Varty, Keith; Arreguín, Barbarín L.; Gómez, Miguel T.; López, Pablo Jaime T.; Gómez, Miguel Angel L.
1983-01-01
Gibberellic acid-induced α-amylase synthesis in wheat aleurone layers (Triticum aestivum L. var Potam S-70) escaped from transcriptional control 30 h after addition of the hormone, as evidenced by the tissue's loss of susceptibility to cordycepin. Abscisic acid inhibited the accumulation of α-amylase activity when added to the tissue during this cordycepin-insensitive phase of enzyme induction. α-Amylase synthesis was not restored by the addition of cordycepin, indicating that the response to abscisic acid was not dependent upon the continuous synthesis of a short lived RNA. When ethylene was added simultaneously or some time after abscisic acid, the accumulation of α-amylase activity was sustained or quickly restored. The loss of susceptibility to cordycepin was completely prevented when aleurone layers were incubated with a combination of gibberellic and abscisic acids from the start of the induction period. This effect of abscisic acid was not reversed by ethylene. On the basis of these observations, it is suggested that abscisic acid inhibits both the transcription and translation of α-amylase mRNA, and that only the latter site of action is susceptible to reversal by ethylene. The rate of incorporation of [methyl-14C]choline into phospholipids was also inhibited by abscisic acid. Ethylene reversed this effect. The effects of abscisic acid and ethylene on phospholipid synthesis were not dependent upon the presence of gibberellic acid. No direct relationship was found between the control of α-amylase synthesis and membrane formation by abscisic acid and ethylene. PMID:16663284
Do rice suspension-cultured cells treated with abscisic acid mimic developing seeds?
Matsuno, Koya; Fujimura, Tatsuhito
2015-08-01
Starch synthesis is activated in the endosperm during seed development and also in rice suspension cells cultured with abscisic acid. In the anticipation that the mechanisms of starch synthesis are similar between the endosperm and the suspension cells cultured with abscisic acid, expression of genes involved in starch synthesis was evaluated in the suspension cells after abscisic acid treatment. However, it was found that the regulatory mechanism of starch synthesis in the suspension cells cultured with abscisic acid was different from that in developing seeds. Expression analyses of genes involved in oil bodies, which accumulate in the embryo and aleurone layer, and seed storage proteins, which accumulate mainly in the endosperm, showed that the former were activated in the suspension cells cultured with abscisic acid, but the latter were not. Master regulators for embryogenesis, OsVP1 (homologue of AtABI3) and OsLFL1 (homologue of AtFUS3 or AtLFL2), were expressed in the suspension cells at levels comparable to those in the embryo. From these results, it is suggested that interactions between regulators and abscisic acid control the synthesis of phytic acid and oil bodies in the cultured cells and embryo. We suggest that the system of suspension cells cultured with abscisic acid helps to reveal the mechanisms of phytic acid and oil body synthesis in embryo.
Abscisic Acid Synthesis and Response
Finkelstein, Ruth
2013-01-01
Abscisic acid (ABA) is one of the “classical” plant hormones, i.e. discovered at least 50 years ago, that regulates many aspects of plant growth and development. This chapter reviews our current understanding of ABA synthesis, metabolism, transport, and signal transduction, emphasizing knowledge gained from studies of Arabidopsis. A combination of genetic, molecular and biochemical studies has identified nearly all of the enzymes involved in ABA metabolism, almost 200 loci regulating ABA response, and thousands of genes regulated by ABA in various contexts. Some of these regulators are implicated in cross-talk with other developmental, environmental or hormonal signals. Specific details of the ABA signaling mechanisms vary among tissues or developmental stages; these are discussed in the context of ABA effects on seed maturation, germination, seedling growth, vegetative stress responses, stomatal regulation, pathogen response, flowering, and senescence. PMID:24273463
Induction of phytic acid synthesis by abscisic acid in suspension-cultured cells of rice.
Matsuno, Koya; Fujimura, Tatsuhito
2014-03-01
A pathway of phytic acid (PA) synthesis in plants has been revealed via investigations of low phytic acid mutants. However, the regulation of this pathway is not well understood because it is difficult to control the environments of cells in the seeds, where PA is mainly synthesized. We modified a rice suspension culture system in order to study the regulation of PA synthesis. Rice cells cultured with abscisic acid (ABA) accumulate PA at higher levels than cells cultured without ABA, and PA accumulation levels increase with ABA concentration. On the other hand, higher concentrations of sucrose or inorganic phosphorus do not affect PA accumulation. Mutations in the genes RINO1, OsMIK, OsIPK1 and OsLPA1 have each been reported to confer low phytic acid phenotypes in seeds. Each of these genes is upregulated in cells cultured with ABA. OsITPK4 and OsITPK6 are upregulated in cells cultured with ABA and in developing seeds. These results suggest that the regulation of PA synthesis is similar between developing seeds and cells in this suspension culture system. This system will be a powerful tool for elucidating the regulation of PA synthesis. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Abscisic acid negatively regulates elicitor-induced synthesis of capsidiol in wild tobacco.
Mialoundama, Alexis Samba; Heintz, Dimitri; Debayle, Delphine; Rahier, Alain; Camara, Bilal; Bouvier, Florence
2009-07-01
In the Solanaceae, biotic and abiotic elicitors induce de novo synthesis of sesquiterpenoid stress metabolites known as phytoalexins. Because plant hormones play critical roles in the induction of defense-responsive genes, we have explored the effect of abscisic acid (ABA) on the synthesis of capsidiol, the major wild tobacco (Nicotiana plumbaginifolia) sesquiterpenoid phytoalexin, using wild-type plants versus nonallelic mutants Npaba2 and Npaba1 that are deficient in ABA synthesis. Npaba2 and Npaba1 mutants exhibited a 2-fold higher synthesis of capsidiol than wild-type plants when elicited with either cellulase or arachidonic acid or when infected by Botrytis cinerea. The same trend was observed for the expression of the capsidiol biosynthetic genes 5-epi-aristolochene synthase and 5-epi-aristolochene hydroxylase. Treatment of wild-type plants with fluridone, an inhibitor of the upstream ABA pathway, recapitulated the behavior of Npaba2 and Npaba1 mutants, while the application of exogenous ABA reversed the enhanced synthesis of capsidiol in Npaba2 and Npaba1 mutants. Concomitant with the production of capsidiol, we observed the induction of ABA 8'-hydroxylase in elicited plants. In wild-type plants, the induction of ABA 8'-hydroxylase coincided with a decrease in ABA content and with the accumulation of ABA catabolic products such as phaseic acid and dihydrophaseic acid, suggesting a negative regulation exerted by ABA on capsidiol synthesis. Collectively, our data indicate that ABA is not required per se for the induction of capsidiol synthesis but is essentially implicated in a stress-response checkpoint to fine-tune the amplification of capsidiol synthesis in challenged plants.
Sites of abscisic acid synthesis and metabolism in Ricinus communis L
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zeevaart, J.A.D.
1977-05-01
The sites of abscisic acid (ABA) synthesis and metabolism in Ricinus communis L. were investigated by analyzing the levels of ABA and its two metabolites phaseic acid (PA) and dihydrophaseic acid (DPA) in the shoot tips, mature leaves, and phloem sap of stressed and nonstressed plants. Water stress increased the concentration of ABA, PA, and DPA in phloem exudate and also increased the levels of all three compounds in mature leaves and in shoot tips. The latter had a very high DPA content (18.7 ..mu..g/g fresh weight) even in plants not subjected to water stress. When young and mature leavesmore » were excised and allowed to wilt, the level of ABA increased in both, demonstrating that leaves at an early stage of development have the capacity to produce ABA. These results have been interpreted to mean that in mature leaves of nonstressed Ricinus plants, ABA is synthesized and metabolized, and that ABA itself, as well as its metabolites, are translocated in the phloem to the shoot tips (sinks). Since DPA, but not ABA, accumulates in the shoot tips, it follows that ABA is metabolized rapidly in the apical region. To what extent ABA present in young leaves of nonstressed plants is the consequence of synthesis in situ and of import from older leaves remains to be determined.« less
Abscisic Acid Negatively Regulates Elicitor-Induced Synthesis of Capsidiol in Wild Tobacco1[W
Mialoundama, Alexis Samba; Heintz, Dimitri; Debayle, Delphine; Rahier, Alain; Camara, Bilal; Bouvier, Florence
2009-01-01
In the Solanaceae, biotic and abiotic elicitors induce de novo synthesis of sesquiterpenoid stress metabolites known as phytoalexins. Because plant hormones play critical roles in the induction of defense-responsive genes, we have explored the effect of abscisic acid (ABA) on the synthesis of capsidiol, the major wild tobacco (Nicotiana plumbaginifolia) sesquiterpenoid phytoalexin, using wild-type plants versus nonallelic mutants Npaba2 and Npaba1 that are deficient in ABA synthesis. Npaba2 and Npaba1 mutants exhibited a 2-fold higher synthesis of capsidiol than wild-type plants when elicited with either cellulase or arachidonic acid or when infected by Botrytis cinerea. The same trend was observed for the expression of the capsidiol biosynthetic genes 5-epi-aristolochene synthase and 5-epi-aristolochene hydroxylase. Treatment of wild-type plants with fluridone, an inhibitor of the upstream ABA pathway, recapitulated the behavior of Npaba2 and Npaba1 mutants, while the application of exogenous ABA reversed the enhanced synthesis of capsidiol in Npaba2 and Npaba1 mutants. Concomitant with the production of capsidiol, we observed the induction of ABA 8′-hydroxylase in elicited plants. In wild-type plants, the induction of ABA 8′-hydroxylase coincided with a decrease in ABA content and with the accumulation of ABA catabolic products such as phaseic acid and dihydrophaseic acid, suggesting a negative regulation exerted by ABA on capsidiol synthesis. Collectively, our data indicate that ABA is not required per se for the induction of capsidiol synthesis but is essentially implicated in a stress-response checkpoint to fine-tune the amplification of capsidiol synthesis in challenged plants. PMID:19420326
Incorporation of oxygen into abscisic Acid and phaseic Acid from molecular oxygen.
Creelman, R A; Zeevaart, J A
1984-05-01
Abscisic acid accumulates in detached, wilted leaves of Xanthium strumarium. When these leaves are subsequently rehydrated, phaseic acid, a catabolite of abscisic acid, accumulates. Analysis by gas chromatography-mass spectrometry of phaseic acid isolated from stressed and subsequently rehydrated leaves placed in an atmosphere containing 20% (18)O(2) and 80% N(2) indicates that one atom of (18)O is incorporated in the 6'-hydroxymethyl group of phaseic acid. This suggests that the enzyme that converts abscisic acid to phaseic acid is an oxygenase.Analysis by gas chromatography-mass spectrometry of abscisic acid isolated from stressed leaves kept in an atmosphere containing (18)O(2) indicates that one atom of (18)O is present in the carboxyl group of abscisic acid. Thus, when abscisic acid accumulates in water-stressed leaves, only one of the four oxygens present in the abscisic acid molecule is derived from molecular oxygen. This suggests that either (a) the oxygen present in the 1'-, 4'-, and one of the two oxygens at the 1-position of abscisic acid arise from water, or (b) there exists a stored precursor with oxygen atoms already present in the 1'- and 4'-positions of abscisic acid which is converted to abscisic acid under conditions of water stress.
Abscisic Acid Stimulates Elongation of Excised Pea Root Tips
Gaither, Douglas H.; Lutz, Donald H.; Forrence, Leonard E.
1975-01-01
Excised Pisum sativum L. root tips were incubated in a pH 5.2 sucrose medium containing abscisic acid. Elongation growth was inhibited by 100 μm abscisic acid. However, decreasing the abscisic acid concentration caused stimulation of elongation, the maximum response (25% to 30%) occurring at 1 μm abscisic acid. Prior to two hours, stimulation of elongation by 1 μm abscisic acid was not detectable. Increased elongation did not occur in abscisic acid-treated root tips of Lens culinaris L., Phaseolus vulgaris L., or Zea mays L. PMID:16659198
Incorporation of Oxygen into Abscisic Acid and Phaseic Acid from Molecular Oxygen 1
Creelman, Robert A.; Zeevaart, Jan A. D.
1984-01-01
Abscisic acid accumulates in detached, wilted leaves of Xanthium strumarium. When these leaves are subsequently rehydrated, phaseic acid, a catabolite of abscisic acid, accumulates. Analysis by gas chromatography-mass spectrometry of phaseic acid isolated from stressed and subsequently rehydrated leaves placed in an atmosphere containing 20% 18O2 and 80% N2 indicates that one atom of 18O is incorporated in the 6′-hydroxymethyl group of phaseic acid. This suggests that the enzyme that converts abscisic acid to phaseic acid is an oxygenase. Analysis by gas chromatography-mass spectrometry of abscisic acid isolated from stressed leaves kept in an atmosphere containing 18O2 indicates that one atom of 18O is present in the carboxyl group of abscisic acid. Thus, when abscisic acid accumulates in water-stressed leaves, only one of the four oxygens present in the abscisic acid molecule is derived from molecular oxygen. This suggests that either (a) the oxygen present in the 1′-, 4′-, and one of the two oxygens at the 1-position of abscisic acid arise from water, or (b) there exists a stored precursor with oxygen atoms already present in the 1′- and 4′-positions of abscisic acid which is converted to abscisic acid under conditions of water stress. PMID:16663564
Synthesis, photostability and bioactivity of 2,3-cyclopropanated abscisic acid.
Wenjian, Liu; Xiaoqiang, Han; Yumei, Xiao; Jinlong, Fan; Yuanzhi, Zhang; Huizhe, Lu; Mingan, Wang; Zhaohai, Qin
2013-12-01
The plant hormone abscisic acid (ABA) plays a central role in the regulation of plant development and adaptation to environmental stress. The isomerization of ABA to the biologically inactive 2E-isomer by light considerably limits its applications in agricultural fields. To overcome this shortcoming, an ABA analogue, cis-2,3-cyclopropanated ABA, was synthesized, and its photostability and biological activities were investigated. This compound showed high photostability under UV light exposure, which was 4-fold higher than that of (±)-ABA. cis-2,3-cyclopropanated ABA exhibited high ABA-like activity, including the ability to effectively inhibit seed germination, seedling growth and stomatal movements of Arabidopsis. In some cases, its bioactivity approaches that of (±)-ABA. trans-2,3-cyclopropanated abscisic acid was also prepared, an isomer that was more photostable but which showed weak ABA-like activity. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.
NASA Technical Reports Server (NTRS)
Feldman, L. J.; Sun, P. S.
1986-01-01
Maize seeds were germinated in the dark in the presence of the carotenoid synthesis inhibitor norflurazon and the levels of abscisic acid, xanthoxin and total carotenoids were measured in the root cap and in the adjacent 1.5 mm segment. In norflurazon-treated roots abscisic acid levels were markedly reduced, but an increase occurred in the levels of xanthoxin, a compound structurally and physiologically similar to abscisic acid. In the cultivar of maize (Zea mays L. cv. Merit) used for this work, brief illumination of the root is required for gravitropic curving. Following illumination both control and norflurazon-treated roots showed normal gravitropic curvature; however, the rate of curvature was delayed in norflurazon-treated roots. Our data from norflurazon-treated roots are consistent with a role for xanthoxin in maize root gravitropism. The increase in xanthoxin in the presence of an inhibitor of carotenoid synthesis suggests that xanthoxin and abscisic acid originate, at least in part, via different metabolic pathways.
Evolution of Abscisic Acid Synthesis and Signaling Mechanisms
Hauser, Felix; Waadt, Rainer; Schroeder, Julian I.
2011-01-01
The plant hormone abscisic acid (ABA) mediates seed dormancy, controls seedling development and triggers tolerance to abiotic stresses, including drought. Core ABA signaling components consist of a recently identified group of ABA receptor proteins of the PYRABACTIN RESISTANCE (PYR)/REGULATORY COMPONENT OF ABA RECEPTOR (RCAR) family that act as negative regulators of members of the PROTEIN PHOSPHATASE 2C (PP2C) family. Inhibition of PP2C activity enables activation of SNF1-RELATED KINASE 2 (SnRK2) protein kinases, which target downstream components, including transcription factors, ion channels and NADPH oxidases. These and other components form a complex ABA signaling network. Here, an in depth analysis of the evolution of components in this ABA signaling network shows that (i) PYR/RCAR ABA receptor and ABF-type transcription factor families arose during land colonization of plants and are not found in algae and other species, (ii) ABA biosynthesis enzymes have evolved to plant- and fungal-specific forms, leading to different ABA synthesis pathways, (iii) existing stress signaling components, including PP2C phosphatases and SnRK kinases, were adapted for novel roles in this plant-specific network to respond to water limitation. In addition, evolutionarily conserved secondary structures in the PYR/RCAR ABA receptor family are visualized. PMID:21549957
Cross-talk in abscisic acid signaling
NASA Technical Reports Server (NTRS)
Fedoroff, Nina V.
2002-01-01
"Cross-talk" in hormone signaling reflects an organism's ability to integrate different inputs and respond appropriately, a crucial function at the heart of signaling network operation. Abscisic acid (ABA) is a plant hormone involved in bud and seed dormancy, growth regulation, leaf senescence and abscission, stomatal opening, and a variety of plant stress responses. This review summarizes what is known about ABA signaling in the control of stomatal opening and seed dormancy and provides an overview of emerging knowledge about connections between ABA, ethylene, sugar, and auxin synthesis and signaling.
Synthesis and biological activity of amino acid conjugates of abscisic acid.
Todoroki, Yasushi; Narita, Kenta; Muramatsu, Taku; Shimomura, Hajime; Ohnishi, Toshiyuki; Mizutani, Masaharu; Ueno, Kotomi; Hirai, Nobuhiro
2011-03-01
We prepared 19 amino acid conjugates of the plant hormone abscisic acid (ABA) and investigated their biological activity, enzymatic hydrolysis by a recombinant Arabidopsis amidohydrolases GST-ILR1 and GST-IAR3, and metabolic fate in rice seedlings. Different sets of ABA-amino acids induced ABA-like responses in different plants. Some ABA-amino acids, including some that were active in bioassays, were hydrolyzed by recombinant Arabidopsis GST-IAR3, although GST-ILR1 did not show hydrolysis activity for any of the ABA-amino acids. ABA-L-Ala, which was active in all the bioassays, an Arabidopsis seed germination, spinach seed germination, and rice seedling elongation assays, except in a lettuce seed germination assay and was hydrolyzed by GST-IAR3, was hydrolyzed to free ABA in rice seedlings. These findings suggest that some plant amidohydrolases hydrolyze some ABA-amino acid conjugates. Because our study indicates the possibility that different plants have hydrolyzing activity toward different ABA-amino acids, an ABA-amino acid may function as a species-selective pro-hormone of ABA. Copyright © 2011 Elsevier Ltd. All rights reserved.
Abscisic acid is involved in the iron-induced synthesis of maize ferritin.
Lobréaux, S; Hardy, T; Briat, J F
1993-01-01
The ubiquitous iron storage protein ferritin has a highly conserved structure in plants and animals, but a distinct cytological location and a different level of control in response to iron excess. Plant ferritins are plastid-localized and transcriptionally regulated in response to iron, while animal ferritins are found in the cytoplasm and have their expression mainly controlled at the translational level. In order to understand the basis of these differences, we developed hydroponic cultures of maize plantlets which allowed an increase in the intracellular iron concentration, leading to a transient accumulation of ferritin mRNA and protein (Lobréaux,S., Massenet,O. and Briat,J.F., 1992, Plant Mol. Biol., 19, 563-575). Here, it is shown that iron induces ferritin and RAB (Responsive to Abscisic Acid) mRNA accumulation relatively with abscisic acid (ABA) accumulation. Ferritin mRNA also accumulates in response to exogenous ABA. Synergistic experiments demonstrate that the ABA and iron responses are linked, although full expression of the ferritin genes cannot be entirely explained by an increase in ABA concentration. Inducibility of ferritin mRNA accumulation by iron is dramatically decreased in the maize ABA-deficient mutant vp2 and can be rescued by addition of exogenous ABA, confirming the involvement of ABA in the iron response in plants. Therefore, it is concluded that a major part of the iron-induced biosynthesis of ferritin is achieved through a pathway involving an increase in the level of the plant hormone ABA. The general conclusion of this work is that the synthesis of the same protein in response to the same environmental signal can be controlled by separate and distinct mechanisms in plants and animals. Images PMID:8440255
Huang, Tengfang; Jander, Georg
2017-10-01
Whereas proline accumulates through de novo biosynthesis in plants subjected to osmotic stress, leucine, isoleucine, and valine accumulation in drought-stressed Arabidopsis thaliana is caused by abscisic acid-regulated protein degradation. In response to several kinds of abiotic stress, plants greatly increase their accumulation of free amino acids. Although stress-induced proline increases have been studied the most extensively, the fold-increase of other amino acids, in particular branched-chain amino acids (BCAAs; leucine, isoleucine, and valine), is often higher than that of proline. In Arabidopsis thaliana (Arabidopsis), BCAAs accumulate in response to drought, salt, mannitol, polyethylene glycol, herbicide treatment, and nitrogen starvation. Plants that are deficient in abscisic acid signaling accumulate lower amounts of BCAAs, but not proline and most other amino acids. Previous bioinformatic studies had suggested that amino acid synthesis, rather than protein degradation, is responsible for the observed BCAA increase in osmotically stressed Arabidopsis. However, whereas treatment with the protease inhibitor MG132 decreased drought-induced BCAA accumulation, inhibition of BCAA biosynthesis with the acetolactate synthase inhibitors chlorsulfuron and imazapyr did not. Additionally, overexpression of BRANCHED-CHAIN AMINO ACID TRANSFERASE2 (BCAT2), which is upregulated in response to osmotic stress and functions in BCAA degradation, decreased drought-induced BCAA accumulation. Together, these results demonstrate that BCAA accumulation in osmotically stressed Arabidopsis is primarily the result of protein degradation. After relief of the osmotic stress, BCAA homeostasis is restored over time by amino acid degradation involving BCAT2. Thus, drought-induced BCAA accumulation is different from that of proline, which is accumulated due to de novo synthesis in an abscisic acid-independent manner and remains elevated for a more prolonged period of time after removal of
Presence of abscisic acid, a phytohormone, in the mammalian brain
DOE Office of Scientific and Technical Information (OSTI.GOV)
Le Page-Degivry, M.T.; Bidard, J.N.; Rouvier, E.
1986-02-01
This paper reports the presence of abscisic acid, one of the most important phytohormones, in the central nervous system of pigs and rats. The identification of this hormone in brain was made after extensive purification by using a radioimmunoassay that is very specific for (+)-cis-abscisic acid. The final product of purification from mammalian brain has the same properties as authentic abscisic acid: it crossreacts in the radioimmunoassay for the phytohormone and it has the same retention properties and the same gas chromatography/mass spectrometry characteristics. Moreover, like (+)-cis-abscisic acid itself, the brain factor inhibits stomatal apertures of abaxial epidermis strips ofmore » Setcreasea purpurea Boom (Commelinaceae). The presence of abscisic acid conjugates that are present in plants has also been identified in brain.« less
Bi, Baodi; Tang, Jingliang; Han, Shuang; Guo, Jinggong; Miao, Yuchen
2017-06-06
Sinapic acid and its esters have broad functions in different stages of seed germination and plant development and are thought to play a role in protecting against ultraviolet irradiation. To better understand the interactions between sinapic acid esters and seed germination processes in response to various stresses, we analyzed the role of the plant hormone abscisic acid (ABA) in the regulation of sinapic acid esters involved in seed germination and early seedling growth. We found that exogenous sinapic acid promotes seed germination in a dose-dependent manner in Arabidopsis thaliana. High-performance liquid chromatography mass spectrometry analysis showed that exogenous sinapic acid increased the sinapoylcholine content of imbibed seeds. Furthermore, sinapic acid affected ABA catabolism, resulting in reduced ABA levels and increased levels of the ABA-glucose ester. Using mutants deficient in the synthesis of sinapate esters, we showed that the germination of mutant sinapoylglucose accumulator 2 (sng2) and bright trichomes 1 (brt1) seeds was more sensitive to ABA than the wild-type. Moreover, Arabidopsis mutants deficient in either abscisic acid deficient 2 (ABA2) or abscisic acid insensitive 3 (ABI3) displayed increased expression of the sinapoylglucose:choline sinapoyltransferase (SCT) and sinapoylcholine esterase (SCE) genes with sinapic acid treatment. This treatment also affected the accumulation of sinapoylcholine and free choline during seed germination. We demonstrated that sinapoylcholine, which constitutes the major phenolic component in seeds among various minor sinapate esters, affected ABA homeostasis during seed germination and early seedling growth in Arabidopsis. Our findings provide insights into the role of sinapic acid and its esters in regulating ABA-mediated inhibition of Arabidopsis seed germination in response to drought stress.
Abscisic Acid-Cytokinin Antagonism Modulates Resistance Against Pseudomonas syringae in Tobacco.
Großkinsky, Dominik K; van der Graaff, Eric; Roitsch, Thomas
2014-12-01
Phytohormones are known as essential regulators of plant defenses, with ethylene, jasmonic acid, and salicylic acid as the central immunity backbone, while other phytohormones have been demonstrated to interact with this. Only recently, a function of the classic phytohormone cytokinin in plant immunity has been described in Arabidopsis, rice, and tobacco. Although interactions of cytokinins with salicylic acid and auxin have been indicated, the complete network of cytokinin interactions with other immunity-relevant phytohormones is not yet understood. Therefore, we studied the interaction of kinetin and abscisic acid as a negative regulator of plant immunity to modulate resistance in tobacco against Pseudomonas syringae. By analyzing infection symptoms, pathogen proliferation, and accumulation of the phytoalexin scopoletin as a key mediator of kinetin-induced resistance in tobacco, antagonistic interaction of these phytohormones in plant immunity was identified. Kinetin reduced abscisic acid levels in tobacco, while increased abscisic acid levels by exogenous application or inhibition of abscisic acid catabolism by diniconazole neutralized kinetin-induced resistance. Based on these results, we conclude that reduction of abscisic acid levels by enhanced abscisic acid catabolism strongly contributes to cytokinin-mediated resistance effects. Thus, the identified cytokinin-abscisic acid antagonism is a novel regulatory mechanism in plant immunity.
Grappin, P; Bouinot, D; Sotta, B; Miginiac, E; Jullien, M
2000-01-01
The physiological characteristics of seed dormancy in Nicotiana plumbaginifolia Viv. are described. The level of seed dormancy is defined by the delay in seed germination (i.e the time required prior to germination) under favourable environmental conditions. A wild-type line shows a clear primary dormancy, which is suppressed by afterripening, whereas an abscisic acid (ABA)-deficient mutant shows a non-dormant phenotype. We have investigated the role of ABA and gibberellic acid (GA(3)) in the control of dormancy maintenance or breakage during imbibition in suitable conditions. It was found that fluridone, a carotenoid biosynthesis inhibitor, is almost as efficient as GA(3) in breaking dormancy. Dry dormant seeds contained more ABA than dry afterripened seeds and, during early imbibition, there was an accumulation of ABA in dormant seeds, but not in afterripened seeds. In addition, fluridone and exogenous GA(3) inhibited the accumulation of ABA in imbibed dormant seeds. This reveals an important role for ABA synthesis in dormancy maintenance in imbibed seeds.
Structure-Activity Correlations with Compounds Related to Abscisic Acid 1
Sondheimer, Ernest; Walton, Daniel C.
1970-01-01
Inhibition of cell expansion of excised embryonic axes of Phaseolus vulgaris was used to evaluate the growth-inhibiting activity of abscisic acid and related compounds. None of the 13 compounds tested was as active as abscisic acid. 4-Hydroxyisophorone, a substance representative of the abscisic acid ring system was essentially inactive; cis, trans-3-methylsorbic acid, a compound resembling the side chain of abscisic acid, had low activity; and cis, trans-β-ionylideneacetic acid was one-sixth as active. Loss of the ring double bond results in a drastic decrease in biological activity. Comparison of our results with those reported previously leads to the suggestion that the double bond of the cyclohexyl moiety may have an important function in determining the degree of activity of cis, trans-ionylideneacetic acids. Two modes of action are discussed. It seems possible that the ring double bond is involved in covalent bonding in binding of the abscisic acid analogue to macromolecules. This may require formation of an intermediate epoxide. It can also be argued that stereochemical differences between cyclohexane derivatives are important factors in determining the degree of biological activity. PMID:5423465
Abscisic Acid and the Photoperiodic Induction of Dormancy in Salix viminalis L.
Alvim, R; Saunders, P F; Barros, R S
1979-04-01
A series of growth room experiments was carried out aiming to establish the role of abscisic acid on dormancy of Salix viminalis L. The inhibitor content and abscisic acid levels of extracts from roots, sap, leaves, and apical tissues of willow were measured using biological assay and gas-liquid chromatography.No evidence was obtained that photoperiodically mediated dormancy is associated with changes in abscisic acid levels or beta-inhibitor activity.
WRKY Transcription Factors: Key Components in Abscisic Acid Signaling
2011-01-01
Review article WRKY transcription factors : key components in abscisic acid signalling Deena L. Rushton1, Prateek Tripathi1, Roel C. Rabara1, Jun Lin1...May 2011. *Correspondence (Tel +605 688 5749; fax +605 688 5624; email paul.rushton@sdstate.edu) Keywords: abscisic acid, WRKY transcription factor ...seed germination, drought, abiotic stress. Summary WRKY transcription factors (TFs) are key regulators of many plant processes, including the responses
Abscisic Acid and the Photoperiodic Induction of Dormancy in Salix viminalis L 1
Alvim, Ronald; Saunders, Peter F.; Barros, Raimundo S.
1979-01-01
A series of growth room experiments was carried out aiming to establish the role of abscisic acid on dormancy of Salix viminalis L. The inhibitor content and abscisic acid levels of extracts from roots, sap, leaves, and apical tissues of willow were measured using biological assay and gas-liquid chromatography. No evidence was obtained that photoperiodically mediated dormancy is associated with changes in abscisic acid levels or β-inhibitor activity. PMID:16660810
Xu, N; Coulter, K M; Derek Bewley, J
1990-10-01
Developing seeds of alfalfa (Medicago sativa L.) acquire the ability to germinate during the latter stages of development, the maturation drying phase. Isolated embryos placed on Murashige and Skoog medium germinate well during early and late development, but poorly during mid-development; however, when placed on water they germinate well only during the latter stage of development. Germination of isolated embryos is very slow and poor when they are incubated in the presence of surrounding seed structures (the endosperm or seed coat) taken from the mid-development stages. This inhibitory effect is also achieved by incubating embryos in 10(-5) M abscisic acid (ABA). Endogenous ABA attains a high level during mid-development, especially in the endosperm. Seeds developing in pods treated with fluridone (1-methyl-3-phenyl-5[3-(trifluoromethyl)-phenyl]-4(1H)-pyridinone) contain low levels of ABA during mid-development, and the endosperm and seed coat only weakly inhibit the germination of isolated embryos. However, intact seeds from fluridone-treated pods do not germinate viviparously, which is indicative that ABA alone is not responsible for maintaining seeds in a developing state. Application of osmoticum (e.g. 0.35 M sucrose) to isolated developing embryos prevents their germination. Also, in the developing seed in situ the osmotic potential is high. Thus internal levels of osmoticum may play a role in preventing germination of the embryo and maintaining development. Abscisic acid and osmoticum impart distinctly different metabolic responses on developing embryos, as demonstrated by their protein-synthetic capacity. Only in the presence of osmoticum do embryos synthesize proteins which are distinctly recognizable as those synthesized by developing embryos in situ, i.e. when inside the pod. Abscisic acid induces the synthesis of a few unique proteins, but these arise even in mature embryos treated with ABA. Thus while both osmoticum and ABA prevent precocious
Synthesis and Biological Activity of 2',3'-iso-Aryl-abscisic Acid Analogs.
Wan, Chuan; Wang, Mingan; Yang, Dongyan; Han, Xiaoqiang; Che, Chuanliang; Ding, Shanshan; Xiao, Yumei; Qin, Zhaohai
2017-12-15
2',3'- iso -Benzoabscisic acid ( iso -PhABA), an excellent selective abscisic acid (ABA) analog, was developed in our previous work. In order to find its more structure-activity information, some structural modifications were completed in this paper, including the substitution of phenyl ring and replacing the ring with heterocycles. Thus, 16 novel analogs of iso -PhABA were synthesized and screened with three bioassays, Arabidopsis and lettuce seed germination and rice seedling elongation. Some of them, i.e., 2',3'- iso -pyridoabscisic acid ( iso -PyABA) and 2',3'- iso -franoabscisic acid ( iso -FrABA), displayed good bioactivities that closed to iso -PhABA and natural (+)-ABA. Some others, for instance, substituted- iso -PhABA, exhibited certain selectivity to different physiological process when compared to iso -PhABA or (+)-ABA. These analogs not only provided new candidates of ABA-like synthetic plant growth regulators (PGRs) for practical application, but also new potential selective agonist/antagonist for probing the specific function of ABA receptors.
Isolation of Abscisic Acid from Korean Acacia Honey with Anti-Helicobacter pylori Activity
Kim, SeGun; Hong, InPyo; Woo, SoonOk; Jang, HyeRi; Pak, SokCheon; Han, SangMi
2017-01-01
Background: Helicobacter pylori (H. pylori) is linked to the development of the majority of peptic ulcers and some types of gastric cancers, and its antibiotic resistance is currently found worldwide. Objective: This study is aimed at evaluating the anti-H. pylori activity of Korean acacia honey and isolating the related active components using organic solvents. Material and Methods: The crude acacia honey was extracted with n-hexane, dichloromethane, ethyl acetate (EtOAc), and n-butanol. The EtOAc extract was subjected to octadecyl-silica chromatography. The extracts and fractions were then examined for anti-H. pylori activity using the agar well diffusion method. The antimicrobial activity of abscisic acid against H. pylori was investigated by determining the minimum inhibitory concentrations (MICs), minimum bactericidal concentrations (MBCs), and by performing a time-kill assay. Results: Abscisic acid related to the botanical origins of acacia honey from Korea has been analyzed using ultra-performance liquid chromatography. The MICs and MBCs of abscisic acid were 2.7 ± 1.3 and 6.9 ± 1.9 μg/mL, respectively. The bactericidal activity of abscisic acid (at 10.8 μg/mL corresponding to 4 × MIC) killed the organism within 36–72 h. These results suggest that abscisic acid isolated from Korean acacia honey has antibacterial activity against H. pylori. Conclusion: Abscisic acid isolated from Korean acacia honey can be therapeutic and may be further exploited as a potential lead candidate for the development of treatments for H. pylori-induced infections. SUMMARY The crude acacia honey was extracted with n-hexane, dichloromethane, EtOAc, and n-butanolThe EtOAc extract yielded eight fractions and four subfractions were subsequently obtained chromatographicallyAbscisic acid was isolated from one subfractionAll the solvent extracts and fractions showed antibacterial activity against H. pyloriAbscisic acid exhibited antibacterial activity against H. pylori
Isolation of Abscisic Acid from Korean Acacia Honey with Anti-Helicobacter pylori Activity.
Kim, SeGun; Hong, InPyo; Woo, SoonOk; Jang, HyeRi; Pak, SokCheon; Han, SangMi
2017-07-01
Helicobacter pylori ( H. pylori ) is linked to the development of the majority of peptic ulcers and some types of gastric cancers, and its antibiotic resistance is currently found worldwide. This study is aimed at evaluating the anti- H. pylori activity of Korean acacia honey and isolating the related active components using organic solvents. The crude acacia honey was extracted with n -hexane, dichloromethane, ethyl acetate (EtOAc), and n -butanol. The EtOAc extract was subjected to octadecyl-silica chromatography. The extracts and fractions were then examined for anti- H. pylori activity using the agar well diffusion method. The antimicrobial activity of abscisic acid against H. pylori was investigated by determining the minimum inhibitory concentrations (MICs), minimum bactericidal concentrations (MBCs), and by performing a time-kill assay. Abscisic acid related to the botanical origins of acacia honey from Korea has been analyzed using ultra-performance liquid chromatography. The MICs and MBCs of abscisic acid were 2.7 ± 1.3 and 6.9 ± 1.9 μg/mL, respectively. The bactericidal activity of abscisic acid (at 10.8 μg/mL corresponding to 4 × MIC) killed the organism within 36-72 h. These results suggest that abscisic acid isolated from Korean acacia honey has antibacterial activity against H. pylori . Abscisic acid isolated from Korean acacia honey can be therapeutic and may be further exploited as a potential lead candidate for the development of treatments for H. pylori -induced infections. The crude acacia honey was extracted with n -hexane, dichloromethane, EtOAc, and n -butanolThe EtOAc extract yielded eight fractions and four subfractions were subsequently obtained chromatographicallyAbscisic acid was isolated from one subfractionAll the solvent extracts and fractions showed antibacterial activity against H. pylori Abscisic acid exhibited antibacterial activity against H. pylori . Abbreviations used: MeOH: Methanol; EtOAc: Ethyl acetate; TSB: Trypticase
Rational Discovery of (+) (S) Abscisic Acid as a Potential Antifungal Agent: a Repurposing Approach.
Khedr, Mohammed A; Massarotti, Alberto; Mohamed, Maged E
2018-06-04
Fungal infections are spreading widely worldwide, and the types of treatment are limited due to the lack of diverse therapeutic agents and their associated side effects and toxicity. The discovery of new antifungal classes is vital and critical. We discovered the antifungal activity of abscisic acid through a rational drug design methodology that included the building of homology models for fungal chorismate mutases and a pharmacophore model derived from a transition state inhibitor. Ligand-based virtual screening resulted in some hits that were filtered using molecular docking and molecular dynamic simulations studies. Both in silico methods and in vitro antifungal assays were used as tools to select and validate the abscisic acid repurposing. Abscisic acid inhibition assays confirmed the inhibitory effect of abscisic acid on chorismate mutase through the inhibition of phenylpyruvate production. The repositioning of abscisic acid, the well-known and naturally occurring plant growth regulator, as a potential antifungal agent because of its suggested action as an inhibitor to several fungal chorismate mutases was the main result of this work.
A Highly Sensitive Method for Quantitative Determination of Abscisic Acid 1
Michler, Charles H.; Lineberger, R. Daniel; Chism, Grady W.
1986-01-01
An abscisic acid derivative was formed by reaction with pentafluorobenzyl bromide which allowed highly sensitive detection by gas-liquid chromatography with electron capture detection. In comparison to the methyl ester derivative, the pentafluorobenzyl derivative of abscisic acid was four times more sensitive to electron capture detection and was stable at room temperature in the presence of ultraviolet light. Derivatization was rapid and the molecular weight of the new compound was confirmed by gas-liquid chromatography-mass spectrometry. PMID:16665076
Nicolas, Philippe; Lecourieux, David; Kappel, Christian; Cluzet, Stéphanie; Cramer, Grant; Delrot, Serge; Lecourieux, Fatma
2014-01-01
In grape (Vitis vinifera), abscisic acid (ABA) accumulates during fruit ripening and is thought to play a pivotal role in this process, but the molecular basis of this control is poorly understood. This work characterizes ABSCISIC ACID RESPONSE ELEMENT-BINDING FACTOR2 (VvABF2), a grape basic leucine zipper transcription factor belonging to a phylogenetic subgroup previously shown to be involved in ABA and abiotic stress signaling in other plant species. VvABF2 transcripts mainly accumulated in the berry, from the onset of ripening to the harvesting stage, and were up-regulated by ABA. Microarray analysis of transgenic grape cells overexpressing VvABF2 showed that this transcription factor up-regulates and/or modifies existing networks related to ABA responses. In addition, grape cells overexpressing VvABF2 exhibited enhanced responses to ABA treatment compared with control cells. Among the VvABF2-mediated responses highlighted in this study, the synthesis of phenolic compounds and cell wall softening were the most strongly affected. VvABF2 overexpression strongly increased the accumulation of stilbenes that play a role in plant defense and human health (resveratrol and piceid). In addition, the firmness of fruits from tomato (Solanum lycopersicum) plants overexpressing VvABF2 was strongly reduced. These data indicate that VvABF2 is an important transcriptional regulator of ABA-dependent grape berry ripening. PMID:24276949
[Cloning and bioinformatics analysis of abscisic acid 8'-hydroxylase from Pseudostellariae Radix].
Li, Jun; Long, Deng-Kai; Zhou, Tao; Ding, Ling; Zheng, Wei; Jiang, Wei-Ke
2016-07-01
Abscisic acid 8'-hydroxylase was one of key enzymes genes in the metabolism of abscisic acid (ABA). Seven menbers of abscisic acid 8'-hydroxylase were identified from Pseudostellaria heterophylla transcriptome sequencing results by using sequence homology. The expression profiles of these genes were analyzed by transcriptome data. The coding sequence of ABA8ox1 was cloned and analyzed by informational technology. The full-length cDNA of ABA8ox1 was 1 401 bp,with 480 encoded amino acids. The predicated isoelectric point (pI) and relative molecular mass (MW) were 8.55 and 53 kDa,respectively. Transmembrane structure analysis showed that there were 21 amino acids in-side and 445 amino acids out-side. High level of transcripts can detect in bark of root and fibrous root. Multi-alignment and phylogenetic analysis both show that ABA8ox1 had a high similarity with the CYP707As from other plants,especially with AtCYP707A1 and AtCYP707A3 in Arabidopsis thaliana. These results lay a foundation for molecular mechanism of tuberous root expanding and response to adversity stress. Copyright© by the Chinese Pharmaceutical Association.
Involvement of abscisic acid in correlative control of flower abscission in soybean
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yarrow, G.L.
1985-01-01
Studies were carried out in three parts: (1) analysis of endogenous abscisic acid (ABA) in abscising and non-abscising flowers, (2) partitioning of radio-labelled ABA and photoassimilates within the soybean raceme, and (3) shading experiments, wherein endogenous levels, metabolism and partitioning of ABA were determined. Endogenous concentrations of ABA failed to show any consistent relationship to abscission of soybean flowers. Partitioning of radiolabelled ABA and photoassimilates displayed consistently higher sink strengths (% DPM) for both /sup 3/H-ABA and /sup 14/C-photoassimilates for non-abscising flowers than for abscising flowers within control racemes. Shading flowers with aluminum foil, 48 hrs prior to sampling, resultedmore » in lowered endogenous ABA concentrations at 12, 17 and 22 days after anthesis (DAA), but not at 0 or 4 DAA. No differences were found in the catabolism of /sup 3/H-ABA between shaded (abscising) and non-shaded (non-abscising) flowers. Reduced partitioning of ABA and photoassimilates to shaded flowers resulted when shades were applied at 0, 4, 12, and 17 DAA, but not at 22 DAA.« less
Fonseca, Jorge M; Rushing, James W; Rajapakse, Nihal C; Thomas, Ronald L; Riley, Melissa B
2005-05-01
The effect of harvest time, shading prior to harvest and water stress on parthenolide (PRT) concentration in feverfew and its possible connection with the abscisic acid (ABA) pathway were investigated. In plants harvested at different times of the day, acetumar the PRT levels were highest during late afternoon while ABA levels were greatest during morning hours. Shading plants during the afternoon prior to harvest caused a two-fold increase in ABA and no significant difference in PRT levels. ABA was higher in water-stressed plants while PRTcontent increased in plants following recovery from a water stress event. ABA inhibitors, norflurazon, sodium tungstate, naproxen and sodium bisulfite, were used to determine the connection between the biosynthesis of PRTand ABA. Norflurazon and naproxen reduced PRT concentration in cut flowers and in 2-month old plants. Sodium bisulfite and sodium tungstate reduced PRT only in cut flowers. Application of 2,4-D, a promoter of ABA synthesis, to potted plants resulted in a 2.5 fold increase in PRT levels. The inhibition of PRT formation in response to ABA inhibitors and the increase in PRT concentration observed with 2,4-D application indicated that PRT is derived from carotenoid synthesis similarly to ABA and not directly from farnesyl pyrosphosphate (FPP) as suggested for other sesquiterpene Lactones. However, PRT and ABA levels are affected dissimilarly by environmental conditions. The overall results of the study indicated that simple agricultural practices, such as harvesting during afternoon and subjecting plants to a single water stress event, can increase PRT concentration in the final feverfew product with no additional costs of production prior to harvest.
Mollashahi, Mahtab; Abbasnejad, Mehdi; Esmaeili-Mahani, Saeed
2018-08-05
The phytohormone abscisic acid exists in animal tissues particularly in the brain. However, its neurophysiological effects have not yet been fully clarified. This study was designed to evaluate the possible antinociceptive effects of abscisic acid on animal models of pain and determine its possible signaling mechanism. Tail-flick, hot-plate and formalin tests were used to assess the nociceptive threshold. All experiments were carried out on male Wistar rats. To determine the role of Peroxisome proliferator-activated receptor β/δ (PPARβ/δ) and opioid receptors on the induction of abscisic acid antinociception, specific antagonists were injected 15 min before abscisic acid. The data showed that abscisic acid (5, 10 and 15 µg/rat, i.c.v.) significantly decreased pain responses in formalin test. In addition, it could also produce dose-dependent antinociceptive effect in tail-flick and hot-plate tests. Administration of PPARβ/δ antagonist (GSK0660, 80 nM, i.c.v.) significantly attenuated the antinociceptive effect of abscisic acid in all tests. The antinociceptive effects of abscisic acid were completely inhibited by naloxone (6 µg, i.c.v.) during the time course of tail-flick and hot-plate tests. The results indicated that the central injection of abscisic acid has potent pain-relieving property which is mediated partly via the PPAR β/δ and opioid signaling. Copyright © 2018 Elsevier B.V. All rights reserved.
Radhakrishnan, Ramalingam; Park, Jae-Man; Lee, In-Jung
2016-12-01
Very few bacterial species were identified as bio-herbicides for weed control. The present research was focused to elucidate the plant growth retardant properties of Enterobacter sp. I-3 during their interaction by determining the changes in endogenous photosynthetic pigments, plant hormones and amino acids. The two bacterial isolates I-4-5 and I-3 were used to select the superior bacterium for controlling weed seeds (Echinochloa crus-galli L. and Portulaca oleracea L.) germination. The post-inoculation of I-3 (Enterobacter sp. I-3) significantly inhibited the weeds seed germination than their controls. The mechanism of bacterium induced plant growth reduction was identified in lettuce treated with I-3 bacterium and compared their effects with known chemical herbicide, trinexapac-ethyl (TE). The treatment of I-3 and TE showed a significant inhibitory effect on shoot length, leaf number, leaf length, leaf width, shoot weight, root weight and chlorophyll content in lettuce seedlings. The endogenous gibberellins (GAs) and abscisic acid (ABA) analysis showed that Enterobacter sp. I-3 treated plants had lower levels of GAs (GA 12 , GA 19 , GA 20 and GA 8 ) and GAs/ABA ratio and then, the higher level of ABA when compared to their controls. Indeed, the individual amino acids ie., aspartic acid, glutamic acid, glycine, threonine, alanine, serine, leucine, isoleucine and tyrosine were declined in TE and I-3 exposed plants. Our results suggest that the utilization of Enterobacter sp. I-3 inhibits the GAs pathway and amino acids synthesis in weeds to control their growth can be an alternative to chemical herbicides. Copyright © 2016 Elsevier GmbH. All rights reserved.
Ren, Cheng-Gang; Kong, Cun-Cui; Xie, Zhi-Hong
2018-05-03
Strigolactones (SLs) are considered to be a novel class of phytohormone involved in plant defense responses. Currently, their relationships with other plant hormones, such as abscisic acid (ABA), during responses to salinity stress are largely unknown. In this study, the relationship between SL and ABA during the induction of H 2 O 2 - mediated tolerance to salt stress were studied in arbuscular mycorrhizal (AM) Sesbania cannabina seedlings. The SL levels increased after ABA treatments and decreased when ABA biosynthesis was inhibited in AM plants. Additionally, the expression levels of SL-biosynthesis genes in AM plants increased following treatments with exogenous ABA and H 2 O 2 . Furthermore, ABA-induced SL production was blocked by a pre-treatment with dimethylthiourea, which scavenges H 2 O 2 . In contrast, ABA production was unaffected by dimethylthiourea. Abscisic acid induced only partial and transient increases in the salt tolerance of TIS108 (a SL synthesis inhibitor) treated AM plants, whereas SL induced considerable and prolonged increases in salt tolerance after a pre-treatment with tungstate. These results strongly suggest that ABA is regulating the induction of salt tolerance by SL in AM S. cannabina seedlings.
Roychoudhury, Aryadeep; Paul, Saikat; Basu, Supratim
2013-07-01
Salinity, drought and low temperature are the common forms of abiotic stress encountered by land plants. To cope with these adverse environmental factors, plants execute several physiological and metabolic responses. Both osmotic stress (elicited by water deficit or high salt) and cold stress increase the endogenous level of the phytohormone abscisic acid (ABA). ABA-dependent stomatal closure to reduce water loss is associated with small signaling molecules like nitric oxide, reactive oxygen species and cytosolic free calcium, and mediated by rapidly altering ion fluxes in guard cells. ABA also triggers the expression of osmotic stress-responsive (OR) genes, which usually contain single/multiple copies of cis-acting sequence called abscisic acid-responsive element (ABRE) in their upstream regions, mostly recognized by the basic leucine zipper-transcription factors (TFs), namely, ABA-responsive element-binding protein/ABA-binding factor. Another conserved sequence called the dehydration-responsive element (DRE)/C-repeat, responding to cold or osmotic stress, but not to ABA, occurs in some OR promoters, to which the DRE-binding protein/C-repeat-binding factor binds. In contrast, there are genes or TFs containing both DRE/CRT and ABRE, which can integrate input stimuli from salinity, drought, cold and ABA signaling pathways, thereby enabling cross-tolerance to multiple stresses. A strong candidate that mediates such cross-talk is calcium, which serves as a common second messenger for abiotic stress conditions and ABA. The present review highlights the involvement of both ABA-dependent and ABA-independent signaling components and their interaction or convergence in activating the stress genes. We restrict our discussion to salinity, drought and cold stress.
de Torres Zabala, Marta; Bennett, Mark H; Truman, William H; Grant, Murray R
2009-08-01
The importance of phytohormone balance is increasingly recognized as central to the outcome of plant-pathogen interactions. Recently it has been demonstrated that abscisic acid signalling pathways are utilized by the bacterial phytopathogen Pseudomonas syringae to promote pathogenesis. In this study, we examined the dynamics, inter-relationship and impact of three key acidic phytohormones, salicylic acid, abscisic acid and jasmonic acid, and the bacterial virulence factor, coronatine, during progression of P. syringae infection of Arabidopsis thaliana. We show that levels of SA and ABA, but not JA, appear to play important early roles in determining the outcome of the infection process. SA is required in order to mount a full innate immune responses, while bacterial effectors act rapidly to activate ABA biosynthesis. ABA suppresses inducible innate immune responses by down-regulating SA biosynthesis and SA-mediated defences. Mutant analyses indicated that endogenous ABA levels represent an important reservoir that is necessary for effector suppression of plant-inducible innate defence responses and SA synthesis prior to subsequent pathogen-induced increases in ABA. Enhanced susceptibility due to loss of SA-mediated basal resistance is epistatically dominant over acquired resistance due to ABA deficiency, although ABA also contributes to symptom development. We conclude that pathogen-modulated ABA signalling rapidly antagonizes SA-mediated defences. We predict that hormonal perturbations, either induced or as a result of environmental stress, have a marked impact on pathological outcomes, and we provide a mechanistic basis for understanding priming events in plant defence.
Frey, Anne; Godin, Béatrice; Bonnet, Magda; Sotta, Bruno; Marion-Poll, Annie
2004-04-01
The role of maternally derived abscisic acid (ABA) during seed development has been studied using ABA-deficient mutants of Nicotiana plumbaginifolia Viviani. ABA deficiency induced seed abortion, resulting in reduced seed yield, and delayed growth of the remaining embryos. Mutant grafting onto wild-type stocks and reciprocal crosses indicated that maternal ABA, synthesized in maternal vegetative tissues and translocated to the seed, promoted early seed development and growth. Moreover ABA deficiency delayed both seed coat pigmentation and capsule dehiscence. Mutant grafting did not restore these phenotypes, indicating that ABA synthesized in the seed coat and capsule envelope may have a positive effect on capsule and testa maturation. Together these results shed light on the positive role of maternal ABA during N. plumbaginifolia seed development.
Mechanisms of action and medicinal applications of abscisic Acid.
Bassaganya-Riera, J; Skoneczka, J; Kingston, D G J; Krishnan, A; Misyak, S A; Guri, A J; Pereira, A; Carter, A B; Minorsky, P; Tumarkin, R; Hontecillas, R
2010-01-01
Since its discovery in the early 1960's, abscisic acid (ABA) has received considerable attention as an important phytohormone, and more recently, as a candidate medicinal in humans. In plants it has been shown to regulate important physiological processes such as response to drought stress, and dormancy. The discovery of ABA synthesis in animal cells has generated interest in the possible parallels between its role in plant and animal systems. The importance of this molecule has prompted the development of several methods for the chemical synthesis of ABA, which differ significantly from the biosynthesis of ABA in plants through the mevalonic acid pathway. ABA recognition in plants has been shown to occur at both the intra- and extracellularly but little is known about the perception of ABA by animal cells. A few ABA molecular targets have been identified in vitro (e.g., calcium signaling, G protein-coupled receptors) in both plant and animal systems. A unique finding in mammalian systems, however, is that the peroxisome proliferator-activated receptor, PPAR gamma, is upregulated by ABA in both in vitro and in vivo studies. Comparison of the human PPAR gamma gene network with Arabidopsis ABA-related genes reveal important orthologs between these groups. Also, ABA can ameliorate the symptoms of type II diabetes, targeting PPAR gamma in a similar manner as the thiazolidinediones class of anti-diabetic drugs. The use of ABA in the treatment of type II diabetes, offers encouragement for further studies concerning the biomedical applications of ABA.
Raschke, K; Pierce, M; Popiela, C C
1976-01-01
The degree of stomatal sensitivity to CO(2) was positively correlated with the content of abscisic acid of leaves of Xanthium strumarium grown in a greenhouse and then transferred for 24 hours or more to a cold (5/10 C, night/day) or a warm growth chamber (20/23 C). This correlation did not exist in plants kept in the greehouse continuously (high abscisic acid, no CO(2) sensitivity), nor in plants transferred from the cold to the warm chamber (low abscisic acid, high CO(2) sensitivity). The abscisic acid content of leaves was correlated with water content only within narrow limits, if at all. At equal water contents, prechilled leaves contained more abscisic acid than leaves of plants pretreated in the warm chamber. There appear to be at least two compartments for abscisic acid in the leaf.
Profiling Abscisic Acid-Induced Changes in Fatty Acid Composition in Mosses.
Shinde, Suhas; Devaiah, Shivakumar; Kilaru, Aruna
2017-01-01
In plants, change in lipid composition is a common response to various abiotic stresses. Lipid constituents of bryophytes are of particular interest as they differ from that of flowering plants. Unlike higher plants, mosses have high content of very long-chain polyunsaturated fatty acids. Such lipids are considered to be important for survival of nonvascular plants. Here, using abscisic acid (ABA )-induced changes in lipid composition in Physcomitrella patens as an example, a protocol for total lipid extraction and quantification by gas chromatography (GC) coupled with flame ionization detector (FID) is described.
Abscisic Acid Metabolism in Salt-Stressed Cells of Dunaliella salina
Cowan, A. Keith; Rose, Peter D.
1991-01-01
The interrelationship between abscisic acid (ABA) production and β-carotene accumulation was investigated in salt-stressed cells of the halotolerant green alga Dunaliella salina var bardawil. Cells were supplied with either R-[2-14C]mevalonolactone or [14C] sodium bicarbonate for 20 hours and then exposed to increased salinity (1.5 to 3.0 molar NaCl) for various lengths of time. Incorporation of label into abscisic acid and phaseic acid and the distribution of [14C]ABA between the cells and incubation media were monitored. [14C]ABA and [14C]phaseic acid were identified as products of both R-[2-14C]mevalonolactone and [14C]sodium bicarbonate metabolism. ABA metabolism was enhanced by hypersalinity stress. Actinomycin D, chloramphenicol, and cycloheximide abolished the stress-induced production of ABA, suggesting a role for gene activation in the process. Kinetic analysis of both ABA and β-carotene production demonstrated two stages of accelerated β-carotene production. In addition, ABA levels increased rapidly, and this increase occurred coincident with the early period of accelerated β-carotene production. A possible role for ABA as a regulator of carotenogenesis in cells of D. salina is therefore discussed. PMID:16668469
Raschke, Klaus; Pierce, Margaret; Popiela, Chu Chen
1976-01-01
The degree of stomatal sensitivity to CO2 was positively correlated with the content of abscisic acid of leaves of Xanthium strumarium grown in a greenhouse and then transferred for 24 hours or more to a cold (5/10 C, night/day) or a warm growth chamber (20/23 C). This correlation did not exist in plants kept in the greehouse continuously (high abscisic acid, no CO2 sensitivity), nor in plants transferred from the cold to the warm chamber (low abscisic acid, high CO2 sensitivity). The abscisic acid content of leaves was correlated with water content only within narrow limits, if at all. At equal water contents, prechilled leaves contained more abscisic acid than leaves of plants pretreated in the warm chamber. There appear to be at least two compartments for abscisic acid in the leaf. PMID:16659416
Sakamoto, Hirokazu; Suzuki, Shigeo; Nagamune, Kisaburo; Kita, Kiyoshi; Matsuzaki, Motomichi
2017-07-01
Some organisms have retained plastids even after they have lost the ability to photosynthesize. Several studies of nonphotosynthetic plastids in apicomplexan parasites have shown that the isopentenyl pyrophosphate biosynthesis pathway in the organelle is essential for their survival. A phytohormone, abscisic acid, one of several compounds biosynthesized from isopentenyl pyrophosphate, regulates the parasite cell cycle. Thus, it is possible that the phytohormone is universally crucial, even in nonphotosynthetic plastids. Here, we examined this possibility using the oyster parasite Perkinsus marinus, which is a plastid-harboring cousin of apicomplexan parasites and has independently lost photosynthetic ability. Fluridone, an inhibitor of abscisic acid biosynthesis, blocked parasite growth and induced cell clustering. Nevertheless, abscisic acid and its intermediate carotenoids did not affect parasite growth or rescue the parasite from inhibition. Moreover, abscisic acid was not detected from the parasite using liquid chromatography mass spectrometry. Our findings show that abscisic acid does not play any significant roles in P. marinus. © 2016 The Authors. Journal of Eukaryotic Microbiology published by Wiley Periodicals, Inc. on behalf of International Society of Protistologists.
Siciliano, Ilenia; Amaral Carneiro, Greice; Spadaro, Davide; Garibaldi, Angelo; Gullino, Maria Lodovica
2015-09-23
Fusarium fujikuroi, the causal agent of bakanae disease, is the main seedborne pathogen on rice. To understand the basis of rice resistance, a quantitative method to simultaneously detect phytohormones and phytoalexins was developed by using HPLC-MS/MS. With this method dynamic profiles and possible interactions of defense-related phytohormones and phytoalexins were investigated on two rice cultivars, inoculated or not with F. fujikuroi. In the resistant cultivar Selenio, the presence of pathogen induced high production of phytoalexins, mainly sakuranetin, and symptoms of bakanae were not observed. On the contrary, in the susceptible genotype Dorella, the pathogen induced the production of gibberellin and abscisic acid and inhibited jasmonic acid production, phytoalexins were very low, and bakanae symptoms were observed. The results suggested that a wide range of secondary metabolites are involved in plant defense against pathogens and phytoalexin synthesis could be an important factor for rice resistance against bakanae disease.
Kondo, Satoru; Tomiyama, Hiroyuki; Rodyoung, Abhichartbut; Okawa, Katsuya; Ohara, Hitoshi; Sugaya, Sumiko; Terahara, Norihiko; Hirai, Nobuhiro
2014-06-15
The effects of blue and red light irradiation at night on abscisic acid (ABA) metabolism and anthocyanin synthesis were examined in grape berries. The expressions of VlMYBA1-2, VlMYBA2, UDP-glucose-flavonoid 3-O-glucosyltransferase (VvUFGT), 9-cis-epoxycarotenoid dioxygenase (VvNCED1), and ABA 8'-hydroxylase (VvCYP707A1) were also investigated. Endogenous ABA, its metabolite phaseic acid (PA), and the expressions of VvNCED1 and VvCYP707A1 were highest in red light-emitting diode (LED)-treated skin. In contrast, anthocyanin concentrations were highest in blue LED-treated skin, followed by red LED treatment. However, the expressions of VlMYBA1-2, VlMYBA2, and VvUFGT did not necessarily coincide with anthocyanin concentrations. The quality of coloring may depend on the amount of malvidin-based anthocyanin, which increased toward harvest in blue and red LED-treated skin, unlike in untreated controls. An increase in sugars was also observed in blue and red LED-treated skin. These results suggest that blue LED irradiation at night may be effective in increasing anthocyanin and sugar concentrations in grape berries. However, there is evidence that another factor may influence anthocyanin concentrations in grape berry skin significantly more than endogenous ABA: ABA concentrations were highest in red LED-treated skin, which had lower anthocyanin concentrations than blue LED-treated skin. Copyright © 2014 Elsevier GmbH. All rights reserved.
The Barley Magnesium Chelatase 150-kD Subunit Is Not an Abscisic Acid Receptor1[OA
Müller, André H.; Hansson, Mats
2009-01-01
Magnesium chelatase is the first unique enzyme of the chlorophyll biosynthetic pathway. It is composed of three gene products of which the largest is 150 kD. This protein was recently identified as an abscisic acid receptor in Arabidopsis (Arabidopsis thaliana). We have evaluated whether the barley (Hordeum vulgare) magnesium chelatase large subunit, XanF, could be a receptor for the phytohormone. The study involved analysis of recombinant magnesium chelatase protein as well as several induced chlorophyll-deficient magnesium chelatase mutants with defects identified at the gene and protein levels. Abscisic acid had no effect on magnesium chelatase activity and binding to the barley 150-kD protein could not be shown. Magnesium chelatase mutants showed a wild-type response in respect to postgermination growth and stomatal aperture. Our results question the function of the large magnesium chelatase subunit as an abscisic acid receptor. PMID:19176716
Bosco, Renato; Daeseleire, Els; Van Pamel, Els; Scariot, Valentina; Leus, Leen
2014-07-09
This paper describes a method to detect and quantitate the endogenous plant hormones (±)-2-cis-4-trans-abscisic acid, (-)-jasmonic acid, and salicylic acid by means of ultrahigh-performance liquid chromatography-tandem mass spectrometry (UHPLC-MS/MS) in hybrid rose leaf matrices. Deuterium-labeled [(2)H6] (+)-2-cis-4-trans-abscisic acid, [(2)H6] (±)-jasmonic acid, and [(2)H4]-salicylic acid were used as internal standards. Rose samples (10 mg) were extracted with methanol/water/acetic acid (10:89:1) and subsequently purified on an Oasis MCX 1 cm(3) Vac SPE cartridge. Performance characteristics were validated according to Commission Decision 2002/657/EC. Recovery, repeatability, and within-laboratory reproducibility were acceptable for all phytohormones tested at three different concentrations. The decision limit and detection capability for (±)-2-cis-4-trans-abscisic acid, (-)-jasmonic acid, and salicylic acid were 0.0075 and 0.015 μg/g, 0.00015 and 0.00030 μg/g, and 0.0089 and 0.018 μg/g, respectively. Matrix effects (signal suppression or enhancement) appeared to be high for all substances considered, implying the need for quantitation based on matrix-matched calibration curves.
Abscisic Acid Metabolism by a Cell-free Preparation from Echinocystis lobata Liquid Endoserum 1
Gillard, Douglas F.; Walton, Daniel C.
1976-01-01
A cell-free enzyme system capable of metabolizing abscisic acid has been obtained from Eastern Wild Cucumber (Echinocystis lobata Michx.) liquid endosperm. The reaction products were determined to be phaseic acid (PA) and dihydrophaseic acid (DPA) by co-chromatography on thin layer chromatograms as the free acids, methyl esters, and their respective oxidation or reduction products. The crude enzyme preparation was separated by centrifugation into a particulate abscisic acid (ABA)-hydroxylating activity and a soluble PA-reducing activity. The particulate ABA-hydroxylating enzyme showed a requirement for O2 and NADPH, inhibition by CO, and high substrate specificity for (+)-ABA. Acetylation of short term incubation mixtures gave evidence for the presence of 6′-hydroxymethyl-ABA as an intermediate in PA formation. Determinations of endogenous ABA and DPA concentrations suggest that the ABA-hydroxylating and PA-reducing enzymes are extensively metabolizing ABA in the intact E. lobata seed. PMID:16659768
Baldermann, Susanne; Yang, Ziyin; Sakai, Miwa; Fleischmann, Peter; Morita, Akio; Todoroki, Yasushi; Watanabe, Naoharu
2013-05-01
Carotenoids are a major class of plant pigments and fulfill many functions in different organisms that either produce or consume them. Although the color of the stamina of tea (Camellia sinensis) flowers is clearly due to the presence of carotenoids, the carotenoid profile and content remain to be discovered. We investigated the carotenoid profile of tea flowers and determined changes in concentrations over the floral development. The flowers contained oxygenated xanthophylls such as neoxanthin, lutein and zeaxanthin, as well as the hydrocarbons β-carotene and α-carotene. Flowers of the tea plant contain to vegetables comparable amounts of carotenoids. The content of 9'-cis-epoxycarotenoids, which serve as abscisic acid precursors, as well as changes in concentration of abscisic acid were studied. The concentrations of carotenoids decreased whereas the abscisic acid content increased over the floral development. Exogenously applied S-abscisic acid affected water uptake, flower opening and carotenoid accumulation. In summary, this paper reports, for the first time, the carotenoid profile and content of tea flowers. The study revealed that carotenoids in tea flowers are an interesting target in respect of possible applications of tea flower extracts as well as biological functions of abscisic acid during floral development. © 2012 Society of Chemical Industry.
Auxin-induced ethylene triggers abscisic acid biosynthesis and growth inhibition.
Hansen, H; Grossmann, K
2000-11-01
The growth-inhibiting effects of indole-3-acetic acid (IAA) at high concentration and the synthetic auxins 7-chloro-3-methyl-8-quinolinecarboxylic acid (quinmerac), 2-methoxy-3,6-dichlorobenzoic acid (dicamba), 4-amino-3,6, 6-trichloropicolinic acid (picloram), and naphthalene acetic acid, were investigated in cleavers (Galium aparine). When plants were root treated with 0.5 mM IAA, shoot epinasty and inhibition of root and shoot growth developed during 24 h. Concomitantly, 1-aminocyclopropane-1-carboxylic acid (ACC) synthase activity, and ACC and ethylene production were transiently stimulated in the shoot tissue within 2 h, followed by increases in immunoreactive (+)-abscisic acid (ABA) and its precursor xanthoxal (xanthoxin) after 5 h. After 24 h of treatment, levels of xanthoxal and ABA were elevated up to 2- and 24-fold, relative to control, respectively. In plants treated with IAA, 7-chloro-3-methyl-8-quinolinecarboxylic acid, naphthalene acetic acid, 2-methoxy-3,6-dichlorobenzoic acid, and 4-amino-3,6,6-trichloropicolinic acid, levels of ethylene, ACC, and ABA increased in close correlation with inhibition of shoot growth. Aminoethoxyvinyl-glycine and cobalt ions, which inhibit ethylene synthesis, decreased ABA accumulation and growth inhibition, whereas the ethylene-releasing ethephon promoted ABA levels and growth inhibition. In accordance, tomato mutants defective in ethylene perception (never ripe) did not produce the xanthoxal and ABA increases and growth inhibition induced by auxins in wild-type plants. This suggests that auxin-stimulated ethylene triggers ABA accumulation and the consequent growth inhibition. Reduced catabolism most probably did not contribute to ABA increase, as indicated by immunoanalyses of ABA degradation and conjugation products in shoot tissue and by pulse experiments with [(3)H]-ABA in cell suspensions of G. aparine. In contrast, studies using inhibitors of ABA biosynthesis (fluridone, naproxen, and tungstate), ABA
Synthesis, resolution and biological evaluation of cyclopropyl analogs of abscisic acid.
Han, Xiaoqiang; Fan, Jinlong; Lu, Huizhe; Wan, Chuan; Li, Xiuyun; Li, Hong; Yang, Dongyan; Zhang, Yuanzhi; Xiao, Yumei; Qin, Zhaohai
2015-09-15
cis-2,3-Cyclopropanated abscisic acid (cis-CpABA) has high photostability and good ABA-like activity. To further investigate its activity and action mechanism, 2S,3S-2,3-cyclopropanated ABA (3a) and 2R,3R-2,3-cyclopropanated ABA (3b) were synthesized. Bioassay showed that 3a displayed higher inhibitory activity in germination than that of 3b and ABA at the concentration of 3.0 μM, but 3a and 3b had much weaker inhibitory activity in inhibition seedling growth compared to ABA. The study of photostability revealed that 3a and 3b showed high stability under UV light exposure, which were 4 times and 3 times greater than (±)-ABA, respectively. Action mechanism study showed that 3a presented higher inhibition on phosphatase activity of HAB1 than 3b, although they all inferior to ABA. Molecular docking studies of 3a, 3b and ABA receptor PYL10 were agreement with the bioassay data and confirmed the importance of the configuration of the 2,3-cyclopropyl ABA analogs for their bioactivity in somewhat. This study provides a new approach for the design of ABA analogs, and the results validated structure-based design for this target class. Copyright © 2015 Elsevier Ltd. All rights reserved.
McElwain, Elizabeth F.; Bohnert, Hans J.; Thomas, John C.
1992-01-01
In Mesembryanthemum crystallinum, phosphoenolpyruvate carboxylase is synthesized de novo in response to osmotic stress, as part of the switch from C3-photosynthesis to Crassulacean acid metabolism. To better understand the environmental signals involved in this pathway, we have investigated the effects of light on the induced expression of phosphoenolpyruvate carboxylase mRNA and protein in response to stress by 400 millimolar NaCl or 10 micromolar abscisic acid in hydroponically grown plants. When plants were grown in high-intensity fluorescent or incandescent light (850 microeinsteins per square meter per second), NaCl and abscisic acid induced approximately an eightfold accumulation of phosphoenolpyruvate carboxylase mRNA when compared to untreated controls. Levels of phosphoenolpyruvate carboxylase protein were high in these abscisic acid- and NaCl-treated plants, and detectable in the unstressed control. Growth in high-intensity incandescent (red) light resulted in approximately twofold higher levels of phosphoenolpyruvate carboxylase mRNA in the untreated plants when compared to control plants grown in high-intensity fluorescent light. In low light (300 microeinsteins per square meter per second fluorescent), only NaCl induced mRNA levels significantly above the untreated controls. Low light grown abscisic acid- and NaCl-treated plants contained a small amount of phosphoenolpyruvate carboxylase protein, whereas the (untreated) control plants did not contain detectable amounts of phosphoenolpyruvate carboxylase. Environmental stimuli, such as light and osmotic stress, exert a combined effect on gene expression in this facultative halophyte. ImagesFigure 1Figure 2 PMID:16668999
Abscisic acid (ABA) receptors: light at the end of the tunnel
USDA-ARS?s Scientific Manuscript database
The plant hormone abscisic acid (ABA) plays a role in several aspects of plant growth and development. Understanding how this hormonal stimulus is sensed and transduced turned out to be one of the major tasks in the field of plant signaling. A series of recent papers proposed several different prote...
Abscisic Acid Levels and Seed Dormancy
Sondheimer, E.; Tzou, D. S.; Galson, Eva C.
1968-01-01
Dormant seeds from Fraxinus species require cold-temperature after-ripening prior to germination. Earlier, we found that abscisic acid (ABA) will inhibit germination of excised nondormant embryos and that this can be reversed with a combination of gibberellic acid and kinetin. Using Milborrow's quantitative “racemate dilution” method the ABA concentration in 3 types of Fraxinus seed and pericarp were determined. While ABA was present in all tissues, the highest concentration was found in the seed and pericarp of dormant F. americana. During the chilling treatment of F. americana the ABA levels decreased 37% in the pericarp and 68% in the seed. The ABA concentration of the seed of the nondormant species, F. ornus, is as low as that found in F. americana seeds after cold treatment. Experiments with exogenously added ABA solutions indicate that it is unlikely that the ABA in the pericarp functions in the regulation of seed dormancy. However, the ABA in the seed does seem to have a regulatory role in germination. Images PMID:16656935
Auxin-Induced Ethylene Triggers Abscisic Acid Biosynthesis and Growth Inhibition1
Hansen, Hauke; Grossmann, Klaus
2000-01-01
The growth-inhibiting effects of indole-3-acetic acid (IAA) at high concentration and the synthetic auxins 7-chloro-3-methyl-8-quinolinecarboxylic acid (quinmerac), 2-methoxy-3,6-dichlorobenzoic acid (dicamba), 4-amino-3,6,6-trichloropicolinic acid (picloram), and naphthalene acetic acid, were investigated in cleavers (Galium aparine). When plants were root treated with 0.5 mm IAA, shoot epinasty and inhibition of root and shoot growth developed during 24 h. Concomitantly, 1-aminocyclopropane-1-carboxylic acid (ACC) synthase activity, and ACC and ethylene production were transiently stimulated in the shoot tissue within 2 h, followed by increases in immunoreactive (+)-abscisic acid (ABA) and its precursor xanthoxal (xanthoxin) after 5 h. After 24 h of treatment, levels of xanthoxal and ABA were elevated up to 2- and 24-fold, relative to control, respectively. In plants treated with IAA, 7-chloro-3-methyl-8-quinolinecarboxylic acid, naphthalene acetic acid, 2-methoxy-3,6-dichlorobenzoic acid, and 4-amino-3,6,6-trichloropicolinic acid, levels of ethylene, ACC, and ABA increased in close correlation with inhibition of shoot growth. Aminoethoxyvinyl-glycine and cobalt ions, which inhibit ethylene synthesis, decreased ABA accumulation and growth inhibition, whereas the ethylene-releasing ethephon promoted ABA levels and growth inhibition. In accordance, tomato mutants defective in ethylene perception (never ripe) did not produce the xanthoxal and ABA increases and growth inhibition induced by auxins in wild-type plants. This suggests that auxin-stimulated ethylene triggers ABA accumulation and the consequent growth inhibition. Reduced catabolism most probably did not contribute to ABA increase, as indicated by immunoanalyses of ABA degradation and conjugation products in shoot tissue and by pulse experiments with [3H]-ABA in cell suspensions of G. aparine. In contrast, studies using inhibitors of ABA biosynthesis (fluridone, naproxen, and tungstate), ABA
Kikuzaki, Hiroe; Kayano, Shin-ichi; Fukutsuka, Naoko; Aoki, Asuka; Kasamatsu, Kumi; Yamasaki, Yuka; Mitani, Takahiko; Nakatani, Nobuji
2004-01-28
Four new abscisic acid related compounds (1-4), together with (+)-abscisic acid (5), (+)-beta-D-glucopyranosyl abscisate (6), (6S,9R)-roseoside (7), and two lignan glucosides ((+)-pinoresinol mono-beta-D-glucopyranoside (8) and 3-(beta-D-glucopyranosyloxymethyl)-2- (4-hydroxy-3-methoxyphenyl)-5-(3-hydroxypropyl)-7-methoxy-(2R,3S)-dihydrobenzofuran (9)) were isolated from the antioxidative ethanol extract of prunes (Prunus domestica L.). The structures of 1-4 were elucidated on the basis of NMR and MS spectrometric data to be rel-5-(3S,8S-dihydroxy-1R,5S-dimethyl-7-oxa-6-oxobicyclo[3,2,1]oct-8-yl)-3-methyl-2Z,4E-pentadienoic acid (1), rel-5-(3S,8S-dihydroxy-1R,5S-dimethyl-7-oxa-6-oxobicyclo[3,2,1]oct-8-yl)-3-methyl-2Z,4E-pentadienoic acid 3'-O-beta-d-glucopyranoside (2), rel-5-(1R,5S-dimethyl-3R,4R,8S-trihydroxy-7-oxa-6-oxobicyclo[3,2,1]oct-8-yl)-3-methyl-2Z,4E-pentadienoic acid (3), and rel-5-(1R,5S-dimethyl-3R,4R,8S-trihydroxy-7-oxabicyclo[3,2,1]- oct-8-yl)-3-methyl-2Z,4E-pentadienoic acid (4). The antioxidant activities of these isolated compounds were evaluated on the basis of oxygen radical absorbance capacity (ORAC). The ORAC values of abscisic acid related compounds (1-7) were very low. Two lignans (8 and 9) were more effective antioxidants whose ORAC values were 1.09 and 2.33 micromol of Trolox equiv/micromol, respectively.
Lindgren, L Ove; Stålberg, Kjell G; Höglund, Anna-Stina
2003-06-01
Phytoene synthase catalyzes the dimerization of two molecules of geranylgeranyl pyrophosphate to phytoene and has been shown to be rate limiting for the synthesis of carotenoids. To elucidate if the capacity to produce phytoene is limiting also in the seed of Arabidopsis (Wassilewskija), a gene coding for an endogenous phytoene synthase was cloned and coupled to a seed-specific promoter, and the effects of the overexpression were examined. The resulting transgenic plants produced darker seeds, and extracts from the seed of five overexpressing plants had a 43-fold average increase of beta-carotene and a total average amount of beta-carotene of approximately 260 microg g-1 fresh weight. Lutein, violaxanthin, and chlorophyll were significantly increased, whereas the levels of zeaxanthin only increased by a factor 1.1. In addition, substantial levels of lycopene and alpha-carotene were produced in the seeds, whereas only trace amounts were found in the control plants. Seeds from the transgenic plants exhibited delayed germination, and the degree of delay was positively correlated with the increased levels of carotenoids. The abscisic acid levels followed the increase of the carotenoids, and plants having the highest carotenoid levels also had the highest abscisic acid content. Addition of gibberellic acid to the growth medium only partly restored germination of the transgenic seeds.
NASA Technical Reports Server (NTRS)
Moore, R.; Dickey, K.
1985-01-01
The objective of this research was to determine if gibberellic acid (GA) and/or abscisic acid (ABA) are necessary for graviresponsiveness by primary roots of Zea mays. To accomplish this objective we measured the growth and graviresponsiveness of primary roots of seedlings in which the synthesis of ABA and GA was inhibited collectively and individually by genetic and chemical means. Roots of seedlings treated with Fluridone (an inhibitor of ABA biosynthesis) and Ancymidol (an inhibitor of GA biosynthesis) were characterized by slower growth rates but not significantly different gravicultures as compared to untreated controls. Gravicurvatures of primary roots of d-5 mutants (having undetectable levels of GA) and vp-9 mutants (having undectable levels of ABA) were not significantly different from those of wild-type seedlings. Roots of seedlings in which the biosynthesis of ABA and GA was collectively inhibited were characterized by gravicurvatures not significantly different for those of controls. These results (1) indicate that drastic reductions in the amount of ABA and GA in Z. mays seedlings do not significantly alter root graviresponsiveness, (2) suggest that neither ABA nor GA is necessary for root gravicurvature, and (3) indicate that root gravicurvature is not necessarily proportional to root elongation.
Kravchenko, Alena; Citerne, Sylvie; Jéhanno, Isabelle; Bersimbaev, Rakhmetkazhi I; Veit, Bruce; Meyer, Christian; Leprince, Anne-Sophie
2015-11-27
The Target of Rapamycin (TOR) kinase regulates essential processes in plant growth and development by modulation of metabolism and translation in response to environmental signals. In this study, we show that abscisic acid (ABA) metabolism is also regulated by the TOR kinase. Indeed ABA hormone level strongly decreases in Lst8-1 and Raptor3g mutant lines as well as in wild-type (WT) Arabidopsis plants treated with AZD-8055, a TOR inhibitor. However the growth and germination of these lines are more sensitive to exogenous ABA. The diminished ABA hormone accumulation is correlated with lower transcript levels of ZEP, NCED3 and AAO3 biosynthetic enzymes, and higher transcript amount of the CYP707A2 gene encoding a key-enzyme in abscisic acid catabolism. These results suggest that the TOR signaling pathway is implicated in the regulation of ABA accumulation in Arabidopsis. Copyright © 2015 Elsevier Inc. All rights reserved.
Shahpiri, Azar; Talaei, Nasim; Finnie, Christine
2015-01-01
Cereal seed germination involves mobilization of storage reserves in the starchy endosperm to support seedling growth. In response to gibberellin produced by the embryo the aleurone layer synthesizes hydrolases that are secreted to the endosperm for degradation of storage products. In this study analysis of intracellular protein accumulation and release from barley aleurone layers is presented for the important enzymes in starch degradation: α-amylase and limit dextrinase (LD). Proteins were visualized by immunoblotting in aleurone layers and culture supernatants from dissected aleurone layers incubated up to 72 h with either gibberellic acid (GA), abscisic acid (ABA) or salicylic acid (SA). The results show that α-amylase is secreted from aleurone layer treated with GA soon after synthesis but the release of LD to culture supernatants was significantly delayed and coincided with a general loss of proteins from aleurone layers. Release of LD was found to differ from that of amylase and was suggested to depend on programmed cell death (PCD). Despite detection of intracellular amylase in untreated aleurone layers or aleurone layers treated with ABA or SA, α-amylase was not released from these samples. Nevertheless, the release of α-amylase was observed from aleurone layers treated with GA+ABA or GA+SA. © 2014 Society of Chemical Industry.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 40 Protection of Environment 23 2010-07-01 2010-07-01 false S-Abscisic Acid, (S)-5-(1-hydroxy-2,6... Exemptions From Tolerances § 180.1281 S-Abscisic Acid, (S)-5-(1-hydroxy-2,6,6-trimethyl-4-oxo-1-cyclohex-2... from the requirement of a tolerance is established for residues of S-Abscisic Acid in or on all food...
Abscisic acid-type sesquiterpenes and ansamycins from Amycolatopsis alba DSM 44262.
Li, Xiao-Mei; Li, Xiao-Man; Lu, Chun-Hua
2017-10-01
Two new abscisic acid-type sesquiterpenes (1, 2), and one new ansamycin (3), together with four known ansamycins, namely ansacarbamitocins 4-7, were isolated from the fermentation extract of Amycolatopsis alba DSM 44262. The structures of the new compounds were elucidated to be (E)-3-methyl-5-(2,6,6-trimethyl-3-oxocyclohex-1-enyl)pent-2-enoic acid (1) and (E)-3-methyl-5-(2,6,6-trimethyl-4-oxocyclohex-2-enyl)pent-2-enoic acid (2), and 9-O-methylansacarbamitocin A1 (3), on the basis of comprehensive analysis of spectroscopic data, respectively. The antimicrobial activities were also evaluated for all seven compounds.
Bellotti, Marta; Salis, Annalisa; Grozio, Alessia; Damonte, Gianluca; Vigliarolo, Tiziana; Galatini, Andrea; Zocchi, Elena; Benatti, Umberto; Millo, Enrico
2015-01-01
The phytohormone abscisic acid (ABA), in addition to regulating physiological functions in plants, is also produced and released by several mammalian cell types, including human granulocytes, where it stimulates innate immune functions via an increase of the intracellular cAMP concentration ([cAMP]i). We synthesized several ABA analogs and evaluated the structure-activity relationship, by the systematical modification of selected regions of these analogs. The resulting molecules were tested for their ability to inhibit the ABA-induced increase of [cAMP]i in human granulocytes. The analogs with modified configurations at C-2' and C-3' abrogated the ABA-induced increase of the [cAMP]i and also inhibited several pro-inflammatory effects induced by exogenous ABA on granulocytes and monocytes. Accordingly, these analogs could be suitable as novel putative anti-inflammatory compounds. Copyright © 2014 Elsevier Ltd. All rights reserved.
Castellarin, Simone D.; Gambetta, Gregory A.; Wada, Hiroshi; Krasnow, Mark N.; Cramer, Grant R.; Peterlunger, Enrico; Shackel, Kenneth A.; Matthews, Mark A.
2016-01-01
Along with sugar accumulation and colour development, softening is an important physiological change during the onset of ripening in fruits. In this work, we investigated the relationships among major events during softening in grape (Vitis vinifera L.) by quantifying elasticity in individual berries. In addition, we delayed softening and inhibited sugar accumulation using a mechanical growth-preventing treatment in order to identify processes that are sugar and/or growth dependent. Ripening processes commenced on various days after anthesis, but always at similarly low elasticity and turgor. Much of the softening occurred in the absence of other changes in berry physiology investigated here. Several genes encoding key cell wall-modifying enzymes were not up-regulated until softening was largely completed, suggesting softening may result primarily from decreases in turgor. Similarly, there was no decrease in solute potential, increase in sugar concentration, or colour development until elasticity and turgor were near minimum values, and these processes were inhibited when berry growth was prevented. Increases in abscisic acid occurred early during softening and in the absence of significant expression of the V. vinifera 9-cis-epoxycarotenoid dioxygenases. However, these increases were coincident with decreases in the abscisic acid catabolite diphasic acid, indicating that initial increases in abscisic acid may result from decreases in catabolism and/or exogenous import. These data suggest that softening, decreases in turgor, and increases in abscisic acid represent some of the earliest events during the onset of ripening. Later, physical growth, further increases in abscisic acid, and the accumulation of sugar are integral for colour development. PMID:26590311
Iwasaki, T; Yamaguchi-Shinozaki, K; Shinozaki, K
1995-05-20
In Arabidopsis thaliana, the induction of a dehydration-responsive gene, rd22, is mediated by abscisic acid (ABA) but the gene does not include any sequence corresponding to the consensus ABA-responsive element (ABRE), RYACGTGGYR, in its promoter region. The cis-regulatory region of the rd22 promoter was identified by monitoring the expression of beta-glucuronidase (GUS) activity in leaves of transgenic tobacco plants transformed with chimeric gene fusions constructed between 5'-deleted promoters of rd22 and the coding region of the GUS reporter gene. A 67-bp nucleotide fragment corresponding to positions -207 to -141 of the rd22 promoter conferred responsiveness to dehydration and ABA on a non-responsive promoter. The 67-bp fragment contains the sequences of the recognition sites for some transcription factors, such as MYC, MYB, and GT-1. The fact that accumulation of rd22 mRNA requires protein synthesis raises the possibility that the expression of rd22 might be regulated by one of these trans-acting protein factors whose de novo synthesis is induced by dehydration or ABA. Although the structure of the RD22 protein is very similar to that of a non-storage seed protein, USP, of Vicia faba, the expression of the GUS gene driven by the rd22 promoter in non-stressed transgenic Arabidopsis plants was found mainly in flowers and bolted stems rather than in seeds.
Yin, Xiaojian; Nishimura, Minoru; Hajika, Makita; Komatsu, Setsuko
2016-06-03
Flooding negatively affects the growth of soybean, and several flooding-specific stress responses have been identified; however, the mechanisms underlying flooding tolerance in soybean remain unclear. To explore the initial flooding tolerance mechanisms in soybean, flooding-tolerant mutant and abscisic acid (ABA)-treated plants were analyzed. In the mutant and ABA-treated soybeans, 146 proteins were commonly changed at the initial flooding stress. Among the identified proteins, protein synthesis-related proteins, including nascent polypeptide-associated complex and chaperonin 20, and RNA regulation-related proteins were increased in abundance both at protein and mRNA expression. However, these proteins identified at the initial flooding stress were not significantly changed during survival stages under continuous flooding. Cluster analysis indicated that glycolysis- and cell wall-related proteins, such as enolase and polygalacturonase inhibiting protein, were increased in abundance during survival stages. Furthermore, lignification of root tissue was improved even under flooding stress. Taken together, these results suggest that protein synthesis- and RNA regulation-related proteins play a key role in triggering tolerance to the initial flooding stress in soybean. Furthermore, the integrity of cell wall and balance of glycolysis might be important factors for promoting tolerance of soybean root to flooding stress during survival stages.
Shuguang Wang; Yongpeng Ma; Chengbin Wan; Chungyun Hse; Todd F. Shupe; Yujun Wang; Changming Wang
2016-01-01
The Bambusoideae subfamily includes the fastest-growing plants worldwide, as a consequence of fast internode elongation. However, few studies have evaluated the temporal and spatial distribution of endogenous hormones during internode elongation. In this paper, endogenous indole-3-acetic acid (IAA) and abscisic acid (ABA) were detected in different developmental...
Uprooting an abscisic acid paradigm: Shoots are the primary source.
McAdam, Scott A M; Manzi, Matías; Ross, John J; Brodribb, Timothy J; Gómez-Cadenas, Aurelio
2016-06-02
In the past, a conventional wisdom has been that abscisic acid (ABA) is a xylem-transported hormone that is synthesized in the roots, while acting in the shoot to close stomata in response to a decrease in plant water status. Now, however, evidence from two studies, which we have conducted independently, challenges this root-sourced ABA paradigm. We show that foliage-derived ABA has a major influence over root development and that leaves are the predominant location for ABA biosynthesis during drought stress.
Castellarin, Simone D; Gambetta, Gregory A; Wada, Hiroshi; Krasnow, Mark N; Cramer, Grant R; Peterlunger, Enrico; Shackel, Kenneth A; Matthews, Mark A
2016-02-01
Along with sugar accumulation and colour development, softening is an important physiological change during the onset of ripening in fruits. In this work, we investigated the relationships among major events during softening in grape (Vitis vinifera L.) by quantifying elasticity in individual berries. In addition, we delayed softening and inhibited sugar accumulation using a mechanical growth-preventing treatment in order to identify processes that are sugar and/or growth dependent. Ripening processes commenced on various days after anthesis, but always at similarly low elasticity and turgor. Much of the softening occurred in the absence of other changes in berry physiology investigated here. Several genes encoding key cell wall-modifying enzymes were not up-regulated until softening was largely completed, suggesting softening may result primarily from decreases in turgor. Similarly, there was no decrease in solute potential, increase in sugar concentration, or colour development until elasticity and turgor were near minimum values, and these processes were inhibited when berry growth was prevented. Increases in abscisic acid occurred early during softening and in the absence of significant expression of the V. vinifera 9-cis-epoxycarotenoid dioxygenases. However, these increases were coincident with decreases in the abscisic acid catabolite diphasic acid, indicating that initial increases in abscisic acid may result from decreases in catabolism and/or exogenous import. These data suggest that softening, decreases in turgor, and increases in abscisic acid represent some of the earliest events during the onset of ripening. Later, physical growth, further increases in abscisic acid, and the accumulation of sugar are integral for colour development. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology.
Violaxanthin is an abscisic acid precursor in water-stressed dark-grown bean leaves
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Yi; Walton, D.C.
The leaves a dark-grown bean (Phaseolus vulgaris L.) seedlings accumulate considerably lower quantities of xanthophylls and carotenes than do leaves of light-grown seedlings, but they synthesize at least comparable amounts of abscisic acid (ABA) and its metabolites when water stressed. We observed a 1:1 relationship on a molar basis between the reduction in levels of ciolaxanthin, 9{prime}-cis-neoxanthin, and 9-cis-violaxanthin and the accumulation of ABA, phaseic acid, and dihydrophaseic acid, when leaves from dark-grown plants were stressed for 7 hours. Early in the stress period, reductions in xanthophylls were greater than the accumulation of ABA and its metabolites, suggesting the accumulationmore » of an intermediate which was subsequently converted to ABA. Leaves which were detached, but no stressed, did not accumulate ABA nor were their xanthophyll levels reduced. Leaves from plants that had been sprayed with cycloheximido did not accumulate ABA when stressed, nor were their xanthophyll levels reduced significantly. Incubation of dark-grown stressed leaves in an {sup 18}O{sub 2}-containing atmosphere resulted in the synthesis of ABA with levels of {sup 18}O in the carboxyl group that were virtually identical to those observed in light-grown leaves. The results of these experiments indicate that violaxanthin is an ABA precursor in stressed dark-grown leaves, and they are used to suggest several possible pathways from violaxanthin to ABA.« less
Alvim, R
1978-11-01
Levels of abscisic acid were followed in the xylem sap, mature leaves, and apices of field-grown willow (Salix viminalis L.) during the summer months, under natural and artificially extended photoperiods. Although the long day treatment prevented the general onset of dormancy, the plants grown under natural daylengths showed lower concentration of abscisic acid than those kept under long days.
López-Carbonell, Marta; Gabasa, Marta; Jáuregui, Olga
2009-04-01
An improved, quick and simple method for the extraction and quantification of the phytohormones (+)-abscisic acid (ABA) and its major glucose conjugate, abscisic acid glucose ester (ABA-GE) in plant samples is described. The method includes the addition of deuterium-labeled internal standards to the leaves at the beginning of the extraction for quantification, a simple extraction/centrifugation process and the injection into the liquid chromatography-electrospray ionization-tandem mass spectrometry (LC-ESI-MS-MS) system in multiple reaction monitoring mode (MRM). Quality parameters of the method (detection limits, repeatability, reproducibility and linearity) have been studied. The objective of this work is to show the applicability of this method for quantifying the endogenous content of both ABA and ABA-GE in Cistus albidus plants that have been grown during an annual cycle under Mediterranean field conditions. Leaf samples from winter plants have low levels of ABA which increase in spring and summer showing two peaks that corresponded to April and August. These increases are coincident with the high temperature and solar radiation and the low RWC and RH registered along the year. On the other hand, the endogenous levels of ABA-GE increase until maximum values in July just before the ABA content reaches its highest concentration, decreasing in August and during autumn and winter. Our results suggest that the method is useful for quantifying both compounds in this plant material and represents the advantage of a short-time sample preparation with a high accuracy and viability.
Response of Cultured Maize Cells to (+)-Abscisic Acid, (-)-Abscisic Acid, and Their Metabolites.
Balsevich, J. J.; Cutler, A. J.; Lamb, N.; Friesen, L. J.; Kurz, E. U.; Perras, M. R.; Abrams, S. R.
1994-01-01
The metabolism and effects of (+)-S- and (-)-R-abscisic acid (ABA) and some metabolites were studied in maize (Zea mays L. cv Black Mexican Sweet) suspension-cultured cells. Time-course studies of metabolite formation were performed in both cells and medium via analytical high-performance liquid chromatography. Metabolites were isolated and identified using physical and chemical methods. At 10 [mu]M concentration and 28[deg] C, (+)-ABA was metabolized within 24 h, yielding natural (-)-phaseic acid [(-)-PA] as the major product. The unnatural enantiomer (-)-ABA was less than 50% metabolized within 24 h and gave primarily (-)-7[prime]-hydroxyABA [(-)-7[prime]-HOABA], together with (+)-PA and ABA glucose ester. The distribution of metabolites in cells and medium was different, reflecting different sites of metabolism and membrane permeabilities of conjugated and nonconjugated metabolites. The results imply that (+)-ABA was oxidized to (-)-PA inside the cell, whereas (-)-ABA was converted to (-)-7[prime]-HOABA at the cell surface. Growth of maize cells was inhibited by both (+)- and (-)-ABA, with only weak contributions from their metabolites. The concentration of (+)-ABA that caused a 50% inhibition of growth of maize cells was approximately 1 [mu]M, whereas that for its metabolite (-)-PA was approximately 50 [mu]M. (-)-ABA was less active than (+)-ABA, with 50% growth inhibition observed at about 10 [mu]M. (-)-7[prime]-HOABA was only weakly active, with 50% inhibition caused by approximately 500 [mu]M. Time-course studies of medium pH indicated that (+)-ABA caused a transient pH increase (+0.3 units) at 6 h after addition that was not observed in controls or in samples treated with (-)-PA. The effect of (-)-ABA on medium Ph was marginal. No racemization at C-1[prime] of (+)-ABA, (-)-ABA, or metabolites was observed during the studies. PMID:12232311
USDA-ARS?s Scientific Manuscript database
Tea [Camellia sinensis (L.) O. Kuntze] is an important economic crop, and drought is the most important abiotic stress affecting yield and quality. Abscisic acid (ABA) is an important phytohormone responsible for activating drought resistance. Increased understanding of ABA effects on tea plant unde...
Salomon, María Victoria; Bottini, Rubén; de Souza Filho, Gonçalo Apolinário; Cohen, Ana Carmen; Moreno, Daniela; Gil, Mariana; Piccoli, Patricia
2014-08-01
Eleven bacterial strains were isolated at different soil depths from roots and rhizosphere of grapevines from a commercial vineyard. By 16S rRNA gene sequencing 10 different genera and 8 possible at species level were identified. From them, Bacillus licheniformis Rt4M10 and Pseudomonas fluorescens Rt6M10 were selected according to their characteristics as plant growth promoting rhizobacteria (PGPR). Both produced abscisic acid (ABA), indole-3-acetic acid (IAA) and the gibberellins A1 and A3 in chemically-defined medium. They also colonized roots of in vitro grown Vitis vinifera cv. Malbec plants. As result of bacterization ABA levels in 45 days-old in vitro plants were increased 76-fold by B. licheniformis and 40-fold by P. fluorescens as compared to controls. Both bacteria diminished plant water loss rate in correlation with increments of ABA. Twenty and 30 days post bacterization the plants incremented terpenes. The monoterpenes α-pinene, terpinolene, 4-carene, limonene, eucalyptol and lilac aldehyde A, and the sesquiterpenes α-bergamotene, α-farnesene, nerolidol and farnesol were assessed by gas chromatography-electron impact mass spectrometry analysis. α-Pinene and nerolidol were the most abundant (µg per g of tissue in plants bacterized with P. fluorescens). Only α-pinene, eucalyptol and farnesol were identified at low concentration in non-bacterized plants treated with ABA, while no terpenes were detected in controls. The results obtained along with others from literature suggest that B. licheniformis and P. fluorescens act as stress alleviators by inducing ABA synthesis so diminishing water losses. These bacteria also elicit synthesis of compounds of plant defense via an ABA independent mechanism. © 2013 Scandinavian Plant Physiology Society.
On the role of abscisic acid in seed dormancy of red rice.
Gianinetti, Alberto; Vernieri, Paolo
2007-01-01
Abscisic acid (ABA) is commonly assumed to be the primary effector of seed dormancy, but conclusive evidence for this role is lacking. This paper reports on the relationships occurring in red rice between ABA and seed dormancy. Content of free ABA in dry and imbibed caryopses, both dormant and after-ripened, the effects of inhibitors, and the ability of applied ABA to revert dormancy breakage were considered. The results indicate: (i) no direct correlation of ABA content with the dormancy status of the seed, either dry or imbibed; (ii) different sensitivity to ABA of non-dormant seed and seed that was forced to germinate by fluridone; and (iii) an inability of exogenous ABA to reinstate dormancy in fluridone-treated seed, even though applied at a pH which favoured high ABA accumulation. These considerations suggest that ABA is involved in regulating the first steps of germination, but unidentified developmental effectors that are specific to dormancy appear to stimulate ABA synthesis and to enforce the responsiveness to this phytohormone. These primary effectors appear physiologically to modulate dormancy and via ABA they effect the growth of the embryo. Therefore, it is suggested that ABA plays a key role in integrating the dormancy-specific developmental signals with the control of growth.
Zhong, Chunmei; Xu, Hao; Ye, Siting; Wang, Shiyi; Li, Lingfei; Zhang, Shengchun; Wang, Xiaojing
2015-11-01
The DELLA protein REPRESSOR OF ga1-3-LIKE2 (RGL2) plays an important role in seed germination under different conditions through a number of transcription factors. However, the functions of the structural genes associated with RGL2-regulated germination are less defined. Here, we report the role of an Arabidopsis (Arabidopsis thaliana) cell wall-localized protein, Gibberellic Acid-Stimulated Arabidopsis6 (AtGASA6), in functionally linking RGL2 and a cell wall loosening expansin protein (Arabidopsis expansin A1 [AtEXPA1]), resulting in the control of embryonic axis elongation and seed germination. AtGASA6-overexpressing seeds showed precocious germination, whereas transfer DNA and RNA interference mutant seeds displayed delayed seed germination under abscisic acid, paclobutrazol, and glucose (Glc) stress conditions. The differences in germination rates resulted from corresponding variation in cell elongation in the hypocotyl-radicle transition region of the embryonic axis. AtGASA6 was down-regulated by RGL2, GLUCOSE INSENSITIVE2, and ABSCISIC ACID-INSENSITIVE5 genes, and loss of AtGASA6 expression in the gasa6 mutant reversed the insensitivity shown by the rgl2 mutant to paclobutrazol and the gin2 mutant to Glc-induced stress, suggesting that it is involved in regulating both the gibberellin and Glc signaling pathways. Furthermore, it was found that the promotion of seed germination and length of embryonic axis by AtGASA6 resulted from a promotion of cell elongation at the embryonic axis mediated by AtEXPA1. Taken together, the data indicate that AtGASA6 links RGL2 and AtEXPA1 functions and plays a role as an integrator of gibberellin, abscisic acid, and Glc signaling, resulting in the regulation of seed germination through a promotion of cell elongation. © 2015 American Society of Plant Biologists. All Rights Reserved.
Yotsui, Izumi; Serada, Satoshi; Naka, Tetsuji; Saruhashi, Masashi; Taji, Teruaki; Hayashi, Takahisa; Quatrano, Ralph S; Sakata, Yoichi
2016-03-18
Desiccation tolerance is an ancestral feature of land plants and is still retained in non-vascular plants such as bryophytes and some vascular plants. However, except for seeds and spores, this trait is absent in vegetative tissues of vascular plants. Although many studies have focused on understanding the molecular basis underlying desiccation tolerance using transcriptome and proteome approaches, the critical molecular differences between desiccation tolerant plants and non-desiccation plants are still not clear. The moss Physcomitrella patens cannot survive rapid desiccation under laboratory conditions, but if cells of the protonemata are treated by the phytohormone abscisic acid (ABA) prior to desiccation, it can survive 24 h exposure to desiccation and regrow after rehydration. The desiccation tolerance induced by ABA (AiDT) is specific to this hormone, but also depends on a plant transcription factor ABSCISIC ACID INSENSITIVE3 (ABI3). Here we report the comparative proteomic analysis of AiDT between wild type and ABI3 deleted mutant (Δabi3) of P. patens using iTRAQ (Isobaric Tags for Relative and Absolute Quantification). From a total of 1980 unique proteins that we identified, only 16 proteins are significantly altered in Δabi3 compared to wild type after desiccation following ABA treatment. Among this group, three of the four proteins that were severely affected in Δabi3 tissue were Arabidopsis orthologous genes, which were expressed in maturing seeds under the regulation of ABI3. These included a Group 1 late embryogenesis abundant (LEA) protein, a short-chain dehydrogenase, and a desiccation-related protein. Our results suggest that at least three of these proteins expressed in desiccation tolerant cells of both Arabidopsis and the moss are very likely to play important roles in acquisition of desiccation tolerance in land plants. Furthermore, our results suggest that the regulatory machinery of ABA- and ABI3-mediated gene expression for desiccation
Liu, Hongyue; Ren, Xiaoqian; Zhu, Jiuzheng; Wu, Xi; Liang, Chanjuan
2018-05-31
Application of proper ABA can improve acid tolerance of rice roots by balancing endogenous hormones and promoting nutrient uptake. Abscisic acid (ABA) has an important signaling role in enhancing plant tolerance to environmental stress. To alleviate the inhibition on plant growth and productivity caused by acid rain, it is crucial to clarify the regulating mechanism of ABA on adaptation of plants to acid rain. Here, we studied the effects of exogenously applied ABA on nutrients uptake of rice roots under simulated acid rain (SAR) stress from physiological, biochemical and molecular aspects. Compared to the single SAR treatment (pH 4.5 or 3.5), exogenous 10 μM ABA alleviated the SAR-induced inhibition of root growth by balancing endogenous hormones (abscisic acid, indole-3-acetic acid, gibberellic acid and zeatin), promoting nutrient uptake (nitrate, P, K and Mg) in rice roots, and increasing the activity of the plasma membrane H + -ATPase by up-regulating expression levels of genes (OSA2, OSA4, OSA9 and OSA10). However, exogenous 100 μM ABA exacerbated the SAR-caused inhibition of root growth by disrupting the balance of endogenous hormones, and inhibiting nutrient uptake (nitrate, P, K, Ca and Mg) through decreasing the activity of the plasma membrane H + -ATPase. These results indicate that proper concentration of exogenous ABA could enhance tolerance of rice roots to SAR stress by promoting nutrients uptake and balancing endogenous hormones.
Kageyama, Akito; Ishizaki, Kimitsune; Kohchi, Takayuki; Matsuura, Hideyuki; Takahashi, Kosaku
2015-09-01
Environmental stresses are effective triggers for the biosynthesis of various secondary metabolites in plants, and phytohormones such as jasmonic acid and abscisic acid are known to mediate such responses in flowering plants. However, the detailed mechanism underlying the regulation of secondary metabolism in bryophytes remains unclear. In this study, the induction mechanism of secondary metabolites in the model liverwort Marchantia polymorpha was investigated. Abscisic acid (ABA) and ultraviolet irradiation (UV-C) were found to induce the biosynthesis of isoriccardin C, marchantin C, and riccardin F, which are categorized as bisbibenzyls, characteristic metabolites of liverworts. UV-C led to the significant accumulation of ABA. Overexpression of MpABI1, which encodes protein phosphatase 2C (PP2C) as a negative regulator of ABA signaling, suppressed accumulation of bisbibenzyls in response to ABA and UV-C irradiation and conferred susceptibility to UV-C irradiation. These data show that ABA plays a significant role in the induction of bisbibenzyl biosynthesis, which might confer tolerance against UV-C irradiation in M. polymorpha. Copyright © 2015 Elsevier Ltd. All rights reserved.
USDA-ARS?s Scientific Manuscript database
The effects of abscisic acid (ABA) form, concentration and application timing on bud cold hardiness, phenology and fruiting performance on ‘Merlot’ grapevines (Vitis vinifera) were evaluated in a three year field trial with site locations in British Columbia Canada, Ontario Canada, Washington U.S. ...
NASA Astrophysics Data System (ADS)
Weiss, Julia; Alcantud-Rodriguez, Raquel; Toksöz, Tugba; Egea-Cortines, Marcos
2016-01-01
Plants grow under climatic changing conditions that cause modifications in vegetative and reproductive development. The degree of changes in organ development i.e. its phenotypic plasticity seems to be determined by the organ identity and the type of environmental cue. We used intraspecific competition and found that Antirrhinum majus behaves as a decoupled species for lateral organ size and number. Crowding causes decreases in leaf size and increased leaf number whereas floral size is robust and floral number is reduced. Genes involved in shoot apical meristem maintenance like ROA and HIRZ, cell cycle (CYCD3a; CYCD3b, HISTONE H4) or organ polarity (GRAM) were not significantly downregulated under crowding conditions. A transcriptomic analysis of inflorescence meristems showed Gene Ontology enriched pathways upregulated including Jasmonic and Abscisic acid synthesis and or signalling. Genes involved in auxin synthesis such as AmTAR2 and signalling AmANT were not affected by crowding. In contrast, AmJAZ1, AmMYB21, AmOPCL1 and AmABA2 were significantly upregulated. Our work provides a mechanistic working hypothesis where a robust SAM and stable auxin signalling enables a homogeneous floral size while changes in JA and ABA signalling maybe responsible for the decreased leaf size and floral number.
Bosco, Renato; Caser, Matteo; Vanara, Francesca; Scariot, Valentina
2013-11-20
Plant hormones play a crucial role in controlling plant growth and development. These groups of naturally occurring substances trigger physiological processes at very low concentrations, which mandate sensitive techniques for their quantitation. This paper describes a method to quantify endogenous (±)-2-cis-4-trans-abscisic acid, indole-3-acetic acid, indole-3-propionic acid, and indole-3-butyric acid. The method combines high-performance liquid chromatography (HPLC) with diode array and fluorescence detection in a single run. Hybrid tea rose 'Monferrato' matrices (leaves, petals, roots, seeds, androecium, gynoecium, and pollen) were used as references. Rose samples were separated and suspended in extracting methanol, after which (±)-2-cis-4-trans-abscisic acid and auxins were extracted by solvent extraction. Sample solutions were added first to cation solid phase extraction (SPE) cartridges and the eluates to anion SPE cartridges. The acidic hormones were bound to the last column and eluted with 5% phosphoric acid in methanol. Experimental results showed that this approach can be successfully applied to real samples and that sample preparation and total time for routine analysis can be greatly reduced.
Involvement of a lipoxygenase-like enzyme in abscisic Acid biosynthesis.
Creelman, R A; Bell, E; Mullet, J E
1992-07-01
Several lines of evidence indicate that abscisic acid (ABA) is derived from 9'-cis-neoxanthin or 9'-cis-violaxanthin with xanthoxin as an intermediate. (18)O-labeling experiments show incorporation primarily into the side chain carboxyl group of ABA, suggesting that oxidative cleavage occurs at the 11, 12 (11', 12') double bond of xanthophylls. Carbon monoxide, a strong inhibitor of heme-containing P-450 monooxygenases, did not inhibit ABA accumulation, suggesting that the oxygenase catalyzing the carotenoid cleavage step did not contain heme. This observation, plus the ability of lipoxygenase to make xanthoxin from violaxanthin, suggested that a lipoxygenase-like enzyme is involved in ABA biosynthesis. To test this idea, the ability of several soybean (Glycine max L.) lipoxygenase inhibitors (5,8,11-eicosatriynoic acid, 5,8,11,14-eicosatetraynoic acid, nordihydroguaiaretic acid, and naproxen) to inhibit stress-induced ABA accumulation in soybean cell culture and soybean seedlings was determined. All lipoxygenase inhibitors significantly inhibited ABA accumulation in response to stress. These results suggest that the in vivo oxidative cleavage reaction involved in ABA biosynthesis requires activity of a nonheme oxygenase having lipoxygenase-like properties.
Fan, L; Zheng, S; Wang, X
1997-01-01
Membrane disruption has been proposed to be a key event in plant senescence, and phospholipase D (PLD; EC 3.1.4.4) has been thought to play an important role in membrane deterioration. We recently cloned and biochemically characterized three different PLDs from Arabidopsis. In this study, we investigated the role of the most prevalent phospholipid-hydrolyzing enzyme, PLD alpha, in membrane degradation and senescence in Arabidopsis. The expression of PLD alpha was suppressed by introducing a PLD alpha antisense cDNA fragment into Arabidopsis. When incubated with abscisic acid and ethylene, leaves detached from the PLD alpha-deficient transgenic plants showed a slower rate of senescence than did those from wild-type and transgenic control plants. The retardation of senescence was demonstrated by delayed leaf yellowing, lower ion leakage, greater photosynthetic activity, and higher content of chlorophyll and phospholipids in the PLD alpha antisense leaves than in those of the wild type. Treatment of detached leaves with abscisic acid and ethylene stimulated PLD alpha expression, as indicated by increases in PLD alpha mRNA, protein, and activity. In the absence of abscisic acid and ethylene, however, detached leaves from the PLD alpha-deficient and wild-type plants showed a similar rate of senescence. In addition, the suppression of PLD alpha did not alter natural plant growth and development. These data suggest that PLD alpha is an important mediator in phytohormone-promoted senescence in detached leaves but is not a direct promoter of natural senescence. The physiological relevance of these findings is discussed. PMID:9437863
Regulatory elements in vivo in the promoter of the abscisic acid responsive gene rab17 from maize.
Busk, P K; Jensen, A B; Pagès, M
1997-06-01
The rab17 gene from maize is transcribed in late embryonic development and is responsive to abscisic acid and water stress in embryo and vegetative tissues. In vivo footprinting and transient transformation of rab17 were performed in embryos and vegetative tissues to characterize the cis-elements involved in regulation of the gene. By in vivo footprinting, protein binding was observed to nine elements in the promoter, which correspond to five putative ABREs (abscisic acid responsive elements) and four other sequences. The footprints indicated that distinct proteins interact with these elements in the two developmental stages. In transient transformation, six of the elements were important for high level expression of the rab17 promoter in embryos, whereas only three elements were important in leaves. The cis-acting sequences can be divided in embryo-specific, ABA-specific and leaf-specific elements on the basis of protein binding and the ability to confer expression of rab17. We found one positive, new element, called GRA, with the sequence CACTGGCCGCCC. This element was important for transcription in leaves but not in embryos. Two other non-ABRE elements that stimulated transcription from the rab17 promoter resemble previously described abscisic acid and drought-inducible elements. There were differences in protein binding and function of the five ABREs in the rab17 promoter. The possible reasons for these differences are discussed. The in vivo data obtained suggest that an embryo-specific pathway regulates transcription of the rab genes during development, whereas another pathway is responsible for induction in response to ABA and drought in vegetative tissues.
Spollen, William G.; LeNoble, Mary E.; Samuels, Timmy D.; Bernstein, Nirit; Sharp, Robert E.
2000-01-01
Previous work showed that primary root elongation in maize (Zea mays L.) seedlings at low water potentials (ψw) requires the accumulation of abscisic acid (ABA) (R.E. Sharp, Y. Wu, G.S. Voetberg, I.N. Saab, M.E. LeNoble [1994] J Exp Bot 45: 1743–1751). The objective of the present study was to determine whether the inhibition of elongation in ABA-deficient roots is attributable to ethylene. At a ψw of −1.6 MPa, inhibition of root elongation in dark-grown seedlings treated with fluridone to impose ABA deficiency was largely prevented with two inhibitors of ethylene synthesis (aminooxyacetic acid and aminoethoxyvinylglycine) and one inhibitor of ethylene action (silver thiosulfate). The fluridone treatment caused an increase in the rate of ethylene evolution from intact seedlings. This effect was completely prevented with aminooxyacetic acid and also when ABA was supplied at a concentration that restored the ABA content of the root elongation zone and the root elongation rate. Consistent results were obtained when ABA deficiency was imposed using the vp5 mutant. Both fluridone-treated and vp5 roots exhibited additional morphological symptoms of excess ethylene. The results demonstrate that an important role of ABA accumulation in the maintenance of root elongation at low ψw is to restrict ethylene production. PMID:10712561
Abscisic acid is not necessary for gravitropism in primary roots of Zea mays
NASA Technical Reports Server (NTRS)
Moore, R.
1990-01-01
Primary roots of Zea mays L. cv. Tx 5855 treated with fluridone are strongly graviresponsive, but have undetectable levels of abscisic acid (ABA). Primary roots of the carotenoid-deficient w-3, vp-5, and vp-7 mutants of Z. mays are also graviresponsive despite having undetectable amounts of ABA. Graviresponsive roots of untreated and wild-type seedlings contain 286 to 317 ng ABA g-1 f. wt, respectively. These results indicate that ABA is not necessary for root gravicurvature.
Renouard, Sullivan; Corbin, Cyrielle; Lopez, Tatiana; Montguillon, Josiane; Gutierrez, Laurent; Lamblin, Frédéric; Lainé, Eric; Hano, Christophe
2012-01-01
Secoisolariciresinol diglucoside (SDG), the main phytoestrogenic lignan of Linum usitatissimum, is accumulated in the seed coat of flax during its development and pinoresinol-lariciresinol reductase (PLR) is a key enzyme in flax for its synthesis. The promoter of LuPLR1, a flax gene encoding a pinoresinol lariciresinol reductase, contains putative regulatory boxes related to transcription activation by abscisic acid (ABA). Gel mobility shift experiments evidenced an interaction of nuclear proteins extracted from immature flax seed coat with a putative cis-acting element involved in ABA response. As ABA regulates a number of physiological events during seed development and maturation we have investigated its involvement in the regulation of this lignan synthesis by different means. ABA and SDG accumulation time courses in the seed as well as LuPLR1 expression were first determined in natural conditions. These results showed that ABA timing and localization of accumulation in the flax seed coat could be correlated with the LuPLR1 gene expression and SDG biosynthesis. Experimental modulations of ABA levels were performed by exogenous application of ABA or fluridone, an inhibitor of ABA synthesis. When submitted to exogenous ABA, immature seeds synthesized 3-times more SDG, whereas synthesis of SDG was reduced in immature seeds treated with fluridone. Similarly, the expression of LuPLR1 gene in the seed coat was up-regulated by exogenous ABA and down-regulated when fluridone was applied. These results demonstrate that SDG biosynthesis in the flax seed coat is positively controlled by ABA through the transcriptional regulation of LuPLR1 gene.
Zhong, Chunmei; Xu, Hao; Ye, Siting; Wang, Shiyi; Li, Lingfei; Zhang, Shengchun; Wang, Xiaojing
2015-01-01
The DELLA protein REPRESSOR OF ga1-3-LIKE2 (RGL2) plays an important role in seed germination under different conditions through a number of transcription factors. However, the functions of the structural genes associated with RGL2-regulated germination are less defined. Here, we report the role of an Arabidopsis (Arabidopsis thaliana) cell wall-localized protein, Gibberellic Acid-Stimulated Arabidopsis6 (AtGASA6), in functionally linking RGL2 and a cell wall loosening expansin protein (Arabidopsis expansin A1 [AtEXPA1]), resulting in the control of embryonic axis elongation and seed germination. AtGASA6-overexpressing seeds showed precocious germination, whereas transfer DNA and RNA interference mutant seeds displayed delayed seed germination under abscisic acid, paclobutrazol, and glucose (Glc) stress conditions. The differences in germination rates resulted from corresponding variation in cell elongation in the hypocotyl-radicle transition region of the embryonic axis. AtGASA6 was down-regulated by RGL2, GLUCOSE INSENSITIVE2, and ABSCISIC ACID-INSENSITIVE5 genes, and loss of AtGASA6 expression in the gasa6 mutant reversed the insensitivity shown by the rgl2 mutant to paclobutrazol and the gin2 mutant to Glc-induced stress, suggesting that it is involved in regulating both the gibberellin and Glc signaling pathways. Furthermore, it was found that the promotion of seed germination and length of embryonic axis by AtGASA6 resulted from a promotion of cell elongation at the embryonic axis mediated by AtEXPA1. Taken together, the data indicate that AtGASA6 links RGL2 and AtEXPA1 functions and plays a role as an integrator of gibberellin, abscisic acid, and Glc signaling, resulting in the regulation of seed germination through a promotion of cell elongation. PMID:26400990
Tougane, Ken; Komatsu, Kenji; Bhyan, Salma Begum; Sakata, Yoichi; Ishizaki, Kimitsune; Yamato, Katsuyuki T; Kohchi, Takayuki; Takezawa, Daisuke
2010-03-01
Abscisic acid (ABA) is postulated to be a ubiquitous hormone that plays a central role in seed development and responses to environmental stresses of vascular plants. However, in liverworts (Marchantiophyta), which represent the oldest extant lineage of land plants, the role of ABA has been least emphasized; thus, very little information is available on the molecular mechanisms underlying ABA responses. In this study, we isolated and characterized MpABI1, an ortholog of ABSCISIC ACID INSENSITIVE1 (ABI1), from the liverwort Marchantia polymorpha. The MpABI1 cDNA encoded a 568-amino acid protein consisting of the carboxy-terminal protein phosphatase 2C (PP2C) domain and a novel amino-terminal regulatory domain. The MpABI1 transcript was detected in the gametophyte, and its expression level was increased by exogenous ABA treatment in the gemma, whose growth was strongly inhibited by ABA. Experiments using green fluorescent protein fusion constructs indicated that MpABI1 was mainly localized in the nucleus and that its nuclear localization was directed by the amino-terminal domain. Transient overexpression of MpABI1 in M. polymorpha and Physcomitrella patens cells resulted in suppression of ABA-induced expression of the wheat Em promoter fused to the beta -glucuronidase gene. Transgenic P. patens expressing MpABI1 and its mutant construct, MpABI1-d2, lacking the amino-terminal domain, had reduced freezing and osmotic stress tolerance, and associated with reduced accumulation of ABA-induced late embryogenesis abundant-like boiling-soluble proteins. Furthermore, ABA-induced morphological changes leading to brood cells were not prominent in these transgenic plants. These results suggest that MpABI1 is a negative regulator of ABA signaling, providing unequivocal molecular evidence of PP2C-mediated ABA response mechanisms functioning in liverworts.
NASA Technical Reports Server (NTRS)
Latimer, J. G.; Mitchell, C. A.
1988-01-01
Container-grown eggplant (Solanum melongena L. var esculentum Nees. 'Burpee's Black Beauty') seedlings were conditioned with brief, periodic mechanical stress or abscisic acid (ABA) in a greenhouse prior to outdoor exposure. Mechanical stress consisted of seismic (shaking) or thigmic (stem flexing) treatment. Exogenous ABA (10(-3) or 10(-4)M) was applied as a soil drench 3 days prior to outdoor transfer. During conditioning, only thigmic stress reduced stem elongation and only 10(-3) M ABA reduced relative growth rate (RGR). Both conditioning treatments increased leaf specific chlorophyll content, but mechanical stress did not affect leaf ABA content. Outdoor exposure of unconditioned eggplant seedlings decreased RGR and leaf-specific chlorophyll content, but tended to increase leaf ABA content relative to that of plants maintained in the greenhouse. Conditioning did not affect RGR of plants subsequently transferred outdoors, but did reduce stem growth. Seismic stress applied in the greenhouse reduced dry weight gain by plants subsequently transferred outdoors. Mechanical stress treatments increased leaf water potential by 18-25% relative to that of untreated plants.
Valdés, Ana Elisa; Overnäs, Elin; Johansson, Henrik; Rada-Iglesias, Alvaro; Engström, Peter
2012-11-01
Plants perceiving drought activate multiple responses to improve survival, including large-scale alterations in gene expression. This article reports on the roles in the drought response of two Arabidopsis thaliana homeodomain-leucine zipper class I genes; ATHB7 and ATHB12, both strongly induced by water-deficit and abscisic acid (ABA). ABA-mediated transcriptional regulation of both genes is shown to depend on the activity of protein phosphatases type 2C (PP2C). ATHB7 and ATHB12 are, thus, targets of the ABA signalling mechanism defined by the PP2Cs and the PYR/PYL family of ABA receptors, with which the PP2C proteins interact. Our results from chromatin immunoprecipitation and gene expression analyses demonstrate that ATHB7 and ATHB12 act as positive transcriptional regulators of PP2C genes, and thereby as negative regulators of abscisic acid signalling. In support of this notion, our results also show that ATHB7 and ATHB12 act to repress the transcription of genes encoding the ABA receptors PYL5 and PYL8 in response to an ABA stimulus. In summary, we demonstrate that ATHB7 and ATHB12 have essential functions in the primary response to drought, as mediators of a negative feedback effect on ABA signalling in the plant response to water deficit.
Specificity determinants for the abscisic acid response element.
Sarkar, Aditya Kumar; Lahiri, Ansuman
2013-01-01
Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interaction with ACGT core motif-containing ABRE sequences. We have also examined the variation in the stability of the protein-DNA complex upon mutating ABRE sequences using the protein design algorithm FoldX. The high throughput free energy calculations successfully predicted the ability of ABF1 to bind to alternative core motifs like GCGT or AAGT and also rationalized the role of the flanking sequences in determining the specificity of the protein-DNA interaction.
Jia, Haifeng; Jiu, Songtao; Zhang, Cheng; Wang, Chen; Tariq, Pervaiz; Liu, Zhongjie; Wang, Baoju; Cui, Liwen; Fang, Jinggui
2016-10-01
Although great progress has been made towards understanding the role of abscisic acid (ABA) and sucrose in fruit ripening, the mechanisms underlying the ABA and sucrose signalling pathways remain elusive. In this study, transcription factor ABA-stress-ripening (ASR), which is involved in the transduction of ABA and sucrose signalling pathways, was isolated and analysed in the nonclimacteric fruit, strawberry and the climacteric fruit, tomato. We have identified four ASR isoforms in tomato and one in strawberry. All ASR sequences contained the ABA stress- and ripening-induced proteins and water-deficit stress-induced proteins (ABA/WDS) domain and all ASR transcripts showed increased expression during fruit development. The expression of the ASR gene was influenced not only by sucrose and ABA, but also by jasmonic acid (JA) and indole-3-acetic acid (IAA), and these four factors were correlated with each other during fruit development. ASR bound the hexose transporter (HT) promoter, which contained a sugar box that activated downstream gene expression. Overexpression of the ASR gene promoted fruit softening and ripening, whereas RNA interference delayed fruit ripening, as well as affected fruit physiological changes. Change in ASR gene expression influenced the expression of several ripening-related genes such as CHS, CHI, F3H, DFR, ANS, UFGT, PG, PL, EXP1/2, XET16, Cel1/2 and PME. Taken together, this study may provide new evidence on the important role of ASR in cross-signalling between ABA and sucrose to regulate tomato and strawberry fruit ripening. The findings of this study also provide new insights into the regulatory mechanism underlying fruit development. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Cuticle Biosynthesis in Tomato Leaves Is Developmentally Regulated by Abscisic Acid.
Martin, Laetitia B B; Romero, Paco; Fich, Eric A; Domozych, David S; Rose, Jocelyn K C
2017-07-01
The expansion of aerial organs in plants is coupled with the synthesis and deposition of a hydrophobic cuticle, composed of cutin and waxes, which is critically important in limiting water loss. While the abiotic stress-related hormone abscisic acid (ABA) is known to up-regulate wax accumulation in response to drought, the hormonal regulation of cuticle biosynthesis during organ ontogeny is poorly understood. To address the hypothesis that ABA also mediates cuticle formation during organ development, we assessed the effect of ABA deficiency on cuticle formation in three ABA biosynthesis-impaired tomato mutants. The mutant leaf cuticles were thinner, had structural abnormalities, and had a substantial reduction in levels of cutin. ABA deficiency also consistently resulted in differences in the composition of leaf cutin and cuticular waxes. Exogenous application of ABA partially rescued these phenotypes, confirming that they were a consequence of reduced ABA levels. The ABA mutants also showed reduced expression of genes involved in cutin or wax formation. This difference was again countered by exogenous ABA, further indicating regulation of cuticle biosynthesis by ABA. The fruit cuticles were affected differently by the ABA-associated mutations, but in general were thicker. However, no structural abnormalities were observed, and the cutin and wax compositions were less affected than in leaf cuticles, suggesting that ABA action influences cuticle formation in an organ-dependent manner. These results suggest dual roles for ABA in regulating leaf cuticle formation: one that is fundamentally associated with leaf expansion, independent of abiotic stress, and another that is drought induced. © 2017 American Society of Plant Biologists. All Rights Reserved.
Hattori, T; Terada, T; Hamasuna, S
1995-06-01
Osem, a rice gene homologous to the wheat Em gene, which encodes one of the late-embryogenesis abundant proteins was isolated. The gene was characterized with respect to control of transcription by abscisic acid (ABA) and the transcriptional activator VP1, which is involved in the ABA-regulated gene expression during late embryo-genesis. A fusion gene (Osem-GUS) consisting of the Osem promoter and the bacterial beta-glucuronidase (GUS) gene was constructed and tested in a transient expression system, using protoplasts derived from a suspension-cultured line of rice cells, for activation by ABA and by co-transfection with an expression vector (35S-Osvp1) for the rice VP1 (OSVP1) cDNA. The expression of Osem-GUS was strongly (40- to 150-fold) activated by externally applied ABA and by over-expression of (OS)VP1. The Osem promoter has three ACGTG-containing sequences, motif A, motif B and motif A', which resemble the abscisic acid-responsive element (ABRE) that was previously identified in the wheat Em and the rice Rab16. There is also a CATGCATG sequence, which is known as the Sph box and is shown to be essential for the regulation by VP1 of the maize anthocyanin regulatory gene C1. Focusing on these sequence elements, various mutant derivatives of the Osem promoter in the transient expression system were assayed. The analysis revealed that motif A functions not only as an ABRE but also as a sequence element required for the regulation by (OS)VP1.
Involvement of a Lipoxygenase-Like Enzyme in Abscisic Acid Biosynthesis 1
Creelman, Robert A.; Bell, Erin; Mullet, John E.
1992-01-01
Several lines of evidence indicate that abscisic acid (ABA) is derived from 9′-cis-neoxanthin or 9′-cis-violaxanthin with xanthoxin as an intermediate. 18O-labeling experiments show incorporation primarily into the side chain carboxyl group of ABA, suggesting that oxidative cleavage occurs at the 11, 12 (11′, 12′) double bond of xanthophylls. Carbon monoxide, a strong inhibitor of heme-containing P-450 monooxygenases, did not inhibit ABA accumulation, suggesting that the oxygenase catalyzing the carotenoid cleavage step did not contain heme. This observation, plus the ability of lipoxygenase to make xanthoxin from violaxanthin, suggested that a lipoxygenase-like enzyme is involved in ABA biosynthesis. To test this idea, the ability of several soybean (Glycine max L.) lipoxygenase inhibitors (5,8,11-eicosatriynoic acid, 5,8,11,14-eicosatetraynoic acid, nordihydroguaiaretic acid, and naproxen) to inhibit stress-induced ABA accumulation in soybean cell culture and soybean seedlings was determined. All lipoxygenase inhibitors significantly inhibited ABA accumulation in response to stress. These results suggest that the in vivo oxidative cleavage reaction involved in ABA biosynthesis requires activity of a nonheme oxygenase having lipoxygenase-like properties. PMID:16668998
Bhardwaj, Pardeep Kumar; Kaur, Jagdeep; Sobti, Ranbir Chander; Ahuja, Paramvir Singh; Kumar, Sanjay
2011-09-01
Lipoxygenase (LOX) catalyses oxygenation of free polyunsaturated fatty acids into oxylipins, and is a critical enzyme of the jasmonate signaling pathway. LOX has been shown to be associated with biotic and abiotic stress responses in diverse plant species, though limited data is available with respect to low temperature and the associated cues. Using rapid amplification of cDNA ends, a full-length cDNA (CjLOX) encoding lipoxygenase was cloned from apical buds of Caragana jubata, a temperate plant species that grows under extreme cold. The cDNA obtained was 2952bp long consisting of an open reading frame of 2610bp encoding 869 amino acids protein. Multiple alignment of the deduced amino acid sequence with those of other plants demonstrated putative LH2/ PLAT domain, lipoxygenase iron binding catalytic domain and lipoxygenase_2 signature sequences. CjLOX exhibited up- and down-regulation of gene expression pattern in response to low temperature (LT), abscisic acid (ABA), methyl jasmonate (MJ) and salicylic acid (SA). Among all the treatments, a strong up-regulation was observed in response to MJ. Data suggests an important role of jasmonate signaling pathway in response to LT in C. jubata. Copyright © 2011 Elsevier B.V. All rights reserved.
Selection and Characterization of Single Stranded DNA Aptamers for the Hormone Abscisic Acid
Gonzalez, Victor M.; Millo, Enrico; Sturla, Laura; Vigliarolo, Tiziana; Bagnasco, Luca; Guida, Lucrezia; D'Arrigo, Cristina; De Flora, Antonio; Salis, Annalisa; Martin, Elena M.; Bellotti, Marta; Zocchi, Elena
2013-01-01
The hormone abscisic acid (ABA) is a small molecule involved in pivotal physiological functions in higher plants. Recently, ABA has been also identified as an endogenous hormone in mammals, regulating different cell functions including inflammatory processes, stem cell expansion, insulin release, and glucose uptake. Aptamers are short, single-stranded (ss) oligonucleotidesable to recognize target molecules with high affinity. The small size of the ABA molecule represented a challenge for aptamer development and the aim of this study was to develop specific anti-ABA DNA aptamers. Biotinylated abscisic acid (bio-ABA) was immobilized on streptavidin-coated magnetic beads. DNA aptamers against bio-ABA were selected with 7 iterative rounds of the systematic evolution of ligands by exponential enrichment method (SELEX), each round comprising incubation of the ABA-binding beads with the ssDNA sequences, DNA elution, electrophoresis, and polymerase chain reaction (PCR) amplification. The PCR product was cloned and sequenced. The binding affinity of several clones was determined using bio-ABA immobilized on streptavidin-coated plates. Aptamer 2 and aptamer 9 showed the highest binding affinity, with dissociation constants values of 0.98±0.14 μM and 0.80±0.07 μM, respectively. Aptamers 2 and 9 were also able to bind free, unmodified ABA and to discriminate between different ABA enantiomers and isomers. Our findings indicate that ssDNA aptamers can selectively bind ABA and could be used for the development of ABA quantitation assays. PMID:23971905
Wang, Shun; Li, Wei; Chang, Keke; Liu, Juan; Guo, Qingqian; Sun, Haifeng; Jiang, Min; Zhang, Hao; Chen, Jing
2017-01-01
Abscisic acid (ABA) plays an important role in abiotic stress response and physiological signal transduction resisting to the adverse environment. Therefore, it is very essential for the quantitative detection of abscisic acid (ABA) due to its indispensable role in plant physiological activities. Herein, a new detection method based on localized surface plasmon resonance (LSPR) using aptamer-functionalized gold nanoparticles (AuNPs) is developed without using expensive instrument and antibody. In the presence of ABA, ABA specifically bind with their aptamers to form the ABA-aptamer complexes with G-quadruplex-like structure and lose the ability to stabilize AuNPs against NaCl-induced aggregation. Meanwhile, the changes of the LSPR spectra of AuNP solution occur and therefore the detection of ABA achieved. Under optimized conditions, this method showed a good linear range covering from 5×10−7 M to 5×10−5 M with a detection limit of 0.33 μM. In practice, the usage of this novel method has been demonstrated by its application to detect ABA from fresh leaves of rice with the relative error of 6.59%-7.93% compared with ELISA bioassay. The experimental results confirmed that this LSPR-based biosensor is simple, selective and sensitive for the detection of ABA. The proposed LSPR method could offer a new analytical platform for the detection of other plant hormones by changing the corresponding aptamer. PMID:28953934
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yotsui, Izumi, E-mail: izumi.yotsui@riken.jp; Serada, Satoshi, E-mail: serada@nibiohn.go.jp; Naka, Tetsuji, E-mail: tnaka@nibiohn.go.jp
2016-03-18
Desiccation tolerance is an ancestral feature of land plants and is still retained in non-vascular plants such as bryophytes and some vascular plants. However, except for seeds and spores, this trait is absent in vegetative tissues of vascular plants. Although many studies have focused on understanding the molecular basis underlying desiccation tolerance using transcriptome and proteome approaches, the critical molecular differences between desiccation tolerant plants and non-desiccation plants are still not clear. The moss Physcomitrella patens cannot survive rapid desiccation under laboratory conditions, but if cells of the protonemata are treated by the phytohormone abscisic acid (ABA) prior to desiccation,more » it can survive 24 h exposure to desiccation and regrow after rehydration. The desiccation tolerance induced by ABA (AiDT) is specific to this hormone, but also depends on a plant transcription factor ABSCISIC ACID INSENSITIVE3 (ABI3). Here we report the comparative proteomic analysis of AiDT between wild type and ABI3 deleted mutant (Δabi3) of P. patens using iTRAQ (Isobaric Tags for Relative and Absolute Quantification). From a total of 1980 unique proteins that we identified, only 16 proteins are significantly altered in Δabi3 compared to wild type after desiccation following ABA treatment. Among this group, three of the four proteins that were severely affected in Δabi3 tissue were Arabidopsis orthologous genes, which were expressed in maturing seeds under the regulation of ABI3. These included a Group 1 late embryogenesis abundant (LEA) protein, a short-chain dehydrogenase, and a desiccation-related protein. Our results suggest that at least three of these proteins expressed in desiccation tolerant cells of both Arabidopsis and the moss are very likely to play important roles in acquisition of desiccation tolerance in land plants. Furthermore, our results suggest that the regulatory machinery of ABA- and ABI3-mediated gene expression for
DOE Office of Scientific and Technical Information (OSTI.GOV)
Du, Z.; Aghoram, K.; Outlaw, W.H. Jr.
Plants regulate water loss and CO{sub 2} gain by modulating the aperture sizes of stomata that penetrate the epidermis. Aperture size itself is increased by osmolyte accumulation and consequent turgor increase in the pair of guard cells that flank each stoma. Guard-cell phosphoenolpyruvate carboxylase, which catalyzes the regulated step leading to malate synthesis, is crucial for charge and pH maintenance during osmolyte accumulation. Regulation of this cytosolic enzyme by effectors is well documented, but additional regulation by posttranslational modification is predicted by the alteration of PEPC kinetics during stomatal opening. In this study, the authors have investigated whether this alterationmore » is associated with the phosphorylation status of this enzyme. Using sonicated epidermal peels (isolated guard cells) pre-loaded with {sub 32}PO{sub 4}, the authors induced stomatal opening and guard-cell malate accumulation by incubation with 5 {micro}M fusicoccin (FC). In corroboratory experiments, guard cells were incubated with 5 {micro}M fusicoccin (FC). In corroboratory experiments, guard cells were incubated with the FC antagonist, 10 {micro}M abscisic acid (ABA). The phosphorylation status of PEPC was assessed by immunoprecipitation, electrophoresis, immunoblotting, and autoradiography. PEPC was phosphorylated when stomata were stimulated to open, and phosphorylation was lessened by incubation with ABA.« less
NASA Astrophysics Data System (ADS)
Meguro, Ayano; Sato, Yutaka
2014-04-01
We analysed effects of abscisic acid (ABA, a negative regulatory hormone), alone and in combination with positive or neutral hormones, including salicylic acid (SA), on rice growth and expression of cell cycle-related genes. ABA significantly inhibited shoot growth and induced expression of OsKRP4, OsKRP5, and OsKRP6. A yeast two-hybrid assay showed that OsKRP4, OsKRP5, and OsKRP6 interacted with OsCDKA;1 and/or OsCDKA;2. When SA was simultaneously supplied with ABA, the antagonistic effect of SA completely blocked ABA inhibition. SA also blocked ABA inhibition of DNA replication and thymidine incorporation in the shoot apical meristem. These results suggest that ABA arrests cell cycle progression by inducing expression of OsKRP4, OsKRP5, and OsKRP6, which inhibit the G1/S transition, and that SA antagonizes ABA by blocking expression of OsKRP genes.
Abscisic Acid and abiotic stress signaling.
Tuteja, Narendra
2007-05-01
Abiotic stress is severe environmental stress, which impairs crop production on irrigated land worldwide. Overall, the susceptibility or tolerance to the stress in plants is a coordinated action of multiple stress responsive genes, which also cross-talk with other components of stress signal transduction pathways. Plant responses to abiotic stress can be determined by the severity of the stress and by the metabolic status of the plant. Abscisic acid (ABA) is a phytohormone critical for plant growth and development and plays an important role in integrating various stress signals and controlling downstream stress responses. Plants have to adjust ABA levels constantly in responce to changing physiological and environmental conditions. To date, the mechanisms for fine-tuning of ABA levels remain elusive. The mechanisms by which plants respond to stress include both ABA-dependent and ABA-independent processes. Various transcription factors such as DREB2A/2B, AREB1, RD22BP1 and MYC/MYB are known to regulate the ABA-responsive gene expression through interacting with their corrosponding cis-acting elements such as DRE/CRT, ABRE and MYCRS/MYBRS, respectively. Understanding these mechanisms is important to improve stress tolerance in crops plants. This article first describes the general pathway for plant stress response followed by roles of ABA and transcription factors in stress tolerance including the regulation of ABA biosynthesis.
Abscisic Acid and Abiotic Stress Signaling
2007-01-01
Abiotic stress is severe environmental stress, which impairs crop production on irrigated land worldwide. Overall, the susceptibility or tolerance to the stress in plants is a coordinated action of multiple stress responsive genes, which also cross-talk with other components of stress signal transduction pathways. Plant responses to abiotic stress can be determined by the severity of the stress and by the metabolic status of the plant. Abscisic acid (ABA) is a phytohormone critical for plant growth and development and plays an important role in integrating various stress signals and controlling downstream stress responses. Plants have to adjust ABA levels constantly in responce to changing physiological and environmental conditions. To date, the mechanisms for fine-tuning of ABA levels remain elusive. The mechanisms by which plants respond to stress include both ABA-dependent and ABA-independent processes. Various transcription factors such as DREB2A/2B, AREB1, RD22BP1 and MYC/MYB are known to regulate the ABA-responsive gene expression through interacting with their corrosponding cis-acting elements such as DRE/CRT, ABRE and MYCRS/MYBRS, respectively. Understanding these mechanisms is important to improve stress tolerance in crops plants. This article first describes the general pathway for plant stress response followed by roles of ABA and transcription factors in stress tolerance including the regulation of ABA biosynthesis. PMID:19516981
Tougane, Ken; Komatsu, Kenji; Bhyan, Salma Begum; Sakata, Yoichi; Ishizaki, Kimitsune; Yamato, Katsuyuki T.; Kohchi, Takayuki; Takezawa, Daisuke
2010-01-01
Abscisic acid (ABA) is postulated to be a ubiquitous hormone that plays a central role in seed development and responses to environmental stresses of vascular plants. However, in liverworts (Marchantiophyta), which represent the oldest extant lineage of land plants, the role of ABA has been least emphasized; thus, very little information is available on the molecular mechanisms underlying ABA responses. In this study, we isolated and characterized MpABI1, an ortholog of ABSCISIC ACID INSENSITIVE1 (ABI1), from the liverwort Marchantia polymorpha. The MpABI1 cDNA encoded a 568-amino acid protein consisting of the carboxy-terminal protein phosphatase 2C (PP2C) domain and a novel amino-terminal regulatory domain. The MpABI1 transcript was detected in the gametophyte, and its expression level was increased by exogenous ABA treatment in the gemma, whose growth was strongly inhibited by ABA. Experiments using green fluorescent protein fusion constructs indicated that MpABI1 was mainly localized in the nucleus and that its nuclear localization was directed by the amino-terminal domain. Transient overexpression of MpABI1 in M. polymorpha and Physcomitrella patens cells resulted in suppression of ABA-induced expression of the wheat Em promoter fused to the β -glucuronidase gene. Transgenic P. patens expressing MpABI1 and its mutant construct, MpABI1-d2, lacking the amino-terminal domain, had reduced freezing and osmotic stress tolerance, and associated with reduced accumulation of ABA-induced late embryogenesis abundant-like boiling-soluble proteins. Furthermore, ABA-induced morphological changes leading to brood cells were not prominent in these transgenic plants. These results suggest that MpABI1 is a negative regulator of ABA signaling, providing unequivocal molecular evidence of PP2C-mediated ABA response mechanisms functioning in liverworts. PMID:20097789
Morrison, Erin N; Knowles, Sarah; Hayward, Allison; Thorn, R Greg; Saville, Barry J; Emery, R J N
2015-01-01
The phytohormones, abscisic acid and cytokinin, once were thought to be present uniquely in plants, but increasing evidence suggests that these hormones are present in a wide variety of organisms. Few studies have examined fungi for the presence of these "plant" hormones or addressed whether their levels differ based on the nutrition mode of the fungus. This study examined 20 temperate forest fungi of differing nutritional modes (ectomycorrhizal, wood-rotting, saprotrophic). Abscisic acid and cytokinin were present in all fungi sampled; this indicated that the sampled fungi have the capacity to synthesize these two classes of phytohormones. Of the 27 cytokinins analyzed by HPLC-ESI MS/MS, seven were present in all fungi sampled. This suggested the existence of a common cytokinin metabolic pathway in fungi that does not vary among different nutritional modes. Predictions regarding the source of isopentenyl, cis-zeatin and methylthiol CK production stemming from the tRNA degradation pathway among fungi are discussed. © 2015 by The Mycological Society of America.
Amiguet-Vercher, Amélia; Santuari, Luca; Gonzalez-Guzman, Miguel; Depuydt, Stephen; Rodriguez, Pedro L; Hardtke, Christian S
2015-02-01
Natural genetic variation is crucial for adaptability of plants to different environments. Seed dormancy prevents precocious germination in unsuitable conditions and is an adaptation to a major macro-environmental parameter, the seasonal variation in temperature and day length. Here we report the isolation of IBO, a quantitative trait locus (QTL) that governs c. 30% of germination rate variance in an Arabidopsis recombinant inbred line (RIL) population derived from the parental accessions Eilenburg-0 (Eil-0) and Loch Ness-0 (Lc-0). IBO encodes an uncharacterized phosphatase 2C-related protein, but neither the Eil-0 nor the Lc-0 variant, which differ in a single amino acid, have any appreciable phosphatase activity in in vitro assays. However, we found that the amino acid change in the Lc-0 variant of the IBO protein confers reduced germination rate. Moreover, unlike the Eil-0 variant of the protein, the Lc-0 variant can interfere with the activity of the phosphatase 2C ABSCISIC ACID INSENSITIVE 1 in vitro. This suggests that the Lc-0 variant possibly interferes with abscisic acid signaling, a notion that is supported by physiological assays. Thus, we isolated an example of a QTL allele with a nonsynonymous amino acid change that might mediate local adaptation of seed germination timing. © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.
Abscisic acid perception and signaling: structural mechanisms and applications
Ng, Ley Moy; Melcher, Karsten; Teh, Bin Tean; Xu, H Eric
2014-01-01
Adverse environmental conditions are a threat to agricultural yield and therefore exert a global effect on livelihood, health and the economy. Abscisic acid (ABA) is a vital plant hormone that regulates abiotic stress tolerance, thereby allowing plants to cope with environmental stresses. Previously, attempts to develop a complete understanding of the mechanisms underlying ABA signaling have been hindered by difficulties in the identification of bona fide ABA receptors. The discovery of the PYR/PYL/RCAR family of ABA receptors therefore represented a major milestone in the effort to overcome these roadblocks; since then, many structural and functional studies have provided detailed insights into processes ranging from ABA perception to the activation of ABA-responsive gene transcription. This understanding of the mechanisms of ABA perception and signaling has served as the basis for recent, preliminary developments in the genetic engineering of stress-resistant crops as well as in the design of new synthetic ABA agonists, which hold great promise for the agricultural enhancement of stress tolerance. PMID:24786231
Cheng, Zhi Juan; Zhao, Xiang Yu; Shao, Xing Xing; Wang, Fei; Zhou, Chao; Liu, Ying Gao; Zhang, Yan; Zhang, Xian Sheng
2014-01-01
Seed development includes an early stage of endosperm proliferation and a late stage of embryo growth at the expense of the endosperm in Arabidopsis thaliana. Abscisic acid (ABA) has known functions during late seed development, but its roles in early seed development remain elusive. In this study, we report that ABA-deficient mutants produced seeds with increased size, mass, and embryo cell number but delayed endosperm cellularization. ABSCISIC ACID DEFICIENT2 (ABA2) encodes a unique short-chain dehydrogenase/reductase that functions in ABA biosynthesis, and its expression pattern overlaps that of SHORT HYPOCOTYL UNDER BLUE1 (SHB1) during seed development. SHB1 RNA accumulation was significantly upregulated in the aba2-1 mutant and was downregulated by the application of exogenous ABA. Furthermore, RNA accumulation of the basic/region leucine zipper transcription factor ABSCISIC ACID-INSENSITIVE5 (ABI5), involved in ABA signaling, was decreased in aba2-1. Consistent with this, seed size was also increased in abi5. We further show that ABI5 directly binds to two discrete regions in the SHB1 promoter. Our results suggest that ABA negatively regulates SHB1 expression, at least in part, through the action of its downstream signaling component ABI5. Our findings provide insights into the molecular mechanisms by which ABA regulates early seed development. PMID:24619610
Arabidopsis YAK1 regulates abscisic acid response and drought resistance.
Kim, Dongjin; Ntui, Valentine Otang; Xiong, Liming
2016-07-01
Abscisic acid (ABA) is an important phytohormone that controls several plant processes such as seed germination, seedling growth, and abiotic stress response. Here, we report that AtYak1 plays an important role in ABA signaling and postgermination growth in Arabidopsis. AtYak1 knockout mutant plants were hyposensitive to ABA inhibition of seed germination, cotyledon greening, seedling growth, and stomatal movement. atyak1-1 mutant plants display reduced drought stress resistance, as evidenced by water loss rate and survival rate. Molecular genetic analysis revealed that AtYak1 deficiency led to elevated expression of stomatal-related gene, MYB60, and down-regulation of several stress-responsive genes. Altogether, these results indicate that AtYak1 plays a role as a positive regulator in ABA-mediated drought response in Arabidopsis. © 2016 Federation of European Biochemical Societies.
Abscisic acid and other plant hormones: Methods to visualize distribution and signaling
Waadt, Rainer; Hsu, Po-Kai; Schroeder, Julian I.
2015-01-01
The exploration of plant behavior on a cellular scale in a minimal invasive manner is key to understanding plant adaptations to their environment. Plant hormones regulate multiple aspects of growth and development and mediate environmental responses to ensure a successful life cycle. To monitor the dynamics of plant hormone actions in intact tissue, we need qualitative and quantitative tools with high temporal and spatial resolution. Here, we describe a set of biological instruments (reporters) for the analysis of the distribution and signaling of various plant hormones. Furthermore, we provide examples of their utility for gaining novel insights into plant hormone action with a deeper focus on the drought hormone abscisic acid. PMID:26577078
Liao, Yongxiang; Bai, Que; Xu, Peizhou; Wu, Tingkai; Guo, Daiming; Peng, Yongbin; Zhang, Hongyu; Deng, Xiaoshu; Chen, Xiaoqiong; Luo, Ming; Ali, Asif; Wang, Wenming; Wu, Xianjun
2018-01-01
Lesion mimic mutants display spontaneous cell death, and thus are valuable for understanding the molecular mechanism of cell death and disease resistance. Although a lot of such mutants have been characterized in rice, the relationship between lesion formation and abscisic acid (ABA) synthesis pathway is not reported. In the present study, we identified a rice mutant, lesion mimic mutant 9150 (lmm9150), exhibiting spontaneous cell death, pre-harvest sprouting, enhanced growth, and resistance to rice bacterial and blast diseases. Cell death in the mutant was accompanied with excessive accumulation of H2O2. Enhanced disease resistance was associated with cell death and upregulation of defense-related genes. Map-based cloning identified a G-to-A point mutation resulting in a D-to-N substitution at the amino acid position 110 of OsABA2 (LOC_Os03g59610) in lmm9150. Knock-out of OsABA2 through CRISPR/Cas9 led to phenotypes similar to those of lmm9150. Consistent with the function of OsABA2 in ABA biosynthesis, ABA level in the lmm9150 mutant was significantly reduced. Moreover, exogenous application of ABA could rescue all the mutant phenotypes of lmm9150. Taken together, our data linked ABA deficiency to cell death and provided insight into the role of ABA in rice disease resistance. PMID:29643863
Liao, Yongxiang; Bai, Que; Xu, Peizhou; Wu, Tingkai; Guo, Daiming; Peng, Yongbin; Zhang, Hongyu; Deng, Xiaoshu; Chen, Xiaoqiong; Luo, Ming; Ali, Asif; Wang, Wenming; Wu, Xianjun
2018-01-01
Lesion mimic mutants display spontaneous cell death, and thus are valuable for understanding the molecular mechanism of cell death and disease resistance. Although a lot of such mutants have been characterized in rice, the relationship between lesion formation and abscisic acid (ABA) synthesis pathway is not reported. In the present study, we identified a rice mutant, lesion mimic mutant 9150 ( lmm9150 ), exhibiting spontaneous cell death, pre-harvest sprouting, enhanced growth, and resistance to rice bacterial and blast diseases. Cell death in the mutant was accompanied with excessive accumulation of H 2 O 2 . Enhanced disease resistance was associated with cell death and upregulation of defense-related genes. Map-based cloning identified a G-to-A point mutation resulting in a D-to-N substitution at the amino acid position 110 of OsABA2 (LOC_Os03g59610) in lmm9150 . Knock-out of OsABA2 through CRISPR/Cas9 led to phenotypes similar to those of lmm9150 . Consistent with the function of OsABA2 in ABA biosynthesis, ABA level in the lmm9150 mutant was significantly reduced. Moreover, exogenous application of ABA could rescue all the mutant phenotypes of lmm9150 . Taken together, our data linked ABA deficiency to cell death and provided insight into the role of ABA in rice disease resistance.
Enhancing tolerance of rice (Oryza sativa) to simulated acid rain by exogenous abscisic acid.
Wu, Xi; Liang, Chanjuan
2017-02-01
Abscisic acid (ABA) regulates much important plant physiological and biochemical processes and induces tolerance to different stresses. Here, we studied the regulation of exogenous ABA on adaptation of rice seedlings to simulated acid rain (SAR) stress by measuring biomass dry weight, stomatal conductance, net photosynthesis rate, nutrient elements, and endogenous hormones. The application of 10 μM ABA alleviated the SAR-induced inhibition on growth, stomatal conductance, net photosynthesis rate, and decreases in contents of nutrient (K, Mg, N, and P) and hormone (auxin, gibberellins, and zeatin). Moreover, 10 μM ABA could stimulate the Ca content as signaling molecules under SAR stress. Contrarily, the application of 100 μM ABA aggravated the SAR-induced inhibition on growth, stomatal conductance, net photosynthesis rate, and contents of nutrient and hormone. The results got after a 5-day recovery (without SAR) show that exogenous 10 μM ABA can promote self-restoration process in rice whereas 100 μM ABA hindered the restoration by increasing deficiency of nutrients and disturbing the balance of hormones. These results confirmed that exogenous ABA at proper concentration could enhance the tolerance of rice to SAR stress.
Zhou, Xiaona; Hao, Hongmei; Zhang, Yuguo; Bai, Yili; Zhu, Wenbo; Qin, Yunxia; Yuan, Feifei; Zhao, Feiyi; Wang, Mengyao; Hu, Jingjiang; Xu, Hong; Guo, Aiguang; Zhao, Huixian; Zhao, Yang; Cao, Cuiling; Yang, Yongqing; Schumaker, Karen S.; Guo, Yan; Xie, Chang Gen
2015-01-01
Abscisic acid (ABA) plays an essential role in seed germination. In this study, we demonstrate that one SNF1-RELATED PROTEIN KINASE3-type protein kinase, SOS2-LIKE PROTEIN KINASE5 (PKS5), is involved in ABA signal transduction via the phosphorylation of an interacting protein, ABSCISIC ACID-INSENSITIVE5 (ABI5). We found that pks5-3 and pks5-4, two previously identified PKS5 superactive kinase mutants with point mutations in the PKS5 FISL/NAF (a conserved peptide that is necessary for interaction with SOS3 or SOS3-LIKE CALCIUM BINDING PROTEINs) motif and the kinase domain, respectively, are hypersensitive to ABA during seed germination. PKS5 was found to interact with ABI5 in yeast (Saccharomyces cerevisiae), and this interaction was further confirmed in planta using bimolecular fluorescence complementation. Genetic studies revealed that ABI5 is epistatic to PKS5. PKS5 phosphorylates a serine (Ser) residue at position 42 in ABI5 and regulates ABA-responsive gene expression. This phosphorylation was induced by ABA in vivo and transactivated ABI5. Expression of ABI5, in which Ser-42 was mutated to alanine, could not fully rescue the ABA-insensitive phenotypes of the abi5-8 and pks5-4abi5-8 mutants. In contrast, mutating Ser-42 to aspartate rescued the ABA insensitivity of these mutants. These data demonstrate that PKS5-mediated phosphorylation of ABI5 at Ser-42 is critical for the ABA regulation of seed germination and gene expression in Arabidopsis (Arabidopsis thaliana). PMID:25858916
Liang, Zongsuo; Ma, Yini; Xu, Tao; Cui, Beimi; Liu, Yan; Guo, Zhixin; Yang, Dongfeng
2013-01-01
Salvia miltiorrhiza is one of the most important traditional Chinese medicinal plants because of its excellent performance in treating coronary heart disease. Phenolic acids mainly including caffeic acid, rosmarinic acid and salvianolic acid B are a group of active ingredients in S. miltiorrhiza. Abscisic acid (ABA), gibberellin (GA) and ethylene are three important phytohormones. In this study, effects of the three phytohormones and their interactions on phenolic production in S. miltiorrhiza hairy roots were investigated. The results showed that ABA, GA and ethylene were all effective to induce production of phenolic acids and increase activities of PAL and TAT in S. miltiorrhiza hairy roots. Effects of phytohormones were reversed by their biosynthetic inhibitors. Antagonistic actions between the three phytohormones played important roles in the biosynthesis of phenolic acids. GA signaling is necessary for ABA and ethylene-induced phenolic production. Yet, ABA and ethylene signaling is probably not necessary for GA3-induced phenolic production. The complex interactions of phytohormones help us reveal regulation mechanism of secondary metabolism and scale-up production of active ingredients in plants.
Xu, Tao; Cui, Beimi; Liu, Yan; Guo, Zhixin; Yang, Dongfeng
2013-01-01
Salvia miltiorrhiza is one of the most important traditional Chinese medicinal plants because of its excellent performance in treating coronary heart disease. Phenolic acids mainly including caffeic acid, rosmarinic acid and salvianolic acid B are a group of active ingredients in S. miltiorrhiza. Abscisic acid (ABA), gibberellin (GA) and ethylene are three important phytohormones. In this study, effects of the three phytohormones and their interactions on phenolic production in S. miltiorrhiza hairy roots were investigated. The results showed that ABA, GA and ethylene were all effective to induce production of phenolic acids and increase activities of PAL and TAT in S. miltiorrhiza hairy roots. Effects of phytohormones were reversed by their biosynthetic inhibitors. Antagonistic actions between the three phytohormones played important roles in the biosynthesis of phenolic acids. GA signaling is necessary for ABA and ethylene-induced phenolic production. Yet, ABA and ethylene signaling is probably not necessary for GA3-induced phenolic production. The complex interactions of phytohormones help us reveal regulation mechanism of secondary metabolism and scale-up production of active ingredients in plants. PMID:24023778
Zhou, Nan; Yao, Yu; Ye, Hongxing; Zhu, Wei; Chen, Liang; Mao, Ying
2016-04-15
Retinoid acid (RA) plays critical roles in regulating differentiation and apoptosis in a variety of cancer cells. Abscisic acid (ABA) and RA are direct derivatives of carotenoids and share structural similarities. Here we proposed that ABA may also play a role in cellular differentiation and apoptosis by sharing a similar signaling pathway with RA that may be involved in glioma pathogenesis. We reported for the first time that the ABA levels were twofold higher in low-grade gliomas compared with high-grade gliomas. In glioma tissues, there was a positive correlation between the ABA levels and the transcription of cellular retinoic acid-binding protein 2 (CRABP2) and a negative correlation between the ABA levels and transcription of fatty acid-binding protein 5 (FABP5). ABA treatment induced a significant increase in the expression of CRABP2 and a decrease in the expression of peroxisome proliferator-activated receptor (PPAR) in glioblastoma cells. Remarkably, both cellular apoptosis and differentiation were increased in the glioblastoma cells after ABA treatment. ABA-induced cellular apoptosis and differentiation were significantly reduced by selectively silencing RAR-α, while RAR-α overexpression exaggerated the ABA-induced effects. These results suggest that ABA may play a role in the pathogenesis of glioma by promoting cellular apoptosis and differentiation through the RA signaling pathway. © 2015 UICC.
Stingl, Nadja; Krischke, Markus; Fekete, Agnes; Mueller, Martin J
2013-01-01
Defense signaling compounds and phytohormones play an essential role in the regulation of plant responses to various environmental abiotic and biotic stresses. Among the most severe stresses are herbivory, pathogen infection, and drought stress. The major hormones involved in the regulation of these responses are 12-oxo-phytodienoic acid (OPDA), the pro-hormone jasmonic acid (JA) and its biologically active isoleucine conjugate (JA-Ile), salicylic acid (SA), and abscisic acid (ABA). These signaling compounds are present and biologically active at very low concentrations from ng/g to μg/g dry weight. Accurate and sensitive quantification of these signals has made a significant contribution to the understanding of plant stress responses. Ultra-performance liquid chromatography (UPLC) coupled with a tandem quadrupole mass spectrometer (MS/MS) has become an essential technique for the analysis and quantification of these compounds.
González-Villagra, Jorge; Kurepin, Leonid V; Reyes-Díaz, Marjorie M
2017-08-01
ABA is involved in anthocyanin synthesis through the regulation of microRNA156, augmenting the level of expression of anthocyanin synthesis-related genes and, therefore, increasing anthocyanin level. Drought stress is the main cause of agricultural crop loss in the world. However, plants have developed mechanisms that allow them to tolerate drought stress conditions. At cellular level, drought stress induces changes in metabolite accumulation, including increases in anthocyanin levels due to upregulation of the anthocyanin biosynthetic pathway. Recent studies suggest that the higher anthocyanin content observed under drought stress conditions could be a consequence of a rise in the abscisic acid (ABA) concentration. This plant hormone crosses the plasma membrane by specific transporters, and it is recognized at the cytosolic level by receptors known as pyrabactin resistance (PYR)/regulatory component of ABA receptors (PYR/RCARs) that regulate downstream components. In this review, we discuss the hypothesis regarding the involvement of ABA in the regulation of microRNA156 (miRNA156), which is upregulated as part of dehydration stress responsiveness in different species. The miRNA156 upregulation produces a greater level of anthocyanin gene expression, forming the multienzyme complex that will synthesize an increased level of anthocyanins at the cytosolic face of the rough endoplasmic reticulum (RER). After synthesis, anthocyanins are transported from the RER to the vacuole by two possible models of transport: (1) membrane vesicle-mediated transport, or (2) membrane transporter-mediated transport. Thus, the aim was to analyze the recent findings on synthesis, transport and the possible mechanism by which ABA could increase anthocyanin synthesis under drought stress conditions potentially throughout microRNA156 (miRNA156).
Qi, Baoxiu
2014-01-01
IgASE1, a C18 Δ9-specific polyunsaturated fatty acid elongase from the marine microalga Isochrysis galbana, is able to convert linoleic acid and α-linolenic acid to eicosadienoic acid and eicosatrienoic acid in Arabidopsis. Eicosadienoic acid and eicosatrienoic acid are precursors of arachidonic acid, eicosapentaenoic acid, and docosahexaenoic acid, which are synthesized via the Δ8 desaturation biosynthetic pathways. This study shows that the IgASE1-expressing transgenic Arabidopsis exhibited altered morphology (decreased leaf area and biomass) and enhanced drought resistance compared to wild-type plants. The transgenic Arabidopsis were hypersensitive to abscisic acid (ABA) during seed germination, post-germination growth, and seedling development. They had elevated leaf ABA levels under well-watered and dehydrated conditions and their stomata were more sensitive to ABA. Exogenous application of eicosadienoic acid and eicosatrienoic acid can mimic ABA and drought responses in the wild type plants, similar to that found in the transgenic ones. The transcript levels of genes involved in the biosynthesis of ABA (NCED3, ABA1, AAO3) as well as other stress-related genes were upregulated in this transgenic line upon osmotic stress (300mM mannitol). Taken together, these results indicate that these two eicosapolyenoic acids or their derived metabolites can mitigate the effects of drought in transgenic Arabidopsis, at least in part, through the action of ABA. PMID:24609499
Yuan, Xiaowei; Li, Yaxiao; Liu, Shiyang; Xia, Fei; Li, Xinzheng; Qi, Baoxiu
2014-04-01
IgASE1, a C₁₈ Δ(9)-specific polyunsaturated fatty acid elongase from the marine microalga Isochrysis galbana, is able to convert linoleic acid and α-linolenic acid to eicosadienoic acid and eicosatrienoic acid in Arabidopsis. Eicosadienoic acid and eicosatrienoic acid are precursors of arachidonic acid, eicosapentaenoic acid, and docosahexaenoic acid, which are synthesized via the Δ(8) desaturation biosynthetic pathways. This study shows that the IgASE1-expressing transgenic Arabidopsis exhibited altered morphology (decreased leaf area and biomass) and enhanced drought resistance compared to wild-type plants. The transgenic Arabidopsis were hypersensitive to abscisic acid (ABA) during seed germination, post-germination growth, and seedling development. They had elevated leaf ABA levels under well-watered and dehydrated conditions and their stomata were more sensitive to ABA. Exogenous application of eicosadienoic acid and eicosatrienoic acid can mimic ABA and drought responses in the wild type plants, similar to that found in the transgenic ones. The transcript levels of genes involved in the biosynthesis of ABA (NCED3, ABA1, AAO3) as well as other stress-related genes were upregulated in this transgenic line upon osmotic stress (300 mM mannitol). Taken together, these results indicate that these two eicosapolyenoic acids or their derived metabolites can mitigate the effects of drought in transgenic Arabidopsis, at least in part, through the action of ABA.
Shoot-derived abscisic acid promotes root growth.
McAdam, Scott A M; Brodribb, Timothy J; Ross, John J
2016-03-01
The phytohormone abscisic acid (ABA) plays a major role in regulating root growth. Most work to date has investigated the influence of root-sourced ABA on root growth during water stress. Here, we tested whether foliage-derived ABA could be transported to the roots, and whether this foliage-derived ABA had an influence on root growth under well-watered conditions. Using both application studies of deuterium-labelled ABA and reciprocal grafting between wild-type and ABA-biosynthetic mutant plants, we show that both ABA levels in the roots and root growth in representative angiosperms are controlled by ABA synthesized in the leaves rather than sourced from the roots. Foliage-derived ABA was found to promote root growth relative to shoot growth but to inhibit the development of lateral roots. Increased root auxin (IAA) levels in plants with ABA-deficient scions suggest that foliage-derived ABA inhibits root growth through the root growth-inhibitor IAA. These results highlight the physiological and morphological importance, beyond the control of stomata, of foliage-derived ABA. The use of foliar ABA as a signal for root growth has important implications for regulating root to shoot growth under normal conditions and suggests that leaf rather than root hydration is the main signal for regulating plant responses to moisture. © 2015 John Wiley & Sons Ltd.
Abscisic Acid and Abiotic Stress Tolerance in Crop Plants
Sah, Saroj K.; Reddy, Kambham R.; Li, Jiaxu
2016-01-01
Abiotic stress is a primary threat to fulfill the demand of agricultural production to feed the world in coming decades. Plants reduce growth and development process during stress conditions, which ultimately affect the yield. In stress conditions, plants develop various stress mechanism to face the magnitude of stress challenges, although that is not enough to protect them. Therefore, many strategies have been used to produce abiotic stress tolerance crop plants, among them, abscisic acid (ABA) phytohormone engineering could be one of the methods of choice. ABA is an isoprenoid phytohormone, which regulates various physiological processes ranging from stomatal opening to protein storage and provides adaptation to many stresses like drought, salt, and cold stresses. ABA is also called an important messenger that acts as the signaling mediator for regulating the adaptive response of plants to different environmental stress conditions. In this review, we will discuss the role of ABA in response to abiotic stress at the molecular level and ABA signaling. The review also deals with the effect of ABA in respect to gene expression. PMID:27200044
Novel Abscisic Acid Antagonists Identified with Chemical Array Screening.
Ito, Takuya; Kondoh, Yasumitsu; Yoshida, Kazuko; Umezawa, Taishi; Shimizu, Takeshi; Shinozaki, Kazuo; Osada, Hiroyuki
2015-11-01
Abscisic acid (ABA) signaling is involved in multiple processes in plants, such as water stress control and seed dormancy. Major regulators of ABA signaling are the PYR/PYL/RCAR family receptor proteins, group A protein phosphatases 2C (PP2Cs), and subclass III of SNF1-related protein kinase 2 (SnRK2). Novel ABA agonists and antagonists to modulate the functions of these proteins would not only contribute to clarification of the signaling mechanisms but might also be used to improve crop yields. To obtain small molecules that interact with Arabidopsis ABA receptor PYR1, we screened 24 275 compounds from a chemical library at the RIKEN Natural Products Depository by using a chemical array platform. Subsequent SnRK2 and PP2C assays narrowed down the candidates to two molecules. One antagonized ABA in a competitive manner and inhibited the formation of the PYR1-ABA-PP2C ternary complex. These compounds might have potential as bioprobes to analyze ABA signaling. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Ye, Nenghui; Zhang, Jianhua
2012-05-01
The antagonism between abscisic acid (ABA) and gibberellin (GA) plays a key role in controlling seed germination, but the mechanism of antagonism during this process is not known. In the associated study, we investigated the relationship among ABA, reactive oxygen species (ROS), ascorbic acid (ASC) and GA during rice seed germination. ROS production is reduced by ABA, which hence results in decreasing ASC accumulation during imbibition. GA accumulation was also suppressed by a reduced ROS and ASC level, whereas application of exogenous ASC can partially rescue seed germination from ABA treatment. Further results show that production of ASC, which acts as a substrate in GA biosynthesis, was significantly inhibited by lycorine which thus suppressed the accumulation of GA. Consequently, expression of GA biosynthesis genes was suppressed by the low levels of ROS and ASC in ABA-treated seeds. These studies reveal a new role for ASC in mediating the antagonism between ABA and GA during seed germination in rice.
Evidence for abscisic acid biosynthesis in Cuscuta reflexa, a parasitic plant lacking neoxanthin.
Qin, Xiaoqiong; Yang, Seung Hwan; Kepsel, Andrea C; Schwartz, Steven H; Zeevaart, Jan A D
2008-06-01
Abscisic acid (ABA) is a plant hormone found in all higher plants; it plays an important role in seed dormancy, embryo development, and adaptation to environmental stresses, most notably drought. The regulatory step in ABA synthesis is the cleavage reaction of a 9-cis-epoxy-carotenoid catalyzed by the 9-cis-epoxy-carotenoid dioxygenases (NCEDs). The parasitic angiosperm Cuscuta reflexa lacks neoxanthin, one of the common precursors of ABA in all higher plants. Thus, is C. reflexa capable of synthesizing ABA, or does it acquire ABA from its host plants? Stem tips of C. reflexa were cultured in vitro and found to accumulate ABA in the absence of host plants. This demonstrates that this parasitic plant is capable of synthesizing ABA. Dehydration of detached stem tips caused a big rise in ABA content. During dehydration, 18O was incorporated into ABA from 18O2, indicating that ABA was synthesized de novo in C. reflexa. Two NCED genes, CrNCED1 and CrNCED2, were cloned from C. reflexa. Expression of CrNCEDs was up-regulated significantly by dehydration. In vitro enzyme assays with recombinant CrNCED1 protein showed that the protein is able to cleave both 9-cis-violaxanthin and 9'-cis-neoxanthin to give xanthoxin. Thus, despite the absence of neoxanthin in C. reflexa, the biochemical activity of CrNCED1 is similar to that of NCEDs from other higher plants. These results provide evidence for conservation of the ABA biosynthesis pathway among members of the plant kingdom.
Cuticle Biosynthesis in Tomato Leaves Is Developmentally Regulated by Abscisic Acid1[OPEN
2017-01-01
The expansion of aerial organs in plants is coupled with the synthesis and deposition of a hydrophobic cuticle, composed of cutin and waxes, which is critically important in limiting water loss. While the abiotic stress-related hormone abscisic acid (ABA) is known to up-regulate wax accumulation in response to drought, the hormonal regulation of cuticle biosynthesis during organ ontogeny is poorly understood. To address the hypothesis that ABA also mediates cuticle formation during organ development, we assessed the effect of ABA deficiency on cuticle formation in three ABA biosynthesis-impaired tomato mutants. The mutant leaf cuticles were thinner, had structural abnormalities, and had a substantial reduction in levels of cutin. ABA deficiency also consistently resulted in differences in the composition of leaf cutin and cuticular waxes. Exogenous application of ABA partially rescued these phenotypes, confirming that they were a consequence of reduced ABA levels. The ABA mutants also showed reduced expression of genes involved in cutin or wax formation. This difference was again countered by exogenous ABA, further indicating regulation of cuticle biosynthesis by ABA. The fruit cuticles were affected differently by the ABA-associated mutations, but in general were thicker. However, no structural abnormalities were observed, and the cutin and wax compositions were less affected than in leaf cuticles, suggesting that ABA action influences cuticle formation in an organ-dependent manner. These results suggest dual roles for ABA in regulating leaf cuticle formation: one that is fundamentally associated with leaf expansion, independent of abiotic stress, and another that is drought induced. PMID:28483881
Yu, Jingling; Yang, Lei; Liu, Xiaobing; Tang, Renjie; Wang, Yuan; Ge, Haiman; Wu, Mengting; Zhang, Jiang; Zhao, Fugeng; Luan, Sheng; Lan, Wenzhi
2016-01-01
Drought stress is an important environmental factor limiting productivity of plants, especially fast growing species with high water consumption like poplar. Abscisic acid (ABA) is a phytohormone that positively regulates seed dormancy and drought resistance. The PYR1 (Pyrabactin Resistance 1)/ PYRL (PYR-Like)/ RCAR (Regulatory Component of ABA Receptor) (PYR/PYL/RCAR) ABA receptor family has been identified and widely characterized in Arabidopsis thaliana. However, their functions in poplars remain unknown. Here, we report that 2 of 14 PYR/PYL/RCAR orthologues in poplar (Populus trichocarpa) (PtPYRLs) function as a positive regulator of the ABA signal transduction pathway. The Arabidopsis transient expression and yeast two-hybrid assays showed the interaction among PtPYRL1 and PtPYRL5, a clade A protein phosphatase 2C, and a SnRK2, suggesting that a core signalling complex for ABA signaling pathway exists in poplars. Phenotypic analysis of PtPYRL1 and PtPYRL5 transgenic Arabidopsis showed that these two genes positively regulated the ABA responses during the seed germination. More importantly, the overexpression of PtPYRL1 and PtPYRL5 substantially improved ABA sensitivity and drought stress tolerance in transgenic plants. In summary, we comprehensively uncovered the properties of PtPYRL1 and PtPYRL5, which might be good target genes to genetically engineer drought-Resistant plants.
Enoki, Shinichi; Hattori, Tomoki; Ishiai, Shiho; Tanaka, Sayumi; Mikami, Masachika; Arita, Kayo; Nagasaka, Shu; Suzuki, Shunji
2017-12-01
We investigated the effect of vanillylacetone (VA) on anthocyanin accumulation with aim of improving grape berry coloration. Spraying Vitis vinifera cv. Muscat Bailey A berries with VA at veraison increased sugar/acid ratio, an indicator of maturation and total anthocyanin accumulation. To elucidate the molecular mechanism underlying the effect of VA on anthocyanin accumulation, in vitro VA treatment of a grapevine cell culture was carried out. Endogenous abscisic acid (ABA) content was higher in the VA-treated cell cultures than in control at 3h after treatment. Consistent with this, the relative expression levels of anthocyanin-synthesis-related genes, including DFR, LDOX, MybA1 and UFGT, in VA-treated cell cultures were much higher than those in control, and high total anthocyanin accumulation was noted in the VA-treated cell cultures as well. These results suggest that VA up-regulates the expression of genes leading to anthocyanin accumulation by inducing endogenous ABA. In addition, VA increased total anthocyanin content in a dose-dependent manner. Although VA treatment in combination with exogenous ABA did not exhibit any synergistic effect, treatment with VA alone showed an equivalent effect to that with exogenous ABA alone on total anthocyanin accumulation. These findings point to the possibility of using VA for improving grape berry coloration. Copyright © 2017 Elsevier GmbH. All rights reserved.
Abscisic acid and pyrabactin improve vitamin C contents in raspberries.
Miret, Javier A; Munné-Bosch, Sergi
2016-07-15
Abscisic acid (ABA) is a plant growth regulator with roles in senescence, fruit ripening and environmental stress responses. ABA and pyrabactin (a non-photosensitive ABA agonist) effects on red raspberry (Rubus idaeus L.) fruit development (including ripening) were studied, with a focus on vitamin and antioxidant composition. Application of ABA and/or pyrabactin just after fruit set did not affect the temporal pattern of fruit development and ripening; neither provitamin A (carotenoids) nor vitamin E contents were modified. In contrast, ABA and pyrabactin altered the vitamin C redox state at early stages of fruit development and more than doubled vitamin C contents at the end of fruit ripening. These were partially explained by changes in ascorbate oxidation and recycling. Therefore, ABA and pyrabactin applications may be used to increase vitamin C content of ripe fruits, increasing fruit quality and value. However, treatments containing pyrabactin-combined with ABA or alone-diminished protein content, thus partially limiting its potential applicability. Copyright © 2016 Elsevier Ltd. All rights reserved.
A Central Role of Abscisic Acid in Stress-Regulated Carbohydrate Metabolism
Kempa, Stefan; Krasensky, Julia; Dal Santo, Silvia; Kopka, Joachim; Jonak, Claudia
2008-01-01
Background Abiotic stresses adversely affect plant growth and development. The hormone abscisic acid (ABA) plays a central role in the response and adaptation to environmental constraints. However, apart from the well established role of ABA in regulating gene expression programmes, little is known about its function in plant stress metabolism. Principal Findings Using an integrative multiparallel approach of metabolome and transcriptome analyses, we studied the dynamic response of the model glyophyte Arabidopsis thaliana to ABA and high salt conditions. Our work shows that salt stress induces complex re-adjustment of carbohydrate metabolism and that ABA triggers the initial steps of carbon mobilisation. Significance These findings open new perspectives on how high salinity and ABA impact on central carbohydrate metabolism and highlight the power of iterative combinatorial approaches of non-targeted and hypothesis-driven experiments in stress biology. PMID:19081841
Guo, Huijuan; Sun, Yucheng; Peng, Xinhong; Wang, Qinyang; Harris, Marvin; Ge, Feng
2016-02-01
The activation of the abscisic acid (ABA) signaling pathway reduces water loss from plants challenged by drought stress. The effect of drought-induced ABA signaling on the defense and nutrition allocation of plants is largely unknown. We postulated that these changes can affect herbivorous insects. We studied the effects of drought on different feeding stages of pea aphids in the wild-type A17 of Medicago truncatula and ABA signaling pathway mutant sta-1. We examined the impact of drought on plant water status, induced plant defense signaling via the abscisic acid (ABA), jasmonic acid (JA), and salicylic acid (SA) pathways, and on the host nutritional quality in terms of leaf free amino acid content. During the penetration phase of aphid feeding, drought decreased epidermis/mesophyll resistance but increased mesophyll/phloem resistance of A17 but not sta-1 plants. Quantification of transcripts associated with ABA, JA and SA signaling indicated that the drought-induced up-regulation of ABA signaling decreased the SA-dependent defense but increased the JA-dependent defense in A17 plants. During the phloem-feeding phase, drought had little effect on the amino acid concentrations and the associated aphid phloem-feeding parameters in both plant genotypes. In the xylem absorption stage, drought decreased xylem absorption time of aphids in both genotypes because of decreased water potential. Nevertheless, the activation of the ABA signaling pathway increased water-use efficiency of A17 plants by decreasing the stomatal aperture and transpiration rate. In contrast, the water potential of sta-1 plants (unable to close stomata) was too low to support xylem absorption activity of aphids; the aphids on sta-1 plants had the highest hemolymph osmolarity and lowest abundance under drought conditions. Taken together this study illustrates the significance of cross-talk between biotic-abiotic signaling pathways in plant-aphid interaction, and reveals the mechanisms leading to alter
Guo, Huijuan; Sun, Yucheng; Peng, Xinhong; Wang, Qinyang; Harris, Marvin; Ge, Feng
2016-01-01
The activation of the abscisic acid (ABA) signaling pathway reduces water loss from plants challenged by drought stress. The effect of drought-induced ABA signaling on the defense and nutrition allocation of plants is largely unknown. We postulated that these changes can affect herbivorous insects. We studied the effects of drought on different feeding stages of pea aphids in the wild-type A17 of Medicago truncatula and ABA signaling pathway mutant sta-1. We examined the impact of drought on plant water status, induced plant defense signaling via the abscisic acid (ABA), jasmonic acid (JA), and salicylic acid (SA) pathways, and on the host nutritional quality in terms of leaf free amino acid content. During the penetration phase of aphid feeding, drought decreased epidermis/mesophyll resistance but increased mesophyll/phloem resistance of A17 but not sta-1 plants. Quantification of transcripts associated with ABA, JA and SA signaling indicated that the drought-induced up-regulation of ABA signaling decreased the SA-dependent defense but increased the JA-dependent defense in A17 plants. During the phloem-feeding phase, drought had little effect on the amino acid concentrations and the associated aphid phloem-feeding parameters in both plant genotypes. In the xylem absorption stage, drought decreased xylem absorption time of aphids in both genotypes because of decreased water potential. Nevertheless, the activation of the ABA signaling pathway increased water-use efficiency of A17 plants by decreasing the stomatal aperture and transpiration rate. In contrast, the water potential of sta-1 plants (unable to close stomata) was too low to support xylem absorption activity of aphids; the aphids on sta-1 plants had the highest hemolymph osmolarity and lowest abundance under drought conditions. Taken together this study illustrates the significance of cross-talk between biotic-abiotic signaling pathways in plant-aphid interaction, and reveals the mechanisms leading to alter
Rodriguez, Lesia; Gonzalez-Guzman, Miguel; Diaz, Maira; Rodrigues, Americo; Izquierdo-Garcia, Ana C; Peirats-Llobet, Marta; Fernandez, Maria A; Antoni, Regina; Fernandez, Daniel; Marquez, Jose A; Mulet, Jose M; Albert, Armando; Rodriguez, Pedro L
2014-12-01
Membrane-delimited abscisic acid (ABA) signal transduction plays a critical role in early ABA signaling, but the molecular mechanisms linking core signaling components to the plasma membrane are unclear. We show that transient calcium-dependent interactions of PYR/PYL ABA receptors with membranes are mediated through a 10-member family of C2-domain ABA-related (CAR) proteins in Arabidopsis thaliana. Specifically, we found that PYL4 interacted in an ABA-independent manner with CAR1 in both the plasma membrane and nucleus of plant cells. CAR1 belongs to a plant-specific gene family encoding CAR1 to CAR10 proteins, and bimolecular fluorescence complementation and coimmunoprecipitation assays showed that PYL4-CAR1 as well as other PYR/PYL-CAR pairs interacted in plant cells. The crystal structure of CAR4 was solved, which revealed that, in addition to a classical calcium-dependent lipid binding C2 domain, a specific CAR signature is likely responsible for the interaction with PYR/PYL receptors and their recruitment to phospholipid vesicles. This interaction is relevant for PYR/PYL function and ABA signaling, since different car triple mutants affected in CAR1, CAR4, CAR5, and CAR9 genes showed reduced sensitivity to ABA in seedling establishment and root growth assays. In summary, we identified PYR/PYL-interacting partners that mediate a transient Ca(2+)-dependent interaction with phospholipid vesicles, which affects PYR/PYL subcellular localization and positively regulates ABA signaling. © 2014 American Society of Plant Biologists. All rights reserved.
González-Guzmán, Miguel; Abia, David; Salinas, Julio; Serrano, Ramón; Rodríguez, Pedro L.
2004-01-01
The abscisic aldehyde oxidase 3 (AAO3) gene product of Arabidopsis catalyzes the final step in abscisic acid (ABA) biosynthesis. An aao3-1 mutant in a Landsberg erecta genetic background exhibited a wilty phenotype in rosette leaves, whereas seed dormancy was not affected (Seo et al., 2000a). Therefore, it was speculated that a different aldehyde oxidase would be the major contributor to ABA biosynthesis in seeds (Seo et al., 2000a). Through a screening based on germination under high-salt concentration, we isolated two mutants in a Columbia genetic background, initially named sre2-1 and sre2-2 (for salt resistant). Complementation tests with different ABA-deficient mutants indicated that sre2-1 and sre2-2 mutants were allelic to aao3-1, and therefore they were renamed as aao3-2 and aao3-3, respectively. Indeed, molecular characterization of the aao3-2 mutant revealed a T-DNA insertional mutation that abolished the transcription of AAO3 gene, while sequence analysis of AAO3 in aao3-3 mutant revealed a deletion of three nucleotides and several missense mutations. Physiological characterization of aao3-2 and aao3-3 mutants revealed a wilty phenotype and osmotolerance in germination assays. In contrast to aao3-1, both aao3-2 and aao3-3 mutants showed a reduced dormancy. Accordingly, ABA levels were reduced in dry seeds and rosette leaves of both aao3-2 and aao3-3. Taken together, these results indicate that AAO3 gene product plays a major role in seed ABA biosynthesis. PMID:15122034
Rodriguez, Lesia; Diaz, Maira; Rodrigues, Americo; Izquierdo-Garcia, Ana C.; Peirats-Llobet, Marta; Fernandez, Maria A.; Antoni, Regina; Fernandez, Daniel; Marquez, Jose A.; Mulet, Jose M.; Albert, Armando; Rodriguez, Pedro L.
2014-01-01
Membrane-delimited abscisic acid (ABA) signal transduction plays a critical role in early ABA signaling, but the molecular mechanisms linking core signaling components to the plasma membrane are unclear. We show that transient calcium-dependent interactions of PYR/PYL ABA receptors with membranes are mediated through a 10-member family of C2-domain ABA-related (CAR) proteins in Arabidopsis thaliana. Specifically, we found that PYL4 interacted in an ABA-independent manner with CAR1 in both the plasma membrane and nucleus of plant cells. CAR1 belongs to a plant-specific gene family encoding CAR1 to CAR10 proteins, and bimolecular fluorescence complementation and coimmunoprecipitation assays showed that PYL4-CAR1 as well as other PYR/PYL-CAR pairs interacted in plant cells. The crystal structure of CAR4 was solved, which revealed that, in addition to a classical calcium-dependent lipid binding C2 domain, a specific CAR signature is likely responsible for the interaction with PYR/PYL receptors and their recruitment to phospholipid vesicles. This interaction is relevant for PYR/PYL function and ABA signaling, since different car triple mutants affected in CAR1, CAR4, CAR5, and CAR9 genes showed reduced sensitivity to ABA in seedling establishment and root growth assays. In summary, we identified PYR/PYL-interacting partners that mediate a transient Ca2+-dependent interaction with phospholipid vesicles, which affects PYR/PYL subcellular localization and positively regulates ABA signaling. PMID:25465408
Abscisic acid enhances cold tolerance in honeybee larvae
Sturla, Laura; Guida, Lucrezia; Vigliarolo, Tiziana; Maggi, Matías; Eguaras, Martín; Zocchi, Elena; Lamattina, Lorenzo
2017-01-01
The natural composition of nutrients present in food is a key factor determining the immune function and stress responses in the honeybee (Apis mellifera). We previously demonstrated that a supplement of abscisic acid (ABA), a natural component of nectar, pollen, and honey, increases honeybee colony survival overwinter. Here we further explored the role of ABA in in vitro-reared larvae exposed to low temperatures. Four-day-old larvae (L4) exposed to 25°C for 3 days showed lower survival rates and delayed development compared to individuals growing at a standard temperature (34°C). Cold-stressed larvae maintained higher levels of ABA for longer than do larvae reared at 34°C, suggesting a biological significance for ABA. Larvae fed with an ABA-supplemented diet completely prevent the low survival rate due to cold stress and accelerate adult emergence. ABA modulates the expression of genes involved in metabolic adjustments and stress responses: Hexamerin 70b, Insulin Receptor Substrate, Vitellogenin, and Heat Shock Proteins 70. AmLANCL2, the honeybee ABA receptor, is also regulated by cold stress and ABA. These results support a role for ABA increasing the tolerance of honeybee larvae to low temperatures through priming effects. PMID:28381619
Abscisic acid enhances cold tolerance in honeybee larvae.
Ramirez, Leonor; Negri, Pedro; Sturla, Laura; Guida, Lucrezia; Vigliarolo, Tiziana; Maggi, Matías; Eguaras, Martín; Zocchi, Elena; Lamattina, Lorenzo
2017-04-12
The natural composition of nutrients present in food is a key factor determining the immune function and stress responses in the honeybee ( Apis mellifera ). We previously demonstrated that a supplement of abscisic acid (ABA), a natural component of nectar, pollen, and honey, increases honeybee colony survival overwinter. Here we further explored the role of ABA in in vitro -reared larvae exposed to low temperatures. Four-day-old larvae (L4) exposed to 25°C for 3 days showed lower survival rates and delayed development compared to individuals growing at a standard temperature (34°C). Cold-stressed larvae maintained higher levels of ABA for longer than do larvae reared at 34°C, suggesting a biological significance for ABA. Larvae fed with an ABA-supplemented diet completely prevent the low survival rate due to cold stress and accelerate adult emergence. ABA modulates the expression of genes involved in metabolic adjustments and stress responses: Hexamerin 70b, Insulin Receptor Substrate, Vitellogenin , and Heat Shock Proteins 70. AmLANCL2, the honeybee ABA receptor, is also regulated by cold stress and ABA. These results support a role for ABA increasing the tolerance of honeybee larvae to low temperatures through priming effects. © 2017 The Author(s).
Cenzano, Ana M; Masciarelli, O; Luna, M Virginia
2014-10-01
The identification of hormonal and biochemical traits that play functional roles in the adaptation to drought is necessary for the conservation and planning of rangeland management. The aim of this study was to evaluate the effects of drought on i) the water content (WC) of different plant organs, ii) the endogenous level of abscisic acid (ABA) and metabolites (phaseic acid-PA, dihydrophaseic acid-DPA and abscisic acid conjugated with glucose ester-ABA-GE), iii) the total carotenoid concentration and iv) to compare the traits of two desert perennial grasses (Pappostipa speciosa and Poa ligularis) with contrasting morphological and functional drought resistance traits and life-history strategies. Both species were subjected to two levels of gravimetric soil moisture (the highest near field capacity during autumn-winter and the lowest corresponding to summer drought). Drought significantly increased the ABA and DPA levels in the green leaves of P. speciosa and P. ligularis. Drought decreased ABA in the roots of P. speciosa while it increased ABA in the roots of P. ligularis. P. ligularis had the highest ABA level and WC in green leaves. While P. speciosa had the highest DPA levels in leaves. In conclusion, we found the highest ABA level in the mesophytic species P. ligularis and the lowest ABA level in the xerophytic species P. speciosa, revealing that the ABA metabolite profile in each grass species is a plastic response to drought resistance. Copyright © 2014 Elsevier Masson SAS. All rights reserved.
Zhang, Feng Juan; Jin, You Ju; Xu, Xing You; Lu, Rong Chun; Chen, Hua Jun
2008-01-01
Jasmonic acid (JA), abscisic acid (ABA) and indole-3-acetic acid (IAA) are important plant hormones. Plant hormones are difficult to analyse because they occur in small concentrations and other substances in the plant interfere with their detection. To develop a new, inexpensive procedure for the rapid extraction and purification of IAA, ABA and JA from various plant species. Samples were prepared by extraction of plant tissues with methanol and ethyl acetate. Then the extracts were further purified and enriched with C(18) cartridges. The final extracts were derivatised with diazomethane and then measured by GC-MS. The results of the new methodology were compared with those of the Creelman and Mullet procedure. Sequential elution of the assimilates from the C(18 )cartridges revealed that IAA and ABA eluted in 40% methanol, while JA subsequently eluted in 60% methanol. The new plant hormone extraction and purification procedure produced results that were comparable to those obtained with the Creelman and Mullet's procedure. This new procedure requires only 0.5 g leaf samples to quantify these compounds with high reliability and can simultaneously determine the concentrations of the three plant hormones. A simple, inexpensive method was developed for determining endogenous IAA, ABA and JA concentrations in plant tissue.
Abscisic acid is a negative regulator of root gravitropism in Arabidopsis thaliana.
Han, Woong; Rong, Honglin; Zhang, Hanma; Wang, Myeong-Hyeon
2009-01-23
The plant hormone abscisic acid (ABA) plays a role in root gravitropism and has led to an intense debate over whether ABA acts similar to auxin by translating the gravitational signal into directional root growth. While tremendous advances have been made in the past two decades in establishing the role of auxin in root gravitropism, little progress has been made in characterizing the role of ABA in this response. In fact, roots of plants that have undetectable levels of ABA and that display a normal gravitropic response have raised some serious doubts about whether ABA plays any role in root gravitropism. Here, we show strong evidence that ABA plays a role opposite to that of auxin and that it is a negative regulator of the gravitropic response of Arabidopsis roots.
A survey of the pyrabactin resistance-like abscisic acid receptor gene family in poplar.
Yu, Jingling; Li, Hejuan; Peng, Yajing; Yang, Lei; Zhao, Fugeng; Luan, Sheng; Lan, Wenzhi
2017-08-03
The conserved PYR/PYL/RCAR family acts as abscisic acid (ABA) receptors for land plants to adapt to terrestrial environments. Our recent study reported that the exogenous overexpression of poplar PtPYRL1 and PtPYRL5, the PYR/PYL/RCAR orthologs, promoted the sensitivity of transgenic Arabidopsis to ABA responses. Here, we surveyed the PtPYRL family in poplar, and revealed that although the sequence and structure are relatively conserved among these receptors, PtPYRL members have differential expression patterns and the sensitivity to ABA or drought treatment, suggesting that PtPYRLs might be good candidates to a future biotechnological use to enhance poplar resistance to water-stress environments.
NASA Astrophysics Data System (ADS)
Miyakawa, Takuya; Tanokura, Masaru
The phytohormone abscisic acid (ABA) plays a key role in the rapid adaptation of plants to environmental stresses such as drought and high salinity. Accumulated ABA in plant cells promotes stomatal closure in guard cells and transcription of stress-tolerant genes. Our understanding of ABA responses dramatically improved by the discovery of both PYR/PYL/RCAR as a soluble ABA receptor and inhibitory complex of a protein phospatase PP2C and a protein kinase SnRK2. Moreover, several structural analyses of PYR/PYL/RCAR revealed the mechanistic basis for the regulatory mechanism of ABA signaling, which provides a rational framework for the design of alternative agonists in future.
Emerging roles of protein kinase CK2 in abscisic acid signaling.
Vilela, Belmiro; Pagès, Montserrat; Riera, Marta
2015-01-01
The phytohormone abscisic acid (ABA) regulates many aspects of plant growth and development as well as responses to multiple stresses. Post-translational modifications such as phosphorylation or ubiquitination have pivotal roles in the regulation of ABA signaling. In addition to the positive regulator sucrose non-fermenting-1 related protein kinase 2 (SnRK2), the relevance of the role of other protein kinases, such as CK2, has been recently highlighted. We have recently established that CK2 phosphorylates the maize ortholog of open stomata 1 OST1, ZmOST1, suggesting a role of CK2 phosphorylation in the control of ZmOST1 protein degradation (Vilela et al., 2015). CK2 is a pleiotropic enzyme involved in multiple developmental and stress-responsive pathways. This review summarizes recent advances that taken together suggest a prominent role of protein kinase CK2 in ABA signaling and related processes.
Li, Zhou; Yu, Jingjin; Peng, Yan; Huang, Bingru
2017-01-01
Abscisic acid (ABA), salicylic acid (SA) and γ-aminobutyric acid (GABA) are known to play roles in regulating plant stress responses. This study was conducted to determine metabolites and associated pathways regulated by ABA, SA and GABA that could contribute to drought tolerance in creeping bentgrass (Agrostis stolonifera). Plants were foliar sprayed with ABA (5 μM), GABA (0.5 mM) and SA (10 μM) or water (untreated control) prior to 25 days drought stress in controlled growth chambers. Application of ABA, GABA or SA had similar positive effects on alleviating drought damages, as manifested by the maintenance of lower electrolyte leakage and greater relative water content in leaves of treated plants relative to the untreated control. Metabolic profiling showed that ABA, GABA and SA induced differential metabolic changes under drought stress. ABA mainly promoted the accumulation of organic acids associated with tricarboxylic acid cycle (aconitic acid, succinic acid, lactic acid and malic acid). SA strongly stimulated the accumulation of amino acids (proline, serine, threonine and alanine) and carbohydrates (glucose, mannose, fructose and cellobiose). GABA enhanced the accumulation of amino acids (GABA, glycine, valine, proline, 5-oxoproline, serine, threonine, aspartic acid and glutamic acid) and organic acids (malic acid, lactic acid, gluconic acid, malonic acid and ribonic acid). The enhanced drought tolerance could be mainly due to the enhanced respiration metabolism by ABA, amino acids and carbohydrates involved in osmotic adjustment (OA) and energy metabolism by SA, and amino acid metabolism related to OA and stress-defense secondary metabolism by GABA. © 2016 Scandinavian Plant Physiology Society.
Soler, Marçal; Molinas, Marisa; Figueras, Mercè
2013-01-01
The present study provides new insights on the role of the potato (Solanum tuberosum) suberin feruloyl transferase FHT in native and wound tissues, leading to conclusions about hitherto unknown properties of the phellogen. In agreement with the enzymatic role of FHT, it is shown that its transcriptional activation and protein accumulation are specific to tissues that undergo suberization such as the root boundary layers of the exodermis and the endodermis, along with the tuber periderm. Remarkably, FHT expression and protein accumulation within the periderm is restricted to the phellogen derivative cells with phellem identity. FHT levels in the periderm are at their peak near harvest during periderm maturation, with the phellogen becoming meristematically inactive and declining thereafter. However, periderm FHT levels remain high for several months after harvest, suggesting that the inactive phellogen retains the capacity to synthesize ferulate esters. Tissue wounding induces FHT expression and the protein accumulates from the first stages of the healing process onwards. FHT is up-regulated by abscisic acid and down-regulated by salicylic acid, emphasizing the complex regulation of suberin synthesis and wound healing. These findings open up new prospects important for the clarification of the suberization process and yield important information with regard to the skin quality of potatoes. PMID:23918964
Benson, Chantel L; Kepka, Michal; Wunschel, Christian; Rajagopalan, Nandhakishore; Nelson, Ken M; Christmann, Alexander; Abrams, Suzanne R; Grill, Erwin; Loewen, Michele C
2015-05-01
Abscisic acid (ABA) is a phytohormone known to mediate numerous plant developmental processes and responses to environmental stress. In Arabidopsis thaliana, ABA acts, through a genetically redundant family of ABA receptors entitled Regulatory Component of ABA Receptor (RCAR)/Pyrabactin Resistant 1 (PYR1)/Pyrabactin Resistant-Like (PYL) receptors comprised of thirteen homologues acting in concert with a seven-member set of phosphatases. The individual contributions of A. thaliana RCARs and their binding partners with respect to specific physiological functions are as yet poorly understood. Towards developing efficacious plant growth regulators selective for specific ABA functions and tools for elucidating ABA perception, a panel of ABA analogs altered specifically on positions around the ABA ring was assembled. These analogs have been used to probe thirteen RCARs and four type 2C protein phosphatases (PP2Cs) and were also screened against representative physiological assays in the model plant Arabidopsis. The 1'-O methyl ether of (S)-ABA was identified as selective in that, at physiologically relevant levels, it regulates stomatal aperture and improves drought tolerance, but does not inhibit germination or root growth. Analogs with the 7'- and 8'-methyl groups of the ABA ring replaced with bulkier groups generally retained the activity and stereoselectivity of (S)- and (R)-ABA, while alteration of the 9'-methyl group afforded an analog that substituted for ABA in inhibiting germination but neither root growth nor stomatal closure. Further in vitro testing indicated differences in binding of analogs to individual RCARs, as well as differences in the enzyme activity resulting from specific PP2Cs bound to RCAR-analog complexes. Ultimately, these findings highlight the potential of a broader chemical genetics approach for dissection of the complex network mediating ABA-perception, signaling and functionality within a given species and modifications in the future design
Influence of chilling and drought on water relations and abscisic acid accumulation in bean
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vernieri, P.; Pardossi, A.; Tognoni, F.
Intact bean seedlings were subjected to either chilling (4{degree}C) or drought stress. Leaf water relations and abscisic acid (ABA) content were monitored throughout a stress-recovery cycle. Chilling at low relative humidity (RH) and drought caused similar water deficits, as indicated by the decline in relative water content and water potentials, but they had different effects on ABA accumulation. There was a rapid increase in ABA levels in the leaves of water-deprived plants while only slight ABA accumulation was observed after 48 h of chilling (4{degree}C). After 24 h cold treatment there were large changes in turgor but no change inmore » ABA content. Plants chilled for 24 h accumulated ABA only when transferred to recovery conditions (20{degree}C, 90-95% RH, in the dark) to an extent that was related to the rate of leaf rehydration. When the chilling treatment was performed in a water-saturated atmosphere, plants did not suffer any water stress and ABA levels did not increase over a period of 48 h. However, when the chilling treatment lasted for a longer period (72 h), a significant increase in ABA levels was found also in the absence of water deficit. Experiments performed with leaf discs incubated in a mannitol solution (osmotic potential {minus}1{center dot}6 MPa) at different temperatures indicated that low temperature markedly inhibits ABA synthesis and that water stress induces increases in ABA content only at non-limiting warm temperatures.« less
Preliminary evidence that abscisic acid improves spatial memory in rats.
Qi, Cong-Cong; Ge, Jin-Fang; Zhou, Jiang-Ning
2015-02-01
Abscisic acid (ABA) is a crucial phytohormone that exists in a wide range of animals, including humans, and has multiple bioactivities. As direct derivatives of carotenoids, ABA and retinoic acid (RA) share similar molecular structures, and RA has been reported to improve spatial memory in rodents. To explore the potential effects of ABA on spatial learning and memory in rodents, 20mg/kg ABA was administered to young rats for 6weeks, and its effects on behaviour performance were evaluated through a series of behavioural tests. ABA pharmacokinetic analysis revealed that the exogenous ABA was distributed widely in the rat brain, characterised by rapid absorption and slow elimination. The behavioural tests showed that ABA increased both the duration spent in the target quadrant and the frequency it was entered in the probe test of the Morris water maze (MWM) and decreased the latency to locate the target quadrant. Moreover, ABA decreased the latency to enter the novel arm in the Y-maze test, accompanied by increases in the total entries and distance travelled in the three arms. However, there were no significant differences between the ABA-treated and control rats in the open field test and elevated plus-maze test. These results preliminarily indicate that ABA improves spatial memory in MWM and exploratory activity in Y-maze in young rats. Copyright © 2014 Elsevier Inc. All rights reserved.
Shkolnik, Doron; Bar-Zvi, Dudy
2008-05-01
The manipulation of transacting factors is commonly used to achieve a wide change in the expression of a large number of genes in transgenic plants as a result of a change in the expression of a single gene product. This is mostly achieved by the overexpression of transactivator or repressor proteins. In this study, it is demonstrated that the overexpression of an exogenous DNA-binding protein can be used to compete with the expression of an endogenous transcription factor sharing the same DNA-binding sequence. Arabidopsis was transformed with cDNA encoding tomato abscisic acid stress ripening 1 (ASR1), a sequence-specific DNA protein that has no orthologues in the Arabidopsis genome. ASR1-overexpressing (ASR1-OE) plants display an abscisic acid-insensitive 4 (abi4) phenotype: seed germination is not sensitive to inhibition by abscisic acid (ABA), glucose, NaCl and paclobutrazol. ASR1 binds coupling element 1 (CE1), a cis-acting element bound by the ABI4 transcription factor, located in the ABI4-regulated promoters, including that of the ABI4 gene. Chromatin immunoprecipitation demonstrates that ASR1 is bound in vivo to the promoter of the ABI4 gene in ASR1-OE plants, but not to promoters of genes known to be regulated by the transcription factors ABI3 or ABI5. Real-time polymerase chain reaction (PCR) analysis confirmed that the expression of ABI4 and ABI4-regulated genes is markedly reduced in ASR1-OE plants. Therefore, it is concluded that the abi4 phenotype of ASR1-OE plants is the result of competition between the foreign ASR1 and the endogenous ABI4 on specific promoter DNA sequences. The biotechnological advantage of using this approach in crop plants from the Brassicaceae family to reduce the transactivation activity of ABI4 is discussed.
Ju, Yan-Lun; Liu, Min; Zhao, Hui; Meng, Jiang-Fei; Fang, Yu-Lin
2016-10-12
The anthocyanin composition, fatty acids, and volatile aromas are important for Cabernet Sauvignon grape quality. This study evaluated the effect of exogenous abscisic acid (ABA) and methyl jasmonate (MeJA) on the anthocyanin composition, fatty acids, lipoxygenase activity, and the volatile compounds of Cabernet Sauvignon grape berries. Exogenous ABA and MeJA improved the content of total anthocyanins (TAC) and individual anthocyanins. Lipoxygenase (LOX) activity also increased after treatment. Furthermore, 16 fatty acids were detected. The linoleic acid concentration gradually increased with ABA concentration. The fatty acid content decreased with increasing MeJA concentration and then increased again, with the exception of linoleic acid. After exogenous ABA and MeJA treatment, the C6 aroma content increased significantly. Interestingly, the exogenous ABA and MeJA treatments improved mainly the content of 1-hexanol, hexanal, and 2-heptanol. These results provide insight into the effect of plant hormones on wine grapes, which is useful for grape quality improvement.
Interactions between red light, abscisic acid, and calcium in gravitropism
NASA Technical Reports Server (NTRS)
Leopold, A. C.; LaFavre, A. K.
1989-01-01
The effect of red light on orthogravitropism of Merit corn (Zea mays L.) roots has been attributed to its effects on the transduction phase of gravitropism (AC Leopold, SH Wettlaufer [1988] Plant Physiol 87:803-805). In an effort to characterize the orthogravitropic transduction system, comparative experiments have been carried out on the effects of red light, calcium, and abscisic acid (ABA). The red light effect can be completely satisfied with added ABA (100 micromolar) or with osmotic shock, which is presumed to increase endogenous ABA. The decay of the red light effect is closely paralleled by the decay of the ABA effect. ABA and exogenous calcium show strong additive effects when applied to either Merit or a line of corn which does not require red light for orthogravitropism. Measurements of the ABA content show marked increases in endogenous ABA in the growing region of the roots after red light. The interpretation is offered that red light or ABA may serve to increase the cytoplasmic concentrations of calcium, and that this may be an integral part of orthogravitropic transduction.
Abscisic-acid-dependent basic leucine zipper (bZIP) transcription factors in plant abiotic stress.
Banerjee, Aditya; Roychoudhury, Aryadeep
2017-01-01
One of the major causes of significant crop loss throughout the world is the myriad of environmental stresses including drought, salinity, cold, heavy metal toxicity, and ultraviolet-B (UV-B) rays. Plants as sessile organisms have evolved various effective mechanism which enable them to withstand this plethora of stresses. Most of such regulatory mechanisms usually follow the abscisic-acid (ABA)-dependent pathway. In this review, we have primarily focussed on the basic leucine zipper (bZIP) transcription factors (TFs) activated by the ABA-mediated signalosome. Upon perception of ABA by specialized receptors, the signal is transduced via various groups of Ser/Thr kinases, which phosphorylate the bZIP TFs. Following such post-translational modification of TFs, they are activated so that they bind to specific cis-acting sequences called abscisic-acid-responsive elements (ABREs) or GC-rich coupling elements (CE), thereby influencing the expression of their target downstream genes. Several in silico techniques have been adopted so far to predict the structural features, recognize the regulatory modification sites, undergo phylogenetic analyses, and facilitate genome-wide survey of TF under multiple stresses. Current investigations on the epigenetic regulation that controls greater accessibility of the inducible regions of DNA of the target gene to the bZIP TFs exclusively under stress situations, along with the evolved stress memory responses via genomic imprinting mechanism, have been highlighted. The potentiality of overexpression of bZIP TFs, either in a homologous or in a heterologous background, in generating transgenic plants tolerant to various abiotic stressors have also been addressed by various groups. The present review will provide a coherent documentation on the functional characterization and regulation of bZIP TFs under multiple environmental stresses, with the major goal of generating multiple-stress-tolerant plant cultivars in near future.
Synchronization of Somatic Embryogenesis in Date Palm Suspension Culture Using Abscisic Acid.
Alwael, Hussain A; Naik, Poornananda M; Al-Khayri, Jameel M
2017-01-01
Somatic embryogenesis is considered the most effective method for commercial propagation of date palm. However, the limitation of obtaining synchronized development of somatic embryos remains an impediment. The synchronization of somatic embryo development is ideal for the applications to produce artificial seeds. Abscisic acid (ABA) is associated with stress response and influences in vitro growth and development. This chapter describes an effective method to achieve synchronized development of somatic embryos in date palm cell suspension culture. Among the ABA concentrations tested (0, 1, 10, 50, 100 μM), the best synchronized growth was obtained in response to 50-100 μM. Here we provide a comprehensive protocol for in vitro plant regeneration of date palm starting with shoot-tip explant, callus initiation and growth, cell suspension establishment, embryogenesis synchronization with ABA treatment, somatic embryo germination, and rooting as well as acclimatized plantlet establishment.
Postharvest Exogenous Application of Abscisic Acid Reduces Internal Browning in Pineapple.
Zhang, Qin; Liu, Yulong; He, Congcong; Zhu, Shijiang
2015-06-10
Internal browning (IB) is a postharvest physiological disorder causing economic losses in pineapple, but there is no effective control measure. In this study, postharvest application of 380 μM abscisic acid (ABA) reduced IB incidence by 23.4-86.3% and maintained quality in pineapple fruit. ABA reduced phenolic contents and polyphenol oxidase and phenylalanine ammonia lyase activities; increased catalase and peroxidase activities; and decreased O2(·-), H2O2, and malondialdehyde levels. This suggests ABA could control IB through inhibiting phenolics biosynthesis and oxidation and enhancing antioxidant capability. Furthermore, the efficacy of IB control by ABA was not obviously affected by tungstate, ABA biosynthesis inhibitor, nor by diphenylene iodonium, NADPH oxidase inhibitor, nor by lanthanum chloride, calcium channel blocker, suggesting that ABA is sufficient for controlling IB. This process might not involve H2O2 generation, but could involve the Ca(2+) channels activation. These results provide potential for developing effective measures for controlling IB in pineapple.
Developmental priming of stomatal sensitivity to abscisic acid by leaf microclimate.
Pantin, Florent; Renaud, Jeanne; Barbier, François; Vavasseur, Alain; Le Thiec, Didier; Rose, Christophe; Bariac, Thierry; Casson, Stuart; McLachlan, Deirdre H; Hetherington, Alistair M; Muller, Bertrand; Simonneau, Thierry
2013-09-23
Plant water loss and CO2 uptake are controlled by valve-like structures on the leaf surface known as stomata. Stomatal aperture is regulated by hormonal and environmental signals. We show here that stomatal sensitivity to the drought hormone abscisic acid (ABA) is acquired during leaf development by exposure to an increasingly dryer atmosphere in the rosette plant Arabidopsis. Young leaves, which develop in the center of the rosette, do not close in response to ABA. As the leaves increase in size, they are naturally exposed to increasingly dry air as a consequence of the spatial arrangement of the leaves, and this triggers the acquisition of ABA sensitivity. Interestingly, stomatal ABA sensitivity in young leaves is rapidly restored upon water stress. These findings shed new light on how plant architecture and stomatal physiology have coevolved to optimize carbon gain against water loss in stressing environments. Copyright © 2013 Elsevier Ltd. All rights reserved.
Abscisic acid deficiency increases defence responses against Myzus persicae in Arabidopsis.
Hillwig, Melissa S; Chiozza, Mariana; Casteel, Clare L; Lau, Siau Ting; Hohenstein, Jessica; Hernández, Enrique; Jander, Georg; MacIntosh, Gustavo C
2016-02-01
Comparison of Arabidopsis thaliana (Arabidopsis) gene expression induced by Myzus persicae (green peach aphid) feeding, aphid saliva infiltration and abscisic acid (ABA) treatment showed a significant positive correlation. In particular, ABA-regulated genes are over-represented among genes that are induced by M. persicae saliva infiltration into Arabidopsis leaves. This suggests that the induction of ABA-related gene expression could be an important component of the Arabidopsis-aphid interaction. Consistent with this hypothesis, M. persicae populations induced ABA production in wild-type plants. Furthermore, aphid populations were smaller on Arabidopsis aba1-1 mutants, which cannot synthesize ABA, and showed a significant preference for wild-type plants compared with the mutant. Total free amino acids, which play an important role in aphid nutrition, were not altered in the aba1-1 mutant line, but the levels of isoleucine (Ile) and tryptophan (Trp) were differentially affected by aphids in wild-type and mutant plants. Recently, indole glucosinolates have been shown to promote aphid resistance in Arabidopsis. In this study, 4-methoxyindol-3-ylmethylglucosinolate was more abundant in the aba1-1 mutant than in wild-type Arabidopsis, suggesting that the induction of ABA signals that decrease the accumulation of defence compounds may be beneficial for aphids. © 2015 BSPP AND JOHN WILEY & SONS LTD.
To Stimulate or Inhibit? That Is the Question for the Function of Abscisic Acid.
Humplík, Jan F; Bergougnoux, Véronique; Van Volkenburgh, Elizabeth
2017-10-01
Physiologically, abscisic acid (ABA) is believed to be a general inhibitor of plant growth, including during the crucial early development of seedlings. However, this view contradicts many reports of stimulatory effects of ABA that, so far, have not been considered in the debate concerning ABA's function in plant development. To address this apparent contradiction, we propose a hypothetical mechanism to explain how ABA might contribute to the promotion of cell expansion. We wish to overturn conventional views on ABA's role during juvenile plant development and put forward the idea that, as for other phytohormones, the role of ABA is determined by dose and sensitivity and ranges from stimulatory to inhibitory effects. Copyright © 2017 Elsevier Ltd. All rights reserved.
Zeevaart, J A
1980-10-01
The time course of abscisic acid (ABA) accumulation during water stress and of degradation following rehydration was investigated by analyzing the levels of ABA and its metabolites phaseic acid (PA) and alkalihydrolyzable conjugated ABA in excised leaf blades of Xanthium strumarium. Initial purification was by reverse-phase, preparative, high performance liquid chromatography (HPLC) which did not require prior partitioning. ABA and PA were purified further by analytical HPLC with a muBondapak-NH(2) column, and quantified by GLC with an electron capture detector.The ABA content of stressed leaves increased for 4 to 5 hours and then leveled off due to a balance between synthesis and degradation. Since PA accumulated at a constant rate throughout the wilting period, it was concluded that the rate of ABA synthesis decreased after the first 4 to 5 hours stress. Conjugated ABA increased at a low rate during stress. This is interpreted to indicate that free ABA was converted to the conjugated form, rather than the reverse.Following rehydration of wilted leaves, the ABA level immediately ceased increasing; it remained constant for 1 hour and then declined rapidly to the prestress level over a 2- to 3-hour period with a concomitant rise in the PA level. In contrast to the rapid disappearance of ABA after relief of stress, the high PA content of rehydrated leaves declined only slowly. The level of conjugated ABA did not change following rehydration, indicating that conjugation of ABA was irreversible.Detached Xanthium leaves that were subjected to a wilting-recovery-rewilting cycle in darkness, responded to the second wilting period by formation of the same amount of ABA as accumulated after the first stress period.
Zhang, Lixin; Gao, Mei; Hu, Jingjiang; Zhang, Xifeng; Wang, Kai; Ashraf, Muhammad
2012-01-01
The role of plant hormone abscisic acid (ABA) in plants under drought stress (DS) is crucial in modulating physiological responses that eventually lead to adaptation to an unfavorable environment; however, the role of this hormone in modulation of glycinebetaine (GB) metabolism in maize particularly at the seedling stage is still poorly understood. Some hydroponic experiments were conducted to investigate the modulation role of ABA on plant growth, water relations and GB metabolism in the leaves of two maize cultivars, Zhengdan 958 (ZD958; drought tolerant), and Jundan 20 (JD20; drought sensitive), subjected to integrated root-zone drought stress (IR-DS) simulated by the addition of polyethylene glycol (PEG, 12% w/v, MW 6000). The IR-DS substantially resulted in increased betaine aldehyde dehydrogenase (BADH) activity and choline content which act as the key enzyme and initial substrate, respectively, in GB biosynthesis. Drought stress also induced accumulation of GB, whereas it caused reduction in leaf relative water content (RWC) and dry matter (DM) in both cultivars. The contents of ABA and GB increased in drought-stressed maize seedlings, but ABA accumulated prior to GB accumulation under the drought treatment. These responses were more predominant in ZD958 than those in JD20. Addition of exogenous ABA and fluridone (Flu) (ABA synthesis inhibitor) applied separately increased and decreased BADH activity, respectively. Abscisic acid application enhanced GB accumulation, leaf RWC and shoot DM production in both cultivars. However, of both maize cultivars, the drought sensitive maize cultivar (JD20) performed relatively better than the other maize cultivar ZD958 under both ABA and Flu application in view of all parameters appraised. It is, therefore, concluded that increase in both BADH activity and choline content possibly resulted in enhancement of GB accumulation under DS. The endogenous ABA was probably involved in the regulation of GB metabolism by regulating
A new look at stress: abscisic acid patterns and dynamics at high-resolution.
Jones, Alexander M
2016-04-01
Abscisic acid (ABA) is a key phytohormone promoting abiotic stress tolerance as well as developmental processes such as seed dormancy. A spatiotemporal map of ABA concentrations would greatly advance our understanding of the cell type and timing of ABA action. Organ and tissue-level ABA measurements, as well as indirect in vivo measurements such as cell-specific transcriptional analysis of ABA metabolic enzymes and ABA-responsive promoters, have all contributed to current views of the localization and timing of ABA accumulations. Recently developed Förster resonance energy transfer (FRET) biosensors for ABA that sense ABA levels directly promise to add unprecedented resolution to in vivo ABA spatiotemporal mapping and expand our knowledge of the mechanisms controlling ABA levels in space and time. © 2015 Carnegie Institution for Science New Phytologist © 2015 New Phytologist Trust.
Structural basis and functions of abscisic acid receptors PYLs
Zhang, Xing L.; Jiang, Lun; Xin, Qi; Liu, Yang; Tan, Jian X.; Chen, Zhong Z.
2015-01-01
Abscisic acid (ABA) plays a key role in many developmental processes and responses to adaptive stresses in plants. Recently, a new family of nucleocytoplasmic PYR/PYL/RCAR (PYLs) has been identified as bona fide ABA receptors. PYLs together with protein phosphatases type-2C (PP2Cs), Snf1 (Sucrose-non-fermentation 1)-related kinases subfamily 2 (SnRK2s) and downstream substrates constitute the core ABA signaling network. Generally, PP2Cs inactivate SnRK2s kinases by physical interaction and direct dephosphorylation. Upon ABA binding, PYLs change their conformations and then contact and inhibit PP2Cs, thus activating SnRK2s. Here, we reviewed the recent progress in research regarding the structures of the core signaling pathways of ABA, including the (+)-ABA, (−)-ABA and ABA analogs pyrabactin as well as 6AS perception by PYLs, SnRK2s mimicking PYLs in binding PP2Cs. PYLs inhibited PP2Cs in both the presence and absence of ABA and activated SnRK2s. The present review elucidates multiple ABA signal perception and transduction by PYLs, which might shed light on how to design small chemical compounds for improving plant performance in the future. PMID:25745428
Abscisic acid controlled sex before transpiration in vascular plants
McAdam, Scott A. M.; Brodribb, Timothy J.; Hedrich, Rainer; Atallah, Nadia M.; Cai, Chao; Geringer, Michael A.; Lind, Christof; Nichols, David S.; Stachowski, Kye; Sussmilch, Frances C.
2016-01-01
Sexual reproduction in animals and plants shares common elements, including sperm and egg production, but unlike animals, little is known about the regulatory pathways that determine the sex of plants. Here we use mutants and gene silencing in a fern species to identify a core regulatory mechanism in plant sexual differentiation. A key player in fern sex differentiation is the phytohormone abscisic acid (ABA), which regulates the sex ratio of male to hermaphrodite tissues during the reproductive cycle. Our analysis shows that in the fern Ceratopteris richardii, a gene homologous to core ABA transduction genes in flowering plants [SNF1-related kinase2s (SnRK2s)] is primarily responsible for the hormonal control of sex determination. Furthermore, we provide evidence that this ABA–SnRK2 signaling pathway has transitioned from determining the sex of ferns to controlling seed dormancy in the earliest seed plants before being co-opted to control transpiration and CO2 exchange in derived seed plants. By tracing the evolutionary history of this ABA signaling pathway from plant reproduction through to its role in the global regulation of plant–atmosphere gas exchange during the last 450 million years, we highlight the extraordinary effect of the ABA–SnRK2 signaling pathway in plant evolution and vegetation function. PMID:27791082
Abscisic acid controlled sex before transpiration in vascular plants.
McAdam, Scott A M; Brodribb, Timothy J; Banks, Jo Ann; Hedrich, Rainer; Atallah, Nadia M; Cai, Chao; Geringer, Michael A; Lind, Christof; Nichols, David S; Stachowski, Kye; Geiger, Dietmar; Sussmilch, Frances C
2016-10-26
Sexual reproduction in animals and plants shares common elements, including sperm and egg production, but unlike animals, little is known about the regulatory pathways that determine the sex of plants. Here we use mutants and gene silencing in a fern species to identify a core regulatory mechanism in plant sexual differentiation. A key player in fern sex differentiation is the phytohormone abscisic acid (ABA), which regulates the sex ratio of male to hermaphrodite tissues during the reproductive cycle. Our analysis shows that in the fern Ceratopteris richardii, a gene homologous to core ABA transduction genes in flowering plants [SNF1-related kinase2s (SnRK2s)] is primarily responsible for the hormonal control of sex determination. Furthermore, we provide evidence that this ABA-SnRK2 signaling pathway has transitioned from determining the sex of ferns to controlling seed dormancy in the earliest seed plants before being co-opted to control transpiration and CO 2 exchange in derived seed plants. By tracing the evolutionary history of this ABA signaling pathway from plant reproduction through to its role in the global regulation of plant-atmosphere gas exchange during the last 450 million years, we highlight the extraordinary effect of the ABA-SnRK2 signaling pathway in plant evolution and vegetation function.
Hole, David J.; Smith, J. D.; Cobb, B. Greg
1989-01-01
Sectors of Zea mays cobs, with and without kernels were cultured in vitro in the presence and absence of fluridone. Cultured kernels, cob tissue, and embryos developed similarly to those grown in the field. Abscisic acid (ABA) levels in the embryos were evaluated by enzyme-linked immunosorbant assay. ABA levels in intact embryos cultured in the presence of fluridone were extremely low and indicate an inhibition of ABA synthesis. ABA levels in isolated cob tissue indicate that ABA can be produced by cob tissue. Sections containing kernels cultured in the presence of fluridone were transferred to medium containing fluridone and ABA. Dormancy was induced in more than 50% of the kernels transferred from 13 to 15 days after pollination, but all of the kernels transferred at 16 days after pollination or later were viviparous. ABA recovered from kernels that were placed in medium containing fluridone and ABA suggest that ABA can be transported through the cob tissue into developing embryos and that ABA is required for induction of dormancy in intact embryos. PMID:16666978
Bastías, Adriana; López-Climent, María; Valcárcel, Mercedes; Rosello, Salvador; Gómez-Cadenas, Aurelio; Casaretto, José A
2011-03-01
Growing evidence suggests that the phytohormone abscisic acid (ABA) plays a role in fruit development. ABA signaling components of developmental programs and responses to stress conditions include the group of basic leucine zipper transcriptional activators known as ABA-response element binding factors (AREBs/ABFs). AREB transcription factors mediate ABA-regulated gene expression involved in desiccation tolerance and are expressed mainly in seeds and in vegetative tissues under stress; however, they are also expressed in some fruits such as tomato. In order to get an insight into the role of ABA signaling in fruit development, the expression of two AREB-like factors were investigated during different developmental stages. In addition, tomato transgenic lines that overexpress and downregulate one AREB-like transcription factor, SlAREB1, were used to determine its effect on the levels of some metabolites determining fruit quality. Higher levels of citric acid, malic acid, glutamic acid, glucose and fructose were observed in SlAREB1-overexpressing lines compared with those in antisense suppression lines in red mature fruit pericarp. The higher hexose concentration correlated with increased expression of genes encoding a vacuolar invertase (EC 3.2.1.26) and a sucrose synthase (EC 2.4.1.13). No significant changes were found in ethylene content which agrees with the normal ripening phenotype observed in transgenic fruits. These results suggest that an AREB-mediated ABA signal affects the metabolism of these compounds during the fruit developmental program. Copyright © Physiologia Plantarum 2010.
Audenaert, Kris; De Meyer, Geert B.; Höfte, Monica M.
2002-01-01
Abscisic acid (ABA) is one of the plant hormones involved in the interaction between plants and pathogens. In this work, we show that tomato (Lycopersicon esculentum Mill. cv Moneymaker) mutants with reduced ABA levels (sitiens plants) are much more resistant to the necrotrophic fungus Botrytis cinerea than wild-type (WT) plants. Exogenous application of ABA restored susceptibility to B. cinerea in sitiens plants and increased susceptibility in WT plants. These results indicate that ABA plays a major role in the susceptibility of tomato to B. cinerea. ABA appeared to interact with a functional plant defense response against B. cinerea. Experiments with transgenic NahG tomato plants and benzo(1,2,3)thiadiazole-7-carbothioic acid demonstrated the importance of salicylic acid in the tomato-B. cinerea interaction. In addition, upon infection with B. cinerea, sitiens plants showed a clear increase in phenylalanine ammonia lyase activity, which was not observed in infected WT plants, indicating that the ABA levels in healthy WT tomato plants partly repress phenylalanine ammonia lyase activity. In addition, sitiens plants became more sensitive to benzo(1,2,3)thiadiazole-7-carbothioic acid root treatment. The threshold values for PR1a gene expression declined with a factor 10 to 100 in sitiens compared with WT plants. Thus, ABA appears to negatively modulate the salicylic acid-dependent defense pathway in tomato, which may be one of the mechanisms by which ABA levels determine susceptibility to B. cinerea. PMID:11842153
Wilmowicz, Emilia; Frankowski, Kamil; Kućko, Agata; Świdziński, Michał; de Dios Alché, Juan; Nowakowska, Anna; Kopcewicz, Jan
2016-11-01
Flower abscission is a highly regulated developmental process activated in response to exogenous (e.g. changing environmental conditions) and endogenous stimuli (e.g. phytohormones). Ethylene (ET) and abscisic acid (ABA) are very effective stimulators of flower abortion in Lupinus luteus, which is a widely cultivated species in Poland, Australia and Mediterranean countries. In this paper, we show that artificial activation of abscission by flower removal caused an accumulation of ABA in the abscission zone (AZ). Moreover, the blocking of that phytohormone's biosynthesis by NDGA (nordihydroguaiaretic acid) decreased the number of abscised flowers. However, the application of NBD - an inhibitor of ET action - reversed the stimulatory effect of ABA on flower abscission, indicating that ABA itself is not sufficient to turn on the organ separation. Our analysis revealed that exogenous ABA significantly accelerated the transcriptional activity of the ET biosynthesis genes ACC synthase (LlACS) and oxidase (LlACO), and moreover, strongly increased the level of 1-aminocyclopropane-1-carboxylic acid (ACC) - ET precursor, which was specifically localized within AZ cells. We cannot exclude the possibility that ABA mediates flower abscission processes by enhancing the ET biosynthesis rate. The findings of our study will contribute to the overall basic knowledge on the phytohormone-regulated generative organs abscission in L. luteus. Copyright © 2016 Elsevier GmbH. All rights reserved.
Wang, Shanshan; Saito, Takanori; Ohkawa, Katsuya; Ohara, Hitoshi; Shishido, Masahiro; Ikeura, Hiromi; Takagi, Kazuteru; Ogawa, Shigeyuki; Yokoyama, Mineyuki; Kondo, Satoru
2016-03-15
Effects of α-ketol linolenic acid (KODA) application on endogenous abscisic acid (ABA), jasmonic acid (JA), and aromatic volatiles were investigated in 'Kyoho' grapes (Vitis labrusca×Vitis vinifera) infected by a pathogen (Glomerella cingulata). The expressions of 9-cis-epoxycarotenoid dioxygenase (VvNCED1), ABA 8'-hydroxylase (VvCYP707A1), lipoxygenase (VvLOX), and allene oxide synthase (VvAOS) were also examined. The grape berries were dipped in 0.1mM KODA solution before inoculation with the pathogen and stored at 25°C for 12 days. The development of infection was significantly suppressed upon KODA treatment. Endogenous ABA, JA and phaseic acid (PA) were induced in inoculated berries. KODA application before inoculation increased endogenous ABA, PA and JA through the activation of VvNCED1, VvCYP707A1 and VvAOS genes, respectively. In addition, terpenes, methyl salicylate (Me-SA) and C6-aldehydes such as (E)-2-hexenal and cis-3-hexenal associated with fungal resistance also increased in KODA-treated berries during storage. These results suggest that the synergistic effect of JA, ABA, and some aromatic volatiles induced by KODA application may provide resistance to pathogen infection in grape berries. Copyright © 2016 Elsevier GmbH. All rights reserved.
Tu, Bingjie; Liu, Changkai; Tian, Bowen; Zhang, Qiuying; Liu, Xiaobing; Herbert, Stephen J
2017-05-01
In order to understand the physiological mechanism of potassium (K) application in enhancing sugar content of vegetable soybean seeds, pot experiments were conducted in 2014 and 2015 with two vegetable soybean (Glycine max L. Merr.) cultivars (c.v. Zhongkemaodou 1 and c.v. 121) under normal rate of nitrogen and phosphorus application. Three potassium (K) fertilization treatments were imposed: No K application (K0), 120 kg K 2 SO 4 ha -1 at seeding (K1), and 120 kg K 2 SO 4 ha -1 at seedling + 1% K 2 SO 4 foliar application at flowering (K2). Contents of indole-3-acetic acid (IAA), gibberellins (GA), cytokinins (ZR) and abscisic acid (ABA) in seeds were determined from 4 to 8 weeks after flowering. K fertilization increased the contents of IAA, GA, ZR, soluble sugar, sucrose and fresh pod yield, but reduced ABA content consistently. When the contents of soluble sugar and sucrose reached the highest level at 7 weeks after flowering for the 2 cultivars, the contents of IAA、GA、ZR all reached the lowest level in general. The content of ABA in seed was negatively correlated with the sucrose content (P < 0.01, r = -0.749**, -0.768** in 2014 and -0.535**, -0.791** in 2015 for c.v.121 and c.v. Zhongkemaodou 1 respectively). The changes in ratio of the ABA to (IAA + GA + ZR) from 4 to 8 weeks after flowering affected by K application were coincident to the changes of sucrose accumulation. The reduced ratio of ABA/(IAA + GA + ZR) affected by K nutrition particularly reduced abscisic acid content plays a critical role in enhancing sucrose content, which might be a partial mechanism involved in K nutrition to improve the quality of vegetable soybean.
Polyamines Regulate Strawberry Fruit Ripening by Abscisic Acid, Auxin, and Ethylene.
Guo, Jiaxuan; Wang, Shufang; Yu, Xiaoyang; Dong, Rui; Li, Yuzhong; Mei, Xurong; Shen, Yuanyue
2018-05-01
Polyamines (PAs) participate in many plant growth and developmental processes, including fruit ripening. However, it is not clear whether PAs play a role in the ripening of strawberry ( Fragaria ananassa ), a model nonclimacteric plant. Here, we found that the content of the PA spermine (Spm) increased more sharply after the onset of fruit coloration than did that of the PAs putrescine (Put) or spermidine (Spd). Spm dominance in ripe fruit resulted from abundant transcripts of a strawberry S -adenosyl-l-Met decarboxylase gene ( FaSAMDC ), which encodes an enzyme that generates a residue needed for PA biosynthesis. Exogenous Spm and Spd promoted fruit coloration, while exogenous Put and a SAMDC inhibitor inhibited coloration. Based on transcriptome data, up- and down-regulation of FaSAMDC expression promoted and inhibited ripening, respectively, which coincided with changes in several physiological parameters and their corresponding gene transcripts, including firmness, anthocyanin content, sugar content, polyamine content, auxin (indole-3-acetic acid [IAA]) content, abscisic acid (ABA) content, and ethylene emission. Using isothermal titration calorimetry, we found that FaSAMDC also had a high enzymatic activity with a K d of 1.7 × 10 -3 m In conclusion, PAs, especially Spm, regulate strawberry fruit ripening in an ABA-dominated, IAA-participating, and ethylene-coordinated manner, and FaSAMDC plays an important role in ripening. © 2018 American Society of Plant Biologists. All Rights Reserved.
Supplementation with Abscisic Acid Reduces Malaria Disease Severity and Parasite Transmission
Glennon, Elizabeth K. K.; Adams, L. Garry; Hicks, Derrick R.; Dehesh, Katayoon; Luckhart, Shirley
2016-01-01
Nearly half of the world's population is at risk for malaria. Increasing drug resistance has intensified the need for novel therapeutics, including treatments with intrinsic transmission-blocking properties. In this study, we demonstrate that the isoprenoid abscisic acid (ABA) modulates signaling in the mammalian host to reduce parasitemia and the formation of transmissible gametocytes and in the mosquito host to reduce parasite infection. Oral ABA supplementation in a mouse model of malaria was well tolerated and led to reduced pathology and enhanced gene expression in the liver and spleen consistent with infection recovery. Oral ABA supplementation also increased mouse plasma ABA to levels that can signal in the mosquito midgut upon blood ingestion. Accordingly, we showed that supplementation of a Plasmodium falciparum-infected blood meal with ABA increased expression of mosquito nitric oxide synthase and reduced infection prevalence in a nitric oxide-dependent manner. Identification of the mechanisms whereby ABA reduces parasite growth in mammals and mosquitoes could shed light on the balance of immunity and metabolism across eukaryotes and provide a strong foundation for clinical translation. PMID:27001761
Development of an indirect enzyme linked immunoassay for abscisic acid. [Pisum sativum
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ross, G.S.; Elder, P.A.; McWha, J.A.
1987-09-01
AN INDIRECT METHOD OF ENZYME-LINKED-IMMUNOSORBENT-ASSAY (ELISA) IS REPORTED FOR ABSCISIC ACID (ABA), UTILIZING A THYROGLOBULIN-ABA CONJUGATE FOR COATING WELLS. THE ASSAY CAN USE COMMERCIALLY AVAILABLE MONOCLONAL ANTIBODIES, IS SENSITIVE TO AS LITTLE AS 20 PICOGRAMS ABA PER WELL, AND IS MUCH MORE CONSERVATIVE OF ANTIBODY THAN DIRECT METHODS. THE MOST DILUTE ABA STANDARDS DID NOT RETAIN THEIR ANTIGENICITY DURING STORAGE, SO ABA STANDARD SETS WERE DILUTED IMMEDIATELY PRIOR TO USE. THE INDIRECT ELISA WAS USED SUCCESSFULLY TO ESTIMATE ABA CONCENTRATIONS IN DEVELOPING COTYLEDONS OF PISUM SATIVUM L., AFTER ONLY LITTLE PRELIMINARY PURIFICATION. IT WAS VALIDATED FOR THIS TISSUE THROUGH THEmore » USE OF GAS CHROMATOGRAPHY-ELECTRON CAPTURE DETECTION (GC-EC), AND CAPILLARY GC-SELECTED ION MONITORING (GC-MS-SIM) USING LABELLED ABA AS AN INTERNAL STANDARD. FULL SPECTRUM GC-MASS SPECTROMETRY WAS ALSO USED TO VERIFY THAT ABA WAS PRESENT IN A SAMPLE ASSAYED QUANTITATIVELY BY BOTH ELISA AND GC-MS-SIM.« less
Guri, Amir J.; Misyak, Sarah A.; Hontecillas, Raquel; Hasty, Alyssa; Liu, Dongmin; Si, Hongwei; Bassaganya-Riera, Josep
2009-01-01
Abscisic acid (ABA) is a natural phytohormone which improves insulin sensitivity and reduces adipose tissue inflammation when supplemented into diets of obese mice. The objective of this study was to investigate the mechanisms by which abscisic acid (ABA) prevents or ameliorates atherosclerosis. Apolipoprotein E-deficient (ApoE −/−) mice were fed high-fat diets with or without ABA for 84 days. Systolic blood pressure was assessed on days 0, 28, 56, and 72. Gene expression, immune cell infiltration, and histological lesions were evaluated in the aortic root wall. Human aortic endothelial cells were used to examine the effect of ABA on 3’, 5’-cyclic adenosine monophosphate (cAMP) and nitric oxide (NO) production in vitro. We report that ABA-treated mice had significantly improved systolic blood pressure and decreased accumulation of F4/80+CD11b+ macrophages and CD4+ T cells in aortic root walls. At the molecular level, ABA significantly enhanced aortic endothelial nitric oxide synthase (eNOS) and tended to suppress aortic vascular cell adhesion molecule-1 (VCAM-1) and monocyte chemoattractant protein-1 (MCP-1) expression and plasma MCP-1 concentrations. ABA also caused a dose-dependent increase in intracellular concentrations of cAMP and NO and upregulated eNOS mRNA expression in human aortic endothelial cells. This is the first report showing that ABA prevents or ameliorates atherosclerosis-induced hypertension, immune cell recruitment into the aortic root wall, and upregulates aortic eNOS expression in ApoE−/− mice. PMID:20092994
Wang, Yanyan; Zhang, Tianbao; Song, Xiaxia; Zhang, Jianping; Dang, Zhanhai; Pei, Xinwu; Long, Yan
2018-01-01
Alternative splicing is a popular phenomenon in different types of plants. It can produce alternative spliced transcripts that encode proteins with altered functions. Previous studies have shown that one transcription factor, ABSCISIC ACID INSENSITIVE3 (ABI3), which encodes an important component in abscisic acid (ABA) signaling, is subjected to alternative splicing in both mono- and dicotyledons. In the current study, we identified two homologs of ABI3 in the genome of linseed flax. We screened two alternatively spliced flax LuABI3 transcripts, LuABI3-2 and LuABI3-3, and one normal flax LuABI3 transcript, LuABI3-1. Sequence analysis revealed that one of the alternatively spliced transcripts, LuABI3-3, retained a 6 bp intron. RNA accumulation analysis showed that all three transcripts were expressed during seed development, while subcellular localization and transgene experiments showed that LuABI3-3 had no biological function. The two normal transcripts, LuABI3-1 and LuABI3-2, are the important functional isoforms in flax and play significant roles in the ABA regulatory pathway during seed development, germination, and maturation.
Sulochana, Sujitha Balakrishnan; Arumugam, Muthu
2016-08-01
Scenedesmus quadricauda, accumulated more lipid but with a drastic reduction in biomass yield during nitrogen starvation. Abscisic acid (ABA) being a stress responsible hormone, its effect on growth and biomass with sustainable lipid yield during nitrogen depletion was studied. The result revealed that the ABA level shoots up at 24h (27.21pmol/L) during the onset of nitrogen starvation followed by a sharp decline. The external supplemented ABA showed a positive effect on growth pattern (38×10(6)cells/ml) at a lower concentration. The dry biomass yield is also increasing up to 2.1 fold compared to nitrogen deficient S. quadricauda. The lipid content sustains in 1 and 2μM concentration of ABA under nitrogen-deficient condition. The fatty acid composition of ABA treated S. quadricauda cultures with respect to nitrogen-starved cells showed 11.17% increment in saturated fatty acid content, the desired lipid composition for biofuel application. Copyright © 2016 Elsevier Ltd. All rights reserved.
Qin, Xiaoqiong; Yang, Seung Hwan; Kepsel, Andrea C.; Schwartz, Steven H.; Zeevaart, Jan A.D.
2008-01-01
Abscisic acid (ABA) is a plant hormone found in all higher plants; it plays an important role in seed dormancy, embryo development, and adaptation to environmental stresses, most notably drought. The regulatory step in ABA synthesis is the cleavage reaction of a 9-cis-epoxy-carotenoid catalyzed by the 9-cis-epoxy-carotenoid dioxygenases (NCEDs). The parasitic angiosperm Cuscuta reflexa lacks neoxanthin, one of the common precursors of ABA in all higher plants. Thus, is C. reflexa capable of synthesizing ABA, or does it acquire ABA from its host plants? Stem tips of C. reflexa were cultured in vitro and found to accumulate ABA in the absence of host plants. This demonstrates that this parasitic plant is capable of synthesizing ABA. Dehydration of detached stem tips caused a big rise in ABA content. During dehydration, 18O was incorporated into ABA from 18O2, indicating that ABA was synthesized de novo in C. reflexa. Two NCED genes, CrNCED1 and CrNCED2, were cloned from C. reflexa. Expression of CrNCEDs was up-regulated significantly by dehydration. In vitro enzyme assays with recombinant CrNCED1 protein showed that the protein is able to cleave both 9-cis-violaxanthin and 9′-cis-neoxanthin to give xanthoxin. Thus, despite the absence of neoxanthin in C. reflexa, the biochemical activity of CrNCED1 is similar to that of NCEDs from other higher plants. These results provide evidence for conservation of the ABA biosynthesis pathway among members of the plant kingdom. PMID:18441226
Wu, Guanxun; Gao, Zhengquan; Du, Huanmin; Lin, Bin; Yan, Yuchen; Li, Guoqiang; Guo, Yanyun; Fu, Shenggui; Wei, Gongxiang; Wang, Miaomiao; Cui, Meng; Meng, Chunxiao
2018-03-27
Sustainable renewable energy is being hotly debated globally because the continued use of finite fossil fuels is now widely recognized as being unsustainable. Microalgae potentially offer great opportunities for resolving this challenge. Abscisic acid (ABA), jasmonic acid (JA) and salicylic acid (SA) are involved in regulating many physiological properties and have been widely used in higher plants. To test if phytohormones have an impact on accumulating lipid for microalgae, ABA, JA and SA were used to induce two Chlorella strains in the present study. The results showed 1.0 mg/L ABA, 10 mg/L SA, and 0.5 mg/L JA, led strain C. vulgaris ZF strain to produce a 45%, 42% and 49% lipid content that was 1.8-, 1.7- and 2.0-fold that of controls, respectively. For FACHB 31 (number 31 of the Freshwater Algae Culture Collection at the Institute of Hydrobiology, Chinese Academy of Sciences), the addition of 1.0 mg/L ABA, 10 mg/L SA, and 0.5 mg/L, JA produced 33%, 30% and 38% lipid content, which was 1.8-, 1.6- and 2.1-fold that of controls, respectively. As for lipid productivity, 1.0 mg/L ABA increased the lipid productivity of C. vulgaris ZF strain and FACHB-31 by 123% and 44%; 10 mg/L SA enhanced lipid productivity by 100% and 33%; the best elicitor, 0.5 mg/L JA, augmented lipid productivity by 127% and 75% compared to that of controls, respectively. The results above suggest that the three phytohormones at physiological concentrations play crucial roles in inducing lipid accumulation in Chlorella.
Abscisic Acid as Pathogen Effector and Immune Regulator
Lievens, Laurens; Pollier, Jacob; Goossens, Alain; Beyaert, Rudi; Staal, Jens
2017-01-01
Abscisic acid (ABA) is a sesquiterpene signaling molecule produced in all kingdoms of life. To date, the best known functions of ABA are derived from its role as a major phytohormone in plant abiotic stress resistance. Different organisms have developed different biosynthesis and signal transduction pathways related to ABA. Despite this, there are also intriguing common themes where ABA often suppresses host immune responses and is utilized by pathogens as an effector molecule. ABA also seems to play an important role in compatible mutualistic interactions such as mycorrhiza and rhizosphere bacteria with plants, and possibly also the animal gut microbiome. The frequent use of ABA in inter-species communication could be a possible reason for the wide distribution and re-invention of ABA as a signaling molecule in different organisms. In humans and animal models, it has been shown that ABA treatment or nutrient-derived ABA is beneficial in inflammatory diseases like colitis and type 2 diabetes, which confer potential to ABA as an interesting nutraceutical or pharmacognostic drug. The anti-inflammatory activity, cellular metabolic reprogramming, and other beneficial physiological and psychological effects of ABA treatment in humans and animal models has sparked an interest in this molecule and its signaling pathway as a novel pharmacological target. In contrast to plants, however, very little is known about the ABA biosynthesis and signaling in other organisms. Genes, tools and knowledge about ABA from plant sciences and studies of phytopathogenic fungi might benefit biomedical studies on the physiological role of endogenously generated ABA in humans. PMID:28469630
Abscisic Acid: A Novel Nutraceutical for Glycemic Control
Zocchi, Elena; Hontecillas, Raquel; Leber, Andrew; Einerhand, Alexandra; Carbo, Adria; Bruzzone, Santina; Tubau-Juni, Nuria; Philipson, Noah; Zoccoli-Rodriguez, Victoria; Sturla, Laura; Bassaganya-Riera, Josep
2017-01-01
Abscisic acid is naturally present in fruits and vegetables, and it plays an important role in managing glucose homeostasis in humans. According to the latest U.S. dietary survey, about 92% of the population might have a deficient intake of ABA due to their deficient intake of fruits and vegetables. This review summarizes the in vitro, preclinical, mechanistic, and human translational findings obtained over the past 15 years in the study of the role of ABA in glycemic control. In 2007, dietary ABA was first reported to ameliorate glucose tolerance and obesity-related inflammation in mice. The most recent findings regarding the topic of ABA and its proposed receptor lanthionine synthetase C-like 2 in glycemic control and their interplay with insulin and glucagon-like peptide-1 suggest a major role for ABA in the physiological response to a glucose load in humans. Moreover, emerging evidence suggests that the ABA response might be dysfunctional in diabetic subjects. Follow on intervention studies in healthy individuals show that low-dose dietary ABA administration exerts a beneficial effect on the glycemia and insulinemia profiles after oral glucose load. These recent findings showing benefits in humans, together with extensive efficacy data in mouse models of diabetes and inflammatory disease, suggest the need for reference ABA values and its possible exploitation of the glycemia-lowering effects of ABA for preventative purposes. Larger clinical studies on healthy, prediabetic, and diabetic subjects are needed to determine whether addressing the widespread dietary ABA deficiency improves glucose control in humans. PMID:28660193
Yamburenko, Maria V; Zubo, Yan O; Börner, Thomas
2015-06-01
Abscisic acid (ABA) represses the transcriptional activity of chloroplast genes (determined by run-on assays), with the exception of psbD and a few other genes in wild-type Arabidopsis seedlings and mature rosette leaves. Abscisic acid does not influence chloroplast transcription in the mutant lines abi1-1 and abi2-1 with constitutive protein phosphatase 2C (PP2C) activity, suggesting that ABA affects chloroplast gene activity by binding to the pyrabactin resistance (PYR)/PYR1-like or regulatory component of ABA receptor protein family (PYR/PYL/RCAR) and signaling via PP2Cs and sucrose non-fermenting protein-related kinases 2 (SnRK2s). Further we show by quantitative PCR that ABA enhances the transcript levels of RSH2, RSH3, PTF1 and SIG5. RelA/SpoT homolog 2 (RSH2) and RSH3 are known to synthesize guanosine-3'-5'-bisdiphosphate (ppGpp), an inhibitor of the plastid-gene-encoded chloroplast RNA polymerase. We propose, therefore, that ABA leads to an inhibition of chloroplast gene expression via stimulation of ppGpp synthesis. On the other hand, sigma factor 5 (SIG5) and plastid transcription factor 1 (PTF1) are known to be necessary for the transcription of psbD from a specific light- and stress-induced promoter (the blue light responsive promoter, BLRP). We demonstrate that ABA activates the psbD gene by stimulation of transcription initiation at BLRP. Taken together, our data suggest that ABA affects the transcription of chloroplast genes by a PP2C-dependent activation of nuclear genes encoding proteins involved in chloroplast transcription. © 2015 The Authors The Plant Journal © 2015 John Wiley & Sons Ltd.
Zeevaart, Jan A. D.
1980-01-01
The time course of abscisic acid (ABA) accumulation during water stress and of degradation following rehydration was investigated by analyzing the levels of ABA and its metabolites phaseic acid (PA) and alkalihydrolyzable conjugated ABA in excised leaf blades of Xanthium strumarium. Initial purification was by reverse-phase, preparative, high performance liquid chromatography (HPLC) which did not require prior partitioning. ABA and PA were purified further by analytical HPLC with a μBondapak-NH2 column, and quantified by GLC with an electron capture detector. The ABA content of stressed leaves increased for 4 to 5 hours and then leveled off due to a balance between synthesis and degradation. Since PA accumulated at a constant rate throughout the wilting period, it was concluded that the rate of ABA synthesis decreased after the first 4 to 5 hours stress. Conjugated ABA increased at a low rate during stress. This is interpreted to indicate that free ABA was converted to the conjugated form, rather than the reverse. Following rehydration of wilted leaves, the ABA level immediately ceased increasing; it remained constant for 1 hour and then declined rapidly to the prestress level over a 2- to 3-hour period with a concomitant rise in the PA level. In contrast to the rapid disappearance of ABA after relief of stress, the high PA content of rehydrated leaves declined only slowly. The level of conjugated ABA did not change following rehydration, indicating that conjugation of ABA was irreversible. Detached Xanthium leaves that were subjected to a wilting-recovery-rewilting cycle in darkness, responded to the second wilting period by formation of the same amount of ABA as accumulated after the first stress period. PMID:16661500
NASA Technical Reports Server (NTRS)
Nan, R.; Carman, J. G.; Salisbury, F. B.
1999-01-01
Wheat (Triticum aestivum L.) plants were grown under four irradiance levels: 1,400, 400, 200, and 100 micromol m-2 s-1. Leaves and roots were sampled before, during, and after the boot stage, and levels of abscisic acid (ABA), indole-3-acetic acid (IAA), zeatin, zeatin riboside, dihydrozeatin, dihydrozeatin riboside, isopentenyl adenine, and isopentenyl adenosine were quantified using noncompetitive indirect ELISA systems. Levels of IAA in leaves and roots of plants exposed to 100 micromol m-2 s-1 of irradiance were 0.7 and 2.9 micromol kg-1 dry mass (DM), respectively. These levels were 0.2 and 1.0 micromol kg-1 DM, respectively, when plants were exposed to 1,400 micromol m-2 s-1. Levels of ABA in leaves and roots of plants exposed to 100 micromol m-2 s-1 were 0.65 and 0.55 micromol kg-1 DM, respectively. They were 0.24 micromol kg-1 DM (both leaves and roots) when plants were exposed to 1,400 micromol m-2 s-1. Levels of isopentenyl adenosine in leaves (24.3 nmol kg-1 DM) and roots (29.9 nmol kg-1 DM) were not affected by differences in the irradiance regime. Similar values were obtained in a second experiment. Other cytokinins could not be detected (<10 nmol kg 1 DM) in either experiment with the sample sizes used (150-600 mg DM for roots and shoots, respectively).
Manandhar, Miglena; Cronan, John E
2017-05-01
Biotin synthetic pathways are readily separated into two stages, synthesis of the seven carbon α, ω-dicarboxylic acid pimelate moiety and assembly of the fused heterocyclic rings. The biotin pathway genes responsible for pimelate moiety synthesis vary widely among bacteria whereas the ring synthesis genes are highly conserved. Bacillus subtilis seems to have redundant genes, bioI and bioW, for generation of the pimelate intermediate. Largely consistent with previous genetic studies it was found that deletion of bioW caused a biotin auxotrophic phenotype whereas deletion of bioI did not. BioW is a pimeloyl-CoA synthetase that converts pimelic acid to pimeloyl-CoA. The essentiality of BioW for biotin synthesis indicates that the free form of pimelic acid is an intermediate in biotin synthesis although this is not the case in E. coli. Since the origin of pimelic acid in Bacillus subtilis is unknown, 13 C-NMR studies were carried out to decipher the pathway for its generation. The data provided evidence for the role of free pimelate in biotin synthesis and the involvement of fatty acid synthesis in pimelate production. Cerulenin, an inhibitor of the key fatty acid elongation enzyme, FabF, markedly decreased biotin production by B. subtilis resting cells whereas a strain having a cerulenin-resistant FabF mutant produced more biotin. In addition, supplementation with pimelic acid fully restored biotin production in cerulenin-treated cells. These results indicate that pimelic acid originating from fatty acid synthesis pathway is a bona fide precursor of biotin in B. subtilis. © 2017 John Wiley & Sons Ltd.
Teaster, Neal D; Motes, Christy M; Tang, Yuhong; Wiant, William C; Cotter, Matthew Q; Wang, Yuh-Shuh; Kilaru, Aruna; Venables, Barney J; Hasenstein, Karl H; Gonzalez, Gabriel; Blancaflor, Elison B; Chapman, Kent D
2007-08-01
N-Acylethanolamines (NAEs) are bioactive acylamides that are present in a wide range of organisms. In plants, NAEs are generally elevated in desiccated seeds, suggesting that they may play a role in seed physiology. NAE and abscisic acid (ABA) levels were depleted during seed germination, and both metabolites inhibited the growth of Arabidopsis thaliana seedlings within a similar developmental window. Combined application of low levels of ABA and NAE produced a more dramatic reduction in germination and growth than either compound alone. Transcript profiling and gene expression studies in NAE-treated seedlings revealed elevated transcripts for a number of ABA-responsive genes and genes typically enriched in desiccated seeds. The levels of ABI3 transcripts were inversely associated with NAE-modulated growth. Overexpression of the Arabidopsis NAE degrading enzyme fatty acid amide hydrolase resulted in seedlings that were hypersensitive to ABA, whereas the ABA-insensitive mutants, abi1-1, abi2-1, and abi3-1, exhibited reduced sensitivity to NAE. Collectively, our data indicate that an intact ABA signaling pathway is required for NAE action and that NAE may intersect the ABA pathway downstream from ABA. We propose that NAE metabolism interacts with ABA in the negative regulation of seedling development and that normal seedling establishment depends on the reduction of the endogenous levels of both metabolites.
Terry, Paul H.; Aung, Louis H.; De Hertogh, August A.
1982-01-01
A major growth inhibitory substance of tulip bulbs (Tulipa gesneriana L. cv Paul Richter) has been unequivocally shown to be abscisic acid (ABA). The ABA methyl ester of the free ether-soluble acid fractions of tulip organs had the identical retention time on gas-liquid chromatography with electron capture detector as authentic ABA methyl ester. In addition, the mass spectra were the same. On a unit dry matter basis, the basalplate and floral shoot contained 3.6 and 2.6 times more ABA than the fleshy scales, respectively. PMID:16662721
Agrochemical control of plant water use using engineered abscisic acid receptors.
Park, Sang-Youl; Peterson, Francis C; Mosquna, Assaf; Yao, Jin; Volkman, Brian F; Cutler, Sean R
2015-04-23
Rising temperatures and lessening fresh water supplies are threatening agricultural productivity and have motivated efforts to improve plant water use and drought tolerance. During water deficit, plants produce elevated levels of abscisic acid (ABA), which improves water consumption and stress tolerance by controlling guard cell aperture and other protective responses. One attractive strategy for controlling water use is to develop compounds that activate ABA receptors, but agonists approved for use have yet to be developed. In principle, an engineered ABA receptor that can be activated by an existing agrochemical could achieve this goal. Here we describe a variant of the ABA receptor PYRABACTIN RESISTANCE 1 (PYR1) that possesses nanomolar sensitivity to the agrochemical mandipropamid and demonstrate its efficacy for controlling ABA responses and drought tolerance in transgenic plants. Furthermore, crystallographic studies provide a mechanistic basis for its activity and demonstrate the relative ease with which the PYR1 ligand-binding pocket can be altered to accommodate new ligands. Thus, we have successfully repurposed an agrochemical for a new application using receptor engineering. We anticipate that this strategy will be applied to other plant receptors and represents a new avenue for crop improvement.
Engineering Sialic Acid Synthesis Ability in Insect Cells.
Viswanathan, Karthik; Narang, Someet; Betenbaugh, Michael J
2015-01-01
Insect cells lack the ability to synthesize the sialic acid donor molecule CMP-sialic acid or its precursor, sialic acid. In this chapter, we describe a method to engineer CMP-sialic acid synthesis capability into Spodoptera frugiperda (Sf9) cells, a prototypical insect cell line, by recombinant expression of sialic acid synthesis pathway genes using baculovirus technology. Co-expression of a sialuria mutant UDP-GlcNAc-2-epimerase/ManNAc kinase (EKR263L), wild-type sialic acid 9-phosphate synthase (SAS), and wild-type CMP-sialic acid synthetase (CSAS) in the presence of GlcNAc leads to synthesis of CMP-sialic acids synthesis to support sialylation of N-glycans on glycoproteins.
Abscisic Acid Biosynthesis in Leaves and Roots of Xanthium strumarium.
Creelman, R A; Gage, D A; Stults, J T; Zeevaart, J A
1987-11-01
RESEARCH ON THE BIOSYNTHESIS OF ABSCISIC ACID (ABA) HAS FOCUSED PRIMARILY ON TWO PATHWAYS: (a) the direct pathway from farnesyl pyrophosphate, and (b) the indirect pathway involving a carotenoid precursor. We have investigated which biosynthetic pathway is operating in turgid and stressed Xanthium leaves, and in stressed Xanthium roots using long-term incubations in (18)O(2). It was found that in stressed leaves three atoms of (18)O from (18)O(2) are incorporated into the ABA molecule, and that the amount of (18)O incorporated increases with time. One (18)O atom is incorporated rapidly into the carboxyl group of ABA, whereas the other two atoms are very slowly incorporated into the ring oxygens. The fourth oxygen atom in the carboxyl group of ABA is derived from water. ABA from stressed roots of Xanthium incubated in (18)O(2) shows a labeling pattern similar to that of ABA in stressed leaves, but with incorporation of more (18)O into the tertiary hydroxyl group at C-1' after 6 and 12 hours than found in ABA from stressed leaves. It is proposed that the precursors to stress-induced ABA are xanthophylls, and that a xanthophyll lacking an oxygen function at C-6 (carotenoid numbering scheme) plays a crucial role in ABA biosynthesis in Xanthium roots. In turgid Xanthium leaves, (18)O is incorporated into ABA to a much lesser extent than it is in stressed leaves, whereas exogenously applied (14)C-ABA is completely catabolized within 48 hours. This suggests that ABA in turgid leaves is either (a) made via a biosynthetic pathway which is different from the one in stressed leaves, or (b) has a half-life on the order of days as compared with a half-life of 15.5 hours in water-stressed Xanthium leaves. Phaseic acid showed a labeling pattern similar to that of ABA, but with an additional (18)O incorporated during 8'-hydroxylation of ABA to phaseic acid.
Xiao, Xiang; Cheng, Xi; Yin, Kangquan; Li, Huali; Qiu, Jin-Long
2017-08-01
Pytohormone abscisic acid (ABA) plays important roles in defense responses. Nonetheless, how ABA regulates plant resistance to biotrophic fungi remains largely unknown. Arabidopsis ABA-deficient mutants, aba2-1 and aba3-1, displayed enhanced resistance to the biotrophic powdery mildew fungus Golovinomyces cichoracearum. Moreover, exogenously administered ABA increased the susceptibility of Arabidopsis to G. cichoracearum. Arabidopsis ABA perception components mutants, abi1-1 and abi2-1, also displayed similar phenotypes to ABA-deficient mutants in resistance to G. cichoracearum. However, the resistance to G. cichoracearum is not changed in downstream ABA signaling transduction mutants, abi3-1, abi4-1, and abi5-1. Microscopic examination revealed that hyphal growth and conidiophore production of G. cichoracearum were compromised in the ABA deficient mutants, even though pre-penetration and penetration growth of the fungus were not affected. In addition, salicylic acid (SA) and MPK3 are found to be involved in ABA-regulated resistance to G. cichoracearum. Our work demonstrates that ABA negatively regulates post-penetration resistance of Arabidopsis to powdery mildew fungus G. cichoracearum, probably through antagonizing the function of SA.
Lin, Qibing; Wu, Fuqing; Sheng, Peike; Zhang, Zhe; Zhang, Xin; Guo, Xiuping; Wang, Jiulin; Cheng, Zhijun; Wang, Jie; Wang, Haiyang; Wan, Jianmin
2015-01-01
Abscisic acid (ABA) and gibberellic acid (GA) antagonistically regulate many developmental processes and responses to biotic or abiotic stresses in higher plants. However, the molecular mechanism underlying this antagonism is still poorly understood. Here, we show that loss-of-function mutation in rice Tiller Enhancer (TE), an activator of the APC/CTE complex, causes hypersensitivity and hyposensitivity to ABA and GA, respectively. We find that TE physically interacts with ABA receptor OsPYL/RCARs and promotes their degradation by the proteasome. Genetic analysis also shows OsPYL/RCARs act downstream of TE in mediating ABA responses. Conversely, ABA inhibits APC/CTE activity by phosphorylating TE through activating the SNF1-related protein kinases (SnRK2s), which may interrupt the interaction between TE and OsPYL/RCARs and subsequently stabilize OsPYL/RCARs. In contrast, GA can reduce the level of SnRK2s and may promote APC/CTE-mediated degradation of OsPYL/RCARs. Thus, we propose that the SnRK2-APC/CTE regulatory module represents a regulatory hub underlying the antagonistic action of GA and ABA in plants. PMID:26272249
Furihata, Takashi; Maruyama, Kyonoshin; Fujita, Yasunari; Umezawa, Taishi; Yoshida, Riichiro; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko
2006-02-07
bZIP-type transcription factors AREBs/ABFs bind an abscisic acid (ABA)-responsive cis-acting element named ABRE and transactivate downstream gene expression in Arabidopsis. Because AREB1 overexpression could not induce downstream gene expression, activation of AREB1 requires ABA-dependent posttranscriptional modification. We confirmed that ABA activated 42-kDa kinase activity, which, in turn, phosphorylated Ser/Thr residues of R-X-X-S/T sites in the conserved regions of AREB1. Amino acid substitutions of R-X-X-S/T sites to Ala suppressed transactivation activity, and multiple substitution of these sites resulted in almost complete suppression of transactivation activity in transient assays. In contrast, substitution of the Ser/Thr residues to Asp resulted in high transactivation activity without exogenous ABA application. A phosphorylated, transcriptionally active form was achieved by substitution of Ser/Thr in all conserved R-X-X-S/T sites to Asp. Transgenic plants overexpressing the phosphorylated active form of AREB1 expressed many ABA-inducible genes, such as RD29B, without ABA treatment. These results indicate that the ABA-dependent multisite phosphorylation of AREB1 regulates its own activation in plants.
Rapid Quantification of Abscisic Acid by GC-MS/MS for Studies of Abiotic Stress Response.
Verslues, Paul E
2017-01-01
Drought and low water potential induce large increases in Abscisic Acid (ABA ) content of plant tissue. This increased ABA content is essential to regulate downstream stress resistance responses; however, the mechanisms regulating ABA accumulation are incompletely known. Thus, the ability to accurately quantify ABA at high throughput and low cost is important for plant stress research. We have combined and modified several previously published protocols to establish a rapid ABA analysis protocol using gas chromatography-tandem mass spectrometry (GC-MS/MS). Derivatization of ABA is performed with (trimethylsilyl)-diazomethane rather than the harder to prepare diazomethane. Sensitivity of the analysis is sufficient that small samples of low water potential treated Arabidopsis thaliana seedlings can be routinely analyzed in reverse genetic studies of putative stress regulators as well as studies of natural variation in ABA accumulation.
Yuan, Congying; Ai, Jianping; Chang, Hongping; Xiao, Wenjun; Liu, Lu; Zhang, Cheng; He, Zhuang; Huang, Ji; Li, Jinyan; Guo, Xinhong
2017-05-01
Casein kinase II (CK2), an evolutionarily well-conserved Ser/Thr kinase, plays critical roles in all higher organisms including plants. CKB1 is a regulatory subunit beta of CK2. In this study, homozygous T-DNA mutants (ckb1-1 and ckb1-2) and over-expression plants (35S:CKB1-1, 35S:CKB1-2) of Arabidopsis thaliana were studied to understand the role of CKB1 in abiotic stress and gibberellic acid (GA) signaling. Histochemical staining showed that although CKB1 was expressed in all organs, it had a relatively higher expression in conducting tissues. The ckb1 mutants showed reduced sensitivity to abscisic acid (ABA) during seed germination and seedling growth. The increased stomatal aperture, leaf water loss and proline accumulation were observed in ckb1 mutants. In contrast, the ckb1 mutant had increased sensitivity to polyaluminum chloride during seed germination and hypocotyl elongation. We obtained opposite results in over-expression plants. The expression levels of a number of genes in the ABA and GA regulatory network had changed. This study demonstrates that CKB1 is an ABA signaling-related gene, which subsequently influences GA metabolism, and may play a positive role in ABA signaling.
Badescu, George O.; Marsh, Andrew; Smith, Timothy R.; Thompson, Andrew J.; Napier, Richard M.
2016-01-01
A single-chain Fv fragment antibody (scFv) specific for the plant hormone abscisic acid (ABA) has been expressed in the bacterium Escherichia coli as a fusion protein. The kinetics of ABA binding have been measured using surface plasmon resonance spectrometry (BIAcore 2000) using surface and solution assays. Care was taken to calculate the concentration of active protein in each sample using initial rate measurements under conditions of partial mass transport limitation. The fusion product, parental monoclonal antibody and the free scFv all have low nanomolar affinity constants, but there is a lower dissociation rate constant for the parental monoclonal resulting in a three-fold greater affinity. Analogue specificity was tested and structure-activity binding preferences measured. The biologically-active (+)-ABA enantiomer is recognised with an affinity three orders of magnitude higher than the inactive (-)-ABA. Metabolites of ABA including phaseic acid, dihydrophaseic acid and deoxy-ABA have affinities over 100-fold lower than that for (+)-ABA. These properties of the scFv make it suitable as a sensor domain in bioreporters specific for the naturally occurring form of ABA. PMID:27023768
NASA Technical Reports Server (NTRS)
Evans, M. L.; Mulkey, T. J.
1984-01-01
In order to test the idea that auxin action on root growth may be mediated by H(+) movement, the correlation of auxin action on growth and H(+) movement in roots was examined along with changes in H(+) efflux patterns associated with the asymmetric growth which occurs during gravitropism. The effects of indoleacetic acid (IAA) and abscisic acid (AbA) on growth, H(+) secretion, and gravitropism in roots were compared. Results show a close correlation existent between H(+) efflux and growth in maize roots. In intact roots there is strong H(+) efflux from the elongation zone. Growth-promoting concentrations of IAA stimulate H(+) efflux. During gravitropism the H(+) efflux from the elongation zone becomes asymmetric; the evidence indicates that auxin redistribution contributes to the development of acid efflux asymmetry. That AbA stimulates root growth is reflected in its ability to stimulate H(+) efflux from apical root segments.
Shi, Yiting; Wang, Zheng; Meng, Pei; Tian, Siqi; Zhang, Xiaoyan; Yang, Shuhua
2013-07-01
ALTERED MERISTEM PROGRAM1 (AMP1) encodes a glutamate carboxypeptidase that plays an important role in shoot apical meristem development and phytohormone homeostasis. We isolated a new mutant allele of AMP1, amp1-20, from a screen for abscisic acid (ABA) hypersensitive mutants and characterized the function of AMP1 in plant stress responses. amp1 mutants displayed ABA hypersensitivity, while overexpression of AMP1 caused ABA insensitivity. Moreover, endogenous ABA concentration was increased in amp1-20- and decreased in AMP1-overexpressing plants under stress conditions. Application of ABA reduced the AMP1 protein level in plants. Interestingly, amp1 mutants accumulated excess superoxide and displayed hypersensitivity to oxidative stress. The hypersensitivity of amp1 to ABA and oxidative stress was partially rescued by reactive oxygen species (ROS) scavenging agent. Furthermore, amp1 was tolerant to freezing and drought stress. The ABA hypersensitivity and freezing tolerance of amp1 was dependent on ABA signaling. Moreover, amp1 had elevated soluble sugar content and showed hypersensitivity to high concentrations of sugar. By contrast, the contents of amino acids were changed in amp1 mutant compared to the wild-type. This study suggests that AMP1 modulates ABA, oxidative and abotic stress responses, and is involved in carbon and amino acid metabolism in Arabidopsis. © 2013 The Authors. New Phytologist © 2013 New Phytologist Trust.
Du, Hao; Chang, Yu; Huang, Fei; Xiong, Lizhong
2015-11-01
Plant responses to abiotic stresses are coordinated by arrays of growth and developmental programs. Gibberellic acid (GA) and abscisic acid (ABA) play critical roles in the developmental programs and environmental responses, respectively, through complex signaling and metabolism networks. However, crosstalk between the two phytohormones in stress responses remains largely unknown. In this study, we report that GIBBERELLIN-INSENSITIVE DWARF 1 (GID1), a soluble receptor for GA, regulates stomatal development and patterning in rice (Oryza sativa L.). The gid1 mutant showed impaired biosynthesis of endogenous ABA under drought stress conditions, but it exhibited enhanced sensitivity to exogenous ABA. Scanning electron microscope and infrared thermal image analysis indicated an increase in the stomatal conductance in the gid1 mutant under drought conditions. Interestingly, the gid1 mutant had increased levels of chlorophyll and carbohydrates under submergence conditions, and showed enhanced reactive oxygen species (ROS)-scavenging ability and submergence tolerance compared with the wild-type. Further analyses suggested that the function of GID1 in submergence responses is partially dependent on ABA, and GA signaling by GID1 is involved in submergence tolerance by modulating carbohydrate consumption. Taken together, these findings suggest GID1 plays distinct roles in stomatal response and submergence tolerance through both the ABA and GA signaling pathways in rice. © 2014 Institute of Botany, Chinese Academy of Sciences.
Waadt, Rainer; Krebs, Melanie; Kudla, Jörg; Schumacher, Karin
2017-10-01
Calcium signals occur in specific spatio-temporal patterns in response to various stimuli and are coordinated with, for example, hormonal signals, for physiological and developmental adaptations. Quantification of calcium together with other signalling molecules is required for correlative analyses and to decipher downstream calcium-decoding mechanisms. Simultaneous in vivo imaging of calcium and abscisic acid has been performed here to investigate the interdependence of the respective signalling processes in Arabidopsis thaliana roots. Advanced ratiometric genetically encoded calcium indicators have been generated and in vivo calcium calibration protocols were established to determine absolute calcium concentration changes in response to auxin and ATP. In roots, abscisic acid induced long-term basal calcium concentration increases, while auxin triggered rapid signals in the elongation zone. The advanced ratiometric calcium indicator R-GECO1-mTurquoise exhibited an increased calcium signal resolution compared to commonly used Förster resonance energy transfer-based indicators. Quantitative calcium measurements in Arabidopsis root tips using R-GECO1-mTurquoise revealed detailed maps of absolute calcium concentration changes in response to auxin and ATP. Calcium calibration protocols using R-GECO1-mTurquoise enabled high-resolution quantitative imaging of resting cytosolic calcium concentrations and their dynamic changes that revealed distinct hormonal and ATP responses in roots. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.
Staroske, Nicole; Conrad, Udo; Kumlehn, Jochen; Hensel, Götz; Radchuk, Ruslana; Erban, Alexander; Kopka, Joachim; Weschke, Winfriede; Weber, Hans
2016-01-01
Abscisic acid (ABA) accumulates in seeds during the transition to the seed filling phase. ABA triggers seed maturation, storage activity, and stress signalling and tolerance. Immunomodulation was used to alter the ABA status in barley grains, with the resulting transgenic caryopses responding to the anti-ABA antibody gene expression with increased accumulation of ABA. Calculation of free versus antibody-bound ABA reveals large excess of free ABA, increasing signficantly in caryopses from 10 days after fertilization. Metabolite and transcript profiling in anti-ABA grains expose triggered and enhanced ABA-functions such as transcriptional up-regulation of sucrose-to-starch metabolism, storage protein synthesis and ABA-related signal transduction. Thus, enhanced ABA during transition phases induces precocious maturation but negatively interferes with growth and development. Anti-ABA grains display broad constitutive gene induction related to biotic and abiotic stresses. Most of these genes are ABA- and/or stress-inducible, including alcohol and aldehyde dehydrogenases, peroxidases, chaperones, glutathione-S-transferase, drought- and salt-inducible proteins. Conclusively, ABA immunomodulation results in precocious ABA accumulation that generates an integrated response of stress and maturation. Repression of ABA signalling, occurring in anti-ABA grains, potentially antagonizes effects caused by overshooting production. Finally, mature grain weight and composition are unchanged in anti-ABA plants, although germination is somewhat delayed. This indicates that anti-ABA caryopses induce specific mechanisms to desensitize ABA signalling efficiently, which finally yields mature grains with nearly unchanged dry weight and composition. Such compensation implicates the enormous physiological and metabolic flexibilities of barley grains to adjust effects of unnaturally high ABA amounts in order to ensure and maintain proper grain development. PMID:26951372
Li, Wei; Cui, Xiao; Meng, Zhaolu; Huang, Xiahe; Xie, Qi; Wu, Heng; Jin, Hailing; Zhang, Dabing; Liang, Wanqi
2012-03-01
The accumulation of a number of small RNAs in plants is affected by abscisic acid (ABA) and abiotic stresses, but the underlying mechanisms are poorly understood. The miR168-mediated feedback regulatory loop regulates ARGONAUTE1 (AGO1) homeostasis, which is crucial for gene expression modulation and plant development. Here, we reveal a transcriptional regulatory mechanism by which MIR168 controls AGO1 homeostasis during ABA treatment and abiotic stress responses in Arabidopsis (Arabidopsis thaliana). Plants overexpressing MIR168a and the AGO1 loss-of-function mutant ago1-27 display ABA hypersensitivity and drought tolerance, while the mir168a-2 mutant shows ABA hyposensitivity and drought hypersensitivity. Both the precursor and mature miR168 were induced under ABA and several abiotic stress treatments, but no obvious decrease for the target of miR168, AGO1, was shown under the same conditions. However, promoter activity analysis indicated that AGO1 transcription activity was increased under ABA and drought treatments, suggesting that transcriptional elevation of MIR168a is required for maintaining a stable AGO1 transcript level during the stress response. Furthermore, we showed both in vitro and in vivo that the transcription of MIR168a is directly regulated by four abscisic acid-responsive element (ABRE) binding factors, which bind to the ABRE cis-element within the MIR168a promoter. This ABRE motif is also found in the promoter of MIR168a homologs in diverse plant species. Our findings suggest that transcriptional regulation of miR168 and posttranscriptional control of AGO1 homeostasis may play an important and conserved role in stress response and signal transduction in plants.
Bacaicoa, Eva; Garnica, María; Fuentes, Marta; Casanova, Esther; Etayo, David; Ederra, Iñigo; Gonzalo, Ramón
2015-01-01
The physiological and metabolic mechanisms behind the humic acid-mediated plant growth enhancement are discussed in detail. Experiments using cucumber (Cucumis sativus) plants show that the shoot growth enhancement caused by a structurally well-characterized humic acid with sedimentary origin is functionally associated with significant increases in abscisic acid (ABA) root concentration and root hydraulic conductivity. Complementary experiments involving a blocking agent of cell wall pores and water root transport (polyethylenglycol) show that increases in root hydraulic conductivity are essential in the shoot growth-promoting action of the model humic acid. Further experiments involving an inhibitor of ABA biosynthesis in root and shoot (fluridone) show that the humic acid-mediated enhancement of both root hydraulic conductivity and shoot growth depended on ABA signaling pathways. These experiments also show that a significant increase in the gene expression of the main root plasma membrane aquaporins is associated with the increase of root hydraulic conductivity caused by the model humic acid. Finally, experimental data suggest that all of these actions of model humic acid on root functionality, which are linked to its beneficial action on plant shoot growth, are likely related to the conformational structure of humic acid in solution and its interaction with the cell wall at the root surface. PMID:26450705
Olaetxea, Maite; Mora, Verónica; Bacaicoa, Eva; Garnica, María; Fuentes, Marta; Casanova, Esther; Zamarreño, Angel M; Iriarte, Juan C; Etayo, David; Ederra, Iñigo; Gonzalo, Ramón; Baigorri, Roberto; García-Mina, Jose M
2015-12-01
The physiological and metabolic mechanisms behind the humic acid-mediated plant growth enhancement are discussed in detail. Experiments using cucumber (Cucumis sativus) plants show that the shoot growth enhancement caused by a structurally well-characterized humic acid with sedimentary origin is functionally associated with significant increases in abscisic acid (ABA) root concentration and root hydraulic conductivity. Complementary experiments involving a blocking agent of cell wall pores and water root transport (polyethylenglycol) show that increases in root hydraulic conductivity are essential in the shoot growth-promoting action of the model humic acid. Further experiments involving an inhibitor of ABA biosynthesis in root and shoot (fluridone) show that the humic acid-mediated enhancement of both root hydraulic conductivity and shoot growth depended on ABA signaling pathways. These experiments also show that a significant increase in the gene expression of the main root plasma membrane aquaporins is associated with the increase of root hydraulic conductivity caused by the model humic acid. Finally, experimental data suggest that all of these actions of model humic acid on root functionality, which are linked to its beneficial action on plant shoot growth, are likely related to the conformational structure of humic acid in solution and its interaction with the cell wall at the root surface. © 2015 American Society of Plant Biologists. All Rights Reserved.
Beilby, Mary J; Turi, Christina E; Baker, Teesha C; Tymm, Fiona Jm; Murch, Susan J
2015-01-01
Giant-celled Characeae (Chara australis Brown), grown for 4 months on 12/12 hr day/night cycle and summer/autumn temperatures, exhibited distinct concentration maxima in auxin (indole-3-acetic acid; IAA), melatonin and serotonin about 4 hr after subjective daybreak. These concentration peaks persisted after 3 day pretreatment in continuous darkness: confirming a circadian rhythm, rather than a response to "light on." The plants pretreated for 3 d in continuous light exhibited several large IAA concentration maxima throughout the 24 hr. The melatonin and serotonin concentrations decreased and were less synchronized with IAA. Chara plants grown on 9/15 hr day/night cycle for 4 months and winter/spring temperatures contained much smaller concentrations of IAA, melatonin and serotonin. The IAA concentration maxima were observed in subjective dark phase. Serotonin concentration peaks were weakly correlated with those of IAA. Melatonin concentration was low and mostly independent of circadian cycle. The "dark" IAA concentration peaks persisted in plants treated for 3 d in the dark. The plants pretreated for 3 d in the light again developed more IAA concentration peaks. In this case the concentration maxima in melatonin and serotonin became more synchronous with those in IAA. The abscisic acid (ABA) and jasmonic acid (JA) concentrations were also measured in plants on winter regime. The ABA concentration did not exhibit circadian pattern, while JA concentration peaks were out of phase with those of IAA. The data are discussed in terms of crosstalk between metabolic pathways.
NASA Technical Reports Server (NTRS)
Weber, Arthur L.
1998-01-01
Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.
Giulia, Eccher; Alessandro, Botton; Mariano, Dimauro; Andrea, Boschetti; Benedetto, Ruperti; Angelo, Ramina
2013-01-01
Apple (Malus domestica) fruitlet abscission represents an interesting model system to study the early phases of the shedding process, during which major transcriptomic changes and metabolic rearrangements occur within the fruit. In apple, the drop of fruits at different positions within the cluster can be selectively magnified through chemical thinners, such as benzyladenine and metamitron, acting as abscission enhancers. In this study, different abscission potentials were obtained within the apple fruitlet population by means of the above-cited thinners. A metabolomic study was conducted on the volatile organic compounds emitted by abscising fruitlets, allowing for identification of isoprene as an early marker of abscission induction. A strong correlation was also observed between isoprene production and abscisic acid (ABA) levels in the fruit cortex, which were shown to increase in abscising fruitlets with respect to nonabscising ones. Transcriptomic evidence indicated that abscission-related ABA is biologically active, and its increased biosynthesis is associated with the induction of a specific ABA-responsive 9-cis-epoxycarotenoid dioxygenase gene. According to a hypothetical model, ABA may transiently cooperate with other hormones and secondary messengers in the generation of an intrafruit signal leading to the downstream activation of the abscission zone. The shedding process therefore appears to be triggered by multiple interdependent pathways, whose fine regulation, exerted within a very short temporal window by both endogenous and exogenous factors, determines the final destiny of the fruitlets. PMID:23444344
NASA Technical Reports Server (NTRS)
Schulze, A.; Jensen, P. J.; Desrosiers, M.; Buta, J. G.; Bandurski, R. S.
1992-01-01
Measurements were made of the fresh weight, dry weight, dry weight-fresh weight ratio, free and conjugated indole-3-acetic acid, and free and conjugated abscisic acid in seedlings of Zea mays grown in darkness in microgravity and on earth. Imbibition of the dry kernels was 17 h prior to launch. Growth was for 5 d at ambient orbiter temperature and at a chronic accelerational force of the order of 3 x 10(-5) times earth gravity. Weights and hormone content of the microgravity seedlings were, with minor exceptions, not statistically different from seedlings grown in normal gravity. The tissues of the shuttle-grown plants appeared normal and the seedlings differed only in the lack of orientation of roots and shoots. These findings, based upon 5 d of growth in microgravity, cannot be extrapolated to growth in microgravity for weeks, months, and years, as might occur on a space station. Nonetheless, it is encouraging, for prospects of bioregeneration of the atmosphere and food production in a space station, that no pronounced differences in the parameters measured were apparent during the 5 d of plant seedling growth in microgravity.
Ye, Nenghui; Zhu, Guohui; Liu, Yinggao; Liu, Rui; Shi, Lu; Jia, Liguo; Zhang, Jianhua
2012-01-01
The antagonism between abscisic acid (ABA) and gibberellin (GA) plays a key role in controlling seed germination, but the mechanism of antagonism during this process is not known. The possible links among ABA, reactive oxygen species (ROS), ascorbic acid (ASC), and GA during rice seed germination were investigated. Unlike in non-seed tissues where ROS production is increased by ABA, ABA reduced ROS production in imbibed rice seeds, especially in the embryo region. Such reduced ROS also led to an inhibition of ASC production. GA accumulation was also suppressed by a reduced ROS and ASC level, which was indicated by the inhibited expression of GA biosynthesis genes, amylase genes, and enzyme activity. Application of exogenous ASC can partially rescue seed germination from ABA treatment. Production of ASC, which acts as a substrate in GA biosynthesis, was significantly inhibited by lycorine which thus suppressed the accumulation of GA. Consequently, expression of GA biosynthesis genes was suppressed by the low levels of ROS and ASC in ABA-treated seeds. It can be concluded that ABA regulates seed germination in multiple dimensions. ROS and ASC are involved in its inhibition of GA biosynthesis. PMID:22200664
Nelson, David C; Riseborough, Julie-Anne; Flematti, Gavin R; Stevens, Jason; Ghisalberti, Emilio L; Dixon, Kingsley W; Smith, Steven M
2009-02-01
Discovery of the primary seed germination stimulant in smoke, 3-methyl-2H-furo[2,3-c]pyran-2-one (KAR1), has resulted in identification of a family of structurally related plant growth regulators, karrikins. KAR1 acts as a key germination trigger for many species from fire-prone, Mediterranean climates, but a molecular mechanism for this response remains unknown. We demonstrate that Arabidopsis (Arabidopsis thaliana), an ephemeral of the temperate northern hemisphere that has never, to our knowledge, been reported to be responsive to fire or smoke, rapidly and sensitively perceives karrikins. Thus, these signaling molecules may have greater significance among angiosperms than previously realized. Karrikins can trigger germination of primary dormant Arabidopsis seeds far more effectively than known phytohormones or the structurally related strigolactone GR-24. Natural variation and depth of seed dormancy affect the degree of KAR1 stimulation. Analysis of phytohormone mutant germination reveals suppression of KAR1 responses by abscisic acid and a requirement for gibberellin (GA) synthesis. The reduced germination of sleepy1 mutants is partially recovered by KAR1, which suggests that germination enhancement by karrikin is only partly DELLA dependent. While KAR1 has little effect on sensitivity to exogenous GA, it enhances expression of the GA biosynthetic genes GA3ox1 and GA3ox2 during seed imbibition. Neither abscisic acid nor GA levels in seed are appreciably affected by KAR1 treatment prior to radicle emergence, despite marked differences in germination outcome. KAR1 stimulation of Arabidopsis germination is light-dependent and reversible by far-red exposure, although limited induction of GA3ox1 still occurs in the dark. The observed requirements for light and GA biosynthesis provide the first insights into the karrikin mode of action.
Gonai, Takeru; Kawahara, Shusuke; Tougou, Makoto; Satoh, Shigeru; Hashiba, Teruyoshi; Hirai, Nobuhiro; Kawaide, Hiroshi; Kamiya, Yuji; Yoshioka, Toshihito
2004-01-01
Germination of lettuce (Lactuca sativa L. cv. 'Grand Rapids') seeds was inhibited at high temperatures (thermoinhibition). Thermoinhibition at 28 degrees C was prevented by the application of fluridone, an inhibitor of abscisic acid (ABA) biosynthesis. At 33 degrees C, the sensitivity of the seeds to ABA increased, and fluridone on its own was no longer effective. However, a combined application of fluridone and gibberellic acid (GA3) was able to restore the germination. Exogenous GA3 lowered endogenous ABA content in the seeds, enhancing catabolism of ABA and export of the catabolites from the intact seeds. The fluridone application also decreased the ABA content. Consequently, the combined application of fluridone and GA3 decreased the ABA content to a sufficiently low level to allow germination at 33 degrees C. There was no significant temperature-dependent change in endogenous GA1 contents. It is concluded that ABA is an important factor in the regulation of thermoinhibition of lettuce seed germination, and that GA affects the temperature responsiveness of the seeds through ABA metabolism.
Zhou, Cheng; Zhu, Lin; Xie, Yue; Li, Feiyue; Xiao, Xin; Ma, Zhongyou; Wang, Jianfei
2017-01-01
Soil saline-alkalization is a major abiotic stress that leads to low iron (Fe) availability and high toxicity of sodium ions (Na + ) for plants. It has recently been shown that plant growth promoting rhizobacteria (PGPR) can enhance the ability of plants to tolerate multiple abiotic stresses such as drought, salinity, and nutrient deficiency. However, the possible involvement of PGPR in improving saline-alkaline tolerance of plants and the underlying mechanisms remain largely unknown. In this study, we investigated the effects of Bacillus licheniformis (strain SA03) on the growth of Chrysanthemum plants under saline-alkaline conditions. Our results revealed that inoculation with SA03 alleviated saline-alkaline stress in plants with increased survival rates, photosynthesis and biomass. The inoculated plants accumulated more Fe and lower Na + concentrations under saline-alkaline stress compared with the non-inoculated plants. RNA-Sequencing analyses further revealed that SA03 significantly activated abiotic stress- and Fe acquisition-related pathways in the stress-treated plants. However, SA03 failed to increase saline-alkaline tolerance in plants when cellular abscisic acid (ABA) and nitric oxide (NO) synthesis were inhibited by treatment with fluridone (FLU) and 2-(4-carboxyphenyl)-4,4,5,5-tetramethylimidazoline-1-oxyl-3-oxide (c-PTIO), respectively. Importantly, we also found that NO acted downstream of SA03-induced ABA to activate a series of adaptive responses in host plants under saline-alkaline stress. These findings demonstrated the potential roles of B. licheniformis SA03 in enhancing saline-alkaline tolerance of plants and highlighted the intricate integration of microbial signaling in regulating cellular Fe and Na + accumulation.
Abscisic acid, xanthoxin and violaxanthin in the caps of gravistimulated maize roots
NASA Technical Reports Server (NTRS)
Feldman, L. J.; Arroyave, N. J.; Sun, P. S.
1985-01-01
The occurrence and distribution of abscisic acid (ABA), xanthoxin (Xa) and the carotenoid violaxanthin (Va) were investigated in root tips of maize (Zea mays L. cv. Merit). In roots grown in the dark, Va and ABA were present in relatively high amounts in the root cap and in low amounts in the adjacent terminal 1.5 mm of the root. Xanthoxin was present in equal concentrations in both regions. In roots exposed to light, the ABA distribution was reversed, with relatively low levels in the root cap and high levels in the adjacent 1.5-mm segment. Light also caused a decrease in Va in both regions of the root and an increase in Xa, especially in the cap. In the maize cultivar used for this work, light is necessary for gravitropic curving. This response occurs within the same time frame as the light-induced ABA redistribution as well as the changes in the levels of Va and Xa. These data are consistent with a role for ABA in root gravitropism and support the proposal that Xa may arise from the turnover of Va.
A gate-latch-lock mechanism for hormone signalling by abscisic acid receptors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Melcher, Karsten; Ng, Ley-Moy; Zhou, X Edward
2010-01-12
Abscisic acid (ABA) is a ubiquitous hormone that regulates plant growth, development and responses to environmental stresses. Its action is mediated by the PYR/PYL/RCAR family of START proteins, but it remains unclear how these receptors bind ABA and, in turn, how hormone binding leads to inhibition of the downstream type 2C protein phosphatase (PP2C) effectors. Here we report crystal structures of apo and ABA-bound receptors as well as a ternary PYL2-ABA-PP2C complex. The apo receptors contain an open ligand-binding pocket flanked by a gate that closes in response to ABA by way of conformational changes in two highly conserved β-loopsmore » that serve as a gate and latch. Moreover, ABA-induced closure of the gate creates a surface that enables the receptor to dock into and competitively inhibit the PP2C active site. A conserved tryptophan in the PP2C inserts directly between the gate and latch, which functions to further lock the receptor in a closed conformation. Together, our results identify a conserved gate-latch-lock mechanism underlying ABA signalling.« less
McAdam, Scott A. M.
2017-01-01
Angiosperms are able to respond rapidly to the first sign of dry conditions, a decrease in air humidity, more accurately described as an increase in the vapor pressure deficit between the leaf and the atmosphere (VPD), by abscisic acid (ABA)-mediated stomatal closure. The genes underlying this response offer valuable candidates for targeted selection of crop varieties with improved drought tolerance, a critical goal for current plant breeding programs, to maximize crop production in drier and increasingly marginalized environments, and meet the demands of a growing population in the face of a changing climate. Here, we review current understanding of the genetic mechanisms underpinning ABA-mediated stomatal closure, a key means for conserving water under dry conditions, examine how these mechanisms evolved, and discuss what remains to be investigated. PMID:29113039
Epidermal Cell Death in Rice Is Regulated by Ethylene, Gibberellin, and Abscisic Acid
Steffens, Bianka; Sauter, Margret
2005-01-01
Programmed cell death (PCD) of epidermal cells that cover adventitious root primordia in deepwater rice (Oryza sativa) is induced by submergence. Early suicide of epidermal cells may prevent injury to the growing root that emerges under flooding conditions. Induction of PCD is dependent on ethylene signaling and is further promoted by gibberellin (GA). Ethylene and GA act in a synergistic manner, indicating converging signaling pathways. Treatment of plants with GA alone did not promote PCD. Treatment with the GA biosynthesis inhibitor paclobutrazol resulted in increased PCD in response to ethylene and GA presumably due to an increased sensitivity of epidermal cells to GA. Abscisic acid (ABA) was shown to efficiently delay ethylene-induced as well as GA-promoted cell death. The results point to ethylene signaling as a target of ABA inhibition of PCD. Accumulation of ethylene and GA and a decreased ABA level in the rice internode thus favor induction of epidermal cell death and ensure that PCD is initiated as an early response that precedes adventitious root growth. PMID:16169967
Abscisic Acid Metabolism in Relation to Water Stress and Leaf Age in Xanthium strumarium.
Cornish, K; Zeevaart, J A
1984-12-01
Intact plants of Xanthium strumarium L. were subjected to a water stress-recovery cycle. As the stress took effect, leaf growth ceased and stomatal resistance increased. The mature leaves then wilted, followed by the half expanded ones. Water, solute, and pressure potentials fell steadily in all leaves during the rest of the stress period. After 3 days, the young leaves lost turgor and the plants were rewatered. All the leaves rapidly regained turgor and the younger ones recommenced elongation. Stomatal resistance declined, but several days elapsed before pre-stress values were attained.Abscisic acid (ABA) and phaseic acid (PA) levels rose in all the leaves after the mature ones wilted. ABA-glucose ester (ABA-GE) levels increased to a lesser extent, and the young leaves contained little of this conjugate. PA leveled off in the older leaves during the last 24 hours of stress, and ABA levels declined slightly. The young leaves accumulated ABA and PA throughout the stress period and during the 14-hour period immediately following rewatering. The ABA and PA contents, expressed per unit dry weight, were highest in the young leaves. Upon rewatering, large quantities of PA appeared in the mature leaves as ABA levels fell to the pre-stress level within 14 hours. In the half expanded and young leaves, it took several days to reach pre-stress ABA values. ABA-GE synthesis ceased in the mature leaves, once the stress was relieved, but continued in the half expanded and young leaves for 2 days.Mature leaves, when detached and stressed, accumulated an amount of ABA similar to that in leaves on the intact plant. In contrast, detached and stressed young leaves produced little ABA. Detached mature leaves, and to a lesser extent the half expanded ones, rapidly catabolized ABA to PA and ABA-GE, but the young leaves did not. Studies with radioactive (+/-)-ABA indicated that in young leaves the conversion of ABA to PA took place at a much lower rate than in mature ones. Leaves of all
Donini, Pierluigi
1970-01-01
Starvation for a required amino acid of normal or RCstrEscherichia coli infected with T-even phages arrests further synthesis of phage deoxyribonucleic acid (DNA). This amino acid control over phage DNA synthesis does not occur in RCrelE. coli mutants. Heat inactivation of a temperature-sensitive aminoacyl-transfer ribonucleic acid (RNA) synthetase similarly causes an arrest of phage DNA synthesis in infected cells of RCstr phenotype but not in cells of RCrel phenotype. Inhibition of phage DNA synthesis in amino acid-starved RCstr host cells can be reversed by addition of chloramphenicol to the culture. Thus, the general features of amino acid control over T-even phage DNA synthesis are entirely analogous to those known for amino acid control over net RNA synthesis of uninfected bacteria. This analogy shows that the bacterial rel locus controls a wider range of macromolecular syntheses than had been previously thought. PMID:4914067
Abscisic Acid Biosynthesis in Leaves and Roots of Xanthium strumarium1
Creelman, Robert A.; Gage, Douglas A.; Stults, John T.; Zeevaart, Jan A. D.
1987-01-01
Research on the biosynthesis of abscisic acid (ABA) has focused primarily on two pathways: (a) the direct pathway from farnesyl pyrophosphate, and (b) the indirect pathway involving a carotenoid precursor. We have investigated which biosynthetic pathway is operating in turgid and stressed Xanthium leaves, and in stressed Xanthium roots using long-term incubations in 18O2. It was found that in stressed leaves three atoms of 18O from 18O2 are incorporated into the ABA molecule, and that the amount of 18O incorporated increases with time. One 18O atom is incorporated rapidly into the carboxyl group of ABA, whereas the other two atoms are very slowly incorporated into the ring oxygens. The fourth oxygen atom in the carboxyl group of ABA is derived from water. ABA from stressed roots of Xanthium incubated in 18O2 shows a labeling pattern similar to that of ABA in stressed leaves, but with incorporation of more 18O into the tertiary hydroxyl group at C-1′ after 6 and 12 hours than found in ABA from stressed leaves. It is proposed that the precursors to stress-induced ABA are xanthophylls, and that a xanthophyll lacking an oxygen function at C-6 (carotenoid numbering scheme) plays a crucial role in ABA biosynthesis in Xanthium roots. In turgid Xanthium leaves, 18O is incorporated into ABA to a much lesser extent than it is in stressed leaves, whereas exogenously applied 14C-ABA is completely catabolized within 48 hours. This suggests that ABA in turgid leaves is either (a) made via a biosynthetic pathway which is different from the one in stressed leaves, or (b) has a half-life on the order of days as compared with a half-life of 15.5 hours in water-stressed Xanthium leaves. Phaseic acid showed a labeling pattern similar to that of ABA, but with an additional 18O incorporated during 8′-hydroxylation of ABA to phaseic acid. PMID:16665768
Staroske, Nicole; Conrad, Udo; Kumlehn, Jochen; Hensel, Götz; Radchuk, Ruslana; Erban, Alexander; Kopka, Joachim; Weschke, Winfriede; Weber, Hans
2016-04-01
Abscisic acid (ABA) accumulates in seeds during the transition to the seed filling phase. ABA triggers seed maturation, storage activity, and stress signalling and tolerance. Immunomodulation was used to alter the ABA status in barley grains, with the resulting transgenic caryopses responding to the anti-ABA antibody gene expression with increased accumulation of ABA. Calculation of free versus antibody-bound ABA reveals large excess of free ABA, increasing signficantly in caryopses from 10 days after fertilization. Metabolite and transcript profiling in anti-ABA grains expose triggered and enhanced ABA-functions such as transcriptional up-regulation of sucrose-to-starch metabolism, storage protein synthesis and ABA-related signal transduction. Thus, enhanced ABA during transition phases induces precocious maturation but negatively interferes with growth and development. Anti-ABA grains display broad constitutive gene induction related to biotic and abiotic stresses. Most of these genes are ABA- and/or stress-inducible, including alcohol and aldehyde dehydrogenases, peroxidases, chaperones, glutathione-S-transferase, drought- and salt-inducible proteins. Conclusively, ABA immunomodulation results in precocious ABA accumulation that generates an integrated response of stress and maturation. Repression of ABA signalling, occurring in anti-ABA grains, potentially antagonizes effects caused by overshooting production. Finally, mature grain weight and composition are unchanged in anti-ABA plants, although germination is somewhat delayed. This indicates that anti-ABA caryopses induce specific mechanisms to desensitize ABA signalling efficiently, which finally yields mature grains with nearly unchanged dry weight and composition. Such compensation implicates the enormous physiological and metabolic flexibilities of barley grains to adjust effects of unnaturally high ABA amounts in order to ensure and maintain proper grain development. © The Author 2016. Published by
Abscisic Acid (ABA) Regulation of Arabidopsis SR Protein Gene Expression
Cruz, Tiago M. D.; Carvalho, Raquel F.; Richardson, Dale N.; Duque, Paula
2014-01-01
Serine/arginine-rich (SR) proteins are major modulators of alternative splicing, a key generator of proteomic diversity and flexible means of regulating gene expression likely to be crucial in plant environmental responses. Indeed, mounting evidence implicates splicing factors in signal transduction of the abscisic acid (ABA) phytohormone, which plays pivotal roles in the response to various abiotic stresses. Using real-time RT-qPCR, we analyzed total steady-state transcript levels of the 18 SR and two SR-like genes from Arabidopsis thaliana in seedlings treated with ABA and in genetic backgrounds with altered expression of the ABA-biosynthesis ABA2 and the ABA-signaling ABI1 and ABI4 genes. We also searched for ABA-responsive cis elements in the upstream regions of the 20 genes. We found that members of the plant-specific SC35-Like (SCL) Arabidopsis SR protein subfamily are distinctively responsive to exogenous ABA, while the expression of seven SR and SR-related genes is affected by alterations in key components of the ABA pathway. Finally, despite pervasiveness of established ABA-responsive promoter elements in Arabidopsis SR and SR-like genes, their expression is likely governed by additional, yet unidentified cis-acting elements. Overall, this study pinpoints SR34, SR34b, SCL30a, SCL28, SCL33, RS40, SR45 and SR45a as promising candidates for involvement in ABA-mediated stress responses. PMID:25268622
The Physiological Role of Abscisic Acid in Eliciting Turion Morphogenesis.
Smart, C. C.; Fleming, A. J.; Chaloupkova, K.; Hanke, D. E.
1995-01-01
The exogenous application of hormones has led to their implication in a number of processes within the plant. However, proof of their function in vivo depends on quantitative data demonstrating that the exogenous concentration used to elicit a response leads to tissue hormone levels within the physiological range. Such proof is often lacking in many investigations. We are using abscisic acid (ABA)-induced turion formation in Spirodela polyrrhiza L. to investigate the mechanism by which a hormone can trigger a morphogenic switch. In this paper, we demonstrate that the exogenous concentration of ABA used to induce turions leads to tissue concentrations of ABA within the physiological range, as quantified by both enzyme-linked immunosorbent assay and high-performance liquid chromatography/gas chromatography-electron capture detection analysis. These results are consistent with ABA having a physiological role in turion formation, and they provide an estimate of the changes in endogenous ABA concentration required if environmental effectors of turion formation (e.g. nitrate deficiency, cold) act via an increased level of ABA. In addition, we show that the (+)- and (-)-enantiomers of ABA are equally effective in inducing turions. Moreover, comparison of the ABA; levels attained after treatment with (+)-, (-)-, and ([plus or minus])-ABA and their effect on turion induction and comparison of the effectiveness of ABA on turion induction under different pH regimes suggest that ABA most likely interacts with a plasmalemma-located receptor system to induce turion formation. PMID:12228499
Trusov, Yuri; Sewelam, Nasser; Rookes, James Edward; Kunkel, Matt; Nowak, Ekaterina; Schenk, Peer Martin; Botella, José Ramón
2009-04-01
Heterotrimeric G proteins are involved in the defense response against necrotrophic fungi in Arabidopsis. In order to elucidate the resistance mechanisms involving heterotrimeric G proteins, we analyzed the effects of the Gβ (subunit deficiency in the mutant agb1-2 on pathogenesis-related gene expression, as well as the genetic interaction between agb1-2 and a number of mutants of established defense pathways. Gβ-mediated signaling suppresses the induction of salicylic acid (SA)-, jasmonic acid (JA)-, ethylene (ET)- and abscisic acid (ABA)-dependent genes during the initial phase of the infection with Fusarium oxysporum (up to 48 h after inoculation). However, at a later phase it enhances JA/ET-dependent genes such as PDF1.2 and PR4. Quantification of the Fusarium wilt symptoms revealed that Gβ- and SA-deficient mutants were more susceptible than wild-type plants, whereas JA- and ET-insensitive and ABA-deficient mutants demonstrated various levels of resistance. Analysis of the double mutants showed that the Gβ-mediated resistance to F. oxysporum and Alternaria brassicicola was mostly independent of all of the previously mentioned pathways. However, the progressive decay of agb1-2 mutants was compensated by coi1-21 and jin1-9 mutations, suggesting that at this stage of F. oxysporum infection Gβ acts upstream of COI1 and ATMYC2 in JA signaling. © 2008 The Authors. Journal compilation © 2008 Blackwell Publishing Ltd.
Beilby, Mary J; Turi, Christina E; Baker, Teesha C; Tymm, Fiona JM; Murch, Susan J
2015-01-01
Giant-celled Characeae (Chara australis Brown), grown for 4 months on 12/12 hr day/night cycle and summer/autumn temperatures, exhibited distinct concentration maxima in auxin (indole-3-acetic acid; IAA), melatonin and serotonin about 4 hr after subjective daybreak. These concentration peaks persisted after 3 day pretreatment in continuous darkness: confirming a circadian rhythm, rather than a response to “light on.” The plants pretreated for 3 d in continuous light exhibited several large IAA concentration maxima throughout the 24 hr. The melatonin and serotonin concentrations decreased and were less synchronized with IAA. Chara plants grown on 9/15 hr day/night cycle for 4 months and winter/spring temperatures contained much smaller concentrations of IAA, melatonin and serotonin. The IAA concentration maxima were observed in subjective dark phase. Serotonin concentration peaks were weakly correlated with those of IAA. Melatonin concentration was low and mostly independent of circadian cycle. The “dark” IAA concentration peaks persisted in plants treated for 3 d in the dark. The plants pretreated for 3 d in the light again developed more IAA concentration peaks. In this case the concentration maxima in melatonin and serotonin became more synchronous with those in IAA. The abscisic acid (ABA) and jasmonic acid (JA) concentrations were also measured in plants on winter regime. The ABA concentration did not exhibit circadian pattern, while JA concentration peaks were out of phase with those of IAA. The data are discussed in terms of crosstalk between metabolic pathways. PMID:26382914
NASA Astrophysics Data System (ADS)
Enomoto, Hirofumi; Sensu, Takuya; Sato, Kei; Sato, Futoshi; Paxton, Thanai; Yumoto, Emi; Miyamoto, Koji; Asahina, Masashi; Yokota, Takao; Yamane, Hisakazu
2017-02-01
The plant hormone abscisic acid (ABA) and the jasmonic acid related-compound 12-oxo-phytodienoic acid (OPDA) play crucial roles in seed development, dormancy, and germination. However, a lack of suitable techniques for visualising plant hormones has restricted the investigation of their biological mechanisms. In the present study, desorption electrospray ionisation-imaging mass spectrometry (DESI-IMS), a powerful tool for visualising metabolites in biological tissues, was used to visualise ABA and OPDA in immature Phaseolus vulgaris L. seed sections. The mass spectra, peak values and chemical formulae obtained from the analysis of seed sections were consistent with those determined for ABA and OPDA standards, as were the precursor and major fragment ions observed in tandem mass spectrometry (MS/MS) imaging. Furthermore, the precursor and fragment ion images showed similar distribution patterns. In addition, the localisation of ABA and OPDA using DESI-IMS was confirmed using liquid chromatography-MS/MS (LC-MS/MS). The results indicated that ABA was mainly distributed in the radical and cotyledon of the embryo, whereas OPDA was distributed exclusively in external structures, such as the hilum and seed coat. The present study is the first to report the visualisation of plant hormones using IMS, and demonstrates that DESI-IMS is a promising technique for future plant hormone research.
Enomoto, Hirofumi; Sensu, Takuya; Sato, Kei; Sato, Futoshi; Paxton, Thanai; Yumoto, Emi; Miyamoto, Koji; Asahina, Masashi; Yokota, Takao; Yamane, Hisakazu
2017-01-01
The plant hormone abscisic acid (ABA) and the jasmonic acid related-compound 12-oxo-phytodienoic acid (OPDA) play crucial roles in seed development, dormancy, and germination. However, a lack of suitable techniques for visualising plant hormones has restricted the investigation of their biological mechanisms. In the present study, desorption electrospray ionisation-imaging mass spectrometry (DESI-IMS), a powerful tool for visualising metabolites in biological tissues, was used to visualise ABA and OPDA in immature Phaseolus vulgaris L. seed sections. The mass spectra, peak values and chemical formulae obtained from the analysis of seed sections were consistent with those determined for ABA and OPDA standards, as were the precursor and major fragment ions observed in tandem mass spectrometry (MS/MS) imaging. Furthermore, the precursor and fragment ion images showed similar distribution patterns. In addition, the localisation of ABA and OPDA using DESI-IMS was confirmed using liquid chromatography-MS/MS (LC-MS/MS). The results indicated that ABA was mainly distributed in the radical and cotyledon of the embryo, whereas OPDA was distributed exclusively in external structures, such as the hilum and seed coat. The present study is the first to report the visualisation of plant hormones using IMS, and demonstrates that DESI-IMS is a promising technique for future plant hormone research. PMID:28211480
Energetics of amino acid synthesis in hydrothermal ecosystems
NASA Technical Reports Server (NTRS)
Amend, J. P.; Shock, E. L.
1998-01-01
Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.
Savchenko, Tatyana; Kolla, Venkat A; Wang, Chang-Quan; Nasafi, Zainab; Hicks, Derrick R; Phadungchob, Bpantamars; Chehab, Wassim E; Brandizzi, Federica; Froehlich, John; Dehesh, Katayoon
2014-03-01
Membranes are primary sites of perception of environmental stimuli. Polyunsaturated fatty acids are major structural constituents of membranes that also function as modulators of a multitude of signal transduction pathways evoked by environmental stimuli. Different stresses induce production of a distinct blend of oxygenated polyunsaturated fatty acids, "oxylipins." We employed three Arabidopsis (Arabidopsis thaliana) ecotypes to examine the oxylipin signature in response to specific stresses and determined that wounding and drought differentially alter oxylipin profiles, particularly the allene oxide synthase branch of the oxylipin pathway, responsible for production of jasmonic acid (JA) and its precursor 12-oxo-phytodienoic acid (12-OPDA). Specifically, wounding induced both 12-OPDA and JA levels, whereas drought induced only the precursor 12-OPDA. Levels of the classical stress phytohormone abscisic acid (ABA) were also mainly enhanced by drought and little by wounding. To explore the role of 12-OPDA in plant drought responses, we generated a range of transgenic lines and exploited the existing mutant plants that differ in their levels of stress-inducible 12-OPDA but display similar ABA levels. The plants producing higher 12-OPDA levels exhibited enhanced drought tolerance and reduced stomatal aperture. Furthermore, exogenously applied ABA and 12-OPDA, individually or combined, promote stomatal closure of ABA and allene oxide synthase biosynthetic mutants, albeit most effectively when combined. Using tomato (Solanum lycopersicum) and Brassica napus verified the potency of this combination in inducing stomatal closure in plants other than Arabidopsis. These data have identified drought as a stress signal that uncouples the conversion of 12-OPDA to JA and have revealed 12-OPDA as a drought-responsive regulator of stomatal closure functioning most effectively together with ABA.
Nazaruddin, Nazaruddin; Samad, Abdul Fatah A; Sajad, Muhammad; Jani, Jaeyres; Zainal, Zamri; Ismail, Ismanizan
2017-06-01
Persicaria minor (Kesum) is an important medicinal plant with high level of secondary metabolite contents, especially, terpenoids and flavonoids. Previous studies have revealed that application of exogenous phytohormone could increase secondary metabolite contents of the plant. MicroRNAs (miRNAs) are small RNAs that play important regulatory roles in various biological processes. In order to explore the possible role of miRNA in the regulation of these phytohormones signaling pathway and uncovering their potential correlation, we, for the first time, have generated the smallRNA library of Kesum plant. The library was developed in response to methyl jasmonate (MJ) and abscisic acid (ABA) treatment by using next-generation sequencing technology. Raw reads have been deposited to SRA database with the accession numbers, SRX2655642 and SRX2655643 (MJ-treated), SRXSRX2655644 and SRX2655645 (ABA-treated) and SRX2655646and SRX2655647 (Control).
Liu, Tingwu; Jiang, Xinwu; Shi, Wuliang; Chen, Juan; Pei, Zhenming; Zheng, Hailei
2011-05-01
Acid rain is a worldwide environmental issue that has seriously destroyed forest ecosystems. As a highly effective and broad-spectrum plant resistance-inducing agent, β-aminobutyric acid could elevate the tolerance of Arabidopsis when subjected to simulated acid rain. Using comparative proteomic strategies, we analyzed 203 significantly varied proteins of which 175 proteins were identified responding to β-aminobutyric acid in the absence and presence of simulated acid rain. They could be divided into ten groups according to their biological functions. Among them, the majority was cell rescue, development and defense-related proteins, followed by transcription, protein synthesis, folding, modification and destination-associated proteins. Our conclusion is β-aminobutyric acid can lead to a large-scale primary metabolism change and simultaneously activate antioxidant system and salicylic acid, jasmonic acid, abscisic acid signaling pathways. In addition, β-aminobutyric acid can reinforce physical barriers to defend simulated acid rain stress. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Lee, Kyounghee; Lee, Hong Gil; Kim, Hyun Uk; Seo, Pil Joon
2015-01-01
Seed germination is a key developmental transition that initiates the plant life cycle. The timing of germination is determined by the coordinated action of two phytohormones, gibberellin and abscisic acid (ABA). In particular, ABA plays a key role in integrating environmental information and inhibiting the germination process. The utilization of embryonic lipid reserves contributes to seed germination by acting as an energy source, and ABA suppresses lipid degradation to modulate the germination process. Here, we report that the ABA-responsive R2R3-type MYB transcription factor MYB96, which is highly expressed in embryo, regulates seed germination by controlling the expression of ABSCISIC ACID-INSENSITIVE4 (ABI4) in Arabidopsis (Arabidopsis thaliana). In the presence of ABA, germination was accelerated in MYB96-deficient myb96-1 seeds, whereas the process was significantly delayed in MYB96-overexpressing activation-tagging myb96-ox seeds. Consistently, myb96-1 seeds degraded a larger extent of lipid reserves even in the presence of ABA, while reduced lipid mobilization was observed in myb96-ox seeds. MYB96 directly regulates ABI4, which acts as a repressor of lipid breakdown, to define its spatial and temporal expression. Genetic analysis further demonstrated that ABI4 is epistatic to MYB96 in the control of seed germination. Taken together, the MYB96-ABI4 module regulates lipid mobilization specifically in the embryo to ensure proper seed germination under suboptimal conditions. PMID:25869652
Kong, Dongdong; Ju, Chuanli; Parihar, Aisha; Kim, So; Cho, Daeshik; Kwak, June M.
2015-01-01
Seed germination is a critical step in a plant’s life cycle that allows successful propagation and is therefore strictly controlled by endogenous and environmental signals. However, the molecular mechanisms underlying germination control remain elusive. Here, we report that the Arabidopsis (Arabidopsis thaliana) glutamate receptor homolog3.5 (AtGLR3.5) is predominantly expressed in germinating seeds and increases cytosolic Ca2+ concentration that counteracts the effect of abscisic acid (ABA) to promote germination. Repression of AtGLR3.5 impairs cytosolic Ca2+ concentration elevation, significantly delays germination, and enhances ABA sensitivity in seeds, whereas overexpression of AtGLR3.5 results in earlier germination and reduced seed sensitivity to ABA. Furthermore, we show that Ca2+ suppresses the expression of ABSCISIC ACID INSENSITIVE4 (ABI4), a key transcription factor involved in ABA response in seeds, and that ABI4 plays a fundamental role in modulation of Ca2+-dependent germination. Taken together, our results provide molecular genetic evidence that AtGLR3.5-mediated Ca2+ influx stimulates seed germination by antagonizing the inhibitory effects of ABA through suppression of ABI4. These findings establish, to our knowledge, a new and pivotal role of the plant glutamate receptor homolog and Ca2+ signaling in germination control and uncover the orchestrated modulation of the AtGLR3.5-mediated Ca2+ signal and ABA signaling via ABI4 to fine-tune the crucial developmental process, germination, in Arabidopsis. PMID:25681329
Three grape CBF/DREB1 genes respond to low temperature, drought and abscisic acid.
Xiao, Huogen; Siddiqua, Mahbuba; Braybrook, Siobhan; Nassuth, Annette
2006-07-01
The C-repeat (CRT)-binding factor/dehydration-responsive element (DRE) binding protein 1 (CBF/ DREB1) transcription factors control an important pathway for increased freezing and drought tolerance in plants. Three CBF/DREB1-like genes, CBF 1-3, were isolated from both freezing-tolerant wild grape (Vitis riparia) and freezing-sensitive cultivated grape (Vitis vinifera). The deduced proteins in V. riparia are 63-70% identical to each other and 96-98% identical to the corresponding proteins in V. vinifera. All Vitis CBF proteins are 42-51% identical to AtCBF1 and contain CBF-specific amino acid motifs, supporting their identification as CBF proteins. Grape CBF sequences are unique in that they contain 20-29 additional amino acids and three serine stretches. Agro-infiltration experiments revealed that VrCBF1b localizes to the nucleus. VrCBF1a, VrCBF1b and VvCBF1 activated a green fluorescent protein (GFP) or glucuronidase (GUS) reporter gene behind CRT-containing promoters. Expression of the endogenous CBF genes was low at ambient temperature and enhanced upon low temperature (4 degrees C) treatment, first for CBF1, followed by CBF2, and about 2 d later by CBF3. No obvious significant difference was observed between V. riparia and V. vinifera genes. The expression levels of all three CBF genes were higher in young tissues than in older tissues. CBF1, 2 and 3 transcripts also accumulated in response to drought and exogenous abscisic acid (ABA) treatment, indicating that grape contains unique CBF genes.
Yang, Xiaorui; Bai, Yang; Shang, Jianxiu; Xin, Ruijiao; Tang, Wenqiang
2016-09-01
Brassinosteroids (BRs) and abscisic acid (ABA) are plant hormones that antagonistically regulate many aspects of plant growth and development; however, the mechanisms that regulate the crosstalk of these two hormones are still not well understood. BRs regulate plant growth and development by activating BRASSINAZOLE RESISTANT 1 (BZR1) family transcription factors. Here we show that the crosstalk between BRs and ABA signalling is partially mediated by BZR1 regulated gene expression. bzr1-1D is a dominant mutant with enhanced BR signalling; our results showed that bzr1-1D mutant is less sensitive to ABA-inhibited primary root growth. By RNA sequencing, a subset of BZR1 regulated ABA-responsive root genes were identified. Of these genes, the expression of a major ABA signalling component ABA INSENSITIVE 5 (ABI5) was found to be suppressed by BR and by BZR1. Additional evidences showed that BZR1 could bind strongly with several G-box cis-elements in the promoter of ABI5, suppress the expression of ABI5 and make plants less sensitive to ABA. Our study demonstrated that ABI5 is a direct target gene of BZR1, and modulating the expression of ABI5 by BZR1 plays important roles in regulating the crosstalk between the BR and ABA signalling pathways. © 2016 John Wiley & Sons Ltd.
Barkla; Vera-Estrella; Maldonado-Gama; Pantoja
1999-07-01
Abscisic acid (ABA) has been implicated as a key component in water-deficit-induced responses, including those triggered by drought, NaCl, and low- temperature stress. In this study a role for ABA in mediating the NaCl-stress-induced increases in tonoplast H+-translocating ATPase (V-ATPase) and Na+/H+ antiport activity in Mesembryanthemum crystallinum, leading to vacuolar Na+ sequestration, were investigated. NaCl or ABA treatment of adult M. crystallinum plants induced V-ATPase H+ transport activity, and when applied in combination, an additive effect on V-ATPase stimulation was observed. In contrast, treatment of juvenile plants with ABA did not induce V-ATPase activity, whereas NaCl treatment resulted in a similar response to that observed in adult plants. Na+/H+ antiport activity was induced in both juvenile and adult plants by NaCl, but ABA had no effect at either developmental stage. Results indicate that ABA-induced changes in V-ATPase activity are dependent on the plant reaching its adult phase, whereas NaCl-induced increases in V-ATPase and Na+/H+ antiport activity are independent of plant age. This suggests that ABA-induced V-ATPase activity may be linked to the stress-induced, developmentally programmed switch from C3 metabolism to Crassulacean acid metabolism in adult plants, whereas, vacuolar Na+ sequestration, mediated by the V-ATPase and Na+/H+ antiport, is regulated through ABA-independent pathways.
Teaster, Neal D.; Motes, Christy M.; Tang, Yuhong; Wiant, William C.; Cotter, Matthew Q.; Wang, Yuh-Shuh; Kilaru, Aruna; Venables, Barney J.; Hasenstein, Karl H.; Gonzalez, Gabriel; Blancaflor, Elison B.; Chapman, Kent D.
2007-01-01
N-Acylethanolamines (NAEs) are bioactive acylamides that are present in a wide range of organisms. In plants, NAEs are generally elevated in desiccated seeds, suggesting that they may play a role in seed physiology. NAE and abscisic acid (ABA) levels were depleted during seed germination, and both metabolites inhibited the growth of Arabidopsis thaliana seedlings within a similar developmental window. Combined application of low levels of ABA and NAE produced a more dramatic reduction in germination and growth than either compound alone. Transcript profiling and gene expression studies in NAE-treated seedlings revealed elevated transcripts for a number of ABA-responsive genes and genes typically enriched in desiccated seeds. The levels of ABI3 transcripts were inversely associated with NAE-modulated growth. Overexpression of the Arabidopsis NAE degrading enzyme fatty acid amide hydrolase resulted in seedlings that were hypersensitive to ABA, whereas the ABA-insensitive mutants, abi1-1, abi2-1, and abi3-1, exhibited reduced sensitivity to NAE. Collectively, our data indicate that an intact ABA signaling pathway is required for NAE action and that NAE may intersect the ABA pathway downstream from ABA. We propose that NAE metabolism interacts with ABA in the negative regulation of seedling development and that normal seedling establishment depends on the reduction of the endogenous levels of both metabolites. PMID:17766402
Graviresponsiveness and abscisic-acid content of roots of carotenoid-deficient mutants of Zea mays L
NASA Technical Reports Server (NTRS)
Moore, R.; Smith, J. D.
1985-01-01
The abscisic-acid (ABA) content of roots of the carotenoid-deficient w-3, vp-5, and vp-7 mutants of Z. mays was analyzed using gas chromatography-mass spectrometry with an analysis sensitivity of 6 ng ABA g-1 fresh weight (FW). Roots of normal seedlings of the same lines were characterized by the following amounts of ABA (as ng ABA g-1 FW, +/- standard deviation): w-3, 279 +/- 43; vp-5, 237 +/- 26; vp-7, 338 +/- 61. We did not detect any ABA in roots of any of the mutants. Thus, the lack of carotenoids in these mutants correlated positively with the apparent absence of ABA. Primary roots of normal and mutant seedlings were positively gravitropic, with no significant differences in the curvatures of roots of normal as compared with mutant seedlings. These results indicate that ABA 1) is synthesized in maize roots via the carotenoid pathway, and 2) is not necessary for positive gravitropism by primary roots of Z. mays.
Xue, Beibei; Zhang, Aying; Jiang, Mingyi
2009-03-01
Using pharmacological and biochemical approaches, the role of maize polyamine oxidase (MPAO) in abscisic acid (ABA)-induced antioxidant defense in leaves of maize (Zea mays L.) plants was investigated. Exogenous ABA treatment enhanced the expression of the MPAO gene and the activities of apoplastic MPAO. Pretreatment with two different inhibitors for apoplastic MPAO partly reduced hydrogen peroxide (H2O2) accumulation induced by ABA and blocked the ABA-induced expression of the antioxidant genes superoxide dismutase 4 and cytosolic ascorbate peroxidase and the activities of the cytosolic antioxidant enzymes. Treatment with spermidine, the optimum substrate of MPAO, also induced the expression and the activities of the antioxidant enzymes, and the upregulation of the antioxidant enzymes was prevented by two inhibitors of MPAO and two scavengers of H2O2. These results suggest that MPAO contributes to ABA-induced cytosolic antioxidant defense through H2O2, a Spd catabolic product.
Davis, J.W. Jr.
1979-09-21
A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.
Li, Wei; Cui, Xiao; Meng, Zhaolu; Huang, Xiahe; Xie, Qi; Wu, Heng; Jin, Hailing; Zhang, Dabing; Liang, Wanqi
2012-01-01
The accumulation of a number of small RNAs in plants is affected by abscisic acid (ABA) and abiotic stresses, but the underlying mechanisms are poorly understood. The miR168-mediated feedback regulatory loop regulates ARGONAUTE1 (AGO1) homeostasis, which is crucial for gene expression modulation and plant development. Here, we reveal a transcriptional regulatory mechanism by which MIR168 controls AGO1 homeostasis during ABA treatment and abiotic stress responses in Arabidopsis (Arabidopsis thaliana). Plants overexpressing MIR168a and the AGO1 loss-of-function mutant ago1-27 display ABA hypersensitivity and drought tolerance, while the mir168a-2 mutant shows ABA hyposensitivity and drought hypersensitivity. Both the precursor and mature miR168 were induced under ABA and several abiotic stress treatments, but no obvious decrease for the target of miR168, AGO1, was shown under the same conditions. However, promoter activity analysis indicated that AGO1 transcription activity was increased under ABA and drought treatments, suggesting that transcriptional elevation of MIR168a is required for maintaining a stable AGO1 transcript level during the stress response. Furthermore, we showed both in vitro and in vivo that the transcription of MIR168a is directly regulated by four abscisic acid-responsive element (ABRE) binding factors, which bind to the ABRE cis-element within the MIR168a promoter. This ABRE motif is also found in the promoter of MIR168a homologs in diverse plant species. Our findings suggest that transcriptional regulation of miR168 and posttranscriptional control of AGO1 homeostasis may play an important and conserved role in stress response and signal transduction in plants. PMID:22247272
Zhou, Cheng; Zhu, Lin; Xie, Yue; Li, Feiyue; Xiao, Xin; Ma, Zhongyou; Wang, Jianfei
2017-01-01
Soil saline-alkalization is a major abiotic stress that leads to low iron (Fe) availability and high toxicity of sodium ions (Na+) for plants. It has recently been shown that plant growth promoting rhizobacteria (PGPR) can enhance the ability of plants to tolerate multiple abiotic stresses such as drought, salinity, and nutrient deficiency. However, the possible involvement of PGPR in improving saline–alkaline tolerance of plants and the underlying mechanisms remain largely unknown. In this study, we investigated the effects of Bacillus licheniformis (strain SA03) on the growth of Chrysanthemum plants under saline–alkaline conditions. Our results revealed that inoculation with SA03 alleviated saline–alkaline stress in plants with increased survival rates, photosynthesis and biomass. The inoculated plants accumulated more Fe and lower Na+ concentrations under saline–alkaline stress compared with the non-inoculated plants. RNA-Sequencing analyses further revealed that SA03 significantly activated abiotic stress- and Fe acquisition-related pathways in the stress-treated plants. However, SA03 failed to increase saline–alkaline tolerance in plants when cellular abscisic acid (ABA) and nitric oxide (NO) synthesis were inhibited by treatment with fluridone (FLU) and 2-(4-carboxyphenyl)-4,4,5,5-tetramethylimidazoline-1-oxyl-3-oxide (c-PTIO), respectively. Importantly, we also found that NO acted downstream of SA03-induced ABA to activate a series of adaptive responses in host plants under saline–alkaline stress. These findings demonstrated the potential roles of B. licheniformis SA03 in enhancing saline–alkaline tolerance of plants and highlighted the intricate integration of microbial signaling in regulating cellular Fe and Na+ accumulation. PMID:28706529
Blintsov, A N; Gussakovskaya, M A
2004-10-01
An original modification of the standard ELISA procedure for differential determination of different forms of abscisic acid (ABA) is proposed. It is shown that endogenous forms of ABA may be quantitatively determined in plant tissues subjected to minimal treatment, without purification of the hormones and their chemical modification. The modification has been approved when analyzing changes in the content of different ABA forms in plant tissues differing in physiological activity. Quantitative differential determination of changes in the content of different ABA forms has been performed in ovaries of Triticum aestivum L. and Taraxacum officinale Web. in the period of activity of the ovule (from the moment of its activation to the beginning of division). It is shown that, despite the different types of reproduction in the species studied (amphimixis and apomixis), the time course of changes in the content of different forms of ABA in ovaries is similar, which is suggestive of a correlation between the activity of endogenous hormonal system and chronology of main events (e.g., the beginning of endospermogenesis) of the reproductive cycle.
Brandt, Benjamin; Munemasa, Shintaro; Wang, Cun; ...
2015-07-20
One central question is how specificity in cellular responses to the eukaryotic second messenger Ca 2+ is achieved. Plant guard cells, that form stomatal pores for gas exchange, provide a powerful system for in depth investigation of Ca 2+-signaling specificity in plants. In intact guard cells, abscisic acid (ABA) enhances (primes) the Ca 2+-sensitivity of downstream signaling events that result in activation of S-type anion channels during stomatal closure, providing a specificity mechanism in Ca 2+-signaling. However, the underlying genetic and biochemical mechanisms remain unknown. Here we show impairment of ABA signal transduction in stomata of calcium-dependent protein kinase quadruplemore » mutant plants. Interestingly, protein phosphatase 2Cs prevent non-specific Ca 2+-signaling. Moreover, we demonstrate an unexpected interdependence of the Ca 2+-dependent and Ca 2+-independent ABA-signaling branches and the in planta requirement of simultaneous phosphorylation at two key phosphorylation sites in SLAC1. We identify novel mechanisms ensuring specificity and robustness within stomatal Ca 2+-signaling on a cellular, genetic, and biochemical level.« less
Brandt, Benjamin; Munemasa, Shintaro; Wang, Cun; ...
2015-07-29
A central question is how specificity in cellular responses to the eukaryotic second messenger Ca 2+ is achieved. Plant guard cells, that form stomatal pores for gas exchange, provide a powerful system for in depth investigation of Ca 2+-signaling specificity in plants. In intact guard cells, abscisic acid (ABA) enhances (primes) the Ca 2+-sensitivity of downstream signaling events that result in activation of S-type anion channels during stomatal closure, providing a specificity mechanism in Ca 2+-signaling. However, the underlying genetic and biochemical mechanisms remain unknown. Here we show impairment of ABA signal transduction in stomata of calcium-dependent protein kinase quadruplemore » mutant plants. Interestingly, protein phosphatase 2Cs prevent non-specific Ca 2+-signaling. Moreover, we demonstrate an unexpected interdependence of the Ca 2+-dependent and Ca 2+-independent ABA-signaling branches and the in planta requirement of simultaneous phosphorylation at two key phosphorylation sites in SLAC1. We identify novel mechanisms ensuring specificity and robustness within stomatal Ca 2+-signaling on a cellular, genetic, and biochemical level.« less
Leveraging abscisic acid receptors for efficient water use in Arabidopsis
Yang, Zhenyu; Liu, Jinghui; Tischer, Stefanie V.; Christmann, Alexander; Windisch, Wilhelm; Schnyder, Hans; Grill, Erwin
2016-01-01
Plant growth requires the influx of atmospheric CO2 through stomatal pores, and this carbon uptake for photosynthesis is inherently associated with a large efflux of water vapor. Under water deficit, plants reduce transpiration and are able to improve carbon for water exchange leading to higher water use efficiency (WUE). Whether increased WUE can be achieved without trade-offs in plant growth is debated. The signals mediating the WUE response under water deficit are not fully elucidated but involve the phytohormone abscisic acid (ABA). ABA is perceived by a family of related receptors known to mediate acclimation responses and to reduce transpiration. We now show that enhanced stimulation of ABA signaling via distinct ABA receptors can result in plants constitutively growing at high WUE in the model species Arabidopsis. WUE was assessed by three independent approaches involving gravimetric analyses, 13C discrimination studies of shoots and derived cellulose fractions, and by gas exchange measurements of whole plants and individual leaves. Plants expressing the ABA receptors RCAR6/PYL12 combined up to 40% increased WUE with high growth rates, i.e., are water productive. Water productivity was associated with maintenance of net carbon assimilation by compensatory increases of leaf CO2 gradients, thereby sustaining biomass acquisition. Leaf surface temperatures and growth potentials of plants growing under well-watered conditions were found to be reliable indicators for water productivity. The study shows that ABA receptors can be explored to generate more plant biomass per water transpired, which is a prime goal for a more sustainable water use in agriculture. PMID:27247417
Brandt, Benjamin; Munemasa, Shintaro; Wang, Cun; Nguyen, Desiree; Yong, Taiming; Yang, Paul G; Poretsky, Elly; Belknap, Thomas F; Waadt, Rainer; Alemán, Fernando; Schroeder, Julian I
2015-01-01
A central question is how specificity in cellular responses to the eukaryotic second messenger Ca2+ is achieved. Plant guard cells, that form stomatal pores for gas exchange, provide a powerful system for in depth investigation of Ca2+-signaling specificity in plants. In intact guard cells, abscisic acid (ABA) enhances (primes) the Ca2+-sensitivity of downstream signaling events that result in activation of S-type anion channels during stomatal closure, providing a specificity mechanism in Ca2+-signaling. However, the underlying genetic and biochemical mechanisms remain unknown. Here we show impairment of ABA signal transduction in stomata of calcium-dependent protein kinase quadruple mutant plants. Interestingly, protein phosphatase 2Cs prevent non-specific Ca2+-signaling. Moreover, we demonstrate an unexpected interdependence of the Ca2+-dependent and Ca2+-independent ABA-signaling branches and the in planta requirement of simultaneous phosphorylation at two key phosphorylation sites in SLAC1. We identify novel mechanisms ensuring specificity and robustness within stomatal Ca2+-signaling on a cellular, genetic, and biochemical level. DOI: http://dx.doi.org/10.7554/eLife.03599.001 PMID:26192964
Nishiyama, Rie; Watanabe, Yasuko; Fujita, Yasunari; Le, Dung Tien; Kojima, Mikiko; Werner, Tomás; Vankova, Radomira; Yamaguchi-Shinozaki, Kazuko; Shinozaki, Kazuo; Kakimoto, Tatsuo; Sakakibara, Hitoshi; Schmülling, Thomas; Tran, Lam-Son Phan
2011-01-01
Cytokinins (CKs) regulate plant growth and development via a complex network of CK signaling. Here, we perform functional analyses with CK-deficient plants to provide direct evidence that CKs negatively regulate salt and drought stress signaling. All CK-deficient plants with reduced levels of various CKs exhibited a strong stress-tolerant phenotype that was associated with increased cell membrane integrity and abscisic acid (ABA) hypersensitivity rather than stomatal density and ABA-mediated stomatal closure. Expression of the Arabidopsis thaliana ISOPENTENYL-TRANSFERASE genes involved in the biosynthesis of bioactive CKs and the majority of the Arabidopsis CYTOKININ OXIDASES/DEHYDROGENASES genes was repressed by stress and ABA treatments, leading to a decrease in biologically active CK contents. These results demonstrate a novel mechanism for survival under abiotic stress conditions via the homeostatic regulation of steady state CK levels. Additionally, under normal conditions, although CK deficiency increased the sensitivity of plants to exogenous ABA, it caused a downregulation of key ABA biosynthetic genes, leading to a significant reduction in endogenous ABA levels in CK-deficient plants relative to the wild type. Taken together, this study provides direct evidence that mutual regulation mechanisms exist between the CK and ABA metabolism and signals underlying different processes regulating plant adaptation to stressors as well as plant growth and development. PMID:21719693
Abscisic Acid Metabolism in Relation to Water Stress and Leaf Age in Xanthium strumarium1
Cornish, Katrina; Zeevaart, Jan A.D.
1984-01-01
Intact plants of Xanthium strumarium L. were subjected to a water stress-recovery cycle. As the stress took effect, leaf growth ceased and stomatal resistance increased. The mature leaves then wilted, followed by the half expanded ones. Water, solute, and pressure potentials fell steadily in all leaves during the rest of the stress period. After 3 days, the young leaves lost turgor and the plants were rewatered. All the leaves rapidly regained turgor and the younger ones recommenced elongation. Stomatal resistance declined, but several days elapsed before pre-stress values were attained. Abscisic acid (ABA) and phaseic acid (PA) levels rose in all the leaves after the mature ones wilted. ABA-glucose ester (ABA-GE) levels increased to a lesser extent, and the young leaves contained little of this conjugate. PA leveled off in the older leaves during the last 24 hours of stress, and ABA levels declined slightly. The young leaves accumulated ABA and PA throughout the stress period and during the 14-hour period immediately following rewatering. The ABA and PA contents, expressed per unit dry weight, were highest in the young leaves. Upon rewatering, large quantities of PA appeared in the mature leaves as ABA levels fell to the pre-stress level within 14 hours. In the half expanded and young leaves, it took several days to reach pre-stress ABA values. ABA-GE synthesis ceased in the mature leaves, once the stress was relieved, but continued in the half expanded and young leaves for 2 days. Mature leaves, when detached and stressed, accumulated an amount of ABA similar to that in leaves on the intact plant. In contrast, detached and stressed young leaves produced little ABA. Detached mature leaves, and to a lesser extent the half expanded ones, rapidly catabolized ABA to PA and ABA-GE, but the young leaves did not. Studies with radioactive (±)-ABA indicated that in young leaves the conversion of ABA to PA took place at a much lower rate than in mature ones. Leaves of all
WRKY transcription factors: key components in abscisic acid signalling.
Rushton, Deena L; Tripathi, Prateek; Rabara, Roel C; Lin, Jun; Ringler, Patricia; Boken, Ashley K; Langum, Tanner J; Smidt, Lucas; Boomsma, Darius D; Emme, Nicholas J; Chen, Xianfeng; Finer, John J; Shen, Qingxi J; Rushton, Paul J
2012-01-01
WRKY transcription factors (TFs) are key regulators of many plant processes, including the responses to biotic and abiotic stresses, senescence, seed dormancy and seed germination. For over 15 years, limited evidence has been available suggesting that WRKY TFs may play roles in regulating plant responses to the phytohormone abscisic acid (ABA), notably some WRKY TFs are ABA-inducible repressors of seed germination. However, the roles of WRKY TFs in other aspects of ABA signalling, and the mechanisms involved, have remained unclear. Recent significant progress in ABA research has now placed specific WRKY TFs firmly in ABA-responsive signalling pathways, where they act at multiple levels. In Arabidopsis, WRKY TFs appear to act downstream of at least two ABA receptors: the cytoplasmic PYR/PYL/RCAR-protein phosphatase 2C-ABA complex and the chloroplast envelope-located ABAR-ABA complex. In vivo and in vitro promoter-binding studies show that the target genes for WRKY TFs that are involved in ABA signalling include well-known ABA-responsive genes such as ABF2, ABF4, ABI4, ABI5, MYB2, DREB1a, DREB2a and RAB18. Additional well-characterized stress-inducible genes such as RD29A and COR47 are also found in signalling pathways downstream of WRKY TFs. These new insights also reveal that some WRKY TFs are positive regulators of ABA-mediated stomatal closure and hence drought responses. Conversely, many WRKY TFs are negative regulators of seed germination, and controlling seed germination appears a common function of a subset of WRKY TFs in flowering plants. Taken together, these new data demonstrate that WRKY TFs are key nodes in ABA-responsive signalling networks. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.
Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.
Awasthi, Neeraj Praphulla; Singh, R P
2007-01-01
Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %.
[Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].
Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua
2016-03-01
Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis.
Häffner, Eva; Karlovsky, Petr; Splivallo, Richard; Traczewska, Anna; Diederichsen, Elke
2014-04-01
Verticillium longisporum is a soil-borne vascular pathogen infecting cruciferous hosts such as oilseed rape. Quantitative disease resistance (QDR) is the major control means, but its molecular basis is poorly understood so far. Quantitative trait locus (QTL) mapping was performed using a new (Bur×Ler) recombinant inbred line (RIL) population of Arabidopsis thaliana. Phytohormone measurements and analyses in defined mutants and near-isogenic lines (NILs) were used to identify genes and signalling pathways that underlie different resistance QTL. QTL for resistance to V. longisporum-induced stunting, systemic colonization by the fungus and for V. longisporum-induced chlorosis were identified. Stunting resistance QTL were contributed by both parents. The strongest stunting resistance QTL was shown to be identical with Erecta. A functional Erecta pathway, which was present in Bur, conferred partial resistance to V. longisporum-induced stunting. Bur showed severe stunting susceptibility in winter. Three stunting resistance QTL of Ler origin, two co-localising with wall-associated kinase-like (Wakl)-genes, were detected in winter. Furthermore, Bur showed a much stronger induction of salicylic acid (SA) by V. longisporum than Ler. Systemic colonization was controlled independently of stunting. The vec1 QTL on chromosome 2 had the strongest effect on systemic colonization. The same chromosomal region controlled the level of abscisic acid (ABA) and jasmonic acid (JA) in response to V. longisporum: The level of ABA was higher in colonization-susceptible Ler than in colonization-resistant Bur after V. longisporum infection. JA was down-regulated in Bur after infection, but not in Ler. These differences were also demonstrated in NILs, varying only in the region containing vec1. All phytohormone responses were shown to be independent of Erecta. Signalling systems with a hitherto unknown role in the QDR of A. thaliana against V. longisporum were identified: Erecta mediated
Hays, Dirk B.; Wilen, Ronald W.; Sheng, Chuxing; Moloney, Maurice M.; Pharis, Richard P.
1999-01-01
The induction of napin and oleosin gene expression in Brassica napus microspore-derived embryos (MDEs) was studied to assess the possible interaction between abscisic acid (ABA) and jasmonic acid (JA). Napin and oleosin transcripts were detected sooner following treatment with ABA than JA. Treatment of MDEs with ABA plus JA gave an additive accumulation of both napin and oleosin mRNA, the absolute amount being dependent on the concentration of each hormone. Endogenous ABA levels were reduced by 10-fold after treatment with JA, negating the possibility that the observed additive interaction was due to JA-induced ABA biosynthesis. Also, JA did not significantly increase the uptake of [3H-ABA] from the medium into MDEs. This suggests that the additive interaction was not due to an enhanced carrier-mediated ABA uptake by JA. Finally, when JA was added to MDEs that had been treated with the ABA biosynthesis inhibitor fluridone, napin mRNA did not increase. Based on these results with the MDE system, it is possible that embryos of B. napus use endogenous JA to modulate ABA effects on expression of both napin and oleosin. In addition, JA could play a causal role in the reduction of ABA that occurs during late stages of seed development. PMID:10069845
Plastid Located WHIRLY1 Enhances the Responsiveness of Arabidopsis Seedlings Toward Abscisic Acid
Isemer, Rena; Krause, Kirsten; Grabe, Nils; Kitahata, Nobutaka; Asami, Tadao; Krupinska, Karin
2012-01-01
WHIRLY1 is a protein that can be translocated from the plastids to the nucleus, making it an ideal candidate for communicating information between these two compartments. Mutants of Arabidopsis thaliana lacking WHIRLY1 (why1) were shown to have a reduced sensitivity toward salicylic acid (SA) and abscisic acid (ABA) during germination. Germination assays in the presence of abamine, an inhibitor of ABA biosynthesis, revealed that the effect of SA on germination was in fact caused by a concomitant stimulation of ABA biosynthesis. In order to distinguish whether the plastid or the nuclear isoform of WHIRLY1 is adjusting the responsiveness toward ABA, sequences encoding either the complete WHIRLY1 protein or a truncated form lacking the plastid transit peptide were overexpressed in the why1 mutant background. In plants overexpressing the full-length sequence, WHIRLY1 accumulated in both plastids and the nucleus, whereas in plants overexpressing the truncated sequence, WHIRLY1 accumulated exclusively in the nucleus. Seedlings containing recombinant WHIRLY1 in both compartments were hypersensitive toward ABA. In contrast, seedlings possessing only the nuclear form of WHIRLY1 were as insensitive toward ABA as the why1 mutants. ABA was furthermore shown to lower the rate of germination of wildtype seeds even in the presence of abamine which is known to inhibit the formation of xanthoxin, the plastid located precursor of ABA. From this we conclude that plastid located WHIRLY1 enhances the responsiveness of seeds toward ABA even when ABA is supplied exogenously. PMID:23269926
Abscisic acid (ABA) sensitivity regulates desiccation tolerance in germinated Arabidopsis seeds.
Maia, Julio; Dekkers, Bas J W; Dolle, Miranda J; Ligterink, Wilco; Hilhorst, Henk W M
2014-07-01
During germination, orthodox seeds lose their desiccation tolerance (DT) and become sensitive to extreme drying. Yet, DT can be rescued, in a well-defined developmental window, by the application of a mild osmotic stress before dehydration. A role for abscisic acid (ABA) has been implicated in this stress response and in DT re-establishment. However, the path from the sensing of an osmotic cue and its signaling to DT re-establishment is still largely unknown. Analyses of DT, ABA sensitivity, ABA content and gene expression were performed in desiccation-sensitive (DS) and desiccation-tolerant Arabidopsis thaliana seeds. Furthermore, loss and re-establishment of DT in germinated Arabidopsis seeds was studied in ABA-deficient and ABA-insensitive mutants. We demonstrate that the developmental window in which DT can be re-established correlates strongly with the window in which ABA sensitivity is still present. Using ABA biosynthesis and signaling mutants, we show that this hormone plays a key role in DT re-establishment. Surprisingly, re-establishment of DT depends on the modulation of ABA sensitivity rather than enhanced ABA content. In addition, the evaluation of several ABA-insensitive mutants, which can still produce normal desiccation-tolerant seeds, but are impaired in the re-establishment of DT, shows that the acquisition of DT during seed development is genetically different from its re-establishment during germination. © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.
Nelson, David C.; Riseborough, Julie-Anne; Flematti, Gavin R.; Stevens, Jason; Ghisalberti, Emilio L.; Dixon, Kingsley W.; Smith, Steven M.
2009-01-01
Discovery of the primary seed germination stimulant in smoke, 3-methyl-2H-furo[2,3-c]pyran-2-one (KAR1), has resulted in identification of a family of structurally related plant growth regulators, karrikins. KAR1 acts as a key germination trigger for many species from fire-prone, Mediterranean climates, but a molecular mechanism for this response remains unknown. We demonstrate that Arabidopsis (Arabidopsis thaliana), an ephemeral of the temperate northern hemisphere that has never, to our knowledge, been reported to be responsive to fire or smoke, rapidly and sensitively perceives karrikins. Thus, these signaling molecules may have greater significance among angiosperms than previously realized. Karrikins can trigger germination of primary dormant Arabidopsis seeds far more effectively than known phytohormones or the structurally related strigolactone GR-24. Natural variation and depth of seed dormancy affect the degree of KAR1 stimulation. Analysis of phytohormone mutant germination reveals suppression of KAR1 responses by abscisic acid and a requirement for gibberellin (GA) synthesis. The reduced germination of sleepy1 mutants is partially recovered by KAR1, which suggests that germination enhancement by karrikin is only partly DELLA dependent. While KAR1 has little effect on sensitivity to exogenous GA, it enhances expression of the GA biosynthetic genes GA3ox1 and GA3ox2 during seed imbibition. Neither abscisic acid nor GA levels in seed are appreciably affected by KAR1 treatment prior to radicle emergence, despite marked differences in germination outcome. KAR1 stimulation of Arabidopsis germination is light-dependent and reversible by far-red exposure, although limited induction of GA3ox1 still occurs in the dark. The observed requirements for light and GA biosynthesis provide the first insights into the karrikin mode of action. PMID:19074625
Zhao, Huayan; Zhang, Huoming; Cui, Peng; Ding, Feng; Wang, Guangchao; Li, Rongjun; Jenks, Matthew A; Lü, Shiyou; Xiong, Liming
2014-07-01
The ECERIFERUM9 (CER9) gene encodes a putative E3 ubiquitin ligase that functions in cuticle biosynthesis and the maintenance of plant water status. Here, we found that CER9 is also involved in abscisic acid (ABA) signaling in seeds and young seedlings of Arabidopsis (Arabidopsis thaliana). The germinated embryos of the mutants exhibited enhanced sensitivity to ABA during the transition from reversible dormancy to determinate seedling growth. Expression of the CER9 gene is closely related to ABA levels and displays a similar pattern to that of ABSCISIC ACID-INSENSITIVE5 (ABI5), which encodes a positive regulator of ABA responses in seeds. cer9 mutant seeds exhibited delayed germination that is independent of seed coat permeability. Quantitative proteomic analyses showed that cer9 seeds had a protein profile similar to that of the wild type treated with ABA. Transcriptomics analyses revealed that genes involved in ABA biosynthesis or signaling pathways were differentially regulated in cer9 seeds. Consistent with this, high levels of ABA were detected in dry seeds of cer9. Blocking ABA biosynthesis by fluridone treatment or by combining an ABA-deficient mutation with cer9 attenuated the phenotypes of cer9. Whereas introduction of the abi1-1, abi3-1, or abi4-103 mutation could completely eliminate the ABA hypersensitivity of cer9, introduction of abi5 resulted only in partial suppression. These results indicate that CER9 is a novel negative regulator of ABA biosynthesis and the ABA signaling pathway during seed germination. © 2014 American Society of Plant Biologists. All Rights Reserved.
Perata, Pierdomenico; Picciarelli, Piero; Alpi, Amedeo
1990-01-01
Free abscisic acid (ABA) content in suspensors, embryos, and integuments was determined during seed development of Phaseolus coccineus. A highly specific and sensitive solid-phase radioimmunoassay based on a monocional antibody raised against free (S)-ABA was used for ABA quantification. Very small amounts of ABA were detected in the suspensor during initial stages of development; later two peaks of ABA occurred. Levels of ABA in the embryo and integument show a coincident triphasic distribution: two maxima in ABA content occurred when the embryo was 11 to 12 and 15 to 16 millimeters in length; later, when the embryo was 19 to 20 millimeters long, a further increase was observed. The role of ABA in runner bean seeds is discussed in relation to the development of the different seed tissues. PMID:16667915
The P450 Monooxygenase BcABA1 Is Essential for Abscisic Acid Biosynthesis in Botrytis cinerea
Siewers, Verena; Smedsgaard, Jørn; Tudzynski, Paul
2004-01-01
The phytopathogenic ascomycete Botrytis cinerea is known to produce abscisic acid (ABA), which is thought to be involved in host-pathogen interaction. Biochemical analyses had previously shown that, in contrast to higher plants, the fungal ABA biosynthesis probably does not proceed via carotenoids but involves direct cyclization of farnesyl diphosphate and subsequent oxidation steps. We present here evidence that this “direct” pathway is indeed the only one used by an ABA-overproducing strain of B. cinerea. Targeted inactivation of the gene bccpr1 encoding a cytochrome P450 oxidoreductase reduced the ABA production significantly, proving the involvement of P450 monooxygenases in the pathway. Expression analysis of 28 different putative P450 monooxygenase genes revealed two that were induced under ABA biosynthesis conditions. Targeted inactivation showed that one of these, bcaba1, is essential for ABA biosynthesis: ΔBcaba1 mutants contained no residual ABA. Thus, bcaba1 represents the first identified fungal ABA biosynthetic gene. PMID:15240257
Vilaró, Francisca; Canela-Xandri, Anna; Canela, Ramon
2006-09-01
A specific, sensitive, precise, and accurate method for the determination of abscisic acid (ABA) in grapevine leaf tissues is described. The method employs high-performance liquid chromatography and electrospray ionization-mass spectrometry (LC-ESI-MS) in selected ion monitoring mode (SIM) to analyze ABA using a stable isotope-labeled ABA as an internal standard. Absolute recoveries ranged from 72% to 79% using methanol/water pH 5.5 (50:50 v/v) as an extraction solvent. The best efficiency was obtained when the chromatographic separation was carried out by using a porous graphitic carbon (PGC) column. The statistical evaluation of the method was satisfactory in the work range. A relative standard deviation (RDS) of < 5.5% and < 6.0% was obtained for intra-batch and inter-batch comparisons, respectively. As for accuracy, the relative error (%Er) was between -2.7 and 4.3%, and the relative recovery ranged from 95% to 107%.
Abscisic acid regulation of DC8, a carrot embryonic gene. [Daucus carota
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hatzopoulos, P.; Fong, F.; Sung, Z.R.
1990-10-01
DC8 encodes a hydrophylic 66 kilodalton protein located in the cytoplasm and cell walls of carrot (Daucus carota) embryo and endosperm. During somatic embryogenesis, the levels of DC8 mRNA and protein begin to increase 5 days after removal of auxin. To study the role of abscisic acid (ABA) in the regulation of DC8 gene, fluridone, 1-methyl-3-phenyl,-5(3-trifluoro-methyl-phenyl)-4(1H)-pyridinone, was used to inhibit the endogenous ABA content of the embryos. Fluridone, 50 micrograms per milliliter, effectively inhibits the accumulation of ABA in globular-tage embryos. Western and Northern analysis show that when fluridone is added to the culture medium DC8 protein and mRNA decreasemore » to very low levels. ABA added to fluridone supplemented culture media restores the DC8 protein and mRNA to control levels. Globular-stage embryos contain 0.9 to 1.4 {times} 10{sup {minus}7} molar ABA while 10{sup {minus}6} molar exogenously supplied ABA is the optimal concentration for restoration of DC8 protein accumulation in fluridone-treated embryos. The mRNA level is increased after 15 minutes of ABA addition and reaches maximal levels by 60 minutes. Evidence is presented that, unlike other ABA-regulated genes, DC8 is not induced in nonembryonic tissues via desiccation nor addition of ABA.« less
Ruggiero, Bruno; Koiwa, Hisashi; Manabe, Yuzuki; Quist, Tanya M.; Inan, Gunsu; Saccardo, Franco; Joly, Robert J.; Hasegawa, Paul M.; Bressan, Ray A.; Maggio, Albino
2004-01-01
We have identified a T-DNA insertion mutation of Arabidopsis (ecotype C24), named sto1 (salt tolerant), that results in enhanced germination on both ionic (NaCl) and nonionic (sorbitol) hyperosmotic media. sto1 plants were more tolerant in vitro than wild type to Na+ and K+ both for germination and subsequent growth but were hypersensitive to Li+. Postgermination growth of the sto1 plants on sorbitol was not improved. Analysis of the amino acid sequence revealed that STO1 encodes a 9-cis-epoxicarotenoid dioxygenase (similar to 9-cis-epoxicarotenoid dioxygenase GB:AAF26356 [Phaseolus vulgaris] and to NCED3 GB:AB020817 [Arabidopsis]), a key enzyme in the abscisic acid (ABA) biosynthetic pathway. STO1 transcript abundance was substantially reduced in mutant plants. Mutant sto1 plants were unable to accumulate ABA following a hyperosmotic stress, although their basal ABA level was only moderately altered. Either complementation of the sto1 with the native gene from the wild-type genome or supplementation of ABA to the growth medium restored the wild-type phenotype. Improved growth of sto1 mutant plants on NaCl, but not sorbitol, medium was associated with a reduction in both NaCl-induced expression of the ICK1 gene and ethylene accumulation. Osmotic adjustment of sto1 plants was substantially reduced compared to wild-type plants under conditions where sto1 plants grew faster. The sto1 mutation has revealed that reduced ABA can lead to more rapid growth during hyperionic stress by a signal pathway that apparently is at least partially independent of signals that mediate nonionic osmotic responses. PMID:15466233
Liu, Yang; Chen, Xiaoyi; Wang, Xinhui; Fang, Yang; Huang, Mengjun; Guo, Ling; Zhang, Yin; Zhao, Hai
2018-06-22
Duckweed is a valuable feedstock for bioethanol production due to its high biomass and starch accumulation. In our preliminary experiment, we found that abscisic acid (ABA) could simultaneously increase starch and biomass accumulation of duckweed, but the mechanisms are still unclear. The results showed that the biomass production of duckweed reached up to 59.70 and 63.93 g m -2 in 6 days, respectively, with an increase of 7% (P < 0.05) compared to the control. The starch percentage increased from 2.29% up to 46.18% after 14 days of treatment, with a total of starch level 2.6-fold higher than that of the control. Moreover, the level of endogenous ABA, zeatin-riboside (ZR) and indole-3-acetic acid (IAA) increased, while gibberellins (GAs) decreased. Notably, ABA content in treated samples reached 336.5 mg/kg (fresh weight), which was 7.5-fold greater than that of the control. Importantly, the enzyme activities involved in starch biosynthesis increased while those catalyzing starch degradation decreased after ABA application. Taken together, these results indicated that ABA can promote biomass and starch accumulation by regulating endogenous hormone levels and the activity of starch metabolism related key enzymes. These results will provide an operable method for high starch accumulation in duckweed for biofuels production.
Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko
2014-09-01
Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.
Jiang, Jishan; Chen, Zhihong; Ban, Liping; Wu, Yudi; Huang, Jianping; Chu, Jinfang; Fang, Shuang; Wang, Zan; Gao, Hongwen; Wang, Xuemin
2017-01-01
P-HYDROXYPHENYLPYRUVATE DIOXYGENASE (HPPD) is the first committed enzyme involved in the biosynthesis of vitamin E, and is characterized by catalyzing the conversion of p-hydroxyphenyl pyruvate (HPP) to homogentisic acid (HGA). Here, an HPPD gene was cloned from Medicago sativa L. and designated MsHPPD, which was expressed at high levels in alfalfa leaves. PEG 6000 (polyethylene glycol), NaCl, abscisic acid and salicylic acid were shown to significantly induce MsHPPD expression, especially in the cotyledons and root tissues. Overexpression of MsHPPD was found to significantly increase the level of β-tocotrienol and the total vitamin E content in Arabidopsis seeds. Furthermore, these transgenic Arabidopsis seeds exhibited an accelerated germination time, compared with wild-type seeds under normal conditions, as well as under NaCl and ABA treatments. Meanwhile, the expression level of several genes associated with ABA biosynthesis (NCED3, NCED5 and NCED9) and the ABA signaling pathway (RAB18, ABI3 and ABI5) were significantly down-regulated in MsHPPD-overexpressing transgenic lines, as well as the total free ABA content. Taken together, these results demonstrate that MsHPPD functions not only in the vitamin E biosynthetic pathway, but also plays a critical role in seed germination via affecting ABA biosynthesis and signaling. PMID:28084442
NASA Technical Reports Server (NTRS)
Lu, C.; Fedoroff, N.
2000-01-01
Both physiological and genetic evidence indicate interconnections among plant responses to different hormones. We describe a pleiotropic recessive Arabidopsis transposon insertion mutation, designated hyponastic leaves (hyl1), that alters the plant's responses to several hormones. The mutant is characterized by shorter stature, delayed flowering, leaf hyponasty, reduced fertility, decreased rate of root growth, and an altered root gravitropic response. It also exhibits less sensitivity to auxin and cytokinin and hypersensitivity to abscisic acid (ABA). The auxin transport inhibitor 2,3,5-triiodobenzoic acid normalizes the mutant phenotype somewhat, whereas another auxin transport inhibitor, N-(1-naph-thyl)phthalamic acid, exacerbates the phenotype. The gene, designated HYL1, encodes a 419-amino acid protein that contains two double-stranded RNA (dsRNA) binding motifs, a nuclear localization motif, and a C-terminal repeat structure suggestive of a protein-protein interaction domain. We present evidence that the HYL1 gene is ABA-regulated and encodes a nuclear dsRNA binding protein. We hypothesize that the HYL1 protein is a regulatory protein functioning at the transcriptional or post-transcriptional level.
Photoprotectant improves photostability and bioactivity of abscisic acid under UV radiation.
Gao, Fei; Hu, Tanglu; Tan, Weiming; Yu, Chunxin; Li, Zhaohu; Zhang, Lizhen; Duan, Liusheng
2016-05-01
Photosensitivity causes serious drawback for abscisic acid (ABA) application, but preferable methods to stabilize the compound were not found yet. To select an efficient photoprotectant for the improvement of photostability and bioactivity of ABA when exposed to UV light, we tested the effects of a photostabilizer bis(2,2,6,6-tetramethyl-4-piperidinyl) sebacate (HS-770) and two UV absorbers 2-hydroxy-4-n-octoxy-benzophenone (UV-531) and 2-hydroxy-4-methoxybenzophenone-5-sulfonic acid (BP-4) with or without HS-770 on the photodegradation of ABA. Water soluble UV absorber BP-4 and oil soluble UV absorber UV-531 showed significant photo-stabilizing capability on ABA, possibly due to competitive energy absorption of UVB by the UV absorbers. The two absorbers showed no significant difference. Photostabilizer HS-770 accelerated the photodegradation of ABA and did not improve the photo-stabilizing capability of BP-4, likely due to no absorption in UVB region and salt formation with ABA and BP-4. Approximately 26% more ABA was kept when 280mg/l ABA aqueous solution was irradiated by UV light for 2h in the presence of 200mg/l BP-4. What's more, its left bioactivity on wheat seed (JIMAI 22) germination was greatly kept by BP-4, comparing to that of ABA alone. The 300 times diluent of 280mg/l ABA plus 200mg/l BP-4 after 2h irradiation showed more than 13% inhibition on shoot and root growth of wheat seed than that of ABA diluent alone. We concluded that water soluble UV absorber BP-4 was an efficient agent to keep ABA activity under UV radiation. The results could be used to produce photostable products of ABA compound or other water soluble agrichemicals which are sensitive to UV radiation. The frequencies and amounts of the agrichemicals application could be thereafter reduced. Copyright © 2016 Elsevier B.V. All rights reserved.
ERIC Educational Resources Information Center
Forster, Denis; DeKleva, Thomas W.
1986-01-01
Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)
Shu, Kai; Zhou, Wenguan; Yang, Wenyu
2018-02-01
The phytohormones abscisic acid (ABA) and gibberellin (GA) antagonistically mediate diverse plant developmental processes including seed dormancy and germination, root development, and flowering time control, and thus the optimal balance between ABA and GA is essential for plant growth and development. Although more than a half and one century have passed since the initial discoveries of ABA and GA, respectively, the precise mechanisms underlying ABA-GA antagonism still need further investigation. Emerging evidence indicates that two APETALA 2 (AP2)-domain-containing transcription factors (ATFs), ABI4 in Arabidopsis and OsAP2-39 in rice, play key roles in ABA and GA antagonism. These two transcription factors precisely regulate the transcription pattern of ABA and GA biosynthesis or inactivation genes, mediating ABA and GA levels. In this Viewpoint article, we try to shed light on the effects of ATFs on ABA-GA antagonism, and summarize the overlapping but distinct biological functions of these ATFs in the antagonism between ABA and GA. Finally, we strongly propose that further research is needed into the detailed roles of additional numerous ATFs in ABA and GA crosstalk, which will improve our understanding of the antagonism between these two phytohormones. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.
Degu, Asfaw; Ayenew, Biruk; Cramer, Grant R; Fait, Aaron
2016-12-01
Grape-berries are exposed to a plethora of abiotic and biotic stimuli during their development. The developmental and temporal regulation of grape berry polyphenol metabolism in response to various cues was investigated using LC-QTOF-MS based metabolite profiling. High light (2500μmolm(-2)s(-1)), high temperature (40°C), jasmonic acid (200μM), menadione (120μM) and abscisic acid (3.026mM) treatments were applied to detached berries. Greater magnitudes of metabolite fluctuations characterize the pre-veraison berries than the veraison stage in response to the treatments. Furthermore, a tighter co-response of metabolic processes was shown at veraison, likely supporting the resilience to change in response to stress. High temperature and ABA treatments led to greater magnitudes of change during the course of the experiment. The present study demonstrates the occurrence of differential patterns of metabolic responses specific to individual cues and berry developmental stage, which in the field are commonly associated and thus hardly discernable. Copyright © 2016 Elsevier Ltd. All rights reserved.
Mesophyll cells are the main site of abscisic acid biosynthesis in water-stressed leaves.
McAdam, Scott A M; Brodribb, Timothy John
2018-05-07
The hormone abscisic acid (ABA) plays a critical role in enhancing plant survival during water deficit. Recent molecular evidence suggests that ABA is synthesized in the phloem companion cells and guard cells. However, the nature of cell turgor and water status in these two cell types cannot easily account for the rapid, water status-triggered ABA biosynthesis observed in leaves. Here we utilize the unique foliar anatomies of an angiosperm (Hakea lissosperma) and of four conifer species (Saxegothaea conspicua, Podocarpus latifolius, Cephalotaxus harringtonii, and Amentotaxus formosana) in which the mesophyll can be isolated from the vascular tissue to identify the main site of ABA biosynthesis in water-stressed leaves. In all five species tested, considerable ABA biosynthesis occurred in mesophyll tissue that had been separated from vascular tissue. In addition, the removal of the epidermis from the mesophyll in two conifer species had no impact on the observed increase in ABA levels under water deficit. Our results suggest that mesophyll cells are the predominant location of water deficit-triggered ABA biosynthesis in the leaf. {copyright, serif} 2018 American Society of Plant Biologists. All rights reserved.
Involvement of WRKY Transcription Factors in Abscisic-Acid-Induced Cold Tolerance of Banana Fruit.
Luo, Dong-Lan; Ba, Liang-Jie; Shan, Wei; Kuang, Jian-Fei; Lu, Wang-Jin; Chen, Jian-Ye
2017-05-10
Phytohormone abscisic acid (ABA) and plant-specific WRKY transcription factors (TFs) have been implicated to play important roles in various stress responses. The involvement of WRKY TFs in ABA-mediated cold tolerance of economical fruits, such as banana fruit, however remains largely unknown. Here, we reported that ABA application could induce expressions of ABA biosynthesis-related genes MaNCED1 and MaNCED2, increase endogenous ABA contents, and thereby enhance cold tolerance in banana fruit. Four banana fruit WRKY TFs, designated as MaWRKY31, MaWRKY33, MaWRKY60, and MaWRKY71, were identified and characterized. All four of these MaWRKYs were nuclear-localized and displayed transactivation activities. Their expressions were induced by ABA treatment during cold storage. More importantly, the gel mobility shift assay and transient expression analysis revealed that MaWRKY31, MaWRKY33, MaWRKY60, and MaWRKY71 directly bound to the W-box elements in MaNCED1 and MaNCED2 promoters and activated their expressions. Taken together, our findings demonstrate that banana fruit WRKY TFs are involved in ABA-induced cold tolerance by, at least in part, increasing ABA levels via directly activating NECD expressions.
Merlot, Sylvain; Leonhardt, Nathalie; Fenzi, Francesca; Valon, Christiane; Costa, Miguel; Piette, Laurie; Vavasseur, Alain; Genty, Bernard; Boivin, Karine; Müller, Axel; Giraudat, Jérôme; Leung, Jeffrey
2007-07-11
Light activates proton (H(+))-ATPases in guard cells, to drive hyperpolarization of the plasma membrane to initiate stomatal opening, allowing diffusion of ambient CO(2) to photosynthetic tissues. Light to darkness transition, high CO(2) levels and the stress hormone abscisic acid (ABA) promote stomatal closing. The overall H(+)-ATPase activity is diminished by ABA treatments, but the significance of this phenomenon in relationship to stomatal closure is still debated. We report two dominant mutations in the OPEN STOMATA2 (OST2) locus of Arabidopsis that completely abolish stomatal response to ABA, but importantly, to a much lesser extent the responses to CO(2) and darkness. The OST2 gene encodes the major plasma membrane H(+)-ATPase AHA1, and both mutations cause constitutive activity of this pump, leading to necrotic lesions. H(+)-ATPases have been traditionally assumed to be general endpoints of all signaling pathways affecting membrane polarization and transport. Our results provide evidence that AHA1 is a distinct component of an ABA-directed signaling pathway, and that dynamic downregulation of this pump during drought is an essential step in membrane depolarization to initiate stomatal closure.
Role of fatty-acid synthesis in dendritic cell generation and function.
Rehman, Adeel; Hemmert, Keith C; Ochi, Atsuo; Jamal, Mohsin; Henning, Justin R; Barilla, Rocky; Quesada, Juan P; Zambirinis, Constantinos P; Tang, Kerry; Ego-Osuala, Melvin; Rao, Raghavendra S; Greco, Stephanie; Deutsch, Michael; Narayan, Suchithra; Pachter, H Leon; Graffeo, Christopher S; Acehan, Devrim; Miller, George
2013-05-01
Dendritic cells (DC) are professional APCs that regulate innate and adaptive immunity. The role of fatty-acid synthesis in DC development and function is uncertain. We found that blockade of fatty-acid synthesis markedly decreases dendropoiesis in the liver and in primary and secondary lymphoid organs in mice. Human DC development from PBMC precursors was also diminished by blockade of fatty-acid synthesis. This was associated with higher rates of apoptosis in precursor cells and increased expression of cleaved caspase-3 and BCL-xL and downregulation of cyclin B1. Further, blockade of fatty-acid synthesis decreased DC expression of MHC class II, ICAM-1, B7-1, and B7-2 but increased their production of selected proinflammatory cytokines including IL-12 and MCP-1. Accordingly, inhibition of fatty-acid synthesis enhanced DC capacity to activate allogeneic as well as Ag-restricted CD4(+) and CD8(+) T cells and induce CTL responses. Further, blockade of fatty-acid synthesis increased DC expression of Notch ligands and enhanced their ability to activate NK cell immune phenotype and IFN-γ production. Because endoplasmic reticulum (ER) stress can augment the immunogenic function of APC, we postulated that this may account for the higher DC immunogenicity. We found that inhibition of fatty-acid synthesis resulted in elevated expression of numerous markers of ER stress in humans and mice and was associated with increased MAPK and Akt signaling. Further, lowering ER stress by 4-phenylbutyrate mitigated the enhanced immune stimulation associated with fatty-acid synthesis blockade. Our findings elucidate the role of fatty-acid synthesis in DC development and function and have implications to the design of DC vaccines for immunotherapy.
Mazumder, Mrinmoy; Das, Srirupa; Saha, Upala; Chatterjee, Madhuvanti; Bannerjee, Kaushik; Basu, Debabrata
2013-09-01
This work addresses the changes in the phytohormonal signature in the recognition of the necrotrophic fungal pathogen Alternaria brassicicola by susceptible Brassica juncea and resistant Sinapis alba. Although B. juncea, S. alba and Arabidopsis all belong to the same family, Brassicaceae, the phytohormonal response of susceptible B. juncea towards this pathogen is unique because the latter two species express non-host resistance. The differential expression of the PR1 gene and the increased level of salicylic acid (SA) indicated that an SA-mediated biotrophic mode of defence response was triggered in B. juncea upon challenge with the pathogen. Compared to B. juncea, resistant S. alba initiated enhanced abscisic acid (ABA) and jasmonic acid (JA) responses following challenge with this pathogen, as revealed by monitoring the expression of ABA-related genes along with the concentration of ABA and JA. Furthermore, these results were verified by the exogenous application of ABA on B. juncea leaves prior to challenge with A. brassicicola, which resulted in a delayed disease progression, followed by the inhibition of the pathogen-mediated increase in SA response and enhanced JA levels. Therefore, it seems that A. brassicicola is steering the defence response towards a biotrophic mode by mounting an SA response in susceptible B. juncea, whereas the enhanced ABA response of S. alba not only counteracts the SA response but also restores the necrotrophic mode of resistance by enhancing JA biosynthesis. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
Regulation of protein synthesis by amino acids in muscle of neonates
Suryawan, Agus; Davis, Teresa A.
2011-01-01
The marked increase in skeletal muscle mass during the neonatal period is largely due to a high rate of postprandial protein synthesis that is modulated by an enhanced sensitivity to insulin and amino acids. The amino acid signaling pathway leading to the stimulation of protein synthesis has not been fully elucidated. Among the amino acids, leucine is considered to be a principal anabolic agent that regulates protein synthesis. mTORC1, which controls protein synthesis, has been implicated as a target for leucine. Until recently, there have been few studies exploring the role of amino acids in enhancing muscle protein synthesis in vivo. In this review, we discuss amino acid-induced protein synthesis in muscle in the neonate, focusing on current knowledge of the role of amino acids in the activation of mTORC1 leading to mRNA translation. The role of the amino acid transporters, SNAT2, LAT1, and PAT, in the modulation of mTORC1 activation and the role of amino acids in the activation of putative regulators of mTORC1, i.e., raptor, Rheb, MAP4K3, Vps34, and Rag GTPases, are discussed. PMID:21196241
Synthesis of alpha-amino acids
Davis, Jr., Jefferson W.
1983-01-01
A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.
Synthesis of alpha-amino acids
Davis, Jr., Jefferson W.
1983-01-01
A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.
Glennon, Elizabeth K K; Torrevillas, Brandi K; Morrissey, Shannon F; Ejercito, Jadrian M; Luckhart, Shirley
2017-07-13
Abscisic acid (ABA) is naturally present in mammalian blood and circulating levels can be increased by oral supplementation. We showed previously that oral ABA supplementation in a mouse model of Plasmodium yoelii 17XNL infection reduced parasitemia and gametocytemia, spleen and liver pathology, and parasite transmission to the mosquito Anopheles stephensi fed on these mice. Treatment of cultured Plasmodium falciparum with ABA at levels detected in our model had no effects on asexual growth or gametocyte formation in vitro. However, ABA treatment of cultured P. falciparum immediately prior to mosquito feeding significantly reduced oocyst development in A. stephensi via ABA-dependent synthesis of nitric oxide (NO) in the mosquito midgut. Here we describe the mechanisms of effects of ABA on mosquito physiology, which are dependent on phosphorylation of TGF-β-activated kinase 1 (TAK1) and associated with changes in homeostatic gene expression and activity of kinases that are central to metabolic regulation in the midgut epithelium. Collectively, the timing of these effects suggests a transient physiological shift that enhances NF-κB-dependent innate immunity without significantly altering mosquito lifespan or fecundity. ABA is a highly conserved regulator of immune and metabolic homeostasis within the malaria vector A. stephensi with potential as a transmission-blocking supplemental treatment.
Synthesis of new kojic acid based unnatural α-amino acid derivatives.
Balakrishna, C; Payili, Nagaraju; Yennam, Satyanarayana; Uma Devi, P; Behera, Manoranjan
2015-11-01
An efficient method for the preparation of kojic acid based α-amino acid derivatives by alkylation of glycinate schiff base with bromokojic acids have been described. Using this method, mono as well as di alkylated kojic acid-amino acid conjugates have been prepared. This is the first synthesis of C-linked kojic acid-amino acid conjugate where kojic acid is directly linked to amino acid through a C-C bond. Copyright © 2015 Elsevier Ltd. All rights reserved.
Alonso, Rodrigo; Berli, Federico J; Fontana, Ariel; Piccoli, Patricia; Bottini, Rubén
2016-12-01
High-altitude vineyards receive elevated solar ultraviolet-B (UV-B) levels so producing high quality berries for winemaking because of induction in the synthesis of phenolic compounds. Water deficit (D) after veraison, is a commonly used tool to regulate berry polyphenols concentration in red wine cultivars. Abscisic acid (ABA) plays a crucial role in the acclimation to environmental factors/signals (including UV-B and D). The aim of the present study was to evaluate independent and interactive effects of high-altitude solar UV-B, moderate water deficit and ABA applications on Vitis vinifera cv. Malbec berries. The experiment was conducted during two growing seasons with two treatments of UV-B (+UV-B and -UV-B), watering (+D and -D) and ABA (+ABA and -ABA), in a factorial design. Berry fresh weight, sugar content, fruit yield, phenolic compounds profile and antioxidant capacity (ORAC) were analyzed at harvest. Previous incidence of high UV-B prevented deleterious effects of water deficit, i.e. berry weight reduction and diminution of sugar accumulation. High UV-B increased total phenols (mainly astilbin, quercetin and kaempferol) and ORAC, irrespectively of the combination with other factors. Fruit yield was reduced by combining water deficit and high UV-B or water deficit and ABA. Two applications of ABA were enough to induced biochemical changes increasing total anthocyanins, especially those with higher antioxidant capacity. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Role of Fatty-acid Synthesis in Dendritic Cell Generation and Function
Rehman, Adeel; Hemmert, Keith C.; Ochi, Atsuo; Jamal, Mohsin; Henning, Justin R.; Barilla, Rocky; Quesada, Juan P.; Zambirinis, Constantinos P.; Tang, Kerry; Ego-Osuala, Melvin; Rao, Raghavendra S.; Greco, Stephanie; Deutsch, Michael; Narayan, Suchithra; Pachter, H. Leon; Graffeo, Christopher S.; Acehan, Devrim; Miller, George
2013-01-01
Dendritic cells (DC) are professional antigen presenting cells that regulate innate and adaptive immunity. The role of fatty-acid synthesis in DC development and function is uncertain. We found that blockade of fatty-acid synthesis markedly decreases dendropoiesis in the liver and in primary and secondary lymphoid organs in mice. Human DC development from PBMC precursors was also diminished by blockade of fatty-acid synthesis. This was associated with higher rates of apoptosis in precursor cells and increased expression of Cleaved Caspase 3 and BCL-xL, and down-regulation of Cyclin B1. Further, blockade of fatty-acid synthesis decreased DC expression of MHCII, ICAM-1, B7-1, B7-2 but increased their production of selected pro-inflammatory cytokines including IL-12 and MCP-1. Accordingly, inhibition of fatty-acid synthesis enhanced DC capacityto activate allogeneic as well as antigen-restricted CD4+ and CD8+ T cells and induce CTL responses. Further, blockade of fatty-acid synthesis increased DC expression of Notch ligands and enhanced their ability to activate NK cell immune-phenotype and IFN-γ production. Since endoplasmic reticular (ER)-stress can augment the immunogenic function of APC, we postulated that this may account for the higher DC immunogenicity. We found that inhibition of fatty-acid synthesis resulted in elevated expression of numerous markers of ER stress in humans and mice and was associated with increased MAP kinase and Akt signaling. Further, lowering ER-stress by 4-phenylbutyrate mitigated the enhanced immune-stimulation associated with fatty-acid synthesis blockade. Our findings elucidate the role of fatty-acid synthesis in DC development and function and have implications to the design of DC vaccines for immunotherapy. PMID:23536633
Abscisic acid ameliorates the systemic sclerosis fibroblast phenotype in vitro
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bruzzone, Santina, E-mail: santina.bruzzone@unige.it; Centre of Excellence for Biomedical Research, University of Genova, Viale Benedetto XV 9, 16132 Genova; Advanced Biotechnology Center, Largo Rosanna Benzi 10, 16132 Genova
Highlights: Black-Right-Pointing-Pointer ABA is an endogenous hormone in humans, regulating different cell responses. Black-Right-Pointing-Pointer ABA reverts some of the functions altered in SSc fibroblasts to a normal phenotype. Black-Right-Pointing-Pointer UV-B irradiation increases ABA content in SSc cultures. Black-Right-Pointing-Pointer SSc fibroblasts could benefit from exposure to ABA and/or to UV-B. -- Abstract: The phytohormone abscisic acid (ABA) has been recently identified as an endogenous hormone in humans, regulating different cell functions, including inflammatory processes, insulin release and glucose uptake. Systemic sclerosis (SSc) is a chronic inflammatory disease resulting in fibrosis of skin and internal organs. In this study, we investigated themore » effect of exogenous ABA on fibroblasts obtained from healthy subjects and from SSc patients. Migration of control fibroblasts induced by ABA was comparable to that induced by transforming growth factor-{beta} (TGF-{beta}). Conversely, migration toward ABA, but not toward TGF-{beta}, was impaired in SSc fibroblasts. In addition, ABA increased cell proliferation in fibroblasts from SSc patients, but not from healthy subjects. Most importantly, presence of ABA significantly decreased collagen deposition by SSc fibroblasts, at the same time increasing matrix metalloproteinase-1 activity and decreasing the expression level of tissue inhibitor of metalloproteinase (TIMP-1). Thus, exogenously added ABA appeared to revert some of the functions altered in SSc fibroblasts to a normal phenotype. Interestingly, ABA levels in plasma from SSc patients were found to be significantly lower than in healthy subjects. UV-B irradiation induced an almost 3-fold increase in ABA content in SSc cultures. Altogether, these results suggest that the fibrotic skin lesions in SSc patients could benefit from exposure to high(er) ABA levels.« less
Rewiring protein synthesis: From natural to synthetic amino acids.
Fan, Yongqiang; Evans, Christopher R; Ling, Jiqiang
2017-11-01
The protein synthesis machinery uses 22 natural amino acids as building blocks that faithfully decode the genetic information. Such fidelity is controlled at multiple steps and can be compromised in nature and in the laboratory to rewire protein synthesis with natural and synthetic amino acids. This review summarizes the major quality control mechanisms during protein synthesis, including aminoacyl-tRNA synthetases, elongation factors, and the ribosome. We will discuss evolution and engineering of such components that allow incorporation of natural and synthetic amino acids at positions that deviate from the standard genetic code. The protein synthesis machinery is highly selective, yet not fixed, for the correct amino acids that match the mRNA codons. Ambiguous translation of a codon with multiple amino acids or complete reassignment of a codon with a synthetic amino acid diversifies the proteome. Expanding the genetic code with synthetic amino acids through rewiring protein synthesis has broad applications in synthetic biology and chemical biology. Biochemical, structural, and genetic studies of the translational quality control mechanisms are not only crucial to understand the physiological role of translational fidelity and evolution of the genetic code, but also enable us to better design biological parts to expand the proteomes of synthetic organisms. This article is part of a Special Issue entitled "Biochemistry of Synthetic Biology - Recent Developments" Guest Editor: Dr. Ilka Heinemann and Dr. Patrick O'Donoghue. Copyright © 2017 Elsevier B.V. All rights reserved.
Transaminases for the synthesis of enantiopure beta-amino acids
2012-01-01
Optically pure β-amino acids constitute interesting building blocks for peptidomimetics and a great variety of pharmaceutically important compounds. Their efficient synthesis still poses a major challenge. Transaminases (also known as aminotransferases) possess a great potential for the synthesis of optically pure β-amino acids. These pyridoxal 5'-dependent enzymes catalyze the transfer of an amino group from a donor substrate to an acceptor, thus enabling the synthesis of a wide variety of chiral amines and amino acids. Transaminases can be applied either for the kinetic resolution of racemic compounds or the asymmetric synthesis starting from a prochiral substrate. This review gives an overview over microbial transaminases with activity towards β-amino acids and their substrate spectra. It also outlines current strategies for the screening of new biocatalysts. Particular emphasis is placed on activity assays which are applicable to high-throughput screening. PMID:22293122
Gao, Shan; Guo, Wenya; Feng, Wen; Liu, Liang; Song, Xiaorui; Chen, Jian; Hou, Wei; Zhu, Hongxia; Tang, Saijun; Hu, Jian
2016-04-01
Several plant lipid transfer proteins (LTPs) act positively in plant disease resistance. Here, we show that LTP3 (At5g59320), a pathogen and abscisic acid (ABA)-induced gene, negatively regulates plant immunity in Arabidopsis. The overexpression of LTP3 (LTP3-OX) led to an enhanced susceptibility to virulent bacteria and compromised resistance to avirulent bacteria. On infection of LTP3-OX plants with Pseudomonas syringae pv. tomato, genes involved in ABA biosynthesis, NCED3 and AAO3, were highly induced, whereas salicylic acid (SA)-related genes, ICS1 and PR1, were down-regulated. Accordingly, in LTP3-OX plants, we observed increased ABA levels and decreased SA levels relative to the wild-type. We also showed that the LTP3 overexpression-mediated enhanced susceptibility was partially dependent on AAO3. Interestingly, loss of function of LTP3 (ltp3-1) did not affect ABA pathways, but resulted in PR1 gene induction and elevated SA levels, suggesting that LTP3 can negatively regulate SA in an ABA-independent manner. However, a double mutant consisting of ltp3-1 and silent LTP4 (ltp3/ltp4) showed reduced susceptibility to Pseudomonas and down-regulation of ABA biosynthesis genes, suggesting that LTP3 acts in a redundant manner with its closest homologue LTP4 by modulating the ABA pathway. Taken together, our data show that LTP3 is a novel negative regulator of plant immunity which acts through the manipulation of the ABA-SA balance. © 2015 BSPP and John Wiley & Sons Ltd.
Wang, Junfang; Wang, Shuqin; Liu, Guotian; Edwards, Everard J.; Duan, Wei; Li, Shaohua; Wang, Lijun
2016-01-01
Resveratrols are polyphenolic secondary metabolites that can benefit human health, and only occur in a few plant families including Vitaceae. It has been reported that abscisic acid (ABA) can induce veraison (the onset of grape berry ripening) and may induce the accumulation of resveratrol in berry skin. However, the relationships between ABA, veraison, the accumulation of anthocyanins and the accumulation of resveratrol in the berry are poorly understood. This study attempted to answer this question through an investigation of the effect of applied ABA and fluridone (a synthetic inhibitor of ABA) on the biosynthesis and accumulation of ABA, anthocyanin, and resveratrol in Beihong (Vitis vinifera × Vitis amurensis) berry skin. Under natural conditions, resveratrol concentration was very low before 91 DAA (days after anthesis), i.e., 2 weeks after veraison, however, it increased sharply from this point to 126 DAA (maturity). Exogenous ABA applications all resulted in an increase in berry skin ABA and anthocyanin concentration, irrespective of the developmental stage at which the treatment occurred (20 and 10 days pre-veraison, veraison or 7 days post-veraison), thereby advancing veraison. In contrast, resveratrol concentration increased only when ABA was applied at 10 days pre-veraison or at veraison. As a result, the accumulation of resveratrol was associated with veraison in grape berry skin and this accumulation, together with that of anthocyanins, was associated with ABA concentration. The response of resveratrol biosynthesis in the berry skin to manipulation of ABA varied during berry development and was less sensitive to ABA than the response of anthocyanin biosynthesis. PMID:27857716
Raschke, K; Zeevaart, J A
1976-08-01
Among the four uppermost leaves of greenhouse-grown plants of Xanthium strumarium L. the content of abscisic acid per unit fresh or dry weight was highest in the youngest leaf and decreased gradually with increasing age of the leaves. Expressed per leaf, the second youngest leaf was richest in ABA; the amount of ABA per leaf declined only slightly as the leaves expanded. Transpiration and stomatal conductance were negatively correlated with the ABA concentration in the leaves; the youngest leaf lost the least amount of water. This correlation was always very good if the youngest leaf was compared with the older leaves but not always good among the older leaves. Since stomatal sensitivity to exogenous (+/-)-ABA was the same in leaves of all four age groups ABA may be in at least two compartments in the leaf, one of which is isolated from the guard cells.The ability to synthesize ABA in response to wilting or chilling was strongly expressed in young leaves and declined with leaf age. There was no difference between leaves in their content of the metabolites of ABA, phaseic, and dihydrophaseic acid, expressed per unit weight.
Koyama, Renata; Roberto, Sergio R.; de Souza, Reginaldo T.; Borges, Wellington F. S.; Anderson, Mauri; Waterhouse, Andrew L.; Cantu, Dario; Fidelibus, Matthew W.; Blanco-Ulate, Barbara
2018-01-01
Hybrid (Vitis vinifera ×Vitis labrusca) table grape cultivars grown in the subtropics often fail to accumulate sufficient anthocyanins to achieve good uniform berry color. Growers of V. vinifera table grapes in temperate regions generally use ethephon and, more recently, (S)-cis-abscisic acid (S-ABA) to overcome this problem. The objective of this study was to determine if S-ABA applications at different timings and concentrations have an effect on anthocyanin regulatory and biosynthetic genes, pigment accumulation, and berry color of the Selection 21 cultivar, a new V. vinifera ×V. labrusca hybrid seedless grape that presents lack of red color when grown in subtropical areas. Applications of S-ABA 400 mg/L resulted in a higher accumulation of total anthocyanins and of the individual anthocyaninsanthocyanins: delphinidin-3-glucoside, cyanidin-3-glucoside, peonidin-3-glucoside, and malvidin-3-glucoside in the berry skin and improved the color attributes of the berries. Treatment with two applications at 7 days after véraison (DAV) and 21 DAV of S-ABA 400 mg/L resulted in a higher accumulation of total anthocyanins in the skin of berries and increased the gene expression of CHI, F3H, DFR, and UFGT and of the VvMYBA1 and VvMYBA2 transcription factors in the seedless grape cultivar. PMID:29632542
Seiler, Christiane; Harshavardhan, Vokkaliga T.; Reddy, Palakolanu S.; Hensel, Götz; Kumlehn, Jochen; Eschen-Lippold, Lennart; Rajesh, Kalladan; Korzun, Viktor; Wobus, Ulrich; Lee, Justin; Selvaraj, Gopalan; Sreenivasulu, Nese
2014-01-01
Abscisic acid (ABA) is a central player in plant responses to drought stress. How variable levels of ABA under short-term versus long-term drought stress impact assimilation and growth in crops is unclear. We addressed this through comparative analysis, using two elite breeding lines of barley (Hordeum vulgare) that show senescence or stay-green phenotype under terminal drought stress and by making use of transgenic barley lines that express Arabidopsis (Arabidopsis thaliana) 9-cis-epoxycarotenoid dioxygenase (AtNCED6) coding sequence or an RNA interference (RNAi) sequence of ABA 8′-hydroxylase under the control of a drought-inducible barley promoter. The high levels of ABA and its catabolites in the senescing breeding line under long-term stress were detrimental for assimilate productivity, whereas these levels were not perturbed in the stay-green type that performed better. In transgenic barley, drought-inducible AtNCED expression afforded temporal control in ABA levels such that the ABA levels rose sooner than in wild-type plants but also subsided, unlike as in the wild type , to near-basal levels upon prolonged stress treatment due to down-regulation of endogenous HvNCED genes. Suppressing of ABA catabolism with the RNA interference approach of ABA 8′-hydroxylase caused ABA flux during the entire period of stress. These transgenic plants performed better than the wild type under stress to maintain a favorable instantaneous water use efficiency and better assimilation. Gene expression analysis, protein structural modeling, and protein-protein interaction analyses of the members of the PYRABACTIN RESISTANCE1/PYRABACTIN RESISTANCE1-LIKE/REGULATORY COMPONENT OF ABA RECEPTORS, TYPE 2C PROTEIN PHOSPHATASE Sucrose non-fermenting1-related protein kinase2, and ABA-INSENSITIVE5/ABA-responsive element binding factor family identified specific members that could potentially impact ABA metabolism and stress adaptation in barley. PMID:24610749
Genetics Home Reference: congenital bile acid synthesis defect type 1
... type 1 Congenital bile acid synthesis defect type 1 Printable PDF Open All Close All Enable Javascript to view the expand/collapse boxes. Description Congenital bile acid synthesis defect type 1 ...
The Dynamics of Embolism Refilling in Abscisic Acid (ABA)-Deficient Tomato Plants
Secchi, Francesca; Perrone, Irene; Chitarra, Walter; Zwieniecka, Anna K.; Lovisolo, Claudio; Zwieniecki, Maciej A.
2013-01-01
Plants are in danger of embolism formation in xylem vessels when the balance between water transport capacity and transpirational demand is compromised. To maintain this delicate balance, plants must regulate the rate of transpiration and, if necessary, restore water transport in embolized vessels. Abscisic acid (ABA) is the dominant long-distance signal responsible for plant response to stress, and it is possible that it plays a role in the embolism/refilling cycle. To test this idea, a temporal analysis of embolism and refilling dynamics, transpiration rate and starch content was performed on ABA-deficient mutant tomato plants. ABA-deficient mutants were more vulnerable to embolism formation than wild-type plants, and application of exogenous ABA had no effect on vulnerability. However, mutant plants treated with exogenous ABA had lower stomatal conductance and reduced starch content in the xylem parenchyma cells. The lower starch content could have an indirect effect on the plant’s refilling activity. The results confirm that plants with high starch content (moderately stressed mutant plants) were more likely to recover from loss of water transport capacity than plants with low starch content (mutant plants with application of exogenous ABA) or plants experiencing severe water stress. This study demonstrates that ABA most likely does not play any direct role in embolism refilling, but through the modulation of carbohydrate content, it could influence the plant’s capacity for refilling. PMID:23263667
Abscisic acid signaling is controlled by a BRANCHED1/HD-ZIP I cascade in Arabidopsis axillary buds.
González-Grandío, Eduardo; Pajoro, Alice; Franco-Zorrilla, José M; Tarancón, Carlos; Immink, Richard G H; Cubas, Pilar
2017-01-10
Shoot-branching patterns determine key aspects of plant life and are important targets for crop breeding. However, we are still largely ignorant of the genetic networks controlling locally the most important decision during branch development: whether the axillary bud, or branch primordium, grows out to give a lateral shoot or remains dormant. Here we show that, inside the buds, the TEOSINTE BRANCHED1, CYCLOIDEA, PCF (TCP) transcription factor BRANCHED1 (BRC1) binds to and positively regulates the transcription of three related Homeodomain leucine zipper protein (HD-ZIP)-encoding genes: HOMEOBOX PROTEIN 21 (HB21), HOMEOBOX PROTEIN 40 (HB40), and HOMEOBOX PROTEIN 53 (HB53). These three genes, together with BRC1, enhance 9-CIS-EPOXICAROTENOID DIOXIGENASE 3 (NCED3) expression, lead to abscisic acid accumulation, and trigger hormone response, thus causing suppression of bud development. This TCP/HD-ZIP genetic module seems to be conserved in dicot and monocotyledonous species to prevent branching under light-limiting conditions.
Johnson-Flanagan, Anne M.; Huiwen, Zhong; Thiagarajah, Mohan R.; Saini, Hargurdeep S.
1991-01-01
Brassica napus suspension-cultured cells could be hardened in 6 days at 25°C by the addition of mefluidide or ABA to the culture medium. Cells treated with mefluidide (10 milligrams per liter) or ABA (50 micromolar) attained an LT50 of −17.5°C or −18°C, respectively, while the LT50 for the comparable nonhardened control (sucrose) was −10°C. The increased freezing tolerance of mefluidide-treated cells was paralleled by a 4- to 23-fold increase in ABA, as measured by gas-liquid chromatography using electron capture detection. Application of 1 milligram per liter of fluridone, an inhibitor of abscisic acid biosynthesis, prevented the mefluidide-induced increase in freezing tolerance and the accumulation of ABA. Both these inhibitory effects of fluridone were overridden by 50 micromolar ABA in the culture medium. On the basis of these results, we concluded that increased ABA levels are important for the induction of freezing tolerance in suspension-cultured cells. PMID:16668089
Barkla, Bronwyn J.; Vera-Estrella, Rosario; Maldonado-Gama, Minerva; Pantoja, Omar
1999-01-01
Abscisic acid (ABA) has been implicated as a key component in water-deficit-induced responses, including those triggered by drought, NaCl, and low- temperature stress. In this study a role for ABA in mediating the NaCl-stress-induced increases in tonoplast H+-translocating ATPase (V-ATPase) and Na+/H+ antiport activity in Mesembryanthemum crystallinum, leading to vacuolar Na+ sequestration, were investigated. NaCl or ABA treatment of adult M. crystallinum plants induced V-ATPase H+ transport activity, and when applied in combination, an additive effect on V-ATPase stimulation was observed. In contrast, treatment of juvenile plants with ABA did not induce V-ATPase activity, whereas NaCl treatment resulted in a similar response to that observed in adult plants. Na+/H+ antiport activity was induced in both juvenile and adult plants by NaCl, but ABA had no effect at either developmental stage. Results indicate that ABA-induced changes in V-ATPase activity are dependent on the plant reaching its adult phase, whereas NaCl-induced increases in V-ATPase and Na+/H+ antiport activity are independent of plant age. This suggests that ABA-induced V-ATPase activity may be linked to the stress-induced, developmentally programmed switch from C3 metabolism to Crassulacean acid metabolism in adult plants, whereas, vacuolar Na+ sequestration, mediated by the V-ATPase and Na+/H+ antiport, is regulated through ABA-independent pathways. PMID:10398716
Synthesis of alpha-amino acids
Davis, J.W. Jr.
1983-01-25
A method is described for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R[sub 1]R[sub 2]C(OSOCl)CN, R[sub 1]R[sub 2]C(Cl)CN and [R[sub 1]R[sub 2]C(CN)O][sub 2]SO wherein R[sub 1] and R[sub 2] are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art. No Drawings
Antimycobacterial action of thiolactomycin: an inhibitor of fatty acid and mycolic acid synthesis.
Slayden, R A; Lee, R E; Armour, J W; Cooper, A M; Orme, I M; Brennan, P J; Besra, G S
1996-01-01
Thiolactomycin (TLM) possesses in vivo antimycobacterial activity against the saprophytic strain Mycobacterium smegmatis mc2155 and the virulent strain M. tuberculosis Erdman, resulting in complete inhibition of growth on solid media at 75 and 25 micrograms/ml, respectively. Use of an in vitro murine macrophage model also demonstrated the killing of viable intracellular M. tuberculosis in a dose-dependent manner. Through the use of in vivo [1,2-14C]acetate labeling of M. smegmatis, TLM was shown to inhibit the synthesis of both fatty acids and mycolic acids. However, synthesis of the shorter-chain alpha'-mycolates of M. smegmatis was not inhibited by TLM, whereas synthesis of the characteristic longer-chain alpha-mycolates and epoxymycolates was almost completely inhibited at 75 micrograms/ml. The use of M. smegmatis cell extracts demonstrated that TLM specifically inhibited the mycobacterial acyl carrier protein-dependent type II fatty acid synthase (FAS-II) but not the multifunctional type I fatty acid synthase (FAS-I). In addition, selective inhibition of long-chain mycolate synthesis by TLM was demonstrated in a dose-response manner in purified, cell wall-containing extracts of M. smegmatis cells. The in vivo and in vitro data and knowledge of the mechanism of TLM resistance in Escherichia coli suggest that two distinct TLM targets exist in mycobacteria, the beta-ketoacyl-acyl carrier protein synthases involved in FAS-II and the elongation steps leading to the synthesis of the alpha-mycolates and oxygenated mycolates. The efficacy of TLM against M. smegmatis and M. tuberculosis provides the prospects of identifying fatty acid and mycolic acid biosynthetic genes and revealing a novel range of chemotherapeutic agents directed against M. tuberculosis. PMID:9124847
An efficient synthesis of tetramic acid derivatives with extended conjugation from L-Ascorbic Acid
Singh, Biswajit K; Bisht, Surendra S; Tripathi, Rama P
2006-01-01
Background Tetramic acids with polyenyl substituents are an important class of compounds in medicinal chemistry. Both solid and solution phase syntheses of such molecules have been reported recently. Thiolactomycin, a clinical candidate for treatment of tuberculosis has led to further explorations in this class. We have recently developed an efficient synthesis of tetramic acids derivatives from L- ascorbic acid. In continuation of this work, we have synthesised dienyl tetramic acid derivatives. Results 5,6-O-Isopropylidene-ascorbic acid on reaction with DBU led to the formation of tetronolactonyl allyl alcohol, which on oxidation with pyridinium chlorochromate gave the respective tetranolactonyl allylic aldehydes. Wittig olefination followed by reaction of the resulting tetranolactonyl dienyl esters with different amines resulted in the respective 5-hydroxy lactams. Subsequent dehydration of the hydroxy lactams with p-toluene sulphonic acid afforded the dienyl tetramic acid derivatives. All reactions were performed at ambient temperature and the yields are good. Conclusion An efficient and practical method for the synthesis of dienyl tetramic acid derivatives from inexpensive and easily accessible ascorbic acid has been developed. The compounds bear structural similarities to the tetramic acid based polyenic antibiotics and thus this method offers a new and short route for the synthesis of tetramic acid derivatives of biological significance. PMID:17147830
An efficient synthesis of tetramic acid derivatives with extended conjugation from L-ascorbic acid.
Singh, Biswajit K; Bisht, Surendra S; Tripathi, Rama P
2006-12-06
Tetramic acids with polyenyl substituents are an important class of compounds in medicinal chemistry. Both solid and solution phase syntheses of such molecules have been reported recently. Thiolactomycin, a clinical candidate for treatment of tuberculosis has led to further explorations in this class. We have recently developed an efficient synthesis of tetramic acids derivatives from L-ascorbic acid. In continuation of this work, we have synthesised dienyl tetramic acid derivatives. 5,6-O-isopropylidene-ascorbic acid on reaction with DBU led to the formation of tetronolactonyl allyl alcohol, which on oxidation with pyridinium chlorochromate gave the respective tetranolactonyl allylic aldehydes. Wittig olefination followed by reaction of the resulting tetranolactonyl dienyl esters with different amines resulted in the respective 5-hydroxy lactams. Subsequent dehydration of the hydroxy lactams with p-toluene sulphonic acid afforded the dienyl tetramic acid derivatives. All reactions were performed at ambient temperature and the yields are good. An efficient and practical method for the synthesis of dienyl tetramic acid derivatives from inexpensive and easily accessible ascorbic acid has been developed. The compounds bear structural similarities to the tetramic acid based polyenic antibiotics and thus this method offers a new and short route for the synthesis of tetramic acid derivatives of biological significance.
Transcriptomic analysis of rice aleurone cells identified a novel abscisic acid response element.
Watanabe, Kenneth A; Homayouni, Arielle; Gu, Lingkun; Huang, Kuan-Ying; Ho, Tuan-Hua David; Shen, Qingxi J
2017-09-01
Seeds serve as a great model to study plant responses to drought stress, which is largely mediated by abscisic acid (ABA). The ABA responsive element (ABRE) is a key cis-regulatory element in ABA signalling. However, its consensus sequence (ACGTG(G/T)C) is present in the promoters of only about 40% of ABA-induced genes in rice aleurone cells, suggesting other ABREs may exist. To identify novel ABREs, RNA sequencing was performed on aleurone cells of rice seeds treated with 20 μM ABA. Gibbs sampling was used to identify enriched elements, and particle bombardment-mediated transient expression studies were performed to verify the function. Gene ontology analysis was performed to predict the roles of genes containing the novel ABREs. This study revealed 2443 ABA-inducible genes and a novel ABRE, designated as ABREN, which was experimentally verified to mediate ABA signalling in rice aleurone cells. Many of the ABREN-containing genes are predicted to be involved in stress responses and transcription. Analysis of other species suggests that the ABREN may be monocot specific. This study also revealed interesting expression patterns of genes involved in ABA metabolism and signalling. Collectively, this study advanced our understanding of diverse cis-regulatory sequences and the transcriptomes underlying ABA responses in rice aleurone cells. © 2017 John Wiley & Sons Ltd.
Waadt, Rainer; Hitomi, Kenichi; Nishimura, Noriyuki; Hitomi, Chiharu; Adams, Stephen R; Getzoff, Elizabeth D; Schroeder, Julian I
2014-01-01
Abscisic acid (ABA) is a plant hormone that regulates plant growth and development and mediates abiotic stress responses. Direct cellular monitoring of dynamic ABA concentration changes in response to environmental cues is essential for understanding ABA action. We have developed ABAleons: ABA-specific optogenetic reporters that instantaneously convert the phytohormone-triggered interaction of ABA receptors with PP2C-type phosphatases to send a fluorescence resonance energy transfer (FRET) signal in response to ABA. We report the design, engineering and use of ABAleons with ABA affinities in the range of 100–600 nM to map ABA concentration changes in plant tissues with spatial and temporal resolution. High ABAleon expression can partially repress Arabidopsis ABA responses. ABAleons report ABA concentration differences in distinct cell types, ABA concentration increases in response to low humidity and NaCl in guard cells and to NaCl and osmotic stress in roots and ABA transport from the hypocotyl to the shoot and root. DOI: http://dx.doi.org/10.7554/eLife.01739.001 PMID:24737861
The pivotal role of abscisic acid signaling during transition from seed maturation to germination.
Yan, An; Chen, Zhong
2017-05-01
Seed maturation and germination are two continuous developmental processes that link two distinct generations in spermatophytes; the precise genetic control of these two processes is, therefore, crucially important for the survival of the next generation. Pieces of experimental evidence accumulated so far indicate that a concerted action of endogenous signals and environmental cues is required to govern these processes. Plant hormone abscisic acid (ABA) has been suggested to play a predominant role in directing seed maturation and maintaining seed dormancy under unfavorable environmental conditions until antagonized by gibberellins (GA) and certain environmental cues to allow the commencement of seed germination when environmental conditions are favorable; therefore, the balance of ABA and GA is a major determinant of the timing of seed germination. Due to the advent of new technologies and system biology approaches, molecular studies are beginning to draw a picture of the sophisticated genetic network that drives seed maturation during the past decade, though the picture is still incomplete and many details are missing. In this review, we summarize recent advances in ABA signaling pathway in the regulation of seed maturation as well as the transition from seed maturation to germination, and highlight the importance of system biology approaches in the study of seed maturation.
Meng, Yongjie; Chen, Feng; Shuai, Haiwei; Luo, Xiaofeng; Ding, Jun; Tang, Shengwen; Xu, Shuanshuan; Liu, Jianwei; Liu, Weiguo; Du, Junbo; Liu, Jiang; Yang, Feng; Sun, Xin; Yong, Taiwen; Wang, Xiaochun; Feng, Yuqi; Shu, Kai; Yang, Wenyu
2016-01-01
Karrikins (KAR) are a class of signal compounds, discovered in wildfire smoke, which affect seed germination. Currently, numerous studies have focused on the model plant Arabidopsis in the KAR research field, rather than on crops. Thus the regulatory mechanisms underlying KAR regulation of crop seed germination are largely unknown. Here, we report that KAR delayed soybean seed germination through enhancing abscisic acid (ABA) biosynthesis, while impairing gibberellin (GA) biogenesis. Interestingly, KAR only retarded soybean seed germination under shaded conditions, rather than under dark and white light conditions, which differs from in Arabidopsis. Phytohormone quantification showed that KAR enhanced ABA biogenesis while impairing GA biosynthesis during the seed imbibition process, and subsequently, the ratio of active GA4 to ABA was significantly reduced. Further qRT-PCR analysis showed that the transcription pattern of genes involved in ABA and GA metabolic pathways are consistent with the hormonal measurements. Finally, fluridone, an ABA biogenesis inhibitor, remarkably rescued the delayed-germination phenotype of KAR-treatment; and paclobutrazol, a GA biosynthesis inhibitor, inhibited soybean seed germination. Taken together, these evidences suggest that KAR inhibit soybean seed germination by mediating the ratio between GA and ABA biogenesis. PMID:26902640
Meng, Yongjie; Chen, Feng; Shuai, Haiwei; Luo, Xiaofeng; Ding, Jun; Tang, Shengwen; Xu, Shuanshuan; Liu, Jianwei; Liu, Weiguo; Du, Junbo; Liu, Jiang; Yang, Feng; Sun, Xin; Yong, Taiwen; Wang, Xiaochun; Feng, Yuqi; Shu, Kai; Yang, Wenyu
2016-02-23
Karrikins (KAR) are a class of signal compounds, discovered in wildfire smoke, which affect seed germination. Currently, numerous studies have focused on the model plant Arabidopsis in the KAR research field, rather than on crops. Thus the regulatory mechanisms underlying KAR regulation of crop seed germination are largely unknown. Here, we report that KAR delayed soybean seed germination through enhancing abscisic acid (ABA) biosynthesis, while impairing gibberellin (GA) biogenesis. Interestingly, KAR only retarded soybean seed germination under shaded conditions, rather than under dark and white light conditions, which differs from in Arabidopsis. Phytohormone quantification showed that KAR enhanced ABA biogenesis while impairing GA biosynthesis during the seed imbibition process, and subsequently, the ratio of active GA4 to ABA was significantly reduced. Further qRT-PCR analysis showed that the transcription pattern of genes involved in ABA and GA metabolic pathways are consistent with the hormonal measurements. Finally, fluridone, an ABA biogenesis inhibitor, remarkably rescued the delayed-germination phenotype of KAR-treatment; and paclobutrazol, a GA biosynthesis inhibitor, inhibited soybean seed germination. Taken together, these evidences suggest that KAR inhibit soybean seed germination by mediating the ratio between GA and ABA biogenesis.
A chloroplast lipoxygenase is required for wound-induced jasmonic acid accumulation in Arabidopsis.
Bell, E; Creelman, R A; Mullet, J E
1995-01-01
Plant lipoxygenases are thought to be involved in the biosynthesis of lipid-derived signaling molecules. The potential involvement of a specific Arabidopsis thaliana lipoxygenase isozyme, LOX2, in the biosynthesis of the plant growth regulators jasmonic acid (JA) and abscisic acid was investigated. Our characterization of LOX2 indicates that the protein is targeted to chloroplasts. The physiological role of this chloroplast lipoxygenase was analyzed in transgenic plants where cosuppression reduced LOX2 accumulation. The reduction in LOX2 levels caused no obvious changes in plant growth or in the accumulation of abscisic acid. However, the wound-induced accumulation of JA observed in control plants was absent in leaves of transgenic plants that lacked LOX2. Thus, LOX2 is required for the wound-induced synthesis of the plant growth regulator JA in leaves. We also examined the expression of a wound- and JA-inducible Arabidopsis gene, vsp, in transgenic and control plants. Leaves of transgenic plants lacking LOX2 accumulated less vsp mRNA than did control leaves in response to wounding. This result suggests that wound-induced JA (or some other LOX2-requiring component of the wound response pathway) is involved in the wound-induced regulation of this gene. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:7567995
A chloroplast lipoxygenase is required for wound-induced jasmonic acid accumulation in Arabidopsis.
Bell, E; Creelman, R A; Mullet, J E
1995-09-12
Plant lipoxygenases are thought to be involved in the biosynthesis of lipid-derived signaling molecules. The potential involvement of a specific Arabidopsis thaliana lipoxygenase isozyme, LOX2, in the biosynthesis of the plant growth regulators jasmonic acid (JA) and abscisic acid was investigated. Our characterization of LOX2 indicates that the protein is targeted to chloroplasts. The physiological role of this chloroplast lipoxygenase was analyzed in transgenic plants where cosuppression reduced LOX2 accumulation. The reduction in LOX2 levels caused no obvious changes in plant growth or in the accumulation of abscisic acid. However, the wound-induced accumulation of JA observed in control plants was absent in leaves of transgenic plants that lacked LOX2. Thus, LOX2 is required for the wound-induced synthesis of the plant growth regulator JA in leaves. We also examined the expression of a wound- and JA-inducible Arabidopsis gene, vsp, in transgenic and control plants. Leaves of transgenic plants lacking LOX2 accumulated less vsp mRNA than did control leaves in response to wounding. This result suggests that wound-induced JA (or some other LOX2-requiring component of the wound response pathway) is involved in the wound-induced regulation of this gene.
Effect of tannic acid on the synthesis of protein and nucleic acid by rat liver
Badawy, A. A.-B.; White, Audrey E.; Lathe, G. H.
1969-01-01
1. As early as 1hr. after the intraperitoneal administration of tannic acid to rats, it could be demonstrated in the liver. At 3hr. the nuclear fraction contained the largest amount of tannic acid. 2. Nuclear RNA synthesis was inhibited in vivo 2hr. after the administration of tannic acid. Induction by cortisol of tryptophan pyrrolase was 90% inhibited at 24hr. 3. Incorporation of [1-14C]leucine into protein by liver slices from treated rats was decreased by 50% after 24hr. Its incorporation into postmitochondrial supernatant from treated animals was not inhibited. Incorporation into slices and postmitochondrial supernatants were inhibited in vitro by tannic acid. 4. The sequence of events: concentration of tannic acid in nuclei, inhibition of nuclear RNA synthesis, inhibition of protein synthesis and production of necrosis, is discussed. PMID:5808319
Nucleic acid and nucleotide-mediated synthesis of inorganic nanoparticles
NASA Astrophysics Data System (ADS)
Berti, Lorenzo; Burley, Glenn A.
2008-02-01
Since the advent of practical methods for achieving DNA metallization, the use of nucleic acids as templates for the synthesis of inorganic nanoparticles (NPs) has become an active area of study. It is now widely recognized that nucleic acids have the ability to control the growth and morphology of inorganic NPs. These biopolymers are particularly appealing as templating agents as their ease of synthesis in conjunction with the possibility of screening nucleotide composition, sequence and length, provides the means to modulate the physico-chemical properties of the resulting NPs. Several synthetic procedures leading to NPs with interesting photophysical properties as well as studies aimed at rationalizing the mechanism of nucleic acid-templated NP synthesis are now being reported. This progress article will outline the current understanding of the nucleic acid-templated process and provides an up to date reference in this nascent field.
Raschke, Klaus; Zeevaart, Jan A. D.
1976-01-01
Among the four uppermost leaves of greenhouse-grown plants of Xanthium strumarium L. the content of abscisic acid per unit fresh or dry weight was highest in the youngest leaf and decreased gradually with increasing age of the leaves. Expressed per leaf, the second youngest leaf was richest in ABA; the amount of ABA per leaf declined only slightly as the leaves expanded. Transpiration and stomatal conductance were negatively correlated with the ABA concentration in the leaves; the youngest leaf lost the least amount of water. This correlation was always very good if the youngest leaf was compared with the older leaves but not always good among the older leaves. Since stomatal sensitivity to exogenous (±)-ABA was the same in leaves of all four age groups ABA may be in at least two compartments in the leaf, one of which is isolated from the guard cells. The ability to synthesize ABA in response to wilting or chilling was strongly expressed in young leaves and declined with leaf age. There was no difference between leaves in their content of the metabolites of ABA, phaseic, and dihydrophaseic acid, expressed per unit weight. PMID:16659640
Zhao, Huayan; Zhang, Huoming; Cui, Peng; Ding, Feng; Wang, Guangchao; Li, Rongjun; Jenks, Matthew A.; Lü, Shiyou; Xiong, Liming
2014-01-01
The ECERIFERUM9 (CER9) gene encodes a putative E3 ubiquitin ligase that functions in cuticle biosynthesis and the maintenance of plant water status. Here, we found that CER9 is also involved in abscisic acid (ABA) signaling in seeds and young seedlings of Arabidopsis (Arabidopsis thaliana). The germinated embryos of the mutants exhibited enhanced sensitivity to ABA during the transition from reversible dormancy to determinate seedling growth. Expression of the CER9 gene is closely related to ABA levels and displays a similar pattern to that of ABSCISIC ACID-INSENSITIVE5 (ABI5), which encodes a positive regulator of ABA responses in seeds. cer9 mutant seeds exhibited delayed germination that is independent of seed coat permeability. Quantitative proteomic analyses showed that cer9 seeds had a protein profile similar to that of the wild type treated with ABA. Transcriptomics analyses revealed that genes involved in ABA biosynthesis or signaling pathways were differentially regulated in cer9 seeds. Consistent with this, high levels of ABA were detected in dry seeds of cer9. Blocking ABA biosynthesis by fluridone treatment or by combining an ABA-deficient mutation with cer9 attenuated the phenotypes of cer9. Whereas introduction of the abi1-1, abi3-1, or abi4-103 mutation could completely eliminate the ABA hypersensitivity of cer9, introduction of abi5 resulted only in partial suppression. These results indicate that CER9 is a novel negative regulator of ABA biosynthesis and the ABA signaling pathway during seed germination. PMID:24812105
Xu, Ling-Ling; Lai, Yi-Ling; Wang, Lin; Liu, Xing-Zhong
2011-02-01
The in vitro effects of abscisic acid (ABA) and nitric oxide (NO) on the nematode-trapping fungus Drechslerella stenobrocha AS6.1 were examined. The average number of traps (constricting rings) per colony and the percentage of nematodes (Caenorhabditis elegans) trapped were greatly increased by addition of ABA but greatly suppressed by addition of sodium nitroprusside (SNP, an NO donor) to corn meal agar. The suppressive effect of SNP was not negated by addition of an NO synthase competitive inhibitor (l-naphthylacetic acid, L-NNA) or an NO-specific scavenger [2-(4-carboxyphenyl)-4,4, 5,5-tetramethylimidazoline-1-oxyl-3-oxide, cPTIO]. When added without SNP, however, L-NNA and cPTIO caused moderate increases in trap number and trapping. The results indicate that the trap formation and nematode-trapping ability of D. stenobrocha were enhanced by ABA but decreased by exogenous NO. Copyright © 2010 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
González-Villagra, Jorge; Rodrigues-Salvador, Acácio; Nunes-Nesi, Adriano; Cohen, Jerry D; Reyes-Díaz, Marjorie M
2018-03-01
Drought stress is the most important stress factor for plants, being the main cause of agricultural crop loss in the world. Plants have developed complex mechanisms for preventing water loss and oxidative stress such as synthesis of abscisic acid (ABA) and non-enzymatic antioxidant compounds such as anthocyanins, which might help plants to cope with abiotic stress as antioxidants and for scavenging reactive oxygen species. A. chilensis (Mol.) is a pioneer species, colonizing and growing on stressed and disturbed environments. In this research, an integrated analysis of secondary metabolism in Aristotelia chilensis was done to relate ABA effects on anthocyanins biosynthesis, by comparing between young and fully-expanded leaves under drought stress. Plants were subjected to drought stress for 20 days, and physiological, biochemical, and molecular analyses were performed. The relative growth rate and plant water status were reduced in stressed plants, with young leaves significantly more affected than fully-expanded leaves beginning from the 5th day of drought stress. A. chilensis plants increased their ABA and total anthocyanin content and showed upregulation of gene expression when they were subjected to severe drought (day 20), with these effects being higher in fully-expanded leaves. Multivariate analysis indicated a significant positive correlation between transcript levels for NCED1 (9-cis-epoxycarotenoid dioxygenase) and UFGT (UDP glucose: flavonoid-3-O-glucosyltransferase) with ABA and total anthocyanin, respectively. Thus, this research provides a more comprehensive analysis of the mechanisms that allow plants to cope with drought stress. This is highlighted by the differences between young and fully-expanded leaves, showing different sensibility to stress due to their ability to synthesize anthocyanins. In addition, this ability to synthesize different and high amounts of anthocyanins could be related to higher NCED1 and MYB expression and ABA levels
The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis
NASA Technical Reports Server (NTRS)
Morowitz, Harold; Peterson, Eta; Chang, Sherwood
1995-01-01
This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.
Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine
2016-01-01
Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d3-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725
Ding, Yezhang; Dommel, Matthew; Mou, Zhonglin
2016-04-01
Proteasome-mediated turnover of the transcription coactivator NPR1 is pivotal for efficient activation of the broad-spectrum plant immune responses known as localized acquired resistance (LAR) and systemic acquired resistance (SAR) in adjacent and systemic tissues, respectively, and requires the CUL3-based E3 ligase and its adaptor proteins, NPR3 and NPR4, which are receptors for the signaling molecule salicylic acid (SA). It has been shown that SA prevents NPR1 turnover under non-inducing and LAR/SAR-inducing conditions, but how cellular NPR1 homeostasis is maintained remains unclear. Here, we show that the phytohormone abscisic acid (ABA) and SA antagonistically influence cellular NPR1 protein levels. ABA promotes NPR1 degradation via the CUL3(NPR) (3/) (NPR) (4) complex-mediated proteasome pathway, whereas SA may protect NPR1 from ABA-promoted degradation through phosphorylation. Furthermore, we demonstrate that the timing and strength of SA and ABA signaling are critical in modulating NPR1 accumulation and target gene expression. Perturbing ABA or SA signaling in adjacent tissues alters the temporal dynamic pattern of NPR1 accumulation and target gene transcription. Finally, we show that sequential SA and ABA treatment leads to dynamic changes in NPR1 protein levels and target gene expression. Our results revealed a tight correlation between sequential SA and ABA signaling and dynamic changes in NPR1 protein levels and NPR1-dependent transcription in plant immune responses. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.
Zhang, Lawrence; Sun, Tiefeng
2017-01-01
Activation of mitogen-activated protein kinases (MAPKs) is one of the earliest responses after plants sense an invading pathogen. Here, we show that MPK3 and MPK6, two Arabidopsis thaliana pathogen-responsive MAPKs, and their upstream MAPK kinases, MKK4 and MKK5, are essential to both stomatal and apoplastic immunity. Loss of function of MPK3 and MPK6, or their upstream MKK4 and MKK5, abolishes pathogen/microbe-associated molecular pattern- and pathogen-induced stomatal closure. Gain-of-function activation of MPK3/MPK6 induces stomatal closure independently of abscisic acid (ABA) biosynthesis and signaling. In contrast, exogenously applied organic acids such as malate or citrate are able to reverse the stomatal closure induced by MPK3/MPK6 activation. Gene expression analysis and in situ enzyme activity staining revealed that malate metabolism increases in guard cells after activation of MPK3/MPK6 or inoculation of pathogen. In addition, pathogen-induced malate metabolism requires functional MKK4/MKK5 and MPK3/MPK6. We propose that the pathogen-responsive MPK3/MPK6 cascade and ABA are two essential signaling pathways that control, respectively, the organic acid metabolism and ion channels, two main branches of osmotic regulation in guard cells that function interdependently to control stomatal opening/closure. PMID:28254778
Pawłowski, Tomasz A
2009-01-01
Background Seed dormancy is controlled by the physiological or structural properties of a seed and the external conditions. It is induced as part of the genetic program of seed development and maturation. Seeds with deep physiological embryo dormancy can be stimulated to germinate by a variety of treatments including cold stratification. Hormonal imbalance between germination inhibitors (e.g. abscisic acid) and growth promoters (e.g. gibberellins) is the main cause of seed dormancy breaking. Differences in the status of hormones would affect expression of genes required for germination. Proteomics offers the opportunity to examine simultaneous changes and to classify temporal patterns of protein accumulation occurring during seed dormancy breaking and germination. Analysis of the functions of the identified proteins and the related metabolic pathways, in conjunction with the plant hormones implicated in seed dormancy breaking, would expand our knowledge about this process. Results A proteomic approach was used to analyse the mechanism of dormancy breaking in Norway maple seeds caused by cold stratification, and the participation of the abscisic (ABA) and gibberellic (GA) acids. Forty-four proteins showing significant changes were identified by mass spectrometry. Of these, eight spots were identified as water-responsive, 18 spots were ABA- and nine GA-responsive and nine spots were regulated by both hormones. The classification of proteins showed that most of the proteins associated with dormancy breaking in water were involved in protein destination. Most of the ABA- and GA-responsive proteins were involved in protein destination and energy metabolism. Conclusion In this study, ABA was found to mostly down-regulate proteins whereas GA up-regulated proteins abundance. Most of the changes were observed at the end of stratification in the germinated seeds. This is the most active period of dormancy breaking when seeds pass from the quiescent state to germination. Seed
Pawłowski, Tomasz A
2009-05-04
Seed dormancy is controlled by the physiological or structural properties of a seed and the external conditions. It is induced as part of the genetic program of seed development and maturation. Seeds with deep physiological embryo dormancy can be stimulated to germinate by a variety of treatments including cold stratification. Hormonal imbalance between germination inhibitors (e.g. abscisic acid) and growth promoters (e.g. gibberellins) is the main cause of seed dormancy breaking. Differences in the status of hormones would affect expression of genes required for germination. Proteomics offers the opportunity to examine simultaneous changes and to classify temporal patterns of protein accumulation occurring during seed dormancy breaking and germination. Analysis of the functions of the identified proteins and the related metabolic pathways, in conjunction with the plant hormones implicated in seed dormancy breaking, would expand our knowledge about this process. A proteomic approach was used to analyse the mechanism of dormancy breaking in Norway maple seeds caused by cold stratification, and the participation of the abscisic (ABA) and gibberellic (GA) acids. Forty-four proteins showing significant changes were identified by mass spectrometry. Of these, eight spots were identified as water-responsive, 18 spots were ABA- and nine GA-responsive and nine spots were regulated by both hormones. The classification of proteins showed that most of the proteins associated with dormancy breaking in water were involved in protein destination. Most of the ABA- and GA-responsive proteins were involved in protein destination and energy metabolism. In this study, ABA was found to mostly down-regulate proteins whereas GA up-regulated proteins abundance. Most of the changes were observed at the end of stratification in the germinated seeds. This is the most active period of dormancy breaking when seeds pass from the quiescent state to germination. Seed dormancy breaking involves
Shi, Wen-Guang; Li, Hong; Liu, Tong-Xian; Polle, Andrea; Peng, Chang-Hui; Luo, Zhi-Bin
2015-01-01
A greenhouse experiment was conducted to study whether exogenous abscisic acid (ABA) mediates the responses of poplars to excess zinc (Zn). Populus × canescens seedlings were treated with either basal or excess Zn levels and either 0 or 10 μm ABA. Excess Zn led to reduced photosynthetic rates, increased Zn accumulation, induced foliar ABA and salicylic acid (SA), decreased foliar gibberellin (GA3 ) and auxin (IAA), elevated root H2 O2 levels, and increased root ratios of glutathione (GSH) to GSSG and foliar ratios of ascorbate (ASC) to dehydroascorbate (DHA) in poplars. While exogenous ABA decreased foliar Zn concentrations with 7 d treatments, it increased levels of endogenous ABA, GA3 and SA in roots, and resulted in highly increased foliar ASC accumulation and ratios of ASC to DHA. The transcript levels of several genes involved in Zn uptake and detoxification, such as yellow stripe-like family protein 2 (YSL2) and plant cadmium resistance protein 2 (PCR2), were enhanced in poplar roots by excess Zn but repressed by exogenous ABA application. These results suggest that exogenous ABA can decrease Zn concentrations in P. × canescens under excess Zn for 7 d, likely by modulating the transcript levels of key genes involved in Zn uptake and detoxification. © 2014 John Wiley & Sons Ltd.
Chen, Bingxian; Ma, Jun; Xu, Zhenjiang; Wang, Xiaofeng
2016-10-01
The purpose of this study was to investigate the role of cellulase in endosperm cap weakening and radicle elongation during lettuce (Lactuca sativa L.) seed germination. The application of abscisic acid (ABA) or ethephon inhibits or promotes germination, respectively, by affecting endosperm cap weakening and radicle elongation. Cellulase activities, and related protein and transcript abundances of two lettuce cellulase genes, LsCEL1 and LsCEL2, increase in the endosperm cap and radicle prior to radicle protrusion following imbibition in water. ABA or ethephon reduce or elevate, respectively, cellulase activity, and related protein and transcript abundances in the endosperm cap. Taken together, these observations suggest that cellulase plays a role in endosperm cap weakening and radicle elongation during lettuce seed germination, and that the regulation of cellulase in the endosperm cap by ABA and ethephon play a role in endosperm cap weakening. However, the influence of ABA and ethephon on radicle elongation may not be through their effects on cellulase. © 2016 Institute of Botany, Chinese Academy of Sciences.
Sánchez-Vallet, Andrea; López, Gemma; Ramos, Brisa; Delgado-Cerezo, Magdalena; Riviere, Marie-Pierre; Llorente, Francisco; Fernández, Paula Virginia; Miedes, Eva; Estevez, José Manuel; Grant, Murray; Molina, Antonio
2012-01-01
Plant resistance to necrotrophic fungi is regulated by a complex set of signaling pathways that includes those mediated by the hormones salicylic acid (SA), ethylene (ET), jasmonic acid (JA), and abscisic acid (ABA). The role of ABA in plant resistance remains controversial, as positive and negative regulatory functions have been described depending on the plant-pathogen interaction analyzed. Here, we show that ABA signaling negatively regulates Arabidopsis (Arabidopsis thaliana) resistance to the necrotrophic fungus Plectosphaerella cucumerina. Arabidopsis plants impaired in ABA biosynthesis, such as the aba1-6 mutant, or in ABA signaling, like the quadruple pyr/pyl mutant (pyr1pyl1pyl2pyl4), were more resistant to P. cucumerina than wild-type plants. In contrast, the hab1-1abi1-2abi2-2 mutant impaired in three phosphatases that negatively regulate ABA signaling displayed an enhanced susceptibility phenotype to this fungus. Comparative transcriptomic analyses of aba1-6 and wild-type plants revealed that the ABA pathway negatively regulates defense genes, many of which are controlled by the SA, JA, or ET pathway. In line with these data, we found that aba1-6 resistance to P. cucumerina was partially compromised when the SA, JA, or ET pathway was disrupted in this mutant. Additionally, in the aba1-6 plants, some genes encoding cell wall-related proteins were misregulated. Fourier transform infrared spectroscopy and biochemical analyses of cell walls from aba1-6 and wild-type plants revealed significant differences in their Fourier transform infrared spectratypes and uronic acid and cellulose contents. All these data suggest that ABA signaling has a complex function in Arabidopsis basal resistance, negatively regulating SA/JA/ET-mediated resistance to necrotrophic fungi. PMID:23037505
Negri, Pedro; Ramirez, Leonor; Quintana, Silvina; Szawarski, Nicolás; Maggi, Matías; Le Conte, Yves; Lamattina, Lorenzo; Eguaras, Martin
2017-08-15
Many biotic and abiotic stressors impact bees' health, acting as immunosupressors and contribute to colony losses. Thus, the importance of studying the immune response of honey bees is central to develop new strategies aiming to enhance bees' fitness to confront the threats affecting them. If a pathogen breaches the physical and chemical barriers, honey bees can protect themselves from infection with cellular and humoral immune responses which represent a second line of defense. Through a series of correlative studies we have previously reported that abscisic acid (ABA) and nitric oxide (NO) share roles in the same immune defenses of Apis mellifera ( A. mellifera ). Here we show results supporting that the supplementation of bee larvae's diet reared in vitro with l-Arginine (precursor of NO) or ABA enhanced the immune activation of the granulocytes in response to wounding and lipopolysaccharide (LPS) injection.
The spark discharge synthesis of amino acids from various hydrocarbons
NASA Technical Reports Server (NTRS)
Ring, D.; Miller, S. L.
1984-01-01
The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).
Zifkin, Michael; Jin, Alena; Ozga, Jocelyn A; Zaharia, L Irina; Schernthaner, Johann P; Gesell, Andreas; Abrams, Suzanne R; Kennedy, James A; Constabel, C Peter
2012-01-01
Highbush blueberry (Vaccinium corymbosum) fruits contain substantial quantities of flavonoids, which are implicated in a wide range of health benefits. Although the flavonoid constituents of ripe blueberries are known, the molecular genetics underlying their biosynthesis, localization, and changes that occur during development have not been investigated. Two expressed sequence tag libraries from ripening blueberry fruit were constructed as a resource for gene identification and quantitative real-time reverse transcription-polymerase chain reaction primer design. Gene expression profiling by quantitative real-time reverse transcription-polymerase chain reaction showed that flavonoid biosynthetic transcript abundance followed a tightly regulated biphasic pattern, and transcript profiles were consistent with the abundance of the three major classes of flavonoids. Proanthocyanidins (PAs) and corresponding biosynthetic transcripts encoding anthocyanidin reductase and leucoanthocyanidin reductase were most concentrated in young fruit and localized predominantly to the inner fruit tissue containing the seeds and placentae. Mean PA polymer length was seven to 8.5 subunits, linked predominantly via B-type linkages, and was relatively constant throughout development. Flavonol accumulation and localization patterns were similar to those of the PAs, and the B-ring hydroxylation pattern of both was correlated with flavonoid-3'-hydroxylase transcript abundance. By contrast, anthocyanins accumulated late in maturation, which coincided with a peak in flavonoid-3-O-glycosyltransferase and flavonoid-3'5'-hydroxylase transcripts. Transcripts of VcMYBPA1, which likely encodes an R2R3-MYB transcriptional regulator of PA synthesis, were prominent in both phases of development. Furthermore, the initiation of ripening was accompanied by a substantial rise in abscisic acid, a growth regulator that may be an important component of the ripening process and contribute to the regulation of
Bi, Chao; Ma, Yu; Wang, Xiao-Fang; Zhang, Da-Peng
2017-11-01
Nuclear factor Y (NF-Y) family proteins are involved in many developmental processes and responses to environmental cues in plants, but whether and how they regulate phytohormone abscisic acid (ABA) signaling need further studies. In the present study, we showed that over-expression of the NF-YC9 gene confers ABA hypersensitivity in both the early seedling growth and stomatal response, while down-regulation of NF-YC9 does not affect ABA response in these processes. We also showed that over-expression of the NF-YC9 gene confers salt and osmotic hypersensitivity in early seedling growth, which is likely to be directly associated with the ABA hypersensitivity. Further, we observed that NF-YC9 physically interacts with the ABA-responsive bZIP transcription factor ABA-INSENSITIVE5 (ABI5), and facilitates the function of ABI5 to bind and activate the promoter of a target gene EM6. Additionally, NF-YC9 up-regulates expression of the ABI5 gene in response to ABA. These findings show that NF-YC9 may be involved in ABA signaling as a positive regulator and likely functions redundantly together with other NF-YC members, and support the model that the NF-YC9 mediates ABA signaling via targeting to and aiding the ABA-responsive transcription factors such as ABI5.
Temperature Regulation of Growth and Endogenous Abscisic Acid-like Content of Tulipa gesneriana L
Aung, Louis H.; De Hertogh, August A.
1979-01-01
The ontogenetic changes of dry matter and abscisic acid (ABA)-like content in the component organs of Tulipa gesneriana L. `Paul Richter' and `Golden Melody' under two temperature storage regimes were determined. The organ dry matter and ABA showed marked differences during 13 and 5 C dry storage and during subsequent growth at 13 C. Scale dry matter of both cultivars declined sharply when grown at 13 C. The basalplate of the cultivars showed an initial gain in dry matter, but declined subsequently. The shoot of both cultivars stored at 13 C exhibited greater dry matter gain than at 5 C. In contrast, the bulblets of the cultivars at 5 C showed a much higher rate of dry matter accumulation than at 13 C. An inhibitory substance extracted from tulip bulb organs co-chromatographed with authentic ABA and had identical thin layer chromatographic RF values of ABA in five solvent systems. The total ABA content per bulb increased 3-fold in `Golden Melody' and 2- to 4-fold in `Paul Richter' during the course of the temperature treatments. ABA was low in the scales and shoot, but it was high in the basalplate, bulblets, and roots. It is suggested that the probable ABA biosynthetic sites of tulip bulb are the developing bulblets, basalplate, and roots. PMID:16660867
Abscisic Acid Regulates Auxin Homeostasis in Rice Root Tips to Promote Root Hair Elongation
Wang, Tao; Li, Chengxiang; Wu, Zhihua; Jia, Yancui; Wang, Hong; Sun, Shiyong; Mao, Chuanzao; Wang, Xuelu
2017-01-01
Abscisic acid (ABA) plays an essential role in root hair elongation in plants, but the regulatory mechanism remains to be elucidated. In this study, we found that exogenous ABA can promote rice root hair elongation. Transgenic rice overexpressing SAPK10 (Stress/ABA-activated protein kinase 10) had longer root hairs; rice plants overexpressing OsABIL2 (OsABI-Like 2) had attenuated ABA signaling and shorter root hairs, suggesting that the effect of ABA on root hair elongation depends on the conserved PYR/PP2C/SnRK2 ABA signaling module. Treatment of the DR5-GUS and OsPIN-GUS lines with ABA and an auxin efflux inhibitor showed that ABA-induced root hair elongation depends on polar auxin transport. To examine the transcriptional response to ABA, we divided rice root tips into three regions: short root hair, long root hair and root tip zones; and conducted RNA-seq analysis with or without ABA treatment. Examination of genes involved in auxin transport, biosynthesis and metabolism indicated that ABA promotes auxin biosynthesis and polar auxin transport in the root tip, which may lead to auxin accumulation in the long root hair zone. Our findings shed light on how ABA regulates root hair elongation through crosstalk with auxin biosynthesis and transport to orchestrate plant development. PMID:28702040
Xiong, Liming; Ishitani, Manabu; Zhu, Jian-Kang
1999-01-01
The impact of simultaneous environmental stresses on plants and how they respond to combined stresses compared with single stresses is largely unclear. By using a transgene (RD29A-LUC) consisting of the firefly luciferase coding sequence (LUC) driven by the stress-responsive RD29A promoter, we investigated the interactive effects of temperature, osmotic stress, and the phytohormone abscisic acid (ABA) in the regulation of gene expression in Arabidopsis seedlings. Results indicated that both positive and negative interactions exist among the studied stress factors in regulating gene expression. At a normal growth temperature (22°C), osmotic stress and ABA act synergistically to induce the transgene expression. Low temperature inhibits the response to osmotic stress or to combined treatment of osmotic stress and ABA, whereas low temperature and ABA treatments are additive in inducing transgene expression. Although high temperature alone does not activate the transgene, it significantly amplifies the effects of ABA and osmotic stress. The effect of multiple stresses in the regulation of RD29A-LUC expression in signal transduction mutants was also studied. The results are discussed in the context of cold and osmotic stress signal transduction pathways. PMID:9880362
Changes in isoprenoid lipid synthesis by gemfibrozil and clofibric acid in rat hepatocytes.
Hashimoto, F; Taira, S; Hayashi, H
2000-05-15
We studied whether gemfibrozil and clofibric acid alter isoprenoid lipid synthesis in rat hepatocytes. After incubation of the cells with the agent for 74 hr, [(14)C]acetate or [(3)H]mevalonate was added, and the cells were further incubated for 4 hr. Gemfibrozil and clofibric acid increased ubiquinone synthesis from [(14)C]acetate and [(3)H]mevalonate. The effect of gemfibrozil was greater than that of clofibric acid. Also, gemfibrozil decreased dolichol synthesis from [(14)C]acetate and [(3)H]mevalonate. However, clofibric acid increased dolichol synthesis from [(3)H]mevalonate. Gemfibrozil decreased cholesterol synthesis from [(14)C]acetate and [(3)H]mevalonate. Clofibric acid decreased cholesterol synthesis from [(14)C]acetate, but did not affect synthesis from [(3)H]mevalonate. These results suggest that both agents, at different rates, activate the synthetic pathway of ubiquinone, at least from mevalonate. Gemfibrozil may inhibit the synthetic pathway of dolichol, at least from mevalonate. Contrary to gemfibrozil, clofibric acid may activate the synthetic pathway of dolichol from mevalonate. Gemfibrozil may inhibit the synthetic pathway of cholesterol from mevalonate in addition to the pathway from acetate to mevalonate inhibited by both agents.
Osmotic stress, endogenous abscisic acid and the control of leaf morphology in Hippuris vulgaris L
NASA Technical Reports Server (NTRS)
Goliber, T. E.; Feldman, L. J.
1989-01-01
Previous reports indicate that heterophyllous aquatic plants can be induced to form aerial-type leaves on submerged shoots when they are grown in exogenous abscisic acid (ABA). This study reports on the relationship between osmotic stress (e.g. the situation encountered by a shoot tip when it grows above the water surface), endogenous ABA (as measured by gas chromatography-electron capture detector) and leaf morphology in the heterophyllous aquatic plant, Hippuris vulgaris. Free ABA could not be detected in submerged shoots of H. vulgaris but in aerial shoots ABA occurred at ca. 40 ng (g fr wt)-1. When submerged shoots were osmotically stressed ABA appeared at levels of 26 to 40 ng (g fr wt)-1. These and other data support two main conclusions: (1) Osmotically stressing a submerged shoot causes the appearance of detectable levels of ABA. (2) The rise of ABA in osmotically stressed submerged shoots in turn induces a change in leaf morphology from the submerged to the aerial form. This corroborates the hypothesis that, in the natural environment, ABA levels rise in response to the osmotic stress encountered when a submerged shoot grows up through the water/air interface and that the increased ABA leads to the production of aerial-type leaves.
Li, Xiangnan; Tan, Dun-Xian; Jiang, Dong; Liu, Fulai
2016-10-01
Melatonin is involved in multiple plant developmental processes and various stress responses. To explore the roles of melatonin played as well as its association with abscisic acid (ABA) in a process of drought priming-induced cold tolerance (DPICT), a wild-type barley and its ABA-deficient mutant Az34 counterpart were selected for comparison, in which the effects of melatonin application (either foliarly or rhizospherically) and/or drought priming on the cold tolerance of both types of barleys were systematically investigated. It was demonstrated that the early drought priming induced an increase of endogenous melatonin production, which is not ABA dependent. In addition, exogenously applied melatonin resulted in higher ABA concentration in the drought-primed plants than in the nonprimed plants when exposed to cold stress, indicating that ABA responded in a drought-dependent manner. The interplay of melatonin and ABA leads to plants maintaining better water status. Drought priming-induced melatonin accumulation enhanced the antioxidant capacity in both chloroplasts and mitochondria, which sustained the photosynthetic electron transport in photosynthetic apparatus of the plants under cold stress. These results suggest that the exogenous melatonin application enhances the DPICT by modulating subcellular antioxidant systems and ABA levels in barley. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Shuai, Haiwei; Meng, Yongjie; Luo, Xiaofeng; Chen, Feng; Zhou, Wenguan; Dai, Yujia; Qi, Ying; Du, Junbo; Yang, Feng; Liu, Jiang; Yang, Wenyu; Shu, Kai
2017-10-03
Auxin is an important phytohormone which mediates diverse development processes in plants. Published research has demonstrated that auxin induces seed dormancy. However, the precise mechanisms underlying the effect of auxin on seed germination need further investigation, especially the relationship between auxins and both abscisic acid (ABA) and gibberellins (GAs), the latter two phytohormones being the key regulators of seed germination. Here we report that exogenous auxin treatment represses soybean seed germination by enhancing ABA biosynthesis, while impairing GA biogenesis, and finally decreasing GA 1 /ABA and GA 4 /ABA ratios. Microscope observation showed that auxin treatment delayed rupture of the soybean seed coat and radicle protrusion. qPCR assay revealed that transcription of the genes involved in ABA biosynthetic pathway was up-regulated by application of auxin, while expression of genes involved in GA biosynthetic pathway was down-regulated. Accordingly, further phytohormone quantification shows that auxin significantly increased ABA content, whereas the active GA 1 and GA 4 levels were decreased, resulting insignificant decreases in the ratiosGA 1 /ABA and GA 4 /ABA.Consistent with this, ABA biosynthesis inhibitor fluridone reversed the delayed-germination phenotype associated with auxin treatment, while paclobutrazol, a GA biosynthesis inhibitor, inhibited soybean seed germination. Altogether, exogenous auxin represses soybean seed germination by mediating ABA and GA biosynthesis.
Masclef, Diane; Lebon, Eric; Christophe, Angélique
2017-01-01
Plants evolved different strategies to cope with water stress. While isohydric species maintain their midday leaf water potential (ΨM) under soil water deficit by closing their stomata, anisohydric species maintain higher stomatal aperture and exhibit substantial reductions in ΨM. It was hypothesized that isohydry is related to a locally higher sensitivity of stomata to the drought-hormone abscisic acid (ABA). Interestingly, recent lines of evidence in Arabidopsis (Arabidopsis thaliana) suggested that stomatal responsiveness is also controlled by an ABA action on leaf water supply upstream from stomata. Here, we tested the possibility in grapevine (Vitis vinifera) that different genotypes ranging from near isohydric to more anisohydric may have different sensitivities in these ABA responses. Measurements on whole plants in drought conditions were combined with assays on detached leaves fed with ABA. Two different methods consistently showed that leaf hydraulic conductance (Kleaf) was down-regulated by exogenous ABA, with strong variations depending on the genotype. Importantly, variation between isohydry and anisohydry correlated with Kleaf sensitivity to ABA, with Kleaf in the most anisohydric genotypes being unresponsive to the hormone. We propose that the observed response of Kleaf to ABA may be part of the overall ABA regulation of leaf water status. PMID:28899961
Synthesis of alpha-amino acids
Davis, Jr., Jefferson W.
1983-01-01
A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.
Is Bacterial Fatty Acid Synthesis a Valid Target for Antibacterial Drug Discovery?
Parsons, Joshua B.; Rock, Charles O.
2011-01-01
The emergence of resistance against most current drugs emphasizes the need to develop new approaches to control bacterial pathogens, particularly Staphylococcus aureus. Bacterial fatty acid synthesis is one such target that is being actively pursued by several research groups to develop anti-Staphylococcal agents. Recently, the wisdom of this approach has been challenged based on the ability of a Gram-positive bacterium to incorporate extracellular fatty acids and thus circumvent the inhibition of de novo fatty acid synthesis. The generality of this conclusion has been challenged, and there is enough diversity in the enzymes and regulation of fatty acid synthesis in bacteria to conclude that there isn’t a single organism that can be considered typical and representative of bacteria as a whole. We are left without a clear resolution to this ongoing debate and await new basic research to define the pathways for fatty acid uptake and that determine the biochemical and genetic mechanisms for the regulation of fatty acid synthesis in Gram-positive bacteria. These crucial experiments will determine whether diversity in the control of this important pathway accounts for the apparently different responses of Gram-positive bacteria to the inhibition of de novo fatty acid synthesis in presence of extracellular fatty acid supplements. PMID:21862391
Li, Song; Assmann, Sarah M; Albert, Réka
2006-01-01
Plants both lose water and take in carbon dioxide through microscopic stomatal pores, each of which is regulated by a surrounding pair of guard cells. During drought, the plant hormone abscisic acid (ABA) inhibits stomatal opening and promotes stomatal closure, thereby promoting water conservation. Dozens of cellular components have been identified to function in ABA regulation of guard cell volume and thus of stomatal aperture, but a dynamic description is still not available for this complex process. Here we synthesize experimental results into a consistent guard cell signal transduction network for ABA-induced stomatal closure, and develop a dynamic model of this process. Our model captures the regulation of more than 40 identified network components, and accords well with previous experimental results at both the pathway and whole-cell physiological level. By simulating gene disruptions and pharmacological interventions we find that the network is robust against a significant fraction of possible perturbations. Our analysis reveals the novel predictions that the disruption of membrane depolarizability, anion efflux, actin cytoskeleton reorganization, cytosolic pH increase, the phosphatidic acid pathway, or K+ efflux through slowly activating K+ channels at the plasma membrane lead to the strongest reduction in ABA responsiveness. Initial experimental analysis assessing ABA-induced stomatal closure in the presence of cytosolic pH clamp imposed by the weak acid butyrate is consistent with model prediction. Simulations of stomatal response as derived from our model provide an efficient tool for the identification of candidate manipulations that have the best chance of conferring increased drought stress tolerance and for the prioritization of future wet bench analyses. Our method can be readily applied to other biological signaling networks to identify key regulatory components in systems where quantitative information is limited. PMID:16968132
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu, Xin, E-mail: fangfei6073@126.com; Zhu, Yanming, E-mail: ymzhu2001@neau.edu.cn; Zhai, Hong, E-mail: Zhai.h@neigaehrb.ac.cn
2012-06-15
Highlights: Black-Right-Pointing-Pointer AtPP2CG1 positively regulates salt tolerance in ABA-dependent manner. Black-Right-Pointing-Pointer AtPP2CG1 up-regulates the expression of marker genes in different pathways. Black-Right-Pointing-Pointer AtPP2CG1 expresses in the vascular system and trichomes of Arabidopsis. -- Abstract: AtPP2CG1 (Arabidopsis thaliana protein phosphatase 2C G Group 1) was predicted as an abiotic stress candidate gene by bioinformatic analysis in our previous study. The gene encodes a putative protein phosphatase 2C that belongs to Group G of PP2C. There is no report of Group G genes involved in abiotic stress so far. Real-time RT-PCR analysis showed that AtPP2CG1 expression was induced by salt, drought, andmore » abscisic acid (ABA) treatment. The expression levels of AtPP2CG1 in the ABA synthesis-deficient mutant abi2-3 were much lower than that in WT plants under salt stress suggesting that the expression of AtPP2CG1 acts in an ABA-dependent manner. Over-expression of AtPP2CG1 led to enhanced salt tolerance, whereas its loss of function caused decreased salt tolerance. These results indicate that AtPP2CG1 positively regulates salt stress in an ABA-dependent manner. Under salt treatment, AtPP2CG1 up-regulated the expression levels of stress-responsive genes, including RD29A, RD29B, DREB2A and KIN1. GUS activity was detected in roots, leaves, stems, flower, and trichomes of AtPP2CG1 promoter-GUS transgenic plants. AtPP2CG1 protein was localized in nucleus and cytoplasm via AtPP2CG1:eGFP and YFP:AtPP2CG1 fusion approaches.« less
Abscisic acid regulates seed germination of Vellozia species in response to temperature.
Vieira, B C; Bicalho, E M; Munné-Bosch, S; Garcia, Q S
2017-03-01
The relationship between the phytohormones, gibberellin (GA) and abscisic acid (ABA) and light and temperature on seed germination is still not well understood. We aimed to investigate the role of the ABA and GA on seed germination of Vellozia caruncularis, V. intermedia and V. alutacea in response to light/dark conditions on different temperature. Seeds were incubated in GA (GA 3 or GA 4 ) or ABA and their respective biosynthesis inhibitors (paclobutrazol - PAC, and fluridone - FLU) solutions at two contrasting temperatures (25 and 40 °C). Furthermore, endogenous concentrations of active GAs and those of ABA were measured in seeds of V. intermedia and V. alutacea during imbibition/germination. Exogenous ABA inhibited the germination of Vellozia species under all conditions tested. GA, FLU and FLU + GA 3 stimulated germination in the dark at 25 °C (GA 4 being more effective than GA 3 ). PAC reduced seed germination in V. caruncularis and V. alutacea, but did not affect germination of V. intermedia at 40 °C either under light or dark conditions. During imbibition in the dark, levels of active GAs decreased in the seeds of V. intermedia, but were not altered in those of V. alutacea. Incubation at 40 °C decreased ABA levels during imbibition in both V. caruncularis and V. alutacea. We conclude that the seeds of Vellozia species studied here require light or high temperature to germinate and ABA has a major role in the regulation of Vellozia seed germination in response to light and temperature. © 2016 German Botanical Society and The Royal Botanical Society of the Netherlands.
Xu, Tao; Wang, Yanling; Liu, Xin; Gao, Song; Qi, Mingfang; Li, Tianlai
2015-07-01
2,4-Dichlorophenoxyacetic acid (2,4-D), an important plant growth regulator, is the herbicide most commonly used worldwide to control weeds. However, broad-leaf fruits and vegetables are extremely sensitive to herbicides, which can cause damage and result in lost crops when applied in a manner inconsistent with the directions. Despite detailed knowledge of the mechanism of 2,4-D, the regulation of auxin signalling is still unclear. For example, although the major mediators of auxin signalling, including auxin/indole acetic acid (AUX/IAA) proteins and auxin response factors (ARFs), are known to mediate auxinic herbicides, the underlying mechanisms are still unclear. In this study, the effects of 2,4-D on AUX/IAA gene expression in tomato were investigated, and the two most notably up-regulated genes, SlIAA15 and SlIAA29, were selected for further study. Western blotting revealed the substantial accumulation of both SlIAA15 and SlIAA29, and the expression levels of the corresponding genes were increased following abscisic acid (ABA) and ethylene treatment. Overexpressing SlIAA15, but not SlIAA29, induced a 2,4-D herbicide damage phenotype. The 35S::SlIAA15 line exhibited a strong reduction in leaf stomatal density and altered expression of some R2R3 MYB genes that are putatively involved in the regulation of stomatal differentiation. Further study revealed that root elongation in 35S::SlIAA15 was sensitive to ABA treatment, and was most probably due to the altered expression of an ABA signal transduction gene. In addition, the altered auxin sensitivities of SlIAA15 transformants were also explored. These results suggested that SlIAA15 plays an important role in determining the effects of the herbicide 2,4-D. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Qi, Cong-Cong; Zhang, Zhi; Fang, Hui; Liu, Ji; Zhou, Nan; Ge, Jin-Fang; Chen, Fang-Han; Xiang, Cheng-Bin; Zhou, Jiang-Ning
2014-10-31
Corticotrophin-releasing hormone (CRH) is considered to be the central driving force of the hypothalamic-pituitary-adrenal axis, which plays a key role in the stress response and depression. Clinical reports have suggested that excess retinoic acid (RA) is associated with depression. Abscisic acid (ABA) and RA are direct derivatives of carotenoids and share a similar molecular structure. Here, we proposed that ABA also plays a role in the regulation of CRH activity sharing with the RA signaling pathway. [3H]-ABA radioimmunoassay demonstrated that the hypothalamus of rats shows the highest concentration of ABA compared with the cortex and the hippocampus under basal conditions. Under acute stress, ABA concentrations increased in the serum, but decreased in the hypothalamus and were accompanied by increased corticosterone in the serum and c-fos expression in the hypothalamus. Moreover, chronic ABA administration increased sucrose intake and decreased the mRNA expression of CRH and retinoic acid receptor alpha (RARα) in the hypothalamus of rats. Furthermore, ABA improved the symptom of chronic unpredictable mild stress in model rats, as indicated by increased sucrose intake, increased swimming in the forced swim test, and reduced mRNA expression of CRH and RARα in the rat hypothalamus. In vitro, CRH expression decreased after ABA treatment across different neural cells. In BE(2)-C cells, ABA inhibited a series of retinoid receptor expression, including RARα, a receptor that could facilitate CRH expression directly. These results suggest that ABA may play a role in the pathogenesis of depression by downregulating CRH mRNA expression shared with the RA signaling pathway. © The Author 2014. Published by Oxford University Press on behalf of CINP.
Ding, Zhong-Tao; Zhang, Zhi; Luo, Di; Zhou, Jin-Yan; Zhong, Juan; Yang, Jie; Xiao, Liang; Shu, Dan; Tan, Hong
2015-01-01
The phytopathogenic ascomycete Botrytis cinerea produces several secondary metabolites that have biotechnical significance and has been particularly used for S-(+)-abscisic acid production at the industrial scale. To manipulate the expression levels of specific secondary metabolite biosynthetic genes of B. cinerea with Agrobacterium tumefaciens-mediated transformation system, two expression vectors (pCBh1 and pCBg1 with different selection markers) and one RNA silencing vector, pCBSilent1, were developed with the In-Fusion assembly method. Both expression vectors were highly effective in constitutively expressing eGFP, and pCBSilent1 effectively silenced the eGFP gene in B. cinerea. Bcaba4, a gene suggested to participate in ABA biosynthesis in B. cinerea, was then targeted for gene overexpression and RNA silencing with these reverse genetic tools. The overexpression of bcaba4 dramatically induced ABA formation in the B. cinerea wild type strain Bc-6, and the gene silencing of bcaba4 significantly reduced ABA-production in an ABA-producing B. cinerea strain. PMID:25955649
Biotin and Lipoic Acid: Synthesis, Attachment and Regulation
Cronan, John E.
2014-01-01
Summary Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as “swinging arms” that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well-described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like “arm” of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized and thus there is no transcriptional control of the synthetic genes. In contrast transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA a dual function protein that both represses
Distribution, industrial applications, and enzymatic synthesis of D-amino acids.
Gao, Xiuzhen; Ma, Qinyuan; Zhu, Hailiang
2015-04-01
D-Amino acids exist widely in microbes, plants, animals, and food and can be applied in pharmaceutical, food, and cosmetics. Because of their widespread applications in industry, D-amino acids have recently received more and more attention. Enzymes including D-hydantoinase, N-acyl-D-amino acid amidohydrolase, D-amino acid amidase, D-aminopeptidase, D-peptidase, L-amino acid oxidase, D-amino acid aminotransferase, and D-amino acid dehydrogenase can be used for D-amino acids synthesis by kinetic resolution or asymmetric amination. In this review, the distribution, industrial applications, and enzymatic synthesis methods are summarized. And, among all the current enzymatic methods, D-amino acid dehydrogenase method not only produces D-amino acid by a one-step reaction but also takes environment and atom economics into consideration; therefore, it is deserved to be paid more attention.
Abscisic Acid Acts as a Blocker of the Bitter Taste G Protein-Coupled Receptor T2R4.
Pydi, Sai P; Jaggupilli, Appalaraju; Nelson, Ken M; Abrams, Suzanne R; Bhullar, Rajinder P; Loewen, Michele C; Chelikani, Prashen
2015-04-28
Bitter taste receptors (T2Rs) belong to the G protein-coupled receptor superfamily. In humans, 25 T2Rs mediate bitter taste sensation. In addition to the oral cavity, T2Rs are expressed in many extraoral tissues, including the central nervous system, respiratory system, and reproductive system. To understand the mechanistic roles of the T2Rs in oral and extraoral tissues, novel blockers or antagonists are urgently needed. Recently, we elucidated the binding pocket of T2R4 for its agonist quinine, and an antagonist and inhibitory neurotransmitter, γ-aminobutyric acid. This structure-function information about T2R4 led us to screen the plant hormone abscisic acid (ABA), its precursor (xanthoxin), and catabolite phaseic acid for their ability to bind and activate or inhibit T2R4. Molecular docking studies followed by functional assays involving calcium imaging confirmed that ABA is an antagonist with an IC50 value of 34.4 ± 1.1 μM. However, ABA precursor xanthoxin acts as an agonist on T2R4. Interestingly, molecular model-guided site-directed mutagenesis suggests that the T2R4 residues involved in quinine binding are also predominantly involved in binding to the novel antagonist, ABA. The antagonist ability of ABA was tested using another T2R4 agonist, yohimbine. Our results suggest that ABA does not inhibit yohimbine-induced T2R4 activity. The discovery of natural bitter blockers has immense nutraceutical and physiological significance and will help in dissecting the T2R molecular pathways in various tissues.
Effects of abscisic acid and xanthoxin on elongation and gravitropism in primary roots of Zea mays
NASA Technical Reports Server (NTRS)
Lee, J. S.; Hasenstein, K. H.; Mulkey, T. J.; Yang, R. L.; Evans, M. L.
1990-01-01
We examined the involvement of abscisic acid (ABA) and xanthoxin (Xan) in maize root gravitropism by (1) testing the ability of ABA to allow positive gravitropism in dark-grown seedlings of the maize cultivar LG11, a cultivar known to require light for positive gravitropism of the primary root, (2) comparing curvature in roots in which half of the cap had been excised and replaced with agar containing either ABA or indole-3-acetic acid (IAA), (3) measuring gravitropism in roots of seedlings submerged in oxygenated solutions of ABA or IAA and (4) testing the effect of Xan on root elongation. Using a variety of methods of applying ABA to the root, we found that ABA did not cause horizontally-oriented primary roots of dark-grown seedlings to become positively gravitropic. Replacing half of the root cap of vertically oriented roots with an agar block containing ABA had little or no effect on curvature relative to that of controls in which the half cap was replaced by a plain agar block. Replacement of the removed half cap with IAA either canceled or reversed the curvature displayed by controls. When light-grown seedlings were submerged in ABA they responded strongly to gravistimulation while those in IAA did not. Xan (up to 0.1 mM) did not affect root elongation. The results indicate that ABA is not a likely mediator of root gravitropism and that the putative ABA precursor, Xan, lacks the appropriate growth-inhibiting properties to serve as a mediator of root gravitropism.
Sano, Katsura; Gotoh, Mari; Dodo, Kyoko; Tajima, Noriaki; Shimizu, Yoshibumi; Murakami-Murofushi, Kimiko
2018-01-01
Hyaluronic acid is a major component of the extracellular matrix, which is important for skin hydration. As aging brings skin dehydration, we aimed to clarify the mRNA expression of hyaluronic acid-related proteins in human skin fibroblasts from donors of various ages (range 0.7-69 years). Previously, we reported that cyclic phosphatidic acid (cPA), a unique phospholipid mediator, stimulated the expression of HAS2 and increased hyaluronic acid synthesis in human skin fibroblasts (donor age: 3 days). In this study, we measured the mRNA expression of hyaluronic acid-related proteins: hyaluronan synthase (HAS) 1-3, hyaluronidase-1, -2, and hyaluronic acid-binding protein (versican). In addition, we tested whether cPA could increase hyaluronic acid synthesis in skin fibroblasts derived from donors of various ages. The expression of HAS1, 3, hyaluronidase-1, and -2 did not change with aging. However, the mRNA expression of versican decreased with aging. Although it is thought that the amount of hyaluronic acid in the dermis decreases with aging, the mRNA expression of HAS2 was increased. But the amount of hyaluronic acid secreted by fibroblasts did not increase with aging. This suggests that the activity and/or protein expression of HAS2 decrease with aging. Furthermore, we observed that cPA caused the increase of hyaluronic acid synthesis at any age, and this effect was increased with aging. These results suggest that aging made the fibroblasts more sensitive to cPA treatment. Therefore, cPA represents a suitable candidate for the health maintenance and improvement of the skin by increasing the level of hyaluronic acid in the dermis.
Ramirez, Leonor; Quintana, Silvina; Szawarski, Nicolás; Maggi, Matías; Le Conte, Yves; Lamattina, Lorenzo; Eguaras, Martin
2017-01-01
Many biotic and abiotic stressors impact bees’ health, acting as immunosupressors and contribute to colony losses. Thus, the importance of studying the immune response of honey bees is central to develop new strategies aiming to enhance bees’ fitness to confront the threats affecting them. If a pathogen breaches the physical and chemical barriers, honey bees can protect themselves from infection with cellular and humoral immune responses which represent a second line of defense. Through a series of correlative studies we have previously reported that abscisic acid (ABA) and nitric oxide (NO) share roles in the same immune defenses of Apis mellifera (A. mellifera). Here we show results supporting that the supplementation of bee larvae’s diet reared in vitro with l-Arginine (precursor of NO) or ABA enhanced the immune activation of the granulocytes in response to wounding and lipopolysaccharide (LPS) injection. PMID:28809782
González-Guzmán, Miguel; Rodríguez, Lesia; Lorenzo-Orts, Laura; Pons, Clara; Sarrión-Perdigones, Alejandro; Fernández, Maria A; Peirats-Llobet, Marta; Forment, Javier; Moreno-Alvero, Maria; Cutler, Sean R; Albert, Armando; Granell, Antonio; Rodríguez, Pedro L
2014-08-01
Abscisic acid (ABA) plays a crucial role in the plant's response to both biotic and abiotic stress. Sustainable production of food faces several key challenges, particularly the generation of new varieties with improved water use efficiency and drought tolerance. Different studies have shown the potential applications of Arabidopsis PYR/PYL/RCAR ABA receptors to enhance plant drought resistance. Consequently the functional characterization of orthologous genes in crops holds promise for agriculture. The full set of tomato (Solanum lycopersicum) PYR/PYL/RCAR ABA receptors have been identified here. From the 15 putative tomato ABA receptors, 14 of them could be grouped in three subfamilies that correlated well with corresponding Arabidopsis subfamilies. High levels of expression of PYR/PYL/RCAR genes was found in tomato root, and some genes showed predominant expression in leaf and fruit tissues. Functional characterization of tomato receptors was performed through interaction assays with Arabidopsis and tomato clade A protein phosphatase type 2Cs (PP2Cs) as well as phosphatase inhibition studies. Tomato receptors were able to inhibit the activity of clade A PP2Cs differentially in an ABA-dependent manner, and at least three receptors were sensitive to the ABA agonist quinabactin, which inhibited tomato seed germination. Indeed, the chemical activation of ABA signalling induced by quinabactin was able to activate stress-responsive genes. Both dimeric and monomeric tomato receptors were functional in Arabidopsis plant cells, but only overexpression of monomeric-type receptors conferred enhanced drought resistance. In summary, gene expression analyses, and chemical and transgenic approaches revealed distinct properties of tomato PYR/PYL/RCAR ABA receptors that might have biotechnological implications. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology.
Derivatives of diphosphonic acids: synthesis and biological activity
NASA Astrophysics Data System (ADS)
Zolotukhina, M. M.; Krutikov, V. I.; Lavrent'ev, A. N.
1993-07-01
The scientific-technical and patent literature on the synthesis of derivatives of diphosphonic acids is surveyed. Various methods of synthesis of diphosphonate, phosphonylphosphinyl, and phosphonophosphate compounds are described. The principal aspects of the use of the above compounds in medicine, biochemistry, and agriculture are examined. The bibliography includes 174 references.
Tucker, D J; Mansfield, T A
1971-06-01
Apical dominance in Xanthium strumarium was influenced by the quality of illumination received at the end of the photoperiod. The involvement of the red/far-red regions of the spectrum was apparent. The persistence of the effects was partially dependent on the age of the individual buds concerned. Plants receiving 30 minutes of illumination from tungsten lamps after a 16-hour photoperiod from fluorescent tubes failed to branch, whereas plants given an identical photoperiod, both in terms of day-length and photosynthetically available light energy, but lacking the far-red from tungsten lamps, branched profusely.The influence of the spectral distribution of illumination on the levels of cytokinins and abseisic acid in the plant, and the correlation with the degree of branching, is presented and discussed. The cytokinin content was much higher in inhibited than released buds. The cytokinins present were probably not able to particinate in bud growth because of an accumulation of inhibitors resembling abscisic acid. The concentration of the inhibitors in inhibited buds was 50 to 250 times that occurring in all other plant parts examined.
Galka, Marek M.; Rajagopalan, Nandhakishore; Buhrow, Leann M.; Nelson, Ken M.; Switala, Jacek; Cutler, Adrian J.; Palmer, David R. J.; Loewen, Peter C.; Abrams, Suzanne R.; Loewen, Michele C.
2015-01-01
Abscisic acid ((+)-ABA) is a phytohormone involved in the modulation of developmental processes and stress responses in plants. A chemical proteomics approach using an ABA mimetic probe was combined with in vitro assays, isothermal titration calorimetry (ITC), x-ray crystallography and in silico modelling to identify putative (+)-ABA binding-proteins in crude extracts of Arabidopsis thaliana. Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) was identified as a putative ABA-binding protein. Radiolabelled-binding assays yielded a Kd of 47 nM for (+)-ABA binding to spinach Rubisco, which was validated by ITC, and found to be similar to reported and experimentally derived values for the native ribulose-1,5-bisphosphate (RuBP) substrate. Functionally, (+)-ABA caused only weak inhibition of Rubisco catalytic activity (Ki of 2.1 mM), but more potent inhibition of Rubisco activation (Ki of ~ 130 μM). Comparative structural analysis of Rubisco in the presence of (+)-ABA with RuBP in the active site revealed only a putative low occupancy (+)-ABA binding site on the surface of the large subunit at a location distal from the active site. However, subtle distortions in electron density in the binding pocket and in silico docking support the possibility of a higher affinity (+)-ABA binding site in the RuBP binding pocket. Overall we conclude that (+)-ABA interacts with Rubisco. While the low occupancy (+)-ABA binding site and weak non-competitive inhibition of catalysis may not be relevant, the high affinity site may allow ABA to act as a negative effector of Rubisco activation. PMID:26197050
Galka, Marek M; Rajagopalan, Nandhakishore; Buhrow, Leann M; Nelson, Ken M; Switala, Jacek; Cutler, Adrian J; Palmer, David R J; Loewen, Peter C; Abrams, Suzanne R; Loewen, Michele C
2015-01-01
Abscisic acid ((+)-ABA) is a phytohormone involved in the modulation of developmental processes and stress responses in plants. A chemical proteomics approach using an ABA mimetic probe was combined with in vitro assays, isothermal titration calorimetry (ITC), x-ray crystallography and in silico modelling to identify putative (+)-ABA binding-proteins in crude extracts of Arabidopsis thaliana. Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) was identified as a putative ABA-binding protein. Radiolabelled-binding assays yielded a Kd of 47 nM for (+)-ABA binding to spinach Rubisco, which was validated by ITC, and found to be similar to reported and experimentally derived values for the native ribulose-1,5-bisphosphate (RuBP) substrate. Functionally, (+)-ABA caused only weak inhibition of Rubisco catalytic activity (Ki of 2.1 mM), but more potent inhibition of Rubisco activation (Ki of ~ 130 μM). Comparative structural analysis of Rubisco in the presence of (+)-ABA with RuBP in the active site revealed only a putative low occupancy (+)-ABA binding site on the surface of the large subunit at a location distal from the active site. However, subtle distortions in electron density in the binding pocket and in silico docking support the possibility of a higher affinity (+)-ABA binding site in the RuBP binding pocket. Overall we conclude that (+)-ABA interacts with Rubisco. While the low occupancy (+)-ABA binding site and weak non-competitive inhibition of catalysis may not be relevant, the high affinity site may allow ABA to act as a negative effector of Rubisco activation.
Ferrero, Manuela; Pagliarani, Chiara; Novák, Ondrej; Ferrandino, Alessandra; Cardinale, Francesca; Visentin, Ivan; Schubert, Andrea
2018-04-23
Besides signalling to soil organisms, strigolactones (SLs) control above- and below-ground morphology, in particular shoot branching. Furthermore, SLs interact with stress responses, possibly thanks to a crosstalk with the abscisic acid (ABA) signal. In grapevine (Vitis vinifera L.), ABA drives the accumulation of anthocyanins over the ripening season. In this study, we investigated the effects of treatment with a synthetic strigolactone analogue, GR24, on anthocyanin accumulation in grape berries, in the presence or absence of exogenous ABA treatment. Experiments were performed both on severed, incubated berries, and on berries attached to the vine. Furthermore, we analysed the corresponding transcript concentrations of genes involved in anthocyanin biosynthesis, and in ABA biosynthesis, metabolism, and membrane transport. During the experiment time courses, berries showed the expected increase in soluble sugars and anthocyanins. GR24 treatment had no or little effect on anthocyanin accumulation, or on gene expression levels. Exogenous ABA treatment activated soluble sugar and anthocyanin accumulation, and enhanced expression of anthocyanin and ABA biosynthetic genes, and that of genes involved in ABA hydroxylation and membrane transport. Co-treatment of GR24 with ABA delayed anthocyanin accumulation, decreased expression of anthocyanin biosynthetic genes, and negatively affected ABA concentration. GR24 also enhanced the ABA-induced activation of ABA hydroxylase genes, while it down-regulated the ABA-induced activation of ABA transport genes. Our results show that GR24 affects the ABA-induced activation of anthocyanin biosynthesis in this non-climacteric fruit. We discuss possible mechanisms underlying this effect, and the potential role of SLs in ripening of non-ABA-treated berries.
The regulatory network of ThbZIP1 in response to abscisic acid treatment
Ji, Xiaoyu; Liu, Guifeng; Liu, Yujia; Nie, Xianguang; Zheng, Lei; Wang, Yucheng
2015-01-01
Previously, a bZIP transcription factor from Tamarix hispida, ThbZIP1, was characterized: plants overexpressing ThbZIP1 displayed improved salt stress tolerance but were sensitive to abscisic acid (ABA). In the current study, we further characterized the regulatory network of ThbZIP1 and the mechanism of ABA sensitivity mediated by ThbZIP1. An ABF transcription factor from T. hispida, ThABF1, directly regulates the expression of ThbZIP1. Microarray analysis identified 1662 and 1609 genes that were respectively significantly upregulated or downregulated by ThbZIP1 when exposed to ABA. Gene ontology (GO) analysis showed that the processes including “response to stimulus,” “catalytic activity,” “binding function,” and “metabolic process” were highly altered in ThbZIP1 expressing plants exposed to ABA. The gene expression in ThbZIP1 transformed plants were compared between exposed to ABA and salt on the genome scale. Genes differentially regulated by both salt and ABA treatment only accounted for 9.75% of total differentially regulated genes. GO analysis showed that structural molecule activity, organelle part, membrane-enclosed lumen, reproduction, and reproductive process are enhanced by ABA but inhibited by salt stress. Conversely, immune system and multi-organism process were improved by salt but inhibited by ABA. Transcription regulator activity, enzyme regulator activity, and developmental process were significantly altered by ABA but were not affected by salt stress. Our study provides insights into how ThbZIP1 mediates ABA and salt stress response at the molecular level. PMID:25713576
Qin, Xiaoqiong; Zeevaart, Jan A D
2002-02-01
The plant hormone abscisic acid (ABA) plays important roles in seed maturation and dormancy and in adaptation to a variety of environmental stresses. An effort to engineer plants with elevated ABA levels and subsequent stress tolerance is focused on the genetic manipulation of the cleavage reaction. It has been shown in bean (Phaseolus vulgaris) that the gene encoding the cleavage enzyme (PvNCED1) is up-regulated by water stress, preceding accumulation of ABA. Transgenic wild tobacco (Nicotiana plumbaginifolia Viv.) plants were produced that overexpress the PvNCED1 gene either constitutively or in an inducible manner. The constitutive expression of PvNCED1 resulted in an increase in ABA and its catabolite, phaseic acid (PA). When the PvNCED1 gene was driven by the dexamethasone (DEX)-inducible promoter, a transient induction of PvNCED1 message and accumulation of ABA and PA were observed in different lines after application of DEX. Accumulation of ABA started to level off after 6 h, whereas the PA level continued to increase. In the presence of DEX, seeds from homozygous transgenic line TN1 showed a 4-d delay in germination. After spraying with DEX, the detached leaves from line TN1 had a drastic decrease in their water loss relative to control leaves. These plants also showed a marked increase in their tolerance to drought stress. These results indicate that it is possible to manipulate ABA levels in plants by overexpressing the key regulatory gene in ABA biosynthesis and that stress tolerance can be improved by increasing ABA levels.
A new regulatory mechanism for bacterial lipoic acid synthesis
Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun
2015-01-01
Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID
A new regulatory mechanism for bacterial lipoic acid synthesis.
Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun
2015-01-22
Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015
PlsX deletion impacts fatty acid synthesis and acid adaptation in Streptococcus mutans.
Cross, Benjamin; Garcia, Ariana; Faustoferri, Roberta; Quivey, Robert G
2016-04-01
Streptococcus mutans, one of the primary causative agents of dental caries in humans, ferments dietary sugars in the mouth to produce organic acids. These acids lower local pH values, resulting in demineralization of the tooth enamel, leading to caries. To survive acidic environments, Strep. mutans employs several adaptive mechanisms, including a shift from saturated to unsaturated fatty acids in membrane phospholipids. PlsX is an acyl-ACP : phosphate transacylase that links the fatty acid synthase II (FASII) pathway to the phospholipid synthesis pathway, and is therefore central to the movement of unsaturated fatty acids into the membrane. Recently, we discovered that plsX is not essential in Strep. mutans. A plsX deletion mutant was not a fatty acid or phospholipid auxotroph. Gas chromatography of fatty acid methyl esters indicated that membrane fatty acid chain length in the plsX deletion strain differed from those detected in the parent strain, UA159. The deletion strain displayed a fatty acid shift similar to WT, but had a higher percentage of unsaturated fatty acids at low pH. The deletion strain survived significantly longer than the parent strain when cultures were subjected to an acid challenge of pH 2.5.The ΔplsX strain also exhibited elevated F-ATPase activity at pH 5.2, compared with the parent. These results indicate that the loss of plsX affects both the fatty acid synthesis pathway and the acid-adaptive response of Strep. mutans.
Abiotic synthesis of fatty acids
NASA Technical Reports Server (NTRS)
Leach, W. W.; Nooner, D. W.; Oro, J.
1978-01-01
The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.
Maniscalco, W M; Finkelstein, J N; Parkhurst, A B
1989-05-01
De novo fatty acid synthesis may be an important source of saturated fatty acids for fetal lung disaturated phosphatidylcholine (DSPC) production. To investigate the roles of de novo fatty acid synthesis and exogenous fatty acids, we incubated dispersed fetal lung cells and freshly isolated adult type II cells with exogenous palmitate and oleate and measured DSPC synthesis. Unlike adult type II cells, fetal lung cells did not increase DSPC synthesis when exogenous palmitate was available; adult type II cells increased DSPC synthesis by 70% in the presence of palmitate. Exogenous oleate decreased DSPC synthesis by 48% in fetal cells but not in adult type II cells. Incubation of fetal lung cells with TOFA [2-furancarboxylate, 5-(tetradecyloxy)-sodium], a metabolic inhibitor of fatty acid synthesis, decreased fatty acid synthesis by 65%. There was a simultaneous 56% inhibition of DSPC production, but no effect on protein, DNA, or glyceride-glycerol production, measured by precursor incorporation. The inhibition of DSPC synthesis associated with TOFA was partially prevented by exogenous palmitate but not oleate. Fetal cells prepared from explants that had been cultured in dexamethasone also had TOFA-associated inhibition of DSPC synthesis that was similar to non-dexamethasone-exposed cells. These studies suggest that under baseline conditions of low fatty acid availability, such as in the fetus, de novo fatty acid synthesis in fetal cells, but not in adult type II cells, provides sufficient saturated fatty acids to support maximal DSPC production. Inhibition of de novo fatty acid synthesis resulting in decreased DSPC production in fetal lung cells in conditions of low fatty acid availability suggests that fatty acid synthesis may be central to maintain DSPC synthesis in the fetus.
Enzymic Synthesis of Indole-3-Acetyl-1-O-β-d-Glucose 1
Leznicki, Antoni J.; Bandurski, Robert S.
1988-01-01
The synthesis of indole-3-acetyl-1-O-β-d-glucose from indole-3-acetic acid (IAA) and uridine diphosphoglucose (UDPG) has been shown to be a reversible reaction with the equilibrium away from ester formation and toward formation of IAA. The enzyme occurs primarily in the liquid endosperm of the corn kernel but some activity occurs in the embryo. It is relatively specific showing no glucose ester formation with oxindole-3-acetic acid or 7-hydroxy-oxindole-3-acetic acid, and low activity with phenylpropene acids, such as ρ-coumaric acid. The enzyme is also specific for the nucleotide sugar showing no activity with UDPGalactose or UDPXylose. The enzyme is inhibited by inorganic pyrophosphate, by phosphate esters and by phospholipids, particularly phosphatidyl ethanolamine. The enzyme is inhibited by zeatin, by 2,4-dichlorophenoxy-acetic acid, by IAA-myo-inositol and IAA-glucan, but not by zeatin riboside, and only weakly by gibberellic acid, abscisic acid, and kinetin. The reaction is slightly stimulated by both calcium and calmodulin and, in some cases, by thiol compounds. The role of this enzyme in the homeostatic control of indole-3-acetic acid levels in Zea mays is discussed. PMID:11537439
Poschenrieder, Charlotte; Gunsé, Benet; Barceló, Juan
1989-01-01
Ten day old bush bean plants (Phaseolus vulgaris L. cv Contender) were used to analyze the effects of 3 micromolar Cd on the time courses of expansion growth, dry weight, leaf water relations, stomatal resistance, and abscisic acid (ABA) levels in roots and leaves. Control and Cd-treated plants were grown for 144 hours in nutrient solution. Samples were taken at 24 hour intervals. At the 96 and 144 hour harvests, additional measurements were made on excised leaves which were allowed to dry for 2 hours. From the 48 hour harvest, Cd-treated plants showed lower leaf relative water contents and higher stomatal resistances than controls. At the same time, root and leaf expansion growth, but not dry weight, was significantly reduced. The turgor potentials of leaves from Cd-treated plants were nonsignificantly higher than those of control leaves. A significant increase (almost 400%) of the leaf ABA concentration was detected after 120 hours exposure to Cd. But Cd was found to inhibit ABA accumulation during drying of excised leaves. It is concluded that Cd-induced decrease of expansion growth is not due to turgor decrease. The possible mechanisms of Cd-induced stomatal closure are discussed. PMID:16666937
Enzymatic routes for the synthesis of ursodeoxycholic acid.
Eggert, Thorsten; Bakonyi, Daniel; Hummel, Werner
2014-12-10
Ursodeoxycholic acid, a secondary bile acid, is used as a drug for the treatment of various liver diseases, the optimal dose comprises the range of 8-10mg/kg/day. For industrial syntheses, the structural complexity of this bile acid requires the use of an appropriate starting material as well as the application of regio- and enantio-selective enzymes for its derivatization. Most strategies for the synthesis start from cholic acid or chenodeoxycholic acid. The latter requires the conversion of the hydroxyl group at C-7 from α- into β-position in order to obtain ursodeoxycholic acid. Cholic acid on the other hand does not only require the same epimerization reaction at C-7 but the removal of the hydroxyl group at C-12 as well. There are several bacterial regio- and enantio-selective hydroxysteroid dehydrogenases (HSDHs) to carry out the desired reactions, for example 7α-HSDHs from strains of Clostridium, Bacteroides or Xanthomonas, 7β-HSDHs from Clostridium, Collinsella, or Ruminococcus, or 12α-HSDH from Clostridium or from Eggerthella. However, all these bioconversion reactions need additional steps for the regeneration of the coenzymes. Selected multi-step reaction systems for the synthesis of ursodeoxycholic acid are presented in this review. Copyright © 2014 Elsevier B.V. All rights reserved.
Meyer, Marjolaine D; Chope, Gemma A; Terry, Leon A
2017-08-01
The importance of ethylene in avocado ripening has been extensively studied. In contrast, little is known about the possible role of abscisic acid (ABA). The present work studied the effect of 1-methylcyclopropene (1-MCP) (0.3 μL L -1 ), e+® Ethylene Remover and the combination thereof on the quality of imported avocado cv. Hass fruit stored for 7 days at 12 °C. Ethylene production, respiration, firmness, colour, heptose (C7) sugars and ABA concentrations in mesocarp tissue were measured throughout storage. Treatment with e+® Ethylene Remover reduced ethylene production, respiration rate and physiological ripening compared with controls. Fruit treated with 1-MCP + e+® Ethylene Remover and, to a lesser extent 1-MCP alone, had the lowest ethylene production and respiration rate and hence the best quality. Major sugars measured in mesocarp tissue were mannoheptulose and perseitol, and their content was not correlated with ripening parameters. Mesocarp ABA concentration, as determined by mass spectrometry, increased as fruit ripened and was negatively correlated with fruit firmness. Results suggest a relationship between ABA and ethylene metabolism since blocking ethylene, and to a larger extent blocking and removing ethylene, resulted in lower ABA concentrations. Whether ABA influences avocado fruit ripening needs to be determined in future research. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Priming effect of abscisic acid on alkaline stress tolerance in rice (Oryza sativa L.) seedlings.
Wei, Li-Xing; Lv, Bing-Sheng; Wang, Ming-Ming; Ma, Hong-Yuan; Yang, Hao-Yu; Liu, Xiao-Long; Jiang, Chang-Jie; Liang, Zheng-Wei
2015-05-01
Saline-alkaline stress is characterized by high salinity and high alkalinity (high pH); alkaline stress has been shown to be the primary factor inhibiting rice seedling growth. In this study, we investigated the potential priming effect of abscisic acid (ABA) on tolerance of rice seedlings to alkaline stress simulated by Na2CO3. Seedlings were pretreated with ABA at concentrations of 0 (control), 10, and 50 μM by root-drench for 24 h and then transferred to a Na2CO3 solution that did not contain ABA. Compared to control treatment, pretreatment with ABA substantially improved the survival rate of rice seedlings and increased biomass accumulation after 7 days under the alkaline condition. ABA application at 10 μM also alleviated the inhibitory effects of alkaline stress on the total root length and root surface area. Physiologically, ABA increased relative water content (RWC) and decreased cell membrane injury degree (MI) and Na(+)/K(+) ratios. In contrast, fluridone (an ABA biosynthesis inhibitor) decreased the RWC and increased MI in shoots under the alkaline conditions. These data suggest that ABA has a potent priming effect on the adaptive response to alkaline stress in rice and may be useful for improving rice growth in saline-alkaline paddy fields. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Thiol-based Redox Proteins in Brassica napus Guard Cell Abscisic Acid and Methyl Jasmonate Signaling
Zhu, Mengmeng; Zhu, Ning; Song, Wen-yuan; Harmon, Alice C.; Assmann, Sarah M.; Chen, Sixue
2014-01-01
SUMMARY Reversibly oxidized cysteine sulfhydryl groups serve as redox sensors or targets of redox sensing that are important in different physiological processes. Little is known, however, about redox sensitive proteins in guard cells and how they function in stomatal signaling. In this study, Brassica napus guard cell proteins altered by redox in response to abscisic acid (ABA) or methyl jasmonate (MeJA) were identified by complementary proteomics approaches, saturation differential in-gel electrophoresis (DIGE) and isotope-coded affinity tag (ICAT). In total, 65 and 118 potential redox responsive proteins were identified in ABA and MeJA treated guard cells, respectively. All the proteins contain at least one cysteine, and over half of them are predicted to form intra-molecular disulfide bonds. Most of the proteins fall into the functional groups of energy, stress and defense, and metabolism. Based on the peptide sequences identified by mass spectrometry, 30 proteins were common to ABA and MeJA treated samples. A total of 44 cysteines was mapped in all the identified proteins, and their levels of redox sensitivity were quantified. Two of the proteins, a SNRK2 kinase and an isopropylmalate dehydrogenase were confirmed to be redox regulated and involved in stomatal movement. This study creates an inventory of potential redox switches, and highlights a protein redox regulatory mechanism in guard cell ABA and MeJA signal transduction. PMID:24580573
Ji, Jing; Zheng, Lingyu; Yue, Jianyun; Yao, Xiamei; Chang, Ermei; Xie, Tiantian; Deng, Nan; Chen, Lanzhen; Huang, Yuwen; Jiang, Zeping; Shi, Shengqing
2017-01-01
Glutamate decarboxylase (GAD), as a key enzyme in the γ -aminobutyric acid (GABA) shunt, catalyzes the decarboxylation of L-glutamate to form GABA. This pathway has attracted much interest because of its roles in carbon and nitrogen metabolism, stress responses, and signaling in higher plants. The aim of this study was to isolate and characterize genes encoding GADs from Caragana intermedia , an important nitrogen-fixing leguminous shrub. Two full-length cDNAs encoding GADs (designated as CiGAD1 and CiGAD2 ) were isolated and characterized. Multiple alignment and phylogenetic analyses were conducted to evaluate their structures and identities to each other and to homologs in other plants. Tissue expression analyses were conducted to evaluate their transcriptional responses to stress (NaCl, ZnSO 4 , CdCl 2 , high/low temperature, and dehydration) and exogenous abscisic acid. The CiGAD s contained the conserved PLP domain and calmodulin (CaM)-binding domain in the C-terminal region. The phylogenetic analysis showed that they were more closely related to the GADs of soybean, another legume, than to GADs of other model plants. According to Southern blotting analysis, CiGAD1 had one copy and CiGAD2 -related genes were present as two copies in C. intermedia . In the tissue expression analyses, there were much higher transcript levels of CiGAD2 than CiGAD1 in bark, suggesting that CiGAD2 might play a role in secondary growth of woody plants. Several stress treatments (NaCl, ZnSO 4 , CdCl 2 , high/low temperature, and dehydration) significantly increased the transcript levels of both CiGAD s, except for CiGAD2 under Cd stress. The CiGAD1 transcript levels strongly increased in response to Zn stress (74.3-fold increase in roots) and heat stress (218.1-fold increase in leaves). The transcript levels of both CiGAD s significantly increased as GABA accumulated during a 24-h salt treatment. Abscisic acid was involved in regulating the expression of these two CiGAD s under salt
Inhibition of fatty acid synthesis in isolated adipocytes by 5-(tetradecyloxy)-2-furoic acid.
Halvorson, D L; McCune, S A
1984-11-01
The compound 5-(tetradecyloxy)-2-furoic acid (TOFA), a hypolipidemic agent, inhibits fatty acid synthesis, lactate and pyruvate accumulation and CO2 release in isolated rat adipocytes. TOFA stimulates the accumulation of citrate. ATP levels are not lowered by TOFA. In comparison with the natural fatty acid, oleate, TOFA exhibited a much greater inhibitory effect on lipogenesis. TOFyl-CoA formation within intact adipocytes was demonstrated. Although not inhibited by TOFA, acetyl-CoA carboxylase is inhibited by TOFyl-CoA. It is proposed that many of the metabolic effects of TOFA in isolated adipocytes can be explained by TOFyl-CoA inhibition of acetyl-CoA carboxylase. TOFA inhibits glycolysis as a secondary event with the primary event of inhibition of fatty acid synthesis causing an accumulation of citrate which is an inhibitor of phosphofructokinase.
Pan, Yanglu; Hu, Xin; Li, Chunyan; Xu, Xing; Su, Chenggang; Li, Jinhua; Song, Hongyuan; Zhang, Xingguo; Pan, Yu
2017-01-01
The basic leucine zipper (bZIP) transcription factors have crucial roles in plant stress responses. In this study, the bZIP family gene SlbZIP38 (GenBank accession No: XM004239373) was isolated from a tomato (Solanum lycopersicum cv. Ailsa Craig) mature leaf cDNA library. The DNA sequence of SlbZIP38 encodes a protein of 484 amino acids, including a highly conserved bZIP DNA-binding domain in the C-terminal region. We found that SlbZIP38 was differentially expressed in various organs of the tomato plant and was downregulated by drought, salt stress, and abscisic acid (ABA). However, overexpression of SlbZIP38 significantly decreased drought and salt stress tolerance in tomatoes (Ailsa Craig). The findings that SlbZIP38 overexpression reduced the chlorophyll and free proline content in leaves but increased the malondialdehyde content may explain the reduced drought and salt tolerance observed in these lines. These results suggest that SlbZIP38 is a negative regulator of drought and salt resistance that acts by modulating ABA signaling. PMID:29261143
Glutamic Acid as Enhancer of Protein Synthesis Kinetics in Hepatocytes from Old Rats.
Brodsky, V Y; Malchenko, L A; Butorina, N N; Lazarev Konchenko, D S; Zvezdina, N D; Dubovaya, T K
2017-08-01
Dense cultures of hepatocytes from old rats (~2 years old, body weight 530-610 g) are different from similar cultures of hepatocytes from young rats by the low amplitude of protein synthesis rhythm. Addition of glutamic acid (0.2, 0.4, or 0.6 mg/ml) into the culture medium with hepatocytes of old rats resulted in increase in the oscillation amplitudes of the protein synthesis rhythm to the level of young rats. A similar action of glutamic acid on the protein synthesis kinetics was observed in vivo after feeding old rats with glutamic acid. Inhibition of metabotropic receptors of glutamic acid with α-methyl-4-carboxyphenylglycine (0.01 mg/ml) abolished the effect of glutamic acid. The amplitude of oscillation of the protein synthesis rhythm in a cell population characterizes synchronization of individual oscillations caused by direct cell-cell communications. Hence, glutamic acid, acting as a receptor-dependent transmitter, enhanced direct cell-cell communications of hepatocytes that were decreased with aging. As differentiated from other known membrane signaling factors (gangliosides, norepinephrine, serotonin, dopamine), glutamic acid can penetrate into the brain and thus influence the communications and protein synthesis kinetics that are disturbed with aging not only in hepatocytes, but also in neurons.
Brodsky, V Y; Malchenko, L A; Konchenko, D S; Zvezdina, N D; Dubovaya, T K
2016-08-01
Primary cultures of rat hepatocytes were studied in serum-free media. Ultradian protein synthesis rhythm was used as a marker of cell synchronization in the population. Addition of glutamic acid (0.2 mg/ml) to the medium of nonsynchronous sparse cultures resulted in detection of a common protein synthesis rhythm, hence in synchronization of the cells. The antagonist of glutamic acid metabotropic receptors MCPG (0.01 mg/ml) added together with glutamic acid abolished the synchronization effect; in sparse cultures, no rhythm was detected. Feeding rats with glutamic acid (30 mg with food) resulted in protein synthesis rhythm in sparse cultures obtained from the rats. After feeding without glutamic acid, linear kinetics of protein synthesis was revealed. Thus, glutamic acid, a component of blood as a non-neural transmitter, can synchronize the activity of hepatocytes and can form common rhythm of protein synthesis in vitro and in vivo. This effect is realized via receptors. Mechanisms of cell-cell communication are discussed on analyzing effects of non-neural functions of neurotransmitters. Glutamic acid is used clinically in humans. Hence, a previously unknown function of this drug is revealed.
Abscisic Acid accumulates at positive turgor potential in excised soybean seedling growing zones.
Creelman, R A; Mullet, J E
1991-04-01
Abscisic acid (ABA) accumulated in soybean (Glycine max [L.] Merr. cv Williams) hypocotyl elongating regions when seedlings were transferred to low water potential vermiculite (Psi = -0.3 megapascals) even though positive turgor is retained in this tissue. Accumulation of ABA in growing zones could occur from de novo biosynthesis within this tissue or transport from adjacent nongrowing zones. Both growing and nongrowing hypocotyl and root tissues accumulated significant levels of ABA when excised and dehydrated to reduce turgor. Surprisingly, excised growing zones (which experienced no water loss) also accumulated ABA when incubated in darkness for 4 hours at 100% relative humidity and 29 degrees C. Induction of ABA accumulation in the excised elongating region of the hypocotyl was not caused by disruption of root pressure or wounding. While excision of hypocotyl elongating regions induced ABA accumulation, no change in either extensin or p33 mRNA levels was observed. Accumulation of extensin or p33 mRNA required more severe wounding. This suggests that ABA is not involved in the response of these genes in wounded tissue and that wound signals are not causing ABA accumulation in excised tissue. Accumulation of ABA in excised elongating regions was correlated with growth inhibition and a decline in turgor to the yield threshold (Psi;(p) = 0.37 megapascals; R Matyssek, S Maruyama, JS Boyer [1988] Plant Physiol 86: 1163-1167). Inhibiting hypocotyl growth by transferring seedlings to lower temperatures or light did not cause ABA accumulation. We conclude that induction of ABA accumulation in growing zones is more sensitive to changes in turgor than the induction which occurs in mature tissues.
Qin, Xiaoqiong; Zeevaart, Jan A.D.
2002-01-01
The plant hormone abscisic acid (ABA) plays important roles in seed maturation and dormancy and in adaptation to a variety of environmental stresses. An effort to engineer plants with elevated ABA levels and subsequent stress tolerance is focused on the genetic manipulation of the cleavage reaction. It has been shown in bean (Phaseolus vulgaris) that the gene encoding the cleavage enzyme (PvNCED1) is up-regulated by water stress, preceding accumulation of ABA. Transgenic wild tobacco (Nicotiana plumbaginifolia Viv.) plants were produced that overexpress the PvNCED1 gene either constitutively or in an inducible manner. The constitutive expression of PvNCED1 resulted in an increase in ABA and its catabolite, phaseic acid (PA). When the PvNCED1 gene was driven by the dexamethasone (DEX)-inducible promoter, a transient induction of PvNCED1 message and accumulation of ABA and PA were observed in different lines after application of DEX. Accumulation of ABA started to level off after 6 h, whereas the PA level continued to increase. In the presence of DEX, seeds from homozygous transgenic line TN1 showed a 4-d delay in germination. After spraying with DEX, the detached leaves from line TN1 had a drastic decrease in their water loss relative to control leaves. These plants also showed a marked increase in their tolerance to drought stress. These results indicate that it is possible to manipulate ABA levels in plants by overexpressing the key regulatory gene in ABA biosynthesis and that stress tolerance can be improved by increasing ABA levels. PMID:11842158
Bentz, Emilie L; Goswami, Rajesh; Moloney, Mark G; Westaway, Susan M
2005-08-07
Bicyclic lactams derived from pyroglutamic acid provide a useful scaffold for synthesis of conformationally restricted analogues of lysine, ornithine and glutamine, as well as an Ala-Ala dipeptide analogue. Amino alcohol and carboxylic acid derivatives are accessible from a common intermediate. In this strategy, the bicyclic lactam system not only controls, but also facilitates the determination of the stereochemistry of the synthetic intermediates.
Ribonucleic Acid Synthesis and Glutamate Excretion in Escherichia coli
Broda, Paul
1968-01-01
Cultures of Escherichia coli excreted glutamate into the medium when protein synthesis was blocked in RCrel strains or when it was blocked with chloramphenicol in either RCstr or RCrel strains. Both of these conditions resulted in continued ribonucleic acid (RNA) synthesis in the absence of protein synthesis. Glutamate was also excreted by both RCstr and RCrel strains when RNA synthesis was inhibited by uracil starvation or by treatment with actinomycin D. It is proposed that, in each of these cases, glutamate excretion resulted from an increase in the permeability of the cell membrane. PMID:4973126
A direct method for the synthesis of orthogonally protected furyl- and thienyl- amino acids.
Hudson, Alex S; Caron, Laurent; Colgin, Neil; Cobb, Steven L
2015-04-01
The synthesis of unnatural amino acids plays a key part in expanding the potential application of peptide-based drugs and in the total synthesis of peptide natural products. Herein, we report a direct method for the synthesis of orthogonally protected 5-membered heteroaromatic amino acids.
Marcińska, Izabela; Czyczyło-Mysza, Ilona; Skrzypek, Edyta; Grzesiak, Maciej T.; Janowiak, Franciszek; Filek, Maria; Dziurka, Michał; Dziurka, Kinga; Waligórski, Piotr; Juzoń, Katarzyna; Cyganek, Katarzyna; Grzesiak, Stanisław
2013-01-01
The aim of the study was to assess the role of salicylic acid (SA) and abscisic acid (ABA) in osmotic stress tolerance of wheat seedlings. This was accomplished by determining the impact of the acids applied exogenously on seedlings grown under osmotic stress in hydroponics. The investigation was unique in its comprehensiveness, examining changes under osmotic stress and other conditions, and testing a number of parameters simultaneously. In both drought susceptible (SQ1) and drought resistant (CS) wheat cultivars, significant physiological and biochemical changes were observed upon the addition of SA (0.05 mM) or ABA (0.1 μM) to solutions containing half-strength Hoagland medium and PEG 6000 (−0.75 MPa). The most noticeable result of supplementing SA or ABA to the medium (PEG + SA and PEG + ABA) was a decrease in the length of leaves and roots in both cultivars. While PEG treatment reduced gas exchange parameters, chlorophyll content in CS, and osmotic potential, and conversely, increased lipid peroxidation, soluble carbohydrates in SQ1, proline content in both cultivars and total antioxidants activity in SQ1, PEG + SA or PEG + ABA did not change the values of these parameters. Furthermore, PEG caused a two-fold increase of endogenous ABA content in SQ1 and a four-fold increase in CS. PEG + ABA increased endogenous ABA only in SQ1, whereas PEG + SA caused a greater increase of ABA content in both cultivars compared to PEG. In PEG-treated plants growing until the harvest, a greater decrease of yield components was observed in SQ1 than in CS. PEG + SA, and particularly PEG + ABA, caused a greater increase of these yield parameters in CS compared to SQ1. In conclusion, SA and ABA ameliorate, particularly in the tolerant wheat cultivar, the harmful effects and after effects of osmotic stress induced by PEG in hydroponics through better osmotic adjustment achieved by an increase in proline and carbohydrate content as well as by an increase in antioxidant activity
Barroso, C; Romero, L C; Cejudo, F J; Vega, J M; Gotor, C
1999-07-01
The expression of Atcys-3A gene coding for cytosolic O-acetylserine(thiol)lyase, a key enzyme in cysteine biosynthesis, from Arabidopsis thaliana is significantly induced by exposure to salt and heavy-metal stresses. Addition of NaCl to mature plants induced a rapid accumulation of the mRNA throughout the leaf lamina and roots, and later on in stems, being mainly restricted to vascular tissues. The salt-specific regulation of Atcys-3A was also mediated by abscisic acid (ABA) since: (1) exogenous addition of ABA to the culture medium mimicked the salt-induced plant response by raising the level of Atcys-3A transcript, and (2) Arabidopsis mutants aba-1 and abi2-1 were not able to respond to NaCl. Our results suggest that a high rate of cysteine biosynthesis is required in Arabidopsis under salt stress necessary for a plant protection or adaptation mechanism. This hypothesis was supported by the observation that intracellular levels of cysteine and glutathione increased up to 3-fold after salt treatment.
Sun, Fenglong; Cao, Jie; Huo, Na; Wuda, Bala; Du, Jinkun; Peng, Huiru; Ni, Zhongfu; Sun, Qixin
2018-01-01
Seed germination is important for grain yield and quality and rapid, near-simultaneous germination helps in cultivation; however, cultivars that germinate too readily can undergo preharvest sprouting (PHS), which causes substantial losses in areas that tend to get rain around harvest time. Moreover, our knowledge of mechanisms regulating seed germination in wheat (Triticum aestivum) remains limited. In this study, we analyzed function of a wheat-specific microRNA 9678 (miR9678), which is specifically expressed in the scutellum of developing and germinating seeds. Overexpression of miR9678 delayed germination and improved resistance to PHS in wheat through reducing bioactive gibberellin (GA) levels; miR9678 silencing enhanced germination rates. We provide evidence that miR9678 targets a long noncoding RNA (WSGAR) and triggers the generation of phased small interfering RNAs that play a role in the delay of seed germination. Finally, we found that abscisic acid (ABA) signaling proteins bind the promoter of miR9678 precursor and activate its expression, indicating that miR9678 affects germination by modulating the GA/ABA signaling. PMID:29567662
Xi, Zhu-Mei; Meng, Jiang-Fei; Huo, Shan-Shan; Luan, Li-Ying; Ma, Li-Na; Zhang, Zhen-Wen
2013-06-01
Yan73 is a 'teinturier' red wine variety cultivated in China and widely used in winemaking to strengthen red wine colour. The objective of this study was to evaluate the effect of exogenous abscisic acid (ABA) applied to the grapevine cluster on the antioxidant capacity and phenolic content of the wine made from Yan73. Two hundred mg/l ABA was applied on Yan73 grapevine cluster during veraison. As they mature, these ABA-treated and untreated grape berries were transformed into wines, respectively, and the phenolic content and antioxidant capacity of these wines were compared. The results showed that phenolic content (total phenolics, tannins, flavonoids and anthocyanins) and antioxidant capacity were higher in the wine produced with ABA-treated Yan73 grapes than those in the wine from untreated grapes. Compared to Cabernet Sauvignon wine, Yan73 wine had higher phenolic content and stronger antioxidant capacity. These strongly suggest that exogenously applied ABA to Yan73 grapes can enhance phenolic content and antioxidant capacity of its wine, and Yan73 wine has the higher utilization value and potential for development.
Synthesis and chirality of amino acids under interstellar conditions.
Giri, Chaitanya; Goesmann, Fred; Meinert, Cornelia; Evans, Amanda C; Meierhenrich, Uwe J
2013-01-01
Amino acids are the fundamental building blocks of proteins, the biomolecules that provide cellular structure and function in all living organisms. A majority of amino acids utilized within living systems possess pre-specified orientation geometry (chirality); however the original source for this specific orientation remains uncertain. In order to trace the chemical evolution of life, an appreciation of the synthetic and evolutional origins of the first chiral amino acids must first be gained. Given that the amino acids in our universe are likely to have been synthesized in molecular clouds in interstellar space, it is necessary to understand where and how the first synthesis might have occurred. The asymmetry of the original amino acid synthesis was probably the result of exposure to chiral photons in the form of circularly polarized light (CPL), which has been detected in interstellar molecular clouds. This chirality transfer event, from photons to amino acids, has been successfully recreated experimentally and is likely a combination of both asymmetric synthesis and enantioselective photolysis. A series of innovative studies have reported successful simulation of these environments and afforded production of chiral amino acids under realistic circumstellar and interstellar conditions: irradiation of interstellar ice analogues (CO, CO2, NH3, CH3OH, and H2O) with circularly polarized ultraviolet photons at low temperatures does result in enantiomer enriched amino acid structures (up to 1.3% ee). This topical review summarizes current knowledge and recent discoveries about the simulated interstellar environments within which amino acids were probably formed. A synopsis of the COSAC experiment onboard the ESA cometary mission ROSETTA concludes this review: the ROSETTA mission will soft-land on the nucleus of the comet 67P/Churyumov-Gerasimenko in November 2014, anticipating the first in situ detection of asymmetric organic molecules in cometary ices.
de Sá, Marta; Ferreira, João P; Queiroz, Vagner T; Vilas-Boas, Luís; Silva, Maria C; Almeida, Maria H; Guerra-Guimarães, Leonor; Bronze, Maria R
2014-02-01
Plants have developed an efficient system of recognition that induces a complex network of signalling molecules such as salicylic acid (SA), jasmonic acid (JA) and abscisic acid (ABA) in case of a pathogenic infection. The use of specific and sensitive methods is mandatory for the analysis of compounds in these complex samples. In this study a liquid chromatography/electrospray ionisation tandem mass spectrometry method was developed and validated for the simultaneous quantification of SA, JA and ABA in Coffea arabica (L.) leaves in order to understand the role of these phytohormones in the signalling network involved in the coffee defence response against Hemileia vastatrix. The results showed that the method was specific, linear (r ≥ 0.99) in the range 0.125-1.00 µg mL⁻¹ for JA and ABA and 0.125-5.00 µg mL⁻¹ for SA, and precise (relative standard deviation ≤11%), and the limit of detection (0.010 µg g⁻¹ fresh weight) was adequate for quantifying these phytohormones in this type of matrix. In comparison with healthy leaves, those infected with H. vastatrix (resistance reaction) displayed an increase in SA level 24 h after inoculation, suggesting the involvement of an SA-dependent pathway in coffee resistance. © 2013 Society of Chemical Industry.
Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester
NASA Technical Reports Server (NTRS)
Weber, A. L.
1986-01-01
The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20% for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.
Chen, Jingxin; Mao, Linchun; Lu, Wenjing; Ying, Tiejin; Luo, Zisheng
2016-01-01
Auxin and abscisic acid regulate strawberry fruit ripening and senescence through cross-talk of their signal transduction pathways that further modulate the structural genes related to physico-chemical properties of fruit. The physiological and transcriptomic changes in harvested strawberry fruits in responses to IAA, ABA and their combination were analyzed. Exogenous IAA delayed the ripening process of strawberries after harvest while ABA promoted the postharvest ripening. However, treatment with a combination of IAA and ABA did not slow down nor accelerate the postharvest ripening in the strawberry fruits. At the molecular level, exogenous IAA up regulated the expressions of genes related to IAA signaling, including AUX/IAA, ARF, TOPLESS and genes encoding E3 ubiquitin protein ligase and annexin, and down regulated genes related to pectin depolymerization, cell wall degradation, sucrose and anthocyanin biosyntheses. In contrast, exogenous ABA induced genes related to fruit softening, and genes involved in signaling pathways including SKP1, HSPs, CK2, and SRG1. Comparison of transcriptomes in responses to individual treatments with IAA or ABA or the combination revealed that there were cooperative and antagonistic actions between IAA and ABA in fruit. However, 17% of the differentially expressed unigenes in response to the combination of IAA and ABA were unique and were not found in those unigenes responding to either IAA or ABA alone. The analyses also found that receptor-like kinases and ubiquitin ligases responded to both IAA and ABA, which seemed to play a pivotal role in both hormones' signaling pathways and thus might be the cross-talk points of both hormones.
Salicylic acid derivatives: synthesis, features and usage as therapeutic tools.
Ekinci, Deniz; Sentürk, Murat; Küfrevioğlu, Ömer İrfan
2011-12-01
In the field of medicinal chemistry, there is a growing interest in the use of small molecules. Although acetyl salicylic acid is well known for medical applications, little is known about other salicylic acid derivatives, and there is serious lack of data and information on the effects and biological evaluation that connect them. This review covers the synthesis and drug potencies of salicylic acid derivatives. After a brief overview of the information on salicylic acid and its features, a detailed review of salicylic acids as drugs and prodrugs, usage as cyclooxygenase inhibitors, properties in plants, synthesis and recent patents, is developed. Salicylic acid research is still an important area and innovations continue to arise, which offer hope for new therapeutics in related fields. It is anticipated that this review will guide the direction of long-term drug/nutraceutical safety trials and stimulate ideas for future research.
Metherel, Adam H; Domenichiello, Anthony F; Kitson, Alex P; Hopperton, Kathryn E; Bazinet, Richard P
2016-09-01
Whole body docosahexaenoic acid (DHA, 22:6n-3) synthesis from α-linolenic acid (ALA, 18:3n-3) is considered to be very low, however, the daily synthesis-secretion of DHA may be sufficient to supply the adult brain. The current study aims to assess whether whole body DHA synthesis-secretion kinetics are different when comparing plasma ALA versus eicosapentaenoic acid (EPA, 20:5n-3) as the precursor. Male Long Evans rats (n=6) were fed a 2% ALA in total fat diet for eight weeks, followed by surgery to implant a catheter into each of the jugular vein and carotid artery and 3h of steady-state infusion with a known amount of (2)H-ALA and (13)C-eicosapentaenoic acid (EPA, 20:5n3). Blood samples were collected at thirty-minute intervals and plasma enrichment of (2)H- and (13)C EPA, n-3 docosapentaenoic acid (DPAn-3, 22:5n-3) and DHA were determined for assessment of synthesis-secretion kinetic parameters. Results indicate a 13-fold higher synthesis-secretion coefficient for DHA from EPA as compared to ALA. However, after correcting for the 6.6 fold higher endogenous plasma ALA concentration, no significant differences in daily synthesis-secretion (nmol/day) of DHA (97.6±28.2 and 172±62), DPAn-3 (853±279 and 1139±484) or EPA (1587±592 and 1628±366) were observed from plasma unesterified ALA and EPA sources, respectively. These results suggest that typical diets which are significantly higher in ALA compared to EPA yield similar daily DHA synthesis-secretion despite a significantly higher synthesis-secretion coefficient from EPA. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
Raschke, K
1975-01-01
Open stomata of detached leaves of Xanthium strumarium L. closed only when carbon dioxide and abscisic acid (ABA) were presented simultaneously. Three parameters of stomatal closing were determined after additions of ABA to the irrigation water of detached leaves, while the leaves were exposed to various CO2 concentrations ([CO2]s) in the air; a) the delay between addition of ABA and a reduction of stomatal conductance by 5%, b) the velocity of stomatal closing, and c) the new conductance. Changes in all three parameters showed that stomatal responses to ABA were enhanced by CO2; this effect followed saturation kinetics. Half saturation occurred at an estimated [CO2] in the stomatal pore of 200 μl l(-1). With respect to ABA, stomata responded in normal air with half their maximal amplitude at [ABA]s between 10(-6) and 10(-5) M(+-)-ABA. The amounts of ABA taken up by the leaves during the delay increased with a power <1 (on the average, 0.67) of the [ABA] in the transpiration stream. The minimal amount of ABA found to produce a stomatal response was about 1 pmol of (+-)-ABA per cm(2) leaf area, almost two orders of magnitude smaller than the original content of the leaves in ABA indicating that most of the endogenous ABA was in a compartment isolated from the guard cells.An interaction between stomatal responses to CO2 and ABA was also found in Gossypium hirsutum L. and Commelina communis L.; it was however much weaker than in X. strumarium.Based on earlier findings and on the results of this investigation it is suggested that stomata close if the cytoplasm of the guard cells contains much malate and H(+). The acid content in turn is determined by the relative rates of production of malic acid (from endogenous as well as exogenous CO2) and its removal (by transport of the anion into the vacuole and exchange of the H(+) for K(+) with the environment of the guard cells). The simultaneous requirement of CO2 and ABA for stomatal closure leads to the inference that ABA
Humplík, Jan F.; Bergougnoux, Véronique; Jandová, Michaela; Šimura, Jan; Pěnčík, Aleš; Tomanec, Ondřej; Rolčík, Jakub; Novák, Ondřej; Fellner, Martin
2015-01-01
Dark-induced growth (skotomorphogenesis) is primarily characterized by rapid elongation of the hypocotyl. We have studied the role of abscisic acid (ABA) during the development of young tomato (Solanum lycopersicum L.) seedlings. We observed that ABA deficiency caused a reduction in hypocotyl growth at the level of cell elongation and that the growth in ABA-deficient plants could be improved by treatment with exogenous ABA, through which the plants show a concentration dependent response. In addition, ABA accumulated in dark-grown tomato seedlings that grew rapidly, whereas seedlings grown under blue light exhibited low growth rates and accumulated less ABA. We demonstrated that ABA promotes DNA endoreduplication by enhancing the expression of the genes encoding inhibitors of cyclin-dependent kinases SlKRP1 and SlKRP3 and by reducing cytokinin levels. These data were supported by the expression analysis of the genes which encode enzymes involved in ABA and CK metabolism. Our results show that ABA is essential for the process of hypocotyl elongation and that appropriate control of the endogenous level of ABA is required in order to drive the growth of etiolated seedlings. PMID:25695830
Du, Yan-Lei; Wang, Zhen-Yu; Fan, Jing-Wei; Turner, Neil C; Wang, Tao; Li, Feng-Min
2012-08-01
A pot experiment was conducted to investigate the effect of the non-protein amino acid, β-aminobutyric acid (BABA), on the homeostasis between reactive oxygen species (ROS) and antioxidant defence during progressive soil drying, and its relationship with the accumulation of abscisic acid (ABA), water use, grain yield, and desiccation tolerance in two spring wheat (Triticum aestivum L.) cultivars released in different decades and with different yields under drought. Drenching the soil with 100 µM BABA increased drought-induced ABA production, leading to a decrease in the lethal leaf water potential (Ψ) used to measure desiccation tolerance, decreased water use, and increased water use efficiency for grain (WUEG) under moderate water stress. In addition, at severe water stress levels, drenching the soil with BABA reduced ROS production, increased antioxidant enzyme activity, and reduced the oxidative damage to lipid membranes. The data suggest that the addition of BABA triggers ABA accumulation that acts as a non-hydraulic root signal, thereby closing stomata, and reducing water use at moderate stress levels, and also reduces the production of ROS and increases the antioxidant defence enzymes at severe stress levels, thus increasing the desiccation tolerance. However, BABA treatment had no effect on grain yield of wheat when water availability was limited. The results suggest that there are ways of effectively priming the pre-existing defence pathways, in addition to genetic means, to improve the desiccation tolerance and WUEG of wheat.
Wang, Zhen-Yu; Gehring, Chris; Zhu, Jianhua; Li, Feng-Min; Zhu, Jian-Kang; Xiong, Liming
2015-01-01
Osmotic stress activates the biosynthesis of the phytohormone abscisic acid (ABA) through a pathway that is rate limited by the carotenoid cleavage enzyme 9-cis-epoxycarotenoid dioxygenase (NCED). To understand the signal transduction mechanism underlying the activation of ABA biosynthesis, we performed a forward genetic screen to isolate mutants defective in osmotic stress regulation of the NCED3 gene. Here, we identified the Arabidopsis (Arabidopsis thaliana) Vacuolar Sorting Receptor1 (VSR1) as a unique regulator of ABA biosynthesis. The vsr1 mutant not only shows increased sensitivity to osmotic stress, but also is defective in the feedback regulation of ABA biosynthesis by ABA. Further analysis revealed that vacuolar trafficking mediated by VSR1 is required for osmotic stress-responsive ABA biosynthesis and osmotic stress tolerance. Moreover, under osmotic stress conditions, the membrane potential, calcium flux, and vacuolar pH changes in the vsr1 mutant differ from those in the wild type. Given that manipulation of the intracellular pH is sufficient to modulate the expression of ABA biosynthesis genes, including NCED3, and ABA accumulation, we propose that intracellular pH changes caused by osmotic stress may play a signaling role in regulating ABA biosynthesis and that this regulation is dependent on functional VSR1. PMID:25416474
Tuan, Pham A.; Kumar, Rohit; Rehal, Pawanpuneet K.; Toora, Parneet K.; Ayele, Belay T.
2018-01-01
Seed dormancy is an adaptive trait that does not allow the germination of an intact viable seed under favorable environmental conditions. Non-dormant seeds or seeds with low level of dormancy can germinate readily under optimal environmental conditions, and such a trait leads to preharvest sprouting, germination of seeds on the mother plant prior to harvest, which significantly reduces the yield and quality of cereal crops. High level of dormancy, on the other hand, may lead to non-uniform germination and seedling establishment. Therefore, intermediate dormancy is considered to be a desirable trait as it prevents the problems of sprouting and allows uniformity of postharvest germination of seeds. Induction, maintenance, and release of seed dormancy are complex physiological processes that are influenced by a wide range of endogenous and environmental factors. Plant hormones, mainly abscisic acid (ABA) and gibberellin (GA), are the major endogenous factors that act antagonistically in the control of seed dormancy and germination; ABA positively regulates the induction and maintenance of dormancy, while GA enhances germination. Significant progress has been made in recent years in the elucidation of molecular mechanisms regulating ABA/GA balance and thereby dormancy and germination in cereal seeds, and this review summarizes the current state of knowledge on the topic. PMID:29875780
Meimoun, Patrice; Vidal, Guillaume; Bohrer, Anne-Sophie; Lehner, Arnaud; Tran, Daniel; Briand, Joël; Bouteau, François
2009-01-01
In Arabidopsis thaliana cell suspension,abscisic acid (aBa) induces changes in cytosolic calcium concentration ([Ca2+]cyt) which are the trigger for aBa-induced plasma membrane anion current activation, H+-aTPase inhibition, and subsequent plasma membrane depolarization. In the present study, we took advantage of this model to analyze the implication of intracellular Ca2+ stores in aBa signal transduction through electrophysiological current measurements, cytosolic Ca2+ activity measurements with the apoaequorin Ca2+ reporter protein and external pH measurement. Intracellular Ca2+ stores involvement was determined by using specific inhibitors of CICR channels: the cADP-ribose/ryanodine receptor (Br-cADPR and dantrolene) and of the inositol trisphosphate receptor (U73122). In addition experiments were performed on epidermal strips of A. thaliana leaves to monitor stomatal closure in response to ABA in presence of the same pharmacology. Our data provide evidence that ryanodine receptor and inositol trisphosphate receptor could be involved in ABA-induced (1) Ca2+ release in the cytosol, (2) anion channel activation and H+-ATPase inhibition leading to plasma membrane depolarization and (3) stomatal closure. Intracellular Ca2+ release could thus contribute to the control of early events in the ABA signal transduction pathway in A. thaliana. PMID:19847112
Zhang, Ya-Wen; Fan, Wei-Wei; Li, Hui; Ni, He; Han, Han-Bing; Li, Hai-Hang
2015-10-01
Abscisic acid (ABA), a universal signaling molecule, plays important roles in regulating plant growth, development and stress responses. The low contents and complex components in plants make it difficult to be accurately analyzed. A novel one-step sample preparation method for ABA in plants was developed. Fresh peanut (Arachis hypogaea) plant materials were fixed by oven-drying, microwave drying, boiling or Carnoy's fixative, and loaded onto a mini-preparing column. After washed the impurities, ABA was eluted with a small amount of solvent. ABA in plant materials was completely extracted and purified in 2mL solution and directly analyzed by HPLC, with a 99.3% recovery rate. Multiple samples can be simultaneously prepared. Analyses using this method indicated that the endogenous ABA in oven-dried peanut leaves increased 20.2-fold from 1.01 to 20.37μgg(-1) dry weight within 12h and then decreased in 30% polyethylene glycol 6000 treated plants, and increased 3.34-fold from 0.85 to 2.84μgg(-1) dry weight in 5 days and then decreased in soil drought treated plants. The method combined the column chromatographic extraction and solid-phase separation technologies in one step and can completely extracted plant endogenous ABA in a purified and highly concentrated form for direct HPLC analysis. Copyright © 2015 Elsevier B.V. All rights reserved.
Guri, Amir J; Hontecillas, Raquel; Bassaganya-Riera, Josep
2010-12-01
Abscisic acid (ABA) has shown effectiveness in ameliorating inflammation in obesity, diabetes and cardiovascular disease models. The objective of this study was to determine whether ABA prevents or ameliorates experimental inflammatory bowel disease (IBD). C57BL/6J mice were fed diets with or without ABA (100mg/kg) for 35 days prior to challenge with 2.5% dextran sodium sulfate (DSS). The severity of clinical disease was assessed daily. Colonic mucosal lesions were evaluated by histopathology, and cellular adhesion molecular and inflammatory markers were assayed by real-time quantitative PCR. Flow cytometry was used to quantify leukocyte populations in the blood, spleen, and mesenteric lymph nodes (MLN). The effect of ABA on cytotoxic T-lymphocyte antigen 4 (CTLA-4) expression in splenocytes was also investigated. ABA significantly ameliorated disease activity, colitis and reduced colonic leukocyte infiltration and inflammation. These improvements were associated with downregulation in vascular cell adhesion marker-1 (VCAM-1), E-selectin, and mucosal addressin adhesion marker-1 (MAdCAM-1) expression. ABA also increased CD4(+) and CD8(+) T-lymphocytes in blood and MLN and regulatory T cells in blood. In vitro, ABA increased CTLA-4 expression through a PPAR γ-dependent mechanism. We conclude that ABA ameliorates gut inflammation by modulating T cell distribution and adhesion molecule expression. Copyright © 2010 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.
Guri, Amir J; Hontecillas, Raquel; Bassaganya-Riera, Josep
2010-01-01
Background & Aims Abscisic acid (ABA) has shown effectiveness in ameliorating inflammation in obesity, diabetes and cardiovascular disease models. The objective of this study was to determine whether ABA prevents or ameliorates experimental inflammatory bowel disease (IBD). Methods C57BL/6J mice were fed diets with or without ABA (100 mg/kg) for 35 days prior to challenge with 2.5% dextran sodium sulfate (DSS). The severity of clinical disease was assessed daily. Colonic mucosal lesions were evaluated by histopathology, and cellular adhesion molecular and inflammatory markers were assayed by real-time quantitative PCR. Flow cytometry was used to quantify leukocyte populations in the blood, spleen, and mesenteric lymph nodes (MLN). The effect of ABA on cytotoxic T-lymphocyte antigen 4 (CTLA-4) expression in splenocytes was also investigated. Results ABA significantly ameliorated disease activity, colitis and reduced colonic leukocyte infiltration and inflammation. These improvements were associated with down-regulation in vascular cell adhesion marker-1 (VCAM-1), E-selectin, and mucosal addressin adhesion marker-1 (MAdCAM-1) expression. ABA also increased CD4+ and CD8+ T-lymphocytes in blood and MLN and regulatory T-cells in blood. In vitro, ABA increased CTLA-4 expression through a PPAR γ-dependent mechanism. Conclusions We conclude that ABA ameliorates gut inflammation by modulating T cell distribution and adhesion molecule expression. PMID:20236740
Lema-Rumińska, J.; Goncerzewicz, K.; Gabriel, M.
2013-01-01
Having produced the embryos of cactus Copiapoa tenuissima Ritt. forma monstruosa at the globular stage and callus, we investigated the effect of abscisic acid (ABA) in the following concentrations: 0, 0.1, 1, 10, and 100 μM on successive stages of direct (DSE) and indirect somatic embryogenesis (ISE). In the indirect somatic embryogenesis process we also investigated a combined effect of ABA (0, 0.1, 1 μM) and sucrose (1, 3, 5%). The results showed that a low concentration of ABA (0-1 μM) stimulates the elongation of embryos at the globular stage and the number of correct embryos in direct somatic embryogenesis, while a high ABA concentration (10–100 μM) results in growth inhibition and turgor pressure loss of somatic embryos. The indirect somatic embryogenesis study in this cactus suggests that lower ABA concentrations enhance the increase in calli fresh weight, while a high concentration of 10 μM ABA or more changes calli color and decreases its proliferation rate. However, in the case of indirect somatic embryogenesis, ABA had no effect on the number of somatic embryos and their maturation. Nevertheless, we found a positive effect of sucrose concentration for both the number of somatic embryos and the increase in calli fresh weight. PMID:23843737
Tan, Tinghong; Sun, Yanni; Peng, Xingji; Wu, Guochun; Bao, Fang; He, Yikun; Zhou, Huapeng; Lin, Honghui
2017-01-01
Synopsis This work demonstrates that PpABI3 contributes to freezing tolerance regulation in Physcomitrella patens. Transcription factor ABSCISIC ACID INSENSITIVE3 (ABI3) is known to play a major role in regulating seed dormancy, germination, seedling development as well as stress responses. ABI3 is conserved among land plants; however, its roles in non-seed plants under stress conditions have not been well characterized. In this study, we report that ABI3 is involved in freezing tolerance regulation during cold acclimation at least in part through ABA signaling pathway in moss Physcomitrella patens ( P. patens ). Deletion of PpABI3 (Δ abi3-1 ) compromises the induction of genes related to cold response and antioxidative protection, resulting in reduced accumulation of cryoprotectants and antioxidants. In addition, photosystem II (PSII) activity is repressed in Δ abi3-1 during cold acclimation partially due to alternations of photosynthetic protein complexes compositions. The gametophyte of Δ abi3-1 displays severe growth inhibition and developmental deficiency under low temperature condition, while two independent complementary lines display phenotypes similar to that of wild-type P. patens (WT). Furthermore, the freezing tolerance of Δ abi3-1 was significantly affected by deletion of PpABI3 . These data revealed that PpABI3 plays an important role in low temperature response and freezing tolerance in P. patens .
Ma, Biao; Yin, Cui-Cui; He, Si-Jie; Lu, Xiang; Zhang, Wan-Ke; Lu, Tie-Gang; Chen, Shou-Yi; Zhang, Jin-Song
2014-10-01
Ethylene and abscisic acid (ABA) have a complicated interplay in many developmental processes. Their interaction in rice is largely unclear. Here, we characterized a rice ethylene-response mutant mhz4, which exhibited reduced ethylene-response in roots but enhanced ethylene-response in coleoptiles of etiolated seedlings. MHZ4 was identified through map-based cloning and encoded a chloroplast-localized membrane protein homologous to Arabidopsis thaliana (Arabidopsis) ABA4, which is responsible for a branch of ABA biosynthesis. MHZ4 mutation reduced ABA level, but promoted ethylene production. Ethylene induced MHZ4 expression and promoted ABA accumulation in roots. MHZ4 overexpression resulted in enhanced and reduced ethylene response in roots and coleoptiles, respectively. In root, MHZ4-dependent ABA pathway acts at or downstream of ethylene receptors and positively regulates root ethylene response. This ethylene-ABA interaction mode is different from that reported in Arabidopsis, where ethylene-mediated root inhibition is independent of ABA function. In coleoptile, MHZ4-dependent ABA pathway acts at or upstream of OsEIN2 to negatively regulate coleoptile ethylene response, possibly by affecting OsEIN2 expression. At mature stage, mhz4 mutation affects branching and adventitious root formation on stem nodes of higher positions, as well as yield-related traits. Together, our findings reveal a novel mode of interplay between ethylene and ABA in control of rice growth and development.
He, Si-Jie; Lu, Xiang; Zhang, Wan-Ke; Lu, Tie-Gang; Chen, Shou-Yi; Zhang, Jin-Song
2014-01-01
Ethylene and abscisic acid (ABA) have a complicated interplay in many developmental processes. Their interaction in rice is largely unclear. Here, we characterized a rice ethylene-response mutant mhz4, which exhibited reduced ethylene-response in roots but enhanced ethylene-response in coleoptiles of etiolated seedlings. MHZ4 was identified through map-based cloning and encoded a chloroplast-localized membrane protein homologous to Arabidopsis thaliana (Arabidopsis) ABA4, which is responsible for a branch of ABA biosynthesis. MHZ4 mutation reduced ABA level, but promoted ethylene production. Ethylene induced MHZ4 expression and promoted ABA accumulation in roots. MHZ4 overexpression resulted in enhanced and reduced ethylene response in roots and coleoptiles, respectively. In root, MHZ4-dependent ABA pathway acts at or downstream of ethylene receptors and positively regulates root ethylene response. This ethylene-ABA interaction mode is different from that reported in Arabidopsis, where ethylene-mediated root inhibition is independent of ABA function. In coleoptile, MHZ4-dependent ABA pathway acts at or upstream of OsEIN2 to negatively regulate coleoptile ethylene response, possibly by affecting OsEIN2 expression. At mature stage, mhz4 mutation affects branching and adventitious root formation on stem nodes of higher positions, as well as yield-related traits. Together, our findings reveal a novel mode of interplay between ethylene and ABA in control of rice growth and development. PMID:25330236
Wang, Yanping; Wang, Ya; Ji, Kai; Dai, Shengjie; Hu, Ying; Sun, Liang; Li, Qian; Chen, Pei; Sun, Yufei; Duan, Chaorui; Wu, Yan; Luo, Hao; Zhang, Dian; Guo, Yangdong; Leng, Ping
2013-03-01
Cucumber (Cucumis sativus L.), a kind of fruit usually harvested at the immature green stage, belongs to non-climacteric fruit. To investigate the contribution of abscisic acid (ABA) to cucumber fruit development and ripening, variation in ABA level was investigated and a peak in ABA level was found in pulp before fruit get fully ripe. To clarify this point further, exogenous ABA was applied to cucumber fruits at two different development stages. Results showed that ABA application at the turning stage promotes cucumber fruit ripening, while application at the immature green stage had inconspicuous effects. In addition, with the purpose of understanding the transcriptional regulation of ABA, two partial cDNAs of CsNCED1 and CsNCED2 encoding 9-cis-epoxycarotenoid dioxygenase (NCED), a key enzyme in ABA biosynthetic pathway; one partial cDNA of CsCYP707A1 for 8'-hydroxylase, a key enzyme in the oxidative catabolism of ABA and two partial cDNAs of CsBG1 and CsBG2 for β-glucosidase (BG) that hydrolyzes ABA glucose ester (ABA-GE) to release active ABA were cloned from cucumber. The DNA and deduced amino acid sequences of these obtained genes respectively showed high similarities to their homologous genes in other plants. Real-time PCR analysis revealed that ABA content may be regulated by its biosynthesis (CsNCEDs), catabolism (CsCYP707A1) and reactivation genes (CsBGs) at the transcriptional level during cucumber fruit development and ripening, in response to ABA application, dehydration and pollination, among which CsNCED1, CsCYP707A1 and CsBG1 were highly expressed in pulp and may play more important roles in regulating ABA metabolism. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
Trivellini, Alice; Ferrante, Antonio; Vernieri, Paolo; Serra, Giovanni
2011-01-01
The effect of the complex relationship between ethylene and abscisic acid (ABA) on flower development and senescence in Hibiscus rosa-sinensis L. was investigated. Ethylene biosynthetic (HrsACS and HrsACO) and receptor (HrsETR and HrsERS) genes were isolated and their expression evaluated in three different floral tissues (petals, style–stigma plus stamens, and ovaries) of detached buds and open flowers. This was achieved through treatment with 0.1 mM 1-aminocyclopropane-1-carboxylic acid (ACC) solution, 500 nl l−1 methylcyclopropene (1-MCP), and 0.1 mM ABA solution. Treatment with ACC and 1-MCP confirmed that flower senescence in hibiscus is ethylene dependent, and treatment with exogenous ABA suggested that ABA may play a role in this process. The 1-MCP impeded petal in-rolling and decreased ABA content in detached open flowers after 9 h. This was preceded by an earlier and sequential increase in ABA content in 1-MCP-treated petals and style–stigma plus stamens between 1 h and 6 h. ACC treatment markedly accelerated flower senescence and increased ethylene production after 6 h and 9 h, particularly in style–stigma plus stamens. Ethylene evolution was positively correlated in these floral tissues with the induction of the gene expression of ethylene biosynthetic and receptor genes. Finally, ABA negatively affected the ethylene biosynthetic pathway and tissue sensitivity in all flower tissues. Transcript abundance of HrsACS, HrsACO, HrsETR, and HrsERS was reduced by exogenous ABA treatment. This research underlines the regulatory effect of ABA on the ethylene biosynthetic and perception machinery at a physiological and molecular level when inhibitors or promoters of senescence are exogenously applied. PMID:21841180
A Reappraisal of the Role of Abscisic Acid and its Interaction with Auxin in Apical Dominance
CLINE, MORRIS G.; OH, CHOONSEOK
2006-01-01
• Background and Aims Evidence from pea rms1, Arabidopsis max4 and petunia dad1 mutant studies suggest an unidentified carotenoid-derived/plastid-produced branching inhibitor which moves acropetally from the roots to the shoots and interacts with auxin in the control of apical dominance. Since the plant hormone, abscisic acid (ABA), known to inhibit some growth processes, is also carotenoid derived/plastid produced, and because there has been indirect evidence for its involvement with branching, a re-examination of the role of ABA in apical dominance is timely. Even though it has been determined that ABA probably is not the second messenger for auxin in apical dominance and is not the above-mentioned unidentified branching inhibitor, the similarity of their derivation suggests possible relationships and/or interactions. • Methods The classic Thimann–Skoog auxin replacement test for apical dominance with auxin [0·5 % naphthalene acetic acid (NAA)] applied both apically and basally was combined in similar treatments with 1 % ABA in Ipomoea nil (Japanese Morning Glory), Solanum lycopersicum (Better Boy tomato) and Helianthus annuus (Mammoth Grey-striped Sunflower). • Key Results Auxin, apically applied to the cut stem surface of decapitated shoots, strongly restored apical dominance in all three species, whereas the similar treatment with ABA did not. However, when ABA was applied basally, i.e. below the lateral bud of interest, there was a significant moderate repression of its outgrowth in Ipomoea and Solanum. There was also some additive repression when apical auxin and basal ABA treatments were combined in Ipomoea. • Conclusion The finding that basally applied ABA is able partially to restore apical dominance via acropetal transport up the shoot suggests possible interactions between ABA, auxin and the unidentified carotenoid-derived branching inhibitor that justify further investigation. PMID:16882681
A reappraisal of the role of abscisic acid and its interaction with auxin in apical dominance.
Cline, Morris G; Oh, Choonseok
2006-10-01
Evidence from pea rms1, Arabidopsis max4 and petunia dad1 mutant studies suggest an unidentified carotenoid-derived/plastid-produced branching inhibitor which moves acropetally from the roots to the shoots and interacts with auxin in the control of apical dominance. Since the plant hormone, abscisic acid (ABA), known to inhibit some growth processes, is also carotenoid derived/plastid produced, and because there has been indirect evidence for its involvement with branching, a re-examination of the role of ABA in apical dominance is timely. Even though it has been determined that ABA probably is not the second messenger for auxin in apical dominance and is not the above-mentioned unidentified branching inhibitor, the similarity of their derivation suggests possible relationships and/or interactions. The classic Thimann-Skoog auxin replacement test for apical dominance with auxin [0.5 % naphthalene acetic acid (NAA)] applied both apically and basally was combined in similar treatments with 1 % ABA in Ipomoea nil (Japanese Morning Glory), Solanum lycopersicum (Better Boy tomato) and Helianthus annuus (Mammoth Grey-striped Sunflower). Auxin, apically applied to the cut stem surface of decapitated shoots, strongly restored apical dominance in all three species, whereas the similar treatment with ABA did not. However, when ABA was applied basally, i.e. below the lateral bud of interest, there was a significant moderate repression of its outgrowth in Ipomoea and Solanum. There was also some additive repression when apical auxin and basal ABA treatments were combined in Ipomoea. The finding that basally applied ABA is able partially to restore apical dominance via acropetal transport up the shoot suggests possible interactions between ABA, auxin and the unidentified carotenoid-derived branching inhibitor that justify further investigation.
New hydrazones of ferulic acid: synthesis, characterization and biological activity.
Wolszleger, Maria; Stan, Cătălina Daniela; Apotrosoaei, Maria; Vasincu, Ioana; Pânzariu, Andreea; Profire, Lenuţa
2014-01-01
The ferulic acid (4-hydroxy-3-methoxy-cinnamic acid) is a phenolic compound with important antioxidant effects and which nowadays is being extensively studied for his potential indications in inflammatory and neurodegenerative diseases, hypertension, atherosclerosis, etc. The synthesis of new ferulic acid compounds with potential antioxidant activity. The synthesis of the designed compounds was performed in several steps: (i) the obtaining of ferulic acid chloride by reacting of ferulic acid with thionyl chloride; (ii) the reaction between the ferulic acid chloride and hydrazine hydrate 98% to obtain the ferulic acid hydrazide; (iii) the condensation of ferrulic acid hydrazide with various benzaldehydes (2-hydroxy/3-hydroxy/4-hydroxy/2-nitro/3-nitro/4-nitro/2-methoxi/ 4-chloro/4-fluoro/4-bromo-benzaldehyde) resulting the correspond- ing hydrazones. The structure of the synthesized compounds was confirmed by FT-IR spectroscopy and the evaluation of antioxidant potential was achieved by determining the total antioxidant capacity and reducing power. In this study new hydrazones of ferulic acid have been synthesized, physic-chemical and spectral characterized. The evaluation of antioxidant potential using in vitro methods showed the favorable influence of the structural modulation on the antioxidant effects of ferulic acid.
Lu, Kai; Liang, Shan; Wu, Zhen; Bi, Chao; Yu, Yong-Tao; Wang, Xiao-Fang; Zhang, Da-Peng
2016-09-01
Receptor-like kinases (RLKs) have been reported to regulate many developmental and defense process, but only a few members have been functionally characterized. In the present study, our observations suggest that one of the RLKs, a membrane-localized cysteine-rich receptor-like protein kinase, CRK5, is involved in abscisic acid (ABA) signaling in Arabidopsis thaliana Overexpression of CRK5 increases ABA sensitivity in ABA-induced early seedling growth arrest and promotion of stomatal closure and inhibition of stomatal opening. Interestingly, and importantly, overexpression of CRK5 enhances plant drought tolerance without affecting plant growth at the mature stages and plant productivity. Transgenic lines overexpressing a mutated form of CRK5, CRK5 (K372E) with the change of the 372nd conserved amino acid residue from lysine to glutamic acid in its kinase domain, result in wild-type ABA and drought responses, supporting the role of CRK5 in ABA signaling. The loss-of-function mutation of the CRK5 gene does not affect the ABA response, while overexpression of two homologs of CRK5, CRK4 and CRK19, confers ABA responses, suggesting that these CRK members function redundantly. We further showed that WRKY18, WRKY40 and WRKY60 transcription factors repress the expression of CRK5, and that CRK5 likely functions upstream of ABI2 in ABA signaling. These findings help in understanding the complex ABA signaling network. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.
Expeditious Synthesis of Dianionic-Headed 4-Sulfoalkanoic Acid Surfactants.
Jiang, Jianghui; Xu, Jiaxi
2017-04-16
4-Sulfoalkanoic acids are a class of important dianionic-headed surfactants. Various 4-sulfoalkanoic acids with straight C8, C10, C12, C14, C16, and C18 chains were synthesized expeditiously through the radical addition of methyl 2-((ethoxycarbonothioyl)thio)acetate to linear terminal olefins and subsequent oxidation with peroxyformic acid. This is a useful and convenient strategy for the synthesis of dianionic-headed surfactants with a carboxylic acid and sulfonic acid functionalities in the head group region.
Synthesis of monomethyl 5,5'-dehydrodiferulic acid
USDA-ARS?s Scientific Manuscript database
Synthesis of the internal reference compound, monomethyl 5,5’-dehydrodiferulic acid, is described. The synthetic scheme relies on a selective monomethylation of the known compound 5,5-dehydrodivanillin, followed by elaboration into the dehydrodiferulic framework through a dual Horner-Emmons-Wadswort...
Dong, Zhijun; Yu, Yanwen; Li, Shenghui; Wang, Juan; Tang, Saijun; Huang, Rongfeng
2016-01-04
Increasing evidence has revealed that abscisic acid (ABA) negatively modulates ethylene biosynthesis, although the underlying mechanism remains unclear. To identify the factors involved, we conducted a screen for ABA-insensitive mutants with altered ethylene production in Arabidopsis. A dominant allele of ABI4, abi4-152, which produces a putative protein with a 16-amino-acid truncation at the C-terminus of ABI4, reduces ethylene production. By contrast, two recessive knockout alleles of ABI4, abi4-102 and abi4-103, result in increased ethylene evolution, indicating that ABI4 negatively regulates ethylene production. Further analyses showed that expression of the ethylene biosynthesis genes ACS4, ACS8, and ACO2 was significantly decreased in abi4-152 but increased in the knockout mutants, with partial dependence on ABA. Chromatin immunoprecipitation-quantitative PCR assays showed that ABI4 directly binds the promoters of these ethylene biosynthesis genes and that ABA enhances this interaction. A fusion protein containing the truncated ABI4-152 peptide accumulated to higher levels than its full-length counterpart in transgenic plants, suggesting that ABI4 is destabilized by its C terminus. Therefore, our results demonstrate that ABA negatively regulates ethylene production through ABI4-mediated transcriptional repression of the ethylene biosynthesis genes ACS4 and ACS8 in Arabidopsis. Copyright © 2016 The Author. Published by Elsevier Inc. All rights reserved.
Carballeira, Néstor M.; Sanabria, David; Oyola, Delise
2006-01-01
An improved synthesis for the (Z)-14-methyl-9-pentadecenoic acid was developed based on the appropriate use of (trimethylsilyl)acetylene as the key reagent in the synthesis. The reported synthesis started with commercially available 8-bromo-1-octanol and furnished the desired acid in seven steps and in a 16% overall yield, a significant improvement over the previous reported synthesis for this fatty acid. The synthesis reported herein afforded sufficient amounts to study the acid topoisomerase I inhibitory potential and it was found that the title acid inhibits the human placenta DNA topoisomerase I enzyme at concentrations of 500 μM. PMID:17680032
Effect of the quality of dietary amino acids composition on the urea synthesis in rats.
Tujioka, Kazuyo; Ohsumi, Miho; Hayase, Kazutoshi; Yokogoshi, Hidehiko
2011-01-01
We have shown that urinary urea excretion increased in rats given a lower quality protein. The purpose of present study was to determine whether the composition of dietary amino acids affects urea synthesis. Experiments were done on three groups of rats given diets containing a 10% gluten amino acid mix diet or 10% casein amino acid mix diet or 10% whole egg protein amino acids mix diet for 10 d. The urinary excretion of urea, the liver concentration of N-acetylglutamate, and the liver concentration of free serine, glutamic acids and alanine were greater in the group given the amino acid mix diet of lower quality. The fractional and absolute rates of protein synthesis in tissues declined with a decrease in quality of dietary amino acids. The hepatic concentration of ornithine and the activities of hepatic urea-cycle enzymes were not related to the urea excretion. These results suggest that the increased concentrations of amino acids and N-acetylglutamate seen in the liver of rats given the amino acid mix diets of lower quality are likely among the factors stimulating urea synthesis. The protein synthesis in tissues is at least partly related to hepatic concentrations of amino acids. The composition of dietary amino acids is likely to be one of the factors regulating urea synthesis when the quality of dietary protein is manipulated.
Content and synthesis of nucleic acids in the cartilage in chondromalacia patellae.
Lund, F; Telhag, H
1978-12-01
The content and the synthesis of nucleic acids in chondromalacian, osteoarthritis and normal cartilage was compared. The chondromalacian cartilage differed from osteoarthritis in that the content of nucleic acids was less. Also, the cell density was less in chondromalacian than in normal cartilage as opposed to previous findings in osteoarthritis. The synthesis of DNA was greater in chondromalacian than in normal cartilage but less than in osteoarthritis. With regard to the RNA synthesis, however, the chondromalacian cartilage showed a higher rate than both normal and osteoarthritic cartilage.
Total amino acid stabilization during cell-free protein synthesis reactions.
Calhoun, Kara A; Swartz, James R
2006-05-17
Limitations in amino acid supply have been recognized as a substantial problem in cell-free protein synthesis reactions. Although enzymatic inhibitors and fed-batch techniques have been beneficial, the most robust way to stabilize amino acids is to remove the responsible enzymatic activities by genetically modifying the source strain used for cell extract preparation. Previous work showed this was possible for arginine, serine, and tryptophan, but cysteine degradation remained a major limitation in obtaining high protein synthesis yields. Through radiolabel techniques, we confirmed that cysteine degradation was caused by the activity of glutamate-cysteine ligase (gene gshA) in the cell extract. Next, we created Escherichia coli strain KC6 that combines a gshA deletion with previously described deletions for arginine, serine, and tryptophan stabilization. Strain KC6 grows well, and active cell extract can be produced from it for cell-free protein synthesis reactions. The extract from strain KC6 maintains stable amino acid concentrations of all 20 amino acids in a 3-h batch reaction. Yields for three different proteins improved 75-250% relative to cell-free expression using the control extract.
Bogamuwa, Srimathi; Jang, Jyan-Chyun
2013-08-01
Tandem CCCH zinc finger proteins (TZFs) are post-transcriptional regulators of gene expression in animals and yeast. Genetic studies indicate that plant TZFs are involved in hormone-mediated developmental and environmental responses. We have demonstrated previously that Arabidopsis AtTZF1 can localize to processing bodies (PBs) and stress granules (SGs), and affects abscisic acid (ABA)- and gibberellic acid (GA)-mediated growth, stress and gene expression responses. Here we show that AtTZF4, 5 and 6 are specifically expressed in seeds. Consistent with the observation that their expression levels decline during seed imbibition, AtTZF4, 5 and 6 are up-regulated by ABA and down-regulated by GA. Mutant analyses indicate that AtTZF4, 5 and 6 act as positive regulators for ABA- and negative regulators for light- and GA-mediated seed germination responses. Results of gene expression analysis indicate that AtTZF4, 5 and 6 affect seed germination by controlling genes critical for ABA and GA response. Furthermore, AtTZF4, 5 and 6 can co-localize with both PB and SG markers in Arabidopsis cells. Specifically, AtTZF6 can be assembled into PBs and SGs in embryos with the induction of stress hormone methyl jasmonate under the control of native AtTZF6 promoter. © 2013 John Wiley & Sons Ltd.
Stereoselective synthesis of unsaturated α-amino acids.
Fanelli, Roberto; Jeanne-Julien, Louis; René, Adeline; Martinez, Jean; Cavelier, Florine
2015-06-01
Stereoselective synthesis of unsaturated α-amino acids was performed by asymmetric alkylation. Two methods were investigated and their enantiomeric excess measured and compared. The first route consisted of an enantioselective approach induced by the Corey-Lygo catalyst under chiral phase transfer conditions while the second one involved the hydroxypinanone chiral auxiliary, both implicating Schiff bases as substrate. In all cases, the use of a prochiral Schiff base gave higher enantiomeric excess and yield in the final desired amino acid.
Tannic acid-mediated green synthesis of antibacterial silver nanoparticles.
Kim, Tae Yoon; Cha, Song-Hyun; Cho, Seonho; Park, Youmie
2016-04-01
The search for novel antibacterial agents is necessary to combat microbial resistance to current antibiotics. Silver nanoparticles (AgNPs) have been reported to be effective antibacterial agents. Tannic acid is a polyphenol compound from plants with antioxidant and antibacterial activities. In this report, AgNPs were prepared from silver ions by tannic acid-mediated green synthesis (TA-AgNPs). The reaction process was facile and involved mixing both silver ions and tannic acid. The absorbance at 423 nm in the UV-Visible spectra demonstrated that tannic acid underwent a reduction reaction to produce TA-AgNPs from silver ions. The synthetic yield of TA-AgNPs was 90.5% based on inductively coupled plasma mass spectrometry analysis. High-resolution transmission electron microscopy and atomic force microscopy images indicated that spherical-shaped TA-AgNPs with a mean particle size of 27.7-46.7 nm were obtained. Powder high-resolution X-ray diffraction analysis indicated that the TA-AgNP structure was face-centered cubic with a zeta potential of -27.56 mV. The hydroxyl functional groups of tannic acid contributed to the synthesis of TA-AgNPs, which was confirmed by Fourier transform infrared spectroscopy. The in vitro antibacterial activity was measured using the minimum inhibitory concentration (MIC) method. The TA-AgNPs were more effective against Gram-negative bacteria than Gram-positive bacteria. The MIC for the TA-AgNPs in all of the tested strains was in a silver concentration range of 6.74-13.48 μg/mL. The tannic acid-mediated synthesis of AgNPs afforded biocompatible nanocomposites for antibacterial applications.
Singh-Blom, Amrita; Hughes, Randall A; Ellington, Andrew D
2014-05-20
Residue-specific incorporation of non-canonical amino acids into proteins is usually performed in vivo using amino acid auxotrophic strains and replacing the natural amino acid with an unnatural amino acid analog. Herein, we present an efficient amino acid depleted cell-free protein synthesis system that can be used to study residue-specific replacement of a natural amino acid by an unnatural amino acid analog. This system combines a simple methodology and high protein expression titers with a high-efficiency analog substitution into a target protein. To demonstrate the productivity and efficacy of a cell-free synthesis system for residue-specific incorporation of unnatural amino acids in vitro, we use this system to show that 5-fluorotryptophan and 6-fluorotryptophan substituted streptavidin retain the ability to bind biotin despite protein-wide replacement of a natural amino acid for the amino acid analog. We envisage this amino acid depleted cell-free synthesis system being an economical and convenient format for the high-throughput screening of a myriad of amino acid analogs with a variety of protein targets for the study and functional characterization of proteins substituted with unnatural amino acids when compared to the currently employed in vivo methodologies. Copyright © 2014 Elsevier B.V. All rights reserved.
Ethylene Receptors Signal via a Noncanonical Pathway to Regulate Abscisic Acid Responses1[OPEN
Bakshi, Arkadipta; Fernandez, Jessica C.
2018-01-01
Ethylene is a gaseous plant hormone perceived by a family of receptors in Arabidopsis (Arabidopsis thaliana) including ETHYLENE RESPONSE1 (ETR1) and ETR2. Previously we showed that etr1-6 loss-of-function plants germinate better and etr2-3 loss-of-function plants germinate worse than wild-type under NaCl stress and in response to abscisic acid (ABA). In this study, we expanded these results by showing that ETR1 and ETR2 have contrasting roles in the control of germination under a variety of inhibitory conditions for seed germination such as treatment with KCl, CuSO4, ZnSO4, and ethanol. Pharmacological and molecular biology results support a model where ETR1 and ETR2 are indirectly affecting the expression of genes encoding ABA signaling proteins to affect ABA sensitivity. The receiver domain of ETR1 is involved in this function in germination under these conditions and controlling the expression of genes encoding ABA signaling proteins. Epistasis analysis demonstrated that these contrasting roles of ETR1 and ETR2 do not require the canonical ethylene signaling pathway. To explore the importance of receptor-protein interactions, we conducted yeast two-hybrid screens using the cytosolic domains of ETR1 and ETR2 as bait. Unique interacting partners with either ETR1 or ETR2 were identified. We focused on three of these proteins and confirmed the interactions with receptors. Loss of these proteins led to faster germination in response to ABA, showing that they are involved in ABA responses. Thus, ETR1 and ETR2 have both ethylene-dependent and -independent roles in plant cells that affect responses to ABA. PMID:29158332
Abscisic Acid Accumulates at Positive Turgor Potential in Excised Soybean Seedling Growing Zones 1
Creelman, Robert A.; Mullet, John E.
1991-01-01
Abscisic acid (ABA) accumulated in soybean (Glycine max [L.] Merr. cv Williams) hypocotyl elongating regions when seedlings were transferred to low water potential vermiculite (Ψ = −0.3 megapascals) even though positive turgor is retained in this tissue. Accumulation of ABA in growing zones could occur from de novo biosynthesis within this tissue or transport from adjacent nongrowing zones. Both growing and nongrowing hypocotyl and root tissues accumulated significant levels of ABA when excised and dehydrated to reduce turgor. Surprisingly, excised growing zones (which experienced no water loss) also accumulated ABA when incubated in darkness for 4 hours at 100% relative humidity and 29°C. Induction of ABA accumulation in the excised elongating region of the hypocotyl was not caused by disruption of root pressure or wounding. While excision of hypocotyl elongating regions induced ABA accumulation, no change in either extensin or p33 mRNA levels was observed. Accumulation of extensin or p33 mRNA required more severe wounding. This suggests that ABA is not involved in the response of these genes in wounded tissue and that wound signals are not causing ABA accumulation in excised tissue. Accumulation of ABA in excised elongating regions was correlated with growth inhibition and a decline in turgor to the yield threshold (Ψ;p = 0.37 megapascals; R Matyssek, S Maruyama, JS Boyer [1988] Plant Physiol 86: 1163-1167). Inhibiting hypocotyl growth by transferring seedlings to lower temperatures or light did not cause ABA accumulation. We conclude that induction of ABA accumulation in growing zones is more sensitive to changes in turgor than the induction which occurs in mature tissues. Images Figure 2 PMID:16668113
Caviglia, M; Mazorra Morales, L M; Concellón, A; Gergoff Grozeff, G E; Wilson, M; Foyer, C H; Bartoli, C G
2018-02-02
Ascorbic acid (AA) is a major redox buffer in plant cells. The role of ethylene in the redox signaling pathways that influence photosynthesis and growth was explored in two independent AA deficient Arabidopsis thaliana mutants (vtc2-1 and vtc2-4). Both mutants, which are defective in the AA biosynthesis gene GDP-L-galactose phosphorylase, produce higher amounts of ethylene than wt plants. In contrast to the wt, the inhibition of ethylene signaling increased leaf conductance, photosynthesis and dry weight in both vtc2 mutant lines. The AA-deficient mutants showed altered expression of genes encoding proteins involved in the synthesis/responses to phytohormones that control growth, particularly auxin, cytokinins, abscisic acid, brassinosterioids, ethylene and salicylic acid. These results demonstrate that AA deficiency modifies hormone signaling in plants, redox-ethylene interactions providing a regulatory node controlling shoot biomass accumulation. Copyright © 2018 Elsevier Inc. All rights reserved.
Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.
Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip
2016-07-02
Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids.
Xiang, Yu; Song, Xiaona; Qiao, Jing; Zang, Yimei; Li, Yanpeng; Liu, Yong; Liu, Chunsheng
2015-07-01
An efficient simplified method was developed to determine multiple classes of phytohormones simultaneously in the medicinal plant Glycyrrhiza uralensis. Ultrahigh-performance liquid chromatography electrospray ionization tandem mass spectrometry (UPLC/ESI-MS/MS) with multiple reaction monitoring (MRM) in negative mode was used for quantification. The five studied phytohormones are gibberellic acid (GA3), abscisic acid (ABA), jasmonic acid (JA), indole-3-acetic acid, and salicylic acid (SA). Only 100 mg of fresh leaves was needed, with one purification step based on C18 solid-phase extraction. Cinnamic acid was chosen as the internal standard instead of isotope-labeled internal standards. Under the optimized conditions, the five phytohormones with internal standard were separated within 4 min, with good linearities and high sensitivity. The validated method was applied to monitor the spatial and temporal changes of the five phytohormones in G. uralensis under ABA stress. The levels of GA3, ABA, JA, and SA in leaves of G. uralensis were increased at different times and with different tendencies in the reported stress mode. These changes in phytohormone levels are discussed in the context of a possible feedback regulation mechanism. Understanding this mechanism will provide a good chance of revealing the mutual interplay between different biosynthetic routes, which could further help elucidate the mechanisms of effective composition accumulation in medicinal plants.
Li, Yangyang; Wang, Cheng; Liu, Xinye; Song, Jian; Li, Hongjian; Sui, Zhipeng; Zhang, Ming; Fang, Shuang; Chu, Jinfang; Xin, Mingming; Xie, Chaojie; Zhang, Yirong; Sun, Qixin; Ni, Zhongfu
2016-04-01
Heterosis has been widely used in agriculture, but the underlying molecular principles are still largely unknown. During seed germination, we observed that maize (Zea mays) hybrid B73/Mo17 was less sensitive than its parental inbred lines to exogenous abscisic acid (ABA), and endogenous ABA content in hybrid embryos decreased more rapidly than in the parental inbred lines. ZmABA8ox1b, an ABA inactivation gene, was consistently more highly up-regulated in hybrid B73/Mo17 than in its parental inbred lines at early stages of seed germination. Moreover, ectopic expression of ZmABA8ox1b obviously promoted seed germination in Arabidopsis Remarkably, microscopic observation revealed that cell expansion played a major role in the ABA-mediated maize seed germination heterosis, which could be attributed to the altered expression of cell wall-related genes. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.
Pornsiriwong, Wannarat; Estavillo, Gonzalo M; Chan, Kai Xun; Tee, Estee E; Ganguly, Diep; Crisp, Peter A; Phua, Su Yin; Zhao, Chenchen; Qiu, Jiaen; Park, Jiyoung; Yong, Miing Tiem; Nisar, Nazia; Yadav, Arun Kumar; Schwessinger, Benjamin; Rathjen, John; Cazzonelli, Christopher I; Wilson, Philippa B; Gilliham, Matthew; Chen, Zhong-Hua; Pogson, Barry J
2017-03-21
Organelle-nuclear retrograde signaling regulates gene expression, but its roles in specialized cells and integration with hormonal signaling remain enigmatic. Here we show that the SAL1-PAP (3'-phosphoadenosine 5'- phosphate) retrograde pathway interacts with abscisic acid (ABA) signaling to regulate stomatal closure and seed germination in Arabidopsis . Genetically or exogenously manipulating PAP bypasses the canonical signaling components ABA Insensitive 1 (ABI1) and Open Stomata 1 (OST1); priming an alternative pathway that restores ABA-responsive gene expression, ROS bursts, ion channel function, stomatal closure and drought tolerance in ost1 -2. PAP also inhibits wild type and abi1 -1 seed germination by enhancing ABA sensitivity. PAP-XRN signaling interacts with ABA, ROS and Ca 2+ ; up-regulating multiple ABA signaling components, including lowly-expressed Calcium Dependent Protein Kinases (CDPKs) capable of activating the anion channel SLAC1. Thus, PAP exhibits many secondary messenger attributes and exemplifies how retrograde signals can have broader roles in hormone signaling, allowing chloroplasts to fine-tune physiological responses.
Inoue, Shinjiro; Okita, Yoichi; de Toledo, Andreia; Miyazaki, Hiroyuki; Hirano, Eiichi; Morinaga, Tetsuo
2015-01-01
We purified pyroglutamic acid from human placental extract and identified it as a potent stimulator of rat primary hepatocyte DNA synthesis. Pyroglutamic acid dose-dependently stimulated DNA synthesis, and this effect was inhibited by PD98059, a dual specificity mitogen-activated protein kinase kinase 1 (MAP2K1) inhibitor. Therefore, pyroglutamic acid stimulated DNA synthesis in rat primary hepatocytes via MAPK signaling.
Phosphatidic Acid Synthesis in Bacteria
Yao, Jiangwei; Rock, Charles O.
2012-01-01
Membrane phospholipid synthesis is a vital facet of bacterial physiology. Although the spectrum of phospholipid headgroup structures produced by bacteria is large, the key precursor to all of these molecules is phosphatidic acid (PtdOH). Glycerol-3-phosphate derived from the glycolysis via glycerol-phosphate synthase is the universal source for the glycerol backbone of PtdOH. There are two distinct families of enzymes responsible for the acylation of the 1-position of glycerol-3-phosphate. The PlsB acyltransferase was discovered in Escherichia coli, and homologs are present in many eukaryotes. This protein family primarily uses acyl-acyl carrier protein (ACP) endproducts of fatty acid synthesis as acyl donors, but may also use acyl-CoA derived from exogenous fatty acids. The second protein family, PlsY, is more widely distributed in bacteria and utilizes the unique acyl donor, acyl-phosphate, which is produced from acyl-ACP by the enzyme PlsX. The acylation of the 2-position is carried out by members of the PlsC protein family. All PlsCs use acyl-ACP as the acyl donor, although the PlsCs of the γ-proteobacteria also may use acyl-CoA. Phospholipid headgroups are precursors in the biosynthesis of other membrane-associated molecules and the diacylglycerol product of these reactions is converted to PtdOH by one of two distinct families of lipid kinases. The central importance of the de novo and recycling pathways to PtdOH in cell physiology suggest these enzymes are suitable targets for the development of antibacterial therapeutics in Gram-positive pathogens. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:22981714
Li, Juan; Hettenhausen, Christian; Sun, Guiling; Zhuang, Huifu; Li, Jian-Hong; Wu, Jianqiang
2015-01-01
Around 1% of angiosperms are parasitic plants. Their growth and development solely or partly depend on host plants from which they extract water, nutrients, and other molecules using a parasitic plant-specific organ, the haustorium. Strong depletion of nutrients can result in serious growth retardation and in some cases, death of the hosts. The genus Cuscuta (dodder) comprises about 200 holoparasitic species occurring on all continents. Their seedlings have no roots and cotyledons but are only string-like hypocotyls. When they contact suitable host plants, haustoria are formed and thereafter seedlings rapidly develop into vigorously growing branches without roots and leaves. This highly specialized lifestyle suggests that Cuscuta plants likely have unique physiology in development and stress responses. Using germination and seedling growth assays, we show that C. australis seeds and seedlings are highly insensitive to abscisic acid (ABA). Transcriptome analysis and protein sequence alignment with Arabidopsis, tomato, and rice homologs revealed that C. australis most likely consists of only four functional ABA receptors. Given that Cuscuta plants are no longer severely challenged by drought stress, we hypothesize that the ABA-mediated drought resistance pathway in Cuscuta spp. might have had degenerated over time during evolution. PMID:26258814
Li, Juan; Hettenhausen, Christian; Sun, Guiling; Zhuang, Huifu; Li, Jian-Hong; Wu, Jianqiang
2015-01-01
Around 1% of angiosperms are parasitic plants. Their growth and development solely or partly depend on host plants from which they extract water, nutrients, and other molecules using a parasitic plant-specific organ, the haustorium. Strong depletion of nutrients can result in serious growth retardation and in some cases, death of the hosts. The genus Cuscuta (dodder) comprises about 200 holoparasitic species occurring on all continents. Their seedlings have no roots and cotyledons but are only string-like hypocotyls. When they contact suitable host plants, haustoria are formed and thereafter seedlings rapidly develop into vigorously growing branches without roots and leaves. This highly specialized lifestyle suggests that Cuscuta plants likely have unique physiology in development and stress responses. Using germination and seedling growth assays, we show that C. australis seeds and seedlings are highly insensitive to abscisic acid (ABA). Transcriptome analysis and protein sequence alignment with Arabidopsis, tomato, and rice homologs revealed that C. australis most likely consists of only four functional ABA receptors. Given that Cuscuta plants are no longer severely challenged by drought stress, we hypothesize that the ABA-mediated drought resistance pathway in Cuscuta spp. might have had degenerated over time during evolution.
Huang, Xi; Duan, Min; Liao, Jiakai; Yuan, Xi; Chen, Hui; Feng, Jiejie; Huang, Ji; Zhang, Hong-Sheng
2014-01-01
Homeodomain-leucine zipper type I (HD-Zip I) proteins are involved in the regulation of plant development and response to environmental stresses. In this study, OsSLI1 (Oryza sativa stress largely induced 1), encoding a member of the HD-Zip I subfamily, was isolated from rice. The expression of OsSLI1 was dramatically induced by multiple abiotic stresses and exogenous abscisic acid (ABA). In silico sequence analysis discovered several cis-acting elements including multiple ABREs (ABA-responsive element binding factors) in the upstream promoter region of OsSLI1. The OsSLI1-GFP fusion protein was localized in the nucleus of rice protoplast cells and the transcriptional activity of OsSLI1 was confirmed by the yeast hybrid system. Further, it was found that OsSLI1 expression was enhanced in an ABI5-Like1 (ABL1) deficiency rice mutant abl1 under stress conditions, suggesting that ABL1 probably negatively regulates OsSLI1 gene expression. Moreover, it was found that OsSLI1 was regulated in panicle development. Taken together, OsSLI1 may be a transcriptional activator regulating stress-responsive gene expression and panicle development in rice.
Myrtle, J D; Beekman, A M; Barrow, R A
2016-09-21
A new antibiotic natural product, ravynic acid, has been isolated from a Penicillium sp. of fungus, collected from Ravensbourne National Park. The 3-acylpolyenyne tetramic acid structure was definitively elucidated via synthesis. Highlights of the synthetic method include the heat induced formation of the 3-acylphosphorane tetramic acid and a selective Wittig cross-coupling to efficiently prepare the natural compounds carbon skeleton. The natural compound was shown to inhibit the growth of Staphylococcus aureus down to concentrations of 2.5 µg mL(-1).
Hong, S W; Jon, J H; Kwak, J M; Nam, H G
1997-01-01
A cDNA clone for a receptor-like protein kinase gene (RPK1) was isolated from Arabidopsis thaliana. The clone is 1952 bp long with 1623 bp of an open reading frame encoding a peptide of 540 amino acids. The deduced peptide (RPK1) contains four distinctive domains characteristic of receptor kinases: (a) a putative amino-terminal signal sequence domain; (b) a domain with five extracellular leucine-rich repeat sequences; (c) a membrane-spanning domain; and (d) a cytoplasmic protein kinase domain that contains all of the 11 subdomains conserved among protein kinases. The RPK1 gene is expressed in flowers, stems, leaves, and roots. Expression of the RPK1 gene is induced within 1 h after treatment with abscisic acid (ABA). The gene is also rapidly induced by several environmental stresses such as dehydration, high salt, and low temperature, suggesting that the gene is involved in a general stress response. The dehydration-induced expression is not impaired in aba-1, abi1-1, abi2-1, and abi3-1 mutants, suggesting that the dehydration-induced expression of the RPK1 gene is ABA-independent. A possible role of this gene in the signal transduction pathway of ABA and the environmental stresses is discussed. PMID:9112773
Duodenal prostaglandin synthesis and acid load in health and in duodenal ulcer disease
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ahlquist, D.A.; Dozois, R.R.; Zinsmeister, A.R.
1983-09-01
We sought to test the hypothesis that duodenal ulcer disease results from an imbalance between duodenal acid load, an injurious force, and mucosal prostaglandin generation, a protective factor. Ten patients with duodenal ulcer and 8 healthy controls were studied. The duodenal acid load after an amino acid soup was quantified by a double-marker technique. Mucosal biopsy specimens were taken endoscopically from the duodenal bulb before and after the test meal. Prostaglandin synthesis activity was measured by incubating biopsy homogenates in excess (/sup 14/C)arachidonic acid. Although mean duodenal acid load was higher in duodenal ulcer, ranges overlapped. Neither the qualitative normore » quantitative profile of mucosal prostaglandin synthesis activities differed significantly between test groups. Prostaglandin synthesis activities, however, tended to increase post cibum in controls, but change little or decrease in duodenal ulcer. Only by comparing the responses with a meal of both parameters together (duodenal acid load and the change in prostaglandin synthesis activities) was there complete or nearly complete separation of duodenal ulcer from controls. Greatest discrimination was observed with prostacyclin (6-keto-PGF1 alpha). We conclude that in health, mucosal prostaglandin generation in the duodenum is induced post cibum in relation to duodenal acid load; this may be a physiologic example of adaptive cytoprotection. In duodenal ulcer there may be a defect in such a mechanism.« less
Yang, Xi; Yang, Ya-Nan; Xue, Liang-Jiao; Zou, Mei-Juan; Liu, Jian-Ying; Chen, Fan; Xue, Hong-Wei
2011-01-01
Abscisic acid (ABA) regulates plant development and is crucial for plant responses to biotic and abiotic stresses. Studies have identified the key components of ABA signaling in Arabidopsis (Arabidopsis thaliana), some of which regulate ABA responses by the transcriptional regulation of downstream genes. Here, we report the functional identification of rice (Oryza sativa) ABI5-Like1 (ABL1), which is a basic region/leucine zipper motif transcription factor. ABL1 is expressed in various tissues and is induced by the hormones ABA and indole-3-acetic acid and stress conditions including salinity, drought, and osmotic pressure. The ABL1 deficiency mutant, abl1, shows suppressed ABA responses, and ABL1 expression in the Arabidopsis abi5 mutant rescued the ABA sensitivity. The ABL1 protein is localized to the nucleus and can directly bind ABA-responsive elements (ABREs; G-box) in vitro. A gene expression analysis by DNA chip hybridization confirms that a large proportion of down-regulated genes of abl1 are involved in stress responses, consistent with the transcriptional activating effects of ABL1. Further studies indicate that ABL1 regulates the plant stress responses by regulating a series of ABRE-containing WRKY family genes. In addition, the abl1 mutant is hypersensitive to exogenous indole-3-acetic acid, and some ABRE-containing genes related to auxin metabolism or signaling are altered under ABL1 deficiency, suggesting that ABL1 modulates ABA and auxin responses by directly regulating the ABRE-containing genes. PMID:21546455
Fukuda, N; Ontko, J A
1984-08-01
In a series of experiments with male rat livers perfused with or without 5-tetradecyloxy-2-furoic acid (TOFA) in the presence and absence of oleate, the relationships between fatty acid synthesis, oxidation, and esterification from newly synthesized and exogenous fatty acid substrates have been examined. When livers from fed rats were perfused without exogenous fatty acid substrate, 20% of the triglyceride secreted was derived from de novo fatty acid synthesis. Addition of TOFA caused immediate and nearly complete inhibition of fatty acid synthesis, measured by incorporation of 3H2O into fatty acids. Concurrently, ketone body production increased 140% and triglyceride secretion decreased 84%. These marked reciprocal alterations in fatty acid synthesis and oxidation in the liver almost completely abolished the production of very low density lipoproteins (VLDL). Cholesterol synthesis was also depressed by TOFA, suggesting that this drug also inhibited lipid synthesis at a site other than acetyl-CoA carboxylase. When livers from fed rats were supplied with a continuous infusion of [1-14C]oleate as exogenous substrate, similar proportions, about 45-47%, of both ketone bodies and triglyceride in the perfusate were derived from the infused [1-14C]oleate. The production of ketone bodies was markedly increased by TOFA; the secretion of triglyceride and cholesterol were decreased. Altered conversion of [1-14C]oleate into these products occurred in parallel. While TOFA decreased esterification of oleate into triglyceride, incorporation of [1-14C]oleate into liver phospholipid was increased, indicating that TOFA also affected glycerolipid synthesis at the stage of diglyceride processing. The decreased secretion of triglyceride and cholesterol following TOFA treatment was localized almost exclusively in VLDL. The specific activities of 3H and of 14C fatty acids in triglyceride of the perfusate were greater than those of liver triglyceride, indicating preferential secretion of
Ali-Rachedi, Sonia; Bouinot, Denise; Wagner, Marie-Hélène; Bonnet, Magda; Sotta, Bruno; Grappin, Philippe; Jullien, Marc
2004-07-01
Mature seeds of the Cape Verde Islands (Cvi) ecotype of Arabidopsis thaliana (L.) Heynh. show a very marked dormancy. Dormant (D) seeds completely fail to germinate in conditions that are favourable for germination whereas non-dormant (ND) seeds germinate easily. Cvi seed dormancy is alleviated by after-ripening, stratification, and also by nitrate or fluridone treatment. Addition of gibberellins to D seeds does not suppress dormancy efficiently, suggesting that gibberellins are not directly involved in the breaking of dormancy. Dormancy expression of Cvi seeds is strongly dependent on temperature: D seeds do not germinate at warm temperatures (20-27 degrees C) but do so easily at a low temperature (13 degrees C) or when a fluridone treatment is given to D seeds sown at high temperature. To investigate the role of abscisic acid (ABA) in dormancy release and maintenance, we measured the ABA content in both ND and D seeds imbibed using various dormancy-breaking conditions. It was found that dry D seeds contained higher amounts of ABA than dry ND after-ripened seeds. During early imbibition in standard conditions, there was a decrease in ABA content in both seeds, the rate of which was slower in D seeds. Three days after sowing, the ABA content in D seeds increased specifically and then remained at a high level. When imbibed with fluridone, nitrate or stratified, the ABA content of D seeds decreased and reached a level very near to that of ND seeds. In contrast, gibberellic acid (GA3) treatment caused a transient increase in ABA content. When D seeds were sown at low optimal temperature their ABA content also decreased to the level observed in ND seeds. The present study indicates that Cvi D and ND seeds can be easily distinguished by their ability to synthesize ABA following imbibition. Treatments used here to break dormancy reduced the ABA level in imbibed D seeds to the level observed in ND seeds, with the exception of GA3 treatment, which was active in promoting
Suryawan, Agus; O’Connor, Pamela M. J.; Bush, Jill A.; Nguyen, Hanh V.
2009-01-01
The high efficiency of protein deposition during the neonatal period is driven by high rates of protein synthesis, which are maximally stimulated after feeding. In the current study, we examined the individual roles of amino acids and insulin in the regulation of protein synthesis in peripheral and visceral tissues of the neonate by performing pancreatic glucose–amino acid clamps in overnight-fasted 7-day-old pigs. We infused pigs (n = 8–12/group) with insulin at 0, 10, 22, and 110 ng kg−0.66 min−1 to achieve ~0, 2, 6 and 30 μU ml−1 insulin so as to simulate below fasting, fasting, intermediate, and fed insulin levels, respectively. At each insulin dose, amino acids were maintained at the fasting or fed level. In conjunction with the highest insulin dose, amino acids were also allowed to fall below the fasting level. Tissue protein synthesis was measured using a flooding dose of L-[4-3H] phenylalanine. Both insulin and amino acids increased fractional rates of protein synthesis in longissimus dorsi, gastrocnemius, masseter, and diaphragm muscles. Insulin, but not amino acids, increased protein synthesis in the skin. Amino acids, but not insulin, increased protein synthesis in the liver, pancreas, spleen, and lung and tended to increase protein synthesis in the jejunum and kidney. Neither insulin nor amino acids altered protein synthesis in the stomach. The results suggest that the stimulation of protein synthesis by feeding in most tissues of the neonate is regulated by the post-prandial rise in amino acids. However, the feeding-induced stimulation of protein synthesis in skeletal muscles is independently mediated by insulin as well as amino acids. PMID:18683020
Yang, Tao; Zhang, Liang; Hao, Hongyan; Zhang, Peng; Zhu, Haowei; Cheng, Wei; Wang, Yongli; Wang, Xinyu; Wang, Chongying
2015-12-01
Salt stress from soil or irrigation water limits plant growth. A T-DNA insertion mutant in C24, named athspr (Arabidopsis thaliana heat shock protein-related), showed several phenotypes, including reduced organ size and enhanced sensitivity to environmental cues. The athspr mutant is severely impaired under salinity levels at which wild-type (WT) plants grow normally. AtHSPR encodes a nuclear-localized protein with ATPase activity, and its expression was enhanced by high salinity and abscisic acid (ABA). Overexpression (OE) of AtHSPR significantly enhanced tolerance to salt stress by increasing the activities of the antioxidant system and by maintaining K(+) /Na(+) homeostasis. Quantitative RT-PCR analyses showed that OE of AtHSPR increased the expression of ABA/stress-responsive, salt overly sensitive (SOS)-related and antioxidant-related genes. In addition, ABA content was reduced in athspr plants with or without salt stress, and exogenous ABA restored WT-like salt tolerance to athspr plants. athspr exhibited increased leaf stomatal density and stomatal index, slower ABA-induced stomatal closure and reduced drought tolerance relative to the WT. AtHSPR OE enhanced drought tolerance by reducing leaf water loss and stomatal aperture. Transcript profiling in athspr showed a differential salt-stress response for genes involved in accumulation of reactive oxygen species (ROS), ABA signaling, cell death, stress response and photosynthesis. Taken together, our results suggested that AtHSPR is involved in salt tolerance in Arabidopsis through modulation of ROS levels, ABA-dependent stomatal closure, photosynthesis and K(+) /Na(+) homeostasis. © 2015 The Authors The Plant Journal © 2015 John Wiley & Sons Ltd.
By-products of electrochemical synthesis of suberic acid
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shirobokova, O.I.; Adamov, A.A.; Freidlin, G.N.
By-products of the electrochemical synthesis of dimethyl suberate from glutaric anhydride were studied. This is isolated by thermal dehydration of a mixture of lower dicarboxylic acids that are wastes from the production of adipic acid. To isolate the by-products, they used the methods of vacuum rectification and preparative gas-liquid chromatography, and for their identification, PMR, IR spectroscopy, gas-liquid chromatography, and other known physicochemical methods of investigation.
Orellana, Renán A; Jeyapalan, Asumthia; Escobar, Jeffery; Frank, Jason W; Nguyen, Hanh V; Suryawan, Agus; Davis, Teresa A
2007-11-01
In skeletal muscle of adults, sepsis reduces protein synthesis by depressing translation initiation and induces resistance to branched-chain amino acid stimulation. Normal neonates maintain a high basal muscle protein synthesis rate that is sensitive to amino acid stimulation. In the present study, we determined the effect of amino acids on protein synthesis in skeletal muscle and other tissues in septic neonates. Overnight-fasted neonatal pigs were infused with endotoxin (LPS, 0 and 10 microg.kg(-1).h(-1)), whereas glucose and insulin were maintained at fasting levels; amino acids were clamped at fasting or fed levels. In the presence of fasting insulin and amino acids, LPS reduced protein synthesis in longissimus dorsi (LD) and gastrocnemius muscles and increased protein synthesis in the diaphragm, but had no effect in masseter and heart muscles. Increasing amino acids to fed levels accelerated muscle protein synthesis in LD, gastrocnemius, masseter, and diaphragm. LPS stimulated protein synthesis in liver, lung, spleen, pancreas, and kidney in fasted animals. Raising amino acids to fed levels increased protein synthesis in liver of controls, but not LPS-treated animals. The increase in muscle protein synthesis in response to amino acids was associated with increased mTOR, 4E-BP1, and S6K1 phosphorylation and eIF4G-eIF4E association in control and LPS-infused animals. These findings suggest that amino acids stimulate skeletal muscle protein synthesis during acute endotoxemia via mTOR-dependent ribosomal assembly despite reduced basal protein synthesis rates in neonatal pigs. However, provision of amino acids does not further enhance the LPS-induced increase in liver protein synthesis.
Enzymic synthesis of indole-3-acetyl-1-O-beta-d-glucose. II. Metabolic characteristics of the enzyme
NASA Technical Reports Server (NTRS)
Leznicki, A. J.; Bandurski, R. S.
1988-01-01
The synthesis of indole-3-acetyl-1-O-beta-D-glucose from indole-3-acetic acid (IAA) and uridine diphosphoglucose (UDPG) has been shown to be a reversible reaction with the equilibrium away from ester formation and toward formation of IAA. The enzyme occurs primarily in the liquid endosperm of the corn kernel but some activity occurs in the embryo. It is relatively specific showing no glucose ester formation with oxindole-3-acetic acid or 7-hydroxy-oxindole-3-acetic acid, and low activity with phenylpropene acids, such as rho-coumaric acid. The enzyme is also specific for the nucleotide sugar showing no activity with UDPGalactose or UDPXylose. The enzyme is inhibited by inorganic pyrophosphate, by phosphate esters and by phospholipids, particularly phosphatidyl ethanolamine. The enzyme is inhibited by zeatin, by 2,4-dichlorophenoxy-acetic acid, by IAA-myo-inositol and IAA-glucan, but not by zeatin riboside, and only weakly by gibberellic acid, abscisic acid and kinetin. The reaction is slightly stimulated by both calcium and calmodulin and, in some cases, by thiol compounds. The role of this enzyme in the homeostatic control of indole-3-acetic acid levels in Zea mays is discussed.
Fatty acid synthesis in Escherichia coli
Knivett, V. A.; Cullen, Julia
1967-01-01
1. Fatty acid formation by cells of a strain of Escherichia coli has been studied in the exponential, post-exponential and stationary phases of growth. 2. During the exponential phase of growth, the metabolic quotient (mμmoles of fatty acid synthesized/mg. dry wt. of cells/hr.) for each fatty acid in the extractable lipid was constant. 3. The newly synthesized fatty acid mixtures produced during this phase contained hexadecanoic acid (41%), hexadecenoic acid (31%), octadecenoic acid (21%) and the C17-cyclopropane acid, methylenehexadecanoic acid (4%). 4. As the proportion of newly synthesized material increased, changes in the fatty acid composition of the cells during this period were towards this constant composition. 5. Abrupt changes in fatty acid synthesis occurred when exponential growth ceased. 6. In media in which glycerol, or SO42− or Mg2+, was growth-limiting there was a small accumulation of C17-cyclopropane acid in cells growing in the post-exponential phase of growth. 7. Where either NH4+ or PO43− was growth-limiting and there were adequate supplies of glycerol, Mg2+ and SO42−, there was a marked accumulation of C17-cyclopropane acid and C19-cyclopropane acid appeared. 8. Under appropriate conditions the metabolic quotient for C17-cyclopropane acid increased up to sevenfold at the end of exponential growth. Simultaneously the metabolic quotients of the other acids fell. 9. A mixture of glycerol, Mg2+ and SO42− stimulated cyclopropane acid formation in resting cells. PMID:5340364
Pelà, M; Del Zoppo, L; Allegri, L; Marzola, E; Ruzza, C; Calo, G; Perissutti, E; Frecentese, F; Salvadori, S; Guerrini, R
2014-07-01
The synthesis of non natural amino acid 2-amino-3,3,4-trimethyl-pentanoic acid (Ipv) ready for solid phase peptide synthesis has been developed. Copper (I) chloride Michael addition, followed by a Curtius rearrangement are the key steps for the lpv synthesis. The racemic valine/leucine chimeric amino acid was then successfully inserted in position 5 of neuropeptide S (NPS) and the diastereomeric mixture separated by reverse phase HPLC. The two diastereomeric NPS derivatives were tested for intracellular calcium mobilization using HEK293 cells stably expressing the mouse NPS receptor where they behaved as partial agonist and pure antagonist.
Suzuki, Nobuhiro; Miller, Gad; Salazar, Carolina; Mondal, Hossain A.; Shulaev, Elena; Cortes, Diego F.; Shuman, Joel L.; Luo, Xiaozhong; Shah, Jyoti; Schlauch, Karen; Shulaev, Vladimir; Mittler, Ron
2013-01-01
Being sessile organisms, plants evolved sophisticated acclimation mechanisms to cope with abiotic challenges in their environment. These are activated at the initial site of exposure to stress, as well as in systemic tissues that have not been subjected to stress (termed systemic acquired acclimation [SAA]). Although SAA is thought to play a key role in plant survival during stress, little is known about the signaling mechanisms underlying it. Here, we report that SAA in plants requires at least two different signals: an autopropagating wave of reactive oxygen species (ROS) that rapidly spreads from the initial site of exposure to the entire plant and a stress-specific signal that conveys abiotic stress specificity. We further demonstrate that SAA is stress specific and that a temporal–spatial interaction between ROS and abscisic acid regulates rapid SAA to heat stress in plants. In addition, we demonstrate that the rapid ROS signal is associated with the propagation of electric signals in Arabidopsis thaliana. Our findings unravel some of the basic signaling mechanisms underlying SAA in plants and reveal that signaling events and transcriptome and metabolome reprogramming of systemic tissues in response to abiotic stress occur at a much faster rate than previously envisioned. PMID:24038652
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zeevaart, J.A.D.; Heath, T.G.; Gage, D.A.
1989-12-01
Previous labeling studies of abscisic acid (ABA) with {sup 18}O{sub 2} have been mainly conducted with water-stressed leaves. In this study, {sup 18}O incorporation into ABA of stressed leaves of various species was compared with {sup 18}O labeling of ABA of turgid leaves and of fruit tissue in different stages of ripening. In stressed leaves of all six species investigated, avocado (Persea americana), barley (Hordeum vulgare), bean (Phaseolus vulgaris), cocklebur (Xanthium strumarium), spinach (Spinacia oleracea), and tobacco (Nicotiana tabacum), {sup 18}O was most abundant in the carboxyl group, whereas incorporation of a second and third {sup 18}O in the oxygenmore » atoms on the ring of ABA was much less prominent after 24 h in {sup 18}O{sub 2}. ABA from turgid bean leaves showed significant {sup 18}O incorporation, again with highest {sup 18}O enrichment in the carboxyl group. On the basis of {sup 18}O-labeling patterns observed in ABA from different tissues it is concluded that, despite variations in precusor pool sizes and intermediate turnover rates, there is a universal pathway of ABA biosynthesis in higher plants which involves cleavage of a larger precursor molecule, presumably an oxygenated carotenoid.« less
Inhibition of rotavirus replication by downregulation of fatty acid synthesis.
Gaunt, Eleanor R; Cheung, Winsome; Richards, James E; Lever, Andrew; Desselberger, Ulrich
2013-06-01
Recently the recruitment of lipid droplets (LDs) to sites of rotavirus (RV) replication was reported. LDs are polymorphic organelles that store triacylglycerols, cholesterol and cholesterol esters. The neutral fats are derived from palmitoyl-CoA, synthesized via the fatty acid biosynthetic pathway. RV-infected cells were treated with chemical inhibitors of the fatty acid biosynthetic pathway, and the effects on viral replication kinetics were assessed. Treatment with compound C75, an inhibitor of the fatty acid synthase enzyme complex (FASN), reduced RV infectivity 3.2-fold (P = 0.07) and modestly reduced viral RNA synthesis (1.2-fold). Acting earlier in the fatty acid synthesis pathway, TOFA [5-(Tetradecyloxy)-2-furoic acid] inhibits the enzyme acetyl-CoA carboxylase 1 (ACC1). TOFA reduced the infectivity of progeny RV 31-fold and viral RNA production 6-fold. The effect of TOFA on RV infectivity and RNA replication was dose-dependent, and infectivity was reduced by administering TOFA up to 4 h post-infection. Co-treatment of RV-infected cells with C75 and TOFA synergistically reduced viral infectivity. Knockdown by siRNA of FASN and ACC1 produced findings similar to those observed by inhibiting these proteins with the chemical compounds. Inhibition of fatty acid synthesis using a range of approaches uniformly had a more marked impact on viral infectivity than on viral RNA yield, inferring a role for LDs in virus assembly and/or egress. Specific inhibitors of fatty acid metabolism may help pinpoint the critical structural and biochemical features of LDs that are essential for RV replication, and facilitate the development of antiviral therapies.
Ha, Jun-Ho; Kim, Ju-Heon; Kim, Sang-Gyu; Sim, Hee-Jung; Lee, Gisuk; Halitschke, Rayko; Baldwin, Ian T; Kim, Jeong-Il; Park, Chung-Mo
2018-06-01
Underground roots normally reside in darkness. However, they are often exposed to ambient light that penetrates through cracks in the soil layers which can occur due to wind, heavy rain or temperature extremes. In response to light exposure, roots produce reactive oxygen species (ROS) which promote root growth. It is known that ROS-induced growth promotion facilitates rapid escape of the roots from non-natural light. Meanwhile, long-term exposure of the roots to light elicits a ROS burst, which causes oxidative damage to cellular components, necessitating that cellular levels of ROS should be tightly regulated in the roots. Here we demonstrate that the red/far-red light photoreceptor phytochrome B (phyB) stimulates the biosynthesis of abscisic acid (ABA) in the shoots, and notably the shoot-derived ABA signals induce a peroxidase-mediated ROS detoxification reaction in the roots. Accordingly, while ROS accumulate in the roots of the phyb mutant that exhibits reduced primary root growth in the light, such an accumulation of ROS did not occur in the dark-grown phyb roots that exhibited normal growth. These observations indicate that mobile shoot-to-root ABA signaling links shoot phyB-mediated light perception with root ROS homeostasis to help roots adapt to unfavorable light exposure. We propose that ABA-mediated shoot-to-root phyB signaling contributes to the synchronization of shoot and root growth for optimal propagation and performance in plants. © 2018 The Authors The Plant Journal © 2018 John Wiley & Sons Ltd.
Zhu, Mengmeng; Zhu, Ning; Song, Wen-yuan; Harmon, Alice C; Assmann, Sarah M; Chen, Sixue
2014-05-01
Reversibly oxidized cysteine sulfhydryl groups serve as redox sensors or targets of redox sensing that are important in various physiological processes. However, little is known about redox-sensitive proteins in guard cells and how they function in stomatal signaling. In this study, Brassica napus guard-cell proteins altered by redox in response to abscisic acid (ABA) or methyl jasmonate (MeJA) were identified by complementary proteomics approaches, saturation differential in-gel electrophoresis and isotope-coded affinity tagging. In total, 65 and 118 potential redox-responsive proteins were identified in ABA- and MeJA-treated guard cells, respectively. All the proteins contain at least one cysteine, and over half of them are predicted to form intra-molecular disulfide bonds. Most of the proteins fall into the functional groups of 'energy', 'stress and defense' and 'metabolism'. Based on the peptide sequences identified by mass spectrometry, 30 proteins were common to ABA- and MeJA-treated samples. A total of 44 cysteines were mapped in the identified proteins, and their levels of redox sensitivity were quantified. Two of the proteins, a sucrose non-fermenting 1-related protein kinase and an isopropylmalate dehydrogenase, were confirmed to be redox-regulated and involved in stomatal movement. This study creates an inventory of potential redox switches, and highlights a protein redox regulatory mechanism in ABA and MeJA signal transduction in guard cells. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.
Vaidya, Aditya S; Peterson, Francis C; Yarmolinsky, Dmitry; Merilo, Ebe; Verstraeten, Inge; Park, Sang-Youl; Elzinga, Dezi; Kaundal, Amita; Helander, Jonathan; Lozano-Juste, Jorge; Otani, Masato; Wu, Kevin; Jensen, Davin R; Kollist, Hannes; Volkman, Brian F; Cutler, Sean R
2017-11-17
Increasing drought and diminishing freshwater supplies have stimulated interest in developing small molecules that can be used to control transpiration. Receptors for the plant hormone abscisic acid (ABA) have emerged as key targets for this application, because ABA controls the apertures of stomata, which in turn regulate transpiration. Here, we describe the rational design of cyanabactin, an ABA receptor agonist that preferentially activates Pyrabactin Resistance 1 (PYR1) with low nanomolar potency. A 1.63 Å X-ray crystallographic structure of cyanabactin in complex with PYR1 illustrates that cyanabactin's arylnitrile mimics ABA's cyclohexenone oxygen and engages the tryptophan lock, a key component required to stabilize activated receptors. Further, its sulfonamide and 4-methylbenzyl substructures mimic ABA's carboxylate and C6 methyl groups, respectively. Isothermal titration calorimetry measurements show that cyanabactin's compact structure provides ready access to high ligand efficiency on a relatively simple scaffold. Cyanabactin treatments reduce Arabidopsis whole-plant stomatal conductance and activate multiple ABA responses, demonstrating that its in vitro potency translates to ABA-like activity in vivo. Genetic analyses show that the effects of cyanabactin, and the previously identified agonist quinabactin, can be abolished by the genetic removal of PYR1 and PYL1, which form subclade A within the dimeric subfamily III receptors. Thus, cyanabactin is a potent and selective agonist with a wide spectrum of ABA-like activities that defines subfamily IIIA receptors as key target sites for manipulating transpiration.
Zifkin, Michael; Jin, Alena; Ozga, Jocelyn A.; Zaharia, L. Irina; Schernthaner, Johann P.; Gesell, Andreas; Abrams, Suzanne R.; Kennedy, James A.; Constabel, C. Peter
2012-01-01
Highbush blueberry (Vaccinium corymbosum) fruits contain substantial quantities of flavonoids, which are implicated in a wide range of health benefits. Although the flavonoid constituents of ripe blueberries are known, the molecular genetics underlying their biosynthesis, localization, and changes that occur during development have not been investigated. Two expressed sequence tag libraries from ripening blueberry fruit were constructed as a resource for gene identification and quantitative real-time reverse transcription-polymerase chain reaction primer design. Gene expression profiling by quantitative real-time reverse transcription-polymerase chain reaction showed that flavonoid biosynthetic transcript abundance followed a tightly regulated biphasic pattern, and transcript profiles were consistent with the abundance of the three major classes of flavonoids. Proanthocyanidins (PAs) and corresponding biosynthetic transcripts encoding anthocyanidin reductase and leucoanthocyanidin reductase were most concentrated in young fruit and localized predominantly to the inner fruit tissue containing the seeds and placentae. Mean PA polymer length was seven to 8.5 subunits, linked predominantly via B-type linkages, and was relatively constant throughout development. Flavonol accumulation and localization patterns were similar to those of the PAs, and the B-ring hydroxylation pattern of both was correlated with flavonoid-3′-hydroxylase transcript abundance. By contrast, anthocyanins accumulated late in maturation, which coincided with a peak in flavonoid-3-O-glycosyltransferase and flavonoid-3′5′-hydroxylase transcripts. Transcripts of VcMYBPA1, which likely encodes an R2R3-MYB transcriptional regulator of PA synthesis, were prominent in both phases of development. Furthermore, the initiation of ripening was accompanied by a substantial rise in abscisic acid, a growth regulator that may be an important component of the ripening process and contribute to the regulation
Vishwakarma, Kanchan; Upadhyay, Neha; Kumar, Nitin; Yadav, Gaurav; Singh, Jaspreet; Mishra, Rohit K.; Kumar, Vivek; Verma, Rishi; Upadhyay, R. G.; Pandey, Mayank; Sharma, Shivesh
2017-01-01
Abiotic stress is one of the severe stresses of environment that lowers the growth and yield of any crop even on irrigated land throughout the world. A major phytohormone abscisic acid (ABA) plays an essential part in acting toward varied range of stresses like heavy metal stress, drought, thermal or heat stress, high level of salinity, low temperature, and radiation stress. Its role is also elaborated in various developmental processes including seed germination, seed dormancy, and closure of stomata. ABA acts by modifying the expression level of gene and subsequent analysis of cis- and trans-acting regulatory elements of responsive promoters. It also interacts with the signaling molecules of processes involved in stress response and development of seeds. On the whole, the stress to a plant can be susceptible or tolerant by taking into account the coordinated activities of various stress-responsive genes. Numbers of transcription factor are involved in regulating the expression of ABA responsive genes by acting together with their respective cis-acting elements. Hence, for improvement in stress-tolerance capacity of plants, it is necessary to understand the mechanism behind it. On this ground, this article enlightens the importance and role of ABA signaling with regard to various stresses as well as regulation of ABA biosynthetic pathway along with the transcription factors for stress tolerance. PMID:28265276
Zhu, Fu-Yuan; Chen, Mo-Xian; Ye, Neng-Hui; Shi, Lu; Ma, Kai-Long; Yang, Jing-Fang; Cao, Yun-Ying; Zhang, Youjun; Yoshida, Takuya; Fernie, Alisdair R; Fan, Guang-Yi; Wen, Bo; Zhou, Ruo; Liu, Tie-Yuan; Fan, Tao; Gao, Bei; Zhang, Di; Hao, Ge-Fei; Xiao, Shi; Liu, Ying-Gao; Zhang, Jianhua
2017-08-01
In eukaryotes, mechanisms such as alternative splicing (AS) and alternative translation initiation (ATI) contribute to organismal protein diversity. Specifically, splicing factors play crucial roles in responses to environment and development cues; however, the underlying mechanisms are not well investigated in plants. Here, we report the parallel employment of short-read RNA sequencing, single molecule long-read sequencing and proteomic identification to unravel AS isoforms and previously unannotated proteins in response to abscisic acid (ABA) treatment. Combining the data from the two sequencing methods, approximately 83.4% of intron-containing genes were alternatively spliced. Two AS types, which are referred to as alternative first exon (AFE) and alternative last exon (ALE), were more abundant than intron retention (IR); however, by contrast to AS events detected under normal conditions, differentially expressed AS isoforms were more likely to be translated. ABA extensively affects the AS pattern, indicated by the increasing number of non-conventional splicing sites. This work also identified thousands of unannotated peptides and proteins by ATI based on mass spectrometry and a virtual peptide library deduced from both strands of coding regions within the Arabidopsis genome. The results enhance our understanding of AS and alternative translation mechanisms under normal conditions, and in response to ABA treatment. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.
Valluru, Ravi; Davies, William J.; Reynolds, Matthew P.; Dodd, Ian C.
2016-01-01
Although, plant hormones play an important role in adjusting growth in response to environmental perturbation, the relative contributions of abscisic acid (ABA) and ethylene remain elusive. Using six spring wheat genotypes differing for stress tolerance, we show that young seedlings of the drought-tolerant (DT) group maintained or increased shoot dry weight (SDW) while the drought-susceptible (DS) group decreased SDW in response to mild drought. Both the DT and DS groups increased endogenous ABA and ethylene concentrations under mild drought compared to control. The DT and DS groups exhibited different SDW response trends, whereby the DS group decreased while the DT group increased SDW, to increased concentrations of ABA and ethylene under mild drought, although both groups decreased ABA/ethylene ratio under mild drought albeit at different levels. We concluded that SDW of the DT and DS groups might be distinctly regulated by specific ABA:ethylene ratio. Further, a foliar-spray of low concentrations (0.1 μM) of ABA increased shoot relative growth rate (RGR) in the DS group while ACC (1-aminocyclopropane-1-carboxylic acid, ethylene precursor) spray increased RGR in both groups compared to control. Furthermore, the DT group accumulated a significantly higher galactose while a significantly lower maltose in the shoot compared to the DS group. Taken all together, these results suggest an impact of ABA, ethylene, and ABA:ethylene ratio on SDW of wheat seedlings that may partly underlie a genotypic variability of different shoot growth sensitivities to drought among crop species under field conditions. We propose that phenotyping based on hormone accumulation, response and hormonal ratio would be a viable, rapid, and an early–stage selection tool aiding genotype selection for stress tolerance. PMID:27148292
Literature Survey on Causes of Spoilage of Fresh Produce - 1959 to 1977
1982-08-01
abscisic acid synthesis, and the enzymatic transformation of colorless carotenes to yellow, then orange, and finally red. 44. WJ. Lipton, 1967. Market...alamine, glycine, aspartic acid , glutamic acid , methionine, seraine, betaine methyl, glyoxalate, acrylate, propionate, ethanol, acetate, citrate...polygalacturonase forming monogalacturonic acid could not be detected. 23. MJ. Ceponis and J. Kaufman, 1968. Effect of Relative Humidity on Moisture Loss and Decay
Zhu, Yuan; Yan, Jingwei; Liu, Weijuan; ...
2016-05-10
Calcium/calmodulin-dependent protein kinase (CCaMK) has been shown to play an important role in abscisic acid (ABA)-induced antioxidant defense and enhance the tolerance of plants to drought stress. However, its downstream molecular events are poorly understood. Here, we identify a NAC transcription factor, ZmNAC84, in maize, which physically interacts with ZmCCaMK in vitro and in vivo. ZmNAC84 display a partially overlapping expression pattern with ZmCCaMK after ABA treatment and H 2O 2 is required for ABA-induced ZmNAC84 expression. Functional analysis reveals that ZmNAC84 is essential for ABA-induced antioxidant defense in a ZmCCaMK-dependent manner. Furthermore, ZmCCaMK directly phosphorylates S113 of ZmNAC84 inmore » vitro, and S113 is essential for the ABA-induced stimulation of antioxidant defense by ZmCCaMK. Moreover, overexpression of ZmNAC84 in tobacco can improve drought tolerance, and alleviate drought-induced oxidative damage of transgenic plants. These results define a mechanism for ZmCCaMK function in ABA-induced antioxidant defense, where ABA-produced H 2O 2 first induces expression of ZmCCaMK and ZmNAC84 and activates ZmCCaMK, and subsequently the activated ZmCCaMK phosphorylates ZmNAC84 at S113, thereby inducing antioxidant defense by activating downstream genes.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhu, Yuan; Yan, Jingwei; Liu, Weijuan
Calcium/calmodulin-dependent protein kinase (CCaMK) has been shown to play an important role in abscisic acid (ABA)-induced antioxidant defense and enhance the tolerance of plants to drought stress. However, its downstream molecular events are poorly understood. Here, we identify a NAC transcription factor, ZmNAC84, in maize, which physically interacts with ZmCCaMK in vitro and in vivo. ZmNAC84 display a partially overlapping expression pattern with ZmCCaMK after ABA treatment and H 2O 2 is required for ABA-induced ZmNAC84 expression. Functional analysis reveals that ZmNAC84 is essential for ABA-induced antioxidant defense in a ZmCCaMK-dependent manner. Furthermore, ZmCCaMK directly phosphorylates S113 of ZmNAC84 inmore » vitro, and S113 is essential for the ABA-induced stimulation of antioxidant defense by ZmCCaMK. Moreover, overexpression of ZmNAC84 in tobacco can improve drought tolerance, and alleviate drought-induced oxidative damage of transgenic plants. These results define a mechanism for ZmCCaMK function in ABA-induced antioxidant defense, where ABA-produced H 2O 2 first induces expression of ZmCCaMK and ZmNAC84 and activates ZmCCaMK, and subsequently the activated ZmCCaMK phosphorylates ZmNAC84 at S113, thereby inducing antioxidant defense by activating downstream genes.« less
Pore-expanded SBA-15 sulfonic acid silicas for biodiesel synthesis.
Dacquin, J P; Lee, A F; Pirez, C; Wilson, K
2012-01-07
Here we present the first application of pore-expanded SBA-15 in heterogeneous catalysis. Pore expansion over the range 6-14 nm confers a striking activity enhancement towards fatty acid methyl ester (FAME) synthesis from triglycerides (TAG), and free fatty acid (FFA), attributed to improved mass transport and acid site accessibility. This journal is © The Royal Society of Chemistry 2012
Synthesis of acid-soluble spore proteins by Bacillus subtilis.
Leventhal, J M; Chambliss, G H
1982-12-01
The major acid-soluble spore proteins (ASSPs) of Bacillus subtilis were detected by immunoprecipitation of radioactively labeled in vitro- and in vivo-synthesized proteins. ASSP synthesis in vivo began 2 h after the initiation of sporulation (t2) and reached its maximum rate at t7. This corresponded to the time of synthesis of mRNA that stimulated the maximum rate of ASSP synthesis in vitro. Under the set of conditions used in these experiments, protease synthesis began near t0, alkaline phosphatase synthesis began at about t2, and refractile spores were first observed between t7 and t8. In vivo- and in vitro-synthesized ASSPs comigrated in sodium dodecyl sulfate-polyacrylamide gels. Their molecular weights were 4,600 (alpha and beta) and 11,000 (gamma). The average half-life of the ASSP messages was 11 min when either rifampin (10 micrograms/ml) or actinomycin D (1 microgram/ml) was used to inhibit RNA synthesis.
NASA Astrophysics Data System (ADS)
Botta, Lorenzo; Mattia Bizzarri, Bruno; Piccinino, Davide; Fornaro, Teresa; Robert Brucato, John; Saladino, Raffaele
2017-07-01
The photochemical transformation of formamide in the presence of a mixture of TiO2 and ZnO metal oxides as catalysts afforded a large panel of molecules of biological relevance, including carboxylic acids, amino acids and nucleic acid bases. The reaction was less effective when performed in the presence of only one mineral, highlighting the role of synergic effects between the photoactive catalysts. Taken together, these results suggest that the synthesis of chemical precursors for both the genetic and the metabolic apparatuses might have occurred in a simple environment, consisting of formamide, photoactive metal oxides and UV-radiation.
Zhou, Yanli; Sun, Xudong; Yang, Yunqiang; Li, Xiong; Cheng, Ying; Yang, Yongping
2016-01-01
Stipa purpurea (S. purpurea) is the dominant plant species in the alpine steppe of the Qinghai-Tibet Plateau, China. It is highly resistant to cold and drought conditions. However, the underlying mechanisms regulating the stress tolerance are unknown. In this study, a CIPK gene from S. purpurea (SpCIPK26) was isolated. The SpCIPK26 coding region consisted of 1392 bp that encoded 464 amino acids. The protein has a highly conserved catalytic structure and regulatory domain. The expression of SpCIPK26 was induced by drought and salt stress. SpCIPK26 overexpression in Arabidopsis thaliana (A. thaliana) plants provided increased tolerance to drought and salt stress in an abscisic acid (ABA)-dependent manner. Compared with wild-type A. thaliana plants, SpCIPK26-overexpressing plants had higher survival rates, water potentials, and photosynthetic efficiency (Fv/Fm), as well as lower levels of reactive oxygen species (ROS) following exposure to drought and salt stress. Gene expression analyses indicated stress-inducible genes (RD29A, RD29B, and ABF2) and a ROS-scavenger gene (CAT1) were upregulated in SpCIPK26-overexpressing plants after stress treatments. All of these marker genes are associated with ABA-responsive cis-acting elements. Additionally, the similarities in the gene expression patterns following ABA, mannitol, and NaCl treatments suggest SpCIPK26 has an important role during plant responses to drought and salt stress and in regulating ABA signaling. PMID:27338368
Gomez-Cadenas, A.; Tadeo, F. R.; Talon, M.; Primo-Millo, E.
1996-01-01
The involvement of abscisic acid (ABA) in the process of leaf abscission induced by 1-aminocyclopropane-1-carboxylic acid (ACC) transported from roots to shoots in Cleopatra mandarin (Citrus reshni Hort. ex Tan.) seedlings grown under water stress was studied using norflurazon (NF). Water stress induced both ABA (24-fold) and ACC (16-fold) accumulation in roots and arrested xylem flow. Leaf bulk ABA also increased (8-fold), although leaf abscission did not occur. Shortly after rehydration, root ABA and ACC returned to their prestress levels, whereas sharp and transitory increases of ACC (17-fold) and ethylene (10-fold) in leaves and high percentages of abscission (up to 47%) were observed. NF suppressed the ABA and ACC accumulation induced by water stress in roots and the sharp increases of ACC and ethylene observed after rewatering in leaves. NF also reduced leaf abscission (7-10%). These results indicate that water stress induces root ABA accumulation and that this is required for the process of leaf abscission to occur. It was also shown that exogenous ABA increases ACC levels in roots but not in leaves. Collectively, the data suggest that ABA, the primary sensitive signal to water stress, modulates the levels of ethylene, which is the hormonal activator of leaf abscission. This assumption implies that root ACC levels are correlated with root ABA amounts in a dependent way, which eventually links water status to an adequate, protective response such as leaf abscission. PMID:12226398
Lindner, Scott E.; Sartain, Mark J.; Hayes, Kiera; Harupa, Anke; Moritz, Robert L.; Kappe, Stefan H. I.; Vaughan, Ashley M.
2014-01-01
SUMMARY Malaria parasites scavenge nutrients from their host but also harbor enzymatic pathways for de novo macromolecule synthesis. One such pathway is apicoplast-targeted type II fatty acid synthesis, which is essential for late liver stage development in rodent malaria. It is likely that fatty acids synthesized in the apicoplast are ultimately incorporated into membrane phospholipids necessary for exoerythrocytic merozoite formation. We hypothesized that these synthesized fatty acids are being utilized for apicoplast-targeted phosphatidic acid synthesis, the phospholipid precursor. Phosphatidic acid is typically synthesized in a three-step reaction utilizing three enzymes: glycerol 3-phosphate dehydrogenase, glycerol 3-phosphate acyltransferase and lysophosphatidic acid acyltransferase. The Plasmodium genome is predicted to harbor genes for both apicoplast- and cytosol/endoplasmic reticulum-targeted phosphatidic synthesis. Our research shows that apicoplast-targeted P. yoelii glycerol 3-phosphate dehydrogenase and glycerol 3-phosphate acyltransferase are expressed only during liver stage development and deletion of the encoding genes resulted in late liver stage growth arrest and lack of merozoite differentiation. However, the predicted apicoplast-targeted lysophosphatidic acid acyltransferase gene was refractory to deletion and was expressed solely in the endoplasmic reticulum throughout the parasite lifecycle. Our results suggest that P. yoelii has an incomplete apicoplast-targeted phosphatidic acid synthesis pathway that is essential for liver stage maturation. PMID:24330260
WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds1[OPEN
Browse, John
2016-01-01
Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047
Wilson, Fiona A; Suryawan, Agus; Orellana, Renán A; Nguyen, Hanh V; Jeyapalan, Asumthia S; Gazzaneo, Maria C; Davis, Teresa A
2008-10-01
Chronic somatotropin (pST) treatment in pigs increases muscle protein synthesis and circulating insulin, a known promoter of protein synthesis. Previously, we showed that the pST-mediated rise in insulin could not account for the pST-induced increase in muscle protein synthesis when amino acids were maintained at fasting levels. This study aimed to determine whether the pST-induced increase in insulin promotes skeletal muscle protein synthesis when amino acids are provided at fed levels and whether the response is associated with enhanced translation initiation factor activation. Growing pigs were treated with pST (0 or 180 microg x kg(-1) x day(-1)) for 7 days, and then pancreatic-glucose-amino acid clamps were performed. Amino acids were raised to fed levels in the presence of either fasted or fed insulin concentrations; glucose was maintained at fasting throughout. Muscle protein synthesis was increased by pST treatment and by amino acids (with or without insulin) (P<0.001). In pST-treated pigs, fed, but not fasting, amino acid concentrations further increased muscle protein synthesis rates irrespective of insulin level (P<0.02). Fed amino acids, with or without raised insulin concentrations, increased the phosphorylation of S6 kinase (S6K1) and eukaryotic initiation factor (eIF) 4E-binding protein 1 (4EBP1), decreased inactive 4EBP1.eIF4E complex association, and increased active eIF4E.eIF4G complex formation (P<0.02). pST treatment did not alter translation initiation factor activation. We conclude that the pST-induced stimulation of muscle protein synthesis requires fed amino acid levels, but not fed insulin levels. However, under the current conditions, the response to amino acids is not mediated by the activation of translation initiation factors that regulate mRNA binding to the ribosomal complex.
Lindner, Scott E; Sartain, Mark J; Hayes, Kiera; Harupa, Anke; Moritz, Robert L; Kappe, Stefan H I; Vaughan, Ashley M
2014-02-01
Malaria parasites scavenge nutrients from their host but also harbour enzymatic pathways for de novo macromolecule synthesis. One such pathway is apicoplast-targeted type II fatty acid synthesis, which is essential for late liver-stage development in rodent malaria. It is likely that fatty acids synthesized in the apicoplast are ultimately incorporated into membrane phospholipids necessary for exoerythrocytic merozoite formation. We hypothesized that these synthesized fatty acids are being utilized for apicoplast-targeted phosphatidic acid synthesis, the phospholipid precursor. Phosphatidic acid is typically synthesized in a three-step reaction utilizing three enzymes: glycerol 3-phosphate dehydrogenase, glycerol 3-phosphate acyltransferase and lysophosphatidic acid acyltransferase. The Plasmodium genome is predicted to harbour genes for both apicoplast- and cytosol/endoplasmic reticulum-targeted phosphatidic acid synthesis. Our research shows that apicoplast-targeted Plasmodium yoelii glycerol 3-phosphate dehydrogenase and glycerol 3-phosphate acyltransferase are expressed only during liver-stage development and deletion of the encoding genes resulted in late liver-stage growth arrest and lack of merozoite differentiation. However, the predicted apicoplast-targeted lysophosphatidic acid acyltransferase gene was refractory to deletion and was expressed solely in the endoplasmic reticulum throughout the parasite life cycle. Our results suggest that P. yoelii has an incomplete apicoplast-targeted phosphatidic acid synthesis pathway that is essential for liver-stage maturation. © 2013 John Wiley & Sons Ltd.
Green synthesis of gold-chitosan nanocomposites for caffeic acid sensing.
Di Carlo, Gabriella; Curulli, Antonella; Toro, Roberta G; Bianchini, Chiara; De Caro, Tilde; Padeletti, Giuseppina; Zane, Daniela; Ingo, Gabriel M
2012-03-27
In this work, colloidal gold nanoparticles (AuNPs) stabilized into a chitosan matrix were prepared using a green route. The synthesis was carried out by reducing Au(III) to Au(0) in an aqueous solution of chitosan and different organic acids (i.e., acetic, malonic, or oxalic acid). We have demonstrated that by varying the nature of the acid it is possible to tune the reduction rate of the gold precursor (HAuCl(4)) and to modify the morphology of the resulting metal nanoparticles. The use of chitosan, a biocompatible and biodegradable polymer with a large number of amino and hydroxyl functional groups, enables the simultaneous synthesis and surface modification of AuNPs in one pot. Because of the excellent film-forming capability of this polymer, AuNPs-chitosan solutions were used to obtain hybrid nanocomposite films that combine highly conductive AuNPs with a large number of organic functional groups. Herein, Au-chitosan nanocomposites are successfully proposed as sensitive and selective electrochemical sensors for the determination of caffeic acid, an antioxidant that has recently attracted much attention because of its benefits to human health. A linear response was obtained over a wide range of concentration from 5.00 × 10(-8) M to 2.00 × 10(-3) M, and the limit of detection (LOD) was estimated to be 2.50 × 10(-8) M. Moreover, further analyses have demonstrated that a high selectivity toward caffeic acid can be achieved without interference from catechin or ascorbic acid (flavonoid and nonphenolic antioxidants, respectively). This novel synthesis approach and the high performances of Au-chitosan hybrid materials in the determination of caffeic acid open up new routes in the design of highly efficient sensors, which are of great interest for the analysis of complex matrices such as wine, soft drinks, and fruit beverages. © 2012 American Chemical Society
Synthesis of new Cα-tetrasubstituted α-amino acids
Grauer, Andreas A
2009-01-01
Summary Cα-Tetrasubstituted α-amino acids are important building blocks for the synthesis of peptidemimetics with stabilized secondary structure, because of their ability to rigidify the peptide backbone. Recently our group reported a new class of cyclic Cα-tetrasubstituted tetrahydrofuran α-amino acids prepared from methionine and aromatic aldehydes. We now report the extension of this methodology to aliphatic aldehydes. Although such aldehydes are prone to give aldol products under the reaction conditions used, we were able to obtain the target cyclic amino acids in low to moderate yields and in some cases with good diastereoselectivity. PMID:19259341
ERIC Educational Resources Information Center
Barrelle, M.; And Others
1983-01-01
Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)
Synthesis of Amino Acid Precursors with Organic Solids in Planetesimals with Liquid Water
NASA Technical Reports Server (NTRS)
Kebukawa, Y; Misawa, S.; Matsukuma, J.; Chan, Q. H. S.; Kobayashi, J.; Tachibana, S.; Zolensky, M. E.
2017-01-01
Amino acids are important ingredients of life that would have been delivered to Earth by extraterrestrial sources, e.g., comets and meteorites. Amino acids are found in aqueously altered carbonaceous chondrites in good part in the form of precursors that release amino acids after acid hydrolysis. Meanwhile, most of the organic carbon (greater than 70 weight %) in carbonaceous chondrites exists in the form of solvent insoluble organic matter (IOM) with complex macromolecular structures. Complex macromolecular organic matter can be produced by either photolysis of interstellar ices or aqueous chemistry in planetesimals. We focused on the synthesis of amino acids during aqueous alteration, and demonstrated one-pot synthesis of a complex suite of amino acids simultaneously with IOM via hydrothermal experiments simulating the aqueous processing
Dhar, Gautam; Sen, Suvajit; Chaudhuri, Gautam
2015-01-01
Aggressive cancers exhibit an efficient conversion of high amounts of glucose to lactate accompanied by acid secretion, a phenomenon popularly known as the Warburg effect. The acidic microenvironment and the alkaline cytosol create a proton-gradient (acid gradient) across the plasma membrane that represents proton-motive energy. Increasing experimental data from physiological relevant models suggest that acid gradient stimulates tumor proliferation, and can also support its energy needs. However, direct biochemical evidence linking extracellular acid gradient to generation of intracellular ATP are missing. In this work, we demonstrate that cancer cells can synthesize significant amounts of phosphate-bonds from phosphate in response to acid gradient across plasma membrane. The noted phenomenon exists in absence of glycolysis and mitochondrial ATP synthesis, and is unique to cancer. Biochemical assays using viable cancer cells, and purified plasma membrane vesicles utilizing radioactive phosphate, confirmed phosphate-bond synthesis from free phosphate (Pi), and also localization of this activity to the plasma membrane. In addition to ATP, predominant formation of pyrophosphate (PPi) from Pi was also observed when plasma membrane vesicles from cancer cells were subjected to trans-membrane acid gradient. Cancer cytosols were found capable of converting PPi to ATP, and also stimulate ATP synthesis from Pi from the vesicles. Acid gradient created through glucose metabolism by cancer cells, as observed in tumors, also proved critical for phosphate-bond synthesis. In brief, these observations reveal a role of acidic tumor milieu as a potential energy source and may offer a novel therapeutic target. PMID:25874623
Synthesis of novel acid electrolytes for phosphoric acid fuel cells
NASA Astrophysics Data System (ADS)
Adcock, James L.
1988-11-01
A 40 millimole per hour scale aerosol direct fluorination reactor was constructed. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4 methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy 1-propene, 18 grams of F-3-(2-methoxy.ethoxy) 1-propene, and 37 grams of F-3,3-dimethyl 1-butene. Eighteen grams of F-2,2-dimethyl 1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy 1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy) 1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other Gas Research Institute (GRI) contractors for synthesis of perfluorinated sulfur (VI) and phosphorous (V) acids.
Jin, Junfei; Lu, Zhongyang; Li, Yanchun; Cowart, L. Ashley; Lopes-Virella, Maria F.
2018-01-01
It is well known that saturated fatty acids (SFAs) and unsaturated fatty acid, in particular omega-3 polyunsaturated fatty acids (n-3 PUFAs), have different effects on inflammatory signaling: SFAs are pro-inflammatory but n-3 PUFAs have strong anti-inflammatory properties. We have reported that palmitic acid (PA), a saturated fatty acid, robustly amplifies lipopolysaccharide (LPS) signaling to upregulate proinflammatory gene expression in macrophages. We also reported that the increased production of ceramide (CER) via sphingomyelin (SM) hydrolysis and CER de novo synthesis plays a key role in the synergistic effect of LPS and PA on proinflammatory gene expression. However, it remains unclear if n-3 PUFAs are capable of antagonizing the synergistic effect of LPS and PA on gene expression and CER production. In this study, we employed the above macrophage culture system and lipidomical analysis to assess the effect of n-3 PUFAs on proinflammatory gene expression and CER production stimulated by LPS and PA. Results showed that DHA strongly inhibited the synergistic effect of LPS and PA on proinflammatory gene expression by targeting nuclear factor kappa B (NFκB)-dependent gene transcription. Results also showed that DHA inhibited the cooperative effect of LPS and PA on CER production by targeting CER de novo synthesis, but not SM hydrolysis. Furthermore, results showed that myriocin, a specific inhibitor of serine palmitoyltransferase, strongly inhibited both LPS-PA-stimulated CER synthesis and proinflammatory gene expression, indicating that CER synthesis is associated with proinflammatory gene expression and that inhibition of CER synthesis contributes to DHA-inhibited proinflammatory gene expression. Taken together, this study demonstrates that DHA antagonizes the boosting effect of PA on LPS signaling on proinflammatory gene expression by targeting both NFκB-dependent transcription and CER de novo synthesis in macrophages. PMID:29474492
Jin, Junfei; Lu, Zhongyang; Li, Yanchun; Cowart, L Ashley; Lopes-Virella, Maria F; Huang, Yan
2018-01-01
It is well known that saturated fatty acids (SFAs) and unsaturated fatty acid, in particular omega-3 polyunsaturated fatty acids (n-3 PUFAs), have different effects on inflammatory signaling: SFAs are pro-inflammatory but n-3 PUFAs have strong anti-inflammatory properties. We have reported that palmitic acid (PA), a saturated fatty acid, robustly amplifies lipopolysaccharide (LPS) signaling to upregulate proinflammatory gene expression in macrophages. We also reported that the increased production of ceramide (CER) via sphingomyelin (SM) hydrolysis and CER de novo synthesis plays a key role in the synergistic effect of LPS and PA on proinflammatory gene expression. However, it remains unclear if n-3 PUFAs are capable of antagonizing the synergistic effect of LPS and PA on gene expression and CER production. In this study, we employed the above macrophage culture system and lipidomical analysis to assess the effect of n-3 PUFAs on proinflammatory gene expression and CER production stimulated by LPS and PA. Results showed that DHA strongly inhibited the synergistic effect of LPS and PA on proinflammatory gene expression by targeting nuclear factor kappa B (NFκB)-dependent gene transcription. Results also showed that DHA inhibited the cooperative effect of LPS and PA on CER production by targeting CER de novo synthesis, but not SM hydrolysis. Furthermore, results showed that myriocin, a specific inhibitor of serine palmitoyltransferase, strongly inhibited both LPS-PA-stimulated CER synthesis and proinflammatory gene expression, indicating that CER synthesis is associated with proinflammatory gene expression and that inhibition of CER synthesis contributes to DHA-inhibited proinflammatory gene expression. Taken together, this study demonstrates that DHA antagonizes the boosting effect of PA on LPS signaling on proinflammatory gene expression by targeting both NFκB-dependent transcription and CER de novo synthesis in macrophages.
Creelman, R A; Zeevaart, J A
1985-01-01
Abscisic acid (ABA) accumulated in detached, wilted leaves of spinach (Spinacia oleracea L. cv Savoy Hybrid 612) and reached a maximum level within 3 to 4 hours. The increase in ABA over that found in detached turgid leaves was approximately 10-fold. The effects of water stress could be mimicked by the use of thin slices of spinach leaves incubated in the presence of 0.6 molar mannitol, a compound which causes plasmolysis (loss of turgor). About equal amounts of ABA were found both in the leaf slices and in detached leaves, whereas 2 to 4 times more ABA accumulated in the medium than in the slices. When spinach leaf slices were incubated with ethylene glycol, a compound which rapidly penetrates the cell membrane causing a decrease in the osmotic potential of the tissue and only transient loss of turgor, no ABA accumulated. Ethylene glycol was not inhibitory with respect to ABA accumulation. Spinach leaf slices incubated in both ethylene glycol and mannitol had ABA levels similar to those found when slices were incubated with mannitol alone. Increases similar to those found with mannitol also occurred when Aquacide III, a highly purified form of polyethylene glycol, was used. Aquacide III causes cytorrhysis, a situation similar to that found in wilted leaves. Thus, it appears that loss of turgor is essential for ABA accumulation.When spinach leaf slices were incubated with solutes which are supposed to disturb membrane integrity (KHSO(3), 2-propanol, or KCl) no increase in ABA was observed. These data indicate that, with respect to the accumulation of ABA, mannitol caused a physical stress (loss of turgor) rather than a chemical stress (membrane damage).
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chander, A.; Gullo, J.; Reicherter, J.
1987-05-01
Regulation of phosphatidylcholine (PC) synthesis in rat granular pneumocytes isolated by tryptic digestion of lungs and maintained in primary culture for 24 h was investigated by following effects of exogenous fatty acids on (/sup 3/H-methyl)choline incorporation into PC and disaturated PC (DSPC). At 0.1 mM choline, the rate of choline incorporation into PC and DSPC was 440 +/- and 380 +/- 50 pmol/h/ug Pi (mean +/- SE, n=3-5), respectively, and was linear for up to 3 h. PC synthesis was significantly increased by 0.1 mM each of palmitic, oleic, linoleic, or linolenic acid. However, synthesis of DSPC was increased onlymore » by palmitic acid and this increase was prevented by addition of oleic acid suggesting lack of effect on the remodeling pathway. Pulse-chase experiments with choline in absence or presence of palmitic or oleic acid showed that the label declined in choline phosphate and increased in PC more rapidly in presence of either of the fatty acids, suggesting rapid conversion of choline phosphate to PC. Microsomal choline phosphate cytidyltransferase activity in cells preincubated without or with palmitic acid for 3 h was 0.81 +/- 0.07 and 1.81 +/- 0.09 nmol choline phosphate converted/min/mg protein (n=4). These results suggest that in granular pneumocytes, exogenous fatty acids modulate PC synthesis by increasing choline phosphate cytidyltransferase activity.« less
Synthesis and antituberculosis activity of new fatty acid amides.
D'Oca, Caroline Da Ros Montes; Coelho, Tatiane; Marinho, Tamara Germani; Hack, Carolina Rosa Lopes; Duarte, Rodrigo da Costa; da Silva, Pedro Almeida; D'Oca, Marcelo Gonçalves Montes
2010-09-01
This work reports the synthesis of new fatty acid amides from C16:0, 18:0, 18:1, 18:1 (OH), and 18:2 fatty acids families with cyclic and acyclic amines and demonstrate for the first time the activity of these compounds as antituberculosis agents against Mycobacterium tuberculosis H(37)Rv, M. tuberculosis rifampicin resistance (ATCC 35338), and M. tuberculosis isoniazid resistance (ATCC 35822). The fatty acid amides derivate from ricinoleic acid were the most potent one among a series of tested compounds, with a MIC 6.25 microg/mL for resistance strains. Copyright 2010 Elsevier Ltd. All rights reserved.
Pulmonary fatty acid synthesis. I. Mitochondrial acetyl transfer by rat lung in vitro.
Evans, R M; Scholz, R W
1977-04-01
Incorporation of tritiated water into fatty acids by rat adipose tissue and lung tissue slices incubated with 5 mM glucose indicated a level of fatty acid synthesis in rat lung approximately 15% that observed in adipose tissue in vitro. (-)-Hydroxycitrate, and inhibitor of ATP citrate lyase, markedly reduced tritiated water incorporation into fatty acids by lung tissue slices. The effects of (-)-hydroxycitrate and n-butymalonate on the incorporation of 14C-labeled glucose, pyruvate, acetate, and citrate suggested that citrate is a major acetyl carrier for de novo fatty acid synthesis in lung tissue. Alternative mechanisms to citrate as an acetyl carrier were also considered. Lung mitochondrial preparations formed significant levels of acetylcarnitine in the presence of pyruvate and carnitine. However, the effect of carnitine on the incorporation of 14C-labeled glucose, pyruvate, acetate, and citrate into fatty acids by lung tissue slices indicated that acetylcarnitine may not be a significant acetyl carrier for fatty acid synthesis but may serve as an acetyl "buffer" in the control of mitochondrial acetyl-CoA levels. Additionally, it appears unlikely that either acetylaspartate or acetoacetate are of major importance in acetyl transfer in lung tissue.
Synthesis of the sulfur amino acids: cysteine and methionine.
Wirtz, Markus; Droux, Michel
2005-12-01
This review will assess new features reported for the molecular and biochemical aspects of cysteine and methionine biosynthesis in Arabidopsis thaliana with regards to early published data from other taxa including crop plants and bacteria (Escherichia coli as a model). By contrast to bacteria and fungi, plant cells present a complex organization, in which the sulfur network takes place in multiple sites. Particularly, the impact of sulfur amino-acid biosynthesis compartmentalization will be addressed in respect to localization of sulfur reduction. To this end, the review will focus on regulation of sulfate reduction by synthesis of cysteine through the cysteine synthase complex and the synthesis of methionine and its derivatives. Finally, regulatory aspects of sulfur amino-acid biosynthesis will be explored with regards to interlacing processes such as photosynthesis, carbon and nitrogen assimilation.
Fraga, Hugo Pacheco de Freitas; Vieira, Leila do Nascimento; Puttkammer, Catarina Corrêa; Dos Santos, Henrique Pessoa; Garighan, Julio de Andrade; Guerra, Miguel Pedro
2016-12-01
Here we propose a protocol for embryogenic cultures induction, proliferation and maturation for the Brazilian conifer Podocarpus lambertii, and investigated the effect of abscisic acid (ABA) and glutathione (GSH) supplementation on the maturation phase. ABA, zeatin (Z) and salicylic acid (SA) endogenous levels were quantified. Number of somatic embryos obtained in ABA-supplemented treatment was significant higher than in ABA-free treatment, showing the relevance of ABA supplementation during somatic embryos maturation. Histological analysis showed the stereotyped sequence of developmental stages in conifer somatic embryos, reaching the late torpedo-staged embryo. GSH supplementation in maturation culture medium improved the somatic embryos number and morphological features. GSH 0mM and GSH 0.1mM treatments correlated with a decreased ABA endogenous level during maturation, while GSH 0.5mM treatment showed constant levels. All treatments resulted in decreased Z endogenous levels, supporting the concept that cytokinins are important during the initial cell division but not for the later stages of embryo development. The lowest SA levels found in GSH 0.5mM treatment were coincident with early embryonic development, and this treatment resulted in the highest development of somatic embryos. Thus, a correlation between lower SA levels and improved somatic embryo formation can be hypothesized. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Peng, Yingyun; Zhang, Tao; Mu, Wanmeng; Miao, Ming; Jiang, Bo
2016-01-15
Bacillus methylotrophicus SK19.001 is a glutamate-independent strain that produces poly(γ-glutamic acid) (γ-PGA), a polymer of D- and L-glutamic acids that possesses applications in food, the environment, agriculture, etc. This study was undertaken to explore the synthetic pathway of intracellular L- and D-glutamic acid in SK19.001 by investigating the effects of tricarboxylic acid cycle intermediates and different amino acids as metabolic precursors on the production of γ-PGA and analyzing the activities of the enzymes involved in the synthesis of L- and D-glutamate. Tricarboxylic acid cycle intermediates and amino acids could participate in the synthesis of γ-PGA via independent pathways in SK19.001. L-Aspartate aminotransferase, L-glutaminase and L-glutamate synthase were the enzymatic sources of L-glutamate. Glutamate racemase was responsible for the formation of D-glutamate for the synthesis of γ-PGA, and the synthetase had stereoselectivity for glutamate substrate. The enzymatic sources of L-glutamate were investigated for the first time in the glutamate-independent γ-PGA-producing strain, and multiple enzymatic sources of L-glutamate were verified in SK19.001, which will benefit efforts to improve production of γ-PGA with metabolic engineering strategies. © 2015 Society of Chemical Industry.
Rowe, James H; Topping, Jennifer F; Liu, Junli; Lindsey, Keith
2016-07-01
Understanding the mechanisms regulating root development under drought conditions is an important question for plant biology and world agriculture. We examine the effect of osmotic stress on abscisic acid (ABA), cytokinin and ethylene responses and how they mediate auxin transport, distribution and root growth through effects on PIN proteins. We integrate experimental data to construct hormonal crosstalk networks to formulate a systems view of root growth regulation by multiple hormones. Experimental analysis shows: that ABA-dependent and ABA-independent stress responses increase under osmotic stress, but cytokinin responses are only slightly reduced; inhibition of root growth under osmotic stress does not require ethylene signalling, but auxin can rescue root growth and meristem size; osmotic stress modulates auxin transporter levels and localization, reducing root auxin concentrations; PIN1 levels are reduced under stress in an ABA-dependent manner, overriding ethylene effects; and the interplay among ABA, ethylene, cytokinin and auxin is tissue-specific, as evidenced by differential responses of PIN1 and PIN2 to osmotic stress. Combining experimental analysis with network construction reveals that ABA regulates root growth under osmotic stress conditions via an interacting hormonal network with cytokinin, ethylene and auxin. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.
Xu, Qianru; Pan, Wei; Zhang, Ranran; Lu, Qi; Xue, Wanlei; Wu, Cainan; Song, Bixiu; Du, Shaoting
2018-05-08
Cadmium (Cd) contamination of agricultural soils represents a serious risk to crop safety. A new strategy using abscisic acid (ABA)-generating bacteria, Bacillus subtilis or Azospirillum brasilense, was developed to reduce the Cd accumulation in plants grown in Cd-contaminated soil. Inoculation with either bacterium resulted in a pronounced increase in the ABA level in wild-type Arabidopsis Col-0 plants, accompanied by a decrease in Cd levels in plant tissues, which mitigated the Cd toxicity. As a consequence, the growth of plants exposed to Cd was improved. Nevertheless, B. subtilis and A. brasilense inoculation had little effect on Cd levels and toxicity in the ABA-insensitive mutant snrk 2.2/2.3, indicating that the action of ABA is required for these bacteria to reduce Cd accumulation in plants. Furthermore, inoculation with either B. subtilis or A. brasilense down-regulated the expression of IRT1 (IRON-REGULATED TRANSPORTER 1) in the roots of wild-type plants and had little effect on Cd levels in the IRT1-knockout mutants irt1-1 and irt1-2. In summary, we conclude that B. subtilis and A. brasilense can reduce Cd levels in plants via an IRT1-dependent ABA-mediated mechanism.
Daminato, Margherita; Guzzo, Flavia; Casadoro, Giorgio
2013-09-01
Strawberries (Fragaria×ananassa) are false fruits the ripening of which follows the non-climacteric pathway. The role played by a C-type MADS-box gene [SHATTERPROOF-like (FaSHP)] in the ripening of strawberries has been studied by transiently modifying gene expression through either over-expression or RNA-interference-mediated down-regulation. The altered expression of the FaSHP gene caused a change in the time taken by the over-expressing and the down- regulated fruits to attain the pink stage, which was slightly shorter and much longer, respectively, compared to controls. In parallel with the modified ripening times, the metabolome components and the expression of ripening-related genes also appeared different in the transiently modified fruits. Differences in the response time of the analysed genes suggest that FaSHP can control the expression of ripening genes either directly or indirectly through other transcription factor-encoding genes. Because fleshy strawberries are false fruits these results indicate that C-type MADS-box genes like SHATTERPROOF may act as modulators of ripening in fleshy fruit-like structures independently of their anatomical origin. Treatment of strawberries with either auxin or abscisic acid had antagonistic impacts on both the expression of FaSHP and the expression of ripening-related genes and metabolome components.
Kuromori, Takashi; Fujita, Miki; Urano, Kaoru; Tanabata, Takanari; Sugimoto, Eriko; Shinozaki, Kazuo
2016-10-01
In addition to improving drought tolerance, improvement of water use efficiency is a major challenge in plant physiology. Due to their trade-off relationships, it is generally considered that achieving stress tolerance is incompatible with maintaining stable growth. Abscisic acid (ABA) is a key phytohormone that regulates the balance between intrinsic growth and environmental responses. Previously, we identified AtABCG25 as a cell-membrane ABA transporter that export ABA from the inside to the outside of cells. AtABCG25-overexpressing plants showed a lower transpiration phenotype without any growth retardation. Here, we dissected this useful trait using precise phenotyping approaches. AtABCG25 overexpression stimulated a local ABA response in guard cells. Furthermore, AtABCG25 overexpression enhanced drought tolerance, probably resulting from maintenance of water contents over the common threshold for survival after drought stress treatment. Finally, we observed enhanced water use efficiency by overexpression of AtABCG25, in addition to drought tolerance. These results were consistent with the function of AtABCG25 as an ABA efflux transporter. This unique trait may be generally useful for improving the water use efficiency and drought tolerance of plants. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Synthesis of 6-phosphofructose aspartic acid and some related Amadori compounds.
Hansen, Alexandar L; Behrman, Edward J
2016-08-05
We describe the synthesis and characterization of 6-phosphofructose-aspartic acid, an intermediate in the metabolism of fructose-asparagine by Salmonella. We also report improved syntheses of fructose-asparagine itself and of fructose-aspartic acid. Copyright © 2016 Elsevier Ltd. All rights reserved.
Ng, Ley-Moy; Soon, Fen-Fen; Zhou, X. Edward; West, Graham M.; Kovach, Amanda; Suino-Powell, Kelly M.; Chalmers, Michael J.; Li, Jun; Yong, Eu-Leong; Zhu, Jian-Kang; Griffin, Patrick R.; Melcher, Karsten; Xu, H. Eric
2011-01-01
Abscisic acid (ABA) is an essential hormone that controls plant growth, development, and responses to abiotic stresses. Central for ABA signaling is the ABA-mediated autoactivation of three monomeric Snf1-related kinases (SnRK2.2, -2.3, and -2.6). In the absence of ABA, SnRK2s are kept in an inactive state by forming physical complexes with type 2C protein phosphatases (PP2Cs). Upon relief of this inhibition, SnRK2 kinases can autoactivate through unknown mechanisms. Here, we report the crystal structures of full-length Arabidopsis thaliana SnRK2.3 and SnRK2.6 at 1.9- and 2.3-Å resolution, respectively. The structures, in combination with biochemical studies, reveal a two-step mechanism of intramolecular kinase activation that resembles the intermolecular activation of cyclin-dependent kinases. First, release of inhibition by PP2C allows the SnRK2s to become partially active because of an intramolecular stabilization of the catalytic domain by a conserved helix in the kinase regulatory domain. This stabilization enables SnRK2s to gain full activity by activation loop autophosphorylation. Autophosphorylation is more efficient in SnRK2.6, which has higher stability than SnRK2.3 and has well-structured activation loop phosphate acceptor sites that are positioned next to the catalytic site. Together, these data provide a structural framework that links ABA-mediated release of PP2C inhibition to activation of SnRK2 kinases. PMID:22160701
Cao, Xueyuan; Costa, Liliana M; Biderre-Petit, Corinne; Kbhaya, Bouchab; Dey, Nrisingha; Perez, Pascual; McCarty, Donald R; Gutierrez-Marcos, Jose F; Becraft, Philip W
2007-02-01
Viviparous1 (Vp1) encodes a B3 domain-containing transcription factor that is a key regulator of seed maturation in maize (Zea mays). However, the mechanisms of Vp1 regulation are not well understood. To examine physiological factors that may regulate Vp1 expression, transcript levels were monitored in maturing embryos placed in culture under different conditions. Expression of Vp1 decreased after culture in hormone-free medium, but was induced by salinity or osmotic stress. Application of exogenous abscisic acid (ABA) also induced transcript levels within 1 h in a dose-dependent manner. The Vp1 promoter fused to beta-glucuronidase or green fluorescent protein reproduced the endogenous Vp1 expression patterns in transgenic maize plants and also revealed previously unknown expression domains of Vp1. The Vp1 promoter is active in the embryo and aleurone cells of developing seeds and, upon drought stress, was also found in phloem cells of vegetative tissues, including cobs, leaves, and stems. Sequence analysis of the Vp1 promoter identified a potential ABA-responsive complex, consisting of an ACGT-containing ABA response element (ABRE) and a coupling element 1-like motif. Electrophoretic mobility shift assay confirmed that the ABRE and putative coupling element 1 components specifically bound proteins in embryo nuclear protein extracts. Treatment of embryos in hormone-free Murashige and Skoog medium blocked the ABRE-protein interaction, whereas exogenous ABA or mannitol treatment restored this interaction. Our data support a model for a VP1-dependent positive feedback mechanism regulating Vp1 expression during seed maturation.
Guri, Amir J; Evans, Nicholas P; Hontecillas, Raquel; Bassaganya-Riera, Josep
2011-09-01
The phytohormone abscisic acid (ABA) has been shown to be effective in ameliorating chronic and acute inflammation. The objective of this study was to investigate whether ABA's anti-inflammatory efficacy in the gut is dependent on peroxisome proliferator-activated receptor γ (PPARγ) in T cells. PPARγ-expressing and T cell-specific PPARγ null mice were fed diets with or without ABA (100 mg/kg) for 35 days prior to challenge with 2.5% dextran sodium sulfate. The severity of clinical disease was assessed daily, and mice were euthanized on Day 7 of the dextran sodium sulfate challenge. Colonic inflammation was assessed through macroscopic and histopathological examination of inflammatory lesions and real-time quantitative RT-PCR-based quantification of inflammatory genes. Flow cytometry was used to phenotypically characterize leukocyte populations in the blood and mesenteric lymph nodes. Colonic sections were stained immunohistochemically to determine the effect of ABA on colonic regulatory T (T(reg)) cells. ABA's beneficial effects on disease activity were completely abrogated in T cell-specific PPARγ null mice. Additionally, ABA improved colon histopathology, reduced blood F4/80(+)CD11b(+) monocytes, increased the percentage of CD4(+) T cells expressing the inhibitory molecule cytotoxic T lymphocyte antigen 4 in blood and enhanced the number of T(reg) cells in the mesenteric lymph nodes and colons of PPARγ-expressing but not T cell-specific PPARγ null mice. We conclude that dietary ABA ameliorates experimental inflammatory bowel disease by enhancing T(reg) cell accumulation in the colonic lamina propria through a PPARγ-dependent mechanism. Copyright © 2011 Elsevier Inc. All rights reserved.
Stereoselective Synthesis of α-Amino-C-phosphinic Acids and Derivatives.
Viveros-Ceballos, José Luis; Ordóñez, Mario; Sayago, Francisco J; Cativiela, Carlos
2016-08-29
α-Amino-C-phosphinic acids and derivatives are an important group of compounds of synthetic and medicinal interest and particular attention has been dedicated to their stereoselective synthesis in recent years. Among these, phosphinic pseudopeptides have acquired pharmacological importance in influencing physiologic and pathologic processes, primarily acting as inhibitors for proteolytic enzymes where molecular stereochemistry has proven to be critical. This review summarizes the latest developments in the asymmetric synthesis of acyclic and phosphacyclic α-amino-C-phosphinic acids and derivatives, following in the first case an order according to the strategy used, whereas for cyclic compounds the nitrogen embedding in the heterocyclic core is considered. In addition selected examples of pharmacological implications of title compounds are also disclosed.
Jones, J A; Blecher, M
1966-05-01
The chemical synthesis and characterization of three intermediates in the Beta oxidation of palmitic acid-1-(14)C by rat liver mitochondria, namely, 3-ketohexadecanoic acid-1-(14)C, DL-3-hydroxyhexadecanoic acid-1-(14)C, and trans-2-hexadecenoic acid-1-(14)C, are described.
Tijero, Verónica; Teribia, Natalia; Muñoz, Paula; Munné-Bosch, Sergi
2016-01-01
Sweet cherry, a non-climacteric fruit, is usually cold-stored during post-harvest to prevent over-ripening. The aim of the study was to evaluate the role of abscisic acid (ABA) on fruit growth and ripening of this fruit, considering as well its putative implication in over-ripening and effects on quality. We measured the endogenous concentrations of ABA during the ripening of sweet cherries (Prunus avium L. var. Prime Giant) collected from orchard trees and in cherries exposed to 4°C and 23°C during 10 days of post-harvest. Furthermore, we examined to what extent endogenous ABA concentrations were related to quality parameters, such as fruit biomass, anthocyanin accumulation and levels of vitamins C and E. Endogenous concentrations of ABA in fruits increased progressively during fruit growth and ripening on the tree, to decrease later during post-harvest at 23°C. Cold treatment, however, increased ABA levels and led to an inhibition of over-ripening. Furthermore, ABA levels positively correlated with anthocyanin and vitamin E levels during pre-harvest, but not during post-harvest. We conclude that ABA plays a major role in sweet cherry development, stimulating its ripening process and positively influencing quality parameters during pre-harvest. The possible influence of ABA preventing over-ripening in cold-stored sweet cherries is also discussed. PMID:27200070
Lei, Gui Jie; Zhu, Xiao Fang; Wang, Zhi Wei; Dong, Fang; Dong, Ning Yu; Zheng, Shao Jian
2014-04-01
Abscisic acid (ABA) has been demonstrated to be involved in iron (Fe) homeostasis, but the underlying mechanism is largely unknown. Here, we found that Fe deficiency induced ABA accumulation rapidly (within 6 h) in the roots of Arabidopsis. Exogenous ABA at 0.5 μM decreased the amount of root apoplastic Fe bound to pectin and hemicellulose, and increased the shoot Fe content significantly, thus alleviating Fe deficiency-induced chlorosis. Exogenous ABA promoted the secretion of phenolics to release apoplastic Fe and up-regulated the expression of AtNRAMP3 to enhance reutilization of Fe stored in the vacuoles, leading to a higher level of soluble Fe and lower ferric-chelate reductase (FCR) activity in roots. Treatment with ABA also led to increased Fe concentrations in the xylem sap, partially because of the up-regulation of AtFRD3, AtYSL2 and AtNAS1, genes related to long-distance transport of Fe. Exogenous ABA could not alleviate the chlorosis of abi5 mutant resulting from the significantly low expression of AtYSL2 and low transport of Fe from root to shoot. Taken together, our data support the conclusion that ABA is involved in the reutilization and transport of Fe from root to shoot under Fe deficiency conditions in Arabidopsis. © 2013 John Wiley & Sons Ltd.
Guri, Amir J; Hontecillas, Raquel; Si, Hongwei; Liu, Dongmin; Bassaganya-Riera, Josep
2007-02-01
Despite their efficacy in improving insulin sensitivity, thiazolidinediones (TZDs) are associated with a number of side effects (i.e. weight gain, hepatotoxicity, congestive heart failure) that have limited their use by millions of diabetic patients. We have investigated whether abscisic acid (ABA), a naturally occurring phytochemical with structural similarities to TZDs, could be used as an alternative to TZDs to improve glucose homeostasis. We first examined whether ABA, similar to TZDs, activates PPARgamma in vitro. We next determined the lowest effective dose of dietary ABA (100 mg/kg) and assessed its effect on glucose tolerance, obesity-related inflammation, and mRNA expression of PPARgamma and its responsive genes in white adipose tissue (WAT) of db/db mice fed high-fat diets. We found that ABA induced transactivation of PPARgamma in 3T3-L1 pre-adipocytes in vitro. Dietary ABA-supplementation for 36 days decreased fasting blood glucose concentrations, ameliorated glucose tolerance, and increased mRNA expression of PPARgamma and its responsive genes (i.e., adiponectin, aP2, and CD36) in WAT. We also found that adipocyte hypertrophy, tumor necrosis factor-alpha (TNF-alpha) expression, and macrophage infiltration in WAT were significantly attenuated in ABA-fed mice. These findings suggest that ABA could be used as a nutritional intervention against type II diabetes and obesity-related inflammation.
Inhibition of Fatty Acid Synthesis Induces Apoptosis of Human Pancreatic Cancer Cells.
Nishi, Koji; Suzuki, Kenta; Sawamoto, Junpei; Tokizawa, Yuma; Iwase, Yumiko; Yumita, Nagahiko; Ikeda, Toshihiko
2016-09-01
Cancer cells tend to have a high requirement for lipids, including fatty acids, cholesterol and triglyceride, because of their rapid proliferative rate compared to normal cells. In this study, we investigated the effects of inhibition of lipid synthesis on the proliferation and viability of human pancreatic cancer cells. Of the inhibitors of lipid synthesis that were tested, 5-(tetradecyloxy)-2-furoic acid (TOFA), which is an inhibitor of acetyl-CoA carboxylase, and the fatty acid synthase (FAS) inhibitors cerulenin and irgasan, significantly suppressed the proliferation of MiaPaCa-2 and AsPC-1 cells. Treatment of MiaPaCa-2 cells with these inhibitors significantly increased the number of apoptotic cells. In addition, TOFA increased caspase-3 activity and induced cleavage of poly (ADP-ribose) polymerase in MiaPaCa-2 cells. Moreover, addition of palmitate to MiaPaCa-2 cells treated with TOFA rescued cells from apoptotic cell death. These results suggest that TOFA induces apoptosis via depletion of fatty acids and that, among the various aspects of lipid metabolism, inhibition of fatty acid synthesis may be a notable target for the treatment of human pancreatic cancer cells. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
Thalmann, Matthias; Pazmino, Diana; Seung, David; Horrer, Daniel; Nigro, Arianna; Meier, Tiago; Zeeman, Samuel C.; Santelia, Diana
2016-01-01
Starch serves functions that range over a timescale of minutes to years, according to the cell type from which it is derived. In guard cells, starch is rapidly mobilized by the synergistic action of β-AMYLASE1 (BAM1) and α-AMYLASE3 (AMY3) to promote stomatal opening. In the leaves, starch typically accumulates gradually during the day and is degraded at night by BAM3 to support heterotrophic metabolism. During osmotic stress, starch is degraded in the light by stress-activated BAM1 to release sugar and sugar-derived osmolytes. Here, we report that AMY3 is also involved in stress-induced starch degradation. Recently isolated Arabidopsis thaliana amy3 bam1 double mutants are hypersensitive to osmotic stress, showing impaired root growth. amy3 bam1 plants close their stomata under osmotic stress at similar rates as the wild type but fail to mobilize starch in the leaves. 14C labeling showed that amy3 bam1 plants have reduced carbon export to the root, affecting osmolyte accumulation and root growth during stress. Using genetic approaches, we further demonstrate that abscisic acid controls the activity of BAM1 and AMY3 in leaves under osmotic stress through the AREB/ABF-SnRK2 kinase-signaling pathway. We propose that differential regulation and isoform subfunctionalization define starch-adaptive plasticity, ensuring an optimal carbon supply for continued growth under an ever-changing environment. PMID:27436713
Effects of soil freezing and drought stress on abscisic acid content of sugar maple sap and leaves.
Bertrand, A; Robitaille, G; Nadeau, P; Boutin, R
1994-04-01
In 1991 and 1992, mature maple trees (Acer saccharum Marsh.) were freeze-stressed or drought-stressed by preventing precipitation (snow or rain) from reaching the forest floor under selected trees. Lack of snow cover caused a decrease in soil temperature to well below 0 degrees C from December to April and a lowering of the soil water content to 10%. The abscisic acid (ABA) concentration in the spring sap of deep-soil frost-stressed trees was significantly higher than in control or drought-stressed trees. The increase in ABA concentration in the xylem sap in the spring of 1991 and 1992 preceded symptoms of canopy decline and a decrease in leaf area that were observed during the summers of 1991 and 1992. These results suggest a role for ABA in root-to-shoot communication in response to environmental stress. The largest differences in ABA concentration induced by the treatments was found in sap collected at the end of sap flow. The increase in ABA concentration in spring sap at the end of the sap flow could be used as an early indicator of stress suffered by trees during the winter. Not only did the increase in ABA concentration occur before any visible symptoms of tree decline appeared, but the trees that showed the most evident decline had the highest ABA concentrations in the spring sap. Leaf ABA concentration was not a good indicator of induced stress.