride levels decreased significantly from baseline to one year. Mean weight and BMI improved at 6 months. Weight continued to improve with stabilization of BMI at one year. Chest HRCT showed significant improvement at one year in mean modified Brody scores for bronchiectasis, mucous plugging, airway wall thickness, and total Brody scores. Elevated bronchiectasis and airway wall thickness scores correlated significantly with lower %FEV1, while higher airway wall thickness and mucus plugging scores correlated with more pulmonary exacerbations requiring IV and oral antibiotics respectively. Based on our findings, HRCT imaging is a useful tool in monitoring response to ivacaftor therapy that corrects the gating defect associated with the G551D-CFTR mutation. Copyright © 2014 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.

  7. A Novel Founder Mutation in MYBPC3: Phenotypic Comparison With the Most Prevalent MYBPC3 Mutation in Spain.

    PubMed

    Sabater-Molina, María; Saura, Daniel; García-Molina Sáez, Esperanza; González-Carrillo, Josefa; Polo, Luis; Pérez-Sánchez, Inmaculada; Olmo, María Del Carmen; Oliva-Sandoval, María José; Barriales-Villa, Roberto; Carbonell, Pablo; Pascual-Figal, Domigo; Gimeno, Juan R

    2017-02-01

    Mutations in MYBPC3 are the cause of hypertrophic cardiomyopathy (HCM). Although most lead to a truncating protein, the severity of the phenotype differs. We describe the clinical phenotype of a novel MYBPC3 mutation, p.Pro108Alafs*9, present in 13 families from southern Spain and compare it with the most prevalent MYBPC3 mutation in this region (c.2308+1 G>A). We studied 107 relatives of 13 index cases diagnosed as HCM carriers of the p.Pro108Alafs*9 mutation. Pedigree analysis, clinical evaluation, and genotyping were performed. A total of 54 carriers of p.Pro108Alafs*9 were identified, of whom 39 had HCM. There were 5 cases of sudden death in the 13 families. Disease penetrance was greater as age increased and HCM patients were more frequently male and developed disease earlier than female patients. The phenotype was similar in p.Pro108Alafs*9 and in c.2308+1 G>A, but differences were found in several risk factors and in survival. There was a trend toward a higher left ventricular mass in p.Pro108Alafs*9 vs c.2308+1G>A. Cardiac magnetic resonance revealed a similar extent and pattern of fibrosis. The p.Pro108Alafs*9 mutation is associated with HCM, high penetrance, and disease onset in middle age. Copyright © 2016 Sociedad Española de Cardiología. Published by Elsevier España, S.L.U. All rights reserved.

  8. Isocitrate dehydrogenase 1 R132C mutation occurs exclusively in microsatellite stable colorectal cancers with the CpG island methylator phenotype.

    PubMed

    Whitehall, V L J; Dumenil, T D; McKeone, D M; Bond, C E; Bettington, M L; Buttenshaw, R L; Bowdler, L; Montgomery, G W; Wockner, L F; Leggett, B A

    2014-11-01

    The CpG Island Methylator Phenotype (CIMP) is fundamental to an important subset of colorectal cancer; however, its cause is unknown. CIMP is associated with microsatellite instability but is also found in BRAF mutant microsatellite stable cancers that are associated with poor prognosis. The isocitrate dehydrogenase 1 (IDH1) gene causes CIMP in glioma due to an activating mutation that produces the 2-hydroxyglutarate oncometabolite. We therefore examined IDH1 alteration as a potential cause of CIMP in colorectal cancer. The IDH1 mutational hotspot was screened in 86 CIMP-positive and 80 CIMP-negative cancers. The entire coding sequence was examined in 81 CIMP-positive colorectal cancers. Forty-seven cancers varying by CIMP-status and IDH1 mutation status were examined using Illumina 450K DNA methylation microarrays. The R132C IDH1 mutation was detected in 4/166 cancers. All IDH1 mutations were in CIMP cancers that were BRAF mutant and microsatellite stable (4/45, 8.9%). Unsupervised hierarchical cluster analysis identified an IDH1 mutation-like methylation signature in approximately half of the CIMP-positive cancers. IDH1 mutation appears to cause CIMP in a small proportion of BRAF mutant, microsatellite stable colorectal cancers. This study provides a precedent that a single gene mutation may cause CIMP in colorectal cancer, and that this will be associated with a specific epigenetic signature and clinicopathological features.

  9. Homozygous Mutation G539R in the Gene for P450 Oxidoreductase in a Family Previously Diagnosed as Having 17,20-Lyase Deficiency

    PubMed Central

    Hershkovitz, Eli; Parvari, Ruthi; Wudy, Stefan A.; Hartmann, Michaela F.; Gomes, Larissa G.; Loewental, Neta; Miller, Walter L.

    2008-01-01

    Context: Very few patients have been described with isolated 17,20-lyase deficiency who have had their mutations in P450c17 (17α-hydroxylase/17,20-lyase) proven by DNA sequencing and in vitro characterization of the mutations. Most patients with 17,20-lyase deficiency have mutations in the domain of P450c17 that interact with the electron-donating redox partner, P450 oxidoreductase (POR). Objective: Our objective was to clarify the genetic and functional basis of isolated 17,20-lyase deficiency in familial cases who were previously reported as having 17,20-lyase deficiency. Patients: Four undervirilized males of an extended Bedouin family were investigated. One of these has previously been reported to carry mutations in the CYP17A1 gene encoding P450c17 causing isolated 17,20-lyase deficiency. Methods: Serum hormones were evaluated before and after stimulation with ACTH. Urinary steroid metabolites were profiled by gas chromatography-mass spectrometry. Exons 1 and 8 of CYP17A1 previously reported to harbor mutations in one of these patients and all 15 coding exons of POR were sequenced. Results: Gas chromatography-mass spectrometry (GC-MS) urinary steroid profiling and serum steroid measurements showed combined deficiencies of 17,20-lyase and 21-hydroxylase. Sequencing of exons 1 and 8 of CYP17A1 in two different laboratories showed no mutations. Sequencing of POR showed that all four patients were homozygous for G539R, a previously studied mutation that retains 46% of normal capacity to support the 17α-hydroxylase activity but only 8% of the 17,20-lyase activity of P450c17. Conclusion: POR deficiency can masquerade clinically as isolated 17,20-lyase deficiency. PMID:18559916

  10. Homozygous mutation G539R in the gene for P450 oxidoreductase in a family previously diagnosed as having 17,20-lyase deficiency.

    PubMed

    Hershkovitz, Eli; Parvari, Ruthi; Wudy, Stefan A; Hartmann, Michaela F; Gomes, Larissa G; Loewental, Neta; Miller, Walter L

    2008-09-01

    Very few patients have been described with isolated 17,20-lyase deficiency who have had their mutations in P450c17 (17alpha-hydroxylase/17,20-lyase) proven by DNA sequencing and in vitro characterization of the mutations. Most patients with 17,20-lyase deficiency have mutations in the domain of P450c17 that interact with the electron-donating redox partner, P450 oxidoreductase (POR). Our objective was to clarify the genetic and functional basis of isolated 17,20-lyase deficiency in familial cases who were previously reported as having 17,20-lyase deficiency. Four undervirilized males of an extended Bedouin family were investigated. One of these has previously been reported to carry mutations in the CYP17A1 gene encoding P450c17 causing isolated 17,20-lyase deficiency. Serum hormones were evaluated before and after stimulation with ACTH. Urinary steroid metabolites were profiled by gas chromatography-mass spectrometry. Exons 1 and 8 of CYP17A1 previously reported to harbor mutations in one of these patients and all 15 coding exons of POR were sequenced. Gas chromatography-mass spectrometry (GC-MS) urinary steroid profiling and serum steroid measurements showed combined deficiencies of 17,20-lyase and 21-hydroxylase. Sequencing of exons 1 and 8 of CYP17A1 in two different laboratories showed no mutations. Sequencing of POR showed that all four patients were homozygous for G539R, a previously studied mutation that retains 46% of normal capacity to support the 17alpha-hydroxylase activity but only 8% of the 17,20-lyase activity of P450c17. POR deficiency can masquerade clinically as isolated 17,20-lyase deficiency.

  11. P-loop Conformation Governed Crizotinib Resistance in G2032R-Mutated ROS1 Tyrosine Kinase: Clues from Free Energy Landscape

    PubMed Central

    Sun, Huiyong; Li, Youyong; Tian, Sheng; Wang, Junmei; Hou, Tingjun

    2014-01-01

    Tyrosine kinases are regarded as excellent targets for chemical drug therapy of carcinomas. However, under strong purifying selection, drug resistance usually occurs in the cancer cells within a short term. Many cases of drug resistance have been found to be associated with secondary mutations in drug target, which lead to the attenuated drug-target interactions. For example, recently, an acquired secondary mutation, G2032R, has been detected in the drug target, ROS1 tyrosine kinase, from a crizotinib-resistant patient, who responded poorly to crizotinib within a very short therapeutic term. It was supposed that the mutation was located at the solvent front and might hinder the drug binding. However, a different fact could be uncovered by the simulations reported in this study. Here, free energy surfaces were characterized by the drug-target distance and the phosphate-binding loop (P-loop) conformational change of the crizotinib-ROS1 complex through advanced molecular dynamics techniques, and it was revealed that the more rigid P-loop region in the G2032R-mutated ROS1 was primarily responsible for the crizotinib resistance, which on one hand, impaired the binding of crizotinib directly, and on the other hand, shortened the residence time induced by the flattened free energy surface. Therefore, both of the binding affinity and the drug residence time should be emphasized in rational drug design to overcome the kinase resistance. PMID:25033171

  12. Temporal frequency of knockdown resistance mutations, F1534C and V1016G, in Aedes aegypti in Chiang Mai city, Thailand and the impact of the mutations on the efficiency of thermal fogging spray with pyrethroids.

    PubMed

    Plernsub, Suriya; Saingamsook, Jassada; Yanola, Jintana; Lumjuan, Nongkran; Tippawangkosol, Pongsri; Walton, Catherine; Somboon, Pradya

    2016-10-01

    In Thailand, control of dengue outbreaks is currently attained by the use of space sprays, particularly thermal fogging using pyrethroids, with the aim of killing infected Aedes mosquito vectors in epidemic areas. However, the principal dengue vector, Aedes aegypti, is resistant to pyrethroids conferred mainly by mutations in the voltage-gated sodium channel gene, F1534C and V1016G, termed knockdown resistance (kdr). The objectives of this study were to determine the temporal frequencies of F1534C and V1016G in Ae. aegypti populations in relation to pyrethroid resistance in Chiang Mai city, and to evaluate the impact of the mutations on the efficacy of thermal fogging with the pyrethroid deltamethrin. Larvae and pupae were collected from several areas around Chiang Mai city during 2011-2015 and reared to adulthood for bioassays for deltamethrin susceptibility. These revealed no trend of increasing deltamethrin resistance during the study period (mortality 58.0-69.5%, average 62.8%). This corresponded to no overall change in the frequencies of the C1534 allele (0.55-0.66, average 0.62) and G1016 allele (0.34-0.45, average 0.38), determined using allele specific amplification. Only three genotypes of kdr mutations were detected: C1534 homozygous (VV/CC); G1016/C1534 double heterozygous (VG/FC); and G1016 homozygous (GG/FF) indicating that the F1534C and V1016G mutations occurred on separate haplotypic backgrounds and a lack of recombination between them to date. The F1 progeny females were used to evaluate the efficacy of thermal fogging spray with Damthrin-SP(®) (deltamethrin+S-bioallethrin+piperonyl butoxide) using a caged mosquito bioassay. The thermal fogging spray killed 100% and 61.3% of caged mosquito bioassay placed indoors and outdoors, respectively. The outdoor spray had greater killing effect on C1534 homozygous and had partially effect on double heterozygous mosquitoes, but did not kill any G1016 homozygous mutants living outdoors. As this selection

  13. Whole blood genome-wide expression profiling and network analysis suggest MELAS master regulators.

    PubMed

    Mende, Susanne; Royer, Loic; Herr, Alexander; Schmiedel, Janet; Deschauer, Marcus; Klopstock, Thomas; Kostic, Vladimir S; Schroeder, Michael; Reichmann, Heinz; Storch, Alexander

    2011-07-01

    The heteroplasmic mitochondrial DNA (mtDNA) mutation A3243G causes the mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes (MELAS) syndrome as one of the most frequent mitochondrial diseases. The process of reconfiguration of nuclear gene expression profile to accommodate cellular processes to the functional status of mitochondria might be a key to MELAS disease manifestation and could contribute to its diverse phenotypic presentation. To determine master regulatory protein networks and disease-modifying genes in MELAS syndrome. Analyses of whole blood transcriptomes from 10 MELAS patients using a novel strategy by combining classic Affymetrix oligonucleotide microarray profiling with regulatory and protein interaction network analyses. Hierarchical cluster analysis elucidated that the relative abundance of mutant mtDNA molecules is decisive for the nuclear gene expression response. Further analyses confirmed not only transcription factors already known to be involved in mitochondrial diseases (such as TFAM), but also detected the hypoxia-inducible factor 1 complex, nuclear factor Y and cAMP responsive element-binding protein-related transcription factors as novel master regulators for reconfiguration of nuclear gene expression in response to the MELAS mutation. Correlation analyses of gene alterations and clinico-genetic data detected significant correlations between A3243G-induced nuclear gene expression changes and mutant mtDNA load as well as disease characteristics. These potential disease-modifying genes influencing the expression of the MELAS phenotype are mainly related to clusters primarily unrelated to cellular energy metabolism, but important for nucleic acid and protein metabolism, and signal transduction. Our data thus provide a framework to search for new pathogenetic concepts and potential therapeutic approaches to treat the MELAS syndrome.

  14. A deletion mutation in GJB6 cooperating with a GJB2 mutation in trans in non-syndromic deafness: A novel founder mutation in Ashkenazi Jews.

    PubMed

    Lerer, I; Sagi, M; Ben-Neriah, Z; Wang, T; Levi, H; Abeliovich, D

    2001-11-01

    A deletion of at least 140 kb starting approximately 35kb upstream (telomeric) to the GJB2 (CX26) gene was identified in 7 patients from 4 unrelated Jewish Ashkenazi families with non-syndromic hearing loss. These patients were heterozygous for one of the common mutations 167delT or 35delG in the GJB2 gene in trans to the deletion. The deletion started at 5' side of the GJB6 (CX30) gene including the first exon and it did not affect the integrity of the GJB2 gene. The deletion mutation segregated together with the hearing loss, and was not found in a control group of 100 Ashkenazi individuals. We suggest that the deletion is a recessive mutation causing hearing loss in individuals that are double heterozygous for the deletion and for a mutation in the GJB2 gene. The effect of the deletion mutation could be due to a digenic mode of inheritance of GJB2 and GJB6 genes that encode two different connexins; connexin 26 and connexin 30, or it may abolish control elements that are important in the expression of the GJB2 gene in the cochlea. Regardless which of the options is valid, it is apparent that the deletion mutation provides a new insight into connexin function in the auditory system. The deletion mutation was on the same haplotypic background in all the families, and therefore is a founder mutation that increases the impact of GJB2 in the etiology of prelingual recessive non-syndromic hearing loss in the Ashkenazi population. Copyright 2001 Wiley-Liss, Inc.

  15. 8-oxoguanine causes spontaneous de novo germline mutations in mice.

    PubMed

    Ohno, Mizuki; Sakumi, Kunihiko; Fukumura, Ryutaro; Furuichi, Masato; Iwasaki, Yuki; Hokama, Masaaki; Ikemura, Toshimichi; Tsuzuki, Teruhisa; Gondo, Yoichi; Nakabeppu, Yusaku

    2014-04-15

    Spontaneous germline mutations generate genetic diversity in populations of sexually reproductive organisms, and are thus regarded as a driving force of evolution. However, the cause and mechanism remain unclear. 8-oxoguanine (8-oxoG) is a candidate molecule that causes germline mutations, because it makes DNA more prone to mutation and is constantly generated by reactive oxygen species in vivo. We show here that endogenous 8-oxoG caused de novo spontaneous and heritable G to T mutations in mice, which occurred at different stages in the germ cell lineage and were distributed throughout the chromosomes. Using exome analyses covering 40.9 Mb of mouse transcribed regions, we found increased frequencies of G to T mutations at a rate of 2 × 10(-7) mutations/base/generation in offspring of Mth1/Ogg1/Mutyh triple knockout (TOY-KO) mice, which accumulate 8-oxoG in the nuclear DNA of gonadal cells. The roles of MTH1, OGG1, and MUTYH are specific for the prevention of 8-oxoG-induced mutation, and 99% of the mutations observed in TOY-KO mice were G to T transversions caused by 8-oxoG; therefore, we concluded that 8-oxoG is a causative molecule for spontaneous and inheritable mutations of the germ lineage cells.

  16. Adult siblings with homozygous G6PC3 mutations expand our understanding of the severe congenital neutropenia type 4 (SCN4) phenotype.

    PubMed

    Fernandez, Bridget A; Green, Jane S; Bursey, Ford; Barrett, Brendan; MacMillan, Andrée; McColl, Sarah; Fernandez, Sara; Rahman, Proton; Mahoney, Krista; Pereira, Sergio L; Scherer, Stephen W; Boycott, Kym M; Woods, Michael O

    2012-11-21

    Severe congenital neutropenia type 4 (SCN4) is an autosomal recessive disorder caused by mutations in the third subunit of the enzyme glucose-6-phosphatase (G6PC3). Its core features are congenital neutropenia and a prominent venous skin pattern, and affected individuals have variable birth defects. Oculocutaneous albinism type 4 (OCA4) is caused by autosomal recessive mutations in SLC45A2. We report a sister and brother from Newfoundland, Canada with complex phenotypes. The sister was previously reported by Cullinane et al., 2011. We performed homozygosity mapping, next generation sequencing and conventional Sanger sequencing to identify mutations that cause the phenotype in this family. We have also summarized clinical data from 49 previously reported SCN4 cases with overlapping phenotypes and interpret the medical histories of these siblings in the context of the literature. The siblings' phenotype is due in part to a homozygous mutation in G6PC3, [c.829C > T, p.Gln277X]. Their ages are 38 and 37 years respectively and they are the oldest SCN4 patients published to date. Both presented with congenital neutropenia and later developed Crohn disease. We suggest that the latter is a previously unrecognized SCN4 manifestation and that not all affected individuals have an intellectual disability. The sister also has a homozygous mutation in SLC45A2, which explains her severe oculocutaneous hypopigmentation. Her brother carried one SLC45A2 mutation and was diagnosed with "partial OCA" in childhood. This family highlights that apparently novel syndromes can in fact be caused by two known autosomal recessive disorders.

  17. A new SETX mutation producing AOA2 in two siblings.

    PubMed

    Datta, Neil; Hohler, Anna

    2013-09-01

    In this paper, we document two cases of a new SETX mutation (820:A>G) combined with an established recessive SETX mutation (5927:T>G) causing ataxia with oculomotor apraxia type 2 (AOA2). The patients had a detailed neurological history and examination performed. Radiological imaging was obtained and genetic analysis was obtained. Both siblings demonstrated healthy and normal growth until adolescence. At that time, slowed speech, hypophonia, dysarthria, extraocular muscle dysfunction and some mild choreiform movements began to appear. Family history included some movement disorder difficulties in second degree relatives. The diagnosis of AOA2 was confirmed by genetic testing. We describe a new SETX gene mutation, which when combined with a recognized SETX mutation results in AOA2. The clinical, radiographic and ancillary testing are described.

  18. Validation of Deleterious Mutations in Vorderwald Cattle

    PubMed Central

    Reinartz, Sina; Distl, Ottmar

    2016-01-01

    In Montbéliarde cattle two candidate mutations on bovine chromosomes 19 and 29 responsible for embryonic lethality have been detected. Montbéliarde bulls have been introduced into Vorderwald cattle to improve milk and fattening performance. Due to the small population size of Vorderwald cattle and the wide use of a few Montbéliarde bulls through artificial insemination, inbreeding on Montbéliarde bulls in later generations was increasing. Therefore, we genotyped an aborted fetus which was inbred on Montbéliarde as well as Vorderwald x Montbéliarde crossbred bulls for both deleterious mutations. The abortion was observed in an experimental herd of Vorderwald cattle. The objectives of the present study were to prove if one or both lethal mutations may be assumed to have caused this abortion and to show whether these deleterious mutations have been introduced into the Vorderwald cattle population through Montbéliarde bulls. The aborted fetus was homozygous for the SLC37A2:g.28879810C>T mutation (ss2019324563) on BTA29 and both parents as well as the paternal and maternal grandsire were heterozygous for this mutation. In addition, the parents and the paternal grandsire were carriers of the MH2-haplotype linked with the T-allele of the SLC37A2:g.28879810C>T mutation. For the SHBG:g.27956790C>T mutation (rs38377500) on BTA19 (MH1), the aborted fetus and its sire were heterozygous. Among all further 341 Vorderwald cattle genotyped we found 27 SLC37A2:g.28879810C>T heterozygous animals resulting in an allele frequency of 0.0396. Among the 120 male Vorderwald cattle, there were 12 heterozygous with an allele frequency of 0.05. The SLC37A2:g.28879810C>T mutation could not be found in further nine cattle breeds nor in Vorderwald cattle with contributions from Ayrshire bulls. In 69 Vorderwald cattle without genes from Montbéliarde bulls the mutated allele of SLC37A2:g.28879810C>T could not be detected. The SHBG:g.27956790C>T mutation appeared unlikely to be responsible

  19. Functional analysis of mutations in a severe congenital neutropenia syndrome caused by glucose-6-phosphatase-β deficiency

    PubMed Central

    Lin, Su Ru; Pan, Chi-Jiunn; Mansfield, Brian C.; Chou, Janice Yang

    2016-01-01

    Glucose-6-phosphatase-β (G6Pase-β or G6PC3) deficiency is characterized by neutropenia and dysfunction in both neutrophils and macrophages. G6Pase-β is an enzyme embedded in the endoplasmic reticulum membrane that catalyzes the hydrolysis of glucose-6-phosphate (G6P) to glucose and phosphate. To date, 33 separate G6PC3 mutations have been identified in G6Pase-β-deficient patients but only the p.R253H and p.G260R missense mutations have been characterized functionally for pathogenicity. Here we functionally characterize 16 of the 19 known missense mutations using a sensitive assay, based on a recombinant adenoviral vector-mediated expression system, to demonstrate pathogenicity. Fourteen missense mutations completely abolish G6Pase-β enzymatic activity while the p.S139I and p.R189Q mutations retain 49% and 45%, respectively of wild type G6Pase-β activity. A database of residual enzymatic activity retained by the G6Pase-β mutations will serve as a reference for evaluating genotype-phenotype relationships. PMID:25492228

  20. Mutations in the vesicular trafficking protein annexin A11 are associated with amyotrophic lateral sclerosis.

    PubMed

    Smith, Bradley N; Topp, Simon D; Fallini, Claudia; Shibata, Hideki; Chen, Han-Jou; Troakes, Claire; King, Andrew; Ticozzi, Nicola; Kenna, Kevin P; Soragia-Gkazi, Athina; Miller, Jack W; Sato, Akane; Dias, Diana Marques; Jeon, Maryangel; Vance, Caroline; Wong, Chun Hao; de Majo, Martina; Kattuah, Wejdan; Mitchell, Jacqueline C; Scotter, Emma L; Parkin, Nicholas W; Sapp, Peter C; Nolan, Matthew; Nestor, Peter J; Simpson, Michael; Weale, Michael; Lek, Monkel; Baas, Frank; Vianney de Jong, J M; Ten Asbroek, Anneloor L M A; Redondo, Alberto Garcia; Esteban-Pérez, Jesús; Tiloca, Cinzia; Verde, Federico; Duga, Stefano; Leigh, Nigel; Pall, Hardev; Morrison, Karen E; Al-Chalabi, Ammar; Shaw, Pamela J; Kirby, Janine; Turner, Martin R; Talbot, Kevin; Hardiman, Orla; Glass, Jonathan D; De Belleroche, Jacqueline; Maki, Masatoshi; Moss, Stephen E; Miller, Christopher; Gellera, Cinzia; Ratti, Antonia; Al-Sarraj, Safa; Brown, Robert H; Silani, Vincenzo; Landers, John E; Shaw, Christopher E

    2017-05-03

    Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disorder. We screened 751 familial ALS patient whole-exome sequences and identified six mutations including p.D40G in the ANXA11 gene in 13 individuals. The p.D40G mutation was absent from 70,000 control whole-exome sequences. This mutation segregated with disease in two kindreds and was present in another two unrelated cases ( P = 0.0102), and all mutation carriers shared a common founder haplotype. Annexin A11-positive protein aggregates were abundant in spinal cord motor neurons and hippocampal neuronal axons in an ALS patient carrying the p.D40G mutation. Transfected human embryonic kidney cells expressing ANXA11 with the p.D40G mutation and other N-terminal mutations showed altered binding to calcyclin, and the p.R235Q mutant protein formed insoluble aggregates. We conclude that mutations in ANXA11 are associated with ALS and implicate defective intracellular protein trafficking in disease pathogenesis. Copyright © 2017, American Association for the Advancement of Science.

  1. GNAQ mutation in a patient with metastatic mucosal melanoma

    PubMed Central

    2014-01-01

    Background Mucosal melanomas represent about 1% of all melanoma cases and classically have a worse prognosis than cutaneous melanomas. Due to the rarity of mucosal melanomas, only limited clinical studies with metastatic mucosal melanoma are available. Mucosal melanomas most commonly contain mutations in the gene CKIT, and treatments have been investigated using targeted therapy for this gene. Mutations in mucosal melanoma are less common than in cutaneous or uveal melanomas and occur in descending order of frequency as: CKIT (20%), NRAS (5%) or BRAF (3%). Mutations in G-alpha proteins, which are associated with activation of the mitogen-activated protein kinase pathway, have not been reported in mucosal melanomas. These G-alpha protein mutations occur in the genes GNAQ and GNA11 and are seen at a high frequency in uveal melanomas, those melanomas that begin in the eye. Case presentation A 59-year old Caucasian male was diagnosed with a mucosal melanoma after evaluation for what was thought to be a hemorrhoid. Molecular analysis of the tumor revealed a GNAQ mutation. Ophthalmologic exam did not disclose a uveal melanoma. Conclusion Here we report, to our knowledge, the first known case of GNAQ mutation in a patient with metastatic mucosal melanoma. PMID:25030020

  2. Risk of colorectal cancer for people with a mutation in both a MUTYH and a DNA mismatch repair gene.

    PubMed

    Win, Aung Ko; Reece, Jeanette C; Buchanan, Daniel D; Clendenning, Mark; Young, Joanne P; Cleary, Sean P; Kim, Hyeja; Cotterchio, Michelle; Dowty, James G; MacInnis, Robert J; Tucker, Katherine M; Winship, Ingrid M; Macrae, Finlay A; Burnett, Terrilea; Le Marchand, Loïc; Casey, Graham; Haile, Robert W; Newcomb, Polly A; Thibodeau, Stephen N; Lindor, Noralane M; Hopper, John L; Gallinger, Steven; Jenkins, Mark A

    2015-12-01

    The base excision repair protein, MUTYH, functionally interacts with the DNA mismatch repair (MMR) system. As genetic testing moves from testing one gene at a time, to gene panel and whole exome next generation sequencing approaches, understandin g the risk associated with co-existence of germline mutations in these genes will be important for clinical interpretation and management. From the Colon Cancer Family Registry, we identified 10 carriers who had both a MUTYH mutation (6 with c.1187G>A p.(Gly396Asp), 3 with c.821G>A p.(Arg274Gln), and 1 with c.536A>G p.(Tyr179Cys)) and a MMR gene mutation (3 in MLH1, 6 in MSH2, and 1 in PMS2), 375 carriers of a single (monoallelic) MUTYH mutation alone, and 469 carriers of a MMR gene mutation alone. Of the 10 carriers of both gene mutations, 8 were diagnosed with colorectal cancer. Using a weighted cohort analysis, we estimated that risk of colorectal cancer for carriers of both a MUTYH and a MMR gene mutation was substantially higher than that for carriers of a MUTYH mutation alone [hazard ratio (HR) 21.5, 95% confidence interval (CI) 9.19-50.1; p < 0.001], but not different from that for carriers of a MMR gene mutation alone (HR 1.94, 95% CI 0.63-5.99; p = 0.25). Within the limited power of this study, there was no evidence that a monoallelic MUTYH gene mutation confers additional risk of colorectal cancer for carriers of a MMR gene mutation alone. Our finding suggests MUTYH mutation testing in MMR gene mutation carriers is not clinically informative.

  3. sup 60 Co. gamma. -rays induce predominantly C/G to G/C transversions in double-stranded M13 DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hoebee, B.; Loman, H.; Brouwer, J.

    Upon irradiation with gamma rays of an oxygenated aqueous solution of double-stranded M13 DNA, a very specific mutation spectrum was found with respect to both the type and the positions in the DNA sequence. Of the 23 mutations, which were sequenced, 16 represent a C/G to G/C transversion. A C/G to T/A transition was found once and a G/C to T/A transversion twice. The remaining 4 mutations are frameshifts, 2 are identical and formed by the insertion of a G/C basepair; the other 2 mutations are due to a duplication of 10 basepairs situated at different positions but with amore » remarkable homology in base sequence. Fourteen mutations, including the 2 duplications are found in the neighborhood of a TGCT/ACGA sequence.« less

  4. [Study of a family with epidermolysis bullosa simplex resulting from a novel mutation of KRT14 gene].

    PubMed

    Meng, Lanlan; Du, Juan; Li, Wen; Lu, Guangxiu; Tan, Yueqiu

    2017-08-10

    To determine the molecular etiology for a Chinese pedigree affected with epidermolysis bullosa simplex (EBS). Target region sequencing using a hereditary epidermolysis bullosa capture array combined with Sanger sequencing and bioinformatics analysis were used. Mutation taster, PolyPhen-2, Provean, and SIFT software and NCBI online were employed to assess the pathogenicity and conservation of detected mutations. One hundred healthy unrelated individuals were used as controls. Target region sequencing showed that the proband has carried a unreported heterozygous c.1234A>G (p.Ile412Val) mutation of the KRT14 gene, which was confirmed by Sanger sequencing in other 8 affected individuals but not among healthy members of the pedigree. Bioinformatics analysis indicated that the mutation is highly pathogenic. Remarkably, 3 members of the family (2 affected and 1 unaffected) have carried a heterozygous c.1237G>A (p.Ala413Thr) mutation of the KRT14 gene, which was collected in Human Gene Mutation Database (HGMD). Bioinformatics analysis indicated that the mutation may not be pathogenic. Both mutations were not detected among the 100 healthy controls. The novel c.1234A>G(p.Ile412Val) mutation of the KRT14 gene is probably responsible for the disease, while c.1237G>A (p.Ala413Thr) mutation of KRT14 gene may be a polymorphism. Compared with Sanger sequencing, target region capture sequencing is more efficient and can significantly reduce the cost of genetic testing for EBS.

  5. MYO15A (DFNB3) mutations in Turkish hearing loss families and functional modeling of a novel motor domain mutation.

    PubMed

    Kalay, Ersan; Uzumcu, Abdullah; Krieger, Elmar; Caylan, Refik; Uyguner, Oya; Ulubil-Emiroglu, Melike; Erdol, Hidayet; Kayserili, Hülya; Hafiz, Gunter; Başerer, Nermin; Heister, Angelien J G M; Hennies, Hans C; Nürnberg, Peter; Başaran, Seher; Brunner, Han G; Cremers, Cor W R J; Karaguzel, Ahmet; Wollnik, Bernd; Kremer, Hannie

    2007-10-15

    Myosin XVA is an unconventional myosin which has been implicated in autosomal recessive nonsyndromic hearing impairment (ARNSHI) in humans. In Myo15A mouse models, vestibular dysfunction accompanies the autosomal recessive hearing loss. Genomewide homozygosity mapping and subsequent fine mapping in two Turkish families with ARNSHI revealed significant linkage to a critical interval harboring a known deafness gene MYO15A on chromosome 17p13.1-17q11.2. Subsequent sequencing of the MYO15A gene led to the identification of a novel missense mutation, c.5492G-->T (p.Gly1831Val) and a novel splice site mutation, c.8968-1G-->C. These mutations were not detected in additional 64 unrelated ARNSHI index patients and in 230 Turkish control chromosomes. Gly1831 is a conserved residue located in the motor domains of the different classes of myosins of different species. Molecular modeling of the motor head domain of the human myosin XVa protein suggests that the Gly1831Val mutation inhibits the powerstroke by reducing backbone flexibility and weakening the hydrophobic interactions necessary for signal transmission to the converter domain. Copyright (c) 2007 Wiley-Liss, Inc.

  6. Prevalence of the HOXB13 G84E mutation in Danish men undergoing radical prostatectomy and its correlations with prostate cancer risk and aggressiveness.

    PubMed

    Storebjerg, Tine M; Høyer, Søren; Kirkegaard, Pia; Bro, Flemming; Ørntoft, Torben F; Borre, Michael; Sørensen, Karina D

    2016-10-01

    To determine the prevalence of the HOXB13 G84E mutation (rs138213197) in Danish men with or without prostate cancer (PCa) and to investigate possible correlations between HOXB13 mutation status and clinicopathological characteristics associated with tumour aggressiveness. We conducted a case-control study including 995 men with PCa (cases) who underwent radical prostatectomy (RP) between 1997 and 2011 at the Department of Urology, Aarhus University Hospital, Denmark. As controls, we used 1622 healthy men with a normal prostate specific antigen (PSA) level. The HOXB13 G84E mutation was identified in 0.49% of controls and in 2.51% of PCa cases. The mutation was associated with a 5.12-fold increased relative risk (RR) of PCa (95% confidence interval [CI] 2.26-13.38; P = 13 × 10(-6) ). Furthermore, carriers of the risk allele were significantly more likely to have a higher PSA level at diagnosis (mean PSA 19.9 vs 13.6 ng/mL; P = 0.032), a pathological Gleason score ≥7 (83.3 vs 60.9%; P = 0.032), and positive surgical margins (56.0 vs 28.5%; P = 0.006) than non-carriers. Risk allele carriers were also more likely to have aggressive disease (54.2 vs 28.6%; P = 0.011), as defined by a preoperative PSA ≥20 ng/mL, pathological Gleason score ≥ (4+3) and/or presence of regional/distant disease. At a mean follow-up of 7 months, we found no significant association between HOXB13 mutation status and biochemical recurrence in this cohort of men who underwent RP. This is the first study to investigate the HOXB13 G84E mutation in Danish men. The mutation was detected in 0.49% of controls and in 2.51% of cases, and was associated with 5.12-fold increased RR of being diagnosed with PCa. In our RP cohort, HOXB13 mutation carriers were more likely to develop aggressive PCa. Further studies are needed to assess the potential of HOXB13 for future targeted screening approaches. © 2016 The Authors BJU International © 2016 BJU International Published by John Wiley & Sons Ltd.

  7. The novel Parkinson's disease linked mutation G51D attenuates in vitro aggregation and membrane binding of α-synuclein, and enhances its secretion and nuclear localization in cells

    PubMed Central

    Fares, Mohamed-Bilal; Ait-Bouziad, Nadine; Dikiy, Igor; Mbefo, Martial K.; Jovičić, Ana; Kiely, Aoife; Holton, Janice L.; Lee, Seung-Jae; Gitler, Aaron D.; Eliezer, David; Lashuel, Hilal A.

    2014-01-01

    A novel mutation in the α-Synuclein (α-Syn) gene “G51D” was recently identified in two familial cases exhibiting features of Parkinson's disease (PD) and multiple system atrophy (MSA). In this study, we explored the impact of this novel mutation on the aggregation, cellular and biophysical properties of α-Syn, in an attempt to unravel how this mutant contributes to PD/MSA. Our results show that the G51D mutation significantly attenuates α-Syn aggregation in vitro. Moreover, it disrupts local helix formation in the presence of SDS, decreases binding to lipid vesicles C-terminal to the site of mutation and severely inhibits helical folding in the presence of acidic vesicles. When expressed in yeast, α-SynG51D behaves similarly to α-SynA30P, as both exhibit impaired membrane association, form few inclusions and are non-toxic. In contrast, enhanced secreted and nuclear levels of the G51D mutant were observed in mammalian cells, as well as in primary neurons, where α-SynG51D was enriched in the nuclear compartment, was hyper-phosphorylated at S129 and exacerbated α-Syn-induced mitochondrial fragmentation. Finally, post-mortem human brain tissues of α-SynG51D cases were examined, and revealed only partial colocalization with nuclear membrane markers, probably due to post-mortem tissue delay and fixation. These findings suggest that the PD-linked mutations may cause neurodegeneration via different mechanisms, some of which may be independent of α-Syn aggregation. PMID:24728187

  8. A novel donor splice site in intron 11 of the CFTR gene, created by mutation 1811 + 1.6kbA {yields} G, produces a new exon: High frequency in spanish cystic fibrosis chromosomes and association with severe phenotype

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chillon, M.; Casals, T.; Gimenez, J.

    1995-03-01

    mRNA analysis of the cystic fibrosis transmembrane regulator (CFTR) gene in tissues of cystic fibrosis (CF) patients has allowed us to detect a cryptic exon. The new exon involves 49 base pairs between exons 11 and 12 and is due to a point mutation (1811+1.6bA{yields}G) that creates a new donor splice site in intron 11. Semiquantitative mRNA analysis showed that 1811+1.6kbA{r_arrow}G-mRNA was 5-10-fold less abundant than {triangle}F508 mRNA. Mutations 1811+1.6kbA{yields}G was found in 21 Spanish and 1 German CF chromosome(s), making it the fourth-most-frequent mutation (2%) in the Spanish population. Individuals with genotype {triangle}F508/1811+1.6kbA{yields}G have only 1%-3% of normal CFTRmore » mRNA. This loss of 97% of normal CFTR mRNA must be responsible for the pancreatic insufficiency and for the severe CF phenotype in these patients. 30 refs., 3 figs., 2 tabs.« less

  9. An innovative strategy to clone positive modifier genes of defects caused by mtDNA mutations: MRPS18C as suppressor gene of m.3946G>A mutation in MT-ND1 gene.

    PubMed

    Rodríguez-García, María Elena; Cotrina-Vinagre, Francisco Javier; Carnicero-Rodríguez, Patricia; Martínez-Azorín, Francisco

    2017-07-01

    We have developed a new functional complementation approach to clone modifier genes which overexpression is able to suppress the biochemical defects caused by mtDNA mutations (suppressor genes). This strategy consists in transferring human genes into respiratory chain-deficient fibroblasts, followed by a metabolic selection in a highly selective medium. We used a normalized expression cDNA library in an episomal vector (pREP4) to transfect the fibroblasts, and a medium with glutamine and devoid of any carbohydrate source to select metabolically. Growing the patient's fibroblasts in this selective medium, the deficient cells rapidly disappear unless they are rescued by the cDNA of a suppressor gene. The use of an episomal vector allows us to carry out several rounds of transfection/selection (cyclical phenotypic rescue) to enrich the rescue with true clones of suppressor genes. Using fibroblasts from a patient with epileptic encephalopathy with the m.3946G>A (p.E214K) mutation in the MT-ND1 gene, several candidate genes were identified and one of them was characterized functionally. Thus, overexpression of MRPS18C gene (that encode for bS18m protein) suppressed the molecular defects produced by this mtDNA mutation, recovering the complex I activity and reducing the ROS produced by this complex to normal levels. We suggest that modulation of bS18m expression may be an effective therapeutic strategy for the patients with this mutation.

  10. A novel CDKL5 mutation in a Japanese patient with atypical Rett syndrome.

    PubMed

    Christianto, Antonius; Katayama, Syouichi; Kameshita, Isamu; Inazu, Tetsuya

    2016-08-01

    Rett syndrome (RTT) is a severe X-linked dominant inheritance disorder with a wide spectrum of clinical manifestations. Mutations in Methyl CpG binding protein 2 (MECP2), Cyclin dependent kinase-like 5 (CDKL5) and Forkhead box G1 (FOXG1) have been associated with classic and/or variant RTT. This study was conducted to identify the responsible gene(s) in atypical RTT patient, and to examine the effect of the mutation on protein function. DNA sequence analysis showed a novel heterozygous mutation in CDKL5 identified as c.530A>G which resulted in an amino acid substitution at position 177, from tyrosine to cysteine. Genotyping analysis indicated that the mutation was not merely a single nucleotide polymorphism (SNP). We also revealed that patient's blood lymphocytes had random X-chromosome inactivation (XCI) pattern. Further examination by bioinformatics analysis demonstrated the mutation caused damage or deleterious in its protein. In addition, we demonstrated in vitro kinase assay of mutant protein showed impairment of its activity. Taken together, the results suggested the mutant CDKL5 was responsible for the disease. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. G6PD deficiency assessment in Freetown, Sierra Leone, reveals further insight into the molecular heterogeneity of G6PD A-.

    PubMed

    Jalloh, Amadu; Jalloh, Muctarr; Gamanga, Idrissa; Baion, David; Sahr, Foday; Gbakima, Aiah; Willoughby, Victor R; Matsuoka, Hiroyuki

    2008-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency in Africa is of high prevalence, although precise data are lacking in many individual nations. We investigated 129 unrelated subjects (71 male subjects, 58 female subjects) visiting a teaching hospital in Freetown, Sierra Leone, to collect baseline data on the distribution of G6PD deficiency among respective ethnic groups in the country. We confirmed eight G6PD-deficient male subjects by two formazan-based blood tests (11.3% of the male subjects examined), and also detected the common 376A > G mutation in 11 male subjects and eight female subjects by sequencing exons 3-5 of the G6PD gene. Selected samples were further sequenced for exons 2-13 and introns 5, 7, 8, and 11. Among the deficient male subjects, six were G6PD A- carrying the double mutations (202G > A and 376A > G), all of whom were in the Temne and Mende ethnic groups. Others included A- Betica, and a novel variant having double mutations in exon 5 (311G > A and 376A > G forming 104 Arg > His and 126 Asn > Asp, respectively), which we designate as G6PD Sierra Leone. Subsequent haplotype analysis linked this novel variant to the G6PD A- "family".

  12. Novel compound heterozygous mutations in MYO7A in a Chinese family with Usher syndrome type 1

    PubMed Central

    Liu, Fei; Li, Pengcheng; Liu, Ying; Li, Weirong; Wong, Fulton; Du, Rong; Wang, Lei; Li, Chang; Jiang, Fagang; Tang, Zhaohui

    2013-01-01

    Purpose To identify the disease-causing mutation(s) in a Chinese family with autosomal recessive Usher syndrome type 1 (USH1). Methods An ophthalmic examination and an audiometric test were conducted to ascertain the phenotype of two affected siblings. The microsatellite marker D11S937, which is close to the candidate gene MYO7A (USH1B locus), was selected for genotyping. From the DNA of the proband, all coding exons and exon-intron boundaries of MYO7A were sequenced to identify the disease-causing mutation(s). Restriction fragment length polymorphism (RFLP) analysis was performed to exclude the alternative conclusion that the mutations are non-pathogenic rare polymorphisms. Results Based on severe hearing impairment, unintelligible speech, and retinitis pigmentosa, a clinical diagnosis of Usher syndrome type 1 was made. The genotyping results did not exclude the USH1B locus, which suggested that the MYO7A gene was likely the gene associated with the disease-causing mutation(s) in the family. With direct DNA sequencing of MYO7A, two novel compound heterozygous mutations (c.3742G>A and c.6051+1G>A) of MYO7A were identified in the proband. DNA sequence analysis and RFLP analysis of other family members showed that the mutations cosegregated with the disease. Unaffected members, including the parents, uncle, and sister of the proband, carry only one of the two mutations. The mutations were not present in the controls (100 normal Chinese subjects=200 chromosomes) according to the RFLP analysis. Conclusions In this study, we identified two novel mutations, c.3742G>A (p.E1248K) and c.6051+1G>A (donor splice site mutation in intron 44), of MYO7A in a Chinese non-consanguineous family with USH1. The mutations cosegregated with the disease and most likely cause the phenotype in the two affected siblings who carry these mutations compound heterozygously. Our finding expands the mutational spectrum of MYO7A. PMID:23559863

  13. Novel compound heterozygous mutations in MYO7A in a Chinese family with Usher syndrome type 1.

    PubMed

    Liu, Fei; Li, Pengcheng; Liu, Ying; Li, Weirong; Wong, Fulton; Du, Rong; Wang, Lei; Li, Chang; Jiang, Fagang; Tang, Zhaohui; Liu, Mugen

    2013-01-01

    To identify the disease-causing mutation(s) in a Chinese family with autosomal recessive Usher syndrome type 1 (USH1). An ophthalmic examination and an audiometric test were conducted to ascertain the phenotype of two affected siblings. The microsatellite marker D11S937, which is close to the candidate gene MYO7A (USH1B locus), was selected for genotyping. From the DNA of the proband, all coding exons and exon-intron boundaries of MYO7A were sequenced to identify the disease-causing mutation(s). Restriction fragment length polymorphism (RFLP) analysis was performed to exclude the alternative conclusion that the mutations are non-pathogenic rare polymorphisms. Based on severe hearing impairment, unintelligible speech, and retinitis pigmentosa, a clinical diagnosis of Usher syndrome type 1 was made. The genotyping results did not exclude the USH1B locus, which suggested that the MYO7A gene was likely the gene associated with the disease-causing mutation(s) in the family. With direct DNA sequencing of MYO7A, two novel compound heterozygous mutations (c.3742G>A and c.6051+1G>A) of MYO7A were identified in the proband. DNA sequence analysis and RFLP analysis of other family members showed that the mutations cosegregated with the disease. Unaffected members, including the parents, uncle, and sister of the proband, carry only one of the two mutations. The mutations were not present in the controls (100 normal Chinese subjects=200 chromosomes) according to the RFLP analysis. In this study, we identified two novel mutations, c.3742G>A (p.E1248K) and c.6051+1G>A (donor splice site mutation in intron 44), of MYO7A in a Chinese non-consanguineous family with USH1. The mutations cosegregated with the disease and most likely cause the phenotype in the two affected siblings who carry these mutations compound heterozygously. Our finding expands the mutational spectrum of MYO7A.

  14. Biochemical Analysis of Two Single Mutants that Give Rise to a Polymorphic G6PD A-Double Mutant

    PubMed Central

    Ramírez-Nava, Edson Jiovany; González-Valdez, Abigail; Vanoye-Carlo, America; Hernández-Ochoa, Beatriz; Sierra-Palacios, Edgar; Hernández-Pineda, Jessica; Rodríguez-Bustamante, Eduardo; Arreguin-Espinosa, Roberto; Oria-Hernández, Jesús; Reyes-Vivas, Horacio; Marcial-Quino, Jaime

    2017-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) is a key regulatory enzyme that plays a crucial role in the regulation of cellular energy and redox balance. Mutations in the gene encoding G6PD cause the most common enzymopathy that drives hereditary nonspherocytic hemolytic anemia. To gain insights into the effects of mutations in G6PD enzyme efficiency, we have investigated the biochemical, kinetic, and structural changes of three clinical G6PD variants, the single mutations G6PD A+ (Asn126AspD) and G6PD Nefza (Leu323Pro), and the double mutant G6PD A− (Asn126Asp + Leu323Pro). The mutants showed lower residual activity (≤50% of WT G6PD) and displayed important kinetic changes. Although all Class III mutants were located in different regions of the three-dimensional structure of the enzyme and were not close to the active site, these mutants had a deleterious effect over catalytic activity and structural stability. The results indicated that the G6PD Nefza mutation was mainly responsible for the functional and structural alterations observed in the double mutant G6PD A−. Moreover, our study suggests that the G6PD Nefza and G6PD A− mutations affect enzyme functions in a similar fashion to those reported for Class I mutations. PMID:29072585

  15. Segregation and manifestations of the mtDNA tRNA[sup Lys] A[r arrow]G[sup (8344)] mutation of myoclonus epilepsy and ragged-red fibers (MERRF) syndrome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Larsson, N.G.; Tulinius, M.H.; Holme, E.

    1992-12-01

    The authors have studied the segregation and manifestations of the tRNA[sup Lys] A[r arrow]G[sup (8344)] mutation of mtDNA. Three unrelated patients with myoclonus epilepsy and ragged-red fibers (MERRF) syndrome were investigated, along with 30 of their maternal relatives. Mutated mtDNA was not always found in the offspring of women carrying the tRNA[sup Lys] mutation. Four women had 10%-33% of mutated mtDNA in lymphocytes, and no mutated mtDNA was found in 7 of their 14 investigated children. The presence of mutated mtDNA was excluded at a level of 3:1,000. Five women had a proportion of 43%-73% mutated mtDNA in lymphocytes, andmore » mutated mtDNA was found in all their 12 investigated children. This suggests that the risk for transmission of mutated mtDNA to the offspring increases if high levels are present in the mother and that, above a threshold level of 35%-40%, it is very likely that transmission will occur to all children. The three patients with MERRF syndrone had, in muscle, both 94%-96% mutated mtDNA and biochemical and histochemical evidence of a respiratory-chain dysfunction. Four relatives had a proportion of 61%-92% mutated mtDNA in muscle, and biochemical measurements showed a normal respiratory-chain function in muscle in all cases. These findings suggest that >92% of mtDNA with the tRNA[sup Lys] mutation in muscle is required to cause a respiratory-chain dysfunction that can be detected by biochemical methods. There was a positive correlation between the levels of mtDNA with the tRNA[sup Lys] mutation in lymphocytes and the levels in muscle, in all nine investigated cases. The levels of mutated mtDNA were higher in muscle than in lymphocytes in all cases. 30 refs., 3 figs., 5 tabs.« less

  16. Hb Mozhaisk [β92(F8)His→Arg; HBB: c.278A>G] as a De Novo Mutation in a Child of Mixed Ethnic Origins.

    PubMed

    Benzoni, Elena; Giannone, Valentina; Michetti, Laura; Seia, Manuela; Cavalleri, Laura; Curcio, Cristina

    Approximately 150 variants described in the HbVar database have been found to be unstable and about 80.0% of these are on the β-globin gene. We describe the case of a 3-year-old child who presented at the emergency room with fever and asthenia. Hematological data suggested severe hemolytic anemia. Sequencing of the β-globin gene revealed the mutation HBB: c.278A>G at codon 92 in a heterozygous state, reported as Hb Mozhaisk in the HbVar database. Other family members did not have Hb Mozhaisk, thus, this variant is due to a de novo mutation. Because of the rarity of this globin variant, we believe it is important to report similar cases, to have a more complete phenotype description of the pathology and define an adequate reproductive risk for couples, considering the dominant inheritance pattern (hence an inheritance risk of 50.0%).

  17. A Novel Mutation in DMD (c.10797+5G>A) Causes Becker Muscular Dystrophy Associated with Intellectual Disability.

    PubMed

    Banihani, Rudaina; Baskin, Berivan; Halliday, William; Kobayashi, Jeff; Kawamura, Anne; McAdam, Laura; Ray, Peter N; Yoon, Grace

    2016-04-01

    Severe intellectual disability has been reported in a subgroup of patients with Duchenne muscular dystrophy but is not typically associated with Becker muscular dystrophy. The authors report a 13-year-old boy, with severe intellectual disability (Wechsler Intelligence Scales for Children-IV, Full Scale IQ < 0.1 percentile), attention-deficit hyperactivity disorder, and mild muscle weakness. He had elevated serum creatine kinase and dystrophic changes on muscle biopsy. Dystrophin immunohistochemistry revealed decreased staining with the C-terminal and mid-rod antibodies and essentially absent staining of the N-terminal immunostain. Sequencing of muscle mRNA revealed aberrant splicing due to a c.10797+5G > A mutation in DMD. Dystrophinopathy may be associated with predominantly cognitive impairment and neurobehavioral disorder, and should be considered in the differential diagnosis of unexplained cognitive or psychiatric disturbance in males.

  18. Mutation-Induced Changes in the Protein Environment and Site Energies in the (M)L214G Mutant of the Rhodobacter sphaeroides Bacterial Reaction Center.

    PubMed

    Jankowiak, Ryszard; Rancova, Olga; Chen, Jinhai; Kell, Adam; Saer, Rafael G; Beatty, J Thomas; Abramavicius, Darius

    2016-08-18

    This work focuses on the low-temperature (5 K) photochemical (transient) hole-burned (HB) spectra within the P870 absorption band, and their theoretical analysis, for the (M)L214G mutant of the photosynthetic Rhodobacter sphaeroides bacterial reaction center (bRC). To provide insight into system-bath interactions of the bacteriochlorophyll a (BChl a) special pair, i.e., P870, in the mutated bRC, the optical line shape function for the P870 band is calculated numerically. On the basis of the modeling studies, we demonstrate that (M)L214G mutation leads to a heterogeneous population of bRCs with modified (increased) total electron-phonon coupling strength of the special pair BChl a and larger inhomogeneous broadening. Specifically, we show that after mutation in the (M)L214G bRC a large fraction (∼50%) of the bacteriopheophytin (HA) chromophores shifts red and the 800 nm absorption band broadens, while the remaining fraction of HA cofactors retains nearly the same site energy as HA in the wild-type bRC. Modeling using these two subpopulations allowed for fits of the absorption and nonresonant (transient) HB spectra of the mutant bRC in the charge neutral, oxidized, and charge-separated states using the Frenkel exciton Hamiltonian, providing new insight into the mutant's complex electronic structure. Although the average (M)L214G mutant quantum efficiency of P(+)QA(-) state formation seems to be altered in comparison with the wild-type bRC, the average electron transfer time (measured via resonant transient HB spectra within the P870 band) was not affected. Thus, mutation in the vicinity of the electron acceptor (HA) does not tune the charge separation dynamics. Finally, quenching of the (M)L214G mutant excited states by P(+) is addressed by persistent HB spectra burned within the B band in chemically oxidized samples.

  19. Cognitive impairment, clinical severity and MRI changes in MELAS syndrome.

    PubMed

    Kraya, Torsten; Neumann, Lena; Paelecke-Habermann, Yvonne; Deschauer, Marcus; Stoevesandt, Dietrich; Zierz, Stephan; Watzke, Stefan

    2017-12-29

    To examine clinical severity, cognitive impairment, and MRI changes in patients with MELAS syndrome. Cognitive-mnestic functions, brain MRI (lesion load, cella media index) and clinical severity of ten patients with MELAS syndrome were examined. All patients carried the m.3243A>G mutation. The detailed neuropsychological assessment revealed cognitive deficits in attention, executive function, visuoperception, and -construction. There were significant correlations between these cognitive changes, lesion load in MRI, disturbances in everyday life (clinical scale), and high scores in NMDAS. Patients with MELAS syndrome showed no global neuropsychological deficit, but rather distinct cognitive deficits. Copyright © 2018 Elsevier B.V. and Mitochondria Research Society. All rights reserved.

  20. Association of folate intake, dietary habits, smoking and COX-2 promotor -765G>C polymorphism with K-ras mutation in patients with colorectal cancer.

    PubMed

    Kamal, Manal M; Youssef, Omar Z; Lotfy, Ahmed N; Elsaed, Eman T; Fawzy, May M T

    2012-09-01

    Understanding the role of environmental and molecular influences on the nature and rate of K-ras mutations in colorectal neoplasms is crucial. COX-2 polymorphisms -765G>C may play a role in carcinogenic processes in combination with specific life-style conditions or dependent on the racial composition of a particular population. If mutational events play an important role in colorectal carcinogenesis sequence, one can hypothesize that modification of these events by life-style or other factors would be a useful prevention strategy. To explore the association between K-ras mutation and potential variables known or suspected to be related to the risk of colorectal cancer (CRC) as well as determining the possible modulating effect of the COX-2 polymorphism, -765G>C. The study was conducted on 80 patients with colorectal cancer from Tropical Medicine and Gastrointestinal Tract endoscopy Departments and those attending clinic of the National Cancer Institute, Cairo University during the period extending from April 2009 to March 2010. Full history taking with emphasis on the risk factors of interest, namely age, sex, family history, smoking and dietary history. Serum CEA and CA19-9, RBCs folic acid and occult blood in stool were done to all samples. K-ras protooncogene mutation at codon 12 (exon 1) and cyclooxygenase 2 (COX-2) -765G>C polymorphism were determined by PCR-RFLP. The K-ras mutation was positive in 23 (28.7%) patients. COX-2 polymorphism revealed GG in 62.5%, GC in 26.2 % and CC genotype was found in 11.3 % of cases. The mean red blood cell folic acid level was lower in the K-ras positive group (100.96±51.3 ng/ml) than the negative group (216.6±166.4 ng/ml), (P<0.01). Higher folate levels were found in males than females (median=173 ng/ml and 85 ng/ml; respectively, P=0.002) with adjusted odds ratio (OR) of 0.984. Only, the RBCs folate (P=0.0018) followed by gender (P=0.036) contributed significantly in the discrimination between patients prone to develop K

  1. Introducing the human Leigh syndrome mutation T9176G into Saccharomyces cerevisiae mitochondrial DNA leads to severe defects in the incorporation of Atp6p into the ATP synthase and in the mitochondrial morphology.

    PubMed

    Kucharczyk, Roza; Salin, Bénédicte; di Rago, J-P

    2009-08-01

    The Leigh syndrome is a severe neurological disorder that has been associated with mutations affecting the mitochondrial energy transducing system. One of these mutations, T9176G, has been localized in the mitochondrial ATP6 gene encoding the Atp6p (or a) subunit of the ATP synthase. This mutation converts a highly conserved leucine residue into arginine within a presumed trans-membrane alpha-helical segment, at position 217 of Atp6p. The T9176G mutation was previously shown to severely reduce the rate of mitochondrial ATP production in cultured human cells containing high loads of this mutation. However, the underlying mechanism responsible for the impaired ATP production is still unknown. To better understand how T9176G affects the ATP synthase, we have created and analyzed the properties of a yeast strain bearing an equivalent of this mutation. We show that incorporation of Atp6p within the ATP synthase was almost completely prevented in the modified yeast. Based on previous partial biochemical characterization of human T9176G cells, it is likely that this mutation similarly affects the human ATP synthase instead of causing a block in the rotary mechanism of this enzyme as it had been suggested. Interestingly, the T9176G yeast exhibits important anomalies in mitochondrial morphology, an observation which indicates that the pathogenicity of T9176G may not be limited to a bioenergetic deficiency.

  2. Phenotypic Variation in Patients with Homozygous c.1678G>T Mutation in EVC Gene: Report of Two Mexican Families with Ellis-van Creveld Syndrome

    PubMed Central

    Ibarra-Ramirez, Marisol; Campos-Acevedo, Luis Daniel; Lugo-Trampe, Jose; Martínez-Garza, Laura E.; Martinez-Glez, Víctor; Valencia-Benitez, María; Lapunzina, Pablo; Ruiz-Peréz, Víctor

    2017-01-01

    Case series Patient: — Final Diagnosis: Ellis van Creveld syndrome Symptoms: Conical teeth • polydactyly • short stature Medication: — Clinical Procedure: — Specialty: Pediatrics and Neonatology Objective: Rare disease Background: Ellis-van Creveld syndrome is an autosomal recessive chondro-ectodermal dysplasia characterized by disproportionate short stature, limb shortening, narrow chest, postaxial polydactyly and dysplastic nails and teeth. In addition, 60% of cases present congenital heart defects. Ellis-van Creveld syndrome is predominantly caused by mutations in the EVC or EVC2 (4p16) genes, with only a few cases caused by mutations in WDR35. Case Report: Here, we report on two Mexican families with patients diagnosed with Ellis-van Creveld syndrome. Family 1 includes four patients: three females of 15, 18, and 23 years of age and a 7-year old male. Family 2 has only one affected newborn male. All patients exhibited multiple features including hypodontia, dysplastic teeth, extra frenula, mild short stature, distal limb shortening, postaxial polydactyly of hands and feet, nail dystrophy, and knee joint abnormalities. Only two patients had an atrial septal defect. In all cases, molecular analysis by Sanger sequencing identified the same homozygous mutation in exon 12 of EVC, c.1678G>T, which leads to a premature stop codon. Conclusions: The mutation c.1678G>T has been previously reported in another Mexican patient and it appears to be a recurrent mutation in Mexico which could represent a founder mutation. The large number of patients in this case allows the clinical variability and spectrum of manifestations present in individuals with Ellis-van Creveld syndrome even if they carry the same homozygous mutation in a same family. PMID:29229899

  3. Novel drug and soluble target tolerant antidrug antibody assay for therapeutic antibodies bearing the P329G mutation.

    PubMed

    Wessels, Uwe; Schick, Eginhard; Ritter, Mirko; Kowalewsky, Frank; Heinrich, Julia; Stubenrauch, Kay

    2017-06-01

    Bridging immunoassays for detection of antidrug antibodies (ADAs) are typically susceptible to high concentrations of residual drug. Sensitive drug-tolerant assays are, therefore, needed. An immune complex assay to detect ADAs against therapeutic antibodies bearing Pro329Gly mutation was established. The assay uses antibodies specific for the Pro329Gly mutation for capture and human soluble Fcγ receptor for detection. When compared with a bridging assay, the new assay showed similar precision, high sensitivity to IgG1 ADA and dramatically improved drug tolerance. However, it was not able to detect early (IgM-based) immune responses. Applied in combination with a bridging assay, the novel assay serves as orthogonal assay for immunogenicity assessment and allows further characterization of ADA responses.

  4. Relatively high rates of G:C → A:T transitions at CpG sites were observed in certain epithelial tissues including pancreas and submaxillary gland of adult big blue® mice.

    PubMed

    Prtenjaca, Anita; Tarnowski, Heather E; Marr, Alison M; Heney, Melanie A; Creamer, Laura; Sathiamoorthy, Sarmitha; Hill, Kathleen A

    2014-01-01

    With few exceptions, spontaneous mutation frequency and pattern are similar across tissue types and relatively constant in young to middle adulthood in wild type mice. Underrepresented in surveys of spontaneous mutations across murine tissues is the diversity of epithelial tissues. For the first time, spontaneous mutations were detected in pancreas and submaxillary gland and compared with kidney, lung, and male germ cells from five adult male Big Blue® mice. Mutation load was assessed quantitatively through measurement of mutant and mutation frequency and qualitatively through identification of mutations and characterization of recurrent mutations, multiple mutations, mutation pattern, and mutation spectrum. A total of 9.6 million plaque forming units were screened, 226 mutants were collected, and 196 independent mutations were identified. Four novel mutations were discovered. Spontaneous mutation frequency was low in pancreas and high in the submaxillary gland. The submaxillary gland had multiple recurrent mutations in each of the mice and one mutant had two independent mutations. Mutation patterns for epithelial tissues differed from that observed in male germ cells with a striking bias for G:C to A:T transitions at CpG sites. A comprehensive review of lacI spontaneous mutation patterns in young adult mice and rats identified additional examples of this mutational bias. An overarching observation about spontaneous mutation frequency in adult tissues of the mouse remains one of stability. A repeated observation in certain epithelial tissues is a higher rate of G:C to A:T transitions at CpG sites and the underlying mechanisms for this bias are not known. Copyright © 2013 Wiley Periodicals, Inc.

  5. A novel STXBP1 mutation causes typical Rett syndrome in a Japanese girl.

    PubMed

    Yuge, Kotaro; Iwama, Kazuhiro; Yonee, Chihiro; Matsufuji, Mayumi; Sano, Nozomi; Saikusa, Tomoko; Yae, Yukako; Yamashita, Yushiro; Mizuguchi, Takeshi; Matsumoto, Naomichi; Matsuishi, Toyojiro

    2018-06-01

    Rett syndrome (RTT) is a neurodevelopmental disorder mostly caused by mutations in Methyl-CpG-binding protein 2 (MECP2); however, mutations in various other genes may lead to RTT-like phenotypes. Here, we report the first case of a Japanese girl with RTT caused by a novel syntaxin-binding protein 1 (STXBP1) frameshift mutation (c.60delG, p.Lys21Argfs*16). She showed epilepsy at one year of age, regression of acquired psychomotor abilities thereafter, and exhibited stereotypic hand and limb movements at 3 years of age. Her epilepsy onset was earlier than is typical for RTT patients. However, she fully met the 2010 diagnostic criteria of typical RTT. STXBP1 mutations cause early infantile epileptic encephalopathy (EIEE), various intractable epilepsies, and neurodevelopmental disorders. However, the case described here presented a unique clinical presentation of typical RTT without EIEE and a novel STXBP1 mutation. Copyright © 2018 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

  6. A novel OPA1 mutation in a Chinese family with autosomal dominant optic atrophy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Juanjuan; Yuan, Yimin; Lin, Bing

    2012-03-23

    Highlights: Black-Right-Pointing-Pointer We report the characterization of a four-generation large Chinese family with ADOA. Black-Right-Pointing-Pointer We find a new heterozygous mutation c.C1198G in OPA1 gene which may be a novel pathogenic mutation in this pedigree. Black-Right-Pointing-Pointer We do not find any mitochondrial DNA mutations associated with optic atrophy. Black-Right-Pointing-Pointer Other factors may also contribute to the phenotypic variability of ADOA in this pedigree. -- Abstract: A large four-generation Chinese family with autosomal dominant optic atrophy (ADOA) was investigated in the present study. Eight of the family members were affected in this pedigree. The affected family members exhibited early-onset and progressivemore » visual impairment, resulting in mild to profound loss of visual acuity. The average age-at-onset was 15.9 years. A new heterozygous mutation c.C1198G was identified by sequence analysis of the 12th exon of the OPA1 gene. This mutation resulted in a proline to alanine substitution at codon 400, which was located in an evolutionarily conserved region. This missense mutation in the GTPase domain was supposed to result in a loss of function for the encoded protein and act through a dominant negative effect. No other mutations associated with optic atrophy were found in our present study. The c.C1198G heterozygous mutation in the OPA1 gene may be a novel key pathogenic mutation in this pedigree with ADOA. Furthermore, additional nuclear modifier genes, environmental factors, and psychological factors may also contribute to the phenotypic variability of ADOA in this pedigree.« less

  7. Characterization of D150E and G196D aquaporin-2 mutations responsible for nephrogenic diabetes insipidus: importance of a mild phenotype

    PubMed Central

    Guyon, Cécile; Lussier, Yoann; Bissonnette, Pierre; Leduc-Nadeau, Alexandre; Lonergan, Michèle; Arthus, Marie-Françoise; Perez, Rafael Bedoya; Tiulpakov, Anatoly; Lapointe, Jean-Yves; Bichet, Daniel G.

    2009-01-01

    Aquaporin-2 (AQP2) is a water channel responsible for the final water reabsorption in renal collecting ducts. Alterations in AQP2 function induce nephrogenic diabetes insipidus (NDI), a condition characterized by severe polyuria and polydipsia. Three patients affected with severe NDI, who were compound heterozygous for the AQP2 mutations D150E and G196D, are presented here along with a mildly affected D150E homozygous patient from another family. Using Xenopus oocytes as an expression system, these two mutations (G196D and D150E) were compared with the wild-type protein (AQP2-wt) for functional activity (water flux analysis), protein maturation, and plasma membrane targeting. AQP2-wt induces a major increase in water permeability (Pf = 47.4 ± 12.2 × 10−4 cm/s) whereas D150E displays intermediate Pf values (Pf = 12.5 ± 3.0 × 10−4 cm/s) and G196D presents no specific water flux, similar to controls (Pf = 2.1 ± 0.8 × 10−4 cm/s and 2.2 ± 0.7 × 10−4 cm/s, respectively). Western blot and immunocytochemical evaluations show protein targeting that parallels activity levels with AQP2-wt adequately targeted to the plasma membrane, partial targeting for D150E, and complete sequestration of G196D within intracellular compartments. When coinjecting AQP2-wt with mutants, no (AQP2-wt + D150E) or partial (AQP2-wt + G196D) reduction of water flux were observed compared with AQP2-wt alone, whereas complete loss of function was found when both mutants were coinjected. These results essentially recapitulate the clinical profiles of the family members, showing a typical dominant negative effect when G196D is coinjected with either AQP2-wt or D150E but not between AQP2-wt and D150E mutant. PMID:19458121

  8. Plasminogen activator inhibitor-1 4G/5G polymorphism, factor V Leiden, prothrombin mutations and the risk of VTE recurrence.

    PubMed

    Sundquist, Kristina; Wang, Xiao; Svensson, Peter J; Sundquist, Jan; Hedelius, Anna; Larsson Lönn, Sara; Zöller, Bengt; Memon, Ashfaque A

    2015-11-25

    Plasminogen-activator inhibitor (PAI)-1 is an important inhibitor of the plasminogen/plasmin system. PAI-1 levels are influenced by the 4G/5G polymorphism in the PAI-1 promoter. We investigated the relationship between the PAI-1 polymorphism and VTE recurrence, and its possible modification by factor V Leiden (FVL) and prothrombin (PTM) mutations. Patients (n=1,069) from the Malmö Thrombophilia Study were followed from discontinuation of anticoagulant treatment until diagnosis of VTE recurrence or the end of the study (maximum follow-up 9.8 years). One hundred twenty-seven patients (11.9 %) had VTE recurrence. PAI-1 was genotyped by TaqMan PCR. Cox regression analysis adjusted for age, sex and acquired risk factors of VTE showed no evidence of an association between PAI-1 genotype and risk of VTE recurrence in the study population as a whole. However, by including an interaction term in the analysis we showed that FVL but not PTM modified the effect of PAI-1 genotype: patients with the 4G allele plus FVL had a higher risk of VTE recurrence [hazard ratio (HR) =2.3, 95 % confidence interval (CI) =1.5-3.3] compared to patients with the 4G allele but no FVL (reference group) or FVL irrespective of PAI-1 genotype (HR=1.8, 95 % CI=1.3-2.5). Compared to reference group, 5G allele irrespective of FVL was associated with lower risk of VTE recurrence only when compared with 4G allele together with FVL. In conclusion, FVL has a modifying effect on PAI-1 polymorphism in relation to risk of VTE recurrence. The role of PAI-1 polymorphism as a risk factor of recurrent VTE may be FVL dependent.

  9. MicroRNA-31 expression in relation to BRAF mutation, CpG island methylation and colorectal continuum in serrated lesions.

    PubMed

    Ito, Miki; Mitsuhashi, Kei; Igarashi, Hisayoshi; Nosho, Katsuhiko; Naito, Takafumi; Yoshii, Shinji; Takahashi, Hiroaki; Fujita, Masahiro; Sukawa, Yasutaka; Yamamoto, Eiichiro; Takahashi, Taiga; Adachi, Yasushi; Nojima, Masanori; Sasaki, Yasushi; Tokino, Takashi; Baba, Yoshifumi; Maruyama, Reo; Suzuki, Hiromu; Imai, Kohzoh; Yamamoto, Hiroyuki; Shinomura, Yasuhisa

    2014-12-01

    The CpG island methylator phenotype (CIMP) is a distinct form of epigenomic instability. Many CIMP-high colorectal cancers (CRCs) with BRAF mutation are considered to arise from serrated pathway. We recently reported that microRNA-31 (miR-31) is associated with BRAF mutation in colorectal tumors. Emerging new approaches have revealed gradual changes in BRAF mutation and CIMP-high throughout the colorectum in CRCs. Here, we attempted to identify a possible association between miR-31 and epigenetic features in serrated pathway, and hypothesized that miR-31 supports the "colorectal continuum" concept. We evaluated miR-31 expression, BRAF mutation and epigenetic features including CIMP status in 381 serrated lesions and 222 non-serrated adenomas and examined associations between them and tumor location (rectum; sigmoid, descending, transverse and ascending colon and cecum). A significant association was observed between high miR-31 expression and CIMP-high status in serrated lesions with BRAF mutation (p = 0.0001). In contrast, miR-31 was slightly but insignificantly associated with CIMP status in the cases with wild-type BRAF. miR-31 expression in sessile serrated adenomas (SSAs) with cytological dysplasia was higher than that in SSAs, whereas, no significant difference was observed between traditional serrated adenomas (TSAs) and TSAs with high-grade dysplasia. The frequency of miR-31, BRAF mutation CIMP-high and MLH1 methylation increased gradually from the rectum to cecum in serrated lesions. In conclusion, miR-31 expression was associated with CIMP-high status in serrated lesions with BRAF mutation. Our data also suggested that miR-31 plays an important role in SSA evolution and may be a molecule supporting the colorectal continuum. © 2014 UICC.

  10. Early-onset L-dopa-responsive parkinsonism with pyramidal signs due to ATP13A2, PLA2G6, FBXO7 and spatacsin mutations.

    PubMed

    Paisán-Ruiz, Coro; Guevara, Rocio; Federoff, Monica; Hanagasi, Hasmet; Sina, Fardaz; Elahi, Elahe; Schneider, Susanne A; Schwingenschuh, Petra; Bajaj, Nin; Emre, Murat; Singleton, Andrew B; Hardy, John; Bhatia, Kailash P; Brandner, Sebastian; Lees, Andrew J; Houlden, Henry

    2010-09-15

    Seven autosomal recessive genes associated with juvenile and young-onset Levodopa-responsive parkinsonism have been identified. Mutations in PRKN, DJ-1, and PINK1 are associated with a rather pure parkinsonian phenotype, and have a more benign course with sustained treatment response and absence of dementia. On the other hand, Kufor-Rakeb syndrome has additional signs, which distinguish it clearly from Parkinson's disease including supranuclear vertical gaze palsy, myoclonic jerks, pyramidal signs, and cognitive impairment. Neurodegeneration with brain iron accumulation type I (Hallervorden-Spatz syndrome) due to mutations in PANK2 gene may share similar features with Kufor-Rakeb syndrome. Mutations in three other genes, PLA2G6 (PARK14), FBXO7 (PARK15), and Spatacsin (SPG11) also produce clinical similar phenotypes in that they presented with rapidly progressive parkinsonism, initially responsive to Levodopa treatment but later, developed additional features including cognitive decline and loss of Levodopa responsiveness. Here, using homozygosity mapping and sequence analysis in families with complex parkinsonisms, we identified genetic defects in the ATP13A2 (1 family), PLA2G6 (1 family) FBXO7 (2 families), and SPG11 (1 family). The genetic heterogeneity was surprising given their initially common clinical features. On careful review, we found the FBXO7 cases to have a phenotype more similar to PRKN gene associated parkinsonism. The ATP13A2 and PLA2G6 cases were more seriously disabled with additional swallowing problems, dystonic features, severe in some, and usually pyramidal involvement including pyramidal weakness. These data suggest that these four genes account for many cases of Levodopa responsive parkinsonism with pyramidal signs cases formerly categorized clinically as pallido-pyramidal syndrome. © 2010 Movement Disorder Society.

  11. Early-Onset L-dopa-Responsive Parkinsonism with Pyramidal Signs Due to ATP13A2, PLA2G6, FBXO7 and Spatacsin Mutations

    PubMed Central

    Paisán-Ruiz, Coro; Guevara, Rocio; Federoff, Monica; Hanagasi, Hasmet; Sina, Fardaz; Elahi, Elahe; Schneider, Susanne A.; Schwingenschuh, Petra; Bajaj, Nin; Emre, Murat; Singleton, Andrew B.; Hardy, John; Bhatia, Kailash P.; Brandner, Sebastian; Lees, Andrew J.; Houlden, Henry

    2018-01-01

    Seven autosomal recessive genes associated with juvenile and young-onset Levodopa-responsive parkinsonism have been identified. Mutations in PRKN, DJ-1, and PINK1 are associated with a rather pure parkinsonian phenotype, and have a more benign course with sustained treatment response and absence of dementia. On the other hand, Kufor-Rakeb syndrome has additional signs, which distinguish it clearly from Parkinson’s disease including supranu-clear vertical gaze palsy, myoclonic jerks, pyramidal signs, and cognitive impairment. Neurodegeneration with brain iron accumulation type I (Hallervorden-Spatz syndrome) due to mutations in PANK2 gene may share similar features with Kufor-Rakeb syndrome. Mutations in three other genes, PLA2G6 (PARK14), FBXO7 (PARK15), and Spatacsin (SPG11) also produce clinical similar phenotypes in that they presented with rapidly progressive parkinsonism, initially responsive to Levodopa treatment but later, developed additional features including cognitive decline and loss of Levodopa responsiveness. Here, using homozygosity mapping and sequence analysis in families with complex parkinsonisms, we identified genetic defects in the ATP13A2 (1 family), PLA2G6 (1 family) FBXO7 (2 families), and SPG11 (1 family). The genetic heterogeneity was surprising given their initially common clinical features. On careful review, we found the FBXO7 cases to have a phenotype more similar to PRKN gene associated parkinsonism. The ATP13A2 and PLA2G6 cases were more seriously disabled with additional swallowing problems, dystonic features, severe in some, and usually pyramidal involvement including pyramidal weakness. These data suggest that these four genes account for many cases of Levodopa responsive parkinsonism with pyramidal signs cases formerly categorized clinically as pallido-pyramidal syndrome. 3 2010 Movement Disorder Society PMID:20669327

  12. Glucose-6-phosphate dehydrogenase Buenos Aires: a novel de novo missense mutation associated with severe enzyme deficiency.

    PubMed

    Minucci, Angelo; Concolino, Paola; Vendittelli, Francesca; Giardina, Bruno; Zuppi, Cecilia; Capoluongo, Ettore

    2008-06-01

    : Glucose 6-phosphate dehydrogenase (G6PD) catalyzes the first committed steps in the pentose phosphate pathway: the generation of NADPH by this enzyme is essential for protection against oxidative stress. The human enzyme is in a dimer<-->tetramer equilibrium and its stability depends on NADP(+) concentration. Herein, we report a case of a symptomatic baby affected by severe deficiency of G6PD activity due to a novel de novo genetic mutation (g1465C>T) in the thirteenth exon of its gene. : Clinical, biochemical and genetic evaluations of the affected baby and his mother were performed. : We found the g1465C>T novel mutation, in the thirteenth exon of G6PD gene (named "G6PD Buenos Aires variant"). This g1465C>T mutation produce a P489S substitution at protein level. The P489S mutation was absent in his mother, suggesting that G6PD Buenos Aires resulted from a de novo mutation. : The absence of mosaicism in the baby's DNA (from saliva and blood samples) suggests that a de novo mutation event may occur in the very early stages in embryogenesis or in the mother's germ cell lines.

  13. Detection of the V1016G mutation in the voltage-gated sodium channel gene of Aedes aegypti (Diptera: Culicidae) by allele-specific PCR assay, and its distribution and effect on deltamethrin resistance in Thailand.

    PubMed

    Stenhouse, Steven A; Plernsub, Suriya; Yanola, Jintana; Lumjuan, Nongkran; Dantrakool, Anchalee; Choochote, Wej; Somboon, Pradya

    2013-08-30

    Resistance to pyrethroid insecticides is widespread among populations of Aedes aegypti, the main vector for the dengue virus. Several different point mutations within the voltage-gated sodium channel (VGSC) gene contribute to such resistance. A mutation at position 1016 in domain II, segment 6 of the VGSC gene in Ae. aegypti leads to a valine to glycine substitution (V1016G) that confers resistance to deltamethrin. This study developed and utilized an allele-specific PCR (AS-PCR) assay that could be used to detect the V1016G mutation. The assay was validated against a number of sequenced DNA samples of known genotype and was determined to be in complete agreement. Larvae and pupae were collected from various localities throughout Thailand. Samples were reared to adulthood and their resistance status against deltamethrin was determined by standard WHO susceptibility bioassays. Deltamethrin-resistant and susceptible insects were then genotyped for the V1016G mutation. Additionally, some samples were genotyped for a second mutation at position 1534 in domain III (F1534C) which is also known to confer pyrethroid resistance. The bioassay results revealed an overall mortality of 77.6%. Homozygous 1016G individuals survived at higher rates than either heterozygous or wild-type (1016 V) mosquitoes. The 1016G mutation was significantly and positively associated with deltamethrin resistance and was widely distributed throughout Thailand. Interestingly, wild-type 1016 V mosquitoes tested were homozygous for the 1534C mutation, and all heterozygous mosquitoes were also heterozygous for 1534C. Mutant homozygous (G/G) mosquitoes expressed the wild-type (F/F) at position 1534. However, the presence of the 1534C mutation was not associated with deltamethrin resistance. Our bioassay results indicate that all populations sampled display some degree of resistance to deltamethrin. Homozygous 1016G mosquitoes were far likelier to survive such exposure. However, resistance in some

  14. Enhanced striatal dopamine transmission and motor performance with LRRK2 overexpression in mice is eliminated by familial Parkinson's disease mutation G2019S.

    PubMed

    Li, Xianting; Patel, Jyoti C; Wang, Jing; Avshalumov, Marat V; Nicholson, Charles; Buxbaum, Joseph D; Elder, Gregory A; Rice, Margaret E; Yue, Zhenyu

    2010-02-03

    PARK8/LRRK2 (leucine-rich repeat kinase 2) was recently identified as a causative gene for autosomal dominant Parkinson's disease (PD), with LRRK2 mutation G2019S linked to the most frequent familial form of PD. Emerging in vitro evidence indicates that aberrant enzymatic activity of LRRK2 protein carrying this mutation can cause neurotoxicity. However, the physiological and pathophysiological functions of LRRK2 in vivo remain elusive. Here we characterize two bacterial artificial chromosome (BAC) transgenic mouse strains overexpressing LRRK2 wild-type (Wt) or mutant G2019S. Transgenic LRRK2-Wt mice had elevated striatal dopamine (DA) release with unaltered DA uptake or tissue content. Consistent with this result, LRRK2-Wt mice were hyperactive and showed enhanced performance in motor function tests. These results suggest a role for LRRK2 in striatal DA transmission and the consequent motor function. In contrast, LRRK2-G2019S mice showed an age-dependent decrease in striatal DA content, as well as decreased striatal DA release and uptake. Despite increased brain kinase activity, LRRK2-G2019S overexpression was not associated with loss of DAergic neurons in substantia nigra or degeneration of nigrostriatal terminals at 12 months. Our results thus reveal a pivotal role for LRRK2 in regulating striatal DA transmission and consequent control of motor function. The PD-associated mutation G2019S may exert pathogenic effects by impairing these functions of LRRK2. Our LRRK2 BAC transgenic mice, therefore, could provide a useful model for understanding early PD pathological events.

  15. Oncogenic PIK3CA mutations occur in epidermal nevi and seborrheic keratoses with a characteristic mutation pattern

    PubMed Central

    Hafner, Christian; López-Knowles, Elena; Luis, Nuno M.; Toll, Agustí; Baselga, Eulàlia; Fernández-Casado, Alex; Hernández, Silvia; Ribé, Adriana; Mentzel, Thomas; Stoehr, Robert; Hofstaedter, Ferdinand; Landthaler, Michael; Vogt, Thomas; Pujol, Ramòn M.; Hartmann, Arndt; Real, Francisco X.

    2007-01-01

    Activating mutations of the p110 α subunit of PI3K (PIK3CA) oncogene have been identified in a broad spectrum of malignant tumors. However, their role in benign or preneoplastic conditions is unknown. Activating FGF receptor 3 (FGFR3) mutations are common in benign skin lesions, either as embryonic mutations in epidermal nevi (EN) or as somatic mutations in seborrheic keratoses (SK). FGFR3 mutations are also common in low-grade malignant bladder tumors, where they often occur in association with PIK3CA mutations. Therefore, we examined exons 9 and 20 of PIK3CA and FGFR3 hotspot mutations in EN (n = 33) and SK (n = 62), two proliferative skin lesions lacking malignant potential. Nine of 33 (27%) EN harbored PIK3CA mutations; all cases showed the E545G substitution, which is uncommon in cancers. In EN, R248C was the only FGFR3 mutation identified. By contrast, 10 of 62 (16%) SK revealed the typical cancer-associated PIK3CA mutations E542K, E545K, and H1047R. The same lesions displayed a wide range of FGFR3 mutations. Corresponding unaffected tissue was available for four EN and two mutant SK: all control samples displayed a WT sequence, confirming the somatic nature of the mutations found in lesional tissue. Forty of 95 (42%) lesions showed at least one mutation in either gene. PIK3CA and FGFR3 mutations displayed an independent distribution; 5/95 lesions harbored mutations in both genes. Our findings suggest that, in addition to their role in cancer, oncogenic PIK3CA mutations contribute to the pathogenesis of skin tumors lacking malignant potential. The remarkable genotype–phenotype correlation as observed in this study points to a distinct etiopathogenesis of the mutations in keratinocytes occuring either during fetal development or in adult life. PMID:17673550

  16. Clinical impact of factor V Leiden, prothrombin G20210A, and MTHFR C677T mutations among sickle cell disease patients of Central India.

    PubMed

    Nishank, Sudhansu Sekhar; Singh, Mendi Prema Shyam Sunder; Yadav, Rajiv

    2013-11-01

    It is known that patients with sickle cell disease (SCD) present activation of the blood coagulation and fibrinolytic systems, especially during vaso-occlusive crises and also during the steady state of the disease. We determined whether the presence of the factor prothrombin gene G20210A variant, factor V gene G1691A mutation (factor V Leiden), and methylenetetrahydrofolate reductase (MTHFR) C677T polymorphisms may be risk factors for vascular complications in individuals with SCD. The study involved 150 patients with sickle cell anemia and 150 healthy controls of Central India. Genotyping of three thrombophilic mutations was carried out by PCR-RFLP methods using MnlI, Hind III, and Hinf I, respectively, for factor V Leiden, prothrombin, and MTHFR mutations. Patients with SCD had significantly higher prevalence of mutant variants of MTHFR gene (28.0% heterozygotes and 14.6% homozygotes) and FVL gene (14.6% heterozygotes) as compared to normal/control individuals, but complete absence of mutant variants of prothrombin gene. The patients with SCD having mutant variants of MTHFR and FVL genes showed higher incidence of pain in chest, abdomen, and bone joints along with early age of onset of clinical manifestations as well as frequent dependence on blood transfusion than those patients with SCD having wild variants of these thrombotic genes. As compared to control subjects, SCD individuals having mutant variants of FVL and MTHFR genes had significant association with higher levels of prothrombin fragment (F1+2), D-dimer, thrombin-antithrombin (TAT), and lower level of protein C. MTHFR C677T and FVL G1691A polymorphisms may be risk factors for increased vascular complications in patient with SCD. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  17. A rare connexin 26 mutation in a patient with a forme fruste of keratitis-ichthyosis-deafness (KID) syndrome.

    PubMed

    Neoh, Ching Yin; Chen, Huijia; Ng, See Ket; Lane, Ellen Birgitte; Common, John Edmund Armourer

    2009-10-01

    Keratitis-ichthyosis-deafness (KID) syndrome is a rare ectodermal dysplasia characterized by generalized erythrokeratotic plaques, sensorineural hearing loss, and vascularizing keratitis. Cutaneous changes and hearing loss typically present in early childhood, whereas ocular symptoms present later. Mutations in the connexin (Cx) 26 gene, GJB2, are now established to underlie many of the affected cases, with the majority of patients harboring the p.D50N mutation. A rare patient demonstrating features of incomplete KID syndrome associated with an uncommon Cx26 gene mutation is described. The patient presented late in adolescence with partial features of KID syndrome. There was limited cutaneous involvement and the rare association of cystic acne. Both hearing impairment and ophthalmic involvement were mild in severity. Genetic mutation analysis revealed a previously described, rare mutation in GJB2, resulting in a glycine to arginine change at codon 12 (p.G12R). This report describes a patient exhibiting characteristics suggestive of a late-onset, incomplete form of KID syndrome with the GJB2 mutation (p.G12R). The p.G12R mutation has only been described in one other patient with KID syndrome, whose clinical presentation was not characterized.

  18. Glucose-6-phosphate dehydrogenase deficiency in northern Mexico and description of a novel mutation.

    PubMed

    García-Magallanes, N; Luque-Ortega, F; Aguilar-Medina, E M; Ramos-Payán, R; Galaviz-Hernández, C; Romero-Quintana, J G; Del Pozo-Yauner, L; Rangel-Villalobos, H; Arámbula-Meraz, E

    2014-08-01

    Glucose-6-phosphate dehydrogenase deficiency (G6PD) is the most common enzyme pathology in humans; it is X-linked inherited and causes neonatal hyperbilirubinaemia, chronic nonspherocytic haemolytic anaemia and drug-induced acute haemolytic anaemia. G6PD deficiency has scarcely been studied in the northern region of Mexico, which is important because of the genetic heterogeneity described in Mexican population. Therefore, samples from the northern Mexico were biochemically screened for G6PD deficiency, and PCR-RFLPs, and DNA sequencing used to identify mutations in positive samples. The frequency of G6PD deficiency in the population was 0.95% (n = 1993); the mutations in 86% of these samples were G6PD A(-202A/376G), G6PDA(-376G/968C) and G6PD Santamaria(376G/542T). Contrary to previous reports, we demonstrated that G6PD deficiency distribution is relatively homogenous throughout the country (P = 0.48336), and the unique exception with high frequency of G6PD deficiency does not involve a coastal population (Chihuahua: 2.4%). Analysis of eight polymorphic sites showed only 10 haplotypes. In one individual we identified a new G6PD mutation named Mexico DF(193A>G) (rs199474830), which probably results in a damaging functional effect, according to PolyPhen analysis. Proteomic impact of the mutation is also described.

  19. Screening of the USH1G gene among Spanish patients with Usher syndrome. Lack of mutations and evidence of a minor role in the pathogenesis of the syndrome.

    PubMed

    Aller, Elena; Jaijo, Teresa; Beneyto, Magdalena; Nájera, Carmen; Morera, Constantino; Pérez-Garrigues, Herminio; Ayuso, Carmen; Millán, Jose

    2007-09-01

    The Usher syndrome (USH) is an autosomal recessive hereditary disorder characterized by the association of sensorineural hearing loss, retinitis pigmentosa (RP) and, in some cases, vestibular dysfunction. The USH1G gene, encoding SANS, has been found to cause both Usher syndrome type I and atypical Usher syndrome. 109 Spanish unrelated patients suffering from Usher syndrome type I, type II, type III and unclassified Usher syndrome were screened for mutations in this gene, but only eight different changes without a clear pathogenic effect have been detected. Based on these results as well as previous studies in other populations where mutational analysis of this gene has been carried out, one can conclude that USH1G has a minor involvement in Usher syndrome pathogenesis.

  20. Mutation Spectrum and Phenotypic Features in Noonan Syndrome with PTPN11 Mutations: Definition of Two Novel Mutations.

    PubMed

    Atik, Tahir; Aykut, Ayca; Hazan, Filiz; Onay, Huseyin; Goksen, Damla; Darcan, Sukran; Tukun, Ajlan; Ozkinay, Ferda

    2016-06-01

    To evaluate the spectrum of PTPN11 gene mutations in Noonan syndrome patients and to study the genotype-phenotype associations. In this study, twenty Noonan syndrome patients with PTPN11 mutations were included. The patients underwent a detailed clinical and physical evaluation. To identify inherited cases, parents of all mutation positive patients were analyzed. Thirteen different PTPN11 mutations, two of them being novel, were detected in the study group. These mutations included eleven missense mutations: p.G60A, p.D61N, p.Y62D, p.Y63C, p.E69Q, p.Q79R, p.Y279C,p.N308D, p.N308S, p.M504V, p.Q510R and two novel missense mutations: p.I56V and p.I282M. The frequency of cardiac abnormalities and short stature were found to be 80 % and 80 %, respectively. Mental retardation was not observed in patients having exon 8 mutations. No significant correlations were detected between other phenotypic features and genotypes. By identifying genotype-phenotype correlations, this study provides information on phenotypes observed in NS patients with different PTPN11 mutations.

  1. Voltage-sensitive sodium channel mutations S989P + V1016G in Aedes aegypti confer variable resistance to pyrethroids, DDT and oxadiazines.

    PubMed

    Smith, Letícia B; Kasai, Shinji; Scott, Jeffrey G

    2018-03-01

    Aedes aegypti is a vector of several important human pathogens. Control efforts rely primarily on pyrethroid insecticides for adult mosquito control, especially during disease outbreaks. A. aegypti has developed resistance nearly everywhere it occurs and insecticides are used. An important mechanism of resistance is due to mutations in the voltage-sensitive sodium channel (Vssc) gene. Two mutations, in particular, S989P + V1016G, commonly occur together in parts of Asia. We have created a strain (KDR:ROCK) that contains the Vssc mutations S989P + V1016G as the only mechanism of pyrethroid resistance within the genetic background of Rockefeller (ROCK), a susceptible lab strain. We created KDR:ROCK by crossing the pyrethroid-resistant strain Singapore with ROCK followed by four backcrosses with ROCK and Vssc S989P + V1016G genotype selections. We determined the levels of resistance conferred to 17 structurally diverse pyrethroids, the organochloride DDT, and oxadiazines (VSSC blockers) indoxacarb (proinsecticide) and DCJW (the active metabolite of indoxacarb). Levels of resistance to the pyrethroids were variable, ranging from 21- to 107-fold, but no clear pattern between resistance and chemical structure was observed. Resistance is inherited as an incompletely recessive trait. KDR:ROCK had a > 2000-fold resistance to DDT, 37.5-fold cross-resistance to indoxacarb and 13.4-fold cross-resistance to DCJW. Etofenprox (and DDT) should be avoided in areas where Vssc mutations S989P + V1016G exist at high frequencies. We found that pyrethroid structure cannot be used to predict the level of resistance conferred by kdr. These results provide useful information for resistance management and for better understanding pyrethroid interactions with VSSC. © 2017 The Authors. Pest Management Science published by John Wiley & Sons Ltd on behalf of Society of Chemical Industry. © 2017 The Authors. Pest Management Science published by John Wiley & Sons Ltd on behalf of Society of

  2. Maternally-inherited diabetes with deafness (MIDD) and hyporeninemic hypoaldosteronism.

    PubMed

    Mory, Patricia B; Santos, Marcia C dos; Kater, Claudio E; Moisés, Regina S

    2012-11-01

    Maternally-inherited diabetes with deafness (MIDD) is a rare form of monogenic diabetes that results, in most cases, from an A-to-G transition at position 3243 of mitochondrial DNA (m.3243A>G) in the mitochondrial-encoded tRNA leucine (UUA/G) gene. As the name suggests, this condition is characterized by maternally-inherited diabetes and bilateral neurosensory hearing impairment. A characteristic of mitochondrial cytopathies is the progressive multisystemic involvement with the development of more symptoms during the course of the disease. We report here the case of a patient with MIDD who developed hyporeninemic hypoaldosteronism.

  3. Gradual Loss of ACTH Due to a Novel Mutation in LHX4: Comprehensive Mutation Screening in Japanese Patients with Congenital Hypopituitarism

    PubMed Central

    Takagi, Masaki; Ishii, Tomohiro; Inokuchi, Mikako; Amano, Naoko; Narumi, Satoshi; Asakura, Yumi; Muroya, Koji; Hasegawa, Yukihiro; Adachi, Masanori; Hasegawa, Tomonobu

    2012-01-01

    Mutations in transcription factors genes, which are well regulated spatially and temporally in the pituitary gland, result in congenital hypopituitarism (CH) in humans. The prevalence of CH attributable to transcription factor mutations appears to be rare and varies among populations. This study aimed to define the prevalence of CH in terms of nine CH-associated genes among Japanese patients. We enrolled 91 Japanese CH patients for DNA sequencing of POU1F1, PROP1, HESX1, LHX3, LHX4, SOX2, SOX3, OTX2, and GLI2. Additionally, gene copy numbers for POU1F1, PROP1, HESX1, LHX3, and LHX4 were examined by multiplex ligation-dependent probe amplification. The gene regulatory properties of mutant LHX4 proteins were characterized in vitro. We identified two novel heterozygous LHX4 mutations, namely c.249-1G>A, p.V75I, and one common POU1F1 mutation, p.R271W. The patient harboring the c.249-1G>A mutation exhibited isolated growth hormone deficiency at diagnosis and a gradual loss of ACTH, whereas the patient with the p.V75I mutation exhibited multiple pituitary hormone deficiency. In vitro experiments showed that both LHX4 mutations were associated with an impairment of the transactivation capacities of POU1F1 andαGSU, without any dominant-negative effects. The total mutation prevalence in Japanese CH patients was 3.3%. This study is the first to describe, a gradual loss of ACTH in a patient carrying an LHX4 mutation. Careful monitoring of hypothalamic–pituitary -adrenal function is recommended for CH patients with LHX4 mutations. PMID:23029363

  4. Cis-oriented solvent-front EGFR G796S mutation in tissue and ctDNA in a patient progressing on osimertinib: a case report and review of the literature.

    PubMed

    Klempner, Samuel J; Mehta, Pareen; Schrock, Alexa B; Ali, Siraj M; Ou, Sai-Hong Ignatius

    2017-01-01

    Acquired resistance to epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKI) is a universal event and limits clinical efficacy. The third-generation EGFR inhibitor osimertinib is active in EGFR-mutant/T790M positive non-small-cell lung cancer. Mechanisms of acquired resistance are emerging, and here we describe a cis -oriented solvent-front EGFR G796S mutation as the resistance mechanism observed in a progression biopsy and circulating tumor DNA (ctDNA) from a patient with initial response followed by progression on osimertinib. This is one of the earliest reports of a sole solvent-front tertiary EGFR mutation as a resistance mechanism to osimertinib. Our case suggests a monoclonal resistance mechanism. We review the importance of the solvent-front residues across TKIs and describe known osimertinib resistance mechanisms. We observe that nearly all clinical osimertinib-resistant tertiary EGFR mutations are oriented in cis with EGFR T790M. This case highlights the importance of mutations affecting EGFR kinase domains and supports the feasibility of broad panel ctDNA assays for detection of novel acquired resistance and tumor heterogeneity in routine clinical care.

  5. Clinical and molecular survey in 124 Chinese patients with Leigh or Leigh-like syndrome.

    PubMed

    Zhang, Y; Yang, Y L; Sun, F; Cai, X; Qian, N; Yuan, Y; Wang, Z X; Qi, Y; Xiao, J X; Wang, X Y; Zhang, Y H; Jiang, Y W; Qin, J; Wu, X R

    2007-04-01

    Leigh syndrome is the most common mitochondrial disorder in children characterized by necrotic lesions in the central nervous system. Both mitochondrial DNA (mtDNA) and nuclear DNA defects in the mitochondrial respiratory chain can lead to this disease. To characterize the clinical and genetic traits of Leigh or Leigh-like syndrome patients in China, 124 unrelated cases were collected between 1992 and 2005. Seventy-seven cases (62.1%) met the typical criteria of Leigh syndrome, including symmetrical bilateral abnormal signals in the basal ganglia, thalamus and brain stem, etc. Other cases (37.9%) belonged to Leigh-like syndrome with atypical clinical or radiological manifestations. Late-onset patients accounted for 20.2%, which is more than previously reported. Movement disorder was the most common symptoms in our patients. Thirty-two patients (25.8%) were confirmed to carry mutant genes. Among them, six cases (4.8%) have been demonstrated to have point mutations in mitochondrial DNA. Two separate patients were detected to have mutations on A8344G and A3243G. The T8993G point mutation was identified in one patient and T8993C in one other patient. SURF1 mutations associated with cytochrome-c oxidase deficiency were identified in 25 patients (20.2%). Four unreported variations have been identified in SURF1 gene from three patients. G604C was found in 22 patients. Only one patient had C214T mutation in the pyruvate dehydrogenase E1alpha subunit gene. In the remaining 92 patients (74.2%), a specific molecular dysfunction or underlying metabolic abnormality could not be identified.

  6. Characterization of variegate porphyria mutations using a minigene approach.

    PubMed

    Granata, Barbara Xoana; Baralle, Marco; De Conti, Laura; Parera, Victoria; Rossetti, Maria Victoria

    2015-01-01

    Porphyrias are a group of metabolic diseases that affect the skin and/or nervous system. In 2008, three unrelated patients were diagnosed with variegate porphyria at the CIPYP (Centro de Investigaciones sobre Porfirinas y Porfirias). Sequencing of the protoporphyrinogen oxidase gene, the gene altered in this type of porphyria, revealed three previously undescribed mutations: c.338+3insT, c.807G>A, and c.808-1G>C. As these mutations do not affect the protein sequence, we hypothesized that they might be splicing mutations. RT-PCRs performed on the patient's mRNAs showed normal mRNA or no amplification at all. This result indicated that the aberrant spliced transcript is possibly being degraded. In order to establish whether they were responsible or not for the patient's disease by causing aberrant splicing, we utilized a minigene approach. We found that the three mutations lead to exon skipping; therefore, the abnormal mRNAs are most likely degraded by a mechanism such as nonsense-mediated decay. In conclusion, these mutations are responsible for the disease because they alter the normal splicing pathway, thus providing a functional explanation for the appearance of disease and highlighting the use of minigene assays to complement transcript analysis.

  7. Exome capture sequencing identifies a novel mutation in BBS4

    PubMed Central

    Wang, Hui; Chen, Xianfeng; Dudinsky, Lynn; Patenia, Claire; Chen, Yiyun; Li, Yumei; Wei, Yue; Abboud, Emad B.; Al-Rajhi, Ali A.; Lewis, Richard Alan; Lupski, James R.; Mardon, Graeme; Gibbs, Richard A.; Perkins, Brian D.

    2011-01-01

    Purpose Leber congenital amaurosis (LCA) is one of the most severe eye dystrophies characterized by severe vision loss at an early stage and accounts for approximately 5% of all retinal dystrophies. The purpose of this study was to identify a novel LCA disease allele or gene and to develop an approach combining genetic mapping with whole exome sequencing. Methods Three patients from King Khaled Eye Specialist Hospital (KKESH205) underwent whole genome single nucleotide polymorphism genotyping, and a single candidate region was identified. Taking advantage of next-generation high-throughput DNA sequencing technologies, whole exome capture sequencing was performed on patient KKESH205#7. Sanger direct sequencing was used during the validation step. The zebrafish model was used to examine the function of the mutant allele. Results A novel missense mutation in Bardet-Biedl syndrome 4 protein (BBS4) was identified in a consanguineous family from Saudi Arabia. This missense mutation in the fifth exon (c.253G>C;p.E85Q) of BBS4 is likely a disease-causing mutation as it segregates with the disease. The mutation is not found in the single nucleotide polymorphism (SNP) database, the 1000 Genomes Project, or matching normal controls. Functional analysis of this mutation in zebrafish indicates that the G253C allele is pathogenic. Coinjection of the G253C allele cannot rescue the mislocalization of rhodopsin in the retina when BBS4 is knocked down by morpholino injection. Immunofluorescence analysis in cell culture shows that this missense mutation in BBS4 does not cause obvious defects in protein expression or pericentriolar localization. Conclusions This mutation likely mainly reduces or abolishes BBS4 function in the retina. Further studies of this allele will provide important insights concerning the pleiotropic nature of BBS4 function. PMID:22219648

  8. Translational read-through of a nonsense mutation causing Bartter syndrome.

    PubMed

    Cho, Hee Yeon; Lee, Beom Hee; Cheong, Hae Il

    2013-06-01

    Bartter syndrome (BS) is classified into 5 genotypes according to underlying mutant genes and BS III is caused by loss-of-function mutations in the CLCNKB gene encoding for basolateral ClC-Kb. BS III is the most common genotype in Korean patients with BS and W610X is the most common CLCNKB mutation in Korean BS III. In this study, we tested the hypothesis that the CLCNKB W610X mutation can be rescued in vitro using aminoglycoside antibiotics, which are known to induce translational read-through of a nonsense mutation. The CLCNKB cDNA was cloned into a eukaryotic expression vector and the W610X nonsense mutation was generated by site-directed mutagenesis. Cultured polarized MDCK cells were transfected with the vectors, and the read-through was induced using an aminoglycoside derivative, G418. Cellular expression of the target protein was monitored via immunohistochemistry. While cells transfected with the mutant CLCNKB failed to express ClC-Kb, G418 treatment of the cells induced the full-length protein expression, which was localized to the basolateral plasma membranes. It is demonstrated that the W610X mutation in CLCNKB can be a good candidate for trial of translational read-through induction as a therapeutic modality.

  9. A Hypertension-Associated tRNAAla Mutation Alters tRNA Metabolism and Mitochondrial Function

    PubMed Central

    Jiang, Pingping; Wang, Meng; Xue, Ling; Xiao, Yun; Yu, Jialing; Wang, Hui; Yao, Juan; Liu, Hao; Peng, Yanyan; Liu, Hanqing; Li, Haiying; Chen, Ye

    2016-01-01

    In this report, we investigated the pathophysiology of a novel hypertension-associated mitochondrial tRNAAla 5655AG (m.5655AG) mutation. The destabilization of a highly conserved base pairing (A1-U72) at the aminoacyl acceptor stem by an m.5655AG mutation altered the tRNAAla function. An in vitro processing analysis showed that the m.5655AG mutation reduced the efficiency of tRNAAla precursor 5′ end cleavage catalyzed by RNase P. By using cybrids constructed by transferring mitochondria from lymphoblastoid cell lines derived from a Chinese family into mitochondrial DNA (mtDNA)-less (ρo) cells, we showed a 41% reduction in the steady-state level of tRNAAla in mutant cybrids. The mutation caused an improperly aminoacylated tRNAAla, as suggested by aberrantly aminoacylated tRNAAla and slower electrophoretic mobility of mutated tRNA. A failure in tRNAAla metabolism contributed to variable reductions in six mtDNA-encoded polypeptides in mutant cells, ranging from 21% to 37.5%, with an average of a 29.1% reduction, compared to levels of the controls. The impaired translation caused reduced activities of mitochondrial respiration chains. Furthermore, marked decreases in the levels of mitochondrial ATP and membrane potential were observed in mutant cells. These caused increases in the production of reactive oxygen species in the mutant cybrids. The data provide evidence for the association of the tRNAAla 5655AG mutation with hypertension. PMID:27161322

  10. A novel Werner Syndrome mutation: pharmacological treatment by read-through of nonsense mutations and epigenetic therapies

    PubMed Central

    Agrelo, Ruben; Sutz, Miguel Arocena; Setien, Fernando; Aldunate, Fabian; Esteller, Manel; Da Costa, Valeria; Achenbach, Ricardo

    2015-01-01

    Werner Syndrome (WS) is a rare inherited disease characterized by premature aging and increased propensity for cancer. Mutations in the WRN gene can be of several types, including nonsense mutations, leading to a truncated protein form. WRN is a RecQ family member with both helicase and exonuclease activities, and it participates in several cell metabolic pathways, including DNA replication, DNA repair, and telomere maintenance. Here, we reported a novel homozygous WS mutation (c.3767 C > G) in 2 Argentinian brothers, which resulted in a stop codon and a truncated protein (p.S1256X). We also observed increased WRN promoter methylation in the cells of patients and decreased messenger WRN RNA (WRN mRNA) expression. Finally, we showed that the read-through of nonsense mutation pharmacologic treatment with both aminoglycosides (AGs) and ataluren (PTC-124) in these cells restores full-length protein expression and WRN functionality. PMID:25830902

  11. Forecasting US ivacaftor outcomes and cost in cystic fibrosis patients with the G551D mutation.

    PubMed

    Dilokthornsakul, Piyameth; Hansen, Ryan N; Campbell, Jonathan D

    2016-06-01

    Ivacaftor, a breakthrough treatment for cystic fibrosis (CF) patients with the G551D genetic mutation, lacks long-term clinical and cost projections. This study forecasted outcomes and cost by comparing ivacaftor plus usual care versus usual care alone.A lifetime Markov model was conducted from a US payer perspective. The model consisted of five health states: 1) forced expiratory volume in 1 s (FEV1) % pred ≥70%, 2) 40%≤ FEV1 % pred <70%, 3) FEV1 % pred <40%, 4) lung transplantation and 5) death. All inputs were extracted from published literature. Budget impact was also estimated. We estimated ivacaftor's improvement in outcomes compared with a non-CF referent population.Ivacaftor was associated with 18.25 (95% credible interval (CrI) 13.71-22.20) additional life-years and 15.03 (95% CrI 11.13-18.73) additional quality-adjusted life-years (QALYs). Ivacaftor was associated with improvements in survival and QALYs equivalent to 68% and 56%, respectively, for the survival and QALY gaps between CF usual care and their non-CF peers. The incremental lifetime cost was $3 374 584. The budget impact was $0.087 per member per month.Ivacaftor increased life-years and QALYs in CF patients with the G551D mutation, and moved morbidity and mortality closer to that of their non-CF peers. Ivacaftor costs much more than usual care, but comes at a relatively limited budget impact. Copyright ©ERS 2016.

  12. Impact of the CFTR-potentiator ivacaftor on airway microbiota in cystic fibrosis patients carrying a G551D mutation.

    PubMed

    Bernarde, Cédric; Keravec, Marlène; Mounier, Jérôme; Gouriou, Stéphanie; Rault, Gilles; Férec, Claude; Barbier, Georges; Héry-Arnaud, Geneviève

    2015-01-01

    Airway microbiota composition has been clearly correlated with many pulmonary diseases, and notably with cystic fibrosis (CF), an autosomal genetic disorder caused by mutation in the CF transmembrane conductance regulator (CFTR). Recently, a new molecule, ivacaftor, has been shown to re-establish the functionality of the G551D-mutated CFTR, allowing significant improvement in lung function. The purpose of this study was to follow the evolution of the airway microbiota in CF patients treated with ivacaftor, using quantitative PCR and pyrosequencing of 16S rRNA amplicons, in order to identify quantitative and qualitative changes in bacterial communities. Three G551D children were followed up longitudinally over a mean period of more than one year covering several months before and after initiation of ivacaftor treatment. 129 operational taxonomy units (OTUs), representing 64 genera, were identified. There was no significant difference in total bacterial load before and after treatment. Comparison of global community composition found no significant changes in microbiota. Two OTUs, however, showed contrasting dynamics: after initiation of ivacaftor, the relative abundance of the anaerobe Porphyromonas 1 increased (p<0.01) and that of Streptococcus 1 (S. mitis group) decreased (p<0.05), possibly in relation to the anti-Gram-positive properties of ivacaftor. The anaerobe Prevotella 2 correlated positively with the pulmonary function test FEV-1 (r=0.73, p<0.05). The study confirmed the presumed positive role of anaerobes in lung function. Several airway microbiota components, notably anaerobes (obligate or facultative anaerobes), could be valuable biomarkers of lung function improvement under ivacaftor, and could shed light on the pathophysiology of lung disease in CF patients.

  13. Mutations in the glucose-6-phosphatase gene that cause glycogen storage disease type 1a

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chou, J.Y.; Lei, K.J.; Shelly, L.L.

    1994-09-01

    Glycogen storage disease (GSD) type la (von Gierke disease) is caused by the deficiency of glucose-6-phosphatase (G6Pase), the key enzyme in glucose homeostasis. The disease presents with clinical manifestations of severe hypoglycemia, hepatomegaly, growth retardation, lactic acidemia, hyperlipidemia, and hyperuricemia. We have succeeded in isolating a murine G6Pase cDNA from a normal mouse liver cDNA library by differentially screening method. We then isolated the human G6Pase cDNA and gene. To date, we have characterized the G6Pase genes of twelve GSD type la patients and uncovered a total of six different mutations. The mutations are comprised of R83C (an Arg atmore » codon 83 to a Cys), Q347X (a Gly at codon 347 to a stop codon), 459insTA (a two basepair insertion at nucleotide 459 yielding a truncated G6Pase of 129 residues), R295C (an Arg at codon 295 to a Cys), G222R (a Gly at codon 222 to an Arg) and {delta}F327 (a codon deletion for Phe-327 at nucleotides 1058 to 1060). The relative incidences of these mutations are 37.5% (R83C), 33.3% (Q347X), 16.6% (459insTA), 4.2% (G222R), 4.2% (R295C) and 4.2% ({delta}F327). Site-directed mutagenesis and transient expression assays demonstrated that the R83C, Q347X, R295C, and {delta}F327 mutations abolished whereas the G222R mutation greatly reduced G6Pase activity. We further characterized the structure-function requirements of amino acids 83, 222, and 295 in G6Pase catalysis. The identification of mutations in GSD type la patients has unequivocally established the molecular basis of the type la disorder. Knowledge of the mutations may be applied to prenatal diagnosis and opens the way for developing and evaluating new therapeutic approaches.« less

  14. Spectrum of CFTR gene mutations in Ecuadorian cystic fibrosis patients: the second report of the p.H609R mutation.

    PubMed

    Ortiz, Sofía C; Aguirre, Santiago J; Flores, Sofía; Maldonado, Claudio; Mejía, Juan; Salinas, Lilian

    2017-11-01

    High heterogeneity in the CFTR gene mutations disturbs the molecular diagnosis of cystic fibrosis (CF). In order to improve the diagnosis of CF in our country, the present study aims to define a panel of common CFTR gene mutations by sequencing 27 exons of the gene in Ecuadorian Cystic Fibrosis patients. Forty-eight Ecuadorian individuals with suspected/confirmed CF diagnosis were included. Twenty-seven exons of CFTR gene were sequenced to find sequence variations. Prevalence of pathogenic variations were determined and compared with other countries' data. We found 70 sequence variations. Eight of these are CF-causing mutations: p.F508del, p.G85E, p.G330E, p.A455E, p.G970S, W1098X, R1162X, and N1303K. Also this study is the second report of p.H609R in Ecuadorian population. Mutation prevalence differences between Ecuadorian population and other Latin America countries were found. The panel of mutations suggested as an initial screening for the Ecuadorian population with cystic fibrosis should contain the mutations: p.F508del, p.G85E, p.G330E, p.A455E, p.G970S, W1098X, R1162X, and N1303K. © 2017 NETLAB Laboratorios Especializados. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

  15. A novel missense Norrie disease mutation associated with a severe ocular phenotype.

    PubMed

    Khan, Arif O; Shamsi, Farrukh A; Al-Saif, Amr; Kambouris, Marios

    2004-01-01

    Clinical findings and pedigree analysis led to the diagnosis of severe Norrie disease in two brothers. DNA sequencing demonstrated a novel missense mutation (703G>T) that significantly alters predicted protein structure. Less severe retinal developmental disease may be associated with milder mutations in the Norrie disease gene.

  16. Recurrent and founder mutations in the PMS2 gene.

    PubMed

    Tomsic, J; Senter, L; Liyanarachchi, S; Clendenning, M; Vaughn, C P; Jenkins, M A; Hopper, J L; Young, J; Samowitz, W; de la Chapelle, A

    2013-03-01

    Germline mutations in PMS2 are associated with Lynch syndrome (LS), the most common known cause of hereditary colorectal cancer. Mutation detection in PMS2 has been difficult due to the presence of several pseudogenes, but a custom-designed long-range PCR strategy now allows adequate mutation detection. Many mutations are unique. However, some mutations are observed repeatedly across individuals not known to be related due to the mutation being either recurrent, arising multiple times de novo at hot spots for mutations, or of founder origin, having occurred once in an ancestor. Previously, we observed 36 distinct mutations in a sample of 61 independently ascertained Caucasian probands of mixed European background with PMS2 mutations. Eleven of these mutations were detected in more than one individual not known to be related and of these, six were detected more than twice. These six mutations accounted for 31 (51%) ostensibly unrelated probands. Here, we performed genotyping and haplotype analysis in four mutations observed in multiple probands and found two (c.137G>T and exon 10 deletion) to be founder mutations and one (c.903G>T) a probable founder. One (c.1A>G) could not be evaluated for founder mutation status. We discuss possible explanations for the frequent occurrence of founder mutations in PMS2. © 2012 John Wiley & Sons A/S.

  17. Mitochondrial tRNAPhe mutation as a cause of end-stage renal disease in childhood

    PubMed Central

    D’Aco, Kristin E; Manno, Megan; Clarke, Colleen; Ganesh, Jaya; Meyers, Kevin EC; Sondheimer, Neal

    2012-01-01

    Background We identified a mitochondrial tRNA mutation (m.586G>A) in a patient with renal failure and symptoms consistent with a mitochondrial cytopathy. This mutation was of unclear significance because there were neither consistent reports of linkage to specific disease phenotypes nor an existing analysis of effects upon mitochondrial function. Case-Diagnosis/Treatment A 16-month-old girl with failure-to-thrive, developmental regression, persistent lactic acidosis, hypotonia, GI dysmotility, adrenal insufficiency and hematologic abnormalities developed hypertension and renal impairment with chronic tubulointerstitial fibrosis, progressing to renal failure with need for peritoneal dialysis. Evaluation of her muscle and blood identified a mutation of the mitochondrial tRNA for phenylalanine, m.586G>A. Conclusions The m.586G>A mutation is pathogenic and is a cause of end-stage renal disease in childhood. The mutation interferes with the stability of tRNAPhe and affects the translation of mitochondrial proteins and the stability of the electron transport chain. PMID:23135609

  18. Novel cystathionine β-synthase gene mutations in a Filipino patient with classic homocystinuria.

    PubMed

    Silao, Catherine Lynn T; Fabella, Terence Diane F; Rama, Kahlil Izza D; Estrada, Sylvia C

    2015-10-01

    Classic homocystinuria due to cystathionine β-synthase (CBS) deficiency is an autosomal recessive disorder of sulfur metabolism. Clinical manifestations include mental retardation, dislocation of the optic lens (ectopia lentis), skeletal abnormalities and a tendency to thromboembolic episodes. We present the first mutational analysis of CBS in a Filipino patient with classic homocystinuria. Genomic DNA was extracted from peripheral blood collected from a diagnosed Filipino patient with classic homocystinuria. The entire coding region of CBS (17 exons) was amplified using polymerase chain reaction and bidirectionally sequenced using standard protocols. The patient was found to be compound heterozygous for two novel mutations, g.13995G>A [c.982G>A; p.D328K] and g.15860-15868dupGCAGGAGCT [c.1083-1091dupGCAGGAGCT; p. Q362-L364dupQEL]. Four known single-nucleotide polymorphisms (rs234706, rs1801181, rs706208 and rs706209) were also detected in the present patient's CBS. The patient was heterozygous for all the identified alleles. This is the first mutational analysis of CBS done in a Filipino patient with classic homocystinuria who presented with a novel duplication mutation and a novel missense mutation. Homocystinuria due to CBS deficiency is a heterogeneous disorder at the molecular level. © 2015 Japan Pediatric Society.

  19. Recurrent and founder mutations in the PMS2 gene

    PubMed Central

    Tomsic, Jerneja; Senter, Leigha; Liyanarachchi, Sandya; Clendenning, Mark; Vaughn, Cecily P.; Jenkins, Mark A.; Hopper, John L.; Young, Joanne; Samowitz, Wade; de la Chapelle, Albert

    2012-01-01

    Germline mutations in PMS2 are associated with Lynch syndrome (LS), the most common known cause of hereditary colorectal cancer. Mutation detection in PMS2 has been difficult due to the presence of several pseudogenes, but a custom-designed long-range PCR strategy now allows adequate mutation detection. Many mutations are unique. However some mutations are observed repeatedly, across individuals not known to be related, due to the mutation being either recurrent, arising multiple times de novo at hot spots for mutations, or of founder origin, having occurred once in an ancestor. Previously, we observed 36 distinct mutations in a sample of 61 independently ascertained Caucasian probands of mixed European background with PMS2 mutations. Eleven of these mutations were detected in more than one individual not known to be related and of these, six were detected more than twice. These six mutations accounted for 31 (51%) ostensibly unrelated probands. Here we performed genotyping and haplotype analysis in four mutations observed in multiple probands and found two (c.137G>T and exon 10 deletion) to be founder mutations, one (c.903G>T) a probable founder, and one (c.1A>G) where founder mutation status could not be evaluated. We discuss possible explanations for the frequent occurrence of founder mutations in PMS2. PMID:22577899

  20. A meta-analysis of the relationship between FGFR3 and TP53 mutations in bladder cancer.

    PubMed

    Neuzillet, Yann; Paoletti, Xavier; Ouerhani, Slah; Mongiat-Artus, Pierre; Soliman, Hany; de The, Hugues; Sibony, Mathilde; Denoux, Yves; Molinie, Vincent; Herault, Aurélie; Lepage, May-Linda; Maille, Pascale; Renou, Audrey; Vordos, Dimitri; Abbou, Claude-Clément; Bakkar, Ashraf; Asselain, Bernard; Kourda, Nadia; El Gaaied, Amel; Leroy, Karen; Laplanche, Agnès; Benhamou, Simone; Lebret, Thierry; Allory, Yves; Radvanyi, François

    2012-01-01

    TP53 and FGFR3 mutations are the most common mutations in bladder cancers. FGFR3 mutations are most frequent in low-grade low-stage tumours, whereas TP53 mutations are most frequent in high-grade high-stage tumours. Several studies have reported FGFR3 and TP53 mutations to be mutually exclusive events, whereas others have reported them to be independent. We carried out a meta-analysis of published findings for FGFR3 and TP53 mutations in bladder cancer (535 tumours, 6 publications) and additional unpublished data for 382 tumours. TP53 and FGFR3 mutations were not independent events for all tumours considered together (OR = 0.25 [0.18-0.37], p = 0.0001) or for pT1 tumours alone (OR = 0.47 [0.28-0.79], p = 0.0009). However, if the analysis was restricted to pTa tumours or to muscle-invasive tumours alone, FGFR3 and TP53 mutations were independent events (OR = 0.56 [0.23-1.36] (p = 0.12) and OR = 0.99 [0.37-2.7] (p = 0.35), respectively). After stratification of the tumours by stage and grade, no dependence was detected in the five tumour groups considered (pTaG1 and pTaG2 together, pTaG3, pT1G2, pT1G3, pT2-4). These differences in findings can be attributed to the putative existence of two different pathways of tumour progression in bladder cancer: the CIS pathway, in which FGFR3 mutations are rare, and the Ta pathway, in which FGFR3 mutations are frequent. TP53 mutations occur at the earliest stage of the CIS pathway, whereas they occur would much later in the Ta pathway, at the T1G3 or muscle-invasive stage.

  1. Screening for mutations in exon 4 of the LDL receptor gene: identification of a new deletion mutation.

    PubMed Central

    Theart, L; Kotze, M J; Langenhoven, E; Loubser, O; Peeters, A V; Lintott, C J; Scott, R S

    1995-01-01

    DNA from 14 unrelated New Zealand familial hypercholesterolaemia (FH) heterozygotes, originating from the United Kingdom, was screened for mutations in exon 4 of the low density lipoprotein receptor (LDLR) gene. One patient was heterozygous for mutation D206E, which was initially identified in South Africa. The chromosomal background of this mutant allele was compatible with that described previously in Afrikaner and English patients, suggesting that this mutation originated in the United Kingdom. The 2 bp deletion in codon 206 and mutations D154N and D200G, previously reported in English FH patients, were not detected in this sample. In one of the patients, however, a new deletion of 7 bp was identified after nucleotide 581 (or 582) in exon 4 of the LDLR gene. Images PMID:7616546

  2. Estimating the age of Hb G-Coushatta [β22(B4)Glu→Ala] mutation by haplotypes of β-globin gene cluster in Denizli, Turkey.

    PubMed

    Ozturk, Onur; Arikan, Sanem; Atalay, Ayfer; Atalay, Erol O

    2018-05-01

    Hb G-Coushatta variant was reported from various populations' parts of the world such as Thai, Korea, Algeria, Thailand, China, Japan and Turkey. In our study, we aimed to discuss the possible historical relationships of the Hb G-Coushatta mutation with the possible migration routes of the world. For this purpose, associated haplotypes were determined using polymorphic loci in the beta globin gene cluster of hemoglobin G-Coushatta and normal populations in Denizli, Turkey. We performed statistical analysis such as haplotype analysis, Hardy-Weinberg equilibrium, measurement of genetic diversity and population differentiation parameters, analysis of molecular variance using F-statistics, historical-demographic analyses, mismatch distribution analysis of both populations and applied the test statistics in Arlequin ver. 3.5 software program. The diversity of haplotypes has been shown to indicate different genetic origins for two populations. However, AMOVA results, molecular diversity parameters and population demographic expansion times showed that the Hb G-Coushatta mutation develops on the normal population gene pool. Our estimated τ values showed the average time since the demographic expansion for normal and Hb G-Coushatta populations ranged from approximately 42,000 to 38,000 ybp, respectively. Our data suggest that Hb G-Coushatta population originate in normal population in Denizli, Turkey. These results support the hypothesis that the multiple origin of Hb G-Coushatta and indicate that mutation may have been triggered the formation of new variants on beta globin haplotypes. © 2018 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

  3. Risk of colorectal cancer for people with a mutation in both a MUTYH and a DNA mismatch repair gene

    PubMed Central

    Win, Aung Ko; Reece, Jeanette C.; Buchanan, Daniel D.; Clendenning, Mark; Young, Joanne P.; Cleary, Sean P.; Kim, Hyeja; Cotterchio, Michelle; Dowty, James G.; MacInnis, Robert J.; Tucker, Katherine M.; Winship, Ingrid M.; Macrae, Finlay A.; Burnett, Terrilea; Le Marchand, Loïc; Casey, Graham; Haile, Robert W.; Newcomb, Polly A.; Thibodeau, Stephen N.; Lindor, Noralane M.; Hopper, John L.; Gallinger, Steven; Jenkins, Mark A.

    2015-01-01

    The base excision repair protein, MUTYH, functionally interacts with the DNA mismatch repair (MMR) system. As genetic testing moves from testing one gene at a time, to gene panel and whole exome next generation sequencing approaches, understanding the risk associated with co-existence of germline mutations in these genes will be important for clinical interpretation and management. From the Colon Cancer Family Registry, we identified 10 carriers who had both a MUTYH mutation (6 with c.1187G>A p.(Gly396Asp), 3 with c.821G>A p.(Arg274Gln), and 1 with c.536A>G p.(Tyr179Cys)) and a MMR gene mutation (3 in MLH1, 6 in MSH2, and 1 in PMS2), 375 carriers of a single (monoallelic) MUTYH mutation alone, and 469 carriers of a MMR gene mutation alone. Of the 10 carriers of both gene mutations, 8 were diagnosed with colorectal cancer. Using a weighted cohort analysis, we estimated that risk of colorectal cancer for carriers of both a MUTYH and a MMR gene mutation was substantially higher than that for carriers of a MUTYH mutation alone [hazard ratio (HR) 21.5, 95 % confidence interval (CI) 9.19–50.1; p < 0.001], but not different from that for carriers of a MMR gene mutation alone (HR 1.94, 95 % CI 0.63–5.99; p = 0.25). Within the limited power of this study, there was no evidence that a monoallelic MUTYH gene mutation confers additional risk of colorectal cancer for carriers of a MMR gene mutation alone. Our finding suggests MUTYH mutation testing in MMR gene mutation carriers is not clinically informative. PMID:26202870

  4. A novel point mutation (G[sup [minus]1] to T) in a 5[prime] splice donor site of intron 13 of the dystrophin gene results in exon skipping and is responsible for Becker Muscular Dystrophy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hagiwara, Yoko; Nishio, Hisahide; Kitoh, Yoshihiko

    1994-01-01

    The mutations in one-third of Duchenne and Becker muscular dystrophy patients remain unknown, as they do not involve gross rearrangements of the dystrophin gene. The authors now report a defect in the splicing of precursor mRNA (pre-mRNA), resulting from a maternally inherited mutation of the dystrophin gene in a patient with Becker muscular dystrophy. This defect results from a G-to-T transversion at the terminal nucleotide of exon 13, within the 5[prime] splice site of intron 13, and causes complete skipping of exon 13 during processing of dystrophin pre-mRNA. The predicted polypeptide encoded by the aberrant mRNA is a truncated dystrophinmore » lacking 40 amino acids from the amino-proximal end of the rod domain. This is the first report of an intraexon point mutation that completely inactivates a 5[prime] splice donor site in dystrophin pre-mRNA. Analysis of the genomic context of the G[sup [minus]1]-to-T mutation at the 5[prime] splice site supports the exon-definition model of pre-mRNA splicing and contributes to the understanding of splice-site selection. 48 refs., 5 figs.« less

  5. The Frequency and Type of K-RAS Mutations in Mexican Patients With Colorectal Cancer: A National Study.

    PubMed

    Cárdenas-Ramos, Susana G; Alcázar-González, Gregorio; Reyes-Cortés, Luisa M; Torres-Grimaldo, Abdiel A; Calderón-Garcidueñas, Ana L; Morales-Casas, José; Flores-Sánchez, Patricia; De León-Escobedo, Raúl; Gómez-Díaz, Antonio; Moreno-Bringas, Carmen; Sánchez-Guillén, Jorge; Ramos-Salazar, Pedro; González-de León, César; Barrera-Saldaña, Hugo A

    2017-06-01

    Current metastatic colorectal cancer (mCRC) therapy uses monoclonal antibodies against the epidermal growth factor receptor. This treatment is only useful in the absence of K-RAS gene mutations; therefore the study of such mutations is part of a personalized treatment. The aim of this work is to determine the frequency and type of the most common K-RAS mutations in Mexican patients with metastatic disease by nucleotide sequencing. We studied 888 patients with mCRC from different regions of Mexico. The presence of mutations in exon 2, codons 12 and 13, of the K-RAS gene was determined by nucleotide sequencing. Patients exhibited K-RAS gene mutations in 35% (310/888) of cases. Mutation frequency of codons 12 and 13 was 71% (221/310) and 29% (89/310), respectively. The most common mutation (45.7%) in codon 12 was c.35G>A (p.G12D), whereas the one in codon 13 was c.38G>A (p.G13D) (78.7%). Given the frequency of K-RAS mutations in Mexicans, making a genetic study before deciding to treat mCRC patients with monoclonal antibodies is indispensable.

  6. Coinheritance of a novel mutation on the HBA1 gene: c.187delG (p.W62fsX66) [codon 62 (-G) (α1)] with the α212 patchwork allele and Hb S [β6(A3)Glu→Val, GAG>GTG; HBB: c.20A>T].

    PubMed

    Scheps, Karen G; De Paula, Silvia M; Bitsman, Alicia R; Freigeiro, Daniel H; Basack, F Nora; Pennesi, Sandra P; Varela, Viviana

    2013-01-01

    We describe a novel frameshift mutation on the HBA1 gene (c.187delG), causative of α-thalassemia (α-thal) in a Black Cuban family with multiple sequence variants in the HBA genes and the Hb S [β6(A3)Glu→Val, GAG>GTG; HBB: c.20A>T] mutation. The deletion of the first base of codon 62 resulted in a frameshift at amino acid 62 with a putative premature termination codon (PTC) at amino acid 66 on the same exon (p.W62fsX66), which most likely triggers nonsense mediated decay of the resulting mRNA. This study also presents the first report of the α212 patchwork allele in Latin America and the description of two new sequence variants in the HBA2 region (c.-614G>A in the promoter region and c.95+39 C>T on the first intron).

  7. Muscle MRI in neutral lipid storage disease with myopathy carrying mutation c.187+1G>A.

    PubMed

    Xu, Chunxiao; Zhao, Yawen; Liu, Jing; Zhang, Wei; Wang, Zhaoxia; Yuan, Yun

    2015-06-01

    We describe the clinical and muscle MRI changes in 2 siblings with neutral lipid storage disease with myopathy (NLSDM) carrying the mutation c.187+1G>A. Peripheral blood smears, genetic tests, and muscle biopsies were performed. Thigh MRI was performed to observe fatty replacement, muscle edema, and muscle bulk from axial sections. Both siblings had similar fatty infiltration and edema. T1-weighted images of the gluteus maximus, adductor magnus, semitendinosus, and semimembranosus revealed marked and diffuse fatty infiltration. There was asymmetric involvement in biceps femoris and quadriceps. There was extensive fatty infiltration in the quadriceps, except for the rectus femoris. Gracilis and sartorius were relatively spared. Thigh muscle volume was decreased, while the gracilis and sartorius appeared to show compensatory hypertrophy. Compared with previous reports in NLSDM, MRI changes in this myopathy tended to be more severe. Asymmetry and relatively selective fatty infiltration were characteristics. © 2014 Wiley Periodicals, Inc.

  8. iMARS--mutation analysis reporting software: an analysis of spontaneous cII mutation spectra.

    PubMed

    Morgan, Claire; Lewis, Paul D

    2006-01-31

    The sensitivity of any mutational assay is determined by the level at which spontaneous mutations occur in the corresponding untreated controls. Establishing the type and frequency at which mutations occur naturally within a test system is essential if one is to draw scientifically sound conclusions regarding chemically induced mutations. Currently, mutation-spectra analysis is laborious and time-consuming. Thus, we have developed iMARS, a comprehensive mutation-spectrum analysis package that utilises routinely used methodologies and visualisation tools. To demonstrate the use and capabilities of iMARS, we have analysed the distribution, types and sequence context of spontaneous base substitutions derived from the cII gene mutation assay in transgenic animals. Analysis of spontaneous mutation spectra revealed variation both within and between the transgenic rodent test systems Big Blue Mouse, MutaMouse and Big Blue Rat. The most common spontaneous base substitutions were G:C-->A:T transitions and G:C-->T:A transversions. All Big Blue Mouse spectra were significantly different from each other by distribution and nearly all by mutation type, whereas the converse was true for the other test systems. Twenty-eight mutation hotspots were observed across all spectra generally occurring in CG, GA/TC, GG and GC dinucleotides. A mutation hotspot at nucleotide 212 occurred at a higher frequency in MutaMouse and Big Blue Rat. In addition, CG dinucleotides were the most mutable in all spectra except two Big Blue Mouse spectra. Thus, spontaneous base-substitution spectra showed more variation in distribution, type and sequence context in Big Blue Mouse relative to spectra derived from MutaMouse and Big Blue Rat. The results of our analysis provide a baseline reference for mutation studies utilising the cII gene in transgenic rodent models. The potential differences in spontaneous base-substitution spectra should be considered when making comparisons between these test systems

  9. [Mutation analysis of seven patients with Waardenburg syndrome].

    PubMed

    Hao, Ziqi; Zhou, Yongan; Li, Pengli; Zhang, Quanbin; Li, Jiao; Wang, Pengfei; Li, Xiangshao; Feng, Yong

    2016-06-01

    To perform genetic analysis for 7 patients with Waardenburg syndrome. Potential mutation of MITF, PAX3, SOX10 and SNAI2 genes was screened by polymerase chain reaction and direct sequencing. Functions of non-synonymous polymorphisms were predicted with PolyPhen2 software. Seven mutations, including c.649-651delAGA (p.R217del), c.72delG (p.G24fs), c.185T>C (p.M62T), c.118C>T (p.Q40X), c.422T>C (p.L141P), c.640C>T (p.R214X) and c.28G>T(p.G43V), were detected in the patients. Among these, four mutations of the PAX3 gene (c.72delG, c.185T>C, c.118C>T and c.128G>T) and one SOX10 gene mutation (c.422T>C) were not reported previously. Three non-synonymous SNPs (c.185T>C, c.128G>T and c.422T>C) were predicted as harmful. Genetic mutations have been detected in all patients with Waardenburg syndrome.

  10. Biallelic Mutations in PLA2G5, Encoding Group V Phospholipase A2, Cause Benign Fleck Retina

    PubMed Central

    Sergouniotis, Panagiotis I.; Davidson, Alice E.; Mackay, Donna S.; Lenassi, Eva; Li, Zheng; Robson, Anthony G.; Yang, Xu; Kam, Jaimie Hoh; Isaacs, Timothy W.; Holder, Graham E.; Jeffery, Glen; Beck, Jonathan A.; Moore, Anthony T.; Plagnol, Vincent; Webster, Andrew R.

    2011-01-01

    Flecked-retina syndromes, including fundus flavimaculatus, fundus albipunctatus, and benign fleck retina, comprise a group of disorders with widespread or limited distribution of yellow-white retinal lesions of various sizes and configurations. Three siblings who have benign fleck retina and were born to consanguineous parents are the basis of this report. A combination of homozygosity mapping and exome sequencing helped to identify a homozygous missense mutation, c.133G>T (p.Gly45Cys), in PLA2G5, a gene encoding a secreted phospholipase (group V phospholipase A2). A screen of a further four unrelated individuals with benign fleck retina detected biallelic variants in the same gene in three patients. In contrast, no loss of function or common (minor-allele frequency>0.05%) nonsynonymous PLA2G5 variants have been previously reported (EVS, dbSNP, 1000 Genomes Project) or were detected in an internal database of 224 exomes (from subjects with adult onset neurodegenerative disease and without a diagnosis of ophthalmic disease). All seven affected individuals had fundoscopic features compatible with those previously described in benign fleck retina and no visual or electrophysiological deficits. No medical history of major illness was reported. Levels of low-density lipoprotein were mildly elevated in two patients. Optical coherence tomography and fundus autofluorescence findings suggest that group V phospholipase A2 plays a role in the phagocytosis of photoreceptor outer-segment discs by the retinal pigment epithelium. Surprisingly, immunohistochemical staining of human retinal tissue revealed localization of the protein predominantly in the inner and outer plexiform layers. PMID:22137173

  11. First report of HGD mutations in a Chinese with alkaptonuria.

    PubMed

    Yang, Yong-jia; Guo, Ji-hong; Chen, Wei-jian; Zhao, Rui; Tang, Jin-song; Meng, Xiao-hua; Zhao, Liu; Tu, Ming; He, Xin-yu; Wu, Ling-qian; Zhu, Yi-min

    2013-04-15

    Alkaptonuria (AKU) is one of the first prototypic inborn errors in metabolism and the first human disease found to be transmitted via Mendelian autosomal recessive inheritance. It is caused by HGD mutations, which leads to a deficiency in homogentisate 1,2-dioxygenase (HGD) activity. To date, several HGD mutations have been identified as the cause of the prototypic disease across different ethnic populations worldwide. However, in Asia, the HGD mutation is very rarely reported. For the Chinese population, no literature on HGD mutation screening is available to date. In this paper, we describe two novel HGD mutations in a Chinese AKU family, the splicing mutation of IVS7+1G>C, a donor splice site of exon 7, and a missense mutation of F329C in exon 12. The predicted new splicing site of the mutated exon 7 sequence demonstrated a 303bp extension after the mutation site. The F329C mutation most probably disturbed the stability of the conformation of the two loops critical to the Fe(2+) active site of the HGD enzyme. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. Characterization of a new disease-causing mutation of SH2D1A in a family with X-linked lymphoproliferative disease.

    PubMed

    Erdõs, Melinda; Uzvölgyi, Eva; Nemes, Zoltán; Török, Olga; Rákóczi, Eva; Went-Sümegi, Nils; Sümegi, János; Maródi, László

    2005-05-01

    Males with an expressed mutation in the SH2D1A gene that encodes an SH2 domain protein named SH2D1A or SAP (NP_002342; signaling lymphocyte activating molecule [SLAM]-associated protein), have an X-linked syndrome characterized by an increased vulnerability to infection with Epstein-Barr virus (EBV). We evaluated two related male patients with fatal infectious mononucleosis (FIM) and mutation in the SH2D1A gene. Sequence analysis revealed a hemizygous c.47G>A mutation in one of the patients, and heterozygosity for this mutation in the genomic DNA from his mother and maternal grandmother. This mutation resulted in p.G16D amino acid change in the sequence of the SAP protein. To analyze the effect of this missense mutation on protein function cDNA was generated by site-directed mutagenesis and expressed in COS cells. We found that half-life of the p.G16D protein was comparable to that of wild type SAP. However, the mutant protein was defective in binding to its physiological ligands SLAM and 2B4. These results suggest that a defect in ligand binding contributes to the loss of function of the SAP protein in patients carrying p.G16D mutation.

  13. Development of a Molecular-Beacon Assay To Detect the G1896A Precore Mutation in Hepatitis B Virus-Infected Individuals

    PubMed Central

    Waltz, Therese L.; Marras, Salvatore; Rochford, Gemma; Nolan, John; Lee, Eugenia; Melegari, Margherita; Pollack, Henry

    2005-01-01

    The 1896 precore (PC) mutation is the most frequent cause of hepatitis B virus e-antigen (HBeAg)-negative chronic hepatitis B virus (HBV) infection. Detection of the 1896 PC mutation has application in studies monitoring antiviral therapy and the natural history of the disease. Identification of this mutation is usually performed by direct sequencing, which is both costly and laborious. The aim of this study was to develop a rapid, high-throughput assay to detect the 1896 PC mutation using real-time PCR and molecular-beacon technology. The assay was initially standardized on oligonucleotide targets and plasmids containing the wild-type (WT) and PC mutation and then tested on plasma samples from children with HBV DNA of >106 copies/ml. Nine individuals were HBeAg negative and suspected to harbor HBeAg mutations, while 12 children were HBeAg positive and selected as controls. Ninety percent (19 of 21) of plasma samples tested with molecular beacons were in complete agreement with sequencing results. The remaining 10% (2 of 21) of samples were identified as heterogeneous mixtures of WT and mutant virus by molecular beacons, though sequencing found only a homogeneous mutant in both cases. Overall, the 1896 PC mutation was detected by this assay in 55.5% of the children with HBeAg-negative infection. In summary, this assay is a rapid, sensitive, and specific technique that effectively discriminates WT from 1896 PC mutant HBV and may be useful in clinical and epidemiological studies. PMID:15634980

  14. Cystic fibrosis transmembrane conductance regulator mutations at a referral center for cystic fibrosis*

    PubMed Central

    Coutinho, Cyntia Arivabeni de Araújo Correia; Marson, Fernando Augusto de Lima; Ribeiro, Antônio Fernando; Ribeiro, José Dirceu; Bertuzzo, Carmen Silvia

    2013-01-01

    OBJECTIVE: To determine the frequency of six mutations (F508del, G542X, G551D, R553X, R1162X, and N1303K) in patients with cystic fibrosis (CF) diagnosed, at a referral center, on the basis of abnormal results in two determinations of sweat sodium and chloride concentrations. METHODS: This was a cross-sectional study involving 70 patients with CF. The mean age of the patients was 12.38 ± 9.00 years, 51.43% were female, and 94.29% were White. Mutation screening was performed with polymerase chain reaction (for F508del), followed by enzymatic digestion (for other mutations). Clinical analysis was performed on the basis of gender, age, ethnicity, pulmonary/gastrointestinal symptoms, and Shwachman-Kulczycki (SK) score. RESULTS: All of the patients showed pulmonary symptoms, and 8 had no gastrointestinal symptoms. On the basis of the SK scores, CF was determined to be mild, moderate, and severe in 22 (42.3%), 17 (32.7%), and 13 (25.0%) of the patients, respectively. There was no association between F508del mutation and disease severity by SK score. Of the 140 alleles analyzed, F508del mutation was identified in 70 (50%). Other mutations (G542X, G551D, R553X, R1162X, and N1303K) were identified in 12 (7.93%) of the alleles studied. In F508del homozygous patients with severe disease, the OR was 0.124 (95% CI: 0.005-0.826). CONCLUSIONS: In 50% of the alleles studied, the molecular diagnosis of CF was confirmed by identifying a single mutation (F508del). If we consider the analysis of the six most common mutations in the Brazilian population (including F508del), the molecular diagnosis was confirmed in 58.57% of the alleles studied. PMID:24310628

  15. Cystic fibrosis transmembrane conductance regulator mutations at a referral center for cystic fibrosis.

    PubMed

    Coutinho, Cyntia Arivabeni de Araújo Correia; Marson, Fernando Augusto de Lima; Ribeiro, Antônio Fernando; Ribeiro, José Dirceu; Bertuzzo, Carmen Silvia

    2013-01-01

    To determine the frequency of six mutations (F508del, G542X, G551D, R553X, R1162X, and N1303K) in patients with cystic fibrosis (CF) diagnosed, at a referral center, on the basis of abnormal results in two determinations of sweat sodium and chloride concentrations. This was a cross-sectional study involving 70 patients with CF. The mean age of the patients was 12.38 ± 9.00 years, 51.43% were female, and 94.29% were White. Mutation screening was performed with polymerase chain reaction (for F508del), followed by enzymatic digestion (for other mutations). Clinical analysis was performed on the basis of gender, age, ethnicity, pulmonary/gastrointestinal symptoms, and Shwachman-Kulczycki (SK) score. All of the patients showed pulmonary symptoms, and 8 had no gastrointestinal symptoms. On the basis of the SK scores, CF was determined to be mild, moderate, and severe in 22 (42.3%), 17 (32.7%), and 13 (25.0%) of the patients, respectively. There was no association between F508del mutation and disease severity by SK score. Of the 140 alleles analyzed, F508del mutation was identified in 70 (50%). Other mutations (G542X, G551D, R553X, R1162X, and N1303K) were identified in 12 (7.93%) of the alleles studied. In F508del homozygous patients with severe disease, the OR was 0.124 (95% CI: 0.005-0.826). In 50% of the alleles studied, the molecular diagnosis of CF was confirmed by identifying a single mutation (F508del). If we consider the analysis of the six most common mutations in the Brazilian population (including F508del), the molecular diagnosis was confirmed in 58.57% of the alleles studied.

  16. Description of a novel missense mutation of glucose-6-phosphate dehydrogenase gene associated with asymptomatic high enzyme deficiency.

    PubMed

    Minucci, Angelo; Concolino, Paola; Antenucci, Mirca; Santonocito, Concetta; Ameglio, Franco; Zuppi, Cecilia; Giardina, Bruno; Capoluongo, Ettore

    2007-08-01

    We report a case of an asymptomatic young subject affected by severe deficiency of Glucose 6-phosphate dehydrogenase (G6PD) activity. A novel genetic mutation (G130A) in the third exon was found. We named this novel mutation the "G6PD RIGNANO variant". These findings may contribute to a better knowledge of molecular epidemiology of the G6PD mutation and may represent an additional variant to be studied for a deep comprehension of in vivo compensation mechanisms of G6PD deficiency.

  17. Identification of six new Gaucher disease mutations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Beutler, E.; Gelbart, T.; West, C.

    1993-01-01

    The four most common mutations account for 97% of the Gaucher disease-producing alleles in Jewish patients and 75% of the alleles in non-Jewish patients. Although at least 15 other mutations and some examples of gene conversion and/or fusion genes have been described, a number of mutations remain unidentified. We have now identified six new mutations, a deletion of a C at the 72 position of the cDNA, a 481C[yields]T mutation (122p[sup Gly[yields]Ser]), a 751T [yields] C (212 [sup Tyr[yields]His]), a 1549G [yields] A (478[sup Gly[yields]Ser]), a 1604G [yields] A (496 [sup Arg[yields]His]), and a 55-bp deletion. All but one ofmore » these were found in single families. The 1604A mutation, however, was observed in four unrelated individuals. 7 refs., 2 tabs.« less

  18. Molecular Characterization of β-Thalassemia Mutations in Central Vietnam.

    PubMed

    Doro, Maria G; Casu, Giuseppina; Frogheri, Laura; Persico, Ivana; Triet, Le Phan Minh; Hoa, Phan Thi Thuy; Hoang, Nguyen Huy; Pirastru, Monica; Mereu, Paolo; Cucca, Francesco; Masala, Bruno

    2017-03-01

    The molecular basis of β-thalassemia (β-thal) mutations in North and in South Vietnam have been described during the past 15 years, whereas limited data were available concerning the central area of the country. In this study, we describe the molecular characterization and frequency of β-globin gene mutations in the Thua Thien Hue Province of Central Vietnam as the result of a first survey conducted in 22 transfusion-dependent patients, and four unrelated heterozygotes. Nine different known mutations were identified (seven of the β 0 and two of the β + type) in a total of 48 chromosomes. The most common was codon 26 (G>A) or Hb E (HBB: c.79 G>A) accounting for 29.2% of the total studied chromosomes, followed by codon 17 (A>T) (HBB: c.52 A>T) (25.0%), and codons 41/42 (-TTCT) (HBB: c.126_129delCTTT) (18.8%). Other mutations with appreciable frequencies (6.3-8.3%) were IVS-I-1 (G>T) (HBB: c.92+1 G>T), codon 26 (G>T) (HBB: c.79 G>T) and codons 71/72 (+A) (HBB: c.216_217insA). Relatively rarer (2.0%) were the promoter -28 (A>G) (HBB: c.78 A>G) mutation, the codon 95 (+A) (HBB: c.287_288insA), which is reported only in the Vietnamese, and the codons 14/15 (+G) (HBB: c.45_46insG) mutation, thus far observed only in Thailand. Results are relevant for implementing appropriate measures for β-thal prevention and control in the region as well as in the whole country.

  19. HPLC-ESI-MS/MS analysis of hemoglobin peptides in tryptic digests of dried-blood spot extracts detects HbS, HbC, HbD, HbE, HbO-Arab, and HbG-Philadelphia mutations.

    PubMed

    Haynes, Christopher A; Guerra, Stephanie L; Fontana, Jessalyn C; DeJesús, Víctor R

    2013-09-23

    Hemoglobinopathies are mutations resulting in abnormal globin chain structure; some have clinically significant outcomes such as anemia or reduced lifespan. Five β-globin mutations are (c.20A>T, p.E6V), (c.19G>A, p. E6K), (c.79G>A, p.E26K), (c.364G>C, p.E121Q), and (c.364G>A, p.E121K), resulting in HbS (sickle-cell hemoglobin), HbC, HbE, HbD-Los Angeles, and HbO-Arab, respectively. One α-globin mutation is (c.[207C>G or 207C>A], p.N68K), resulting in HbG-Philadelphia. HPLC-ESI-MS/MS analysis of dried-blood spot (DBS) punches from newborns extracted with a trypsin-containing solution provides greater than 90% coverage of α-, β-, and γ-globin amino acid sequences. Because the (c.20A>T, p.E6V), (c.19G>A, p. E6K), (c.79G>A, p.E26K), (c.364G>C, p.E121Q), (c.364G>A, p.E121K), and (c.[207C>G or 207C>A], p.N68K) mutations generate globin peptides with novel amino acid sequences, detecting one of these peptides in DBS extracts is indicative of the presence of a hemoglobinopathy in the newborn. The method described here can distinguish normal β-globin peptides from the mutant HbS, HbC, HbE, HbD-Los Angeles and HbO-Arab peptides, as well as normal α-globin peptide from the mutant HbG-Philadelphia peptide, allowing the identification of unaffected heterozygotes such as HbAS, and of compound heterozygotes such as HbASG-Philadelphia. This HPLC-ESI-MS/MS analytical approach provides information that is not available from traditional hemoglobin analyses such as isoelectric focusing and HPLC-UV. It is also capable of determining the amino acid sequence of hemoglobin peptides, potentially allowing the detection of numerous hemoglobinopathies resulting from point mutations. Published by Elsevier B.V.

  20. Screening for Fabry disease in left ventricular hypertrophy: documentation of a novel mutation.

    PubMed

    Baptista, Ana; Magalhães, Pedro; Leão, Sílvia; Carvalho, Sofia; Mateus, Pedro; Moreira, Ilídio

    2015-08-01

    Fabry disease is a lysosomal storage disease caused by enzyme α-galactosidase A deficiency as a result of mutations in the GLA gene. Cardiac involvement is characterized by progressive left ventricular hypertrophy. To estimate the prevalence of Fabry disease in a population with left ventricular hypertrophy. The patients were assessed for the presence of left ventricular hypertrophy defined as a left ventricular mass index ≥ 96 g/m2 for women or ≥ 116 g/m2 for men. Severe aortic stenosis and arterial hypertension with mild left ventricular hypertrophy were exclusion criteria. All patients included were assessed for enzyme α-galactosidase A activity using dry spot testing. Genetic study was performed whenever the enzyme activity was decreased. A total of 47 patients with a mean left ventricular mass index of 141.1 g/m2 (± 28.5; 99.2 to 228.5 g/m2] were included. Most of the patients were females (51.1%). Nine (19.1%) showed decreased α-galactosidase A activity, but only one positive genetic test - [GLA] c.785G>T; p.W262L (exon 5), a mutation not previously described in the literature. This clinical investigation was able to establish the association between the mutation and the clinical presentation. In a population of patients with left ventricular hypertrophy, we documented a Fabry disease prevalence of 2.1%. This novel case was defined in the sequence of a mutation of unknown meaning in the GLA gene with further pathogenicity study. Thus, this study permitted the definition of a novel causal mutation for Fabry disease - [GLA] c.785G>T; p.W262L (exon 5).

  1. Novel RS1 mutations associated with X-linked juvenile retinoschisis

    PubMed Central

    YI, JUNHUI; LI, SHIQIANG; JIA, XIAOYUN; XIAO, XUESHAN; WANG, PANFENG; GUO, XIANGMING; ZHANG, QINGJIONG

    2012-01-01

    To identify mutations in the retinoschisin (RS1) gene in families with X-linked retinoschisis (XLRS). Twenty families with XLRS were enrolled in this study. All six coding exons and adjacent intronic regions of RS1 were amplified by polymerase chain reaction (PCR). The nucleotide sequences of the amplicons were determined by Sanger sequencing. Ten hemizygous mutations in RS1 were detected in patients from 14 of the 20 families. Four of the ten mutations were novel, including c:176G>A (p:Cys59Tyr) in exon 3, c:531T>G (p:Tyr177X), c:607C>G (p:Pro203Ala) and c:668G>A (p:Cys223Tyr) in exon 6. These four novel mutations were not present in 176 normal individuals. The remaining six were recurrent mutations, including c:214G>A (p:Glu72Lys), c:304C>T (p:Arg102Trp), c:436G>A (p:Glu146Lys), c:544C>T (p:Arg182Cys), c:599G>A (p:Arg200His) and c:644A>T (p:Glu215Val). Our study expanded the mutation spectrum of RS1 and enriches our understanding of the molecular basis of XLRS. PMID:22245991

  2. Novel RS1 mutations associated with X-linked juvenile retinoschisis.

    PubMed

    Yi, Junhui; Li, Shiqiang; Jia, Xiaoyun; Xiao, Xueshan; Wang, Panfeng; Guo, Xiangming; Zhang, Qingjiong

    2012-04-01

    To identify mutations in the retinoschisin (RS1) gene in families with X-linked retinoschisis (XLRS). Twenty families with XLRS were enrolled in this study. All six coding exons and adjacent intronic regions of RS1 were amplified by polymerase chain reaction (PCR). The nucleotide sequences of the amplicons were determined by Sanger sequencing. Ten hemizygous mutations in RS1 were detected in patients from 14 of the 20 families. Four of the ten mutations were novel, including c:176G>A (p:Cys59Tyr) in exon 3, c:531T>G (p:Tyr177X), c:607C>G (p:Pro203Ala) and c:668G>A (p:Cys223Tyr) in exon 6. These four novel mutations were not present in 176 normal individuals. The remaining six were recurrent mutations, including c:214G>A (p:Glu72Lys), c:304C>T (p:Arg102Trp), c:436G>A (p:Glu146Lys), c:544C>T (p:Arg182Cys), c:599G>A (p:Arg200His) and c:644A>T (p:Glu215Val). Our study expanded the mutation spectrum of RS1 and enriches our understanding of the molecular basis of XLRS.

  3. A calcium-sensing receptor mutation causing hypocalcemia disrupts a transmembrane salt bridge to activate β-arrestin-biased signaling.

    PubMed

    Gorvin, Caroline M; Babinsky, Valerie N; Malinauskas, Tomas; Nissen, Peter H; Schou, Anders J; Hanyaloglu, Aylin C; Siebold, Christian; Jones, E Yvonne; Hannan, Fadil M; Thakker, Rajesh V

    2018-02-20

    The calcium-sensing receptor (CaSR) is a G protein-coupled receptor (GPCR) that signals through G q/11 and G i/o to stimulate cytosolic calcium (Ca 2+ i ) and mitogen-activated protein kinase (MAPK) signaling to control extracellular calcium homeostasis. Studies of loss- and gain-of-function CASR mutations, which cause familial hypocalciuric hypercalcemia type 1 (FHH1) and autosomal dominant hypocalcemia type 1 (ADH1), respectively, have revealed that the CaSR signals in a biased manner. Thus, some mutations associated with FHH1 lead to signaling predominantly through the MAPK pathway, whereas mutations associated with ADH1 preferentially enhance Ca 2+ i responses. We report a previously unidentified ADH1-associated R680G CaSR mutation, which led to the identification of a CaSR structural motif that mediates biased signaling. Expressing CaSR R680G in HEK 293 cells showed that this mutation increased MAPK signaling without altering Ca 2+ i responses. Moreover, this gain of function in MAPK activity occurred independently of G q/11 and G i/o and was mediated instead by a noncanonical pathway involving β-arrestin proteins. Homology modeling and mutagenesis studies showed that the R680G CaSR mutation selectively enhanced β-arrestin signaling by disrupting a salt bridge formed between Arg 680 and Glu 767 , which are located in CaSR transmembrane domain 3 and extracellular loop 2, respectively. Thus, our results demonstrate CaSR signaling through β-arrestin and the importance of the Arg 680 -Glu 767 salt bridge in mediating signaling bias. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  4. JAK and MPL mutations in myeloid malignancies.

    PubMed

    Tefferi, Ayalew

    2008-03-01

    The Janus family of non-receptor tyrosine kinases (JAK1, JAK2, JAK3 and tyrosine kinase 2) transduces signals downstream of type I and II cytokine receptors via signal transducers and activators of transcription (STATs). JAK3 is important in lymphoid and JAK2 in myeloid cell proliferation and differentiation. The thrombopoietin receptor MPL is one of several JAK2 cognate receptors and is essential for myelopoiesis in general and megakaryopoiesis in particular. Germline loss-of-function (LOF) JAK3 and MPL mutations cause severe combined immunodeficiency and congenital amegakaryocytic thrombocytopenia, respectively. Germline gain-of-function (GOF) MPL mutation (MPLS505N) causes familial thrombocytosis. Somatic JAK3 (e.g. JAK3A572V, JAK3V722I, JAK3P132T) and fusion JAK2 (e.g. ETV6-JAK2, PCM1-JAK2, BCR-JAK2) mutations have respectively been described in acute megakaryocytic leukemia and acute leukemia/chronic myeloid malignancies. However, current attention is focused on JAK2 (e.g. JAK2V617F, JAK2 exon 12 mutations) and MPL (e.g. MPLW515L/K/S, MPLS505N) mutations associated with myeloproliferative neoplasms (MPNs). A JAK2 mutation, primarily JAK2V617F, is invariably associated with polycythemia vera (PV). The latter mutation also occurs in the majority of patients with essential thrombocythemia (ET) or primary myelofibrosis (PMF). MPL mutational frequency in MPNs is substantially less (<10%). In general, despite a certain degree of genotype - phenotype correlations, the prognostic relevance of harbouring one of these mutations, or their allele burden when present, remains dubious. Regardless, based on the logical assumption that amplified JAK-STAT signalling is central to the pathogenesis of PV, ET and PMF, several anti-JAK2 tyrosine kinase inhibitors have been developed and are currently being tested in humans with these disorders.

  5. Overrepresentation of missense mutations in mild hemophilia A patients from Belgium: founder effect or independent occurrence?

    PubMed

    Lannoy, N; Lambert, C; Vikkula, M; Hermans, C

    2015-06-01

    Roughly 40% of observed mutations responsible for hemophilia A (HA) are novel and present in either a single family or a limited number of unrelated families. During routine diagnostic analysis of 73 unrelated Belgian patients with mild HA, 4 out of 43 different mutations (p.Ser2030Asn, p.Arg2178Cys, p.Arg2178His, and p.Pro2311His) were detected in more than one family, representing 35% of total identified mutations. To discriminate between an independent recurrence or a founder effect, an analysis of intra- and -extragenic single nucleotide polymorphisms (SNPs) and short tandem repeats (STRs) flanking the F8 gene was conducted. SNP haplotype and microsatellite analysis revealed strong evidence that p.Ser2030Asn and p.Pro2311His mutations were probably associated with a founder effect. The two other mutations localized in an F8 cytosine-phosphate-guanine (CpG) site likely resulted from recurrent de novo events. This study suggests that missense mutations producing C-to-T or G-to-A substitutions in CpG dinucleotide can occur de novo with more repetition than other causal substitutions that do not affect the CpG site. Analysis of F8 database implied that CpG sites throughout the F8 gene are not all mutated with the same frequency. Causes are still unknown and remain to be identified. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. HRAS mutations in Costello syndrome: detection of constitutional activating mutations in codon 12 and 13 and loss of wild-type allele in malignancy.

    PubMed

    Estep, Anne L; Tidyman, William E; Teitell, Michael A; Cotter, Philip D; Rauen, Katherine A

    2006-01-01

    Costello syndrome (CS) is a complex developmental disorder involving characteristic craniofacial features, failure to thrive, developmental delay, cardiac and skeletal anomalies, and a predisposition to develop neoplasia. Based on similarities with other cancer syndromes, we previously hypothesized that CS is likely due to activation of signal transduction through the Ras/MAPK pathway [Tartaglia et al., 2003]. In this study, the HRAS coding region was sequenced for mutations in a large, well-characterized cohort of 36 CS patients. Heterogeneous missense point mutations predicting an amino acid substitution were identified in 33/36 (92%) patients. The majority (91%) had a 34G --> A transition in codon 12. Less frequent mutations included 35G --> C (codon 12) and 37G --> T (codon 13). Parental samples did not have an HRAS mutation supporting the hypothesis of de novo heterogeneous mutations. There is phenotypic variability among patients with a 34G --> A transition. The most consistent features included characteristic facies and skin, failure to thrive, developmental delay, musculoskeletal abnormalities, visual impairment, cardiac abnormalities, and generalized hyperpigmentation. The two patients with 35G --> C had cardiac arrhythmias whereas one patient with a 37G --> T transversion had an enlarged aortic root. Of the patients with a clinical diagnosis of CS, neoplasia was the most consistent phenotypic feature for predicating an HRAS mutation. To gain an understanding of the relationship between constitutional HRAS mutations and malignancy, HRAS was sequenced in an advanced biphasic rhabdomyosarcoma/fibrosarcoma from an individual with a 34G --> A mutation. Loss of the wild-type HRAS allele was observed, suggesting tumorigenesis in CS patients is accompanied by additional somatic changes affecting HRAS. Finally, due to phenotypic overlap between CS and cardio-facio-cutaneous (CFC) syndromes, the HRAS coding region was sequenced in a well-characterized CFC cohort

  7. Novel growth hormone receptor gene mutation in a patient with Laron syndrome.

    PubMed

    Arman, Ahmet; Yüksel, Bilgin; Coker, Ajda; Sarioz, Ozlem; Temiz, Fatih; Topaloglu, Ali Kemal

    2010-04-01

    Growth Hormone (GH) is a 22 kDa protein that has effects on growth and glucose and fat metabolisms. These effects are initiated by binding of growth hormone (GH) to growth hormone receptors (GHR) expressed in target cells. Mutations or deletions in the growth hormone receptor cause an autosomal disorder called Laron-type dwarfism (LS) characterized by high circulating levels of serum GH and low levels of insulin like growth factor-1 (IGF-1). We analyzed the GHR gene for genetic defect in seven patients identified as Laron type dwarfism. We identified two missense mutations (S40L and W104R), and four polymorphisms (S473S, L526I, G168G and exon 3 deletion). We are reporting a mutation (W104R) at exon 5 of GHR gene that is not previously reported, and it is a novel mutation.

  8. Pseudo-Bartter syndrome as the sole manifestation of cystic fibrosis in a child with 711+G>T/IVS8-5T mutation: a new face of an old disease.

    PubMed

    Tinsa, Faten; Hadj Fredj, Sondes; Bel Hadj, Imen; Khalsi, Fatma; Abdelhak, Sonia; Boussetta, Khadija; Messaoud, Taieb

    2017-08-01

    Pseudo-Bartter syndrome (PBS) describes an uncommon complication of cystic fibrosis leading to hypochloraemic, hypokalaemic metabolic alkalosis. PBS as the sole manifestation of cystic fibrosis in children is extremely rare and has never been described in patients carrying 5T variant. We report a clinical, biochemical and genetic study of a four year-old boy presenting a pseudo-Bartter syndrome as the sole manifestation of cystic fibrosis. All 27 exons and the flanking intron regions of the CFTR gene were analysed by PCR and direct sequencing. Direct sequencing was also used to analyse TG m T n and M470V polymorphisms in the patient and his parents. Two sweat tests were abnormal with elevated chloride levels at 78 and 88 mmol/L. DNA sequencing revealed a heterozygous mutation 711+1 G>T and an IVS8-T5 allele. The mutation 711+1 G>T is in trans with the IVS8-T5-TG11 allele and the child carried M470/V470 genotype. To the best of our knowledge, the genotype 711+1 G>T /IVS8-5T found in our patient is described for the first time. The role of TG11-5T-V470 allele in cases of cystic fibrosis with PB syndrome remains to be determined.

  9. A Meta-Analysis of the Relationship between FGFR3 and TP53 Mutations in Bladder Cancer

    PubMed Central

    Ouerhani, Slah; Mongiat-Artus, Pierre; Soliman, Hany; de The, Hugues; Sibony, Mathilde; Denoux, Yves; Molinie, Vincent; Herault, Aurélie; Lepage, May-Linda; Maille, Pascale; Renou, Audrey; Vordos, Dimitri; Abbou, Claude-Clément; Bakkar, Ashraf; Asselain, Bernard; Kourda, Nadia; El Gaaied, Amel; Leroy, Karen; Laplanche, Agnès; Benhamou, Simone; Lebret, Thierry; Allory, Yves; Radvanyi, François

    2012-01-01

    TP53 and FGFR3 mutations are the most common mutations in bladder cancers. FGFR3 mutations are most frequent in low-grade low-stage tumours, whereas TP53 mutations are most frequent in high-grade high-stage tumours. Several studies have reported FGFR3 and TP53 mutations to be mutually exclusive events, whereas others have reported them to be independent. We carried out a meta-analysis of published findings for FGFR3 and TP53 mutations in bladder cancer (535 tumours, 6 publications) and additional unpublished data for 382 tumours. TP53 and FGFR3 mutations were not independent events for all tumours considered together (OR = 0.25 [0.18–0.37], p = 0.0001) or for pT1 tumours alone (OR = 0.47 [0.28–0.79], p = 0.0009). However, if the analysis was restricted to pTa tumours or to muscle-invasive tumours alone, FGFR3 and TP53 mutations were independent events (OR = 0.56 [0.23–1.36] (p = 0.12) and OR = 0.99 [0.37–2.7] (p = 0.35), respectively). After stratification of the tumours by stage and grade, no dependence was detected in the five tumour groups considered (pTaG1 and pTaG2 together, pTaG3, pT1G2, pT1G3, pT2-4). These differences in findings can be attributed to the putative existence of two different pathways of tumour progression in bladder cancer: the CIS pathway, in which FGFR3 mutations are rare, and the Ta pathway, in which FGFR3 mutations are frequent. TP53 mutations occur at the earliest stage of the CIS pathway, whereas they occur would much later in the Ta pathway, at the T1G3 or muscle-invasive stage. PMID:23272046

  10. Detection of Ultra-Rare Mitochondrial Mutations in Breast Stem Cells by Duplex Sequencing.

    PubMed

    Ahn, Eun Hyun; Hirohata, Kensen; Kohrn, Brendan F; Fox, Edward J; Chang, Chia-Cheng; Loeb, Lawrence A

    2015-01-01

    Long-lived adult stem cells could accumulate non-repaired DNA damage or mutations that increase the risk of tumor formation. To date, studies on mutations in stem cells have concentrated on clonal (homoplasmic) mutations and have not focused on rarely occurring stochastic mutations that may accumulate during stem cell dormancy. A major challenge in investigating these rare mutations is that conventional next generation sequencing (NGS) methods have high error rates. We have established a new method termed Duplex Sequencing (DS), which detects mutations with unprecedented accuracy. We present a comprehensive analysis of mitochondrial DNA mutations in human breast normal stem cells and non-stem cells using DS. The vast majority of mutations occur at low frequency and are not detectable by NGS. The most prevalent point mutation types are the C>T/G>A and A>G/T>C transitions. The mutations exhibit a strand bias with higher prevalence of G>A, T>C, and A>C mutations on the light strand of the mitochondrial genome. The overall rare mutation frequency is significantly lower in stem cells than in the corresponding non-stem cells. We have identified common and unique non-homoplasmic mutations between non-stem and stem cells that include new mutations which have not been reported previously. Four mutations found within the MT-ND5 gene (m.12684G>A, m.12705C>T, m.13095T>C, m.13105A>G) are present in all groups of stem and non-stem cells. Two mutations (m.8567T>C, m.10547C>G) are found only in non-stem cells. This first genome-wide analysis of mitochondrial DNA mutations may aid in characterizing human breast normal epithelial cells and serve as a reference for cancer stem cell mutation profiles.

  11. Association between Three Mutations, F1565C, V1023G and S996P, in the Voltage-Sensitive Sodium Channel Gene and Knockdown Resistance in Aedes aegypti from Yogyakarta, Indonesia

    PubMed Central

    Rochmijati Wuliandari, Juli; Lee, Siu Fai; White, Vanessa Linley; Tantowijoyo, Warsito; Hoffmann, Ary Anthony; Endersby-Harshman, Nancy Margaret

    2015-01-01

    Mutations in the voltage-sensitive sodium channel gene (Vssc) have been identified in Aedes aegypti and some have been associated with pyrethroid insecticide resistance. Whether these mutations cause resistance, alone or in combination with other alleles, remains unclear, but must be understood if mutations are to become markers for resistance monitoring. We describe High Resolution Melt (HRM) genotyping assays for assessing mutations found in Ae. aegypti in Indonesia (F1565C, V1023G, S996P) and use them to test for associations with pyrethroid resistance in mosquitoes from Yogyakarta, a city where insecticide use is widespread. Such knowledge is important because Yogyakarta is a target area for releases of Wolbachia-infected mosquitoes with virus-blocking traits for dengue suppression. We identify three alleles across Yogyakarta putatively linked to resistance in previous research. By comparing resistant and susceptible mosquitoes from bioassays, we show that the 1023G allele is associated with resistance to type I and type II pyrethroids. In contrast, F1565C homozygotes were rare and there was only a weak association between individuals heterozygous for the mutation and resistance to a type I pyrethroid. As the heterozygote is expected to be incompletely recessive, it is likely that this association was due to a different resistance mechanism being present. A resistance advantage conferred to V1023G homozygotes through addition of the S996P allele in the homozygous form was suggested for the Type II pyrethroid, deltamethrin. Screening of V1023G and S996P should assist resistance monitoring in Ae. aegypti from Yogyakarta, and these mutations should be maintained in Wolbachia strains destined for release in this city to ensure that these virus-blocking strains of mosquitoes are not disadvantaged, relative to resident populations. PMID:26463408

  12. Association between Three Mutations, F1565C, V1023G and S996P, in the Voltage-Sensitive Sodium Channel Gene and Knockdown Resistance in Aedes aegypti from Yogyakarta, Indonesia.

    PubMed

    Wuliandari, Juli Rochmijati; Lee, Siu Fai; White, Vanessa Linley; Tantowijoyo, Warsito; Hoffmann, Ary Anthony; Endersby-Harshman, Nancy Margaret

    2015-07-23

    Mutations in the voltage-sensitive sodium channel gene (Vssc) have been identified in Aedes aegypti and some have been associated with pyrethroid insecticide resistance. Whether these mutations cause resistance, alone or in combination with other alleles, remains unclear, but must be understood if mutations are to become markers for resistance monitoring. We describe High Resolution Melt (HRM) genotyping assays for assessing mutations found in Ae. aegypti in Indonesia (F1565C, V1023G, S996P) and use them to test for associations with pyrethroid resistance in mosquitoes from Yogyakarta, a city where insecticide use is widespread. Such knowledge is important because Yogyakarta is a target area for releases of Wolbachia-infected mosquitoes with virus-blocking traits for dengue suppression. We identify three alleles across Yogyakarta putatively linked to resistance in previous research. By comparing resistant and susceptible mosquitoes from bioassays, we show that the 1023G allele is associated with resistance to type I and type II pyrethroids. In contrast, F1565C homozygotes were rare and there was only a weak association between individuals heterozygous for the mutation and resistance to a type I pyrethroid. As the heterozygote is expected to be incompletely recessive, it is likely that this association was due to a different resistance mechanism being present. A resistance advantage conferred to V1023G homozygotes through addition of the S996P allele in the homozygous form was suggested for the Type II pyrethroid, deltamethrin. Screening of V1023G and S996P should assist resistance monitoring in Ae. aegypti from Yogyakarta, and these mutations should be maintained in Wolbachia strains destined for release in this city to ensure that these virus-blocking strains of mosquitoes are not disadvantaged, relative to resident populations.

  13. Chronic pancreatitis associated with the p.G208A variant of PRSS1 gene in a European patient.

    PubMed

    Hegyi, Eszter; Cierna, Iveta; Vavrova, Ludmila; Ilencikova, Denisa; Konecny, Michal; Kovacs, Laszlo

    2014-01-10

    The major etiologic factor of chronic pancreatitis in adults is excessive alcohol consumption, whereas among children structural anomalies, systemic and metabolic disorders, and genetic factors are prevalent. Mutations in the cationic trypsinogen gene (PRSS1) cause hereditary pancreatitis, while mutations in serine protease inhibitor Kazal type 1 (SPINK1), cystic fibrosis transmembrane conductance regulator (CFTR) and chymotrypsin C (CTRC) genes have been shown to associate with chronic pancreatitis as independent risk factors. We present a case of 13-year-old boy with idiopathic chronic pancreatitis. Given the unexplained attacks of pancreatitis since early childhood and despite the negative family history, molecular-genetic analysis of four pancreatitis susceptibility genes (PRSS1, SPINK1, CTRC and CFTR) was performed. The boy was found to carry the c.623G>C (p.G208A) mutation of the PRSS1 gene and the c.180C>T (p.G60G) mutation of the CTRC gene, both in heterozygous state. These mutations are considered as contributing risk factors for chronic pancreatitis. In children with idiopathic chronic pancreatitis genetic causes should be considered, even in absence of positive family history. To the best of our knowledge, this is the first description of a European patient with chronic pancreatitis associated with the p.G208A mutation of PRSS1 gene. This mutation was previously reported only in Asian subjects and is thought to be a unique genetic cause of pancreatitis in Asia.

  14. Identification of a novel mutation in a Chinese family with Nance-Horan syndrome by whole exome sequencing*

    PubMed Central

    Hong, Nan; Chen, Yan-hua; Xie, Chen; Xu, Bai-sheng; Huang, Hui; Li, Xin; Yang, Yue-qing; Huang, Ying-ping; Deng, Jian-lian; Qi, Ming; Gu, Yang-shun

    2014-01-01

    Objective: Nance-Horan syndrome (NHS) is a rare X-linked disorder characterized by congenital nuclear cataracts, dental anomalies, and craniofacial dysmorphisms. Mental retardation was present in about 30% of the reported cases. The purpose of this study was to investigate the genetic and clinical features of NHS in a Chinese family. Methods: Whole exome sequencing analysis was performed on DNA from an affected male to scan for candidate mutations on the X-chromosome. Sanger sequencing was used to verify these candidate mutations in the whole family. Clinical and ophthalmological examinations were performed on all members of the family. Results: A combination of exome sequencing and Sanger sequencing revealed a nonsense mutation c.322G>T (E108X) in exon 1 of NHS gene, co-segregating with the disease in the family. The nonsense mutation led to the conversion of glutamic acid to a stop codon (E108X), resulting in truncation of the NHS protein. Multiple sequence alignments showed that codon 108, where the mutation (c.322G>T) occurred, was located within a phylogenetically conserved region. The clinical features in all affected males and female carriers are described in detail. Conclusions: We report a nonsense mutation c.322G>T (E108X) in a Chinese family with NHS. Our findings broaden the spectrum of NHS mutations and provide molecular insight into future NHS clinical genetic diagnosis. PMID:25091991

  15. Identification of a novel mutation in a Chinese family with Nance-Horan syndrome by whole exome sequencing.

    PubMed

    Hong, Nan; Chen, Yan-hua; Xie, Chen; Xu, Bai-sheng; Huang, Hui; Li, Xin; Yang, Yue-qing; Huang, Ying-ping; Deng, Jian-lian; Qi, Ming; Gu, Yang-shun

    2014-08-01

    Nance-Horan syndrome (NHS) is a rare X-linked disorder characterized by congenital nuclear cataracts, dental anomalies, and craniofacial dysmorphisms. Mental retardation was present in about 30% of the reported cases. The purpose of this study was to investigate the genetic and clinical features of NHS in a Chinese family. Whole exome sequencing analysis was performed on DNA from an affected male to scan for candidate mutations on the X-chromosome. Sanger sequencing was used to verify these candidate mutations in the whole family. Clinical and ophthalmological examinations were performed on all members of the family. A combination of exome sequencing and Sanger sequencing revealed a nonsense mutation c.322G>T (E108X) in exon 1 of NHS gene, co-segregating with the disease in the family. The nonsense mutation led to the conversion of glutamic acid to a stop codon (E108X), resulting in truncation of the NHS protein. Multiple sequence alignments showed that codon 108, where the mutation (c.322G>T) occurred, was located within a phylogenetically conserved region. The clinical features in all affected males and female carriers are described in detail. We report a nonsense mutation c.322G>T (E108X) in a Chinese family with NHS. Our findings broaden the spectrum of NHS mutations and provide molecular insight into future NHS clinical genetic diagnosis.

  16. Mutation Analysis of IDH1/2 Genes in Unselected De novo Acute Myeloid Leukaemia Patients in India - Identification of A Novel IDH2 Mutation.

    PubMed

    Raveendran, Sureshkumar; Sarojam, Santhi; Vijay, Sangeetha; Geetha, Aswathy Chandran; Sreedharan, Jayadevan; Narayanan, Geetha; Sreedharan, Hariharan

    2015-01-01

    IDH1/2 mutations which result in alternation in DNA methylation pattern are one of the most common methylation associated mutations in Acute myeloid leukaemia. IDH1/2 mutations frequently associated with higher platelet level, normal cytogentics and NPM1 mutations. Here we analyzed IDH1/2 mutations in 200 newly diagnosed unselected Indian adult AML patients and investigated their correlation with clinical, cytogenetic parameters along with cooperating NPM1 mutation. We detected 5.5% and 4% mutations in IDH1/2 genes, respectively. Except IDH2 c.515_516GG>AA mutation, all the other identified mutations were reported mutations. Similar to reported c.515G>A mutation, the novel c.515_516GG>AA mutation replaces 172nd arginine to lysine in the active site of the enzyme. Even though there was a preponderance of IDH1/2 mutations in NK-AML, cytogenetically abnormal patients also harboured IDH1/2 mutations. IDH1 mutations showed significant higher platelet count and NPM1 mutations. IDH2 mutated patients displayed infrequent NPM1 mutations and lower WBC count. All the NPM1 mutations in the IDH1/2 mutated cases showed type A mutation. The present data suggest that IDH1/2 mutations are associated with normal cytogenetics and type A NPM1 mutations in adult Indian AML patients.

  17. Degenerative myelopathy in the Collie breed: a retrospective immunohistochemical analysis of superoxide dismutase 1 in an affected Rough Collie, and a molecular epidemiological survey of the SOD1: c.118G>A mutation in Japan

    PubMed Central

    KOHYAMA, Moeko; KITAGAWA, Masato; KAMISHINA, Hiroaki; KOBATAKE, Yui; YABUKI, Akira; SAWA, Mariko; KAKITA, Shusaku; YAMATO, Osamu

    2016-01-01

    Canine degenerative myelopathy (DM) is an adult-onset, progressive neurodegenerative disease that occurs in multiple dog breeds. A DM-associated mutation of the canine superoxide dismutase 1 (SOD1) gene, designated as c.118G>A (p.E40K), has been implicated as one of pathogenetic determinants of the disease in many breeds, but it remains to be determined whether the c.118G>A mutation is responsible for development or progression of DM in Collies. Previously, a Rough Collie was diagnosed clinically and histopathologically as having DM in Japan, suggesting the possibility that the Collie breed may be predisposed to DM due to the high frequency of c.118G>A in Japan. In this study, accumulation and aggregate formation of SOD1 protein were retrospectively demonstrated in the spinal cord of the DM-affected dog by immunohistochemical analysis. Furthermore, a molecular epidemiological survey revealed a high carrier rate (27.6%) and mutant allele frequency (0.138) of c.118G>A in a population of Collies in Japan, suggesting that the Collie breed may be predisposed to DM associated with c.118G>A, and the prevention of DM in Collies in Japan should be addressed through epidemiological and genetic testing strategies. PMID:27941298

  18. A Novel Nonsense Mutation in Exon 5 of KIND1 Gene in an Iranian Family with Kindler Syndrome.

    PubMed

    Heidari, Mohammad Mehdi; Khatami, Mehri; Kargar, Saeed; Azari, Mojdeh; Hoseinzadeh, Hassan; Fallah, Hamedeh

    2016-06-01

    Kindler syndrome (KS) is an autosomal recessive skin disease characterized by actual blistering, photosensitivity and a progressive poikiloderma. The disorder results from rare mutations in the KIND1 gene. This gene contains 15 exons and expresses two kindlin-1 isoforms. The aim of this investigation was to analyze mutations in the exons 1 to 15 of KIND1 gene in an Iranian family clinically affected with Kindler syndrome. The mutations analysis of 15 coding exons of KIND1 gene was performed with PCR-SSCP and direct sequencing in 14 subjects from one Iranian family clinically affected with Kindler syndrome. We identified eight new nucleotide changes in KIND1 in this family. These changes were found in g.3892delA, g.3951T>C, g.3962T>G, g.4190G>T, g.7497G>A, g.11076T>C, g.11102C>T and g.13177C>T positions. Among them, the g.13177C>T mutation resulting in the formation of a premature stop codon (Q226X) was detected only in seven affected family individuals as homozygous but was not present in 100 unrelated healthy controls. This study suggests that nonsense mutation may lead to incomplete and non-functional protein products and is pathogenic and has meaningful implications for the diagnosis of patients with Kindler syndrome.

  19. [Mutation analysis of FGFR3 gene in a family featuring hereditary dwarfism].

    PubMed

    Zhang, Qiong; Jiang, Hai-ou; Quan, Qing-li; Li, Jun; He, Ting; Huang, Xue-shuang

    2011-12-01

    To investigate the clinical symptoms and potential mutation in FGFR3 gene for a family featuring hereditary dwarfism in order to attain diagnosis and provide prenatal diagnosis. Five patients and two unaffected relatives from the family, in addition with 100 healthy controls, were recruited. Genome DNA was extracted. Exons 10 and 13 of the FGFR3 gene were amplified using polymerase chain reaction (PCR). PCR products were sequenced in both directions. All patients had similar features including short stature, short limbs, lumbar hyperlordosis but normal craniofacial features. A heterozygous mutation G1620T (N540K) was identified in the cDNA from all patients but not in the unaffected relatives and 100 control subjects. A heterozygous G380R mutation was excluded. The hereditary dwarfism featured by this family has been caused by hypochondroplasia (HCH) due to a N540K mutation in the FGFR3 gene.

  20. Destabilizing Mutations Alter the Hydrogen Exchange Mechanism in Ribonuclease A

    PubMed Central

    Bruix, Marta; Ribó, Marc; Benito, Antoni; Laurents, Douglas V.; Rico, Manuel; Vilanova, Maria

    2008-01-01

    The effect of strongly destabilizing mutations, I106A and V108G of Ribonuclease A (RNase A), on its structure and stability has been determined by NMR. The solution structures of these variants are essentially equivalent to RNase A. The exchange rates of the most protected amide protons in RNase A (35°C), the I106A variant (35°C), and the V108G variant (10°C) yield stability values of 9.9, 6.0, and 6.8 kcal/mol, respectively, when analyzed assuming an EX2 exchange mechanism. Thus, the destabilization induced by these mutations is propagated throughout the protein. Simulation of RNase A hydrogen exchange indicates that the most protected protons in RNase A and the V108G variant exchange via the EX2 regime, whereas those of I106A exchange through a mixed EX1 + EX2 process. It is striking that a single point mutation can alter the overall exchange mechanism. Thus, destabilizing mutations joins high temperatures, high pH and the presence of denaturating agents as a factor that induces EX1 exchange in proteins. The calculations also indicate a shift from the EX2 to the EX1 mechanism for less protected groups within the same protein. This should be borne in mind when interpreting exchange data as a measure of local stability in less protected regions. PMID:18192347