Study of hopping type conduction from AC conductivity in multiferroic composite
NASA Astrophysics Data System (ADS)
Pandey, Rabichandra; Guha, Shampa; Pradhan, Lagen Kumar; Kumar, Sunil; Supriya, Sweety; Kar, Manoranjan
2018-05-01
0.5BiFe0.80Ti0.20O3-0.5Co0.5Ni0.5Fe2O4(BFTO-CNFO) multiferroic composite was prepared by planetary ball mill method. X-ray diffraction analysis confirms the formation of the compound with the simultaneous presence of spinel Co0.5Ni0.5Fe2O4 (CNFO) and perovskite BiFe0.80Ti0.20O3 (BFTO) phase. Temperature dependent dielectric permittivity and loss tangent were studied with a frequency range of 100Hz to 1MHz. AC conductivity study was performed to analyze the electrical conduction behaviour in the composite. Johnscher's power law was employed to the AC conductivity data to understand the hopping of localized charge carrier in the compound. The binding energy, minimum hopping distance and density of states of the charge carriers in the composite were evaluated from the AC conductivity data. Minimum hopping distance is found to be in order of Angstrom (Å).
AC and DC conductivity due to hopping mechanism in double ion doped ceramics
NASA Astrophysics Data System (ADS)
Rizwana, Mahboob, Syed; Sarah, P.
2018-04-01
Sr1-2xNaxNdxBi4Ti4O15 (x = 0.1, 0.2 and 0.4) system is prepared by sol gel method involving Pechini process of modified polymeric precursor method. Phase identification is done using X-ray diffraction. Conduction in prepared materials involves different mechanisms and is explained through detailed AC and DC conductivity studies. AC conductivity studies carried out on the samples at different frequencies and different temperatures gives more information about electrical transport. Exponents used in two term power relation helps us to understand the different hopping mechanism involved at low as well as high frequencies. Activation energies calculated from the Arrhenius plots are used to calculate activation energies at different temperatures and frequencies. Hopping frequency calculated from the measured data explains hopping of charge carriers at different temperatures. DC conductivity studies help us to know the role of oxygen vacancies in conduction.
AC conductivity and dielectric behavior of bulk Furfurylidenemalononitrile
NASA Astrophysics Data System (ADS)
El-Nahass, M. M.; Ali, H. A. M.
2012-06-01
AC conductivity and dielectric behavior for bulk Furfurylidenemalononitrile have been studied over a temperature range (293-333 K) and frequency range (50-5×106 Hz). The frequency dependence of ac conductivity, σac, has been investigated by the universal power law, σac(ω)=Aωs. The variation of the frequency exponent (s) with temperature was analyzed in terms of different conduction mechanisms, and it was found that the correlated barrier hopping (CBH) model is the predominant conduction mechanism. The temperature dependence of σac(ω) showed a linear increase with the increase in temperature at different frequencies. The ac activation energy was determined at different frequencies. Dielectric data were analyzed using complex permittivity and complex electric modulus for bulk Furfurylidenemalononitrile at various temperatures.
Purely hopping conduction in c-axis oriented LiNbO3 thin films
NASA Astrophysics Data System (ADS)
Shandilya, Swati; Tomar, Monika; Sreenivas, K.; Gupta, Vinay
2009-05-01
Dielectric constant and ac conductivity of highly c-axis oriented LiNbO3 thin film grown by pulsed laser deposition were studied in a metal-insulator-metal configuration over a wide temperature (200 to 450 K) and frequency (100 Hz to 1 MHz) range. The preferred oriented Al (1%) doped ZnO film with electrical conductivity 1.1×103 Ω-1 cm-1 was deposited for dual purpose: (1) to serve as nucleating center for LiNbO3 crystallites along preferred c-axis growth direction, and (2) to act as a suitable bottom electrode for electrical studies. The room temperature dc conductivity (σdc) of LiNbO3 film was about 5.34×10-10 Ω-1 cm-1 with activation energy ˜0.3 eV, indicating extrinsic conduction. The ac conductivity σac was found to be much higher in comparison to σdc in the low temperature region (<300 K) and exhibits a power law behavior due to the hopping of charge carriers. In higher temperature region (>300 K), σac shows a weak frequency dependence, whereas dielectric constant exhibits a strong frequency dispersion. The dielectric dispersion data has been discussed in the light of theoretical models based on Debye type mixed conduction and purely hopping conduction. The dominant conduction in c-axis oriented LiNbO3 thin film is attributed to the purely hopping where both σdc and σac arise due to same mechanism.
Dielectric and AC conductivity studies on SrBi4Ti4O15
NASA Astrophysics Data System (ADS)
Jose, Roshan; Saravanan, K. Venkata
2018-05-01
The four layered SrBi4Ti4O15 ceramics which belong to the aurivillius family of oxide was prepared by conventional solid state reaction technique. Analysis of the dielectric data as a function of temperature and frequency revealed normal phase transition. The frequency dependent ac conductivity follows Jonscher's universal power law. Frequency exponent (n), pre-exponential factor (A), bulk dc conductivity (σdc), and hopping frequency (ωp) were determined from the fitting curves. The variation of frequency exponent with temperature indicates that large polaron hopping mechanism up to curie-temperature, then its changes to small polaron hopping. The activation energies were calculated from ac conductivity, bulk dc conductivity and hopping frequency. The activation energies revealed that conductivity had contributions from migrations of oxygen vacancies, bismuth ion vacancies and strontium ion vacancies.
Polaron conductivity mechanism in oxalic acid dihydrate: ac conductivity experiment
NASA Astrophysics Data System (ADS)
Levstik, Adrijan; Filipič, Cene; Bobnar, Vid; Levstik, Iva; Hadži, Dušan
2006-10-01
The ac electrical conductivity of the oxalic acid dihydrate ( α -POX) was investigated as a function of the frequency and temperature. The real part of the complex ac electrical conductivity was found to follow the universal dielectric response σ'∝νs , indicating that hopping or tunneling of localized charge carriers governs the electrical transport. A detailed analysis of the temperature dependence of the exponent s revealed that in a broad temperature range 50-200K the tunneling of polarons is the dominating charge transport mechanism.
AC and DC conductivity study on Ca substituted bismuth ferrite
NASA Astrophysics Data System (ADS)
Pandey, Rabichandra; Pradhan, Lagen Kumar; Kumar, Sunil; Kar, Manoranjan
2018-05-01
Bi0.95Ca0.05FeO3 multiferroic compound was synthesized by the citric acid modified sol-gel method. Crystal structure of Bi0.95Ca0.05FeO3 is studied by the X-ray diffraction (XRD) technique. The ac impedance analysis of the compound has been carried out in a wide range of frequency (100 Hz - 1MHz) as well as temperature (40-2500C). Frequency variation of dielectric constant at different temperatures can be understood by the modified Debye formula. The activation energy was found to be 0.48eV, which was obtained by employing Arrhenius equation. The AC conductivity of the sample follows the Johnscher's power law which indicates the presence of hopping type conduction in localized charged states. To understand the conduction mechanism with localized charge states, the DC resistivity data were analyzed by Mott's variable range hopping (VRH) model. The activation energy calculated from Debye relaxation time, AC conductivity and DC resistivity are comparable to each other.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Khaldi, O.; Kassmi, M.; El Manar University, LMOP, 2092 Tunis
2014-08-28
Capacitance nonlinearities were studied in atomic layer deposited HfO{sub 2} films using two types of signals: a pure ac voltage of large magnitude (ac nonlinearities) and a small ac voltage superimposed to a large dc voltage (dc nonlinearities). In theory, ac and dc nonlinearities should be of the same order of magnitude. However, in practice, ac nonlinearities are found to be an order of magnitude higher than dc nonlinearities. Besides capacitance nonlinearities, hopping conduction is studied using low-frequency impedance measurements and is discussed through the correlated barrier hopping model. The link between hopping and nonlinearity is established. The ac nonlinearitiesmore » are ascribed to the polarization of isolated defect pairs, while dc nonlinearities are attributed to electrode polarization which originates from defect percolation paths. Both the ac and dc capacitance nonlinearities display an exponential variation with voltage, which results from field-induced lowering of the hopping barrier energy.« less
AC conductivity and Dielectric Study of Chalcogenide Glasses of Se-Te-Ge System
NASA Astrophysics Data System (ADS)
Salman, Fathy
2004-01-01
The ac conductivity and dielectric properties of glassy system SexTe79 - xGe21, with x = 11, 14, 17 at.%, has been studied at temperatures 300 to 450 K and over a wide range of frequencies (50 Hz to 500 kHz). Experimental results indicate that the ac conductivity and the dielectric constants depend on temperature, frequency and Se content. The conductivity as a function of frequency exhibited two components: dc conductivity s dc, and ac conductivity s ac, where s ac ˜ w s. The mechanism of ac conductivity can be reasonably interpreted in terms of the correlated barrier hopping model (CBH). The activation energies are estimated and discussed. The dependence of ac conductivity and dielectric constants on the Se content x can be interpreted as the effect of Se fraction on the positional disorder. The impedance plot at each temperature appeared as a semicircle passes through the origin. Each semicircle is represented by an equivalent circuit of parallel resistance Rb and capacitance Cb.
AC conductivity and dielectric properties of bulk tungsten trioxide (WO3)
NASA Astrophysics Data System (ADS)
El-Nahass, M. M.; Ali, H. A. M.; Saadeldin, M.; Zaghllol, M.
2012-11-01
AC conductivity and dielectric properties of tungsten trioxide (WO3) in a pellet form were studied in the frequency range from 42 Hz to 5 MHz with a variation of temperature in the range from 303 K to 463 K. AC conductivity, σac(ω) was found to be a function of ωs where ω is the angular frequency and s is the frequency exponent. The values of s were found to be less than unity and decrease with increasing temperature, which supports the correlated barrier hopping mechanism (CBH) as the dominant mechanism for the conduction in WO3. The dielectric constant (ε‧) and dielectric loss (ε″) were measured. The Cole-Cole diagram determined complex impedance for different temperatures.
Study of dielectric relaxation and AC conductivity of InP:S single crystal
NASA Astrophysics Data System (ADS)
El-Nahass, M. M.; Ali, H. A. M.; El-Shazly, E. A.
2012-07-01
The dielectric relaxation and AC conductivity of InP:S single crystal were studied in the frequency range from 100 to 5.25 × 105 Hz and in the temperature range from 296 to 455 K. The dependence of the dielectric constant (ɛ1) and the dielectric loss (ɛ2) on both frequency and temperature was investigated. Since no peak was observed on the dielectric loss, we used a method based on the electric modulus to evaluate the activation energy of the dielectric relaxation. Scaling of the electric modulus spectra showed that the charge transport dynamics is independent of temperature. The AC conductivity (σAC) was found to obey the power law: Aωs. Analysis of the AC conductivity data and the frequency exponent showed that the correlated barrier hopping (CBH) model is the dominant mechanism for the AC conduction. The variation of AC conductivity with temperature at different frequencies showed that σAC is a thermally activated process.
NASA Astrophysics Data System (ADS)
Essaleh, L.; Amhil, S.; Wasim, S. M.; Marín, G.; Choukri, E.; Hajji, L.
2018-05-01
In the present work, an attempt has been made to study theoretically and experimentally the AC electrical conduction mechanism in disordered semiconducting materials. The key parameter considered in this analysis is the frequency exponent s(ω , T) =( ∂ln(σAC(ω , T))/∂ ln(ω)T , where σAC is the AC electrical conductivity that depends on angular frequency ω and temperature T. In the theoretical part of this work, the effect of the barrier hopping energy, the polaron radius and the characteristic relaxation time is considered. The theoretical models of Quantum Mechanical Tunneling (QMT), Non overlapping Small Polaron Tunneling (NSPT), Overlapping Large Polaron Tunneling (OLPT) and Correlated Barrier Hopping (CBH) are considered to fit experimental data of σAC in p-CuIn3Se5 (p-CIS135) in the low temperature range up to 96 K. Some important parameters, as the polaron radius, the localization length and the barrier hopping energies, are estimated and their temperature and frequency dependence discussed.
AC conduction of Ba1-xCaxTiO3 and BZT-BCTx
NASA Astrophysics Data System (ADS)
Khien, Nguyen Van; Huy, Than Trong; Hong, Le Van
2018-03-01
Ba1-xCaxTiO3 (BCTx), (x =0.0-0.3) and Ba0.8Zr0.2TiO3-Ba1-xCaxTiO3 (BZT-BCTx), (x=0.15-0.35) were fabricated by the solid state reaction method. Phase structure of the material samples was identified by X-ray diffraction. The impedance versus frequency in a range of 100 Hz to 2.5 MHz was measured for all the samples at room temperature. AC conductivity versus frequency of the BCTx and BZT-BCTx was evaluated and fitted by using the extended Universal Dielectric Response (UDR) equations. The fitting results were discussed in detail and shown that the localized reorientation polarization-based mechanism is most contributed in BCTx matrial samples. Basically both two the hopping polaron and polarization mechanisms play roles in BZT-BCTx material samples. In contrary the short-range polaron hopping is dominated in ac conductivity of BZT-BCTx material samples in low frequency range.
ac conductivity in Gd doped Pb(Zr0.53Ti0.47)O3 ceramics
NASA Astrophysics Data System (ADS)
Portelles, J.; Almodovar, N. S.; Fuentes, J.; Raymond, O.; Heiras, J.; Siqueiros, J. M.
2008-10-01
This study is focused in the conduction processes taking place in 0.6 wt % Gd doped lead zirconate titanate samples PbZr0.53Ti0.47O3:Gd (PZT53/47:Gd) in the vicinity of the morphotropic phase boundary. Doped samples show very large dielectric permittivity with respect to that of undoped ones near the transition temperature. The frequency dependent ac conductivity of PZT53/47:Gd ceramics was studied in the 30-450 °C temperature range. X-ray diffraction analyses indicate the incorporation of Gd atoms to the structure. The changes in the dielectric properties as functions of temperature of the doped samples are taken as additional evidence of the incorporation of Gd into the crystal structure. Gd acts as donor center promoting extrinsic n-type conduction. The ac conductivity behavior obeys Jonscher universal relation in the 100 Hz-1 MHz frequency range for temperatures between 30 and 300 °C. The measured conductivity values for Gd doped PZT53/47 are higher than those of pure PZT53/47. According to the correlated barrier hopping model, the preponderant conduction mechanism in the frequency-temperature response was recognized as small polarons hopping mechanism.
Nerve Conduction Through Dendrites via Proton Hopping.
Kier, Lemont B
2017-01-01
In our previous studies of nerve conduction conducted by proton hopping, we have considered the axon, soma, synapse and the nodes of Ranvier. The role of proton hopping described the passage of information through each of these units of a typical nerve system. The synapse projects information from the axon to the dendrite and their associated spines. We have invoked the passage of protons via a hopping mechanism to illustrate the continuum of the impulse through the system, via the soma following the dendrites. This is proposed to be a continuum invoked by the proton hopping method. With the proposal of the activity through the dendrites, via proton hopping, a complete model of the nerve function is invoked. At each step to the way, a water pathway is present and is invoked in the proposed model as the carrier of the message via proton hopping. The importance of the dendrites is evident by the presence of a vast number of spines, each possessing the possibility to carry unique messages through the nervous system. With this model of the role of dendrites, functioning with the presence of proton hopping, a complete model of the nerve system is presented. The validity of this model will be available for further studies and models to assess it's validity. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
NASA Astrophysics Data System (ADS)
Ma, Song-Shan; Xu, Hui; Wang, Huan-You; Guo, Rui
2009-08-01
This paper presents a model to describe alternating current (AC) conductivity of DNA sequences, in which DNA is considered as a one-dimensional (1D) disordered system, and electrons transport via hopping between localized states. It finds that AC conductivity in DNA sequences increases as the frequency of the external electric field rises, and it takes the form of øac(ω) ~ ω2 ln2(1/ω). Also AC conductivity of DNA sequences increases with the increase of temperature, this phenomenon presents characteristics of weak temperature-dependence. Meanwhile, the AC conductivity in an off-diagonally correlated case is much larger than that in the uncorrelated case of the Anderson limit in low temperatures, which indicates that the off-diagonal correlations in DNA sequences have a great effect on the AC conductivity, while at high temperature the off-diagonal correlations no longer play a vital role in electric transport. In addition, the proportion of nucleotide pairs p also plays an important role in AC electron transport of DNA sequences. For p < 0.5, the conductivity of DNA sequence decreases with the increase of p, while for p >= 0.5, the conductivity increases with the increase of p.
NASA Astrophysics Data System (ADS)
El-Shabaan, M. M.
2018-02-01
Impedance spectroscopy and alternating-current (AC) conductivity (σ AC) studies of bulk 3-amino-7-(dimethylamino)-2-methyl-hydrochloride (neutral red, NR) have been carried out over the temperature (T) range from 303 K to 383 K and frequency (f) range from 0.5 kHz to 5 MHz. Dielectric data were analyzed using the complex impedance (Z *) and complex electric modulus (M *) for bulk NR at various temperatures. The impedance loss peaks were found to shift towards high frequencies, indicating an increase in the relaxation time (τ 0) and loss in the material, with increasing temperature. For each temperature, a single depressed semicircle was observed at high frequencies, originating from the bulk transport, and a spike in the low-frequency region, resulting from the electrode effect. Fitting of these curves yielded an equivalent circuit containing a parallel combination of a resistance R and constant-phase element (CPE) Q. The carrier transport in bulk NR is governed by the correlated barrier hopping (CBH) mechanism, some parameters of which, such as the maximum barrier height (W M), charge density (N), and hopping distance (r), were determined as functions of both temperature and frequency. The frequency dependence of σ AC at different temperatures indicated that the conduction in bulk NR is a thermally activated process. The σ AC value at different frequencies increased linearly with temperature.
NASA Astrophysics Data System (ADS)
Dutta, Rituraj; Kumar, A.
2017-10-01
Dielectric relaxation dynamics and AC conductivity scaling of a metal-organic framework (MOF-5) based poly (vinylidene fluoride-co-hexafluoropropylene) (PVdf-HFP) incorporated with 1-Butyl-3-methylimidazolium hexafluorophosphate have been studied over a frequency range of 40 Hz-5 MHz and in the temperature range of 300 K-380 K. High values of dielectric permittivity (~{{\\varepsilon }\\prime} ) having strong dispersion are obtained at low frequency because of interfacial polarization. The real part of the dielectric modulus spectra (M‧) shows no prominent peak, whereas the imaginary part (M″) shows certain peaks, with a reduction in relaxation time (τ) that can be attributed to a non-Debye relaxation mechanism. The spectra also depict both concentration- and temperature-independent scaling behavior. The power law dependent variation of AC conductivity follows the jump relaxation model and reveals activated ion hopping over diffusion barriers. The value of the frequency exponent is observed to decrease with increasing concentration of ionic liquid, indicating the forward hopping of ions in the relaxation process. The AC conductivity scaling curves at different temperatures also depict the temperature-independent relaxation dynamics.
NASA Astrophysics Data System (ADS)
El-Nahass, M. M.; Attia, A. A.; Ali, H. A. M.; Salem, G. F.; Ismail, M. I.
2018-02-01
The structural characteristics of thermally deposited ZnIn2Se4 thin films were indexed utilizing x-ray diffraction as well as scanning electron microscopy techniques. Dielectric properties, electric modulus and AC electrical conductivity of ZnIn2Se4 thin films were examined in the frequency range from 42 Hz to 106 Hz. The capacitance, conductance and impedance were measured at different temperatures. The dielectric constant and dielectric loss decrease with an increase in frequency. The maximum barrier height was determined from the analysis of the dielectric loss depending on the Giuntini model. The real part of the electric modulus revealed a constant maximum value at higher frequencies and the imaginary part of the electric modulus was characterized by the appearance of dielectric relaxation peaks. The AC electrical conductivity obeyed the Jonscher universal power law. Correlated barrier hopping model was the appropriate mechanism for AC conduction in ZnIn2Se4 thin films. Estimation of the density of states at the Fermi level and activation energy, for AC conduction, was carried out based on the temperature dependence of AC electrical conductivity.
Ac conductivity and dielectric properties of bulk tin phthalocyanine dichloride (SnPcCl 2)
NASA Astrophysics Data System (ADS)
El-Nahass, M. M.; Farid, A. M.; Abd El-Rahman, K. F.; Ali, H. A. M.
2008-07-01
The ac conductivity, σac( ω), has been measured for bulk tin phthalocyanine dichloride (SnPcCl 2) in the form of compressed pellet with evaporated ohmic Au electrodes in a temperature range 303-403 K. Ac conductivity, σac( ω), is found to vary as ωs in the frequency range 42 Hz-5×10 6 Hz. At low range of frequency, s<1 and it decreases with the increase in temperature indicating a dominant hopping process. At high range of frequency, s is found to be equal to ≈1.09 and is temperature independent. The dielectric constant, ε1, and dialectic loss, ε2, have been determined for bulk SnPcCl 2. Both ε1 and ε2 decrease with the increase in frequency and increase with the increase in temperature. The Cole-Cole types have been used to determine some parameters such as; the macroscopic relaxation time ( τo), the molecular relaxation time ( τ), the activation energy for relaxation ( Eo) and the distribution parameter ( α). The temperature dependence of τ is expressed by a thermally activated process with the activation energy of 0.299 eV.
Temperature-dependent ac conductivity and dielectric response of vanadium doped CaCu3Ti4O12 ceramic
NASA Astrophysics Data System (ADS)
Sen, A.; Maiti, U. N.; Thapa, R.; Chattopadhyay, K. K.
2011-09-01
Successful incorporation of vanadium dopant within the giant dielectric material CaCu 3Ti 4O12 (CCTO) through a conventional solid-state sintering process is achieved and its influence on the dielectric as well as electrical properties as a function of temperature and frequency is reported here. Proper crystalline phase formation together with dopant induced lattice constant shrinkage was confirmed through X-ray diffraction. The temperature dependence of the dielectric constant at different constant frequencies was investigated. We infer that the correlated barrier hopping (CBH) model is dominant in the conduction mechanism of the ceramic as per the temperature-dependent ac conductivity measurements. The electronic parameters such as density of the states at the Fermi level, N( E f) and hopping distance, R ω of the ceramic were also calculated using this model.
NASA Astrophysics Data System (ADS)
Amrin, Sayed; Deshpande, V. D.
2017-03-01
We study the dielectric relaxation and ac conductivity behavior of MWCNT-COOH/Polyvinyl alcohol nanocomposite films in the temperature (T) range 303-423 K and in the frequency (f) range 0.1 Hz-1 MHz. The dielectric constant increases with an increase in temperature and also with an increase in MWCNT-COOH loading into the polymer matrix, as a result of interfacial polarization. The permittivity data were found to fit well with the modified Cole-Cole equation. Temperature dependent values of the relaxation times, free charge carrier conductivity and space charge carrier conductivity were extracted from the equation. An observed increment in the ac conductivity for the nanocomposites was analysed by a Jonscher power law which suggests that the correlated barrier hopping is the dominant charge transport mechanism for the nanocomposite films. The electric modulus study revealed deviations from ideal Debye-type behavior which are explained by considering a generalized susceptibility function. XRD and DSC results show an increase in the degree of crystallinity.
NASA Astrophysics Data System (ADS)
Gupta, Surbhi; Deshpande, S. K.; Sathe, V. G.; Siruguri, V.
2018-04-01
We present dielectric, complex impedance, modulus spectroscopy and AC conductivity studies of the compound BaFe10Sc2O19 as a function of temperature and frequency to understand the conduction mechanism. The variation in complex dielectric constant with frequency and temperature were analyzed on the basis of Maxwell-Wagner-Koop's theory and charge hopping between ferrous and ferric ions. The complex impedance spectroscopy study shows only grain contribution whereas complex modulus plot shows two semicircular arcs which indicate both grain and grain boundary contributions in conduction mechanism. AC conductivity has also been evaluated which follows the Jonscher's law. The activation energy calculated from temperature dependence of DC conductivity comes out to be Ea˜ 0.31eV.
NASA Astrophysics Data System (ADS)
Sinha, Subhojyoti; Kumar Chatterjee, Sanat; Ghosh, Jiten; Kumar Meikap, Ajit
2013-03-01
We have used Rietveld refinement technique to extract the microstructural parameters of thioglycolic acid capped CdSe quantum dots. The quantum dot formation and its efficient capping are further confirmed by HR-TEM, UV-visible and FT-IR spectroscopy. Comparative study of the variation of dc conductivity with temperature (298 K ≤ T ≤ 460 K) is given considering Arrhenius formalism, small polaron hopping and Schnakenberg model. We observe that only Schnakenberg model provides good fit to the non-linear region of the variation of dc conductivity with temperature. Experimental variation of ac conductivity and dielectric parameters with temperature (298 K ≤ T ≤ 460 K) and frequency (80 Hz ≤ f ≤ 2 MHz) are discussed in the light of hopping theory and quantum confinement effect. We have elucidated the observed non-linearity in the I-V curves (measured within ±50 V), at dark and at ambient light, in view of tunneling mechanism. Tunnel exponents and non-linearity weight factors have also been evaluated in this regard.
Unique dielectric dipole and hopping ion dipole relaxation in disordered systems
NASA Astrophysics Data System (ADS)
Govindaraj, G.
2018-04-01
Dielectric or ac conductivity measurements of dielectric and ion conducting glass and crystalline systems provide considerable insight into the nature of the dipolar and ionic motions in disordered solids. However, interpreting the dielectric or ac conductivity has been a matter of considerable debate based on the existing models and empirical formalism, particularly in regards to how best to represent the relaxation process that is the result of a transition from correlated to uncorrelated dipolar and ionic motions. A unique dipole interaction process has been proposed for the (a) dielectric dipole process (b) the hopping ion conducting dipole process and the (c) combination (a) and (b) for the description of dielectric spectra and ac conductivityspectra and results are reported.
Dielectric and ac ionic conductivity investigation of Li2SrP2O7
NASA Astrophysics Data System (ADS)
Ajili, O.; Louati, B.; Guidara, K.
2018-07-01
The pyrophosphate Li2SrP2O7 compound has been synthesized by the classic ceramic method and characterized by X-ray diffraction, IR, Raman and electrical impedance spectroscopy. Detailed electrical properties of the compound were analyzed as a function of frequency (209 Hz-1 MHz) and temperature (519-628) K. Impedance analysis exhibits the grain and grain boundary contribution to the electrical response of the sample. The temperature dependence of these contribution obey the Arrhenius law with activation energies (1.03 ± 0.05) and (1.25 ± 0.05) eV, respectively. The ac conductivity for grain contribution was interpreted using the universal Jonscher's power law. The temperature dependence of frequency exponent s was investigated to understand the conduction mechanism. The correlated barrier hopping model was found to be the best model describing the conduction mechanism.
Dielectric and ac ionic conductivity investigation of Li2SrP2O7
NASA Astrophysics Data System (ADS)
Ajili, O.; Louati, B.; Guidara, K.
2018-02-01
The pyrophosphate Li2SrP2O7 compound has been synthesized by the classic ceramic method and characterized by X-ray diffraction, IR, Raman and electrical impedance spectroscopy. Detailed electrical properties of the compound were analyzed as a function of frequency (209 Hz-1 MHz) and temperature (519-628) K. Impedance analysis exhibits the grain and grain boundary contribution to the electrical response of the sample. The temperature dependence of these contribution obey the Arrhenius law with activation energies (1.03 ± 0.05) and (1.25 ± 0.05) eV, respectively. The ac conductivity for grain contribution was interpreted using the universal Jonscher's power law. The temperature dependence of frequency exponent s was investigated to understand the conduction mechanism. The correlated barrier hopping model was found to be the best model describing the conduction mechanism.
NASA Astrophysics Data System (ADS)
El-Bashir, S. M.; Alwadai, N. M.; AlZayed, N.
2018-02-01
Polymer nanocomposite films were prepared by doping fullerene C60 in polymer blend composed of polymethacrylate/polyvinyl acetate blends (PMMA/PVAc) using solution cast technique. The films were characterized by differential scanning calorimeter (DSC), Transmission electron microscope (TEM), DC/AC electrical conductivity and dielectric measurements in the frequency range (100 Hz- 1 MHz). The glass transition temperature, Tg, was increased by increasing the concentration of fullerene C60; this property reflects the increase of thermal stability by increasing the nanofiller content. The DC and AC electrical conductivities were enhanced by increasing C60 concentration due to the electron hopping or tunneling between filled and empty localized states above Tg. The relaxation time was determined from the αβ -relaxations and found to be attenuated by increasing the temperature as a typical behavior of amorphous polymers. The calculated values of thermodynamic parameters revealed the increase of molecular stability by increasing the doping concentration; this feature supports the application of PMMA/PVAc/C60 nanocomposite films in a wide scale of solar energy conversion applications such as luminescent down-shifting (LDS) coatings for photovoltaic cells.
NASA Astrophysics Data System (ADS)
Qashou, Saleem I.; Darwish, A. A. A.; Rashad, M.; Khattari, Z.
2017-11-01
Both Alternating current (AC) conductivity and dielectric behavior of n-type organic thin films of N, N‧-Dimethyl-3,4,9,10-perylenedicarboximide (DMPDC) have been investigated. Fourier transformation infrared (FTIR) spectroscopy is used for identifying both powder and film bonds which confirm that there are no observed changes in the bonds between the DMPDC powder and evaporated films. The dependence of AC conductivity on the temperature for DMPDC evaporated films was explained by the correlated barrier hopping (CBH) model. The calculated barrier height using CBH model shows a decreasing behavior with increasing temperature. The mechanism of dielectric relaxation was interpreted on the basis of the modulus of the complex dielectric. The calculated activation energy of the relaxation process was found to be 0.055 eV.
Unified conduction mechanism in unconventional VZnCaFeO glasses
NASA Astrophysics Data System (ADS)
Ahmed, E. M.; Abdel-Wahab, F.
2014-09-01
Unconventional glasses with (70-x)%V2O5 - x%ZnO-10%CaO-20%FeO compositions (where x=0, 2.5, 5, 7.5, 10, 12.5 and 15 mol %) were prepared by a normal melt-quench technique. We investigated the DC and AC conductivities of these glasses as functions of temperature and frequency. We have noted that activation energy and pre-exponential factor of the DC conductivity both vary with composition and satisfy Meyer-Neldel rule (MNR). The AC conductivity exhibited a universal dynamic response: σAC=Aωs. The obtained results of the DC, AC and exponent factor S were discussed in terms of the modified correlated barrier hopping model, which assumes that the relaxation time should contain a Meyer-Neldel rule term. An agreement between experimental and theoretical results suggests that the conduction mechanism could be hopping of polarons over barriers.
Field-dependent hopping conduction
NASA Astrophysics Data System (ADS)
Hayashi, T.; Tokura, Y.; Fujiwara, A.
2018-07-01
We have numerically calculated transport characteristics on a Miller-Abraham network in a non-linear regime by solving the Kirchhoff's current law at each site. Assuming the Mott model, we obtained the relation between current density and electric field, J ∝exp(γ√{ E}) , which has often been observed in low-mobility materials and whose mechanism has been a source of controversy for over half a century. Our numerical calculation makes it possible to analyze the energy configuration of relevant hopping sites and visualize percolation networks. Following the percolation theory proposed by Shklovskii [Shklovskii, Sov. Phys. Semicond. 10, 855 (1976)], we show that the main mechanism of the field dependence is the replacement of dominating resistances accompanied by the geometrical evolution of the percolation networks. Our calculation is so general that it can be applied to hopping transport in a variety of systems.
NASA Astrophysics Data System (ADS)
Gmati, Fethi; Fattoum, Arbi; Bohli, Nadra; Dhaoui, Wadia; Belhadj Mohamed, Abdellatif
2007-08-01
We report the results of studies on two series of polyaniline (PANI), doped with dichloroacetic (DCA) and trichloroacetic (TCA) acids, respectively, at various doping rates and obtained by the in situ polymerization method. Samples were characterized by x-ray diffraction, scanning electron microscopy and conductivity measurements. The direct current (dc) and alternating current (ac) electrical conductivities of PANI salts have been investigated in the temperature range 100-310 K and frequency range 7-106 Hz. The results of this study indicate better chain ordering and higher conductivity for PANI doped with TCA. The dc conductivity of all samples is suitably fitted to Mott's three-dimensional variable-range hopping (VRH) model. Different Mott parameters such as characteristic temperature T0, density of states at the Fermi level (N(EF)), average hopping energy (W) and the average hopping distance (R) have been evaluated. The dependence of such values on the dopant acid used is discussed. At high frequencies, the ac conductivity follows the power law σac(ω,T) = A(T)ωs(T,ω), which is characteristic for charge transport in disordered materials by hopping or tunnelling processes. The observed increase in the frequency exponent s with temperature suggests that the small-polaron tunnelling model best describes the dominant ac conduction mechanism. A direct correlation between conductivity, structure and morphology was obtained in our systems.
Atomistic interpretation of the ac-dc crossover frequency in crystalline and glassy ionic conductors
NASA Astrophysics Data System (ADS)
Marple, M. A. T.; Avila-Paredes, H.; Kim, S.; Sen, S.
2018-05-01
A comprehensive analysis of the ionic dynamics in a wide variety of crystalline and glassy ionic conductors, obtained in recent studies using a combination of electrochemical impedance and nuclear magnetic resonance spectroscopic techniques, is presented. These results demonstrate that the crossover frequency, between the frequency-independent dc conductivity and the frequency-dependent ac conductivity, corresponds to the time scale of "successful" diffusive hops of the mobile ions between the trapping sites in the structure. These inter-site hops are typically compound in nature and consist of several elementary hops in the intervening region between the neighboring trapping sites.
Marple, M A T; Avila-Paredes, H; Kim, S; Sen, S
2018-05-28
A comprehensive analysis of the ionic dynamics in a wide variety of crystalline and glassy ionic conductors, obtained in recent studies using a combination of electrochemical impedance and nuclear magnetic resonance spectroscopic techniques, is presented. These results demonstrate that the crossover frequency, between the frequency-independent dc conductivity and the frequency-dependent ac conductivity, corresponds to the time scale of "successful" diffusive hops of the mobile ions between the trapping sites in the structure. These inter-site hops are typically compound in nature and consist of several elementary hops in the intervening region between the neighboring trapping sites.
NASA Astrophysics Data System (ADS)
Anjali; Patial, Balbir Singh; Bhardwaj, Suresh; Awasthi, A. M.; Thakur, Nagesh
2017-10-01
In-depth analysis of complex AC-conductivity for nano-crystalline Se79-xTe15In6Pbx (x = 0, 1, 2, 4, 6, 8 and 10 at wt%) alloys is made in the temperature range 308-423 K and over the frequency range 10-1-107 Hz, to understand the conduction mechanism. The investigated nano-crystalline alloys were prepared by melt-quench technique. Sharp structural peaks in X-ray diffraction pattern indicate the nano-crystalline nature, which is also confirmed by FESEM. The AC conductivity shows universal characteristics and at higher frequency a transition from dc to dispersive behavior occurs. Moreover, it is confirmed that ac conductivity (σac) obeys the Jonscher power law as ωs (s< 1). The obtained results are analyzed in the light of various theoretical models. The correlated barrier hopping (CBH) model associated with non-intimate valence alternation pairs (NVAP's) is found most appropriate to describe the conduction mechanisms in these alloys. In addition, the CBH model description reveals that the bipolaron (single polaron) transport dominates at lower (higher) temperature. The density of localized states has also been deduced.
Conduction mechanism in bismuth silicate glasses containing titanium
NASA Astrophysics Data System (ADS)
Dult, Meenakshi; Kundu, R. S.; Murugavel, S.; Punia, R.; Kishore, N.
2014-11-01
Bismuth silicate glasses mixed with different concentrations of titanium dioxide having compositions xTiO2-(60-x)Bi2O3-40SiO2 with x=0, 5, 10, 15 and 20 were prepared by the normal melt quench technique. The frequency dependence of the ac electrical conductivity of different compositions of titanium bismuth silicate glasses has been studied in the frequency range 10-1 Hz to 10 MHz and in the temperature range 623-703 K. The temperature and frequency dependent conductivity is found to obey Jonscher's universal power law for all the compositions of titanium bismuth silicate glass system. The dc conductivity (σdc), so called crossover frequency (ωH), and frequency exponent (s) have been estimated from the fitting of experimental data of ac conductivity with Jonscher's universal power law. Enthalpy to dissociate the cation from its original site next to a charge compensating center (Hf) and enthalpy of migration (Hm) have also been estimated. The conductivity data have been analyzed in terms of different theoretical models to determine the possible conduction mechanism. Analysis of the conductivity data and the frequency exponent shows that the correlated barrier hopping of electrons between Ti3+ and Ti4+ ions in the glasses is the most favorable mechanism for ac conduction. The temperature dependent dc conductivity has been analyzed in the framework of theoretical variable range hopping model (VRH) proposed by Mott which describe the hopping conduction in disordered semiconducting systems. The various polaron hopping parameters have also been deduced. Mott's VRH model is found to be in good agreement with experimental data and the values of inverse localization length of s-like wave function (α) obtained by this model with modifications suggested by Punia et al. are close to the ones reported for a number of oxide glasses.
The crossover between tunnel and hopping conductivity in granulated films of noble metals
NASA Astrophysics Data System (ADS)
Kavokin, Alexey; Kutrovskaya, Stella; Kucherik, Alexey; Osipov, Anton; Vartanyan, Tigran; Arakelyan, Sergey
2017-11-01
The conductivity of thin films composed by clusters of gold and silver nanoparticles has been studies in a wide range of temperatures. The switch from a temperature independence to an exponential thermal dependence of the conductivity manifests the crossover between the tunnel and thermally activated hopping regimes of the electronic transport at the temperature of 60 °C. The characteristic thermal activation energy that governs hopping of electrons between nanoparticles is estimated as 1.3 eV. We have achieved a good control of the composition and thicknesses of nano-cluster films by use of the laser ablation method in colloidal solutions.
Kim, Hyehwang; Segal, Dvira
2017-04-28
The electrical conductance of molecular junctions may depend strongly on the temperature and weakly on molecular length, under two distinct mechanisms: phase-coherent resonant conduction, with charges proceeding via delocalized molecular orbitals, and incoherent thermally assisted multi-step hopping. While in the case of coherent conduction, the temperature dependence arises from the broadening of the Fermi distribution in the metal electrodes, in the latter case it corresponds to electron-vibration interaction effects on the junction. With the objective to distill the thermally activated hopping component, thus exposing intrinsic electron-vibration interaction phenomena on the junction, we suggest the design of molecular junctions with "spacers," extended anchoring groups that act to filter out phase-coherent resonant electrons. Specifically, we study the electrical conductance of fixed-gap and variable-gap junctions that include a tunneling block, with spacers at the boundaries. Using numerical simulations and analytical considerations, we demonstrate that in our design, resonant conduction is suppressed. As a result, the electrical conductance is dominated by two (rather than three) mechanisms: superexchange (deep tunneling) and multi-step thermally induced hopping. We further exemplify our analysis on DNA junctions with an A:T block serving as a tunneling barrier. Here, we show that the electrical conductance is insensitive to the number of G:C base-pairs at the boundaries. This indicates that the tunneling-to-hopping crossover revealed in such sequences truly corresponds to the properties of the A:T barrier.
AC conductivity of a quantum Hall line junction
NASA Astrophysics Data System (ADS)
Agarwal, Amit; Sen, Diptiman
2009-09-01
We present a microscopic model for calculating the AC conductivity of a finite length line junction made up of two counter- or co-propagating single mode quantum Hall edges with possibly different filling fractions. The effect of density-density interactions and a local tunneling conductance (σ) between the two edges is considered. Assuming that σ is independent of the frequency ω, we derive expressions for the AC conductivity as a function of ω, the length of the line junction and other parameters of the system. We reproduce the results of Sen and Agarwal (2008 Phys. Rev. B 78 085430) in the DC limit (\\omega \\to 0 ), and generalize those results for an interacting system. As a function of ω, the AC conductivity shows significant oscillations if σ is small; the oscillations become less prominent as σ increases. A renormalization group analysis shows that the system may be in a metallic or an insulating phase depending on the strength of the interactions. We discuss the experimental implications of this for the behavior of the AC conductivity at low temperatures.
Electrical conductivity and dielectric properties of TlInS2 single crystals
NASA Astrophysics Data System (ADS)
El-Nahass, M. M.; Youssef, S. B.; Ali, H. A. M.; Hassan, A.
2011-07-01
TlInS2 single crystals were grown by using Bridgman-Stockbauer technique. Measurements of DC conductivity were carried out in parallel (σ//) and perpendicular (σ⊥) directions to the c-axis over a temperature range from 303 to 463 K. The anisotropic behaviour of the electrical conductivity was also detected. AC conductivity and dielectric measurements were studied as a function of both frequency (102-106 Hz) and temperature (297-375 K). The frequency dependence of the AC conductivity revealed that σac(ω) obeys the universal law: σac(ω) = Aωs. The mechanism of the ac charge transport across the layers of TlInS2 single crystals was referred to the hopping over localized states near the Fermi level in the frequency range >3.5 × 103 Hz. The temperature dependence of σac(ω) for TlInS2 showed that σac is thermally activated process. Both of ɛ1 and ɛ2 decrease by increasing frequency and increase by increasing temperature. Some parameters were calculated as: the density of localized states near the Fermi level NF = 1.5 × 1020 eV-1 cm-3, the average time of charge carrier hoping between localized states τ = 3.79 μs and the average hopping distance R = 6.07 nm.
Hopping Conduction in Polymers
NASA Astrophysics Data System (ADS)
Bässler, Heinz
The concept of hopping within a Gaussian density of localized states introduced earlier to rationalize charge transport in random organic photoconductors is developed further to account for temporal features of time of flight (TOF) signals. At moderate degree of energetic disorder (σ/kT~3.5…4.5) there is a transport regime intermediate between dispersive and quasi-Gaussian type whose signatures are (i) universal TOF signals that can appear weakly dispersive despite yielding a well defined carrier mobility and (ii) an asymmetric propagator of the carrier packet yielding a time dependent diffusivity.
Nanoscale live cell imaging using hopping probe ion conductance microscopy
Novak, Pavel; Li, Chao; Shevchuk, Andrew I.; Stepanyan, Ruben; Caldwell, Matthew; Hughes, Simon; Smart, Trevor G.; Gorelik, Julia; Ostanin, Victor P.; Lab, Max J.; Moss, Guy W. J.; Frolenkov, Gregory I.; Klenerman, David; Korchev, Yuri E.
2009-01-01
We describe a major advance in scanning ion conductance microscopy: a new hopping mode that allows non-contact imaging of the complex surfaces of live cells with resolution better than 20 nm. The effectiveness of this novel technique was demonstrated by imaging networks of cultured rat hippocampal neurons and mechanosensory stereocilia of mouse cochlear hair cells. The technique allows studying nanoscale phenomena on the surface of live cells under physiological conditions. PMID:19252505
AC Conductivity and Dielectric Properties of Borotellurite Glass
NASA Astrophysics Data System (ADS)
Taha, T. A.; Azab, A. A.
2016-10-01
Borotellurite glasses with formula 60B2O3-10ZnO-(30 - x)NaF- xTeO2 ( x = 0 mol.%, 5 mol.%, 10 mol.%, and 15 mol.%) have been synthesized by thermal melting. X-ray diffraction (XRD) analysis confirmed that the glasses were amorphous. The glass density ( ρ) was determined by the Archimedes method at room temperature. The density ( ρ) and molar volume ( V m) were found to increase with increasing TeO2 content. The direct-current (DC) conductivity was measured in the temperature range from 473 K to 623 K, in which the electrical activation energy of ionic conduction increased from 0.27 eV to 0.48 eV with increasing TeO2 content from 0 mol.% to 15 mol.%. The dielectric parameters and alternating-current (AC) conductivity ( σ ac) were investigated in the frequency range from 1 kHz to 1 MHz and temperature range from 300 K to 633 K. The AC conductivity and dielectric constant decreased with increasing TeO2 content from 0 mol.% to 15 mol.%.
DC and AC conductivity properties of bovine dentine hydroxyapatite (BDHA)
NASA Astrophysics Data System (ADS)
Dumludag, F.; Gunduz, O.; Kılıc, O.; Ekren, N.; Kalkandelen, C.; Ozbek, B.; Oktar, F. N.
2017-12-01
Bovine dentine bio-waste may be used as a potential natural source of hydroxyapatite (BDHA), thus extraction of bovine dentin hydroxyapatite (BDHA) from bio-waste is significantly important to fabricate in a simple, economically and environmentally preferable. DC and AC conductivity properties of BDHA were investigated depending on sintering temperature (1000ºC - 1300°C) in air and vacuum (<10-2 mbar) ambient at room temperature. DC conductivity measurements performed between -1 and 1 V. AC conductivity measurements performed in the frequency range of 40 Hz - 100 kHz. DC conductivity results showed that dc conductivity values of the BDHA decrease with increasing sintering temperature in air ambient. It is not observed remarkable/systematic behavior for ac conductivity depending on sintering temperature.
NASA Astrophysics Data System (ADS)
Hazarika, J.; Kumar, A.
2016-12-01
Polypyrrole (PPy) nanofibers have been synthesized by interfacial polymerization method and irradiated with 160 MeV Ni12+ ions under vacuum with fluences in the range of 1010-1012 ions/cm2. High-resolution transmission electron microscopy results show that upon swift heavy ion (SHI) irradiation the PPy nanofibers become denser. The crystallinity of PPy nanofibers increases upon SHI irradiation, while their d-spacing decreases. Upon SHI irradiation, the polaron absorption band gets red-shifted indicating reduction in the optical band gap energy of the irradiated PPy nanofibers. The indirect optical band gap energy is decreased as compared to corresponding direct optical band gap energy. The number of carbon atoms per conjugation length (N) and carbon atoms per cluster (M) of the SHI-irradiated PPy nanofibers increase with increasing the irradiation fluence. Fourier transform infrared spectra reveal the enhancement in intensity of some characteristic vibration bands upon SHI irradiation. The thermal stability of the PPy nanofibers is enhanced on SHI irradiation. The charge carriers in both pristine and irradiated PPy nanofibers follow the correlated barrier hopping mechanism. Scaling of ac conductivity reveals that the conduction mechanism is independent of the SHI irradiation fluence.
NASA Astrophysics Data System (ADS)
El-Shabaan, M. M.
2018-05-01
Thermal, structural, alternating-current (AC) conductivity (σ AC), and dielectric properties of ethyl-2-amino-6-ethyl-5-oxo-4-(3-phenoxyphenyl)-5,6-dihydro-4H-pyrano[3,2-c]quinoline-3-carboxylate (HPQC) thin films have been studied. Thermogravimetry analysis and differential scanning calorimetry confirmed the thermal stability of HPQC over a wide temperature range. Fourier-transform infrared spectroscopy and x-ray diffraction analysis were carried out on HPQC in powder form and as-deposited thin film. The crystal system and space group type were determined for HPQC in powder form. The AC conductivity and dielectric properties were determined in the frequency range from 0.5 kHz to 5 MHz and temperature range from 296 K to 443 K. The AC electrical conduction of HPQC thin film was found to be governed by the small-polaron tunneling mechanism. The polaron hopping energy (W H), tunneling distance (R), and density of states (N) near the Fermi level were determined as functions of temperature and frequency. The dielectric properties of HPQC thin film were studied by analysis of Nyquist diagrams, the dissipation factor (tan δ), and real (ɛ') and imaginary (ɛ″) parts of the dielectric constant.
Electrical conduction mechanism and dielectric characterization of MnTPPCl thin films
NASA Astrophysics Data System (ADS)
Meikhail, M. S.; Oraby, A. H.; El-Nahass, M. M.; Zeyada, H. M.; Al-Muntaser, A. A.
2018-06-01
The AC conductivity and dielectric properties of MnTPPCl sandwich structure as Au/MnTPPCl/Au were studied. The conductivity of the MnTPPCl thin films have been interpreted by the correlated barrier hopping (CBH) model. The dominant conduction process have found to be the single polaron hopping conduction. The values of the hopping distance, Rω, barrier height, W, and the localized-state density, N, are estimated at different frequencies. The behavior of dielectric constant and dielectric loss was discussed as a function of temperature and frequency. The dielectric constant was described in terms of polarization mechanism in materials. The spectral behavior of dielectric loss is interpreted on the basis of the Giuntini et al. model [1]. The value of WM is obtained as 0.32 eV. A non-Debye relaxation phenomenon was observed from the dielectric relaxation mechanism.
Partially suppressed shot noise in hopping conduction: observation in SiGe quantum wells
Kuznetsov; Mendez; Zuo; Snider; Croke
2000-07-10
We have observed shot noise in the hopping conduction of two-dimensional carriers confined in a p-type SiGe quantum well at a temperature of 4 K. Moreover, shot noise is suppressed relative to its "classical" value 2eI by an amount that depends on the length of the sample and the carrier density. We have found a suppression factor to the classical value of about one-half for a 2 &mgr;m long sample, and of one-fifth for a 5 &mgr;m sample. In each case, the factor decreased slightly as the density increased toward the insulator-metal transition. We explain these results in terms of the characteristic length ( approximately 1 &mgr;m in our case) of the inherent inhomogeneity of hopping transport, obtained from percolation theory.
Hopping Conduction and Bacteria: Transport Properties of Disordered Reaction-Diffusion Systems
NASA Astrophysics Data System (ADS)
Missel, Andrew; Dahmen, Karin
2008-03-01
Reaction-diffusion (RD) systems are used to model everything from the formation of animal coat patterns to the spread of genes in a population to the seasonal variation of plankton density in the ocean. In all of these problems, disorder plays a large role, but determining its effects on transport properties in RD systems has been a challenge. We present here both analytical and numerical studies of a particular disordered RD system consisting of particles which are allowed to diffuse and compete for resources (2A->A) with spatially homogeneous rates, reproduce (A->2A) in certain areas (``oases''), and die (A->0) everywhere else (the ``desert''). In the low oasis density regime, transport is mediated through rare ``hopping events'' in which a small number of particles diffuse through the desert from one oasis to another; the situation is mathematically analogous to hopping conduction in doped semiconductors, and this analogy, along with some ideas from first passage percolation theory, allows us to make some quantitative predictions about the transport properties of the system on a large scale.
Structural, ac conductivity and dielectric properties of 3-formyl chromone
NASA Astrophysics Data System (ADS)
Ali, H. A. M.
2017-07-01
The structure for the powder of 3-formyl chromone was examined by X-ray diffraction technique in the 2θ° range ( 4° - 60° . The configuration of Al/3-formyl chromone/Al samples was designed. The electrical and dielectric properties were studied as a function of frequency (42- 5 × 106 Hz) and temperature (298-408K). The ac conductivity data of bulk of 3-formyl chromone varies as a power law with the frequency at different temperatures. The predominant mechanism for ac conduction was deduced. The ac conductivity shows a thermally activated process at different frequencies. The dielectric constant and dielectric loss were determined using the capacitance and dissipation factor measurements at different temperatures. The dielectric loss shows a peak of relaxation time that shifted to higher frequency with an increase in the temperature. The activation energy of the relaxation process was estimated.
Tsuji, Kosuke; Han, HyukSu; Guillemet-Fritsch, Sophie; Randall, Clive A
2017-03-28
Dielectric spectroscopy was performed on a Nb and In co-doped rutile TiO 2 nano-crystalline ceramic (n-NITO) synthesized by a low-temperature spark plasma sintering (SPS) technique. The dielectric properties of the n-NITO were not largely affected by the metal electrode contacts. Huge dielectric relaxation was observed at a very low temperature below 35 K. Both the activation energy and relaxation time suggested that the electronic hopping motion is the underlying mechanism responsible for the colossal dielectric permittivity (CP) and its relaxation, instead of the internal barrier layer effect or a dipolar relaxation. With Havriliak-Negami (H-N) fitting, a relaxation time with a large distribution of dielectric relaxations was revealed. The broad distributed relaxation phenomena indicated that Nb and In were involved, controlling the dielectric relaxation by modifying the polarization mechanism and localized states. The associated distribution function is calculated and presented. The frequency-dependent a.c. conductance is successfully explained by a hopping conduction model of the localized electrons with the distribution function. It is demonstrated that the dielectric relaxation is strongly correlated with the hopping electrons in the localized states. The CP in SPS n-NITO is then ascribed to a hopping polarization.
NASA Astrophysics Data System (ADS)
Pattipaka, Srinivas; James, A. R.; Dobbidi, Pamu
2018-04-01
We report a detailed study on the structural, microstructural, piezoelectric, dielectric and AC conductivity of Bi0.5(Na1-x K x )0.5TiO3 (BNKT; x = 0, 0.1, 0.2 and 0.3) ceramics fabricated by a conventional solid-state reaction method. XRD and Raman analysis revealed that Bi0.5(Na0.8K0.2)0.5TiO3 and Bi0.5(Na0.7K0.3)0.5TiO3 ceramics exhibit a mixture of rhombohedral and tetragonal structures. The segregation of K at the grain boundary was confirmed by transmission electron microscopy and is related to typical microstructural local compositional mapping analysis. Two transitions, at ˜ 330°C and 150°C, observed from the ɛ' versus T curve in pure BNT are associated with the ferroelectric tetragonal to paraelectric cubic phase (T C) and ferroelectric rhombohedral to ferroelectric tetragonal phase (T d), respectively. Further, the T C and T d shifted towards the lower temperature with a rise in K concentration. Frequency dispersion of T d and T C suggest that BNKT ceramics exhibit a weak relaxor behavior with diffuse phase transition, which is confirmed by Uchino-Nomura criteria and the Vogel-Fulcher law. The AC resistivity ρ ac(T) follows the Mott variable range hopping conduction mechanism. A significant enhancement of dielectric and piezoelectric properties were observed for x = 0.2 system: dielectric constant (ɛ' = 1273), dielectric loss (tanδ = 0.047) at 1 kHz, electromechanical coupling coefficients (k ij : k 33, k t ˜ 60%, k 31 ˜ 62% and k p ˜ 46%), elastic coupling coefficients ( S_{33}D = 6.40 × 10-13 m2/N and S_{33}E = 10.06 × 10-13 m2/N) and piezoelectric constants (d 33 = 64.23 pC/N and g 33 = 5.69 × 10-3 Vm/N).
NASA Astrophysics Data System (ADS)
Pattipaka, Srinivas; James, A. R.; Dobbidi, Pamu
2018-07-01
We report a detailed study on the structural, microstructural, piezoelectric, dielectric and AC conductivity of Bi0.5(Na1- x K x )0.5TiO3 (BNKT; x = 0, 0.1, 0.2 and 0.3) ceramics fabricated by a conventional solid-state reaction method. XRD and Raman analysis revealed that Bi0.5(Na0.8K0.2)0.5TiO3 and Bi0.5(Na0.7K0.3)0.5TiO3 ceramics exhibit a mixture of rhombohedral and tetragonal structures. The segregation of K at the grain boundary was confirmed by transmission electron microscopy and is related to typical microstructural local compositional mapping analysis. Two transitions, at ˜ 330°C and 150°C, observed from the ɛ' versus T curve in pure BNT are associated with the ferroelectric tetragonal to paraelectric cubic phase ( T C) and ferroelectric rhombohedral to ferroelectric tetragonal phase ( T d), respectively. Further, the T C and T d shifted towards the lower temperature with a rise in K concentration. Frequency dispersion of T d and T C suggest that BNKT ceramics exhibit a weak relaxor behavior with diffuse phase transition, which is confirmed by Uchino-Nomura criteria and the Vogel-Fulcher law. The AC resistivity ρ ac( T) follows the Mott variable range hopping conduction mechanism. A significant enhancement of dielectric and piezoelectric properties were observed for x = 0.2 system: dielectric constant ( ɛ' = 1273), dielectric loss (tan δ = 0.047) at 1 kHz, electromechanical coupling coefficients ( k ij : k 33, k t ˜ 60%, k 31 ˜ 62% and k p ˜ 46%), elastic coupling coefficients ( S_{33}D = 6.40 × 10-13 m2/N and S_{33}E = 10.06 × 10-13 m2/N) and piezoelectric constants ( d 33 = 64.23 pC/N and g 33 = 5.69 × 10-3 Vm/N).
Kassegne, Sam; Wibowo, Denni; Chi, James; Ramesh, Varsha; Narenji, Alaleh; Khosla, Ajit; Mokili, John
2015-06-01
In this study, AC characterisation of DNA molecular wires, effects of frequency, temperature and UV irradiation on their conductivity is presented. λ-DNA molecular wires suspended between high aspect-ratio electrodes exhibit highly frequency-dependent conductivity that approaches metal-like behaviour at high frequencies (∼MHz). Detailed temperature dependence experiments were performed that traced the impedance response of λ-DNA until its denaturation. UV irradiation experiments where conductivity was lost at higher and longer UV exposures helped to establish that it is indeed λ-DNA molecular wires that generate conductivity. The subsequent renaturation of λ-DNA resulted in the recovery of current conduction, providing yet another proof of the conducting DNA molecular wire bridge. The temperature results also revealed hysteretic and bi-modal impedance responses that could make DNA a candidate for nanoelectronics components like thermal transistors and switches. Further, these experiments shed light on the charge transfer mechanism in DNA. At higher temperatures, the expected increase in thermal-induced charge hopping may account for the decrease in impedance supporting the 'charge hopping mechanism' theory. UV light, on the other hand, causes damage to GC base-pairs and phosphate groups reducing the path available both for hopping and short-range tunneling mechanisms, and hence increasing impedance--this again supporting both the 'charge hopping' and 'tunneling' mechanism theories.
Charging in the ac Conductance of a Double Barrier Resonant Tunneling Structure
NASA Technical Reports Server (NTRS)
Anantram, M. P.; Saini, Subhash (Technical Monitor)
1998-01-01
There have been many studies of the linear response ac conductance of a double barrier resonant tunneling structure (DBRTS), both at zero and finite dc biases. While these studies are important, they fail to self consistently include the effect of the time dependent charge density in the well. In this paper, we calculate the ac conductance at both zero and finite do biases by including the effect of the time dependent charge density in the well in a self consistent manner. The charge density in the well contributes to both the flow of displacement currents in the contacts and the time dependent potential in the well. We find that including these effects can make a significant difference to the ac conductance and the total ac current is not equal to the simple average of the non-selfconsistently calculated conduction currents in the two contacts. This is illustrated by comparing the results obtained with and without the effect of the time dependent charge density included correctly. Some possible experimental scenarios to observe these effects are suggested.
Hopping conduction in zirconium oxynitrides thin film deposited by reactive magnetron sputtering
NASA Astrophysics Data System (ADS)
Guo, Jie; Zhan, Guanghui; Liu, Jingquan; Yang, Bin; Xu, Bin; Feng, Jie; Chen, Xiang; Yang, Chunsheng
2015-10-01
Zirconium oxynitrides thin film thermometers were demonstrated to be useful temperature sensors. However, the basic conduction mechanism of zirconium oxynitrides films has been a long-standing issue, which hinders the prediction and optimization of their ultimate performance. In this letter, zirconium oxynitrides films were grown on sapphire substrates by magnetron sputtering and their electric transport mechanism has been systemically investigated. It was found that in high temperatures region (>150 K) the electrical conductivity was dominated by thermal activation for all samples. In the low temperatures range, while Mott variable hopping conduction (VRH) was dominated the transport for films with relatively low resistance, a crossover from Mott VRH conduction to Efros-Shklovskii (ES) VRH was observed for films with relatively high resistance. This low temperature crossover from Mott to ES VRH indicates the presence of a Coulomb gap (~7 meV). These results demonstrate the competing and tunable conduction mechanism in zirconium oxynitrides thin films, which would be helpful for optimizing the performance of zirconium oxynitrides thermometer.
NASA Astrophysics Data System (ADS)
Batkova, Marianna; Batko, Ivan; Gabáni, Slavomír; Gažo, Emil; Konovalova, Elena; Filippov, Vladimir
2018-05-01
We studied electrical resistance of a single-crystalline SmB6 sample with a focus on the region of the "low-temperature resistivity plateau". Our observations did not show any true saturation of the electrical resistance at temperatures below 3 K down to 70 mK. According to our findings, temperature dependence of the electrical conduction in a certain temperature interval above 70 mK can be decomposed into a temperature-independent term and a temperature-activated term that can be described by variable-range hopping formula for two-dimensional systems, exp [ -(T0 / T) 1 / 3 ]. Thus, our results indicate importance of hopping type of electrical transport in the near-surface region of SmB6.
Characteristics of dielectric properties and conduction mechanism of TlInS2:Cu single crystals
NASA Astrophysics Data System (ADS)
El-Nahass, M. M.; Ali, H. A. M.; El-Zaidia, E. F. M.
2013-12-01
Single crystals of TlInS2:Cu were grown by the modified Bridgman method. The dielectric behavior of TlInS2:Cu was investigated using the impedance spectroscopy technique. The real (ε1), imaginary (ε2) parts of complex dielectric permittivity and ac conductivity were measured in the frequency range (42-2×105) Hz with a variation of temperature in the range from 291 K to 483 K. The impedance data were presented in Nyquist diagrams for different temperatures. The frequency dependence of σtot (ω) follows the Jonscher's universal dynamic law with the relation σtot (ω)=σdc+Aωs, (where s is the frequency exponent). The mechanism of the ac charge transport across the layers of TlInS2:Cu single crystals was referred to the hopping over localized states near the Fermi level. The examined system exhibits temperature dependence of σac (ω), which showed a linear increase with the increase in temperature at different frequencies. Some parameters were calculated as: the density of localized states near the Fermi level, NF, the average time of charge carrier hopping between localized states, τ, and the average hopping distance, R.
NASA Astrophysics Data System (ADS)
Vinay, K.; Shivakumar, K.; Ravikiran, Y. T.; Revanasiddappa, M.
2018-05-01
The present work is an investigation of ac conduction behaviour and dielectric response of Polyaniline/Ag/Graphene/SrTiO3 (PAGS) composite prepared by in-situ chemical oxidative interfacial polymerization using (NH4)2S2O8 as an oxidising agent at 0-5°C. The structural characterization of the samples was examined using FT-IR and XRD techniques. The ac conductivity and dielectric response of synthesized polymer composites were investigated at room temperature in the frequency range varying from 5 × 101 - 5 × 106 Hz using HIOKI make 3532-50 LCR Hi-tester. The ac conductivity increases with increase in frequency and follows the regular trend, the real dielectric constant (ɛ') and imaginary dielectric constant (ɛ'') decreases with increase in frequency and exhibits almost zero dielectric loss at higher frequencies, which suggests that the composite is a lossless material at frequencies beyond 3Hz.
NASA Astrophysics Data System (ADS)
Ali, H. A. M.
2016-03-01
The structure for the powder of N,N', N"-tris(4-methylphenyl)phosphoric triamide, TMP-TA, was characterized using X-ray diffraction (XRD) and differential thermal analysis (DTA) techniques. The ac conductivity and dielectric properties were measured in the frequency range of 42-105 Hz for the bulk TMP-TA in a pellet form at different temperatures. The frequency dependence of ac conductivity was expressed by a Jonscher's universal power law. The frequency exponent (s) was determined from the fitting of experimental data of ac conductivity. The correlated barrier hopping (CBH) model was found to be responsible for the ac conduction mechanism in TMP-TA. The activation energy was calculated from the temperature dependence of ac conductivity. The values of the density of states at the Fermi level were determined for different frequencies. The components of the electric modulus (M' and M") were calculated and used to estimate the relaxation time.
NASA Astrophysics Data System (ADS)
Das, M. R.; Mukherjee, A.; Mitra, P.
2017-09-01
We have studied the electrical conductivity, dielectric relaxation mechanism and impedance spectroscopy characteristics of nickel oxide (NiO) thin films synthesized by chemical bath deposition (CBD) method. Thickness dependent structural, optical and ac electrical characterization has been carried out and deposition time was varied to control the thickness. The material has been characterized using X-ray diffraction and UV-VIS spectrophotometer. Impedance spectroscopy analysis confirmed enhancement of ac conductivity and dielectric constant for films deposited with higher deposition time. Decrease of grain size in thicker films were confirmed from XRD analysis and activation energy of the material for electrical charge hopping process was increased with thickness of the film. Decrease in band gap in thicker films were observed which could be associated with creation of additional energy levels in the band gap of the material. Cole-Cole plot shows contribution of both grain and grain boundary towards total resistance and capacitance. The overall resistance was found to decrease from 14.6 × 105 Ω for 30 min deposited film ( 120 nm thick) to 2.42 × 105 Ω for 120 min deposited film ( 307 nm thick). Activation energy value to electrical conduction process evaluated from conductivity data was found to decrease with thickness. Identical result was obtained from relaxation time approach suggesting hopping mechanism of charge carriers.
AC transport in p-Ge/GeSi quantum well in high magnetic fields
DOE Office of Scientific and Technical Information (OSTI.GOV)
Drichko, I. L.; Malysh, V. A.; Smirnov, I. Yu.
2014-08-20
The contactless surface acoustic wave technique is implemented to probe the high-frequency conductivity of a high-mobility p-Ge/GeSi quantum well structure in the regime of integer quantum Hall effect (IQHE) at temperatures 0.3–5.8 K and magnetic fields up to 18 T. It is shown that, in the IQHE regime at the minima of conductivity, holes are localized and ac conductivity is of hopping nature and can be described within the “two-site” model. The analysis of the temperature and magnetic-field-orientation dependence of the ac conductivity at odd filing factors enables us to determine the effective hole g-factor, |g{sub zz}|≈4.5. It is shownmore » that the in-plane component of the magnetic field leads to a decrease in the g-factor as well as increase in the cyclotron mass, which is explained by orbital effects in the complex valence band of germanium.« less
Electrical conduction in PVDF/ZnO-Ag nanocomposites
NASA Astrophysics Data System (ADS)
Singh, Utpal; Jha, Anal K.; Chandra, K. P.; Kolte, Jayant; Kulkarni, A. R.; Prasad, K.
2018-05-01
A hybrid combination of Ag and ZnO nanoparticles were utilized to fabricate PVDF/ZnO(90/10)-Ag nanocomposites (with Ag as filler: 0.5, 1 and 1.5%) utilizing melt-mixing technique. X-ray diffraction study confirmed the formations of nanocomposites. Electric modulus analysis indicated the dielectric relaxation in this system to be of non- Debye type. Correlated barrier hopping model successfully explained the charge conduction in PVDF/ZnO-Ag nanocomposites and ac conductivity data followed Jonscher's power law.
Microwave a.c. conductivity of domain walls in ferroelectric thin films
Tselev, Alexander; Yu, Pu; Cao, Ye; ...
2016-05-31
Ferroelectric domain walls are of great interest as elementary building blocks for future electronic devices due to their intrinsic few-nanometre width, multifunctional properties and field-controlled topology. To realize the electronic functions, domain walls are required to be electrically conducting and addressable non-destructively. However, these properties have been elusive because conducting walls have to be electrically charged, which makes them unstable and uncommon in ferroelectric materials. Here we reveal that spontaneous and recorded domain walls in thin films of lead zirconate and bismuth ferrite exhibit large conductance at microwave frequencies despite being insulating at d.c. We explain this effect by morphologicalmore » roughening of the walls and local charges induced by disorder with the overall charge neutrality. a.c. conduction is immune to large contact resistance enabling completely non-destructive walls read-out. Finally, this demonstrates a technological potential for harnessing a.c. conduction for oxide electronics and other materials with poor d.c. conduction, particularly at the nanoscale.« less
Microwave a.c. conductivity of domain walls in ferroelectric thin films
Tselev, Alexander; Yu, Pu; Cao, Ye; Dedon, Liv R.; Martin, Lane W.; Kalinin, Sergei V.; Maksymovych, Petro
2016-01-01
Ferroelectric domain walls are of great interest as elementary building blocks for future electronic devices due to their intrinsic few-nanometre width, multifunctional properties and field-controlled topology. To realize the electronic functions, domain walls are required to be electrically conducting and addressable non-destructively. However, these properties have been elusive because conducting walls have to be electrically charged, which makes them unstable and uncommon in ferroelectric materials. Here we reveal that spontaneous and recorded domain walls in thin films of lead zirconate and bismuth ferrite exhibit large conductance at microwave frequencies despite being insulating at d.c. We explain this effect by morphological roughening of the walls and local charges induced by disorder with the overall charge neutrality. a.c. conduction is immune to large contact resistance enabling completely non-destructive walls read-out. This demonstrates a technological potential for harnessing a.c. conduction for oxide electronics and other materials with poor d.c. conduction, particularly at the nanoscale. PMID:27240997
NASA Astrophysics Data System (ADS)
El-Menyawy, E. M.; Zedan, I. T.; Nawar, H. H.
2014-03-01
The electrical and dielectric properties of the synthesized 2-(antipyrin-4-ylhydrazono)-2-(4-nitrophenyl)acetonitrile (AHNA) have been studied. The direct and alternating current (DC and AC) conductivities and complex dielectric constant were investigated in temperature range 303-403 K. The AC conductivity and dielectric properties of AHNA were investigated over frequency range 100 Hz-5 MHz. From DC and AC measurements, electrical conduction is found to be a thermally activated process. The frequency-dependent AC conductivity obeys Jonscher's universal power law in which the frequency exponent decreases with increasing temperature. The correlated barrier hopping (CBH) is the predominant model for describing the charge carrier transport in which the electrical parameters are evaluated. The activation energy is found to decrease with increasing frequency. The behaviors of dielectric and dielectric loss are discussed in terms of a polarization mechanism. The dielectric loss shows frequency power law from which the maximum barrier height is determined as 0.19 eV in terms of the Guintini model.
Influence of temperature on AC conductivity of nanocrystalline CuAlO2
NASA Astrophysics Data System (ADS)
Prakash, T.
2012-07-01
Nanocrystalline CuAlO2 was synthesized by mechanical alloying of Cu2O and α-Al2O3 powders in the molar ratio of 1:1 for 20 h in toluene medium with tungsten carbide balls and vials using planetary ball mill. The ball milling was carried out at 300 rpm with a ball to powder weight ratio of 10:1 and then annealed at 1373 K in a platinum crucible for 20 h to get CuAlO2 phase with average crystallite size 45 nm. Complex impedance spectroscopic measurement in the frequency region 1 Hz to 10 MHz between the temperatures 333 to 473 K was carried out for nanocrystalline CuAlO2 sample. The obtained complex impedance data was analyzed for AC conductivities, DC and AC conductivities correlations and crossover frequencies ( f co ). The BNN (Barton, Nakajima and Namikawa) relation was applied to understand the correlation between DC and AC conductivities. The observed experimental results were discussed in the paper.
NASA Astrophysics Data System (ADS)
Yesappa, L.; Niranjana, M.; Ashokkumar, S. P.; Vijeth, H.; Ganesh, S.; Devendrappa, H.
2018-05-01
The polymer (PVdF-co-HFP: LiClO4=90:10, PHL10) electrolyte films prepared by solution casting method and studied morphology, dielectric properties and ac conductivity before and after electron beam (EB) irradiation. The polarized optical micrographs reveals size of spherulite reduced with increasing EB dose represents increase in amorphousity. The dielectric measurements were studied at different temperatures and observed increase with frequency at different temperatures upon EB irradiation. The ac conductivity increases with frequency due to effect of EB dose.
Electrical conductivity and modulus formulation in zinc modified bismuth boro-tellurite glasses
NASA Astrophysics Data System (ADS)
Dhankhar, Sunil; Kundu, R. S.; Dult, Meenakshi; Murugavel, S.; Punia, R.; Kishore, N.
2016-09-01
The ac conductivity of zinc modified tellurium based quaternary glasses having composition 60 TeO2-10 B2O3-(30 - x) Bi2O3-x ZnO; x = 10, 15, 20, 25 and 30 has been investigated in the frequency range 10-1-105 Hz and in temperature range 483-593 K. Frequency and temperature dependent ac conductivity found to obey Jonscher power law modified by Almond-West. DC conductivity, crossover frequency and frequency exponent have been estimated from the fitting of the experimental data of conductivity with Jonscher power law modified by Almond-West. The ac conductivity and its frequency exponent have been analyzed by various theoretical models. In presently studied glasses ac conduction takes place via tunneling of overlapping large polaron tunneling. Activation energy is found to be increased with increase in zinc content and dc conduction takes place via variable range hopping proposed by Mott with some modification suggested by Punia et al. The value of the stretched exponent ( β) obtained by fitting of M^' ' }} reveals the presence of non-Debye type relaxation. Scaling spectra of ac conductivity and electric modulus collapse into a single master curve for all compositions and temperatures, reveals the presence of composition and temperature independent conduction and relaxation process in these glasses. Activation energy of conduction ( W) and electric modulus ( E R ) are nearly equal, indicating that polaron have to overcome the same energy barrier during conduction as well as relaxation processes.
NASA Astrophysics Data System (ADS)
Poklonski, N. A.; Vyrko, S. A.; Zabrodskii, A. G.
2010-08-01
Expressions for the pre-exponential factor σ3 and the thermal activation energy ɛ3 of hopping electric conductivity of electrons via hydrogen-like donors in n-type gallium arsenide are obtained in the quasiclassical approximation. Crystals with the donor concentration N and the acceptor concentration KN at the intermediate compensation ratio K (approximately from 0.25 to 0.75) are considered. We assume that the donors in the charge states (0) and (+1) and the acceptors in the charge state (-1) form a joint nonstoichiometric simple cubic 'sublattice' within the crystalline matrix. In such sublattice the distance between nearest impurity atoms is Rh = [(1 + K)N]-1/3 which is also the length of an electron hop between donors. To take into account orientational disorder of hops we assume that the impurity sublattice randomly and smoothly changes orientation inside a macroscopic sample. Values of σ3(N) and ɛ3(N) calculated for the temperature of 2.5 K agree with known experimental data at the insulator side of the insulator-metal phase transition.
Small polaron hopping conduction mechanism in LiFePO4 glass and crystal
NASA Astrophysics Data System (ADS)
Banday, Azeem; Murugavel, Sevi
2017-01-01
The optimization of a cathode material is the most important criterion of lithium ion battery technology, which decides the power density. In order to improve the rate capability, a cathode material must possess high electronic and ionic conductivities. Therefore, it is important to understand the charge transport mechanism in such an advanced cathode material in its intrinsic state before modifying it by various means. In this work, we report the thermal, structural, and electrical conductivity studies on lithium iron phosphate, LiFePO4, both in its polycrystalline (LFPC) and glassy (LFPG) counterpart states. The vibrational spectroscopic measurements reveal the characteristic vibrational modes, which are the intrinsic part of LFPC, whereas in LFPG, the phonon modes become broader and overlap with each other due to the lattice disorder. The electrical conductivity measurements reveal that LFPG exhibits a higher polaronic conductivity of 1.6 orders than the LFPC sample. The temperature dependent dc conductivity has been analyzed with the Mott model of polarons and reveals the origin of enhanced polaronic conductivity in LFPG. Based on the analysis, the enhanced polaronic conductivity in LFPG has been attributed to the combined effect of reduced hopping length, decreased activation energy, and enhanced polaron concentration.
Studies on a.c. conductivity behaviour of milled carbon fibre reinforced epoxy gradient composites
NASA Astrophysics Data System (ADS)
Nigrawal, Archana; Sharma, Arun Kumar; Ojha, Pragya
2018-05-01
Temperature and frequency dependence of a.c. conductivity (σa.c) of milled carbon fibre (MCF) reinforced epoxy gradient composites has been studied in a wide temperature (30 to 150°C) and frequency range (1 to 10kHz). It is observed that the ac conductivity of composites increases with increase in temperature. Activation energy decreases from 0.55 eV to 0.43 eV on increase of MCF content from 0.45to 1.66 Vol%.
NASA Astrophysics Data System (ADS)
Rahal, A.; Borchani, S. Megdiche; Guidara, K.; Megdiche, M.
2018-02-01
In this paper, we report the measurements of impedance spectroscopy for a new olivine-type lithium deficiency Li0.9□0.1NiV0.5P0.5O4 compound. It was synthesized by the conventional solid-state technique. All the X-ray diffraction peaks of the compound are indexed, and it is found that the sample is well crystallized in orthorhombic olivine structure belonging to the space group Pnma. Conductivity and dielectric analyses of the sample are carried out at different temperatures and frequencies using the complex impedance spectroscopy technique. The electrical conductivity of Li0.9□0.1NiV0.5P0.5O4 is higher than that of parent compound LiNiV0.5P0.5O4. Temperature dependence of the DC conductivity and modulus was found to obey the Arrhenius law. The obtained values of activation energy are different which confirms that transport in the title compound is not due to a simple hopping mechanism. To determine the conduction mechanism, the AC conductivity and its frequency exponent have been analysed in this work by a theoretical model based on quantum mechanical tunnelling: the non-overlapping small polaron tunnelling model.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dahiya, M. S.; Khasa, S., E-mail: skhasa@yahoo.com; Yadav, Arti
2016-05-23
Lithium bismuth borate glasses containing different amounts of cobalt and iron oxides having chemical composition xFe{sub 2}O{sub 3}•(20-x)CoO•30Li{sub 2}O•10Bi{sub 2}O{sub 3}•40B{sub 2}O{sub 3} (x = 0, 5, 10, 15 and 20 mol% abbreviated as CFLBB1-5 respectively) prepared via melt quench technique have been investigated for their dc electrical conductivity. The amorphous nature of prepared glasses has been confirmed through X-ray diffraction measurements. The dc electrical conductivity has been analyzed by applying Mott’s small polaron hopping model. Activation energies corresponding to lower and higher temperature region have been evaluated. The iron ion concentration (N), mean spacing between iron ions (R) and polaronmore » radius (R{sub p}) has been evaluated using the values of phonon radius (R{sub ph}) and Debye temperature (θ{sub D}). The glass sample without iron (CFLBB1) shows ionic conductivity but the incorporation of iron in the glass matrix results in the appearance of electronic conductivity.« less
HOPPING CONDUCTIVITY AND MAGNETIC TRANSITIONS OF THE Cu2+ SPINS IN SINGLE-CRYSTAL La2CuO4+y
NASA Astrophysics Data System (ADS)
Thio, Tineke; Birgeneau, R. J.; Chen, C. Y.; Freer, B. S.; Gabbe, D. R.; Jenssen, H. P.; Kastner, M. A.; Picone, P. J.; Preyer, N. W.
Measurements are reported of the magnetoresistance (MR) for fields up to 23T in La2CuO4+y single crystals in which the Cu2+ spins order antiferromagnetically at TN˜240K, and in which the conductivity at low temperature is characterised by hopping between localised states. Using the MR, we map out the phase diagram of the spin flop transition, observed when the magnetic field is applied parallel to the zero-field staggered magnetisation, and that of the weak-ferromagnetic transition, observed with the field perpendicular to the CuO planes. In both transitions the antiferromagnetic propagation vector changes from the ěca direction at zero field to the ěcc direction at the highest fields. This rather subtle change of the Cu spin ordering is accompanied by a large increase in the interlayer hopping conductivity: up to a factor 2. We show that the magnetoconductance is proportional to the three-dimensional staggered moment with propagation vector in the orthorhombic ěcc direction. The origin of this unusual behaviour is an important unsolved problem.
Dielectric behavior and AC conductivity of Cr doped α-Mn2O3
NASA Astrophysics Data System (ADS)
Chandra, Mohit; Yadav, Satish; Singh, K.
2018-05-01
The complex dielectric behavior of polycrystalline α-Mn2-xCrxO3 (x = 0.10) has been investigated isothermally at wide frequency range (4Hz-1 MHz) at different temperatures (300-390K). The dielectric spectroscopy results have been discussed in different formulism like dielectric constant, impedance and ac conductivity. The frequency dependent dielectric loss (tanδ) exhibit a clear relaxation behavior in the studied temperature range. The relaxation frequency increases with increasing temperature. These results are fitted using Arrhenius equation which suggest thermally activated process and the activation energy is 0.173±0.0024 eV. The normalized tanδ curves at different temperatures merge as a single master curve which indicate that the relaxation process follow the similar relaxation dynamics in the studied temperature range. Further, the dielectric relaxation follows non-Debye behavior. The impedance results inference that the grain boundary contribution dominate at lower frequency whereas grain contribution appeared at higher frequencies and exhibit strong temperature dependence. The ac conductivity data shows that the ac conductivity increases with increasing temperature which corroborate the semiconducting nature of the studied sample.
Characterization of a highly hop-resistant Lactobacillus brevis strain lacking hop transport.
Behr, Jürgen; Gänzle, Michael G; Vogel, Rudi F
2006-10-01
Resistance to hops is a prerequisite for lactic acid bacteria to spoil beer. In this study we analyzed mechanisms of hop resistance of Lactobacillus brevis at the metabolism, membrane physiology, and cell wall composition levels. The beer-spoiling organism L. brevis TMW 1.465 was adapted to high concentrations of hop compounds and compared to a nonadapted strain. Upon adaptation to hops the metabolism changed to minimize ethanol stress. Fructose was used predominantly as a carbon source by the nonadapted strain but served as an electron acceptor upon adaptation to hops, with concomitant formation of acetate instead of ethanol. Furthermore, hop adaptation resulted in higher levels of lipoteichoic acids (LTA) incorporated into the cell wall and altered composition and fluidity of the cytoplasmic membrane. The putative transport protein HitA and enzymes of the arginine deiminase pathway were overexpressed upon hop adaptation. HorA was not expressed, and the transport of hop compounds from the membrane to the extracellular space did not account for increased resistance to hops upon adaptation. Accordingly, hop resistance is a multifactorial dynamic property, which can develop during adaptation. During hop adaptation, arginine catabolism contributes to energy and generation of the proton motive force until a small fraction of the population has established structural improvements. This acquired hop resistance is energy independent and involves an altered cell wall composition. LTA shields the organism from accompanying stresses and provides a reservoir of divalent cations, which are otherwise scarce as a result of their complexation by hop acids. Some of the mechanisms involved in hop resistance overlap with mechanisms of pH resistance and ethanol tolerance and as a result enable beer spoilage by L. brevis.
NASA Astrophysics Data System (ADS)
Punia, R.; Kundu, R. S.; Dult, Meenakshi; Murugavel, S.; Kishore, N.
2012-10-01
The ac conductivity of bismuth zinc vanadate glasses with compositions 50V2O5. xBi2O3. (50-x) ZnO has been studied in the frequency range 10-1 Hz to 2 MHz and in temperature range 333.16 K to 533.16 K. The temperature and frequency dependent conductivity is found to obey Jonscher's universal power law for all the compositions of bismuth zinc vanadate glass system. The dc conductivity (σdc), crossover frequency (ωH), and frequency exponent (s) have been estimated from the fitting of experimental data of ac conductivity with Jonscher's universal power law. Enthalpy to dissociate the cation from its original site next to a charge compensating center (Hf) and enthalpy of migration (Hm) have also been estimated. It has been observed that mobility of charge carriers and ac conductivity in case of zinc vanadate glass system increases with increase in Bi2O3 content. In order to determine the conduction mechanism, the ac conductivity and its frequency exponent have been analyzed in the frame work of various theoretical models based on classical hopping over barriers and quantum mechanical tunneling. The ac conduction takes place via tunneling of overlapping large polarons in all the compositions of presently studied vanadate glasses. The fitting of experimental data of ac conductivity with overlapping large polarons tunneling model has also been done. The parameters; density of states at Fermi level (N(EF)), activation energy associated with charge transfer between the overlapping sites (WHO), inverse localization length (α) and polaron radius (rp) obtained from fitting of this model with experimental data are reasonable.
NASA Astrophysics Data System (ADS)
Poklonski, N. A.; Vyrko, S. A.; Poklonskaya, O. N.; Zabrodskii, A. G.
2011-12-01
For nondegenerate bulk semiconductors, we have used the virial theorem to derive an expression for the temperature Tj of the transition from the regime of "free" motion of electrons in the c-band (or holes in the υ-band) to their hopping motion between donors (or acceptors). Distribution of impurities over the crystal was assumed to be of the Poisson type, while distribution of their energy levels was assumed to be of the Gaussian type. Our conception of the virial theorem implementation is that the transition from the band-like conduction to hopping conduction occurs when the average kinetic energy of an electron in the c-band (hole in the υ-band) is equal to the half of the absolute value of the average energy of the Coulomb interaction of an electron (hole) with the nearest neighbor ionized donor (acceptor). Calculations of Tj according to our model agree with experimental data for crystals of Ge, Si, diamond, etc. up to the concentrations of a hydrogen-like impurity, at which the phase insulator-metal transition (Mott transition) occurs. Under the temperature Th ≈ Tj /3, when the nearest neighbor hopping conduction via impurity atoms dominates, we obtained expressions for the electrostatic field screening length Λh in the Debye-Hückel approximation, taking into account a nonzero width of the impurity energy band. It is shown that the measurements of quasistatic capacitance of the semiconductor in a metal-insulator-semiconductor structure in the regime of the flat bands at the temperature Th allow to determine the concentration of doping impurity or its compensation ratio by knowing Λh.
Charge transport and ac response under light illumination in gate-modulated DNA molecular junctions.
Zhang, Yan; Zhu, Wen-Huan; Ding, Guo-Hui; Dong, Bing; Wang, Xue-Feng
2015-05-22
Using a two-strand tight-binding model and within nonequilibrium Green's function approach, we study charge transport through DNA sequences (GC)NGC and (GC)1(TA)NTA (GC)3 sandwiched between two Pt electrodes. We show that at low temperature DNA sequence (GC)NGC exhibits coherent charge carrier transport at very small bias, since the highest occupied molecular orbital in the GC base pair can be aligned with the Fermi energy of the metallic electrodes by a gate voltage. A weak distance dependent conductance is found in DNA sequence (GC)1(TA)NTA (GC)3 with large NTA. Different from the mechanism of thermally induced hopping of charges proposed by the previous experiments, we find that this phenomenon is dominated by quantum tunnelling through discrete quantum well states in the TA base pairs. In addition, ac response of this DNA junction under light illumination is also investigated. The suppression of ac conductances of the left and right lead of DNA sequences at some particular frequencies is attributed to the excitation of electrons in the DNA to the lead Fermi surface by ac potential, or the excitation of electrons in deep DNA energy levels to partially occupied energy levels in the transport window. Therefore, measuring ac response of DNA junctions can reveal a wealth of information about the intrinsic dynamics of DNA molecules.
Polaronic conductivity and scaling behavior of lithium iron phosphate glass
NASA Astrophysics Data System (ADS)
Banday, Azeem; Murugavel, Sevi
2018-05-01
Charge transport properties of the Lithium Iron Phosphate (LFP) glass has been investigated in a wide frequency and temperature range by means of broadband dielectric spectroscopy. The conductivity spectra has been studied on the basis of Jonscher power law for characterizing the hopping dynamics of charge carriers. The ac conductivity and scaling behavior of the LFP glass has been studied in the temperature range from 333K to 573K and frequency range from 100 mHz to 1 MHz. The conductivity isotherms of LFP glass do not superimpose upon each other by using Summerfield scaling. The structural peculiarities in the material could result in different conduction pathways giving rise to the deviation from Summerfield scaling.
Topological Anderson insulator induced by inter-cell hopping disorder
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lv, Shu-Hui; College of Sciences, Hebei University of Science and Technology, Shijiazhuang 050018; Song, Juntao, E-mail: jtsong@mail.hebtu.edu.cn
We have studied in detail the influence of same-orbit and different-orbit hopping disorders in HgTe/CdTe quantum wells. Intriguingly, similar to the behavior of the on-site Anderson disorder, a phase transition from a topologically trivial phase to a topological phase is induced at a proper strength of the same-orbit hopping disorder. For different-orbit hopping disorder, however, the phase transition does not occur. The results have been analytically verified by using effective medium theory. A consistent conclusion can be obtained by comparing phase diagrams, conductance, and conductance fluctuations. In addition, the influence of Rashba spin-orbit interaction (RSOI) on the system has beenmore » studied for different types of disorder, and the RSOI shows different influence on topological phase at different disorders. The topological phase induced by same-orbit hopping disorder is more robust against the RSOI than that induced by on-site Anderson disorder. For different-orbit hopping disorder, no matter whether the RSOI is included or not, the phase transition does not occur. The results indicate, whether or not the topological Anderson insulator can be observed depends on a competition between the different types of the disorder as well as the strength of the RSOI in a system.« less
AC impedance investigations of proton conduction in Nafion(sup TM)
NASA Astrophysics Data System (ADS)
Cahan, B. D.; Wainright, J. S.
1993-12-01
AC impedance spectroscopy has been employed to study the conduction of protons in Nafion 117 polymer electrolyte membrane. Both two- and four-electrode geometries have been used to uniquely distinguish between the membrane impedance and the interfacial impedances. The results show that the impedance of Nafion for frequencies up to 100 kHz is characterized by a pure resistance, similar to conventional liquid electrolytes. The frequency dependent features observed using a two-electrode geometry are shown to be consistent will well-characterized interfacial impedances and do not arise from ionic conduction in the membrane. These results show that previous two-electrode studies reported in the literature have misinterpreted the impedance of the electrode interfaces as belonging to the conduction process in the electrolyte.
Helicobacter pylori HopE and HopV porins present scarce expression among clinical isolates
Lienlaf, Maritza; Morales, Juan Pablo; Díaz, María Inés; Díaz, Rodrigo; Bruce, Elsa; Siegel, Freddy; León, Gloria; Harris, Paul R; Venegas, Alejandro
2010-01-01
AIM: To evaluate how widely Helicobacter pylori (H. pylori) HopE and HopV porins are expressed among Chilean isolates and how seroprevalent they are among infected patients in Chile. METHODS: H. pylori hopE and hopV genes derived from strain CHCTX-1 were cloned by polymerase chain reaction (PCR), sequenced and expressed in Escherichia coli AD494 (DE3). Gel-purified porins were used to prepare polyclonal antibodies. The presence of both genes was tested by PCR in a collection of H. pylori clinical isolates and their expression was detected in lysates by immunoblotting. Immune responses against HopE, HopV and other H. pylori antigens in sera from infected and non-infected patients were tested by Western blotting using these sera as first antibody on recombinant H. pylori antigens. RESULTS: PCR and Western blotting assays revealed that 60 and 82 out of 130 Chilean isolates carried hopE and hopV genes, respectively, but only 16 and 9, respectively, expressed these porins. IgG serum immunoreactivity evaluation of 69 H. pylori-infected patients revealed that HopE and HopV were infrequently recognized (8.7% and 10.1% respectively) compared to H. pylori VacA (68.1%) and CagA (59.5%) antigens. Similar values were detected for IgA serum immunoreactivity against HopE (11.6%) and HopV (10.5%) although lower values for VacA (42%) and CagA (17.4%) were obtained when compared to the IgG response. CONCLUSION: A scarce expression of HopE and HopV among Chilean isolates was found, in agreement with the infrequent seroconversion against these antigens when tested in infected Chilean patients. PMID:20082477
Spletzer, Barry L.; Fischer, Gary J.; Marron, Lisa C.; Martinez, Michael A.; Kuehl, Michael A.; Feddema, John T.
2001-01-01
The present invention provides a hopping robot that includes a misfire tolerant linear actuator suitable for long trips, low energy steering and control, reliable low energy righting, miniature low energy fuel control. The present invention provides a robot with hopping mobility, capable of traversing obstacles significant in size relative to the robot and capable of operation on unpredictable terrain over long range. The present invention further provides a hopping robot with misfire-tolerant combustion actuation, and with combustion actuation suitable for use in oxygen-poor environments.
NASA Technical Reports Server (NTRS)
Barlow, Edward; Marzwell, Nevellie; Fuller, Sawyer; Fionni, Paolo; Tretton, Andy; Burdick, Joel; Schell, Steve
2003-01-01
A small prototype mobile robot is capable of (1) hopping to move rapidly or avoid obstacles and then (2) moving relatively slowly and precisely on the ground by use of wheels in the manner of previously reported exploratory robots of the "rover" type. This robot is a descendant of a more primitive hopping robot described in "Minimally Actuated Hopping Robot" (NPO- 20911), NASA Tech Briefs, Vol. 26, No. 11 (November 2002), page 50. There are many potential applications for robots with hopping and wheeled-locomotion (roving) capabilities in diverse fields of endeavor, including agriculture, search-and-rescue operations, general military operations, removal or safe detonation of land mines, inspection, law enforcement, and scientific exploration on Earth and remote planets. The combination of hopping and roving enables this robot to move rapidly over very rugged terrain, to overcome obstacles several times its height, and then to position itself precisely next to a desired target. Before a long hop, the robot aims itself in the desired hopping azimuth and at a desired takeoff angle above horizontal. The robot approaches the target through a series of hops and short driving operations utilizing the steering wheels for precise positioning.
Low Power Multi-Hop Networking Analysis in Intelligent Environments.
Etxaniz, Josu; Aranguren, Gerardo
2017-05-19
Intelligent systems are driven by the latest technological advances in many different areas such as sensing, embedded systems, wireless communications or context recognition. This paper focuses on some of those areas. Concretely, the paper deals with wireless communications issues in embedded systems. More precisely, the paper combines the multi-hop networking with Bluetooth technology and a quality of service (QoS) metric, the latency. Bluetooth is a radio license-free worldwide communication standard that makes low power multi-hop wireless networking available. It establishes piconets (point-to-point and point-to-multipoint links) and scatternets (multi-hop networks). As a result, many Bluetooth nodes can be interconnected to set up ambient intelligent networks. Then, this paper presents the results of the investigation on multi-hop latency with park and sniff Bluetooth low power modes conducted over the hardware test bench previously implemented. In addition, the empirical models to estimate the latency of multi-hop communications over Bluetooth Asynchronous Connectionless Links (ACL) in park and sniff mode are given. The designers of devices and networks for intelligent systems will benefit from the estimation of the latency in Bluetooth multi-hop communications that the models provide.
Low Power Multi-Hop Networking Analysis in Intelligent Environments
Etxaniz, Josu; Aranguren, Gerardo
2017-01-01
Intelligent systems are driven by the latest technological advances in many different areas such as sensing, embedded systems, wireless communications or context recognition. This paper focuses on some of those areas. Concretely, the paper deals with wireless communications issues in embedded systems. More precisely, the paper combines the multi-hop networking with Bluetooth technology and a quality of service (QoS) metric, the latency. Bluetooth is a radio license-free worldwide communication standard that makes low power multi-hop wireless networking available. It establishes piconets (point-to-point and point-to-multipoint links) and scatternets (multi-hop networks). As a result, many Bluetooth nodes can be interconnected to set up ambient intelligent networks. Then, this paper presents the results of the investigation on multi-hop latency with park and sniff Bluetooth low power modes conducted over the hardware test bench previously implemented. In addition, the empirical models to estimate the latency of multi-hop communications over Bluetooth Asynchronous Connectionless Links (ACL) in park and sniff mode are given. The designers of devices and networks for intelligent systems will benefit from the estimation of the latency in Bluetooth multi-hop communications that the models provide. PMID:28534847
Range and energetics of charge hopping in organic semiconductors
NASA Astrophysics Data System (ADS)
Abdalla, Hassan; Zuo, Guangzheng; Kemerink, Martijn
2017-12-01
The recent upswing in attention for the thermoelectric properties of organic semiconductors (OSCs) adds urgency to the need for a quantitative description of the range and energetics of hopping transport in organic semiconductors under relevant circumstances, i.e., around room temperature (RT). In particular, the degree to which hops beyond the nearest neighbor must be accounted for at RT is still largely unknown. Here, measurements of charge and energy transport in doped OSCs are combined with analytical modeling to reach the univocal conclusion that variable-range hopping is the proper description in a large class of disordered OSC at RT. To obtain quantitative agreement with experiment, one needs to account for the modification of the density of states by ionized dopants. These Coulomb interactions give rise to a deep tail of trap states that is independent of the material's initial energetic disorder. Insertion of this effect into a classical Mott-type variable-range hopping model allows one to give a quantitative description of temperature-dependent conductivity and thermopower measurements on a wide range of disordered OSCs. In particular, the model explains the commonly observed quasiuniversal power-law relation between the Seebeck coefficient and the conductivity.
Electrical transport via variable range hopping in an individual multi-wall carbon nanotube
NASA Astrophysics Data System (ADS)
Husain Khan, Zishan; Husain, M.; Perng, T. P.; Salah, Numan; Habib, Sami
2008-11-01
E-beam lithography is used to make four leads on an individual multi-wall carbon nanotube for carrying out electrical transport measurements. Temperature dependence of conductance of an individual multi-wall carbon nanotube (MWNT) is studied over a temperature range of (297 4.8 K). The results indicate that the conduction is governed by variable range hopping (VRH) for the entire temperature range (297 4.8 K). This VRH mechanism changes from three dimensions (3D) to two dimensions (2D) as we go down to 70 K. Three-dimensional variable range hopping (3D VRH) is responsible for conduction in the temperature range (297 70 K), which changes to two-dimensional VRH for much lower temperatures (70 4.8 K). For 3D VRH, various Mott parameters such as density of states, hopping distance and hopping energy have been calculated. The 2D VRH mechanism has been applied for the temperature range (70 4.8 K) and, with the help of this model, the parameters such as localization length and hopping distance are calculated. All these parameters give interesting information about this complex structure, which may be useful for many applications.
Perceived bitterness character of beer in relation to hop variety and the impact of hop aroma.
Oladokun, Olayide; James, Sue; Cowley, Trevor; Dehrmann, Frieda; Smart, Katherine; Hort, Joanne; Cook, David
2017-09-01
The impact of hop variety and hop aroma on perceived beer bitterness intensity and character was investigated using analytical and sensory methods. Beers made from malt extract were hopped with 3 distinctive hop varieties (Hersbrucker, East Kent Goldings, Zeus) to achieve equi-bitter levels. A trained sensory panel determined the bitterness character profile of each singly-hopped beer using a novel lexicon. Results showed different bitterness character profiles for each beer, with hop aroma also found to change the hop variety-derived bitterness character profiles of the beer. Rank-rating evaluations further showed the significant effect of hop aroma on selected key bitterness character attributes, by increasing perceived harsh and lingering bitterness, astringency, and bitterness intensity via cross-modal flavour interactions. This study advances understanding of the complexity of beer bitterness perception by demonstrating that hop variety selection and hop aroma both impact significantly on the perceived intensity and character of this key sensory attribute. Copyright © 2017 Elsevier Ltd. All rights reserved.
Fischer, Gary J [Albuquerque, NM
2010-08-17
The present invention provides robotic vehicles having wheeled and hopping mobilities that are capable of traversing (e.g. by hopping over) obstacles that are large in size relative to the robot and, are capable of operation in unpredictable terrain over long range. The present invention further provides combustion powered linear actuators, which can include latching mechanisms to facilitate pressurized fueling of the actuators, as can be used to provide wheeled vehicles with a hopping mobility.
The Hip-Hop club scene: Gender, grinding and sex.
Muñoz-Laboy, Miguel; Weinstein, Hannah; Parker, Richard
2007-01-01
Hip-Hop culture is a key social medium through which many young men and women from communities of colour in the USA construct their gender. In this study, we focused on the Hip-Hop club scene in New York City with the intention of unpacking narratives of gender dynamics from the perspective of young men and women, and how these relate to their sexual experiences. We conducted a three-year ethnographic study that included ethnographic observations of Hip-Hop clubs and their social scene, and in-depth interviews with young men and young women aged 15-21. This paper describes how young people negotiate gender relations on the dance floor of Hip-Hop clubs. The Hip-Hop club scene represents a context or setting where young men's masculinities are contested by the social environment, where women challenge hypermasculine privilege and where young people can set the stage for what happens next in their sexual and emotional interactions. Hip-Hop culture therefore provides a window into the gender and sexual scripts of many urban minority youth. A fuller understanding of these patterns can offer key insights into the social construction of sexual risk, as well as the possibilities for sexual health promotion, among young people in urban minority populations.
USDA-ARS?s Scientific Manuscript database
The versatile hop plant, Humulus L., is a climbing, vine with a perennial root. The genus includes three species, H. japonicus, H. lupulus, and H. yunnanensis. The European hops (H. lupulus) is the species of primary economic importance from which most hop cultivars have been selected. This species ...
From "They" Science to "Our" Science: Hip Hop Epistemology in STEAM Education
NASA Astrophysics Data System (ADS)
Dolberry, Maurice E.
Hip hop has moved from being considered a type of music into being understood as a culture in which a prominent type of music originates. Hip hop culture has a philosophy and epistemological constructs as well. This study analyzed those constructs to determine how conceptions of science factor in hip hop worldviews. Pedagogical models in culturally responsive teaching and Science, Technology, Engineering, Arts, and Mathematics (STEAM) education were also examined to discern their philosophical connections with hip hop culture. These connections were used to create two theoretical models. The first one, Hip Hop Science, described how scientific thought functions in hip hop culture. The second model, Hip Hop STEAM Pedagogy, proposes how hip hop culture can inform STEAM teaching practices. The study began by using Critical Race Theory to create a theoretical framework proposing how the two theoretical models could be derived from the philosophical and pedagogical concepts. Content analysis and narrative inquiry were used to analyze data collected from scholarly texts, hip hop songs, and interviews with hip hop-responsive educators. The data from these sources were used initially to assess the adequacy of the proposed theoretical framework, and subsequently to improve its viability. Four overlapping themes emerged from the data analyses, including hip hop-resistance to formal education; how hip hop culture informs pedagogical practice in hip hop-responsive classrooms; conceptions of knowledge and reality that shape how hip hoppers conduct scientific inquiry; and hip hop-based philosophies of effective teaching for hip hoppers as a marginalized cultural group. The findings indicate that there are unique connections between hip hop epistemology, sciencemindedness, and pedagogical practices in STEAM education. The revised theoretical framework clarified the nature of these connections, and supported claims from prior research that hip hop culture provides viable sites of
Scheduling with hop-by-hop priority increasing in meshed optical burst-switched network
NASA Astrophysics Data System (ADS)
Chang, Hao; Luo, Jiangtao; Zhang, Zhizhong; Xia, Da; Gong, Jue
2006-09-01
In OBS, JET (Just-Enough-Time) is the classical wavelength reservation scheme. But there is a phenomenon that the burst priority decreasing hop-by-hop in multi-hop networks that will waste the bandwidth that was used in the upstream. Based on the HPI (Hop-by-hop Priority Increasing) proposed in the former research, this paper will do an unprecedented simulation in 4×4 meshed topology, which is closer to the real network environment with the help of a NS2-based OBSN simulation platform constructed by ourselves. By contrasting, the drop probability and throughput on one of the longest end-to-end path lengths in the whole networks, it shows that the HPI scheme can improve the utilance of bandwidth better.
Temperature and frequency response of conductivity in Ag2S doped chalcogenide glassy semiconductor
NASA Astrophysics Data System (ADS)
Ojha, Swarupa; Das, Anindya Sundar; Roy, Madhab; Bhattacharya, Sanjib
2018-06-01
The electric conductivity of chalcogenide glassy semiconductor xAg2S-(1-x)(0.5S-0.5Te) has been presented here as a function of temperature and frequency. Formation of different nanocrystallites has been confirmed from X-ray diffraction study. It is also noteworthy that average size of nanocrystallites decreases with the increase of dislocation density. Dc conductivity data have been interpreted using Mott's model and Greaves's model in low and high temperature regions respectively. Ac conductivity above the room temperature has been analyzed using Meyer-Neldel (MN) conduction rule. It is interestingly noted that Correlated Barrier Hopping (CBH) model is the most appropriate conduction mechanism for x = 0.35, where pairs of charge carrier are considered to hop over the potential barrier between the sites via thermal activation. To interpret experimental data for x = 0.45, modified non-overlapping small polaron tunnelling (NSPT) model is supposed to be appropriate model due to tunnelling through grain boundary. The conductivity spectra at various temperatures have been analyzed using Almond-West Formalism (power law model). Scaling of conductivity spectra reveals that electrical relaxation process of charge carriers (polaron) is temperature independent but depends upon the composition of the present chalcogenide glassy system.
The 1963 Hip-Hop Machine: Hip-Hop Pedagogy as Composition.
ERIC Educational Resources Information Center
Rice, Jeff
2003-01-01
Proposes an alternative invention strategy for research-based argumentative writing. Investigates the coincidental usage of the term "whatever" in hip-hop, theory, and composition studies. Presents a "whatever-pedagogy" identified as "hip-hop pedagogy," a writing practice that models itself after digital sampling's…
Injury incidence in hip hop dance.
Ojofeitimi, S; Bronner, S; Woo, H
2012-06-01
Hip hop dance has rapidly become a popular international art form. There is limited information on injury patterns in this population. The purpose of this study was to determine injury incidence and patterns among three groups of hip hop dancers. Three hundred and twelve intermediate, advanced, and expert hip hop dancers were recruited at battles, dance conferences, clubs, and on dance related web sites within the United States and internationally. A Web-based survey was conducted over a 6-month period. Inclusion criteria included intermediate and advanced level dancers over the age of 13. Dancers were divided into three main categories: Breakers, Popper/Lockers, and New Schoolers. Separate analysis of variances were used to compare injury pattern differences between groups. Two hundred and thirty-two dancers reported a total of 738 injuries. Five hundred and six of these (sustained by 205 dancers) were time-loss (TL) injuries. Annual injury incidence was 237% (162% involving TL). Lower extremity injuries were 52% and upper extremity injuries 32% of total injuries. Breakers had a higher injury incidence compared with Popper/Lockers, and New Schoolers. Hip hop dancers report injury rates that are higher than other dance forms but similar to gymnastics. These dancers should be educated concerning injury prevention, biomechanics, and use of protective equipment. © 2010 John Wiley & Sons A/S.
An Efficient Next Hop Selection Algorithm for Multi-Hop Body Area Networks
Ayatollahitafti, Vahid; Ngadi, Md Asri; Mohamad Sharif, Johan bin; Abdullahi, Mohammed
2016-01-01
Body Area Networks (BANs) consist of various sensors which gather patient’s vital signs and deliver them to doctors. One of the most significant challenges faced, is the design of an energy-efficient next hop selection algorithm to satisfy Quality of Service (QoS) requirements for different healthcare applications. In this paper, a novel efficient next hop selection algorithm is proposed in multi-hop BANs. This algorithm uses the minimum hop count and a link cost function jointly in each node to choose the best next hop node. The link cost function includes the residual energy, free buffer size, and the link reliability of the neighboring nodes, which is used to balance the energy consumption and to satisfy QoS requirements in terms of end to end delay and reliability. Extensive simulation experiments were performed to evaluate the efficiency of the proposed algorithm using the NS-2 simulator. Simulation results show that our proposed algorithm provides significant improvement in terms of energy consumption, number of packets forwarded, end to end delay and packet delivery ratio compared to the existing routing protocol. PMID:26771586
Electrical conductivity, thermopower and 57Fe Mössbauer spectroscopy of aegirine (NaFeSi2O6)
NASA Astrophysics Data System (ADS)
Schmidbauer, E.; Kunzmann, Th.
DC and AC electrical conductivities were measured on samples of two different crystals of the mineral aegirine (NaFeSi2O6) parallel (∥) and perpendicular (⊥) to the [001] direction of the clinopyroxene structure between 200 and 600 K. Impedance spectroscopy was applied (20 Hz-1 MHz) and the bulk DC conductivity σDC was determined by extrapolating AC data to zero frequency. In both directions, the log σDC - 1/T curves bend slightly. In the high- and low-temperature limits, differential activation energies were derived for measurements ∥ [001] of EA 0.45 and 0.35 eV, respectively, and the numbers ⊥ [001] are very similar. The value of σDC ∥ [001] with σDC(300 K) 2.0 × 10-6 Ω-1cm-1 is by a factor of 2-10 above that measured ⊥ [001], depending on temperature, which means anisotropic charge transport. Below 350 K, the AC conductivity σ'(ω) (ω/2π=frequency) is enhanced relative to σDC for both directions with an increasing difference for rising frequencies on lowering the temperature. An approximate power law for σ'(ω) is noted at higher frequencies and low temperatures with σ'(ω) ωs, which is frequently observed on amorphous and disordered semiconductors. Scaling of σ'(ω) data is possible with reference to σDC, which results in a quasi-universal curve for different temperatures. An attempt was made to discuss DC and AC results in the light of theoretical models of hopping charge transport and of a possible Fe2+ --> Fe3+ electron hopping mechanism. The thermopower Θ (Seebeck effect) in the temperature range 360 K < T < 770 K is negative in both directions. There is a linear Θ - 1/T relationship above 400 K with activation energy EΘ 0.030 eV ∥ [001] and 0.070 eV ⊥ [001]. 57Fe Mössbauer spectroscopy was applied to detect Fe2+ in addition to the dominating concentration of Fe3+.
Zininga, Tawanda; Makumire, Stanely; Gitau, Grace Wairimu; Njunge, James M; Pooe, Ofentse Jacob; Klimek, Hanna; Scheurr, Robina; Raifer, Hartmann; Prinsloo, Earl; Przyborski, Jude M; Hoppe, Heinrich; Shonhai, Addmore
2015-01-01
recombinant PfHop occasionally eluted as a protein species of twice its predicted size, suggesting that it may occur as a dimer. We conducted SPR analysis which suggested that PfHop is capable of self-association in presence or absence of ATP/ADP. Overall, our findings suggest that PfHop is a stress-inducible protein that directly associates with PfHsp70-1 and PfHsp90. In addition, the protein is capable of self-association. The findings suggest that PfHop serves as a module that brings these two prominent chaperones (PfHsp70-1 and PfHsp90) into a functional complex. Since PfHsp70-1 and PfHsp90 are essential for parasite growth, findings from this study are important towards the development of possible antimalarial inhibitors targeting the cooperation of these two chaperones.
Classification of Scaffold Hopping Approaches
Sun, Hongmao; Tawa, Gregory; Wallqvist, Anders
2012-01-01
The general goal of drug discovery is to identify novel compounds that are active against a preselected biological target with acceptable pharmacological properties defined by marketed drugs. Scaffold hopping has been widely applied by medicinal chemists to discover equipotent compounds with novel backbones that have improved properties. In this review, scaffold hopping is classified into four major categories, namely heterocycle replacements, ring opening or closure, peptidomimetics, and topology-based hopping. The structural diversity of original and final scaffolds with respect to each category will be reviewed. The advantages and limitations of small, medium, and large-step scaffold hopping will also be discussed. Software that is frequently used to facilitate different kinds of scaffold hopping methods will be summarized. PMID:22056715
Steerable Hopping Six-Legged Robot
NASA Technical Reports Server (NTRS)
Younse, Paulo; Aghazarian, Hrand
2010-01-01
The figure depicts selected aspects of a six-legged robot that moves by hopping and that can be steered in the sense that it can be launched into a hop in a controllable direction. This is a prototype of hopping robots being developed for use in scientific exploration of rough terrain on remote planets that have surface gravitation less than that of Earth. Hopping robots could also be used on Earth, albeit at diminished hopping distances associated with the greater Earth gravitation. The upper end of each leg is connected through two universal joints to an upper and a lower hexagonal frame, such that the tilt of the leg depends on the relative position of the two frames. Two non-back-driveable worm-gear motor drives are used to control the relative position of the two frames along two axes 120 apart, thereby controlling the common tilt of all six legs and thereby, further, controlling the direction of hopping. Each leg includes an upper and a lower aluminum frame segment with a joint between them. A fiberglass spring, connected via hinges to both segments, is used to store hopping energy prior to launch into a hop and to cushion the landing at the end of the hop. A cable for loading the spring is run into each leg through the center of the universal joints and then down along the center lines of the segments to the lower end of the leg. A central spool actuated by a motor with a harmonic drive and an electromagnetic clutch winds in all six cables to compress all six springs (thereby also flexing all six legs) simultaneously. To ensure that all the legs push off and land in the same direction, timing- belt pulley drives are attached to the leg segments, restricting the flexing and extension of all six legs to a common linear motion. In preparation for a hop, the spool can be driven to load the spring legs by an amount corresponding to a desired hop distance within range. The amount of compression can be computed from the reading of a shaft-angle encoder that
Effect of pH on the electrical properties and conducting mechanism of SnO2 nanoparticles
NASA Astrophysics Data System (ADS)
Periathai, R. Sudha; Abarna, S.; Hirankumar, G.; Jeyakumaran, N.; Prithivikumaran, N.
2017-03-01
Semiconductor nanoparticles have attracted more interests because of their size-dependent optical and electrical properties.SnO2 is an oxygen-deficient n-type semiconductor with a wide band gap of 3.6 eV (300 K). It has many remarkable applications as sensors, catalysts, transparent conducting electrodes, anode material for rechargeable Li- ion batteries and optoelectronic devices. In the present work, the role of pH in determining the electrical and dielectric properties of SnO2 nanoparticles has been studied as a function of temperature ranging from Room temperature (RT) to 114 °C in the frequency range of 7 MHz to 50 mHz using impedance spectroscopic technique. The non linear behavior observed in the thermal dependence of the conductance of SnO2 nanoparticles is explained by means of the surface property of SnO2 nanoparticles where proton hopping mechanism is dealt with. Jonscher's power law has been fitted for the conductance spectra and the frequency exponent ("s" value) gives an insight about the ac conducting mechanism. The temperature dependence of electrical relaxation phenomenon in the material has been observed. The complex electric modulus analysis indicates the possibility of hopping conduction mechanism in the system with non-exponential type of conductivity relaxation.
Dielectric and conductivity studies of Co-Cu mixed ferrite
NASA Astrophysics Data System (ADS)
Parveez, Asiya; Shekhawat, M. S.; Nayeem, Firdous; Mohd. Shariff, S.; Sinha, R. R.; Khader, S. Abdul
2018-05-01
Nanoparticles of Co-Cu mixed ferrite having the basic composition Co1-xCuxFe2O4(x=0, 0.2, 0.4, 0.6, 0.8 and 1.0) were synthesized using nitrate-citrate combustion method. Structural, dielectric and a.c conductivity of nanopowders, which are sintered at 900°C were studied. Powder X-ray diffraction studies confirmed phase and their nanocrystalline nature. The peaks observed in the XRD spectrum indicated single phase spinel cubic structure for the synthesized samples. Surface morphology of the samples has been investigated using High ResolutionScanning Electron Microscope. The dielectric constant (ɛ') and dielectric loss factor (ɛ″) of nanocrystalline Co-Cu mixed ferrites were investigated as a function of frequency and Cu+2 concentration at room temperature over the frequency range 100 Hz to 1 MHz using Hioki make LCR Hi-Tester 3250. Synthesized mixed ferrites exhibited usual dielectric dispersion, dependence of ɛ' and ɛ″ with the frequency of the alternating applied electric field is in accordance with the Maxwell-Wagner type interfacial polarization. The electrical conductivity (σac) deduced from the measured dielectric data has been thoroughly analyzed and found that the conduction mechanism in Co1-xCuxFe2O4 mixed nanoferrites are in conformity with the electron hopping model.
ERIC Educational Resources Information Center
Kruse, Adam J.
2016-01-01
This article offers considerations for music teachers interested in including hip-hop music in their classrooms but who might feel concerned with or overwhelmed by issues of appropriateness. Two concerns related to hip-hop music are examined: language and negative social themes. Commercial interests in hip-hop music have created a simulacrum (or…
NASA Astrophysics Data System (ADS)
Shubha, L. N.; Madhusudana Rao, P.
2016-06-01
The polyaniline/copper oxide (PANI/CuO) nanocomposite was prepared by mixing solutions of polyaniline and copper oxide nanoparticles in dimethyl sulfoxide (DMSO). The synthesized polymer nanocomposites were characterized by X-ray powder diffraction (XRD), scanning electron microscope (SEM) and UV-visible spectroscopy. The characteristic peaks in XRD and UV-visible spectra confirmed the presence of CuO in the polymer structure. SEM images indicated morphological changes in the composite matrix as compared to the pristine PANI. The DC conductivity measurements were performed using two-probe method for various temperatures. AC conductivity and dielectric response of the composites were investigated in the frequency range of 102-106Hz using LCR meter. Dielectric permittivity ɛ‧(w) and dielectric loss factor ɛ‧‧(w) were investigated. It was observed that ɛ‧(w) and ɛ‧‧(w) decrease with increase in frequency at all temperatures. At a particular frequency it is observed that both ɛ‧(w) and ɛ‧‧(w) increase with increase in temperature. It was also observed that AC conductivity increased with increase in frequency and temperature.
Ac Conduction in Mixed Oxides Al-In2O3-SnO2-Al Structure Deposited by Co-Evaporation
NASA Astrophysics Data System (ADS)
Anwar, M.; Siddiqi, S. A.; Ghauri, I. M.
Conductivity-frequency and capacitance-frequency characteristics of mixed oxides Al-In2O3-SnO2-Al structure are examined to elicit any correlation with the conduction mechanisms most often observed in thin film work. The existence of Schottky barriers is believed to be due to a strong donor band in the insulator established during the vacuum evaporation when a layer of mixed oxides In2O3-SnO2 system is sandwiched between two metal electrodes. Low values of activation energy at low temperatures indicate that the transport of the carriers between localized states is mainly due to electronic hopping over the barrier separating the two nearest neighbor sites. The increase in the formation of ionized donors with increase in temperature during electrical measurements indicates that electronic part of the conductivity is higher than the ionic part. The initial increase in conductivity with increase in Sn content in In2O3 lattice is caused by the Sn atom substitution of In atom, giving out one extra electron. The decrease in electrical conductivity above the critical Sn content (10 mol% SnO2) is caused by the defects formed by Sn atoms, which act as carrier traps rather than electron donors. The increase in electrical conductivity with film thickness is caused by the increase in free carriers density, which is generated by oxygen vacancy acting as two electron donor. The increase in conductivity with substrate and annealing temperatures is due to either the severe deficiency of oxygen, which deteriorates the film properties and reduces the mobility of the carriers or to the diffusion of Sn atoms from interstitial locations into the In cation sites and formation of indium species of lower oxidation state (In2+). Calculations of C and σac from tan δ measurements suggest that there is some kind of space-charge polarization in the material, caused by the storage of carriers at the electrodes. Capacitance decreases not only with the rise of frequency but also with the
The Formation of "Hip-Hop Academicus"--How American Scholars Talk about the Academisation of Hip-Hop
ERIC Educational Resources Information Center
Soderman, Johan
2013-01-01
Social activism and education have been associated with hip-hop since it emerged in New York City 38 years ago. Therefore, it might not be surprising that universities have become interested in hip-hop. This article aims to highlight this "hip-hop academisation" and analyse the discursive mechanisms that manifest in these academisation…
Variable range hopping in ZnO films
NASA Astrophysics Data System (ADS)
Ali, Nasir; Ghosh, Subhasis
2018-04-01
We report the variable range hopping in ZnO films grown by RF magnetron sputtering in different argon and oxygen partial pressure. It has been found that Mott variable range hopping dominant over Efros variable range hopping in all ZnO films. It also has been found that hopping distance and energy increases with increasing oxygen partial pressure.
Characterizing fiber-reinforced composite structures using AC-impedance spectroscopy (AC-IS)
NASA Astrophysics Data System (ADS)
Woo, Leta Y.
Property enhancement in composites depends largely on the reinforcement. For fiber-reinforced composites, the distribution of fibers is crucial in determining the electrical and mechanical performance. Image analysis methods for characterization can be time-consuming and/or destructive. This work explores the capability of AC-impedance spectroscopy (AC-IS), an electrical measurement technique, to serve as a rapid, non-destructive tool for characterizing composite microstructure. The composite requirements include a filler that is electrically conducting or semi-conducting with higher conductivity than the matrix, and a high-impedance interface or coating between the filler and the matrix. To establish an AC-IS characterization method, cement-matrix composites with steel reinforcement were employed as both a technologically important and a model system to investigate how fibers affect the electrical response. Beginning with spherical particulates and then fibers, composites were examined using composite theory and an "intrinsic conductivity" approach. The intrinsic conductivity approach applies to composites with low volume fractions of fibers (i.e., in the dilute regime) and relates how the composite conductivity varies relative to the matrix as a function of volume fraction. A universal equivalent circuit model was created to understand the AC-IS response of composites based on the geometry and volume fraction of the filler. Deviation from predicted behavior was assessed using a developed f-function, which quantifies how fibers contribute to the overall electrical response of the composite. Using the f-function, an AC-IS method for investigating fiber dispersion was established to characterize alignment, settling/segregation, and aggregation. Alignment was investigated using measurements made in three directions. A point-probe technique characterized settling and/or large-scale inhomogeneous mixing in samples. Aggregation was quantified using a "dispersion factor
Hop Optimization and Relay Node Selection in Multi-hop Wireless Ad-Hoc Networks
NASA Astrophysics Data System (ADS)
Li, Xiaohua(Edward)
In this paper we propose an efficient approach to determine the optimal hops for multi-hop ad hoc wireless networks. Based on the assumption that nodes use successive interference cancellation (SIC) and maximal ratio combining (MRC) to deal with mutual interference and to utilize all the received signal energy, we show that the signal-to-interference-plus-noise ratio (SINR) of a node is determined only by the nodes before it, not the nodes after it, along a packet forwarding path. Based on this observation, we propose an iterative procedure to select the relay nodes and to calculate the path SINR as well as capacity of an arbitrary multi-hop packet forwarding path. The complexity of the algorithm is extremely low, and scaling well with network size. The algorithm is applicable in arbitrarily large networks. Its performance is demonstrated as desirable by simulations. The algorithm can be helpful in analyzing the performance of multi-hop wireless networks.
The Effect of Rap/Hip-Hop Music on Young Adult Smoking: An Experimental Study.
Harakeh, Zeena; Bogt, Tom F M Ter
2018-02-16
Music may influence young people's behavior through its lyrics. Substance use references occur more frequently in rap/hip-hop than in other music genres. The aim was to examine whether the exposure to rap/hip-hop lyrics referring to substance use affected cigarette smoking. An experiment with a 3-group between subject design was conducted among 74 daily-smoking young adults ranging in age from 17 to 25 years old. Three conditions were tested in a mobile lab (camper vehicle) from May to December 2011, i.e., regular chart pop music (N = 28), rap/hip-hop with non-frequent references to substance use (N = 24), and rap/hip-hop with frequent references to substance use (N = 22). One-way ANOVA showed that participants listening to substance use infused rap/hip-hop songs felt significantly less pleasant, liked the songs less, and comprehended the songs less compared to participants listening to pop songs. Poisson loglinear analyses revealed that compared to the pop music condition, none of the two rap/hip-hop music conditions had a significant effect on acute smoking. Thus, contrary to expectations, the two different rap/hip-hop conditions did not have a significantly different effect on acute smoking. Listening to rap/hip-hop, even rap hip/hop with frequent referrals to substance use (primarily alcohol and drug use, and general smoking referrals), does not seem to encourage cigarette smoking among Dutch daily-smoking young adults, at least short term.
... The effectiveness ratings for HOPS are as follows:Body odor. Early research suggests that applying a deodorant that ... specific zinc salt to the underarm can reduce body odor. Insomnia. Some research suggests that taking a combination ...
ERIC Educational Resources Information Center
Craig, Todd
2015-01-01
Prompted by a moment in the classroom in which the DJ becomes integral for the writing instructor, this article looks at how the hip-hop DJ and hip-hop DJ/Producer become the intrinsic examples for first-year college writing students to think about how they conduct revision in their writing. After a review of two seminal hip-hop books and other…
ERIC Educational Resources Information Center
Hall, Marcella Runell
2009-01-01
Hip-hop music and culture are often cited as being public pedagogy, meaning the music itself has intrinsic educational value. Non-profit organizations and individual educators have graciously taken the lead in utilizing hip-hop to educate. As the academy continues to debate its effectiveness, teachers and community organizers are moving forward.…
Mode Hopping in Semiconductor Lasers
NASA Astrophysics Data System (ADS)
Heumier, Timothy Alan
Semiconductor lasers have found widespread use in fiberoptic communications, merchandising (bar-code scanners), entertainment (videodisc and compact disc players), and in scientific inquiry (spectroscopy, laser cooling). Some uses require a minimum degree of stability of wavelength which is not met by these lasers: Under some conditions, semiconductor lasers can discontinuously switch wavelengths in a back-and-forth manner. This is called mode hopping. We show that mode hopping is directly correlated to noise in the total intensity, and that this noise is easily detected by a photodiode. We also show that there are combinations of laser case temperature and injection current which lead to mode hopping. Conversely, there are other combinations for which the laser is stable. These results are shown to have implications for controlling mode hopping.
2018-01-01
As an intrinsic part of the Internet of Things (IoT) ecosystem, machine-to-machine (M2M) communications are expected to provide ubiquitous connectivity between machines. Millimeter-wave (mmWave) communication is another promising technology for the future communication systems to alleviate the pressure of scarce spectrum resources. For this reason, in this paper, we consider multi-hop M2M communications, where a machine-type communication (MTC) device with the limited transmit power relays to help other devices using mmWave. To be specific, we focus on hop distance statistics and their impacts on system performances in multi-hop wireless networks (MWNs) with directional antenna arrays in mmWave for M2M communications. Different from microwave systems, in mmWave communications, wireless channel suffers from blockage by obstacles that heavily attenuate line-of-sight signals, which may result in limited per-hop progress in MWNs. We consider two routing strategies aiming at different types of applications and derive the probability distributions of their hop distances. Moreover, we provide their baseline statistics assuming the blockage-free scenario to quantify the impact of blockages. Based on the hop distance analysis, we propose a method to estimate the end-to-end performances (e.g., outage probability, hop count, and transmit energy) of the mmWave MWNs, which provides important insights into mmWave MWN design without time-consuming and repetitive end-to-end simulation. PMID:29329248
Jung, Haejoon; Lee, In-Ho
2018-01-12
As an intrinsic part of the Internet of Things (IoT) ecosystem, machine-to-machine (M2M) communications are expected to provide ubiquitous connectivity between machines. Millimeter-wave (mmWave) communication is another promising technology for the future communication systems to alleviate the pressure of scarce spectrum resources. For this reason, in this paper, we consider multi-hop M2M communications, where a machine-type communication (MTC) device with the limited transmit power relays to help other devices using mmWave. To be specific, we focus on hop distance statistics and their impacts on system performances in multi-hop wireless networks (MWNs) with directional antenna arrays in mmWave for M2M communications. Different from microwave systems, in mmWave communications, wireless channel suffers from blockage by obstacles that heavily attenuate line-of-sight signals, which may result in limited per-hop progress in MWNs. We consider two routing strategies aiming at different types of applications and derive the probability distributions of their hop distances. Moreover, we provide their baseline statistics assuming the blockage-free scenario to quantify the impact of blockages. Based on the hop distance analysis, we propose a method to estimate the end-to-end performances (e.g., outage probability, hop count, and transmit energy) of the mmWave MWNs, which provides important insights into mmWave MWN design without time-consuming and repetitive end-to-end simulation.
Ortiz, Alexis; Olson, Sharon; Trudelle-Jackson, Elaine; Rosario, Martin; Venegas, Heidi L.
2011-01-01
Objective To compare, landing mechanics and electromyographic activity of the lower extremities during side hopping and crossover hopping maneuvers, in noninjured women and women with anterior cruciate ligament (ACL) reconstruction. Design A case-control study. Setting A 3-dimensional motion analysis laboratory. Participants Twenty-eight young women (range, 21–35 years) (15 control subjects and 13 subjects with ACL reconstruction). Patients and Methods All participants performed a side-to-side hopping task that consisted of hopping single-legged 10 times consecutively from side to side across 2 lines marked 30 cm apart on 2 individual force plates. The task was designated as a side hopping when the hop was to the opposite side of the stance leg and as crossover hopping when the hop was toward the side of the stance leg. Main Outcome Measurements Peak hip-/knee-joint angles; peak knee extension/abduction joint moments; electromyographic studies of the gluteus maximus, gluteus medius, rectus femoris, and hamstring muscles; and quadriceps/hamstring co-contraction ratio were compared between the groups by means of 2 × 2 multivariate analysis of variance tests (group × maneuver). Results Noninjured women and women with ACL reconstruction exhibited similar hip-and knee-joint angles during both types of hopping. Hip-joint angles were greater during the crossover hopping in both groups, and knee-joint angles did not differ between the groups or hops. Knee-joint moments demonstrated a significant group × maneuver interaction. Greater knee extension and valgus moments were noted in the control group during crossover hopping, and greater knee abduction moments were noted in the ACL group during side hopping. Electromyographic data revealed no statistically significantly differences between the groups. Conclusions Women with ACL reconstruction exhibited the restoration of functional biomechanical movements such as hip-/knee-joint angles and lower extremity neuromuscular
Relaxation processes and conduction mechanism in bismuth ferrite lead titanate composites
NASA Astrophysics Data System (ADS)
Sahu, Truptimayee; Behera, Banarji
2018-02-01
In this study, samarium (Sm)-doped multiferroic composites of 0.8BiSmxFe1-xO3-0.2PbTiO3 where x = 0.05, 0.10, 0.15, and 0.20 were prepared via the conventional solid state reaction route. The electrical properties of these composites were analyzed using an impedance analyzer over a wide range of temperatures and frequencies (102-106 Hz). The impedance and modulus analyses confirmed the presence of both bulk and grain boundary effects in the materials. The temperature dependence of impedance and modulus spectrum indicated the negative temperature coefficient of resistance behavior. The dielectric relaxation exhibited non-Debye type behavior and it was temperature dependent. The relaxation time (τ) and DC conductivity followed an Arrhenius type behavior. The frequency-dependent AC conductivity obeyed Jonscher's power law. The correlated barrier hopping model was appropriate to understand the conduction mechanism in the composites considered.
NASA Technical Reports Server (NTRS)
Degner, R.; Kaplan, M. H.; Manning, J.; Meetin, R.; Pasternack, S.; Peterson, S.; Seifert, H.
1971-01-01
Research on several aspects of lunar transport using the hopping mode is reported. Hopping exploits the weak lunar gravity, permits fuel economy because of partial recompression of propellant gas on landing, and does not require a continuous smooth surface for operation. Three questions critical to the design of a lunar hopping vehicle are addressed directly in this report: (1) the tolerance of a human pilot for repeated accelerations; (2) means for controlling vehicle attitude during ballistic flight; and (3) means of propulsion. In addition, a small scale terrestrial demonstrator built to confirm feasibility of the proposed operational mode is described, along with results of preliminary study of unmanned hoppers for moon exploration.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, Z.; Hering, P.; Brown, S. B.
To study the rapid evolution of AC conductivity from ultrafast laser excited warm dense matter (WDM), a spatial chirp single-shot method is developed utilizing a crossing angle pump-probe configuration. The pump beam is shaped individually in two spatial dimensions so that it can provide both sufficient laser intensity to excite the material to warm dense matter state and a uniform time window of up to 1 ps with sub-100 fs FWHM temporal resolution. Here, temporal evolution of AC conductivity in laser excited warm dense gold was also measured.
Chen, Z.; Hering, P.; Brown, S. B.; ...
2016-09-19
To study the rapid evolution of AC conductivity from ultrafast laser excited warm dense matter (WDM), a spatial chirp single-shot method is developed utilizing a crossing angle pump-probe configuration. The pump beam is shaped individually in two spatial dimensions so that it can provide both sufficient laser intensity to excite the material to warm dense matter state and a uniform time window of up to 1 ps with sub-100 fs FWHM temporal resolution. Here, temporal evolution of AC conductivity in laser excited warm dense gold was also measured.
Beer spoilage bacteria and hop resistance.
Sakamoto, Kanta; Konings, Wil N
2003-12-31
For brewing industry, beer spoilage bacteria have been problematic for centuries. They include some lactic acid bacteria such as Lactobacillus brevis, Lactobacillus lindneri and Pediococcus damnosus, and some Gram-negative bacteria such as Pectinatus cerevisiiphilus, Pectinatus frisingensis and Megasphaera cerevisiae. They can spoil beer by turbidity, acidity and the production of unfavorable smell such as diacetyl or hydrogen sulfide. For the microbiological control, many advanced biotechnological techniques such as immunoassay and polymerase chain reaction (PCR) have been applied in place of the conventional and time-consuming method of incubation on culture media. Subsequently, a method is needed to determine whether the detected bacterium is capable of growing in beer or not. In lactic acid bacteria, hop resistance is crucial for their ability to grow in beer. Hop compounds, mainly iso-alpha-acids in beer, have antibacterial activity against Gram-positive bacteria. They act as ionophores which dissipate the pH gradient across the cytoplasmic membrane and reduce the proton motive force (pmf). Consequently, the pmf-dependent nutrient uptake is hampered, resulting in cell death. The hop-resistance mechanisms in lactic acid bacteria have been investigated. HorA was found to excrete hop compounds in an ATP-dependent manner from the cell membrane to outer medium. Additionally, increased proton pumping by the membrane bound H(+)-ATPase contributes to hop resistance. To energize such ATP-dependent transporters hop-resistant cells contain larger ATP pools than hop-sensitive cells. Furthermore, a pmf-dependent hop transporter was recently presented. Understanding the hop-resistance mechanisms has enabled the development of rapid methods to discriminate beer spoilage strains from nonspoilers. The horA-PCR method has been applied for bacterial control in breweries. Also, a discrimination method was developed based on ATP pool measurement in lactobacillus cells. However
Dielectric Measurements on Sol-Gel Derived Titania Films
NASA Astrophysics Data System (ADS)
Capan, Rifat; Ray, Asim K.
2017-11-01
Alternating current (AC) impedance measurements were performed on 37 nm thick nanostructured sol-gel derived anatase titania films on ultrasonically cleaned (100) p-silicon substrates at temperatures T ranging from 100 K to 300 K over a frequency range between 20 Hz and 1 MHz. The frequency-dependent behavior of the AC conductivity σ ac( f, T) obeys the universal power law, and the values of the effective hopping barrier and hopping distance were found to be 0.79 eV and 6.7 × 10-11 m from an analysis due to the correlated barrier-hopping model. The dielectric relaxation was identified as a thermally activated non-Debye process involving an activation energy of 41.5 meV.
Hip-Hop and the Academic Canon
ERIC Educational Resources Information Center
Abe, Daudi
2009-01-01
Over the last 30 years, the hip-hop movement has risen from the margins to become the preeminent force in US popular culture. In more recent times academics have begun to harness the power of hip-hop culture and use it as a means of infusing transformative knowledge into the mainstream academic discourse. On many college campuses, hip-hop's…
HopBase: a unified resource for Humulus genomics
Hill, Steven T.; Sudarsanam, Ramcharan
2017-01-01
Abstract Hop (Humulus lupulus L. var lupulus) is a dioecious plant of worldwide significance, used primarily for bittering and flavoring in brewing beer. Studies on the medicinal properties of several unique compounds produced by hop have led to additional interest from pharmacy and healthcare industries as well as livestock production as a natural antibiotic. Genomic research in hop has resulted a published draft genome and transcriptome assemblies. As research into the genomics of hop has gained interest, there is a critical need for centralized online genomic resources. To support the growing research community, we report the development of an online resource "HopBase.org." In addition to providing a gene annotation to the existing Shinsuwase draft genome, HopBase makes available genome assemblies and annotations for both the cultivar “Teamaker” and male hop accession number USDA 21422M. These genome assemblies, gene annotations, along with other common data, coupled with a genome browser and BLAST database enable the hop community to enter the genomic age. The HopBase genomic resource is accessible at http://hopbase.org and http://hopbase.cgrb.oregonstate.edu. PMID:28415075
Charge Energy Transport in Hopping Systems with Rapidly Decreasing Density of States
NASA Astrophysics Data System (ADS)
Mendels, Dan; Organic Electronics Group Technion Team
2014-03-01
An accurate description of the carrier hopping topology in the energy domain of hopping systems incorporating a rapidly decreasing density of states and the subsequent energetic position of these systems' so called effective conduction band is crucial for rationalizing and quantifying these systems' thermo-electric properties, doping related phenomena and carrier gradient effects such as the emergence of the General Einstein Relation under degenerate conditions. Additionally, as will be shown, the 'mobile' carriers propagating through the system can have excess energies reaching 0.3eV above the system quasi-Fermi energy. Hence, since these mobile carriers are most prone to reach systems interfaces and interact with oppositely charged carriers, their excess energy should be considered in determining the efficiencies of energy dependent processes such as carrier recombination and exciton dissociation. In light of the stated motivations, a comprehensive numerical and analytical study of the topology of hopping in the energetic density of such systems (i.e. the statistics regarding which energy values carriers visit most and in what manner) was implemented and the main statistical features of the hopping process that determine the position in energy of the system's effective conduction band were distilled. The obtained results also help shed light on yet to be elucidated discrepancies between predictions given by the widely employed transport energy concept and Monte Carlo simulations.
Electrical conductivity and dielectric behavior in sodium zinc divanadates
NASA Astrophysics Data System (ADS)
Sallemi, F.; Louati, B.; Guidara, K.
2014-11-01
The Na2ZnV2O7 compound was obtained by the conventional solid-state reaction. The sample was characterized by X-ray powder diffraction, Raman and impedance spectroscopy. The ac electrical conductivity and dielectric properties have been investigated in the frequency and temperature range of 200 Hz-1 MHz and 513 K-729 K, respectively. The direct current conductivity process is thermally activated. The frequency dependence of the conductivity is interpreted using the power law. The close values of activation energies obtained from the analysis of hopping frequency and dc conductivity implies that the transport is due to Na+ cation displacement parallel to (0 0 1) plane located between ZnO4 and VO4 tetrahedra. The evolution of the complex permittivity as a function of angular frequency was investigated. Several important parameters such as charge carrier concentration, ionic mobility and diffusion coefficient were determined. Thermodynamic parameters such as the free energy of activation ∆F, the enthalpy ∆H, and the change in entropy ∆S have been calculated.
Why do mammals hop? Understanding the ecology, biomechanics and evolution of bipedal hopping.
McGowan, Craig P; Collins, Clint E
2018-06-15
Bipedal hopping is a specialized mode of locomotion that has arisen independently in at least five groups of mammals. We review the evolutionary origins of these groups, examine three of the most prominent hypotheses for why bipedal hopping may have arisen, and discuss how this unique mode of locomotion influences the behavior and ecology of modern species. While all bipedal hoppers share generally similar body plans, differences in underlying musculoskeletal anatomy influence what performance benefits each group may derive from this mode of locomotion. Based on a review of the literature, we conclude that the most likely reason that bipedal hopping evolved is associated with predator avoidance by relatively small species in forested environments. Yet, the morphological specializations associated with this mode of locomotion have facilitated the secondary acquisition of performance characteristics that enable these species to be highly successful in ecologically demanding environments such as deserts. We refute many long-held misunderstandings about the origins of bipedal hopping and identify potential areas of research that would advance the understanding of this mode of locomotion. © 2018. Published by The Company of Biologists Ltd.
Ac-conductivity and dielectric response of new zinc-phosphate glass/metal composites
NASA Astrophysics Data System (ADS)
Maaroufi, A.; Oabi, O.; Lucas, B.
2016-07-01
The ac-conductivity and dielectric response of new composites based on zinc-phosphate glass with composition 45 mol%ZnO-55 mol%P2O5, filled with metallic powder of nickel (ZP/Ni) were investigated by impedance spectroscopy in the frequency range from 100 Hz to 1 MHz at room temperature. A high percolating jump of seven times has been observed in the conductivity behavior from low volume fraction of filler to the higher fractions, indicating an insulator - semiconductor phase transition. The measured conductivity at higher filler volume fraction is about 10-1 S/cm and is frequency independent, while, the obtained conductivity for low filler volume fraction is around 10-8 S/cm and is frequency dependent. Moreover, the elaborated composites are characterized by high dielectric constants in the range of 105 for conductive composites at low frequencies (100 Hz). In addition, the distribution of the relaxation processes was also evaluated. The Debye, Cole-Cole, Davidson-Cole and Havriliak-Negami models in electric modulus formalism were used to model the observed relaxation phenomena in ZP/Ni composites. The observed relaxation phenomena are fairly simulated by Davidson-Cole model, and an account of the interpretation of results is given.
Genomics of the hop psuedo-autosomal regions
USDA-ARS?s Scientific Manuscript database
Hop is one of the few crop species with female and male plants with sex being determined by either XX or XY chromosomes. Hop cones are only produced in female hops with or without fertilization. This has lead to most genomic research being directed toward female plants. Very little work has been don...
A Review of Hip Hop-Based Interventions for Health Literacy, Health Behaviors, and Mental Health.
Robinson, Cendrine; Seaman, Elizabeth L; Montgomery, LaTrice; Winfrey, Adia
2018-06-01
African-American children and adolescents experience an undue burden of disease for many health outcomes compared to their White peers. More research needs to be completed for this priority population to improve their health outcomes and ameliorate health disparities. Integrating hip hop music or hip hop dance into interventions may help engage African-American youth in health interventions and improve their health outcomes. We conducted a review of the literature to characterize hip hop interventions and determine their potential to improve health. We searched Web of Science, Scopus, PsycINFO, and EMBASE to identify studies that assessed hip hop interventions. To be included, studies had to (1) be focused on a psychosocial or physical health intervention that included hip hop and (2) present quantitative data assessing intervention outcomes. Twenty-three articles were identified as meeting all inclusion criteria and were coded by two reviewers. Articles were assessed with regards to sample characteristics, study design, analysis, intervention components, and results. Hip hop interventions have been developed to improve health literacy, health behavior, and mental health. The interventions were primarily targeted to African-American and Latino children and adolescents. Many of the health literacy and mental health studies used non-experimental study designs. Among the 12 (of 14) health behavior studies that used experimental designs, the association between hip hop interventions and positive health outcomes was inconsistent. The number of experimental hip hop intervention studies is limited. Future research is required to determine if hip hop interventions can promote health.
Dead mouse hopping: Tyzzer's disease in spinifex hopping-mice (Notomys alexis).
Stannard, Hayley J; Tulk, Melissa L; Old, Julie M
2017-03-01
Tyzzer's disease is caused by Clostridium piliformes and affects a wide range of domestic and wildlife species. Non-descript signs, if any, and a short incubation period make Tyzzer's disease difficult to diagnose and treat before death occurs. Here we describe an unexpected outbreak of Tyzzer's disease in a colony of native Australian spinifex hopping-mice (Notomys alexis). In this study captive hopping-mice were used in a nutrition trial (n=11), and others were housed in close proximity (n=4). During the nutrition trial, two hopping-mice exhibited signs of lethargy and diarrhoea, and were removed from the trial but died soon after. Other hopping-mice exhibited limited clinical signs of ill-health, prior to their death. In total four animals were found dead, and another seven were euthanised, to prevent a potential disease outbreak. Tyzzer's disease was confirmed post-mortem using histopathology silver stain to detect the bacilli-shaped bacteria (C. piliformes) in liver tissue of two hopping-mice. After Tyzzer's disease was confirmed enhanced infection control measures were implemented. Enhanced control measures included the use of metal containers for food and water, sick animals were fed and cleaned last, 5% sodium hypochlorite was used as the cleaning agent, stricter hand washing protocols and a change of gloves between feeding animals, and strict limits on persons entering the facility. Control measures for this disease should include euthanasia of any animals suspected to be infected, complete disinfection of all enclosures and associated equipment using sodium hypochlorite. Molecular methods could be employed to ensure complete removal of bacterial spores prior to new animals being moved into enclosures where affected animals were housed. Tyzzer's disease is a fast spreading disease which can cause detrimental effects to captive colonies and their environment. Captive colonies subjected to stress are at risk of Tyzzer's disease. Appropriate quarantine
Logerstedt, David; Grindem, Hege; Lynch, Andrew; Eitzen, Ingrid; Engebretsen, Lars; Risberg, May Arna; Axe, Michael J.; Snyder-Mackler, Lynn
2012-01-01
Background Single-legged hop tests are commonly used functional performance measures that can capture limb asymmetries in patients after anterior cruciate ligament (ACL) reconstruction. Hop tests hold potential as predictive factors of self-reported knee function in individuals after ACL reconstruction. Hypothesis Single-legged hop tests conducted preoperatively would not and 6 months after ACL reconstruction would predict self-reported knee function (International Knee Documentation Committee [IKDC] 2000) 1 year after ACL reconstruction. Study Design Cohort study (prognosis); Level of evidence, 2. Methods One hundred twenty patients who were treated with ACL reconstruction performed 4 single-legged hop tests preoperatively and 6 months after ACL reconstruction. Self-reported knee function within normal ranges was defined as IKDC 2000 scores greater than or equal to the age- and sex-specific normative 15th percentile score 1 year after surgery. Logistic regression analyses were performed to identify predictors of self-reported knee function within normal ranges. The area under the curve (AUC) from receiver operating characteristic curves was used as a measure of discriminative accuracy. Results Eighty-five patients completed single-legged hop tests 6 months after surgery and the 1-year follow-up with 68 patients classified as having self-reported knee function within normal ranges 1 year after reconstruction. The crossover hop and 6-m timed hop limb symmetry index (LSI) 6 months after ACL reconstruction were the strongest individual predictors of self-reported knee function (odds ratio, 1.09 and 1.10) and the only 2 tests in which the confidence intervals of the discriminatory accuracy (AUC) were above 0.5 (AUC = 0.68). Patients with knee function below normal ranges were over 5 times more likely of having a 6-m timed hop LSI lower than the 88% cutoff than those with knee function within normal ranges. Patients with knee function within normal ranges were 4 times
Electrical modulus and dielectric behavior of Cr3+ substituted Mg-Zn nanoferrites
NASA Astrophysics Data System (ADS)
Mansour, S. F.; Abdo, M. A.
2017-04-01
The dielectric parameters and ac electrical conductivity of Mg0.8Zn0.2CrxFe2-xO4; (0≤x≤0.025) nanoferrites synthesized citrate-nitrate auto-combustion method were studied using the complex impedance technique in the frequency and temperature ranges 4 Hz-5 MHz and 303-873 K respectively. Hopping of charge carriers plus interfacial polarization could interpret the behaviors of dielectric constant (ε‧), dielectric loss tangent (tanδ) and ac electrical conductivity (σac) with frequency, temperatures and composition. The up-normal behavior observed in tanδ trend with temperatures confirms the presence of relaxation loss (dipoles losses). Correlated barrier hopping (CBH) of electron is the conduction mechanism of the investigated nanoferrites. Cole-Cole plots at different temperatures emphasize the main role of grain and grain boundaries in the properties of the investigated nanoferrites. Cr3+ substitution can control the dielectric parameters and ac electrical conductivity of Mg-Zn nanoferrites making it candidates for versatile applications.
Powdery mildew reaction of hop cultivars and USDA germplasm, 2015
USDA-ARS?s Scientific Manuscript database
This research was conducted to identify possible sources of resistance to the disease powdery mildew in publicly-available hop germplasm and cultivars. Germplasm with the highest levels of downy mildew resistance in the USDA collection and various cultivars of interest were screened for their reac...
Structure, Raman, dielectric behavior and electrical conduction mechanism of strontium titanate
NASA Astrophysics Data System (ADS)
Trabelsi, H.; Bejar, M.; Dhahri, E.; Graça, M. P. F.; Valente, M. A.; Khirouni, K.
2018-05-01
Strontium titanate was prepared by solid-state reaction method. According to the XRD, it was single phase and has a cubic perovskite structure. The Raman spectroscopic investigation was carried out at room-temperature, and the second-order Raman modes were observed. By employing impedance spectroscopy, the dielectric relaxation and electrical properties were investigated over the temperature range of 500-700 K at various frequencies. The activation energies evaluated from dielectric and modulus studies are in good agreement and these values are attributed to the bulk relaxation. The impedance data were well fitted to an (R1//C1)-(R2//CPE1) equivalent electrical circuit. It could be concluded that the grain boundaries are more resistive and capacitive than the grains. The ac conductivity was found to follow the Jonscher's universal dynamic law ωS and the correlated barrier hopping model (CBH) has been proposed to describe the conduction mechanism.
AC conductivity studies of La doped Ba0.5Sr0.5TiO3
NASA Astrophysics Data System (ADS)
D'Souza, Slavia Deeksha; Rohith, Kotla Surya; Bhatnagar, Anil K.; Kumar, A. Sendil
2017-05-01
Ferroelectric material with high dielectric constant of Ba0.5Sr0.5TiO3 is synthesized through Solid State Reaction and fraction of Lanthanum is substituted to introduce hole concentration. XRay Diffraction shows all the samples are stabilized in cubic crystal structure. With La doped samples the Cole-Cole plot is modified and AC conductivity increases at higher temperatures as well as higher frequencies compared to undoped sample.
HIP HOP for HIV Awareness: Using Hip Hop Culture to Promote Community-Level HIV Prevention
ERIC Educational Resources Information Center
Hill, Mandy J.; Hallmark, Camden J.; McNeese, Marlene; Blue, Nike; Ross, Michael W.
2014-01-01
The goal of this paper was to determine the effectiveness of the HIP HOP for HIV Awareness intervention, an innovative model utilising an exchange of an HIV test for a hip hop concert ticket, in a metropolitan city among African American youth and young adults. A subset of intervention participants participated in standardised testing, sex…
Mechanisms of Hop Inhibition Include the Transmembrane Redox Reaction▿
Behr, Jürgen; Vogel, Rudi F.
2010-01-01
In this work, a novel mechanistic model of hop inhibition beyond the proton ionophore action toward (beer spoiling) bacteria was developed. Investigations were performed with model systems using cyclic voltammetry for the determination of redox processes/conditions in connection with growth challenges with hop-sensitive and -resistant Lactobacillus brevis strains in the presence of oxidants. Cyclic voltammetry identified a transmembrane redox reaction of hop compounds at low pH (common in beer) and in the presence of manganese (present in millimolar levels in lactic acid bacteria). The antibacterial action of hop compounds could be extended from the described proton ionophore activity, lowering the intracellular pH, to pronounced redox reactivity, causing cellular oxidative damage. Accordingly, a correlation between the resistance of L. brevis strains to a sole oxidant to their resistance to hop could not be expected and was not detected. However, in connection with our recent study concerning hop ionophore properties and the resistance of hop-sensitive and -tolerant L. brevis strains toward proton ionophores (J. Behr and R. F. Vogel, J. Agric. Food Chem. 57:6074-6081, 2009), we suggest that both ionophore and oxidant resistance are required for survival under hop stress conditions and confirmed this correlation according to the novel mechanistic model. In consequence, the expression of several published hop resistance mechanisms involved in manganese binding/transport and intracellular redox balance, as well as that of proteins involved in oxidative stress under “highly reducing” conditions (cf. anaerobic cultivation and “antioxidative” hop compounds in the growth medium), is now comprehensible. Accordingly, hop resistance as a multifactorial dynamic property at least implies distinct resistance levels against two different mechanisms of hop inhibition, namely, proton ionophore-induced and oxidative stress-induced mechanisms. Beyond this specific model of
Multi-hop teleportation based on W state and EPR pairs
NASA Astrophysics Data System (ADS)
Hai-Tao, Zhan; Xu-Tao, Yu; Pei-Ying, Xiong; Zai-Chen, Zhang
2016-05-01
Multi-hop teleportation has significant value due to long-distance delivery of quantum information. Many studies about multi-hop teleportation are based on Bell pairs, partially entangled pairs or W state. The possibility of multi-hop teleportation constituted by partially entangled pairs relates to the number of nodes. The possibility of multi-hop teleportation constituted by double W states is after n-hop teleportation. In this paper, a multi-hop teleportation scheme based on W state and EPR pairs is presented and proved. The successful possibility of quantum information transmitted hop by hop through intermediate nodes is deduced. The possibility of successful transmission is after n-hop teleportation. Project supported by the National Natural Science Foundation of China (Grant No. 61571105), the Prospective Future Network Project of Jiangsu Province, China (Grant No. BY2013095-1-18), and the Independent Project of State Key Laboratory of Millimeter Waves, China (Grant No. Z201504).
Thermopower of molecular junctions: Tunneling to hopping crossover in DNA
NASA Astrophysics Data System (ADS)
Korol, Roman; Kilgour, Michael; Segal, Dvira
2016-12-01
We study the electrical conductance G and the thermopower S of single-molecule junctions and reveal signatures of different transport mechanisms: off-resonant tunneling, on-resonant coherent (ballistic) motion, and multi-step hopping. These mechanisms are identified by studying the behavior of G and S while varying molecular length and temperature. Based on a simple one-dimensional model for molecular junctions, we derive approximate expressions for the thermopower in these different regimes. Analytical results are compared to numerical simulations, performed using a variant of Büttiker's probe technique, the so-called voltage-temperature probe, which allows us to phenomenologically introduce environmentally induced elastic and inelastic electron scattering effects, while applying both voltage and temperature biases across the junction. We further simulate the thermopower of GC-rich DNA sequences with mediating A:T blocks and manifest the tunneling-to-hopping crossover in both the electrical conductance and the thermopower, in accord with measurements by Li et al. [Nat. Commun. 7, 11294 (2016)].
Condom use and hip hop culture: the case of urban young men in New York City.
Muñoz-Laboy, Miguel A; Castellanos, Daniel H; Haliburton, Chanel S; del Aguila, Ernesto Vasquez; Weinstein, Hannah J; Parker, Richard G
2008-06-01
We explored how young men's perceptions of and participation in hip hop culture--urban social and artistic expressions, such as clothing style, breakdancing, graffiti, and rap music--and how contextual factors of the hip hop scene may be associated with their condom use, condom-use self-efficacy, and sense of community. We conducted a cross-sectional survey of 95 African American and Latino men aged 15 to 25 years as part of a 4-year ethnographic study in New York City. Differences in young men's perceptions of and levels of affiliation with hip hop culture were not statistically associated with differences in their sense of community or condom-use self-efficacy. Frequency of participation in the hip hop nightclub scene was the strongest factor negatively associated with condom use. Popular discourses on young men's health risks often blame youths' cultures such as the hip hop culture for increased risk practices but do not critically examine how risk emerges in urban young men's lives and what aspects of youths' culture can be protective. Further research needs to focus on contextual factors of risk such as the role of hip hop nightlife on increased HIV risk.
Electrical conductivity of Gd doped BiFeO3-PbZrO3 composite
NASA Astrophysics Data System (ADS)
Satpathy, Santosh Kumar; Mohanty, Nilaya Kumar; Behera, Ajay Kumar; Behera, Banarji; Nayak, Pratibindhya
2013-09-01
The composite, 0.5(BiGd0.15Fe0.85O3)-0.5(PbZrO3), was synthesized using the solid-state reaction technique. The formation of the compound was confirmed by XRD with an orthorhombic structure at room temperature. The impedance parameters were studied using an impedance analyzer in a wide range of frequency (102-106 Hz) at different temperatures. The Nyquist plot suggests the contribution of bulk effect and a slight indication of grain boundary effect and the bulk resistance decreases with a rise in temperature. The presence of temperature-dependent relaxation process occurs in the material. Electrical modulus reveals the presence of the hopping mechanism in the materials. The value of exponent n, pre-factor A and σ dc were obtained by fitting ac conductivity data with Jonscher's universal power law. The activation energies calculated from the ac conductivity were found to be 0.50, 0.46, 0.44, 0.43, 0.42 and 0.38 eV at 1, 10, 50, 100, 500 kHz and 1 MHz respectively in the temperature region of 110°C-350°C. The dc conductivity was found to increase with the rise in temperature. The activation energy calculated from complex impedance plot and from the fitted Jonscher's power law are very close, which results similar type of charge carrier exist in conduction mechanism of the material.
Evaluation of fungicides for hop downy mildew, Hubbard, Oregon, 2016
USDA-ARS?s Scientific Manuscript database
This research was conducted to quantify the degree of control of the disease with a phosphorous acid-based fungicide, the present industry-standard for management of downy mildew on hop in the Pacific Northwestern U.S. No suppression of the disease was observed with the industry standard fungicide,...
Evaluation of fungicides for hop downy mildew, Woodburn, Oregon, 2016
USDA-ARS?s Scientific Manuscript database
This research was conducted to quantify the degree of control of the disease downy mildew with a phosphorous acid-based fungicide, the present industry-standard for management of downy mildew on hop in the Pacific Northwestern U.S. No suppression of the disease was observed with the industry standa...
Revolutionizing Environmental Education through Indigenous Hip Hop Culture
ERIC Educational Resources Information Center
Gorlewski, Julie; Porfilio, Brad J.
2012-01-01
Based upon the life histories of six Indigenous hip hop artists of the Beat Nation artist collective, this essay captures how Indigenous hip hop has the potential to revolutionize environmental education. Hip hop provides Indigenous youth an emancipatory space to raise their opposition to neocolonial controls of Indigenous territories that…
NASA Astrophysics Data System (ADS)
Li, Zhaoguo; Peng, Liping; Zhang, Jicheng; Li, Jia; Zeng, Yong; Zhan, Zhiqiang; Wu, Weidong
2018-06-01
Direct evidence of quantum interference magnetotransport in polycrystalline germanium films in the variable-range hopping (VRH) regime is reported. The temperature dependence of the conductivity of germanium films fulfilled the Mott VRH mechanism with the form of ? in the low-temperature regime (?). For the magnetotransport behaviour of our germanium films in the VRH regime, a crossover, from negative magnetoconductance at the low-field to positive magnetoconductance at the high-field, is observed while the zero-field conductivity is higher than the critical value (?). In the regime of ?, the magnetoconductance is positive and quadratic in the field for some germanium films. These features are in agreement with the VRH magnetotransport theory based on the quantum interference effect among random paths in the hopping process.
Kankolongo Cibaka, Marie-Lucie; Decourrière, Laura; Lorenzo-Alonso, Celso-José; Bodart, Etienne; Robiette, Raphaël; Collin, Sonia
2016-11-16
Monovarietal dry-hopped beers were produced with the dual-purpose hop cultivars Amarillo, Hallertau Blanc, and Mosaic. The grapefruit-like 3-sulfanyl-4-methylpentan-1-ol was found in all three beers at concentrations much higher than expected on the basis of the free thiol content in hop. Even cysteinylated precursors proved unable to explain our results. As observed in wine, the occurrence of S-glutathione precursors was therefore suspected in hop. The analytical standards of S-3-(4-methyl-1-hydroxypentyl)glutathione, never described before, and of S-3-(1-hydroxyhexyl)glutathione, previously evidenced in grapes, were chemically synthesized. An optimized extraction of glutathionylated precursors was then applied to Amarillo, Hallertau Blanc, and Mosaic hop samples. HPLC-ESI(+)MS/MS revealed, for the first time, the occurrence of S-3-(1-hydroxyhexyl)glutathione and S-3-(4-methyl-1-hydroxypentyl)glutathione in hop, at levels well above those reported for their cysteinylated counterparts. S-3-(1-Hydroxyhexyl)glutathione emerged in all cases as the major adduct in hop. Yet, although 3-sulfanylhexan-1-ol seems relatively ubiquitous in free, cysteinylated, and glutathionylated forms, the glutathione adduct of 3-sulfanyl-4-methylpentan-1-ol, never evidenced in other plants up to now, was found only in the Hallertau Blanc variety.
ERIC Educational Resources Information Center
Horton, Akesha Monique
2013-01-01
Hip-hop has exploded around the world among youth. It is not simply an American source of entertainment; it is a global cultural movement that provides a voice for youth worldwide who have not been able to express their "cultural world" through mainstream media. The emerging field of critical hip-hop pedagogy has produced little…
Knee Joint Loading during Single-Leg Forward Hopping.
Krupenevich, Rebecca L; Pruziner, Alison L; Miller, Ross H
2017-02-01
Increased or abnormal loading on the intact limb is thought to contribute to the relatively high risk of knee osteoarthritis in this limb for individuals with unilateral lower limb loss. This theory has been assessed previously by studying walking, but knee joint loading during walking is often similar between individuals with and without limb loss, prompting assessment of other movements that may place unusual loads on the knee. One such movement, hopping, is a form of locomotion that individuals with unilateral lower limb loss may situationally use instead of walking, but the mechanical effects of hopping on the intact limb are unknown. Compare knee joint kinetics of healthy adults during single-leg forward hopping compared to walking, a more traditional form of locomotion. Twenty-four healthy adults walked and hopped at self-selected speeds of 1.5 and 2.3 m·s, respectively. Joint moments were calculated using inverse dynamics. A paired Student's t-test was utilized to compare peak, impulse, and loading rate (LR) of knee adduction moment (KAM), and peak knee flexion moment (KFM) between walking and hopping. Peak KFM and KAM LR were greater during hopping compared to walking (peak KFM: 20.73% vs 5.51% body weight (BW) × height (Ht), P < 0.001; KAM LR: 0.47 vs. 0.33 BW·Ht·s, P = 0.01). Kinetic measures affecting knee joint loading are greater in hopping compared to walking. It may be advisable to limit single-leg forward hopping in the limb loss population until it is known if these loads increase knee osteoarthritis risk.
Castañeda-Ojeda, María Pilar; Moreno-Pérez, Alba; Ramos, Cayo; López-Solanilla, Emilia
2017-01-01
The effector repertoire of the olive pathogen P. savastanoi pv. savastanoi NCPPB 3335 includes two members of the HopAO effector family, one of the most diverse T3E families of the P. syringae complex. The study described here explores the phylogeny of these dissimilar members, HopAO1 and HopAO2, among the complex and reveals their activities as immune defense suppressors. Although HopAO1 is predominantly encoded by phylogroup 3 strains isolated from woody organs of woody hosts, both HopAO1 and HopAO2 are phylogenetically clustered according to the woody/herbaceous nature of their host of isolation, suggesting host specialization of the HopAO family across the P. syringae complex. HopAO1 and HopAO2 translocate into plant cells and show hrpL-dependent expression, which allows their classification as actively deployed type III effectors. Our data also show that HopAO1 and HopAO2 possess phosphatase activity, a hallmark of the members of this family. Both of them exert an inhibitory effect on early plant defense responses, such as ROS production and callose deposition, and are able to suppress ETI responses induced by the effectorless polymutant of P. syringae pv. tomato DC3000 (DC3000D28E) in Nicotiana. Moreover, we demonstrate that a ΔhopAO1 mutant of P. savastanoi NCPBB 3335 exhibits a reduced fitness and virulence in olive plants, which supports the relevance of this effector during the interaction of this strain with its host plants. This work contributes to the field with the first report regarding functional analysis of HopAO homologs encoded by P. syringae or P. savastanoi strains isolated from woody hosts. PMID:28529516
Hip-hop as a resource for understanding the urban context
NASA Astrophysics Data System (ADS)
Brown, Bryan
2010-06-01
This review explores Edmin's "Science education for the hip-hop generation" by documenting how he frames hip-hop as a means to access urban student culture. He argues that hip-hop is more than a mere music genre, but rather a culture that provides young people with ways of connecting to the world. Two primary ideas emerged as central to his work. First, he contends that students develop communal relationships and collective identities based on the common experiences expressed in hip-hop. Second, he identifies how the conscious recognition of institutional oppression serves a central feature in urban schools. Emdin's rich, and personal call for a greater understanding of hip-hop culture provides the text with an unmatched strength. He skillfully uses personal narratives from his own experience as well as quotes and references from hip-hop songs to make the nuances of hip hop transparent to science educators. Conversely, the limitation of this text is found in its unfulfilled promise to provide pragmatic examples of how to engage in a hip-hop based science education. Emdin's work is ultimately valuable as it extends our current knowledge about urban students and hip-hop in meaningful ways.
Time synchronization of a frequency-hopped MFSK communication system
NASA Technical Reports Server (NTRS)
Simon, M. K.; Polydoros, A.; Huth, G. K.
1981-01-01
In a frequency-hopped (FH) multiple-frequency-shift-keyed (MFSK) communication system, frequency hopping causes the necessary frequency transitions for time synchronization estimation rather than the data sequence as in the conventional (nonfrequency-hopped) system. Making use of this observation, this paper presents a fine synchronization (i.e., time errors of less than a hop duration) technique for estimation of FH timing. The performance degradation due to imperfect FH time synchronization is found in terms of the effect on bit error probability as a function of full-band or partial-band noise jamming levels and of the number of hops used in the FH timing estimate.
Nonadiabatic small-polaron hopping conduction in Li-doped and undoped Bi4Sr3Ca3CuyOx (0<=y<=5)
NASA Astrophysics Data System (ADS)
Mollah, S.; Som, K. K.; Bose, K.; Chakravorty, A. K.; Chaudhuri, B. K.
1992-11-01
Detailed experimental results of temperature- and CuO-concentration-dependent dc conductivities of semiconducting Bi4Sr3Ca3CuyOx (y=0 to 5) and Li-doped Bi4Sr3Ca3-zLizCu4Ox (z=0.1, 0.5, and 1.0) glasses are reported. The variation of activation energy with glass compositions dominates the conductivity. Unlike many glasses with transition-metal ions, a strong preexponential factor containing the ``small-polaron'' tunneling term [exp(-2αR)] is observed. Nonadiabatic small-polaron hopping mechanism is found to be appropriate for explaining the conductivity data of both glass systems. Addition of alkali-metal ions decreases the conductivities and causes appreciable change of some model parameters obtained from least-squares fittings of the experimental data. The overall thermal behavior of the electrical conductivities of the glasses, however, remains unaltered. This indicates that small (less than 10 wt.%) amount of Li or other alkali-metal ions in these glasses acts as a flux to keep the oxygen content fixed in the corresponding glass-ceramic (superconducting) phases. This in turn helps increase the superconducting transition temperature of the glass ceramics and also lower the sintering and melting temperatures of the glasses.
Condom Use and Hip Hop Culture: The Case of Urban Young Men in New York City
Muñoz-Laboy, Miguel A.; Castellanos, Daniel H.; Haliburton, Chanel S.; del Aguila, Ernesto Vasquez; Weinstein, Hannah J.; Parker, Richard G.
2008-01-01
Objectives. We explored how young men’s perceptions of and participation in hip hop culture—urban social and artistic expressions, such as clothing style, breakdancing, graffiti, and rap music—and how contextual factors of the hip hop scene may be associated with their condom use, condom-use self-efficacy, and sense of community. Methods. We conducted a cross-sectional survey of 95 African American and Latino men aged 15 to 25 years as part of a 4-year ethnographic study in New York City. Results. Differences in young men’s perceptions of and levels of affiliation with hip hop culture were not statistically associated with differences in their sense of community or condom-use self-efficacy. Frequency of participation in the hip hop nightclub scene was the strongest factor negatively associated with condom use. Conclusions. Popular discourses on young men’s health risks often blame youths’ cultures such as the hip hop culture for increased risk practices but do not critically examine how risk emerges in urban young men’s lives and what aspects of youths’ culture can be protective. Further research needs to focus on contextual factors of risk such as the role of hip hop nightlife on increased HIV risk. PMID:18445799
High-Speed On-Board Data Processing for Science Instruments: HOPS
NASA Technical Reports Server (NTRS)
Beyon, Jeffrey
2015-01-01
The project called High-Speed On-Board Data Processing for Science Instruments (HOPS) has been funded by NASA Earth Science Technology Office (ESTO) Advanced Information Systems Technology (AIST) program during April, 2012 â€" April, 2015. HOPS is an enabler for science missions with extremely high data processing rates. In this three-year effort of HOPS, Active Sensing of CO2 Emissions over Nights, Days, and Seasons (ASCENDS) and 3-D Winds were of interest in particular. As for ASCENDS, HOPS replaces time domain data processing with frequency domain processing while making the real-time on-board data processing possible. As for 3-D Winds, HOPS offers real-time high-resolution wind profiling with 4,096-point fast Fourier transform (FFT). HOPS is adaptable with quick turn-around time. Since HOPS offers reusable user-friendly computational elements, its FPGA IP Core can be modified for a shorter development period if the algorithm changes. The FPGA and memory bandwidth of HOPS is 20 GB/sec while the typical maximum processor-to-SDRAM bandwidth of the commercial radiation tolerant high-end processors is about 130-150 MB/sec. The inter-board communication bandwidth of HOPS is 4 GB/sec while the effective processor-to-cPCI bandwidth of commercial radiation tolerant high-end boards is about 50-75 MB/sec. Also, HOPS offers VHDL cores for the easy and efficient implementation of ASCENDS and 3-D Winds, and other similar algorithms. A general overview of the 3-year development of HOPS is the goal of this presentation.
NASA Astrophysics Data System (ADS)
El-Nahass, M. M.; El-Zaidia, E. F. M.; Darwish, A. A. A.; Salem, G. F.
2017-02-01
Dielectric relaxation and alternative current conductivity of a new organic compound 2-(1,2-dihydro-7-methyl-2-oxoquinoline-5-yl) malononitrile (DMOQMN) have been investigated. X-ray diffraction (XRD) at room temperature reveals that DMOQMN samples have a polycrystalline structure of the triclinic system. The analysis of the dielectric constant and dielectric loss index suggested the dominant polarization is performed and the Maxwell-Wagner-Sillar type polarization is dominating at low frequency and high temperature. These results have been confirmed by the XRD and dielectric modulus. The estimated relaxation time and the activation energy are 9 × 10-13 s and 0.43 eV, respectively. Our results indicated that the conduction mechanism of DMOQMN is controlled by the correlation barrier hopping (CBH) model.
Research on synchronization technology of frequency hopping communication system
NASA Astrophysics Data System (ADS)
Zhao, Xiangwu; Quan, Houde; Cui, Peizhang
2018-05-01
Frequency Hopping (FH) communication is a technology of spread spectrum communication. It has strong anti-interference, anti-interception and security capabilities, and has been widely applied in the field of communications. Synchronization technology is one of the most crucial technologies in frequency hopping communication. The speed of synchronization establishment and the reliability of synchronous system directly affect the performance of frequency hopping communication system. Therefore, the research of synchronization technology in frequency hopping communication has important value.
NASA Astrophysics Data System (ADS)
Kumar, E. Ramesh; Nageswar Rao, P.; Appa Rao, B.
2016-09-01
Super ion conducting glasses of composition D%AgI-(100-D)%[MAg2O-F{(F1)B2O3- (F2)TeO2}]; D=10.0 to 60.0 in steps of 10.0 for a fixed values of F1 (0.4), F2 (0.6) which are glass network formers, fixed values of modifier M(0.667), F (0.333) and D is dopant salt which was varied. These glasses were prepared by melt quenching technique. XRD spectra taken for all the samples. Electrical characterization was done in terms of AC and DC conductivities. DC and AC conductivities at room temperature increased from 10-5 to 10-1 scm-1 and DC activation energy (Edc) found to decrease from 0.36 to 0.19eV with increase in D% ratio. Measurements are performed over the frequency range 1 kHz to 3 MHz at different temperatures. From the impedance spectroscopy real and imaginary parts of impedances (Z', Z"), conductivities were calculated and plotted, and equivalent R-C circuit parameters were obtained from Cole-Cole plots. With the increase in D%, AC conductivity is observed to increase whereas the AC activation energy (Eac) is observed to decrease from 0.23 to 0.14 eV. The quantitative analysis of these results indicates that the electrical conductivity of silver borate glasses is enhanced with increase in D% ratio. Based on conductivity values these glasses are ionic conductors, in which conduction is by hopping mechanism. An attempt is made to understand the charge transportation process.
Scaffold hopping in drug discovery using inductive logic programming.
Tsunoyama, Kazuhisa; Amini, Ata; Sternberg, Michael J E; Muggleton, Stephen H
2008-05-01
In chemoinformatics, searching for compounds which are structurally diverse and share a biological activity is called scaffold hopping. Scaffold hopping is important since it can be used to obtain alternative structures when the compound under development has unexpected side-effects. Pharmaceutical companies use scaffold hopping when they wish to circumvent prior patents for targets of interest. We propose a new method for scaffold hopping using inductive logic programming (ILP). ILP uses the observed spatial relationships between pharmacophore types in pretested active and inactive compounds and learns human-readable rules describing the diverse structures of active compounds. The ILP-based scaffold hopping method is compared to two previous algorithms (chemically advanced template search, CATS, and CATS3D) on 10 data sets with diverse scaffolds. The comparison shows that the ILP-based method is significantly better than random selection while the other two algorithms are not. In addition, the ILP-based method retrieves new active scaffolds which were not found by CATS and CATS3D. The results show that the ILP-based method is at least as good as the other methods in this study. ILP produces human-readable rules, which makes it possible to identify the three-dimensional features that lead to scaffold hopping. A minor variant of a rule learnt by ILP for scaffold hopping was subsequently found to cover an inhibitor identified by an independent study. This provides a successful result in a blind trial of the effectiveness of ILP to generate rules for scaffold hopping. We conclude that ILP provides a valuable new approach for scaffold hopping.
Multi-Hop Teleportation of an Unknown Qubit State Based on W States
NASA Astrophysics Data System (ADS)
Zhou, Xiang-Zhen; Yu, Xu-Tao; Zhang, Zai-Chen
2018-04-01
Quantum teleportation is important in quantum communication networks. Considering that quantum state information is also transmitted between two distant nodes, intermediated nodes are employed and two multi-hop teleportation protocols based on W state are proposed. One is hop-by-hop teleportation protocol and the other is the improved multi-hop teleportation protocol with centralized unitary transformation. In hop-by-hop protocol, the transmitted quantum state needs to be recovered at every node on the route. In improved multi-hop teleportation protocol with centralized unitary transformation, intermediate nodes need not to recover the transmitted quantum state. Compared to the hop-by-hop protocol, the improved protocol can reduce the transmission delay and improve the transmission efficiency.
Variable range hopping electric and thermoelectric transport in anisotropic black phosphorus
Liu, Huili; Sung Choe, Hwan; Chen, Yabin; ...
2017-09-05
Black phosphorus (BP) is a layered semiconductor with a high mobility of up to ~1000 cm 2 V -1 s -1 and a narrow bandgap of ~0.3 eV, and shows potential applications in thermoelectrics. In stark contrast to most other layered materials, electrical and thermoelectric properties in the basal plane of BP are highly anisotropic. In order to elucidate the mechanism for such anisotropy, we fabricated BP nanoribbons (~100 nm thick) along the armchair and zigzag directions, and measured the transport properties. It is found that both the electrical conductivity and Seebeck co efficient increase with temperature, a behavior contradictorymore » to that of traditional semiconductors. The three-dimensional variable range hopping model is adopted to analyze this abnormal temperature dependency of electrical conductivity and Seebeck coefficient. Furthermore, the hopping transport of the BP nanoribbons, attributed to high density of trap states in the samples, provides a fundamental understanding of the anisotropic BP for potential thermoelectric applications.« less
Variable range hopping electric and thermoelectric transport in anisotropic black phosphorus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu, Huili; Sung Choe, Hwan; Chen, Yabin
Black phosphorus (BP) is a layered semiconductor with a high mobility of up to ~1000 cm 2 V -1 s -1 and a narrow bandgap of ~0.3 eV, and shows potential applications in thermoelectrics. In stark contrast to most other layered materials, electrical and thermoelectric properties in the basal plane of BP are highly anisotropic. In order to elucidate the mechanism for such anisotropy, we fabricated BP nanoribbons (~100 nm thick) along the armchair and zigzag directions, and measured the transport properties. It is found that both the electrical conductivity and Seebeck co efficient increase with temperature, a behavior contradictorymore » to that of traditional semiconductors. The three-dimensional variable range hopping model is adopted to analyze this abnormal temperature dependency of electrical conductivity and Seebeck coefficient. Furthermore, the hopping transport of the BP nanoribbons, attributed to high density of trap states in the samples, provides a fundamental understanding of the anisotropic BP for potential thermoelectric applications.« less
2012-01-01
We have theoretically studied the thermoelectric properties of serially coupled quantum dots (SCQDs) embedded in an insulator connected to metallic electrodes. In the framework of Keldysh Green’s function technique, the Landauer formula of transmission factor is obtained using the equation of motion method. Based on such analytical expressions of charge and heat currents, we calculate the electrical conductance, Seebeck coefficient, electron thermal conductance, and figure of merit (ZT) of SCQDs in the linear response regime. The effects of interdot hopping and electron Coulomb interactions on ZT are analyzed. We demonstrate that ZT is not a monotonic increasing function of interdot electron hopping strength (tc). We also show that in the absence of phonon thermal conductance, SCQD can reach the Carnot efficiency as tcapproaches zero. PMID:22591807
How Does a Hopping Kangaroo Breathe?
ERIC Educational Resources Information Center
Giuliodori, Mauricio J.; Lujan, Heidi L.; Janbaih, Hussein; DiCarlo, Stephen E.
2010-01-01
We developed a model to demonstrate how a hopping kangaroo breathes. Interestingly, a kangaroo uses less energy to breathe while hopping than while standing still. This occurs, in part, because rather than using muscle power to move air into and out of the lungs, air is pulled into (inspiration) and pushed out of (expiration) the lungs as the…
Sueyoshi, Ted; Nakahata, Akihiro; Emoto, Gen; Yuasa, Tomoki
2017-01-01
Background: Isokinetic strength and hop tests are commonly used to assess athletes’ readiness to return to sport after knee surgery. Purpose/Hypothesis: The purpose of this study was to investigate the results of single-leg hop and isokinetic knee strength testing in athletes who underwent anterior cruciate ligament reconstruction (ACLR) upon returning to sport participation as well as to study the correlation between these 2 test batteries. The secondary purpose was to compare the test results by graft type (patellar tendon or hamstring). It was hypothesized that there would be no statistically significant limb difference in either isokinetic knee strength or single-leg hop tests, that there would be a moderate to strong correlation between the 2 test batteries, and that there would be no significant difference between graft types. Study Design: Cross-sectional study; Level of evidence, 3. Methods: Twenty-nine high school and collegiate athletes who underwent ACLR participated in this study. At the time of return to full sport participation, a series of hop tests and knee extension/flexion isokinetic strength measurements were conducted. The results were analyzed using analysis of variance and Pearson correlation (r). Results: The timed 6-m hop test was the only hop test that showed a significant difference between the involved and uninvolved limbs (2.3 and 2.2 seconds, respectively; P = .02). A significant difference between limbs in knee strength was found for flexion peak torque/body weight at 180 deg/s (P = .03), flexion total work/body weight at 180 deg/s (P = .04), and flexion peak torque/body weight at 300 deg/s (P = .03). The strongest correlation between the hop tests and knee strength was found between the total distance of the hop tests and flexion total work/body weight at 300 deg/s (r = 0.69) and between the timed 6-m hop test and flexion peak torque/body weight at 300 deg/s (r = –0.54). There was no statistically significant difference in hop
Hsu, Chao-Jung; George, Steven Z; Chmielewski, Terese L
2016-12-01
Clinicians use the single-leg hop test to assess readiness for return to sports after knee injury. Few studies have reported the results of single-leg hop testing after meniscectomy. Additionally, the contributions of impairments in quadriceps strength and psychosocial factors to single-leg hop performance are unknown. To compare single-leg hop performance (distance and landing mechanics) between limbs and to examine the association of single-leg hop performance with quadriceps strength and psychosocial factors in patients with meniscectomy. Descriptive laboratory study. A total of 22 subjects who underwent meniscectomy for traumatic meniscal tears received either standard rehabilitation alone or with additional quadriceps strengthening. Testing was conducted immediately postrehabilitation and at 1 year postsurgery. A single-leg hop test was performed bilaterally, and hop distance was used to create a hop symmetry index. Landing mechanics (peak knee flexion angle, knee extension moment, and peak vertical ground-reaction force) were analyzed with a motion-capture system and a force plate. An isokinetic dynamometer (60 deg/s) assessed knee extensor peak torque and rate of torque development (RTD 0-200ms and RTD 0-peak torque ). Questionnaires assessed fear of reinjury (Tampa Scale for Kinesiophobia [TSK-11]) and self-efficacy (Knee Activity Self-Efficacy [KASE]). Rehabilitation groups did not significantly differ in single-leg hop performance; therefore, groups were combined for further analyses. The mean hop symmetry index was 88.6% and 98.9% at postrehabilitation and 1 year postsurgery, respectively. Compared with the nonsurgical limb, the surgical limb showed decreased peak knee flexion angle at postrehabilitation and decreased knee extension moment at 1 year postsurgery. The hop symmetry index was positively associated with peak torque, RTD 0-200ms , and the KASE score at postrehabilitation. Moreover, at postrehabilitation, the peak knee flexion angle was
Hsu, Chao-Jung; George, Steven Z.; Chmielewski, Terese L.
2016-01-01
Background: Clinicians use the single-leg hop test to assess readiness for return to sports after knee injury. Few studies have reported the results of single-leg hop testing after meniscectomy. Additionally, the contributions of impairments in quadriceps strength and psychosocial factors to single-leg hop performance are unknown. Purpose: To compare single-leg hop performance (distance and landing mechanics) between limbs and to examine the association of single-leg hop performance with quadriceps strength and psychosocial factors in patients with meniscectomy. Study Design: Descriptive laboratory study. Methods: A total of 22 subjects who underwent meniscectomy for traumatic meniscal tears received either standard rehabilitation alone or with additional quadriceps strengthening. Testing was conducted immediately postrehabilitation and at 1 year postsurgery. A single-leg hop test was performed bilaterally, and hop distance was used to create a hop symmetry index. Landing mechanics (peak knee flexion angle, knee extension moment, and peak vertical ground-reaction force) were analyzed with a motion-capture system and a force plate. An isokinetic dynamometer (60 deg/s) assessed knee extensor peak torque and rate of torque development (RTD0-200ms and RTD0–peak torque). Questionnaires assessed fear of reinjury (Tampa Scale for Kinesiophobia [TSK-11]) and self-efficacy (Knee Activity Self-Efficacy [KASE]). Results: Rehabilitation groups did not significantly differ in single-leg hop performance; therefore, groups were combined for further analyses. The mean hop symmetry index was 88.6% and 98.9% at postrehabilitation and 1 year postsurgery, respectively. Compared with the nonsurgical limb, the surgical limb showed decreased peak knee flexion angle at postrehabilitation and decreased knee extension moment at 1 year postsurgery. The hop symmetry index was positively associated with peak torque, RTD0-200ms, and the KASE score at postrehabilitation. Moreover, at
Hip-Hopping across China: Intercultural Formulations of Local Identities
ERIC Educational Resources Information Center
Barrett, Catrice
2012-01-01
The linguistic dimensions of globalized hip-hop cannot be understood simply as a byproduct of English as an American export. As hip-hop mobilizes, it is common (and arguably necessary) for global hip-hop communities to struggle through purposeful, semiotically rooted dialectics over what constitutes "authentic" and respectable forms of…
Hip-Hop to Health Jr. for Latino preschool children.
Fitzgibbon, Marian L; Stolley, Melinda R; Schiffer, Linda; Van Horn, Linda; KauferChristoffel, Katherine; Dyer, Alan
2006-09-01
Hip-Hop to Health Jr. was a diet/physical activity intervention designed to reduce gains in BMI (kilograms per meter squared) in preschool minority children. Twelve predominantly Latino Head Start centers participated in a group-randomized trial conducted between Fall 2001 and Winter 2003. Six centers were randomized to a culturally proficient 14-week (three times weekly) diet/physical activity intervention. Parents participated by completing weekly homework assignments. The children in the other six centers received a general health intervention that did not address either diet or physical activity. The primary outcome was change in BMI, and secondary outcomes were changes in dietary intake and physical activity. Measures were collected at baseline, post-intervention, and at Years 1 and 2 follow-up. There were no significant differences between intervention and control schools in either primary or secondary outcomes at post-intervention, Year 1, or Year 2 follow-ups. When Hip-Hop to Health Jr. was conducted in predominantly black Head Start centers, it was effective in reducing subsequent increases in BMI in preschool children. In contrast, when the program was conducted in Latino centers, it was not effective. Although the intervention did not prevent excessive weight gain in Latino children, it was very well received. Future interventions with this population may require further cultural tailoring and a more robust parent intervention.
"Writing in the Margins": Brazilian Hip-Hop as an Educational Project
ERIC Educational Resources Information Center
Pardue, Derek
2004-01-01
Hip-hop culture's force as part of globalization in the fields of economics, popular aesthetics, and identity politics has been well documented. However, its articulation to educational practices has received less attention. This article draws upon fieldwork conducted in 1999 and 2002 in a youth correctional facility to analyze how state…
Signaling induced by hop/STI-1 depends on endocytosis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Americo, Tatiana A.; Chiarini, Luciana B.; Linden, Rafael
The co-chaperone hop/STI-1 is a ligand of the cell surface prion protein (PrP{sup C}), and their interaction leads to signaling and biological effects. Among these, hop/STI-1 induces proliferation of A172 glioblastoma cells, dependent on both PrP{sup C} and activation of the Erk pathway. We tested whether clathrin-mediated endocytosis affects signaling induced by hop/STI-1. Both hyperosmolarity induced by sucrose and monodansyl-cadaverine blocked Erk activity induced by hop/STI-1, without affecting the high basal Akt activity typical of A172. The endocytosis inhibitors also affected the sub-cellular distribution of phosphorylated Erk, consistent with blockade of the latter's activity. The data indicate that signaling inducedmore » by hop/STI-1 depends on endocytosis. These findings are consistent with a role of sub-cellular trafficking in signal transduction following engagement by PrP{sup C} by ligands such as hop/STI-1, and may help help unravel both the functions of the prion protein, as well as possible loss-of-function components of prion diseases.« less
HOP family plays a major role in long-term acquired thermotolerance in Arabidopsis.
Fernández-Bautista, Nuria; Fernández-Calvino, Lourdes; Muñoz, Alfonso; Toribio, René; Mock, Hans P; Castellano, M Mar
2018-05-08
HSP70-HSP90 organizing protein (HOP) is a family of cytosolic cochaperones whose molecular role in thermotolerance is quite unknown in eukaryotes and unexplored in plants. In this article, we describe that the three members of the AtHOP family display a different induction pattern under heat, being HOP3 highly regulated during the challenge and the attenuation period. Despite HOP3 is the most heat-regulated member, the analysis of the hop1 hop2 hop3 triple mutant demonstrates that the three HOP proteins act redundantly to promote long-term acquired thermotolerance in Arabidopsis. HOPs interact strongly with HSP90 and part of the bulk of HOPs shuttles from the cytoplasm to the nuclei and to cytoplasmic foci during the challenge. RNAseq analyses demonstrate that, although the expression of the Hsf targets is not generally affected, the transcriptional response to heat is drastically altered during the acclimation period in the hop1 hop2 hop3 triple mutant. This mutant also displays an unusual high accumulation of insoluble and ubiquitinated proteins under heat, which highlights the additional role of HOP in protein quality control. These data reveal that HOP family is involved in different aspects of the response to heat, affecting the plant capacity to acclimate to high temperatures for long periods. © 2018 John Wiley & Sons Ltd.
HPLC Analysis of [Alpha]- and [Beta]-Acids in Hops
ERIC Educational Resources Information Center
Danenhower, Travis M.; Force, Leyna J.; Petersen, Kenneth J.; Betts, Thomas A.; Baker, Gary A.
2008-01-01
Hops have been used for centuries to impart aroma and bitterness to beer. The cones of the female hop plant contain both essential oils, which include many of the fragrant components of hops, and a collection of compounds known as [alpha]- and [beta]-acids that are the precursors to bittering agents. In order for brewers to predict the ultimate…
Leg exoskeleton reduces the metabolic cost of human hopping.
Grabowski, Alena M; Herr, Hugh M
2009-09-01
During bouncing gaits such as hopping and running, leg muscles generate force to enable elastic energy storage and return primarily from tendons and, thus, demand metabolic energy. In an effort to reduce metabolic demand, we designed two elastic leg exoskeletons that act in parallel with the wearer's legs; one exoskeleton consisted of a multiple leaf (MLE) and the other of a single leaf (SLE) set of fiberglass springs. We hypothesized that hoppers, hopping on both legs, would adjust their leg stiffness while wearing an exoskeleton so that the combination of the hopper and exoskeleton would behave as a linear spring-mass system with the same total stiffness as during normal hopping. We also hypothesized that decreased leg force generation while wearing an exoskeleton would reduce the metabolic power required for hopping. Nine subjects hopped in place at 2.0, 2.2, 2.4, and 2.6 Hz with and without an exoskeleton while we measured ground reaction forces, exoskeletal compression, and metabolic rates. While wearing an exoskeleton, hoppers adjusted their leg stiffness to maintain linear spring-mass mechanics and a total stiffness similar to normal hopping. Without accounting for the added weight of each exoskeleton, wearing the MLE reduced net metabolic power by an average of 6% and wearing the SLE reduced net metabolic power by an average of 24% compared with hopping normally at frequencies between 2.0 and 2.6 Hz. Thus, when hoppers used external parallel springs, they likely decreased the mechanical work performed by the legs and substantially reduced metabolic demand compared with hopping without wearing an exoskeleton.
Hopper on wheels: evolving the hopping robot concept
NASA Technical Reports Server (NTRS)
Schell, S.; Tretten, A.; Burdick, J.; Fuller, S. B.; Fiorini, P.
2001-01-01
This paper describes the evolution of our concept of hopping robot for planetary exploration, that combines coarse long range mobility achieved by hopping, with short range wheeled mobility for precision target acquisition.
Extreme Kinematics in Selected Hip Hop Dance Sequences.
Bronner, Shaw; Ojofeitimi, Sheyi; Woo, Helen
2015-09-01
Hip hop dance has many styles including breakdance (breaking), house, popping and locking, funk, streetdance, krumping, Memphis jookin', and voguing. These movements combine the complexity of dance choreography with the challenges of gymnastics and acrobatic movements. Despite high injury rates in hip hop dance, particularly in breakdance, to date there are no published biomechanical studies in this population. The purpose of this study was to compare representative hip hop steps found in breakdance (toprock and breaking) and house and provide descriptive statistics of the angular displacements that occurred in these sequences. Six expert female hip hop dancers performed three choreographed dance sequences, top rock, breaking, and house, to standardized music-based tempos. Hip, knee, and ankle kinematics were collected during sequences that were 18 to 30 sec long. Hip, knee, and ankle three-dimensional peak joint angles were compared in repeated measures ANOVAs with post hoc tests where appropriate (p<0.01). Peak angles of the breaking sequence, which included floorwork, exceeded the other two sequences in the majority of planes and joints. Hip hop maximal joint angles exceeded reported activities of daily living and high injury sports such as gymnastics. Hip hop dancers work at weight-bearing joint end ranges where muscles are at a functional disadvantage. These results may explain why lower extremity injury rates are high in this population.
Čeh, Barbara; Kač, Milica; Košir, Iztok J.; Abram, Veronika
2007-01-01
The effect of water supply – especially of drought stress – on the content of some secondary metabolites in hops (Humulus lupulus L.) was studied. The experiment took place in 2006. Some relevant data from 2005 were included for comparison. Leaves and cones of nine hop cultivars grown under field conditions as well as in a pot experiment under three water regimes were analyzed. The cultivars ranged from those most grown in Slovenia to promising crossbreed being tested. Leaves were sampled from July 18, 2006 to August 18, 2006, while cones were picked in the time of technological maturity. Standard analytical methods were applied to determine the contents of xanthohumol, polyphenols and α-acids in hop leaves and hop cones. The contents of the secondary metabolites in question depended more on the cultivar under investigation than on the water supply, at least as far the growing conditions for a relatively normal development of the plant were met.
Deterministic Multi-hop Controlled Teleportation of Arbitrary Single-Qubit State
NASA Astrophysics Data System (ADS)
Peng, Jia-yin; Bai, Ming-qiang; Mo, Zhi-wen
2017-10-01
Multi-hop teleportation is of great significance due to long-distance delivery of quantum information and wireless quantum communication networks. In existing protocols of multi-hop teleportation, the more nodes, the smaller the success probability. In this paper, fusing the ideas of multi-hop teleportation and controlled teleportation, we put forward a scheme for implementing multi-hop controlled teleportation of single-qubit state. A set of ingenious three-qubit non-maximally entangled states are constructed to serve as the quantum channels. The information is perfectly transmitted hop by hop through teleportation under the control of the supervisors. Unit success probability can be achieved independent of channel's entanglement degree and the number of intermediate nodes. Only Pauli operations, single-qubit rotation, Hadamard gate, controlled-NOT gate, Bell-state measurement and single-qubit measurement are used in our scheme, so this scheme is easily realized in physical experiment.
NASA Astrophysics Data System (ADS)
Mariappan, C. R.
2014-05-01
AC conductivity spectra of Li-analogues NASICON-type Li1.5Al0.5Ge1.5P3O12 (LAGP), Li-Al-Ti-P-O (LATP) glass-ceramics and garnet-type Li7La2Ta2O13 (LLTO) ceramic are analyzed by universal power law and Summerfield scaling approaches. The activation energies and pre-exponential factors of total and grain conductivities are following the Meyer-Neldel (M-N) rule for NASICON-type materials. However, the garnet-type LLTO material deviates from the M-N rule line of NASICON-type materials. The frequency- and temperature-dependent conductivity spectra of LAGP and LLTO are superimposed by Summerfield scaling. The scaled conductivity curves of LATP are not superimposed at the grain boundary response region. The superimposed conductivity curves are observed at cross-over frequencies of grain boundary response region for LATP by incorporating the exp ( {{{ - (EAt - EAg )} {{{ - (EAt - EAg )} {kT}}} ) factor along with Summerfield scaling factors on the frequency axis, where EAt and EAg are the activation energies of total and grain conductivities, respectively.
Kappagantu, Madhu; Villamor, Dan Edward V; Bullock, Jeff M; Eastwell, Kenneth C
2017-07-01
Hop stunt disease caused by Hop stunt viroid (HSVd) is a growing threat to hop cultivation globally. HSVd spreads mainly by use of contaminated planting material and by mechanical means. Thorough testing of hop yards and removal of infected bines are critical components of efforts to control the spread of the disease. Reverse transcription-polymerase chain reaction (RT-PCR) has become the primary technique used for HSVd detection; however, sample handling and analysis are technically challenging. In this study, a robust reverse transcription-recombinase polymerase amplification (RT-RPA) assay was developed to facilitate analysis of multiple samples. The assay was optimized with all major variants of HSVd from other host species in addition to hop variants. Used in conjunction with sample collection cards, RT-RPA accommodates large sample numbers. Greenhouse and farm samples tested with RT-RPA were also tested with RT-PCR and a 100% correlation between the two techniques was found. Copyright © 2017. Published by Elsevier B.V.
Toward Hip-Hop Pedagogies for Music Education
ERIC Educational Resources Information Center
Kruse, Adam J.
2016-01-01
Music education scholarship in the areas of popular, vernacular, and participatory musicianship has grown in the past decades; however, music education research concerned specifically with hip-hop has been relatively scarce. Because hip-hop music can differ tremendously from the traditional western genres with which many music educators are most…
21 CFR 172.560 - Modified hop extract.
Code of Federal Regulations, 2010 CFR
2010-04-01
... manufactured by one of the following processes: (1) The additive is manufactured from a hexane extract of hops... solids is made up in approximately 0.012 n alkaline methyl alcohol (6 milliliters of 1 n sodium hydroxide... hops by a sequence of extractions and fractionations, using methylene chloride, hexane, and methyl...
21 CFR 172.560 - Modified hop extract.
Code of Federal Regulations, 2013 CFR
2013-04-01
... manufactured by one of the following processes: (1) The additive is manufactured from a hexane extract of hops... solids is made up in approximately 0.012 n alkaline methyl alcohol (6 milliliters of 1 n sodium hydroxide... hops by a sequence of extractions and fractionations, using methylene chloride, hexane, and methyl...
21 CFR 172.560 - Modified hop extract.
Code of Federal Regulations, 2012 CFR
2012-04-01
... manufactured by one of the following processes: (1) The additive is manufactured from a hexane extract of hops... solids is made up in approximately 0.012 n alkaline methyl alcohol (6 milliliters of 1 n sodium hydroxide... hops by a sequence of extractions and fractionations, using methylene chloride, hexane, and methyl...
21 CFR 172.560 - Modified hop extract.
Code of Federal Regulations, 2011 CFR
2011-04-01
... manufactured by one of the following processes: (1) The additive is manufactured from a hexane extract of hops... solids is made up in approximately 0.012 n alkaline methyl alcohol (6 milliliters of 1 n sodium hydroxide... hops by a sequence of extractions and fractionations, using methylene chloride, hexane, and methyl...
Framing and Reviewing Hip-Hop Educational Research
ERIC Educational Resources Information Center
Petchauer, Emery
2009-01-01
Hip-hop has become relevant to the field of education because of its implications for understanding language, learning, identity, curriculum, and other areas. This integrative review provides historical context and cohesion for the burgeoning and discursive body of hip-hop scholarship by framing it according to three heuristic categories and…
Internal twisting motion dependent conductance of an aperiodic DNA molecule
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta
The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less
Vortex variable range hopping in a conventional superconducting film
NASA Astrophysics Data System (ADS)
Percher, Ilana M.; Volotsenko, Irina; Frydman, Aviad; Shklovskii, Boris I.; Goldman, Allen M.
2017-12-01
The behavior of a disordered amorphous thin film of superconducting indium oxide has been studied as a function of temperature and magnetic field applied perpendicular to its plane. A superconductor-insulator transition has been observed, though the isotherms do not cross at a single point. The curves of resistance versus temperature on the putative superconducting side of this transition, where the resistance decreases with decreasing temperature, obey two-dimensional Mott variable-range hopping of vortices over wide ranges of temperature and resistance. To estimate the parameters of hopping, the film is modeled as a granular system and the hopping of vortices is treated in a manner analogous to hopping of charges. The reason the long-range interaction between vortices over the range of magnetic fields investigated does not lead to a stronger variation of resistance with temperature than that of two-dimensional Mott variable-range hopping remains unresolved.
NASA Astrophysics Data System (ADS)
Laurita, N. J.; Morris, C. M.; Koohpayeh, S. M.; Phelan, W. A.; McQueen, T. M.; Armitage, N. P.
2018-05-01
Recent experiments have uncovered evidence of low energy excitations in the bulk of SmB6 that are perhaps associated with unconventional quasiparticles, bringing into question whether this Kondo "insulator" is truly insulating in the bulk. Recently, we demonstrated that SmB6 possesses significant in-gap bulk ac conduction far in excess of typical disordered semiconductors. Whether such conduction is an intrinsic feature of SmB6, suggesting the formation of an exotic state, or residual conduction from impurities continues to be a topic of debate. Here, we further examine the origin of the ac optical conductivity of SmB6 in light of recent experimental and theoretical developments. The optical conductivity of SmB6 is shown to possess distinct regimes of either dominant free carrier or localized response contributions. The free carrier response is found to be in good qualitative agreement with previous literature, although quantitative differences are revealed and discussed. The localized response, which dominates at the lowest temperatures, is analyzed in the context of models of either in-gap impurity states or an exotic neutral Fermi surface. The charge density or effective mass of this low temperature in-gap conductivity is extracted through a conductivity sum rule analysis and found to be in general alignment with both models in the appropriate limits. Our results shed further light on the nature of the in-gap states of SmB6.
NASA Astrophysics Data System (ADS)
M, Dongol; M, M. El-Nahass; A, El-Denglawey; A, A. Abuelwafa; T, Soga
2016-06-01
Alternating current (AC) conductivity and dielectric properties of thermally evaporated Au/PtOEP/Au thin films are investigated each as a function of temperature (303 K-473 K) and frequency (50 Hz-5 MHz). The frequency dependence of AC conductivity follows the Jonscher universal dynamic law. The AC-activation energies are determined at different frequencies. It is found that the correlated barrier hopping (CBH) model is the dominant conduction mechanism. The variation of the frequency exponent s with temperature is analyzed in terms of the CBH model. Coulombic barrier height W m , hopping distance R ω , and the density of localized states N(E F) are valued at different frequencies. Dielectric constant ɛ 1(ω,T) and dielectric loss ɛ 2(ω,T) are discussed in terms of the dielectric polarization process. The dielectric modulus shows the non-Debye relaxation in the material. The extracted relaxation time by using the imaginary part of modulus (M″) is found to follow the Arrhenius law.
Optimum Detection Of Slow-Frequency-Hopping Signals
NASA Technical Reports Server (NTRS)
Levitt, Barry K.; Cheng, Unjeng
1994-01-01
Two papers present theoretical analyses of various schemes for coherent and noncoherent detection of M-ary-frequency-shift-keyed (MFSK) signals with slow frequency hopping. Special attention focused on continuous-phase-modulation (CPM) subset of SFH/MFSK signals, for which frequency modulation such carrier phase remains continuous (albeit unknown) during each hop.
NASA Astrophysics Data System (ADS)
Liao, Zhikun; Lu, Dawei; Hu, Jiemin; Zhang, Jun
2018-04-01
For the random hopping frequency signal, the modulated frequencies are randomly distributed over given bandwidth. The randomness of modulated frequency not only improves the electronic counter countermeasure capability for radar systems, but also determines its performance of range compression. In this paper, the range ambiguity function of RHF signal is firstly derived. Then, a design method of frequency hopping pattern based on stationary phase principle to improve the peak to side-lobe ratio is proposed. Finally, the simulated experiments show a good effectiveness of the presented design method.
Varietal discrimination of hop pellets by near and mid infrared spectroscopy.
Machado, Julio C; Faria, Miguel A; Ferreira, Isabel M P L V O; Páscoa, Ricardo N M J; Lopes, João A
2018-04-01
Hop is one of the most important ingredients of beer production and several varieties are commercialized. Therefore, it is important to find an eco-real-time-friendly-low-cost technique to distinguish and discriminate hop varieties. This paper describes the development of a method based on vibrational spectroscopy techniques, namely near- and mid-infrared spectroscopy, for the discrimination of 33 commercial hop varieties. A total of 165 samples (five for each hop variety) were analysed by both techniques. Principal component analysis, hierarchical cluster analysis and partial least squares discrimination analysis were the chemometric tools used to discriminate positively the hop varieties. After optimizing the spectral regions and pre-processing methods a total of 94.2% and 96.6% correct hop varieties discrimination were obtained for near- and mid-infrared spectroscopy, respectively. The results obtained demonstrate the suitability of these vibrational spectroscopy techniques to discriminate different hop varieties and consequently their potential to be used as an authenticity tool. Compared with the reference procedures normally used for hops variety discrimination these techniques are quicker, cost-effective, non-destructive and eco-friendly. Copyright © 2017 Elsevier B.V. All rights reserved.
Efros-Shklovskii variable range hopping and nonlinear transport in 1 T /1 T'-MoS2
NASA Astrophysics Data System (ADS)
Papadopoulos, N.; Steele, G. A.; van der Zant, H. S. J.
2017-12-01
We have studied temperature- and electric-field-dependent carrier transport in single flakes of MoS2 treated with n -butyllithium. The temperature dependence of the four-terminal resistance follows the Efros-Shklovskii variable range hopping conduction mechanism. From measurements in the Ohmic and non-Ohmic regime, we estimate the localization length and the average hopping length of the carriers, as well as the effective dielectric constant. Furthermore, a comparison between two- and four-probe measurements yields a contact resistance that increases significantly with decreasing temperature.
ERIC Educational Resources Information Center
Porfilio, Brad J., Ed.; Viola, Michael J., Ed.
2012-01-01
Illuminating hip-hop as an important cultural practice and a global social movement, this collaborative project highlights the emancipatory messages and cultural work generated by the organic intellectuals of global hip-hop. Contributors describe the social realities--globalization, migration, poverty, criminalization, and racism--youth are…
Three-Dimensional Tracking of Interfacial Hopping Diffusion
NASA Astrophysics Data System (ADS)
Wang, Dapeng; Wu, Haichao; Schwartz, Daniel K.
2017-12-01
Theoretical predictions have suggested that molecular motion at interfaces—which influences processes including heterogeneous catalysis, (bio)chemical sensing, lubrication and adhesion, and nanomaterial self-assembly—may be dominated by hypothetical "hops" through the adjacent liquid phase, where a diffusing molecule readsorbs after a given hop according to a probabilistic "sticking coefficient." Here, we use three-dimensional (3D) single-molecule tracking to explicitly visualize this process for human serum albumin at solid-liquid interfaces that exert varying electrostatic interactions on the biomacromolecule. Following desorption from the interface, a molecule experiences multiple unproductive surface encounters before readsorption. An average of approximately seven surface collisions is required for the repulsive surfaces, decreasing to approximately two and a half for surfaces that are more attractive. The hops themselves are also influenced by long-range interactions, with increased electrostatic repulsion causing hops of longer duration and distance. These findings explicitly demonstrate that interfacial diffusion is dominated by biased 3D Brownian motion involving bulk-surface coupling and that it can be controlled by influencing short- and long-range adsorbate-surface interactions.
NASA Astrophysics Data System (ADS)
Youn, Joo-Sang; Seok, Seung-Joon; Kang, Chul-Hee
This paper presents a new QoS model for end-to-end service provisioning in multi-hop wireless networks. In legacy IEEE 802.11e based multi-hop wireless networks, the fixed assignment of service classes according to flow's priority at every node causes priority inversion problem when performing end-to-end service differentiation. Thus, this paper proposes a new QoS provisioning model called Dynamic Hop Service Differentiation (DHSD) to alleviate the problem and support effective service differentiation between end-to-end nodes. Many previous works for QoS model through the 802.11e based service differentiation focus on packet scheduling on several service queues with different service rate and service priority. Our model, however, concentrates on a dynamic class selection scheme, called Per Hop Class Assignment (PHCA), in the node's MAC layer, which selects a proper service class for each packet, in accordance with queue states and service requirement, in every node along the end-to-end route of the packet. The proposed QoS solution is evaluated using the OPNET simulator. The simulation results show that the proposed model outperforms both best-effort and 802.11e based strict priority service models in mobile ad hoc environments.
ERIC Educational Resources Information Center
Pulido, Isaura
2009-01-01
Using Critical Race and Latino Critical theories, this study examines 20 in-depth interviews conducted by the author with Mexican and Puerto Rican youth from the Chicago area. The author contends that youth utilized hip hop music in multiple and overlapping ways, engaging hip hop music as both a pedagogy that centers the perspectives of people of…
Gold Binding by Native and Chemically Modified Hops Biomasses
López, M. Laura; Gardea-Torresdey, J. L.; Peralta-Videa, J. R.; ...
2005-01-01
Heavy metals from mining, smelting operations and other industrial processing facilities pollute wastewaters worldwide. Extraction of metals from industrial effluents has been widely studied due to the economic advantages and the relative ease of technical implementation. Consequently, the search for new and improved methodologies for the recovery of gold has increased. In this particular research, the use of cone hops biomass ( Humulus lupulus ) was investigated as a new option for gold recovery. The results showed that the gold binding to native hops biomass was pH dependent from pH 2 to pH 6, with a maximum percentage binding atmore » pH 3. Time dependency studies demonstrated that Au(III) binding to native and modified cone hops biomasses was found to be time independent at pH 2 while at pH 5, it was time dependent. Capacity experiments demonstrated that at pH 2, esterified hops biomass bound 33.4 mg Au/g of biomass, while native and hydrolyzed hops biomasses bound 28.2 and 12.0 mg Au/g of biomass, respectively. However, at pH 5 the binding capacities were 38.9, 37.8 and 11.4 mg of Au per gram of native, esterified and hydrolyzed hops biomasses, respectively.« less
Gold Binding by Native and Chemically Modified Hops Biomasses
López, M. Laura; Peralta-Videa, J. R.; de la Rosa, G.; Armendáriz, V.; Herrera, I.; Troiani, H.; Henning, J.
2005-01-01
Heavy metals from mining, smelting operations and other industrial processing facilities pollute wastewaters worldwide. Extraction of metals from industrial effluents has been widely studied due to the economic advantages and the relative ease of technical implementation. Consequently, the search for new and improved methodologies for the recovery of gold has increased. In this particular research, the use of cone hops biomass (Humulus lupulus) was investigated as a new option for gold recovery. The results showed that the gold binding to native hops biomass was pH dependent from pH 2 to pH 6, with a maximum percentage binding at pH 3. Time dependency studies demonstrated that Au(III) binding to native and modified cone hops biomasses was found to be time independent at pH 2 while at pH 5, it was time dependent. Capacity experiments demonstrated that at pH 2, esterified hops biomass bound 33.4 mg Au/g of biomass, while native and hydrolyzed hops biomasses bound 28.2 and 12.0 mg Au/g of biomass, respectively. However, at pH 5 the binding capacities were 38.9, 37.8 and 11.4 mg of Au per gram of native, esterified and hydrolyzed hops biomasses, respectively. PMID:18365087
Being Hip-Hop: Beyond Skills and Songs
ERIC Educational Resources Information Center
Kruse, Adam J.
2016-01-01
In this article, I offer four principles relevant to hip-hop cultures (keep it real, flip the script, make some noise, and stay fresh) and explore how these principles might affect music classrooms. I argue that a music classroom that works to keep it real, flip the script, make some noise, and stay fresh might go beyond teaching hip-hop skills…
HopBase: A unified resource for Humulus genomics
USDA-ARS?s Scientific Manuscript database
Hop (Humulus lupulus L. var lupulus) is a plant of worldwide significance, used primarily for its’ bittering and flavoring in brewing beer. Studies on the medicinal properties of several unique compounds produced by hop has led to additional interest from pharmacy and healthcare industries as well a...
ERIC Educational Resources Information Center
Buchanan, Ian P.
2013-01-01
Using a critical race lens, this narrative study employs a focus group design to explore the intersections between black males, hip hop culture and schooling experiences. To provide a sociocultural grounding, this study first reviews the research literature around hip hop culture.s sociocultural development and its impact as a culture force that…
Standardization of Weed Pollen Extracts, Japanese Hop and Mugwort, in Korea
Jeong, Kyoung Yong; Son, Mina; Choi, Soo-Young; Park, Kyung Hee; Park, Hye Jung; Hong, Chein-Soo; Lee, Jae-Hyun
2016-01-01
Purpose Japanese hop (Humulus spp.) and mugwort (Artemisia spp.) are notable causes of autumn pollinosis in East Asia. However, Japanese hop and mugwort pollen extracts, which are widely used for the diagnosis, have not been standardized. This study was performed to standardize Japanese hop and mugwort pollen extracts. Materials and Methods Allergen extracts were prepared in a standardized way using locally collected Humulus japonicus and purchased Artemisia vulgaris pollens. The immunoglobulin E (IgE) reactivities of prepared extracts were compared with commercial extracts via IgE immunoblotting and inhibition analyses. Intradermal skin tests were performed to determine the bioequivalent allergy unit (BAU). Results The IgE reactive components of the extracts via IgE immunoblotting were similar to those of commercial extracts. A 11-kDa allergen showed the strongest IgE reactivity in Japanese hop, as did a 28-kDa allergen in mugwort pollen extracts. Allergenic potencies of the investigatory Japanese hop and mugwort extracts were essentially indistinguishable from the commercial ones. Sums of erythema of 50 mm by the intradermal skin test (ΣED50) were calculated to be 14.4th and 13.6th three-fold dilutions for Japanese hop and mugwort extracts, respectively. Therefore, the allergenic activity of the prepared extracts was 90827.4 BAU/mg for Japanese hop and 34412 BAU/mg for mugwort. Conclusion We produced Japanese hop and mugwort pollen extracts using a standardized method. Standardized Japanese hop and mugwort pollen extracts will facilitate the production of improved diagnostic and immunotherapeutic reagents. PMID:26847293
Resonant Mode-hopping Micromixing
Jang, Ling-Sheng; Chao, Shih-Hui; Holl, Mark R.; Meldrum, Deirdre R.
2009-01-01
A common micromixer design strategy is to generate interleaved flow topologies to enhance diffusion. However, problems with these designs include complicated structures and dead volumes within the flow fields. We present an active micromixer using a resonating piezoceramic/silicon composite diaphragm to generate acoustic streaming flow topologies. Circulation patterns are observed experimentally and correlate to the resonant mode shapes of the diaphragm. The dead volumes in the flow field are eliminated by rapidly switching from one discrete resonant mode to another (i.e., resonant mode-hop). Mixer performance is characterized by mixing buffer with a fluorescence tracer containing fluorescein. Movies of the mixing process are analyzed by converting fluorescent images to two-dimensional fluorescein concentration distributions. The results demonstrate that mode-hopping operation rapidly homogenized chamber contents, circumventing diffusion-isolated zones. PMID:19551159
Energy landscape in frustrated systems: Cation hopping in pyrochlores
NASA Astrophysics Data System (ADS)
Brooks Hinojosa, Beverly; Asthagiri, Aravind; Nino, Juan C.
2013-07-01
We investigate the dynamics of the local environment and electronic structure in inherently dipolar frustrated pyrochlore compounds to help identify the fundamental nature of dipolar disorder in pyrochlore systems and determine the necessary and sufficient conditions for dielectric relaxation. We map out the energy landscape associated with cation hopping events in three compounds and correlate the hopping pathway with experimental dielectric response. Comprehensive analysis of the calculations allows us to postulate rules to predict the occurrence of relaxation and cation hopping pathways.
Kalveram, Karl Theodor; Haeufle, Daniel F B; Seyfarth, André; Grimmer, Sten
2012-01-01
While hopping, 12 subjects experienced a sudden step down of 5 or 10 cm. Results revealed that the hopping style was "terrain following". It means that the subjects pursued to keep the distance between maximum hopping height (apex) and ground profile constant. The spring-loaded inverse pendulum (SLIP) model, however, which is currently considered as template for stable legged locomotion would predict apex-preserving hopping, by which the absolute maximal hopping height is kept constant regardless of changes of the ground level. To get more insight into the physics of hopping, we outlined two concepts of energy management: "constant energy supply", by which in each bounce--regardless of perturbations--the same amount of mechanical energy is injected, and "lost energy supply", by which the mechanical energy that is going to be dissipated in the current cycle is assessed and replenished. When tested by simulations and on a robot testbed capable of hopping, constant energy supply generated stable and robust terrain following hopping, whereas lost energy supply led to something like apex-preserving hopping, which, however, lacks stability as well as robustness. Comparing simulated and machine hopping with human hopping suggests that constant energy supply has a good chance to be used by humans to generate hopping.
Quantitative Improvements in Hop Test Scores After a 6-Week Neuromuscular Training Program.
Meierbachtol, Adam; Rohman, Eric; Paur, Eric; Bottoms, John; Tompkins, Marc
2016-09-12
In patients who have undergone anterior cruciate ligament reconstruction (ACLR), the effect of neuromuscular re-education (NMR) programs on standard hop tests outcomes, including limb symmetry indices (LSIs), is unknown. Both legs will show improvement in hop test-measured units after neuromuscular training, but the involved leg will show relatively greater improvement leading to improved limb symmetry. Patients younger than 18 years will show more improvement than patients who are older. Retrospective cohort study. Level 3. Patients self-selected their participation in this NMR program, which was completed after traditional outpatient physical therapy. Pre- and post-hop test scores were recorded as the primary outcome measure. Seventy-one patients met the inclusion criteria and completed hop testing. Overall, the involved leg showed significant improvements (pretest/posttest) for single-leg hop (138.30 cm/156.89 cm), triple crossover hop (370.05 cm/423.11 cm), and timed hop (2.21 s/1.99 s). Similarly, on the uninvolved leg, improvements were seen for the single-leg hop (159.30 cm/171.87 cm) and triple crossover hop (427.50 cm/471.27 cm). Overall mean limb symmetry improved across all 4 hop tests, but there was significant improvement only on the single-leg hop (87% pretest to 92% posttest). Patients younger than 18 years showed mean significant LSI improvement on the triple crossover hop. Utilizing an intensive 6-week NMR program after ACLR prior to return to sport can improve quantitative hop test measurements. Patients younger than 18 years had greater improvement than those 18 years and older. Advanced NMR programs can be successfully utilized in the postoperative ACLR setting to improve quantitative limb symmetry. © 2016 The Author(s).
Quantitative Improvements in Hop Test Scores After a 6-Week Neuromuscular Training Program
Meierbachtol, Adam; Rohman, Eric; Paur, Eric; Bottoms, John; Tompkins, Marc
2016-01-01
Background: In patients who have undergone anterior cruciate ligament reconstruction (ACLR), the effect of neuromuscular re-education (NMR) programs on standard hop tests outcomes, including limb symmetry indices (LSIs), is unknown. Hypothesis: Both legs will show improvement in hop test–measured units after neuromuscular training, but the involved leg will show relatively greater improvement leading to improved limb symmetry. Patients younger than 18 years will show more improvement than patients who are older. Study Design: Retrospective cohort study. Level of Evidence: Level 3. Methods: Patients self-selected their participation in this NMR program, which was completed after traditional outpatient physical therapy. Pre– and post–hop test scores were recorded as the primary outcome measure. Results: Seventy-one patients met the inclusion criteria and completed hop testing. Overall, the involved leg showed significant improvements (pretest/posttest) for single-leg hop (138.30 cm/156.89 cm), triple crossover hop (370.05 cm/423.11 cm), and timed hop (2.21 s/1.99 s). Similarly, on the uninvolved leg, improvements were seen for the single-leg hop (159.30 cm/171.87 cm) and triple crossover hop (427.50 cm/471.27 cm). Overall mean limb symmetry improved across all 4 hop tests, but there was significant improvement only on the single-leg hop (87% pretest to 92% posttest). Patients younger than 18 years showed mean significant LSI improvement on the triple crossover hop. Conclusion: Utilizing an intensive 6-week NMR program after ACLR prior to return to sport can improve quantitative hop test measurements. Patients younger than 18 years had greater improvement than those 18 years and older. Clinical Relevance: Advanced NMR programs can be successfully utilized in the postoperative ACLR setting to improve quantitative limb symmetry. PMID:27620968
Flipping the Misogynist Script: Gender, Agency, Hip Hop and Music Education
ERIC Educational Resources Information Center
Tobias, Evan S.
2014-01-01
Excluding Hip Hop culture and rap music from music education misses opportunities for addressing key aspects of popular culture, society, and students' lives. This article addresses intersections of Hip Hop, gender, and music education to forward potential Hip Hop praxis. After tracing related scholarship, I discuss and problematize…
Hip Hop Dance Experience Linked to Sociocognitive Ability.
Bonny, Justin W; Lindberg, Jenna C; Pacampara, Marc C
2017-01-01
Expertise within gaming (e.g., chess, video games) and kinesthetic (e.g., sports, classical dance) activities has been found to be linked with specific cognitive skills. Some of these skills, working memory, mental rotation, problem solving, are linked to higher performance in science, technology, math, and engineering (STEM) disciplines. In the present study, we examined whether experience in a different activity, hip hop dance, is also linked to cognitive abilities connected with STEM skills as well as social cognition ability. Dancers who varied in hip hop and other dance style experience were presented with a set of computerized tasks that assessed working memory capacity, mental rotation speed, problem solving efficiency, and theory of mind. We found that, when controlling for demographic factors and other dance style experience, those with greater hip hop dance experience were faster at mentally rotating images of hands at greater angle disparities and there was a trend for greater accuracy at identifying positive emotions displayed by cropped images of human faces. We suggest that hip hop dance, similar to other more technical activities such as video gameplay, tap some specific cognitive abilities that underlie STEM skills. Furthermore, we suggest that hip hop dance experience can be used to reach populations who may not otherwise be interested in other kinesthetic or gaming activities and potentially enhance select sociocognitive skills.
Hip Hop Dance Experience Linked to Sociocognitive Ability
Bonny, Justin W.; Lindberg, Jenna C.; Pacampara, Marc C.
2017-01-01
Expertise within gaming (e.g., chess, video games) and kinesthetic (e.g., sports, classical dance) activities has been found to be linked with specific cognitive skills. Some of these skills, working memory, mental rotation, problem solving, are linked to higher performance in science, technology, math, and engineering (STEM) disciplines. In the present study, we examined whether experience in a different activity, hip hop dance, is also linked to cognitive abilities connected with STEM skills as well as social cognition ability. Dancers who varied in hip hop and other dance style experience were presented with a set of computerized tasks that assessed working memory capacity, mental rotation speed, problem solving efficiency, and theory of mind. We found that, when controlling for demographic factors and other dance style experience, those with greater hip hop dance experience were faster at mentally rotating images of hands at greater angle disparities and there was a trend for greater accuracy at identifying positive emotions displayed by cropped images of human faces. We suggest that hip hop dance, similar to other more technical activities such as video gameplay, tap some specific cognitive abilities that underlie STEM skills. Furthermore, we suggest that hip hop dance experience can be used to reach populations who may not otherwise be interested in other kinesthetic or gaming activities and potentially enhance select sociocognitive skills. PMID:28146562
Smith, Christopher E; Odoh, Samuel O; Ghosh, Soumen; Gagliardi, Laura; Cramer, Christopher J; Frisbie, C Daniel
2015-12-23
Self-assembled conjugated molecular wires containing thiophene up to 6 nm in length were grown layer-by-layer using click chemistry. Reflection-absorption infrared spectroscopy, ellipsometry and X-ray photoelectron spectroscopy were used to follow the stepwise growth. The electronic structure of the conjugated wires was studied with cyclic voltammetry and UV-vis spectroscopy as well as computationally with density functional theory (DFT). The current-voltage curves (±1 V) of the conjugated molecular wires were measured with conducting probe atomic force microscopy (CP-AFM) in which the molecular wire film bound to a gold substrate was contacted with a conductive AFM probe. By systematically measuring the low bias junction resistance as a function of length for molecules 1-4 nm long, we extracted the structure dependent tunneling attenuation factor (β) of 3.4 nm(-1) and a contact resistance of 220 kΩ. The crossover from tunneling to hopping transport was observed at a molecular length of 4-5 nm with an activation energy of 0.35 eV extracted from Arrhenius plots of resistance versus temperature. DFT calculations revealed localizations of spin densities (polarons) on molecular wire radical cations. The calculations were employed to gauge transition state energies for hopping of polarons along wire segments. Individual estimated transition state energies were 0.2-0.4 eV, in good agreement with the experimental activation energy. The transition states correspond to flattening of dihedral angles about specific imine bonds. These results open up possibilities to further explore the influence of molecular architecture on hopping transport in molecular junctions, and highlight the utility of DFT to understand charge localization and associated hopping-based transport.
Kline, Paul W; Burnham, Jeremy; Yonz, Michael; Johnson, Darren; Ireland, Mary Lloyd; Noehren, Brian
2018-04-01
Quadriceps strength and single-leg hop performance are commonly evaluated prior to return to sport after anterior cruciate ligament reconstruction (ACLR). However, few studies have documented potential hip strength deficits after ACLR, or ascertained the relative contribution of quadriceps and hip strength to hop performance. Patients cleared for return to sports drills after ACLR were compared to a control group. Participants' peak isometric knee extension, hip abduction, hip extension, and hip external rotation (HER) strength were measured. Participants also performed single-leg hops, timed hops, triple hops, and crossover hops. Between-limb comparisons for the ACLR to control limb and the non-operative limb were made using independent two-sample and paired sample t tests. Pearson's correlations and stepwise multiple linear regression were used to determine the relationships and predictive ability of limb strength, graft type, sex, and limb dominance to hop performance. Sixty-five subjects, 20 ACLR [11F, age 22.8 (15-45) years, 8.3 ± 2 months post-op, mass 70.47 ± 12.95 kg, height 1.71 ± 0.08 m, Tegner 5.5 (3-9)] and 45 controls [22F, age 25.8 (15-45) years, mass 74.0 ± 15.2 kg, height 1.74 ± 0.1 m, Tegner 6 (3-7)], were tested. Knee extension (4.4 ± 1.5 vs 5.4 ± 1.8 N/kg, p = 0.02), HER (1.4 ± 0.4 vs 1.7 ± 0.5 N/kg, p = 0.04), single-leg hop (146 ± 37 vs 182 ± 38% limb length, p < 0.01), triple hop (417 ± 106 vs 519 ± 102% limb length, p < 0.01), timed hop (3.3 ± 2.0 vs 2.3 ± 0.6 s, p < 0.01), and crossover hop (364 ± 107 vs 446 ± 123% limb length, p = 0.01) were significantly impaired in the operative versus control subject limbs. Similar deficits existed between the operative and non-operative limbs. Knee extension and HER strength were significantly correlated with each of the hop tests, but only HER significantly predicted hop performance. After ACLR, patients have persistent HER strength
Single-leg hop testing following fatiguing exercise: reliability and biomechanical analysis.
Augustsson, J; Thomeé, R; Lindén, C; Folkesson, M; Tranberg, R; Karlsson, J
2006-04-01
A fatiguing exercise protocol was combined with single-leg hop testing to improve the possibilities of evaluating the effects of training or rehabilitation interventions. In the first test-retest experiment, 11 healthy male subjects performed two trials of single-leg hops under three different test conditions: non-fatigued and following fatiguing exercise, which consisted of unilateral weight machine knee extensions at 80% and 50%, respectively, of 1 repetition maximum (1 RM) strength. Intraclass correlation coefficients ranged from 0.75 to 0.98 for different hop test conditions, indicating that all tests were reliable. For the second experiment, eight healthy male subjects performed the fatiguing exercise protocol to investigate how fatigue influences lower-extremity joint kinematics and kinetics during single-leg hops. Hip, knee and ankle joint angles, moments and powers, as well as ground-reaction forces were recorded with a six-camera, motion-capture system and a force platform. Recovery of hop performance following the fatiguing exercise was also measured. During the take-off for the single-leg hops, hip and knee flexion angles, generated powers for the knee and ankle joints, and ground-reaction forces decreased for the fatigued hop conditions compared with the non-fatigued condition (P<0.05). Compared with landing during the non-fatigued condition, hip moments and ground-reaction forces were lower for the fatigued hop conditions (P<0.05). The negative joint power was two to three times greater for the knee than for the hip and five to 10 times greater for the knee than for the ankle during landing for all test conditions (P<0.05). Most measured variables had recovered three minutes post-exercise. It is concluded that the fatiguing exercise protocol combined with single-leg hop testing was a reliable method for investigating functional performance under fatigued test conditions. Further, subjects utilized an adapted hop strategy, which employed less hip and
Rethinking Pedagogy in Urban Spaces: Implementing Hip-Hop Pedagogy in the Urban Science Classroom
ERIC Educational Resources Information Center
Adjapong, Edmund S.; Emdin, Christopher
2015-01-01
A significant amount of research regarding Hip-Hop Based Education (HHBE) fails to provide insight on how to incorporate elements of Hip-Hop into daily teaching practices; rather Hip-Hop based educators focus mainly on incorporating Hip-Hop culture into curricula. This study explores the benefits of using two specific Hip-Hop pedagogical practices…
Treating primary insomnia - the efficacy of valerian and hops.
Salter, Shanah; Brownie, Sonya
2010-06-01
To evaluate the efficacy of valerian and hops in the treatment of primary insomnia. The AMED and MEDLINE databases were searched for primary sources of literature published between 1950 and 2009, using keywords: herbal medicine, medicinal plants, herbal, Valeriana officinalis, valerian, Humulus lupulus, hops, sleep, insomnia. Studies were included if they evaluated the efficacy of valerian or hops in improving primary insomnia in adults: sixteen studies met the inclusion criteria. Twelve of these found that the use of valerian, on its own, or in combination with hops, is associated with improvements in some sleep parameters (eg. sleep latency and quality of sleep). However, these results need to be interpreted cautiously as there were significant differences in design between the studies. Further randomised, double blind, placebo controlled trials are needed before such herbal treatments can be confidently recommended for the treatment of primary insomnia.
Reeb-Whitaker, Carolyn K; Bonauto, David K
2014-11-01
There is little published evidence for occupational respiratory disease caused by hop dust inhalation. In the United States, hops are commercially produced in the Pacific Northwest region. To describe occupational respiratory disease in hop workers. Washington State workers' compensation claims filed by hop workers for respiratory disease were systematically identified and reviewed. Incidence rates of respiratory disease in hop workers were compared with rates in field vegetable crop farm workers. Fifty-seven cases of respiratory disease associated with hop dust inhalation were reported from 1995 to 2011. Most cases (61%) were diagnosed by the attending health care practitioner as having work-related asthma. Seven percent of cases were diagnosed as chronic obstructive pulmonary disease, and the remaining cases were diagnosed as allergic respiratory disorders (eg, allergic rhinitis) or asthma-associated symptoms (eg, dyspnea). Cases were associated with hop harvesting, secondary hop processing, and indirect exposure. The incidence rate of respiratory disease in hop workers was 15 cases per 10,000 full-time workers, which was 30 times greater than the incidence rate for field vegetable crop workers. A strong temporal association between hop dust exposure and respiratory symptoms and a clear association between an increase in hop dust concentrations and the clinical onset of symptoms were apparent in 3 cases. Occupational exposure to hop dust is associated with respiratory disease. Respiratory disease rates were higher in hop workers than in a comparison group of agricultural workers. Additional research is needed before hop dust can be confirmed as a causative agent for occupational asthma. Copyright © 2014 American College of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.
Let Me Blow Your Mind: Hip Hop Feminist Futures in Theory and Praxis
ERIC Educational Resources Information Center
Lindsey, Treva B.
2015-01-01
This essay brings together key theoretical interventions in hip-hop feminism to explore the continued, but undervalued, significance of hip-hop feminism in urban education. More specifically, the essay challenges narrow conceptualizations of the "hip hop subject" as Black and male by using hip-hop feminist theory to incorporate the lived…
Gao, Zhengguang; Liu, Hongzhan; Ma, Xiaoping; Lu, Wei
2016-11-10
Multi-hop parallel relaying is considered in a free-space optical (FSO) communication system deploying binary phase-shift keying (BPSK) modulation under the combined effects of a gamma-gamma (GG) distribution and misalignment fading. Based on the best path selection criterion, the cumulative distribution function (CDF) of this cooperative random variable is derived. Then the performance of this optical mesh network is analyzed in detail. A Monte Carlo simulation is also conducted to demonstrate the effectiveness of the results for the average bit error rate (ABER) and outage probability. The numerical result proves that it needs a smaller average transmitted optical power to achieve the same ABER and outage probability when using the multi-hop parallel network in FSO links. Furthermore, the system use of more number of hops and cooperative paths can improve the quality of the communication.
Hopping Diffusion of Nanoparticles in Polymer Matrices
2016-01-01
We propose a hopping mechanism for diffusion of large nonsticky nanoparticles subjected to topological constraints in both unentangled and entangled polymer solids (networks and gels) and entangled polymer liquids (melts and solutions). Probe particles with size larger than the mesh size ax of unentangled polymer networks or tube diameter ae of entangled polymer liquids are trapped by the network or entanglement cells. At long time scales, however, these particles can diffuse by overcoming free energy barrier between neighboring confinement cells. The terminal particle diffusion coefficient dominated by this hopping diffusion is appreciable for particles with size moderately larger than the network mesh size ax or tube diameter ae. Much larger particles in polymer solids will be permanently trapped by local network cells, whereas they can still move in polymer liquids by waiting for entanglement cells to rearrange on the relaxation time scales of these liquids. Hopping diffusion in entangled polymer liquids and networks has a weaker dependence on particle size than that in unentangled networks as entanglements can slide along chains under polymer deformation. The proposed novel hopping model enables understanding the motion of large nanoparticles in polymeric nanocomposites and the transport of nano drug carriers in complex biological gels such as mucus. PMID:25691803
Multiple-hopping trajectories near a rotating asteroid
NASA Astrophysics Data System (ADS)
Shen, Hong-Xin; Zhang, Tian-Jiao; Li, Zhao; Li, Heng-Nian
2017-03-01
We present a study of the transfer orbits connecting landing points of irregular-shaped asteroids. The landing points do not touch the surface of the asteroids and are chosen several meters above the surface. The ant colony optimization technique is used to calculate the multiple-hopping trajectories near an arbitrary irregular asteroid. This new method has three steps which are as follows: (1) the search of the maximal clique of candidate target landing points; (2) leg optimization connecting all landing point pairs; and (3) the hopping sequence optimization. In particular this method is applied to asteroids 433 Eros and 216 Kleopatra. We impose a critical constraint on the target landing points to allow for extensive exploration of the asteroid: the relative distance between all the arrived target positions should be larger than a minimum allowed value. Ant colony optimization is applied to find the set and sequence of targets, and the differential evolution algorithm is used to solve for the hopping orbits. The minimum-velocity increment tours of hopping trajectories connecting all the landing positions are obtained by ant colony optimization. The results from different size asteroids indicate that the cost of the minimum velocity-increment tour depends on the size of the asteroids.
Framing Hip Hop: New Methodologies for New Times
ERIC Educational Resources Information Center
Dimitriadis, Greg
2015-01-01
This article revisits the central impulse behind early advocacy for ethnographic approaches to hip hop--that critics should try as much as possible to limit their own certainties around what hip hop can and might mean. While ethnographic approaches can engender the kinds of personal dislocations that allow for this negotiation, they do not…
Hip Hop Is Now: An Evolving Youth Culture
ERIC Educational Resources Information Center
Taylor, Carl; Taylor, Virgil
2007-01-01
Emerging from Rap music, Hip Hop has become a lifestyle to many modern youth around the world. Embodying both creativity and controversy, Hip Hop mirrors the values, violence, and hypocrisy of modern culture. The authors dispel some of the simplistic views that surround this evolving youth movement embraced by millions of young people who are…
ERIC Educational Resources Information Center
Brown, Bryan
2010-01-01
This review explores Edmin's "Science education for the hip-hop generation" by documenting how he frames hip-hop as a means to access urban student culture. He argues that hip-hop is more than a mere music genre, but rather a culture that provides young people with ways of connecting to the world. Two primary ideas emerged as central to…
Moriya, Hyuga; Tanaka, Sohei; Iida, Yukari; Kitagawa, Satomi; Aizawa, Sen-Ichi; Taga, Atsushi; Terashima, Hiroyuki; Yamamoto, Atsushi; Kodama, Shuji
2018-05-16
Xanthohumol, isoxanthohumol, and 8-prenylnaringenin in beer, hop, and hop pellet samples were analyzed by HPLC using InertSustain phenyl column and the mobile phase containing 40% methanol and 12% 2-propanol. Fractions of isoxanthohumol and 8-prenylnaringenin obtained by the above HPLC were separately collected. Isoxanthohumol and 8-prenylnaringenin were enantioseparated by HPLC using Chiralcel OD-H column with a mobile phase composed of hexane/ethanol (90/10, v/v) and Chiralpak AD-RH column with a mobile phase composed of methanol/2-propanol/water (40/20/40, v/v/v), respectively. Both of isoxanthohumol and 8-prenylnaringenin from beer, hop, and hop pellet samples were found to be a racemic mixture. This can be explained that the two analytes were produced by non-enzymatic process. The effects of boiling conditions on the conversion of xanthohumol into isoxanthohumol were also studied. A higher concentration of ethanol in heating solvent resulted in a decrease in the conversion ratio and the conversion was stopped by addition of ethanol more than 50% (v/v). The isomerization was significantly affected pH (2-10) and the boiling medium at pH 5 was minimum for the conversion. Therefore, it was suggested that xanthohumol was relatively difficult to convert to isoxanthohumol in wort (pH 5-5.5) during boiling. This article is protected by copyright. All rights reserved.
DC electrical conductivity of Ag2O-TeO2-V2O5 glassy systems
NASA Astrophysics Data System (ADS)
Souri, D.; Tahan, Z. Esmaeili; Salehizadeh, S. A.
2016-04-01
In the present article, samples of xAg2O-40TeO2-(60 - x)V2O5 ternary tellurite glasses with 0 ≤ x ≤ 50 (in mol%) have been prepared using the melt-quenching technique. XRD analysis, density measurement by Archimedes' law, determination of reduced vanadium ions by titration method, and electrical conductivity measurement by using four-probe methods have been done for these glasses. The mixed electronic-ionic conduction of these glasses has been investigated over a wide temperature range of 150-380 K. The experimental results have been analyzed with different theoretical models of hopping conduction. The analysis shows that at high temperatures the conductivity data are consistent with Mott's model of phonon-assisted polaronic hopping, while Mott's variable-range hopping model and Greaves' hopping model are valid at low temperatures. The temperature dependence of the conductivity has been also interpreted in the framework of the percolation model proposed by Triberis and Friedman. The analysis of the conductivity data also indicates that the hopping in these tellurite glasses occurs in the non-adiabatic regime. In each sample, based upon the justified transport mechanism, carrier density and mobility have been determined at different temperatures. The values of oxygen molar volume indicate the effect of Ag2O concentration on the thermal stability or fragility of understudied samples.
AC motor controller with 180 degree conductive switches
NASA Technical Reports Server (NTRS)
Oximberg, Carol A. (Inventor)
1995-01-01
An ac motor controller is operated by a modified time-switching scheme where the switches of the inverter are on for electrical-phase-and-rotation intervals of 180.degree. as opposed to the conventional 120.degree.. The motor is provided with three-phase drive windings, a power inverter for power supplied from a dc power source consisting of six switches, and a motor controller which controls the current controlled switches in voltage-fed mode. During full power, each switch is gated continuously for three successive intervals of 60.degree. and modulated for only one of said intervals. Thus, during each 60.degree. interval, the two switches with like signs are on continuously and the switch with the opposite sign is modulated.
Effect of swift heavy O7+ ion radiations on conductivity of lithium based polymer blend electrolyte
NASA Astrophysics Data System (ADS)
Joge, Prajakta; Kanchan, D. K.; Sharma, Poonam; Jayswal, Manish; Avasthi, D. K.
2014-07-01
In the present work, effect of swift heavy O7+ ion of 80 MeV of different fluences, on conductivity of [PVA(47.5)-PEO(47.5)-LiCF3SO3(5)]-EC(8) polymeric films has been investigated using ac impedance spectroscopy. The power law exponent n, hopping frequency ωh and activation energies for conduction Eac and relaxation Ear, have been investigated for different fluences. The DSC measurements are carried out in order to investigate the variations in the degree of crystallinity and thermal parameters (Tm) of the blend specimen prior and after irradiation. The Fourier Transform Infrared (FT-IR) measurements are carried out in order to investigate the changes in the vibrational modes of molecules upon irradiation. The FT-IR measurements corroborate the formation of amorphous phase in the blend matrix after irradiation. The conductivity is found to be optimum at the fluence of 1×1012 ions/cm2. The enhancement and the improvement in the electrolytic properties of PVA-PEO blend upon O7+ ion irradiation have been observed.
Yan, Guang; Xu, Qingfang; Anissimov, Yuri G; Hao, Jinsong; Higuchi, William I; Li, S Kevin
2008-03-01
As a continuing effort to understand the mechanisms of alternating current (AC) transdermal iontophoresis and the iontophoretic transport pathways in the stratum corneum (SC), the objectives of the present study were to determine the interplay of AC frequency, AC voltage, and iontophoretic transport of ionic and neutral permeants across human epidermal membrane (HEM) and use AC as a means to characterize the transport pathways. Constant AC voltage iontophoresis experiments were conducted with HEM in 0.10 M tetraethyl ammonium pivalate (TEAP). AC frequencies ranging from 0.0001 to 25 Hz and AC applied voltages of 0.5 and 2.5 V were investigated. Tetraethyl ammonium (TEA) and arabinose (ARA) were the ionic and neutral model permeants, respectively. In data analysis, the logarithm of the permeability coefficients of HEM for the model permeants was plotted against the logarithm of the HEM electrical resistance for each AC condition. As expected, linear correlations between the logarithms of permeability coefficients and the logarithms of resistances of HEM were observed, and the permeability data were first normalized and then compared at the same HEM electrical resistance using these correlations. Transport enhancement of the ionic permeant was significantly larger than that of the neutral permeant during AC iontophoresis. The fluxes of the ionic permeant during AC iontophoresis of 2.5 V in the frequency range from 5 to 1,000 Hz were relatively constant and were approximately 4 times over those of passive transport. When the AC frequency decreased from 5 to 0.001 Hz at 2.5 V, flux enhancement increased to around 50 times over passive transport. While the AC frequency for achieving the full effect of iontophoretic enhancement at low AC frequency was lower than anticipated, the frequency for approaching passive diffusion transport at high frequency was higher than expected from the HEM morphology. These observations are consistent with a transport model of multiple
Electrical transport in lead-free (Na0.5Bi0.5)1-xSrxTiO3 ceramics (x = 0, 0.01 and 0.02)
NASA Astrophysics Data System (ADS)
Dutkiewicz, E. M.; Suchanicz, J.; Konieczny, K.; Czaja, P.; Kluczewska, K.; Czternastek, H.; Antonova, M.; Sternberg, A.
2017-09-01
Lead-free (Na0.5Bi0.5)1xSrxTiO3 (x = 0, 0.01 and 0.02) ceramics were manufactured through a solid-state mixed oxide method and their ac (σac) and dc (σdc) electric conductivity were studied. It is shown that the low-frequency (100 Hz-1 MHz) ac conductivity obeys a power law σac ∼ ωs characteristic for disordered materials. Both the dc and ac conductivities have thermally activated character and possess linear parts with different activation energies. The calculated activation energies are attributed to different mechanism of conductivity. Frequency dependence of σdc and exponent s is reasonably interpreted by a correlated barrier hopping model. The NBT-ST system is expected to be a new promising candidate for lead-free electronic materials.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Poklonski, N. A., E-mail: poklonski@bsu.by; Vyrko, S. A.; Poklonskaya, O. N.
The electrostatic model of ionization equilibrium between hydrogen-like acceptors and v-band holes in crystalline covalent p-type semiconductors is developed. The range of applicability of the model is the entire insulator side of the insulator–metal (Mott) phase transition. The density of the spatial distribution of acceptor- and donor-impurity atoms and holes over a crystal was assumed to be Poissonian and the fluctuations of their electrostatic potential energy, to be Gaussian. The model takes into account the effect of a decrease in the energy of affinity of an ionized acceptor to a v-band hole due to Debye–Hückel ion screening by both freemore » v-band holes and localized holes hopping over charge states (0) and (–1) of acceptors in the acceptor band. All donors are in charge state (+1) and are not directly involved in the screening, but ensure the total electroneutrality of a sample. In the quasiclassical approximation, analytical expressions for the root-mean-square fluctuation of the v-band hole energy W{sub p} and effective acceptor bandwidth W{sub a} are obtained. In calculating W{sub a}, only fluctuations caused by the Coulomb interaction between two nearest point charges (impurity ions and holes) are taken into account. It is shown that W{sub p} is lower than W{sub a}, since electrostatic fluctuations do not manifest themselves on scales smaller than the average de Broglie wavelength of a free hole. The delocalization threshold for v-band holes is determined as the sum of the diffusive-percolation threshold and exchange energy of holes. The concentration of free v-band holes is calculated at the temperature T{sub j} of the transition from dc band conductivity to conductivity implemented via hopping over acceptor states, which is determined from the virial theorem. The dependence of the differential energy of the thermal ionization of acceptors at the temperature 3T{sub j}/2 on their concentration N and degree of compensation K (the ratio
Antimicrobial activity of hop extracts against foodborne pathogens for meat applications.
Kramer, B; Thielmann, J; Hickisch, A; Muranyi, P; Wunderlich, J; Hauser, C
2015-03-01
The objective of this study was the fundamental investigation of the antimicrobial efficiency of various hop extracts against selected foodborne pathogens in vitro, as well as their activity against Listeria monocytogenes in a model meat marinade and on marinated pork tenderloins. In a first step, the minimum inhibitory concentrations (MIC) of three hop extracts containing either α- or β-acids or xanthohumol were determined against test bacteria including L. monocytogenes, Staphylococcus aureus, Salmonella enterica and Escherichia coli by a colorimetric method based on the measurement of bacterial metabolic activity. Moreover, the influence of either lactic or citric acid on the antimicrobial activity of the hop extracts was evaluated. The efficiency of hop extracts as a natural food preservative was then tested in a model meat marinade at 2 and 8°C, respectively, and finally on marinated pork. The experiments showed that Gram-positive bacteria were strongly inhibited by hop extracts containing β-acids and xanthohumol (MIC values of 6.3 and 12.5 ppm, respectively), whereas the antimicrobial activity of the investigated α-acid extract was significantly lower (MIC values of 200 ppm). Gram-negative bacteria were highly resistant against all tested hop extracts. Acidification of the test media led to a decrease of the MIC values. The inhibitory activity of the hop extracts against L. monocytogenes was strongly reduced in a fat-containing model meat marinade, but the efficiency of β-acids in this matrix could be increased by lowering pH and storage temperatures. By applying 0.5 % β-acids at pH = 5 in a model marinade, the total aerobic count of pork tenderloins was reduced up to 0.9 log10 compared with marinated pork without hop extract after 2 weeks of storage at 5°C. β-acid containing hop extracts have proven to possess a high antimicrobial activity against Gram-positive bacteria in vitro and in a practice-related application for food preservation
USDA-ARS?s Scientific Manuscript database
As climate and weather become more variable, hop growers face increased uncertainty in making decisions about their crop. Given the unprecedented nature of these changes, growers may no longer have enough information and intuitive understanding to adequately assess the situation and evaluate their m...
Investigating Cultural Collision: Educators' Perceptions of Hip-Hop Culture
ERIC Educational Resources Information Center
Beachum, Floyd D.
2013-01-01
Hip-hop music has been embraced worldwide by youth, pummeled in the media for supposedly increasing social misery and hailed as a significant musical breakthrough. Hip-hop culture has transcended musical boundaries and now impacts speech, clothing, mannerisms, movies, websites, television programming, magazines, and energy drinks (Dyson, 2007;…
Degradation of hop bitter acids by fungi
DOE Office of Scientific and Technical Information (OSTI.GOV)
Huszcza, Ewa; Bartmanska, Agnieszka; Aniol, Miroslaw
2008-07-01
Nine fungal strains related to: Trametes versicolor, Nigrospora oryzae, Inonotus radiatus, Crumenulopsis sororia, Coryneum betulinum, Cryptosporiopsis radicicola, Fusarium equiseti, Rhodotorula glutinis and Candida parapsilosis were tested for their ability to degrade humulones and lupulones. The best results were obtained for T. versicolor culture, in which humulones and lupulones were fully degraded after 4 days of incubation in the dark or after 36 h in the light. The experiments were performed on a commercial hop extract and on sterilized spent hops.
A new method of hybrid frequency hopping signals selection and blind parameter estimation
NASA Astrophysics Data System (ADS)
Zeng, Xiaoyu; Jiao, Wencheng; Sun, Huixian
2018-04-01
Frequency hopping communication is widely used in military communications at home and abroad. In the case of single-channel reception, it is scarce to process multiple frequency hopping signals both effectively and simultaneously. A method of hybrid FH signals selection and blind parameter estimation is proposed. The method makes use of spectral transformation, spectral entropy calculation and PRI transformation basic theory to realize the sorting and parameter estimation of the components in the hybrid frequency hopping signal. The simulation results show that this method can correctly classify the frequency hopping component signal, and the estimated error of the frequency hopping period is about 5% and the estimated error of the frequency hopping frequency is less than 1% when the SNR is 10dB. However, the performance of this method deteriorates seriously at low SNR.
Charge transport in molecular junctions: From tunneling to hopping with the probe technique
NASA Astrophysics Data System (ADS)
Kilgour, Michael; Segal, Dvira
2015-07-01
We demonstrate that a simple phenomenological approach can be used to simulate electronic conduction in molecular wires under thermal effects induced by the surrounding environment. This "Landauer-Büttiker's probe technique" can properly replicate different transport mechanisms, phase coherent nonresonant tunneling, ballistic behavior, and hopping conduction. Specifically, our simulations with the probe method recover the following central characteristics of charge transfer in molecular wires: (i) the electrical conductance of short wires falls off exponentially with molecular length, a manifestation of the tunneling (superexchange) mechanism. Hopping dynamics overtakes superexchange in long wires demonstrating an ohmic-like behavior. (ii) In off-resonance situations, weak dephasing effects facilitate charge transfer, but under large dephasing, the electrical conductance is suppressed. (iii) At high enough temperatures, kBT/ɛB > 1/25, with ɛB as the molecular-barrier height, the current is enhanced by a thermal activation (Arrhenius) factor. However, this enhancement takes place for both coherent and incoherent electrons and it does not readily indicate on the underlying mechanism. (iv) At finite-bias, dephasing effects may impede conduction in resonant situations. We further show that memory (non-Markovian) effects can be implemented within the Landauer-Büttiker's probe technique to model the interaction of electrons with a structured environment. Finally, we examine experimental results of electron transfer in conjugated molecular wires and show that our computational approach can reasonably reproduce reported values to provide mechanistic information.
Precision QTL mapping of downy mildew resistance in Hop (Humulus lupulus L.)
USDA-ARS?s Scientific Manuscript database
Hop Downy mildew (DM) is an obligate parasite causing severe losses in hop if not controlled. Resistance to this pathogen is a primary goal for hop breeding programs. The objective of this study was to identify QTLs linked to DM resistance. Next-generation-sequencing was performed on a mapping po...
Vélez-Ortega, A. Catalina; Frolenkov, Gregory I.
2016-01-01
The mechanosensory apparatus that detects sound-induced vibrations in the cochlea is located on the apex of the auditory sensory hair cells and it is made up of actin-filled projections, called stereocilia. In young rodents, stereocilia bundles of auditory hair cells consist of 3 to 4 rows of stereocilia of decreasing height and varying thickness. Morphological studies of the auditory stereocilia bundles in live hair cells have been challenging because the diameter of each stereocilium is near or below the resolution limit of optical microscopy. In theory, scanning probe microscopy techniques, such as atomic force microscopy, could visualize the surface of a living cell at a nanoscale resolution. However, their implementations for hair cell imaging have been largely unsuccessful because the probe usually damages the bundle and disrupts the bundle cohesiveness during imaging. We overcome these limitations by using hopping probe ion conductance microscopy (HPICM), a non-contact scanning probe technique that is ideally suited for the imaging of live cells with a complex topography. Organ of Corti explants are placed in a physiological solution and then a glass nanopipette –which is connected to a 3D-positioning piezoelectric system and to a patch clamp amplifier– is used to scan the surface of the live hair cells at nanometer resolution without ever touching the cell surface. Here we provide a detailed protocol for the imaging of mouse or rat stereocilia bundles in live auditory hair cells using HPICM. We provide information about the fabrication of the nanopipettes, the calibration of the HPICM setup, the parameters we have optimized for the imaging of live stereocilia bundles and, lastly, a few basic image post-processing manipulations. PMID:27259929
Vélez-Ortega, A Catalina; Frolenkov, Gregory I
2016-01-01
The mechanosensory apparatus that detects sound-induced vibrations in the cochlea is located on the apex of the auditory sensory hair cells and it is made up of actin-filled projections, called stereocilia. In young rodents, stereocilia bundles of auditory hair cells consist of 3-4 rows of stereocilia of decreasing height and varying thickness. Morphological studies of the auditory stereocilia bundles in live hair cells have been challenging because the diameter of each stereocilium is near or below the resolution limit of optical microscopy. In theory, scanning probe microscopy techniques, such as atomic force microscopy, could visualize the surface of a living cell at a nanoscale resolution. However, their implementations for hair cell imaging have been largely unsuccessful because the probe usually damages the bundle and disrupts the bundle cohesiveness during imaging. We overcome these limitations by using hopping probe ion conductance microscopy (HPICM), a non-contact scanning probe technique that is ideally suited for the imaging of live cells with a complex topography. Organ of Corti explants are placed in a physiological solution and then a glass nanopipette-which is connected to a 3D-positioning piezoelectric system and to a patch clamp amplifier-is used to scan the surface of the live hair cells at nanometer resolution without ever touching the cell surface.Here, we provide a detailed protocol for the imaging of mouse or rat stereocilia bundles in live auditory hair cells using HPICM. We provide information about the fabrication of the nanopipettes, the calibration of the HPICM setup, the parameters we have optimized for the imaging of live stereocilia bundles and, lastly, a few basic image post-processing manipulations.
Surface hopping simulation of vibrational predissociation of methanol dimer
NASA Astrophysics Data System (ADS)
Jiang, Ruomu; Sibert, Edwin L.
2012-06-01
The mixed quantum-classical surface hopping method is applied to the vibrational predissociation of methanol dimer, and the results are compared to more exact quantum calculations. Utilizing the vibrational SCF basis, the predissociation problem is cast into a curve crossing problem between dissociative and quasibound surfaces with different vibrational character. The varied features of the dissociative surfaces, arising from the large amplitude OH torsion, generate rich predissociation dynamics. The fewest switches surface hopping algorithm of Tully [J. Chem. Phys. 93, 1061 (1990), 10.1063/1.459170] is applied to both diabatic and adiabatic representations. The comparison affords new insight into the criterion for selecting the suitable representation. The adiabatic method's difficulty with low energy trajectories is highlighted. In the normal crossing case, the diabatic calculations yield good results, albeit showing its limitation in situations where tunneling is important. The quadratic scaling of the rates on coupling strength is confirmed. An interesting resonance behavior is identified and is dealt with using a simple decoherence scheme. For low lying dissociative surfaces that do not cross the quasibound surface, the diabatic method tends to overestimate the predissociation rate whereas the adiabatic method is qualitatively correct. Analysis reveals the major culprits involve Rabi-like oscillation, treatment of classically forbidden hops, and overcoherence. Improvements of the surface hopping results are achieved by adopting a few changes to the original surface hopping algorithms.
Robotic investigation on effect of stretch reflex and crossed inhibitory response on bipedal hopping
Rosendo, Andre; Ikemoto, Shuhei; Shimizu, Masahiro; Hosoda, Koh
2018-01-01
To maintain balance during dynamic locomotion, the effects of proprioceptive sensory feedback control (e.g. reflexive control) should not be ignored because of its simple sensation and fast reaction time. Scientists have identified the pathways of reflexes; however, it is difficult to investigate their effects during locomotion because locomotion is controlled by a complex neural system and current technology does not allow us to change the control pathways in living humans. To understand these effects, we construct a musculoskeletal bipedal robot, which has similar body structure and dynamics to those of a human. By conducting experiments on this robot, we investigate the effects of reflexes (stretch reflex and crossed inhibitory response) on posture during hopping, a simple and representative bouncing gait with complex dynamics. Through over 300 hopping trials, we confirm that both the stretch reflex and crossed response can contribute to reducing the lateral inclination during hopping. These reflexive pathways do not use any prior knowledge of the dynamic information of the body such as its inclination. Beyond improving the understanding of the human neural system, this study provides roboticists with biomimetic ideas for robot locomotion control. PMID:29593088
Multi-Hop Link Capacity of Multi-Route Multi-Hop MRC Diversity for a Virtual Cellular Network
NASA Astrophysics Data System (ADS)
Daou, Imane; Kudoh, Eisuke; Adachi, Fumiyuki
In virtual cellular network (VCN), proposed for high-speed mobile communications, the signal transmitted from a mobile terminal is received by some wireless ports distributed in each virtual cell and relayed to the central port that acts as a gateway to the core network. In this paper, we apply the multi-route MHMRC diversity in order to decrease the transmit power and increase the multi-hop link capacity. The transmit power, the interference power and the link capacity are evaluated for DS-CDMA multi-hop VCN by computer simulation. The multi-route MHMRC diversity can be applied to not only DS-CDMA but also other access schemes (i. e. MC-CDMA, OFDM, etc.).
Factors of Intensification in the Hops Cluster of Chuvashia
ERIC Educational Resources Information Center
Zakharov, Anatoly I.; Evgrafov, Oleg V.; Zakharov, Dmitry A.; Ivanova, Elena V.; Tolstova, Marija L.; Tsaregorodtsev, Evgeny I.
2016-01-01
The complex analysis of development of hop-growing for 1971-2015 is carried out. In the conditions of the field experiment made in the Chuvash Republic hop-growing intensification elements--technology of its cultivation, mechanization are fulfilled. Based on researches it is established that the main internal allowance of increase in efficiency of…
A Hybrid DV-Hop Algorithm Using RSSI for Localization in Large-Scale Wireless Sensor Networks.
Cheikhrouhou, Omar; M Bhatti, Ghulam; Alroobaea, Roobaea
2018-05-08
With the increasing realization of the Internet-of-Things (IoT) and rapid proliferation of wireless sensor networks (WSN), estimating the location of wireless sensor nodes is emerging as an important issue. Traditional ranging based localization algorithms use triangulation for estimating the physical location of only those wireless nodes that are within one-hop distance from the anchor nodes. Multi-hop localization algorithms, on the other hand, aim at localizing the wireless nodes that can physically be residing at multiple hops away from anchor nodes. These latter algorithms have attracted a growing interest from research community due to the smaller number of required anchor nodes. One such algorithm, known as DV-Hop (Distance Vector Hop), has gained popularity due to its simplicity and lower cost. However, DV-Hop suffers from reduced accuracy due to the fact that it exploits only the network topology (i.e., number of hops to anchors) rather than the distances between pairs of nodes. In this paper, we propose an enhanced DV-Hop localization algorithm that also uses the RSSI values associated with links between one-hop neighbors. Moreover, we exploit already localized nodes by promoting them to become additional anchor nodes. Our simulations have shown that the proposed algorithm significantly outperforms the original DV-Hop localization algorithm and two of its recently published variants, namely RSSI Auxiliary Ranging and the Selective 3-Anchor DV-hop algorithm. More precisely, in some scenarios, the proposed algorithm improves the localization accuracy by almost 95%, 90% and 70% as compared to the basic DV-Hop, Selective 3-Anchor, and RSSI DV-Hop algorithms, respectively.
"Deeper than Rap": Gifted Males and Their Relationship with Hip Hop Culture
ERIC Educational Resources Information Center
Callahan, J. Sean; Grantham, Tarek C.
2012-01-01
One would be hard-pressed to deny the impact that hip hop is having on gifted students. More specifically, because hip hop is a creative and exciting male-dominated culture, gifted males gravitate to hip hop culture. From the perspective of two Black men from two different generations, this article was inspired by discussions about the role of hip…
Interaction of alcoholic extracts of hops with cocaine and paracetamol in mice.
Horvat, Olga; Raskovic, Aleksandar; Jakovljevic, Vida; Sabo, Jan; Berenji, Janos
2007-01-01
This work describes a study of the interaction in the mouse model of alcoholic extracts of hops of Magnum, Aroma and wild genotypes with drugs that have excitatory effect on the cerebral cortex (cocaine) and analgesic action (paracetamol). Hop drying and preparation of the extracts were carried out according to standard pharmacological procedures for preparing total alcoholic extracts of dry herbs, consisting of one part of dry drug and two parts of 70% alcohol. The mice received four doses i.p. of 0.5% aqueous solutions of the above-mentioned extracts (10 ml/kg) 24, 16, 4 and 0.5 h prior to receiving cocaine (25 mg/kg) or paracetamol (80 mg/kg). The parameter investigated was the change in spontaneous motility of mice after combined treatment with the extracts and cocaine/paracetamol compared to control animals that received the same dose of the drug after treatment with physiological solution. Only the ethanolic extract of Magnum hops increased the spontaneous motility of mice, while none of the extracts showed analgesic action as measured by the hot-plate method. In the interaction with cocaine, the extract of Magnum hops suppressed almost completely the action of cocaine compared to controls. Extracts of the other hops also decreased the cocaine-induced locomotor activity of mice, but to a lesser extent. Hop extracts exhibited a significant pharmacological interaction with paracetamol, with the most pronounced increase in analgesic action being found for the ethanolic extract of Aroma hops and the tert-butanolic extract of wild hops.
Being Hipped to Their Hop: Tapping into Young Minds through Hip Hop Play
ERIC Educational Resources Information Center
Broughton, Anthony
2017-01-01
Adults gain a wealth of knowledge from listening to the voices of children through intentional observations and interactions [Owocki, G., and Y. M. Goodman. 2002. "Kidwatching: Documenting Children's Literacy Development." Portsmouth: Heinemann]. Hip Hop play may provide optimal opportunities for teachers to tap into the young minds of…
Hierarchical Hopping through Localized States in a Random Potential
NASA Astrophysics Data System (ADS)
Rajan, Harihar; Srivastava, Vipin
2003-03-01
Generalisation of Mott's idea on (low - temperature, large-time), Variable-range-hopping is considered to include hopping at some what higher temperature(that do not kill localization). These transitions complement the variable- range-hopping in that they do not conserve energy and occur at relatively lower time scales. The hopper picks the next state in a hierarchical fashion in accordance with certain conditions. The results are found to tie up nicely with an interesting property pertaining to the energy dependence of localized states. Acknowlwdgements: One of us(VS) would like to thank Association of Commonwealth Universities and Leverhulme Trust for financial help and to Sir Sam Edwards for hospitality at Cavendish Laboratory,Cambridge CB3 0HE.
Hopping Diffusion of Nanoparticles Subjected to Topological Constraints
NASA Astrophysics Data System (ADS)
Cai, Li-Heng; Panyukov, Sergey; Rubinstein, Michael
2013-03-01
We describe a novel hopping mechanism for diffusion of large non-sticky nanoparticles subjected to topological constraints in polymer solids (networks and gels) and entangled polymer liquids (melts and solutions). Probe particles with size larger than the mesh size of unentangled polymer networks (tube diameter of entangled polymer liquids) are trapped by the network (entanglement) cages at time scales longer than the relaxation time of the network (entanglement) strand. At long time scales, however, these particles can move further by hopping between neighboring confinement cages. This hopping is controlled by fluctuations of surrounding confinement cages, which could be large enough to allow particles to slip through. The terminal particle diffusion coefficient dominated by this hopping diffusion is appreciable for particles with size slightly larger than the network mesh size (tube diameter). Very large particles in polymer solids will be permanently trapped by local network cages, whereas they can still move in polymer liquids by waiting for entanglement cages to rearrange on the relaxation time scale of the liquids. We would like to acknowledge the financial support of NSF CHE-0911588, DMR-0907515, DMR-1121107, DMR-1122483, and CBET-0609087, NIH R01HL077546 and P50HL107168, and Cystic Fibrosis Foundation under grant RUBIN09XX0.
Starting with Style: Toward a Second Wave of Hip-Hop Education Research and Practice
ERIC Educational Resources Information Center
Petchauer, Emery
2015-01-01
One fundamental breakthrough in the field of hip-hop education in recent years is the shift from understanding hip-hop solely as content to understanding hip-hop also as aesthetic form. In this article, I chart the roots of this shift across disciplines and focus on what it might mean for the future of hip-hop education, pedagogy, and research in…
Hop powdery mildew control through alteration of spring pruning practices
USDA-ARS?s Scientific Manuscript database
Since 1997, Podosphaera macularis, the causal agent of hop powdery mildew, has become a recurrent threat to hops in the Pacific Northwest because of the potential to reduce cone yield and quality. Disease management practices often involve preventative fungicide applications, but alternative approac...
Hip Hop as Empowerment: Voices in El Alto, Bolivia
ERIC Educational Resources Information Center
Tarifa, Ariana
2012-01-01
In response to neoliberal policies that have been in place since 1985, Bolivian young people have increasingly used hip hop music as a means of protest and to reclaim social and political participation. Hip hop in Latin America tells the story of the struggles that marginalized people have suffered, and speaks to the effects of international…
Hip-Hop, the "Obama Effect," and Urban Science Education
ERIC Educational Resources Information Center
Emdin, Christopher; Lee, Okhee
2012-01-01
Background/Context: With the ever increasing diversity of schools, and the persistent need to develop teaching strategies for the students who attend today's urban schools, hip-hop culture has been proposed to be a means through which urban youth can find success in school. As a result, studies of the role of hip-hop in urban education have grown…
NASA Astrophysics Data System (ADS)
Yuan, Ye; Wang, Mao; Xu, Chi; Hübner, René; Böttger, Roman; Jakiela, Rafal; Helm, Manfred; Sawicki, Maciej; Zhou, Shengqiang
2018-03-01
In the present work, low compensated insulating (Ga,Mn)As with 0.7% Mn is obtained by ion implantation combined with pulsed laser melting. The sample shows variable-range hopping transport behavior with a Coulomb gap in the vicinity of the Fermi energy, and the activation energy is reduced by an external magnetic field. A blocking super-paramagnetism is observed rather than ferromagnetism. Below the blocking temperature, the sample exhibits a colossal negative magnetoresistance. Our studies confirm that the disorder-induced electronic phase separation occurs in (Ga,Mn)As samples with a Mn concentration in the insulator-metal transition regime, and it can account for the observed superparamagnetism and the colossal magnetoresistance.
Collision-based energetic comparison of rolling and hopping over obstacles
Iida, Fumiya
2018-01-01
Locomotion of machines and robots operating in rough terrain is strongly influenced by the mechanics of the ground-machine interactions. A rolling wheel in terrain with obstacles is subject to collisional energy losses, which is governed by mechanics comparable to hopping or walking locomotion. Here we investigate the energetic cost associated with overcoming an obstacle for rolling and hopping locomotion, using a simple mechanics model. The model considers collision-based interactions with the ground and the obstacle, without frictional losses, and we quantify, analyse, and compare the sources of energetic costs for three locomotion strategies. Our results show that the energetic advantages of the locomotion strategies are uniquely defined given the moment of inertia and the Froude number associated with the system. We find that hopping outperforms rolling at larger Froude numbers and vice versa. The analysis is further extended for a comparative study with animals. By applying size and inertial properties through an allometric scaling law of hopping and trotting animals to our models, we found that the conditions at which hopping becomes energetically advantageous to rolling roughly corresponds to animals’ preferred gait transition speeds. The energetic collision losses as predicted by the model are largely verified experimentally. PMID:29538459
Variable-Range Hopping through Marginally Localized Phonons
NASA Astrophysics Data System (ADS)
Banerjee, Sumilan; Altman, Ehud
2016-03-01
We investigate the effect of coupling Anderson localized particles in one dimension to a system of marginally localized phonons having a symmetry protected delocalized mode at zero frequency. This situation is naturally realized for electrons coupled to phonons in a disordered nanowire as well as for ultracold fermions coupled to phonons of a superfluid in a one-dimensional disordered trap. To determine if the coupled system can be many-body localized we analyze the phonon-mediated hopping transport for both the weak and strong coupling regimes. We show that the usual variable-range hopping mechanism involving a low-order phonon process is ineffective at low temperature due to discreteness of the bath at the required energy. Instead, the system thermalizes through a many-body process involving exchange of a diverging number n ∝-log T of phonons in the low temperature limit. This effect leads to a highly singular prefactor to Mott's well-known formula and strongly suppresses the variable range hopping rate. Finally, we comment on possible implications of this physics in higher dimensional electron-phonon coupled systems.
Wish to Live: The Hip-Hop Feminism Pedagogy Reader. Educational Psychology. Volume 3
ERIC Educational Resources Information Center
Brown, Ruth Nicole, Ed.; Kwakye, Chamara Jewel, Ed.
2012-01-01
"Wish To Live: The Hip-hop Feminism Pedagogy Reader" moves beyond the traditional understanding of the four elements of hip-hop culture--rapping, breakdancing, graffiti art, and deejaying--to articulate how hip-hop feminist scholarship can inform educational practices and spark, transform, encourage, and sustain local and global youth…
Behind Beats and Rhymes: Working Class from a Hampton Roads Hip Hop Homeplace
ERIC Educational Resources Information Center
Durham, Aisha S.
2009-01-01
The film documentary titled "Hip Hop: beyond beats and rhymes" captures ongoing conversations among scholars, cultural critics, and hip hop insiders about the state of African Americans by interrogating distinct expressive forms associated with hip hop culture. Durham draws from two scenes to describe her memories as the researched…
Structural studies on the co-chaperone Hop and its complexes with Hsp90.
Onuoha, S C; Coulstock, E T; Grossmann, J G; Jackson, S E
2008-06-13
The tetratricopeptide repeat domain (TPR)-containing co-chaperone Hsp-organising protein (Hop) plays a critical role in mediating interactions between Heat Shock Protein (Hsp)70 and Hsp90 as part of the cellular assembly machine. It also modulates the ATPase activity of both Hsp70 and Hsp90, thus facilitating client protein transfer between the two. Despite structural work on the individual domains of Hop, no structure for the full-length protein exists, nor is it clear exactly how Hop interacts with Hsp90, although it is known that its primary binding site is the C-terminal MEEVD motif. Here, we have undertaken a biophysical analysis of the structure and binding of Hop to Hsp90 using a variety of truncation mutants of both Hop and Hsp90, in addition to mutants of Hsp90 that are thought to modulate the conformation, in particular the N-terminal dimerisation of the chaperone. The results establish that whilst the primary binding site of Hop is the C-terminal MEEVD peptide of Hsp90, binding also occurs at additional sites in the C-terminal and middle domain. In contrast, we show that another TPR-containing co-chaperone, CyP40, binds solely to the C-terminus of Hsp90. Truncation mutants of Hop were generated and used to investigate the dimerisation interface of the protein. In good agreement with recently published data, we find that the TPR2a domain that contains the Hsp90-binding site is also the primary site for dimerisation. However, our results suggest that residues within the TPR2b may play a role. Together, these data along with shape reconstruction analysis from small-angle X-ray scattering measurements are used to generate a solution structure for full-length Hop, which we show has an overall butterfly-like quaternary structure. Studies on the nucleotide dependence of Hop binding to Hsp90 establish that Hop binds to the nucleotide-free, 'open' state of Hsp90. However, the Hsp90-Hop complex is weakened by the conformational changes that occur in Hsp90 upon ATP
Sensor-Motor Maps for Describing Linear Reflex Composition in Hopping.
Schumacher, Christian; Seyfarth, André
2017-01-01
In human and animal motor control several sensory organs contribute to a network of sensory pathways modulating the motion depending on the task and the phase of execution to generate daily motor tasks such as locomotion. To better understand the individual and joint contribution of reflex pathways in locomotor tasks, we developed a neuromuscular model that describes hopping movements. In this model, we consider the influence of proprioceptive length (LFB), velocity (VFB) and force feedback (FFB) pathways of a leg extensor muscle on hopping stability, performance and efficiency (metabolic effort). Therefore, we explore the space describing the blending of the monosynaptic reflex pathway gains. We call this reflex parameter space a sensor-motor map . The sensor-motor maps are used to visualize the functional contribution of sensory pathways in multisensory integration. We further evaluate the robustness of these sensor-motor maps to changes in tendon elasticity, body mass, segment length and ground compliance. The model predicted that different reflex pathway compositions selectively optimize specific hopping characteristics (e.g., performance and efficiency). Both FFB and LFB were pathways that enable hopping. FFB resulted in the largest hopping heights, LFB enhanced hopping efficiency and VFB had the ability to disable hopping. For the tested case, the topology of the sensor-motor maps as well as the location of functionally optimal compositions were invariant to changes in system designs (tendon elasticity, body mass, segment length) or environmental parameters (ground compliance). Our results indicate that different feedback pathway compositions may serve different functional roles. The topology of the sensor-motor map was predicted to be robust against changes in the mechanical system design indicating that the reflex system can use different morphological designs, which does not apply for most robotic systems (for which the control often follows a specific
Teaching Controversal Topics in Contemporary German Culture through Hip-Hop
ERIC Educational Resources Information Center
Putnam, Michael
2006-01-01
This article discusses the rich cultural resources embedded with German hip-hop music and its potential impact on the foreign language classroom. In particular, this article suggests methods and materials for integrating German hip-hop music in the discussion of recent controversial cultural events and attitudes in German after the "Wende."
NASA Astrophysics Data System (ADS)
Demirezen, S.; Kaya, A.; Yerişkin, S. A.; Balbaşı, M.; Uslu, İ.
In this study, praseodymium barium cobalt oxide nanofiber interfacial layer was sandwiched between Au and n-Si. Frequency and voltage dependence of ε‧, ε‧, tanδ, electric modulus (M‧ and M″) and σac of PrBaCoO nanofiber capacitor have been investigated by using impedance spectroscopy method. The obtained experimental results show that the values of ε‧, ε‧, tanδ, M‧, M″ and σac of the PrBaCoO nanofiber capacitor are strongly dependent on frequency of applied bias voltage. The values of ε‧, ε″ and tanδ show a steep decrease with increasing frequency for each forward bias voltage, whereas the values of σac and the electric modulus increase with increasing frequency. The high dispersion in ε‧ and ε″ values at low frequencies may be attributed to the Maxwell-Wagner and space charge polarization. The high values of ε‧ may be due to the interfacial effects within the material, PrBaCoO nanofibers interfacial layer and electron effect. The values of M‧ and M″ reach a maximum constant value corresponding to M∞ ≈ 1/ε∞ due to the relaxation process at high frequencies, but both the values of M‧ and M″ approach almost to zero at low frequencies. The changes in the dielectric and electrical properties with frequency can be also attributed to the existence of Nss and Rs of the capacitors. As a result, the change in the ε‧, ε″, tanδ, M‧, M″ and ac electric conductivity (σac) is a result of restructuring and reordering of charges at the PrBaCoO/n-Si interface under an external electric field or voltage and interface polarization.
Adsorbate hopping via vibrational-mode coupling induced by femtosecond laser pulses
NASA Astrophysics Data System (ADS)
Ueba, H.; Hayashi, M.; Paulsson, M.; Persson, B. N. J.
2008-09-01
We study the heat transfer from femtosecond laser-heated hot electrons in a metal to adsorbates in the presence of vibrational-mode coupling. The theory is successfully applied to the experimental result of atomic oxygen hopping on a vicinal Pt(111) surface. The effective friction coupling between hot electrons and the vibrational mode relevant to the hopping motion depends on the transient temperature of the partner mode excited by hot electrons. The calculated two-pulse correlation and fluence dependence of the hopping probability reproduce the experimental results, which were previously analyzed using the hot-electron temperature (Te) -dependent friction ηa(Te) in a conventional heat transfer equation. A possible elementary process behind such a hypothetic modeling using ηa(Te) is discussed in terms of an indirect heating of the vibrational mode for hopping at the surface.
Anomalous three-dimensional bulk ac conduction within the Kondo gap of SmB 6 single crystals
DOE Office of Scientific and Technical Information (OSTI.GOV)
Laurita, N. J.; Morris, C. M.; Koohpayeh, S. M.
The Kondo insulator SmB 6 has long been known to display anomalous transport behavior at low temperatures, T < 5 K. In this temperatures range, a plateau is observed in the dc resistivity, contrary to the exponential divergence expected for a gapped system. Some recent theoretical calculations suggest that SmB 6 may be the first topological Kondo insulator (TKI) and propose that the residual conductivity is due to topological surface states which reside within the Kondo gap. Since the TKI prediction many experiments have claimed to observe high mobility surface states within a perfectly insulating hybridization gap. We investigate themore » low energy optical conductivity within the hybridization gap of single crystals of SmB 6 via time domain terahertz spectroscopy. Samples grown by both optical floating zone and aluminum flux methods are investigated to probe for differences originating from sample growth techniques. We find that both samples display significant three-dimensional bulk conduction originating within the Kondo gap. Although SmB 6 may be a bulk dc insulator, it shows significant bulk ac conduction that is many orders of magnitude larger than any known impurity band conduction. The nature of these in-gap states and their coupling with the low energy spin excitons of SmB 6 is discussed. In addition, the well-defined conduction path geometry of our optical experiments allows us to show that any surface states, which lie below our detection threshold if present, must have a sheet resistance of R / square ≥ 1000 Ω .« less
Anomalous three-dimensional bulk ac conduction within the Kondo gap of SmB 6 single crystals
Laurita, N. J.; Morris, C. M.; Koohpayeh, S. M.; ...
2016-10-21
The Kondo insulator SmB 6 has long been known to display anomalous transport behavior at low temperatures, T < 5 K. In this temperatures range, a plateau is observed in the dc resistivity, contrary to the exponential divergence expected for a gapped system. Some recent theoretical calculations suggest that SmB 6 may be the first topological Kondo insulator (TKI) and propose that the residual conductivity is due to topological surface states which reside within the Kondo gap. Since the TKI prediction many experiments have claimed to observe high mobility surface states within a perfectly insulating hybridization gap. We investigate themore » low energy optical conductivity within the hybridization gap of single crystals of SmB 6 via time domain terahertz spectroscopy. Samples grown by both optical floating zone and aluminum flux methods are investigated to probe for differences originating from sample growth techniques. We find that both samples display significant three-dimensional bulk conduction originating within the Kondo gap. Although SmB 6 may be a bulk dc insulator, it shows significant bulk ac conduction that is many orders of magnitude larger than any known impurity band conduction. The nature of these in-gap states and their coupling with the low energy spin excitons of SmB 6 is discussed. In addition, the well-defined conduction path geometry of our optical experiments allows us to show that any surface states, which lie below our detection threshold if present, must have a sheet resistance of R / square ≥ 1000 Ω .« less
Affiliation and Alienation: Hip-Hop, Rap, and Urban Science Education
ERIC Educational Resources Information Center
Emdin, Christopher
2010-01-01
The critiques of rap artists and other participants in hip-hop culture provide data for teachers and researchers to investigate the attitudes of US urban youth towards schooling. This study explores the complex relationships between hip-hop and science education by examining how rap lyrics project beliefs about schooling, the relevance of existing…
NASA Astrophysics Data System (ADS)
Miyazaki, Jun
2013-10-01
We present an analytical method for quantifying exciton hopping in an energetically disordered system with quenching sites. The method is subsequently used to provide a quantitative understanding of exciton hopping in a quantum dot (QD) array. Several statistical quantities that characterize the dynamics (survival probability, average number of distinct sites visited, average hopping distance, and average hopping rate in the initial stage) are obtained experimentally by measuring time-resolved fluorescence intensities at various temperatures. The time evolution of these quantities suggests in a quantitative way that at low temperature an exciton tends to be trapped at a local low-energy site, while at room temperature, exciton hopping occurs repeatedly, leading to a large hopping distance. This method will serve to facilitate highly efficient optoelectronic devices using QDs such as photovoltaic cells and light-emitting diodes, since exciton hopping is considered to strongly influence their operational parameters. The presence of a dark QD (quenching site) that exhibits fast decay is also quantified.
The impact of hop bitter acid and polyphenol profiles on the perceived bitterness of beer.
Oladokun, Olayide; Tarrega, Amparo; James, Sue; Smart, Katherine; Hort, Joanne; Cook, David
2016-08-15
Thirty-four commercial lager beers were analysed for their hop bitter acid, phenolic acid and polyphenol contents. Based on analytical data, it was evident that the beers had been produced using a range of different raw materials and hopping practices. Principal Components Analysis was used to select a sub-set of 10 beers that contained diverse concentrations of the analysed bitter compounds. These beers were appraised sensorially to determine the impacts of varying hop acid and polyphenolic profiles on perceived bitterness character. Beers high in polyphenol and hop acid contents were perceived as having 'harsh' and 'progressive' bitterness, whilst beers that had evidently been conventionally hopped were 'sharp' and 'instant' in their bitterness. Beers containing light-stable hop products (tetrahydro-iso-α-acids) were perceived as 'diminishing', 'rounded' and 'acidic' in bitterness. The hopping strategy adopted by brewers impacts on the nature, temporal profile and intensity of bitterness perception in beer. Copyright © 2016 Elsevier Ltd. All rights reserved.
Two Hop Adaptive Vector Based Quality Forwarding for Void Hole Avoidance in Underwater WSNs
Javaid, Nadeem; Ahmed, Farwa; Wadud, Zahid; Alrajeh, Nabil; Alabed, Mohamad Souheil; Ilahi, Manzoor
2017-01-01
Underwater wireless sensor networks (UWSNs) facilitate a wide range of aquatic applications in various domains. However, the harsh underwater environment poses challenges like low bandwidth, long propagation delay, high bit error rate, high deployment cost, irregular topological structure, etc. Node mobility and the uneven distribution of sensor nodes create void holes in UWSNs. Void hole creation has become a critical issue in UWSNs, as it severely affects the network performance. Avoiding void hole creation benefits better coverage over an area, less energy consumption in the network and high throughput. For this purpose, minimization of void hole probability particularly in local sparse regions is focused on in this paper. The two-hop adaptive hop by hop vector-based forwarding (2hop-AHH-VBF) protocol aims to avoid the void hole with the help of two-hop neighbor node information. The other protocol, quality forwarding adaptive hop by hop vector-based forwarding (QF-AHH-VBF), selects an optimal forwarder based on the composite priority function. QF-AHH-VBF improves network good-put because of optimal forwarder selection. QF-AHH-VBF aims to reduce void hole probability by optimally selecting next hop forwarders. To attain better network performance, mathematical problem formulation based on linear programming is performed. Simulation results show that by opting these mechanisms, significant reduction in end-to-end delay and better throughput are achieved in the network. PMID:28763014
Two Hop Adaptive Vector Based Quality Forwarding for Void Hole Avoidance in Underwater WSNs.
Javaid, Nadeem; Ahmed, Farwa; Wadud, Zahid; Alrajeh, Nabil; Alabed, Mohamad Souheil; Ilahi, Manzoor
2017-08-01
Underwater wireless sensor networks (UWSNs) facilitate a wide range of aquatic applications in various domains. However, the harsh underwater environment poses challenges like low bandwidth, long propagation delay, high bit error rate, high deployment cost, irregular topological structure, etc. Node mobility and the uneven distribution of sensor nodes create void holes in UWSNs. Void hole creation has become a critical issue in UWSNs, as it severely affects the network performance. Avoiding void hole creation benefits better coverage over an area, less energy consumption in the network and high throughput. For this purpose, minimization of void hole probability particularly in local sparse regions is focused on in this paper. The two-hop adaptive hop by hop vector-based forwarding (2hop-AHH-VBF) protocol aims to avoid the void hole with the help of two-hop neighbor node information. The other protocol, quality forwarding adaptive hop by hop vector-based forwarding (QF-AHH-VBF), selects an optimal forwarder based on the composite priority function. QF-AHH-VBF improves network good-put because of optimal forwarder selection. QF-AHH-VBF aims to reduce void hole probability by optimally selecting next hop forwarders. To attain better network performance, mathematical problem formulation based on linear programming is performed. Simulation results show that by opting these mechanisms, significant reduction in end-to-end delay and better throughput are achieved in the network.
Hop/STI1 modulates retinal proliferation and cell death independent of PrP{sup C}
DOE Office of Scientific and Technical Information (OSTI.GOV)
Arruda-Carvalho, Maithe; Njaine, Brian; Silveira, Mariana S.
Hop/STI1 is a co-chaperone adaptor protein for Hsp70/Hsp90 complexes. Hop/STI1 is found extracellularly and modulates cell death and differentiation through interaction with the prion protein (PrP{sup C}). Here, we investigated the expression of hop/STI1 and its role upon cell proliferation and cell death in the developing retina. Hop/STI1 is more expressed in developing rat retina than in the mature tissue. Hop/STI1 blocks retinal cell death in the neuroblastic layer (NBL) in a PrP{sup C} dependent manner, but failed to protect ganglion cells against axotomy-induced cell death. An antibody raised against hop/STI1 ({alpha}-STI1) blocked both ganglion cell and NBL cell deathmore » independent of PrP{sup C}. cAMP/PKA, ERK, PI3K and PKC signaling pathways were not involved in these effects. Hop/STI1 treatment reduced proliferation, while {alpha}-STI1 increased proliferation in the developing retina, both independent of PrP{sup C}. We conclude that hop/STI1 can modulate both proliferation and cell death in the developing retina independent of PrP{sup C}.« less
Impedance and AC conductivity studies of Sm3+ substituted 0.8Ba0.2(Bi0.5K0.5)TiO3 lead free ceramics
NASA Astrophysics Data System (ADS)
Sastry, C. V. S. S.; Ramesh, M. N. V.; Ramesh, K. V.
2017-07-01
Samarium substituted 0.8Ba0.2(Bi0.5K0.5)TiO3 (here after abbreviated as BTBKT-20) lead free ceramics with composition 0.8Ba0.2(Bi0.5(1-x)Sm0.5xK0.5)TiO3 (where x=0.01,0.03,0.05) lead free ceramics have been prepared by solid state reaction and followed by high energy ball milling process. The present paper focuses the impedance and ac conductivity studies of Sm substituted BTBKT-20 lead free ceramics. Impedance spectroscopic studies revealthat temperature dependent relaxation process. Single depressed semi circle was observed in Cole-Cole plots, indicates non-Debye kind of relaxation process. Maximum grain resistance was observed for x=0.03 Sm substituted BTBKT-20 sample. Frequency and temperature dependent AC conductivity was calculated and it found to obey the universal Jonscher's power law and the values of activation energies suggest that conduction is ionic in nature.
El-Ghamaz, N A; Diab, M A; El-Bindary, A A; El-Sonbati, A Z; Nozha, S G
2015-05-15
A novel series of (5-(4'-derivatives phenyl azo)-8-hydroxy-7-quinolinecarboxaldehyde) (AQLn) (n=1, p-OCH3; n=2, R=H; and n=3; p-NO2) and their complexes [Cu(AQLn)2]·5H2O are synthesized and investigated. The optimized bond lengths, bond angles and the calculated quantum chemical parameters for AQLn are investigated. HOMO-LUMO energy gap, absolute electronegativities, chemical potentials, and absolute hardness are also calculated. The thermal properties, dielectric properties, alternating current conductivity (σac) and conduction mechanism are investigated in the frequency range 0.1-100kHz and temperature range 293-568K for AQL1-3 and 318-693K for [Cu(AQL1-3)2]·5H2O complexes. The thermal properties are of ligands (AQLn) and their Cu(II) complexes investigated by thermogravimetric analysis (TGA). The temperature and frequency dependence of the real and the imaginary part of the dielectric constant are studied. The values of the thermal activation energy of conduction mechanism for AQLn and their complexes [Cu(AQLn)2]·5H2O under investigation are calculated at different test frequencies. The values of thermal activation energies ΔE1 and ΔE2 for AQLn and [Cu(AQLn)2]·5H2O decrease with increasing the values of frequency. The ac conductivity is found to be depending on the chemical structure of the compounds. Different conduction mechanisms have been proposed to explain the obtained experimental data. The small polaron tunneling (SPT) is the dominant conduction mechanism for AQL1 and its complex [Cu(AQL1)2]·5H2O. The quantum mechanical tunneling (QMT) is the dominant conduction mechanism for AQL2 and its complex [Cu(AQL2)2]·5H2O. The correlated barrier hopping (CBH) is the dominant conduction mechanism for AQL3 and its complex [Cu(AQL3)2]·5H2O, and the values of the maximum barrier height (Wm) are calculated. Copyright © 2015 Elsevier B.V. All rights reserved.
The AC-120: The advanced commercial transport
NASA Technical Reports Server (NTRS)
Duran, David; Griffin, Ernest; Mendoza, Saul; Nguyen, Son; Pickett, Tim; Noernberg, Clemm
1993-01-01
The main objective of this design was to fulfill a need for a new airplane to replace the aging 100 to 150 passenger, 1500 nautical mile range aircraft such as the Douglas DC9 and Boeing 737-100 airplanes. After researching the future aircraft market, conducting extensive trade studies, and analysis on different configurations, the AC-120 Advanced Commercial Transport final design was achieved. The AC-120's main design features include the incorporation of a three lifting surface configuration which is powered by two turboprop engines. The AC-120 is an economically sensitive aircraft which meets the new FM Stage Three noise requirements, and has lower NO(x) emissions than current turbofan powered airplanes. The AC-120 also improves on its contemporaries in passenger comfort, manufacturing, and operating cost.
Hip-Hop Is the Healer: Sense of Belonging and Diversity among Hip-Hop Collegians
ERIC Educational Resources Information Center
Sulé, V. Thandi
2016-01-01
Sense of belonging is recognized as a factor contributing to persistence to graduation. Furthermore, interactional diversity is associated with learning and civic outcomes--touted higher education goals. Hip-hop culture, one of the most influential cultural creations of the mid-20th century, has succeeded in attracting devotees from diverse…
Towards a Pedagogy of Hip Hop in Urban Teacher Education
ERIC Educational Resources Information Center
Bridges, Thurman
2011-01-01
This article draws from a qualitative study often Black male K-12 teachers from the Hip Hop Generation who are closely connected to Hip Hop culture and have been effective in addressing the academic and social needs of Black boys. Through an analysis of their social, educational and cultural experiences, this article highlights three organizing…
ERIC Educational Resources Information Center
Talley, Clarence, Sr.
2011-01-01
Art has a way of helping students better understand and appreciate the world around them, particularly the things that are most important to them. Hip hop is one of those generational genres that capture the attention of young students like few other things do. Drawing on this genre to get students to create art is an excellent way to demonstrate…
Beats, Rhymes, and Classroom Life: Hip-Hop Pedagogy and the Politics of Identity
ERIC Educational Resources Information Center
Hill, Marc Lamont
2009-01-01
For over a decade, educators have looked to capitalize on the appeal of hip-hop culture, sampling its language, techniques, and styles as a way of reaching out to students. But beyond a fashionable hipness, what does hip-hop have to offer our schools? In this revelatory new book, Marc Lamont Hill shows how a serious engagement with hip-hop culture…
Exact Open Quantum System Dynamics Using the Hierarchy of Pure States (HOPS).
Hartmann, Richard; Strunz, Walter T
2017-12-12
We show that the general and numerically exact Hierarchy of Pure States method (HOPS) is very well applicable to calculate the reduced dynamics of an open quantum system. In particular, we focus on environments with a sub-Ohmic spectral density (SD) resulting in an algebraic decay of the bath correlation function (BCF). The universal applicability of HOPS, reaching from weak to strong coupling for zero and nonzero temperature, is demonstrated by solving the spin-boson model for which we find perfect agreement with other methods, each one suitable for a special regime of parameters. The challenges arising in the strong coupling regime are not only reflected in the computational effort needed for the HOPS method to converge but also in the necessity for an importance sampling mechanism, accounted for by the nonlinear variant of HOPS. In order to include nonzero-temperature effects in the strong coupling regime we found that it is highly favorable for the HOPS method to use the zero-temperature BCF and include temperature via a stochastic Hermitian contribution to the system Hamiltonian.
Odor-Active Compounds in the Special Flavor Hops Huell Melon and Polaris.
Neiens, Silva D; Steinhaus, Martin
2018-02-14
The volatiles isolated from samples of the special flavor hop varieties, Huell Melon and Polaris, and from the aroma hop variety, Hallertau Tradition, by solvent extraction and solvent-assisted flavor evaporation (SAFE) were subjected to a comparative aroma extract dilution analysis (cAEDA), which resulted in 46 odor-active compounds in the flavor dilution (FD) factor range of 16 to 2048. On the basis of high FD factors, myrcene, (3R)-linalool, and 2- and 3-methylbutanoic acid were confirmed as important variety-independent hop odorants. (1R,4S)-Calamenene was identified for the first time as an odor-active compound in hops. Clear differences in the FD factors and their subsequent objectification by stable isotope dilution quantitation suggested that high concentrations of the esters ethyl 2-methylbutanoate, ethyl 2-methylpropanoate, and propyl 2-methylbutanoate cause the characteristic fruity, cantaloupe-like odor note in Huell Melon hops, whereas the fruity and minty odor notes in Polaris are associated with high amounts of 3-methylbutyl acetate and 1,8-cineole.
Christian Hip Hop as Pedagogy: A South African Case Study
ERIC Educational Resources Information Center
Abraham, Ibrahim
2015-01-01
Drawing on interviews with creators of Christian hip hop music in South Africa, this article demonstrates that this genre of popular music and youth culture is utilised as a form of pedagogy to transmit religious beliefs and values to contemporary youth. The pedagogical aspects of hip hop have been recognised in research on the topic, but the…
Hopping and trapping mechanisms in organic field-effect transistors
NASA Astrophysics Data System (ADS)
Konezny, S. J.; Bussac, M. N.; Zuppiroli, L.
2010-01-01
A charge carrier in the channel of an organic field-effect transistor (OFET) is coupled to the electric polarization of the gate in the form of a surface Fröhlich polaron [N. Kirova and M. N. Bussac, Phys. Rev. B 68, 235312 (2003)]. We study the effects of the dynamical field of polarization on both small-polaron hopping and trap-limited transport mechanisms. We present numerical calculations of polarization energies, band-narrowing effects due to polarization, hopping barriers, and interface trap depths in pentacene and rubrene transistors as functions of the dielectric constant of the gate insulator and demonstrate that a trap-and-release mechanism more appropriately describes transport in high-mobility OFETs. For mobilities on the order 0.1cm2/Vs and below, all states are highly localized and hopping becomes the predominant mechanism.
Hop acid-rich spent craft brewer's yeast modulates gut bacterial growth
USDA-ARS?s Scientific Manuscript database
Alpha and beta hop acids (humulones and lupulones) from Humulus lupulus are inhibitors of Gram-positive organisms and important natural antibiotics for beer fermentation and carbohydrate feed stocks for biofuel production. Recent observations (Bryant and Cohen) of high levels of hop acids in spent ...
Hop limited epidemic-like information spreading in mobile social networks with selfish nodes
NASA Astrophysics Data System (ADS)
Wu, Yahui; Deng, Su; Huang, Hongbin
2013-07-01
Similar to epidemics, information can be transmitted directly among users in mobile social networks. Different from epidemics, we can control the spreading process by adjusting the corresponding parameters (e.g., hop count) directly. This paper proposes a theoretical model to evaluate the performance of an epidemic-like spreading algorithm, in which the maximal hop count of the information is limited. In addition, our model can be used to evaluate the impact of users’ selfish behavior. Simulations show the accuracy of our theoretical model. Numerical results show that the information hop count can have an important impact. In addition, the impact of selfish behavior is related to the information hop count.
Lopes, M H; Santos, T G; Rodrigues, B R; Queiroz-Hazarbassanov, N; Cunha, I W; Wasilewska-Sampaio, A P; Costa-Silva, B; Marchi, F A; Bleggi-Torres, L F; Sanematsu, P I; Suzuki, S H; Oba-Shinjo, S M; Marie, S K N; Toulmin, E; Hill, A F; Martins, V R
2015-06-01
Glioblastomas (GBMs) are resistant to current therapy protocols and identification of molecules that target these tumors is crucial. Interaction of secreted heat-shock protein 70 (Hsp70)-Hsp90-organizing protein (HOP) with cellular prion protein (PrP(C)) triggers a large number of trophic effects in the nervous system. We found that both PrP(C) and HOP are highly expressed in human GBM samples relative to non-tumoral tissue or astrocytoma grades I-III. High levels of PrP(C) and HOP were associated with greater GBM proliferation and lower patient survival. HOP-PrP(C) binding increased GBM proliferation in vitro via phosphatidylinositide 3-kinase and extracellular-signal-regulated kinase pathways, and a HOP peptide mimicking the PrP(C) binding site (HOP230-245) abrogates this effect. PrP(C) knockdown impaired tumor growth and increased survival of mice with tumors. In mice, intratumor delivery of HOP230-245 peptide impaired proliferation and promoted apoptosis of GBM cells. In addition, treatment with HOP230-245 peptide inhibited tumor growth, maintained cognitive performance and improved survival. Thus, together, the present results indicate that interfering with PrP(C)-HOP engagement is a promising approach for GBM therapy.
NASA Astrophysics Data System (ADS)
Xiong, Pei-Ying; Yu, Xu-Tao; Zhang, Zai-Chen; Zhan, Hai-Tao; Hua, Jing-Yu
2017-08-01
Quantum multi-hop teleportation is important in the field of quantum communication. In this study, we propose a quantum multi-hop communication model and a quantum routing protocol with multihop teleportation for wireless mesh backbone networks. Based on an analysis of quantum multi-hop protocols, a partially entangled Greenberger-Horne-Zeilinger (GHZ) state is selected as the quantum channel for the proposed protocol. Both quantum and classical wireless channels exist between two neighboring nodes along the route. With the proposed routing protocol, quantum information can be transmitted hop by hop from the source node to the destination node. Based on multi-hop teleportation based on the partially entangled GHZ state, a quantum route established with the minimum number of hops. The difference between our routing protocol and the classical one is that in the former, the processes used to find a quantum route and establish quantum channel entanglement occur simultaneously. The Bell state measurement results of each hop are piggybacked to quantum route finding information. This method reduces the total number of packets and the magnitude of air interface delay. The deduction of the establishment of a quantum channel between source and destination is also presented here. The final success probability of quantum multi-hop teleportation in wireless mesh backbone networks was simulated and analyzed. Our research shows that quantum multi-hop teleportation in wireless mesh backbone networks through a partially entangled GHZ state is feasible.
Cu1–xFexO: hopping transport and ferromagnetism
Nasir, Mohd.; Islam, Rakibul; Ahmed, Md. A; Ayaz, Saniya; Kumar, Gautham; Kumar, Sunil; Prajapat, C. L.; Roussel, Frederick; Biring, Sajal
2017-01-01
Single phase, sol–gel prepared Cu1–xFexO (0 ≤ x ≤ 0.125) powders are characterized in terms of structural, electronic and magnetic properties. Using dielectric and magnetic studies we investigate the coupling of electron and spin. The electrical conductivities and activation energies are studied with increasing Fe content. Modelling of experimental conductivity data emphasizes a single hopping mechanism for all samples except x = 0.125, which have two activation energies. Hole doping is confirmed by confirming a majority Fe3+ substitution of Cu2+ in CuO from X-ray photoelectron spectroscopy studies (XPS). Such a substitution results in stabilized ferromagnetism. Fe substitution introduces variation in coercivity as an intrinsic magnetic property in Fe-doped CuO, and not as a secondary impurity phase. PMID:28989741
Design, testing, and performance of a hybrid micro vehicle---The Hopping Rotochute
NASA Astrophysics Data System (ADS)
Beyer, Eric W.
The Hopping Rotochute is a new hybrid micro vehicle that has been developed to robustly explore environments with rough terrain while minimizing energy consumption over long periods of time. The device consists of a small coaxial rotor system housed inside a lightweight cage. The vehicle traverses an area by intermittently powering a small electric motor which drives the rotor system, allowing the vehicle to hop over obstacles of various shapes and sizes. A movable internal mass controls the direction of travel while the egg-like exterior shape and low mass center allows the vehicle to passively reorient itself to an upright attitude when in contact with the ground. This dissertation presents the design, fabrication, and testing of a radio-controlled Hopping Rotochute prototype as well as an analytical study of the flight performance of the device. The conceptual design iterations are first outlined which were driven by the mission and system requirements assigned to the vehicle. The aerodynamic, mechanical, and electrical design of a prototype is then described, based on the final conceptual design, with particular emphasis on the fundamental trades that must be negotiated for this type of hopping vehicle. The fabrication and testing of this prototype is detailed as well as experimental results obtained from a motion capture system. Basic flight performance of the prototype are reported which demonstrates that the Hopping Rotochute satisfies all appointed system requirements. A dynamic model of the Hopping Rotochute is also developed in this thesis and employed to predict the flight performance of the vehicle. The dynamic model includes aerodynamic loads from the body and rotor system as well as a soft contact model to estimate the forces and moments during ground contact. The experimental methods used to estimate the dynamic model parameters are described while comparisons between measured and simulated motion are presented. Good correlation between these motions
Structure and DNA-binding of meiosis-specific protein Hop2
NASA Astrophysics Data System (ADS)
Zhou, Donghua; Moktan, Hem; Pezza, Roberto
2014-03-01
Here we report structure elucidation of the DNA binding domain of homologous pairing protein 2 (Hop2), which is important to gene diversity when sperms and eggs are produced. Together with another protein Mnd1, Hop2 enhances the strand invasion activity of recombinase Dmc1 by over 30 times, facilitating proper synapsis of homologous chromosomes. However, the structural and biochemical bases for the function of Hop2 and Mnd1 have not been well understood. As a first step toward such understanding, we recently solved the structure for the N-terminus of Hop2 (1-84) using solution NMR. This fragment shows a typical winged-head conformation with recognized DNA binding activity. DNA interacting sites were then investigated by chemical shift perturbations in a titration experiment. Information of these sites was used to guide protein-DNA docking with MD simulation, revealing that helix 3 is stably lodged in the DNA major groove and that wing 1 (connecting strands 2 and 3) transiently comes in contact with the minor groove in nanosecond time scale. Mutagenesis analysis further confirmed the DNA binding sites in this fragment of the protein.
Risk Assessment Using The Homeland-Defense Operational Planning System (HOPS)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Price, D E; Durling, R L
2005-10-10
The Homeland-Defense Operational Planning System (HOPS), is a new operational planning tool leveraging Lawrence Livermore National Laboratory's expertise in weapons systems and in sparse information analysis to support the defense of the U.S. homeland. HOPS provides planners with a basis to make decisions to protect against acts of terrorism, focusing on the defense of facilities critical to U.S. infrastructure. Criticality of facilities, structures, and systems is evaluated on a composite matrix of specific projected casualty, economic, and sociopolitical impact bins. Based on these criteria, significant unidentified vulnerabilities are identified and secured. To provide insight into potential successes by malevolent actors,more » HOPS analysts strive to base their efforts mainly on unclassified open-source data. However, more cooperation is needed between HOPS analysts and facility representatives to provide an advantage to those whose task is to defend these facilities. Evaluated facilities include: refineries, major ports, nuclear power plants and other nuclear licensees, dams, government installations, convention centers, sports stadiums, tourist venues, and public and freight transportation systems. A generalized summary of analyses of U.S. infrastructure facilities will be presented.« less
Dielectric and impedance spectral characteristics of bulk ZnIn2Se4
NASA Astrophysics Data System (ADS)
El-Nahass, M. M.; Attia, A. A.; Salem, G. F.; Ali, H. A. M.; Ismail, M. I.
2014-02-01
The frequency and temperature dependence of ac conductivity, dielectric constant and dielectric loss of ZnIn2Se4 in a pellet form were investigated in the frequency range of 102-106 Hz and temperature range of 293-356 K. The behavior of ac conductivity was interpreted by the correlated barrier hopping (CBH) model. Temperature dependence of ac conductivity indicates that ac conduction is a thermally activated process. The density of localized states N(EF) and ac activation energy were estimated for various frequencies. Dielectric constant and dielectric loss showed a decrease with increasing frequency and an increase with increasing in temperature. The frequency dependence of real and imaginary parts of the complex impedance was investigated. The relaxation time decreases with the increase in temperature. The impedance spectrum exhibits the appearance of the single semicircular arc. The radius of semicircular arcs decreases with increasing temperature which suggests a mechanism of temperature-dependent on relaxation.
Analysis of muscle activity and ankle joint movement during the side-hop test.
Yoshida, Masahiro; Taniguchi, Keigo; Katayose, Masaki
2011-08-01
Functional performance tests (FPTs) that consist of movements, such as hopping, landing, and cutting, provide useful measurements. Although some tests have been established for kinematic studies of the knee joint, very few tests have been established for the ankle joint. To use the FPT as a test battery for patients with an ankle sprain, it is necessary to document typical patterns of muscle activation and range of motion (ROM) of the ankle joint during FPTs. Therefore, the purpose of this study was to investigate the pattern of the ROM of the ankle inversion/eversion and the muscle activity of the peroneus longus muscle (PL) and the tibial anterior muscle (TA) in normal subjects during the side-hop test. To emphasize the characteristics of ROM and electromyography (EMG) at each phase, the side-hop tests were divided into 4 phases: lateral-hop contact phase (LC), lateral-hop flight phase (LF), medial hop contact phase (MC), and medial hop flight phase (MF), and the ROM of ankle inversion/eversion, a peak angle of ankle inversion, and Integral EMG (IEMG) of PL and TA compared among 4 phases. Fifteen male subjects with no symptoms of ankle joint problems participated in this research. The ROM of ankle inversion/eversion during the side-hop test was 27 ± 3.8° (mean ± SD), and there was a significant difference in the ROM of ankle inversion/eversion among 4 phases (p < 0.05). The phase in which the widest ROM was presented was the MF. A peak angle of the ankle inversion at MC was significantly greater than at LC and MF (p <0.05). A peak angle of the ankle inversion at LF was significantly greater than at LC and MF. The PL remained contracting with 50-160% of maximal voluntary contraction (MVC). The IEMGs of PL in both the contact phases were significantly greater than in both the flight phases (p < 0.05). In addition, the PL activity at LC was significantly greater than at MC. The TA remained contracting at 50-80% of MVC through the side-hop test. The IEMG of TA at
He, Guo-qing; Xiong, Hao-ping; Chen, Qi-he; Ruan, Hui; Wang, Zhao-yue; Traoré, Lonseny
2005-01-01
Waste hops are good sources of flavonoids. Extraction of flavonoids from waste hops (SC-CO2 extracted hops) using supercritical fluids technology was investigated. Various temperatures, pressures and concentrations of ethanol (modifier) and the ratio (w/w) of solvent to material were tested in this study. The results of single factor and orthogonal experiments showed that at 50 °C, 25 MPa, the ratio of solvent to material (50%), ethanol concentration (80%) resulted in maximum extraction yield flavonoids (7.8 mg/g). HPLC-MS analysis of the extracts indicated that flavonoids obtained were xanthohumol, the principal prenylflavonoid in hops. PMID:16187413
DC-biased AC-electroosmotic and AC-electrothermal flow mixing in microchannels.
Ng, Wee Yang; Goh, Shireen; Lam, Yee Cheong; Yang, Chun; Rodríguez, Isabel
2009-03-21
This paper presents a novel approach of mixing two laminar flowing streams in microchannels. The mixer consists of a pair of electrodes disposed along a fluidic channel. By energizing the electrodes with a DC-biased (2.5 V) AC voltage (20 Vpp), an electrokinetic flow is induced with a flow profile perpendicular to that of the incoming laminar streams of liquids to be mixed. As a result, the flow lines of the incoming streams and the induced flow are forced to crossover and very efficient stirring and mixing at short mixing length can be achieved. The mixer can be operated from the AC-electroosmotic (ACEO) (sigma=1 mS/m, f=100 kHz) to the AC-electrothermal (ACET) (sigma=500 mS/m, f=500 kHz) flow regimes. The mixing efficiency in the ACEO regime was 92%, with a mixing length of 600 microm (Q=2 microL/min), an estimated mixing time of 69 ms and an induced ACEO flow velocity of approximately 725 microm/s. The mixing efficiency in the ACET regime was 65% for a mixing length of approximately 1200 microm. The mixer is efficient and suitable for mixing reagents in a fluid media from low to high conductivity as required in diverse microfluidic applications.
Basin Hopping Graph: a computational framework to characterize RNA folding landscapes
Kucharík, Marcel; Hofacker, Ivo L.; Stadler, Peter F.; Qin, Jing
2014-01-01
Motivation: RNA folding is a complicated kinetic process. The minimum free energy structure provides only a static view of the most stable conformational state of the system. It is insufficient to give detailed insights into the dynamic behavior of RNAs. A sufficiently sophisticated analysis of the folding free energy landscape, however, can provide the relevant information. Results: We introduce the Basin Hopping Graph (BHG) as a novel coarse-grained model of folding landscapes. Each vertex of the BHG is a local minimum, which represents the corresponding basin in the landscape. Its edges connect basins when the direct transitions between them are ‘energetically favorable’. Edge weights endcode the corresponding saddle heights and thus measure the difficulties of these favorable transitions. BHGs can be approximated accurately and efficiently for RNA molecules well beyond the length range accessible to enumerative algorithms. Availability and implementation: The algorithms described here are implemented in C++ as standalone programs. Its source code and supplemental material can be freely downloaded from http://www.tbi.univie.ac.at/bhg.html. Contact: qin@bioinf.uni-leipzig.de Supplementary information: Supplementary data are available at Bioinformatics online. PMID:24648041
Limit Properties of One Dimensional Periodic Hopping Model
NASA Astrophysics Data System (ADS)
Zhang, Yun-xin
2010-02-01
One dimensional periodic hopping model is useful to understand the motion of microscopic particles in thermal noise environment. In this research, by formal calculation and based on detailed balance, the explicit expressions of the limits of mean velocity and diffusion constant of this model as the number of internal mechanochemical sates tend to infinity are obtained. These results will be helpful to understand the limit of the one dimensional hopping model. At the same time, the work can be used to get more useful results in continuous form from the corresponding ones obtained by discrete models.
A Multicomponent UV Analysis of ["alpha"]- and ["beta"]-Acids in Hops
ERIC Educational Resources Information Center
Egts, Haley; Durben, Dan J.; Dixson, John A.; Zehfus, Micheal H.
2012-01-01
A method is presented for the determination of ["alpha"]- and ["beta"]-acids (humulones and lupulones) in a hops sample using a multicomponent UV spectroscopic analysis of a methanolic hop extract. When compared with standard methods, this lab can be considered "greener" because it uses smaller volumes of safer solvents (methanol instead of…
Hip-Hop and a Hybrid Text in a Postsecondary English Class
ERIC Educational Resources Information Center
Sanchez, Deborah M.
2010-01-01
This study explores the epistemology present in hip-hop music and its reflection in the writing of one African American student in a postsecondary transitional English class. An integration of hip-hop and academic literacy practices in the student's essay challenges the supremacy of a "standard" academic English and deficit perspectives about…
Hegemony, Hope, and the Harlem Renaissance: Taking Hip Hop Culture Seriously
ERIC Educational Resources Information Center
Price, Robert J., Jr.
2005-01-01
Adult education instructors and administrators, who typically are not members of the hip hop generation, often have little knowledge and understanding of rap music (also known as gangsta rap) and hip hop culture, and consequently do not take the black popular cultural phenomenon seriously as it relates to adult education. Adult educators,…
Unexpectedly Fast Phonon-Assisted Exciton Hopping between Carbon Nanotubes
Davoody, A. H.; Karimi, F.; Arnold, M. S.; ...
2017-06-05
Carbon-nanotube (CNT) aggregates are promising light-absorbing materials for photovoltaics. The hopping rate of excitons between CNTs directly affects the efficiency of these devices. We theoretically investigate phonon-assisted exciton hopping, where excitons scatter with phonons into a same-tube transition state, followed by intertube Coulomb scattering into the final state. Second-order hopping between bright excitonic states is as fast as the first-order process (~1 ps). For perpendicular CNTs, the high rate stems from the high density of phononic states; for parallel CNTs, the reason lies in relaxed selection rules. Moreover, second-order exciton transfer between dark and bright states, facilitated by phonons withmore » large angular momentum, has rates comparable to bright-to-bright transfer, so dark excitons provide an additional pathway for energy transfer in CNT composites. Furthermore, as dark excitons are difficult to probe in experiment, predictive theory is critical for understanding exciton dynamics in CNT composites.« less
Unexpectedly Fast Phonon-Assisted Exciton Hopping between Carbon Nanotubes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Davoody, A. H.; Karimi, F.; Arnold, M. S.
Carbon-nanotube (CNT) aggregates are promising light-absorbing materials for photovoltaics. The hopping rate of excitons between CNTs directly affects the efficiency of these devices. We theoretically investigate phonon-assisted exciton hopping, where excitons scatter with phonons into a same-tube transition state, followed by intertube Coulomb scattering into the final state. Second-order hopping between bright excitonic states is as fast as the first-order process (~1 ps). For perpendicular CNTs, the high rate stems from the high density of phononic states; for parallel CNTs, the reason lies in relaxed selection rules. Moreover, second-order exciton transfer between dark and bright states, facilitated by phonons withmore » large angular momentum, has rates comparable to bright-to-bright transfer, so dark excitons provide an additional pathway for energy transfer in CNT composites. Furthermore, as dark excitons are difficult to probe in experiment, predictive theory is critical for understanding exciton dynamics in CNT composites.« less
Comparison of the carboxy-terminal DP-repeat region in the co-chaperones Hop and Hip
Nelson, Gregory M.; Huffman, Holly; Smith, David F.
2003-01-01
Functional steroid receptor complexes are assembled and maintained by an ordered pathway of interactions involving multiple components of the cellular chaperone machinery. Two of these components, Hop and Hip, serve as co-chaperones to the major heat shock proteins (Hsps), Hsp70 and Hsp90, and participate in intermediate stages of receptor assembly. In an effort to better understand the functions of Hop and Hip in the assembly process, we focused on a region of similarity located near the C-terminus of each co-chaperone. Contained within this region is a repeated sequence motif we have termed the DP repeat. Earlier mutagenesis studies implicated the DP repeat of either Hop or Hip in Hsp70 binding and in normal assembly of the co-chaperones with progesterone receptor (PR) complexes. We report here that the DP repeat lies within a protease-resistant domain that extends to or is near the C-terminus of both co-chaperones. Point mutations in the DP repeats render the C-terminal regions hypersensitive to proteolysis. In addition, a Hop DP mutant displays altered proteolytic digestion patterns, which suggest that the DP-repeat region influences the folding of other Hop domains. Although the respective DP regions of Hop and Hip share sequence and structural similarities, they are not functionally interchangeable. Moreover, a double-point mutation within the second DP-repeat unit of Hop that converts this to the sequence found in Hip disrupts Hop function; however, the corresponding mutation in Hip does not alter its function. We conclude that the DP repeats are important structural elements within a C-terminal domain, which is important for Hop and Hip function. PMID:14627198
Comparison of the carboxy-terminal DP-repeat region in the co-chaperones Hop and Hip.
Nelson, Gregory M; Huffman, Holly; Smith, David F
2003-01-01
Functional steroid receptor complexes are assembled and maintained by an ordered pathway of interactions involving multiple components of the cellular chaperone machinery. Two of these components, Hop and Hip, serve as co-chaperones to the major heat shock proteins (Hsps), Hsp70 and Hsp90, and participate in intermediate stages of receptor assembly. In an effort to better understand the functions of Hop and Hip in the assembly process, we focused on a region of similarity located near the C-terminus of each co-chaperone. Contained within this region is a repeated sequence motif we have termed the DP repeat. Earlier mutagenesis studies implicated the DP repeat of either Hop or Hip in Hsp70 binding and in normal assembly of the co-chaperones with progesterone receptor (PR) complexes. We report here that the DP repeat lies within a protease-resistant domain that extends to or is near the C-terminus of both co-chaperones. Point mutations in the DP repeats render the C-terminal regions hypersensitive to proteolysis. In addition, a Hop DP mutant displays altered proteolytic digestion patterns, which suggest that the DP-repeat region influences the folding of other Hop domains. Although the respective DP regions of Hop and Hip share sequence and structural similarities, they are not functionally interchangeable. Moreover, a double-point mutation within the second DP-repeat unit of Hop that converts this to the sequence found in Hip disrupts Hop function; however, the corresponding mutation in Hip does not alter its function. We conclude that the DP repeats are important structural elements within a C-terminal domain, which is important for Hop and Hip function.
NASA Astrophysics Data System (ADS)
Aziz, Nor Diyana Abdul; Kamarulzaman, Norlida; Subban, Ri Hanum Yahaya; Hamzah, Ahmad Sazali; Ahmed, Azni Zain; Osman, Zurina; Rusdi, Roshidah; Kamarudin, Norashikin; Mohalid, Norhanim; Romli, Ahmad Zafir; Shaameri, Zurina
2017-09-01
Polymer electrolytes have been an essential area of research for many decades. One of the reasons was the need to find new electrolyte materials suitable for device applications like solid-state batteries, supercapacitors, fuel cells, etc. with enhanced characteristics. For more than 40 years, polyimide has been known as a super-engineering plastic due to its excellent thermal stability (Tg > 250 °C) and mechanical properties. Therefore, in an effort to develop new polymer electrolytes, polyimide as a polymer matrix was chosen. Composite films of the polymer doped with lithium salt, LiCF3SO3 was prepared. These PI based polymer electrolyte films were investigated by the alternating current (a.c.) impedance spectroscopy method in the temperature range from 300 K to 373 K. It was observed that conductivity increased with the increase of temperature and amount of doping salt. Alternatively, the activation energy (Ea) of the composite films decreased with the increase of the doping salt, LiCF3SO3.
Polish Hip Hop as a Form of Multiliteracies and Situated Learning
ERIC Educational Resources Information Center
Torrence, Michael L.
2009-01-01
The purpose of this ethnographic study was to examine Hip Hop in Poland through the lens of multiliteracies and situated learning. This analysis is concerned with the transmission of Hip Hop to and within Wroclaw, Poland, and its acculturation and assimilation in Wroclaw, Poland. Further, this study seeks to illustrate how professional Polish Hip…
A study on a wheel-based stair-climbing robot with a hopping mechanism
NASA Astrophysics Data System (ADS)
Kikuchi, Koki; Sakaguchi, Keisuke; Sudo, Takayuki; Bushida, Naoki; Chiba, Yasuhiro; Asai, Yuji
2008-08-01
In this study, we propose a simple hopping mechanism using the vibration of a two-degree-of-freedom system for a wheel-based stair-climbing robot. The robot, consisting of two bodies connected by springs and a wire, hops by releasing energy stored in the springs and quickly travels using wheels mounted in its lower body. The trajectories of the bodies during hopping change in accordance with the design parameters, such as the reduced mass of the two bodies, the mass ratio between the upper and lower bodies, the spring constant, the control parameters such as the initial contraction of the spring and the wire tension. This property allows the robot to quickly and economically climb up and down stairs, leap over obstacles, and landing softly without complex control. In this paper, the characteristics of hopping motion for the design and control parameters are clarified by both numerical simulations and experiments. Furthermore, using the robot design based on the results the abilities to hop up and down a step, leap over a cable, and land softly are demonstrated.
Majorana edge States in atomic wires coupled by pair hopping.
Kraus, Christina V; Dalmonte, Marcello; Baranov, Mikhail A; Läuchli, Andreas M; Zoller, P
2013-10-25
We present evidence for Majorana edge states in a number conserving theory describing a system of spinless fermions on two wires that are coupled by pair hopping. Our analysis is based on a combination of a qualitative low energy approach and numerical techniques using the density matrix renormalization group. In addition, we discuss an experimental realization of pair-hopping interactions in cold atom gases confined in optical lattices.
van der Kant, Rik; Jonker, Caspar T. H.; Wijdeven, Ruud H.; Bakker, Jeroen; Janssen, Lennert; Klumperman, Judith; Neefjes, Jacques
2015-01-01
Trafficking of cargo through the endosomal system depends on endosomal fusion events mediated by SNARE proteins, Rab-GTPases, and multisubunit tethering complexes. The CORVET and HOPS tethering complexes, respectively, regulate early and late endosomal tethering and have been characterized in detail in yeast where their sequential membrane targeting and assembly is well understood. Mammalian CORVET and HOPS subunits significantly differ from their yeast homologues, and novel proteins with high homology to CORVET/HOPS subunits have evolved. However, an analysis of the molecular interactions between these subunits in mammals is lacking. Here, we provide a detailed analysis of interactions within the mammalian CORVET and HOPS as well as an additional endosomal-targeting complex (VIPAS39-VPS33B) that does not exist in yeast. We show that core interactions within CORVET and HOPS are largely conserved but that the membrane-targeting module in HOPS has significantly changed to accommodate binding to mammalian-specific RAB7 interacting lysosomal protein (RILP). Arthrogryposis-renal dysfunction-cholestasis (ARC) syndrome-associated mutations in VPS33B selectively disrupt recruitment to late endosomes by RILP or binding to its partner VIPAS39. Within the shared core of CORVET/HOPS, we find that VPS11 acts as a molecular switch that binds either CORVET-specific TGFBRAP1 or HOPS-specific VPS39/RILP thereby allowing selective targeting of these tethering complexes to early or late endosomes to time fusion events in the endo/lysosomal pathway. PMID:26463206
An ac initiation system is described which uses three ac transmission signals interlocked for safety by frequency, phase, and power discrimination...The ac initiation system is pre-armed by the application of two ac signals have the proper phases, and activates a load when an ac power signal of the proper frequency and power level is applied. (Author)
No evidence hip joint angle modulates intrinsically produced stretch reflex in human hopping.
Gibson, W; Campbell, A; Allison, G
2013-09-01
Motor output in activities such as walking and hopping is suggested to be mediated neurally by purported stretch reflex augmentation of muscle output. Reflex EMG activity during these tasks has been frequently investigated in the soleus muscle; with alterations in reflex amplitude being associated with changes in hip joint angle/phase of the gait cycle. Previous work has focussed on reflex activity induced by an artificial perturbation or by induction of H-reflexes. As such, it is currently unknown if stretch reflex activity induced intrinsically (as part of the task) is modulated by changes in hip joint angle. This study investigated whether hip joint angle modulated reflex EMG 'burst' activity during a hopping task performed on a custom-built partially reclined sleigh. Ten subjects participated; EMG and kinematic data (VICON motor capture system) was collected for each hop cycle. Participants completed 5 sets of 30s of self-paced hopping in (1) hip neutral and (2) hip 60° flexion conditions. There was no difference in EMG 'burst' activity or in sagittal plane kinematics (knee/ankle) in the hopping task between the two conditions. The results indicate that during a functional task such as hopping, changes in hip angle do not alter the stretch reflex-like activity associated with landing. Copyright © 2013 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Niu, Yuekun; Sun, Jian; Ni, Yu; Song, Yun
2018-06-01
The dynamical mean-field theory is employed to study the orbital-selective Mott transition (OSMT) of the two-orbital Hubbard model with nearest neighbor hopping and next-nearest neighbor (NNN) hopping. The NNN hopping breaks the particle-hole symmetry at half filling and gives rise to an asymmetric density of states (DOS). Our calculations show that the broken symmetry of DOS benefits the OSMT, where the region of the orbital-selective Mott phase significantly extends with the increasing NNN hopping integral. We also find that Hund's rule coupling promotes OSMT by blocking the orbital fluctuations, but the influence of NNN hopping is more remarkable.
Don't Believe the Hype: Hip-Hop Literacies and English Education
ERIC Educational Resources Information Center
Belle, Crystal
2016-01-01
Current scholarship suggests that many youths identify with hip-hop, especially youths of color. Study of this artistic form has been suggested as a means of helping youths acquire and become fluent in literacy practices. This article explores how the use of a hip-hop literacies curriculum addressed the literacy skills of urban ninth-grade English…
ERIC Educational Resources Information Center
Piekarski, Bill
2004-01-01
From its humble origins some 30 years ago in New York's bombed-out, poverty-ravaged South Bronx, hip-hop has risen to become a dominant cultural force both here and abroad. Strictly defined, the term refers to the entire cultural constellation that accompanies rap music, which in 2001 surpassed country music as the most popular musical genre in…
High-throughput genotyping of hop (Humulus lupulus L.) utilising diversity arrays technology (DArT).
Howard, E L; Whittock, S P; Jakše, J; Carling, J; Matthews, P D; Probasco, G; Henning, J A; Darby, P; Cerenak, A; Javornik, B; Kilian, A; Koutoulis, A
2011-05-01
Implementation of molecular methods in hop (Humulus lupulus L.) breeding is dependent on the availability of sizeable numbers of polymorphic markers and a comprehensive understanding of genetic variation. However, use of molecular marker technology is limited due to expense, time inefficiency, laborious methodology and dependence on DNA sequence information. Diversity arrays technology (DArT) is a high-throughput cost-effective method for the discovery of large numbers of quality polymorphic markers without reliance on DNA sequence information. This study is the first to utilise DArT for hop genotyping, identifying 730 polymorphic markers from 92 hop accessions. The marker quality was high and similar to the quality of DArT markers previously generated for other species; although percentage polymorphism and polymorphism information content (PIC) were lower than in previous studies deploying other marker systems in hop. Genetic relationships in hop illustrated by DArT in this study coincide with knowledge generated using alternate methods. Several statistical analyses separated the hop accessions into genetically differentiated North American and European groupings, with hybrids between the two groups clearly distinguishable. Levels of genetic diversity were similar in the North American and European groups, but higher in the hybrid group. The markers produced from this time and cost-efficient genotyping tool will be a valuable resource for numerous applications in hop breeding and genetics studies, such as mapping, marker-assisted selection, genetic identity testing, guidance in the maintenance of genetic diversity and the directed breeding of superior cultivars.
Hopping locomotion at different gravity: metabolism and mechanics in humans.
Pavei, Gaspare; Minetti, Alberto E
2016-05-15
Previous literature on the effects of low gravity on the mechanics and energetics of human locomotion already dealt with walking, running, and skipping. The aim of the present study is to obtain a comprehensive view on that subject by including measurements of human hopping in simulated low gravity, a gait often adopted in many Apollo Missions and documented in NASA footage. Six subjects hopped at different speeds at terrestrial, Martian, and Lunar gravity on a treadmill while oxygen consumption and 3D body kinematic were sampled. Results clearly indicate that hopping is too metabolically expensive to be a sustainable locomotion on Earth but, similarly to skipping (and running), its economy greatly (more than ×10) increases at lower gravity. On the Moon, the metabolic cost of hopping becomes even lower than that of walking, skipping, and running, but the general finding is that gaits with very different economy on Earth share almost the same economy on the Moon. The mechanical reasons for such a decrease in cost are discussed in the paper. The present data, together with previous findings, will allow also to predict the aerobic traverse range/duration of astronauts when getting far from their base station on low gravity planets. Copyright © 2016 the American Physiological Society.
Back-Hopping in Spin-Transfer-Torque Devices: Possible Origin and Countermeasures
NASA Astrophysics Data System (ADS)
Abert, Claas; Sepehri-Amin, Hossein; Bruckner, Florian; Vogler, Christoph; Hayashi, Masamitsu; Suess, Dieter
2018-05-01
The effect of undesirable high-frequency free-layer switching in magnetic multilayer systems, referred to as back-hopping, is investigated by means of the spin-diffusion model. A possible origin of the back-hopping effect is found to be the destabilization of the pinned layer, which leads to the perpetual switching of both layers. While the presented mechanism is not claimed to be the only possible reason for back-hopping, we show that it is a fundamental effect that will occur in any spin-transfer-torque device when exceeding a critical current. The influence of different material parameters on the critical switching currents for the free and pinned layer is obtained by micromagnetic simulations. The spin-diffusion model enables an accurate description of the torque on both layers, depending on various material parameters. It is found that the choice of a free-layer material with low polarization β and saturation magnetization Ms and a pinned-layer material with high β and Ms leads to a low free-layer critical current and a high pinned-layer critical current and hence reduces the likelihood of back-hopping. While back-hopping has been observed in various types of devices, there are only a few experiments that exhibit this effect in perpendicularly magnetized systems. However, our simulations suggest that the described effect will also gain importance in perpendicular systems due to the loss of pinned-layer anisotropy for decreasing device sizes.
ERIC Educational Resources Information Center
Roach, Ronald
2004-01-01
As a cultural movement, hip-hop manages to get billed as both a positive and negative influence on young people, especially on Black and Latino youth. On one hand, there are African American activists, artists and entrepreneurs, such as Russell Simmons, who seek to build a progressive political movement among young hip-hop fans and who have had…
Analytical methods for quantitation of prenylated flavonoids from hops.
Nikolić, Dejan; van Breemen, Richard B
2013-01-01
The female flowers of hops ( Humulus lupulus L.) are used as a flavoring agent in the brewing industry. There is growing interest in possible health benefits of hops, particularly as estrogenic and chemopreventive agents. Among the possible active constituents, most of the attention has focused on prenylated flavonoids, which can chemically be classified as prenylated chalcones and prenylated flavanones. Among chalcones, xanthohumol (XN) and desmethylxanthohumol (DMX) have been the most studied, while among flavanones, 8-prenylnaringenin (8-PN) and 6-prenylnaringenin (6-PN) have received the most attention. Because of the interest in medicinal properties of prenylated flavonoids, there is demand for accurate, reproducible and sensitive analytical methods to quantify these compounds in various matrices. Such methods are needed, for example, for quality control and standardization of hop extracts, measurement of the content of prenylated flavonoids in beer, and to determine pharmacokinetic properties of prenylated flavonoids in animals and humans. This review summarizes currently available analytical methods for quantitative analysis of the major prenylated flavonoids, with an emphasis on the LC-MS and LC-MS-MS methods and their recent applications to biomedical research on hops. This review covers all methods in which prenylated flavonoids have been measured, either as the primary analytes or as a part of a larger group of analytes. The review also discusses methodological issues relating to the quantitative analysis of these compounds regardless of the chosen analytical approach.
Buttles, John W [Idaho Falls, ID
2011-12-20
Wireless communication devices include a software-defined radio coupled to processing circuitry. The processing circuitry is configured to execute computer programming code. Storage media is coupled to the processing circuitry and includes computer programming code configured to cause the processing circuitry to configure and reconfigure the software-defined radio to operate on each of a plurality of communication networks according to a selected sequence. Methods for communicating with a wireless device and methods of wireless network-hopping are also disclosed.
Buttles, John W
2013-04-23
Wireless communication devices include a software-defined radio coupled to processing circuitry. The system controller is configured to execute computer programming code. Storage media is coupled to the system controller and includes computer programming code configured to cause the system controller to configure and reconfigure the software-defined radio to operate on each of a plurality of communication networks according to a selected sequence. Methods for communicating with a wireless device and methods of wireless network-hopping are also disclosed.
High-Speed Hopping: Time-Resolved Tomographic PIV Measurements of Water Flea Swimming
NASA Astrophysics Data System (ADS)
Murphy, D. W.; Webster, D. R.; Yen, J.
2012-11-01
Daphniids, also known as water fleas, are small, freshwater crustaceans that live in a low-to-intermediate Reynolds number regime. These plankters are equipped with a pair of branched, setae-bearing antennae that they beat to impulsively propel themselves, or ``hop,'' through the water. A typical hop carries the daphniid one body length forward and is followed by a period of sinking. We present time-resolved tomographic PIV measurements of swimming by Daphnia magna. The body kinematics and flow physics of the daphniid hop are quantified. It is shown that the flow generated by each stroking antenna resembles an asymmetric viscous vortex ring. It is proposed that the flow produced by the daphniid hop can be modeled as a double Stokeslet consisting of two impulsively applied point forces separated by the animal width. The flow physics are discussed in the context of other species operating in the same Reynolds number range of 10 to 100: sea butterfly swimming and flight by the smallest flying insects.
You know what it is: learning words through listening to hip-hop.
Chesley, Paula
2011-01-01
Music listeners have difficulty correctly understanding and remembering song lyrics. However, results from the present study support the hypothesis that young adults can learn African-American English (AAE) vocabulary from listening to hip-hop music. Non-African-American participants first gave free-response definitions to AAE vocabulary items, after which they answered demographic questions as well as questions addressing their social networks, their musical preferences, and their knowledge of popular culture. Results from the survey show a positive association between the number of hip-hop artists listened to and AAE comprehension vocabulary scores. Additionally, participants were more likely to know an AAE vocabulary item if the hip-hop artists they listen to use the word in their song lyrics. Together, these results suggest that young adults can acquire vocabulary through exposure to hip-hop music, a finding relevant for research on vocabulary acquisition, the construction of adolescent and adult identities, and the adoption of lexical innovations.
You Know What It Is: Learning Words through Listening to Hip-Hop
Chesley, Paula
2011-01-01
Music listeners have difficulty correctly understanding and remembering song lyrics. However, results from the present study support the hypothesis that young adults can learn African-American English (AAE) vocabulary from listening to hip-hop music. Non-African-American participants first gave free-response definitions to AAE vocabulary items, after which they answered demographic questions as well as questions addressing their social networks, their musical preferences, and their knowledge of popular culture. Results from the survey show a positive association between the number of hip-hop artists listened to and AAE comprehension vocabulary scores. Additionally, participants were more likely to know an AAE vocabulary item if the hip-hop artists they listen to use the word in their song lyrics. Together, these results suggest that young adults can acquire vocabulary through exposure to hip-hop music, a finding relevant for research on vocabulary acquisition, the construction of adolescent and adult identities, and the adoption of lexical innovations. PMID:22205942
NASA Astrophysics Data System (ADS)
Yoshioka, Hironori; Hirata, Kazuto
2018-04-01
The characteristics of SiC MOSFETs (drain current vs. gate voltage) were measured at 0.14-350 K and analyzed considering variable-range hopping conduction through interface states. The total interface state density was determined to be 5.4×1012 cm-2 from the additional shift in the threshold gate voltage with a temperature change. The wave-function size of interface states was determined from the temperature dependence of the measured hopping current and was comparable to the theoretical value. The channel mobility was approximately 100 cm2V-1s-1 and was almost independent of temperature.
NASA Astrophysics Data System (ADS)
Yadav, Abhinav; Mantry, Snigdha Paramita; Fahad, Mohd.; Sarun, P. M.
2018-05-01
Sodium niobate (NaNbO3) ceramics is prepared by conventional solid state reaction method at sintering temperature 1150 °C for 4 h. The structural information of the material has been investigated by X-ray diffraction (XRD) and Field emission scanning electron microscopy (FE-SEM). The XRD analysis of NaNbO3 ceramics shows an orthorhombic structure. The FE-SEM micrograph of NaNbO3 ceramics exhibit grains with grain sizes ranging between 1 μm to 5 μm. The surface coverage and average grain size of NaNbO3 ceramics are found to be 97.6 % and 2.5 μm, respectively. Frequency dependent electrical properties of NaNbO3 is investigated from room temperature to 500 °C in wide frequency range (100 Hz-5 MHz). Dielectric constant, ac-conductivity, impedance, modulus and Nyquist analysis are performed. The observed dielectric constant (1 kHz) at transition temperature (400 °C) are 975. From conductivity analysis, the estimated activation energy of NaNbO3 ceramics is 0.58 eV at 10 kHz. The result of Nyquist plot shows that the electrical behavior of NaNbO3 ceramics is contributed by grain and grain boundary responses. The impedance and modulus spectrum asserts that the negative temperature coefficient of resistance (NTCR) behavior and non-Debye type relaxation in NaNbO3.
Simulation of Downlink Synchronization for a Frequency-Hopped Satellite Communication System
1992-04-01
naflonie SIMULATION OF DOWNLINK SYNCHRONIZATION FOR A FREQUENCY-HOPPED SATELLITE COMMUNICATION SYSTEM (U) by Lyle Waper_Communicadion and Xa elo Elkaoftron...is offset by an increase in complexity while establishing the communication link, termed synchronization . This document describes a downlink... synchronization process that involves the transmission of synchronization hops by the satellite and a two-step ground terminal synchonization procedure. In
Student Perceptions of the Hip Hop Culture's Influence on the Undergraduate Experience
ERIC Educational Resources Information Center
Wessel, Roger D.; Wallaert, Kerry A.
2011-01-01
This study sought to determine how identification and engagement with the hip hop culture influenced the educational experiences of undergraduate students at a Midwestern, predominately White university by interviewing 11 students who self-identified as being immersed in the hip hop culture. Through a qualitative, phenomenological investigation,…
QTL analysis of resistance to powdery mildew in Hop (Humulus lupulus L.)
USDA-ARS?s Scientific Manuscript database
Powdery mildew infection of hop results in significant production losses on an annual basis by reducing yields as well as cone quality. One of the best means to increase yield and quality is the production of resistant hop lines. Breeding for resistance can be significantly improved and accelerate...
Hip-Hop, Social Justice, and Environmental Education: Toward a Critical Ecological Literacy
ERIC Educational Resources Information Center
Cermak, Michael J.
2012-01-01
This essay describes an educational initiative that used environmentally themed (green) hip-hop to stimulate learning in an environmental science classroom. Students were then challenged to compose their own green hip-hop and their lyrics demonstrated skills that have thematic consistency around what is called a Critical Ecological Literacy (CEL).…
The Effects of Theta and Gamma tACS on Working Memory and Electrophysiology
Pahor, Anja; Jaušovec, Norbert
2018-01-01
A single blind sham-controlled study was conducted to explore the effects of theta and gamma transcranial alternating current stimulation (tACS) on offline performance on working memory tasks. In order to systematically investigate how specific parameters of tACS affect working memory, we manipulated the frequency of stimulation (theta frequency vs. gamma frequency), the type of task (n-back vs. change detection task) and the content of the tasks (verbal vs. figural stimuli). A repeated measures design was used that consisted of three sessions: theta tACS, gamma tACS and sham tACS. In total, four experiments were conducted which differed only with respect to placement of tACS electrodes (bilateral frontal, bilateral parietal, left fronto-parietal and right-fronto parietal). Healthy female students (N = 72) were randomly assigned to one of these groups, hence we were able to assess the efficacy of theta and gamma tACS applied over different brain areas, contrasted against sham stimulation. The pre-post/sham resting electroencephalogram (EEG) analysis showed that theta tACS significantly affected theta amplitude, whereas gamma tACS had no significant effect on EEG amplitude in any of the frequency bands of interest. Gamma tACS did not significantly affect working memory performance compared to sham, and theta tACS led to inconsistent changes in performance on the n-back tasks. Active theta tACS significantly affected P3 amplitude and latency during performance on the n-back tasks in the bilateral parietal and right-fronto parietal protocols. PMID:29375347
First report of hop stunt viroid from sweet cherry with dapple apple fruit symptoms in China
USDA-ARS?s Scientific Manuscript database
Hop stunt viroid (HSVd), the type member of the genus Hostuviroid, family Pospiviroidae, was first described from hops with stunt disease in Japan. HSVd has a wide host range that includes hop, cucumber, citrus, grapevine, plum, pear, peach, apricot and almond and is the causal agent of serious dis...
Resistance distribution in the hopping percolation model.
Strelniker, Yakov M; Havlin, Shlomo; Berkovits, Richard; Frydman, Aviad
2005-07-01
We study the distribution function P (rho) of the effective resistance rho in two- and three-dimensional random resistor networks of linear size L in the hopping percolation model. In this model each bond has a conductivity taken from an exponential form sigma proportional to exp (-kappar) , where kappa is a measure of disorder and r is a random number, 0< or = r < or =1 . We find that in both the usual strong-disorder regime L/ kappa(nu) >1 (not sensitive to removal of any single bond) and the extreme-disorder regime L/ kappa(nu) <1 (very sensitive to such a removal) the distribution depends only on L/kappa(nu) and can be well approximated by a log-normal function with dispersion b kappa(nu) /L , where b is a coefficient which depends on the type of lattice, and nu is the correlation critical exponent.
Structure and Charge Hopping Dynamics in Green Rust
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wander, Matthew C; Rosso, Kevin M; Schoonen, Martin A
Green rust is a family of mixed-valent iron phases formed by a number of abiotic and biotic processes under alkaline suboxic conditions. Due to its high Fe 2+ content, green rust is a potentially important phase for pollution remediation by serving as a powerful electron donor for reductive transformation. However, mechanisms of oxidation of this material are poorly understood. An essential component of the green rust structure is a mixed-valent brucite-like Fe(OH) 2 sheet comprised of a two dimensional network of edge-sharing iron octahedra. Room temperature Mössbauer spectra show a characteristic signature for intermediate valence on the iron atoms inmore » this sheet, indicative of a Fe 2+-Fe 3+ valence interchange reaction faster than approximately 10 7 s -1. Using Fe(OH) 2 as structural analogue for reduced green rust, we performed Hartree-Fock calculations on periodic slab models and cluster representations to determine the structure and hopping mobility of Fe 3+ hole polarons in this material, providing a first principles assessment of the Fe 2+-Fe 3+ valence interchange reaction rate. The calculations show that among three possible symmetry unique iron-to-iron hops within a sheet, a hop to next-nearest neighbors at an intermediate distance of 5.6 Å is the fastest. The predicted rate is on the order of 10 12 s -1 consistent the Mössbauer-based constraint. All other possibilities, including hopping across interlayer spaces, are predicted to be slower than 10 7 s -1. Collectively, the findings suggest the possibility of hole self-diffusion along sheets as a mechanism for regeneration of lattice Fe 2+ sites, consistent with previous experimental observations of edge-inward progressive oxidation of green rust.« less
Brown, Simon David; Jarosinska, Olga Dorota; Lorenz, Alexander
2018-03-17
Hop1 is a component of the meiosis-specific chromosome axis and belongs to the evolutionarily conserved family of HORMA domain proteins. Hop1 and its orthologs in higher eukaryotes are a major factor in promoting double-strand DNA break formation and inter-homolog recombination. In budding yeast and mammals, they are also involved in a meiotic checkpoint kinase cascade monitoring the completion of double-strand DNA break repair. We used the fission yeast, Schizosaccharomyces pombe, which lacks a canonical synaptonemal complex to test whether Hop1 has a role beyond supporting the generation of double-strand DNA breaks and facilitating inter-homolog recombination events. We determined how mutants of homologous recombination factors genetically interact with hop1, studied the role(s) of the HORMA domain of Hop1, and characterized a bio-informatically predicted interactor of Hop1, Aho1 (SPAC688.03c). Our observations indicate that in fission yeast, Hop1 does require its HORMA domain to support wild-type levels of meiotic recombination and localization to meiotic chromatin. Furthermore, we show that hop1∆ only weakly interacts genetically with mutants of homologous recombination factors, and in fission yeast likely has no major role beyond break formation and promoting inter-homolog events. We speculate that after the evolutionary loss of the synaptonemal complex, Hop1 likely has become less important for modulating recombination outcome during meiosis in fission yeast, and that this led to a concurrent rewiring of genetic pathways controlling meiotic recombination.
Hip-Hop Culture in College Students' Lives: Elements, Embodiment, and Higher Edutainment
ERIC Educational Resources Information Center
Petchauer, Emery
2011-01-01
College campuses have become rich sites of hip-hop culture and knowledge production. Despite the attention that campus personnel and researchers have paid to student life, the field of higher education has often misunderstood the ways that hip-hop culture exists in college students' lives. Based upon in-depth interviews, observations of…
Trends in German Hip Hop Music and Its Usefulness for the Classroom
ERIC Educational Resources Information Center
Schmidt, Johannes
2008-01-01
German hip hop music has proved productive, especially since 2000 when rap in Germany experienced something like a first crisis. As a response, German hip hop artists and record labels have ventured off in several different directions including other musical genres, different topics, and new approaches to German rap. This article discusses the…
Charge carrier transport mechanisms in perovskite CdTiO{sub 3} fibers
DOE Office of Scientific and Technical Information (OSTI.GOV)
Imran, Z.; Rafiq, M. A., E-mail: aftab@cantab.net; Hasan, M. M.
Electrical transport properties of electrospun cadmium titanate (CdTiO{sub 3}) fibers have been investigated using ac and dc measurements. Air annealing of as spun fibers at 1000 °C yielded the single phase perovskite fibers having diameter ∼600 nm - 800 nm. Both the ac and dc electrical measurements were carried out at temperatures from 200 K – 420 K. The complex impedance plane plots revealed a single semicircular arc which indicates the interfacial effect due to grain boundaries of fibers. The dielectric properties obey the Maxwell-Wagner theory of interfacial polarization. In dc transport study at low voltages, data show Ohmic like behaviormore » followed by space charge limited current (SCLC) with traps at higher voltages at all temperatures (200 K – 420 K). Trap density in our fibers system is N{sub t} = 6.27 × 10{sup 17} /cm{sup 3}. Conduction mechanism in the sample is governed by 3-D variable range hopping (VRH) from 200 K – 300 K. The localized density of states were found to be N(E{sub F}) = 5.51 × 10{sup 21} eV{sup −1} cm{sup −3} at 2 V. Other VRH parameters such as hopping distance (R{sub hop}) and hopping energy (W{sub hop}) were also calculated. In the high temperature range of 320 K – 420 K, conductivity follows the Arrhenius law. The activation energy found at 2 V is 0.10 eV. Temperature dependent and higher values of dielectric constant make the perovskite CdTiO{sub 3} fibers efficient material for capacitive energy storage devices.« less
Nanowire-based thermoelectric ratchet in the hopping regime
NASA Astrophysics Data System (ADS)
Bosisio, Riccardo; Fleury, Geneviève; Pichard, Jean-Louis; Gorini, Cosimo
2016-04-01
We study a thermoelectric ratchet consisting of an array of disordered nanowires arranged in parallel on top of an insulating substrate and contacted asymmetrically to two electrodes. Transport is investigated in the Mott hopping regime, when localized electrons can propagate through the nanowires via thermally assisted hops. When the electronic temperature in the nanowires is different from the phononic one in the substrate, we show that a finite electrical current is generated even in the absence of driving forces between the electrodes. We discuss the device performance both as an energy harvester, when an excess heat from the substrate is converted into useful power, and as a refrigerator, when an external power is supplied to cool down the substrate.
Results of Computing Amplitude and Phase of the VLF Wave Using Wave Hop Theory
NASA Astrophysics Data System (ADS)
Pal, Sujay; Basak, Tamal; Chakrabarti, Sandip K.
2011-07-01
We present the basics of the wave hop theory to compute the amplitude and phase of the VLF signals. We use the Indian Navy VTX transmitter at 18.2 kHz as an example of the source and compute the VLF propagation characteristics for several propagation paths using the wave-hop theory. We find the signal amplitudes as a function of distance from the transmitter using wave hop theory in different bearing angles and compare with the same obtained from the Long Wave Propagation Capability (LWPC) code which uses the mode theory. We repeat a similar exercise for the diurnal and seasonal behavior. We note that the signal variation by wave hop theory gives more detailed information in the day time. We further present the spatial variation of the signal amplitude over whole of India at a given time including the effect of sunrise and sunset terminator and also compare the same with that from the mode theory. We point out that the terminator effect is clearly understood in wave hop results than that from the mode theory.
Jackowski, J; Hurej, M; Rój, E; Popłoński, J; Kośny, L; Huszcza, E
2015-08-01
Xanthohumol, a prenylated flavonoid from hops, and a supercritical carbon dioxide extract of spent hops were studied for their antifeedant activity against stored product insect pests: Sitophilus granarius L., Tribolium confusum Duv. and Trogoderma granarium Everts. Xanthohumol exhibited medium deterrent activity against the adults of S. granarius L. and larvae of T. confusum Duv. The spent hops extract was more active than xanthohumol towards the adults of T. confusum Duv. The potential application of the crude spent hops extract as a feeding deterrent against the stored product pests is proposed.
Frame error rate for single-hop and dual-hop transmissions in 802.15.4 LoWPANs
NASA Astrophysics Data System (ADS)
Biswas, Sankalita; Ghosh, Biswajit; Chandra, Aniruddha; Dhar Roy, Sanjay
2017-08-01
IEEE 802.15.4 is a popular standard for personal area networks used in different low-rate short-range applications. This paper examines the error rate performance of 802.15.4 in fading wireless channel. An analytical model is formulated for evaluating frame error rate (FER); first, for direct single-hop transmission between two sensor nodes, and second, for dual-hop (DH) transmission using an in-between relay node. During modeling the transceiver design parameters are chosen according to the specifications set for both the 2.45 GHz and 868/915 MHz bands. We have also developed a simulation test bed for evaluating FER. Some results showed expected trends, such as FER is higher for larger payloads. Other observations are not that intuitive. It is interesting to note that the error rates are significantly higher for the DH case and demands a signal-to-noise ratio (SNR) penalty of about 7 dB. Also, the FER shoots from zero to one within a very small range of SNR.
Bidirectional Teleportation Protocol in Quantum Wireless Multi-hop Network
NASA Astrophysics Data System (ADS)
Cai, Rui; Yu, Xu-Tao; Zhang, Zai-Chen
2018-06-01
We propose a bidirectional quantum teleportation protocol based on a composite GHZ-Bell state. In this protocol, the composite GHZ-Bell state channel is transformed into two-Bell state channel through gate operations and single qubit measurements. The channel transformation will lead to different kinds of quantum channel states, so a method is proposed to help determine the unitary matrices effectively under different quantum channels. Furthermore, we discuss the bidirectional teleportation protocol in the quantum wireless multi-hop network. This paper is aimed to provide a bidirectional teleportation protocol and study the bidirectional multi-hop teleportation in the quantum wireless communication network.
Bidirectional Teleportation Protocol in Quantum Wireless Multi-hop Network
NASA Astrophysics Data System (ADS)
Cai, Rui; Yu, Xu-Tao; Zhang, Zai-Chen
2018-02-01
We propose a bidirectional quantum teleportation protocol based on a composite GHZ-Bell state. In this protocol, the composite GHZ-Bell state channel is transformed into two-Bell state channel through gate operations and single qubit measurements. The channel transformation will lead to different kinds of quantum channel states, so a method is proposed to help determine the unitary matrices effectively under different quantum channels. Furthermore, we discuss the bidirectional teleportation protocol in the quantum wireless multi-hop network. This paper is aimed to provide a bidirectional teleportation protocol and study the bidirectional multi-hop teleportation in the quantum wireless communication network.
Empowerment in Context: Lessons from Hip-Hop Culture for Social Work Practice
ERIC Educational Resources Information Center
Travis, Raphael, Jr.; Deepak, Anne
2011-01-01
Hip-hop culture can be used as a conduit to enhanced cultural competence and practice skills through the individual and community empowerment framework. This framework is introduced as a tool for direct practice that allows social workers to understand the competing messages within hip-hop culture and how they may impact youths by promoting or…
NASA Astrophysics Data System (ADS)
Dimova, Dilyana; Bajorath, Jürgen
2017-07-01
Computational scaffold hopping aims to identify core structure replacements in active compounds. To evaluate scaffold hopping potential from a principal point of view, regardless of the computational methods that are applied, a global analysis of conventional scaffolds in analog series from compound activity classes was carried out. The majority of analog series was found to contain multiple scaffolds, thus enabling the detection of intra-series scaffold hops among closely related compounds. More than 1000 activity classes were found to contain increasing proportions of multi-scaffold analog series. Thus, using such activity classes for scaffold hopping analysis is likely to overestimate the scaffold hopping (core structure replacement) potential of computational methods, due to an abundance of artificial scaffold hops that are possible within analog series.
Metal-insulator transition in a doubly orbitally degenerate model with correlated hopping
NASA Astrophysics Data System (ADS)
Didukh, L.; Skorenkyy, Yu.; Dovhopyaty, Yu.; Hankevych, V.
2000-03-01
In the present paper, we propose a doubly orbitally degenerate narrow-band model with correlated hopping. The peculiarity of the model is taking into account the matrix element of electron-electron interaction, which describes intersite hoppings of electrons. In particular, this leads to the concentration dependence of the effective hopping integral. The cases of the strong and weak Hund's coupling are considered. By means of a generalized mean-field approximation the single-particle Green function and quasiparticle energy spectrum are calculated. Metal-insulator transition is studied in the model at different integer values of the electron concentration. With the help of the obtained energy spectrum, we find energy gap width and criteria of metal-insulator transition.
HopW1 from Pseudomonas syringae disrupts the actin cytoskeleton to promote virulence in Arabidopsis.
Kang, Yongsung; Jelenska, Joanna; Cecchini, Nicolas M; Li, Yujie; Lee, Min Woo; Kovar, David R; Greenberg, Jean T
2014-06-01
A central mechanism of virulence of extracellular bacterial pathogens is the injection into host cells of effector proteins that modify host cellular functions. HopW1 is an effector injected by the type III secretion system that increases the growth of the plant pathogen Pseudomonas syringae on the Columbia accession of Arabidopsis. When delivered by P. syringae into plant cells, HopW1 causes a reduction in the filamentous actin (F-actin) network and the inhibition of endocytosis, a known actin-dependent process. When directly produced in plants, HopW1 forms complexes with actin, disrupts the actin cytoskeleton and inhibits endocytosis as well as the trafficking of certain proteins to vacuoles. The C-terminal region of HopW1 can reduce the length of actin filaments and therefore solubilize F-actin in vitro. Thus, HopW1 acts by disrupting the actin cytoskeleton and the cell biological processes that depend on actin, which in turn are needed for restricting P. syringae growth in Arabidopsis.
Dipolar Spin Ice States with a Fast Monopole Hopping Rate in CdEr2X4 (X =Se , S)
NASA Astrophysics Data System (ADS)
Gao, Shang; Zaharko, O.; Tsurkan, V.; Prodan, L.; Riordan, E.; Lago, J.; Fâk, B.; Wildes, A. R.; Koza, M. M.; Ritter, C.; Fouquet, P.; Keller, L.; Canévet, E.; Medarde, M.; Blomgren, J.; Johansson, C.; Giblin, S. R.; Vrtnik, S.; Luzar, J.; Loidl, A.; Rüegg, Ch.; Fennell, T.
2018-03-01
Excitations in a spin ice behave as magnetic monopoles, and their population and mobility control the dynamics of a spin ice at low temperature. CdEr2 Se4 is reported to have the Pauling entropy characteristic of a spin ice, but its dynamics are three orders of magnitude faster than the canonical spin ice Dy2 Ti2 O7 . In this Letter we use diffuse neutron scattering to show that both CdEr2 Se4 and CdEr2 S4 support a dipolar spin ice state—the host phase for a Coulomb gas of emergent magnetic monopoles. These Coulomb gases have similar parameters to those in Dy2 Ti2 O7 , i.e., dilute and uncorrelated, and so cannot provide three orders faster dynamics through a larger monopole population alone. We investigate the monopole dynamics using ac susceptometry and neutron spin echo spectroscopy, and verify the crystal electric field Hamiltonian of the Er3 + ions using inelastic neutron scattering. A quantitative calculation of the monopole hopping rate using our Coulomb gas and crystal electric field parameters shows that the fast dynamics in CdEr2X4 (X =Se , S) are primarily due to much faster monopole hopping. Our work suggests that CdEr2X4 offer the possibility to study alternative spin ice ground states and dynamics, with equilibration possible at much lower temperatures than the rare earth pyrochlore examples.
Ho, Ruoya; Stroupe, Christopher
2016-10-01
Membrane tethering is a physical association of two membranes before their fusion. Many membrane tethering factors have been identified, but the interactions that mediate inter-membrane associations remain largely a matter of conjecture. Previously, we reported that the homotypic fusion and protein sorting/Class C vacuolar protein sorting (HOPS/Class C Vps) complex, which has two binding sites for the yeast vacuolar Rab GTPase Ypt7p, can tether two low-curvature liposomes when both membranes bear Ypt7p. Here, we show that HOPS tethers highly curved liposomes to Ypt7p-bearing low-curvature liposomes even when the high-curvature liposomes are protein-free. Phosphorylation of the curvature-sensing amphipathic lipid-packing sensor (ALPS) motif from the Vps41p HOPS subunit abrogates tethering of high-curvature liposomes. A HOPS complex without its Vps39p subunit, which contains one of the Ypt7p binding sites in HOPS, lacks tethering activity, though it binds high-curvature liposomes and Ypt7p-bearing low-curvature liposomes. Thus, HOPS tethers highly curved membranes via a direct protein-membrane interaction. Such high-curvature membranes are found at the sites of vacuole tethering and fusion. There, vacuole membranes bend sharply, generating large areas of vacuole-vacuole contact. We propose that HOPS localizes via the Vps41p ALPS motif to these high-curvature regions. There, HOPS binds via Vps39p to Ypt7p in an apposed vacuole membrane. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Biddle, J.; Priour, D. J. Jr.; Wang, B.
We study the quantum localization phenomena of noninteracting particles in one-dimensional lattices based on tight-binding models with various forms of hopping terms beyond the nearest neighbor, which are generalizations of the famous Aubry-Andre and noninteracting Anderson models. For the case with deterministic disordered potential induced by a secondary incommensurate lattice (i.e., the Aubry-Andre model), we identify a class of self-dual models, for which the boundary between localized and extended eigenstates are determined analytically by employing a generalized Aubry-Andre transformation. We also numerically investigate the localization properties of nondual models with next-nearest-neighbor hopping, Gaussian, and power-law decay hopping terms. We findmore » that even for these nondual models, the numerically obtained mobility edges can be well approximated by the analytically obtained condition for localization transition in the self-dual models, as long as the decay of the hopping rate with respect to distance is sufficiently fast. For the disordered potential with genuinely random character, we examine scenarios with next-nearest-neighbor hopping, exponential, Gaussian, and power-law decay hopping terms numerically. We find that the higher-order hopping terms can remove the symmetry in the localization length about the energy band center compared to the Anderson model. Furthermore, our results demonstrate that for the power-law decay case, there exists a critical exponent below which mobility edges can be found. Our theoretical results could, in principle, be directly tested in shallow atomic optical lattice systems enabling non-nearest-neighbor hopping.« less
The Philippine "Hip Hop Stick Dance"
ERIC Educational Resources Information Center
Lewis, Lisa
2012-01-01
This article introduces a dance that blends the traditional cultural heritage of the Philippines with modern music and moves. "Hip Hop Stick Dance" incorporates Tinikling (the Philippine national dance) and Arnis (a Filipino style of martial arts) to create a contemporary combination of rhythm, dance, and fitness. It was designed to introduce…
ERIC Educational Resources Information Center
MEE Productions Inc., Philadelphia, PA. Research Div.
This final report attempts to capture the work and atmosphere of the recent symposium convened by Motivational Educational Entertainment, Inc. (MEE), a black-owned communications research, consulting, and video production company. In its commitment to helping urban youth, MEE conducted a study of the "hip-hop" generation and its…
Steenackers, Bart; De Cooman, Luc; De Vos, Dirk
2015-04-01
The annual production of hops (Humulus lupulus L.) exceeds 100,000 mt and is almost exclusively consumed by the brewing industry. The value of hops is attributed to their characteristic secondary metabolites; these metabolites are precursors which are transformed during the brewing process into important bittering, aromatising and preservative components with rather low efficiency. By selectively transforming these components off-line, both their utilisation efficiency and functionality can be significantly improved. Therefore, the chemical transformations of these secondary metabolites will be considered with special attention to recent advances in the field. The considered components are the hop alpha-acids, hop beta-acids and xanthohumol, which are components unique to hops, and alpha-humulene and beta-caryophyllene, sesquiterpenes which are highly characteristic of hops. Copyright © 2014 Elsevier Ltd. All rights reserved.
AC-electric field dependent electroformation of giant lipid vesicles.
Politano, Timothy J; Froude, Victoria E; Jing, Benxin; Zhu, Yingxi
2010-08-01
Giant vesicles of larger than 5 microm, which have been of intense interest for their potential as drug delivery vehicles and as a model system for cell membranes, can be rapidly formed from a spin-coated lipid thin film under an electric field. In this work, we explore the AC-field dependent electroformation of giant lipid vesicles in aqueous media over a wide range of AC-frequency from 1 Hz to 1 MHz and peak-to-peak field strength from 0.212 V/mm to 40 V/mm between two parallel conducting electrode surfaces. By using fluorescence microscopy, we perform in-situ microscopic observations of the structural evolution of giant vesicles formed from spin-coated lipid films under varied uniform AC-electric fields. The real-time observation of bilayer bulging from the lipid film, vesicle growth and fusing further examine the critical role of AC-induced electroosmotic flow of surrounding fluids for giant vesicle formation. A rich AC-frequency and field strength phase diagram is obtained experimentally to predict the AC-electroformation of giant unilamellar vesicles (GUVs) of l-alpha-phosphatidylcholine, where a weak dependence of vesicle size on AC-frequency is observed at low AC-field voltages, showing decreased vesicle size with a narrowed size distribution with increased AC-frequency. Formation of vesicles was shown to be constrained by an upper field strength of 10 V/mm and an upper AC-frequency of 10 kHz. Within these parameters, giant lipid vesicles were formed predominantly unilamellar and prevalent across the entire electrode surfaces. Copyright 2010 Elsevier B.V. All rights reserved.
Generalized trajectory surface-hopping method for internal conversion and intersystem crossing
NASA Astrophysics Data System (ADS)
Cui, Ganglong; Thiel, Walter
2014-09-01
Trajectory-based fewest-switches surface-hopping (FSSH) dynamics simulations have become a popular and reliable theoretical tool to simulate nonadiabatic photophysical and photochemical processes. Most available FSSH methods model internal conversion. We present a generalized trajectory surface-hopping (GTSH) method for simulating both internal conversion and intersystem crossing processes on an equal footing. We consider hops between adiabatic eigenstates of the non-relativistic electronic Hamiltonian (pure spin states), which is appropriate for sufficiently small spin-orbit coupling. This choice allows us to make maximum use of existing electronic structure programs and to minimize the changes to available implementations of the traditional FSSH method. The GTSH method is formulated within the quantum mechanics (QM)/molecular mechanics framework, but can of course also be applied at the pure QM level. The algorithm implemented in the GTSH code is specified step by step. As an initial GTSH application, we report simulations of the nonadiabatic processes in the lowest four electronic states (S0, S1, T1, and T2) of acrolein both in vacuo and in acetonitrile solution, in which the acrolein molecule is treated at the ab initio complete-active-space self-consistent-field level. These dynamics simulations provide detailed mechanistic insight by identifying and characterizing two nonadiabatic routes to the lowest triplet state, namely, direct S1 → T1 hopping as major pathway and sequential S1 → T2 → T1 hopping as minor pathway, with the T2 state acting as a relay state. They illustrate the potential of the GTSH approach to explore photoinduced processes in complex systems, in which intersystem crossing plays an important role.
MLF1 is a proapoptotic antagonist of HOP complex-mediated survival.
Sun, Yi; Chao, Jyh-Rong; Xu, Wu; Pourpak, Alan; Boyd, Kelli; Moshiach, Simon; Qi, Guo-Yan; Fu, Amina; Shao, Hua-Rong; Pounds, Stanley; Morris, Stephan W
2017-04-01
In the HAX1/HtrA2-OMI/PARL (HOP) mitochondrial protein complex, anti-apoptotic signals are generated by cleavage and activation of the serine protease HtrA2/OMI by the rhomboid protease PARL upon recruitment of both proteases to inner mitochondrial membrane protein HAX1 (HS1-associated protein X-1). Here we report the negative regulation of the HOP complex by human leukemia-associated myeloid leukemia factor 1 (MLF1). We demonstrate that MLF1 physically and functionally associates with HAX1 and HtrA2. Increased interaction of MLF1 with HAX1 and HtrA2 displaces HtrA2 from the HOP complex and inhibits HtrA2 cleavage and activation, resulting in the apoptotic cell death. Conversely, over-expressed HAX1 neutralizes MLF1's effect and inhibits MLF1-induced apoptosis. Importantly, Mlf1 deletion reverses B- and T-cell lymphopenia and significantly ameliorates the progressive striatal and cerebellar neurodegeneration observed in Hax1 -/- mice, with a doubling of the lifespan of Mlf1 -/- /Hax1 -/- animals compared to Hax1 -/- animals. Collectively, these data indicate that MLF1 serves as a proapoptotic antagonist that interacts with the HOP mitochondrial complex to modulate cell survival. Copyright © 2017 Elsevier B.V. All rights reserved.
Throughput Analysis on 3-Dimensional Underwater Acoustic Network with One-Hop Mobile Relay.
Zhong, Xuefeng; Chen, Fangjiong; Fan, Jiasheng; Guan, Quansheng; Ji, Fei; Yu, Hua
2018-01-16
Underwater acoustic communication network (UACN) has been considered as an essential infrastructure for ocean exploitation. Performance analysis of UACN is important in underwater acoustic network deployment and management. In this paper, we analyze the network throughput of three-dimensional randomly deployed transmitter-receiver pairs. Due to the long delay of acoustic channels, complicated networking protocols with heavy signaling overhead may not be appropriate. In this paper, we consider only one-hop or two-hop transmission, to save the signaling cost. That is, we assume the transmitter sends the data packet to the receiver by one-hop direct transmission, or by two-hop transmission via mobile relays. We derive the closed-form formulation of packet delivery rate with respect to the transmission delay and the number of transmitter-receiver pairs. The correctness of the derivation results are verified by computer simulations. Our analysis indicates how to obtain a precise tradeoff between the delay constraint and the network capacity.
Throughput Analysis on 3-Dimensional Underwater Acoustic Network with One-Hop Mobile Relay
Zhong, Xuefeng; Fan, Jiasheng; Guan, Quansheng; Ji, Fei; Yu, Hua
2018-01-01
Underwater acoustic communication network (UACN) has been considered as an essential infrastructure for ocean exploitation. Performance analysis of UACN is important in underwater acoustic network deployment and management. In this paper, we analyze the network throughput of three-dimensional randomly deployed transmitter–receiver pairs. Due to the long delay of acoustic channels, complicated networking protocols with heavy signaling overhead may not be appropriate. In this paper, we consider only one-hop or two-hop transmission, to save the signaling cost. That is, we assume the transmitter sends the data packet to the receiver by one-hop direct transmission, or by two-hop transmission via mobile relays. We derive the closed-form formulation of packet delivery rate with respect to the transmission delay and the number of transmitter–receiver pairs. The correctness of the derivation results are verified by computer simulations. Our analysis indicates how to obtain a precise tradeoff between the delay constraint and the network capacity. PMID:29337911
Luczak, Susan E; Hawkins, Ashley L; Dai, Zheng; Wichmann, Raphael; Wang, Chunming; Rosen, I Gary
2018-08-01
Biosensors have been developed to measure transdermal alcohol concentration (TAC), but converting TAC into interpretable indices of blood/breath alcohol concentration (BAC/BrAC) is difficult because of variations that occur in TAC across individuals, drinking episodes, and devices. We have developed mathematical models and the BrAC Estimator software for calibrating and inverting TAC into quantifiable BrAC estimates (eBrAC). The calibration protocol to determine the individualized parameters for a specific individual wearing a specific device requires a drinking session in which BrAC and TAC measurements are obtained simultaneously. This calibration protocol was originally conducted in the laboratory with breath analyzers used to produce the BrAC data. Here we develop and test an alternative calibration protocol using drinking diary data collected in the field with the smartphone app Intellidrink to produce the BrAC calibration data. We compared BrAC Estimator software results for 11 drinking episodes collected by an expert user when using Intellidrink versus breath analyzer measurements as BrAC calibration data. Inversion phase results indicated the Intellidrink calibration protocol produced similar eBrAC curves and captured peak eBrAC to within 0.0003%, time of peak eBrAC to within 18min, and area under the eBrAC curve to within 0.025% alcohol-hours as the breath analyzer calibration protocol. This study provides evidence that drinking diary data can be used in place of breath analyzer data in the BrAC Estimator software calibration procedure, which can reduce participant and researcher burden and expand the potential software user pool beyond researchers studying participants who can drink in the laboratory. Copyright © 2017. Published by Elsevier Ltd.
AC impedance and conductivity study of alkali salt form [of] perfluorosulfonate ionomer membranes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zaluski, C.S.; Xu, G.
1994-02-01
AC impedance studies were performed on Na+ and K+ alkali salt forms of the short sidechain perfluorosulfonate ionomer (PFSI) membrane films. With impressive performances of 4 A/cm[sup 2] current density and power densities near 2.5 W/cm[sup 2], the acid forms of these short sidechain PFSI are very promising candidates for use in fuel cells for future electric vehicles. Since, at present, little is known about the exact transport mechanisms for the ionic species within PFSIs, an ac impedance study of the Na+ and K+ forms has been performed. It is hoped that this will provide some insight and understanding ofmore » the transport mechanisms in the PFSI and thus will aid in the development and optimization of fuel cells. Results suggest that there are marked differences with respect to host environments within the Dow membrane as compared to Nafion[reg sign] long sidechain PFSI membrane films. Impedance spectra of the Dow salt form membranes displaying two distinct relaxation peaks while the spectra for all forms of Nafion reveal only a single peak. This second low temperature peak in the Dow membrane has been attributed to a much larger [OH[sup [minus
Lamm, Christian E.; Kraner, Max. E.; Hofmann, Jörg; Börnke, Frederik; Mock, Hans-Peter; Sonnewald, Uwe
2017-01-01
Perception of pathogens by host pattern recognition receptors (PRRs) or R proteins is a prerequisite to promote successful immune responses. The Hsp70/Hsp90 organizing protein Hop/Sti1, a multifunctional cochaperone, has been implicated in the maturation of a receptor-like kinase (RLK) necessary for chitin sensing. However, it remains unknown whether Hop/Sti1 is generally participating in PRR genesis. Using RNA-interference (RNAi), we silenced Hop/Sti1 expression in Nicotiana tabacum to gain further insight into the role of the cochaperone in plant defense responses. As expected, transgenic plants do not respond to chitin treatment anymore. In contrast to this, trafficking and functionality of the flagellin PRR FLS2 were unaltered, suggesting a selective involvement of Hop/Sti1 during PRR maturation. Furthermore, Hop/Sti1 was identified as a cellular determinant of Potato virus Y (PVY) symptom development in tobacco, since PVY was able to accumulate to near wild-type level without provoking the usual veinal necrosis phenotype. In addition, typical antiviral host defense responses were suppressed in the transgenic plants. These data suggest that perception of PVY is dependent on Hop/Sti1-mediated receptor maturation, while viral symptoms represent a failing attempt to restrict PVY spread. In addition, Hop/Sti1 colocalized with virus-induced membrane aggregates in wild-type plants. The retention of Hop/Sti1 in potential viral replication complexes suggests a role during viral translation/replication, explaining why RNAi-lines do not exhibit increased susceptibility to PVY. This study provides evidence for a dual role of Hop/Sti1 in PRR maturation and pathogen perception as well as in promoting viral proliferation. PMID:29075278
Dumas, Elizabeth R; Michaud, Amy E; Bergeron, Chantal; Lafrance, Jennifer L; Mortillo, Susan; Gafner, Stefan
2009-09-01
There is little scientific evidence to support the efficacy of natural deodorants and therefore, such products may be perceived as inefficacious. The evaluation of the in vitro antibacterial activity of a hop extract and the evaluation of the odor-reducing capacity of a hops/zinc ricinoleate-containing product by a sensory evaluation panel is employed to verify deodorant performance. The goal of this study was to evaluate the in vitro antibacterial activity of a hop extract against Corynebacterium xerosis and Staphylococcus epidermidis and to verify in vivo deodorant performance of a hops/zinc ricinoleate-containing product. The hops extract was evaluated on a culture of an armpit swab from six volunteers. Furthermore, the extract was submitted to a zone of inhibition test and an agar-dilution assay against two major odor-causing bacteria. The clinical evaluation of the finished product was carried out according to a standard method for substantiating deodorant efficacy using trained odor judges for the assessment of axillary malodor (ASTM method E 1207-87 Standard Practice for the Sensory Evaluation of Axillary Deodorancy). The supercritical hops extract showed good antibacterial activities in all three tests. Minimum inhibitory concentration values of 6.25 and 25 mug/mL against C. xerosis and S. aureus, respectively, were obtained in the agar-dilution assay. In the clinical underarm odor-reduction evaluation, the mean malodor score dropped from 6.28 (+/-0.70) to 1.80 (+/-0.71) after 8 h of application. There was still a noticeable effect at both 12 and 24 h after the application, with a score of 1.82 (+/-0.74) and 2.24 (+/-0.77), respectively. The hops extract has good in vitro antibacterial properties and, in combination with zinc ricinoleate in an appropriate base, delivers in vivo odor reduction. The clinical efficacy is likely due to a combination of the base ingredients and the antibacterial actives.
Granata, K P; Padua, D A; Wilson, S E
2002-04-01
Leg stiffness was compared between age-matched males and females during hopping at preferred and controlled frequencies. Stiffness was defined as the linear regression slope between the vertical center of mass (COM) displacement and ground-reaction forces recorded from a force plate during the stance phase of the hopping task. Results demonstrate that subjects modulated the vertical displacement of the COM during ground contact in relation to the square of hopping frequency. This supports the accuracy of the spring-mass oscillator as a representative model of hopping. It also maintained peak vertical ground-reaction load at approximately three times body weight. Leg stiffness values in males (33.9+/-8.7 kN/m) were significantly (p<0.01) greater than in females (26.3+/-6.5 kN/m) at each of three hopping frequencies, 3.0, 2.5 Hz, and a preferred hopping rate. In the spring-mass oscillator model leg stiffness and body mass are related to the frequency of motion. Thus male subjects necessarily recruited greater leg stiffness to drive their heavier body mass at the same frequency as the lighter female subjects during the controlled frequency trials. However, in the preferred hopping condition the stiffness was not constrained by the task because frequency was self-selected. Nonetheless, both male and female subjects hopped at statistically similar preferred frequencies (2.34+/-0.22 Hz), therefore, the females continued to demonstrate less leg stiffness. Recognizing the active muscle stiffness contributes to biomechanical stability as well as leg stiffness, these results may provide insight into the gender bias in risk of musculoskeletal knee injury.
Use of the Homeland-Defense Operational Planning System (HOPS) for Emergency Management
DOE Office of Scientific and Technical Information (OSTI.GOV)
Durling, Jr., R L; Price, D E
2005-12-16
The Homeland-Defense Operational Planning System (HOPS), is a new operational planning tool leveraging Lawrence Livermore National Laboratory's expertise in weapons systems and in sparse information analysis to support the defense of the U.S. homeland. HOPS provides planners with a basis to make decisions to protect against acts of terrorism, focusing on the defense of facilities critical to U.S. infrastructure. Criticality of facilities, structures, and systems is evaluated on a composite matrix of specific projected casualty, economic, and sociopolitical impact bins. Based on these criteria, significant unidentified vulnerabilities are identified and secured. To provide insight into potential successes by malevolent actors,more » HOPS analysts strive to base their efforts mainly on unclassified open-source data. However, more cooperation is needed between HOPS analysts and facility representatives to provide an advantage to those whose task is to defend these facilities. Evaluated facilities include: refineries, major ports, nuclear power plants and other nuclear licensees, dams, government installations, convention centers, sports stadiums, tourist venues, and public and freight transportation systems. A generalized summary of analyses of U.S. infrastructure facilities will be presented.« less
AC-Induced Bias Potential Effect on Corrosion of Steels
2009-02-05
induction, variable conduction Experimental Setup Super- martensitic stainless steel composition Analysis: C Mn Si Cr Ni Mo Cu N Typical 13 Cr ɘ.01 0.6... stainless steel used in pipelines. •Low carbon (ɘ.01): allows the formation of a “soft” martensite that is more resistant than standard martensitic ...Proposed AC Corrosion Models AC Simulated Corrosion testing Stainless steel pipe and coating Cathodic protection Experimental Setup Preliminary
NASA Technical Reports Server (NTRS)
Beyon, Jeffrey Y.; Ng, Tak-Kwong; Davis, Mitchell J.; Adams, James K.; Bowen, Stephen C.; Fay, James J.; Hutchinson, Mark A.
2015-01-01
The project called High-Speed On-Board Data Processing for Science Instruments (HOPS) has been funded by NASA Earth Science Technology Office (ESTO) Advanced Information Systems Technology (AIST) program since April, 2012. The HOPS team recently completed two flight campaigns during the summer of 2014 on two different aircrafts with two different science instruments. The first flight campaign was in July, 2014 based at NASA Langley Research Center (LaRC) in Hampton, VA on the NASA's HU-25 aircraft. The science instrument that flew with HOPS was Active Sensing of CO2 Emissions over Nights, Days, and Seasons (ASCENDS) CarbonHawk Experiment Simulator (ACES) funded by NASA's Instrument Incubator Program (IIP). The second campaign was in August, 2014 based at NASA Armstrong Flight Research Center (AFRC) in Palmdale, CA on the NASA's DC-8 aircraft. HOPS flew with the Multifunctional Fiber Laser Lidar (MFLL) instrument developed by Excelis Inc. The goal of the campaigns was to perform an end-to-end demonstration of the capabilities of the HOPS prototype system (HOPS COTS) while running the most computationally intensive part of the ASCENDS algorithm real-time on-board. The comparison of the two flight campaigns and the results of the functionality tests of the HOPS COTS are presented in this paper.
Experiments in balance with a 2D one-legged hopping machine
NASA Astrophysics Data System (ADS)
Raibert, M. H.; Brown, H. B., Jr.
1984-03-01
The ability to balance is important to the mobility obtained by legged creatures found in nature, and may someday lead to versatile legged vehicles. In order to study the role of balance in legged locomotion and to develop appropriate control strategies, a 2D hopping machine was constructed for experimentation. The machine has one leg on which it hops and runs, making balance a prime consideration. Control of the machine's locomotion was decomposed into three separate parts: a vertical height control part, a horizontal velocity part, and an angular attitude control part. Experiments showed that the three part control scheme, while very simple to implement, was powerful enough to permit the machine to hop in place, to run at a desired rate, to translate from place to place, and to leap over obstacles. Results from modeling and computer simulation of a similar one-legged device are described by Raibert (1983).
Assessing hopping developmental level in childhood using wearable inertial sensor devices.
Masci, Ilaria; Vannozzi, Giuseppe; Getchell, Nancy; Cappozzo, Aurelio
2012-07-01
Assessing movement skills is a fundamental issue in motor development. Current process-oriented assessments, such as developmental sequences, are based on subjective judgments; if paired with quantitative assessments, a better understanding of movement performance and developmental change could be obtained. Our purpose was to examine the use of inertial sensors to evaluate developmental differences in hopping over distance. Forty children executed the task wearing the inertial sensor and relevant time durations and 3D accelerations were obtained. Subjects were also categorized in different developmental levels according to the hopping developmental sequence. Results indicated that some time and kinematic parameters changed with some developmental levels, possibly as a function of anthropometry and previous motor experience. We concluded that, since inertial sensors were suitable in describing hopping performance and sensitive to developmental changes, this technology is promising as an in-field and user-independent motor development assessment tool.
Representin': Drawing from Hip-Hop and Urban Youth Culture to Inform Teacher Education
ERIC Educational Resources Information Center
Irizarry, Jason G.
2009-01-01
The potential of drawing from urban youth culture, and hip-hop more specifically, to serve as a bridge to the standard curriculum has been well documented. However, the richness and potential benefits of hip-hop are more far-reaching and present significant implications for teacher education and professional development efforts as well. This…
Distributed Detection with Collisions in a Random, Single-Hop Wireless Sensor Network
2013-05-26
public release; distribution is unlimited. Distributed detection with collisions in a random, single-hop wireless sensor network The views, opinions...1274 2 ABSTRACT Distributed detection with collisions in a random, single-hop wireless sensor network Report Title We consider the problem of... WIRELESS SENSOR NETWORK Gene T. Whipps?† Emre Ertin† Randolph L. Moses† ?U.S. Army Research Laboratory, Adelphi, MD 20783 †The Ohio State University
Block, Anna; Guo, Ming; Li, Guangyong; Elowsky, Christian; Clemente, Thomas E.; Alfano, James R.
2009-01-01
Summary The bacterial plant pathogen Pseudomonas syringae uses a type III protein secretion system to inject type III effectors into plant cells. Primary targets of these effectors appear to be effector-triggered immunity (ETI) and pathogen-associated molecular pattern (PAMP)-triggered immunity (PTI). The type III effector HopG1 is a suppressor of ETI that is broadly conserved in bacterial plant pathogens. Here we show that HopG1 from P. syringae pv. tomato DC3000 also suppresses PTI. Interestingly, HopG1 localizes to plant mitochondria, suggesting that its suppression of innate immunity may be linked to a perturbation of mitochondrial function. While HopG1 possesses no obvious mitochondrial signal peptide, its N-terminal two-thirds was sufficient for mitochondrial localization. A HopG1-GFP fusion lacking HopG1’s N-terminal 13 amino acids was not localized to the mitochondria reflecting the importance of the N-terminus for targeting. Constitutive expression of HopG1 in Arabidopsis thaliana, Nicotiana tabacum (tobacco) and Lycopersicon esculentum (tomato) dramatically alters plant development resulting in dwarfism, increased branching and infertility. Constitutive expression of HopG1 in planta leads to reduced respiration rates and an increased basal level of reactive oxygen species. These findings suggest that HopG1’s target is mitochondrial and that effector/target interaction promotes disease by disrupting mitochondrial functions. PMID:19863557
Dietz, Birgit M.; Hagos, Ghenet K.; Eskra, Jillian N.; Wijewickrama, Gihani T.; Anderson, Jeffrey R.; Nikolic, Dejan; Guo, Jian; Wright, Brian; Chen, Shao-Nong; Pauli, Guido F.; van Breemen, Richard B.; Bolton, Judy L.
2013-01-01
Scope Hops contain the phytoestrogen, 8-prenylnaringenin, and the cytoprotective compound, xanthohumol (XH). XH induces the detoxification enzyme, NAD(P)H-quinone oxidoreductase (NQO1) in vitro; however, the tissue distribution of XH and 8-prenylnaringenin and their tissue specific activity have not been analyzed. Methods and results A standardized hop extract (p.o.) and XH (s.c.) were administered to Sprague-Dawley rats over four days. LC-MS-MS analysis of plasma, liver and mammary gland revealed that XH accumulated in liver and mammary glands. Compared with the low level in the original extract, 8-prenylnaringenin was enriched in the tissues. Hops and XH induced NQO1 in the liver, while only hops reduced NQO1 activity in the mammary gland. Mechanistic studies revealed that hops modulated NQO1 through three mechanisms. In liver cells, 1) XH modified Keap1 leading to Nrf2 translocation and antioxidant response element (ARE) activation; 2) hop-mediated ARE induction was partially mediated through phosphorylation of Nrf2 by PKC; 3) in breast cells, 8-prenylnaringenin reduced NQO1 likely through binding to ERα, recruiting Nrf2, and downregulating ARE-regulated genes. Conclusions XH and 8-prenylnaringenin in dietary hops are bioavailable to the target tissues. While hops and XH might be cytoprotective in the liver, 8-prenylnaringenin seems responsible for hop-mediated NQO1 reduction in the mammary gland. PMID:23512484
2016-12-15
This graphic shows a theoretical path of a water molecule on Ceres. Some water molecules fall into cold, dark craters at high latitudes called "cold traps," where very little of the ice turns into vapor, even over the course of a billion years. Other water molecules that do not land in cold traps are lost to space as they hop around the dwarf planet. http://photojournal.jpl.nasa.gov/catalog/PIA21083
ERIC Educational Resources Information Center
Love, Bettina L.
2016-01-01
Hip hop music and culture have a complex identity in that hip hop is based in self-determination, resistance, and the long enduring fight for Black freedom, but was also created alongside the seductiveness of the material and psychological conditions of capitalism, sexism, and patriarchy. Hip hop pedagogy (HHP) as a pedagogical framework is…
2006-01-01
1 AC -130 Employment Subject Area Aviation EWS 2006 Author Captain Robert Hornick, USMC Report Documentation Page Form ApprovedOMB No. 0704...00-2006 4. TITLE AND SUBTITLE AC -130 Employment 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) 5d. PROJECT NUMBER... AC -130 gunship is an aircraft that can provide all of these needs. Regrettably, there are too few AC -130’s in the inventory to cover all the needs
Hopping and the Stokes-Einstein relation breakdown in simple glass formers.
Charbonneau, Patrick; Jin, Yuliang; Parisi, Giorgio; Zamponi, Francesco
2014-10-21
One of the most actively debated issues in the study of the glass transition is whether a mean-field description is a reasonable starting point for understanding experimental glass formers. Although the mean-field theory of the glass transition--like that of other statistical systems--is exact when the spatial dimension d → ∞, the evolution of systems properties with d may not be smooth. Finite-dimensional effects could dramatically change what happens in physical dimensions,d = 2, 3. For standard phase transitions finite-dimensional effects are typically captured by renormalization group methods, but for glasses the corrections are much more subtle and only partially understood. Here, we investigate hopping between localized cages formed by neighboring particles in a model that allows to cleanly isolate that effect. By bringing together results from replica theory, cavity reconstruction, void percolation, and molecular dynamics, we obtain insights into how hopping induces a breakdown of the Stokes-Einstein relation and modifies the mean-field scenario in experimental systems. Although hopping is found to supersede the dynamical glass transition, it nonetheless leaves a sizable part of the critical regime untouched. By providing a constructive framework for identifying and quantifying the role of hopping, we thus take an important step toward describing dynamic facilitation in the framework of the mean-field theory of glasses.
Hopping and the Stokes–Einstein relation breakdown in simple glass formers
Charbonneau, Patrick; Jin, Yuliang; Parisi, Giorgio; Zamponi, Francesco
2014-01-01
One of the most actively debated issues in the study of the glass transition is whether a mean-field description is a reasonable starting point for understanding experimental glass formers. Although the mean-field theory of the glass transition—like that of other statistical systems—is exact when the spatial dimension d→∞, the evolution of systems properties with d may not be smooth. Finite-dimensional effects could dramatically change what happens in physical dimensions, d=2,3. For standard phase transitions finite-dimensional effects are typically captured by renormalization group methods, but for glasses the corrections are much more subtle and only partially understood. Here, we investigate hopping between localized cages formed by neighboring particles in a model that allows to cleanly isolate that effect. By bringing together results from replica theory, cavity reconstruction, void percolation, and molecular dynamics, we obtain insights into how hopping induces a breakdown of the Stokes–Einstein relation and modifies the mean-field scenario in experimental systems. Although hopping is found to supersede the dynamical glass transition, it nonetheless leaves a sizable part of the critical regime untouched. By providing a constructive framework for identifying and quantifying the role of hopping, we thus take an important step toward describing dynamic facilitation in the framework of the mean-field theory of glasses. PMID:25288722
Lürick, Anna; Kuhlee, Anne; Bröcker, Cornelia; Kümmel, Daniel; Raunser, Stefan; Ungermann, Christian
2015-01-01
Membrane fusion at vacuoles requires a consecutive action of the HOPS tethering complex, which is recruited by the Rab GTPase Ypt7, and vacuolar SNAREs to drive membrane fusion. It is assumed that the Sec1/Munc18-like Vps33 within the HOPS complex is largely responsible for SNARE chaperoning. Here, we present direct evidence for HOPS binding to SNAREs and the Habc domain of the Vam3 SNARE protein, which may explain its function during fusion. We show that HOPS interacts strongly with the Vam3 Habc domain, assembled Q-SNAREs, and the R-SNARE Ykt6, but not the Q-SNARE Vti1 or the Vam3 SNARE domain. Electron microscopy combined with Nanogold labeling reveals that the binding sites for vacuolar SNAREs and the Habc domain are located in the large head of the HOPS complex, where Vps16 and Vps33 have been identified before. Competition experiments suggest that HOPS bound to the Habc domain can still interact with assembled Q-SNAREs, whereas Q-SNARE binding prevents recognition of the Habc domain. In agreement, membranes carrying Vam3ΔHabc fuse poorly unless an excess of HOPS is provided. These data suggest that the Habc domain of Vam3 facilitates the assembly of the HOPS/SNARE machinery at fusion sites and thus supports efficient membrane fusion. PMID:25564619
Analytical theory and possible detection of the ac quantum spin Hall effect
Deng, W. Y.; Ren, Y. J.; Lin, Z. X.; ...
2017-07-11
Here, we develop an analytical theory of the low-frequency ac quantum spin Hall (QSH) effect based upon the scattering matrix formalism. It is shown that the ac QSH effect can be interpreted as a bulk quantum pumping effect. When the electron spin is conserved, the integer-quantized ac spin Hall conductivity can be linked to the winding numbers of the reflection matrices in the electrodes, which also equal to the bulk spin Chern numbers of the QSH material. Furthermore, a possible experimental scheme by using ferromagnetic metals as electrodes is proposed to detect the topological ac spin current by electrical means.
Long-Term Oral Administration of Hop Flower Extracts Mitigates Alzheimer Phenotypes in Mice
Sasaoka, Norio; Sakamoto, Megumi; Kanemori, Shoko; Kan, Michiru; Tsukano, Chihiro; Takemoto, Yoshiji; Kakizuka, Akira
2014-01-01
Coincident with the expanding population of aged people, the incidence of Alzheimer disease (AD) is rapidly increasing in most advanced countries. At present, no effective prophylactics are available. Among several pathological mechanisms proposed for AD, the “amyloid hypothesis” has been most widely accepted, in which accumulation or deposition of Aβ is considered to be the initial event. Thus, prevention of Aβ production would be an ideal strategy for the treatment or prevention of AD. Aβ is produced via the proteolytic cleavage of its precursor protein, APP (amyloid precursor protein), by two different enzymes, β and γ-secretases. Indeed, inhibitors against either or both enzymes have been developed and tested for clinical efficacy. Based on the “amyloid hypothesis”, we developed a luciferase-based screening method to monitor γ-secretase activity, screened more than 1,600 plant extracts, most of which have long been used in Chinese medicine, and observed that Hop extracts significantly inhibit Aβ production in cultured cells. A major component of the inhibitory activity was purified, and its chemical identity was determined by NMR to be Garcinielliptone HC. In vivo, oral administration of Hop extracts to AD model mice decreased Aβ depositions in the cerebral cortex of the parietal lobe, hippocampus, and artery walls (amyloid angiopathy) in the brains. In a Morris water maze test, AD model mice that had daily consumed Hop extracts in their drinking water showed significant mitigation of memory impairment at ages of 9 and 12 months. Moreover, in the open field test oral administration of Hop extracts also prevented an emotional disturbance that appeared in the AD mice at 18 months. Despite lifelong consumption of Hop extracts, no deleterious side effects were observed at any age. These results support the “amyloid hypothesis”, and indicate that Hop extract is a promising candidate for an effective prophylactic for AD. PMID:24489866
We Got Next: Hip-Hop Pedagogy and the Next Generation of Democratic Education
ERIC Educational Resources Information Center
Dando, Michael
2017-01-01
Using daily experiences and existing identities as the subject matter, a hip-hop-centered class encourages students to develop a critical lens so that they can "envision a social order which supports their full humanity" (Shor, 1987, p. 48) and embraces the idea that hip-hop culture provides context for students to develop critical…
Thermal and ac electrical properties of N-methylanthranilic acid below room temperature
NASA Astrophysics Data System (ADS)
Abdel-Kader, M. M.; Basha, M. A. F.; Ramzy, G. H.; Aboud, A. I.
2018-06-01
In this study, we investigated the thermal and alternating current (ac) electrical properties of N-methylanthranilic acid. Based on data obtained by differential scanning calorimetry, we detected two endothermic transitions at ≈ 213 K and ≈265.41 K. The weakening of hydrogen bonds as the temperature increased appeared to be the main cause of these phase transitions. We also recorded the melting point at about 475.5 K. Both the ac conductivity (σac) and complex dielectric constant (ε∗ = ε ' - jε ' ') were studied as functions of temperature over the frequency range from 1 kHz to 100 kHz. We observed significant variations in the thermal and electrical properties before and after the transition temperature at 265.41 K. The conduction mechanism responsible for the ac electrical properties before this transition was due to overlapping large polarons. These novel results are expected to have impacts on the application of organic semiconductors and dielectrics.
21 CFR 172.560 - Modified hop extract.
Code of Federal Regulations, 2014 CFR
2014-04-01
... following processes: (1) The additive is manufactured from a hexane extract of hops by simultaneous... approximately 0.012 n alkaline methyl alcohol (6 milliliters of 1 n sodium hydroxide diluted to 500 milliliters... fractionations, using methylene chloride, hexane, and methyl alcohol as solvents, followed by isomerization by...
Epigenetic changes detected in micropropagated hop plants.
Peredo, Elena L; Arroyo-García, Rosa; Revilla, M Angeles
2009-07-01
Micropropagation is a widely used technique in hops (Humulus lupulus L.). However, to the best of our knowledge, the genetic and epigenetic stability of the microplants has never been tested before. In the present study, two hop accessions were established in vitro and micropropagated for 2 years. The genetic and epigenetic stability of the in vitro plants was analyzed with several molecular techniques: random amplified DNA polymorphism (RAPD), retrotransposon microsatellite amplified polymorphism (REMAP), and methylation-sensitive amplification polymorphism (MSAP). No genetic variation among control and treated plants was found, even after 12 cycles of micropropagation. Epigenetic variation was detected, first, when field and in vitro samples were compared. Nearly a 30% of the detected fragments presented the same pattern of alterations in all the vitroplants. Second, lower levels of epigenetic variation were detected among plants from the different subcultures. Part of this detected variation seemed to be accumulated along the 12 sequential subcultures tested.
Spectrophotometric and electrical properties of imperatorin: an organic molecule
NASA Astrophysics Data System (ADS)
Mir, Feroz A.
2015-09-01
Imperatorin (molecular formula = C16H14O4, molecular mass = 270) an organic molecule was isolated from ethyl acetate extract of the root parts of the plant Prangos pabularia. The optical study was carried out by ultraviolet-visible spectroscopy, and this compound showed an indirect allowed transition. The optical band gap ( E g ) was found around 3.75 eV. Photoluminescence shows various good emission bands. The frequency-dependent real part of the complex ac conductivity was found to follow the universal dielectric response: σ ac ( ω) α ω s [where σ ac ( ω) is the frequency-dependent total conductivity, ω is the frequency, and s is the frequency exponent]. From ac conductivity data analysis, correlated barrier hopping charge-transport mechanism is the dominant electrical transport process shown by this compound. The good emission, less absorption, wide band gap and good electrical properties shown by this compound project them as a bright choice for organic electronic devices.
USDA-ARS?s Scientific Manuscript database
Increasing labor costs and reduced labor pools for hop production have resulted in the necessity to develop strategies to improve efficiency and automate hop production and harvest. One solution for reducing labor inputs is the use and production of “low-trellis” hop varieties optimized for mechani...
Sampling Practices and Social Spaces: Exploring a Hip-Hop Approach to Higher Education
ERIC Educational Resources Information Center
Petchauer, Emery
2010-01-01
Much more than a musical genre, hip-hop culture exists as an animating force in the lives of many young adults. This article looks beyond the moral concerns often associated with rap music to explore how hip-hop as a larger set of expressions and practices implicates the educational experiences, activities, and approaches for students. The article…
Fujibayashi, Nobuaki; Otsuka, Mitsuo; Yoshioka, Shinsuke; Isaka, Tadao
2017-10-24
The present study aims to cross-sectionally clarify the characteristics of the motions of an inverted pendulum model, a stance leg, a swing leg and arms in different triple-jumping techniques to understand whether or not hop displacement is relatively longer rather than step and jump displacements. Eighteen male athletes performed the triple jump with a full run-up. Based on the technique of the jumpers, they were classified as hop-dominated (n = 10) or balance (n = 8) jumpers. The kinematic data were calculated using motion capture and compared between the two techniques using the inverted pendulum model. The hop-dominated jumpers had a significantly longer hop displacement and faster vertical centre-of-mass (COM) velocity of their whole body at hop take-off, which was generated by faster rotation behaviours of inverted pendulum model and faster swinging behaviours of arms. Conversely, balance jumpers had a significantly longer jump displacement and faster horizontal COM velocity of their whole body at take-off, which was generated by a stiffer inverted pendulum model and stance leg. The results demonstrate that hop-dominated and balance jumpers enhanced each dominated-jump displacement using different swing- and stance-leg motions. This information may help to enhance the actual displacement of triple jumpers using different jumping techniques.
Polaron formation in normal state optical conductivity of iron-based superconductor
NASA Astrophysics Data System (ADS)
Choudhary, K. K.; Lodhi, Pavitra Devi; Kaurav, Netram
2018-05-01
Normal state Optical conductivity σ(ω) of Iron-Based superconductor LaFeAsO have been investigated using polaron formation mechanism. The coherent Drude free carrier excitations as well as the incoherent motion of carriers leading to a polaron formation, originated from inter and intra layer transitions of charge carriers are incorporated in the present model. Coherent motion of Drude carriers obtained from an effective interaction potential leads to a peak at zero frequency regime which is an indication of metallic conduction in superconducting materials and also produces a long tail at higher frequencies infrared region. Whereas, the incoherent motion i.e. hopping of carriers from Fe to Fe in the FeAs layer and from FeAs layer to LaO layer produces two different peaks at around 100 cm-1 and 430 cm-1 respectively. Two contributions, Drude and hopping carriers successfully explain the anomalies observed in the optical conductivity of metallic state of the iron-based superconductors.
HARE: Supporting Efficient Uplink Multi-Hop Communications in Self-Organizing LPWANs.
Adame Vázquez, Toni; Barrachina-Muñoz, Sergio; Bellalta, Boris; Bel, Albert
2018-01-03
The emergence of low-power wide area networks (LPWANs) as a new agent in the Internet of Things (IoT) will result in the incorporation into the digital world of low-automated processes from a wide variety of sectors. The single-hop conception of typical LPWAN deployments, though simple and robust, overlooks the self-organization capabilities of network devices, suffers from lack of scalability in crowded scenarios, and pays little attention to energy consumption. Aimed to take the most out of devices' capabilities, the HARE protocol stack is proposed in this paper as a new LPWAN technology flexible enough to adopt uplink multi-hop communications when proving energetically more efficient. In this way, results from a real testbed show energy savings of up to 15% when using a multi-hop approach while keeping the same network reliability. System's self-organizing capability and resilience have been also validated after performing numerous iterations of the association mechanism and deliberately switching off network devices.
HARE: Supporting Efficient Uplink Multi-Hop Communications in Self-Organizing LPWANs
Barrachina-Muñoz, Sergio; Bellalta, Boris
2018-01-01
The emergence of low-power wide area networks (LPWANs) as a new agent in the Internet of Things (IoT) will result in the incorporation into the digital world of low-automated processes from a wide variety of sectors. The single-hop conception of typical LPWAN deployments, though simple and robust, overlooks the self-organization capabilities of network devices, suffers from lack of scalability in crowded scenarios, and pays little attention to energy consumption. Aimed to take the most out of devices’ capabilities, the HARE protocol stack is proposed in this paper as a new LPWAN technology flexible enough to adopt uplink multi-hop communications when proving energetically more efficient. In this way, results from a real testbed show energy savings of up to 15% when using a multi-hop approach while keeping the same network reliability. System’s self-organizing capability and resilience have been also validated after performing numerous iterations of the association mechanism and deliberately switching off network devices. PMID:29301351
Stumpfe, Dagmar; Dimova, Dilyana; Bajorath, Jürgen
2015-07-01
Scaffold hopping and activity cliff formation define opposite ends of the activity landscape feature spectrum. To rationalize these events at the level of scaffolds, active compounds involved in scaffold hopping were required to contain topologically distinct scaffolds but have only limited differences in potency, whereas compounds involved in activity cliffs were required to share the same scaffold but have large differences in potency. A systematic search was carried out for compounds involved in scaffold hopping and/or activity cliff formation. Results obtained for compound data sets covering more than 300 human targets revealed clear trends. If scaffolds represented multiple but fewer than 10 active compounds, nearly 90% of all scaffolds were exclusively involved in hopping events. With increasing compound coverage, the fraction of scaffolds involved in both scaffold hopping and activity cliff formation significantly increased to more than 50%. However, ∼40% of the scaffolds representing large numbers of active compounds continued to be exclusively involved in scaffold hopping. More than 200 scaffolds with broad target coverage were identified that consistently represented potent compounds and yielded an abundance of scaffold hops in the low-nanomolar range. These and other subsets of scaffolds we characterized are of prime interest for structure-activity relationship (SAR) exploration and compound design. Therefore, the complete scaffold classification generated in the course of our analysis is made freely available. Copyright © 2015 Elsevier Ltd. All rights reserved.
Hazelwood, Lucie A.; Walsh, Michael C.; Pronk, Jack T.; Daran, Jean-Marc
2010-01-01
The hop plant, Humulus lupulus L., has an exceptionally high content of secondary metabolites, the hop α-acids, which possess a range of beneficial properties, including antiseptic action. Studies performed on the mode of action of hop iso-α-acids have hitherto been restricted to lactic acid bacteria. The present study investigated molecular mechanisms of hop iso-α-acid resistance in the model eukaryote Saccharomyces cerevisiae. Growth inhibition occurred at concentrations of hop iso-α-acids that were an order of magnitude higher than those found with hop-tolerant prokaryotes. Chemostat-based transcriptome analysis and phenotype screening of the S. cerevisiae haploid gene deletion collection were used as complementary methods to screen for genes involved in hop iso-α-acid detoxification and tolerance. This screening and further analysis of deletion mutants confirmed that yeast tolerance to hop iso-α-acids involves three major processes, active proton pumping into the vacuole by the vacuolar-type ATPase to enable vacuolar sequestration of iso-α-acids and alteration of cell wall structure and, to a lesser extent, active export of iso-α-acids across the plasma membrane. Furthermore, iso-α-acids were shown to affect cellular metal homeostasis by acting as strong zinc and iron chelators. PMID:19915041
Examining Hip-Hop as Culturally Relevant Pedagogy
ERIC Educational Resources Information Center
Kim, Jung; Pulido, Isaura
2015-01-01
Culturally relevant pedagogy is a framework that conceptualizes the process of student learning as contingent upon educators' deep understanding of students' cultural backgrounds to co-construct knowledge and develop academic skills. Concurrently, there are a growing number of studies that explore hip-hop as a culturally relevant curriculum for…
The small GTPase Arl8b regulates assembly of the mammalian HOPS complex on lysosomes
Khatter, Divya; Raina, Vivek B.; Dwivedi, Devashish; Sindhwani, Aastha; Bahl, Surbhi; Sharma, Mahak
2015-01-01
The homotypic fusion and protein sorting (HOPS) complex is a multi-subunit complex conserved from yeast to mammals that regulates late endosome and lysosome fusion. However, little is known about how the HOPS complex is recruited to lysosomes in mammalian cells. Here, we report that the small GTPase Arl8b, but not Rab7 (also known as RAB7A), is essential for membrane localization of the human (h)Vps41 subunit of the HOPS complex. Assembly of the core HOPS subunits to Arl8b- and hVps41-positive lysosomes is guided by their subunit–subunit interactions. RNA interference (RNAi)-mediated depletion of hVps41 resulted in the impaired degradation of EGFR that was rescued upon expression of wild-type but not an Arl8b-binding-defective mutant of hVps41, suggesting that Arl8b-dependent lysosomal localization of hVps41 is required for its endocytic function. Furthermore, we have also identified that the Arl8b effector SKIP (also known as PLEKHM2) interacts with and recruits HOPS subunits to Arl8b and kinesin-positive peripheral lysosomes. Accordingly, RNAi-mediated depletion of SKIP impaired lysosomal trafficking and degradation of EGFR. These findings reveal that Arl8b regulates the association of the human HOPS complex with lysosomal membranes, which is crucial for the function of this tethering complex in endocytic degradation. PMID:25908847
Towards an Efficient Flooding Scheme Exploiting 2-Hop Backward Information in MANETs
NASA Astrophysics Data System (ADS)
Le, Trong Duc; Choo, Hyunseung
Flooding is an indispensable operation for providing control or routing functionalities to mobile ad hoc networks (MANETs). Previously, many flooding schemes have been studied with the intention of curtailing the problems of severe redundancies, contention, and collisions in traditional implementations. A recent approach with relatively high efficiency is 1HI by Liu et al., which uses only 1-hop neighbor information. The scheme achieves local optimality in terms of the number of retransmission nodes with time complexity &Theta(n log n), where n is the number of neighbors of a node; however, this method tends to make many redundant transmissions. In this paper, we present a novel flooding algorithm, 2HBI (2-hop backward information), that efficiently reduces the number of retransmission nodes and solves the broadcast storm problem in ad hoc networks using our proposed concept, “2-hop backward information.” The most significant feature of the proposed algorithm is that it does not require any extra communication overhead other than the exchange of 1-hop HELLO messages but maintains high deliverability. Comprehensive computer simulations show that the proposed scheme significantly reduces redundant transmissions in 1HI and in pure flooding, up to 38% and 91%, respectively; accordingly it alleviates contention and collisions in networks.
Studying the hopping parameters of half-Heusler NaAuS using maximally localized Wannier function
NASA Astrophysics Data System (ADS)
Sihi, Antik; Lal, Sohan; Pandey, Sudhir K.
2018-04-01
Here, the electronic behavior of half-Heusler NaAuS is studied using PBEsol exchange correlation functional by plotting the band structure curve. These bands are reproduced using maximally localized Wannier function using WANNIER90. Tight-binding bands are nicely matched with density functional theory bands. By fitting the tight-binding model, hopping parameter for NaAuS is obtained by including Na 2s, 2p, Au 6s, 5p, 5d and S 3s, 3p orbitals within the energy interval of -5 to 16 eV around the Fermi level. In present study, hopping integrals for NaAuS are computed for the first primitive unit cell atoms as well as the first nearest neighbor primitive unit cell. The most dominating hopping integrals are found for Na (3s) - S (3s), Na (2px) - S (2px), Au (6s) - S (3px), Au (6s) - S (3py) and Au (6s) - S (3pz) orbitals. The hopping integrals for the first nearest neighbor primitive unit cell are also discussed in this manuscript. In future, these hopping integrals are very important to find the topological invariant for NaAuS compound.
O'Connor, Annalouise; Konda, Veera; Reed, Ralph L; Christensen, J Mark; Stevens, Jan F; Contractor, Nikhat
2018-03-01
Xanthohumol (XN), a prenylated flavonoid found in hops, exhibits anti-inflammatory and antioxidant properties. However, poor bioavailability may limit therapeutic applications. As food components are known to modulate polyphenol absorption, the objective is to determine whether a protein matrix could enhance the bioavailability of XN post oral consumption in humans. This is a randomized, double-blind, crossover study in healthy participants (n = 6) evaluating XN and its major metabolites (isoxanthohumol [IX], 6- and 8-prenylnaringenin [6-PN, 8-PN]) for 6 h following consumption of 12.4 mg of XN delivered via a spent hops-rice protein matrix preparation or a control spent hops preparation. Plasma XN and metabolites are measured by LC-MS/MS. C max , T max , and area-under-the-curve (AUC) values were determined. Circulating XN and metabolite response to each treatment was not bioequivalent. Plasma concentrations of XN and XN + metabolites (AUC) are greater with consumption of the spent hops-rice protein matrix preparation. Compared to a standard spent hops powder, a protein-rich spent hops matrix demonstrates enhanced plasma levels of XN and metabolites following acute oral intake. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Lateral hopping of CO molecules on Pt(111) surface by femtosecond laser pulses
NASA Astrophysics Data System (ADS)
Hayashi, M.; Ootsuka, Y.; Paulsson, M.; Persson, B. N. J.; Ueba, H.
2009-12-01
Theory of heat transfer between adsorbate vibrational degrees of freedom and ultrafast laser heated hot electrons including vibrational intermode coupling is applied to calculate two-pulse correlation, laser fluence dependence and time dependence of lateral hopping of CO molecules from a step to terrace site on a stepped Pt (111) surface. The intermode coupling is a key ingredient to describe vibrational heating of the frustrated translation mode responsible for the CO hopping. The calculated results are in good agreement with the experimental results, especially if we scale down the experimentally determined absorbed fluence. It is found that CO hopping is induced by indirect heating of the FT mode by the FR mode with a strong frictional coupling to hot electrons.
NASA Astrophysics Data System (ADS)
McCune, Robert C.; Upadhyay, Vinod; Wang, Yar-Ming; Battocchi, Dante
The potential utility of AC-DC-AC electrochemical methods in comparative measures of corrosion-resisting coating system performance for magnesium alloys under consideration for the USAMP "Magnesium Front End Research and Development" project was previously shown in this forum [1]. Additional studies of this approach using statistically-designed experiments have been conducted with focus on alloy types, pretreatment, topcoat material and topcoat thickness as the variables. Additionally, sample coupons made for these designed experiments were also subjected to a typical automotive cyclic corrosion test cycle (SAE J2334) as well as ASTM B117 for comparison of relative performance. Results of these studies are presented along with advantages and limitations of the proposed methodology.
Adaptations in single-leg hop biomechanics following anterior cruciate ligament reconstruction.
Orishimo, Karl F; Kremenic, Ian J; Mullaney, Michael J; McHugh, Malachy P; Nicholas, Stephen J
2010-11-01
When a patient performs a clinically normal hop test based on distance, it cannot be assumed that the biomechanics are similar between limbs. The objective was to compare takeoff and landing biomechanics between legs in patients who have undergone anterior cruciate ligament reconstruction. Kinematics and ground reaction forces were recorded as 13 patients performed the single-leg hop on each leg. Distance hopped, joint range of motion, peak joint kinetics and the peak total extensor moment were compared between legs during both takeoff and landing. Average hop distance ratio (involved/noninvolved) was 93 ± 4%. Compared to the noninvolved side, knee motion during takeoff on the involved side was significantly reduced (P = 0.008). Peak moments and powers on the involved side were lower at the knee and higher at the ankle and hip compared with the noninvolved side (Side by Joint P = 0.011; P = 0.003, respectively). The peak total extensor moment was not different between legs (P = 0.305) despite a decrease in knee moment and increases in ankle and hip moments (Side by Joint P = 0.015). During landing, knee motion was reduced (P = 0.043), and peak power absorbed was decreased at the knee and hip and increased at the ankle on the involved side compared to the noninvolved side (P = 0.003). The compensations by other joints may indicate protective adaptations to avoid overloading the reconstructed knee.
Mortality in American Hip-Hop and Rap Recording Artists, 1987-2014.
Lawson, Carl J
2015-12-01
The deaths of American hip-hop and rap recording artists often receive considerable media attention. However, these artists' deaths have not been examined as a distinct group like the deaths of rock, classical, jazz, and pop music artists. This is a seminal epidemiological analysis on the deaths of an understudied group, American hip-hop and rap music recording artists. Media reports were analyzed of the deaths of American hip-hop and rap music recording artists that occurred from January 1, 1987 to December 31, 2014. The decedents' age, sex, race, cause of death, stage names, and city and state of death were recorded for analysis. The most commonly reported cause of death was homicide. The 280 deaths were categorized as homicide (55%), unintentional injury (13%), cardiovascular (7%), undetermined/undisclosed (7%), cancer (6%), other (5%), suicide (4%), and infectious disease (3%). The mean reported age at death was 30 yrs (range 15-75) and the median was 29 yrs; 97% were male and 92% were black. All but one of the homicides were committed with firearms. Homicide was the most commonly reported cause of death. Public health focus and guidance for hip-hop and rap recording artists should mirror that for African-American men and adolescent males ages 15-54 yrs, for whom the leading causes of death are homicide, unintentional injury, and heart disease. Given the preponderance of homicide deaths in this analysis, premature mortality reduction efforts should focus on violence prevention and conflict mitigation.
Polaron hopping in olivine phosphates studied by nuclear resonant scattering
NASA Astrophysics Data System (ADS)
Tracy, Sally June
Valence fluctuations of Fe2+ and Fe3+ were studied in a solid solution of LixFePO4 by nuclear resonant forward scattering of synchrotron x rays while the sample was heated in a diamond-anvil pressure cell. The spectra acquired at different temperatures and pressures were analyzed for the frequencies of valence changes using the Blume-Tjon model of a system with a fluctuating Hamiltonian. These frequencies were analyzed to obtain activation energies and an activation volume for polaron hopping. There was a large suppression of hopping frequency with pressure, giving an anomalously large activation volume. This large, positive value is typical of ion diffusion, which indicates correlated motions of polarons, and Li+ ions that alter the dynamics of both. In a parallel study of NaxFePO4, the interplay between sodium ordering and electron mobility was investigated using a combination of synchrotron x-ray diffraction and nuclear resonant scattering. Conventional Mossbauer spectra were collected while the sample was heated in a resistive furnace. An analysis of the temperature evolution of the spectral shapes was used to identify the onset of fast electron hopping and determine the polaron hopping rate. Synchrotron x-ray diffraction measurements were carried out in the same temperature range. Reitveld analysis of the diffraction patterns was used to determine the temperature of sodium redistribution on the lattice. The diffraction analysis also provides new information about the phase stability of the system. The temperature evolution of the iron site occupancies from the Mossbauer measurements, combined with the synchrotron diffraction results give strong evidence for a relationship between the onset of fast electron dynamics and the redistribution of sodium in the lattice. Measurements of activation barriers for polaron hopping gave fundamental insights about the correlation between electronic carriers and mobile ions. This work established that polaron-ion interactions
Wren, Tishya A L; Mueske, Nicole M; Brophy, Christopher H; Pace, J Lee; Katzel, Mia J; Edison, Bianca R; VandenBerg, Curtis D; Zaslow, Tracy L
2018-03-30
Study Design Retrospective cohort. Background Return to sport (RTS) protocols after anterior cruciate ligament reconstruction (ACLR) often include assessment of hop distance symmetry. However, it is unclear if movement deficits are present regardless of hop symmetry. Objectives To assess biomechanics and symmetry of adolescent athletes following ACLR during a single leg hop for distance. Methods Forty-six patients with ACLR (5-12 months post-surgery; 27 female; age 15.6, SD 1.7 years) were classified as asymmetric (operative limb hop distance <90% of non-operative limb; n=17) or symmetric (n=29). Lower extremity biomechanics were compared among operative and contralateral limbs and 24 symmetric controls (12 female; age 14.7, SD 1.5 years) using ANOVA. Results Compared to controls, asymmetric patients hopped a shorter distance on their operative limb (P<0.001), while symmetric patients hopped an intermediate distance on both sides (P≥0.12). During landing, operative limbs, regardless of hop distance, exhibited lower knee flexion moments compared to controls and the contralateral side (P≤0.04) with lower knee energy absorption than the contralateral side (P≤0.006). During take-off, both symmetric and asymmetric patients had less hip extension and smaller ankle range of motion on the operative side compared with controls (P≤0.05). Asymmetric patients also had lower hip range of motion on the operative, compared with the contralateral, side (P=0.001). Conclusion Both symmetric and asymmetric patients offloaded the operative knee; symmetric patients achieved symmetry in part by hopping a shorter distance on the contralateral side. Therefore, hop distance symmetry may not be an adequate test of single limb function and RTS readiness. Level of Evidence 2b. J Orthop Sports Phys Ther, Epub 30 Mar 2018. doi:10.2519/jospt.2018.7817.
Force feedback effects on single molecule hopping and pulling experiments
NASA Astrophysics Data System (ADS)
Rico-Pasto, M.; Pastor, I.; Ritort, F.
2018-03-01
Single-molecule experiments with optical tweezers have become an important tool to study the properties and mechanisms of biological systems, such as cells and nucleic acids. In particular, force unzipping experiments have been used to extract the thermodynamics and kinetics of folding and unfolding reactions. In hopping experiments, a molecule executes transitions between the unfolded and folded states at a preset value of the force [constant force mode (CFM) under force feedback] or trap position [passive mode (PM) without feedback] and the force-dependent kinetic rates extracted from the lifetime of each state (CFM) and the rupture force distributions (PM) using the Bell-Evans model. However, hopping experiments in the CFM are known to overestimate molecular distances and folding free energies for fast transitions compared to the response time of the feedback. In contrast, kinetic rate measurements from pulling experiments have been mostly done in the PM while the CFM is seldom implemented in pulling protocols. Here, we carry out hopping and pulling experiments in a short DNA hairpin in the PM and CFM at three different temperatures (6 °C, 25 °C, and 45 °C) exhibiting largely varying kinetic rates. As expected, we find that equilibrium hopping experiments in the CFM and PM perform well at 6 °C (where kinetics are slow), whereas the CFM overestimates molecular parameters at 45 °C (where kinetics are fast). In contrast, nonequilibrium pulling experiments perform well in both modes at all temperatures. This demonstrates that the same kind of feedback algorithm in the CFM leads to more reliable determination of the folding reaction parameters in irreversible pulling experiments.
Force feedback effects on single molecule hopping and pulling experiments.
Rico-Pasto, M; Pastor, I; Ritort, F
2018-03-28
Single-molecule experiments with optical tweezers have become an important tool to study the properties and mechanisms of biological systems, such as cells and nucleic acids. In particular, force unzipping experiments have been used to extract the thermodynamics and kinetics of folding and unfolding reactions. In hopping experiments, a molecule executes transitions between the unfolded and folded states at a preset value of the force [constant force mode (CFM) under force feedback] or trap position [passive mode (PM) without feedback] and the force-dependent kinetic rates extracted from the lifetime of each state (CFM) and the rupture force distributions (PM) using the Bell-Evans model. However, hopping experiments in the CFM are known to overestimate molecular distances and folding free energies for fast transitions compared to the response time of the feedback. In contrast, kinetic rate measurements from pulling experiments have been mostly done in the PM while the CFM is seldom implemented in pulling protocols. Here, we carry out hopping and pulling experiments in a short DNA hairpin in the PM and CFM at three different temperatures (6 °C, 25 °C, and 45 °C) exhibiting largely varying kinetic rates. As expected, we find that equilibrium hopping experiments in the CFM and PM perform well at 6 °C (where kinetics are slow), whereas the CFM overestimates molecular parameters at 45 °C (where kinetics are fast). In contrast, nonequilibrium pulling experiments perform well in both modes at all temperatures. This demonstrates that the same kind of feedback algorithm in the CFM leads to more reliable determination of the folding reaction parameters in irreversible pulling experiments.
Engaging Black Males on Their Own Terms: What Schools Can Learn from Black Males Who Produce Hip-Hop
ERIC Educational Resources Information Center
Irby, Decoteau J.; Petchauer, Emery; Kirkland, David
2013-01-01
Education scholars and practitioners have much to learn about engagement and motivation of Black males by directing their inquiries to more organic sites of hip-hop cultural production outside of schools. One such site is the hip-hop's informal labor economy where Black males engage in earning money through hip-hop cultural production. Labor…
Human hopping on damped surfaces: strategies for adjusting leg mechanics.
Moritz, Chet T; Farley, Claire T
2003-08-22
Fast-moving legged animals bounce along the ground with spring-like legs and agilely traverse variable terrain. Previous research has shown that hopping and running humans maintain the same bouncing movement of the body's centre of mass on a range of elastic surfaces by adjusting their spring-like legs to exactly offset changes in surface stiffness. This study investigated human hopping on damped surfaces that dissipated up to 72% of the hopper's mechanical energy. On these surfaces, the legs did not act like pure springs. Leg muscles performed up to 24-fold more net work to replace the energy lost by the damped surface. However, considering the leg and surface together, the combination appeared to behave like a constant stiffness spring on all damped surfaces. By conserving the mechanics of the leg-surface combination regardless of surface damping, hoppers also conserved centre-of-mass motions. Thus, the normal bouncing movements of the centre of mass in hopping are not always a direct result of spring-like leg behaviour. Conserving the trajectory of the centre of mass by maintaining spring-like mechanics of the leg-surface combination may be an important control strategy for fast-legged locomotion on variable terrain.
ERIC Educational Resources Information Center
Hill, Marc Lamont
2009-01-01
This article examines the salience of collective "memory" and "remembering" among a group of students in Hip-Hop Lit, a hip-hop centered English literature course that I co-taught at "Howard High School," an urban high school in the Northeastern United States. Specifically, this article examines the memory work that occurred within Hip-Hop Lit in…
Bridge-mediated hopping or superexchange electron-transfer processes in bis(triarylamine) systems
NASA Astrophysics Data System (ADS)
Lambert, Christoph; Nöll, Gilbert; Schelter, Jürgen
2002-09-01
Hopping and superexchange are generally considered to be alternative electron-transfer mechanisms in molecular systems. In this work we used mixed-valence radical cations as model systems for the investigation of electron-transfer pathways. We show that substituents attached to a conjugated bridge connecting two triarylamine redox centres have a marked influence on the near-infrared absorption spectra of the corresponding cations. Spectral analysis, followed by evaluation of the electron-transfer parameters using the Generalized Mulliken-Hush theory and simulation of the potential energy surfaces, indicate that hopping and superexchange are not alternatives, but are both present in the radical cation with a dimethoxybenzene bridge. We found that the type of electron-transfer mechanism depends on the bridge-reorganization energy as well as on the bridge-state energy. Because superexchange and hopping follow different distance laws, our findings have implications for the design of new molecular and polymeric electron-transfer materials.
AC electrothermal technique in microchannels
NASA Astrophysics Data System (ADS)
Salari, Alinaghi; Navi, Maryam; Dalton, Colin
2017-02-01
Electrokinetic techniques have a wide range of applications in droplet, particle, and fluid manipulation systems. In general, they can be categorized into different subgroups including electroosmosis, electrothermal, electrophoresis, dielectrophoresis, etc. The AC electrothermal (ACET) technique has been shown to be very effective in applications which involve high conductivity fluids, such as blood, which are typically used in biomedical applications. In the past few years, the ACET effect has received considerable attention. Unlike AC electroosmosis (ACEO), the ACET effect shows plateaus in force in a wide frequency range. In other words, with electrothermal force, velocity is more steady and predictable at different frequencies, compared to ACEO and dielectrophoresis (DEP). Although electrothermal microflows form as a result of Joule heating in the fluid, due to high conduction of heat to the ambience, the temperature rise in the fluid is not so high as to threaten the nature of the biofluids. The average temperature rise resulting from the ACET effect is below 5 °K. In order to generate high strength AC electric fields, microfabricated electrode arrays are commonly used in microchannels. For pumping applications, it is essential to create asymmetry in the electric field, typically by having asymmetrical electrode pairs. There is no defined border between many electrokinetic techniques, and as such the point where electrothermal processes interferes with other electrokinetic techniques is not clear in the literature. In addition, there have been comprehensive reviews on micropumps, electrokinetics, and their subcategories, but the literature lacks a detailed up-to-date review on electrothermal microdevices. In this paper, a brief review is made specifically on electric fields in ACET devices, in order to provide an insight for the reader about the importance of this aspect of ACET devices and the improvements made to date.
The effect of interface hopping on inelastic scattering of oppositely charged polarons in polymers
NASA Astrophysics Data System (ADS)
Di, Bing; Wang, Ya-Dong; Zhang, Ya-Lin; An, Zhong
2013-06-01
The inelastic scattering of oppositely charge polarons in polymer heterojunctions is believed to be of fundamental importance for the light-emitting and transport properties of conjugated polymers. Based on the tight-binding SSH model, and by using a nonadiabatic molecular dynamic method, we investigate the effects of interface hopping on inelastic scattering of oppositely charged polarons in a polymer heterojunction. It is found that the scattering processes of the charge and lattice defect depend sensitively on the hopping integrals at the polymer/polymer interface when the interface potential barrier and applied electric field strength are constant. In particular, at an intermediate electric field, when the interface hopping integral of the polymer/polymer heterojunction material is increased beyond a critical value, two polarons can combine to become a lattice deformation in one of the two polymer chains, with the electron and the hole bound together, i.e., a self-trapped polaron—exciton. The yield of excitons then increases to a peak value. These results show that interface hopping is of fundamental importance and facilitates the formation of polaron—excitons.
Multimodal Hip Hop Productions as Media Literacies
ERIC Educational Resources Information Center
Turner, K. C. Nat
2012-01-01
This study draws on ethnographic data from a year-long multimodal media production (MMP) course and the experience of an African American female adolescent who used the production of multimodal Hip Hop texts to express her creativity and growing socially conscious view of the world. The study demonstrates how students made meaning multimodally and…
Generalized trajectory surface hopping method based on the Zhu-Nakamura theory
NASA Astrophysics Data System (ADS)
Oloyede, Ponmile; Mil'nikov, Gennady; Nakamura, Hiroki
2006-04-01
We present a generalized formulation of the trajectory surface hopping method applicable to a general multidimensional system. The method is based on the Zhu-Nakamura theory of a nonadiabatic transition and therefore includes the treatment of classically forbidden hops. The method uses a generalized recipe for the conservation of angular momentum after forbidden hops and an approximation for determining a nonadiabatic transition direction which is crucial when the coupling vector is unavailable. This method also eliminates the need for a rigorous location of the seam surface, thereby ensuring its applicability to a wide class of chemical systems. In a test calculation, we implement the method for the DH2+ system, and it shows a remarkable agreement with the previous results of C. Zhu, H. Kamisaka, and H. Nakamura, [J. Chem. Phys. 116, 3234 (2002)]. We then apply it to a diatomic-in-molecule model system with a conical intersection, and the results compare well with exact quantum calculations. The successful application to the conical intersection system confirms the possibility of directly extending the present method to an arbitrary potential of general topology.
Anti-jamming communication for body area network using chaotic frequency hopping.
Gopalakrishnan, Balamurugan; Bhagyaveni, Marcharla Anjaneyulu
2017-12-01
The healthcare industries research trends focus on patient reliable communication and security is a paramount requirement of healthcare applications. Jamming in wireless communication medium has become a major research issue due to the ease of blocking communication in wireless networks and throughput degradation. The most commonly used technique to overcome jamming is frequency hopping (FH). However, in traditional FH pre-sharing of key for channel selection and a high-throughput overhead is required. So to overcome this pre-sharing of key and to increase the security chaotic frequency hopping (CFH) has been proposed. The design of chaos-based hop selection is a new development that offers improved performance in transmission of information without pre-shared key and also increases the security. The authors analysed the performance of proposed CFH system under different reactive jamming durations. The percentage of error reduction by the reactive jamming for jamming duration 0.01 and 0.05 s for FH and CFH is 55.03 and 84.24%, respectively. The obtained result shows that CFH is more secure and difficult to jam by the reactive jammer.
Chordekar, Shai; Kriksunov, Leonid; Kishon-Rabin, Liat; Adelman, Cahtia; Sohmer, Haim
2012-01-01
Auditory sensation can be elicited not only by air conducted (AC) sound or bone conducted (BC) sound, but also by stimulation of soft tissue (STC) sites on the head and neck relatively distant from deeply underlying bone. Tone stimulation by paired combinations of AC with BC (mastoid) and/or with soft tissue conduction produce the same pitch sensation, mutual masking and beats. The present study was designed to determine whether they can also cancel each other. The study was conducted on ten normal hearing subjects. Tones at 2 kHz were presented in paired combinations by AC (insert earphone), by BC (bone vibrator) at the mastoid, and by the same bone vibrator to several STC sites; e.g. the neck, the sterno-cleido-mastoid muscle, the eye, and under the chin, shifting the phases between the pairs. Subjects reported changes in loudness and cancellation. The phase for cancellation differed across subjects. Neck muscle manipulations (changes in head position) led to alterations in the phase at which cancellation was reported. Cancellation was also achieved between pairs of tones to two STC sites. The differing phases for cancellation across subjects and the change in phase accompanying different head positions may be due to the different acoustic impedances of the several tissues in the head and neck. A major component of auditory stimulation by STC may not induce actual skull bone vibrations and may not involve bulk fluid volume displacements. Copyright © 2011 Elsevier B.V. All rights reserved.
[Accidents of the everyday life (AcVC) in children in Dakar: about 201 cases].
Mohamed, Azhar Salim; Sagna, Aloïse; Fall, Mbaye; Ndoye, Ndeye Aby; Mbaye, Papa Alassane; Fall, Aimé Lakh; Diaby, Alou; Ndour, Oumar; Ngom, Gabriel
2017-01-01
Accidents of everyday life (AcVC) are common in children and can led to disabling injuries and death. This study aimed to analyze the epidemiological aspects of AcVC and the related injury mechanisms in Dakar. We conducted a descriptive, cross-sectional study conducted from 1 January 2013 to 30 June 2013. All the children victims of domestic accidents, sport and leisure accidents or school accidents were included. We studied some general parameters and some parameters related to each type of AcVC. Two hundred and one children were included, accounting for 27% of emergency consultations. There were 148 boys and 53 girls. Children less than 5 years of age were most affected (37.8%). Football and wrestling game were the main causes of AcVC. AcVC occur mainly at home (58.2%) and in the areas of sport and recreation (31.8%). The fractures predominated in the different types of AcVC: 54.9% of domestic accidents, 68.8% of sport and recreation accidents and 40% of school accidents. From an epidemiological perspective, our results are superimposable to literature. Fractures predominated contrary to literature where bruises were preponderant. Wrestling game is the main cause of these fractures, after football. The acquisition of knowledge about the epidemiological aspects of AcVC and the related injury mechanisms will allow for prevention campaigns in Dakar.
Chicano Hip-Hop as Interethnic Contact Zone
ERIC Educational Resources Information Center
McFarland, Pancho
2008-01-01
Hip-hop is an interethnic contact zone that allows for the creation of new expressive cultures and new identities for young people. Its openness derives in part from the wide range of expression and interpretation allowed in 182 "McFarland" African musics. Moving beyond the often stifling options offered by an earlier generation that focused on…
Parallel Monotonic Basin Hopping for Low Thrust Trajectory Optimization
NASA Technical Reports Server (NTRS)
McCarty, Steven L.; McGuire, Melissa L.
2018-01-01
Monotonic Basin Hopping has been shown to be an effective method of solving low thrust trajectory optimization problems. This paper outlines an extension to the common serial implementation by parallelizing it over any number of available compute cores. The Parallel Monotonic Basin Hopping algorithm described herein is shown to be an effective way to more quickly locate feasible solutions, and improve locally optimal solutions in an automated way without requiring a feasible initial guess. The increased speed achieved through parallelization enables the algorithm to be applied to more complex problems that would otherwise be impractical for a serial implementation. Low thrust cislunar transfers and a hybrid Mars example case demonstrate the effectiveness of the algorithm. Finally, a preliminary scaling study quantifies the expected decrease in solve time compared to a serial implementation.,
Performance of cellular frequency-hopped spread-spectrum radio networks
NASA Astrophysics Data System (ADS)
Gluck, Jeffrey W.; Geraniotis, Evaggelos
1989-10-01
Multiple access interference is characterized for cellular mobile networks, in which users are assumed to be Poisson-distributed in the plane and employ frequency-hopped spread-spectrum signaling with transmitter-oriented assignment of frequency-hopping patterns. Exact expressions for the bit error probabilities are derived for binary coherently demodulated systems without coding. Approximations for the packet error probability are derived for coherent and noncoherent systems and these approximations are applied when forward-error-control coding is employed. In all cases, the effects of varying interference power are accurately taken into account according to some propagation law. Numerical results are given in terms of bit error probability for the exact case and throughput for the approximate analyses. Comparisons are made with previously derived bounds and it is shown that these tend to be very pessimistic.
Locomotion in Extinct Giant Kangaroos: Were Sthenurines Hop-Less Monsters?
Janis, Christine M.; Buttrill, Karalyn; Figueirido, Borja
2014-01-01
Sthenurine kangaroos (Marsupialia, Diprotodontia, Macropodoidea) were an extinct subfamily within the family Macropodidae (kangaroos and rat-kangaroos). These “short-faced browsers” first appeared in the middle Miocene, and radiated in the Plio-Pleistocene into a diversity of mostly large-bodied forms, more robust than extant forms in their build. The largest (Procoptodon goliah) had an estimated body mass of 240 kg, almost three times the size of the largest living kangaroos, and there is speculation whether a kangaroo of this size would be biomechanically capable of hopping locomotion. Previously described aspects of sthenurine anatomy (specialized forelimbs, rigid lumbar spine) would limit their ability to perform the characteristic kangaroo pentapedal walking (using the tail as a fifth limb), an essential gait at slower speeds as slow hopping is energetically unfeasible. Analysis of limb bone measurements of sthenurines in comparison with extant macropodoids shows a number of anatomical differences, especially in the large species. The scaling of long bone robusticity indicates that sthenurines are following the “normal” allometric trend for macropodoids, while the large extant kangaroos are relatively gracile. Other morphological differences are indicative of adaptations for a novel type of locomotor behavior in sthenurines: they lacked many specialized features for rapid hopping, and they also had anatomy indicative of supporting their body with an upright trunk (e.g., dorsally tipped ischiae), and of supporting their weight on one leg at a time (e.g., larger hips and knees, stabilized ankle joint). We propose that sthenurines adopted a bipedal striding gait (a gait occasionally observed in extant tree-kangaroos): in the smaller and earlier forms, this gait may have been employed as an alternative to pentapedal locomotion at slower speeds, while in the larger Pleistocene forms this gait may have enabled them to evolve to body sizes where hopping was
NASA Astrophysics Data System (ADS)
Zhao, Wei; Yang, Fang; Qiao, Rui; Wang, Guiren; Rui Qiao Collaboration
2015-11-01
Understanding the instantaneous response of flows to applied AC electric fields may help understand some unsolved issues in induced-charge electrokinetics and enhance performance of microfluidic devices. Since currently available velocimeters have difficulty in measuring velocity fluctuations with frequency higher than 1 kHz, most experimental studies so far focus only on the average velocity measurement in AC electrokinetic flows. Here, we present measurements of AC electroosmotic flow (AC-EOF) response time in microchannels by a novel velocimeter with submicrometer spatial resolution and microsecond temporal resolution, i.e. laser-induced fluorescence photobleaching anemometer (LIFPA). Several parameters affecting the AC-EOF response time to the applied electric signal were investigated, i.e. channel length, transverse position and solution conductivity. The experimental results show that the EOF response time under a pulsed electric field decreases with the reduction of the microchannel length, distance between the detection position to the wall and the conductivity of the solution. This work could provide a new powerful tool to measure AC electrokinetics and enhance our understanding of AC electrokinetic flows.
Pistachio (Pistacia vera L.) is a new natural host of Hop stunt viroid.
Elleuch, Amine; Hamdi, Imen; Ellouze, Olfa; Ghrab, Mohamed; Fkahfakh, Hatem; Drira, Noureddine
2013-10-01
Besides hop, Hop stunt viroid (HpSVd) infects many woody species including grapevine, citrus, peach, plum, apricot, almond, pomegranate, mulberry and jujube. Here, we report the first detection of HpSVd in pistachio (Pistacia vera L.). Samples corresponding to 16 pistachio cultivars were obtained from a nearby almond collection. From these samples, low molecular weight RNAs were extracted for double polyacrylamide gel electrophoresis, northern-blot analysis and reverse transcription polymerase chain reaction assays. HpSVd was detected in 4 of the 16 pistachio cultivars in the first year and in 6 in the second, being also detected in the almond collection. Examination of the nucleotide sequences of pistachio and almond isolates revealed 13 new sequence variants. Sequences from pistachio shared 92-96 % similarity with the first reported HpSVd sequence (GenBank X00009), and multiple alignment and phylogenetic analyses showed that one pistachio isolate (HpSVdPis67Jabari) clustered with the plum group, whereas all the others clustered with the hop, and the recombinants plum-citrus and plum-Hop/cit3 groups. By identifying pistachio as a new natural host, we confirm that HpSVd is an ubiquitous and genetically variable viroid that infects many different fruit trees cultivated worldwide.
An efficient solution to the decoherence enhanced trivial crossing problem in surface hopping
NASA Astrophysics Data System (ADS)
Bai, Xin; Qiu, Jing; Wang, Linjun
2018-03-01
We provide an in-depth investigation of the time interval convergence when both trivial crossing and decoherence corrections are applied to Tully's fewest switches surface hopping (FSSH) algorithm. Using one force-based and one energy-based decoherence strategies as examples, we show decoherence corrections intrinsically enhance the trivial crossing problem. We propose a restricted decoherence (RD) strategy and incorporate it into the self-consistent (SC) fewest switches surface hopping algorithm [L. Wang and O. V. Prezhdo, J. Phys. Chem. Lett. 5, 713 (2014)]. The resulting SC-FSSH-RD approach is applied to general Hamiltonians with different electronic couplings and electron-phonon couplings to mimic charge transport in tens to hundreds of molecules. In all cases, SC-FSSH-RD allows us to use a large time interval of 0.1 fs for convergence and the simulation time is reduced by over one order of magnitude. Both the band and hopping mechanisms of charge transport have been captured perfectly. SC-FSSH-RD makes surface hops in the adiabatic representation and can be implemented in both diabatic and locally diabatic representations for wave function propagation. SC-FSSH-RD can potentially describe general nonadiabatic dynamics of electrons and excitons in organics and other materials.
Human hopping on damped surfaces: strategies for adjusting leg mechanics.
Moritz, Chet T; Farley, Claire T
2003-01-01
Fast-moving legged animals bounce along the ground with spring-like legs and agilely traverse variable terrain. Previous research has shown that hopping and running humans maintain the same bouncing movement of the body's centre of mass on a range of elastic surfaces by adjusting their spring-like legs to exactly offset changes in surface stiffness. This study investigated human hopping on damped surfaces that dissipated up to 72% of the hopper's mechanical energy. On these surfaces, the legs did not act like pure springs. Leg muscles performed up to 24-fold more net work to replace the energy lost by the damped surface. However, considering the leg and surface together, the combination appeared to behave like a constant stiffness spring on all damped surfaces. By conserving the mechanics of the leg-surface combination regardless of surface damping, hoppers also conserved centre-of-mass motions. Thus, the normal bouncing movements of the centre of mass in hopping are not always a direct result of spring-like leg behaviour. Conserving the trajectory of the centre of mass by maintaining spring-like mechanics of the leg-surface combination may be an important control strategy for fast-legged locomotion on variable terrain. PMID:12965003
Coleman, M Nicole; Butler, Ebony O; Long, Amanda M; Fisher, Felicia D
2016-10-01
Hip-hop media and Black-oriented reality television are powerful mechanisms for conveying and promoting stereotypes of Black women. Black women's sexuality is frequently presented as highly-salient in each medium. However, little is known about the impact of those images on Black women's sexuality and identity. The current study uses focus-group methodology to engage young adult Black in critical discussion of two predominant sexual scripts found in hip-hop music and Black-oriented reality television - the Freak and the Gold Digger. Analyses revealed shared and distinct aspects of each sexual script represented in both media and the impact of those scripts on participants' experiences. Implications for future research are discussed.
ERIC Educational Resources Information Center
Söderman, Johan; Sernhede, Ove
2016-01-01
Since hip-hop first appeared in New York over 35 years ago, it has been associated with social activism and education. Accordingly, it is not surprising that academic institutions in universities and K-12 schools are interested in hip-hop. In this article, we will highlight the "hip-hop academisation" and map out a new direction in a…
Hardesty, Kelly; Hegedus, Eric J.; Ford, Kevin R.; Nguyen, Anh‐Dung
2017-01-01
Background ACL injury prevention programs are less successful in female basketball players than in soccer players. Previous authors have identified anthropometric and biomechanical differences between the athletes and different sport‐specific demands, including a higher frequency of frontal plane activities in basketball. Current injury risk screening and preventive training practices do not place a strong emphasis on frontal plane activities. The medial and lateral triple hop for distance tests may be beneficial for use in the basketball population. Hypothesis/Purpose To 1) establish normative values for the medial and lateral triple hop tests in healthy female collegiate athletes, and 2) analyze differences in test scores between female basketball and soccer players. It was hypothesized that due to the frequent frontal plane demands of their sport, basketball players would exhibit greater performance during these frontal plane performance tests. Study Design Cross‐sectional. Methods Thirty‐two NCAA Division‐1 female athletes (20 soccer, 12 basketball) performed three trials each of a medial and lateral triple hop for distance test. Distances were normalized to height and mass in order to account for anthropometric differences. Repeated measures ANOVAs were performed to identify statistically significant main effects of sport (basketball vs. soccer), and side (right vs. left), and sport x side interactions. Results After accounting for anthropometric differences, soccer players exhibited significantly better performance than basketball players in the medial and lateral triple hop tests (p < 0.05). Significant side differences (p = 0.02) were identified in the entire population for the medial triple hop test, such that participants jumped farther on their left (400.3 ± 41.5 cm) than right (387.9 ± 43.4 cm) limbs, but no side differences were identified in the lateral triple hop. No significant side x sport interactions were identified
Hip-Hop Feminism: A Standpoint to Enhance the Positive Self-Identity of Black College Women
ERIC Educational Resources Information Center
Henry, Wilma J.
2010-01-01
The popularity of hip-hop among young Black college women, coupled with the deluge of negative and positive messages in this culture regarding these women's identity, signals an opportunity for the arrival of a contemporary, culturally relevant epistemology--hip-hop feminism. Through the lens of Black feminist theory, this article explores hip-hop…
Potential for Non-Contact ACL Injury Between Step-Close-Jump and Hop-Jump Tasks.
Wang, Li-I; Gu, Chin-Yi; Chen, Wei-Ling; Chang, Mu-San
2010-01-01
This study aimed to compare the kinematics and kinetics during the landing of hop-jump and step-close-jump movements in order to provide further inferring that the potential risk of ACL injuries. Eleven elite male volleyball players were recruited to perform hop-jump and step-close-jump tasks. Lower extremity kinematics and ground reaction forces during landing in stop-jump tasks were recorded. Lower extremity kinetics was calculated by using an inverse dynamic process. Step-close-jump tasks demonstrated smaller peak proximal tibia anterior shear forces during the landing phase. In step-close-jump tasks, increasing hip joint angular velocity during initial foot-ground contact decreased peak posterior ground reaction force during the landing phase, which theoretically could reduce the risk of ACL injury. Key pointsThe different landing techniques required for these two stop-jump tasks do not necessarily affect the jump height.Hop-jump decreased the hip joint angular velocity at initial foot contact with ground, which could lead to an increasing peak posterior GRF during the landing phase.Hop-jump decreased hip and knee joint angular flexion displacement during the landing, which could increase the peak vertical loading rate during the landing phase.
The acute effects of heavy back squats on mechanical variables during a series of bilateral hops.
Moir, Gavin L; Dale, Jonathan R; Dietrich, Wendy W
2009-07-01
The purpose of the present study was to investigate the acute effects of performing a heavy resistance exercise (HRE) protocol on the mechanical variables during a series of bilateral hops. In a block-randomized design, 10 strength trained men performed an HRE or a control treatment before performing 5 series of bilateral hops separated by 2 minutes of passive recovery. Each series of bilateral hops was performed for 15 seconds on a force platform with the subject hopping at a frequency of 2.0 Hz. From the vertical force trace, the vertical force during the countermovement phase of each hop, the negative displacement during the countermovement phase, and the vertical stiffness were calculated. The HRE treatment consisted of performing parallel back squats with 40, 50, 60, and 80% of each subject's 1-repetition maximum after a series of dynamic stretches. The control treatment consisted of the dynamic stretches only. No significant differences in any of the mechanical variables were reported after the 2 treatments (p > 0.05). There were no significant correlations between the absolute maximal strength values and the percent change in any of the mechanical variables after the 2 treatments. Despite the lack of significant changes reported for the group, there were some notable individual responses. It is possible that increases in vertical stiffness during bilateral hops can be achieved after an HRE protocol in certain individuals. However, practitioners should be aware of the specificity issues and the individual nature of the responses to such protocols.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kassmi, M.; LMOP, El Manar University, Tunis 2092; Pointet, J.
2016-06-28
Dielectric spectroscopy is carried out for intrinsic and aluminum-doped TiO{sub 2} rutile films which are deposited on RuO{sub 2} by the atomic layer deposition technique. Capacitance and conductance are measured in the 0.1 Hz–100 kHz range, for ac electric fields up to 1 MV{sub rms}/cm. Intrinsic films have a much lower dielectric constant than rutile crystals. This is ascribed to the presence of oxygen vacancies which depress polarizability. When Al is substituted for Ti, the dielectric constant further decreases. By considering Al-induced modification of polarizability, a theoretical relationship between the dielectric constant and the Al concentration is proposed. Al doping drastically decreasesmore » the loss in the very low frequency part of the spectrum. However, Al doping has almost no effect on the loss at high frequencies. The effect of Al doping on loss is discussed through models of hopping transport implying intrinsic oxygen vacancies and Al related centers. When increasing the ac electric field in the MV{sub rms}/cm range, strong voltage non-linearities are evidenced in undoped films. The conductance increases exponentially with the ac field and the capacitance displays negative values (inductive behavior). Hopping barrier lowering is proposed to explain high-field effects. Finally, it is shown that Al doping strongly improves the high-field dielectric behavior.« less
NASA Astrophysics Data System (ADS)
H, M. Zeyada; F, M. El-Taweel; M, M. El-Nahass; M, M. El-Shabaan
2016-07-01
The AC electrical conductivity and dielectrical properties of 2-amino-6-ethyl-5-oxo-4-(3-phenoxyphenyl)-5,6-dihydro-4H-pyrano[3, 2-c]quinoline-3-carbonitrile (Ph-HPQ) and 2-amino-4-(2-chlorophenyl)-6-ethyl-5-oxo-5,6-dihydro-4H-pyrano [3, 2-c] quinoline-3-carbonitrile (Ch-HPQ) thin films were determined in the frequency range of 0.5 kHz-5 MHz and the temperature range of 290-443 K. The AC electrical conduction of both compounds in thin film form is governed by the correlated barrier hopping (CBH) mechanism. Some parameters such as the barrier height, the maximum barrier height, the density of charges, and the hopping distance were determined as functions of temperature and frequency. The phenoxyphenyl group has a greater influence on those parameters than the chlorophenyl group. The AC activation energies were determined at different frequencies and temperatures. The dielectric behaviors of Ph-HPQ and Ch-HPQ were investigated using the impedance spectroscopy technique. The impedance data are presented in Nyquist diagrams for different temperatures. The Ch-HPQ films have higher impedance than the Ph-HPQ films. The real dielectric constant and dielectric loss show a remarkable dependence on the frequency and temperature. The Ph-HPQ has higher dielectric constants than the Ch-HPQ.
This patent describes a low offset AC correlator avoids DC offset and low frequency noise by frequency operating the correlation signal so that low...noise, low level AC amplification can be substituted for DC amplification. Subsequently, the high level AC signal is demodulated to a DC level. (Author)
Sindhwani, Aastha; Kaur, Harmeet; Tuli, Amit
2017-01-01
Salmonella enterica serovar typhimurium extensively remodels the host late endocytic compartments to establish its vacuolar niche within the host cells conducive for its replication, also known as the Salmonella-containing vacuole (SCV). By maintaining a prolonged interaction with late endosomes and lysosomes of the host cells in the form of interconnected network of tubules (Salmonella-induced filaments or SIFs), Salmonella gains access to both membrane and fluid-phase cargo from these compartments. This is essential for maintaining SCV membrane integrity and for bacterial intravacuolar nutrition. Here, we have identified the multisubunit lysosomal tethering factor—HOPS (HOmotypic fusion and Protein Sorting) complex as a crucial host factor facilitating delivery of late endosomal and lysosomal content to SCVs, providing membrane for SIF formation, and nutrients for intravacuolar bacterial replication. Accordingly, depletion of HOPS subunits significantly reduced the bacterial load in non-phagocytic and phagocytic cells as well as in a mouse model of Salmonella infection. We found that Salmonella effector SifA in complex with its binding partner; SKIP, interacts with HOPS subunit Vps39 and mediates recruitment of this tethering factor to SCV compartments. The lysosomal small GTPase Arl8b that binds to, and promotes membrane localization of Vps41 (and other HOPS subunits) was also required for HOPS recruitment to SCVs and SIFs. Our findings suggest that Salmonella recruits the host late endosomal and lysosomal membrane fusion machinery to its vacuolar niche for access to host membrane and nutrients, ensuring its intracellular survival and replication. PMID:29084291
PARALLEL HOP: A SCALABLE HALO FINDER FOR MASSIVE COSMOLOGICAL DATA SETS
DOE Office of Scientific and Technical Information (OSTI.GOV)
Skory, Stephen; Turk, Matthew J.; Norman, Michael L.
2010-11-15
Modern N-body cosmological simulations contain billions (10{sup 9}) of dark matter particles. These simulations require hundreds to thousands of gigabytes of memory and employ hundreds to tens of thousands of processing cores on many compute nodes. In order to study the distribution of dark matter in a cosmological simulation, the dark matter halos must be identified using a halo finder, which establishes the halo membership of every particle in the simulation. The resources required for halo finding are similar to the requirements for the simulation itself. In particular, simulations have become too extensive to use commonly employed halo finders, suchmore » that the computational requirements to identify halos must now be spread across multiple nodes and cores. Here, we present a scalable-parallel halo finding method called Parallel HOP for large-scale cosmological simulation data. Based on the halo finder HOP, it utilizes message passing interface and domain decomposition to distribute the halo finding workload across multiple compute nodes, enabling analysis of much larger data sets than is possible with the strictly serial or previous parallel implementations of HOP. We provide a reference implementation of this method as a part of the toolkit {sup yt}, an analysis toolkit for adaptive mesh refinement data that include complementary analysis modules. Additionally, we discuss a suite of benchmarks that demonstrate that this method scales well up to several hundred tasks and data sets in excess of 2000{sup 3} particles. The Parallel HOP method and our implementation can be readily applied to any kind of N-body simulation data and is therefore widely applicable.« less
I Feel What He Was Doin': Responding to Justice-Oriented Teaching through Hip-Hop Aesthetics
ERIC Educational Resources Information Center
Petchauer, Emery
2011-01-01
This study illustrates a set of learning activities designed from two hip-hop aesthetics and explores their use among a classroom of African American preservice teachers who graduated from urban school districts. Based on the two hip-hop aesthetics of kinetic consumption and autonomy/distance, the specific goal of these learning activities is to…
ERIC Educational Resources Information Center
Emdin, Christopher
2011-01-01
This paper is based on an exploration of communication and argumentation in urban science classrooms, and provides a description of the role that Hip-hop based education plays in supporting these major components of science education. The paper is intended to both support, and critique conventional uses of hip-hop based education, and provide…
ERIC Educational Resources Information Center
Henry, Wilma J.; West, Nicole M.; Jackson, Andrea
2010-01-01
This article explores unique issues regarding the effects of hip-hop culture on the identity development of young Black female college students. Through the lenses of womanist and Black feminist perspectives, the intersecting impact of race and gender are reviewed within the context of the competing influences of hip-hop on Black female identity.…
ERIC Educational Resources Information Center
Irby, Decoteau J.; Hall, H. Bernard
2011-01-01
Grounded in critical and culturally relevant theory, hip-hop-based education (HHBE) research documents the use of hip-hop in educational settings. Despite the richness of the emerging field, overreliance on teacher-researcher perspectives leaves much to be desired. Little is known of the extent and ways HHBE is used by nonresearching K-12…
"You Don't Have to Claim Her": Reconstructing Black Femininity through Critical Hip-Hop Literacy
ERIC Educational Resources Information Center
Kelly, Lauren Leigh
2016-01-01
This article explores the ways in which females who identify with hip-hop often develop and construct their identities in relation to media representations of blackness and femininity in hip-hop music and culture. In order for educators to support female students in constructing identities of empowerment and agency, they should be willing and able…
Ionic-to-electronic conductivity of glasses in the P2O5-V2O5-ZnO-Li2O system
NASA Astrophysics Data System (ADS)
Langar, A.; Sdiri, N.; Elhouichet, H.; Ferid, M.
2016-12-01
Glasses having a composition 15V2O5-5ZnO-(80- x P2O5- xLi2O ( x = 5 , 10, 15 mol%) were prepared by the conventional melt quenching. Conduction and relaxation mechanisms in these glasses were studied using impedance spectroscopy in a frequency range from 10 Hz to 10 MHz and in a temperature range from 513 K to 566 K. The structure of the amorphous synthetic product was corroborated by X-ray diffraction (disappearance of nacrite peaks). The DC conductivity follows the Arrhenius law and the activation energy determined by regression analysis varies with the content of Li2O. Frequency-dependent AC conductivity was analyzed by Jonscher's universal power law, which is varying as ωn, and the temperature-dependent power parameter supported by the Correlated Barrier Hopping (CBH) model. For x = 15 mol%, the values of n ≤ 0.5 confirm the dominance of ionic conductivity. The analysis of the modulus formalism with a distribution of relaxation times was carried out using the Kohlrausch-Williams-Watts (KWW) stretched exponential function. The stretching exponent, β, is dependent on temperature. The analysis of the temperature variation of the M" peak indicates that the relaxation process is thermally activated. Modulus study reveals the temperature-dependent non-Debye-type relaxation phenomenon.
Guo, Zhong; Johnston, Wayne; Kovtun, Oleksiy; Mureev, Sergey; Bröcker, Cornelia; Ungermann, Christian; Alexandrov, Kirill
2013-01-01
Biochemical and structural analysis of macromolecular protein assemblies remains challenging due to technical difficulties in recombinant expression, engineering and reconstitution of multisubunit complexes. Here we use a recently developed cell-free protein expression system based on the protozoan Leishmania tarentolae to produce in vitro all six subunits of the 600 kDa HOPS and CORVET membrane tethering complexes. We demonstrate that both subcomplexes and the entire HOPS complex can be reconstituted in vitro resulting in a comprehensive subunit interaction map. To our knowledge this is the largest eukaryotic protein complex in vitro reconstituted to date. Using the truncation and interaction analysis, we demonstrate that the complex is assembled through short hydrophobic sequences located in the C-terminus of the individual Vps subunits. Based on this data we propose a model of the HOPS and CORVET complex assembly that reconciles the available biochemical and structural data. PMID:24312556
Analysis and Relative Evaluation of Connectivity of a Mobile Multi-Hop Network
NASA Astrophysics Data System (ADS)
Nakano, Keisuke; Miyakita, Kazuyuki; Sengoku, Masakazu; Shinoda, Shoji
In mobile multi-hop networks, a source node S and a destination node D sometimes encounter a situation where there is no multi-hop path between them when a message M, destined for D, arrives at S. In this situation, we cannot send M from S to D immediately; however, we can deliver M to D after waiting some time with the help of two capabilities of mobility. One of the capabilities is to construct a connected multi-hop path by changing the topology of the network during the waiting time (Capability 1), and the other is to move M closer to D during the waiting time (Capability 2). In this paper, we consider three methods to deliver M from S to D by using these capabilities in different ways. Method 1 uses Capability 1 and sends M from S to D after waiting until a connected multi-hop path appears between S and D. Method 2 uses Capability 2 and delivers M to D by allowing a mobile node to carry M from S to D. Method 3 is a combination of Methods 1 and 2 and minimizes the waiting time. We evaluate and compare these three methods in terms of the mean waiting time, from the time when M arrives at S to the time when D starts receiving M, as a new approach to connectivity evaluation. We consider a one-dimensional mobile multi-hop network consisting of mobile nodes flowing in opposite directions along a street. First, we derive some approximate equations and propose an estimation method to compute the mean waiting time of Method 1. Second, we theoretically analyze the mean waiting time of Method 2, and compute a lower bound of that of Method 3. By comparing the three methods under the same assumptions using results of the analyses and some simulation results, we show relations between the mean waiting times of these methods and show how Capabilities 1 and 2 differently affect the mean waiting time.
Sbardella, Maicon; Racanicci, Aline Mc; Gois, Franz D; de Lima, Cristiane B; Migotto, Dannielle L; Costa, Leandro B; Miyada, Valdomiro S
2018-04-01
The effects of dietary levels of hop β-acids on physical attributes, lipid oxidation and chemical composition of pork meat were evaluated. Thirty-two castrated male pigs obtained from a complete block design feeding experiment (6.23 ± 0.42 kg initial body weight (BW) to 20.45 ± 0.95 kg final BW) and fed diets supplemented with 0, 120, 240 or 360 mg kg -1 hop β-acids during 35 days were slaughtered to sample longissimus dorsi muscle for meat analysis. No effects (P > 0.05) of dietary hop β-acids were observed on meat physical attributes. Quadratic effects (P < 0.05) of hop β-acids were observed on lipid and protein contents and on thiobarbituric acid-reactive substance (TBARS) values of meatballs, whose equations allowed the estimation of dietary hop β-acid levels of 176, 169 and 181 mg kg -1 to provide up to 16.20% lipid reduction, 1.95% protein accretion and 23.31% TBARS reduction respectively. Dietary hop β-acids fed to pigs might reduce lipid, increase protein and reduce lipid oxidation without affecting physical attributes of the pork meat. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Deal with It We Must: Education, Social Justice, and the Curriculum of Hip Hop Culture
ERIC Educational Resources Information Center
Baszile, Denise Taliaferro
2009-01-01
Although hip hop culture has been one of the most significant urban youth movements over the last three decades, it has only recently gained attention within the educational literature as a force to be reckoned with. And even then, much of the literature seeks to understand how hip hop can be used to engage students in the official school…
NASA Astrophysics Data System (ADS)
Odeyemi, Kehinde O.; Owolawi, Pius A.; Srivastava, Viranjay M.
2017-11-01
Dual-hops transmission is a growing interest technique that can be used to mitigate against atmospheric turbulence along the Free Space Optical (FSO) communication links. This paper analyzes the performance of Decode-and-Forward (DF) dual-hops FSO systems in-conjunction with spatial modulation and diversity combiners over a Gamma-Gamma atmospheric turbulence channel using heterodyne detection. Maximum Ratio Combiner (MRC), Equal Gain Combiner (EGC) and Selection Combiner (SC) are considered at the relay and destination as mitigation tools to improve the system error performance. Power series expansion of modified Bessel function is used to derive the closed form expression for the end-to-end Average Pairwise Error Probability (APEP) expressions for each of the combiners under study and a tight upper bound on the Average Bit Error Rate (ABER) per hop is given. Thus, the overall end-to-end ABER for the dual-hops FSO system is then evaluated. The numerical results depicted that dual-hops transmission systems outperformed the direct link systems. Moreover, the impact of having the same and different combiners at the relay and destination are also presented. The results also confirm that the combination of dual hops transmission with spatial modulation and diversity combiner significantly improves the systems error rate with the MRC combiner offering an optimal performance with respect to variation in atmospheric turbulence, change in links average received SNR and link range of the system.
Elastic all-optical multi-hop interconnection in data centers with adaptive spectrum allocation
NASA Astrophysics Data System (ADS)
Hong, Yuanyuan; Hong, Xuezhi; Chen, Jiajia; He, Sailing
2017-01-01
In this paper, a novel flex-grid all-optical interconnect scheme that supports transparent multi-hop connections in data centers is proposed. An inter-rack all-optical multi-hop connection is realized with an optical loop employed at flex-grid wavelength selective switches (WSSs) in an intermediate rack rather than by relaying through optical-electric-optical (O-E-O) conversions. Compared with the conventional O-E-O based approach, the proposed all-optical scheme is able to off-load the traffic at intermediate racks, leading to a reduction of the power consumption and cost. The transmission performance of the proposed flex-grid multi-hop all-optical interconnect scheme with various modulation formats, including both coherently detected and directly detected approaches, are investigated by Monte-Carlo simulations. To enhance the spectrum efficiency (SE), number-of-hop adaptive bandwidth allocation is introduced. Numerical results show that the SE can be improved by up to 33.3% at 40 Gbps, and by up to 25% at 100 Gbps. The impact of parameters, such as targeted bit error rate (BER) level and insertion loss of components, on the transmission performance of the proposed approach are also explored. The results show that the maximum SE improvement of the adaptive approach over the non-adaptive one is enhanced with the decrease of the targeted BER levels and the component insertion loss.
Liu, Zechang; Wang, Liping; Liu, Yumei
2018-01-18
Hops impart flavor to beer, with the volatile components characterizing the various hop varieties and qualities. Fingerprinting, especially flavor fingerprinting, is often used to identify 'flavor products' because inconsistencies in the description of flavor may lead to an incorrect definition of beer quality. Compared to flavor fingerprinting, volatile fingerprinting is simpler and easier. We performed volatile fingerprinting using head space-solid phase micro-extraction gas chromatography-mass spectrometry combined with similarity analysis and principal component analysis (PCA) for evaluating and distinguishing between three major Chinese hops. Eighty-four volatiles were identified, which were classified into seven categories. Volatile fingerprinting based on similarity analysis did not yield any obvious result. By contrast, hop varieties and qualities were identified using volatile fingerprinting based on PCA. The potential variables explained the variance in the three hop varieties. In addition, the dendrogram and principal component score plot described the differences and classifications of hops. Volatile fingerprinting plus multivariate statistical analysis can rapidly differentiate between the different varieties and qualities of the three major Chinese hops. Furthermore, this method can be used as a reference in other fields. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.
Karam, Joseph A; Parikh, Rasesh Y; Nayak, Dhananjaya; Rosenkranz, David; Gangaraju, Vamsi K
2017-04-14
Piwi-interacting RNAs (piRNAs) are 26-30-nucleotide germ line-specific small non-coding RNAs that have evolutionarily conserved function in mobile genetic element (transposons) silencing and maintenance of genome integrity. Drosophila Hsp70/90-organizing protein homolog (Hop), a co-chaperone, interacts with piRNA-binding protein Piwi and mediates silencing of phenotypic variations. However, it is not known whether Hop has a direct role in piRNA biogenesis and transposon silencing. Here, we show that knockdown of Hop in the germ line nurse cells (GLKD) of Drosophila ovaries leads to activation of transposons. Hop GLKD females can lay eggs at the same rate as wild-type counterparts, but the eggs do not hatch into larvae. Hop GLKD leads to the accumulation of γ-H2Av foci in the germ line, indicating increased DNA damage in the ovary. We also show that Hop GLKD-induced transposon up-regulation is due to inefficient piRNA biogenesis. Based on these results, we conclude that Hop is a critical component of the piRNA pathway and that it maintains genome integrity by silencing transposons. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
An Energy Efficient MAC Protocol for Multi-Hop Swallowable Body Sensor Networks
Lin, Lin; Yang, Chengfeng; Wong, Kai Juan; Yan, Hao; Shen, Junwen; Phee, Soo Jay
2014-01-01
Swallowable body sensor networks (BSNs) are composed of sensors which are swallowed by patients and send the collected data to the outside coordinator. These sensors are energy constraint and the batteries are difficult to be replaced. The medium access control (MAC) protocol plays an important role in energy management. This paper investigates an energy efficient MAC protocol design for swallowable BSNs. Multi-hop communication is analyzed and proved more energy efficient than single-hop communication within the human body when the circuitry power is low. Based on this result, a centrally controlled time slotting schedule is proposed. The major workload is shifted from the sensors to the coordinator. The coordinator collects the path-loss map and calculates the schedules, including routing, slot assignment and transmission power. Sensor nodes follow the schedules to send data in a multi-hop way. The proposed protocol is compared with the IEEE 802.15.6 protocol in terms of energy consumption. The results show that it is more energy efficient than IEEE 802.15.6 for swallowable BSN scenarios. PMID:25330049
Lateral hopping of CO on Cu(111) induced by femtosecond laser pulses
NASA Astrophysics Data System (ADS)
Ueba, H.; Ootsuka, Y.; Paulsson, M.; Persson, B. N. J.
2010-09-01
We present a theoretical study of the lateral hopping of a single CO molecule on Cu(111) induced by femtosecond laser pulses by Mehlhorn [Phys. Rev. Lett. 104, 076101 (2010)]10.1103/PhysRevLett.104.076101. Our model assumes an intermode coupling between the CO frustrated translation (FT) and frustrated rotation (FR) modes with a weak and strong electronic friction coupling to hot electrons, respectively, and heat transfer between the FT mode and the substrate phonons. In this model the effective electronic friction coupling of the FT mode depends on the absorbed laser fluence F through the temperature of the FR mode. The calculated hopping yield as a function of F nicely reproduces the nonlinear increase observed above F=4.0J/m2 . It is found that the electronic heating via friction coupling nor the phonon coupling alone cannot explain the experimental result. Both heatings are cooperatively responsible for CO hopping on Cu(111). The electronic heat transfer dominates over the phononic one at high F , where the effective electronic friction coupling becomes larger than the phononic coupling.
Influence of Ag, Cd or Pb Addition on Electrical and Dielectric Properties of Bulk Glassy Se-Ge
NASA Astrophysics Data System (ADS)
El-Metwally, E. G.; Shakra, A. M.
2018-05-01
Bulk glassy samples of Se0.7Ge0.3 and Se0.7Ge0.25 X 0.05 (X = Ag, Cd or Pb) chalcogenide glass have been prepared by melt-quenching method. The studied compositions were examined in powder form by x-ray diffraction analysis. The direct-current (dc) conductivity σ_{{dc}} was measured for bulk samples in the temperature range from 303 K to 433 K, revealing enhancement with temperature for all samples. The results indicate two values of activation energy ( Δ E_{{σ1 }} and Δ E_{{σ2 }} ) due to two conduction mechanisms. Measurements of the alternating-current (ac) conductivity σ_{{ac}} ( ω ) and dielectric properties for bulk samples were carried out in the temperature range from 303 K to 433 K and frequency range from 1 kHz to 1 MHz. The ac conductivity σ_{{ac}} ( ω ) was temperature dependent and proportional to ωS , where S is the frequency exponent, which reduced with rising temperature, and ω is the angular frequency. These results are discussed based on a correlated barrier hopping model. The calculated values of the maximum height of the barrier W_{{M}} for each composition are consistent with carrier hopping over a potential barrier. The density of localized states N( {E_{{F}} } ) at the Fermi level lay in the range from 1019 eV-1 cm-3 to 1020 eV-1 cm-3, and increased with temperature. The dielectric constant ɛ1 ( ω ) and loss ɛ2 ( ω ) increased with temperature but decreased with frequency. The values of σ_{{dc}} , σ_{{ac}} ( ω ) , ɛ1 ( ω ) , and ɛ2 ( ω ) increased with temperature and with addition of Ag, Cd or Pb. The observed increase was greater for Se0.7Ge0.25Pb0.05 than for Se0.7Ge0.25Cd0.05, which was greater than for Se0.7Ge0.25Ag0.05.
NASA Astrophysics Data System (ADS)
Halder, Saswata; Dutta, Alo; Sinha, T. P.
2017-03-01
The AC electrical properties of polycrystalline double perovskite oxides A2HoSbO6 (A=Ba, Sr, Ca; AHS) synthesized by solid state reaction technique has been explored by using impedance spectroscopic studies. The Rietveld refinement of the room temperature X-ray diffraction data show that Ba2HoSbO6 (BHS) has cubic phase and Sr2HoSbO6 (SHS) and Ca2HoSbO6 (CHS) crystallize in monoclinic phase. The samples show significant frequency dispersion in their dielectric properties. The polydispersive nature of the relaxation mechanism is explained by the modified Cole-Cole model. The scaling behavior of dielectric loss indicate the temperature independence of the relaxation mechanism. The magnitude of the activation energy indicates that the hopping mechanism is responsible for carrier transport in AHS. The frequency dependent conductivity spectra follow the double power law. Impedance spectroscopic data presented in the Nyquist plot (Z" versus Z‧) are used to identify an equivalent circuit along with to know the grain, grain boundary and interface contributions. The constant phase element (CPE) is used to analyze the experimental response of BHS, SHS and CHS comprehending the contribution of different microstructural features to the conduction process. The temperature dependent electrical conductivity shows a semiconducting behavior.
Trigsted, Stephanie M; Post, Eric G; Bell, David R
2017-05-01
To determine possible differences in single-hop kinematics and kinetics in females with anterior cruciate ligament reconstruction compared to healthy controls. A second purpose was to make comparisons between the healthy and reconstructed limbs. Subjects were grouped based on surgical status (33 ACLR patients and 31 healthy controls). 3D motion capture synchronized with force plates was used to capture the landing phase of three successful trials of single hop for distance during a single data collection session. Peak values during the loading phase were analysed. Subjects additionally completed three successful trials of the triple hop for distance Tegner activity scale and International Knee Document Committee 2000 (IKDC). Controls demonstrated greater peak knee flexion and greater internal knee extension moment and hip extension moment than ACLR subjects. Within the ACLR group, the healthy limb exhibited greater peak knee flexion, hip flexion, hip extension moment, single hop and triple hops for distance and normalized quadriceps strength. Patients who undergo anterior cruciate ligament reconstruction land in a more extended posture when compared to healthy controls and compared to their healthy limb. III.
NASA Astrophysics Data System (ADS)
Denis-le Coarer, Florian; Quirce, Ana; Valle, Angel; Pesquera, Luis; Rodríguez, Miguel A.; Panajotov, Krassimir; Sciamanna, Marc
2018-03-01
We present experimental and theoretical results of noise-induced attractor hopping between dynamical states found in a single transverse mode vertical-cavity surface-emitting laser (VCSEL) subject to parallel optical injection. These transitions involve dynamical states with different polarizations of the light emitted by the VCSEL. We report an experimental map identifying, in the injected power-frequency detuning plane, regions where attractor hopping between two, or even three, different states occur. The transition between these behaviors is characterized by using residence time distributions. We find multistability regions that are characterized by heavy-tailed residence time distributions. These distributions are characterized by a -1.83 ±0.17 power law. Between these regions we find coherence enhancement of noise-induced attractor hopping in which transitions between states occur regularly. Simulation results show that frequency detuning variations and spontaneous emission noise play a role in causing switching between attractors. We also find attractor hopping between chaotic states with different polarization properties. In this case, simulation results show that spontaneous emission noise inherent to the VCSEL is enough to induce this hopping.
Opportunity Looks Back After Hop to a New Pad
2010-05-19
NASA rover Opportunity captured this image of the tracks the rover left on a drive from one energy-favorable position on the northern end of a sand ripple to another. The rover team calls this hopping from lily pad to lily pad.
NASA Astrophysics Data System (ADS)
Sarathi, R.; Giridhar, A. V.; Sethupathi, K.
2010-01-01
Liquid nitrogen (LN 2) is used as an insulant as well as coolant in high temperature superconducting power equipments. Particle contamination in liquid nitrogen is one of the major cause for formation of partial discharges during operation. An attempt has been made in the present study to understand the feasibility of using Ultra High Frequency (UHF) sensors for identification of partial discharge (PD) formed due to particle movement in liquid nitrogen under AC voltages. It is observed that the partial discharge formed in LN 2 radiates UHF signal. The results of the study indicate that the conventional partial discharge measurement and UHF peak amplitude measurement have direct correlation. The Phase Resolved Partial Discharge (PRPD) analysis indicates that the partial discharge formed due to particle movement occurs in the entire phase windows of the AC voltage. The PD magnitude increases with increase in applied voltage. The frequency content of UHF signal generated due to particle movement in liquid nitrogen under AC voltages lies in the range of 0.5-1.5 GHz. The UHF sensor output signal analyzed using spectrum analyzer by operating it in zero-span mode, indicates that burst type PD occurs due to particle movement.
Farris, Dominic James; Hicks, Jennifer L.; Delp, Scott L.; Sawicki, Gregory S.
2014-01-01
Experiments have shown that elastic ankle exoskeletons can be used to reduce ankle joint and plantar-flexor muscle loading when hopping in place and, in turn, reduce metabolic energy consumption. However, recent experimental work has shown that such exoskeletons cause less favourable soleus (SO) muscle–tendon mechanics than is observed during normal hopping, which might limit the capacity of the exoskeleton to reduce energy consumption. To directly link plantar-flexor mechanics and energy consumption when hopping in exoskeletons, we used a musculoskeletal model of the human leg and a model of muscle energetics in simulations of muscle–tendon dynamics during hopping with and without elastic ankle exoskeletons. Simulations were driven by experimental electromyograms, joint kinematics and exoskeleton torque taken from previously published data. The data were from seven males who hopped at 2.5 Hz with and without elastic ankle exoskeletons. The energetics model showed that the total rate of metabolic energy consumption by ankle muscles was not significantly reduced by an ankle exoskeleton. This was despite large reductions in plantar-flexor force production (40–50%). The lack of larger metabolic reductions with exoskeletons was attributed to increases in plantar-flexor muscle fibre velocities and a shift to less favourable muscle fibre lengths during active force production. This limited the capacity for plantar-flexors to reduce activation and energy consumption when hopping with exoskeleton assistance. PMID:25278469
AC Electroosmotic Pumping in Nanofluidic Funnels.
Kneller, Andrew R; Haywood, Daniel G; Jacobson, Stephen C
2016-06-21
We report efficient pumping of fluids through nanofluidic funnels when a symmetric AC waveform is applied. The asymmetric geometry of the nanofluidic funnel induces not only ion current rectification but also electroosmotic flow rectification. In the base-to-tip direction, the funnel exhibits a lower ion conductance and a higher electroosmotic flow velocity, whereas, in the tip-to-base direction, the funnel has a higher ion conductance and a lower electroosmotic flow velocity. Consequently, symmetric AC waveforms easily pump fluid through the nanofunnels over a range of frequencies, e.g., 5 Hz to 5 kHz. In our experiments, the nanofunnels were milled into glass substrates with a focused ion beam (FIB) instrument, and the funnel design had a constant 5° taper with aspect ratios (funnel tip width to funnel depth) of 0.1 to 1.0. We tracked ion current rectification by current-voltage (I-V) response and electroosmotic flow rectification by transport of a zwitterionic fluorescent probe. Rectification of ion current and electroosmotic flow increased with increasing electric field applied to the nanofunnel. Our results support three-dimensional simulations of ion transport and electroosmotic transport through nanofunnels, which suggest the asymmetric electroosmotic transport stems from an induced pressure at the junction of the nanochannel and nanofunnel tip.
Organic magnetoresistance based on hopping theory
NASA Astrophysics Data System (ADS)
Yang, Fu-Jiang; Xie, Shi-Jie
2014-09-01
For the organic magnetoresistance (OMAR) effect, we suggest a spin-related hopping of carriers (polarons) based on Marcus theory. The mobility of polarons is calculated with the master equation (ME) and then the magnetoresistance (MR) is obtained. The theoretical results are consistent with the experimental observation. Especially, the sign inversion of the MR under different driving bias voltages found in the experiment is predicted. Besides, the effects of molecule disorder, hyperfine interaction (HFI), polaron localization, and temperature on the MR are investigated.
Conformational gating of DNA conductance
Artés, Juan Manuel; Li, Yuanhui; Qi, Jianqing; Anantram, M. P.; Hihath, Joshua
2015-01-01
DNA is a promising molecule for applications in molecular electronics because of its unique electronic and self-assembly properties. Here we report that the conductance of DNA duplexes increases by approximately one order of magnitude when its conformation is changed from the B-form to the A-form. This large conductance increase is fully reversible, and by controlling the chemical environment, the conductance can be repeatedly switched between the two values. The conductance of the two conformations displays weak length dependencies, as is expected for guanine-rich sequences, and can be fit with a coherence-corrected hopping model. These results are supported by ab initio electronic structure calculations that indicate that the highest occupied molecular orbital is more disperse in the A-form DNA case. These results demonstrate that DNA can behave as a promising molecular switch for molecular electronics applications and also provide additional insights into the huge dispersion of DNA conductance values found in the literature. PMID:26648400
Conformational gating of DNA conductance.
Artés, Juan Manuel; Li, Yuanhui; Qi, Jianqing; Anantram, M P; Hihath, Joshua
2015-12-09
DNA is a promising molecule for applications in molecular electronics because of its unique electronic and self-assembly properties. Here we report that the conductance of DNA duplexes increases by approximately one order of magnitude when its conformation is changed from the B-form to the A-form. This large conductance increase is fully reversible, and by controlling the chemical environment, the conductance can be repeatedly switched between the two values. The conductance of the two conformations displays weak length dependencies, as is expected for guanine-rich sequences, and can be fit with a coherence-corrected hopping model. These results are supported by ab initio electronic structure calculations that indicate that the highest occupied molecular orbital is more disperse in the A-form DNA case. These results demonstrate that DNA can behave as a promising molecular switch for molecular electronics applications and also provide additional insights into the huge dispersion of DNA conductance values found in the literature.
Dong, Zhijun; Yu, Yanwen; Li, Shenghui; Wang, Juan; Tang, Saijun; Huang, Rongfeng
2016-01-04
Increasing evidence has revealed that abscisic acid (ABA) negatively modulates ethylene biosynthesis, although the underlying mechanism remains unclear. To identify the factors involved, we conducted a screen for ABA-insensitive mutants with altered ethylene production in Arabidopsis. A dominant allele of ABI4, abi4-152, which produces a putative protein with a 16-amino-acid truncation at the C-terminus of ABI4, reduces ethylene production. By contrast, two recessive knockout alleles of ABI4, abi4-102 and abi4-103, result in increased ethylene evolution, indicating that ABI4 negatively regulates ethylene production. Further analyses showed that expression of the ethylene biosynthesis genes ACS4, ACS8, and ACO2 was significantly decreased in abi4-152 but increased in the knockout mutants, with partial dependence on ABA. Chromatin immunoprecipitation-quantitative PCR assays showed that ABI4 directly binds the promoters of these ethylene biosynthesis genes and that ABA enhances this interaction. A fusion protein containing the truncated ABI4-152 peptide accumulated to higher levels than its full-length counterpart in transgenic plants, suggesting that ABI4 is destabilized by its C terminus. Therefore, our results demonstrate that ABA negatively regulates ethylene production through ABI4-mediated transcriptional repression of the ethylene biosynthesis genes ACS4 and ACS8 in Arabidopsis. Copyright © 2016 The Author. Published by Elsevier Inc. All rights reserved.
Sparsity-aware multiple relay selection in large multi-hop decode-and-forward relay networks
NASA Astrophysics Data System (ADS)
Gouissem, A.; Hamila, R.; Al-Dhahir, N.; Foufou, S.
2016-12-01
In this paper, we propose and investigate two novel techniques to perform multiple relay selection in large multi-hop decode-and-forward relay networks. The two proposed techniques exploit sparse signal recovery theory to select multiple relays using the orthogonal matching pursuit algorithm and outperform state-of-the-art techniques in terms of outage probability and computation complexity. To reduce the amount of collected channel state information (CSI), we propose a limited-feedback scheme where only a limited number of relays feedback their CSI. Furthermore, a detailed performance-complexity tradeoff investigation is conducted for the different studied techniques and verified by Monte Carlo simulations.
Correlated Hopping in the 1D Falicov--Kimball Model
NASA Astrophysics Data System (ADS)
Gajek, Z.; Lemanski, R.
2001-10-01
Ground state phase diagrams in the canonical ensemble of the one-dimensional Falicov-Kimball Model (FKM) with the correlated hopping are presented for several values of the model parameters. As compare to the conventional FKM, the diagrams exhibit a loss of the particle--hole symmetry.
The Hip Hop peer crowd: An opportunity for intervention to reduce tobacco use among at-risk youth.
Walker, Matthew W; Navarro, Mario A; Hoffman, Leah; Wagner, Dana E; Stalgaitis, Carolyn A; Jordan, Jeffrey W
2018-07-01
Peer crowds, peer groups with macro-level connections and shared norms that transcend geography and race/ethnicity, have been linked to risky health behaviors. Research has demonstrated that Hip Hop peer crowd identification, which is common among multicultural youth, is associated with increased risk of tobacco use. To address this, the FDA Center for Tobacco Products created Fresh Empire, the first national tobacco education campaign tailored for Hip Hop youth aged 12-17 who are multicultural (Hispanic, African American, Asian-Pacific Islander, or Multiracial). As part of campaign development, peer crowd (Hip Hop, Mainstream, Popular, Alternative, Country) and cigarette smoking status were examined for the first time with a nationally recruited sample. Youth were recruited via targeted social media advertisements. Participants aged 13-17 (n = 5153) self-reported peer crowd identification via the I-Base Survey™ and cigarette smoking status. Differences in smoking status by peer crowd were examined using chi-square and followed up with z-tests to identify specific differences. Alternative youth were most at risk of cigarette smoking, followed by Hip Hop. Specifically, Hip Hop youth were significantly less likely to be Non-susceptible Non-triers than Popular, Mainstream, and Country youth, and more likely to be Experimenters than Popular and Mainstream youth. Representative studies show that Alternative is relatively small compared to other high-risk crowds, such as the Hip Hop peer crowd. The current research underscores the potential utility of interventions tailored to larger at-risk crowds for campaigns like Fresh Empire. Published by Elsevier Ltd.
60. View of lined canal and hop barn, looking southwest. ...
60. View of lined canal and hop barn, looking southwest. Photo by Robin Lee Tedder, Puget Power, 1989. - Puget Sound Power & Light Company, White River Hydroelectric Project, 600 North River Avenue, Dieringer, Pierce County, WA
Several fluidic tuned AC Amplifiers were designed and tested. Interstage tuning and feedback designs are considered. Good results were obtained...corresponding Q’s as high as 12. Element designs and test results of one, two, and three stage amplifiers are presented. AC Modulated Carrier Systems
Federal Register 2010, 2011, 2012, 2013, 2014
2010-09-27
... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. ER10-2658-000] HOP Energy, LLC; Supplemental Notice That Initial Market-Based Rate Filing Includes Request for Blanket Section... of HOP Energy, LLC's application for market-based rate authority, with an accompanying rate tariff...
Kobayashi, Hajime; Kobayashi, Norihito; Hosoi, Shizuka; Koshitani, Naoki; Murakami, Daisuke; Shirasawa, Raku; Kudo, Yoshihiro; Hobara, Daisuke; Tokita, Yuichi; Itabashi, Masao
2013-07-07
Hopping and band mobilities of holes in organic semiconductors at room temperature were estimated from first principle calculations. Relaxation times of charge carriers were evaluated using the acoustic deformation potential model. It is found that van der Waals interactions play an important role in determining accurate relaxation times. The hopping mobilities of pentacene, rubrene, and 2,7-dioctyl[1]benzothieno[3,2-b][1]benzothiophene (C8-BTBT) in bulk single crystalline structures were found to be smaller than 4 cm(2)∕Vs, whereas the band mobilities were estimated between 36 and 58 cm(2)∕Vs, which are close to the maximum reported experimental values. This strongly suggests that band conductivity is dominant in these materials even at room temperature.
NASA Astrophysics Data System (ADS)
Landry, Brian R.; Subotnik, Joseph E.
2011-11-01
We evaluate the accuracy of Tully's surface hopping algorithm for the spin-boson model for the case of a small diabatic coupling parameter (V). We calculate the transition rates between diabatic surfaces, and we compare our results to the expected Marcus rates. We show that standard surface hopping yields an incorrect scaling with diabatic coupling (linear in V), which we demonstrate is due to an incorrect treatment of decoherence. By modifying standard surface hopping to include decoherence events, we recover the correct scaling (˜V2).
Flythe, Michael D.; Kagan, Isabelle A.; Wang, Yuxi; Narvaez, Nelmy
2017-01-01
Antibiotics can improve ruminant growth and efficiency by altering rumen fermentation via selective inhibition of microorganisms. However, antibiotic use is increasingly restricted due to concerns about the spread of antibiotic-resistance. Plant-based antimicrobials are alternatives to antibiotics in animal production. The hops plant (Humulus lupulus L.) produces a range of bioactive secondary metabolites, including antimicrobial prenylated phloroglucinols, which are commonly called alpha- and beta-acids. These latter compounds can be considered phyto-ionophores, phytochemicals with a similar antimicrobial mechanism of action to ionophore antibiotics (e.g., monensin, lasalocid). Like ionophores, the hop beta-acids inhibit rumen bacteria possessing a classical Gram-positive cell envelope. This selective inhibition causes several effects on rumen fermentation that are beneficial to finishing cattle, such as decreased proteolysis, ammonia production, acetate: propionate ratio, and methane production. This article reviews the effects of hops and hop secondary metabolites on rumen fermentation, including the physiological mechanisms on specific rumen microorganisms, and consequences for the ruminant host and ruminant production. Further, we propose that hop beta-acids are useful model natural products for ruminants because of (1) the ionophore-like mechanism of action and spectrum of activity and (2) the literature available on the plant due to its use in brewing. PMID:28871284
Development of a hardware-based AC microgrid for AC stability assessment
NASA Astrophysics Data System (ADS)
Swanson, Robert R.
As more power electronic-based devices enable the development of high-bandwidth AC microgrids, the topic of microgrid power distribution stability has become of increased interest. Recently, researchers have proposed a relatively straightforward method to assess the stability of AC systems based upon the time-constants of sources, the net bus capacitance, and the rate limits of sources. In this research, a focus has been to develop a hardware test system to evaluate AC system stability. As a first step, a time domain model of a two converter microgrid was established in which a three phase inverter acts as a power source and an active rectifier serves as an adjustable constant power AC load. The constant power load can be utilized to create rapid power flow transients to the generating system. As a second step, the inverter and active rectifier were designed using a Smart Power Module IGBT for switching and an embedded microcontroller as a processor for algorithm implementation. The inverter and active rectifier were designed to operate simultaneously using a synchronization signal to ensure each respective local controller operates in a common reference frame. Finally, the physical system was created and initial testing performed to validate the hardware functionality as a variable amplitude and variable frequency AC system.
Dichotomy between the band and hopping transport in organic crystals: insights from experiments.
Yavuz, I
2017-10-04
The molecular understanding of charge-transport in organic crystals has often been tangled with identifying the true dynamical origin. While in two distinct cases where complete delocalization and localization of charge-carriers are associated with band-like and hopping-like transports, respectively, their possible coalescence poses some mystery. Moreover, the existing models are still controversial at ambient temperatures. Here, we review the issues in charge-transport theories of organic materials and then provide an overview of prominent transport models. We explored ∼60 organic crystals, the single-crystal hole/electron mobilities of which have been predicted by band-like and hopping-like transport models, separately. Our comparative results show that at room-temperature neither of the models are exclusively capable of accurately predicting mobilities in a very broad range. Hopping-like models well-predict experimental mobilities around μ ∼ 1 cm 2 V -1 s -1 but systematically diverge at high mobilities. Similarly, band-like models are good at μ > ∼50 cm 2 V -1 s -1 but systematically diverge at lower mobilities. These results suggest the development of a unique and robust room-temperature transport model incorporating a mixture of these two extreme cases, whose relative importance is associated with their predominant regions. We deduce that while band models are beneficial for rationally designing high mobility organic-semiconductors, hopping models are good to elucidate the charge-transport of most organic-semiconductors.
Abortion and contemporary hip-hop: a thematic analysis of lyrics from 1990-2015.
Premkumar, Ashish; Brown, Katherine; Mengesha, Biftu; Jackson, Andrea V
2017-07-01
To evaluate the representation of abortion in contemporary hip-hop music, gaining insight into the myriad of attitudes of abortion in the black community. We used Genius, an online storehouse for lyrical content, to identify songs by querying the database for search terms related to family planning, including slang terms. We then cross-referenced identified songs using an online list of songs about abortion. We analyzed eligible songs using grounded theory in order to identify key themes. Of 6577 songs available, a total of 101 songs performed by 122 individual artists met inclusion criteria. The majority of artists were Black men; five artists were Black women. Key themes were: use of abortion as braggadocio; equating abortion with sin, genocide, or murder; male pressure for women to seek abortion; and the specific association of Planned Parenthood services with abortion. The moral and ethical themes surrounding abortion in hip-hop lyrics reveal a unique perspective within a marginalized community. The overall negative context of abortion in hip-hop lyrics needs to be reconciled with the gendered, economic, historical, political, racial and ethnic background of hip-hop and rap music in America. This study is the first to evaluate lyrical content from contemporary popular music in relation to abortion and family planning. Examining the intersection of reproductive rights and popular culture can provide a unique insight into the limited knowledge of the perspectives of abortion in the black community. Copyright © 2017 Elsevier Inc. All rights reserved.
Hébert-Losier, Kim; Jensen, Kurt; Holmberg, Hans-Christer
2014-11-01
Jumping and hopping are used to measure lower-body muscle power, stiffness, and stretch-shortening-cycle utilization in sports, with several studies reporting correlations between such measures and sprinting and/or running abilities in athletes. Neither jumping and hopping nor correlations with sprinting and/or running have been examined in orienteering athletes. The authors investigated squat jump (SJ), countermovement jump (CMJ), standing long jump (SLJ), and hopping performed by 8 elite and 8 amateur male foot-orienteering athletes (29 ± 7 y, 183 ± 5 cm, 73 ± 7 kg) and possible correlations to road, path, and forest running and sprinting performance, as well as running economy, velocity at anaerobic threshold, and peak oxygen uptake (VO(2peak)) from treadmill assessments. During SJs and CMJs, elites demonstrated superior relative peak forces, times to peak force, and prestretch augmentation, albeit lower SJ heights and peak powers. Between-groups differences were unclear for CMJ heights, hopping stiffness, and most SLJ parameters. Large pairwise correlations were observed between relative peak and time to peak forces and sprinting velocities; time to peak forces and running velocities; and prestretch augmentation and forest-running velocities. Prestretch augmentation and time to peak forces were moderately correlated to VO(2peak). Correlations between running economy and jumping or hopping were small or trivial. Overall, the elites exhibited superior stretch-shortening-cycle utilization and rapid generation of high relative maximal forces, especially vertically. These functional measures were more closely related to sprinting and/or running abilities, indicating benefits of lower-body training in orienteering.
Sista Girl Rock: Women of Colour and Hip-Hop Deejaying as Raced/Gendered Knowledge and Language
ERIC Educational Resources Information Center
Craig, Todd; Kynard, Carmen
2017-01-01
This article seeks to introduce and situate a seldom-explored subject: the role and contribution of women hip-hop deejays in the testosterone-filled genre called hip-hop. Grounding the analysis in the interviews of six women deejays--Spinderella, Kuttin Kandi, Pam the Funkstress, Reborn, Shorty Wop and Natasha Diggs--"Sista Girl Rock"…
Federal Register 2010, 2011, 2012, 2013, 2014
2010-11-17
... of Agriculture to use hop beta acids (CAS Reg. No. none specified) to treat up to 181,000 honey bee... exemption regional request for use of hop beta acids in honey bee hives to control varroa mites. Information... effect on honey bee populations. The parasitic mite is considered the primary pest of honeybees and its...
Electrical conduction mechanism of LaNi{sub x}Me{sub 1−x}O{sub 3−δ} (Me = Fe, Mn)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Niwa, Eiki, E-mail: e-niwa@phys.chs.nihon-u.ac.jp; Department of Integrated Sciences in Physics and Biology, College of Humanities and Sciences, Nihon University, Setagaya-ku, Tokyo 156-8550; Maeda, Hiroki
Graphical abstract: Compositional dependence of (a) electrical conductivity and (b) E{sub a} for hopping conduction of LaNi{sub x}Me{sub 1−x}O{sub 3} (Me = Fe, Mn). - Highlights: • Electrical conduction mechanism of LaNi{sub x}Me{sub 1−x}O{sub 3} (Me = Fe, Mn) was investigated. • Hopping conduction model could be applied for conductivity of both specimens. • The difference of E{sub a} due to that of energy level of Fe and Mn was observed. • Hole concentration estimated by iodimetry increases with increasing Ni content. - Abstract: Electrical conduction mechanism of LaNi{sub x}Fe{sub 1−x}O{sub 3−δ} and LaNi{sub x}Mn{sub 1−x}O{sub 3+δ} expected as Sr-freemore » new cathode material for solid oxide fuel cells was analyzed. Electrical conduction behaviors of both specimens could be well fitted by small polaron hopping conduction model. The electrical conductivity of LaNi{sub x}Fe{sub 1−x}O{sub 3−δ} increased with increasing Ni content, showing agreement with decrease of activation energy for hopping conduction. The decrease of electrical conductivity and increase of activation energy of LaNi{sub x}Mn{sub 1−x}O{sub 3+δ} were observed with increasing Ni content for 0.0 ≤ x ≤ 0.4. Further Ni substitution increased electrical conductivity and decreased activation energy for 0.4 ≤ x ≤ 0.6. It was revealed using iodometry that the difference of hole carrier density between LaNi{sub x}Fe{sub 1−x}O{sub 3−δ} and LaNi{sub x}Mn{sub 1−x}O{sub 3+δ} was small. It was suspected that the origin of the difference of electrical conduction behavior of LaNi{sub x}Fe{sub 1−x}O{sub 3−δ} and LaNi{sub x}Mn{sub 1-x}O{sub 3+δ} was difference of energy level of e{sub g} band composed of Fe 3d or Mn 3d orbitals and their overlapping quantity with O 2p and Ni 3d band.« less
[Air conducted ocular VEMP: II. First clinical investigations].
Walther, L E; Schaaf, H; Sommer, D; Hörmann, K
2011-10-01
Vestibular-evoked myogenic potentials (VEMP) are widely used to assess vestibular function. Air conducted (AC) cervical VEMP (cVEMP) reflect sacculus and inferior vestibular nerve function. Ocular VEMP (oVEMP) however has been hardly examined up to now. In recent studies it has been assumed that AC oVEMP probably reflects superior vestibular nerve function. The aim of this pilot study was to evaluate clinical application of the AC oVEMP. AC oVEMP were recorded in patients with peripheral vestibular disorders (n=21). In addition thermal irritation and head impulse test were performed and AC cVEMP were recorded. For intense AC-sound stimulation tone bursts (500 Hz) with 100 dB nHL were used. In peripheral vestibular disorders AC oVEMP and AC cVEMP could be classified into: • type 1 (inferior vestibular neuritis) with loss of AC oVEMP but normal AC cVEMP, • type 2, probable type of superior vestibular neuritis, showing present AC cVEMP but loss of AC oVEMP, • type 3, probable complete vestibular neuritis, without AC oVEMP and AC cVEMP. AC oVEMP may be used as an appropriate test for clinical investigation in patients with vestibular disorders. AC oVEMP is an additional, essential test for assessing otolith function beside AC cVEMP. Further vestibular test are necessary for precise clinical interpretation. © Georg Thieme Verlag KG Stuttgart · New York.
Surface-hopping dynamics and decoherence with quantum equilibrium structure.
Grunwald, Robbie; Kim, Hyojoon; Kapral, Raymond
2008-04-28
In open quantum systems, decoherence occurs through interaction of a quantum subsystem with its environment. The computation of expectation values requires a knowledge of the quantum dynamics of operators and sampling from initial states of the density matrix describing the subsystem and bath. We consider situations where the quantum evolution can be approximated by quantum-classical Liouville dynamics and examine the circumstances under which the evolution can be reduced to surface-hopping dynamics, where the evolution consists of trajectory segments exclusively evolving on single adiabatic surfaces, with probabilistic hops between these surfaces. The justification for the reduction depends on the validity of a Markovian approximation on a bath averaged memory kernel that accounts for quantum coherence in the system. We show that such a reduction is often possible when initial sampling is from either the quantum or classical bath initial distributions. If the average is taken only over the quantum dispersion that broadens the classical distribution, then such a reduction is not always possible.
Ahmadi, Sheida; Bowles, Richard K
2017-04-21
Particles confined to a single file, in a narrow quasi-one-dimensional channel, exhibit a dynamic crossover from single file diffusion to Fickian diffusion as the channel radius increases and the particles begin to pass each other. The long time diffusion coefficient for a system in the crossover regime can be described in terms of a hopping time, which measures the time it takes for a particle to escape the cage formed by its neighbours. In this paper, we develop a transition state theory approach to the calculation of the hopping time, using the small system isobaric-isothermal ensemble to rigorously account for the volume fluctuations associated with the size of the cage. We also describe a Monte Carlo simulation scheme that can be used to calculate the free energy barrier for particle hopping. The theory and simulation method correctly predict the hopping times for a two-dimensional confined ideal gas system and a system of confined hard discs over a range of channel radii, but the method breaks down for wide channels in the hard discs' case, underestimating the height of the hopping barrier due to the neglect of interactions between the small system and its surroundings.
NASA Astrophysics Data System (ADS)
Kohno, Masanori
2018-05-01
The single-particle spectral properties of the two-dimensional t-J model with next-nearest-neighbor hopping are investigated near the Mott transition by using cluster perturbation theory. The spectral features are interpreted by considering the effects of the next-nearest-neighbor hopping on the shift of the spectral-weight distribution of the two-dimensional t-J model. Various anomalous features observed in hole-doped and electron-doped high-temperature cuprate superconductors are collectively explained in the two-dimensional t-J model with next-nearest-neighbor hopping near the Mott transition.
An, Yong Q; Taylor, Antoinette J; Conradson, Steven D; Trugman, Stuart A; Durakiewicz, Tomasz; Rodriguez, George
2011-05-20
We describe a femtosecond pump-probe study of ultrafast hopping dynamics of 5f electrons in the Mott insulator UO₂ following Mott-gap excitation at temperatures of 5-300 K. Hopping-induced response of the lattice and electrons is probed by transient reflectivity at mid- and above-gap photon energies, respectively. These measurements show an instantaneous hop, subsequent picosecond lattice deformation, followed by acoustic phonon emission and microsecond relaxation. Temperature-dependent studies indicate that the slow relaxation results from Hubbard excitons formed by U³⁺-U⁵⁺ pairs.
First-principles investigation of polarization and ion conduction mechanisms in hydroxyapatite
NASA Astrophysics Data System (ADS)
Kasamatsu, Shusuke; Sugino, Osamu
We report first-principles simulation of polarization mechanisms in hydroxyapatite to explain the underlying mechanism behind the reported ion conductivities and polarization under electrical poling at elevated temperatures. It is found that ion conduction occurs mainly in the column of OH$^-$ ions along the $c$-axis through a combination of the flipping of OH$^-$ ions, exchange of proton vacancies between OH$^-$ ions, and the hopping of the OH$^-$ vacancy. The calculated activation energies are consistent with those found in conductivity measurements and thermally stimulated depolarization current measurements.
59. View of lined canal east of bellmouth near hop ...
59. View of lined canal east of bellmouth near hop barn, looking southwest. Photo by Robin Lee Tedder, Puget Power, 1989. - Puget Sound Power & Light Company, White River Hydroelectric Project, 600 North River Avenue, Dieringer, Pierce County, WA
GENERAL VIEW OF SITE LOOKING SOUTHWEST. JUPITER 'HOP' STAND, FOREGROUND ...
GENERAL VIEW OF SITE LOOKING SOUTHWEST. JUPITER 'HOP' STAND, FOREGROUND CENTER, REDSTONE TEST STAND FOREGROUND RIGHT, SATURN I C TEST STAND BACKGROUND LEFT. - Marshall Space Flight Center, Redstone Rocket (Missile) Test Stand, Dodd Road, Huntsville, Madison County, AL
Uanschou, Clemens; Ronceret, Arnaud; Von Harder, Mona; De Muyt, Arnaud; Vezon, Daniel; Pereira, Lucie; Chelysheva, Liudmila; Kobayashi, Wataru; Kurumizaka, Hitoshi; Schlögelhofer, Peter; Grelon, Mathilde
2013-01-01
During meiosis, homologous recombination (HR) is essential to repair programmed DNA double-strand breaks (DSBs), and a dedicated protein machinery ensures that the homologous chromosome is favored over the nearby sister chromatid as a repair template. The HOMOLOGOUS-PAIRING PROTEIN2/MEIOTIC NUCLEAR DIVISION PROTEIN1 (HOP2/MND1) protein complex has been identified as a crucial factor of meiotic HR in Arabidopsis thaliana, since loss of either MND1 or HOP2 results in failure of DNA repair. We isolated two mutant alleles of HOP2 (hop2-2 and hop2-3) that retained the capacity to repair meiotic DSBs via the sister chromatid but failed to use the homologous chromosome. We show that in these alleles, the recombinases RADIATION SENSITIVE51 (RAD51) and DISRUPTED MEIOTIC cDNA1 (DMC1) are loaded, but only the intersister DNA repair pathway is activated. The hop2-2 phenotype is correlated with a decrease in HOP2/MND1 complex abundance. In hop2-3, a truncated HOP2 protein is produced that retains its ability to bind to DMC1 and DNA but forms less stable complexes with MND1 and fails to efficiently stimulate DMC1-driven D-loop formation. Genetic analyses demonstrated that in the absence of DMC1, HOP2/MND1 is dispensable for RAD51-mediated intersister DNA repair, while in the presence of DMC1, a minimal amount of functional HOP2/MND1 is essential to drive intersister DNA repair. PMID:24363313
Nicaise, Valerie; Joe, Anna; Jeong, Byeong-ryool; Korneli, Christin; Boutrot, Freddy; Westedt, Isa; Staiger, Dorothee; Alfano, James R; Zipfel, Cyril
2013-03-06
Pathogens target important components of host immunity to cause disease. The Pseudomonas syringae type III-secreted effector HopU1 is a mono-ADP-ribosyltransferase required for full virulence on Arabidopsis thaliana. HopU1 targets several RNA-binding proteins including GRP7, whose role in immunity is still unclear. Here, we show that GRP7 associates with translational components, as well as with the pattern recognition receptors FLS2 and EFR. Moreover, GRP7 binds specifically FLS2 and EFR transcripts in vivo through its RNA recognition motif. HopU1 does not affect the protein-protein associations between GRP7, FLS2 and translational components. Instead, HopU1 blocks the interaction between GRP7 and FLS2 and EFR transcripts in vivo. This inhibition correlates with reduced FLS2 protein levels upon Pseudomonas infection in a HopU1-dependent manner. Our results reveal a novel virulence strategy used by a microbial effector to interfere with host immunity.
Prediction of infection risk of hop by Pseudoperonspora humuli
USDA-ARS?s Scientific Manuscript database
Downy mildew, caused by Pseudoperonospora humuli, is one of the most destructive diseases of hop. Weather factors associated with infection risk by P. humuli in the maritime region of western Oregon were examined for 24 and 48-h periods and quadratic discriminant function models were developed to c...
Bertelli, Davide; Brighenti, Virginia; Marchetti, Lucia; Reik, Anna; Pellati, Federica
2018-06-01
Humulus lupulus L. (hop) represents one of the most cultivated crops, it being a key ingredient in the brewing process. Many health-related properties have been described for hop extracts, making this plant gain more interest in the field of pharmaceutical and nutraceutical research. Among the analytical tools available for the phytochemical characterization of plant extracts, quantitative nuclear magnetic resonance (qNMR) represents a new and powerful technique. In this ambit, the present study was aimed at the development of a new, simple, and efficient qNMR method for the metabolite fingerprinting of bioactive compounds in hop cones, taking advantage of the novel ERETIC 2 tool. To the best of our knowledge, this is the first attempt to apply this method to complex matrices of natural origin, such as hop extracts. The qNMR method set up in this study was applied to the quantification of both prenylflavonoids and bitter acids in eight hop cultivars. The performance of this analytical method was compared with that of HPLC-UV/DAD, which represents the most frequently used technique in the field of natural product analysis. The quantitative data obtained for hop samples by means of the two aforementioned techniques highlighted that the amount of bioactive compounds was slightly higher when qNMR was applied, although the order of magnitude of the values was the same. The accuracy of qNMR was comparable to that of the chromatographic method, thus proving to be a reliable tool for the analysis of these secondary metabolites in hop extracts. Graphical abstract Graphical abstract related to the extraction and analytical methods applied in this work for the analysis of bioactive compounds in Humulus lupulus L. (hop) cones.
AC Loss Measurements on a 2G YBCO Coil
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rey, Christopher M; Duckworth, Robert C; Schwenterly, S W
2011-01-01
The Oak Ridge National Laboratory (ORNL) is collaborating with Waukesha Electric Systems (WES) to continue development of HTS power transformers. For compatibility with the existing power grid, a commercially viable HTS transformer will have to operate at high voltages in the range of 138 kV and above, and will have to withstand 550-kV impulse voltages as well. Second-generation (2G) YBCO coated conductors will be required for an economically-competitive design. In order to adequately size the refrigeration system for these transformers, the ac loss of these HTS coils must be characterized. Electrical AC loss measurements were conducted on a prototype highmore » voltage (HV) coil with co-wound stainless steel at 60 Hz in a liquid nitrogen bath using a lock-in amplifier technique. The prototype HV coil consisted of 26 continuous (without splice) single pancake coils concentrically centered on a stainless steel former. For ac loss measurement purposes, voltage tap pairs were soldered across each set of two single pancake coils so that a total of 13 separate voltage measurements could be made across the entire length of the coil. AC loss measurements were taken as a function of ac excitation current. Results show that the loss is primarily concentrated at the ends of the coil where the operating fraction of critical current is the highest and show a distinct difference in current scaling of the losses between low current and high current regimes.« less