Sample records for acad sci usa

  1. Regulation & Development of Membrane Transport Processes.

    DTIC Science & Technology

    1985-05-15

    221, 733-741. 30. Liu, A. Y. C. and Greengard, P. (1974) Proc. Nall. Acad. Sci. USA, 71, 3869-3873. 31. MacKnight, A. D. C., DiBona , D. R., and Leaf...However, DiBona and Sachs and their collaborators 2. IXO(YI’(YI’IC INSEITION OF OTHER TANSPORT SYSTEMS 155 have challenged this view, suggesting that...the U.S. Public Health Service. REFERENCES I. DiBona , D. R., Ito, S., Berglindh, T.. and Sachs, G. (1979) Proc. Nall. Acad. Sci. USA, 76, 6689-6693. 2

  2. Selection of Human Antibody Fragments Which Bind Novel Breast Tumor Antigens

    DTIC Science & Technology

    1998-09-01

    chain Fv analogue produced in Escherichia coli. Proc Natl Acad Sci U S A. 85: 5879-83. 11. Adams, G.P., McCartney, J.E., Tai, M.-S., Oppermann, H...antidigoxin single-chain Fv analogue produced in E coil. Proc NailAcadSci Bernard Foundation, the Frank Strick Foundation and the USA 85:5879-5883 CaPCURE...recovery of infectious phage was increased by preincubation of cells with chloroquine . Measurement of phage recovery from within the cytosol as a

  3. Engineering Bony Hybrid Organs In Vitro

    DTIC Science & Technology

    2006-11-01

    microfluidic cell culture system using elastomeric channels and Braille displays (Gu et al., 2004; Futai et al., 2004). We have now further developed this...Takayama S, 2004: Computerized microfluidic cell culture using elastomeric channels and braille displays. Proc. Natl. Acad. Sci. USA 101, 15861-15866

  4. Study protocol: Münster tinnitus randomized controlled clinical trial-2013 based on tailor-made notched music training (TMNMT).

    PubMed

    Pantev, Christo; Rudack, Claudia; Stein, Alwina; Wunderlich, Robert; Engell, Alva; Lau, Pia; Wollbrink, Andreas; Shaykevich, Alex

    2014-03-02

    Tinnitus is a result of hyper-activity/hyper-synchrony of auditory neurons coding the tinnitus frequency, which has developed to synchronous mass activity owing the lack of inhibition. We assume that removal of exactly these frequency components from an auditory stimulus will cause the brain to reorganize around tonotopic regions coding the tinnitus frequency. Based on this assumption a novel treatment for tonal tinnitus - tailor-made notched music training (TMNMT) (Proc Natl Acad Sci USA 107:1207-1210, 2010; Ann N Y Acad Sci 1252:253-258, 2012; Frontiers Syst Neurosci 6:50, 2012) has been introduced and will be tested in this clinical trial on a large number of tinnitus patients. A randomized controlled trial (RCT) in parallel group design will be performed in a double-blinded manner. The choice of the intervention we are going to apply is based on two "proof of concept" studies in humans (Proc Natl Acad Sci USA 107:1207-1210, 2010; Ann N Y Acad Sci 1252:253-258, 2012; Frontiers Syst Neurosci 6:50, 2012; PloS One 6(9):e24685, 2011) and on a recent animal study (Front Syst Neurosci 7:21, 2013).The RCT includes 100 participants with chronic, tonal tinnitus who listened to tailor-made notched music (TMNM) for two hours a day for three months. The effect of TMNMT is assessed by the tinnitus handicap questionnaire and visual analogue scales (VAS) measuring perceived tinnitus loudness, distress and handicap. This is the first randomized controlled trial applying TMNMT on a larger number of patients with tonal tinnitus. Our data will verify more securely and reliably the effectiveness of this kind of completely non-invasive and low-cost treatment approach on tonal tinnitus. Current Controlled Trials ISRCTN04840953.

  5. The Function of PTP1B in Neuroendocrine Differentation of Prostate Cancer

    DTIC Science & Technology

    2009-01-01

    TCTGTGGCTTCACCACTT TTCTC-30; for b-actin, 50-GCGGGAAATCGTGCGT GACATT-30 and 50-GATGGAGTTGAAGGTAGTTTC GTG -30. Real time PCR was performed with iQ...regenerating cell subpopulation that can initiate prostate tumorigenesis. Proc Natl Acad Sci USA 2005; 102(19):6942–6947. 16. Huss WJ, Gray DR

  6. Boolean networks with veto functions

    NASA Astrophysics Data System (ADS)

    Ebadi, Haleh; Klemm, Konstantin

    2014-08-01

    Boolean networks are discrete dynamical systems for modeling regulation and signaling in living cells. We investigate a particular class of Boolean functions with inhibiting inputs exerting a veto (forced zero) on the output. We give analytical expressions for the sensitivity of these functions and provide evidence for their role in natural systems. In an intracellular signal transduction network [Helikar et al., Proc. Natl. Acad. Sci. USA 105, 1913 (2008), 10.1073/pnas.0705088105], the functions with veto are over-represented by a factor exceeding the over-representation of threshold functions and canalyzing functions in the same system. In Boolean networks for control of the yeast cell cycle [Li et al., Proc. Natl. Acad. Sci. USA 101, 4781 (2004), 10.1073/pnas.0305937101; Davidich et al., PLoS ONE 3, e1672 (2008), 10.1371/journal.pone.0001672], no or minimal changes to the wiring diagrams are necessary to formulate their dynamics in terms of the veto functions introduced here.

  7. The chimeric VirA-tar receptor protein is locked into a highly responsive state.

    PubMed Central

    Turk, S C; van Lange, R P; Sonneveld, E; Hooykaas, P J

    1993-01-01

    The wild-type VirA protein is known to be responsive not only to phenolic compounds but also to sugars via the ChvE protein (G. A. Cangelosi, R. G. Ankenbauer, and E. W. Nester, Proc. Natl. Acad. Sci. USA 87:6708-6712, 1990, and N. Shimoda, A. Toyoda-Yamamoto, J. Nagamine, S. Usami, M. Katayama, Y. Sakagami, and Y. Machida, Proc. Natl. Acad. Sci. USA 87:6684-6688, 1990). It is shown here that the mutant VirA(Ser-44, Arg-45) protein and the chimeric VirA-Tar protein are no longer responsive to sugars and the ChvE protein. However, whereas the chimeric VirA-Tar protein was found to be locked in a highly responsive state, the VirA(Ser-44, Arg-45) mutant protein appeared to be locked in a low responsive state. This difference turned out to be important for tumorigenicity of the host strains in virulence assays on Kalanchoë daigremontiana. Images PMID:8366057

  8. Quantitative in Situ Assessment of the Somatostatin Receptor in Breast Cancer to Assess Response to Targeted Therapy with 111-In-Pentetreotide

    DTIC Science & Technology

    2005-05-01

    chondrosarcoma . Clin Nuc Med 1996 ;21 :1008-9 . 25. Redding TW, Schally AV . Inhibition of growth of the transplantable rat chondrosarcoma by analogs of...hypothalami c hormones . P Nat Acad Sci USA 1983 ;80 :1078-82 . 26. Reubi JC . A somatostatin analogue inhibits chondrosarcoma an d insulinoma tumor

  9. The gap of the area-weighted Motzkin spin chain is exponentially small

    NASA Astrophysics Data System (ADS)

    Levine, Lionel; Movassagh, Ramis

    2017-06-01

    We prove that the energy gap of the model proposed by Zhang et al (2016 arXiv:1606.07795) is exponentially small in the square of the system size. In Movassagh and Shor (2016 Proc. Natl Acad. Sci. USA) a class of exactly solvable quantum spin chain models was proposed that have integer spins (s), with a nearest neighbors Hamiltonian, and a unique ground state. The ground state can be seen as a uniform superposition of all s-colored Motzkin walks. The half-chain entanglement entropy provably violates the area law by a square root factor in the system’s size (˜\\sqrt{n} ) for s  >  1. For s  =  1, the violation is logarithmic (Bravyi et al 2012 Phys. Rev. Lett. 109 207202). Moreover in Movassagh and Shor (2016 Proc. Natl Acad. Sci. USA) it was proved that the gap vanishes polynomially and is O(n -c ) with c≥slant2 . Recently, a deformation of Movassagh and Shor (2016 Proc. Natl Acad. Sci. USA), which we call ‘weighted Motzkin quantum spin chain’ was proposed Zhang et al (2016 arXiv:1606.07795). This model has a unique ground state that is a superposition of the s-colored Motzkin walks weighted by tarea\\{Motzkin walk\\} with t  >  1. The most surprising feature of this model is that it violates the area law by a factor of n. Here we prove that the gap of this model is upper bounded by 8ns t-n2/3 for t  >  1 and s  >  1.

  10. Effect of Dietary Intervention on Prostate Tumor Development in TRAMP Mice

    DTIC Science & Technology

    2006-05-01

    Proc.Natl.Acad.Sci.USA, 92, 3439-3443. 5. Gingrich,J.R., Barrios ,R.J., Morton,R.A., Boyce,B.F., DeMayo,F.J., Finegold,M.J., Angelopoulou,R., Rosen,J.M...the research effort Margot P. Cleary, Principal Investigator Michael Grossmann, Research Associate Patricia Grambsch, Statistician Olga Rogozin

  11. Isolating a Cell Maximally Secreting Acetylcholinesterase

    DTIC Science & Technology

    1985-04-01

    have been obtained through a researh collaboration with Novo Laboratories in Denmark for characterization of antigens found in the different forms of...Biochem. M33, 450-456. 5. Soreq, H., Pavari, R. and Silman, I. (1982) Proc. Natl. Acad. Sci. USA I9, 830-834. 6. Silver, A. (1974) The Biology of

  12. Apoptosis and Tumor Progressionin Prostate Cancer

    DTIC Science & Technology

    2005-02-01

    control. Proc Natl Acad Sci USA 94: 10057- 10062 . 5. Colombel M, Symmans F, et al. (1993): Detection of the apoptosis-suppressing oncoprotein bcl-2 in...hours prior to treatment. After treatment, cells were washed with phosphate buffered saline ( PBS ) and fixed in 500 [tL 0.2% glutaraldehyde in water for

  13. ADP Regulates the Structure and Function of the Protein KaiC

    DTIC Science & Technology

    2016-08-11

    J. S., Lee, Y., Kang, S., Lee, D., Li, S., Britt, R. D., Rust , M., J., Golden, S., S., LiWang, A. (2015) A protein fold switch joins the circadian... Rust , M.J. (2013). Robust and tunable circadian rhythms from differentially sensitive catalytic domains. Proc. Natl. Acad. Sci. USA 110, 1124- 1129

  14. The Role of VDR in Phosphorylation in Vitamin D-Induced Apoptosis

    DTIC Science & Technology

    2001-07-01

    nuclear pellet was resuspended in Buffer A, Cytometer (Coulter Corp., Miami, FL) equipped with an argon laser . sonicated 2 x 10 s, and stored at -80 ’C...rickets type II with alopecia . Proc Natl Acad Sci [45] Mezzetti G, Barbiroli B, Oka T. 1,25-Dihydroxycholecalciferol re- USA 1997;94:9831-5. ceptor

  15. The Plasmodium falciparum Sexual Development Transcriptome: A Microarray Analysis using Ontology-Based Pattern Identification

    DTIC Science & Technology

    2005-06-17

    ciparum. Mol Biochem Parasitol 1992;56(2):239–50. [56] Vinetz JM, Dave SK, Specht CA, et al. The chitinase PfCHT1 from the human malaria parasite Plasmodium...falciparum lacks proenzyme and chitin -binding domains and displays unique substrate prefer- ences. Proc Natl Acad Sci USA 1999;96(24):14061–6. [57

  16. Pathobiology of HIV in the Human Monocyte-Macrophage

    DTIC Science & Technology

    1993-12-03

    dementia, was obtained from I S Y Chen through sues of tropism and cytopathicity of HIV in megakaryo- the AIDS Researh anid Rekferenc Re~nt Program...Natl. Acad. Sci. USA 88:6632-6636. 10. Bielawska, A., Linardic, C. N. and Y. A. Hannun, Y. A. 1992. Ceramide-mediated Biology . J. Biol. Chem. 267:18493

  17. The Effects of Letter Spacing and Coloured Overlays on Reading Speed and Accuracy in Adult Dyslexia

    ERIC Educational Resources Information Center

    Sjoblom, Amanda M.; Eaton, Elizabeth; Stagg, Steven D.

    2016-01-01

    Background: Zorzi et al. (2012, Proc. Natl. Acad. Sci. U.S.A., 109, 11455) found evidence that extra-large letter spacing aids children with dyslexia, but the evidence for the coloured overlays is contradictory (e.g., Henderson et al., 2013, "J. Res. Special Educ. Needs," 13, 57; Wilkins, 2002, "Ophthalmic Physiol. Opt.," 22,…

  18. How Gender and Reformed Introductory Physics Impacts Student Success in Advanced Physics Courses and Continuation in the Physics Major

    ERIC Educational Resources Information Center

    Rodriguez, Idaykis; Potvin, Geoff; Kramer, Laird H.

    2016-01-01

    Active-learning approaches to teaching introductory physics have been found to improve student learning and affective gains on short-term outcomes [S. Freeman et al., "Proc. Natl. Acad. Sci. U.S.A. 111," 8410 (2014)]; however, whether or not the benefits of active learning impact women to the same degree as men has been a point of…

  19. Role of Hunk and Punc in Breast Cancer and Mammary Development

    DTIC Science & Technology

    2001-08-01

    of the 4 small cell lung carcinoma cell lines, but is detected in only one of ten other lung cancer cell Lung < branchio adeno Kids ml Pell CNS PNCK 3...polarity in Schizosaccharomyces Schnurch, H., and Risau, W. (1993). Expression of tie-2, a member of porn be. Proc. Natl. Acad. Sci. USA 87: 8272-8276

  20. Cooperative Interactions During Human Mammary Epithelial Cell Immortalization

    DTIC Science & Technology

    2005-07-01

    papilloma virus 16 E6 or E7. Proc. Nat. Acad. Sci. USA, 92: 3687-3691, 1995. 6. Huschtscha, L. I., Neumann, A. A., Noble, J. R., and Reddel, R. R. Effects...Oncology, In press. 5. Wazer, D. E., Liu, X.-L., Chu, Q., Gao, Q., and Band, V. Immortalization of distinct human mammary epithelial cell types by human

  1. SciLinks

    Science.gov Websites

    SciLinks Forgot your login? Sign up for FREE access Log In I'm a ... Teacher Student User Name questions and satisfy their curiosity Learn More Sign up for Free Access Sites in the SciLinks program . SciLinks-Targeted, Grade-Specific Web Content for your Books Free web content to extend and expand student

  2. SCI peer health coach influence on self-management with peers: a qualitative analysis.

    PubMed

    Skeels, S E; Pernigotti, D; Houlihan, B V; Belliveau, T; Brody, M; Zazula, J; Hasiotis, S; Seetharama, S; Rosenblum, D; Jette, A

    2017-11-01

    A process evaluation of a clinical trial. To describe the roles fulfilled by peer health coaches (PHCs) with spinal cord injury (SCI) during a randomized controlled trial research study called 'My Care My Call', a novel telephone-based, peer-led self-management intervention for adults with chronic SCI 1+ years after injury. Connecticut and Greater Boston Area, MA, USA. Directed content analysis was used to qualitatively examine information from 504 tele-coaching calls, conducted with 42 participants with SCI, by two trained SCI PHCs. Self-management was the focus of each 6-month PHC-peer relationship. PHCs documented how and when they used the communication tools (CTs) and information delivery strategies (IDSs) they developed for the intervention. Interaction data were coded and analyzed to determine PHC roles in relation to CT and IDS utilization and application. PHCs performed three principal roles: Role Model, Supporter, and Advisor. Role Model interactions included CTs and IDSs that allowed PHCs to share personal experiences of managing and living with an SCI, including sharing their opinions and advice when appropriate. As Supporters, PHCs used CTs and IDSs to build credible relationships based on dependability and reassuring encouragement. PHCs fulfilled the unique role of Advisor using CTs and IDSs to teach and strategize with peers about SCI self-management. The SCI PHC performs a powerful, flexible role in promoting SCI self-management among peers. Analysis of PHC roles can inform the design of peer-led interventions and highlights the importance for the provision of peer mentor training.

  3. Governance of Cutaneous Photocarcinogenesis by Chronic UVA-Exposed Dermal Fibroblasts

    DTIC Science & Technology

    2014-09-01

    UV lamp (Ted...repair of oxidative DNA damage and UV -induced photoproducts. Proc Natl Acad Sci USA 107:12180–5 RW Redmond et al. Bystander Oxidative Stress Due to UVA Irradiation 1090 Journal of Investigative Dermatology (2014), Volume 134 ...component of terrestrial UV radiation and is also the predominant constituent of indoor sunlamps, both of which have been shown to increase

  4. Effects of Chronic Alcohol Exposure on Kainate Receptor-Mediated Neurotransmission in the Hippocampus

    DTIC Science & Technology

    2004-09-01

    hippocampus and hypothalamus. J Neurosci Res 63:200-208. Thorpe GH et al. (1989) Chemiluminescent enzyme immunoassay of alpha - fetoprotein based on an...cells. Proc Natl Acad Sci USA 83:6213-6215. Montpied Pet al. (1991) Prolonged ethanol inhalation decreases gamma-aminobutyric acidA receptor alpha ...potentials mediated via alpha -bungarotoxin-sensitive nico- tinic acetylcholine receptors in rat hippocampal interneurons. J Neurosci 18:8228- 8235

  5. Use of Synthetic Antibodies Targeted to the Jak/Stat Pathway in Breast Cancer

    DTIC Science & Technology

    2011-03-01

    substance P ( SP ), an 11 amino acid neuropeptide that is rapidly internalized through specific interaction...no. 27 11011–11015 BI O CH EM IS TR Y Results Engineering a Delivery Vehicle Based on Substance P . Substance P ( SP ) is an 11 amino acid... substance P variant for receptor-mediated delivery of synthetic antibodies into tumor cells, Proc Natl Acad Sci USA. 106:11011- 5 , 2009.

  6. Systemic and Pulmonary Hypertension After Resuscitation with Cell-Free Hemoglobin

    DTIC Science & Technology

    1992-07-01

    Endotoxin was measured using a kinetic turbidimetric modification of the Limulus amoebocyte lysate assay (9). The rabbit pyrogen test was performed...renal failure. This injury occurred in half of the animals that were resuscitated with HPLC purified, pyrogen -negative, low-residual- phosphate HbAo...oxide: an endogenous modulator of leukocyte adhesion. Proc. Nat. Acad. Sci. USA 88:4651-4655, 1991. 17. Moncada, S., K. M. J. Palmer, E. A. Higgs. Nitric

  7. The Relationship of African Apes, Man, and Old World Monkeys

    PubMed Central

    Leakey, L. S. B.

    1970-01-01

    The conclusions of Wilson and Sarich (Proc. Nat. Acad. Sci. USA, 63, 1088-1093 (1969) that the human lineage diverged from that leading to the African apes about 4 to 5 million years ago is shown to be based upon a wholly unsupported assumption that the Superfamilies Hominoidea and Cercopithecoidea only separated from each other some 30 million years ago. This is entirely contrary to most recent palaeontological evidence. PMID:5002096

  8. Biological versus Electronic Adaptive Coloration: How Can One Inform the Other?

    DTIC Science & Technology

    2012-01-01

    Hyperspectral imaging of cuttlefish camouflage indicates good color match in the eyes of fish predators. Proc. Natl Acad. Sci. USA 108, 9148–9153. (doi...Patrick B. Dennis, Rajesh R. Naik, Eric Forsythe and inform the other? Biological versus electronic adaptive coloration : how can one References...TYPE 3. DATES COVERED 00-00-2012 to 00-00-2012 4. TITLE AND SUBTITLE Biological versus electronic adaptive coloration : how can one inform the

  9. Quantifying the distribution of nanodiamonds in pre-Younger Dryas to recent age deposits along Bull Creek, Oklahoma Panhandle, USA

    NASA Astrophysics Data System (ADS)

    Bement, Leland C.; Madden, Andrew S.; Carter, Brian J.; Simms, Alexander R.; Swindle, Andrew L.; Alexander, Hanna M.; Fine, Scott; Benamara, Mourad

    2014-02-01

    High levels of nanodiamonds (nds) have been used to support the transformative hypothesis that an extraterrestrial (ET) event (comet explosion) triggered Younger Dryas changes in temperature, flora and fauna assemblages, and human adaptations [Firestone RB, et al. (2007) Proc Natl Acad Sci USA 104(41):16016-16021]. We evaluate this hypothesis by establishing the distribution of nds within the Bull Creek drainage of the Beaver River basin in the Oklahoma panhandle. The earlier report of an abundance spike of nds in the Bull Creek I Younger Dryas boundary soil is confirmed, although no pure cubic diamonds were identified. The lack of hexagonal nds suggests Bull Creek I is not near any impact site. Potential hexagonal nds at Bull Creek were found to be more consistent with graphene/graphane. An additional nd spike is found in deposits of late Holocene through the modern age, indicating nds are not unique to the Younger Dryas boundary. Nd distributions do not correlate with depositional environment, pedogenesis, climate perturbations, periods of surface stability, or cultural activity.

  10. Bacterial susceptibility patterns in patients with spinal cord injury and disorder (SCI/D): an opportunity for customized stewardship tools.

    PubMed

    Suda, K J; Patel, U C; Sabzwari, R; Cao, L; Ramanathan, S; Hill, J N; Evans, C T

    2016-11-01

    Retrospective observational study of bacterial susceptibilities in Veterans with SCI/D as compared to a general patient population. The purpose of this project was to evaluate the prevalence and susceptibility of bacteria isolated from spinal cord injury and disorder (SCI/D) patients as compared with a general patient population and determine whether a SCI/D-specific antibiogram, a report of bacterial susceptibilities used to guide empiric antibiotic selection, would be a useful stewardship tool. Veterans Affairs Medical Center located in Cook county, IL, USA. Microbiology reports from 1 October 2012 to 30 September 2013 were compiled into a SCI/D-specific antibiogram and compared to a non-SCI/D antibiogram. Persons with positive cultures and SCI/D were younger and had a higher Charlson Index as compared to non-SCI/D patients (P<0.0001 for both). Five thousand one hundred and thirty-one unique isolate cultures were evaluated (SCI/D=23.0%). Frequencies of pathogens isolated in SCI/D and non-SCI/D differed. Methicillin-resistant Staphylococcus aureus occurred more frequently in SCI/D (27.8% vs 55.4%; P<0.0001). Gram-negatives had generally lower susceptibilities in SCI/D and a higher frequency of organisms producing extended-spectrum Beta-lactamases (17.6% vs 5.0%; P<0.0001), carbapenem-resistant Enterobacteriaceae (2.4% vs 0.5%; P<0.0001), carbapenem resistance (7.6% vs 2.4%; P<0.0001) and isolates resistant to ⩾3 antibiotic classes (60.7% vs 28.0%; P=0.0001). Different pathogens with poorer susceptibilities are isolated in SCI/D. Thus an SCI/D-specific antibiogram reflective of resistance patterns in these patients may increase the appropriateness of empiric antibiotic selection. The frequency of multi-drug resistant organisms in cultures obtained from patients with SCI/D is worrisome.

  11. Calibration of the soil conditioning index (SCI) to soil organic carbon in the southeastern USA

    USDA-ARS?s Scientific Manuscript database

    Prediction of soil organic C sequestration with adoption of various conservation agricultural management approaches is needed to meet the emerging market for environmental services provided by agricultural land stewardship. The soil conditioning index (SCI) is a relatively simple model used by the ...

  12. Novel Magnetic Resonance Detection and Profiling of Ovarian Cancer Across Specimens

    DTIC Science & Technology

    2012-10-01

    Cancer Cells in Fine - Needle Aspirates. Proc. Natl. Acad. Sci. U.S.A. 2009, 106, 12459–12464. 25. Han,H. S.; Devaraj,N. K.; Lee, J.; Hilderbrand, S.A... fine needle aspirates, biopsies, ascites, blood, sputum), which are inherently complex in composition, as well as heterogeneous and variable in cell...in ascitic fluid, we anticipate that this method could similarly be applied to fine needle aspirates, blood, biopsy spec- imens, sputum, and other

  13. Immunologic Control of Diarrheal Disease Due to Enterotoxigenic Escherichia coli: Reactogenicity, Immunogenicity, and Efficacy Studies of Pili Vaccines

    DTIC Science & Technology

    1981-09-01

    pathogens that lack CFA/I including enteropathogenic E. coli, some ETEC ana Vibrio cholerae (Figure 1). The mean change in net O.D. between the paired...intestine. In a further analogy, we have found that 20% of 50 recipients of a highly ad- hesive non-toxigenic Vibrio cholerae attenuated iaccine strain...and Characteristics of a Vibrio cholerae Mutant Lacking the A (ADP-Ribosylating) Portion of the Cholera Enterotoxin. Proc. Nat. Acad. Sci. USA 76:2052

  14. TrkB Activators for the Treatment of Traumatic Vision Loss

    DTIC Science & Technology

    2015-10-01

    immunemodulator fingolimod on acute ischemic stroke . Proc Natl Acad Sci USA 111:18315-20. Gauthier R., Joly S., Pernet V., Lachapelle P. and Di Polo A...it has shown clinical efficacy in the treatment of stroke and multiple sclerosis patients (Noda et al., 2013; Yang et al., 2014; Fu et al., 2014...prevents inflammation-sensitized hypoxic- ischemic brain injury in newborns. J Neurosci. 34: 16467-81. Appendix 1. Copy of ARVO abstract

  15. The Mechanism of E2F/P130 Mediated Repression and Its Potential Tumor Suppressor Function in Breast Cancer

    DTIC Science & Technology

    2000-07-01

    conserved PLDLS motif. JBC 273, 8549-8552 (1998). 4. Nibu, Y., Zhang, H., and Levine, M . Interaction of short-range repressors with Drosophila CtBP in...oncogenic transformation. Proc. Natl. Acad. Sci. USA 92, 10467-10471 (1995). 11. Poortinga,G., Watanabe, M . & Parkhurst,S.M. Drosophila CtBP: A hairy...Levine, M . Groucho and dCtBP mediate separate pathways of transcriptional repression in the Drosophila embryo. Developmental Biology 96, 535-540 (1999). 13

  16. Effects of Long-Term Immunization with Multiple Antigens.

    DTIC Science & Technology

    1980-01-01

    to infectious mononucleosis . Proc. Natl. Acad. Sci. USA 59:94-101, 1968. 23. Holt, S., D. Hudgins, K. R. Krishnan, and E. M. R. Critchley. Diffuse...and J. C. Bausher. Epstein-Barr virus infection in relation to infectious mononucleosis and Burkitt’s lymphoma. Annu. Rev. Med. 23:39-56, 1972. 54...Army Biological Laboratory at Fort Detrick, Maryland, it had been the prac- tice to immunize workers repeatedly with multiple antigens of infectious

  17. Membrane Estrogen Receptor Alpha Targeting and its Association with SHC in Regulating Breast Cancer Cell Proliferation

    DTIC Science & Technology

    2004-06-01

    American Society for Cell Biology, San Francisco , California, Dec. 13-17, 2003. 3. Invited speaker in one of symposiums "Recognition of estrogen receptor in...Oncology, Bahamonde MI, Mann GE, Vergara C, Latorre R 1999 University of Virginia Health Science Center, Charlottesville, Acute activation of Maxi-K...intracellular Bahamonde, G.E. Mann, C. Vergara , R. Latorre, Acute activa- calcium, Proc. Nati. Acad. Sci. USA. 96 (1999) 4686-4691. tion of Maxi-K channels by

  18. Granulopoietic Growth Factor Secretion in Ovarian Carcinoma as a Mechanism for the Emergence of Immune Suppressive Myeloid Subsets

    DTIC Science & Technology

    2014-08-01

    levels will be determined and tracked biweekly during the course of tumor growth. Age/ gender -matched non-tumor-bearing mice will serve as controls for...parameter flow cytometry, we compared 21 ovarian cancer patients reflecting stages II - IV to 22 gender - race- and age-matched controls. All patient...Sitkovsky, M. A2A adenosine receptors protect tumors from anti- tumor T cells. (*equal authorship ) Proc. Natl. Acad. Sci. USA 103: 13132-13137, 2006

  19. Role of Growth Hormone in Prostate Cancer

    DTIC Science & Technology

    2007-02-01

    syndrome produced by targeted disruption of the mouse growth hormone receptor/binding protein gene (the Laron mouse). Proc Natl Acad Sci USA 94:13215... Laron mouse, in which the gene coding for both GHR and GH binding protein has been disrupted or knocked out, with the C3(1)/Tag mouse, which develops...the Laron mouse). Nevertheless, the new model presented here demonstrates that the loss of GHR produced a significant reduction in the level of PIN in

  20. Algorithms for Automated DNA Assembly

    DTIC Science & Technology

    2010-01-01

    polyketide synthase gene cluster. Proc. Natl Acad. Sci. USA, 101, 15573–15578. 16. Shetty,R.P., Endy,D. and Knight,T.F. Jr (2008) Engineering BioBrick vectors...correct theoretical construction scheme is de- veloped manually, it is likely to be suboptimal by any number of cost metrics. Modular, robust and...to an exhaustive search on a small synthetic dataset and our results show that our algorithms can quickly find an optimal solution. Comparison with

  1. Mechanism of RhoB/FTI Action in Breast Cancer

    DTIC Science & Technology

    2004-05-01

    deprival conditions, respectively, as de - lysis in lX radioimmunoprecipitation (RIPA) buffer supplemented with 10 scribed previously (5). MtL/mL Protease... adenocarcinoma cells. Neoplasia 2000;2:261-72. FTI responses in the clinic based on cytotoxic susceptibility. To date, 20. Amundadottir LT, Nass SJ, Berchem GJ...and are fertile whereas cyclin B I-null mice die in utero . Proc Natl Acad Sci USA 47. Kumar J, Yu H, Sheetz MP. Kinectin, an essential anchor for

  2. Wavelength Independent Optical Lithography.

    DTIC Science & Technology

    1986-06-06

    lamp because it has a smooth, broadband output in the visible and near UV. High Density Optical Intormation Storage The NSOM concept can be combined...stringent control can be maintained over the temperature of the entire apparatus. Ideally, both of these methods should be used. - . * S P. .~ V: -:V- TwT ...DNA helixes : enantiomers of tris(4, 7-diphenylpheanthroline)ruthenium (II). Proc. Natl. Acad. Sci. U.S.A. 81, 7 (1984). 27. J.M. Fernandez, E. Neher

  3. Unobserved time effects confound the identification of climate change impacts.

    PubMed

    Auffhammer, Maximilian; Vincent, Jeffrey R

    2012-07-24

    A recent study by Feng et al. [Feng S, Krueger A, Oppenheimer M (2010) Proc Natl Acad Sci USA 107:14257-14262] in PNAS reported statistical evidence of a weather-driven causal effect of crop yields on human migration from Mexico to the United States. We show that this conclusion is based on a different statistical model than the one stated in the paper. When we correct for this mistake, there is no evidence of a causal link.

  4. Targeting the Estrogen Receptor for Ubiquitination and Degradation in Breast Cancer Cells

    DTIC Science & Technology

    2004-10-01

    Seery, J.; Daikh, Y.; Moore, C; Chen, L. L.; Pepinsky, B.; Barsoum, J. Proc. Natl. Acad. Sci. U.S.A. 1994, 91, 664-668. aminocaproic acid ...proteins. Although the Hnker length has not been fully explored, a spacer consisting of two aminocaproic acids (12 atoms) has been shown to be flexible...amino acid protein," is conjugated to the target protein by a three-part process. First, the C-terminal carboxyl group of ubiquitin is activated by

  5. Regulation of Breast Cancer Stem Cells by Tissue Rigidity

    DTIC Science & Technology

    2015-06-01

    investigated whether the TWIST1–G3BP2 mechanotrans- duction pathway has a significant role in human cancer progression. We first analysed The Cancer Genome ... the central conserved region. Proc. Natl Acad. Sci. USA 96, 9112–9117 (1999). 38. Singh, S. & Gramolini, A. O. Characterization of sequences in human...breast cancer gene expression data set (TCGA BRCA G4502A_07_3) was downloaded from the UCSC Cancer Genome Browser (https:// genome -cancer.ucsc.edu

  6. Learning Complex Cell Invariance from Natural Videos: A Plausibility Proof

    DTIC Science & Technology

    2007-12-26

    is in the McGovern Institute for Brain Research at MIT, as well as in the Dept. of Brain & Cognitive Sciences, and which is affiliated with the...stimulation induce plasticity? Proc. Nat. Acad. Sci. USA, 92:9682–9686. Deco, G. and Rolls, E. T. (2004). A neurodynamical cor- tical model of visual attention...and invariant object recognition. Vision Res, 44(6):621–42. Deco, G. and Rolls, E. T. (2005). Neurodynamics of biased competition and cooperation for

  7. Octanoyl-Homoserine Lactone Is the Cognate Signal for Burkholderia mallei BmaR1-BmaI1 Quorum Sensing

    DTIC Science & Technology

    2007-07-01

    of genes. Acyl-HSL sig- naling was first identified in the luminescent marine bacterium Vibrio fischeri, which produces blue light at high cell...with shaking at 16°C, cells were harvested by centrifugation at 2,750 g for 20 min. Cell pellets were frozen, thawed at room temperature, suspended in...the Vibrio fischeri strain ATCC7744. Proc. Natl. Acad. Sci. USA 86:5688–5692. 11. Engebrecht, J., and M. Silverman. 1984. Identification of genes and

  8. Reveal genes functionally associated with ACADS by a network study.

    PubMed

    Chen, Yulong; Su, Zhiguang

    2015-09-15

    Establishing a systematic network is aimed at finding essential human gene-gene/gene-disease pathway by means of network inter-connecting patterns and functional annotation analysis. In the present study, we have analyzed functional gene interactions of short-chain acyl-coenzyme A dehydrogenase gene (ACADS). ACADS plays a vital role in free fatty acid β-oxidation and regulates energy homeostasis. Modules of highly inter-connected genes in disease-specific ACADS network are derived by integrating gene function and protein interaction data. Among the 8 genes in ACADS web retrieved from both STRING and GeneMANIA, ACADS is effectively conjoined with 4 genes including HAHDA, HADHB, ECHS1 and ACAT1. The functional analysis is done via ontological briefing and candidate disease identification. We observed that the highly efficient-interlinked genes connected with ACADS are HAHDA, HADHB, ECHS1 and ACAT1. Interestingly, the ontological aspect of genes in the ACADS network reveals that ACADS, HAHDA and HADHB play equally vital roles in fatty acid metabolism. The gene ACAT1 together with ACADS indulges in ketone metabolism. Our computational gene web analysis also predicts potential candidate disease recognition, thus indicating the involvement of ACADS, HAHDA, HADHB, ECHS1 and ACAT1 not only with lipid metabolism but also with infant death syndrome, skeletal myopathy, acute hepatic encephalopathy, Reye-like syndrome, episodic ketosis, and metabolic acidosis. The current study presents a comprehensible layout of ACADS network, its functional strategies and candidate disease approach associated with ACADS network. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. Preface: SciDAC 2009

    NASA Astrophysics Data System (ADS)

    Simon, Horst

    2009-07-01

    By almost any measure, the SciDAC community has come a long way since DOE launched the SciDAC program back in 2001. At the time, we were grappling with how to efficiently run applications on terascale systems (the November 2001 TOP500 list was led by DOE's ASCI White IBM system at Lawrence Livermore achieving 7.2 teraflop/s). And the results stemming from the first round of SciDAC projects were summed up in two-page reports. The scientific results were presented at annual meetings, which were by invitation only and typically were attended by about 75 researchers. Fast forward to 2009 and we now have SciDAC Review, a quarterly magazine showcasing the scientific computing contributions of SciDAC projects and related programs, all focused on presenting a comprehensive look at Scientific Discovery through Advanced Computing. That is also the motivation behind the annual SciDAC conference that in 2009 was held from June 14-18 in San Diego. The annual conference, which can also be described as a celebration of all things SciDAC, grew out those meetings organized in the early days of the program. In 2005, the meeting was held in San Francisco and attendance was opened up to all members of the SciDAC community. The schedule was also expanded to include a keynote address, plenary speakers and other features found in a conference format. This year marks the fifth such SciDAC conference, which now comprises four days of computational science presentations, multiple poster sessions and, since last year, an evening event showcasing simulations and modeling runs resulting from SciDAC projects. The fifth annual SciDAC conference was remarkable on several levels. The primary purpose, of course, is to showcase the research accomplishments resulting from SciDAC programs in particular and computational science in general. It is these accomplishments, represented in 38 papers and 52 posters, that comprise this set of conference proceedings. These proceedings can stand alone as

  10. General topology meets model theory, on and

    PubMed Central

    Malliaris, Maryanthe; Shelah, Saharon

    2013-01-01

    Cantor proved in 1874 [Cantor G (1874) J Reine Angew Math 77:258–262] that the continuum is uncountable, and Hilbert’s first problem asks whether it is the smallest uncountable cardinal. A program arose to study cardinal invariants of the continuum, which measure the size of the continuum in various ways. By Gödel [Gödel K (1939) Proc Natl Acad Sci USA 25(4):220–224] and Cohen [Cohen P (1963) Proc Natl Acad Sci USA 50(6):1143–1148], Hilbert’s first problem is independent of ZFC (Zermelo-Fraenkel set theory with the axiom of choice). Much work both before and since has been done on inequalities between these cardinal invariants, but some basic questions have remained open despite Cohen’s introduction of forcing. The oldest and perhaps most famous of these is whether “,” which was proved in a special case by Rothberger [Rothberger F (1948) Fund Math 35:29–46], building on Hausdorff [Hausdorff (1936) Fund Math 26:241–255]. In this paper we explain how our work on the structure of Keisler’s order, a large-scale classification problem in model theory, led to the solution of this problem in ZFC as well as of an a priori unrelated open question in model theory. PMID:23836659

  11. R-loops: targets for nuclease cleavage and repeat instability.

    PubMed

    Freudenreich, Catherine H

    2018-01-11

    R-loops form when transcribed RNA remains bound to its DNA template to form a stable RNA:DNA hybrid. Stable R-loops form when the RNA is purine-rich, and are further stabilized by DNA secondary structures on the non-template strand. Interestingly, many expandable and disease-causing repeat sequences form stable R-loops, and R-loops can contribute to repeat instability. Repeat expansions are responsible for multiple neurodegenerative diseases, including Huntington's disease, myotonic dystrophy, and several types of ataxias. Recently, it was found that R-loops at an expanded CAG/CTG repeat tract cause DNA breaks as well as repeat instability (Su and Freudenreich, Proc Natl Acad Sci USA 114, E8392-E8401, 2017). Two factors were identified as causing R-loop-dependent breaks at CAG/CTG tracts: deamination of cytosines and the MutLγ (Mlh1-Mlh3) endonuclease, defining two new mechanisms for how R-loops can generate DNA breaks (Su and Freudenreich, Proc Natl Acad Sci USA 114, E8392-E8401, 2017). Following R-loop-dependent nicking, base excision repair resulted in repeat instability. These results have implications for human repeat expansion diseases and provide a paradigm for how RNA:DNA hybrids can cause genome instability at structure-forming DNA sequences. This perspective summarizes mechanisms of R-loop-induced fragility at G-rich repeats and new links between DNA breaks and repeat instability.

  12. SciDB and Geoinformatics Analysis

    NASA Astrophysics Data System (ADS)

    Brown, Paul

    2015-04-01

    The SciDB project took as its design goals a list of features identified as being critical to scientific data management in a survey of working scientists (Stonebraker et al 2009). Earth scientists working with remote sensing data were well represented among those polled so it should come as no surprise that the platform has been embraced by that community. In this talk we focus on work done by researchers at NASA and INPE, and on applications created by commercial data providers in Korea and the United States. For each use-case, we will review the project team's objectives, the nature and quantity of the data involved, the their workload queries. As we discuss each use-case we will describe what is emerging as "best practice" for data management and analysis in this space. M. Stonebraker, J. Becla, D. J. DeWitt, K. T. Lim, D. Maier, O. Ratzesberger, and S. B. Zdonik. Requirements for science data bases and scidb. In CIDR 2009, Fourth Biennial Conference on Innovative Data Systems Research, Asilomar, CA, USA, January 4-7, 2009, Online Proceedings, 2009.

  13. Role of the Integrin-Linked Kinase, ILK, in Mammary Carcinogensis

    DTIC Science & Technology

    2000-08-01

    have been implicated in environmental stress clonei 6-10 responses in yeasts, plants and mammals, as well as regulating abscisic acid signal transduction...phosphatase 2C involved in abscisic acid signal transduction in higher plants. Proc. Natl Acad. Sci. USA, 95, 975-980. Strovel,E.T., Wu,D. and Sussman,D.J...contain a 450bp open reading frame, coding for 149 amino acids and a poly A tail 245bp downstream of the stop codon, although no polyadenylation site

  14. Genome-Wide Nucleic Acid/Protein Interaction in Breast Cancer

    DTIC Science & Technology

    2005-04-01

    Chen W, Zhang J et al: Large-scale genotyping of complex DNA. Nat Biotechnol 2003, 21(10):1233-1237. 25. Bolstad BM, Irizarry RA, Astrand M, Speed TP...2124836802660188/sup8.xls 235 Analysis of RNA-protein interactions by flow cytometry Alexander S Brodsky’*, Angus PR Johnston 2, Matt Trau 2 & Pamela A Silver1...Natl Acad Sci USA (2001) 98(23):12954-12959. genotyping using the Qbead system: A quantum dot-encoded microsphere-based assay. Nucleic Acids Res (2003

  15. Bio-Inspired Metallo-Supramolecular Polymers for Combined Mechanical Properties

    DTIC Science & Technology

    2010-01-01

    3 4 5 6 0 50 100 150 200 Temp (°C) H ea t F lo w (m W ) Figure 8. DSC trace of polymer 7. 1H NMR analysis indicated complete reaction of the...static and dynamic mechanical analysis methods. 11 5. References 1. Guan, Z. Polymer International 2007, 56, 467. 2. Oberhauser, A. F ...Hansma, P. K.; Carrion-Vazques, M.; Fernandez, J. M. Proc. Natl. Acad. Sci. USA 2001, 98, 468. 3. Reif, M. Gautel, M.; Oesterhelt, F .; Fernandez, J

  16. Mutation of Breast Cancer Cell Genomic DNA by APOBEC3B

    DTIC Science & Technology

    2013-09-01

    lethal prostate cancers. Proc. Natl Acad. Sci. USA 108, 17087–17092 (2011). 5. Parsons, D. W. et al. The genetic landscape of the childhood cancer...7. Stransky, N. et al. The mutational landscape of head and neck squamous cell carcinoma. Science 333, 1157–1160 (2011). 8. Nik-Zainal, S. et al...Mutational processes molding the genomes of 21 breast cancers. Cell 149, 979–993 (2012). 9. Stephens, P. J. et al. The landscape of cancer genes and

  17. Molecular Cloning and Function of FAS/APO1 Associated Protein in Breast Cancer.

    DTIC Science & Technology

    1996-06-01

    Ariyama T, Abe T, Druck T, Ohta M, Huebner K, Yanagisawa J, Reed JC, Sato T: PTPN13, a Fas-associated protein tyrosine phosphatase, is located on...20. Yang, Q., and Tonks, N. K. (1991). Isolation of a cDNA clone encoding a human protein-tyrosine phosphatase with homology 7. Huebner, K., Druck , T...Acad. Sci. U.S.A. 91, 7477 (1994). Res. 53, 1945 (1993).(Fig. 3D ). In contrast to Jurkat cells which 13. The original description of PTP-BAS (12

  18. Genome-Wide Analysis of Translational Control in Tuberous Sclerosis Complex

    DTIC Science & Technology

    2013-07-01

    INTRODUCTION The mammalian target of rapamycin (mTOR) is a highly conserved serine/ threonine kinase that is named for its inhibition by the drug...Natl. Acad. Sci. U.S.A. 108, E1070–E1079 (2011). 9. R. Zoncu, A. Efeyan, D. M. Sabatini, mTOR: From growth signal integration to cancer, diabetes ...signaling: At the cross- roads of obesity, diabetes and cancer. Trends Mol. Med. 13, 252–259 (2007). 26. C. G. Proud, mTOR signalling in health and

  19. The Isolation and Characterization of Human Prostate Cancer Stem Cells

    DTIC Science & Technology

    2015-05-01

    GATGGAGTTGAAGGTAGTTTC GTG -30. Real time PCR was performed with iQ SYBR Green Supermix in an iCycler iQ System (Bio-Rad) using the SYBR Green Detection...initiate prostate tumorigenesis. Proc Natl Acad Sci USA 2005; 102(19):6942–6947. 16. Huss WJ, Gray DR, Greenberg NM, Mohler JL, Smith GJ. Breast cancer...receptor protein. Cancer Res. 1995; 55:3068–3072. [PubMed: 7541709] Huss WJ, Gray DR, Greenberg NM, Mohler JL, Smith GJ. Breast cancer resistance

  20. 75 FR 24747 - SCI, LLC/Zener-Rectifier Operations Division A Wholly Owned Subsidiary of SCI, LLC/ON...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-05-05

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-70,235] SCI, LLC/Zener-Rectifier... Adjustment Assistance on October 19, 2009, applicable to workers of SCI LLC/Zener-Rectifier, Operations... Technical Resources were employed on-site at the Phoenix Arizona location of SCI LLC/Zener-Rectifier...

  1. Evaluation and Management of SCI-Associated Pain.

    PubMed

    Saulino, Michael; Averna, Justin F

    2016-09-01

    Traumatic spinal cord injury (SCI) is a devastating neurological condition. Treatment of SCI-related pain is challenging for the treating physician, as normal neural pathways are disrupted. Patients with SCI consistently rate pain as one of the most difficult problems associated with their injury. SCI-related pain can be refractory and complete relief is often not possible. The multidimensional nature of SCI-related pain affects the neural system including autonomic nervous system deregulation and can alter metabolic and biochemical processes throughout the body. Co-morbid psychological illnesses such as depression and adjustment disorder are seen in a significant percentage of patients. Despite a better understanding of the underlying pain mechanisms and advances in procedural, pharmacologic, and non-pharmacologic therapies, treatment of pain after SCI remains elusive. This manuscript reviews the current evidence-based evaluation and management of the SCI patient with the overarching goal of providing appropriate and effective management of their pain. In particular, additional well-designed studies are needed to help elucidate effective treatments for SCI-related neuropathic pain in an effort to help provide these patients with better management of their pain and improve their quality of life.

  2. SCI Hazard Report Methodology

    NASA Technical Reports Server (NTRS)

    Mitchell, Michael S.

    2010-01-01

    This slide presentation reviews the methodology in creating a Source Control Item (SCI) Hazard Report (HR). The SCI HR provides a system safety risk assessment for the following Ares I Upper Stage Production Contract (USPC) components (1) Pyro Separation Systems (2) Main Propulsion System (3) Reaction and Roll Control Systems (4) Thrust Vector Control System and (5) Ullage Settling Motor System components.

  3. Characterization of a SUMO Ligase that is Essential for DNA Damage-Induced NF-Kappa B Activation

    DTIC Science & Technology

    2008-03-01

    DNA damage. Oncogene 18, 2261 – 2271. 80 Jung , M., Zhang, Y., Lee, S. and Dritschilo, A. (1995) Correction of radiation sensitivity in ataxia...telangiectasia cells by a truncated I kappaB-alpha. Science 268, 1619 – 1621. 81 Lee, S. J., Dimtchev, A., Lavin,M. F., Dritschilo, A. and Jung , M. (1998) A...CREB-binding protein/p300 are transcriptional coactivators of p65. Proc. Natl. Acad. Sci. USA 94, 2927 – 2932. 98 Kuo , H. Y., Chang, C. C., Jeng, J. C

  4. Improved Performance of Protected Catecholic Polysiloxanes for Bioinspired Wet Adhesion to Surface Oxides

    DTIC Science & Technology

    2012-11-26

    1374. (2) Cho, Y.; Sundaram, H. S.; Finlay , J. A.; Dimitriou, M. D.; Callow, M. E.; Callow, J. A.; Kramer, E. J.; Ober, C. K. Biomacromolecules 2012...139−144. (11) Zeng, H.; Hwang, D. S.; Israelachvili, J. N .; Waite, J. H. Proc. Natl. Acad. Sci. U.S.A. 2010, 107, 12850−12853. (12) Holten-Andersen, N ...Haeshin, L.; Dellatore, S. M.; Miller, W. M.; Messersmith, P. B. Science 2007, 318, 426−430. (14) Ling, D.; Park, W.; Park, Y. I.; Lee, N .; Li, F

  5. Comparison of the Side Populations in Pretreatment and Postrelapse Neuroblastoma Cell Lines

    DTIC Science & Technology

    2010-08-01

    396–401. [15] Hansford LM, McKee AE, Zhang L, George RE, Gerstle JT, Thorner PS, Smith KM, Look AT, Yeger H, Miller FD, et al. (2007). Neuroblastoma...Acad Sci USA 103, 11154–11159. [32] Wu C, Wei Q , Utomo V, Nadesan P, Whetstone H, Kandel R, Wunder JS, and Alman BA (2007). Side population cells...Jeter CR, Badeaux M, Choy G, Chandra D, Patrawala L, Liu C, Calhoun- Davis T, Zaehres H, Daley GQ, and Tang DG (2009). Functional evidence that the

  6. The Role of Amplified Wild-Type Neu in the Etiology of Breast Cancer

    DTIC Science & Technology

    2004-07-01

    mutations that were found, only one (a C - T change of chromosome 5 (data not shown). DAPI banding patterns of nucleotide 2137) was present in clones...activation. Proc. NatI. Acad. Sci. USA 93, 8878-8883. Koelsch, B.U. (1998). Assignment of erbB2 to rat chromosome band 1Oq32.1 by in situ...was used to map the integration site of the neu transgene in lines 6500 and 2477. Line 6500 contained -3-6 copies of the transgene in chromosome 10

  7. Preface: SciDAC 2007

    NASA Astrophysics Data System (ADS)

    Keyes, David E.

    2007-09-01

    It takes a village to perform a petascale computation—domain scientists, applied mathematicians, computer scientists, computer system vendors, program managers, and support staff—and the village was assembled during 24-28 June 2007 in Boston's Westin Copley Place for the third annual Scientific Discovery through Advanced Computing (SciDAC) 2007 Conference. Over 300 registered participants networked around 76 posters, focused on achievements and challenges in 36 plenary talks, and brainstormed in two panels. In addition, with an eye to spreading the vision for simulation at the petascale and to growing the workforce, 115 participants—mostly doctoral students and post-docs complementary to the conferees—were gathered on 29 June 2007 in classrooms of the Massachusetts Institute of Technology for a full day of tutorials on the use of SciDAC software. Eleven SciDAC-sponsored research groups presented their software at an introductory level, in both lecture and hands-on formats that included live runs on a local BlueGene/L. Computation has always been about garnering insight into the behavior of systems too complex to explore satisfactorily by theoretical means alone. Today, however, computation is about much more: scientists and decision makers expect quantitatively reliable predictions from simulations ranging in scale from that of the Earth's climate, down to quarks, and out to colliding black holes. Predictive simulation lies at the heart of policy choices in energy and environment affecting billions of lives and expenditures of trillions of dollars. It is also at the heart of scientific debates on the nature of matter and the origin of the universe. The petascale is barely adequate for such demands and we are barely established at the levels of resolution and throughput that this new scale of computation affords. However, no scientific agenda worldwide is pushing the petascale frontier on all its fronts as vigorously as SciDAC. The breadth of this conference

  8. Preface: SciDAC 2006

    NASA Astrophysics Data System (ADS)

    Tang, William M., Dr.

    2006-01-01

    The second annual Scientific Discovery through Advanced Computing (SciDAC) Conference was held from June 25-29, 2006 at the new Hyatt Regency Hotel in Denver, Colorado. This conference showcased outstanding SciDAC-sponsored computational science results achieved during the past year across many scientific domains, with an emphasis on science at scale. Exciting computational science that has been accomplished outside of the SciDAC program both nationally and internationally was also featured to help foster communication between SciDAC computational scientists and those funded by other agencies. This was illustrated by many compelling examples of how domain scientists collaborated productively with applied mathematicians and computer scientists to effectively take advantage of terascale computers (capable of performing trillions of calculations per second) not only to accelerate progress in scientific discovery in a variety of fields but also to show great promise for being able to utilize the exciting petascale capabilities in the near future. The SciDAC program was originally conceived as an interdisciplinary computational science program based on the guiding principle that strong collaborative alliances between domain scientists, applied mathematicians, and computer scientists are vital to accelerated progress and associated discovery on the world's most challenging scientific problems. Associated verification and validation are essential in this successful program, which was funded by the US Department of Energy Office of Science (DOE OS) five years ago. As is made clear in many of the papers in these proceedings, SciDAC has fundamentally changed the way that computational science is now carried out in response to the exciting challenge of making the best use of the rapid progress in the emergence of more and more powerful computational platforms. In this regard, Dr. Raymond Orbach, Energy Undersecretary for Science at the DOE and Director of the OS has stated

  9. Combined SCI and TBI: Recovery of forelimb function after unilateral cervical spinal cord injury (SCI) is retarded by contralateral traumatic brain injury (TBI), and ipsilateral TBI balances the effects of SCI on paw placement

    PubMed Central

    Inoue, Tomoo; Lin, Amity; Ma, Xiaokui; McKenna, Stephen L.; Creasey, Graham H.; Manley, Geoffrey T.; Ferguson, Adam R.; Bresnahan, Jacqueline C.; Beattie, Michael S.

    2015-01-01

    A significant proportion (estimates range from 16–74%) of patients with spinal cord injury (SCI) have concomitant traumatic brain injury (TBI), and the combination often produces difficulties in planning and implementing rehabilitation strategies and drug therapies. For example, many of the drugs used to treat SCI may interfere with cognitive rehabilitation, and conversely drugs that are used to control seizures in TBI patients may undermine locomotor recovery after SCI. The current paper presents an experimental animal model for combined SCI and TBI to help drive mechanistic studies of dual diagnosis. Rats received a unilateral SCI (75 kdyn) at C5 vertebral level, a unilateral TBI (2.0 mm depth, 4.0 m/s velocity impact on the forelimb sensori-motor cortex), or both SCI + TBI. TBI was placed either contralateral or ipsilateral to the SCI. Behavioral recovery was examined using paw placement in a cylinder, grooming, open field locomotion, and the IBB cereal eating test. Over 6 weeks, in the paw placement test, SCI + contralateral TBI produced a profound deficit that failed to recover, but SCI + ipsilateral TBI increased the relative use of the paw on the SCI side. In the grooming test, SCI + contralateral TBI produced worse recovery than either lesion alone even though contralateral TBI alone produced no observable deficit. In the IBB forelimb test, SCI + contralateral TBI revealed a severe deficit that recovered in 3 weeks. For open field locomotion, SCI alone or in combination with TBI resulted in an initial deficit that recovered in 2 weeks. Thus, TBI and SCI affected forelimb function differently depending upon the test, reflecting different neural substrates underlying, for example, exploratory paw placement and stereotyped grooming. Concurrent SCI and TBI had significantly different effects on outcomes and recovery, depending upon laterality of the two lesions. Recovery of function after cervical SCI was retarded by the addition of a moderate TBI in the

  10. Combined SCI and TBI: recovery of forelimb function after unilateral cervical spinal cord injury (SCI) is retarded by contralateral traumatic brain injury (TBI), and ipsilateral TBI balances the effects of SCI on paw placement.

    PubMed

    Inoue, Tomoo; Lin, Amity; Ma, Xiaokui; McKenna, Stephen L; Creasey, Graham H; Manley, Geoffrey T; Ferguson, Adam R; Bresnahan, Jacqueline C; Beattie, Michael S

    2013-10-01

    A significant proportion (estimates range from 16 to 74%) of patients with spinal cord injury (SCI) have concomitant traumatic brain injury (TBI), and the combination often produces difficulties in planning and implementing rehabilitation strategies and drug therapies. For example, many of the drugs used to treat SCI may interfere with cognitive rehabilitation, and conversely drugs that are used to control seizures in TBI patients may undermine locomotor recovery after SCI. The current paper presents an experimental animal model for combined SCI and TBI to help drive mechanistic studies of dual diagnosis. Rats received a unilateral SCI (75 kdyn) at C5 vertebral level, a unilateral TBI (2.0 mm depth, 4.0 m/s velocity impact on the forelimb sensori-motor cortex), or both SCI+TBI. TBI was placed either contralateral or ipsilateral to the SCI. Behavioral recovery was examined using paw placement in a cylinder, grooming, open field locomotion, and the IBB cereal eating test. Over 6weeks, in the paw placement test, SCI+contralateral TBI produced a profound deficit that failed to recover, but SCI+ipsilateral TBI increased the relative use of the paw on the SCI side. In the grooming test, SCI+contralateral TBI produced worse recovery than either lesion alone even though contralateral TBI alone produced no observable deficit. In the IBB forelimb test, SCI+contralateral TBI revealed a severe deficit that recovered in 3 weeks. For open field locomotion, SCI alone or in combination with TBI resulted in an initial deficit that recovered in 2 weeks. Thus, TBI and SCI affected forelimb function differently depending upon the test, reflecting different neural substrates underlying, for example, exploratory paw placement and stereotyped grooming. Concurrent SCI and TBI had significantly different effects on outcomes and recovery, depending upon laterality of the two lesions. Recovery of function after cervical SCI was retarded by the addition of a moderate TBI in the contralateral

  11. A Global Scale Scenario for Prebiotic Chemistry: Silica-Based Self-Assembled Mineral Structures and Formamide

    PubMed Central

    2016-01-01

    The pathway from simple abiotically made organic compounds to the molecular bricks of life, as we know it, is unknown. The most efficient geological abiotic route to organic compounds results from the aqueous dissolution of olivine, a reaction known as serpentinization (Sleep, N.H., et al. (2004) Proc. Natl. Acad. Sci. USA 101, 12818–12822). In addition to molecular hydrogen and a reducing environment, serpentinization reactions lead to high-pH alkaline brines that can become easily enriched in silica. Under these chemical conditions, the formation of self-assembled nanocrystalline mineral composites, namely silica/carbonate biomorphs and metal silicate hydrate (MSH) tubular membranes (silica gardens), is unavoidable (Kellermeier, M., et al. In Methods in Enzymology, Research Methods in Biomineralization Science (De Yoreo, J., Ed.) Vol. 532, pp 225–256, Academic Press, Burlington, MA). The osmotically driven membranous structures have remarkable catalytic properties that could be operating in the reducing organic-rich chemical pot in which they form. Among one-carbon compounds, formamide (NH2CHO) has been shown to trigger the formation of complex prebiotic molecules under mineral-driven catalytic conditions (Saladino, R., et al. (2001) Biorganic & Medicinal Chemistry, 9, 1249–1253), proton irradiation (Saladino, R., et al. (2015) Proc. Natl. Acad. Sci. USA, 112, 2746–2755), and laser-induced dielectric breakdown (Ferus, M., et al. (2015) Proc Natl Acad Sci USA, 112, 657–662). Here, we show that MSH membranes are catalysts for the condensation of NH2CHO, yielding prebiotically relevant compounds, including carboxylic acids, amino acids, and nucleobases. Membranes formed by the reaction of alkaline (pH 12) sodium silicate solutions with MgSO4 and Fe2(SO4)3·9H2O show the highest efficiency, while reactions with CuCl2·2H2O, ZnCl2, FeCl2·4H2O, and MnCl2·4H2O showed lower reactivities. The collections of compounds forming inside and outside the tubular

  12. A Global Scale Scenario for Prebiotic Chemistry: Silica-Based Self-Assembled Mineral Structures and Formamide.

    PubMed

    Saladino, Raffaele; Botta, Giorgia; Bizzarri, Bruno Mattia; Di Mauro, Ernesto; Garcia Ruiz, Juan Manuel

    2016-05-17

    The pathway from simple abiotically made organic compounds to the molecular bricks of life, as we know it, is unknown. The most efficient geological abiotic route to organic compounds results from the aqueous dissolution of olivine, a reaction known as serpentinization (Sleep, N.H., et al. (2004) Proc. Natl. Acad. Sci. USA 101, 12818-12822). In addition to molecular hydrogen and a reducing environment, serpentinization reactions lead to high-pH alkaline brines that can become easily enriched in silica. Under these chemical conditions, the formation of self-assembled nanocrystalline mineral composites, namely silica/carbonate biomorphs and metal silicate hydrate (MSH) tubular membranes (silica gardens), is unavoidable (Kellermeier, M., et al. In Methods in Enzymology, Research Methods in Biomineralization Science (De Yoreo, J., Ed.) Vol. 532, pp 225-256, Academic Press, Burlington, MA). The osmotically driven membranous structures have remarkable catalytic properties that could be operating in the reducing organic-rich chemical pot in which they form. Among one-carbon compounds, formamide (NH2CHO) has been shown to trigger the formation of complex prebiotic molecules under mineral-driven catalytic conditions (Saladino, R., et al. (2001) Biorganic & Medicinal Chemistry, 9, 1249-1253), proton irradiation (Saladino, R., et al. (2015) Proc. Natl. Acad. Sci. USA, 112, 2746-2755), and laser-induced dielectric breakdown (Ferus, M., et al. (2015) Proc Natl Acad Sci USA, 112, 657-662). Here, we show that MSH membranes are catalysts for the condensation of NH2CHO, yielding prebiotically relevant compounds, including carboxylic acids, amino acids, and nucleobases. Membranes formed by the reaction of alkaline (pH 12) sodium silicate solutions with MgSO4 and Fe2(SO4)3·9H2O show the highest efficiency, while reactions with CuCl2·2H2O, ZnCl2, FeCl2·4H2O, and MnCl2·4H2O showed lower reactivities. The collections of compounds forming inside and outside the tubular membrane are

  13. Identification of Genes Differentially Expressed During Heat Shock Treatment in Aedes aegypti

    DTIC Science & Technology

    2009-01-01

    Chan, C. W. Cheng, and R. S. Wu. 2003. Cloning of theHSP70 gene in barnacle larvae and its expression under hypoxic conditions. Mar. Pollut. Bull. 46...665Ð671. Chuang, K. H., S. H. Ho, and Y. L. Song. 2007. Cloning and expression analysis of heat shock cognate 70 gene pro- moter in tiger shrimp ...in larvae , but not adults, of a polar insect. Proc. Natl. Acad. Sci. U.S.A. 103: 14223Ð14227. Robich, R. M., J. P. Rinehart, L. J. Kitchen, and D. L

  14. A simplified method for extracting androgens from avian egg yolks

    USGS Publications Warehouse

    Kozlowski, C.P.; Bauman, J.E.; Hahn, D.C.

    2009-01-01

    Female birds deposit significant amounts of steroid hormones into the yolks of their eggs. Studies have demonstrated that these hormones, particularly androgens, affect nestling growth and development. In order to measure androgen concentrations in avian egg yolks, most authors follow the extraction methods outlined by Schwabl (1993. Proc. Nat. Acad. Sci. USA 90:11446-11450). We describe a simplified method for extracting androgens from avian egg yolks. Our method, which has been validated through recovery and linearity experiments, consists of a single ethanol precipitation that produces substantially higher recoveries than those reported by Schwabl.

  15. Learning by Creating and Exchanging Objects: The SCY Experience

    ERIC Educational Resources Information Center

    De Jong, Ton; Van Joolingen, Wouter R.; Giemza, Adam; Girault, Isabelle; Hoppe, Ulrich; Kindermann, Jorg; Kluge, Anders; Lazonder, Ard W.; Vold, Vibeke; Weinberger, Armin; Weinbrenner, Stefan; Wichmann, Astrid; Anjewierden, Anjo; Bodin, Marjolaine; Bollen, Lars; D'Ham, Cedric; Dolonen, Jan; Engler, Jan; Geraedts, Caspar; Grosskreutz, Henrik; Hovardas, Tasos; Julien, Rachel; Lechner, Judith; Ludvigsen, Sten; Matteman, Yuri; Meistadt, Oyvind; Naess, Bjorge; Ney, Muriel; Pedaste, Margus; Perritano, Anthony; Rinket, Marieke; Von Schlanbusch, Henrik; Sarapuu, Tago; Schulz, Florian; Sikken, Jakob; Slotta, Jim; Toussaint, Jeremy; Verkade, Alex; Wajeman, Claire; Wasson, Barbara; Zacharia, Zacharias C.; Van Der Zanden, Martine

    2010-01-01

    Science Created by You (SCY) is a project on learning in science and technology domains. SCY uses a pedagogical approach that centres around products, called "emerging learning objects" (ELOs) that are created by students. Students work individually and collaboratively in SCY-Lab (the general SCY learning environment) on "missions" that are guided…

  16. Psychometric evaluation of the Spanish version of the MPI-SCI.

    PubMed

    Soler, M D; Cruz-Almeida, Y; Saurí, J; Widerström-Noga, E G

    2013-07-01

    Postal surveys. To confirm the factor structure of the Spanish version of the MPI-SCI (MPI-SCI-S, Multidimensional Pain Inventory in the SCI population) and to test its internal consistency and construct validity in a Spanish population. Guttmann Institute, Barcelona, Spain. The MPI-SCI-S along with Spanish measures of pain intensity (Numerical Rating Scale), pain interference (Brief Pain Inventory), functional independence (Functional Independence Measure), depression (Beck Depression Inventory), locus of control (Multidimensional health Locus of Control), support (Functional Social Support Questionnaire (Duke-UNC)), psychological well-being (Psychological Global Well-Being Index) and demographic/injury characteristics were assessed in persons with spinal cord injury (SCI) and chronic pain (n=126). Confirmatory factor analysis suggested an adequate factor structure for the MPI-SCI-S. The internal consistency of the MPI-SCI-S subscales ranged from acceptable (r=0.66, Life Control) to excellent (r=0.94, Life Interference). All MPI-SCI-S subscales showed adequate construct validity, with the exception of the Negative and Solicitous Responses subscales. The Spanish version of the MPI-SCI is adequate for evaluating chronic pain impact following SCI in a Spanish-speaking population. Future studies should include additional measures of pain-related support in the Spanish-speaking SCI population.

  17. [SciELO: method for electronic publishing].

    PubMed

    Laerte Packer, A; Rocha Biojone, M; Antonio, I; Mayumi Takemaka, R; Pedroso García, A; Costa da Silva, A; Toshiyuki Murasaki, R; Mylek, C; Carvalho Reisl, O; Rocha F Delbucio, H C

    2001-01-01

    It describes the SciELO Methodology Scientific Electronic Library Online for electronic publishing of scientific periodicals, examining issues such as the transition from traditional printed publication to electronic publishing, the scientific communication process, the principles which founded the methodology development, its application in the building of the SciELO site, its modules and components, the tools use for its construction etc. The article also discusses the potentialities and trends for the area in Brazil and Latin America, pointing out questions and proposals which should be investigated and solved by the methodology. It concludes that the SciELO Methodology is an efficient, flexible and wide solution for the scientific electronic publishing.

  18. PTEN Loss Antagonizes Calcitriol-Mediated Growth Inhibition in Prostate Epithelial Cells

    DTIC Science & Technology

    2009-05-01

    deleting lentiviral vector: efficient gene targeting in vivo. Proc Natl Acad Sci U S A, 98: 11450-11455, 2001. 27. Vlahos , C. J., Matter, W. F., Hui, K...and in aging skin in vivo. Proc Natl Acad Sci U S A, 92: 9363-9367, 1995. 35. Vlahos , C. J., Matter, W. F., Hui, K. Y., and Brown, R. F. A specific

  19. Steady-states for shear flows of a liquid-crystal model: Multiplicity, stability, and hysteresis

    NASA Astrophysics Data System (ADS)

    Dorn, Tim; Liu, Weishi

    In this work, we study shear flows of a fluid layer between two solid blocks via a liquid-crystal type model proposed in [C.H.A. Cheng, L.H. Kellogg, S. Shkoller, D.L. Turcotte, A liquid-crystal model for friction, Proc. Natl. Acad. Sci. USA 21 (2007) 1-5] for an understanding of frictions. A characterization on the existence and multiplicity of steady-states is provided. Stability issue of the steady-states is examined mainly focusing on bifurcations of zero eigenvalues. The stability result suggests that this simple model exhibits hysteresis, and it is supported by a numerical simulation.

  20. Quota methods for congressional apportionment are still non-unique

    PubMed Central

    Mayberry, John P.

    1978-01-01

    Balinski and Young described a “quota method” for congressional apportionment and recommended it as “the only method satisfying three essential axioms” [Balinski, M. L. & Young, H. P. (1974) Proc. Natl. Acad. Sci. USA 71, 4602-4606]. This paper points out and repairs a slight defect in one of those axioms, producing a quota method slightly different from that described previously. It also presents an alternative to the “consistency” axiom of the paper and describes the “dual quota” method, uniquely satisfying the alternative axioms (which have exactly as much justification as the originals). PMID:16592547

  1. May quasicrystals be good thermoelectric materials?

    NASA Astrophysics Data System (ADS)

    Maciá, Enrique

    2000-11-01

    We present a theoretical analysis of quasicrystals (QCs) as potential thermoelectric materials. We consider a self-similar density of states model and extend the framework introduced in [G. D. Mahan and J. O. Sofo, Proc. Natl. Acad. Sci. U.S.A. 93, 7436 (1996)] to systems exhibiting correlated features in their electronic structure. We show that relatively high values of the thermoelectric figure of merit, ranging from 0.01 up to 1.6 at room temperature, may be expected for these systems. We compare our results with available experimental data on transport properties of QCs and suggest some potential candidates for thermoelectric applications.

  2. MadSciNet: The 24-hour exploding laboratory.

    Science.gov Websites

    Page New! Help Improve The Madsci Network Help Support MadSci MAD Head MAD egg Welcome to the laboratory that never sleeps! MadSci Network represents a collective cranium of scientists providing answers Sunday May 27, 2018. Lynn MadSci Network is a non-profit organization operating in partnership with Third

  3. Performance of the SciBar cosmic ray telescope (SciCRT) toward the detection of high-energy solar neutrons in solar cycle 24

    NASA Astrophysics Data System (ADS)

    Sasai, Yoshinori; Nagai, Yuya; Itow, Yoshitaka; Matsubara, Yutaka; Sako, Takashi; Lopez, Diego; Itow, Tsukasa; Munakata, Kazuoki; Kato, Chihiro; Kozai, Masayoshi; Miyazaki, Takahiro; Shibata, Shoichi; Oshima, Akitoshi; Kojima, Hiroshi; Tsuchiya, Harufumi; Watanabe, Kyoko; Koi, Tatsumi; Valdés-Galicia, Jose Francisco; González, Luis Xavier; Ortiz, Ernesto; Musalem, Octavio; Hurtado, Alejandro; Garcia, Rocio; Anzorena, Marcos

    2014-12-01

    We plan to observe solar neutrons at Mt. Sierra Negra (4,600 m above sea level) in Mexico using the SciBar detector. This project is named the SciBar Cosmic Ray Telescope (SciCRT). The main aims of the SciCRT project are to observe solar neutrons to study the mechanism of ion acceleration on the surface of the sun and to monitor the anisotropy of galactic cosmic-ray muons. The SciBar detector, a fully active tracker, is composed of 14,848 scintillator bars, whose dimension is 300 cm × 2.5 cm × 1.3 cm. The structure of the detector enables us to obtain the particle trajectory and its total deposited energy. This information is useful for the energy reconstruction of primary neutrons and particle identification. The total volume of the detector is 3.0 m × 3.0 m × 1.7 m. Since this volume is much larger than the solar neutron telescope (SNT) in Mexico, the detection efficiency of the SciCRT for neutrons is highly enhanced. We performed the calibration of the SciCRT at Instituto Nacional de Astrofisica, Optica y Electronica (INAOE) located at 2,150 m above sea level in Mexico in 2012. We installed the SciCRT at Mt. Sierra Negra in April 2013 and calibrated this detector in May and August 2013. We started continuous observation in March 2014. In this paper, we report the detector performance as a solar neutron telescope and the current status of the SciCRT.

  4. Development and initial evaluation of the SCI-FI/AT.

    PubMed

    Jette, Alan M; Slavin, Mary D; Ni, Pengsheng; Kisala, Pamela A; Tulsky, David S; Heinemann, Allen W; Charlifue, Susie; Tate, Denise G; Fyffe, Denise; Morse, Leslie; Marino, Ralph; Smith, Ian; Williams, Steve

    2015-05-01

    To describe the domain structure and calibration of the Spinal Cord Injury Functional Index for samples using Assistive Technology (SCI-FI/AT) and report the initial psychometric properties of each domain. Cross sectional survey followed by computerized adaptive test (CAT) simulations. Inpatient and community settings. A sample of 460 adults with traumatic spinal cord injury (SCI) stratified by level of injury, completeness of injury, and time since injury. None SCI-FI/AT RESULTS: Confirmatory factor analysis (CFA) and Item response theory (IRT) analyses identified 4 unidimensional SCI-FI/AT domains: Basic Mobility (41 items) Self-care (71 items), Fine Motor Function (35 items), and Ambulation (29 items). High correlations of full item banks with 10-item simulated CATs indicated high accuracy of each CAT in estimating a person's function, and there was high measurement reliability for the simulated CAT scales compared with the full item bank. SCI-FI/AT item difficulties in the domains of Self-care, Fine Motor Function, and Ambulation were less difficult than the same items in the original SCI-FI item banks. With the development of the SCI-FI/AT, clinicians and investigators have available multidimensional assessment scales that evaluate function for users of AT to complement the scales available in the original SCI-FI.

  5. Opening Comments: SciDAC 2008

    NASA Astrophysics Data System (ADS)

    Strayer, Michael

    2008-07-01

    Welcome to Seattle and the 2008 SciDAC Conference. This conference, the fourth in the series, is a continuation of the PI meetings we first began under SciDAC-1. I would like to start by thanking the organizing committee, and Rick Stevens in particular, for organizing this year's meeting. This morning I would like to look briefly at SciDAC, to give you a brief history of SciDAC and also look ahead to see where we plan to go over the next few years. I think the best description of SciDAC, at least the simulation part, comes from a quote from Dr Ray Orbach, DOE's Under Secretary for Science and Director of the Office of Science. In an interview that appeared in the SciDAC Review magazine, Dr Orbach said, `SciDAC is unique in the world. There isn't any other program like it anywhere else, and it has the remarkable ability to do science by bringing together physical scientists, mathematicians, applied mathematicians, and computer scientists who recognize that computation is not something you do at the end, but rather it needs to be built into the solution of the very problem that one is addressing'. Of course, that is extended not just to physical scientists, but also to biological scientists. This is a theme of computational science, this partnership among disciplines, which goes all the way back to the early 1980s and Ken Wilson. It's a unique thread within the Department of Energy. SciDAC-1, launched around the turn of the millennium, created a new generation of scientific simulation codes. It advocated building out mathematical and computing system software in support of science and a new collaboratory software environment for data. The original concept for SciDAC-1 had topical centers for the execution of the various science codes, but several corrections and adjustments were needed. The ASCR scientific computing infrastructure was also upgraded, providing the hardware facilities for the program. The computing facility that we had at that time was the big 3

  6. The Implementation Challenge and the Learning Health System for SCI Initiative.

    PubMed

    Stucki, Gerold; Bickenbach, Jerome

    2017-02-01

    The paper introduces the special issue by linking the International Spinal Cord Injury (InSCI) Community Survey study to the Learning Health System for SCI Initiative (LHS-SCI). The LHS-SCI was designed to respond to the implementation challenge of bringing about policy reform in light of the targeted policy recommendations of World Health Organization's International Perspectives on SCI report as well as the call for action of WHO's Global Disability Action Plan. The paper reviews the components of LHS-SCI relevant to internationally comparable information, a theory of change to guide for action, and the tools for evidence-informed policy. The interplay between persons, their health needs, and the societal response to those needs provides the foundation for the organization of the LHS-SCI Initiative. Moreover, as the other articles in this special issue describe in detail, the rationale, conceptualization, and study design of the InSCI study are also informed by the rationale, and mission, of the LHS for SCI Initiative. The LHS-SCI, and the implementation challenge that motivates it, is responsible for the design of the InSCI study and the overall mission of LHS-SCI to continuously improve the lived experience of people living with SCI around the world through an international evidence- and rights-informed research and policy reform effort.

  7. Development and initial evaluation of the SCI-FI/AT

    PubMed Central

    Jette, Alan M.; Slavin, Mary D.; Ni, Pengsheng; Kisala, Pamela A.; Tulsky, David S.; Heinemann, Allen W.; Charlifue, Susie; Tate, Denise G.; Fyffe, Denise; Morse, Leslie; Marino, Ralph; Smith, Ian; Williams, Steve

    2015-01-01

    Objectives To describe the domain structure and calibration of the Spinal Cord Injury Functional Index for samples using Assistive Technology (SCI-FI/AT) and report the initial psychometric properties of each domain. Design Cross sectional survey followed by computerized adaptive test (CAT) simulations. Setting Inpatient and community settings. Participants A sample of 460 adults with traumatic spinal cord injury (SCI) stratified by level of injury, completeness of injury, and time since injury. Interventions None Main outcome measure SCI-FI/AT Results Confirmatory factor analysis (CFA) and Item response theory (IRT) analyses identified 4 unidimensional SCI-FI/AT domains: Basic Mobility (41 items) Self-care (71 items), Fine Motor Function (35 items), and Ambulation (29 items). High correlations of full item banks with 10-item simulated CATs indicated high accuracy of each CAT in estimating a person's function, and there was high measurement reliability for the simulated CAT scales compared with the full item bank. SCI-FI/AT item difficulties in the domains of Self-care, Fine Motor Function, and Ambulation were less difficult than the same items in the original SCI-FI item banks. Conclusion With the development of the SCI-FI/AT, clinicians and investigators have available multidimensional assessment scales that evaluate function for users of AT to complement the scales available in the original SCI-FI. PMID:26010975

  8. Exercise therapy and recovery after SCI: evidence that shows early intervention improves recovery of function

    PubMed Central

    Brown, AK; Woller, SA; Moreno, G; Grau, JW; Hook, MA

    2011-01-01

    Study design This was designed as an experimental study. Objectives Locomotor training is one of the most effective strategies currently available for facilitating recovery of function after an incomplete spinal cord injury (SCI). However, there is still controversy regarding the timing of treatment initiation for maximal recovery benefits. To address this issue, the present study compares the effects of exercise initiated in the acute and secondary phase of SCI. Setting Texas A&M University, College Station, TX, USA. Methods Rats received a moderate spinal contusion injury and began an exercise program 1 (D1-EX) or 8 days (D8-EX) later. They were individually placed into transparent exercise balls for 60 min per day, for 14 consecutive days. Control rats were placed in exercise balls that were rendered immobile. Motor and sensory recovery was assessed for 28 days after injury. Results The D1-EX rats recovered significantly more locomotor function (BBB scale) than controls and D8-EX rats. Moreover, analyses revealed that rats in the D8-EX group had significantly lower tactile reactivity thresholds compared with control and D1-EX rats, and symptoms of allodynia were not reversed by exercise. Rats in the D8-EX group also had significantly larger areas of damage across spinal sections caudal to the injury center compared with the D1-EX group. Conclusion These results indicate that implementing an exercise regimen in the acute phase of SCI maximizes the potential for recovery of function. PMID:21242998

  9. Orgasm and SCI: what do we know?

    PubMed

    Alexander, Marcalee; Marson, Lesley

    2018-06-01

    narrative review OBJECTIVES: To determine the percentage of persons with SCI able to achieve orgasm and ejaculation, the associations between ejaculation and orgasm and the subjective and autonomic findings during these events, and the potential benefits with regards to spasticity. Two American medical centers METHODS: Data bases were searched for the terms orgasm and SCI and ejaculation and SCI. Search criteria were human studies published in English from 1990 to 12/2/2016. Approximately 50% of sexually active men and women report orgasmic ability after SCI. There is a relative inability of persons with complete lower motor neuron injuries affecting the sacral segments to achieve orgasm. Time to orgasm is longer in persons with SCIs than able-bodied (AB) persons. With orgasm, elevated blood pressure (BP) occurs after SCI in a similar fashion to AB persons. With penile vibratory stimulation and electroejaculation, BP elevation is common and prophylaxis is recommended in persons with injuries at T6 and above. Dry orgasm occurs approximately 13% of times in males. Midodrine, vibratory stimulation, clitoral vacuum suction, and 4-aminopyridine may improve orgasmic potential. Depending on level and severity of injury, persons with SCIs can achieve orgasm. Sympathetically mediated changes occur during sexual response with culmination at orgasm. Future research should address benefits of orgasm. Additionally, inherent biases associated with studying orgasm must be considered.

  10. Glassy selenium at high pressure: Le Chatelier's principle still works

    NASA Astrophysics Data System (ADS)

    Brazhkin, V. V.; Tsiok, O. B.

    2017-10-01

    Selenium is the only easily vitrified elementary substance. Numerous experimental studies of glassy Se (g -Se) at high pressures show a large spread in the data on the compressibility and electrical resistivity of g -Se. Furthermore, H. Liu et al. [Proc. Natl. Acad. Sci. USA 105, 13229 (2008), 10.1073/pnas.0806857105] have arrived at the surprising conclusion that the volume of glass increases during pressure-induced crystallization. We have performed high-precision measurements of the specific volume and electrical resistivity of glassy selenium (g -Se) at high hydrostatic pressures up to 9 GPa. The measured bulk modulus at normal pressure is B =(9.0 5 ±0.15 ) GPa and its pressure derivative is BP'=6.4 ±0.2 . In the pressure range P <3 GPa, glassy selenium has an anomalously large negative second derivative of the bulk modulus. The electrical resistivity of g -Se decreases almost exponentially with increasing pressure and reaches 20 Ω cm at a pressure of 8.75 GPa. The inelastic behavior and weak relaxation of the volume for g -Se begin at pressures above 3.5 GPa; the volume and logarithm of the electrical resistivity relax significantly (logarithmically with the time) at pressures above 8 GPa. Bulk measurements certainly indicate that the volume of g -Se glass in the crystallization pressure range is larger than the volumes of both appearing crystalline phases (by 2% and 4%). Therefore, the "volume expansion phenomenon" suggested in [H. Liu et al., Proc. Natl. Acad. Sci. USA 105, 13229 (2008), 10.1073/pnas.0806857105] is not observed, and the pressure-induced crystallization of glassy selenium is consistent with the laws of thermodynamics.

  11. Intracellular transport and sorting of mutant human proinsulins that fail to form hexamers

    PubMed Central

    1991-01-01

    Human proinsulin and insulin oligomerize to form dimers and hexamers. It has been suggested that the ability of prohormones to self associate and form aggregates may be responsible for the sorting process at the trans-Golgi. To examine whether insulin oligomerization is required for proper sorting into regulated storage granules, we have constructed point mutations in human insulin B chain that have been previously shown to prevent formation of insulin hexamers (Brange, J., U. Ribel, J. F. Hansen, G. Dodson, M. T. Hansen, S. Havelund, S. G. Melberg, F. Norris, K. Norris, L. Snel, A. R. Sorensen, and H. O. Voight. 1988. Nature [Lond.]. 333:679-682). One mutant (B10His----Asp) allows formation of dimers but not hexamers and the other (B9Ser----Asp) prevents formation of both dimers and hexamers. The mutants were transfected into the mouse pituitary AtT-20 cells, and their ability to be sorted into regulated secretory granules was compared to wild-type insulin. We found that while B10His----Asp is sorted somewhat less efficiently than wild-type insulin as reported previously (Carroll, R. J., R. E. Hammer, S. J. Chan, H. H. Swift, A. H. Rubenstein, and D. F. Steiner. 1988. Proc. Natl. Acad. Sci. USA. 85:8943-8947; Gross, D. J., P. A. Halban, C. R. Kahn, G. C. Weir, and L. Villa-Kumaroff. 1989. Proc. Natl. Acad. Sci. USA. 86:4107-4111). B9Ser----Asp is targeted to granules as efficiently as wild-type insulin. These results indicate that self association of proinsulin into hexamers is not required for its targeting to the regulated secretory pathway. PMID:2040652

  12. Intracellular transport and sorting of mutant human proinsulins that fail to form hexamers.

    PubMed

    Quinn, D; Orci, L; Ravazzola, M; Moore, H P

    1991-06-01

    Human proinsulin and insulin oligomerize to form dimers and hexamers. It has been suggested that the ability of prohormones to self associate and form aggregates may be responsible for the sorting process at the trans-Golgi. To examine whether insulin oligomerization is required for proper sorting into regulated storage granules, we have constructed point mutations in human insulin B chain that have been previously shown to prevent formation of insulin hexamers (Brange, J., U. Ribel, J. F. Hansen, G. Dodson, M. T. Hansen, S. Havelund, S. G. Melberg, F. Norris, K. Norris, L. Snel, A. R. Sorensen, and H. O. Voight. 1988. Nature [Lond.]. 333:679-682). One mutant (B10His----Asp) allows formation of dimers but not hexamers and the other (B9Ser----Asp) prevents formation of both dimers and hexamers. The mutants were transfected into the mouse pituitary AtT-20 cells, and their ability to be sorted into regulated secretory granules was compared to wild-type insulin. We found that while B10His----Asp is sorted somewhat less efficiently than wild-type insulin as reported previously (Carroll, R. J., R. E. Hammer, S. J. Chan, H. H. Swift, A. H. Rubenstein, and D. F. Steiner. 1988. Proc. Natl. Acad. Sci. USA. 85:8943-8947; Gross, D. J., P. A. Halban, C. R. Kahn, G. C. Weir, and L. Villa-Kumaroff. 1989. Proc. Natl. Acad. Sci. USA. 86:4107-4111). B9Ser----Asp is targeted to granules as efficiently as wild-type insulin. These results indicate that self association of proinsulin into hexamers is not required for its targeting to the regulated secretory pathway.

  13. Thermodynamic phase transitions for Pomeau-Manneville maps

    NASA Astrophysics Data System (ADS)

    Venegeroles, Roberto

    2012-08-01

    We study phase transitions in the thermodynamic description of Pomeau-Manneville intermittent maps from the point of view of infinite ergodic theory, which deals with diverging measure dynamical systems. For such systems, we use a distributional limit theorem to provide both a powerful tool for calculating thermodynamic potentials as also an understanding of the dynamic characteristics at each instability phase. In particular, topological pressure and Rényi entropy are calculated exactly for such systems. Finally, we show the connection of the distributional limit theorem with non-Gaussian fluctuations of the algorithmic complexity proposed by Gaspard and Wang [Proc. Natl. Acad. Sci. USA10.1073/pnas.85.13.4591 85, 4591 (1988)].

  14. Default taxonomy: Ernst Mayr's view of the microbial world

    NASA Technical Reports Server (NTRS)

    Woese, C. R.

    1998-01-01

    This perspective is a response to a taxonomic proposal by E. Mayr ["Two empires or three?" (1998) Proc. Natl. Acad. Sci. USA 95, 9720-9723]. Mayr has suggested that the now accepted classification of life into three primary domains, Archaea, Bacteria, and Eucarya-originally proposed by myself and others--be abandoned in favor of the earlier Prokaryote-Eukaryote classification. Although the matter appears a taxonomic quibble, it is not that simple. At issue here are differing views as to the nature of biological classification, which are underlain by differing views as to what biology is and will be--matters of concern to all biologists.

  15. Maximal Fluctuations of Confined Actomyosin Gels: Dynamics of the Cell Nucleus.

    PubMed

    Rupprecht, J-F; Singh Vishen, A; Shivashankar, G V; Rao, M; Prost, J

    2018-03-02

    We investigate the effect of stress fluctuations on the stochastic dynamics of an inclusion embedded in a viscous gel. We show that, in nonequilibrium systems, stress fluctuations give rise to an effective attraction towards the boundaries of the confining domain, which is reminiscent of an active Casimir effect. We apply this generic result to the dynamics of deformations of the cell nucleus, and we demonstrate the appearance of a fluctuation maximum at a critical level of activity, in agreement with recent experiments [E. Makhija, D. S. Jokhun, and G. V. Shivashankar, Proc. Natl. Acad. Sci. U.S.A. 113, E32 (2016)PNASA60027-842410.1073/pnas.1513189113].

  16. Preface: SciDAC 2005

    NASA Astrophysics Data System (ADS)

    Mezzacappa, Anthony

    2005-01-01

    On 26-30 June 2005 at the Grand Hyatt on Union Square in San Francisco several hundred computational scientists from around the world came together for what can certainly be described as a celebration of computational science. Scientists from the SciDAC Program and scientists from other agencies and nations were joined by applied mathematicians and computer scientists to highlight the many successes in the past year where computation has led to scientific discovery in a variety of fields: lattice quantum chromodynamics, accelerator modeling, chemistry, biology, materials science, Earth and climate science, astrophysics, and combustion and fusion energy science. Also highlighted were the advances in numerical methods and computer science, and the multidisciplinary collaboration cutting across science, mathematics, and computer science that enabled these discoveries. The SciDAC Program was conceived and funded by the US Department of Energy Office of Science. It is the Office of Science's premier computational science program founded on what is arguably the perfect formula: the priority and focus is science and scientific discovery, with the understanding that the full arsenal of `enabling technologies' in applied mathematics and computer science must be brought to bear if we are to have any hope of attacking and ultimately solving today's computational Grand Challenge problems. The SciDAC Program has been in existence for four years, and many of the computational scientists funded by this program will tell you that the program has given them the hope of addressing their scientific problems in full realism for the very first time. Many of these scientists will also tell you that SciDAC has also fundamentally changed the way they do computational science. We begin this volume with one of DOE's great traditions, and core missions: energy research. As we will see, computation has been seminal to the critical advances that have been made in this arena. Of course, to

  17. Spontaneous Transition of Turbulent Flames to Detonations in Unconfined Media

    DTIC Science & Technology

    2011-06-07

    1] M. Berthelot and P. Vieille, Compt. Rend. Acad. Sci. 93, 18 (1881). [2] E. Mallard and H.L. le Chatelier , Compt. Rend. Acad. Sci. 93, 145 (1881...or with pre-existing shocks. It remains unclear, however, whether DDT can occur in unconfined media. Here we show, through first- principles direct...converting fuel into product. A simplified reaction-diffusion model rep- resents stoichiometric H2-air and CH4-air mixtures under Le = 1 conditions

  18. The Aplacophora: History, Taxonomy, Phylogeny, Biogeography, and Ecology

    DTIC Science & Technology

    1992-02-01

    Great Bay.] Pp. 28-41. In: A. I. Kafanov (ed.), [ Hydrobiological research of bays and inlets of Primorye.] Far East Science Center, USSR Acad. Sci...gonadal products into the sea (Franzdn 1955; Buckland-Nicks and Chia 1989). The Neomeniomorpha have a slightly modified sperm (Scheltema et al in press...Kafanov (ed.), Hydrobiological research of bays and inlets of Primorye. Far East Science Center, USSR Acad. Sci. Vladivostok Morse, M.P. (1979). Meiomenia

  19. Length of stay and medical stability for spinal cord-injured patients on admission to an inpatient rehabilitation hospital: a comparison between a model SCI trauma center and non-SCI trauma center.

    PubMed

    Ploumis, A; Kolli, S; Patrick, M; Owens, M; Beris, A; Marino, R J

    2011-03-01

    Retrospective database review. To compare lengths of stay (LOS), pressure ulcers and readmissions to the acute care hospital of patients admitted to the inpatient rehabilitation facility (IRF) from a model spinal cord injury (SCI) trauma center or from a non-SCI acute hospital. Only sparse data exist comparing the status of patients admitted to IRF from a model SCI trauma center or from a non-SCI acute hospital. Acute care, IRF and total LOS were compared between patients transferred to IRF from the SCI center (n=78) and from non-SCI centers (n=131). The percentages of pressure ulcers on admission to IRF and transfer back to acute care were also compared. Patients admitted to IRF from the SCI trauma center (SCI TC) had significantly shorter (P=0.01) acute care LOS and total LOS compared with patients admitted from non-SCI TCs. By neurological category, acute-care LOS was less for all groups admitted from the SCI center, but statistically significant only for tetraplegia. There was no significant difference in the incidence of readmissions to acute care from IRF. More patients from non-SCI centers (34%) than SCI centers (12%) had pressure ulcers (P<0.001). Acute care in organized SCI TCs before transfer to IRF can significantly lower acute-care LOS or total LOS and incidence of pressure ulcers compared with non-SCI TCs. Patients admitted to IRF from SCI TCs are no more likely to be sent back to an acute hospital than those from non-SCI TCs.

  20. Opening Remarks: SciDAC 2007

    NASA Astrophysics Data System (ADS)

    Strayer, Michael

    2007-09-01

    Good morning. Welcome to Boston, the home of the Red Sox, Celtics and Bruins, baked beans, tea parties, Robert Parker, and SciDAC 2007. A year ago I stood before you to share the legacy of the first SciDAC program and identify the challenges that we must address on the road to petascale computing—a road E E Cummins described as `. . . never traveled, gladly beyond any experience.' Today, I want to explore the preparations for the rapidly approaching extreme scale (X-scale) generation. These preparations are the first step propelling us along the road of burgeoning scientific discovery enabled by the application of X- scale computing. We look to petascale computing and beyond to open up a world of discovery that cuts across scientific fields and leads us to a greater understanding of not only our world, but our universe. As part of the President's America Competitiveness Initiative, the ASCR Office has been preparing a ten year vision for computing. As part of this planning the LBNL together with ORNL and ANL hosted three town hall meetings on Simulation and Modeling at the Exascale for Energy, Ecological Sustainability and Global Security (E3). The proposed E3 initiative is organized around four programmatic themes: Engaging our top scientists, engineers, computer scientists and applied mathematicians; investing in pioneering large-scale science; developing scalable analysis algorithms, and storage architectures to accelerate discovery; and accelerating the build-out and future development of the DOE open computing facilities. It is clear that we have only just started down the path to extreme scale computing. Plan to attend Thursday's session on the out-briefing and discussion of these meetings. The road to the petascale has been at best rocky. In FY07, the continuing resolution provided 12% less money for Advanced Scientific Computing than either the President, the Senate, or the House. As a consequence, many of you had to absorb a no cost extension for your

  1. The Cross-Cultural Societal Response to SCI: Health and Related Systems.

    PubMed

    Pacheco, Diana; Gross-Hemmi, Mirja H

    2017-02-01

    The Learning Health System for Spinal Cord Injury (LHS-SCI) is an initiative aligned with the World Health Organization's (WHO) Global Disability Action Plan. Based on the outcomes of this initiative, countries will be able to shape their health systems to better respond to the needs of persons with SCI. This paper describes and compares the macroeconomic situation and societal response to SCI across 27 countries from all 6 WHO regions that will participate in the LHS-SCI initiative. A concurrent mixed-methods study was conducted to identify key indicators that describe the situation of persons with SCI, the general societal response, the health and rehabilitation system, and the experience for a SCI person after discharge from inpatient rehabilitation. A strong correlation was found between the efficiency of a healthcare system and the amount a country invests in health. Higher availability of resources does not necessarily imply that unrestricted access to the healthcare system is warranted. Variations in the health systems were found for various domains of the health and rehabilitation systems. The evaluation and comparative analysis of the societal response to SCI raise the awareness of the need of more standardized data to identify current needs and gaps in the quality and access to SCI-specific health system.

  2. GeoSciML and EarthResourceML Update, 2012

    NASA Astrophysics Data System (ADS)

    Richard, S. M.; Commissionthe Management; Application Inte, I.

    2012-12-01

    CGI Interoperability Working Group activities during 2012 include deployment of services using the GeoSciML-Portrayal schema, addition of new vocabularies to support properties added in version 3.0, improvements to server software for deploying services, introduction of EarthResourceML v.2 for mineral resources, and collaboration with the IUSS on a markup language for soils information. GeoSciML and EarthResourceML have been used as the basis for the INSPIRE Geology and Mineral Resources specifications respectively. GeoSciML-Portrayal is an OGC GML simple-feature application schema for presentation of geologic map unit, contact, and shear displacement structure (fault and ductile shear zone) descriptions in web map services. Use of standard vocabularies for geologic age and lithology enables map services using shared legends to achieve visual harmonization of maps provided by different services. New vocabularies have been added to the collection of CGI vocabularies provided to support interoperable GeoSciML services, and can be accessed through http://resource.geosciml.org. Concept URIs can be dereferenced to obtain SKOS rdf or html representations using the SISSVoc vocabulary service. New releases of the FOSS GeoServer application greatly improve support for complex XML feature schemas like GeoSciML, and the ArcGIS for INSPIRE extension implements similar complex feature support for ArcGIS Server. These improved server implementations greatly facilitate deploying GeoSciML services. EarthResourceML v2 adds features for information related to mining activities. SoilML provides an interchange format for soil material, soil profile, and terrain information. Work is underway to add GeoSciML to the portfolio of Open Geospatial Consortium (OGC) specifications.

  3. ComSciCon: The Communicating Science Workshop for Graduate Students

    NASA Astrophysics Data System (ADS)

    Sanders, Nathan; Drout, Maria; Kohler, Susanna; Cook, Ben; ComSciCon Leadership Team

    2018-01-01

    ComSciCon (comscicon.com) is a national workshop series organized by graduate students, for graduate students, focused on leadership and training in science communication. Our goal is to empower young scientists to become leaders in their field, propagating appreciation and understanding of research results to broad and diverse audiences. ComSciCon attendees meet and interact with professional communicators, build lasting networks with graduate students in all fields of science and engineering from around the country, and write and publish original works. ComSciCon consists of both a flagship national conference series run annually for future leaders in science communication, and a series of regional and specialized workshops organized by ComSciCon alumni nationwide. We routinely receive over 1000 applications for 50 spots in our national workshop. Since its founding in 2012, over 300 STEM graduate students have participated in the national workshop, and 23 local spin-off workshops have been organized in 10 different locations throughout the country. This year, ComSciCon is working to grow as a self-sustaining organization by launching as an independent 501(c)(3) non-profit. In this poster we will discuss the ComSciCon program and methods, our results to date, potential future collaborations between ComSciCon and AAS, and how you can become involved.

  4. Clinical interpretation of the Spinal Cord Injury Functional Index (SCI-FI).

    PubMed

    Fyffe, Denise; Kalpakjian, Claire Z; Slavin, Mary; Kisala, Pamela; Ni, Pengsheng; Kirshblum, Steven C; Tulsky, David S; Jette, Alan M

    2016-09-01

    To provide validation of functional ability levels for the Spinal Cord Injury - Functional Index (SCI-FI). Cross-sectional. Inpatient rehabilitation hospital and community settings. A sample of 855 individuals with traumatic spinal cord injury enrolled in 6 rehabilitation centers participating in the National Spinal Cord Injury Model Systems Network. Not Applicable. Spinal Cord Injury-Functional Index (SCI-FI). Cluster analyses identified three distinct groups that represent low, mid-range and high SCI-FI functional ability levels. Comparison of clusters on personal and other injury characteristics suggested some significant differences between groups. These results strongly support the use of SCI-FI functional ability levels to document the perceived functional abilities of persons with SCI. Results of the cluster analysis suggest that the SCI-FI functional ability levels capture function by injury characteristics. Clinical implications regarding tracking functional activity trajectories during follow-up visits are discussed.

  5. Overview of the Spinal Cord Injury--Quality of Life (SCI-QOL) measurement system.

    PubMed

    Tulsky, David S; Kisala, Pamela A; Victorson, David; Tate, Denise G; Heinemann, Allen W; Charlifue, Susan; Kirshblum, Steve C; Fyffe, Denise; Gershon, Richard; Spungen, Ann M; Bombardier, Charles H; Dyson-Hudson, Trevor A; Amtmann, Dagmar; Kalpakjian, Claire Z; Choi, Seung W; Jette, Alan M; Forchheimer, Martin; Cella, David

    2015-05-01

    The Spinal Cord Injury--Quality of Life (SCI-QOL) measurement system was developed to address the shortage of relevant and psychometrically sound patient reported outcome (PRO) measures available for clinical care and research in spinal cord injury (SCI) rehabilitation. Using a computer adaptive testing (CAT) approach, the SCI-QOL builds on the Patient Reported Outcomes Measurement Information System (PROMIS) and the Quality of Life in Neurological Disorders (Neuro-QOL) initiative. This initial manuscript introduces the background and development of the SCI-QOL measurement system. Greater detail is presented in the additional manuscripts of this special issue. Classical and contemporary test development methodologies were employed. Qualitative input was obtained from individuals with SCI and clinicians through interviews, focus groups, and cognitive debriefing. Item pools were field tested in a multi-site sample (n=877) and calibrated using item response theory methods. Initial reliability and validity testing was performed in a new sample of individuals with traumatic SCI (n=245). Five Model SCI System centers and one Department of Veterans Affairs Medical Center across the United States. Adults with traumatic SCI. n/a n/a The SCI-QOL consists of 19 item banks, including the SCI-Functional Index banks, and 3 fixed-length scales measuring physical, emotional, and social aspects of health-related QOL (HRQOL). The SCI-QOL measurement system consists of psychometrically sound measures for individuals with SCI. The manuscripts in this special issue provide evidence of the reliability and initial validity of this measurement system. The SCI-QOL also links to other measures designed for a general medical population.

  6. Sci-Hub provides access to nearly all scholarly literature

    PubMed Central

    Romero, Ariel Rodriguez; Levernier, Jacob G; Munro, Thomas Anthony; McLaughlin, Stephen Reid; Greshake Tzovaras, Bastian

    2018-01-01

    The website Sci-Hub enables users to download PDF versions of scholarly articles, including many articles that are paywalled at their journal’s site. Sci-Hub has grown rapidly since its creation in 2011, but the extent of its coverage has been unclear. Here we report that, as of March 2017, Sci-Hub’s database contains 68.9% of the 81.6 million scholarly articles registered with Crossref and 85.1% of articles published in toll access journals. We find that coverage varies by discipline and publisher, and that Sci-Hub preferentially covers popular, paywalled content. For toll access articles, we find that Sci-Hub provides greater coverage than the University of Pennsylvania, a major research university in the United States. Green open access to toll access articles via licit services, on the other hand, remains quite limited. Our interactive browser at https://greenelab.github.io/scihub allows users to explore these findings in more detail. For the first time, nearly all scholarly literature is available gratis to anyone with an Internet connection, suggesting the toll access business model may become unsustainable. PMID:29424689

  7. Sensitivity of the SCI-FI/AT in Individuals With Traumatic Spinal Cord Injury.

    PubMed

    Keeney, Tamra; Slavin, Mary; Kisala, Pamela; Ni, Pengsheng; Heinemann, Allen W; Charlifue, Susan; Fyffe, Denise C; Marino, Ralph J; Morse, Leslie R; Worobey, Lynn A; Tate, Denise; Rosenblum, David; Zafonte, Ross; Tulsky, David; Jette, Alan M

    2018-03-31

    To examine the ability of the Spinal Cord Injury-Functional Index/Assistive Technology (SCI-FI/AT) measure to detect change in persons with spinal cord injury (SCI). Multisite longitudinal (12-mo follow-up) study. Nine SCI Model Systems programs. Adults (N=165) with SCI enrolled in the SCI Model Systems database. Not applicable. SCI-FI/AT computerized adaptive test (CAT) (Basic Mobility, Self-Care, Fine Motor Function, Wheelchair Mobility, and/or Ambulation domains) completed at discharge from rehabilitation and 12 months after SCI. For each domain, effect size estimates and 95% confidence intervals were calculated for subgroups with paraplegia and tetraplegia. The demographic characteristics of the sample were as follows: 46% (n=76) individuals with paraplegia, 76% (n=125) male participants, 57% (n=94) used a manual wheelchair, 38% (n=63) used a power wheelchair, 30% (n=50) were ambulatory. For individuals with paraplegia, the Basic Mobility, Self-Care, and Ambulation domains of the SCI-FI/AT detected a significantly large amount of change; in contrast, the Fine Motor Function and Wheelchair Mobility domains detected only a small amount of change. For those with tetraplegia, the Basic Mobility, Fine Motor Function, and Self-Care domains detected a small amount of change whereas the Ambulation item domain detected a medium amount of change. The Wheelchair Mobility domain for people with tetraplegia was the only SCI-FI/AT domain that did not detect significant change. SCI-FI/AT CAT item banks detected an increase in function from discharge to 12 months after SCI. The effect size estimates for the SCI-FI/AT CAT vary by domain and level of lesion. Findings support the use of the SCI-FI/AT CAT in the population with SCI and highlight the importance of multidimensional functional measures. Copyright © 2018 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.

  8. Methodology for the development and calibration of the SCI-QOL item banks.

    PubMed

    Tulsky, David S; Kisala, Pamela A; Victorson, David; Choi, Seung W; Gershon, Richard; Heinemann, Allen W; Cella, David

    2015-05-01

    To develop a comprehensive, psychometrically sound, and conceptually grounded patient reported outcomes (PRO) measurement system for individuals with spinal cord injury (SCI). Individual interviews (n=44) and focus groups (n=65 individuals with SCI and n=42 SCI clinicians) were used to select key domains for inclusion and to develop PRO items. Verbatim items from other cutting-edge measurement systems (i.e. PROMIS, Neuro-QOL) were included to facilitate linkage and cross-population comparison. Items were field tested in a large sample of individuals with traumatic SCI (n=877). Dimensionality was assessed with confirmatory factor analysis. Local item dependence and differential item functioning were assessed, and items were calibrated using the item response theory (IRT) graded response model. Finally, computer adaptive tests (CATs) and short forms were administered in a new sample (n=245) to assess test-retest reliability and stability. A calibration sample of 877 individuals with traumatic SCI across five SCI Model Systems sites and one Department of Veterans Affairs medical center completed SCI-QOL items in interview format. We developed 14 unidimensional calibrated item banks and 3 calibrated scales across physical, emotional, and social health domains. When combined with the five Spinal Cord Injury--Functional Index physical function banks, the final SCI-QOL system consists of 22 IRT-calibrated item banks/scales. Item banks may be administered as CATs or short forms. Scales may be administered in a fixed-length format only. The SCI-QOL measurement system provides SCI researchers and clinicians with a comprehensive, relevant and psychometrically robust system for measurement of physical-medical, physical-functional, emotional, and social outcomes. All SCI-QOL instruments are freely available on Assessment CenterSM.

  9. Clinical interpretation of the Spinal Cord Injury Functional Index (SCI-FI)

    PubMed Central

    Fyffe, Denise; Kalpakjian, Claire Z.; Slavin, Mary; Kisala, Pamela; Ni, Pengsheng; Kirshblum, Steven C.; Tulsky, David S.; Jette, Alan M.

    2016-01-01

    Objective: To provide validation of functional ability levels for the Spinal Cord Injury – Functional Index (SCI-FI). Design: Cross-sectional. Setting: Inpatient rehabilitation hospital and community settings. Participants: A sample of 855 individuals with traumatic spinal cord injury enrolled in 6 rehabilitation centers participating in the National Spinal Cord Injury Model Systems Network. Interventions: Not Applicable. Main Outcome Measures: Spinal Cord Injury-Functional Index (SCI-FI). Results: Cluster analyses identified three distinct groups that represent low, mid-range and high SCI-FI functional ability levels. Comparison of clusters on personal and other injury characteristics suggested some significant differences between groups. Conclusions: These results strongly support the use of SCI-FI functional ability levels to document the perceived functional abilities of persons with SCI. Results of the cluster analysis suggest that the SCI-FI functional ability levels capture function by injury characteristics. Clinical implications regarding tracking functional activity trajectories during follow-up visits are discussed. PMID:26781769

  10. Phospholamban and its Phosphorylated Form Interact Differently with Lipid Bilayers: A 31P, 2H and 13C Solid-State NMR Spectroscopic Study

    PubMed Central

    Abu-Baker, Shadi; Lorigan, Gary A.

    2008-01-01

    Phospholamban (PLB) is a 52-amino acid integral membrane protein that helps to regulate the flow of Ca2+ ions in cardiac muscle cells. Recent structural studies on the PLB pentamer and the functionally active monomer (AFA-PLB) debate whether its cytoplasmic domain, in either the phosphorylated or dephosphorylated states, is α-helical in structure as well as whether it associates with the lipid head groups [Oxenoid, K. (2005) Proc Natl. Acad. Sci. USA 102, 10870–10875, Karim, C. B. (2004) Proc. Natl. Acad. Sci. USA 101, 14437–14442, Andronesi, C.A. (2005) J. Am. Chem. Soc. 127, 12965–12974, Li, J. (2003) Biochemistry 42, 10674–10682, Metcalfe, E. E. (2005) Biochemistry 44, 4386–4396, Clayton, J. C. (2005) Biochemistry 44, 17016–17026]. Comparing the secondary structure of the PLB pentamer and its phosphorylated form (P-PLB) as well as their interaction with the lipid bilayer is crucial in order to understand its regulatory function. Therefore, in this study, the full-length wild-type (WT)-PLB and P-PLB were incorporated into 1-palmitoyl-2-oleoyl-sn-glycero-phosphocholine (POPC) phospholipid bilayers and studied utilizing solid-state NMR spectroscopy. The analysis of the 2H and 31P solid-state NMR data of PLB and P-PLB in POPC multilamellar vesicles (MLVs) indicates that a direct interaction takes place between both proteins and the phospholipid head groups. However, the interaction of P-PLB with POPC bilayers was less significant when compared to PLB. Moreover, the secondary structure using 13C=O site-specific isotopically labeled Ala15-PLB and Ala15-P-PLB in POPC bilayers suggests that this residue, located in the cytoplasmic domain, is a part of an α-helical structure for both PLB and P-PLB. PMID:17073452

  11. Genetics Home Reference: aceruloplasminemia

    MedlinePlus

    ... PubMed Harris ZL. Aceruloplasminemia. J Neurol Sci. 2003 Mar 15;207(1-2):108-9. Review. Citation ... nervous system. Ann N Y Acad Sci. 2004 Mar;1012:267-81. Review. Citation on PubMed Vassiliev ...

  12. SCI Longitudinal Aging Study: 40 Years of Research.

    PubMed

    Krause, James S; Clark, Jillian M R; Saunders, Lee L

    2015-01-01

    The Spinal Cord Injury (SCI) Longitudinal Aging Study was initiated in 1973 and has conducted 8 assessments over the past 40 years. It was designed to help rehabilitation professionals understand the life situation of people with SCI, but it has developed into the most long-standing study of aging and SCI and has resulted in over 50 publications. Our purpose was to provide a detailed history of the study, response patterns, utilization of measures, and a summary of key findings reported in the literature. Five participant samples have been incorporated over the 40 years, with enrollment in 1973, 1984, 1993 (2 samples), and 2003. A total of 2,208 participants have completed 6,001 assessments, with a particularly large number of assessments among those who are more than 40 years post injury (n = 349). The overall results have indicated changing patterns of outcomes over time as persons with SCI age, with some notable declines in participation and health. There has been a survivor effect whereby persons who are more active, well-adjusted, and healthier live longer. This study has several important features that are required for longitudinal research including (a) consistency of follow-up, (b) consistency of measures over time, (c) addition of new participant samples to counteract attrition, and (d) inclusion of a large number of individuals who have reached aging milestones unparalleled in the literature. Data from this study can inform the literature on the natural course of aging with SCI.

  13. SciServer Compute brings Analysis to Big Data in the Cloud

    NASA Astrophysics Data System (ADS)

    Raddick, Jordan; Medvedev, Dmitry; Lemson, Gerard; Souter, Barbara

    2016-06-01

    SciServer Compute uses Jupyter Notebooks running within server-side Docker containers attached to big data collections to bring advanced analysis to big data "in the cloud." SciServer Compute is a component in the SciServer Big-Data ecosystem under development at JHU, which will provide a stable, reproducible, sharable virtual research environment.SciServer builds on the popular CasJobs and SkyServer systems that made the Sloan Digital Sky Survey (SDSS) archive one of the most-used astronomical instruments. SciServer extends those systems with server-side computational capabilities and very large scratch storage space, and further extends their functions to a range of other scientific disciplines.Although big datasets like SDSS have revolutionized astronomy research, for further analysis, users are still restricted to downloading the selected data sets locally - but increasing data sizes make this local approach impractical. Instead, researchers need online tools that are co-located with data in a virtual research environment, enabling them to bring their analysis to the data.SciServer supports this using the popular Jupyter notebooks, which allow users to write their own Python and R scripts and execute them on the server with the data (extensions to Matlab and other languages are planned). We have written special-purpose libraries that enable querying the databases and other persistent datasets. Intermediate results can be stored in large scratch space (hundreds of TBs) and analyzed directly from within Python or R with state-of-the-art visualization and machine learning libraries. Users can store science-ready results in their permanent allocation on SciDrive, a Dropbox-like system for sharing and publishing files. Communication between the various components of the SciServer system is managed through SciServer‘s new Single Sign-on Portal.We have created a number of demos to illustrate the capabilities of SciServer Compute, including Python and R scripts

  14. Methodology for the development and calibration of the SCI-QOL item banks

    PubMed Central

    Tulsky, David S.; Kisala, Pamela A.; Victorson, David; Choi, Seung W.; Gershon, Richard; Heinemann, Allen W.; Cella, David

    2015-01-01

    Objective To develop a comprehensive, psychometrically sound, and conceptually grounded patient reported outcomes (PRO) measurement system for individuals with spinal cord injury (SCI). Methods Individual interviews (n = 44) and focus groups (n = 65 individuals with SCI and n = 42 SCI clinicians) were used to select key domains for inclusion and to develop PRO items. Verbatim items from other cutting-edge measurement systems (i.e. PROMIS, Neuro-QOL) were included to facilitate linkage and cross-population comparison. Items were field tested in a large sample of individuals with traumatic SCI (n = 877). Dimensionality was assessed with confirmatory factor analysis. Local item dependence and differential item functioning were assessed, and items were calibrated using the item response theory (IRT) graded response model. Finally, computer adaptive tests (CATs) and short forms were administered in a new sample (n = 245) to assess test-retest reliability and stability. Participants and Procedures A calibration sample of 877 individuals with traumatic SCI across five SCI Model Systems sites and one Department of Veterans Affairs medical center completed SCI-QOL items in interview format. Results We developed 14 unidimensional calibrated item banks and 3 calibrated scales across physical, emotional, and social health domains. When combined with the five Spinal Cord Injury – Functional Index physical function banks, the final SCI-QOL system consists of 22 IRT-calibrated item banks/scales. Item banks may be administered as CATs or short forms. Scales may be administered in a fixed-length format only. Conclusions The SCI-QOL measurement system provides SCI researchers and clinicians with a comprehensive, relevant and psychometrically robust system for measurement of physical-medical, physical-functional, emotional, and social outcomes. All SCI-QOL instruments are freely available on Assessment CenterSM. PMID:26010963

  15. Treatment of Nueropathic Pain after SCI with a Catalytic Oxidoreductant

    DTIC Science & Technology

    2016-10-01

    reducing inflammation and ROS activation acutely post-SCI in rats and mice. On-going experiments will evaluate additional outcome measures and...NF-kB signaling, and inflammation in the spinal cord acutely post-SCI We have completed approximately 100% of the animal experiments in support of this...in the spinal cord acutely post-SCI. These data are in the final analysis stages. Please see the data to date as described in the task section

  16. Dirac cone pairs in silicene induced by interface Si-Ag hybridization: A first-principles effective band study

    NASA Astrophysics Data System (ADS)

    Lian, Chao; Meng, Sheng

    2017-06-01

    Using density functional theory combined with orbital-selective band unfolding techniques, we study the effective band structure of silicene (3 ×3 )/Ag(111) (4 ×4 ) structure. Consistent with the ARPES spectra recently obtained by [Feng et al. Proc. Natl. Acad. Sci. USA 113, 14656 (2016), 10.1073/pnas.1613434114], we observe six pairs of Dirac cones near the boundary of the Brillouin zone (BZ) of Ag (1 ×1 ) , while no Dirac cone is observed inside the BZ. Furthermore, we find that these Dirac cones are induced by the interfacial Si-Ag hybridization, mainly composed of Si pz orbitals and Ag s p bands, which is intrinsically different from the Dirac cones in free-standing silicene.

  17. Prediction of the shapes of deformed nuclei by the polyspheron theory.

    PubMed

    Pauling, L

    1982-04-01

    It is pointed out that some features of the shapes of (62) (154)Sm, (68) (166)Er, and (70) (176)Yb as reported by Cooper et al. [Cooper, T., Bertozzi, W., Heisenberg, J., Kowalski, S., Turchinetz, W., Williamson, C., Cardman, L., Fivozinsky, S., Lightbody, J., Jr., & Penner, S. (1976) Phys. Rev. C 13, 1083-1094] from electron-scattering experiments agree reasonably well with the description of these nuclei, derived from the values of the rotational energy levels, as consisting of a large spherical part (essentially (132)Sn) and a cap [Pauling, L. (1969) Proc. Natl. Acad. Sci. USA 64, 807-809; Pauling, L. & Robinson, A. B. (1975) Can. J. Phys. 53, 1953-1964].

  18. Vortex dynamics and Lagrangian statistics in a model for active turbulence.

    PubMed

    James, Martin; Wilczek, Michael

    2018-02-14

    Cellular suspensions such as dense bacterial flows exhibit a turbulence-like phase under certain conditions. We study this phenomenon of "active turbulence" statistically by using numerical tools. Following Wensink et al. (Proc. Natl. Acad. Sci. U.S.A. 109, 14308 (2012)), we model active turbulence by means of a generalized Navier-Stokes equation. Two-point velocity statistics of active turbulence, both in the Eulerian and the Lagrangian frame, is explored. We characterize the scale-dependent features of two-point statistics in this system. Furthermore, we extend this statistical study with measurements of vortex dynamics in this system. Our observations suggest that the large-scale statistics of active turbulence is close to Gaussian with sub-Gaussian tails.

  19. Brownian versus Newtonian devitrification of hard-sphere glasses

    NASA Astrophysics Data System (ADS)

    Montero de Hijes, Pablo; Rosales-Pelaez, Pablo; Valeriani, Chantal; Pusey, Peter N.; Sanz, Eduardo

    2017-08-01

    In a recent molecular dynamics simulation work it has been shown that glasses composed of hard spheres crystallize via cooperative, stochastic particle displacements called avalanches [E. Sanz et al., Proc. Natl. Acad. Sci. USA 111, 75 (2014), 10.1073/pnas.1308338110]. In this Rapid Communication we investigate if such a devitrification mechanism is also present when the dynamics is Brownian rather than Newtonian. The research is motivated in part by the fact that colloidal suspensions, an experimental realization of hard-sphere systems, undergo Brownian motion. We find that Brownian hard-sphere glasses do crystallize via avalanches with very similar characteristics to those found in the Newtonian case. We briefly discuss the implications of these findings for experiments on colloids.

  20. Mouse chromosomal mapping of a murine leukemia virus integration region (Mis-1) first identified in rat thymic leukemia.

    PubMed Central

    Jolicoeur, P; Villeneuve, L; Rassart, E; Kozak, C

    1985-01-01

    We have previously identified a region of genomic DNA which constitutes the site of frequent provirus integration in rat thymomas induced by Moloney murine leukemia virus (Lemay and Jolicoeur, Proc. Natl. Acad. Sci. USA 81:38-42, 1984). This genetic locus is now designated Mis-1 (Moloney integration site). Cellular sequences homologous to Mis-1 are present in mouse DNA. Using a series of hamster-mouse somatic cell hybrids, we mapped the Mis-1 locus to mouse chromosome 15. Frequent chromosome 15 aberrations have been described in mouse thymomas. Mis-1 represents a putative new oncogene which might be involved in the initiation or maintenance or both of these neoplasms. Images PMID:4068142

  1. Prediction of the shapes of deformed nuclei by the polyspheron theory

    PubMed Central

    Pauling, Linus

    1982-01-01

    It is pointed out that some features of the shapes of 62154Sm, 68166Er, and 70176Yb as reported by Cooper et al. [Cooper, T., Bertozzi, W., Heisenberg, J., Kowalski, S., Turchinetz, W., Williamson, C., Cardman, L., Fivozinsky, S., Lightbody, J., Jr., & Penner, S. (1976) Phys. Rev. C 13, 1083-1094] from electron-scattering experiments agree reasonably well with the description of these nuclei, derived from the values of the rotational energy levels, as consisting of a large spherical part (essentially 132Sn) and a cap [Pauling, L. (1969) Proc. Natl. Acad. Sci. USA 64, 807-809; Pauling, L. & Robinson, A. B. (1975) Can. J. Phys. 53, 1953-1964]. Images PMID:16593183

  2. On the ability of the Viking gas chromatograph-mass spectrometer to detect organic matter.

    PubMed

    Biemann, Klaus

    2007-06-19

    A recent paper by Navarro-Gonzalez et al. [Navarro-Gonzalez R, Navarro KF, de la Rosa J, Iniguez E, Molina P, Miranda LD, Morales P, Cienfuegos E, Coll P, Raulin F, et al. (2006) Proc Natl Acad Sci USA 103:16089-16094] claims to show that the Viking GCMS (gas chromatograph-mass spectrometer) experiment, which carried out a search for organic matter at the surface of Mars in 1976, "may have been blind to low levels of organics." To rebut this assertion, the Viking experiment, test data, and results on Mars are reviewed, and the fallacies in the design, execution, and interpretation of the new experiments presented by Navarro-Gonzalez et al. are critically examined.

  3. An analysis of quantum coherent solar photovoltaic cells

    NASA Astrophysics Data System (ADS)

    Kirk, A. P.

    2012-02-01

    A new hypothesis (Scully et al., Proc. Natl. Acad. Sci. USA 108 (2011) 15097) suggests that it is possible to break the statistical physics-based detailed balance-limiting power conversion efficiency and increase the power output of a solar photovoltaic cell by using “noise-induced quantum coherence” to increase the current. The fundamental errors of this hypothesis are explained here. As part of this analysis, we show that the maximum photogenerated current density for a practical solar cell is a function of the incident spectrum, sunlight concentration factor, and solar cell energy bandgap and thus the presence of quantum coherence is irrelevant as it is unable to lead to increased current output from a solar cell.

  4. Differential conductance and defect states in the heavy-fermion superconductor CeCoIn 5

    DOE PAGES

    John S. Van Dyke; Davis, James C.; Morr, Dirk K.

    2016-01-22

    We demonstrate that the electronic band structure extracted from quasiparticle interference spectroscopy [Nat. Phys. 9, 468 (2013)] and the theoretically computed form of the superconducting gaps [Proc. Natl. Acad. Sci. USA 111, 11663 (2014)] can be used to understand the dI/dV line shape measured in the normal and superconducting state of CeCoIn5 [Nat. Phys. 9, 474 (2013)]. In particular, the dI/dV line shape, and the spatial structure of defect-induced impurity states, reflects the existence of multiple superconducting gaps of d x2–y2 symmetry. As a result, these results strongly support a recently proposed microscopic origin of the unconventional superconducting state.

  5. Using selection bias to explain the observed structure of Internet diffusions

    PubMed Central

    Golub, Benjamin; Jackson, Matthew O.

    2010-01-01

    Recently, large datasets stored on the Internet have enabled the analysis of processes, such as large-scale diffusions of information, at new levels of detail. In a recent study, Liben-Nowell and Kleinberg [(2008) Proc Natl Acad Sci USA 105:4633–4638] observed that the flow of information on the Internet exhibits surprising patterns whereby a chain letter reaches its typical recipient through long paths of hundreds of intermediaries. We show that a basic Galton–Watson epidemic model combined with the selection bias of observing only large diffusions suffices to explain these patterns. Thus, selection biases of which data we observe can radically change the estimation of classical diffusion processes. PMID:20534439

  6. Circulating sclerostin is elevated in short-term and reduced in long-term SCI

    PubMed Central

    Battaglino, Ricardo A.; Sudhakar, Supreetha; Lazzari, Antonio; Garshick, Eric; Zafonte, Ross; Morse, Leslie R.

    2012-01-01

    Spinal cord injury (SCI) causes profound bone loss due to muscle paralysis resulting in the inability to walk. Sclerostin, a Wnt signaling pathway antagonist produced by osteocytes, is a potent inhibitor of bone formation. Short-term studies in rodent models have demonstrated increased sclerostin in response to mechanical unloading that is reversed with reloading. Although sclerostin inhibition has been proposed as a potential therapy for bone loss, it is not known if sclerostin levels vary with duration of SCI in humans. We analyzed circulating sclerostin in 155 men with varying degrees of SCI who were 1 year or more post-injury. We report that sclerostin levels are greatest in subjects with short-term SCI (≤ 5 years post-injury) and decrease significantly over the first 5 years post-injury. There was no association between sclerostin and injury duration in subjects with long-term SCI (> 5 years post-injury). In subjects with long-term SCI, sclerostin levels were positively associated with lower extremity bone density and bone mineral content. These data suggest that sclerostin levels in SCI are initially increased after SCI in response to mechanical unloading. This response is time-limited and as bone loss progresses, circulating sclerostin is lowest in subjects with severe osteoporosis. These findings support a dual role for sclerostin after SCI: a therapeutic target in acute SCI, and a biomarker of osteoporosis severity in chronic SCI. PMID:22575440

  7. Astronomy Popularization via Sci-fi Movies

    NASA Astrophysics Data System (ADS)

    Li, Qingkang

    2015-08-01

    It is astronomers’ duty to let more and more young people know a bit astronomy and be interested in astronomy and appreciate the beauty and great achievements in astronomy. One of the most effective methods to popularize astronomy to young people nowadays might be via enjoying some brilliant sci-fi movies related to astronomy with some guidance from astronomers. Firstly, we will introduce the basic information of our selective course “Appreciation of Sci-fi Movies in Astronomy” for the non-major astronomy students in our University, which is surely unique in China, then we will show its effect on astronomy popularization based on several rounds of teaching.

  8. Sci-Hub provides access to nearly all scholarly literature.

    PubMed

    Himmelstein, Daniel S; Romero, Ariel Rodriguez; Levernier, Jacob G; Munro, Thomas Anthony; McLaughlin, Stephen Reid; Greshake Tzovaras, Bastian; Greene, Casey S

    2018-03-01

    The website Sci-Hub enables users to download PDF versions of scholarly articles, including many articles that are paywalled at their journal's site. Sci-Hub has grown rapidly since its creation in 2011, but the extent of its coverage has been unclear. Here we report that, as of March 2017, Sci-Hub's database contains 68.9% of the 81.6 million scholarly articles registered with Crossref and 85.1% of articles published in toll access journals. We find that coverage varies by discipline and publisher, and that Sci-Hub preferentially covers popular, paywalled content. For toll access articles, we find that Sci-Hub provides greater coverage than the University of Pennsylvania, a major research university in the United States. Green open access to toll access articles via licit services, on the other hand, remains quite limited. Our interactive browser at https://greenelab.github.io/scihub allows users to explore these findings in more detail. For the first time, nearly all scholarly literature is available gratis to anyone with an Internet connection, suggesting the toll access business model may become unsustainable. © 2018, Himmelstein et al.

  9. Women's Sexual Health and Reproductive Function After SCI.

    PubMed

    Courtois, Frédérique; Alexander, Marcalee; McLain, Amie B Jackson

    2017-01-01

    Sexual function and to a lesser extent reproduction are often disrupted in women with spinal cord injuries (SCI), who must be educated to better understand their sexual and reproductive health. Women with SCI are sexually active; they can use psychogenic or reflexogenic stimulation to obtain sexual pleasure and orgasm. Treatment should consider a holistic approach using autonomic standards to describe remaining sexual function and to assess both genital function and psychosocial factors. Assessment of genital function should include thoracolumbar dermatomes, vulvar sensitivity (touch, pressure, vibration), and sacral reflexes. Self-exploration should include not only clitoral stimulation, but also stimulation of the vagina (G spot), cervix, and nipples conveyed by different innervation sources. Treatments may consider PDE5 inhibitors and flibanserin on an individual basis, and secondary consequences of SCI should address concerns with spasticity, pain, incontinence, and side effects of medications. Psychosocial issues must be addressed as possible contributors to sexual dysfunctions (eg, lower self-esteem, past sexual history, depression, dating habits). Pregnancy is possible for women with SCI; younger age at the time of injury and at the time of pregnancy being significant predictors of successful pregnancy, along with marital status, motor score, mobility, and occupational scores. Pregnancy may decrease the level of functioning (eg, self-care, ambulation, upper-extremity tasks), may involve complications (eg, decubitus ulcers, weight gain, urological complications), and must be monitored for postural hypotension and autonomic dysreflexia. Taking into consideration the physical and psychosocial determinants of sexuality and childbearing allows women with SCI to achieve positive sexual and reproductive health.

  10. Women's Sexual Health and Reproductive Function After SCI

    PubMed Central

    Alexander, Marcalee; McLain, Amie B. (Jackson)

    2017-01-01

    Sexual function and to a lesser extent reproduction are often disrupted in women with spinal cord injuries (SCI), who must be educated to better understand their sexual and reproductive health. Women with SCI are sexually active; they can use psychogenic or reflexogenic stimulation to obtain sexual pleasure and orgasm. Treatment should consider a holistic approach using autonomic standards to describe remaining sexual function and to assess both genital function and psychosocial factors. Assessment of genital function should include thoracolumbar dermatomes, vulvar sensitivity (touch, pressure, vibration), and sacral reflexes. Self-exploration should include not only clitoral stimulation, but also stimulation of the vagina (G spot), cervix, and nipples conveyed by different innervation sources. Treatments may consider PDE5 inhibitors and flibanserin on an individual basis, and secondary consequences of SCI should address concerns with spasticity, pain, incontinence, and side effects of medications. Psychosocial issues must be addressed as possible contributors to sexual dysfunctions (eg, lower self-esteem, past sexual history, depression, dating habits). Pregnancy is possible for women with SCI; younger age at the time of injury and at the time of pregnancy being significant predictors of successful pregnancy, along with marital status, motor score, mobility, and occupational scores. Pregnancy may decrease the level of functioning (eg, self-care, ambulation, upper-extremity tasks), may involve complications (eg, decubitus ulcers, weight gain, urological complications), and must be monitored for postural hypotension and autonomic dysreflexia. Taking into consideration the physical and psychosocial determinants of sexuality and childbearing allows women with SCI to achieve positive sexual and reproductive health. PMID:29339874

  11. ScienceDirect through SciVerse: a new way to approach Elsevier.

    PubMed

    Bengtson, Jason

    2011-01-01

    SciVerse is the new combined portal from Elsevier that services their ScienceDirect collection, SciTopics, and their Scopus database. Using SciVerse to access ScienceDirect is the specific focus of this review. Along with advanced keyword searching and citation searching options, SciVerse also incorporates a very useful image search feature. The aim seems to be not only to create an interface that provides broad functionality on par with other database search tools that many searchers use regularly but also to create an open platform that could be changed to respond effectively to the needs of customers.

  12. Preface: SciDAC 2008

    NASA Astrophysics Data System (ADS)

    Stevens, Rick

    2008-07-01

    The fourth annual Scientific Discovery through Advanced Computing (SciDAC) Conference was held June 13-18, 2008, in Seattle, Washington. The SciDAC conference series is the premier communitywide venue for presentation of results from the DOE Office of Science's interdisciplinary computational science program. Started in 2001 and renewed in 2006, the DOE SciDAC program is the country's - and arguably the world's - most significant interdisciplinary research program supporting the development of advanced scientific computing methods and their application to fundamental and applied areas of science. SciDAC supports computational science across many disciplines, including astrophysics, biology, chemistry, fusion sciences, and nuclear physics. Moreover, the program actively encourages the creation of long-term partnerships among scientists focused on challenging problems and computer scientists and applied mathematicians developing the technology and tools needed to address those problems. The SciDAC program has played an increasingly important role in scientific research by allowing scientists to create more accurate models of complex processes, simulate problems once thought to be impossible, and analyze the growing amount of data generated by experiments. To help further the research community's ability to tap into the capabilities of current and future supercomputers, Under Secretary for Science, Raymond Orbach, launched the Innovative and Novel Computational Impact on Theory and Experiment (INCITE) program in 2003. The INCITE program was conceived specifically to seek out computationally intensive, large-scale research projects with the potential to significantly advance key areas in science and engineering. The program encourages proposals from universities, other research institutions, and industry. During the first two years of the INCITE program, 10 percent of the resources at NERSC were allocated to INCITE awardees. However, demand for supercomputing resources

  13. Measurement of Bone: Diagnosis of SCI-Induced Osteoporosis and Fracture Risk Prediction.

    PubMed

    Troy, Karen L; Morse, Leslie R

    2015-01-01

    Spinal cord injury (SCI) is associated with a rapid loss of bone mass, resulting in severe osteoporosis and a 5- to 23-fold increase in fracture risk. Despite the seriousness of fractures in SCI, there are multiple barriers to osteoporosis diagnosis and wide variations in treatment practices for SCI-induced osteoporosis. We review the biological and structural changes that are known to occur in bone after SCI in the context of promoting future research to prevent or reduce risk of fracture in this population. We also review the most commonly used methods for assessing bone after SCI and discuss the strengths, limitations, and clinical applications of each method. Although dual-energy x-ray absorptiometry assessments of bone mineral density may be used clinically to detect changes in bone after SCI, 3-dimensional methods such as quantitative CT analysis are recommended for research applications and are explained in detail.

  14. Circulating sclerostin is elevated in short-term and reduced in long-term SCI.

    PubMed

    Battaglino, Ricardo A; Sudhakar, Supreetha; Lazzari, Antonio A; Garshick, Eric; Zafonte, Ross; Morse, Leslie R

    2012-09-01

    Spinal cord injury (SCI) causes profound bone loss due to muscle paralysis resulting in the inability to walk. Sclerostin, a Wnt signaling pathway antagonist produced by osteocytes, is a potent inhibitor of bone formation. Short-term studies in rodent models have demonstrated increased sclerostin in response to mechanical unloading that is reversed with reloading. Although sclerostin inhibition has been proposed as a potential therapy for bone loss, it is not known if sclerostin levels vary with duration of SCI in humans. We analyzed circulating sclerostin in 155 men with varying degrees of SCI who were 1 year or more post-injury. We report that sclerostin levels are greatest in subjects with short-term SCI (≤5 years post-injury) and decrease significantly over the first 5 years post-injury. There was no association between sclerostin and injury duration in subjects with long-term SCI (>5 years post-injury). In subjects with long-term SCI, sclerostin levels were positively associated with lower extremity bone density and bone mineral content. These data suggest that sclerostin levels are initially increased after SCI in response to mechanical unloading. This response is time-limited and as bone loss progresses, circulating sclerostin is lowest in subjects with severe osteoporosis. These findings support a dual role for sclerostin after SCI: a therapeutic target in acute SCI, and a biomarker of osteoporosis severity in chronic SCI. Copyright © 2012 Elsevier Inc. All rights reserved.

  15. Mexican Space Weather Service (SCiESMEX)

    NASA Astrophysics Data System (ADS)

    Gonzalez-Esparza, J. A.; De la Luz, V.; Corona-Romero, P.; Mejia-Ambriz, J. C.; Gonzalez, L. X.; Sergeeva, M. A.; Romero-Hernandez, E.; Aguilar-Rodriguez, E.

    2017-01-01

    Legislative modifications of the General Civil Protection Law in Mexico in 2014 included specific references to space hazards and space weather phenomena. The legislation is consistent with United Nations promotion of international engagement and cooperation on space weather awareness, studies, and monitoring. These internal and external conditions motivated the creation of a space weather service in Mexico. The Mexican Space Weather Service (SCiESMEX in Spanish) (www.sciesmex.unam.mx) was initiated in October 2014 and is operated by the Institute of Geophysics at the Universidad Nacional Autonoma de Mexico (UNAM). SCiESMEX became a Regional Warning Center of the International Space Environment Services (ISES) in June 2015. We present the characteristics of the service, some products, and the initial actions for developing a space weather strategy in Mexico. The service operates a computing infrastructure including a web application, data repository, and a high-performance computing server to run numerical models. SCiESMEX uses data of the ground-based instrumental network of the National Space Weather Laboratory (LANCE), covering solar radio burst emissions, solar wind and interplanetary disturbances (by interplanetary scintillation observations), geomagnetic measurements, and analysis of the total electron content (TEC) of the ionosphere (by employing data from local networks of GPS receiver stations).

  16. Overview of the Spinal Cord Injury – Quality of Life (SCI-QOL) measurement system

    PubMed Central

    Tulsky, David S.; Kisala, Pamela A.; Victorson, David; Tate, Denise G.; Heinemann, Allen W.; Charlifue, Susan; Kirshblum, Steve C.; Fyffe, Denise; Gershon, Richard; Spungen, Ann M.; Bombardier, Charles H.; Dyson-Hudson, Trevor A.; Amtmann, Dagmar; Z. Kalpakjian, Claire; W. Choi, Seung; Jette, Alan M.; Forchheimer, Martin; Cella, David

    2015-01-01

    Context/Objective The Spinal Cord Injury – Quality of Life (SCI-QOL) measurement system was developed to address the shortage of relevant and psychometrically sound patient reported outcome (PRO) measures available for clinical care and research in spinal cord injury (SCI) rehabilitation. Using a computer adaptive testing (CAT) approach, the SCI-QOL builds on the Patient Reported Outcomes Measurement Information System (PROMIS) and the Quality of Life in Neurological Disorders (Neuro-QOL) initiative. This initial manuscript introduces the background and development of the SCI-QOL measurement system. Greater detail is presented in the additional manuscripts of this special issue. Design Classical and contemporary test development methodologies were employed. Qualitative input was obtained from individuals with SCI and clinicians through interviews, focus groups, and cognitive debriefing. Item pools were field tested in a multi-site sample (n = 877) and calibrated using item response theory methods. Initial reliability and validity testing was performed in a new sample of individuals with traumatic SCI (n = 245). Setting Five Model SCI System centers and one Department of Veterans Affairs Medical Center across the United States. Participants Adults with traumatic SCI. Interventions n/a Outcome Measures n/a Results The SCI-QOL consists of 19 item banks, including the SCI-Functional Index banks, and 3 fixed-length scales measuring physical, emotional, and social aspects of health-related QOL (HRQOL). Conclusion The SCI-QOL measurement system consists of psychometrically sound measures for individuals with SCI. The manuscripts in this special issue provide evidence of the reliability and initial validity of this measurement system. The SCI-QOL also links to other measures designed for a general medical population. PMID:26010962

  17. Measurement of Bone: Diagnosis of SCI-Induced Osteoporosis and Fracture Risk Prediction

    PubMed Central

    Morse, Leslie R.

    2015-01-01

    Background: Spinal cord injury (SCI) is associated with a rapid loss of bone mass, resulting in severe osteoporosis and a 5- to 23-fold increase in fracture risk. Despite the seriousness of fractures in SCI, there are multiple barriers to osteoporosis diagnosis and wide variations in treatment practices for SCI-induced osteoporosis. Methods: We review the biological and structural changes that are known to occur in bone after SCI in the context of promoting future research to prevent or reduce risk of fracture in this population. We also review the most commonly used methods for assessing bone after SCI and discuss the strengths, limitations, and clinical applications of each method. Conclusions: Although dual-energy x-ray absorptiometry assessments of bone mineral density may be used clinically to detect changes in bone after SCI, 3-dimensional methods such as quantitative CT analysis are recommended for research applications and are explained in detail. PMID:26689691

  18. Discontinuous ventilator weaning of patients with acute SCI.

    PubMed

    Füssenich, Wout; Hirschfeld Araujo, Sven; Kowald, Birgitt; Hosman, Allard; Auerswald, Marc; Thietje, Roland

    2018-05-01

    Retrospective, single centre cohort study. To determine factors associated with ventilator weaning success and failure in patients with acute spinal cord injury (SCI); determine length of time and attempts required to wean from the ventilator successfully and determine the incidence of pneumonia. BG Klinikum Hamburg, Level 1 trauma centre, SCI Department, Germany. From 2010 until 2017, 165 consecutive patients with cervical SCI, initially dependent on a ventilator, were included and weaned discontinuously via tracheal cannula. Data related to anthropometric details, neurological injury, respiratory outcomes, and weaning parameters were prospectively recorded in a database and retrospectively analysed. Seventy-nine percent of all patients were successfully weaned from ventilation. Average duration of the complete weaning process was 37 days. Ninety-one percent of the successfully weaned patients completed this on first attempt. Age (>56 years), level of injury (C4 and/or above), vital capacity (<1500 ml), obesity (>25 kg/m 2 ), and chronic obstructive pulmonary disease (COPD) significantly decreased the chance of successful weaning. These factors also correlated with a higher number of weaning attempts. High level of injury, older age, and reduced vital capacity also increased the duration of the weaning process. Patients with low vital capacity and concurrent therapy with Baclofen and Dantrolene showed higher rates of pneumonia. We conclude that mentioned factors are associated with weaning outcome and useful for clinical recommendations and patient counselling. These data further support the complexity of ventilator weaning in the SCI population due to associated complications, therefore we recommend conducting weaning of patients with SCI on intensive or intermediate care units (ICU/IMCU) in specialised centres.

  19. SciTech Clubs for Girls. [Annual] technical report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nogal, A.M.

    1993-02-01

    Since January 1992, 9 exhibits have been constructed by the SciTech Clubs for Girls, which involved 63 girls, ages 10 to 14. These exhibits are: Bubble Shapes by the St. Charles Cadette Girl Scout Troop No. 109. Density Games by the South Elgin Cadette Girl Scout Troop No. 132. Electric Fleas by the Warrenville Junior Girl Scout Troop No. 305. Energy vs. Power by the Aurora Junior Girl Scout Troop No. 242. The Organ Pipe by the Bartlett Junior Girl Scout Troop No. 107. Ohm`s Law by the Geneva Junior Girl Scout Troop No. 401. What is Gravity by themore » Pilsen YMCA girls. Insulation at Work by the Algonquin Junior Girl Scout Troop No. 303. Series vs. Parallel by the Leland Junior Girl Scout Troop No. 50. The report is a description of each exhibit and the group that built the exhibit. Each group had a minimum of 10 hours of contact time at SciTech with the SciTech Clubs for Girls Program Coordinator. All mentors are female. Each exhibit building experience includes a trip to the hardware store to purchase supplies. After the exhibit is complete, the girls receive certificates of achievement and a SciTech Club Patch.« less

  20. SciReader enables reading of medical content with instantaneous definitions.

    PubMed

    Gradie, Patrick R; Litster, Megan; Thomas, Rinu; Vyas, Jay; Schiller, Martin R

    2011-01-25

    A major problem patients encounter when reading about health related issues is document interpretation, which limits reading comprehension and therefore negatively impacts health care. Currently, searching for medical definitions from an external source is time consuming, distracting, and negatively impacts reading comprehension and memory of the material. SciReader was built as a Java application with a Flex-based front-end client. The dictionary used by SciReader was built by consolidating data from several sources and generating new definitions with a standardized syntax. The application was evaluated by measuring the percentage of words defined in different documents. A survey was used to test the perceived effect of SciReader on reading time and comprehension. We present SciReader, a web-application that simplifies document interpretation by allowing users to instantaneously view medical, English, and scientific definitions as they read any document. This tool reveals the definitions of any selected word in a small frame at the top of the application. SciReader relies on a dictionary of ~750,000 unique Biomedical and English word definitions. Evaluation of the application shows that it maps ~98% of words in several different types of documents and that most users tested in a survey indicate that the application decreases reading time and increases comprehension. SciReader is a web application useful for reading medical and scientific documents. The program makes jargon-laden content more accessible to patients, educators, health care professionals, and the general public.

  1. Can FES-rowing mediate bone mineral density in SCI: a pilot study.

    PubMed

    Gibbons, R S; McCarthy, I D; Gall, A; Stock, C G; Shippen, J; Andrews, B J

    2014-11-01

    A single case study. To compare proximal tibia trabecular bone mineral density (BMD) of a participant with complete spinal cord injury (SCI), long-termed functional electrical stimulation-rowing (FES-R) trained, with previously reported SCI and non-SCI group norms. To estimate lower limb joint contact forces (JCFs) in the FES-R trained participant. UK University and orthopaedic hospital research centre. Bilateral proximal tibial trabecular BMD of the FES-R trained participant was measured using peripheral quantitative computerised tomography, and the data were compared with SCI and non-SCI groups. An instrumented four-channel FES-R system was used to measure the lower limb JCFs in the FES-R trained participant. Structurally, proximal tibial trabecular BMD was higher in the FES-R trained participant compared with the SCI group, but was less than the non-SCI group. Furthermore, left (184.7 mg cm(-3)) and right (160.7 mg cm(-3)) BMD were well above the threshold associated with non-traumatic fracture. The knee JCFs were above the threshold known to mediate BMD in SCI, but below threshold at the hip and ankle. As pathological fractures predominate in the distal femur and proximal tibia in chronic SCI patients, the fact that the FES-R trained participant's knee JCFs were above those known to partially prevent bone loss, suggests that FES-R training may provide therapeutic benefit. Although the elevated bilateral proximal tibial BMD of the FES-R participant provides circumstantial evidence of osteogenesis, this single case precludes any statement on the clinical significance. Further investigations are required involving larger numbers and additional channels of FES to increase loading at the hip and ankle.

  2. Surface plasmon resonance studies and biochemical evaluation of a potent peptide inhibitor against cyclooxygenase-2 as an anti-inflammatory agent.

    PubMed

    Somvanshi, Rishi K; Kumar, Ashwini; Kant, Shashi; Gupta, Deepti; Singh, S Bhaskar; Das, Utpal; Srinivasan, Alagiri; Singh, Tej P; Dey, Sharmistha

    2007-09-14

    Cyclooxygenase (COX) is a key enzyme in the biosynthetic pathway leading to the formation of prostaglandins, which are mediators of inflammation [D.L. Dewitt, W.L. Smith, Primary structure of prostaglandin G/H synthase from sheep vesicular gland determined from the complementary DNA sequence, Proc. Natl. Acad. Sci. USA 85 (1988) 1412-1416, 1]. It exists mainly in two isoforms COX-1 and COX-2 [A. Raz, A. Wyche, N. Siegel, P. Needleman, Regulation of fibroblast cyclooxygenase synthesis by interleukin-1, J. Biol. Chem. 263 (1988) 3022-3028, 2]. The conventional non-steroidal anti-inflammatory drugs (NSAIDs) have adverse gastrointestinal side-effects, because they inhibit both isoforms [T.D. Warner, F. Guiliano, I. Vojnovic, A. Bukasa, J.A. Mitchell, J.P. Vane, Nonsteroid drug selectivities for cyclo-oxygenase-1 rather than cyclo-oxygenase-2 are associated with human gastrointestinal toxicity: a full in vitro analysis, Proc. Natl. Acad. Sci. USA 96 (1999) 7563-7568, 3; L.J. Marnett, A.S. Kalgutkar, Cyclooxygenase 2 inhibitors: discovery, selectivity and the future, Trends Pharmacol. Sci. 20 (1999) 465-469, 4; J.R. Vane, NSAIDs, Cox-2 inhibitors, and the gut, Lancet 346 (1995) 1105-1106, 5]. Therefore drugs which selectively inhibit COX-2, known as coxibs were developed. Recent reports on the harmful cardiovascular and renovascular side-effects of the anti-inflammatory drugs have led to the quest for a novel class of COX-2 selective inhibitors. Keeping this in mind, we have used the X-ray crystal structures of the complexes of the COX-1 and COX-2 with the known inhibitors for a rational, structure based approach to design a small peptide, which is potent inhibitor for COX-2. The peptides have been checked experimentally by in-vitro kinetic studies using surface plasmon resonance (SPR) and other biochemical methods. We have identified a tripeptide inhibitor which is a potential lead for a new class of COX-2 inhibitor. The dissociation constant (K(D)) determined for COX-2

  3. Metabolic activity of subseafloor microbes in the South Pacific Gyre

    NASA Astrophysics Data System (ADS)

    Morono, Y.; Ito, M.; Terada, T.; Inagaki, F.

    2013-12-01

    SIMS analysis showed incorporation of the supplemented stable isotope-labeled substrates after 1.5 year-incubation. The substrate incorporation rates of individual microbial cell ranged in average from 1/10 to 1/2 of those values previously observed in an organic-rich ocean margin sediment (Morono et al., 2011). References S. D'Hondt et al., Subseafloor sedimentary life in the South Pacific Gyre. Proc Natl Acad Sci USA 106, 11651 (2009) J. Kallmeyeret al., Global distribution of microbial abundance and biomass in subseafloor sediment. Proc Natl Acad Sci USA 109, 16213 (2012) H. Røy et al., Aerobic microbial respiration in 86-million-year-old deep-sea red clay. Science 336, 922 (2012) Y. Morono et al. Discriminative detection and enumeration of microbial life in marine subsurface sediments. ISME J 3, 503 (2009) Y. Morono et al., An Improved Cell Separation Technique for Marine Subsurface Sediments: Applications for High-throughput Analysis Using Flow Cytometry and Cell Sorting. Environ Microbiol, (2013) Y. Morono et al., Carbon and nitrogen assimilation in deep subseafloor microbial cells. Proc Natl Acad Sci USA 108, 18295 (2011)

  4. Detection of abnormal muscle activations during walking following spinal cord injury (SCI).

    PubMed

    Wang, Ping; Low, K H; McGregor, Alison H; Tow, Adela

    2013-04-01

    In order to identify optimal rehabilitation strategies for spinal cord injury (SCI) participants, assessment of impaired walking is required to detect, monitor and quantify movement disorders. In the proposed assessment, ten healthy and seven SCI participants were recruited to perform an over-ground walking test at slow walking speeds. SCI participants were given assistance from physiotherapists, if required, while they were walking. In agreement with other research, larger cadence and smaller step length and swing phase of SCI gait were observed as a result of muscle weakness and resultant gait instability. Muscle activation patterns of seven major leg muscles were collected. The EMG signal was processed by the RMS in frequency domain to represent the muscle activation power, and the distribution of muscle activation was compared between healthy and SCI participants. The alternations of muscle activation within the phases of the gait cycle are highlighted to facilitate our understanding of the underlying muscular activation following SCI. Key differences were observed (p-value=0.0006) in the reduced activation of tibialis anterior (TA) in single stance phase and rectus femoris (RF) in swing phase (p-value=0.0011). We can then conclude that the proposed assessment approach of gait provides valuable information that can be used to target and define therapeutic interventions and their evaluation; hence impacting the functional outcome of SCI individuals. Copyright © 2012 Elsevier Ltd. All rights reserved.

  5. Development and psychometric characteristics of the SCI-QOL Pressure Ulcers scale and short form.

    PubMed

    Kisala, Pamela A; Tulsky, David S; Choi, Seung W; Kirshblum, Steven C

    2015-05-01

    To develop a self-reported measure of the subjective impact of pressure ulcers on health-related quality of life (HRQOL) in individuals with spinal cord injury (SCI) as part of the SCI quality of life (SCI-QOL) measurement system. Grounded-theory based qualitative item development methods, large-scale item calibration testing, confirmatory factor analysis (CFA), and item response theory-based psychometric analysis. Five SCI Model System centers and one Department of Veterans Affairs medical center in the United States. Adults with traumatic SCI. SCI-QOL Pressure Ulcers scale. 189 individuals with traumatic SCI who experienced a pressure ulcer within the past 7 days completed 30 items related to pressure ulcers. CFA confirmed a unidimensional pool of items. IRT analyses were conducted. A constrained Graded Response Model with a constant slope parameter was used to estimate item thresholds for the 12 retained items. The 12-item SCI-QOL Pressure Ulcers scale is unique in that it is specifically targeted to individuals with spinal cord injury and at every stage of development has included input from individuals with SCI. Furthermore, use of CFA and IRT methods provide flexibility and precision of measurement. The scale may be administered in its entirety or as a 7-item "short form" and is available for both research and clinical practice.

  6. Sci-Hub: What Librarians Should Know and Do about Article Piracy.

    PubMed

    Hoy, Matthew B

    2017-01-01

    The high cost of journal articles has driven many researchers to turn to a new way of getting access: "pirate" article sites. Sci-Hub, the largest and best known of these sites, currently offers instant access to more than 58 million journal articles. Users attracted by the ease of use and breadth of the collection may not realize that these articles are often obtained using stolen credentials and downloading them may be illegal. This article will briefly describe Sci-Hub and how it works, the legal and ethical issues it raises, and the problems it may cause for librarians. Librarians should be aware of Sci-Hub and the ways it may change their patrons' expectations. They should also understand the risks Sci-Hub can pose to their patrons and their institutions.

  7. Calculation of the wetting parameter from a cluster model in the framework of nanothermodynamics.

    PubMed

    García-Morales, V; Cervera, J; Pellicer, J

    2003-06-01

    The critical wetting parameter omega(c) determines the strength of interfacial fluctuations in critical wetting transitions. In this Brief Report, we calculate omega(c) from considerations on critical liquid clusters inside a vapor phase. The starting point is a cluster model developed by Hill and Chamberlin in the framework of nanothermodynamics [Proc. Natl. Acad. Sci. USA 95, 12779 (1998)]. Our calculations yield results for omega(c) between 0.52 and 1.00, depending on the degrees of freedom considered. The findings are in agreement with previous experimental results and give an idea of the universal dynamical behavior of the clusters when approaching criticality. We suggest that this behavior is a combination of translation and vortex rotational motion (omega(c)=0.84).

  8. Rare earth chalcogenide Ce3Te4 as high efficiency high temperature thermoelectric material

    NASA Astrophysics Data System (ADS)

    Wang, Xiaochun; Yang, Ronggui; Zhang, Yong; Zhang, Peihong; Xue, Yu

    2011-05-01

    The electronic band structures of Ce3Te4 have been studied using the first-principles density-functional theory calculations. It is found that the density of states of Ce3Te4 has a very high delta-shaped peak appearing 0.21 eV above the Fermi level, which mainly comes from the f orbital electrons of the rare-earth element Ce. Using the simple theory proposed by Mahan and Sofo, [Proc. Natl. Acad. Sci. U.S.A. 93, 7436 (1996)], we obtain an ideal value of zT=13.5 for Ce3Te4 at T=1200 K, suggesting that the rare-earth chalcogenide Ce3Te4 could be a promising high efficiency high temperature thermoelectric material.

  9. Isolation and molecular cloning of a fast-growing strain of human hepatitis A virus from its double-stranded replicative form.

    PubMed Central

    Venuti, A; Di Russo, C; del Grosso, N; Patti, A M; Ruggeri, F; De Stasio, P R; Martiniello, M G; Pagnotti, P; Degener, A M; Midulla, M

    1985-01-01

    A fast-growing strain of human hepatitis A virus was selected and characterized. The virus has the unusual property of developing a strong cytopathic effect in tissue culture in 7 to 10 days. Sequences of the viral genome were cloned into recombinant plasmids with the double-stranded replicative form as a template for the reverse transcription of cDNA. Restriction analysis and direct sequencing indicate that this strain is different from that described by Ticehurst et al. (Proc. Natl. Acad. Sci. USA 80:5885-5889, 1983) in the region that presumptively codes for the major capsid protein VP1, but both isolates have conserved large areas of homology in the untranslated 5'-terminal sequences of the genome. Images PMID:2997478

  10. On the ability of the Viking gas chromatograph–mass spectrometer to detect organic matter

    PubMed Central

    Biemann, Klaus

    2007-01-01

    A recent paper by Navarro-Gonzalez et al. [Navarro-Gonzalez R, Navarro KF, de la Rosa J, Iniguez E, Molina P, Miranda LD, Morales P, Cienfuegos E, Coll P, Raulin F, et al. (2006) Proc Natl Acad Sci USA 103:16089–16094] claims to show that the Viking GCMS (gas chromatograph–mass spectrometer) experiment, which carried out a search for organic matter at the surface of Mars in 1976, “may have been blind to low levels of organics.” To rebut this assertion, the Viking experiment, test data, and results on Mars are reviewed, and the fallacies in the design, execution, and interpretation of the new experiments presented by Navarro-Gonzalez et al. are critically examined. PMID:17548829

  11. Cloning and sequence analysis of the human brain beta-adrenergic receptor. Evolutionary relationship to rodent and avian beta-receptors and porcine muscarinic receptors.

    PubMed

    Chung, F Z; Lentes, K U; Gocayne, J; Fitzgerald, M; Robinson, D; Kerlavage, A R; Fraser, C M; Venter, J C

    1987-01-26

    Two cDNA clones, lambda-CLFV-108 and lambda-CLFV-119, encoding for the beta-adrenergic receptor, have been isolated from a human brain stem cDNA library. One human genomic clone, LCV-517 (20 kb), was characterized by restriction mapping and partial sequencing. The human brain beta-receptor consists of 413 amino acids with a calculated Mr of 46480. The gene contains three potential glucocorticoid receptor-binding sites. The beta-receptor expressed in human brain was homology with rodent (88%) and avian (52%) beta-receptors and with porcine muscarinic cholinergic receptors (31%), supporting our proposal [(1984) Proc. Natl. Acad. Sci. USA 81, 272 276] that adrenergic and muscarinic cholinergic receptors are structurally related. This represents the first cloning of a neurotransmitter receptor gene from human brain.

  12. What is behind "centromere repositioning"?

    PubMed

    Schubert, Ingo

    2018-06-01

    An increasing number of observations suggest an evolutionary switch of centromere position on monocentric eukaryotic chromosomes which otherwise display a conserved sequence of genes and markers. Such observations are particularly frequent for primates and equidae (for review see Heredity 108:59-67, 2012) but occur also in marsupials (J Hered 96:217-224, 2005) and in plants (Chromosome Res 25:299-311, 2017 and references therein). The actual mechanism(s) behind remained unclear in many cases (Proc Natl Acad Sci USA 101:6542-6547, 2004; Trends Genet 30:66-74, 2014). The same is true for de novo centromere formation on chromosomes lacking an active centromere. This article focuses on recent reports on centromere repositioning and possible mechanisms behind and addresses open questions.

  13. An independent evaluation of the Younger Dryas extraterrestrial impact hypothesis

    PubMed Central

    Surovell, Todd A.; Holliday, Vance T.; Gingerich, Joseph A. M.; Ketron, Caroline; Haynes, C. Vance; Hilman, Ilene; Wagner, Daniel P.; Johnson, Eileen; Claeys, Philippe

    2009-01-01

    Based on elevated concentrations of a set of “impact markers” at the onset of the Younger Dryas stadial from sedimentary contexts across North America, Firestone, Kennett, West, and others have argued that 12.9 ka the Earth experienced an impact by an extraterrestrial body, an event that had devastating ecological consequences for humans, plants, and animals in the New World [Firestone RB, et al. (2007) Proc. Natl. Acad. Sci. USA 104:16016–16021]. Herein, we report the results of an independent analysis of magnetic minerals and microspherules from seven sites of similar age, including two examined by Firestone et al. We were unable to reproduce any results of the Firestone et al. study and find no support for Younger Dryas extraterrestrial impact. PMID:19822748

  14. An independent evaluation of the Younger Dryas extraterrestrial impact hypothesis.

    PubMed

    Surovell, Todd A; Holliday, Vance T; Gingerich, Joseph A M; Ketron, Caroline; Haynes, C Vance; Hilman, Ilene; Wagner, Daniel P; Johnson, Eileen; Claeys, Philippe

    2009-10-27

    Based on elevated concentrations of a set of "impact markers" at the onset of the Younger Dryas stadial from sedimentary contexts across North America, Firestone, Kennett, West, and others have argued that 12.9 ka the Earth experienced an impact by an extraterrestrial body, an event that had devastating ecological consequences for humans, plants, and animals in the New World [Firestone RB, et al. (2007) Proc. Natl. Acad. Sci. USA 104:16016-16021]. Herein, we report the results of an independent analysis of magnetic minerals and microspherules from seven sites of similar age, including two examined by Firestone et al. We were unable to reproduce any results of the Firestone et al. study and find no support for Younger Dryas extraterrestrial impact.

  15. Modeling collective behavior of molecules in nanoscale direct deposition processes

    NASA Astrophysics Data System (ADS)

    Lee, Nam-Kyung; Hong, Seunghun

    2006-03-01

    We present a theoretical model describing the collective behavior of molecules in nanoscale direct deposition processes such as dip-pen nanolithography. We show that strong intermolecular interactions combined with nonuniform substrate-molecule interactions can produce various shapes of molecular patterns including fractal-like structures. Computer simulations reveal circular and starlike patterns at low and intermediate densities of preferentially attractive surface sites, respectively. At large density of such surface sites, the molecules form a two-dimensional invasion percolation cluster. Previous experimental results showing anisotropic patterns of various chemical and biological molecules correspond to the starlike regime [P. Manandhar et al., Phys. Rev. Lett. 90, 115505 (2003); J.-H. Lim and C. A. Mirkin, Adv. Mater. (Weinheim, Ger.) 14, 1474 (2002); D. L. Wilson et al., Proc. Natl. Acad. Sci. U.S.A. 98, 13660 (2001); M. Su et al., Appl. Phys. Lett. 84, 4200 (2004); R. McKendry et al., Nano Lett. 2, 713 (2002); H. Zhou et al., Appl. Surf. Sci. 236, 18 (2004); G. Agarwal et al., J. Am. Chem. Soc. 125, 580 (2003)].

  16. Documenting a significant relationship between macroevolutionary origination rates and Phanerozoic pCO2 levels.

    PubMed

    Cornette, James L; Lieberman, Bruce S; Goldstein, Robert H

    2002-06-11

    We show that the rates of diversification of the marine fauna and the levels of atmospheric CO(2) have been closely correlated for the past 545 million years. These results, using two of the fundamental databases of the Earth's biota and the Earth's atmospheric composition, respectively, are highly statistically significant (P < 0.001). The strength of the correlation suggests that one or more environmental variables controlling CO(2) levels have had a profound impact on evolution throughout the history of metazoan life. Comparing our work with highly significant correlations described by D. H. Rothman [Rothman, D. H. (2001) Proc. Natl. Acad. Sci. USA 98, 4305-4310] between total biological diversity and a measure of stable carbon isotope fractionation, we find that the rates of diversification rather than total diversification correlate with environmental variables, and that the rate of diversification follows the record of CO(2) projected by R. A. Berner and Z. Kothavala [Berner, R. A. & Kothavala, Z. (2001) Am. J. Sci. 301, 182-204] more closely than that predicted by Rothman.

  17. Human mobility in large cities as a proxy for crime.

    PubMed

    Caminha, Carlos; Furtado, Vasco; Pequeno, Tarcisio H C; Ponte, Caio; Melo, Hygor P M; Oliveira, Erneson A; Andrade, José S

    2017-01-01

    We investigate at the subscale of the neighborhoods of a highly populated city the incidence of property crimes in terms of both the resident and the floating population. Our results show that a relevant allometric relation could only be observed between property crimes and floating population. More precisely, the evidence of a superlinear behavior indicates that a disproportional number of property crimes occurs in regions where an increased flow of people takes place in the city. For comparison, we also found that the number of crimes of peace disturbance only correlates well, and in a superlinear fashion too, with the resident population. Our study raises the interesting possibility that the superlinearity observed in previous studies [Bettencourt et al., Proc. Natl. Acad. Sci. USA 104, 7301 (2007) and Melo et al., Sci. Rep. 4, 6239 (2014)] for homicides versus population at the city scale could have its origin in the fact that the floating population, and not the resident one, should be taken as the relevant variable determining the intrinsic microdynamical behavior of the system.

  18. Human mobility in large cities as a proxy for crime

    PubMed Central

    Caminha, Carlos; Furtado, Vasco; Pequeno, Tarcisio H. C.; Ponte, Caio; Melo, Hygor P. M.; Oliveira, Erneson A.; Andrade, José S.

    2017-01-01

    We investigate at the subscale of the neighborhoods of a highly populated city the incidence of property crimes in terms of both the resident and the floating population. Our results show that a relevant allometric relation could only be observed between property crimes and floating population. More precisely, the evidence of a superlinear behavior indicates that a disproportional number of property crimes occurs in regions where an increased flow of people takes place in the city. For comparison, we also found that the number of crimes of peace disturbance only correlates well, and in a superlinear fashion too, with the resident population. Our study raises the interesting possibility that the superlinearity observed in previous studies [Bettencourt et al., Proc. Natl. Acad. Sci. USA 104, 7301 (2007) and Melo et al., Sci. Rep. 4, 6239 (2014)] for homicides versus population at the city scale could have its origin in the fact that the floating population, and not the resident one, should be taken as the relevant variable determining the intrinsic microdynamical behavior of the system. PMID:28158268

  19. SciFlo: Semantically-Enabled Grid Workflow for Collaborative Science

    NASA Astrophysics Data System (ADS)

    Yunck, T.; Wilson, B. D.; Raskin, R.; Manipon, G.

    2005-12-01

    SciFlo is a system for Scientific Knowledge Creation on the Grid using a Semantically-Enabled Dataflow Execution Environment. SciFlo leverages Simple Object Access Protocol (SOAP) Web Services and the Grid Computing standards (WS-* standards and the Globus Alliance toolkits), and enables scientists to do multi-instrument Earth Science by assembling reusable SOAP Services, native executables, local command-line scripts, and python codes into a distributed computing flow (a graph of operators). SciFlo's XML dataflow documents can be a mixture of concrete operators (fully bound operations) and abstract template operators (late binding via semantic lookup). All data objects and operators can be both simply typed (simple and complex types in XML schema) and semantically typed using controlled vocabularies (linked to OWL ontologies such as SWEET). By exploiting ontology-enhanced search and inference, one can discover (and automatically invoke) Web Services and operators that have been semantically labeled as performing the desired transformation, and adapt a particular invocation to the proper interface (number, types, and meaning of inputs and outputs). The SciFlo client & server engines optimize the execution of such distributed data flows and allow the user to transparently find and use datasets and operators without worrying about the actual location of the Grid resources. The scientist injects a distributed computation into the Grid by simply filling out an HTML form or directly authoring the underlying XML dataflow document, and results are returned directly to the scientist's desktop. A Visual Programming tool is also being developed, but it is not required. Once an analysis has been specified for a granule or day of data, it can be easily repeated with different control parameters and over months or years of data. SciFlo uses and preserves semantics, and also generates and infers new semantic annotations. Specifically, the SciFlo engine uses semantic metadata to

  20. Face-Centred Cubic Iron: Ab Initio Calculations of Sound Velocities in the Lunar Core

    NASA Astrophysics Data System (ADS)

    Wood, M. C.; Wood, I. G.; Vočadlo, L.

    2017-12-01

    Studies, such as the reanalysis of the Apollo lunar seismograms [1], have shown that the Moon has undergone differentiation and possesses a small core. The composition of the lunar core is not well constrained, and many compositional models have been suggested including combinations of iron, nickel, and light elements such as sulphur and carbon [e.g. 1, 2, 3, 4], and other more exotic compositions [5]. Additional constraints are crucial to our understanding of the Moon, including its formation, the dynamics of its interior, and a lunar dynamo. We use ab initio molecular dynamics simulations to calculate elastic constants of face-centred cubic (fcc) iron and iron alloys and hence sound velocities at lunar core conditions, at 5-6 GPa and 1,300-1,900 K [3]. The results from these simulations will then be compared with the data from the Apollo seismograms and experimental data to help form a description of the lunar interior. [1] Weber et al. (2011) Science 331, 309-312. [2] Dasgupta et al. (2009) Geochim. Cosmochim. Acta 73, 6678-6692. [3] Antonangeli et al. (2015) Proc. Natl. Acad. Sci. U.S.A. 112, 3916-3919. [4] Righter et al. (2017) Earth Planet. Sci. Lett. 463, 323-332. [5] Wieczorek & Zuber (2002) Lunar Planet. Sci. 33, abstract 1384.

  1. Development and psychometric characteristics of the SCI-QOL Pressure Ulcers scale and short form

    PubMed Central

    Kisala, Pamela A.; Tulsky, David S.; Choi, Seung W.; Kirshblum, Steven C.

    2015-01-01

    Objective To develop a self-reported measure of the subjective impact of pressure ulcers on health-related quality of life (HRQOL) in individuals with spinal cord injury (SCI) as part of the SCI quality of life (SCI-QOL) measurement system. Design Grounded-theory based qualitative item development methods, large-scale item calibration testing, confirmatory factor analysis (CFA), and item response theory-based psychometric analysis. Setting Five SCI Model System centers and one Department of Veterans Affairs medical center in the United States. Participants Adults with traumatic SCI. Main Outcome Measures SCI-QOL Pressure Ulcers scale. Results 189 individuals with traumatic SCI who experienced a pressure ulcer within the past 7 days completed 30 items related to pressure ulcers. CFA confirmed a unidimensional pool of items. IRT analyses were conducted. A constrained Graded Response Model with a constant slope parameter was used to estimate item thresholds for the 12 retained items. Conclusions The 12-item SCI-QOL Pressure Ulcers scale is unique in that it is specifically targeted to individuals with spinal cord injury and at every stage of development has included input from individuals with SCI. Furthermore, use of CFA and IRT methods provide flexibility and precision of measurement. The scale may be administered in its entirety or as a 7-item “short form” and is available for both research and clinical practice. PMID:26010965

  2. www.elearnSCI.org: a global educational initiative of ISCoS.

    PubMed

    Chhabra, H S; Harvey, L A; Muldoon, S; Chaudhary, S; Arora, M; Brown, D J; Biering-Sorensen, F; Wyndaele, J J; Charlifue, S; Horsewell, J; Ducharme, S; Green, D; Simpson, D; Glinsky, J; Weerts, E; Upadhyay, N; Aito, S; Wing, P; Katoh, S; Kovindha, A; Krassioukov, A; Weeks, C; Srikumar, V; Reeves, R; Siriwardane, C; Hasnan, N; Kalke, Y B; Lanig, I

    2013-03-01

    To develop a web-based educational resource for health professionals responsible for the management of spinal cord injury (SCI). The resource:www.elearnSCI.org is comprised of seven learning modules, each subdivided into various submodules. Six of the seven modules address the educational needs of all disciplines involved in comprehensive SCI management. The seventh module addresses prevention of SCI. Each submodule includes an overview, activities, self-assessment questions and references. Three hundred and thirty-two experts from The International Spinal Cord Society (ISCoS) and various affiliated societies from 36 countries were involved in developing the resource through 28 subcommittees. The content of each submodule was reviewed and approved by the Education and Scientific Committees of ISCoS and finally by an Editorial Committee of 23 experts. The content of the learning modules is relevant to students and to new as well as experienced SCI healthcare professionals. The content is applicable globally, has received consumer input and is available at no cost. The material is presented on a website underpinned by a sophisticated content-management system, which allows easy maintenance and ready update of all the content. The resource conforms to key principles of e-learning, including appropriateness of curriculum, engagement of learners, innovative approaches, effective learning, ease of use, inclusion, assessment, coherence, consistency, transparency, cost effectiveness and feedback. www.elearnSCI.org provides a cost effective way of training healthcare professionals that goes beyond the textbook and traditional face-to-face teaching.

  3. A High Resolution Clinical PET with Breast and Whole Body Transfigurations

    DTIC Science & Technology

    2006-08-01

    1999. [6] Inst. Inorganic Chemistry, Siberian Branch, Russian Acad. Sci. 3, Acad. Lavrentyev Prospect, Novosibirsk, Russia. [7] White Reflecting Paint...46, no.6, pp. 491-497, 1999. [6] Institute of Inorganic Chemistry, Siberian Branch, Russian Academy of Science 3, Acad.Lavrentyev Prospect, 630090...demanding, higher spatial resolution 8 x 8 array (2.3 x 2.3 x 10 mm BGO) for mouse PET with shallower crystals, the pulse-height ratio was 0.73 with an

  4. Close Encounters of the Best Kind: The Latest Sci-Fi

    ERIC Educational Resources Information Center

    Kunzel, Bonnie

    2008-01-01

    Not only is science fiction alive and well--it's flourishing. From the big screen (howdy, Wall-E) to the big books (like Suzanne Collins's The Hunger Games, which has attracted loads of prepublication praise), 2008 has been a great year for sci-fi. Publishers have released truckloads of new sci-fi titles this year, but what's particularly…

  5. 76 FR 10395 - BreconRidge Manufacturing Solutions, Now Known as Sanmina-SCI Corporation, Division...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-02-24

    ... Solutions, Now Known as Sanmina-SCI Corporation, Division Optoelectronic and Microelectronic Design and Manufacturing, a Subsidiary of Sanmina-SCI Corporation, Including On- Site Leased Workers From Kelly Services... Manufacturing Solutions, now known as Sanmina-SCI Corporation, Division Optoelectronic and Microelectronic...

  6. Opening Comments: SciDAC 2009

    NASA Astrophysics Data System (ADS)

    Strayer, Michael

    2009-07-01

    Welcome to San Diego and the 2009 SciDAC conference. Over the next four days, I would like to present an assessment of the SciDAC program. We will look at where we've been, how we got to where we are and where we are going in the future. Our vision is to be first in computational science, to be best in class in modeling and simulation. When Ray Orbach asked me what I would do, in my job interview for the SciDAC Director position, I said we would achieve that vision. And with our collective dedicated efforts, we have managed to achieve this vision. In the last year, we have now the most powerful supercomputer for open science, Jaguar, the Cray XT system at the Oak Ridge Leadership Computing Facility (OLCF). We also have NERSC, probably the best-in-the-world program for productivity in science that the Office of Science so depends on. And the Argonne Leadership Computing Facility offers architectural diversity with its IBM Blue Gene/P system as a counterbalance to Oak Ridge. There is also ESnet, which is often understated—the 40 gigabit per second dual backbone ring that connects all the labs and many DOE sites. In the President's Recovery Act funding, there is exciting news that ESnet is going to build out to a 100 gigabit per second network using new optical technologies. This is very exciting news for simulations and large-scale scientific facilities. But as one noted SciDAC luminary said, it's not all about the computers—it's also about the science—and we are also achieving our vision in this area. Together with having the fastest supercomputer for science, at the SC08 conference, SciDAC researchers won two ACM Gordon Bell Prizes for the outstanding performance of their applications. The DCA++ code, which solves some very interesting problems in materials, achieved a sustained performance of 1.3 petaflops, an astounding result and a mark I suspect will last for some time. The LS3DF application for studying nanomaterials also required the development of a

  7. Development and psychometric characteristics of the SCI-QOL Bladder Management Difficulties and Bowel Management Difficulties item banks and short forms and the SCI-QOL Bladder Complications scale.

    PubMed

    Tulsky, David S; Kisala, Pamela A; Tate, Denise G; Spungen, Ann M; Kirshblum, Steven C

    2015-05-01

    To describe the development and psychometric properties of the Spinal Cord Injury--Quality of Life (SCI-QOL) Bladder Management Difficulties and Bowel Management Difficulties item banks and Bladder Complications scale. Using a mixed-methods design, a pool of items assessing bladder and bowel-related concerns were developed using focus groups with individuals with spinal cord injury (SCI) and SCI clinicians, cognitive interviews, and item response theory (IRT) analytic approaches, including tests of model fit and differential item functioning. Thirty-eight bladder items and 52 bowel items were tested at the University of Michigan, Kessler Foundation Research Center, the Rehabilitation Institute of Chicago, the University of Washington, Craig Hospital, and the James J. Peters VA Medical Center, Bronx, NY. Seven hundred fifty-seven adults with traumatic SCI. The final item banks demonstrated unidimensionality (Bladder Management Difficulties CFI=0.965; RMSEA=0.093; Bowel Management Difficulties CFI=0.955; RMSEA=0.078) and acceptable fit to a graded response IRT model. The final calibrated Bladder Management Difficulties bank includes 15 items, and the final Bowel Management Difficulties item bank consists of 26 items. Additionally, 5 items related to urinary tract infections (UTI) did not fit with the larger Bladder Management Difficulties item bank but performed relatively well independently (CFI=0.992, RMSEA=0.050) and were thus retained as a separate scale. The SCI-QOL Bladder Management Difficulties and Bowel Management Difficulties item banks are psychometrically robust and are available as computer adaptive tests or short forms. The SCI-QOL Bladder Complications scale is a brief, fixed-length outcomes instrument for individuals with a UTI.

  8. SciSpark's SRDD : A Scientific Resilient Distributed Dataset for Multidimensional Data

    NASA Astrophysics Data System (ADS)

    Palamuttam, R. S.; Wilson, B. D.; Mogrovejo, R. M.; Whitehall, K. D.; Mattmann, C. A.; McGibbney, L. J.; Ramirez, P.

    2015-12-01

    Remote sensing data and climate model output are multi-dimensional arrays of massive sizes locked away in heterogeneous file formats (HDF5/4, NetCDF 3/4) and metadata models (HDF-EOS, CF) making it difficult to perform multi-stage, iterative science processing since each stage requires writing and reading data to and from disk. We have developed SciSpark, a robust Big Data framework, that extends ApacheTM Spark for scaling scientific computations. Apache Spark improves the map-reduce implementation in ApacheTM Hadoop for parallel computing on a cluster, by emphasizing in-memory computation, "spilling" to disk only as needed, and relying on lazy evaluation. Central to Spark is the Resilient Distributed Dataset (RDD), an in-memory distributed data structure that extends the functional paradigm provided by the Scala programming language. However, RDDs are ideal for tabular or unstructured data, and not for highly dimensional data. The SciSpark project introduces the Scientific Resilient Distributed Dataset (sRDD), a distributed-computing array structure which supports iterative scientific algorithms for multidimensional data. SciSpark processes data stored in NetCDF and HDF files by partitioning them across time or space and distributing the partitions among a cluster of compute nodes. We show usability and extensibility of SciSpark by implementing distributed algorithms for geospatial operations on large collections of multi-dimensional grids. In particular we address the problem of scaling an automated method for finding Mesoscale Convective Complexes. SciSpark provides a tensor interface to support the pluggability of different matrix libraries. We evaluate performance of the various matrix libraries in distributed pipelines, such as Nd4jTM and BreezeTM. We detail the architecture and design of SciSpark, our efforts to integrate climate science algorithms, parallel ingest and partitioning (sharding) of A-Train satellite observations from model grids. These

  9. Implication of altered autonomic control for orthostatic tolerance in SCI.

    PubMed

    Wecht, Jill Maria; Bauman, William A

    2018-01-01

    Neural output from the sympathetic and parasympathetic branches of the autonomic nervous system (ANS) are integrated to appropriately control cardiovascular responses during routine activities of daily living including orthostatic positioning. Sympathetic control of the upper extremity vasculature and the heart arises from the thoracic cord between T1 and T5, whereas splanchnic bed and lower extremity vasculature receive sympathetic neural input from the lower cord between segments T5 and L2. Although the vasculature is not directly innervated by the parasympathetic nervous system, the SA node is innervated by post-ganglionic vagal nerve fibers via cranial nerve X. Segmental differences in sympathetic cardiovascular innervation highlight the effect of lesion level on orthostatic cardiovascular control following spinal cord injury (SCI). Due to impaired sympathetic cardiovascular control, many individuals with SCI, particularly those with lesions above T6, are prone to orthostatic hypotension (OH) and orthostatic intolerance (OI). Symptomatic OH, which may result in OI, is a consequence of episodic reductions in cerebral perfusion pressure and the symptoms may include: dizziness, lightheadedness, nausea, blurred vision, ringing in the ears, headache and syncope. However, many, if not most, individuals with SCI who experience persistent and episodic hypotension and OH do not report symptoms of cerebral hypoperfusion and therefore do not raise clinical concern. This review will discuss the mechanism underlying OH and OI following SCI, and will review our knowledge to date regarding the prevalence, consequences and possible treatment options for these conditions in the SCI population. Published by Elsevier B.V.

  10. Context-dependent effects of asparagine glycosylation on Pin WW folding kinetics and thermodynamics.

    PubMed

    Price, Joshua L; Shental-Bechor, Dalit; Dhar, Apratim; Turner, Maurice J; Powers, Evan T; Gruebele, Martin; Levy, Yaakov; Kelly, Jeffery W

    2010-11-03

    Asparagine glycosylation is one of the most common and important post-translational modifications of proteins in eukaryotic cells. N-glycosylation occurs when a triantennary glycan precursor is transferred en bloc to a nascent polypeptide (harboring the N-X-T/S sequon) as the peptide is cotranslationally translocated into the endoplasmic reticulum (ER). In addition to facilitating binding interactions with components of the ER proteostasis network, N-glycans can also have intrinsic effects on protein folding by directly altering the folding energy landscape. Previous work from our laboratories (Hanson et al. Proc. Natl. Acad. Sci. U.S.A. 2009, 109, 3131-3136; Shental-Bechor, D.; Levy, Y. Proc. Natl. Acad. Sci. U.S.A. 2008, 105, 8256-8261) suggested that the three sugar residues closest to the protein are sufficient for accelerating protein folding and stabilizing the resulting structure in vitro; even a monosaccharide can have a dramatic effect. The highly conserved nature of these three proximal sugars in N-glycans led us to speculate that introducing an N-glycosylation site into a protein that is not normally glycosylated would stabilize the protein and increase its folding rate in a manner that does not depend on the presence of specific stabilizing protein-saccharide interactions. Here, we test this hypothesis experimentally and computationally by incorporating an N-linked GlcNAc residue at various positions within the Pin WW domain, a small β-sheet-rich protein. The results show that an increased folding rate and enhanced thermodynamic stability are not general, context-independent consequences of N-glycosylation. Comparison between computational predictions and experimental observations suggests that generic glycan-based excluded volume effects are responsible for the destabilizing effect of glycosylation at highly structured positions. However, this reasoning does not adequately explain the observed destabilizing effect of glycosylation within flexible

  11. Malaria-specific metabolite hemozoin mediates the release of several potent endogenous pyrogens (TNF, MIP-1 alpha, and MIP-1 beta) in vitro, and altered thermoregulation in vivo.

    PubMed

    Sherry, B A; Alava, G; Tracey, K J; Martiney, J; Cerami, A; Slater, A F

    1995-01-01

    A characteristic feature of malaria infection is the occurrence of periodic bouts of fever. Experimental and clinical studies have strongly implicated inflammatory cytokines, like tumour necrosis factor (TNF), in the induction of these intermittent fevers [Clark et al., Infect Immunol 32:1058-1066, 1981; Clark et al., Am J Pathol 129:192-199, 1987; Karunaweera et al., Proc Natl Acad Sci USA 89:3200-3203, 1992], but the malaria-specific metabolite(s) which induce the production of such endogenous pyrogens have not yet been fully characterized. It is well known that during the course of malaria infection, a unique schizont component, alternatively referred to as "malaria pigment" or hemozoin, is released along with merozoites as the host erythrocyte bursts [Urquhart, Clin Infect Dis 19:117-131, 1994]. We have recently determined that the core structure of hemozoin comprises a novel insoluble polymer of heme units linked by iron-carboxylate bonds [Slater et al., Proc Natl Acad Sci USA 88:325-329, 1991; Slater et al., Nature 355:167-169, 1992]. We now report that purified native, as well as chemically synthesized, hemozoin crystals potently induce the release of several pyrogenic cytokines, including TNF, MIP-1 alpha, and MIP-1 beta, from murine macrophages and human peripheral blood monocytes in vitro. Also, intravenous administration of chemically synthesized preparations of hemozoin to anaesthetized rats results in a marked drop in body temperature. A similar drop in body temperature is observed following the intravenous injection of other well-characterized pyrogenic cytokines (e.g., TNF) which are known to induce a fever response in awake animals, and is thought to reflect the inability of rats to appropriately regulate their body temperature while anaesthetized. As a consequence of its ability to induce pyrogenic cytokines in vitro, and thermal dysregulation in vivo, we propose that this unique parasite metabolite is an important pyrogen released by malaria

  12. OPENING REMARKS: SciDAC: Scientific Discovery through Advanced Computing

    NASA Astrophysics Data System (ADS)

    Strayer, Michael

    2005-01-01

    Good morning. Welcome to SciDAC 2005 and San Francisco. SciDAC is all about computational science and scientific discovery. In a large sense, computational science characterizes SciDAC and its intent is change. It transforms both our approach and our understanding of science. It opens new doors and crosses traditional boundaries while seeking discovery. In terms of twentieth century methodologies, computational science may be said to be transformational. There are a number of examples to this point. First are the sciences that encompass climate modeling. The application of computational science has in essence created the field of climate modeling. This community is now international in scope and has provided precision results that are challenging our understanding of our environment. A second example is that of lattice quantum chromodynamics. Lattice QCD, while adding precision and insight to our fundamental understanding of strong interaction dynamics, has transformed our approach to particle and nuclear science. The individual investigator approach has evolved to teams of scientists from different disciplines working side-by-side towards a common goal. SciDAC is also undergoing a transformation. This meeting is a prime example. Last year it was a small programmatic meeting tracking progress in SciDAC. This year, we have a major computational science meeting with a variety of disciplines and enabling technologies represented. SciDAC 2005 should position itself as a new corner stone for Computational Science and its impact on science. As we look to the immediate future, FY2006 will bring a new cycle to SciDAC. Most of the program elements of SciDAC will be re-competed in FY2006. The re-competition will involve new instruments for computational science, new approaches for collaboration, as well as new disciplines. There will be new opportunities for virtual experiments in carbon sequestration, fusion, and nuclear power and nuclear waste, as well as collaborations

  13. Neuropathic pain and SCI: Identification and treatment strategies in the 21st century.

    PubMed

    Hatch, Maya N; Cushing, Timothy R; Carlson, Gregory D; Chang, Eric Y

    2018-01-15

    Pain is a common complication in patients following spinal cord injury (SCI), with studies citing up to 80% of patients reporting some form of pain. Neuropathic pain (NP) makes up a substantial percentage of all pain symptoms in patients with SCI and is often complex. Given the high prevalence of NP in patients with SCI, proper identification and treatment is imperative. Indeed, identification of pain subtypes is a vital step toward determining appropriate treatment. A variety of pharmacological and non-pharmacological treatments can be undertaken including antiepileptics, tricyclic antidepressants, opioids, transcranial direct current stimulation, and invasive surgical procedures. Despite all the available treatment options and advances in the field of SCI medicine, providing adequate treatment of NP after SCI continues to be challenging. It is therefore extremely important for clinicians to have a strong foundation in the identification of SCI NP, as well as an understanding of appropriate treatment options. Here, we highlight the definitions and classification tools available for NP identification, and discuss current treatment options. We hope that this will not only provide a better understanding of NP for physicians in various subspecialties, but that it will also help guide future research on this subject. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Institutional profile: the national Swedish academic drug discovery & development platform at SciLifeLab

    PubMed Central

    Arvidsson, Per I; Sandberg, Kristian; Sakariassen, Kjell S

    2017-01-01

    The Science for Life Laboratory Drug Discovery and Development Platform (SciLifeLab DDD) was established in Stockholm and Uppsala, Sweden, in 2014. It is one of ten platforms of the Swedish national SciLifeLab which support projects run by Swedish academic researchers with large-scale technologies for molecular biosciences with a focus on health and environment. SciLifeLab was created by the coordinated effort of four universities in Stockholm and Uppsala: Stockholm University, Karolinska Institutet, KTH Royal Institute of Technology and Uppsala University, and has recently expanded to other Swedish university locations. The primary goal of the SciLifeLab DDD is to support selected academic discovery and development research projects with tools and resources to discover novel lead therapeutics, either molecules or human antibodies. Intellectual property developed with the help of SciLifeLab DDD is wholly owned by the academic research group. The bulk of SciLifeLab DDD's research and service activities are funded from the Swedish state, with only consumables paid by the academic research group through individual grants. PMID:28670468

  15. Institutional profile: the national Swedish academic drug discovery & development platform at SciLifeLab.

    PubMed

    Arvidsson, Per I; Sandberg, Kristian; Sakariassen, Kjell S

    2017-06-01

    The Science for Life Laboratory Drug Discovery and Development Platform (SciLifeLab DDD) was established in Stockholm and Uppsala, Sweden, in 2014. It is one of ten platforms of the Swedish national SciLifeLab which support projects run by Swedish academic researchers with large-scale technologies for molecular biosciences with a focus on health and environment. SciLifeLab was created by the coordinated effort of four universities in Stockholm and Uppsala: Stockholm University, Karolinska Institutet, KTH Royal Institute of Technology and Uppsala University, and has recently expanded to other Swedish university locations. The primary goal of the SciLifeLab DDD is to support selected academic discovery and development research projects with tools and resources to discover novel lead therapeutics, either molecules or human antibodies. Intellectual property developed with the help of SciLifeLab DDD is wholly owned by the academic research group. The bulk of SciLifeLab DDD's research and service activities are funded from the Swedish state, with only consumables paid by the academic research group through individual grants.

  16. Hubble's diagram and cosmic expansion

    PubMed Central

    Kirshner, Robert P.

    2004-01-01

    Edwin Hubble's classic article on the expanding universe appeared in PNAS in 1929 [Hubble, E. P. (1929) Proc. Natl. Acad. Sci. USA 15, 168–173]. The chief result, that a galaxy's distance is proportional to its redshift, is so well known and so deeply embedded into the language of astronomy through the Hubble diagram, the Hubble constant, Hubble's Law, and the Hubble time, that the article itself is rarely referenced. Even though Hubble's distances have a large systematic error, Hubble's velocities come chiefly from Vesto Melvin Slipher, and the interpretation in terms of the de Sitter effect is out of the mainstream of modern cosmology, this article opened the way to investigation of the expanding, evolving, and accelerating universe that engages today's burgeoning field of cosmology. PMID:14695886

  17. Identification and characterization of two dermorphins from skin extracts of the Amazonian frog Phyllomedusa bicolor.

    PubMed

    Mignogna, G; Severini, C; Simmaco, M; Negri, L; Erspamer, G F; Kreil, G; Barra, D

    1992-05-11

    Skin extracts of South American hylid frogs of the subfamily Phyllomedusinae contain dermorphins and deltorphins, opioid heptapeptides highly selective for either mu or delta receptors. In all these peptides, a D-amino acid is present in the second position. The structure of the precursors for Ala-deltorphins was recently deduced from cloned cDNAs derived from skin of Phyllomedusa bicolor (Richter et al. (1990) Proc. Natl. Acad. Sci. USA 87, 4836-4839). From the amino acid sequence of these precursors, the existence of three peptides related to dermorphin could be predicted. From methanol extracts of skin of Ph. bicolor we have isolated two of these peptides, [Lys7]dermorphin-OH and [Trp4,Asn7]dermorphin-OH. The biological activity of these new dermorphins and their amidated counterparts is presented.

  18. An item-oriented recommendation algorithm on cold-start problem

    NASA Astrophysics Data System (ADS)

    Qiu, Tian; Chen, Guang; Zhang, Zi-Ke; Zhou, Tao

    2011-09-01

    Based on a hybrid algorithm incorporating the heat conduction and probability spreading processes (Proc. Natl. Acad. Sci. U.S.A., 107 (2010) 4511), in this letter, we propose an improved method by introducing an item-oriented function, focusing on solving the dilemma of the recommendation accuracy between the cold and popular items. Differently from previous works, the present algorithm does not require any additional information (e.g., tags). Further experimental results obtained in three real datasets, RYM, Netflix and MovieLens, show that, compared with the original hybrid method, the proposed algorithm significantly enhances the recommendation accuracy of the cold items, while it keeps the recommendation accuracy of the overall and the popular items. This work might shed some light on both understanding and designing effective methods for long-tailed online applications of recommender systems.

  19. Information filtering via biased heat conduction.

    PubMed

    Liu, Jian-Guo; Zhou, Tao; Guo, Qiang

    2011-09-01

    The process of heat conduction has recently found application in personalized recommendation [Zhou et al., Proc. Natl. Acad. Sci. USA 107, 4511 (2010)], which is of high diversity but low accuracy. By decreasing the temperatures of small-degree objects, we present an improved algorithm, called biased heat conduction, which could simultaneously enhance the accuracy and diversity. Extensive experimental analyses demonstrate that the accuracy on MovieLens, Netflix, and Delicious datasets could be improved by 43.5%, 55.4% and 19.2%, respectively, compared with the standard heat conduction algorithm and also the diversity is increased or approximately unchanged. Further statistical analyses suggest that the present algorithm could simultaneously identify users' mainstream and special tastes, resulting in better performance than the standard heat conduction algorithm. This work provides a creditable way for highly efficient information filtering.

  20. Is there an optimal level of open-endedness in prebiotic evolution?

    PubMed

    Markovitch, Omer; Sorek, Daniel; Lui, Leong Ting; Lancet, Doron; Krasnogor, Natalio

    2012-10-01

    In this paper we explore the question of whether there is an optimal set up for a putative prebiotic system leading to open-ended evolution (OEE) of the events unfolding within this system. We do so by proposing two key innovations. First, we introduce a new index that measures OEE as a function of the likelihood of events unfolding within a universe given its initial conditions. Next, we apply this index to a variant of the graded autocatalysis replication domain (GARD) model, Segre et al. (P Natl Acad Sci USA 97(8):4112-4117, 2000; Markovitch and Lancet Artif Life 18(3), 2012), and use it to study--under a unified and concise prebiotic evolutionary framework--both a variety of initial conditions of the universe and the OEE of species that evolve from them.

  1. Is There an Optimal Level of Open-Endedness in Prebiotic Evolution?

    NASA Astrophysics Data System (ADS)

    Markovitch, Omer; Sorek, Daniel; Lui, Leong Ting; Lancet, Doron; Krasnogor, Natalio

    2012-10-01

    In this paper we explore the question of whether there is an optimal set up for a putative prebiotic system leading to open-ended evolution (OEE) of the events unfolding within this system. We do so by proposing two key innovations. First, we introduce a new index that measures OEE as a function of the likelihood of events unfolding within a universe given its initial conditions. Next, we apply this index to a variant of the graded autocatalysis replication domain (GARD) model, Segre et al. (P Natl Acad Sci USA 97(8):4112-4117, 2000; Markovitch and Lancet Artif Life 18(3), 2012), and use it to study - under a unified and concise prebiotic evolutionary framework - both a variety of initial conditions of the universe and the OEE of species that evolve from them.

  2. Herpesvirus papio contains a plasmid origin of replication that acts in cis interspecies with an Epstein-Barr virus trans-acting function.

    PubMed Central

    Pesano, R L; Pagano, J S

    1986-01-01

    Herpesvirus papio (HVP) and Epstein-Barr virus (EBV) are closely related biologically and biochemically; lymphoblastoid cells infected with either virus contain episomal viral DNA. The putative origin of replication for EBV plasmids (oriP) has been assigned to a 1,790-base-pair fragment (cis) in the short unique region of the genome which requires a viral function supplied in trans from elsewhere in the genome (J. Yates, N. Warren, D. Reisman, and B. Sugden, Proc. Natl. Acad. Sci. USA 81:3806-3810, 1984). We report here the identification of the putative origin of replication (cis) in HVP; we assigned it to the HVP EcoRI K fragment. The results indicate that the HVP replication process requires both a cis and a trans-acting function, analogous to that found in EBV. Images PMID:3023667

  3. Induction of the high-affinity Na(+)-dependent glutamate transport system XAG- by hypertonic stress in the renal epithelial cell line NBL-1.

    PubMed Central

    Ferrer-Martinez, A; Felipe, A; Nicholson, B; Casado, J; Pastor-Anglada, M; McGivan, J

    1995-01-01

    The high-affinity Na(+)-dependent glutamate transport system XAG- is induced (threefold increase in Vmax. with no change in Km) by hypertonicity in the renal epithelial cell line NBL-1. This effect is dependent on protein synthesis and glycosylation and is accompanied by an increase in EAAC1 mRNA levels. Other Na(+)-dependent transport systems in this cell line do not respond to hypertonic stress. In contrast to recent findings [Ruiz-Montasell, Gomez-Angelats, Casado, Felipe, McGivan and Pastor-Anglada (1994) Proc. Natl. Acad. Sci. U.S.A. 91, 9569-9573] showing that increased system A activity after hyperosmotic shock results from induction of a regulatory protein, this is the first demonstration that hypertonicity may increase the expression of the gene for an amino acid transport protein itself. Images Figure 4 PMID:7654212

  4. The dimerization of half-molecule fragments of transferrin.

    PubMed Central

    Williams, J; Moreton, K

    1988-01-01

    Partial proteolysis was used to prepare half-molecule fragments of hen ovotransferrin. N-Terminal and C-terminal fragments associate to form an N-terminal fragment-C-terminal fragment dimer. Variant forms of the N- and C-terminal fragments can be prepared in which a few amino acid residues are lacking from the C-terminal ends of the fragments. These variant fragments are partially or completely unable to associate; the suggestion that the molecular recognition sites are located in these C-terminal stretches of the N-terminal half-molecule (320-332) and of the C-terminal half-molecule (683-686) is in agreement with X-ray-crystallography data for human lactotransferrin [Anderson, Baker, Dodson, Norris, Rumball, Waters & Baker (1987) Proc. Natl. Acad. Sci. U.S.A. 84, 1769-1773]. PMID:3415649

  5. Solitary chemoreceptor cell survival is independent of intact trigeminal innervation.

    PubMed

    Gulbransen, Brian; Silver, Wayne; Finger, Thomas E

    2008-05-01

    Nasal solitary chemoreceptor cells (SCCs) are a population of specialized chemosensory epithelial cells presumed to broaden trigeminal chemoreceptivity in mammals (Finger et al. [2003] Proc Natl Acad Sci USA 100:8981-8986). SCCs are innervated by peptidergic trigeminal nerve fibers (Finger et al. [2003]) but it is currently unknown if intact innervation is necessary for SCC development or survival. We tested the dependence of SCCs on innervation by eliminating trigeminal nerve fibers during development with neurogenin-1 knockout mice, during early postnatal development with capsaicin desensitization, and during adulthood with trigeminal lesioning. Our results demonstrate that elimination of innervation at any of these times does not result in decreased SCC numbers. In conclusion, neither SCC development nor mature cell maintenance is dependent on intact trigeminal innervation. (c) 2008 Wiley-Liss, Inc.

  6. Plant biotechnology for food security and bioeconomy.

    PubMed

    Clarke, Jihong Liu; Zhang, Peng

    2013-09-01

    This year is a special year for plant biotechnology. It was 30 years ago, on January 18 1983, one of the most important dates in the history of plant biotechnology, that three independent groups described Agrobacterium tumefaciens-mediated genetic transformation at the Miami Winter Symposium, leading to the production of normal, fertile transgenic plants (Bevan et al. in Nature 304:184-187, 1983; Fraley et al. in Proc Natl Acad Sci USA 80:4803-4807, 1983; Herrera-Estrella et al. in EMBO J 2:987-995, 1983; Vasil in Plant Cell Rep 27:1432-1440, 2008). Since then, plant biotechnology has rapidly advanced into a useful and valuable tool and has made a significant impact on crop production, development of a biotech industry and the bio-based economy worldwide.

  7. Alternative perspective on the control of transpiration by radiation.

    PubMed

    Mott, Keith A; Peak, David

    2011-12-06

    Stomatal responses to light are important determinants for plant water use efficiency and for general circulation models, but a mechanistic understanding of these responses remains elusive. A recent study [Pieruschka R, Huber G, Berry JA (2010) Proc Natl Acad Sci USA 107:13372-13377] concluded that stomata respond to total absorbed radiation rather than red and blue light as previously thought. We tested this idea by reexamining stomatal responses to red and blue light and to IR radiation. We show that responses to red and blue light are not consistent with a response to total absorbed radiation and that apparent stomatal responses to IR radiation are explainable as experimental artifacts. In addition, our data and analysis provide a method for accurately determining the internal temperature of a leaf.

  8. Novel Random Mutagenesis Method for Directed Evolution.

    PubMed

    Feng, Hong; Wang, Hai-Yan; Zhao, Hong-Yan

    2017-01-01

    Directed evolution is a powerful strategy for gene mutagenesis, and has been used for protein engineering both in scientific research and in the biotechnology industry. The routine method for directed evolution was developed by Stemmer in 1994 (Stemmer, Proc Natl Acad Sci USA 91, 10747-10751, 1994; Stemmer, Nature 370, 389-391, 1994). Since then, various methods have been introduced, each of which has advantages and limitations depending upon the targeted genes and procedure. In this chapter, a novel alternative directed evolution method which combines mutagenesis PCR with dITP and fragmentation by endonuclease V is described. The kanamycin resistance gene is used as a reporter gene to verify the novel method for directed evolution. This method for directed evolution has been demonstrated to be efficient, reproducible, and easy to manipulate in practice.

  9. GeoSciML v3.0 - a significant upgrade of the CGI-IUGS geoscience data model

    NASA Astrophysics Data System (ADS)

    Raymond, O.; Duclaux, G.; Boisvert, E.; Cipolloni, C.; Cox, S.; Laxton, J.; Letourneau, F.; Richard, S.; Ritchie, A.; Sen, M.; Serrano, J.-J.; Simons, B.; Vuollo, J.

    2012-04-01

    GeoSciML version 3.0 (http://www.geosciml.org), released in late 2011, is the latest version of the CGI-IUGS* Interoperability Working Group geoscience data interchange standard. The new version is a significant upgrade and refactoring of GeoSciML v2 which was released in 2008. GeoSciML v3 has already been adopted by several major international interoperability initiatives, including OneGeology, the EU INSPIRE program, and the US Geoscience Information Network, as their standard data exchange format for geoscience data. GeoSciML v3 makes use of recently upgraded versions of several Open Geospatial Consortium (OGC) and ISO data transfer standards, including GML v3.2, SWE Common v2.0, and Observations and Measurements v2 (ISO 19156). The GeoSciML v3 data model has been refactored from a single large application schema with many packages, into a number of smaller, but related, application schema modules with individual namespaces. This refactoring allows the use and future development of modules of GeoSciML (eg; GeologicUnit, GeologicStructure, GeologicAge, Borehole) in smaller, more manageable units. As a result of this refactoring and the integration with new OGC and ISO standards, GeoSciML v3 is not backwardly compatible with previous GeoSciML versions. The scope of GeoSciML has been extended in version 3.0 to include new models for geomorphological data (a Geomorphology application schema), and for geological specimens, geochronological interpretations, and metadata for geochemical and geochronological analyses (a LaboratoryAnalysis-Specimen application schema). In addition, there is better support for borehole data, and the PhysicalProperties model now supports a wider range of petrophysical measurements. The previously used CGI_Value data type has been superseded in favour of externally governed data types provided by OGC's SWE Common v2 and GML v3.2 data standards. The GeoSciML v3 release includes worked examples of best practice in delivering geochemical

  10. NetSciEd: Network Science and Education for the Interconnected World

    ERIC Educational Resources Information Center

    Sayama, Hiroki; Cramer, Catherine; Sheetz, Lori; Uzzo, Stephen

    2017-01-01

    This short article presents a summary of the NetSciEd (Network Science and Education) initiative that aims to address the need for curricula, resources, accessible materials, and tools for introducing K-12 students and the general public to the concept of networks, a crucial framework in understanding complexity. NetSciEd activities include (1)…

  11. HamSCI: The Ham Radio Science Citizen Investigation

    NASA Astrophysics Data System (ADS)

    Frissell, N. A.; Moses, M. L.; Earle, G. D.; McGwier, R. W.; Miller, E. S.; Kaeppler, S. R.; Silver, H. W.; Ceglia, F.; Pascoe, D.; Sinanis, N.; Smith, P.; Williams, R.; Shovkoplyas, A.; Gerrard, A. J.

    2016-12-01

    Amateur (or "ham") radio operators are individuals with a non-pecuniary interest in radio technology, engineering, communications, science, and public service. They are licensed by their national governments to transmit on amateur radio frequencies. In many jurisdictions, there is no age requirement for a ham radio license, and operators from diverse backgrounds participate. There are more than 740,000 hams in the US, and over 3 million (estimated) worldwide. Many amateur communications are conducted using transionospheric links and thus affected by space weather and ionospheric processes. Recent technological advances have enabled the development of automated ham radio observation networks (e.g. the Reverse Beacon Network, www.reversebeacon.net) and specialized operating modes for the study of weak-signal propagation. The data from these networks have been shown to be useful for the study of ionospheric processes. In order to connect professional researchers with the volunteer-based ham radio community, HamSCI (Ham Radio Science Citizen Investigation, www.hamsci.org) has been established. HamSCI is a platform for publicizing and promoting projects that are consistent with the following objectives: (1) Advance scientific research and understanding through amateur radio activities. (2) Encourage the development of new technologies to support this research. (3) Provide educational opportunities for the amateur community and the general public. HamSCI researchers are working with the American Radio Relay League (ARRL, www.arrl.org) to publicize these objectives and recruit interested hams. The ARRL is the US national organization for amateur radio with a membership of over 170,000 and a monthly magazine, QST. HamSCI is currently preparing to support ionospheric research connected to the 21 Aug 2017 Total Solar Eclipse by expanding coverage of the Reverse Beacon Network and organizing a large-scale ham radio operating event ("QSO Party") to generate data during the

  12. Spinal Cord Injury Community Survey: Understanding the Needs of Canadians with SCI.

    PubMed

    Noreau, Luc; Noonan, Vanessa K; Cobb, John; Leblond, Jean; Dumont, Frédéric S

    2014-01-01

    There is a lack of literature regarding service needs of people with SCI living in the community. Better assessment of expressed and met and unmet needs would help in the development of effective service delivery. From a national SCI Community Survey in Canada, the aim was to identify the most critical service needs of people living in the community at least 1 year post discharge from rehabilitation and the support they received to meet their needs. Data were collected mainly through a secure Web site and encompassed demographics, personal and household income, an SCI severity measure, and an SCI community needs measure containing information on 13 SCI-related needs. A total of 1,549 persons with SCI (traumatic lesion, n = 1,137; nontraumatic lesion, n = 412) across Canada completed the survey. Most critical needs for community integration were expressed by a substantial proportion of survey participants, but significantly more expressed and met needs were reported by persons with a traumatic than a nontraumatic lesion. Personal and environmental characteristics influenced the probability of expressing and meeting needs (eg, severity of injury and household income). Help and support to meet expressed needs were received from government agencies, community organizations, and friends or family. Better assessment of expressed and met or unmet needs for services remains a challenge but will serve as a tool to optimize service delivery in the community. Environmental barriers to services, particularly the process of getting needs met and associated costs, remain an issue that requires a reconsideration of some aspects of access to services.

  13. GeoSciML version 3: A GML application for geologic information

    NASA Astrophysics Data System (ADS)

    International Union of Geological Sciences., I. C.; Richard, S. M.

    2011-12-01

    After 2 years of testing and development, XML schema for GeoSciML version 3 are now ready for application deployment. GeoSciML draws from many geoscience data modelling efforts to establish a common suite of feature types to represent information associated with geologic maps (materials, structures, and geologic units) and observations including structure data, samples, and chemical analyses. After extensive testing and use case analysis, in December 2008 the CGI Interoperability Working Group (IWG) released GeoSciML 2.0 as an application schema for basic geological information. GeoSciML 2.0 is in use to deliver geologic data by the OneGeology Europe portal, the Geological Survey of Canada Groundwater Information Network (wet GIN), and the Auscope Mineral Resources portal. GeoSciML to version 3.0 is updated to OGC Geography Markup Language v3.2, re-engineered patterns for association of element values with controlled vocabulary concepts, incorporation of ISO19156 Observation and Measurement constructs for representing numeric and categorical values and for representing analytical data, incorporation of EarthResourceML to represent mineral occurrences and mines, incorporation of the GeoTime model to represent GSSP and stratigraphic time scale, and refactoring of the GeoSciML namespace to follow emerging ISO practices for decoupling of dependencies between standardized namespaces. These changes will make it easier for data providers to link to standard vocabulary and registry services. The depth and breadth of GeoSciML remains largely unchanged, covering the representation of geologic units, earth materials and geologic structures. ISO19156 elements and patterns are used to represent sampling features such as boreholes and rock samples, as well as geochemical and geochronologic measurements. Geologic structures include shear displacement structures (brittle faults and ductile shears), contacts, folds, foliations, lineations and structures with no preferred

  14. Targeting Translational Successes through CANSORT-SCI: Using Pet Dogs To Identify Effective Treatments for Spinal Cord Injury.

    PubMed

    Moore, Sarah A; Granger, Nicolas; Olby, Natasha J; Spitzbarth, Ingo; Jeffery, Nick D; Tipold, Andrea; Nout-Lomas, Yvette S; da Costa, Ronaldo C; Stein, Veronika M; Noble-Haeusslein, Linda J; Blight, Andrew R; Grossman, Robert G; Basso, D Michele; Levine, Jonathan M

    2017-06-15

    Translation of therapeutic interventions for spinal cord injury (SCI) from laboratory to clinic has been historically challenging, highlighting the need for robust models of injury that more closely mirror the human condition. The high prevalence of acute, naturally occurring SCI in pet dogs provides a unique opportunity to evaluate expeditiously promising interventions in a population of animals that receive diagnoses and treatment clinically in a manner similar to persons with SCI, while adhering to National Institutes of Health guidelines for scientific rigor and transparent reporting. In addition, pet dogs with chronic paralysis are often maintained long-term by their owners, offering a similarly unique population for study of chronic SCI. Despite this, only a small number of studies have used the clinical dog model of SCI. The Canine Spinal Cord Injury Consortium (CANSORT-SCI) was recently established by a group of veterinarians and basic science researchers to promote the value of the canine clinical model of SCI. The CANSORT-SCI group held an inaugural meeting November 20 and 21, 2015 to evaluate opportunities and challenges to the use of pet dogs in SCI research. Key challenges identified included lack of familiarity with the model among nonveterinary scientists and questions about how and where in the translational process the canine clinical model would be most valuable. In light of these, we review the natural history, outcome, and available assessment tools associated with canine clinical SCI with emphasis on their relevance to human SCI and the translational process.

  15. SciSpark: In-Memory Map-Reduce for Earth Science Algorithms

    NASA Astrophysics Data System (ADS)

    Ramirez, P.; Wilson, B. D.; Whitehall, K. D.; Palamuttam, R. S.; Mattmann, C. A.; Shah, S.; Goodman, A.; Burke, W.

    2016-12-01

    We are developing a lightning fast Big Data technology called SciSpark based on ApacheTM Spark under a NASA AIST grant (PI Mattmann). Spark implements the map-reduce paradigm for parallel computing on a cluster, but emphasizes in-memory computation, "spilling" to disk only as needed, and so outperforms the disk-based Apache Hadoop by 100x in memory and by 10x on disk. SciSpark extends Spark to support Earth Science use in three ways: Efficient ingest of N-dimensional geo-located arrays (physical variables) from netCDF3/4, HDF4/5, and/or OPeNDAP URLS; Array operations for dense arrays in scala and Java using the ND4S/ND4J or Breeze libraries; Operations to "split" datasets across a Spark cluster by time or space or both. For example, a decade-long time-series of geo-variables can be split across time to enable parallel "speedups" of analysis by day, month, or season. Similarly, very high-resolution climate grids can be partitioned into spatial tiles for parallel operations across rows, columns, or blocks. In addition, using Spark's gateway into python, PySpark, one can utilize the entire ecosystem of numpy, scipy, etc. Finally, SciSpark Notebooks provide a modern eNotebook technology in which scala, python, or spark-sql codes are entered into cells in the Notebook and executed on the cluster, with results, plots, or graph visualizations displayed in "live widgets". We have exercised SciSpark by implementing three complex Use Cases: discovery and evolution of Mesoscale Convective Complexes (MCCs) in storms, yielding a graph of connected components; PDF Clustering of atmospheric state using parallel K-Means; and statistical "rollups" of geo-variables or model-to-obs. differences (i.e. mean, stddev, skewness, & kurtosis) by day, month, season, year, and multi-year. Geo-variables are ingested and split across the cluster using methods on the sciSparkContext object including netCDFVariables() for spatial decomposition and wholeNetCDFVariables() for time-series. The

  16. SciServer: An Online Collaborative Environment for Big Data in Research and Education

    NASA Astrophysics Data System (ADS)

    Raddick, Jordan; Souter, Barbara; Lemson, Gerard; Taghizadeh-Popp, Manuchehr

    2017-01-01

    For the past year, SciServer Compute (http://compute.sciserver.org) has offered access to big data resources running within server-side Docker containers. Compute has allowed thousands of researchers to bring advanced analysis to big datasets like the Sloan Digital Sky Survey and others, while keeping the analysis close to the data for better performance and easier read/write access. SciServer Compute is just one part of the SciServer system being developed at Johns Hopkins University, which provides an easy-to-use collaborative research environment for astronomy and many other sciences.SciServer enables these collaborative research strategies using Jupyter notebooks, in which users can write their own Python and R scripts and execute them on the same server as the data. We have written special-purpose libraries for querying, reading, and writing data. Intermediate results can be stored in large scratch space (hundreds of TBs) and analyzed directly from within Python or R with state-of-the-art visualization and machine learning libraries. Users can store science-ready results in their permanent allocation on SciDrive, a Dropbox-like system for sharing and publishing files.SciServer Compute’s virtual research environment has grown with the addition of task management and access control functions, allowing collaborators to share both data and analysis scripts securely across the world. These features also open up new possibilities for education, allowing instructors to share datasets with students and students to write analysis scripts to share with their instructors. We are leveraging these features into a new system called “SciServer Courseware,” which will allow instructors to share assignments with their students, allowing students to engage with big data in new ways.SciServer has also expanded to include more datasets beyond the Sloan Digital Sky Survey. A part of that growth has been the addition of the SkyQuery component, which allows for simple, fast

  17. Not just quantity: gluteus maximus muscle characteristics in able-bodied and SCI individuals--implications for tissue viability.

    PubMed

    Wu, Gary A; Bogie, Kath M

    2013-08-01

    Some individuals with spinal cord injury (SCI) remain pressure ulcer (PU) free whilst others experience a recurring cycle of tissue breakdown. Detailed analysis of gluteal muscle characteristics may provide insights to local tissue viability variability. The study hypothesis was that SCI individuals have altered muscle composition compared to able-bodied (AB). Ten AB and ten SCI received a supine pelvic CT scan, with contrast. Cross-sectional area (CSA) and overall muscle volume were derived using image analysis. Gluteal muscle tissue type was classified at the S2/S3 sacral vertebrae midpoint, the superior greater trochanters margin (GT) and the inferior ischial tuberosities margin (IT) using the linear transformation Hounsfield Unit scale. SCI gluteal CSA was less than for AB throughout the muscle, with the greatest relative atrophy at the IT (48%). Average AB gluteal volume was nearly double SCI. Eight SCI had over 20% infiltrative adipose tissue, three with over 50%. SCI gluteal CSA and intramuscular fat infiltration were significantly negatively correlated (p < 0.05). SCI IT axial slices showed less lean muscle and higher intramuscular fat infiltration than more proximally (p < 0.05). SCI gluteal muscle characteristics were indicative of impaired tissue viability. SCI disuse muscle atrophy was anticipated; the analytic approach further indicated that intramuscular atrophy was not uniform. SCI muscle composition showed increased proportions of both low density muscle and adipose tissue. CT scan with contrast is effective for gluteal muscle characterization. This assessment technique may contribute to determination of personalized risk for PU development and other secondary complications. Published by Elsevier Ltd.

  18. Targeting Translational Successes through CANSORT-SCI: Using Pet Dogs To Identify Effective Treatments for Spinal Cord Injury

    PubMed Central

    Granger, Nicolas; Olby, Natasha J.; Spitzbarth, Ingo; Jeffery, Nick D.; Tipold, Andrea; Nout-Lomas, Yvette S.; da Costa, Ronaldo C.; Stein, Veronika M.; Noble-Haeusslein, Linda J.; Blight, Andrew R.; Grossman, Robert G.; Basso, D. Michele; Levine, Jonathan M.

    2017-01-01

    Abstract Translation of therapeutic interventions for spinal cord injury (SCI) from laboratory to clinic has been historically challenging, highlighting the need for robust models of injury that more closely mirror the human condition. The high prevalence of acute, naturally occurring SCI in pet dogs provides a unique opportunity to evaluate expeditiously promising interventions in a population of animals that receive diagnoses and treatment clinically in a manner similar to persons with SCI, while adhering to National Institutes of Health guidelines for scientific rigor and transparent reporting. In addition, pet dogs with chronic paralysis are often maintained long-term by their owners, offering a similarly unique population for study of chronic SCI. Despite this, only a small number of studies have used the clinical dog model of SCI. The Canine Spinal Cord Injury Consortium (CANSORT-SCI) was recently established by a group of veterinarians and basic science researchers to promote the value of the canine clinical model of SCI. The CANSORT-SCI group held an inaugural meeting November 20 and 21, 2015 to evaluate opportunities and challenges to the use of pet dogs in SCI research. Key challenges identified included lack of familiarity with the model among nonveterinary scientists and questions about how and where in the translational process the canine clinical model would be most valuable. In light of these, we review the natural history, outcome, and available assessment tools associated with canine clinical SCI with emphasis on their relevance to human SCI and the translational process. PMID:28230415

  19. Whole body vibration (WBV) following spinal cord injury (SCI) in rats: Timing of intervention.

    PubMed

    Manthou, Marilena; Abdulla, Diana Saad Yousif; Pavlov, Stoyan Pavlov; Jansen, Ramona; Bendella, Habib; Nohroudi, Klaus; Stein, Gregor; Meyer, Carolin; Ozsoy, Ozlem; Ozsoy, Umut; Behram Kandemir, Yasemin; Sarikcioglu, Levent; Semler, Oliver; Schoenau, Eckhard; Dunlop, Sarah; Angelov, Doychin Nikolov

    2017-01-01

    Following spinal cord injury (SCI), exercise training provides a wide range of benefits and promotes activity-dependent synaptic plasticity. Whole body vibration (WBV) in SCI patients improves walking and spasticity as well as bone and muscle mass. However, little is known about the effects of timing or frequency of intervention. To determine which WBV-onset improves locomotor and bladder functions and influences synaptic plasticity beneficially. SCI was followed by WBV starting 1, 7, 14, 28 days after injury (WBV1, WBV7, etc.) and continued for 12 weeks. Intact animals and those receiving SCI but no WBV (No WBV), SCI plus WBV twice daily (2×WBV) and SCI followed by passive hindlimb flexion-extension (PFE) served as controls. Locomotor [BBB rating, foot stepping angle (FSA) and rump-height index (RHI)] as well as bladder function were determined at 1, 3, 6, 9, and 12 weeks. Following perfusion fixation at 12 weeks, lesion volume and immunofluorescence for astrogliosis (GFAP), microglia (IBA1) and synaptic vesicles (synaptophysin, SYN) were determined. Compared to the No WBV group, the WB7 and WBV14 groups showed significantly faster speeds of BBB score recovery though this effect was temporary. Considering RHI we detected a sustained improvement in the WBV14 and PFE groups. Bladder function was better in the WBV14, WBV28, 2×WBV and PFE groups. Synaptophysin levels improved in response to WBV7 and WBV14, but worsened after WBV28 in parallel to an increased IBA1 expression. Correlation- and principal components analysis revealed complex relationships between behavioural (BBB, FSA, RHI) and morphological (GFAP, IBA1, SYN) measurements. WBV started 14 days after SCI provides the most benefit (RHI, bladder); starting at 1day after SCI provides no benefit and starting at 28 days may be detrimental. Increasing the intensity of WBV to twice daily did not provide additional benefit.

  20. Detection of Abnormal Muscle Activations during Walking Following Spinal Cord Injury (SCI)

    ERIC Educational Resources Information Center

    Wang, Ping; Low, K. H.; McGregor, Alison H.; Tow, Adela

    2013-01-01

    In order to identify optimal rehabilitation strategies for spinal cord injury (SCI) participants, assessment of impaired walking is required to detect, monitor and quantify movement disorders. In the proposed assessment, ten healthy and seven SCI participants were recruited to perform an over-ground walking test at slow walking speeds. SCI…

  1. GeoSciGraph: An Ontological Framework for EarthCube Semantic Infrastructure

    NASA Astrophysics Data System (ADS)

    Gupta, A.; Schachne, A.; Condit, C.; Valentine, D.; Richard, S.; Zaslavsky, I.

    2015-12-01

    The CINERGI (Community Inventory of EarthCube Resources for Geosciences Interoperability) project compiles an inventory of a wide variety of earth science resources including documents, catalogs, vocabularies, data models, data services, process models, information repositories, domain-specific ontologies etc. developed by research groups and data practitioners. We have developed a multidisciplinary semantic framework called GeoSciGraph semantic ingration of earth science resources. An integrated ontology is constructed with Basic Formal Ontology (BFO) as its upper ontology and currently ingests multiple component ontologies including the SWEET ontology, GeoSciML's lithology ontology, Tematres controlled vocabulary server, GeoNames, GCMD vocabularies on equipment, platforms and institutions, software ontology, CUAHSI hydrology vocabulary, the environmental ontology (ENVO) and several more. These ontologies are connected through bridging axioms; GeoSciGraph identifies lexically close terms and creates equivalence class or subclass relationships between them after human verification. GeoSciGraph allows a community to create community-specific customizations of the integrated ontology. GeoSciGraph uses the Neo4J,a graph database that can hold several billion concepts and relationships. GeoSciGraph provides a number of REST services that can be called by other software modules like the CINERGI information augmentation pipeline. 1) Vocabulary services are used to find exact and approximate terms, term categories (community-provided clusters of terms e.g., measurement-related terms or environmental material related terms), synonyms, term definitions and annotations. 2) Lexical services are used for text parsing to find entities, which can then be included into the ontology by a domain expert. 3) Graph services provide the ability to perform traversal centric operations e.g., finding paths and neighborhoods which can be used to perform ontological operations like

  2. Understanding Quality of Life in Adults with Spinal Cord Injury Via SCI-Related Needs and Secondary Complications.

    PubMed

    Sweet, Shane N; Noreau, Luc; Leblond, Jean; Dumont, Frédéric S

    2014-01-01

    Understanding the factors that can predict greater quality of life (QoL) is important for adults with spinal cord injury (SCI), given that they report lower levels of QoL than the general population. To build a conceptual model linking SCI-related needs, secondary complications, and QoL in adults with SCI. Prior to testing the conceptual model, we aimed to develop and evaluate the factor structure for both SCI-related needs and secondary complications. Individuals with a traumatic SCI (N = 1,137) responded to an online survey measuring 13 SCI-related needs, 13 secondary complications, and the Life Satisfaction Questionnaire to assess QoL. The SCI-related needs and secondary complications were conceptualized into factors, tested with a confirmatory factor analysis, and subsequently evaluated in a structural equation model to predict QoL. The confirmatory factor analysis supported a 2-factor model for SCI related needs, χ(2)(61, N = 1,137) = 250.40, P <.001, comparative fit index (CFI) = .93, root mean square error of approximation (RMSEA) = .05, standardized root mean square residual (SRMR) = .04, and for 11 of the 13 secondary complications, χ(2)(44, N = 1,137) = 305.67, P < .001, CFI = .91, RMSEA = .060, SRMR = .033. The final 2 secondary complications were kept as observed constructs. In the structural model, both vital and personal development unmet SCI-related needs (β = -.22 and -.20, P < .05, respectively) and the neuro-physiological systems factor (β = -.45, P < .05) were negatively related with QoL. Identifying unmet SCI-related needs of individuals with SCI and preventing or managing secondary complications are essential to their QoL.

  3. Emotional Intelligence in Patients with Spinal Cord Injury (SCI).

    PubMed

    Saberi, Hooshang; Ghajarzadeh, Mahsa

    2017-05-01

    Spinal Cord Injury (SCI) is a devastating situation. Spinal Cord Injury affects functional, psychological and socioeconomic aspects of patients' lives. The ability to accomplish and explicate the one's own and other's feelings and emotions to spread over appropriate information for confirming thoughts and actions is defined as emotional intelligence (EI). The goal of this study was to evaluate depression and EI in SCI patients in comparison with healthy subjects. One-hundred-ten patients with SCI and 80 healthy subjects between Aug 2014 and Aug 2015 were enrolled. The study was conducted in Imam Hospital, Tehran, Iran. All participants were asked to fill valid and reliable Persian version Emotional Quotient inventory (EQ-i) and Beck Depression Inventory (BDI). All data were analyzed using SPSS. Data were presented as Mean±SD for continuous or frequencies for categorical variables. Continuous variables compared by means of independent sample t -test. P -values less than 0.05 were considered as significant. Mean age of patients was 28.7 and mean age of controls was 30.2 yr. Spinal cord injury in 20 (18.3%) were at cervical level, in 83 (75.4%) were thoracic and in 7 (6.3%) were lumbar. Mean values of independence, stress tolerance, self-actualization, emotional Self-Awareness, reality testing, Impulse Control, flexibility, responsibility, and assertiveness were significantly different between cases and controls. Mean values of stress tolerance, optimism, self-regard, and responsibility were significantly different between three groups with different injury level. Most scales were not significantly different between male and female cases. Emotional intelligence should be considered in SCI cases as their physical and psychological health is affected by their illness.

  4. Spinal Cord Injury Clinical Registries: Improving Care across the SCI Care Continuum by Identifying Knowledge Gaps.

    PubMed

    Dvorak, Marcel F; Cheng, Christiana L; Fallah, Nader; Santos, Argelio; Atkins, Derek; Humphreys, Suzanne; Rivers, Carly S; White, Barry A B; Ho, Chester; Ahn, Henry; Kwon, Brian K; Christie, Sean; Noonan, Vanessa K

    2017-10-15

    Timely access and ongoing delivery of care and therapeutic interventions is needed to maximize recovery and function after traumatic spinal cord injury (tSCI). To ensure these decisions are evidence-based, access to consistent, reliable, and valid sources of clinical data is required. The Access to Care and Timing Model used data from the Rick Hansen SCI Registry (RHSCIR) to generate a simulation of healthcare delivery for persons after tSCI and to test scenarios aimed at improving outcomes and reducing the economic burden of SCI. Through model development, we identified knowledge gaps and challenges in the literature and current health outcomes data collection throughout the continuum of SCI care. The objectives of this article were to describe these gaps and to provide recommendations for bridging them. Accurate information on injury severity after tSCI was hindered by difficulties in conducting neurological assessments and classifications of SCI (e.g., timing), variations in reporting, and the lack of a validated SCI-specific measure of associated injuries. There was also limited availability of reliable data on patient factors such as multi-morbidity and patient-reported measures. Knowledge gaps related to structures (e.g., protocols) and processes (e.g., costs) at each phase of care have prevented comprehensive evaluation of system performance. Addressing these knowledge gaps will enhance comparative and cost-effectiveness evaluations to inform decision-making and standards of care. Recommendations to do so were: standardize data element collection and facilitate database linkages, validate and adopt more outcome measures for SCI, and increase opportunities for collaborations with stakeholders from diverse backgrounds.

  5. Spinal Cord Injury Clinical Registries: Improving Care across the SCI Care Continuum by Identifying Knowledge Gaps

    PubMed Central

    Cheng, Christiana L.; Fallah, Nader; Santos, Argelio; Atkins, Derek; Humphreys, Suzanne; Rivers, Carly S.; White, Barry A.B.; Ho, Chester; Ahn, Henry; Kwon, Brian K.; Christie, Sean; Noonan, Vanessa K.

    2017-01-01

    Abstract Timely access and ongoing delivery of care and therapeutic interventions is needed to maximize recovery and function after traumatic spinal cord injury (tSCI). To ensure these decisions are evidence-based, access to consistent, reliable, and valid sources of clinical data is required. The Access to Care and Timing Model used data from the Rick Hansen SCI Registry (RHSCIR) to generate a simulation of healthcare delivery for persons after tSCI and to test scenarios aimed at improving outcomes and reducing the economic burden of SCI. Through model development, we identified knowledge gaps and challenges in the literature and current health outcomes data collection throughout the continuum of SCI care. The objectives of this article were to describe these gaps and to provide recommendations for bridging them. Accurate information on injury severity after tSCI was hindered by difficulties in conducting neurological assessments and classifications of SCI (e.g., timing), variations in reporting, and the lack of a validated SCI-specific measure of associated injuries. There was also limited availability of reliable data on patient factors such as multi-morbidity and patient-reported measures. Knowledge gaps related to structures (e.g., protocols) and processes (e.g., costs) at each phase of care have prevented comprehensive evaluation of system performance. Addressing these knowledge gaps will enhance comparative and cost-effectiveness evaluations to inform decision-making and standards of care. Recommendations to do so were: standardize data element collection and facilitate database linkages, validate and adopt more outcome measures for SCI, and increase opportunities for collaborations with stakeholders from diverse backgrounds. PMID:28745934

  6. FES-Rowing versus Zoledronic Acid to Improve BoneHealth in SCI

    DTIC Science & Technology

    2016-12-01

    SUPPLEMENTARY NOTES 14. ABSTRACT There is no established treatment to prevent bone loss or to induce new bone formation following SCI, although the... no established treatment to prevent bone loss or to induce new bone formation following SCI. The goal of this clinical trial -- FES-Rowing versus...Army position, policy or decision unless so designated by other documentation. REPORT DOCUMENTATION PAGE Form Approved OMB No . 0704-0188 Public

  7. Implementing Connected Component Labeling as a User Defined Operator for SciDB

    NASA Technical Reports Server (NTRS)

    Oloso, Amidu; Kuo, Kwo-Sen; Clune, Thomas; Brown, Paul; Poliakov, Alex; Yu, Hongfeng

    2016-01-01

    We have implemented a flexible User Defined Operator (UDO) for labeling connected components of a binary mask expressed as an array in SciDB, a parallel distributed database management system based on the array data model. This UDO is able to process very large multidimensional arrays by exploiting SciDB's memory management mechanism that efficiently manipulates arrays whose memory requirements far exceed available physical memory. The UDO takes as primary inputs a binary mask array and a binary stencil array that specifies the connectivity of a given cell to its neighbors. The UDO returns an array of the same shape as the input mask array with each foreground cell containing the label of the component it belongs to. By default, dimensions are treated as non-periodic, but the UDO also accepts optional input parameters to specify periodicity in any of the array dimensions. The UDO requires four stages to completely label connected components. In the first stage, labels are computed for each subarray or chunk of the mask array in parallel across SciDB instances using the weighted quick union (WQU) with half-path compression algorithm. In the second stage, labels around chunk boundaries from the first stage are stored in a temporary SciDB array that is then replicated across all SciDB instances. Equivalences are resolved by again applying the WQU algorithm to these boundary labels. In the third stage, relabeling is done for each chunk using the resolved equivalences. In the fourth stage, the resolved labels, which so far are "flattened" coordinates of the original binary mask array, are renamed with sequential integers for legibility. The UDO is demonstrated on a 3-D mask of O(1011) elements, with O(108) foreground cells and O(106) connected components. The operator completes in 19 minutes using 84 SciDB instances.

  8. Lifetime exercise intolerance with lactic acidosis as key manifestation of novel compound heterozygous ACAD9 mutations causing complex I deficiency.

    PubMed

    Schrank, Bertold; Schoser, Benedikt; Klopstock, Thomas; Schneiderat, Peter; Horvath, Rita; Abicht, Angela; Holinski-Feder, Elke; Augustis, Sarunas

    2017-05-01

    We report a 36-year-old female having lifetime exercise intolerance and lactic acidosis with nausea associated with novel compound heterozygous Acyl-CoA dehydrogenase 9 gene (ACAD9) mutations (p.Ala390Thr and p.Arg518Cys). ACAD9 is an assembly factor for the mitochondrial respiratory chain complex I. ACAD9 mutations are recognized as frequent causes of complex I deficiency. Our patient presented with exercise intolerance, rapid fatigue, and nausea since early childhood. Mild physical workload provoked the occurrence of nausea and vomiting repeatedly. Her neurological examination, laboratory findings and muscle biopsy demonstrated no abnormalities. A bicycle spiroergometry provoked significant lactic acidosis during and following exercise pointing towards a mitochondrial disorder. Subsequently, the analysis of respiratory chain enzyme activities in muscle revealed severe isolated complex I deficiency. Candidate gene sequencing revealed two novel heterozygous ACAD9 mutations. This patient report expands the mutational and phenotypic spectrum of diseases associated with mutations in ACAD9. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. People Interview: Using sci-fi to promote physics

    NASA Astrophysics Data System (ADS)

    2009-07-01

    INTERVIEW Using sci-fi to promote physics Robert Flack, a research fellow at University College London, talks to David Smith about science writing and the consequences for physicists of books like Angels and Demons.

  10. Le Carbonifère du Maroc central : les formations de Migoumess, de Tirhela et d'Idmarrach. Lithologie, biostratigraphie et conséquences géodynamiquesThe Carboniferous formations of Migoumess, Tirhela and Idmarrach (central Morocco): lithology, biostratigraphy and geodynamic consequences

    NASA Astrophysics Data System (ADS)

    Berkhli, Mostafa; Vachard, Daniel

    2002-01-01

    New biostratigraphical data based on foraminifers, algae and pseudo-algae indicate that the limestone pebbles of the channelized polygenic conglomerates of the Migoumess formation contain Late Visean (V3b γ-V3c) assemblages. That confirms the Westphalian age attributed to this formation by Hollard [Zdt. Geol. Ges. 129 (1978) 495-512]. The Tournaisian age assigned to it by palynology [C. R. Acad. Sci. Paris, série II 310 (1990) 1573-1576] cannot be retained. The Tirhela formation, Late Visean and Serpukhovian (E1) in age, is coeval with the Akerchi formation [Berkhli, thèse d'État, 1999; Berkhli et al., J. Afr. Earth Sci. (accepté)]. The Idmarrach formation, mapped as a thrust sheet [C. R. Acad. Sci. Paris, série II 310 (1990) 1573-1576], is dated as Serpukhovian (E1) and its thrusting is consequently post-Serpukhovian. Palaeogeographic and geodynamic consequences are listed. To cite this article: M. Berkhli, D. Vachard, C. R. Geoscience 334 (2002) 67-72

  11. Scalable Earth-observation Analytics for Geoscientists: Spacetime Extensions to the Array Database SciDB

    NASA Astrophysics Data System (ADS)

    Appel, Marius; Lahn, Florian; Pebesma, Edzer; Buytaert, Wouter; Moulds, Simon

    2016-04-01

    Today's amount of freely available data requires scientists to spend large parts of their work on data management. This is especially true in environmental sciences when working with large remote sensing datasets, such as obtained from earth-observation satellites like the Sentinel fleet. Many frameworks like SpatialHadoop or Apache Spark address the scalability but target programmers rather than data analysts, and are not dedicated to imagery or array data. In this work, we use the open-source data management and analytics system SciDB to bring large earth-observation datasets closer to analysts. Its underlying data representation as multidimensional arrays fits naturally to earth-observation datasets, distributes storage and computational load over multiple instances by multidimensional chunking, and also enables efficient time-series based analyses, which is usually difficult using file- or tile-based approaches. Existing interfaces to R and Python furthermore allow for scalable analytics with relatively little learning effort. However, interfacing SciDB and file-based earth-observation datasets that come as tiled temporal snapshots requires a lot of manual bookkeeping during ingestion, and SciDB natively only supports loading data from CSV-like and custom binary formatted files, which currently limits its practical use in earth-observation analytics. To make it easier to work with large multi-temporal datasets in SciDB, we developed software tools that enrich SciDB with earth observation metadata and allow working with commonly used file formats: (i) the SciDB extension library scidb4geo simplifies working with spatiotemporal arrays by adding relevant metadata to the database and (ii) the Geospatial Data Abstraction Library (GDAL) driver implementation scidb4gdal allows to ingest and export remote sensing imagery from and to a large number of file formats. Using added metadata on temporal resolution and coverage, the GDAL driver supports time-based ingestion of

  12. On the Chemical Emergence of Phosphate-Based Biochemistry

    NASA Astrophysics Data System (ADS)

    Kee, Terence

    Contemporary organisms use orthophosphate derivatives (PO43-) in their cell biochemistry,1 yet questions remain as to how Nature was able to accumulate, activate and exploit the or-thophosphate group from geological sources with both poorly solubility and low chemical activ-ity.2 Gulick argued3 a central role for reduced oxidation state phosphorus (P) oxyacids such as H-phosphonates (H2PO3-) and especially H-phosphinates (H2PO2-) in prebiotic chemistry on account of the greater water solubility of their metal salts and, with the presence of P-H bonds, a different reactivity profile to that expected of orthophosphate. The recent demonstration that hydrothermal corrosion of P-rich mineral phases such as schreibersite (Fe,Ni)3P within iron meteorites leads to production of various P-oxyacids including H-phosphonic (H3PO3)4 and H-phosphinic5 acids as well as orthophosphate has reignited interest in reduced oxida-tion state P chemistry in prebiotic environments. We are examining the prebiotic potential of reduced oxidation state P-chemistry through reactions with carbonyl substrates with rea-sonable prebiotic provenance including formaldehyde glycolaldehyde, both intimately involved in the formose reaction for sugar synthesis6 and pyruvic acid,7 a product of glycolysis and feed-stock for the citric acid cycle, a fundamental cellular metablic process whose heritage is considered an ancient one. In this contribution we present some of our latest results on the H-phosphinate-pyruvate system. References: [1] Lodish H et al. (2000) Molecular Cell Biology, 4th Ed., W. H. Freeman Co., New York. [2] Gulick A. (1955) Am. Sci., 43, 479. [3] Gulick A. (1957) Ann. N. Y. Acad. Sci. 69, 309. [4] Pasek M. A. (2008) Proc. Nat. Acad. Sci. USA, 105, 853. [5] Bryant D. E.and Kee T. P. (2006) Chem. Commun. 2344. [6] Weber A. L. (2000) Origins of Life and Evol. Biosph., 30, 33. [7] Cody G. D. et. al. (2000) Science 289, 1337.

  13. Differential Impact and Use of a Telehealth Intervention by Persons with MS or SCI.

    PubMed

    Mercier, Hannah W; Ni, Pensheng; Houlihan, Bethlyn V; Jette, Alan M

    2015-11-01

    The objective of this study was to compare outcomes and patterns of engaging with a telehealth intervention (CareCall) by adult wheelchair users with severe mobility limitations with a diagnosis of multiple sclerosis (MS) or spinal cord injury (SCI). The design of this study is a secondary analysis from a pilot randomized controlled trial with 106 participants with SCI and 36 participants with MS. General linear model results showed that an interaction between baseline depression score and study group significantly predicted reduced depression at 6 mos for subjects with both diagnoses (P = 0.01). For those with MS, CareCall increased participants' physical independence (P < 0.001). No statistically significant differences in skin integrity were found between study groups for subjects with either diagnosis. All participants were similarly satisfied with CareCall, although those with MS engaged in almost double the amount of calls per person than those with SCI (P = 0.005). Those with SCI missed more calls (P < 0.001) and required more extensive support from a nurse (P = 0.006) than those with MS. An interactive telephone intervention was effective in reducing depression in adult wheelchair users with either MS or SCI, and in increasing health care access and physical independence for those with a diagnosis of MS. Future research should aim to enhance the efficacy of such an intervention for participants with SCI.

  14. Pressure Relief Behaviors and Weight-Shifting Activities to Prevent Pressure Ulcers in Persons with SCI

    DTIC Science & Technology

    2014-10-01

    Prevent Pressure Ulcers in Persons with SCI PRINCIPAL INVESTIGATOR: Stephen Sprigle, PhD CONTRACTING ORGANIZATION: Georgia Tech Research...Pressure Ulcers in Persons with SCI 5a. CONTRACT NUMBER 5b. GRANT NUMBER W81XWH-13-1-0387 5c. PROGRAM ELEMENT NUMBER...SUPPLEMENTARY NOTES 14. ABSTRACT Pressure ulcers (PU) are the most costly secondary complication following an SCI. In addition to the medical costs

  15. Novel Target for Ameliorating Pain and Other Problems after SCI: Spontaneous Activity in Nociceptors

    DTIC Science & Technology

    2013-10-01

    pretest , post -SCI, and post -TRPV1 intervention). Mechanical hypersensitivity was tested with a single series of cal- ibrated von Frey filaments (Stoelting... test sequence ( pretest , post -SCI, postinjection) [F(2,17) = 11.37; P = 0.007] and drug treat- ment [F(1,11) = 10.70; P = 0.008], with latencies for...revealed a significant effect of the test sequence ( pretest , post -SCI, post -ODN) [F(2,18) = 22.78; P < 0.0001] and ODN treatment [F(1,9) = 11.03; P

  16. Natural Killer (NK) Cell Functionality after human Spinal Cord Injury (SCI): protocol of a prospective, longitudinal study.

    PubMed

    Laginha, Inês; Kopp, Marcel A; Druschel, Claudia; Schaser, Klaus-Dieter; Brommer, Benedikt; Hellmann, Rick C; Watzlawick, Ralf; Ossami-Saidi, Ramin-Raul; Prüss, Harald; Failli, Vieri; Meisel, Christian; Liebscher, Thomas; Prilipp, Erik; Niedeggen, Andreas; Ekkernkamp, Axel; Grittner, Ulrike; Piper, Sophie K; Dirnagl, Ulrich; Killig, Monica; Romagnani, Chiara; Schwab, Jan M

    2016-09-13

    Natural killer (NK) cells comprise the main components of lymphocyte-mediated nonspecific immunity. Through their effector function they play a crucial role combating bacterial and viral challenges. They are also thought to be key contributors to the systemic spinal cord injury-induced immune-deficiency syndrome (SCI-IDS). SCI-IDS increases susceptibility to infection and extends to the post-acute and chronic phases after SCI. The prospective study of NK cell function after traumatic SCI was carried out in two centers in Berlin, Germany. SCI patients and control patients with neurologically silent vertebral fracture also undergoing surgical stabilization were enrolled. Furthermore healthy controls were included to provide reference data. The NK cell function was assessed at 7 (5-9) days, 14 days (11-28) days, and 10 (8-12) weeks post-trauma. Clinical documentation included the American Spinal Injury Association (ASIA) impairment scale (AIS), neurological level of injury, infection status, concomitant injury, and medications. The primary endpoint of the study is CD107a expression by NK cells (cytotoxicity marker) 8-12 weeks following SCI. Secondary endpoints are the NK cell's TNF-α and IFN-γ production by the NK cells 8-12 weeks following SCI. The protocol of this study was developed to investigate the hypotheses whether i) SCI impairs NK cell function throughout the post-acute and sub-acute phases after SCI and ii) the degree of impairment relates to lesion height and severity. A deeper understanding of the SCI-IDS is crucial to enable strategies for prevention of infections, which are associated with poor neurological outcome and elevated mortality. DRKS00009855 .

  17. Emotional Intelligence in Patients with Spinal Cord Injury (SCI)

    PubMed Central

    SABERI, Hooshang; GHAJARZADEH, Mahsa

    2017-01-01

    Background: Spinal Cord Injury (SCI) is a devastating situation. Spinal Cord Injury affects functional, psychological and socioeconomic aspects of patients’ lives. The ability to accomplish and explicate the one’s own and other’s feelings and emotions to spread over appropriate information for confirming thoughts and actions is defined as emotional intelligence (EI). The goal of this study was to evaluate depression and EI in SCI patients in comparison with healthy subjects. Methods: One-hundred-ten patients with SCI and 80 healthy subjects between Aug 2014 and Aug 2015 were enrolled. The study was conducted in Imam Hospital, Tehran, Iran. All participants were asked to fill valid and reliable Persian version Emotional Quotient inventory (EQ-i) and Beck Depression Inventory (BDI). All data were analyzed using SPSS. Data were presented as Mean±SD for continuous or frequencies for categorical variables. Continuous variables compared by means of independent sample t-test. P-values less than 0.05 were considered as significant. Results: Mean age of patients was 28.7 and mean age of controls was 30.2 yr. Spinal cord injury in 20 (18.3%) were at cervical level, in 83 (75.4%) were thoracic and in 7 (6.3%) were lumbar. Mean values of independence, stress tolerance, self-actualization, emotional Self-Awareness, reality testing, Impulse Control, flexibility, responsibility, and assertiveness were significantly different between cases and controls. Mean values of stress tolerance, optimism, self-regard, and responsibility were significantly different between three groups with different injury level. Most scales were not significantly different between male and female cases. Conclusion: Emotional intelligence should be considered in SCI cases as their physical and psychological health is affected by their illness. PMID:28560199

  18. Nucleotide sequence of the ribosomal RNA gene of Physarum polycephalum: intron 2 and its flanking regions of the 26S rRNA gene.

    PubMed Central

    Nomiyama, H; Kuhara, S; Kukita, T; Otsuka, T; Sakaki, Y

    1981-01-01

    The 26S ribosomal RNA gene of Physarum polycephalum is interrupted by two introns, and we have previously determined the sequence of one of them (intron 1) (Nomiyama et al. Proc.Natl.Acad.Sci.USA 78, 1376-1380, 1981). In this study we sequenced the second intron (intron 2) of about 0.5 kb length and its flanking regions, and found that one nucleotide at each junction is identical in intron 1 and intron 2, though the junction regions share no other sequence homology. Comparison of the flanking exon sequences to E. coli 23S rRNA sequences shows that conserved sequences are interspersed with tracts having little homology. In particular, the region encompassing the intron 2 interruption site is highly conserved. The E. coli ribosomal protein L1 binding region is also conserved. Images PMID:6171776

  19. Elimination of cannibalistic denaturation by enzyme immobilization or inhibition

    PubMed Central

    Wu, Hua-Lin; Lace, Daniel A.; Bender, Myron L.

    1981-01-01

    The cannibalistic denaturation of α-chymotrypsin (EC 3.4.21.1) around neutral pH can be eliminated by immobilization (insolubilization) of the enzyme or by inhibition by specific reversible inhibitors, but the high-pH denaturation cannot be. The denaturation of the immobilized enzyme at high pH follows first-order kinetics, just as the denaturation of the soluble enzyme does. These results lend credence to the description of the denaturation of chymotrypsin as cannibalistic around neutrality and due to a hydroxide ion reaction at high pH; this interpretation followed from kinetic arguments given in the previous article [Wu, H.-L., Wastell, A. & Bender, M. L. (1981) Proc. Natl. Acad. Sci. USA 78, 4116-4117]. Elimination of denaturation around neutrality by immobilization may be the reason why membrane-bound enzymes are so common in vivo. PMID:16593052

  20. Kinetics of biochemical sensing by single cells and populations of cells

    NASA Astrophysics Data System (ADS)

    Saakian, David B.

    2017-10-01

    We investigate the collective stationary sensing using N communicative cells, which involves surface receptors, diffusive signaling molecules, and cell-cell communication messengers. We restrict the scenarios to the signal-to-noise ratios (SNRs) for both strong communication and extrinsic noise only. We modified a previous model [Bialek and Setayeshgar, Proc. Natl. Acad. Sci. USA 102, 10040 (2005), 10.1073/pnas.0504321102] to eliminate the singularities in the fluctuation correlations by considering a uniform receptor distribution over the surface of each cell with a finite radius a . The modified model enables a simple and rigorous mathematical treatment of the collective sensing phenomenon. We then derive the scaling of the SNR for both juxtacrine and autocrine cases in all dimensions. For the optimal locations of the cells in the autocrine case, we find identical scaling for both two and three dimensions.

  1. Information filtering via biased heat conduction

    NASA Astrophysics Data System (ADS)

    Liu, Jian-Guo; Zhou, Tao; Guo, Qiang

    2011-09-01

    The process of heat conduction has recently found application in personalized recommendation [Zhou , Proc. Natl. Acad. Sci. USA PNASA60027-842410.1073/pnas.1000488107107, 4511 (2010)], which is of high diversity but low accuracy. By decreasing the temperatures of small-degree objects, we present an improved algorithm, called biased heat conduction, which could simultaneously enhance the accuracy and diversity. Extensive experimental analyses demonstrate that the accuracy on MovieLens, Netflix, and Delicious datasets could be improved by 43.5%, 55.4% and 19.2%, respectively, compared with the standard heat conduction algorithm and also the diversity is increased or approximately unchanged. Further statistical analyses suggest that the present algorithm could simultaneously identify users' mainstream and special tastes, resulting in better performance than the standard heat conduction algorithm. This work provides a creditable way for highly efficient information filtering.

  2. Nano-Optics for Chemical and Materials Characterization

    NASA Astrophysics Data System (ADS)

    Beversluis, Michael; Stranick, Stephan

    2007-03-01

    Light microscopy can provide non-destructive, real-time, three-dimensional imaging with chemically-specific contrast, but diffraction frequently limits the resolution to roughly 200 nm. Recently, structured illumination techniques have allowed fluorescence imaging to reach 50 nm resolution [1]. Since these fluorescence techniques were developed for use in microbiology, a key challenge is to take the resolution-enhancing features and apply them to contrast mechanisms like vibrational spectroscopy (e.g., Raman and CARS microscopy) that provide morphological and chemically specific imaging.. We are developing a new hybrid technique that combines the resolution enhancement of structured illumination microscopy with scanning techniques that can record hyperspectral images with 100 nm spatial resolution. We will show such superresolving images of semiconductor nanostructures and discuss the advantages and requirements for this technique. Referenence: 1. M. G. L. Gustafsson, P. Natl. Acad. Sci. USA 102, 13081-13086 (2005).

  3. Increasing specialty care access through use of an innovative home telehealth-based spinal cord injury disease management protocol (SCI DMP)

    PubMed Central

    Seton, Jacinta M.; Washington, Monique; Tomlinson, Suk C.; Phrasavath, Douangmala; Farrell, Karen R.; Goldstein, Barry

    2016-01-01

    Background A spinal cord injury disease management protocol (SCI DMP) was developed to address the unique medical, physical, functional, and psychosocial needs of those living with spinal cord injuries and disorders (SCI/D). The SCI DMP was piloted to evaluate DMP clinical content and to identify issues for broader implementation across the Veterans Affairs (VA) SCI System of Care. Methods Thirty-three patients with SCI/D from four VA SCI centers participated in a 6-month pilot. Patients received customized SCI DMP questions through a data messaging device (DMD). Nurse home telehealth care coordinators (HTCC) monitored responses and addressed clinical alerts daily. One site administered the Duke Severity of Illness (DUSOI) Checklist and Short Form-8 (SF-8™) to evaluate the changes in comorbidity severity and health-related quality of life while on the SCI DMP. Results Patients remained enrolled an average of 116 days, with a mean response rate of 56%. The average distance between patient's home and their VA SCI center was 59 miles. Feedback on SCI DMP content and the DMD included requests for additional clinical topics, changes in administration frequency, and adapting the DMD for functional impairments. Improvement in clinical outcomes was seen in a subset of patients enrolled on the SCI DMP. Conclusion SCI HTCCs and patients reported that the program was most beneficial for newly injured patients recently discharged from acute rehabilitation that live far from specialty SCI care facilities. SCI DMP content changes and broader implementation strategies are currently being evaluated based on lessons learned from the pilot. PMID:24617497

  4. Increasing specialty care access through use of an innovative home telehealth-based spinal cord injury disease management protocol (SCI DMP).

    PubMed

    Woo, Christine; Seton, Jacinta M; Washington, Monique; Tomlinson, Suk C; Phrasavath, Douangmala; Farrell, Karen R; Goldstein, Barry

    2016-01-01

    A spinal cord injury disease management protocol (SCI DMP) was developed to address the unique medical, physical, functional, and psychosocial needs of those living with spinal cord injuries and disorders (SCI/D). The SCI DMP was piloted to evaluate DMP clinical content and to identify issues for broader implementation across the Veterans Affairs (VA) SCI System of Care. Thirty-three patients with SCI/D from four VA SCI centers participated in a 6-month pilot. Patients received customized SCI DMP questions through a data messaging device (DMD). Nurse home telehealth care coordinators (HTCC) monitored responses and addressed clinical alerts daily. One site administered the Duke Severity of Illness (DUSOI) Checklist and Short Form-8 (SF-8™) to evaluate the changes in comorbidity severity and health-related quality of life while on the SCI DMP. Patients remained enrolled an average of 116 days, with a mean response rate of 56%. The average distance between patient's home and their VA SCI center was 59 miles. Feedback on SCI DMP content and the DMD included requests for additional clinical topics, changes in administration frequency, and adapting the DMD for functional impairments. Improvement in clinical outcomes was seen in a subset of patients enrolled on the SCI DMP. SCI HTCCs and patients reported that the program was most beneficial for newly injured patients recently discharged from acute rehabilitation that live far from specialty SCI care facilities. SCI DMP content changes and broader implementation strategies are currently being evaluated based on lessons learned from the pilot.

  5. Documentation of preventive care for pressure ulcers initiated during annual evaluations in SCI

    PubMed Central

    2016-01-01

    Objective Community-acquired pressure ulcers (PrUs) are a frequent cause of hospitalization of Veterans with spinal cord injury (SCI). The Veterans Health Administration (VHA) recommends that SCI annual evaluations include assessment of PrU risk factors, a thorough skin inspection and sharing of recommendations for PrU prevention strategies. We characterized consistency of preventive skin care during annual evaluations for Veterans with SCI as a first step in identifying strategies to more actively promote PrU prevention care in other healthcare encounters. Design/setting/participants Retrospective cross-sectional observational design, including review of electronic medical records for 206 Veterans with SCI admitted to 2 VA SCI centers from January-December, 2011. Outcome measures Proportion of applicable skin health elements documented (number of applicable elements/skin health elements documented). Results Our sample was primarily white (78%) male (96.1%), and mean age = 61 years. 40% of participants’ were hospitalized for PrU treatment, with a mean of 294 days (median = 345 days) from annual evaluation to the index admission. On average, Veterans received an average of 75.5% (IQR 68-86%) of applicable skin health elements. Documentation of applicable skin health elements was significantly higher during inpatient vs. outpatient annual evaluations (mean elements received = 80.3% and 64.3%, respectively, P > 0.001). No significant differences were observed in documentation of skin health elements by Veterans at high vs. low PrU risk. Conclusion Additional PrU preventive care in the VHA outpatient setting may increase identification and detection of PrU risk factors and early PrU damage for Veterans with SCI in the community, allowing for earlier intervention. PMID:26763668

  6. Documentation of preventive care for pressure ulcers initiated during annual evaluations in SCI.

    PubMed

    Guihan, Marylou; Murphy, Deidre; Rogers, Thea J; Parachuri, Ramadevi; Sae Richardson, Michael; Lee, Kenneth K; Bates-Jensen, Barbara M

    2016-05-01

    Community-acquired pressure ulcers (PrUs) are a frequent cause of hospitalization of Veterans with spinal cord injury (SCI). The Veterans Health Administration (VHA) recommends that SCI annual evaluations include assessment of PrU risk factors, a thorough skin inspection and sharing of recommendations for PrU prevention strategies. We characterized consistency of preventive skin care during annual evaluations for Veterans with SCI as a first step in identifying strategies to more actively promote PrU prevention care in other healthcare encounters. Retrospective cross-sectional observational design, including review of electronic medical records for 206 Veterans with SCI admitted to 2 VA SCI centers from January-December, 2011. Proportion of applicable skin health elements documented (number of applicable elements/skin health elements documented). Our sample was primarily white (78%) male (96.1%), and mean age = 61 years. 40% of participants' were hospitalized for PrU treatment, with a mean of 294 days (median = 345 days) from annual evaluation to the index admission. On average, Veterans received an average of 75.5% (IQR 68-86%) of applicable skin health elements. Documentation of applicable skin health elements was significantly higher during inpatient vs. outpatient annual evaluations (mean elements received = 80.3% and 64.3%, respectively, P > 0.001). No significant differences were observed in documentation of skin health elements by Veterans at high vs. low PrU risk. Additional PrU preventive care in the VHA outpatient setting may increase identification and detection of PrU risk factors and early PrU damage for Veterans with SCI in the community, allowing for earlier intervention.

  7. Impact of an implanted neuroprosthesis on community ambulation in incomplete SCI.

    PubMed

    Lombardo, Lisa M; Kobetic, Rudolf; Pinault, Gilles; Foglyano, Kevin M; Bailey, Stephanie N; Selkirk, Stephen; Triolo, Ronald J

    2018-03-01

    Test the effect of a multi-joint control with implanted electrical stimulation on walking after spinal cord injury (SCI). Single subject research design with repeated measures. Hospital-based biomechanics laboratory and user assessment of community use. Female with C6 AIS C SCI 30 years post injury. Lower extremity muscle activation with an implanted pulse generator and gait training. Walking speed, maximum distance, oxygen consumption, upper extremity (UE) forces, kinematics and self-assessment of technology. Short distance walking speed at one-year follow up with or without stimulation was not significantly different from baseline. However, average walking speed was significantly faster (0.22 m/s) with stimulation over longer distances than volitional walking (0.12 m/s). In addition, there was a 413% increase in walking distance from 95 m volitionally to 488 m with stimulation while oxygen consumption and maximum upper extremity forces decreased by 22 and 16%, respectively. Stimulation also produced significant (P ≤ 0.001) improvements in peak hip and knee flexion, ankle angle at foot off and at mid-swing. An implanted neuroprosthesis enabled a subject with incomplete SCI to walk longer distances with improved hip and knee flexion and ankle dorsiflexion resulting in decreased oxygen consumption and UE support. Further research is required to determine the robustness, generalizability and functional implications of implanted neuroprostheses for community ambulation after incomplete SCI.

  8. Microlithography and resist technology information at your fingertips via SciFinder

    NASA Astrophysics Data System (ADS)

    Konuk, Rengin; Macko, John R.; Staggenborg, Lisa

    1997-07-01

    Finding and retrieving the information you need about microlithography and resist technology in a timely fashion can make or break your competitive edge in today's business environment. Chemical Abstracts Service (CAS) provides the most complete and comprehensive database of the chemical literature in the CAplus, REGISTRY, and CASREACT files including 13 million document references, 15 million substance records and over 1.2 million reactions. This includes comprehensive coverage of positive and negative resist formulations and processing, photoacid generation, silylation, single and multilayer resist systems, photomasks, dry and wet etching, photolithography, electron-beam, ion-beam and x-ray lithography technologies and process control, optical tools, exposure systems, radiation sources and steppers. Journal articles, conference proceedings and patents related to microlithography and resist technology are analyzed and indexed by scientific information analysts with strong technical background in these areas. The full CAS database, which is updated weekly with new information, is now available at your desktop, via a convenient, user-friendly tool called 'SciFinder.' Author, subject and chemical substance searching is simplified by SciFinder's smart search features. Chemical substances can be searched by chemical structure, chemical name, CAS registry number or molecular formula. Drawing chemical structures in SciFinder is easy and does not require compliance with CA conventions. Built-in intelligence of SciFinder enables users to retrieve substances with multiple components, tautomeric forms and salts.

  9. Antidepressants Are Effective in Decreasing Neuropathic Pain After SCI: A Meta-Analysis.

    PubMed

    Mehta, Swati; Guy, Stacey; Lam, Tracey; Teasell, Robert; Loh, Eldon

    2015-01-01

    To systematically review and assess the effectiveness and safety of antidepressants for neuropathic pain among individuals with spinal cord injury (SCI). A systematic search was conducted using multiple databases for relevant articles published from 1980 to April 2014. Randomized controlled trials (RCTs) involving antidepressant treatment of neuropathic pain with ≥ 3 individuals and ≥ 50% of study population with SCI were included. Two independent reviewers selected studies based on inclusion criteria and then extracted data. Pooled analysis using Cohen's d to calculate standardized mean difference, standard error, and 95% confidence interval for primary (pain) and other secondary outcomes was conducted. Four RCTs met inclusion criteria. Of these, 2 studies assessed amitriptyline, 1 trazadone, and 1 duloxetine among individuals with neuropathic SCI pain. A small effect was seen in the effectiveness of antidepressants in decreasing pain among individuals with SCI (standardized mean difference = 0.34 ± 0.15; 95% CI, 0.05-0.62; P = .02). A number needed to treat of 3.4 for 30% or more pain relief was found by pooling 2 studies. Of these, significantly higher risk of experiencing constipation (risk ratio [RR] = 1.74; 95% CI, 1.09-2.78; P = .02) and dry mouth (RR = 1.39; 95% CI, 1.04-1.85; P = .02) was found amongst individuals receiving antidepressant treatment compared to those in the control group. The current meta-analysis demonstrates that antidepressants are effective in reducing neuropathic SCI pain. However, this should be interpreted with caution due to the limited number of studies. Further evaluation of long-term therapeutic options may be required.

  10. Pressure Relief Behaviors and Weight Shifting Activities to Prevent Pressure Ulcers in Persons with SCI

    DTIC Science & Technology

    2015-10-01

    AWARD NUMBER: W81XWH-13-1-0387 TITLE: Pressure Relief Behaviors and Weight-Shifting Activities to Prevent Pressure Ulcers in Persons with SCI... Pressure Ulcers in Persons with SCI 5a. CONTRACT NUMBER 5b. GRANT NUMBER W81XWH-13-1-0387 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) Stephen Sprigle, PhD...Unlimited 13. SUPPLEMENTARY NOTES 14. ABSTRACT Pressure ulcers (PU) are the most costly secondary complication following an SCI. In addition to the

  11. Improvement in Student Science Proficiency Through InSciEd Out

    PubMed Central

    Sonju, James D.; Leicester, Jean E.; Hoody, Maggie; LaBounty, Thomas J.; Frimannsdottir, Katrin R.; Ekker, Stephen C.

    2012-01-01

    Abstract Integrated Science Education Outreach (InSciEd Out) is a collaboration formed between Mayo Clinic, Winona State University, and Rochester Public Schools (MN) with the shared vision of achieving excellence in science education. InSciEd Out employs an equitable partnership model between scientists, teachers, education researchers, and the community. Teams of teachers from all disciplines within a single school experience cutting-edge science using the zebrafish model system, as well as current pedagogical methods, during a summer internship at the Mayo Clinic. Within the internship, the teachers produce new curriculum that directly addresses opportunities for science education improvement at their own school. Zebrafish are introduced within the new curriculum to support a living model of the practice of science. Following partnership with the InSciEd Out program and 2 years of implementation in the classroom, teacher-interns from a K–8 public school reported access to local scientific technology and expertise they had not previously recognized. Teachers also reported improved integration of other disciplines into the scientific curriculum and a flow of concepts vertically from K through 8. Students more than doubled selection of an Honors science track in high school to nearly 90%. 98% of students who took the Minnesota Comprehensive Assessments in their 5th and 8th grade year (a span that includes 2 years of InSciEd Out) showed medium or high growth in science proficiency. These metrics indicate that cooperation between educators and scientists can result in positive change in student science proficiency and demonstrate that a higher expectation in science education can be achieved in US public schools. PMID:23244687

  12. [SciELO: A cooperative project for the dissemination of science].

    PubMed

    Bojo Canales, C; Fraga Medín, C; Hernández Villegas, S; Primo Peña, E

    2009-10-01

    The article describes the SciELO (Scientific Electronic Library Online) model for the electronic publication and dissemination of scientific journals, its origin and evolution, methodology, components, services and potential, and its implantation in Spain. It consists of thirteen participant countries with eight certified web portals, with another 5 under development and another two thematic ones. In February 2009 Scielo.org had 611 magazines and 195,789 articles of which 46% were about health sciences. Spain became a project member in 1999 and launched the SciELO web portal in 2001, as well as 4 magazines. It currently has 39 titles in the field of Health Sciences; one of which is the Revista Española de Sanidad Penitenciaria, which joined the project in 2007 and which currently has 6 issues from 2007 and 2008 available. This makes it one of the most important open access initiatives existing. The report concludes by stating that the SciELO model contributes to the development of research and science by offering an effective and efficient method of promoting and increasing the dissemination of scientific publications in Latin America.

  13. Science Classroom Inquiry (SCI) Simulations: A Novel Method to Scaffold Science Learning

    PubMed Central

    Peffer, Melanie E.; Beckler, Matthew L.; Schunn, Christian; Renken, Maggie; Revak, Amanda

    2015-01-01

    Science education is progressively more focused on employing inquiry-based learning methods in the classroom and increasing scientific literacy among students. However, due to time and resource constraints, many classroom science activities and laboratory experiments focus on simple inquiry, with a step-by-step approach to reach predetermined outcomes. The science classroom inquiry (SCI) simulations were designed to give students real life, authentic science experiences within the confines of a typical classroom. The SCI simulations allow students to engage with a science problem in a meaningful, inquiry-based manner. Three discrete SCI simulations were created as website applications for use with middle school and high school students. For each simulation, students were tasked with solving a scientific problem through investigation and hypothesis testing. After completion of the simulation, 67% of students reported a change in how they perceived authentic science practices, specifically related to the complex and dynamic nature of scientific research and how scientists approach problems. Moreover, 80% of the students who did not report a change in how they viewed the practice of science indicated that the simulation confirmed or strengthened their prior understanding. Additionally, we found a statistically significant positive correlation between students’ self-reported changes in understanding of authentic science practices and the degree to which each simulation benefitted learning. Since SCI simulations were effective in promoting both student learning and student understanding of authentic science practices with both middle and high school students, we propose that SCI simulations are a valuable and versatile technology that can be used to educate and inspire a wide range of science students on the real-world complexities inherent in scientific study. PMID:25786245

  14. Science classroom inquiry (SCI) simulations: a novel method to scaffold science learning.

    PubMed

    Peffer, Melanie E; Beckler, Matthew L; Schunn, Christian; Renken, Maggie; Revak, Amanda

    2015-01-01

    Science education is progressively more focused on employing inquiry-based learning methods in the classroom and increasing scientific literacy among students. However, due to time and resource constraints, many classroom science activities and laboratory experiments focus on simple inquiry, with a step-by-step approach to reach predetermined outcomes. The science classroom inquiry (SCI) simulations were designed to give students real life, authentic science experiences within the confines of a typical classroom. The SCI simulations allow students to engage with a science problem in a meaningful, inquiry-based manner. Three discrete SCI simulations were created as website applications for use with middle school and high school students. For each simulation, students were tasked with solving a scientific problem through investigation and hypothesis testing. After completion of the simulation, 67% of students reported a change in how they perceived authentic science practices, specifically related to the complex and dynamic nature of scientific research and how scientists approach problems. Moreover, 80% of the students who did not report a change in how they viewed the practice of science indicated that the simulation confirmed or strengthened their prior understanding. Additionally, we found a statistically significant positive correlation between students' self-reported changes in understanding of authentic science practices and the degree to which each simulation benefitted learning. Since SCI simulations were effective in promoting both student learning and student understanding of authentic science practices with both middle and high school students, we propose that SCI simulations are a valuable and versatile technology that can be used to educate and inspire a wide range of science students on the real-world complexities inherent in scientific study.

  15. Astronomical Data Processing Using SciQL, an SQL Based Query Language for Array Data

    NASA Astrophysics Data System (ADS)

    Zhang, Y.; Scheers, B.; Kersten, M.; Ivanova, M.; Nes, N.

    2012-09-01

    SciQL (pronounced as ‘cycle’) is a novel SQL-based array query language for scientific applications with both tables and arrays as first class citizens. SciQL lowers the entrance fee of adopting relational DBMS (RDBMS) in scientific domains, because it includes functionality often only found in mathematics software packages. In this paper, we demonstrate the usefulness of SciQL for astronomical data processing using examples from the Transient Key Project of the LOFAR radio telescope. In particular, how the LOFAR light-curve database of all detected sources can be constructed, by correlating sources across the spatial, frequency, time and polarisation domains.

  16. SciJourn is magic: construction of a science journalism community of practice

    NASA Astrophysics Data System (ADS)

    Nicholas, Celeste R.

    2017-06-01

    This article is the first to describe the discoursal construction of an adolescent community of practice (CoP) in a non-school setting. CoPs can provide optimal learning environments. The adolescent community centered around science journalism and positioned itself dichotomously in relationship to school literacy practices. The analysis focuses on recordings from a panel-style research interview from an early implementation of the Science Literacy Through Science Journalism (SciJourn) project. Researchers trained high school students participating in a youth development program to write science news articles. Students engaged in the authentic practices of professional science journalists, received feedback from a professional editor, and submitted articles for publication. I used a fine-grained critical discourse analysis of genre, discourse, and style to analyze student responses about differences between writing in SciJourn and in school. Students described themselves as agentic in SciJourn and passive in school, using an academic writing discourse of deficit to describe schooling experiences. They affiliated with and defined a SciJourn CoP, constructing positive journalistic identities therein. Educators are encouraged to develop similar CoPs. The discursive features presented may be used to monitor the development of communities of practice in a variety of settings.

  17. Performance Engineering Research Institute SciDAC-2 Enabling Technologies Institute Final Report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lucas, Robert

    2013-04-20

    Enhancing the performance of SciDAC applications on petascale systems had high priority within DOE SC at the start of the second phase of the SciDAC program, SciDAC-2, as it continues to do so today. Achieving expected levels of performance on high-end computing (HEC) systems is growing ever more challenging due to enormous scale, increasing architectural complexity, and increasing application complexity. To address these challenges, the University of Southern California?s Information Sciences Institute organized the Performance Engineering Research Institute (PERI). PERI implemented a unified, tripartite research plan encompassing: (1) performance modeling and prediction; (2) automatic performance tuning; and (3) performance engineeringmore » of high profile applications. Within PERI, USC?s primary research activity was automatic tuning (autotuning) of scientific software. This activity was spurred by the strong user preference for automatic tools and was based on previous successful activities such as ATLAS, which automatically tuned components of the LAPACK linear algebra library, and other recent work on autotuning domain-specific libraries. Our other major component was application engagement, to which we devoted approximately 30% of our effort to work directly with SciDAC-2 applications. This report is a summary of the overall results of the USC PERI effort.« less

  18. 76 FR 55070 - Government-Owned Inventions; Availability for Licensing

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-09-06

    ...). Publications: 1. Robbins JB, et al. Synthesis, characterization, and immunogenicity in mice of Shigella sonnei O-specific oligosaccharide- core-protein conjugates. Proc Natl Acad Sci U S A. 2009 May 12;106(19...

  19. What Are the Treatments for Spinal Cord Injury (SCI)?

    MedlinePlus

    ... potential risk factors for persons with SCI) Functional electrical stimulation for assistance with restoration of neuromuscular function, ... A-Z Topics Rehabilitation Medicine Rehabilitative and Assistive Technology Pediatric Injury NICHD News and Features Focus on ...

  20. Exploring Student and Supervisor Interaction during the SciPro Thesis Process: Two Use Cases

    ERIC Educational Resources Information Center

    Hansen, Preben; Hansson, Henrik

    2017-01-01

    Common problems identified by students during their interaction with supervisors are too little instructions as well as infrequent and insufficient supervisor feedback. The SciPro system has been developed to tackle these problems. This paper describes, analyzes and discusses the interaction between students and supervisors using the SciPro…

  1. Measuring stigma after spinal cord injury: Development and psychometric characteristics of the SCI-QOL Stigma item bank and short form.

    PubMed

    Kisala, Pamela A; Tulsky, David S; Pace, Natalie; Victorson, David; Choi, Seung W; Heinemann, Allen W

    2015-05-01

    To develop a calibrated item bank and computer adaptive test (CAT) to assess the effects of stigma on health-related quality of life in individuals with spinal cord injury (SCI). Grounded-theory based qualitative item development methods, large-scale item calibration field testing, confirmatory factor analysis, and item response theory (IRT)-based psychometric analyses. Five SCI Model System centers and one Department of Veterans Affairs medical center in the United States. Adults with traumatic SCI. SCI-QOL Stigma Item Bank A sample of 611 individuals with traumatic SCI completed 30 items assessing SCI-related stigma. After 7 items were iteratively removed, factor analyses confirmed a unidimensional pool of items. Graded Response Model IRT analyses were used to estimate slopes and thresholds for the final 23 items. The SCI-QOL Stigma item bank is unique not only in the assessment of SCI-related stigma but also in the inclusion of individuals with SCI in all phases of its development. Use of confirmatory factor analytic and IRT methods provide flexibility and precision of measurement. The item bank may be administered as a CAT or as a 10-item fixed-length short form and can be used for research and clinical applications.

  2. Using the autonomic standards to assess orthostatic hypotension in persons with SCI: a case series.

    PubMed

    Wecht, Jill M; Wilson, James; Previnaire, Jean-Gabriel

    2017-01-01

    Spinal cord injury (SCI) creates a complex and unique syndrome of medical issues related to disruption of somatic and autonomic pathways. Among these impaired control of blood pressure (BP) can significantly impede patients' activities of daily living. The International Standards for the Assessment of Autonomic Function after SCI (ISAFSCI) is used to document the impact of SCI on resting BP (abnormal if below 90 mmHg) and the presence or absence of orthostatic hypotension (OH), defined as a symptomatic or asymptomatic decrease in BP (>/=20/10 mmHg) upon moving to an upright position. Case 1 documents the adverse influence of prescribed medications (antidepressants for neuropathic pain) on OH; case 2 describes the influence of bladder management on cardiovascular instability (autonomic dysreflexia and subsequent OH); case 3 describes the association between spasticity and OH; case 4 describes OH associated with a Valsalva maneuver. Impaired control of BP can stem from a combination of medical issues and autonomic dysfunction in persons with SCI. Management strategies for OH will vary depending on the stage of the SCI, the root cause of the OH and other confounding medical conditions. Non-pharmacological treatment should be considered as a first line of intervention and consideration should be given to cessation of potentially contributory medications prior to implementing pharmaceutical interventions. The systematic use of ISAFSCI by clinicians is recommended to document BP irregularities and to describe the effects of treatment strategies aimed at improving BP control in the SCI population.

  3. Cracking and adhesion at small scales: atomistic and continuum studies of flaw tolerant nanostructures

    NASA Astrophysics Data System (ADS)

    Buehler, Markus J.; Yao, Haimin; Gao, Huajian; Ji, Baohua

    2006-07-01

    Once the characteristic size of materials reaches nanoscale, the mechanical properties may change drastically and classical mechanisms of materials failure may cease to hold. In this paper, we focus on joint atomistic-continuum studies of failure and deformation of nanoscale materials. In the first part of the paper, we discuss the size dependence of brittle fracture. We illustrate that if the characteristic dimension of a material is below a critical length scale that can be on the order of several nanometres, the classical Griffith theory of fracture no longer holds. An important consequence of this finding is that materials with nano-substructures may become flaw-tolerant, as the stress concentration at crack tips disappears and failure always occurs at the theoretical strength of materials, regardless of defects. Our atomistic simulations complement recent continuum analysis (Gao et al 2003 Proc. Natl Acad. Sci. USA 100 5597-600) and reveal a smooth transition between Griffith modes of failure via crack propagation to uniform bond rupture at theoretical strength below a nanometre critical length. Our results may have consequences for understanding failure of many small-scale materials. In the second part of this paper, we focus on the size dependence of adhesion systems. We demonstrate that optimal adhesion can be achieved by either length scale reduction, or by optimization of the shape of the surface of the adhesion element. We find that whereas change in shape can lead to optimal adhesion strength, those systems are not robust against small deviations from the optimal shape. In contrast, reducing the dimensions of the adhesion system results in robust adhesion devices that fail at their theoretical strength, regardless of the presence of flaws. An important consequence of this finding is that even under the presence of surface roughness, optimal adhesion is possible provided the size of contact elements is sufficiently small. Our atomistic results

  4. The JNM1 gene in the yeast Saccharomyces cerevisiae is required for nuclear migration and spindle orientation during the mitotic cell cycle

    PubMed Central

    1994-01-01

    JNM1, a novel gene on chromosome XIII in the yeast Saccharomyces cerevisiae, is required for proper nuclear migration. jnm1 null mutants have a temperature-dependent defect in nuclear migration and an accompanying alteration in astral microtubules. At 30 degrees C, a significant proportion of the mitotic spindles is not properly located at the neck between the mother cell and the bud. This defect is more severe at low temperature. At 11 degrees C, 60% of the cells accumulate with large buds, most of which have two DAPI staining regions in the mother cell. Although mitosis is delayed and nuclear migration is defective in jnm1 mutant, we rarely observe more than two nuclei in a cell, nor do we frequently observe anuclear cells. No loss of viability is observed at 11 degrees C and cells continue to grow exponentially with increased doubling time. At low temperature the large budded cells of jnm1 mutants exhibit extremely long astral microtubules that often wind around the periphery of the cell. jnm1 mutants are not defective in chromosome segregation during mitosis, as assayed by the rate of chromosome loss, or nuclear migration during conjugation, as assayed by the rate of mating and cytoduction. The phenotype of a jnm1 mutant is strikingly similar to that for mutants in the dynein heavy chain gene (Eshel, D., L. A. Urrestarazu, S. Vissers, J.-C. Jauniaux, J. C. van Vliet-Reedijk, R. J. Plants, and I. R. Gibbons. 1993. Proc. Natl. Acad. Sci. USA. 90:11172-11176; Li, Y. Y., E. Yeh, T. Hays, and K. Bloom. 1993. Proc. Natl. Acad. Sci. USA. 90:10096-10100). The JNM1 gene product is predicted to encode a 44-kD protein containing three coiled coil domains. A JNM1:lacZ gene fusion is able to complement the cold sensitivity and microtubule phenotype of a jnm1 deletion strain. This hybrid protein localizes to a single spot in the cell, most often near the spindle pole body in unbudded cells and in the bud in large budded cells. Together these results point to a specific role

  5. A pilot study examining correlates of body image among women living with SCI.

    PubMed

    Bassett, R L; Martin Ginis, K A; Buchholz, A C

    2009-06-01

    Cross-sectional pilot study. To explore correlates of body image among women with spinal cord injury (SCI), within the framework of Cash's cognitive behavioral model of body image. Hamilton, Ontario, Canada. Women with SCI (N=11, 64% with tetraplegia) reported their functional and appearance body image (Adult Body Satisfaction Questionnaire). A 3-day recall of leisure time physical activity (LTPA), three measures of body composition (that is, weight, waist circumference, body fat) and several demographic variables were assessed as potential correlates. Appearance satisfaction was negatively correlated with all three measures of body composition and positively correlated with years postinjury. Functional satisfaction was positively correlated with years postinjury, and negatively correlated with various LTPA variables. Functional and appearance body image may improve with time following SCI. Body composition may impact satisfaction with physical appearance for some women. The negative relationship between LTPA and functional satisfaction merits further examination, as functional dissatisfaction may motivate individuals to engage in certain types and intensities of LTPA. Correlates of body image differ between appearance and functional satisfaction. Future research should examine appearance and functional satisfaction separately among women with SCI.

  6. A Structured Clinical Interview for Kleptomania (SCI-K): preliminary validity and reliability testing.

    PubMed

    Grant, Jon E; Kim, Suck Won; McCabe, James S

    2006-06-01

    Kleptomania presents difficulties in diagnosis for clinicians. This study aimed to develop and test a DSM-IV-based diagnostic instrument for kleptomania. To assess for current kleptomania the Structured Clinical Interview for Kleptomania (SCI-K) was administered to 112 consecutive subjects requesting psychiatric outpatient treatment for a variety of disorders. Reliability and validity were determined. Classification accuracy was examined using the longitudinal course of illness. The SCI-K demonstrated excellent test-retest (Phi coefficient = 0.956 (95% CI = 0.937, 0.970)) and inter-rater reliability (phi coefficient = 0.718 (95% CI = 0.506, 0.848)) in the diagnosis of kleptomania. Concurrent validity was observed with a self-report measure using DSM-IV kleptomania criteria (phi coefficient = 0.769 (95% CI = 0.653, 0.850)). Discriminant validity was observed with a measure of depression (point biserial coefficient = -0.020 (95% CI = -0.205, 0.166)). The SCI-K demonstrated both high sensitivity and specificity based on longitudinal assessment. The SCI-K demonstrated excellent reliability and validity in diagnosing kleptomania in subjects presenting with various psychiatric problems. These findings require replication in larger groups, including non-psychiatric populations, to examine their generalizability. Copyright (c) 2006 John Wiley & Sons, Ltd.

  7. Ertapenem-associated neurotoxicity in the Spinal Cord Injury (SCI) population: a case series.

    PubMed

    Patel, Ursula C; Fowler, Mallory A

    2017-09-06

    Context Ertapenem, a broad spectrum carbapenem antibiotic, is used often in Spinal Cord Injury (SCI) patients due to increased risk factors for multi-drug resistant (MDR) infections in this population. Neurotoxicity, specifically seizures, due to ertapenem is a known adverse effect and has been described previously. Other manifestations such as delirium and visual hallucinations have rarely been reported, and no literature, to the best of our knowledge, specifically describes these effects solely in the SCI population. Findings Four cases of mental status changes and hallucinations in SCI patients attributed to ertapenem therapy are described. Onset of symptoms began between one and six days following initiation of ertapenem and resolved between two to 42 days following discontinuation. Based on the Naranjo probability scale, a probable relationship exists between the adverse events and ertapenem for three out of the four cases. Possible overestimation of renal function and hypoalbuminemia may be contributing factors to the noted adverse reactions. Conclusion/Clinical Relevance The cases described highlight the importance of recognizing ertapenem-associated hallucinations in SCI patients. The population is particularly vulnerable due to risk factors for MDR infections necessitating ertapenem use, possible overestimation of renal function, and a high prevalence of hypoalbuminemia.

  8. Looking into Pandora's Box: The Content of Sci-Hub and its Usage.

    PubMed

    Greshake, Bastian

    2017-01-01

    Despite the growth of Open Access, potentially illegally circumventing paywalls to access scholarly publications is becoming a more mainstream phenomenon. The web service Sci-Hub is amongst the biggest facilitators of this, offering free access to around 62 million publications. So far it is not well studied how and why its users are accessing publications through Sci-Hub. By utilizing the recently released corpus of Sci-Hub and comparing it to the data of  ~28 million downloads done through the service, this study tries to address some of these questions. The comparative analysis shows that both the usage and complete corpus is largely made up of recently published articles, with users disproportionately favoring newer articles and 35% of downloaded articles being published after 2013. These results hint that embargo periods before publications become Open Access are frequently circumnavigated using Guerilla Open Access approaches like Sci-Hub. On a journal level, the downloads show a bias towards some scholarly disciplines, especially Chemistry, suggesting increased barriers to access for these. Comparing the use and corpus on a publisher level, it becomes clear that only 11% of publishers are highly requested in comparison to the baseline frequency, while 45% of all publishers are significantly less accessed than expected. Despite this, the oligopoly of publishers is even more remarkable on the level of content consumption, with 80% of all downloads being published through only 9 publishers. All of this suggests that Sci-Hub is used by different populations and for a number of different reasons, and that there is still a lack of access to the published scientific record. A further analysis of these openly available data resources will undoubtedly be valuable for the investigation of academic publishing.

  9. The Impact of Health Behaviors and Health Management on Employment After SCI: Physical Health and Functioning.

    PubMed

    Meade, Michelle A; Reed, Karla S; Krause, James S

    2016-01-01

    Background : Research has shown that employment following spinal cord injury (SCI) is related to health and functioning, with physical health and functioning after SCI frequently identified as a primary barrier to employment. Objective: To examine the relationship between employment and behaviors associated with the management of physical health and functioning as described by individuals with SCI who have been employed post injury. Methods: A qualitative approach using 6 focus groups at 2 sites included 44 participants with SCI who had worked at some time post injury. Heterogeneous and homogeneous groups were created based on specific characteristics, such as education, gender, or race. A semi-structured interview format asked questions about personal, environmental, and policy-related factors influencing employment after SCI. Groups were recorded, transcribed, and entered into NVivo before coding by 2 reviewers. Results: Within the area of behaviors and management of physical health and functioning, 4 overlapping themes were identified: (1) relearning your own body and what it can do; (2) general health and wellness behaviors; (3) communication, education, and advocacy; and (4) secondary conditions and aging. Specific themes articulate the many types of behaviors individuals must master and their impact on return to work as well as on finding, maintaining, and deciding to leave employment. Conclusions: Individuals with SCI who are successfully employed after injury must learn how to perform necessary behaviors to manage health and function in a work environment. The decision to leave employment often appears to be associated with secondary complications and other conditions that occur as persons with SCI age.

  10. Publishing datasets with eSciDoc and panMetaDocs

    NASA Astrophysics Data System (ADS)

    Ulbricht, D.; Klump, J.; Bertelmann, R.

    2012-04-01

    Currently serveral research institutions worldwide undertake considerable efforts to have their scientific datasets published and to syndicate them to data portals as extensively described objects identified by a persistent identifier. This is done to foster the reuse of data, to make scientific work more transparent, and to create a citable entity that can be referenced unambigously in written publications. GFZ Potsdam established a publishing workflow for file based research datasets. Key software components are an eSciDoc infrastructure [1] and multiple instances of the data curation tool panMetaDocs [2]. The eSciDoc repository holds data objects and their associated metadata in container objects, called eSciDoc items. A key metadata element in this context is the publication status of the referenced data set. PanMetaDocs, which is based on PanMetaWorks [3], is a PHP based web application that allows to describe data with any XML-based metadata schema. The metadata fields can be filled with static or dynamic content to reduce the number of fields that require manual entries to a minimum and make use of contextual information in a project setting. Access rights can be applied to set visibility of datasets to other project members and allow collaboration on and notifying about datasets (RSS) and interaction with the internal messaging system, that was inherited from panMetaWorks. When a dataset is to be published, panMetaDocs allows to change the publication status of the eSciDoc item from status "private" to "submitted" and prepare the dataset for verification by an external reviewer. After quality checks, the item publication status can be changed to "published". This makes the data and metadata available through the internet worldwide. PanMetaDocs is developed as an eSciDoc application. It is an easy to use graphical user interface to eSciDoc items, their data and metadata. It is also an application supporting a DOI publication agent during the process of

  11. Acute spinal cord injury (SCI) transforms how GABA affects nociceptive sensitization.

    PubMed

    Huang, Yung-Jen; Lee, Kuan H; Murphy, Lauren; Garraway, Sandra M; Grau, James W

    2016-11-01

    Noxious input can sensitize pain (nociceptive) circuits within the spinal cord, inducing a lasting increase in spinal cord neural excitability (central sensitization) that is thought to contribute to chronic pain. The development of spinally-mediated central sensitization is regulated by descending fibers and GABAergic interneurons. The current study provides evidence that spinal cord injury (SCI) transforms how GABA affects nociceptive transmission within the spinal cord, recapitulating an earlier developmental state wherein GABA has an excitatory effect. In spinally transected rats, noxious electrical stimulation and inflammation induce enhanced mechanical reactivity (EMR), a behavioral index of nociceptive sensitization. Pretreatment with the GABA A receptor antagonist bicuculline blocked these effects. Peripheral application of an irritant (capsaicin) also induced EMR. Both the induction and maintenance of this effect were blocked by bicuculline. Cellular indices of central sensitization [c-fos expression and ERK phosphorylation (pERK)] were also attenuated. In intact (sham operated) rats, bicuculline had the opposite effect. Pretreatment with a GABA agonist (muscimol) attenuated nociceptive sensitization in intact, but not spinally injured, rats. The effect of SCI on GABA function was linked to a reduction in the Cl - transporter, KCC2, leading to a reduction in intracellular Cl - that would attenuate GABA-mediated inhibition. Pharmacologically blocking the KCC2 channel (with i.t. DIOA) in intact rats mimicked the effect of SCI. Conversely, a pharmacological treatment (bumetanide) that should increase intracellular Cl - levels blocked the effect of SCI. The results suggest that GABAergic neurons drive, rather than inhibit, the development of nociceptive sensitization after spinal injury. Copyright © 2016 Elsevier Inc. All rights reserved.

  12. Pediatric SCI/D caregiver mental health and family dynamics in Colombia, South America.

    PubMed

    Doyle, Sarah T; Perrin, Paul B; Nicholls, Elizabeth; Olivera, Silvia Leonor; Quintero, Lorena Medina; Otálvaro, Nadezda Yulieth Méndez; Arango-Lasprilla, Juan Carlos

    2016-01-01

    This study examined the connections between family dynamics and the mental health of caregivers of youth with spinal cord injuries/disorders (SCI/D) caregivers from Colombia, South America. It was hypothesized that lower family functioning would be associated with poorer caregiver mental health. A cross-sectional study of self-report data collected from caregivers through the Hospital Universatario Hernando Moncaleano Perdomo in Neiva, Colombia. Thirty caregivers of children with SCI/D from Nevia, Colombia who were a primary caregiver for ≥3 months, providing care for an individual who was ≥6 months post-injury/diagnosis, familiar with the patient's history, and without neurological or psychiatric conditions. Caregivers' average age was 41.30 years (SD = 10.98), and 90% were female. Caregivers completed Spanish versions of instruments assessing their own mental health and family dynamics. Family dynamics explained 43.2% of the variance in caregiver burden and 50.1% of the variance in satisfaction with life, although family dynamics were not significantly associated with caregiver depression in the overall analysis. Family satisfaction was the only family dynamics variable to yield a significant unique association with any index of caregiver mental health (satisfaction with life). If similar findings emerge in future intervention research, interventions for pediatric SCI/D caregivers in Colombia and other similar global regions could benefit from including techniques to improve family dynamics, especially family satisfaction, given the strong potentially reciprocal connection between these dynamics and caregiver mental health. The degree of disability resulting from SCI/D can vary greatly depending on the severity and level of the lesion, though permanent impairment is often present that profoundly impacts both physical and psychological functioning. Very little is known about the impact of pediatric SCI/D in developing countries, despite the high rates of

  13. Time irreversibility and multifractality of power along single particle trajectories in turbulence

    NASA Astrophysics Data System (ADS)

    Cencini, Massimo; Biferale, Luca; Boffetta, Guido; De Pietro, Massimo

    2017-10-01

    The irreversible turbulent energy cascade epitomizes strongly nonequilibrium systems. At the level of single fluid particles, time irreversibility is revealed by the asymmetry of the rate of kinetic energy change, the Lagrangian power, whose moments display a power-law dependence on the Reynolds number, as recently shown by Xu et al. [H. Xu et al., Proc. Natl. Acad. Sci. USA 111, 7558 (2014), 10.1073/pnas.1321682111]. Here Lagrangian power statistics are rationalized within the multifractal model of turbulence, whose predictions are shown to agree with numerical and empirical data. Multifractal predictions are also tested, for very large Reynolds numbers, in dynamical models of the turbulent cascade, obtaining remarkably good agreement for statistical quantities insensitive to the asymmetry and, remarkably, deviations for those probing the asymmetry. These findings raise fundamental questions concerning time irreversibility in the infinite-Reynolds-number limit of the Navier-Stokes equations.

  14. Conformational dependence of a protein kinase phosphate transfer reaction

    NASA Astrophysics Data System (ADS)

    Labute, Montiago; Henkelman, Graeme; Tung, Chang-Shung; Fenimore, Paul; McMahon, Ben

    2007-03-01

    Atomic motions and energetics for a phosphate transfer reaction catalyzed by the cAMP-dependent protein kinase have been calculated using plane-wave density functional theory, starting from structures of proteins crystallized in both the reactant conformation (RC) and the transition-state conformation (TC). In TC, we calculate that the reactants and products are nearly isoenergetic with a 20-kJ/mol barrier, whereas phosphate transfer is unfavorable by 120 kJ/mol in the RC, with an even higher barrier. Our results demonstrate that the phosphate transfer reaction occurs rapidly and reversibly in a particular conformation of the protein, and that the reaction can be gated by changes of a few tenths of an angstrom in the catalytic site [1]. [1] G.H. Henkelman, M.X. LaBute, C.-S. Tung, P.W. Fenimore, B.H. McMahon, Proc. Natl. Acad. Sci. USA vol. 102, no. 43:15347-15351 (2005).

  15. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Armstrong, Clare L; Marquardt, Drew; Dies, Hannah

    Rafts, or functional domains, are transient nano- or mesoscopic structures in the exoplasmic leaflet of the plasma membrane, and are thought to be essential for many cellular processes. Using neutron diffraction and computer modelling, we present evidence for the existence of highly ordered lipid domains in the cholesterol-rich (32.5 mol%) liquid-ordered (lo) phase of dipalmitoylphosphatidylcholine membranes. The liquid ordered phase in one-component lipid membranes has previously been thought to be a homogeneous phase. The presence of highly ordered lipid domains embedded in a disordered lipid matrix implies non-uniform distribution of cholesterol between the two phases. The experimental results are inmore » excellent agreement with recent computer simulations of DPPC/cholesterol complexes [Meinhardt, Vink and Schmid (2013). Proc Natl Acad Sci USA 110(12): 4476 4481], which reported the existence of nanometer size lo domains in a liquid disordered lipid environment.« less

  16. Thermodynamics of information processing based on enzyme kinetics: An exactly solvable model of an information pump.

    PubMed

    Cao, Yuansheng; Gong, Zongping; Quan, H T

    2015-06-01

    Motivated by the recent proposed models of the information engine [Proc. Natl. Acad. Sci. USA 109, 11641 (2012)] and the information refrigerator [Phys. Rev. Lett. 111, 030602 (2013)], we propose a minimal model of the information pump and the information eraser based on enzyme kinetics. This device can either pump molecules against the chemical potential gradient by consuming the information to be encoded in the bit stream or (partially) erase the information initially encoded in the bit stream by consuming the Gibbs free energy. The dynamics of this model is solved exactly, and the "phase diagram" of the operation regimes is determined. The efficiency and the power of the information machine is analyzed. The validity of the second law of thermodynamics within our model is clarified. Our model offers a simple paradigm for the investigating of the thermodynamics of information processing involving the chemical potential in small systems.

  17. Isolation with Migration Models for More Than Two Populations

    PubMed Central

    Hey, Jody

    2010-01-01

    A method for studying the divergence of multiple closely related populations is described and assessed. The approach of Hey and Nielsen (2007, Integration within the Felsenstein equation for improved Markov chain Monte Carlo methods in population genetics. Proc Natl Acad Sci USA. 104:2785–2790) for fitting an isolation-with-migration model was extended to the case of multiple populations with a known phylogeny. Analysis of simulated data sets reveals the kinds of history that are accessible with a multipopulation analysis. Necessarily, processes associated with older time periods in a phylogeny are more difficult to estimate; and histories with high levels of gene flow are particularly difficult with more than two populations. However, for histories with modest levels of gene flow, or for very large data sets, it is possible to study large complex divergence problems that involve multiple closely related populations or species. PMID:19955477

  18. Isolation with migration models for more than two populations.

    PubMed

    Hey, Jody

    2010-04-01

    A method for studying the divergence of multiple closely related populations is described and assessed. The approach of Hey and Nielsen (2007, Integration within the Felsenstein equation for improved Markov chain Monte Carlo methods in population genetics. Proc Natl Acad Sci USA. 104:2785-2790) for fitting an isolation-with-migration model was extended to the case of multiple populations with a known phylogeny. Analysis of simulated data sets reveals the kinds of history that are accessible with a multipopulation analysis. Necessarily, processes associated with older time periods in a phylogeny are more difficult to estimate; and histories with high levels of gene flow are particularly difficult with more than two populations. However, for histories with modest levels of gene flow, or for very large data sets, it is possible to study large complex divergence problems that involve multiple closely related populations or species.

  19. Measuring stigma after spinal cord injury: Development and psychometric characteristics of the SCI-QOL Stigma item bank and short form

    PubMed Central

    Kisala, Pamela A.; Tulsky, David S.; Pace, Natalie; Victorson, David; Choi, Seung W.; Heinemann, Allen W.

    2015-01-01

    Objective To develop a calibrated item bank and computer adaptive test (CAT) to assess the effects of stigma on health-related quality of life in individuals with spinal cord injury (SCI). Design Grounded-theory based qualitative item development methods, large-scale item calibration field testing, confirmatory factor analysis, and item response theory (IRT)-based psychometric analyses. Setting Five SCI Model System centers and one Department of Veterans Affairs medical center in the United States. Participants Adults with traumatic SCI. Main Outcome Measures SCI-QOL Stigma Item Bank Results A sample of 611 individuals with traumatic SCI completed 30 items assessing SCI-related stigma. After 7 items were iteratively removed, factor analyses confirmed a unidimensional pool of items. Graded Response Model IRT analyses were used to estimate slopes and thresholds for the final 23 items. Conclusions The SCI-QOL Stigma item bank is unique not only in the assessment of SCI-related stigma but also in the inclusion of individuals with SCI in all phases of its development. Use of confirmatory factor analytic and IRT methods provide flexibility and precision of measurement. The item bank may be administered as a CAT or as a 10-item fixed-length short form and can be used for research and clinical applications. PMID:26010973

  20. MicroRNA-146a Contributes to SCI Recovery via Regulating TRAF6 and IRAK1 Expression.

    PubMed

    Wei, Jinsong; Wang, Jiafeng; Zhou, Yulan; Yan, Shouquan; Li, Keshen; Lin, Hongsheng

    2016-01-01

    MicroRNA-146a participates in spinal cord injury (SCI) recovery. Until recently, how miRNA-146a participates in SCI remained unclear. In this study, we tried to explore the roles of miRNA-146a in the recovery of SCI using a rat model. The expression of the probable target genes of miRNA-146a (including IRAK1 and TARF6) as well as proinflammation cytokines were measured until 7 days after surgery in the three groups (sham group, SCI group, and miRNA-146a antagomir injection group). Also, the animals' motivations were estimated using Basso Beattie Bresnahan (BBB) during the whole experiment. A luciferase assay was performed to demonstrate that miRNA-146a could directly target the mRNAs of IRAK1 and TRAF6 . Our experiments indicate that miRNA-146a inhibits proinflammatory cytokine secretion by suppressing IRAK1 and TRAF6 expression in the SCI model. In contrast, miRNA-146a may be upregulated by inflammatory mediators via the IRAK1 / TRAF6 pathway in the spinal cord. As a negative feedback element, miRNA-146a could make sure that the expression of IRAK1 - and TRAF6 -mediated genes was under tight control. Thus, miRNA-146a may serve as a novel therapeutic target for SCI interventions.

  1. Genetics Home Reference: mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes

    MedlinePlus

    ... my area? Other Names for This Condition MELAS MELAS syndrome mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like ... basic concepts, clinical phenotype, and therapeutic management of MELAS syndrome. Ann N Y Acad Sci. 2008 Oct;1142: ...

  2. Neuroinflammatory contributions to pain after SCI: roles for central glial mechanisms and nociceptor-mediated host defense.

    PubMed

    Walters, Edgar T

    2014-08-01

    Neuropathic pain after spinal cord injury (SCI) is common, often intractable, and can be severely debilitating. A number of mechanisms have been proposed for this pain, which are discussed briefly, along with methods for revealing SCI pain in animal models, such as the recently applied conditioned place preference test. During the last decade, studies of animal models have shown that both central neuroinflammation and behavioral hypersensitivity (indirect reflex measures of pain) persist chronically after SCI. Interventions that reduce neuroinflammation have been found to ameliorate pain-related behavior, such as treatment with agents that inhibit the activation states of microglia and/or astroglia (including IL-10, minocycline, etanercept, propentofylline, ibudilast, licofelone, SP600125, carbenoxolone). Reversal of pain-related behavior has also been shown with disruption by an inhibitor (CR8) and/or genetic deletion of cell cycle-related proteins, deletion of a truncated receptor (trkB.T1) for brain-derived neurotrophic factor (BDNF), or reduction by antisense knockdown or an inhibitor (AMG9810) of the activity of channels (TRPV1 or Nav1.8) important for electrical activity in primary nociceptors. Nociceptor activity is known to drive central neuroinflammation in peripheral injury models, and nociceptors appear to be an integral component of host defense. Thus, emerging results suggest that spinal and systemic effects of SCI can activate nociceptor-mediated host defense responses that interact via neuroinflammatory signaling with complex central consequences of SCI to drive chronic pain. This broader view of SCI-induced neuroinflammation suggests new targets, and additional complications, for efforts to develop effective treatments for neuropathic SCI pain. Copyright © 2014 Elsevier Inc. All rights reserved.

  3. Web life: Planet SciCast

    NASA Astrophysics Data System (ADS)

    2009-08-01

    So what is the site about? Planet SciCast is an online repository for short films about science - a bit like a science-specific, moderated version of YouTube. As of July 2009, the site hosts over 150 films on topics ranging from CERN's Large Hadron Collider to fun things to do with treacle. New content appears on the site every few weeks, and some films include links to information about related experiments, demos and activities. The site also runs an annual competition aimed at getting more people involved in making science films, with prizes in categories like "best original score" and "best presenter".

  4. Use, knowledge, and perception of the scientific contribution of Sci-Hub in medical students: Study in six countries in Latin America

    PubMed Central

    Mejia, Christian R.; Valladares-Garrido, Mario J.; Miñan-Tapia, Armando; Serrano, Felipe T.; Tobler-Gómez, Liz E.; Pereda-Castro, William; Mendoza-Flores, Cynthia R.; Mundaca-Manay, Maria Y.; Valladares-Garrido, Danai

    2017-01-01

    Introduction Sci-Hub is a useful web portal for people working in science as it provides access to millions of free scientific articles. Satisfaction and usage should be explored in the Latino student population. The objective of this study was to evaluate the use, knowledge, and perception of the scientific contribution of Sci-Hub in medical students from Latin America. Methodology A multicenter, observational, analytical study was conducted in 6632 medical students from 6 countries in Latin America. We surveyed from a previously validated instrument, delving into knowledge, monthly average usage, satisfaction level, and perception of the scientific contributions provided by Sci-Hub. Frequencies and percentages are described, and generalized linear models were used to establish statistical associations. Results Only 19.2% of study participants knew of Sci-Hub and its function, while the median use was twice a month. 29.9% of Sci-Hub-aware participants claimed they always find the desired scientific information in their Sci-Hub search; 62.5% of participants affirmed that Sci-Hub contributes to scientific investigation; only 2.2% reported that Sci-Hub does not contribute to science. Conclusion The majority of Latino students are not aware of Sci-Hub. PMID:28982181

  5. Use, knowledge, and perception of the scientific contribution of Sci-Hub in medical students: Study in six countries in Latin America.

    PubMed

    Mejia, Christian R; Valladares-Garrido, Mario J; Miñan-Tapia, Armando; Serrano, Felipe T; Tobler-Gómez, Liz E; Pereda-Castro, William; Mendoza-Flores, Cynthia R; Mundaca-Manay, Maria Y; Valladares-Garrido, Danai

    2017-01-01

    Sci-Hub is a useful web portal for people working in science as it provides access to millions of free scientific articles. Satisfaction and usage should be explored in the Latino student population. The objective of this study was to evaluate the use, knowledge, and perception of the scientific contribution of Sci-Hub in medical students from Latin America. A multicenter, observational, analytical study was conducted in 6632 medical students from 6 countries in Latin America. We surveyed from a previously validated instrument, delving into knowledge, monthly average usage, satisfaction level, and perception of the scientific contributions provided by Sci-Hub. Frequencies and percentages are described, and generalized linear models were used to establish statistical associations. Only 19.2% of study participants knew of Sci-Hub and its function, while the median use was twice a month. 29.9% of Sci-Hub-aware participants claimed they always find the desired scientific information in their Sci-Hub search; 62.5% of participants affirmed that Sci-Hub contributes to scientific investigation; only 2.2% reported that Sci-Hub does not contribute to science. The majority of Latino students are not aware of Sci-Hub.

  6. Differences in the use of everyday technology among persons with MCI, SCI and older adults without known cognitive impairment.

    PubMed

    Malinowsky, Camilla; Kottorp, Anders; Wallin, Anders; Nordlund, Arto; Björklund, Eva; Melin, Ilse; Pernevik, Anette; Rosenberg, Lena; Nygård, Louise

    2017-07-01

    To use valid subjective reports sensible to cognitive decline is vital to identify very early signs of dementia development. Use of everyday technology (ET) has been shown to be sensitive to differentiate adults with mild cognitive impairment (MCI) from controls, but the group with subjective cognitive impairment (SCI) has not yet been examined. This study aims to investigate and compare self-perceived ability in ET use and number of ETs reported as actually used in a sample of older adults with SCI, MCI, and older adults with no known cognitive impairment, i.e. Older adults with MCI (n = 29), SCI ( n = 26), and controls (n = 30) were interviewed with the short version of the Everyday Technology Use Questionnaire (S-ETUQ) to capture self-perceived ability in ET use and number of ETs used. To generate individual measures of ability to use ET, Rasch analysis was used. The measures were then compared group-wise using ANCOVA. The numbers of ETs used were compared group-wise with ANOVA. Controls versus SCI and MCI differed significantly regarding ETs reported as used, but not SCI versus MCI. Similarly, in ability to use ET, controls versus SCI and MCI differed significantly but not SCI versus MCI. The significantly lower numbers of ETs reported as actually used and the lower ability in SCI and MCI groups compared to controls suggest that ET use is affected already in very minor cognitive decline. This indicates that self-reported ET use based on the S-ETUQ is sensitive to detect changes already in SCI.

  7. An international age- and gender-controlled model for the Spinal Cord Injury Ability Realization Measurement Index (SCI-ARMI).

    PubMed

    Scivoletto, Giorgio; Glass, Clive; Anderson, Kim D; Galili, Tal; Benjamin, Yoav; Front, Lilach; Aidinoff, Elena; Bluvshtein, Vadim; Itzkovich, Malka; Aito, Sergio; Baroncini, Ilaria; Benito-Penalva, Jesùs; Castellano, Simona; Osman, Aheed; Silva, Pedro; Catz, Amiram

    2015-01-01

    Background. A quadratic formula of the Spinal Cord Injury Ability Realization Measurement Index (SCI-ARMI) has previously been published. This formula was based on a model of Spinal Cord Independence Measure (SCIM95), the 95th percentile of the SCIM III values, which correspond with the American Spinal Injury Association Motor Scores (AMS) of SCI patients. Objective. To further develop the original formula. Setting. Spinal cord injury centers from 6 countries and the Statistical Laboratory, Tel-Aviv University, Israel. Methods. SCIM95 of 661 SCI patients was modeled, using a quantile regression with or without adjustment for age and gender, to calculate SCI-ARMI values. SCI-ARMI gain during rehabilitation and its correlations were examined. Results. A new quadratic SCIM95 model was created. This resembled the previously published model, which yielded similar SCIM95 values in all the countries, after adjustment for age and gender. Without this adjustment, however, only 86% of the non-Israeli SCIM III observations were lower than those SCIM95 values (P < .0001). Adding the variables age and gender to the new model affected the SCIM95 value significantly (P < .04). Adding country information did not add a significant effect (P > .1). SCI-ARMI gain was positive (38.8 ± 22 points, P < .0001) and correlated weakly with admission age and AMS. Conclusions. The original quadratic SCI-ARMI formula is valid for an international population after adjustment for age and gender. The new formula considers more factors that affect functional ability following SCI. © The Author(s) 2014.

  8. Valproic Acid Arrests Proliferation but Promotes Neuronal Differentiation of Adult Spinal NSPCs from SCI Rats.

    PubMed

    Chu, Weihua; Yuan, Jichao; Huang, Lei; Xiang, Xin; Zhu, Haitao; Chen, Fei; Chen, Yanyan; Lin, Jiangkai; Feng, Hua

    2015-07-01

    Although the adult spinal cord contains a population of multipotent neural stem/precursor cells (NSPCs) exhibiting the potential to replace neurons, endogenous neurogenesis is very limited after spinal cord injury (SCI) because the activated NSPCs primarily differentiate into astrocytes rather than neurons. Valproic acid (VPA), a histone deacetylase inhibitor, exerts multiple pharmacological effects including fate regulation of stem cells. In this study, we cultured adult spinal NSPCs from chronic compressive SCI rats and treated with VPA. In spite of inhibiting the proliferation and arresting in the G0/G1 phase of NSPCs, VPA markedly promoted neuronal differentiation (β-tubulin III(+) cells) as well as decreased astrocytic differentiation (GFAP(+) cells). Cell cycle regulator p21(Cip/WAF1) and proneural genes Ngn2 and NeuroD1 were increased in the two processes respectively. In vivo, to minimize the possible inhibitory effects of VPA to the proliferation of NSPCs as well as avoid other neuroprotections of VPA in acute phase of SCI, we carried out a delayed intraperitoneal injection of VPA (150 mg/kg/12 h) to SCI rats from day 15 to day 22 after injury. Both of the newborn neuron marker doublecortin and the mature neuron marker neuron-specific nuclear protein were significantly enhanced after VPA treatment in the epicenter and adjacent segments of the injured spinal cord. Although the impaired corticospinal tracks had not significantly improved, Basso-Beattie-Bresnahan scores in VPA treatment group were better than control. Our study provide the first evidence that administration of VPA enhances the neurogenic potential of NSPCs after SCI and reveal the therapeutic value of delayed treatment of VPA to SCI.

  9. 75 FR 19626 - Notice of Intent To Grant Exclusive Patent License: SciTech Medical Inc.

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-04-15

    ... DEPARTMENT OF DEFENSE Department of the Navy Notice of Intent To Grant Exclusive Patent License: SciTech Medical Inc. AGENCY: Department of the Navy, DoD. ACTION: Notice. SUMMARY: The Department of the Navy hereby gives notice of its intent to grant a partially exclusive license to SciTech Medical...

  10. Research progress from the SCI Model Systems (SCIMS): An interactive discussion on future directions.

    PubMed

    Boninger, Michael L; Field-Fote, Edelle C; Kirshblum, Steven C; Lammertse, Daniel P; Dyson-Hudson, Trevor A; Hudson, Lesley; Heinemann, Allen W

    2018-03-01

    To describe current and future directions in spinal cord injury (SCI) research. The SCI Model Systems (SCIMS) programs funded by the National Institute on Disability, Independent Living, and Rehabilitation Research (NIDILRR) during the 2011 to 2016 cycle provided abstracts describing findings from current research projects. Discussion among session participants generated ideas for research opportunities. Pre-conference workshop before the 2016 American Spinal Injury Association (ASIA) annual meeting. A steering committee selected by the SCIMS directors that included the moderators of the sessions at the ASIA pre-conference workshop, researchers presenting abstracts during the session, and the audience of over 100 attending participants in the pre-conference workshop. Group discussion followed presentations in 5 thematic areas of (1) Demographics and Measurement; (2) Functional Training; (3) Psychosocial Considerations; (4) Assistive Technology; and (5) Secondary Conditions. The steering committee reviewed and summarized discussion points on future directions for research and made recommendations for research based on the discussion in each of the five areas. Significant areas in need of research in SCI remain, the goal of which is continued improvement in the quality of life of individuals with SCI.

  11. The CanPain SCI Clinical Practice Guidelines for Rehabilitation Management of Neuropathic Pain after Spinal Cord: screening and diagnosis recommendations.

    PubMed

    Mehta, S; Guy, S D; Bryce, T N; Craven, B C; Finnerup, N B; Hitzig, S L; Orenczuk, S; Siddall, P J; Widerström-Noga, E; Casalino, A; Côté, I; Harvey, D; Kras-Dupuis, A; Lau, B; Middleton, J W; Moulin, D E; O'Connell, C; Parrent, A G; Potter, P; Short, C; Teasell, R; Townson, A; Truchon, C; Wolfe, D; Bradbury, C L; Loh, E

    2016-08-01

    Clinical practice guidelines. To develop the first Canadian clinical practice guidelines for screening and diagnosis of neuropathic pain in people with spinal cord injury (SCI). The guidelines are relevant for inpatient and outpatient SCI rehabilitation settings in Canada. The CanPainSCI Working Group reviewed evidence to address clinical questions regarding screening and diagnosis of neuropathic pain after SCI. A consensus process was followed to achieve agreement on recommendations and clinical considerations. Twelve recommendations, based on expert consensus, were developed for the screening and diagnosis of neuropathic pain after SCI. The recommendations address methods for assessment, documentation tools, team member accountability, frequency of screening and considerations for diagnostic investigation. Important clinical considerations accompany each recommendation. The expert Working Group developed recommendations for the screening and diagnosis of neuropathic pain after SCI that should be used to inform practice.

  12. Spinal cord injury (SCI) rehabilitation: systematic analysis of communication from the biopsychosocial perspective.

    PubMed

    Hartley, Naomi A

    2015-07-02

    Communication is powerful predictor of health-related quality of life and overall well-being, yet its role in promoting rehabilitation outcomes in spinal cord injury (SCI) is rarely mentioned. This article systematically analyzes and synthesizes literature from multiple disciplines according to a biopsychosocial perspective, providing an evidence base for clinical practice and clear direction for future research. Systematic literature review and analysis, incorporating mapping to International Classification of Functioning, Disability and Health (ICF) codes. In total 4338 entries were retrieved from CINAHL, PsychInfo, Medline, PubMed and SpeechBite databases for the period 1990-2014. A total of 115 treatment and observational studies (quantitative and qualitative) detailed aspects of communication according to structure, function, activity, participation and environmental factors; evident of the complex interactions between communicative function with daily living after SCI. Communication is a relative strength in SCI, key to empowerment, independence, social interaction, and well-being, yet its potential to enhance SCI rehabilitation outcomes remains largely underexplored and untapped. Through elucidating interactions between communication and functioning, the adapted ICF framework affords clinicians and researchers insight into areas of intervention most likely to result in widespread gains. Conscious consideration should be given to the role of communication, within an integrative, strengths-based, multidisciplinary approach to clinical practice and future research. Implications for Rehabilitation Communication fosters empowerment, independence and greater participation in life roles; recognized as a powerful predictor of health-related quality of life and overall well-being. The ICF framework elucidates influences to communicative function, and components which are influenced by communication, providing valuable insight for clinicians and researchers

  13. What Makes Things Happen? Study Guide. Unit B. ZIM-SCI, Zimbabwe Secondary School Science Project.

    ERIC Educational Resources Information Center

    Dube, Peter

    The Zimbabwe Secondary School Science Project (ZIM-SCI) developed student study guides, corresponding teaching guides, and science kits for a low-cost science course which could be taught during the first 2 years of secondary school without the aid of qualified teachers and conventional laboratories. This ZIM-SCI study guide presents activities…

  14. Looking at Life. Study Guide. Unit A2. ZIM-SCI, Zimbabwe Secondary School Science Project.

    ERIC Educational Resources Information Center

    Hosking, Bunty

    The Zimbabwe Secondary School Science Project (ZIM-SCI) developed student study guides, corresponding teaching guides, and science kits for a low-cost science course which could be taught during the first 2 years of secondary school without the aid of qualified teachers and conventional laboratories. This ZIM-SCI study guide presents activities…

  15. [Analysis on acupuncture literature in Science Citation Index (SCI) periodicals in 2007].

    PubMed

    Gao, Liang; Tian, Li-xin; Guo, Yi

    2009-06-01

    To grasp the international developing tendency of acupuncture research and provide some references for promoting acupuncture and moxibustion internationalization process, the articles about acupuncture in Science Citation Index (SCI) periodicals in 2007 were retrieved by adopting the retrieval tactics on line in combination with database searching. Results indicate that 257 articles about acupuncture had been retrived from the SCI Web databases. These articles were published in 125 journals respectively, most of which were Euramerican journals. Among these journals, the impact factor of the Journal of the American Medical Association (JAMA), 25. 547, is the highest one. It is shown that the impact factors of the SCI periodicals, in which acupuncture articles embodied are increased, the quality of these articles are improved obviously and the types of the articles are various in 2007, but there is obvious difference in the results of these studies due to the difference of experimental methods, the subjects of these experiments and acupuncture manipulations. Therefore, standardization of many problems arising from the researches on acupuncture is extremely imminent.

  16. Measurement properties of the Spinal Cord Injury-Functional Index (SCI-FI) short forms.

    PubMed

    Heinemann, Allen W; Dijkers, Marcel P; Ni, Pengsheng; Tulsky, David S; Jette, Alan

    2014-07-01

    To evaluate the psychometric properties of the Spinal Cord Injury-Functional Index (SCI-FI) short forms (basic mobility, self-care, fine motor, ambulation, manual wheelchair, and power wheelchair) based on internal consistency; correlations between short forms banks, full item bank forms, and a 10-item computer adaptive test version; magnitude of ceiling and floor effects; and test information functions. Cross-sectional cohort study. Six rehabilitation hospitals in the United States. Individuals with traumatic spinal cord injury (N=855) recruited from 6 national Spinal Cord Injury Model Systems facilities. Not applicable. SCI-FI full item bank, 10-item computer adaptive test, and parallel short form scores. The SCI-FI short forms (with separate versions for individuals with paraplegia and tetraplegia) demonstrate very good internal consistency, group-level reliability, excellent correlations between short forms and scores based on the total item bank, and minimal ceiling and floor effects (except ceiling effects for persons with paraplegia on self-care, fine motor, and power wheelchair ability and floor effects for persons with tetraplegia on self-care, fine motor, and manual wheelchair ability). The test information functions are acceptable across the range of scores where most persons in the sample performed. Clinicians and researchers should consider the SCI-FI short forms when computer adaptive testing is not feasible. Copyright © 2014 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.

  17. Does the CDC Definition of Fever Accurately Predict Inflammation and Infection in Persons With SCI?

    PubMed

    Trbovich, Michelle; Li, Carol; Lee, Shuko

    2016-01-01

    Background: Pneumonia and septicemia have the greatest impact on reduced life expectancy in persons with spinal cord injury (SCI). Fever is often the first presenting symptom of infection or inflammation. Thermoregulatory dysfunction in persons with SCI may preclude a typical febrile response to infection or inflammation and thus delay diagnostic workup. Objective: To determine the core temperature of persons with SCI in the setting of infection or inflammation and the frequency with which it meets criteria for the CDC definition of fever (>100.4°F). Methods: Retrospective review of hospitalized SCI patients over 5 years with a diagnosis of infection or inflammation (DI), defined by serum leukocytosis. In this study, 458 persons with paraplegia (PP) and 483 persons with tetraplegia (TP) had 4,191 DI episodes. Aural temperatures (T au ) on the day of DI, 7 days prior, and 14 days afterwards were abstracted from medical records. Main outcome measures were average T au at DI, frequency of temperatures >100.4°F at DI, and average baseline temperatures before and after DI. Results: Average T au at DI was 98.2°F (±1.5) and 98.2°F (±1.4) in the TP and PP groups, respectively, with only 11.6% to 14% of DI resulting in T au >100.4°F. Baseline temperatures ranged from 97.9°F (±0.7) to 98.0°F (±0.8). Conclusion: SCI persons with leukocytosis infrequently mount a fever as defined by the CDC, and baseline temperatures were subnormal (<98.6°F). Thermoregulatory dysfunction likely accounts for these findings. T au >100.4°F is not a sensitive predictor of infection or inflammation in persons with SCI. Clinicians should be vigilant for alternative symptoms of infection and inflammation in these patients, so diagnostic workup is not delayed.

  18. SCI Hospital in Home Program: Bringing Hospital Care Home for Veterans With Spinal Cord Injury.

    PubMed

    Madaris, Linda L; Onyebueke, Mirian; Liebman, Janet; Martin, Allyson

    2016-01-01

    The complex nature of spinal cord injury (SCI) and the level of care required for health maintenance frequently result in repeated hospital admissions for recurrent medical complications. Prolonged hospitalizations of persons with SCI have been linked to the increased risk of hospital-acquired infections and development or worsening pressure ulcers. An evidence-based alternative for providing hospital-level care to patients with specific diagnoses who are willing to receive that level of care in the comfort of their home is being implemented in a Department of Veterans Affairs SCI Home Care Program. The SCI Hospital in Home (HiH) model is similar to a patient-centered interdisciplinary care model that was first introduced in Europe and later tested as part of a National Demonstration and Evaluation Study through Johns Hopkins School of Medicine and School of Public Health. This was funded by the John A. Hartford Foundation and the Department of Veterans Affairs. The objectives of the program are to support veterans' choice and access to patient-centered care, reduce the reliance on inpatient medical care, allow for early discharge, and decrease medical costs. Veterans with SCI who are admitted to the HiH program receive daily oversight by a physician, daily visits by a registered nurse, access to laboratory services, oxygen, intravenous medications, and nursing care in the home setting. In this model, patients may typically access HiH services either as an "early discharge" from the hospital or as a direct admit to the program from the emergency department or SCI clinic. Similar programs providing acute hospital-equivalent care in the home have been previously implemented and are successfully demonstrating decreased length of stay, improved patient access, and increased patient satisfaction.

  19. Does the CDC Definition of Fever Accurately Predict Inflammation and Infection in Persons With SCI?

    PubMed Central

    Li, Carol; Lee, Shuko

    2016-01-01

    Background: Pneumonia and septicemia have the greatest impact on reduced life expectancy in persons with spinal cord injury (SCI). Fever is often the first presenting symptom of infection or inflammation. Thermoregulatory dysfunction in persons with SCI may preclude a typical febrile response to infection or inflammation and thus delay diagnostic workup. Objective: To determine the core temperature of persons with SCI in the setting of infection or inflammation and the frequency with which it meets criteria for the CDC definition of fever (>100.4°F). Methods: Retrospective review of hospitalized SCI patients over 5 years with a diagnosis of infection or inflammation (DI), defined by serum leukocytosis. In this study, 458 persons with paraplegia (PP) and 483 persons with tetraplegia (TP) had 4,191 DI episodes. Aural temperatures (Tau) on the day of DI, 7 days prior, and 14 days afterwards were abstracted from medical records. Main outcome measures were average Tau at DI, frequency of temperatures >100.4°F at DI, and average baseline temperatures before and after DI. Results: Average Tau at DI was 98.2°F (±1.5) and 98.2°F (±1.4) in the TP and PP groups, respectively, with only 11.6% to 14% of DI resulting in Tau >100.4°F. Baseline temperatures ranged from 97.9°F (±0.7) to 98.0°F (±0.8). Conclusion: SCI persons with leukocytosis infrequently mount a fever as defined by the CDC, and baseline temperatures were subnormal (<98.6°F). Thermoregulatory dysfunction likely accounts for these findings. Tau >100.4°F is not a sensitive predictor of infection or inflammation in persons with SCI. Clinicians should be vigilant for alternative symptoms of infection and inflammation in these patients, so diagnostic workup is not delayed. PMID:29339867

  20. The Small Carry-on Impactor (SCI) and the Hayabusa2 Impact Experiment

    NASA Astrophysics Data System (ADS)

    Saiki, T.; Imamura, H.; Arakawa, M.; Wada, K.; Takagi, Y.; Hayakawa, M.; Shirai, K.; Yano, H.; Okamoto, C.

    2017-07-01

    Hayabusa2 is a sample return mission of JAXA launched on 3 December 2014. Hayabusa2 is the successor of Hayabusa, which returned samples from the asteroid Itokawa to the Earth. Although the design of Hayabusa2 follows that of Hayabusa, the former is equipped with some new components. The small carry-on impactor (SCI) is one of those components. The SCI is a compact kinetic impactor designed to remove the asteroid surface regolith locally and create an artificial crater. One of the most important scientific objectives of Hayabusa2 is to investigate the chemical and physical properties of the internal materials and structures of the target body, asteroid Ryugu. Hayabusa2 will attempt to observe the resultant crater with some scientific instruments and to get samples from around the crater. High kinetic energy is required to create a meaningful crater, however, the impact system design needs to fit within strict constraints. Complicated functions, such as a guidance and control system, are not permitted. A special type of shaped charge is used for the acceleration of the impactor of the SCI in order to make system simpler. Using this explosion technique makes it possible to accelerate the impactor very quickly and to hit the asteroid without a guidance system. However, the impact operation will be complicated because the explosive is very powerful and it scatters high-speed debris at the detonation. This paper describes an overview of the SCI system, the results of the development testing and an outline of the impact experiment of the Hayabusa2 mission.

  1. Particles in Action. Study Guide. Unit C2. ZIM-SCI, Zimbabwe Secondary School Science Project.

    ERIC Educational Resources Information Center

    Stocklmayer, Sue

    The Zimbabwe Secondary School Science Project (ZIM-SCI) developed student study guides, corresponding teaching guides, and science kits for a low-cost science course which could be taught during the first 2 years of secondary school without the aid of qualified teachers and conventional laboratories. This ZIM-SCI study guide is a four-part unit…

  2. Valproic acid improves locomotion in vivo after SCI and axonal growth of neurons in vitro.

    PubMed

    Lv, Lei; Han, Xiang; Sun, Yan; Wang, Xin; Dong, Qiang

    2012-02-01

    Previous studies have found that valproic acid (VPA), a histone deacetylases (HDAC) inhibitor, improves outcomes in a rat model of spinal cord injury (SCI). The study here aimed to further illuminate the neuroprotective effects of VPA against SCI, both in vivo and in vitro. First, spinal cord injury was performed in rats using NYU impactor. Delayed VPA injection (8 h following SCI) significantly accelerated locomotor recovery. VPA therapy also suppressed SCI-induced hypoacetylation of histone and promoted expressions of BDNF and GDNF. Next, the influence of VPA on axonal growth inhibited by a myelin protein was tested. Neurons from embryonic spinal cord or hippocampus were cultured on plates coated with Nogo-A peptide, and escalating concentrations of VPA were added into the cultures. VPA treatment, in a concentration dependent manner, allowed neurons to overcome Nogo-A inhibition of neurite outgrowth. Meanwhile, VPA exposure increased the level of histone acetylation and expression of BDNF in spinal neurons. Cumulatively, these findings indicate that VPA is possibly a promising medication and deserves translational trials for spinal cord injury. Copyright © 2011 Elsevier Inc. All rights reserved.

  3. Recommendations for the National Institute for Neurologic Disorders and Stroke spinal cord injury common data elements for children and youth with SCI.

    PubMed

    Mulcahey, M J; Vogel, L C; Sheikh, M; Arango-Lasprilla, J C; Augutis, M; Garner, E; Hagen, E M; Jakeman, L B; Kelly, E; Martin, R; Odenkirchen, J; Scheel-Sailer, A; Schottler, J; Taylor, H; Thielen, C C; Zebracki, K

    2017-04-01

    In 2014, the adult spinal cord injury (SCI) common data element (CDE) recommendations were made available. This project was a review of the adult SCI CDE for relevance to children and youth with SCI. The objective of this study was to review the National Institute of Neurologic Disorders and Stroke (NINDS) adult SCI CDEs for relevance to children and youth with SCI. International. The pediatric working group consisted of international members with varied fields of expertise related to pediatric SCI. The group convened biweekly meetings for 6 months in 2015. All of the adult SCI CDEs were reviewed, evaluated and modified/created for four age groups: 0-5 years, 6-12 years, 13-15 years and 16-18 years. Whenever possible, results of published research studies were used to guide recommendations. In the absence of empirical support, grey literature and international content expert consensus were garnered. Existing pediatric NINDS CDEs and new CDEs were developed in areas where adult recommendations were not appropriate. After internal working group review of domain recommendations, these pediatric CDEs were vetted during a public review from November through December 2015. Version 1.0 of the pediatric SCI CDEs was posted in February 2016. The pediatric SCI CDEs are incorporated directly into the NINDS SCI CDE sets and can be found at https://commondataelements.ninds.nih.gov.

  4. Social Competence Intervention for Parents (SCI-P): Comparing Outcomes for a Parent Education Program Targeting Adolescents with ASD

    PubMed Central

    Schultz, Tia R.; Stichter, Janine P.; Herzog, Melissa J.; McGhee, Stephanie D.; Lierheimer, Kristin

    2012-01-01

    Research has shown that parent education programs can address some of the distinct challenges that parents of youth with autism spectrum disorders (ASDs) encounter. This study examined the effectiveness of the Social Competence Intervention for Parents (SCI-P), a parent education program, administered in conjunction with a social competence intervention that targeted youth with ASD ages 11–14 (SCI-A). Using a quasi-experimental pre-post design, parents were assigned to either the SCI-P group (n = 16) or to the waitlist comparison group (n = 10). Analyses of covariance (ANCOVAs) revealed a significant effect for parent education participation such that SCI-P participants experienced significantly greater reductions in levels of stress and a trend for increases in parenting sense of competence from pre- to post-intervention. Moreover, parents in the SCI-P group reported high satisfaction with the program. These findings suggest that parent education can result in positive outcomes for parents' well being. PMID:22934178

  5. Orthostatic Responses to Anticholinesterase Inhibition in Persons with SCI

    PubMed Central

    Wecht, Jill M.; Cirnigliaro, Christopher M.; Azarelo, Frank; Bauman, William A.; Kirshblum, Steven C.

    2015-01-01

    Acetylcholine (Ach) is the pre-synaptic neurotransmitter of the sympathetic nervous system. Increased pre-synaptic Ach may augment post-synaptic release of norepinephrine thereby increasing systemic blood pressure (BP). The primary objective of this investigation was to determine the hemodynamic effect of pyridostigmine bromide (PYRIDO: 60 mg), an Ach inhibitor (AchI), compared to no-drug (NO-D) during head-up tilt (HUT) in individuals with spinal cord injury (SCI). Secondarily we aimed to determine the effects of PYRIDO compared to NO-D on symptoms of orthostatic intolerance (OI) and adverse event reporting (AE). Ten individuals with SCI (C4–C7) were studied on 2 occasions: visit 1) NO-D and visit 2) PYRIDO. On each visit subjects underwent a progressive HUT maneuver to 15°, 25°, 35° for 5 minutes at each angle and 45 minutes at 45°. Supine and orthostatic heart rate (HR), systolic and diastolic BP (SBP & DBP) were monitored and symptoms of OI and AE recorded. Supine hemodynamics did not differ between the trials. The significant fall in SBP during the NO-D trial was diminished with PYRIDO and five subjects had an increased DBP during HUT with PYRIDO compared to the NO-D trial. Individuals that responded to PYRIDO with an increase in orthostatic BP had significantly lower resting HR than non-responders (p<0.01), which suggests increased levels of pre-synaptic Ach. Subjective symptoms of OI and AE reporting did not differ between the two trials. These preliminary data suggest that PYRIDO is safe and may be effective at ameliorating the orthostatic fall in BP in select individuals with SCI. PMID:25916633

  6. a Study on the Document Information Service of the National Agricultural Library for Agricultural Sci-Tech Innovation in China

    NASA Astrophysics Data System (ADS)

    Xu, Qian; Meng, Xianxue

    This paper presents the significant function of the Chinese National Agricultural Library (CNAL) in the agricultural sci-tech innovation system in China, analyses the development of collection and service in the CNAL, explores the challenge towards sustain and develop information services for the agricultural sci-tech research and innovation, at last proposes the strategy for sci-tech document information service development.

  7. Secretory expression and surface display of a new and biologically active single-chain insulin (SCI-59) analog by lactic acid bacteria.

    PubMed

    Mao, Ruifeng; Wu, Dongli; Hu, Shimeng; Zhou, Kangping; Wang, Man; Wang, Yefu

    2017-04-01

    Insulin plays an important role in drug therapies for diabetes mellitus and as the main route of insulin delivery, subcutaneous injection may cause local discomfort, hypoglycemia, hyperinsulinemia, and patient non-compliance. Therefore, oral delivery of insulin is more preferred. However, there is a low bioavailability due to insulin degradation by proteolytic enzymes and severe pH conditions along the gastrointestinal tract. In order to use the food-grade bacteria lactic acid bacteria (LAB) as oral delivery vehicles, a new and bioactive single-chain insulin (SCI-59) analog, containing the insulin B- and A-chains connected by an eight-residue linker (RSRGLPFR), was secretory expressed in Lactococcus lactis NZ3900 without using an antibiotic resistance gene and displayed onto the surface of various non-viable bacteria (NVBs) without genetic modification. Both the free SCI-59 and SCI-59 displayed on the surface of NVBs are biologically active as assayed by their ability to stimulate Akt signaling in differentiated 3T3-L1 adipocytes. Modification of the pH of the medium by NaOH addition at early time during induction can enhance the bioactivity of SCI-59. The C-terminal fused anchoring domain, three LysM repeats, does not affect the formation of disulfide bonds and/or the folding of SCI-59, and SCI-59 could be exposed properly and fully when SCI-59-3LysM bound to the surface of NVBs. Compared to the free form SCI-59, SCI-59 displayed on the surface of NVBs is more stable in simulate gastric juice. It may open new prospects for possible oral treatments of diabetes using live LAB secreting or NVBs carrying bioactive SCI analogs.

  8. The regulatory effect of electro-acupuncture on the expression of NMDA receptors in a SCI rat model.

    PubMed

    Tu, Wen-Zhan; Chen, Wen-Ci; Xia, Wan; He, Rong; Hu, Jie; Jiang, Ming-Chen; Jiang, Song-He

    2017-05-15

    In early spinal cord injury (SCI), glutamate receptors, including N-methyl-d-aspartate (NMDA) receptors (NMDARs), are over-stimulated by excessively released glutamate. The enhanced activity of NMDARs may cause cell death by overloading calcium (Ca 2+ ) into cells based on their high permeability to Ca 2+ . Studies in SCI animals have shown that treatment with electro-acupuncture (EA) is able to reduce cell death and to improve functional recovery. One possible mechanism of this neuroprotective effect is that EA has regulatory effect on NMDARs. To test whether EA could protect the spinal cord after SCI by decreasing the expression levels of NR1 and NR2A. We conducted EA treatment on a rat SCI model produced with a New York University (NYU) Impactor and measured hindlimb locomotor function by Basso, Beattie and Bresnahan Locomotor Rating Scale (BBB Scale). The expression of NR1 and NR2, the subunits of NMDARs, in the injured spinal cord was measured by Immunofluorescence stainings, western blot and real-time quantitative PCR (RT-qPCR). Our results showed that two days after the SCI the expression of NR1 and NR2 were dramatically enhanced at both protein and mNRA levels, which were significantly reduced by EA treatment at two specific acupoints, Dazhui (DU14) and Mingmen (DU4). EA is a potential therapeutic method for treating early SCI in human. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Enhancing health care professionals' and trainees' knowledge of physical activity guidelines for adults with and without SCI.

    PubMed

    Shirazipour, Celina H; Tomasone, Jennifer R; Martin Ginis, Kathleen A

    2018-01-11

    Health care providers (HCPs) are preferred sources of physical activity (PA) information; however, minimal research has explored HCPs' knowledge of spinal cord injury (SCI) PA guidelines, and no research has examined HCP trainees' PA guideline knowledge. The current study explored HCPs' and trainees' initial knowledge of PA guidelines for both adults with SCI and the general population, and the utility of an event-based intervention for improving this knowledge. Participants (HCPs n = 129; trainees n = 573) reported guideline knowledge for both sets of guidelines (SCI and general population) immediately after, one-month, and six-months following the intervention. Frequencies determined guideline knowledge at each timepoint, while chi-squared tests examined differences in knowledge of both guidelines, as well as knowledge differences in the short- and long-term. Results demonstrated that HCPs and trainees lack knowledge of PA guidelines, particularly guidelines for adults with SCI. The results further suggest that a single event-based intervention is not effective for improving long-term guideline knowledge. Suggestions are made for future research with the aim of improving interventions that target HCP and HCP trainees' long-term guideline knowledge for adults with SCI and the general population.

  10. The Murray Springs Clovis site, Pleistocene extinction, and the question of extraterrestrial impact

    PubMed Central

    Haynes, C. Vance; Boerner, J.; Domanik, K.; Lauretta, D.; Ballenger, J.; Goreva, J.

    2010-01-01

    Some of the evidence for the recent hypothesis of an extraterrestrial impact that caused late Pleistocene megafaunal extinctions [Firestone et al. (2007) Proc Natl Acad Sci USA 104:16016–16021] was based upon samples collected at Murray Springs, a Clovis archaeological site in southeastern Arizona. Here we describe sampling and analyses of magnetic separates from within, above, and below the lower Younger Dryas boundary (LYDB) black mat at Murray Springs, as well as radiation measurements from the LYDB at Murray Springs and two other well-stratified Clovis sites. The main magnetic fraction at Murray Springs is maghemite. Magnetic microspherules have terrestrial origins but also occur as cosmic dust particles. We failed to find iridium or radiation anomalies. The evidence for massive biomass burning at Murray Springs is addressed and found to be lacking. We could not substantiate some of the claims by Firestone and others, but our findings do not preclude a terminal Pleistocene cosmic event. PMID:20160115

  11. Quantitative Universality for a Class of Weakly Chaotic Systems

    NASA Astrophysics Data System (ADS)

    Venegeroles, Roberto

    2014-02-01

    We consider a general class of intermittent maps designed to be weakly chaotic, i.e., for which the separation of trajectories of nearby initial conditions is weaker than exponential. We show that all its spatio and temporal properties, hitherto regarded independently in the literature, can be represented by a single characteristic function ϕ. A universal criterion for the choice of ϕ is obtained within the Feigenbaum's renormalization-group approach. We find a general expression for the dispersion rate ζ( t) of initially nearby trajectories and we show that the instability scenario for weakly chaotic systems is more general than that originally proposed by Gaspard and Wang (Proc. Natl. Acad. Sci. USA 85:4591, 1988). We also consider a spatially extended version of such class of maps, which leads to anomalous diffusion, and we show that the mean squared displacement satisfies σ 2( t)˜ ζ( t). To illustrate our results, some examples are discussed in detail.

  12. Thermodynamics of information processing based on enzyme kinetics: An exactly solvable model of an information pump

    NASA Astrophysics Data System (ADS)

    Cao, Yuansheng; Gong, Zongping; Quan, H. T.

    2015-06-01

    Motivated by the recent proposed models of the information engine [Proc. Natl. Acad. Sci. USA 109, 11641 (2012), 10.1073/pnas.1204263109] and the information refrigerator [Phys. Rev. Lett. 111, 030602 (2013), 10.1103/PhysRevLett.111.030602], we propose a minimal model of the information pump and the information eraser based on enzyme kinetics. This device can either pump molecules against the chemical potential gradient by consuming the information to be encoded in the bit stream or (partially) erase the information initially encoded in the bit stream by consuming the Gibbs free energy. The dynamics of this model is solved exactly, and the "phase diagram" of the operation regimes is determined. The efficiency and the power of the information machine is analyzed. The validity of the second law of thermodynamics within our model is clarified. Our model offers a simple paradigm for the investigating of the thermodynamics of information processing involving the chemical potential in small systems.

  13. Probing entropic repulsion through mesoscopic simulations

    NASA Astrophysics Data System (ADS)

    Vaiwala, Rakesh; Thaokar, Rochish

    2017-11-01

    Following the publication of Freund's work on entropic pressure (Freund L., Proc. Natl. Acad. Sci. U.S.A., 110 (2013) 2047), which states that the undulation pressure for a biomembrane confined between two parallel rigid walls decays linearly with wall separation (d), different contradictory views on the pressure law evolved; some supporting Helfrich's prediction that the entropic pressure scales as 1/d3 . Attempts were made to resolve this stark contradiction by distinct groups of researchers. In this work, using dissipative particle dynamics simulations it has been shown for the first time that the height fluctuations are suppressed by wall confinement. An analysis of the fluctuation spectrum reveals that the entropic loss manifests as a membrane tension for a membrane that conserves its local area, and this fact is confirmed by the rise in stresses with an increase in wall confinement. Furthermore, we theorize a pressure law, which interestingly is congruous with Freund's prediction that the entropic pressure scales as 1/d .

  14. Cloning, expression and characterization of a mammalian Nudix hydrolase-like enzyme that cleaves the pyrophosphate bond of UDP-glucose.

    PubMed Central

    Yagi, Toshihiro; Baroja-Fernández, Edurne; Yamamoto, Ryuji; Muñoz, Francisco José; Akazawa, Takashi; Hong, Kyoung Su; Pozueta-Romero, Javier

    2003-01-01

    A distinct UDP-glucose (UDPG) pyrophosphatase (UGPPase, EC 3.6.1.45) has been characterized using pig kidney ( Sus scrofa ). This enzyme hydrolyses UDPG, the precursor molecule of numerous glycosylation reactions in animals, to produce glucose 1-phosphate (G1P) and UMP. Sequence analyses of the purified enzyme revealed that, similar to the case of a nucleotide-sugar hydrolase controlling the intracellular levels of ADP-glucose linked to glycogen biosynthesis in Escherichia coli [Moreno-Bruna, Baroja-Fernández, Muñoz, Bastarrica-Berasategui, Zandueta-Criado, Rodri;guez-López, Lasa, Akazawa and Pozueta-Romero (2001) Proc. Natl. Acad. Sci. U.S.A. 98, 8128-8132], UGPPase appears to be a member of the ubiquitously distributed group of nucleotide pyrophosphatases designated Nudix hydrolases. A complete cDNA of the UGPPase-encoding gene, designated UGPP, was isolated from a human thyroid cDNA library and expressed in E. coli. The resulting cells accumulated a protein that showed kinetic properties identical to those of pig UGPPase. PMID:12429023

  15. Cloning, expression and characterization of a mammalian Nudix hydrolase-like enzyme that cleaves the pyrophosphate bond of UDP-glucose.

    PubMed

    Yagi, Toshihiro; Baroja-Fernández, Edurne; Yamamoto, Ryuji; Muñoz, Francisco José; Akazawa, Takashi; Hong, Kyoung Su; Pozueta-Romero, Javier

    2003-03-01

    A distinct UDP-glucose (UDPG) pyrophosphatase (UGPPase, EC 3.6.1.45) has been characterized using pig kidney ( Sus scrofa ). This enzyme hydrolyses UDPG, the precursor molecule of numerous glycosylation reactions in animals, to produce glucose 1-phosphate (G1P) and UMP. Sequence analyses of the purified enzyme revealed that, similar to the case of a nucleotide-sugar hydrolase controlling the intracellular levels of ADP-glucose linked to glycogen biosynthesis in Escherichia coli [Moreno-Bruna, Baroja-Fernández, Muñoz, Bastarrica-Berasategui, Zandueta-Criado, Rodri;guez-López, Lasa, Akazawa and Pozueta-Romero (2001) Proc. Natl. Acad. Sci. U.S.A. 98, 8128-8132], UGPPase appears to be a member of the ubiquitously distributed group of nucleotide pyrophosphatases designated Nudix hydrolases. A complete cDNA of the UGPPase-encoding gene, designated UGPP, was isolated from a human thyroid cDNA library and expressed in E. coli. The resulting cells accumulated a protein that showed kinetic properties identical to those of pig UGPPase.

  16. V79 Chinese-hamster cells rendered resistant to high cadmium concentration also become resistant to oxidative stress.

    PubMed Central

    Mello-Filho, A C; Chubatsu, L S; Meneghini, R

    1988-01-01

    Chinese hamster cells (V79) resistant to high concentrations of Cd2+ in the medium were obtained by using the procedure of Beach & Palmiter [(1981) Proc. Natl. Acad. Sci. U.S.A. 78, 2110-2114], which in mouse led to amplification of metallothionein (MT) genes and to an enrichment in cellular MT. The Cd-resistant V79 clones isolated were significantly more resistant than parental cells to oxidative stress by extracellular H2O2 or a mixture of H2O2 and superoxide anion (O2-) generated by xanthine oxidase plus acetaldehyde. On a per-cell basis, there was no difference between the two cells in their total H2O2-decomposing or O2-(-)dismutating activity. The most likely explanation is that an enrichment in MT content in the Cd-resistant cells was responsible for this effect, because of the antioxidant properties already described for this protein. Images Fig. 2. PMID:2851992

  17. Optimal Bandwidth for High Efficiency Thermoelectrics

    NASA Astrophysics Data System (ADS)

    Zhou, Jun; Yang, Ronggui; Chen, Gang; Dresselhaus, Mildred S.

    2011-11-01

    The thermoelectric figure of merit (ZT) in narrow conduction bands of different material dimensionalities is investigated for different carrier scattering models. When the bandwidth is zero, the transport distribution function (TDF) is finite, not infinite as previously speculated by Mahan and Sofo [Proc. Natl. Acad. Sci. U.S.A. 93, 7436 (1996)PNASA60027-842410.1073/pnas.93.15.7436], even though the carrier density of states goes to infinity. Such a finite TDF results in a zero electrical conductivity and thus a zero ZT. We point out that the optimal ZT cannot be found in an extremely narrow conduction band. The existence of an optimal bandwidth for a maximal ZT depends strongly on the scattering models and the dimensionality of the material. A nonzero optimal bandwidth for maximizing ZT also depends on the lattice thermal conductivity. A larger maximum ZT can be obtained for materials with a smaller lattice thermal conductivity.

  18. Twenty-first century vaccines

    PubMed Central

    Rappuoli, Rino

    2011-01-01

    In the twentieth century, vaccination has been possibly the greatest revolution in health. Together with hygiene and antibiotics, vaccination led to the elimination of many childhood infectious diseases and contributed to the increase in disability-free life expectancy that in Western societies rose from 50 to 78–85 years (Crimmins, E. M. & Finch, C. E. 2006 Proc. Natl Acad. Sci. USA 103, 498–503; Kirkwood, T. B. 2008 Nat. Med 10, 1177–1185). In the twenty-first century, vaccination will be expected to eliminate the remaining childhood infectious diseases, such as meningococcal meningitis, respiratory syncytial virus, group A streptococcus, and will address the health challenges of this century such as those associated with ageing, antibiotic resistance, emerging infectious diseases and poverty. However, for this to happen, we need to increase the public trust in vaccination so that vaccines can be perceived as the best insurance against most diseases across all ages. PMID:21893537

  19. X-ray structural characterization of imidazolylcobalamin and histidinylcobalamin: cobalamin models for aquacobalamin bound to the B12 transporter protein transcobalamin.

    PubMed

    Hannibal, Luciana; Bunge, Scott D; van Eldik, Rudi; Jacobsen, Donald W; Kratky, Christoph; Gruber, Karl; Brasch, Nicola E

    2007-04-30

    The X-ray structures of imidazolylcobalamin (ImCbl) and histidinylcobalamin (HisCbl) are reported. These structures are of interest given that the recent structures of human and bovine transcobalamin prepared in their holo forms from aquacobalamin show a histidine residue of the metalloprotein bound at the beta-axial site of the cobalamin (Wuerges, J. et al. Proc. Natl. Acad. Sci. U.S.A. 2006, 103, 4386-4391). The beta-axial Co-N bond distances for ImCbl and HisCbl are 1.94(1) and 1.951(7) A, respectively. The alpha-axial Co-N bond distances to the 5,6-dimethylbenzimidazole are 2.01(1) and 1.979(8) A for ImCbl and HisCbl, respectively, and are typical for cobalamins with weak sigma-donor ligands at the beta-axial site. The corrin fold angles of 11.8(3) degrees (ImCbl) and 12.0(3) degrees (HisCbl) are smaller than those typically observed for cobalamins.

  20. An algorithm for modularization of MAPK and calcium signaling pathways: comparative analysis among different species.

    PubMed

    Nayak, Losiana; De, Rajat K

    2007-12-01

    Signaling pathways are large complex biochemical networks. It is difficult to analyze the underlying mechanism of such networks as a whole. In the present article, we have proposed an algorithm for modularization of signal transduction pathways. Unlike studying a signaling pathway as a whole, this enables one to study the individual modules (less complex smaller units) easily and hence to study the entire pathway better. A comparative study of modules belonging to different species (for the same signaling pathway) has been made, which gives an overall idea about development of the signaling pathways over the taken set of species of calcium and MAPK signaling pathways. The superior performance, in terms of biological significance, of the proposed algorithm over an existing community finding algorithm of Newman [Newman MEJ. Modularity and community structure in networks. Proc Natl Acad Sci USA 2006;103(23):8577-82] has been demonstrated using the aforesaid pathways of H. sapiens.

  1. Large-scale Individual-based Models of Pandemic Influenza Mitigation Strategies

    NASA Astrophysics Data System (ADS)

    Kadau, Kai; Germann, Timothy; Longini, Ira; Macken, Catherine

    2007-03-01

    We have developed a large-scale stochastic simulation model to investigate the spread of a pandemic strain of influenza virus through the U.S. population of 281 million people, to assess the likely effectiveness of various potential intervention strategies including antiviral agents, vaccines, and modified social mobility (including school closure and travel restrictions) [1]. The heterogeneous population structure and mobility is based on available Census and Department of Transportation data where available. Our simulations demonstrate that, in a highly mobile population, restricting travel after an outbreak is detected is likely to delay slightly the time course of the outbreak without impacting the eventual number ill. For large basic reproductive numbers R0, we predict that multiple strategies in combination (involving both social and medical interventions) will be required to achieve a substantial reduction in illness rates. [1] T. C. Germann, K. Kadau, I. M. Longini, and C. A. Macken, Proc. Natl. Acad. Sci. (USA) 103, 5935-5940 (2006).

  2. Exact Solution of a Two-Species Quantum Dimer Model for Pseudogap Metals

    NASA Astrophysics Data System (ADS)

    Feldmeier, Johannes; Huber, Sebastian; Punk, Matthias

    2018-05-01

    We present an exact ground state solution of a quantum dimer model introduced by Punk, Allais, and Sachdev [Quantum dimer model for the pseudogap metal, Proc. Natl. Acad. Sci. U.S.A. 112, 9552 (2015)., 10.1073/pnas.1512206112], which features ordinary bosonic spin-singlet dimers as well as fermionic dimers that can be viewed as bound states of spinons and holons in a hole-doped resonating valence bond liquid. Interestingly, this model captures several essential properties of the metallic pseudogap phase in high-Tc cuprate superconductors. We identify a line in parameter space where the exact ground state wave functions can be constructed at an arbitrary density of fermionic dimers. At this exactly solvable line the ground state has a huge degeneracy, which can be interpreted as a flat band of fermionic excitations. Perturbing around the exactly solvable line, this degeneracy is lifted and the ground state is a fractionalized Fermi liquid with a small pocket Fermi surface in the low doping limit.

  3. Buckling, stiffening, and negative dissipation in the dynamics of a biopolymer in an active medium

    PubMed Central

    Kikuchi, Norio; Ehrlicher, Allen; Koch, Daniel; Käs, Josef A.; Ramaswamy, Sriram; Rao, Madan

    2009-01-01

    We present a generic theory for the dynamics of a stiff filament under tension, in an active medium with orientational correlations, such as a microtubule in contractile actin. In sharp contrast to the case of a passive medium, we find the filament can stiffen, and possibly oscillate or buckle, depending on both the contractile or tensile nature of the activity and the filament-medium anchoring interaction. We also demonstrate a strong violation of the fluctuation–dissipation (FD) relation in the effective dynamics of the filament, including a negative FD ratio. Our approach is also of relevance to the dynamics of axons, and our model equations bear a remarkable formal similarity to those in recent work [Martin P, Hudspeth AJ, Juelicher F (2001) Proc Natl Acad Sci USA 98:14380–14385] on auditory hair cells. Detailed tests of our predictions can be made by using a single filament in actomyosin extracts or bacterial suspensions. PMID:19901332

  4. Alternative Electron-Transfer Channels Ensure Ultrafast Deactivation of Light-Induced Excited States in Riboflavin Binding Protein.

    PubMed

    Zanetti-Polzi, Laura; Aschi, Massimiliano; Amadei, Andrea; Daidone, Isabella

    2017-07-20

    Flavoproteins, containing flavin chromophores, are enzymes capable of transferring electrons at very high speeds. The ultrafast photoinduced electron-transfer (ET) kinetics of riboflavin binding protein to the excited riboflavin was studied by femtosecond spectroscopy and found to occur within a few hundred femtoseconds [ Zhong and Zewail, Proc. Natl. Acad. Sci. U.S.A. 2001, 98, 11867-11872 ]. This ultrafast kinetics was attributed to the presence of two aromatic rings that could transfer the electron to riboflavin: the side chains of tryptophan 156 and tyrosine 75. However, the underlying ET mechanism remained unclear. Here, using a hybrid quantum mechanical-molecular dynamics approach, we perform ET dynamics simulations taking into account the motion of the protein and the solvent upon ET. This approach reveals that ET occurs via a major reaction channel involving tyrosine 75 (83%) and a minor one involving tryptophan 156 (17%). We also show that the protein environment is designed to ensure the fast quenching of the riboflavin excited state.

  5. Dynamic fluctuation of proteins watched in real time

    PubMed Central

    Ormos, Pál

    2008-01-01

    The dynamic nature of protein function is a fundamental concept in the physics of proteins. Although the basic general ideas are well accepted most experimental evidence has an indirect nature. The detailed characterization of the dynamics is necessary for the understanding in detail. The dynamic fluctuations thought crucial for the function span an extremely broad time, starting from the picosecond regime. Recently, a few new experimental techniques emerged that permit the observation of dynamical phenomena directly. Notably, pulsed infrared (IR) spectroscopy has been applied with great success to observe structural changes with picosecond time resolution. Using two-dimensional-IR vibrational echo chemical exchange spectroscopy Ishikawa and co-workers [Ishikawa et al. (2008), Proc. Natl. Acad. Sci. U.S.A. 101, 14402–14407] managed to observe the transition between well defined conformational substrates of carbonmonoxy myoglobin directly. This is an important step in improving our insight into the details of protein function. PMID:19436491

  6. The Murray Springs Clovis site, Pleistocene extinction, and the question of extraterrestrial impact.

    PubMed

    Haynes, C Vance; Boerner, J; Domanik, K; Lauretta, D; Ballenger, J; Goreva, J

    2010-03-02

    Some of the evidence for the recent hypothesis of an extraterrestrial impact that caused late Pleistocene megafaunal extinctions [Firestone et al. (2007) Proc Natl Acad Sci USA 104:16016-16021] was based upon samples collected at Murray Springs, a Clovis archaeological site in southeastern Arizona. Here we describe sampling and analyses of magnetic separates from within, above, and below the lower Younger Dryas boundary (LYDB) black mat at Murray Springs, as well as radiation measurements from the LYDB at Murray Springs and two other well-stratified Clovis sites. The main magnetic fraction at Murray Springs is maghemite. Magnetic microspherules have terrestrial origins but also occur as cosmic dust particles. We failed to find iridium or radiation anomalies. The evidence for massive biomass burning at Murray Springs is addressed and found to be lacking. We could not substantiate some of the claims by Firestone and others, but our findings do not preclude a terminal Pleistocene cosmic event.

  7. Secondary structure and phylogeny of Staphylococcus and Micrococcus 5S rRNAs.

    PubMed Central

    Dekio, S; Yamasaki, R; Jidoi, J; Hori, H; Osawa, S

    1984-01-01

    Nucleotide sequences of 5S rRNAs from four bacteria, Staphylococcus aureus Smith (diffuse), Staphylococcus epidermidis ATCC 14990, Micrococcus luteus ATCC 9341 and Micrococcus luteus ATCC 4698, were determined. The secondary structural models of S. aureus and S. epidermidis sequences showed characteristics of the gram-positive bacterial 5S rRNA (116-N type [H. Hori and S. Osawa, Proc. Natl. Acad. Sci. U.S.A. 76:381-385, 1979]). Those of M. luteus ATCC 9341 and M. luteus ATCC 4698 together with that of Streptomyces griseus (A. Simoncsits, Nucleic Acids Res. 8:4111-4124, 1980) showed intermediary characteristics between the gram-positive and gram-negative (120-N type [H. Hori and S. Osawa, 1979]) 5S rRNAs. This and previous studies revealed that there exist at least three major groups of eubacteria having distinct 5S rRNA and belonging to different stems in the 5S rRNA phylogenic tree. PMID:6735981

  8. Ranking Business and Economics Journals in South America Using the Scientific Electronic Library Online (SciELO)

    ERIC Educational Resources Information Center

    Alexander, Jennifer K.; Pradenas, Lorena; Parada, Victor; Scherer, Robert F.

    2012-01-01

    Access to published research for knowledge creation and education in the administrative science disciplines in South America has been enhanced since the introduction of the Scientific Electronic Library Online (SciELO). Although SciELO has been available as an online journal indexing and publication service since 1998, there have been no…

  9. [Analysis of the citation of the articles published in National Journal of Andrology by SCI periodicals from 2002 to 2008].

    PubMed

    Huang, Hai

    2009-03-01

    Science Citation Index (SCI) is one of the world's most important and influential information retrieval systems. Today Web of Science covers over 9000 international and regional journals and book series in every field of natural sciences, social sciences, and arts and humanities. More and more Chinese periodicals have been cited by SCI. This paper briefly introduces the SCI database and its selection process and analyzes the citation of the articles published in National Journal of Andrology (NJA) by SCI journals from 2002 to 2008, aiming to provide some information for the internationalization of NJA.

  10. Simultaneous Monitoring of Vascular Oxygenation and Tissue Oxygen Tension of Breast Tumors Under Hyperbaric Oxygen Exposure

    DTIC Science & Technology

    2008-04-01

    28. Alagoz, T., R. Buller, B. Anderson, K. Terrell , R...and oxygenation Ann . New Acad. Sci. 838 29–45 Chapman J D, Stobbe C C, Arnfield M R, Santus R, Lee J and McPhee M S 1991 Oxygen dependency of tumor

  11. A faster and more reliable data acquisition system for the full performance of the SciCRT

    DOE PAGES

    Sasai, Y.; Matsubara, Y.; Itow, Y.; ...

    2017-01-03

    The SciBar Cosmic Ray Telescope (SciCRT) is a massive scintillator tracker to observe cosmic rays at a very high-altitude environment in Mexico. The fully active tracker is based on the Scintillator Bar (SciBar) detector developed as a near detector for the KEK-to-Kamioka long-baseline neutrino oscillation experiment (K2K) in Japan. Since the data acquisition (DAQ) system was developed for the accelerator experiment, we determined to develop a new robust DAQ system to optimize it to our cosmic-ray experiment needs at the top of Mt. Sierra Negra (4600 m). One of our special requirements is to achieve a 10 times faster readoutmore » rate. We started to develop a new fast readout back-end board (BEB) based on 100 Mbps SiTCP, a hardware network processor developed for DAQ systems for high energy physics experiments. Then we developed the new BEB which has a potential of 20 times faster than the current one in the case of observing neutrons. Lastly, we installed the new DAQ system including the new BEBs to a part of the SciCRT in July 2015. The system has been operating since then. In this article, we describe the development, the basic performance of the new BEB, the status after the installation in the SciCRT, and the future performance.« less

  12. Assembling Large, Multi-Sensor Climate Datasets Using the SciFlo Grid Workflow System

    NASA Astrophysics Data System (ADS)

    Wilson, B. D.; Manipon, G.; Xing, Z.; Fetzer, E.

    2008-12-01

    NASA's Earth Observing System (EOS) is the world's most ambitious facility for studying global climate change. The mandate now is to combine measurements from the instruments on the A-Train platforms (AIRS, AMSR-E, MODIS, MISR, MLS, and CloudSat) and other Earth probes to enable large-scale studies of climate change over periods of years to decades. However, moving from predominantly single-instrument studies to a multi-sensor, measurement-based model for long-duration analysis of important climate variables presents serious challenges for large-scale data mining and data fusion. For example, one might want to compare temperature and water vapor retrievals from one instrument (AIRS) to another instrument (MODIS), and to a model (ECMWF), stratify the comparisons using a classification of the cloud scenes from CloudSat, and repeat the entire analysis over years of AIRS data. To perform such an analysis, one must discover & access multiple datasets from remote sites, find the space/time matchups between instruments swaths and model grids, understand the quality flags and uncertainties for retrieved physical variables, and assemble merged datasets for further scientific and statistical analysis. To meet these large-scale challenges, we are utilizing a Grid computing and dataflow framework, named SciFlo, in which we are deploying a set of versatile and reusable operators for data query, access, subsetting, co-registration, mining, fusion, and advanced statistical analysis. SciFlo is a semantically-enabled ("smart") Grid Workflow system that ties together a peer-to-peer network of computers into an efficient engine for distributed computation. The SciFlo workflow engine enables scientists to do multi-instrument Earth Science by assembling remotely-invokable Web Services (SOAP or http GET URLs), native executables, command-line scripts, and Python codes into a distributed computing flow. A scientist visually authors the graph of operation in the VizFlow GUI, or uses a

  13. Assembling Large, Multi-Sensor Climate Datasets Using the SciFlo Grid Workflow System

    NASA Astrophysics Data System (ADS)

    Wilson, B.; Manipon, G.; Xing, Z.; Fetzer, E.

    2009-04-01

    NASA's Earth Observing System (EOS) is an ambitious facility for studying global climate change. The mandate now is to combine measurements from the instruments on the "A-Train" platforms (AIRS, AMSR-E, MODIS, MISR, MLS, and CloudSat) and other Earth probes to enable large-scale studies of climate change over periods of years to decades. However, moving from predominantly single-instrument studies to a multi-sensor, measurement-based model for long-duration analysis of important climate variables presents serious challenges for large-scale data mining and data fusion. For example, one might want to compare temperature and water vapor retrievals from one instrument (AIRS) to another instrument (MODIS), and to a model (ECMWF), stratify the comparisons using a classification of the "cloud scenes" from CloudSat, and repeat the entire analysis over years of AIRS data. To perform such an analysis, one must discover & access multiple datasets from remote sites, find the space/time "matchups" between instruments swaths and model grids, understand the quality flags and uncertainties for retrieved physical variables, assemble merged datasets, and compute fused products for further scientific and statistical analysis. To meet these large-scale challenges, we are utilizing a Grid computing and dataflow framework, named SciFlo, in which we are deploying a set of versatile and reusable operators for data query, access, subsetting, co-registration, mining, fusion, and advanced statistical analysis. SciFlo is a semantically-enabled ("smart") Grid Workflow system that ties together a peer-to-peer network of computers into an efficient engine for distributed computation. The SciFlo workflow engine enables scientists to do multi-instrument Earth Science by assembling remotely-invokable Web Services (SOAP or http GET URLs), native executables, command-line scripts, and Python codes into a distributed computing flow. A scientist visually authors the graph of operation in the Viz

  14. Sense from Senses. Study Guide. Unit J. ZIM-SCI, Zimbabwe Secondary School Science Project. Year 2.

    ERIC Educational Resources Information Center

    Simango, Sam

    The Zimbabwe Secondary School Science Project (ZIM-SCI) developed student study guides, corresponding teaching guides, and science kits for a low-cost science course which could be taught during the first 2 years of secondary school without the aid of qualified teachers and conventional laboratories. This ZIM-SCI study guide presents activities…

  15. Understanding Electricity. Study Guide. Unit I1. ZIM-SCI, Zimbabwe Secondary School Science Project. Year 2.

    ERIC Educational Resources Information Center

    Chidume, Kwashira

    The Zimbabwe Secondary School Science Project (ZIM-SCI) developed student study guides, corresponding teaching guides, and science kits for a low-cost science course which could be taught during the first 2 years of secondary school without the aid of qualified teachers and conventional laboratories. This ZIM-SCI study guide presents activities…

  16. Using Electricity. Study Guide. Unit I2. ZIM-SCI, Zimbabwe Secondary School Science Project. Year 2.

    ERIC Educational Resources Information Center

    Chidume, Kwashira

    The Zimbabwe Secondary School Science Project (ZIM-SCI) developed student study guides, corresponding teaching guides, and science kits for a low-cost science course which could be taught during the first 2 years of secondary school without the aid of qualified teachers and conventional laboratories. This ZIM-SCI study guide presents activities…

  17. Measuring depression after spinal cord injury: Development and psychometric characteristics of the SCI-QOL Depression item bank and linkage with PHQ-9.

    PubMed

    Tulsky, David S; Kisala, Pamela A; Kalpakjian, Claire Z; Bombardier, Charles H; Pohlig, Ryan T; Heinemann, Allen W; Carle, Adam; Choi, Seung W

    2015-05-01

    To develop a calibrated spinal cord injury-quality of life (SCI-QOL) item bank, computer adaptive test (CAT), and short form to assess depressive symptoms experienced by individuals with SCI, transform scores to the Patient Reported Outcomes Measurement Information System (PROMIS) metric, and create a crosswalk to the Patient Health Questionnaire (PHQ)-9. We used grounded-theory based qualitative item development methods, large-scale item calibration field testing, confirmatory factor analysis, item response theory (IRT) analyses, and statistical linking techniques to transform scores to a PROMIS metric and to provide a crosswalk with the PHQ-9. Five SCI Model System centers and one Department of Veterans Affairs medical center in the United States. Adults with traumatic SCI. Spinal Cord Injury--Quality of Life (SCI-QOL) Depression Item Bank Individuals with SCI were involved in all phases of SCI-QOL development. A sample of 716 individuals with traumatic SCI completed 35 items assessing depression, 18 of which were PROMIS items. After removing 7 non-PROMIS items, factor analyses confirmed a unidimensional pool of items. We used a graded response IRT model to estimate slopes and thresholds for the 28 retained items. The SCI-QOL Depression measure correlated 0.76 with the PHQ-9. The SCI-QOL Depression item bank provides a reliable and sensitive measure of depressive symptoms with scores reported in terms of general population norms. We provide a crosswalk to the PHQ-9 to facilitate comparisons between measures. The item bank may be administered as a CAT or as a short form and is suitable for research and clinical applications.

  18. Life, Beginning and Growing. Study Guide. Unit E1. ZIM-SCI, Zimbabwe Secondary School Science Project.

    ERIC Educational Resources Information Center

    Hosking, Bunty

    The Zimbabwe Secondary School Science Project (ZIM-SCI) developed student study guides, corresponding teaching guides, and science kits for a low-cost science course which could be taught during the first 2 years of secondary school without the aid of qualified teachers and conventional laboratories. This ZIM-SCI study guide is a three-part unit…

  19. Atoms and Molecules. Study Guide. Unit 2. ZIM-SCI, Zimbabwe Secondary School Science Project. Year 3.

    ERIC Educational Resources Information Center

    Mandizha, George

    The Zimbabwe Secondary School Science Project (ZIM-SCI) developed student study guides, corresponding teaching guides, and science kits for a low-cost science course which could be taught during the third year of secondary school without the aid of qualified teachers and conventional laboratories. This ZIM-SCI study guide is a four-part unit…

  20. Forces. 'O' Level Study Guide. Unit 1. ZIM-SCI, Zimbabwe Secondary School Science Project. Year 3.

    ERIC Educational Resources Information Center

    Udwin, Martin

    The Zimbabwe Secondary School Science Project (ZIM-SCI) developed student study guides, corresponding teaching guides, and science kits for a low-cost science course which could be taught during the third year of secondary school without the aid of qualified teachers and conventional laboratories. This ZIM-SCI study guide is a five-part unit…

  1. SciSpark: Highly Interactive and Scalable Model Evaluation and Climate Metrics

    NASA Astrophysics Data System (ADS)

    Wilson, B. D.; Mattmann, C. A.; Waliser, D. E.; Kim, J.; Loikith, P.; Lee, H.; McGibbney, L. J.; Whitehall, K. D.

    2014-12-01

    Remote sensing data and climate model output are multi-dimensional arrays of massive sizes locked away in heterogeneous file formats (HDF5/4, NetCDF 3/4) and metadata models (HDF-EOS, CF) making it difficult to perform multi-stage, iterative science processing since each stage requires writing and reading data to and from disk. We are developing a lightning fast Big Data technology called SciSpark based on ApacheTM Spark. Spark implements the map-reduce paradigm for parallel computing on a cluster, but emphasizes in-memory computation, "spilling" to disk only as needed, and so outperforms the disk-based ApacheTM Hadoop by 100x in memory and by 10x on disk, and makes iterative algorithms feasible. SciSpark will enable scalable model evaluation by executing large-scale comparisons of A-Train satellite observations to model grids on a cluster of 100 to 1000 compute nodes. This 2nd generation capability for NASA's Regional Climate Model Evaluation System (RCMES) will compute simple climate metrics at interactive speeds, and extend to quite sophisticated iterative algorithms such as machine-learning (ML) based clustering of temperature PDFs, and even graph-based algorithms for searching for Mesocale Convective Complexes. The goals of SciSpark are to: (1) Decrease the time to compute comparison statistics and plots from minutes to seconds; (2) Allow for interactive exploration of time-series properties over seasons and years; (3) Decrease the time for satellite data ingestion into RCMES to hours; (4) Allow for Level-2 comparisons with higher-order statistics or PDF's in minutes to hours; and (5) Move RCMES into a near real time decision-making platform. We will report on: the architecture and design of SciSpark, our efforts to integrate climate science algorithms in Python and Scala, parallel ingest and partitioning (sharding) of A-Train satellite observations from HDF files and model grids from netCDF files, first parallel runs to compute comparison statistics and PDF

  2. SciNews: Incorporating Science Current Events in 21st Century Classrooms

    NASA Astrophysics Data System (ADS)

    DiMaggio, E.

    2011-12-01

    Middle school students are instructed with the aid of textbooks, lectures, and activities to teach topics that satisfy state standards. However, teaching materials created to convey standard-aligned science concepts often leave students asking how the content relates to their lives and why they should be learning it. Conveying relevance is important for student learning and retention, especially in science where abstract concepts can often be incorrectly perceived as irrelevant. One way to create an educational link between classroom content and everyday life is through the use of scientific current events. Students read, hear, and watch media coverage of natural events (such as the 2011 earthquake and tsunami in Japan), but do not necessarily relate the scientific information from media sources to classroom studies. Taking advantage of these brief 'teachable moments'--when student interest is high--provides a valuable opportunity to make classroom-to-everyday life associations and to incorporate inquiry based learning. To address this need, I create pre-packaged current event materials for middle to high school teachers that align to state standards, and which are short, effective, and easy to implement in the classroom. Each lesson takes approximately 15-30 minutes to implement, allowing teachers time to facilitate brief but meaningful discussions. I assemble materials within approximately one week of the regional or global science event, consisting of short slide shows, maps, videos, pictures, and real-time data. I use a listserv to send biweekly emails to subscribed instructors containing the current event topic and a link to download the materials. All materials are hosted on the Arizona State University Education Outreach SciNews website (http://sese.asu.edu/teacher-resources) and are archived. Currently, 285 educators subscribe to the SciNews listserv, representing 36 states and 19 countries. In order to assess the effectiveness and usefulness of Sci

  3. SciDAC Center for Gyrokinetic Particle Simulation of Turbulent Transport in Burning Plasmas

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lin, Zhihong

    2013-12-18

    During the first year of the SciDAC gyrokinetic particle simulation (GPS) project, the GPS team (Zhihong Lin, Liu Chen, Yasutaro Nishimura, and Igor Holod) at the University of California, Irvine (UCI) studied the tokamak electron transport driven by electron temperature gradient (ETG) turbulence, and by trapped electron mode (TEM) turbulence and ion temperature gradient (ITG) turbulence with kinetic electron effects, extended our studies of ITG turbulence spreading to core-edge coupling. We have developed and optimized an elliptic solver using finite element method (FEM), which enables the implementation of advanced kinetic electron models (split-weight scheme and hybrid model) in the SciDACmore » GPS production code GTC. The GTC code has been ported and optimized on both scalar and vector parallel computer architectures, and is being transformed into objected-oriented style to facilitate collaborative code development. During this period, the UCI team members presented 11 invited talks at major national and international conferences, published 22 papers in peer-reviewed journals and 10 papers in conference proceedings. The UCI hosted the annual SciDAC Workshop on Plasma Turbulence sponsored by the GPS Center, 2005-2007. The workshop was attended by about fifties US and foreign researchers and financially sponsored several gradual students from MIT, Princeton University, Germany, Switzerland, and Finland. A new SciDAC postdoc, Igor Holod, has arrived at UCI to initiate global particle simulation of magnetohydrodynamics turbulence driven by energetic particle modes. The PI, Z. Lin, has been promoted to the Associate Professor with tenure at UCI.« less

  4. A cable-driven locomotor training system for restoration of gait in human SCI.

    PubMed

    Wu, Ming; Hornby, T George; Landry, Jill M; Roth, Heidi; Schmit, Brian D

    2011-02-01

    A novel cable-driven robotic locomotor training system was developed to provide compliant assistance/resistance forces to the legs during treadmill training in patients with incomplete spinal cord injury (SCI). Eleven subjects with incomplete SCI were recruited to participate in two experiments to test the feasibility of the robotic gait training system. Specifically, 10 subjects participated in one experimental session to test the characteristics of the robotic gait training system and one subject participated in repeated testing sessions over 8 weeks with the robotic device to test improvements in locomotor function. Limb kinematics were recorded in one experiment to evaluate the system characteristics of the cable-driven locomotor trainer and the overground gait speed and 6 min walking distance were evaluated at pre, 4 and 8 weeks post treadmill training of a single subject as well. The results indicated that the cable driven robotic gait training system improved the kinematic performance of the leg during treadmill walking and had no significant impact on the variability of lower leg trajectory, suggesting a high backdrivability of the cable system. In addition, results from a patient with incomplete SCI indicated that prolonged robotic gait training using the cable robot improved overground gait speed. Results from this study suggested that a cable driven robotic gait training system is effective in improving leg kinematic performance, yet allows variability of gait kinematics. Thus, it seems feasible to improve the locomotor function in human SCI using this cable driven robotic system, warranting testing with a larger group of patients. Copyright © 2010 Elsevier B.V. All rights reserved.

  5. Measuring anxiety after spinal cord injury: Development and psychometric characteristics of the SCI-QOL Anxiety item bank and linkage with GAD-7.

    PubMed

    Kisala, Pamela A; Tulsky, David S; Kalpakjian, Claire Z; Heinemann, Allen W; Pohlig, Ryan T; Carle, Adam; Choi, Seung W

    2015-05-01

    To develop a calibrated item bank and computer adaptive test to assess anxiety symptoms in individuals with spinal cord injury (SCI), transform scores to the Patient Reported Outcomes Measurement Information System (PROMIS) metric, and create a statistical linkage with the Generalized Anxiety Disorder (GAD)-7, a widely used anxiety measure. Grounded-theory based qualitative item development methods; large-scale item calibration field testing; confirmatory factor analysis; graded response model item response theory analyses; statistical linking techniques to transform scores to a PROMIS metric; and linkage with the GAD-7. Setting Five SCI Model System centers and one Department of Veterans Affairs medical center in the United States. Participants Adults with traumatic SCI. Spinal Cord Injury-Quality of Life (SCI-QOL) Anxiety Item Bank Seven hundred sixteen individuals with traumatic SCI completed 38 items assessing anxiety, 17 of which were PROMIS items. After 13 items (including 2 PROMIS items) were removed, factor analyses confirmed unidimensionality. Item response theory analyses were used to estimate slopes and thresholds for the final 25 items (15 from PROMIS). The observed Pearson correlation between the SCI-QOL Anxiety and GAD-7 scores was 0.67. The SCI-QOL Anxiety item bank demonstrates excellent psychometric properties and is available as a computer adaptive test or short form for research and clinical applications. SCI-QOL Anxiety scores have been transformed to the PROMIS metric and we provide a method to link SCI-QOL Anxiety scores with those of the GAD-7.

  6. Does spirituality facilitate adjustment and resilience among individuals and families after SCI?

    PubMed

    Jones, Kate; Simpson, Grahame Kenneth; Briggs, Lynne; Dorsett, Pat

    2016-01-01

    The purpose of this scoping review was to investigate the role of spirituality in facilitating adjustment and resilience after spinal cord injury (SCI) for the individual with SCI and their family members. METHOD-DATA SOURCES: Peer reviewed journals were identified using PsychInfo, MEDLINE, CINAHL, Embase and Sociological Abstracts search engines. After duplicates were removed, 434 abstracts were screened applying inclusion and exclusion criteria. The selected 28 studies were reviewed in detail and grouped according to methodological approach. Of the 28 studies relating to spirituality and related meaning-making constructs, 26 addressed the adjustment of the individual with SCI alone. Only two included family members as participants. Quantitative studies demonstrated that spirituality was positively associated with life satisfaction, quality of life, mental health and resilience. The utilisation of meaning-making and hope as coping strategies in the process of adjustment were highlighted within the qualitative studies. Clinical implications included recommendations that spirituality and meaning-making be incorporated in assessment and interventions during rehabilitation. The use of narratives and peer support was also suggested. Spirituality is an important factor in adjustment after SCI. Further research into the relationship between spirituality, family adjustment and resilience is needed. Higher levels of spirituality were associated with improved quality of life, life satisfaction, mental health, and resilience for individuals affected by spinal cord injury. Health professionals can enhance the role that spirituality plays in spinal rehabilitation by incorporating the spiritual beliefs of individuals and their family members into assessment and intervention. By drawing upon meaning-making tools, such as narrative therapy, incorporating peer support, and assisting clients who report a decline in spirituality, health professionals can provide additional support

  7. SCY-635, a Novel Nonimmunosuppressive Analog of Cyclosporine That Exhibits Potent Inhibition of Hepatitis C Virus RNA Replication In Vitro ▿ †

    PubMed Central

    Hopkins, Sam; Scorneaux, Bernard; Huang, Zhuhui; Murray, Michael G.; Wring, Stephen; Smitley, Craig; Harris, Richard; Erdmann, Frank; Fischer, Gunter; Ribeill, Yves

    2010-01-01

    SCY-635 is a novel nonimmunosuppressive cyclosporine-based analog that exhibits potent suppression of hepatitis C virus (HCV) replication in vitro. SCY-635 inhibited the peptidyl prolyl isomerase activity of cyclophilin A at nanomolar concentrations but showed no detectable inhibition of calcineurin phosphatase activity at concentrations up to 2 μM. Metabolic studies indicated that SCY-635 did not induce the major cytochrome P450 enzymes 1A2, 2B6, and 3A4. SCY-635 was a weak inhibitor and a poor substrate for P-glycoprotein. Functional assays with stimulated Jurkat cells and stimulated human peripheral blood mononuclear cells indicated that SCY-635 is a weaker inhibitor of interleukin-2 secretion than cyclosporine. A series of two-drug combination studies was performed in vitro. SCY-635 exhibited synergistic antiviral activity with alpha interferon 2b and additive antiviral activity with ribavirin. SCY-635 was shown to be orally bioavailable in multiple animal species and produced blood and liver concentrations of parent drug that exceeded the 50% effective dose determined in the bicistronic con1b-derived replicon assay. These results suggest that SCY-635 warrants further investigation as a novel therapeutic agent for the treatment of individuals who are chronically infected with HCV. PMID:19933795

  8. OCCURRENCE AND ORIENTATION OF PARALICHTHID FLOUNDERS (BOTHIDAE: PARALICHTYS) ON AN INTERTIDAL BEACH

    EPA Science Inventory

    Middaugh, Douglas P. and Charles L. McKenney, Jr. 2003. Occurrence and Orientation of Flounders (Bothidae: Paralichthys) on an Intertidal Beach. J. North Carol. Acad. Sci. 119(4):157-171. (ERL,GB 1172).

    The intertidal movement and burying pattern of paralichthid flounders...

  9. Vaccination of High-Risk Breast Cancer Patients with Carbohydrate Mimicking Peptides

    DTIC Science & Technology

    2007-05-01

    and Wheat germ Agglutin (WGA) while mimotope 106 only reacts with WGA. These lectins see terminal monosaccharides . To demonstrate that autoimmunity...Westerink MAJ, Giardina PC, Apicella MA, Kieber-Emmons T. Pep- tide mimicry of the meningococcal group C capsular polysaccharide . Proc Natl Acad Sci

  10. Local delivery of FTY720 in PCL membrane improves SCI functional recovery by reducing reactive astrogliosis.

    PubMed

    Wang, Junjuan; Wang, Jiaqiu; Lu, Ping; Cai, Youzhi; Wang, Yafei; Hong, Lan; Ren, Hao; Heng, Boon Chin; Liu, Hua; Zhou, Jing; Ouyang, Hongwei

    2015-09-01

    FTY720 has recently been approved as an oral drug for treating relapsing forms of multiple sclerosis, and exerts its therapeutic effect by acting as an immunological inhibitor targeting the sphingosine-1-phosphate (S1P) receptor subtype (S1P1) of T cells. Recently studies demonstrated positive efficacy of this drug on spinal cord injury (SCI) in animal models after systemic administration, albeit with significant adverse side effects. We hereby hypothesize that localized delivery of FTY720 can promote SCI recovery by reducing pathological astrogliosis. The mechanistic functions of FTY720 were investigated in vitro and in vivo utilizing immunofluorescence, histology, MRI and behavioral analysis. The in vitro study showed that FTY720 can reduce astrocyte migration and proliferation activated by S1P. FTY720 can prolong internalization of S1P1 and exert antagonistic effects on S1P1. In vivo study of SCI animal models demonstrated that local delivery of FTY720 with polycaprolactone (PCL) membrane significantly decreased S1P1 expression and glial scarring compared with the control group. Furthermore, FTY720-treated groups exhibited less cavitation volume and neuron loss, which significantly improved recovery of motor function. These findings demonstrated that localized delivery of FTY720 can promote SCI recovery by targeting the S1P1 receptor of astrocytes, provide a new therapeutic strategy for SCI treatment. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. Impact of Health Behaviors and Health Management on Employment After SCI: Psychological Health and Health Management.

    PubMed

    Reed, Karla S; Meade, Michelle A; Krause, James S

    2016-01-01

    Objective: The purpose of this study was to examine the relationship between employment and psychological health and health management as described by individuals with spinal cord injury (SCI) who were employed at least once following injury. Methods: A qualitative approach used 6 focus groups at 2 sites with 44 participants who were at least 10 years post SCI. All had been employed at some point since injury. Heterogeneous and homogeneous groups were delineated based on specific characteristics, such as education, gender, or race. Group sessions followed a semi-structured interview format with questions about personal, environmental, and policy related factors influencing employment following SCI. All group sessions were recorded, transcribed, and coded into conceptual categories to identify topics, themes, and patterns. Inferences were drawn about their meaning. NVivo 10 software using the constant comparative method was used for data analysis. Results: Narratives discussed the relationship between employment and psychological and emotional health and health management. Four themes were identified: (1) adjustment and dealing with emotional reactions, (2) gaining self-confidence, (3) preventing burnout, and (4) attitudes and perspectives. Most themes reflected issues that varied based on severity of injury as well as stage of employment. Conclusions: Individuals with SCI who are successful in working following injury must determine how to perform the behaviors necessary to manage their health and prevent emotional or physical complications. The emotional consequences of SCI must be recognized and addressed and specific behaviors enacted in order to optimize employment outcomes.

  12. Regulation of nitrite resistance of the cytochrome cbb3 oxidase by cytochrome c ScyA in Shewanella oneidensis

    PubMed Central

    Yin, Jianhua; Jin, Miao; Zhang, Haiyan; Ju, Lili; Zhang, Lili; Gao, Haichun

    2015-01-01

    Cytochrome c proteins, as enzymes to exchange electrons with substrates or as pure electron carriers to shuttle electrons, play vital roles in bacterial respiration and photosynthesis. In Shewanella oneidensis, a research model for the respiratory diversity, at least 42 c-type cytochromes are predicted to be encoded in the genome and are regarded to be the foundation of its highly branched electron transport pathways. However, only a small number of c-type cytochromes have been extensively studied. In this study, we identify soluble cytochrome c ScyA as an important factor influencing the nitrite resistance of a strain devoid of the bd oxidase by utilizing a newly developed transposon mutagenesis vector, which enables overexpression of the gene(s) downstream of the insertion site. We show that when in overabundance ScyA facilitates growth against nitrite inhibition by enhancing nitrite resistance of the cbb3 oxidase. Based on the data presented in this study, we suggest two possible mechanisms underlying the observed effect of ScyA: (1) ScyA increases electron flow to the cbb3 oxidase; (2) ScyA promotes nitrite resistance of the cbb3 oxidase, possibly by direct interaction. PMID:25417822

  13. 1H, 15N, and 13C resonance assignments of the third domain from the S. aureus innate immune evasion protein Eap.

    PubMed

    Herrera, Alvaro I; Ploscariu, Nicoleta T; Geisbrecht, Brian V; Prakash, Om

    2018-04-01

    Staphylococcus aureus is a widespread and persistent pathogen of humans and livestock. The bacterium expresses a wide variety of virulence proteins, many of which serve to disrupt the host's innate immune system from recognizing and clearing bacteria with optimal efficiency. The extracellular adherence protein (Eap) is a multidomain protein that participates in various protein-protein interactions that inhibit the innate immune response, including both the complement system (Woehl et al in J Immunol 193:6161-6171, 2014) and Neutrophil Serine Proteases (NSPs) (Stapels et al in Proc Natl Acad Sci USA 111:13187-13192, 2014). The third domain of Eap, Eap3, is an ~ 11 kDa protein that was recently shown to bind complement component C4b (Woehl et al in Protein Sci 26:1595-1608, 2017) and therefore play an essential role in inhibiting the classical and lectin pathways of complement (Woehl et al in J Immunol 193:6161-6171, 2014). Since structural characterization of Eap3 is still incomplete, we acquired a series of 2D and 3D NMR spectra of Eap3 in solution. Here we report the backbone and side-chain 1 H, 15 N, and 13 C resonance assignments of Eap3 and its predicted secondary structure via the TALOS-N server. The assignment data have been deposited in the BMRB data bank under accession number 27087.

  14. Measuring pain phenomena after spinal cord injury: Development and psychometric properties of the SCI-QOL Pain Interference and Pain Behavior assessment tools.

    PubMed

    Cohen, Matthew L; Kisala, Pamela A; Dyson-Hudson, Trevor A; Tulsky, David S

    2018-05-01

    To develop modern patient-reported outcome measures that assess pain interference and pain behavior after spinal cord injury (SCI). Grounded-theory based qualitative item development; large-scale item calibration field-testing; confirmatory factor analyses; graded response model item response theory analyses; statistical linking techniques to transform scores to the Patient Reported Outcome Measurement Information System (PROMIS) metric. Five SCI Model Systems centers and one Department of Veterans Affairs medical center in the United States. Adults with traumatic SCI. N/A. Spinal Cord Injury - Quality of Life (SCI-QOL) Pain Interference item bank, SCI-QOL Pain Interference short form, and SCI-QOL Pain Behavior scale. Seven hundred fifty-seven individuals with traumatic SCI completed 58 items addressing various aspects of pain. Items were then separated by whether they assessed pain interference or pain behavior, and poorly functioning items were removed. Confirmatory factor analyses confirmed that each set of items was unidimensional, and item response theory analyses were used to estimate slopes and thresholds for the items. Ultimately, 7 items (4 from PROMIS) comprised the Pain Behavior scale and 25 items (18 from PROMIS) comprised the Pain Interference item bank. Ten of these 25 items were selected to form the Pain Interference short form. The SCI-QOL Pain Interference item bank and the SCI-QOL Pain Behavior scale demonstrated robust psychometric properties. The Pain Interference item bank is available as a computer adaptive test or short form for research and clinical applications, and scores are transformed to the PROMIS metric.

  15. Psychological defense mechanisms among individuals with SCI with adjustment disorder.

    PubMed

    Yazdanshenas Ghazwin, Manijeh; Tavakoli, Seyed Amir Hossein; Latifi, Sahar; Saberi, Hooshang; Derakhshanrad, Nazi; Yekaninejad, Mir Saeed; Sadeghi, Majid; Emami Razavi, Seyed-Hassan; Norouzi Javidan, Abbas; Ghodsi, Seyed-Mohammad

    2017-09-01

    The used psychological defense styles among individuals with spinal cord injury (SCI) with adjustment disorders (AJD) have not yet been described. In the present investigation, the prevalence of AJD among people with SCI has been estimated and the pattern of used defense styles has been identified. Cross-sectional investigation. A tertiary rehabilitation center in Iran. Individuals referred to Brain and Spinal Cord Injury Research Center were invited to participate in a screening interview. AJD was diagnosed based on DSM-V criteria. Those with AJD diagnosis were scheduled for another interview to assess defense mechanisms. Demographic and injury-related variables were recorded. Defense mechanisms were assessed by the 40-item version of the Defense-Style Questionnaire (DSQ-40). Among 114 participants, 32 (28%) were diagnosed with AJD among whom 23 subjects attended the second interview. Mean age and time since injury were 29.57 ± 9.29 years and 11.70 ± 6.34 months, respectively. The majority of patients were using idealization defense mechanism (91.3%). In the second and third place, passive aggression (87.0%) and somatization (82.6%) defense mechanisms were observed, respectively. Neurotic style was dominantly used (11.52 ± 2.26). Sex, marital status, educational level, cause of the injury and injury level were not related to defense style (P: 0.38, 0.69, 0.88, 0.73, and P: 0.32, respectively). Prevalence of AJD is estimated to be 28% among individuals with SCI. The most prevalent defense style was neurotic and the dominant used defense mechanism was "idealization." The role of demographic and injury-related variables in determining the used defense mechanisms was insignificant.

  16. Stepping responses to treadmill perturbations vary with severity of motor deficits in human SCI.

    PubMed

    Chu, Virginia Way Tong; Hornby, T George; Schmit, Brian D

    2018-04-18

    In this study, we investigated the responses to tread perturbations during human stepping on a treadmill. Our approach was to test the effects of perturbations to a single leg using a split-belt treadmill in healthy participants and in participants with varying severity of spinal cord injury (SCI). We recruited 11 people with incomplete SCI and 5 noninjured participants. As participants walked on an instrumented treadmill, the belt on one side was stopped or accelerated briefly during mid to late stance. A majority of participants initiated an unnecessary swing when the treadmill was stopped in mid stance, although the likelihood of initiating a step was decreased in participants with more severe SCI. Accelerating or decelerating one belt of the treadmill during stance altered the characteristics of swing. We observed delayed swing initiation when the belt was decelerated (i.e. the hip was in a more flexed position at time of swing) and advanced swing initiation with acceleration (i.e. hip extended at swing initiation). Further, the timing and leg posture of heel strike appeared to remain constant, reflected by a sagittal plane hip angle at heel strike that remained the same regardless of the perturbation. In summary, our results supported the current understanding of the role of sensory feedback and central drive in the control of stepping in participants with incomplete SCI and noninjured participants. In particular, the observation of unnecessary swing during a stop perturbation highlights the interdependence of central and sensory drive in walking control.

  17. Collaborative Science Using Web Services and the SciFlo Grid Dataflow Engine

    NASA Astrophysics Data System (ADS)

    Wilson, B. D.; Manipon, G.; Xing, Z.; Yunck, T.

    2006-12-01

    The General Earth Science Investigation Suite (GENESIS) project is a NASA-sponsored partnership between the Jet Propulsion Laboratory, academia, and NASA data centers to develop a new suite of Web Services tools to facilitate multi-sensor investigations in Earth System Science. The goal of GENESIS is to enable large-scale, multi-instrument atmospheric science using combined datasets from the AIRS, MODIS, MISR, and GPS sensors. Investigations include cross-comparison of spaceborne climate sensors, cloud spectral analysis, study of upper troposphere-stratosphere water transport, study of the aerosol indirect cloud effect, and global climate model validation. The challenges are to bring together very large datasets, reformat and understand the individual instrument retrievals, co-register or re-grid the retrieved physical parameters, perform computationally-intensive data fusion and data mining operations, and accumulate complex statistics over months to years of data. To meet these challenges, we have developed a Grid computing and dataflow framework, named SciFlo, in which we are deploying a set of versatile and reusable operators for data access, subsetting, registration, mining, fusion, compression, and advanced statistical analysis. SciFlo leverages remote Web Services, called via Simple Object Access Protocol (SOAP) or REST (one-line) URLs, and the Grid Computing standards (WS-* &Globus Alliance toolkits), and enables scientists to do multi-instrument Earth Science by assembling reusable Web Services and native executables into a distributed computing flow (tree of operators). The SciFlo client &server engines optimize the execution of such distributed data flows and allow the user to transparently find and use datasets and operators without worrying about the actual location of the Grid resources. In particular, SciFlo exploits the wealth of datasets accessible by OpenGIS Consortium (OGC) Web Mapping Servers & Web Coverage Servers (WMS/WCS), and by Open Data

  18. Challenges of animal models in SCI research: Effects of pre-injury task-specific training in adult rats before lesion.

    PubMed

    May, Zacnicte; Fouad, Karim; Shum-Siu, Alice; Magnuson, David S K

    2015-09-15

    A rarely explored subject in animal research is the effect of pre-injury variables on behavioral outcome post-SCI. Low reporting of such variables may underlie some discrepancies in findings between laboratories. Particularly, intensive task-specific training before a SCI might be important, considering that sports injuries are one of the leading causes of SCI. Thus, individuals with SCI often underwent rigorous training before their injuries. In the present study, we asked whether training before SCI on a grasping task or a swimming task would influence motor recovery in rats. Swim pre-training impaired recovery of swimming 2 and 4 weeks post-injury. This result fits with the idea of motor learning interference, which posits that learning something new may disrupt learning of a new task; in this case, learning strategies to compensate for functional loss after SCI. In contrast to swimming, grasp pre-training did not influence grasping ability after SCI at any time point. However, grasp pre-trained rats attempted to grasp more times than untrained rats in the first 4 weeks post-injury. Also, lesion volume of grasp pre-trained rats was greater than that of untrained rats, a finding which may be related to stress or activity. The increased participation in rehabilitative training of the pre-trained rats in the early weeks post-injury may have potentiated spontaneous plasticity in the spinal cord and counteracted the deleterious effect of interference and bigger lesions. Thus, our findings suggest that pre-training plays a significant role in recovery after CNS damage and needs to be carefully controlled for. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Development of an International Canine Spinal Cord Injury observational registry: a collaborative data-sharing network to optimize translational studies of SCI.

    PubMed

    Moore, Sarah A; Zidan, Natalia; Spitzbarth, Ingo; Nout-Lomas, Yvette S; Granger, Nicolas; da Costa, Ronaldo C; Levine, Jonathan M; Jeffery, Nick D; Stein, Veronika M; Tipold, Andrea; Olby, Natasha J

    2018-05-23

    Prospective cross-sectional cohort study. The canine spontaneous model of spinal cord injury (SCI) is as an important pre-clinical platform as it recapitulates key facets of human injury in a naturally occurring context. The establishment of an observational canine SCI registry constitutes a key step in performing epidemiologic studies and assessing the impact of therapeutic strategies to enhance translational research. Further, accumulating information on dogs with SCI may contribute to current "big data" approaches to enhance understanding of the disease using heterogeneous multi-institutional, multi-species datasets from both pre-clinical and human studies. Multiple veterinary academic institutions across the United States and Europe. Common data elements recommended for experimental and human SCI studies were reviewed and adapted for use in a web-based registry, to which all dogs presenting to member veterinary tertiary care facilities were prospectively entered over ~1 year. Analysis of data accumulated during the first year of the registry suggests that 16% of dogs with SCI present with severe, sensorimotor-complete injury and that 15% of cases are seen by a tertiary care facility within 8 h of injury. Similar to the human SCI population, 34% were either overweight or obese. Severity of injury and timing of presentation suggests that neuroprotective studies using the canine clinical model could be conducted efficiently using a multi-institutional approach. Additionally, pet dogs with SCI experience similar comorbidities to people with SCI, in particular obesity, and could serve as an important model to evaluate the effects of this condition.

  20. The Evolution of Sterol Biosynthesis in Bacteria: In Situ Fluorescence Localization of Sterols in the Nucleoid Bacterium Gemmata obscuriglobus

    NASA Astrophysics Data System (ADS)

    Budin, M.; Jorgenson, T. L.; Pearson, A.

    2004-12-01

    acquired the ability to produce sterols for a specialized function related to their nuclear membrane. 1. Brocks, J.J., et al., Science 285:1033-36 (1999). 2. Bird, C.W., et al., Nature 230:473-74 (1971). 3. Bode, H.B., et al., Mol. Microbiol. 47:471-81 (2003). 4. Pearson, A., et al., Proc. Natl. Acad. Sci. USA 100:15352-57 (2003). 5. Fuerst, J.A. and R.I. Webb, Proc. Natl. Acad. Sci. USA 88:8184-88 (1991).

  1. Molecular dynamics simulations of transitions for ECD epidermal growth factor receptors show key differences between human and drosophila forms of the receptors.

    PubMed

    Perilla, Juan R; Leahy, Daniel J; Woolf, Thomas B

    2013-07-01

    Recent X-ray structural work on the Drosophila epidermal growth factor receptor (EFGR) has suggested an asymmetric dimer that rationalizes binding affinity measurements that go back decades (Alvarado et al., Cell 2010;142:568-579; Dawson et al., Structure 2007;15:942-954; Lemmon et al., Embo J 1997;16:281-294; Mattoon et al., Proc Natl Acad Sci USA 2004;101:923-928; Mayawala et al., Febs Lett 2005;579:3043-3047; Ozcan et al., Proc Natl Acad Sci USA 2006;103:5735-5740). This type of asymmetric structure has not been seen for the human EGF receptor family and it may or may not be important for function in that realm. We hypothesize that conformational changes in the Drosophila system have been optimized for the transition, whereas the barrier for the same transition is much higher in the human forms. To address our hypothesis we perform dynamic importance sampling (DIMS) (Perilla et al., J Comput Chem 2010;32:196-209) for barrier crossing transitions in both Drosophila and human EFGRs. For each set of transitions, we work from the hypothesis, based on results from the AdK system, that salt-bridge pairs making and breaking connections are central to the conformational change. To evaluate the effectiveness of the salt-bridges as drivers for the conformational change, we use the effective transfer entropy based on stable state MD calculations (Kamberaj and Der Vaart, Biophys J 2009;97:1747-1755) to define a reduced subset of degrees of freedom that seem to be important for driving the transition (Perilla and Woolf, J Chem Phys 2012;136:164101). Our results suggest that salt-bridge making and breaking is not the dominant factor in driving the symmetric to asymmetric transition, but that instead it is a result of more concerted and correlated functional motions within a subset of the dimer structures. Furthermore, the analysis suggests that the set of residues involved in the transitions from the Drosophila relative to the human forms differs and that this difference in

  2. The Cloud Paradigm: Geostable molecules as proxies for surface oxygenation

    NASA Astrophysics Data System (ADS)

    Summons, R. E.; Hallmann, C.

    2011-12-01

    before the great oxidation event. Science 317, 1903-1906. (2007). Bosak T. et al., Morphological record of oxygenic photosynthesis in conical stromatolites. Proc. Natl. Acad. Sci. USA 106:10939-10943 (2009). Kopp, R.E. et al.,The Paleoproterozoic snowball Earth: A climate disaster triggered by the evolution of oxygenic photosynthesis. Proc. Natl. Acad. Sci. USA 102: 11131-11136 (2005). Waldbauer J.R. et al. Late Archean molecular fossils from the Transvaal Supergroup record the antiquity of microbial diversity and aerobiosis. Precambrian Research 169, 28-47 (2008).

  3. Energy for Living. Study Guide. Unit G1. ZIM-SCI, Zimbabwe Secondary School Science Project. Year 2.

    ERIC Educational Resources Information Center

    Hosking, Bunty

    The Zimbabe Secondary School Science Project (ZIM-SCI) developed student study guides, corresponding teaching guides, and science kits for a low-cost science course which could be taught during the first 2 years of secondary school without the aid of qualified teachers and conventional laboratories. This ZIM-SCI study guide includes activities and…

  4. Reproducing by Flowers and Seeds. Study Guide. Unit E2. ZIM-SCI, Zimbabwe Secondary School Science Project.

    ERIC Educational Resources Information Center

    Zesaguli, Josie

    The Zimbabwe Secondary School Science Project (ZIM-SCI) developed student study guides, corresponding teaching guides, and science kits for a low-cost science course which could be taught during the first 2 years of secondary school without the aid of qualified teachers and environmental laboratories. This ZIM-SCI study guide consists of…

  5. Our Planet Earth. Teacher's Guide. Unit F1. ZIM-SCI, Zimbabwe Secondary School Science Project. Year 2.

    ERIC Educational Resources Information Center

    Stocklmayer, Sue

    The Zimbabwe Secondary School Science Project (ZIM-SCI) developed student study guides, corresponding teaching guides, and science kits for a low-cost science course which could be taught during the first 2 years of secondary school without the aid of qualified teachers and conventional laboratories. This ZIM-SCI study guide presents activities,…

  6. Differential Activity of the Oral Glucan Synthase Inhibitor SCY-078 against Wild-Type and Echinocandin-Resistant Strains of Candida Species.

    PubMed

    Pfaller, Michael A; Messer, Shawn A; Rhomberg, Paul R; Borroto-Esoda, Katyna; Castanheira, Mariana

    2017-08-01

    SCY-078 (formerly MK-3118) is a novel orally active inhibitor of fungal β-(1,3)-glucan synthase (GS). SCY-078 is a derivative of enfumafungin and is structurally distinct from the echinocandin class of antifungal agents. We evaluated the in vitro activity of this compound against wild-type (WT) and echinocandin-resistant isolates containing mutations in the FKS genes of Candida spp. Against 36 Candida spp. FKS mutants tested, 30 (83.3%) were non-WT to 1 or more echinocandins, and only 9 (25.0%) were non-WT (MIC, >WT-upper limit) to SCY-078. Among C. glabrata isolates carrying FKS alterations, 84.0% were non-WT to the echinocandins versus only 24.0% for SCY-078. In contrast to the echinocandin comparators, the activity of SCY-078 was minimally affected by the presence of FKS mutations, suggesting that this agent is useful in the treatment of Candida infections due to echinocandin-resistant strains. Copyright © 2017 American Society for Microbiology.

  7. Final Report for DOE Project: Portal Web Services: Support of DOE SciDAC Collaboratories

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mary Thomas, PI; Geoffrey Fox, Co-PI; Gannon, D

    2007-10-01

    Grid portals provide the scientific community with familiar and simplified interfaces to the Grid and Grid services, and it is important to deploy grid portals onto the SciDAC grids and collaboratories. The goal of this project is the research, development and deployment of interoperable portal and web services that can be used on SciDAC National Collaboratory grids. This project has four primary task areas: development of portal systems; management of data collections; DOE science application integration; and development of web and grid services in support of the above activities.

  8. Influence of socio-economic status on access to different components of SCI management across Indian population.

    PubMed

    Chhabra, H S; Bhalla, A M

    2015-11-01

    To assess the influence of financial constraints on access to different components of spinal cord injury (SCI) management in various socio-economic strata of the Indian population. Indian Spinal Injuries Centre (ISIC). One hundred fifty SCI individuals who came for follow-up at ISIC between March 2009 and March 2013 with at least 1 year of community exposure after discharge were included in the study. Socio-economic classification was carried out according to the Kuppuswamy scale, a standard scale for the Indian population. A self-designed questionnaire was administered. No sample was available from the lower group. There was a statistically significant difference (P<0.05) for the levels of difficulty perceived by different socio-economic groups in accessing different components of SCI management. Aided upper lower group was dependent on welfare schemes for in-hospital treatment but could not access other components of management once discharged. Unaided upper lower group either faced severe difficulty or could not access management. Majority of lower middle group faced severe difficulty. Upper middle group was equally divided into facing severe, moderate or no difficulty. Most patients in the upper group faced no difficulty, whereas some faced moderate and a small number of severe difficulty. Financial constraints affected all components of SCI management in all except the upper group. The results of the survey suggest that a very large percentage of the Indian population would find it difficult to access comprehensive SCI management and advocate extension of essential medical coverage to unaided upper lower, lower middle and upper middle groups.

  9. Transporter Protein-Coupled DPCPX Nanoconjugates Induce Diaphragmatic Recovery after SCI by Blocking Adenosine A1 Receptors.

    PubMed

    Minic, Zeljka; Zhang, Yanhua; Mao, Guangzhao; Goshgarian, Harry G

    2016-03-23

    Respiratory complications in patients with spinal cord injury (SCI) are common and have a negative impact on the quality of patients' lives. Systemic administration of drugs that improve respiratory function often cause deleterious side effects. The present study examines the applicability of a novel nanotechnology-based drug delivery system, which induces recovery of diaphragm function after SCI in the adult rat model. We developed a protein-coupled nanoconjugate to selectively deliver by transsynaptic transport small therapeutic amounts of an A1 adenosine receptor antagonist to the respiratory centers. A single administration of the nanoconjugate restored 75% of the respiratory drive at 0.1% of the systemic therapeutic drug dose. The reduction of the systemic dose may obviate the side effects. The recovery lasted for 4 weeks (the longest period studied). These findings have translational implications for patients with respiratory dysfunction after SCI. The leading causes of death in humans following SCI are respiratory complications secondary to paralysis of respiratory muscles. Systemic administration of methylxantines improves respiratory function but also leads to the development of deleterious side effects due to actions of the drug on nonrespiratory sites. The importance of the present study lies in the novel drug delivery approach that uses nanotechnology to selectively deliver recovery-inducing drugs to the respiratory centers exclusively. This strategy allows for a reduction in the therapeutic drug dose, which may reduce harmful side effects and markedly improve the quality of life for SCI patients. Copyright © 2016 the authors 0270-6474/16/363441-12$15.00/0.

  10. Locomotor activity of rats with SCI is improved by dexmedetomidine by targeting the expression of inflammatory factors.

    PubMed

    Wang, Wei-Guo; Wang, Lin; Jiao, Zhen-Hua; Xue, Bin; Xu, Zhan-Wang

    2018-04-26

    Dexmedetomidine, a well‑known selective α‑2 adrenoceptor agonist, inhibits the apoptosis of neurons and protects other organs from oxidative damage. In the present study, the effect of dexmedetomidine on spinal cord injury (SCI) in a rat model was investigated. The SCI rat model was prepared using the weight‑drop method, and the effect of dexmedetomidine on locomotor activity was analyzed using the Basso, Beattie and Bresnahan (BBB) rating scale. Western blot analysis was used to observe changes in the expression of apoptosis‑related proteins, including B‑cell lymphoma 2 (Bcl‑2) and Bcl‑2‑associated X protein (Bax). The results revealed that treatment of the SCI rats with dexmedetomidine at a dose of 50 mg/kg significantly prevented the formation of edema in the tissues of the spinal cord. Dexmedetomidine also inhibited the SCI‑induced accumulation of neutrophils in the spinal cord. The BBB scores were significantly increased (P<0.05) in the rats with SCI treated with dexmedetomidine after 10 days. The results of grid walking test revealed a marked decrease in the number of missteps following 10 days of dexmedetomidine treatment. The expression levels of tumor necrosis factor (TNF)‑α and interleukin (IL)‑1β were significantly reduced (P<0.05) in the spinal cord tissues of the dexmedetomidine group, compared with those in the control group of rats. Dexmedetomidine treatment following SCI exerted an inhibitory effect on the SCI‑induced increase in the expression of Bax. The expression of Bcl‑2 was increased in the dexmedetomidine treated rats, compared with that in the control group. Taken together, dexmedetomidine improved the locomotor activity of the rats through the inhibition of edema, reduction in the expression levels of TNF‑α and IL‑1β, and inhibition of the induction of apoptosis. Therefore, dexmedetomidine may be of therapeutic importance for patients with SCI.

  11. Measurement of the absolute v μ-CCQE cross section at the SciBooNE experiment

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aunion, Jose Luis Alcaraz

    2010-07-01

    This thesis presents the measurement of the charged current quasi-elastic (CCQE) neutrino-nucleon cross section at neutrino energies around 1 GeV. This measurement has two main physical motivations. On one hand, the neutrino-nucleon interactions at few GeV is a region where existing old data are sparse and with low statistics. The current measurement populates low energy regions with higher statistics and precision than previous experiments. On the other hand, the CCQE interaction is the most useful interaction in neutrino oscillation experiments. The CCQE channel is used to measure the initial and final neutrino fluxes in order to determine the neutrino fractionmore » that disappeared. The neutrino oscillation experiments work at low neutrino energies, so precise measurement of CCQE interactions are essential for flux measurements. The main goal of this thesis is to measure the CCQE absolute neutrino cross section from the SciBooNE data. The SciBar Booster Neutrino Experiment (SciBooNE) is a neutrino and anti-neutrino scattering off experiment. The neutrino energy spectrum works at energies around 1 GeV. SciBooNE was running from June 8th 2007 to August 18th 2008. In that period, the experiment collected a total of 2.65 x 10 20 protons on target (POT). This thesis has used full data collection in neutrino mode 0.99 x 10 20 POT. A CCQE selection cut has been performed, achieving around 70% pure CCQE sample. A fit method has been exclusively developed to determine the absolute CCQE cross section, presenting results in a neutrino energy range from 0.2 to 2 GeV. The results are compatible with the NEUT predictions. The SciBooNE measurement has been compared with both Carbon (MiniBoonE) and deuterium (ANL and BNL) target experiments, showing a good agreement in both cases.« less

  12. Sleep-Disordered Breathing in Chronic SCI: A Randomized Controlled Trial of Treatment Impact on Cognition, Quality of Life, and Cardiovascular Disease

    DTIC Science & Technology

    2014-10-01

    SCI. In this prospective randomized controlled trial, we will objectively measure sleep disordered breathing ( SDB ) in chronic SCI patients using...portable sleep studies, and systematically evaluate the association between SDB , cognitive performance, mood, pain, and CV measures. We will randomize...randomized shortly. 15. SUBJECT TERMS SDB , SCI, PAP, CV 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18. NUMBER OF PAGES 19a

  13. SciBox, an end-to-end automated science planning and commanding system

    NASA Astrophysics Data System (ADS)

    Choo, Teck H.; Murchie, Scott L.; Bedini, Peter D.; Steele, R. Josh; Skura, Joseph P.; Nguyen, Lillian; Nair, Hari; Lucks, Michael; Berman, Alice F.; McGovern, James A.; Turner, F. Scott

    2014-01-01

    SciBox is a new technology for planning and commanding science operations for Earth-orbital and planetary space missions. It has been incrementally developed since 2001 and demonstrated on several spaceflight projects. The technology has matured to the point that it is now being used to plan and command all orbital science operations for the MErcury Surface, Space ENvironment, GEochemistry, and Ranging (MESSENGER) mission to Mercury. SciBox encompasses the derivation of observing sequences from science objectives, the scheduling of those sequences, the generation of spacecraft and instrument commands, and the validation of those commands prior to uploading to the spacecraft. Although the process is automated, science and observing requirements are incorporated at each step by a series of rules and parameters to optimize observing opportunities, which are tested and validated through simulation and review. Except for limited special operations and tests, there is no manual scheduling of observations or construction of command sequences. SciBox reduces the lead time for operations planning by shortening the time-consuming coordination process, reduces cost by automating the labor-intensive processes of human-in-the-loop adjudication of observing priorities, reduces operations risk by systematically checking constraints, and maximizes science return by fully evaluating the trade space of observing opportunities to meet MESSENGER science priorities within spacecraft recorder, downlink, scheduling, and orbital-geometry constraints.

  14. Mechanism of Prostate Cancer Prevention by Down-Regulation of the GH/IGF Axis

    DTIC Science & Technology

    2012-07-01

    apoptosis. Recent clinical trials indicate that elevated circulating IGF-I confers an increased risk for the development of prostate cancer. Our...hormone gene suppresses growth of transgenic mice. Proc Natl Acad Sci U S A 1990;87:5061-5. [6] Kopchick JJ, Parkinson C, Stevens EC, Trainer PJ. Growth

  15. Genetics Home Reference: carbonic anhydrase VA deficiency

    MedlinePlus

    ... implicates both enzymes in ammonia detoxification and glucose metabolism. Proc Natl Acad Sci U S A. 2013 Apr 30;110(18):7423-8. doi: 10.1073/pnas.1305805110. Epub 2013 Apr 15. Citation on PubMed or Free article on PubMed Central Sly WS, Hu PY. Human ...

  16. Orthopedics research output from China, USA, UK, Japan, Germany and France: A 10-year survey of the literature.

    PubMed

    Xin, Z; Jin, C; Zhengrong, G; Liehu, C; Weizong, W; Quan, L; Xiao, C; Jiacan, S

    2016-11-01

    In the past decade, researchers have made great progress in the field of Orthopedics. However, the research status of different countries is unclear. To summarize the number of published articles, we assessed the cumulative impact factors in top orthopedic journals. The aims of the study were to measure: 1) the quality and quantity of publications in orthopedics-related journals from China and other five counties, 2) the trend of the number of publications in orthopedics-related journals. The related journals were selected based on the 2014 scientific citation index (SCI) and articles were searched based on the PubMed database. To assess the quantity and quality of research output, the number of publications including clinical trials, randomized controlled trials, meta-analyses, case reports, reviews, citations, impact factors, number of articles in the top 10 journals and most popular journals were recorded. A total of 143,138 orthopedics articles were published from 2005 to 2014. The USA accounts for 24.9% (35,763/143,138) of the publications, followed by UK (7878/143,138 (5.5%)), Japan (7133/143,138 (5.0%)), Germany (5942/143,138 (4.2%)), China (4143/143,138 (2.9%)) and France (2748/143,138 (1.9%)). The ranking for accumulated impact factors as follows: USA, UK, Japan, Germany, France and China. The mean impact factor's order is USA, China, Germany, Japan, France, UK, and interestingly the mean impact factors in Japan is similar to the Germany in 2005-2014. The USA had the highest percentage of articles in the top 10 journals, while China owns the least. The USA had the highest number of average citations, while Japan had lowest number of average citations. According to this study, we can conclude that the USA has had been leading the orthopedics research in the past 10 years. Although China still falls behind, it has made considerable progress in the orthopedics research, not only in quantity but also quality. IV. Copyright © 2016. Published by Elsevier Masson

  17. CitSci.org: A New Model for Managing, Documenting, and Sharing Citizen Science Data

    PubMed Central

    Wang, Yiwei; Kaplan, Nicole; Newman, Greg; Scarpino, Russell

    2015-01-01

    Citizen science projects have the potential to advance science by increasing the volume and variety of data, as well as innovation. Yet this potential has not been fully realized, in part because citizen science data are typically not widely shared and reused. To address this and related challenges, we built CitSci.org (see www.citsci.org), a customizable platform that allows users to collect and generate diverse datasets. We hope that CitSci.org will ultimately increase discoverability and confidence in citizen science observations, encouraging scientists to use such data in their own scientific research. PMID:26492521

  18. CitSci.org: A New Model for Managing, Documenting, and Sharing Citizen Science Data.

    PubMed

    Wang, Yiwei; Kaplan, Nicole; Newman, Greg; Scarpino, Russell

    2015-10-01

    Citizen science projects have the potential to advance science by increasing the volume and variety of data, as well as innovation. Yet this potential has not been fully realized, in part because citizen science data are typically not widely shared and reused. To address this and related challenges, we built CitSci.org (see www.citsci.org), a customizable platform that allows users to collect and generate diverse datasets. We hope that CitSci.org will ultimately increase discoverability and confidence in citizen science observations, encouraging scientists to use such data in their own scientific research.

  19. A pilot study to evaluate the role of the Spinal Cord Impairment Pressure Ulcer Monitoring Tool (SCI-PUMT) in clinical decisions for pressure ulcer treatment.

    PubMed

    Thomason, Susan S; Graves, Barbara Ann; Madaris, Linda

    2014-12-01

    The Spinal Cord Impairment Pressure Ulcer Monitoring Tool (SCI-PUMT) was designed to assess pressure ulcer (PrU) healing in the spinal cord impaired (SCI) population. The tool contains 7 variables: wound surface area, depth, edges, tunneling, undermining, exudate type, and necrotic tissue amount. A 2-phased, quantitative pilot study based on the Theory of Reasoned Action and Theory of Planned Behavior was conducted at a large SCI/Disorders Center in the Department of Veterans Affairs (VA). In the first phase of the study, a convenience sample of 5 physicians, 3 advanced practice registered nurses, and 3 certified wound care nurses (CWCN) was surveyed using a 2-part questionnaire to assess use of the SCI-PUMT instrument, its anticipated improvement in PrU assessment, and intent to use the SCI-PUMT in clinical practice. Attitudes, subjective norms, perceived behavioral controls, and barriers related to the intent to use the SCI-PUMT were evaluated using a 5-point Likert scale (range: 1= extremely likely, 5 = extremely unlikely). In the second phase of the study, the electronic health records (EHR) of 24 veterans (with 30 PrUs) who had at least 2 completed SCI-PUMT scores during a 4-week period were used to evaluate whether an association existed between magnitudes of change of total SCI-PUMT scores and ordered changes in PrU treatment. The overall mean score for intent to use SCI-PUMT was 1.80 (SD 0.75). The least favorable scores were for convenience and motivation to use the SCI-PUMT. Analysis of EHR data showed no significant difference in magnitudes of change in the SCI-PUMT score and changes in PrU treatment recommendations made by the CWCNs. The significance was not affected regardless of an increase or no change in the score (χ2 with 1 degree of freedom = 1.158, P = 0.282) or for a decrease in the score (χ2 with 1 degree of freedom = 0.5, P = 0.478). In this pilot study, the expressed intent to use the SCI-PUMT in making clinical decisions was generally

  20. Online Registries for Researchers: Using ORCID and SciENcv.

    PubMed

    Vrabel, Mark

    2016-12-01

    The Open Researcher and Contributor ID (ORCID) registry helps resolve name ambiguity by assigning persistent unique identifiers that automatically link to a researcher's publications, grants, and other activities. This article provides an overview of ORCID and its benefits, citing several examples of its use in cancer and nursing journals. The article also briefly describes My NCBI and the Science Experts Network Curriculum Vitae (SciENcv) and its connection to ORCID.

  1. Forces in Living Things. Study Guide. Unit H2. ZIM-SCI, Zimbabwe Secondary School Science Project. Year 2.

    ERIC Educational Resources Information Center

    Hosking, Bunty; Zesaguli, Josie

    The Zimbabwe Secondary School Science Project (ZIM-SCI) developed student study guides, corresponding teaching guides, and science kits for a low-cost science course which could be taught during the first 2 years of secondary school without the aid of qualified teachers and conventional laboratories. This ZIM-SCI study guide presents activities…

  2. Development of an evidence-informed leisure time physical activity resource for adults with spinal cord injury: the SCI Get Fit Toolkit.

    PubMed

    Arbour-Nicitopoulos, K P; Martin Ginis, K A; Latimer-Cheung, A E; Bourne, C; Campbell, D; Cappe, S; Ginis, S; Hicks, A L; Pomerleau, P; Smith, K

    2013-06-01

    To systematically develop an evidence-informed leisure time physical activity (LTPA) resource for adults with spinal cord injury (SCI). Canada. The Appraisal of Guidelines, Research and Evaluation (AGREE) II protocol was used to develop a toolkit to teach and encourage adults with SCI how to make smart and informed choices about being physically active. A multidisciplinary expert panel appraised the evidence and generated specific recommendations for the content of the toolkit. Pilot testing was conducted to refine the toolkit's presentation. Recommendations emanating from the consultation process were that the toolkit be a brief, evidence-based resource that contains images of adults with tetraplegia and paraplegia, and links to more detailed online information. The content of the toolkit should include the physical activity guidelines (PAGs) for adults with SCI, activities tailored to manual and power chair users, the benefits of LTPA, and strategies to overcome common LTPA barriers for adults with SCI. The inclusion of action plans and safety tips was also recommended. These recommendations have resulted in the development of an evidence-informed LTPA resource to assist adults with SCI in meeting the PAGs. This toolkit will have important implications for consumers, health care professionals and policy makers for encouraging LTPA in the SCI community.

  3. 75 FR 66104 - Government-Owned Inventions; Availability for Licensing

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-27

    ... receptor gene exhibit impaired growth and resistance to thyroid hormone. Proc Natl Acad Sci U S A. 2000 Nov... overactivated. These mice have a knock-in dominantly negative mutant thyroid hormone receptor [beta] gene (TR... mutation in the thyroid hormone receptor beta gene spontaneously develop thyroid carcinoma: a mouse model...

  4. Exploiting for Breast Cancer Control a Proposed Unified Mechanism for Reduction of Human Breast Cancer Risk by the Hormones of Pregnancy

    DTIC Science & Technology

    2007-05-01

    Thordarson G, Chen X, Nandi S. Hormonal prevention of breast cancer: mimicking the protective effect of pregnancy. Proc Natl Acad Sci U S A. 1999 Mar...2;96(5):2520-5. 4. Rajkumar L, Guzman RC, Yang J, Thordarson G, Talamantes F, Nandi S. Prevention of mammary carcinogenesis by short-term

  5. Bibliometric analysis of the Korean Journal of Parasitology: measured from SCI, PubMed, Scopus, and Synapse databases.

    PubMed

    Lee, Choon Shil

    2009-10-01

    The Korean Journal of Parasitology (KJP) is the official journal of the Korean Society for Parasitology which is celebrating its 50th anniversary in 2009. To assess the contributions and achievements of the KJP, bibliometric analysis was conducted based on the citation data retrieved from 4 major databases; SCI, PubMed, Synapse, and Scopus. It was found that the KJP articles were constantly cited by the articles published in major international journals represented in these databases. More than 60% of 1,370 articles published in the KJP from 1963 to June 2009 were cited at least once by SCI articles. The overall average times cited by SCI articles are 2.6. The rate is almost 3 times higher for the articles published in the last 10 years compared to 1.0 for the articles of the 1960s. The SCI journal impact factor for 2008 is calculated as 0.871. It is increasing and it is expected to increase further with the introduction of the KJP in the database in 2008. The more realistic h-indices were measured from the study data set covering all the citations to the KJP; 17 for SCI, 6 for PubMed, 19 for Synapse, and 17 for Scopus. Synapse extensively picked up the citations to the earlier papers not retrievable from the other 3 databases. It identified many papers published in the 1960s and in the 1980s which have been cited heavily, proving the central role of the KJP in the dissemination of the important research findings over the last 5 decades.

  6. With a little help from my friends: social support and mental health in SCI caregivers from Neiva, Colombia.

    PubMed

    Morlett-Paredes, Alejandra; Perrin, Paul B; Olivera, Silvia Leonor; Rogers, Heather L; Perdomo, Jose Libardo; Arango, Jose Anselmo; Arango-Lasprilla, Juan Carlos

    2014-01-01

    The purpose of this study was to examine the influence of appraisal, belonging, and tangible social support on the mental health (depression, satisfaction with life, anxiety, and burden) of Colombian spinal cord injury (SCI) caregivers. Forty SCI caregivers from Neiva, Colombia completed questionnaires assessing their perceived social support and mental health. Four multiple regressions found that the three social support variables explained 42.8% of the variance in caregiver depression, 22.3% of the variance in satisfaction with life, 24.1% of the variance in anxiety, and 16.5% of the variance in burden, although the effect on burden was marginally significant. Within these regressions, higher belonging social support was uniquely associated with lower depression, and higher tangible social support was uniquely associated with higher caregiver satisfaction with life. Social support may have a particularly important influence on SCI caregiver mental health in Colombia, due in part to the high levels of collectivism and strong family values shown to exist in Latin America, and may therefore be an important target for SCI caregiver interventions in this region.

  7. Comparing NetCDF and SciDB on managing and querying 5D hydrologic dataset

    NASA Astrophysics Data System (ADS)

    Liu, Haicheng; Xiao, Xiao

    2016-11-01

    Efficiently extracting information from high dimensional hydro-meteorological modelling datasets requires smart solutions. Traditional methods are mostly based on files, which can be edited and accessed handily. But they have problems of efficiency due to contiguous storage structure. Others propose databases as an alternative for advantages such as native functionalities for manipulating multidimensional (MD) arrays, smart caching strategy and scalability. In this research, NetCDF file based solutions and the multidimensional array database management system (DBMS) SciDB applying chunked storage structure are benchmarked to determine the best solution for storing and querying 5D large hydrologic modelling dataset. The effect of data storage configurations including chunk size, dimension order and compression on query performance is explored. Results indicate that dimension order to organize storage of 5D data has significant influence on query performance if chunk size is very large. But the effect becomes insignificant when chunk size is properly set. Compression of SciDB mostly has negative influence on query performance. Caching is an advantage but may be influenced by execution of different query processes. On the whole, NetCDF solution without compression is in general more efficient than the SciDB DBMS.

  8. [Summarization and analysis on the acupuncture-related articles published in science citation index (SCI) periodicals in 2005].

    PubMed

    Yang, Jia-Yue; Wu, Li-Ping; Guo, Yi

    2007-04-01

    To retrieve, summarize and analyze journals and articles related to acupuncture published in SCI periodicals in 2005, so as to understand the international dynamics about acupuncture researches. The articles about treatment and mechanisms of acupuncture published in SCI periodicals in 2005 were found out and searched for by acupuncture information retrieval online and databank. Most of the 72 SCI periodicals retrieved are from the west, with 147 articles of acupuncture published, and Lancet has the highest impact factors of 23. 407. The kinds of the journals and articles publishing acupuncture researches are increasing, with varied types, rich and varied contents, and increasing the design level. However, the results of the studies are vastly different due to differences of experimental methods, objects and acupuncture manipulations. Therefore, standardization of acupuncture studies is extremely urgent.

  9. "Sci-Tech - Couldn't be without it !"

    NASA Astrophysics Data System (ADS)

    2002-03-01

    Launch of a Major European Outreach Programme Seven of Europe's leading Research Organizations [1] launch joint outreach programme for the European Science and Technology Week at the Technopolis Museum in Brussels on 22 March. Their aim is to show Europeans how today's society couldn't be without fundamental research . Could you imagine life without mobile phones, cars, CD players, TV, refrigerators, computers, the internet and the World Wide Web, antibiotics, vitamins, anaesthetics, vaccination, heating, pampers, nylon stockings, glue, bar codes, metal detectors, contact lenses, modems, laser printers, digital cameras, gameboys, play stations...? Technology is everywhere and used by everyone in today's society, but how many Europeans suspect that without studies on the structure of the atom, lasers would not exist, and neither would CD players? Most do not realise that most things they couldn't be without have required years of fundamental research . To fill this knowledge gap, the leading Research Organizations in Europe [1], with the support of the research directorate of the European Commission, have joined forces to inform Europeans how technology couldn't be without science, and how science can no longer progress without technology. The project is called...... Sci-Tech - Couldn't be without it! Sci-Tech - Couldn't be without it! invites Europeans to vote online in a survey to identify the top ten technologies they can't live without. It will show them through a dynamic and entertaining Web space where these top technologies really come from, and it will reveal their intimate links with research. Teaching kits will be developed to explain to students how their favourite gadgets actually work, and how a career in science can contribute to inventions that future generations couldn't be without. The results of the survey will be presented as a series of quiz shows live on the Internet during the Science Week, from 4 to 10 November. Sci-tech - Couldn't be without

  10. Health related quality of life and mental health in children with SCI/D from Neiva, Colombia.

    PubMed

    Leibach, Gillian G; Perrin, Paul B; Nicholls, Elizabeth; Leonor Olivera, Silvia; Medina Quintero, Lorena; Mauricio Velasco Trujillo, Diego; Carlos Arango-Lasprilla, Juan

    2015-01-01

    To date, no research has been published on the health related quality of life (HRQOL) and mental health of children with spinal cord injury and disorders (SCI/D) in Latin America, although limited previous research in Western countries has demonstrated the debilitating and chronic nature of these conditions in children. The aim was to examine the connections between HRQOL and mental health in children with SCI/D from Neiva, Colombia. Thirty children (8- 17 years) were recruited from the Hospital Universatario Hernando Mocaleano Perdomo in Neiva, Colombia. Participants completed self-report measures administered verbally by trained research staff. A correlation matrix generally suggested that higher HRQOL was robustly associated with better mental health. A series of multiple regressions found that HRQOL explained 50.5% of the variance in children's depression, 31.5% of the variance in worry, and 41.9% of the variance in social anxiety. Within these regressions, emotional and social functioning were uniquely associated with depression, and emotional functioning was uniquely associated with social anxiety. This is the first published study to examine psychosocial outcomes in children with SCI/D in Latin America, and its findings suggest that future research and interventions for children with SCI/D in Colombia - and possibly in other regions of Latin America - would benefit from emphasizing emotional and social functioning.

  11. The novel oral glucan synthase inhibitor SCY-078 shows in vitro activity against sessile and planktonic Candida spp.

    PubMed

    Marcos-Zambrano, Laura Judith; Gómez-Perosanz, Marta; Escribano, Pilar; Bouza, Emilio; Guinea, Jesús

    2017-07-01

    We studied the antifungal activity of SCY-078 (an orally bioavailable 1,3-β -d- glucan synthesis inhibitor), micafungin and fluconazole against the planktonic and sessile forms of 178 Candida and non- Candida isolates causing fungaemia in patients recently admitted to a large European hospital. The in vitro activity of SCY-078, micafungin and fluconazole against the planktonic form of the isolates was assessed using EUCAST EDef 7.3 and CLSI M27-A3. Antibiofilm activity was assessed using the XTT reduction assay. SCY-078 and micafungin showed potent in vitro activity against Candida and non- Candida isolates. The in vitro activity of both drugs was similar, but SYC-078 displayed significantly lower MIC values than micafungin against Candida parapsilosis and non- Candida isolates, whereas micafungin displayed significantly lower MIC values for the remaining species ( P  <0.001). In contrast, SCY-078 and micafungin showed essentially the same activity against the biofilms with the exception of Candida glabrata , in which the micafungin sessile MIC values were significantly lower ( P  <0.001). These observations were confirmed by assessing biofilm structure by scanning electron microscopy after antifungal treatment. Our study showed that the high in vitro activity of SCY-078 against invasive Candida isolates in both sessile and planktonic forms is comparable to that of micafungin. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  12. SciSpark: Highly Interactive and Scalable Model Evaluation and Climate Metrics

    NASA Astrophysics Data System (ADS)

    Wilson, B. D.; Palamuttam, R. S.; Mogrovejo, R. M.; Whitehall, K. D.; Mattmann, C. A.; Verma, R.; Waliser, D. E.; Lee, H.

    2015-12-01

    Remote sensing data and climate model output are multi-dimensional arrays of massive sizes locked away in heterogeneous file formats (HDF5/4, NetCDF 3/4) and metadata models (HDF-EOS, CF) making it difficult to perform multi-stage, iterative science processing since each stage requires writing and reading data to and from disk. We are developing a lightning fast Big Data technology called SciSpark based on ApacheTM Spark under a NASA AIST grant (PI Mattmann). Spark implements the map-reduce paradigm for parallel computing on a cluster, but emphasizes in-memory computation, "spilling" to disk only as needed, and so outperforms the disk-based ApacheTM Hadoop by 100x in memory and by 10x on disk. SciSpark will enable scalable model evaluation by executing large-scale comparisons of A-Train satellite observations to model grids on a cluster of 10 to 1000 compute nodes. This 2nd generation capability for NASA's Regional Climate Model Evaluation System (RCMES) will compute simple climate metrics at interactive speeds, and extend to quite sophisticated iterative algorithms such as machine-learning based clustering of temperature PDFs, and even graph-based algorithms for searching for Mesocale Convective Complexes. We have implemented a parallel data ingest capability in which the user specifies desired variables (arrays) as several time-sorted lists of URL's (i.e. using OPeNDAP model.nc?varname, or local files). The specified variables are partitioned by time/space and then each Spark node pulls its bundle of arrays into memory to begin a computation pipeline. We also investigated the performance of several N-dim. array libraries (scala breeze, java jblas & netlib-java, and ND4J). We are currently developing science codes using ND4J and studying memory behavior on the JVM. On the pyspark side, many of our science codes already use the numpy and SciPy ecosystems. The talk will cover: the architecture of SciSpark, the design of the scientific RDD (sRDD) data structure, our

  13. [Analysis on literatures about clinical treatment of low back pain with acupuncture and moxibustion published in the periodicals included by SCI in recent 5 years].

    PubMed

    Jiang, Chui-gang

    2007-03-01

    To explore the development state of acupuncture and moxibustion therapy in the world. Retrieve and analyze the literatures about clinically treating low back pain with acupuncture and moxibustion published at periodicals included by SCI in recent 5 years in Pubmed. Nineteen concerned literatures were retrieved. Authors of the literatures come from USA, Germany, Hong Kong of China, UK (including Northern Ireland) , Austria, Sweden and Italy. The literatures were published at Altern Ther Health Med, Am J Phys Med Rehabil, Anesth Analg, Arch Intern Med, Forsch Komplementärmed Klass Naturheilkd, Health Technol Assess, Rheumatology (Oxford), South Med J, Spine, Complment Ther Med, Pain. Three researches show that efficacy of acupuncture is uncertain. Other researches support the efficacy of acupuncture. The researches on treating low back pain with acupuncture and moxibustion are still mainly about efficacy of the acupuncture and moxibustion therapy. The acupuncture and moxibustion therapy is still in the process of gradually admitted by international medicine.

  14. A Program Design To Motivate Individuals with SCI for Self-Care.

    ERIC Educational Resources Information Center

    Scotzin, Martha

    The report compares a skin care education program with a standard rehabilitation program to determine whether the program improved the self care motivations of spinal cord injury (SCI) paraplegic and quadriplegic inpatients (N=42). Study findings suggest that the skin care educational program was successful in changing patients' thinking about…

  15. Plasminogen Activator Inhibitor: A Regulator of Ancrod-Induced Fibrin Deposition in Rabbits

    DTIC Science & Technology

    1987-03-01

    Acad Sci Invest 51:2841. 1972 82:8710. 1985 15. Alving BM, Evait BI., Bell WR: Stimulation of librinogen 4. Colucci M, Paramo JA. Collen D: Generation in... Paramo IA. Stassen .1M. Collen ): Influence of 1986 the fast-acting inhibitor on in vivo thrombolysis induced b, tissue- 7. Wiman B. Ljungberg B

  16. Control of Growth Within Drosophila Peripheral Nerves by Ras and Protein Kinase A

    DTIC Science & Technology

    2009-02-01

    channel gene on behavior and axonal excitability. Genetics 124: 133– 143 . 20. Chouinard SW, Wilson GF, Schlimgen AK, Ganetzky B (1995) A potassium...channel beta subunit related to the aldo- keto reductase superfamily is encoded by the Drosophila hyperkinetic locus. Proc Natl Acad Sci U S A 92: 6763–6767

  17. Genetics Home Reference: megacystis-microcolon-intestinal hypoperistalsis syndrome

    MedlinePlus

    ... mice. Proc Natl Acad Sci U S A. 2017 Mar 28;114(13):E2739-E2747. doi: 10.1073/pnas.1620507114. Epub 2017 Mar 14. Citation on PubMed or Free article on ... megacystis-microcolon-intestinal hypoperistalsis syndrome. PLoS Genet. 2014 Mar 27;10(3):e1004258. doi: 10.1371/journal. ...

  18. SciEthics Interactive: Science and Ethics Learning in a Virtual Environment

    ERIC Educational Resources Information Center

    Nadolny, Larysa; Woolfrey, Joan; Pierlott, Matthew; Kahn, Seth

    2013-01-01

    Learning in immersive 3D environments allows students to collaborate, build, and interact with difficult course concepts. This case study examines the design and development of the TransGen Island within the SciEthics Interactive project, a National Science Foundation-funded, 3D virtual world emphasizing learning science content in the context of…

  19. The SciELO Open Access: A Gold Way from the South

    ERIC Educational Resources Information Center

    Packer, Abel L.

    2009-01-01

    Open access has long emphasized access to scholarly materials. However, open access can also mean access to the means of producing visible and recognized journals. This issue is particularly important in developing and emergent countries. The SciELO (Scientific Electronic Library On-line) project, first started in Brazil and, shortly afterward, in…

  20. CSF Aβ1-42, but not p-Tau181, differentiates aMCI from SCI.

    PubMed

    Rizzi, Liara; Maria Portal, Marcelle; Batista, Carlos Eduardo Alves; Missiaggia, Luciane; Roriz-Cruz, Matheus

    2018-01-01

    Individuals with amnestic mild cognitive impairment (aMCI) are at a high risk to develop Alzheimer's disease (AD). We compared CSF levels of biomarkers of amyloidosis (Aβ 1-42 ) and neurodegeneration (p-Tau 181 ) in individuals with aMCI and with subjective cognitive impairment (SCI) in order to ascertain diagnostic accuracy and predict the odds ratio associated with aMCI. We collected CSF of individuals clinically diagnosed with aMCI (33) and SCI (12) of a memory clinic of Southern Brazil. Levels of Aβ 1-42 and p-Tau 181 were measured by immunoenzymatic assay. Participants also underwent neuropsychological testing including the verbal memory test subscore of the Consortium to Establish a Registry for Alzheimer's Disease (VM-CERAD). CSF concentration of Aβ 1-42 was significantly lower (p: .007) and p-Tau 181 /Aβ 1-42 ratio higher (p: .014) in aMCI individuals than in SCI. However, isolate p-Tau 181 levels were not associated with aMCI (p: .166). There was a statistically significant association between Aβ 1-42 and p-Tau 181 (R 2 : 0.177; β: -4.43; p: .017). ROC AUC of CSF Aβ 1-42 was 0.768 and of the p-Tau 181 /Aβ 1-42 ratio equals 0.742. Individuals with Aβ 1-42  < 823 pg/mL levels were 6.0 times more likely to be diagnosed with aMCI (p: .019), with a 68.9% accuracy. Those with p-Tau 181 /Aβ 1-42 ratio > 0.071 were at 4.6 increased odds to have aMCI (p: .043), with a 64.5% accuracy. VM-CERAD was significantly lower in aMCI than among SCI (p: .041). CSF Aβ 1-42 , but not p-Tau 181, level was significantly associated with aMCI. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. SciDB versus Spark: A Preliminary Comparison Based on an Earth Science Use Case

    NASA Astrophysics Data System (ADS)

    Clune, T.; Kuo, K. S.; Doan, K.; Oloso, A.

    2015-12-01

    We compare two Big Data technologies, SciDB and Spark, for performance, usability, and extensibility, when applied to a representative Earth science use case. SciDB is a new-generation parallel distributed database management system (DBMS) based on the array data model that is capable of handling multidimensional arrays efficiently but requires lengthy data ingest prior to analysis, whereas Spark is a fast and general engine for large scale data processing that can immediately process raw data files and thereby avoid the ingest process. Once data have been ingested, SciDB is very efficient in database operations such as subsetting. Spark, on the other hand, provides greater flexibility by supporting a wide variety of high-level tools including DBMS's. For the performance aspect of this preliminary comparison, we configure Spark to operate directly on text or binary data files and thereby limit the need for additional tools. Arguably, a more appropriate comparison would involve exploring other configurations of Spark which exploit supported high-level tools, but that is beyond our current resources. To make the comparison as "fair" as possible, we export the arrays produced by SciDB into text files (or converting them to binary files) for the intake by Spark and thereby avoid any additional file processing penalties. The Earth science use case selected for this comparison is the identification and tracking of snowstorms in the NASA Modern Era Retrospective-analysis for Research and Applications (MERRA) reanalysis data. The identification portion of the use case is to flag all grid cells of the MERRA high-resolution hourly data that satisfies our criteria for snowstorm, whereas the tracking portion connects flagged cells adjacent in time and space to form a snowstorm episode. We will report the results of our comparisons at this presentation.

  2. Development of a Small Molecule P2X7R Antagonist as a Treatment for Acute SCI

    DTIC Science & Technology

    2012-10-01

    in isolated spinal astrocytes and microglia, concentrating on P2X7R activity -dependent transcription. In year 1, we established the injury...astroglia and microglia in response to SCI. Besides defining the effects of P2X7R activation and its blockade on phenotype-specific gene expression...injury (SCI) in isolated spinal astrocytes and microglia, concentrating on P2X7R activity - dependent transcription. In year 1, we established the injury

  3. Fitness and Independence after SCI: Defining Meaningful Change and Thresholds

    DTIC Science & Technology

    2016-10-01

    STATEMENT Approved for Public Release; Distribution Unlimited 13. SUPPLEMENTARY NOTES 14. ABSTRACT Quality of life after SCI/D is depends more on...determine if low fitness is limiting transfer ability. 15. SUBJECT TERMS Spinal Cord Injury, Fitness, Independence, Quality of Life 16. SECURITY... quality of life . Examples include: • data or databases; • physical collections; • audio or video products; • software; • models; • educational aids

  4. Observation of cosmic ray hadrons at the top of the Sierra Negra volcano in Mexico with the SciCRT prototype

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ortiz, E.; Valdés-Galicia, J. F.; Matsubara, Y.

    In this work we report the flux of protons and neutral emission measured at the top of the Sierra Negra volcano at 4600 m.a.s.l. (575 g/cm2), in Eastern Mexico. As an example of the capability of the mini-SciCR as a cosmic ray detector we present the Forbush decrease recorded on March 7, 2012. These data were obtained with a cosmic ray detector prototype called mini-SciCR that was operating from October 2010 to July 2012. Our main aims were to measure the hadronic component flux of the secondary cosmic ray and to show the appropriate performance of all system of themore » detector. To separate the signals of protons from other charged particles we obtained the energy deposition pattern when they cross the detector using a Monte Carlo simulation, and to separate the signals of neutral emission we used an anticoincidence system between the edge bars and the internal bars of the detector. The mini-SciCR is a prototype of a new cosmic ray detector called SciBar Cosmic Ray Telescope (SciCRT) installed in the same place, which is in the process of calibration. The SciCRT will work mainly as a Solar Neutron and Muon Telescope, it is designed to achieve: (1) larger effective area than the current Solar Neutron Telescope, (2) higher energy resolution to determine the energy spectrum of solar neutrons, (3) lower energy threshold, and (4) higher particle identification ability.« less

  5. Observation of cosmic ray hadrons at the top of the Sierra Negra volcano in Mexico with the SciCRT prototype

    DOE PAGES

    Ortiz, E.; Valdés-Galicia, J. F.; Matsubara, Y.; ...

    2016-02-16

    In this study we report the flux of protons and neutral emission measured at the top of the Sierra Negra volcano at 4600 m.a.s.l. (575 g/cm 2), in Eastern Mexico. As an example of the capability of the mini-SciCR as a cosmic ray detector we present the Forbush decrease recorded on March 7, 2012. These data were obtained with a cosmic ray detector prototype called mini-SciCR that was operating from October 2010 to July 2012. Our main aims were to measure the hadronic component flux of the secondary cosmic ray and to show the appropriate performance of all system ofmore » the detector. To separate the signals of protons from other charged particles we obtained the energy deposition pattern when they cross the detector using a Monte Carlo simulation, and to separate the signals of neutral emission we used an anticoincidence system between the edge bars and the internal bars of the detector. The mini-SciCR is a prototype of a new cosmic ray detector called SciBar Cosmic Ray Telescope (SciCRT) installed in the same place, which is in the process of calibration. The SciCRT will work mainly as a Solar Neutron and Muon Telescope, it is designed to achieve: (1) larger effective area than the current Solar Neutron Telescope, (2) higher energy resolution to determine the energy spectrum of solar neutrons, (3) lower energy threshold, and (4) higher particle identification ability.« less

  6. Observation of cosmic ray hadrons at the top of the Sierra Negra volcano in Mexico with the SciCRT prototype

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ortiz, E.; Valdés-Galicia, J. F.; Matsubara, Y.

    In this study we report the flux of protons and neutral emission measured at the top of the Sierra Negra volcano at 4600 m.a.s.l. (575 g/cm 2), in Eastern Mexico. As an example of the capability of the mini-SciCR as a cosmic ray detector we present the Forbush decrease recorded on March 7, 2012. These data were obtained with a cosmic ray detector prototype called mini-SciCR that was operating from October 2010 to July 2012. Our main aims were to measure the hadronic component flux of the secondary cosmic ray and to show the appropriate performance of all system ofmore » the detector. To separate the signals of protons from other charged particles we obtained the energy deposition pattern when they cross the detector using a Monte Carlo simulation, and to separate the signals of neutral emission we used an anticoincidence system between the edge bars and the internal bars of the detector. The mini-SciCR is a prototype of a new cosmic ray detector called SciBar Cosmic Ray Telescope (SciCRT) installed in the same place, which is in the process of calibration. The SciCRT will work mainly as a Solar Neutron and Muon Telescope, it is designed to achieve: (1) larger effective area than the current Solar Neutron Telescope, (2) higher energy resolution to determine the energy spectrum of solar neutrons, (3) lower energy threshold, and (4) higher particle identification ability.« less

  7. The Chemicals of the Earth. Study Guide. Unit F2. ZIM-SCI, Zimbabwe Secondary School Science Project. Year 2.

    ERIC Educational Resources Information Center

    Stocklmayer, Sue

    The Zimbabwe Secondary School Science Project (ZIM-SCI) developed student study guides, corresponding teaching guides, and science kits for a low-cost science course which could be taught during the first 2 years of secondary school without the aid of qualified teachers and conventional laboratories. This ZIM-SCI study guide presents activities…

  8. Living Things and Their Food. Study Guide. Unit G2. ZIM-SCI, Zimbabwe Secondary School Science Project. Year 2.

    ERIC Educational Resources Information Center

    Hosking, Bunty

    The Zimbabwe Secondary School Science Project (ZIM-SCI) developed student study guides, corresponding teaching guides, and science kits for a low-cost science course which could be taught during the first 2 years of secondary school without the aid of qualified teachers and conventional laboratories. This ZIM-SCI study guide presents activities…

  9. Energy Fluctuations Shape Free Energy of Nonspecific Biomolecular Interactions

    NASA Astrophysics Data System (ADS)

    Elkin, Michael; Andre, Ingemar; Lukatsky, David B.

    2012-01-01

    Understanding design principles of biomolecular recognition is a key question of molecular biology. Yet the enormous complexity and diversity of biological molecules hamper the efforts to gain a predictive ability for the free energy of protein-protein, protein-DNA, and protein-RNA binding. Here, using a variant of the Derrida model, we predict that for a large class of biomolecular interactions, it is possible to accurately estimate the relative free energy of binding based on the fluctuation properties of their energy spectra, even if a finite number of the energy levels is known. We show that the free energy of the system possessing a wider binding energy spectrum is almost surely lower compared with the system possessing a narrower energy spectrum. Our predictions imply that low-affinity binding scores, usually wasted in protein-protein and protein-DNA docking algorithms, can be efficiently utilized to compute the free energy. Using the results of Rosetta docking simulations of protein-protein interactions from Andre et al. (Proc. Natl. Acad. Sci. USA 105:16148, 2008), we demonstrate the power of our predictions.

  10. Accurate thermodynamics for short-ranged truncations of Coulomb interactions in site-site molecular models

    NASA Astrophysics Data System (ADS)

    Rodgers, Jocelyn M.; Weeks, John D.

    2009-12-01

    Coulomb interactions are present in a wide variety of all-atom force fields. Spherical truncations of these interactions permit fast simulations but are problematic due to their incorrect thermodynamics. Herein we demonstrate that simple analytical corrections for the thermodynamics of uniform truncated systems are possible. In particular, results for the simple point charge/extended (SPC/E) water model treated with spherically truncated Coulomb interactions suggested by local molecular field theory [J. M. Rodgers and J. D. Weeks, Proc. Natl. Acad. Sci. U.S.A. 105, 19136 (2008)] are presented. We extend the results developed by Chandler [J. Chem. Phys. 65, 2925 (1976)] so that we may treat the thermodynamics of mixtures of flexible charged and uncharged molecules simulated with spherical truncations. We show that the energy and pressure of spherically truncated bulk SPC/E water are easily corrected using exact second-moment-like conditions on long-ranged structure. Furthermore, applying the pressure correction as an external pressure removes the density errors observed by other research groups in NPT simulations of spherically truncated bulk species.

  11. Balanced branching in transcription termination.

    PubMed

    Harrington, K J; Laughlin, R B; Liang, S

    2001-04-24

    The theory of stochastic transcription termination based on free-energy competition [von Hippel, P. H. & Yager, T. D. (1992) Science 255, 809-812 and von Hippel, P. H. & Yager, T. D. (1991) Proc. Natl. Acad. Sci. USA 88, 2307-2311] requires two or more reaction rates to be delicately balanced over a wide range of physical conditions. A large body of work on glasses and large molecules suggests that this balancing should be impossible in such a large system in the absence of a new organizing principle of matter. We review the experimental literature of termination and find no evidence for such a principle, but do find many troubling inconsistencies, most notably, anomalous memory effects. These effects suggest that termination has a deterministic component and may conceivably not be stochastic at all. We find that a key experiment by Wilson and von Hippel [Wilson, K. S. & von Hippel, P. H. (1994) J. Mol. Biol. 244, 36-51] thought to demonstrate stochastic termination was an incorrectly analyzed regulatory effect of Mg(2+) binding.

  12. The mechanism of uncoupling by picrate in Escherichia coli K-12 membrane systems.

    PubMed

    Michels, M; Bakker, E P

    1981-06-01

    The mechanism of action of the uncoupler picrate on intact cells and everted membrane vesicles of Escherichia coli K-12 was investigated. Like in mitochondria [Hanstein, W. G. and Hatefi, Y. (1974) Proc. Natl Acad. Sci. USA, 71, 288-292], it was observed that picrate uncoupled energy-linked functions only in everted, but not in intact membrane systems. In the vesicles picrate also decreased the magnitude of the transmembrane proton-motive force at concentrations similar to those at which it caused uncoupling. Experiments with 14C-labelled picrate showed that this compound bound both to deenergized intact cells and everted vesicles. However, upon energization of the membrane, picrate was extruded from the intact cell and taken up to a larger extent by the vesicles. These energy-dependent changes in picrate uptake correlated with the magnitude of the transmembrane electrical potential, delta psi. It is therefore proposed that picrate is a permeant uncoupler, that delta psi is the driving force for picrate movement across biological membranes, and that the uncoupling activity of picrate in everted membrane systems is due to its protonophoric action.

  13. Searching for the best thermoelectrics through the optimization of transport distribution function

    NASA Astrophysics Data System (ADS)

    Fan, Zheyong; Wang, Hui-Qiong; Zheng, Jin-Cheng

    2011-04-01

    The thermoelectric performance of materials is dependent on the interplay or competition among three key components, the electrical conductivity, thermopower, and thermal conductivity, which can be written as integrals of a single function, the transport distribution function (TDF). Mahan and Sofo [Proc. Natl. Acad. Sci. USA 93, 7436 (1996)] found that, mathematically, the thermoelectric properties could be maximized by a delta-shaped transport distribution, which was associated with a narrow distribution of the energy of the electrons participating in the transport process. In this work, we revisited the shape effect of TDF on thermoelectric figure of merit. It is confirmed both heuristically and numerically that among all the normalized TDF the Dirac delta function leads to the largest thermoelectric figure of merit. Whereas, for the case of TDF being bounded, a rectangular-shape distribution is instead found to be the most favorable one, which could be achieved through nanoroute. Our results also indicate that high thermoelectric figure of merit is associated with appropriate violations of the Wiedemann-Franz law.

  14. Targeting mechanisms of high voltage-activated Ca2+ channels.

    PubMed

    Herlitze, Stefan; Xie, Mian; Han, Jing; Hümmer, Alexander; Melnik-Martinez, Katya V; Moreno, Rosa L; Mark, Melanie D

    2003-12-01

    Functional voltage-dependent Ca2+ channel complexes are assembled by three to four subunits: alpha1, beta, alpha2delta subunits (C. Leveque et al., 1994, J. Biol Chem. 269, 6306-6312; M. W. McEnery et al., 1991, Proc. Natl. Acad. Sci. U.S.A. 88, 11095-11099) and at least in muscle cells also y subunits (B. M. Curtis and W. A. Catterall, 1984, Biochemistry 23, 2113-2118). Ca2+ channels mediate the voltage-dependent Ca2+ influx in subcellular compartments, triggering such diverse processes as neurotransmitter release, dendritic action potentials, excitation-contraction, and excitation-transcription coupling. The targeting of biophysically defined Ca2+ channel complexes to the correct subcellular structures is, thus, critical to proper cell and physiological functioning. Despite their importance, surprisingly little is known about the targeting mechanisms by which Ca2+ channel complexes are transported to their site of function. Here we summarize what we know about the targeting of Ca2+ channel complexes through the cell to the plasma membrane and subcellular structures.

  15. Reevaluation of the effect of ellagic acid on N-methyl-N-nitrosourea DNA alkylation and mutagenicity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lord, H.L.; Josephy, P.D.; Snieckus, V.A.

    N-Methyl-N-nitrosourea (MNU) is a reactive, mutagenic methylating agent. MNU methylates DNA at various sites, including guanine N{sup 7}, guanine O{sup 6}, and adenine N{sup 3}. Dixit and Gold ((1986) Proc. Natl, Acad. Sci. U.S.A. 83, 8039-8043) reported that ellagic acid, a phenolic natural product, inhibited the mutagenicity of MNU in Salmonella typhimurium strain TA 100, inhibited salmon sperm DNA alkylation by ({sup 3}H)MNU, and also greatly reduced the ratio of guanine O{sup 6} to guanine N{sup 7} alkylation. We have examined the MNU-induced alkylation of calf thymus DNA and evaluated the effect of ellagic acid on this binding. Ellagic acidmore » had only a slight effect on total alkylation and did not alter the ratio of methylation at guanine-O{sup 6} and -N{sup 7} positions. In further experiments, ellagic acid did not significantly inhibit MNU mutagenicity. These findings do not support the potential use of ellagic acid as an inhibitor of biological damage induced by nitrosoureas.« less

  16. Universal phase transition in community detectability under a stochastic block model.

    PubMed

    Chen, Pin-Yu; Hero, Alfred O

    2015-03-01

    We prove the existence of an asymptotic phase-transition threshold on community detectability for the spectral modularity method [M. E. J. Newman, Phys. Rev. E 74, 036104 (2006) and Proc. Natl. Acad. Sci. (USA) 103, 8577 (2006)] under a stochastic block model. The phase transition on community detectability occurs as the intercommunity edge connection probability p grows. This phase transition separates a subcritical regime of small p, where modularity-based community detection successfully identifies the communities, from a supercritical regime of large p where successful community detection is impossible. We show that, as the community sizes become large, the asymptotic phase-transition threshold p* is equal to √[p1p2], where pi(i=1,2) is the within-community edge connection probability. Thus the phase-transition threshold is universal in the sense that it does not depend on the ratio of community sizes. The universal phase-transition phenomenon is validated by simulations for moderately sized communities. Using the derived expression for the phase-transition threshold, we propose an empirical method for estimating this threshold from real-world data.

  17. Kinetic studies on the control of the bean rust fungus (Uromyces phaseoli L.) by an inhibitor of polyamine biosynthesis

    NASA Technical Reports Server (NTRS)

    Rajam, M. V.; Weinstein, L. H.; Galston, A. W.

    1986-01-01

    alpha-Difluoromethylornithine (DFMO), a specific and irreversible inhibitor of the polyamine biosynthetic enzyme ornithine decarboxylase, effectively inhibits mycelial growth of several phytopathogenic fungi on defined media in vitro and provides systemic protection of bean plants against infection by Uromyces phaseoli L. race 0 (MV Rajam, AW Galston 1985 Plant Cell Physiol 26: 683-692; MV Rajam et al. 1985 Proc Natl Acad Sci USA 82: 6874-6878). We now find that application of 0.5 millimolar DFMO to unifoliolate leaves of Pinto beans up to 3 days after inoculation with uredospores of U. phaseoli completely inhibits the growth of the pathogen, while application 4 or 5 days after inoculation results in partial protection against the pathogen. Spores do not germinate on the surface of unifoliolate leaves treated with DFMO 1 day before infection, but addition of spermidine to the DFMO treatments partially reverses the inhibitory effect. The titer of polyamines in bean plants did not decline after DFMO treatment; rather, putrescine and spermidine contents actually rose, probably due to the known but paradoxical stimulation of arginine decarboxylase activity by DFMO.

  18. Predicting repeat protein folding kinetics from an experimentally determined folding energy landscape

    PubMed Central

    Street, Timothy O; Barrick, Doug

    2009-01-01

    The Notch ankyrin domain is a repeat protein whose folding has been characterized through equilibrium and kinetic measurements. In previous work, equilibrium folding free energies of truncated constructs were used to generate an experimentally determined folding energy landscape (Mello and Barrick, Proc Natl Acad Sci USA 2004;101:14102–14107). Here, this folding energy landscape is used to parameterize a kinetic model in which local transition probabilities between partly folded states are based on energy values from the landscape. The landscape-based model correctly predicts highly diverse experimentally determined folding kinetics of the Notch ankyrin domain and sequence variants. These predictions include monophasic folding and biphasic unfolding, curvature in the unfolding limb of the chevron plot, population of a transient unfolding intermediate, relative folding rates of 19 variants spanning three orders of magnitude, and a change in the folding pathway that results from C-terminal stabilization. These findings indicate that the folding pathway(s) of the Notch ankyrin domain are thermodynamically selected: the primary determinants of kinetic behavior can be simply deduced from the local stability of individual repeats. PMID:19177351

  19. Correlations between cannabis use and IQ change in the Dunedin cohort are consistent with confounding from socioeconomic status

    PubMed Central

    Rogeberg, Ole

    2013-01-01

    Does cannabis use have substantial and permanent effects on neuropsychological functioning? Renewed and intense attention to the issue has followed recent research on the Dunedin cohort, which found a positive association between, on the one hand, adolescent-onset cannabis use and dependence and, on the other hand, a decline in IQ from childhood to adulthood [Meier et al. (2012) Proc Natl Acad Sci USA 109(40):E2657–E2664]. The association is given a causal interpretation by the authors, but existing research suggests an alternative confounding model based on time-varying effects of socioeconomic status on IQ. A simulation of the confounding model reproduces the reported associations from the Dunedin cohort, suggesting that the causal effects estimated in Meier et al. are likely to be overestimates, and that the true effect could be zero. Further analyses of the Dunedin cohort are proposed to distinguish between the competing interpretations. Although it would be too strong to say that the results have been discredited, the methodology is flawed and the causal inference drawn from the results premature. PMID:23319626

  20. Estimating Energy Conversion Efficiency of Thermoelectric Materials: Constant Property Versus Average Property Models

    NASA Astrophysics Data System (ADS)

    Armstrong, Hannah; Boese, Matthew; Carmichael, Cody; Dimich, Hannah; Seay, Dylan; Sheppard, Nathan; Beekman, Matt

    2017-01-01

    Maximum thermoelectric energy conversion efficiencies are calculated using the conventional "constant property" model and the recently proposed "cumulative/average property" model (Kim et al. in Proc Natl Acad Sci USA 112:8205, 2015) for 18 high-performance thermoelectric materials. We find that the constant property model generally predicts higher energy conversion efficiency for nearly all materials and temperature differences studied. Although significant deviations are observed in some cases, on average the constant property model predicts an efficiency that is a factor of 1.16 larger than that predicted by the average property model, with even lower deviations for temperature differences typical of energy harvesting applications. Based on our analysis, we conclude that the conventional dimensionless figure of merit ZT obtained from the constant property model, while not applicable for some materials with strongly temperature-dependent thermoelectric properties, remains a simple yet useful metric for initial evaluation and/or comparison of thermoelectric materials, provided the ZT at the average temperature of projected operation, not the peak ZT, is used.

  1. Role of interference in the photosynthetic heat engine

    NASA Astrophysics Data System (ADS)

    Xu, Y. Y.; Liu, J.

    2014-11-01

    The observation of quantum coherence in pigment-protein complexes has attracted considerable interest. One such endeavor entails applying a quantum heat engine to model the photosynthetic reaction center, but the definition of work used is inconsistent with that defined in quantum thermodynamics. Using the definition of work proposed in Weimer et al. [Europhys. Lett. 83, 30008 (2008), 10.1209/0295-5075/83/30008], we investigated two proposals for enhancing the performance of the photosynthetic reaction center. In proposal A, which is similar to that in Dorfman et al. [Proc. Natl. Acad. Sci. USA 110, 2746 (2013), 10.1073/pnas.1212666110], we found that the power and current-voltage characteristic of the heat engine can be increased by Fano interference but the efficiency cannot. In proposal B, which is similar to that in Creatore et al. [Phys. Rev. Lett. 111, 253601 (2013), 10.1103/PhysRevLett.111.253601], we found that the mechanism of strengthening the performance of the heat engine is invalid; i.e., the dipole-dipole interaction between two electron donors could not increase the power, efficiency, or current-voltage characteristic.

  2. Inversions and inverted transpositions as the basis for an almost universal "format" of genome sequences.

    PubMed

    Albrecht-Buehler, Guenter

    2007-09-01

    In genome duplexes that exceed 100 kb the frequency distributions of their trinucleotides (triplet profiles) are the same in both strands. This remarkable symmetry, sometimes called Chargaff's second parity rule, is not the result of base pairing, but can be explained as the result of countless inversions and inverted transpositions that occurred throughout evolution (G. Albrecht-Buehler, 2006, Proc. Natl. Acad. Sci. USA 103, 17828-17833). Furthermore, comparing the triplet profiles of genomes from a large number of different taxa and species revealed that they were not only strand-symmetrical, but even surprisingly similar to one another (majority profile; G. Albrecht-Buehler, 2007, Genomics 89, 596-601). The present article proposes that the same inversion/transposition mechanism(s) that created the strand symmetry may also explain the existence of the majority profile. Thus they may be key factors in the creation of an almost universal "format" in which genome sequences are written. One may speculate that this universality of genome format may facilitate horizontal gene transfer and, thus, accelerate evolution.

  3. Dynamic neutron scattering from conformational dynamics. I. Theory and Markov models

    NASA Astrophysics Data System (ADS)

    Lindner, Benjamin; Yi, Zheng; Prinz, Jan-Hendrik; Smith, Jeremy C.; Noé, Frank

    2013-11-01

    The dynamics of complex molecules can be directly probed by inelastic neutron scattering experiments. However, many of the underlying dynamical processes may exist on similar timescales, which makes it difficult to assign processes seen experimentally to specific structural rearrangements. Here, we show how Markov models can be used to connect structural changes observed in molecular dynamics simulation directly to the relaxation processes probed by scattering experiments. For this, a conformational dynamics theory of dynamical neutron and X-ray scattering is developed, following our previous approach for computing dynamical fingerprints of time-correlation functions [F. Noé, S. Doose, I. Daidone, M. Löllmann, J. Chodera, M. Sauer, and J. Smith, Proc. Natl. Acad. Sci. U.S.A. 108, 4822 (2011)]. Markov modeling is used to approximate the relaxation processes and timescales of the molecule via the eigenvectors and eigenvalues of a transition matrix between conformational substates. This procedure allows the establishment of a complete set of exponential decay functions and a full decomposition into the individual contributions, i.e., the contribution of every atom and dynamical process to each experimental relaxation process.

  4. Representing perturbed dynamics in biological network models

    NASA Astrophysics Data System (ADS)

    Stoll, Gautier; Rougemont, Jacques; Naef, Felix

    2007-07-01

    We study the dynamics of gene activities in relatively small size biological networks (up to a few tens of nodes), e.g., the activities of cell-cycle proteins during the mitotic cell-cycle progression. Using the framework of deterministic discrete dynamical models, we characterize the dynamical modifications in response to structural perturbations in the network connectivities. In particular, we focus on how perturbations affect the set of fixed points and sizes of the basins of attraction. Our approach uses two analytical measures: the basin entropy H and the perturbation size Δ , a quantity that reflects the distance between the set of fixed points of the perturbed network and that of the unperturbed network. Applying our approach to the yeast-cell-cycle network introduced by Li [Proc. Natl. Acad. Sci. U.S.A. 101, 4781 (2004)] provides a low-dimensional and informative fingerprint of network behavior under large classes of perturbations. We identify interactions that are crucial for proper network function, and also pinpoint functionally redundant network connections. Selected perturbations exemplify the breadth of dynamical responses in this cell-cycle model.

  5. Quasi-Axially Symmetric Stellarators with 3 Field Periods

    NASA Astrophysics Data System (ADS)

    Garabedian, Paul; Ku, Long-Poe

    1998-11-01

    Compact hybrid configurations with 2 field periods have been studied recently as candidates for a proof of principle experiment at PPPL, cf. A. Reiman et al., Physics design of a high beta quasi-axially symmetric stellarator, J. Plas. Fus. Res. SERIES 1, 429(1998). This enterprise has led us to the discovery of a family of quasi-axially symmetric stellarators with 3 field periods that seem to have significant advantages, although their aspect ratios are a little larger. They have reversed shear and perform better in a local analysis of ballooning modes. Nonlinear equilibrium and stability calculations predict that the average beta limit may be as high as 6% if the bootstrap current turns out to be as big as that expected in comparable tokamaks. The concept relies on a combination of helical fields and bootstrap current to achieve adequate rotational transform at low aspect ratio. A detailed manuscript describing some of this work will be published soon, cf. P.R. Garabedian, Quasi-axially symmetric stellarators, Proc. Natl. Acad. Sci. USA 95 (1998).

  6. Evidence for an intense solar outburst in prehistory

    NASA Astrophysics Data System (ADS)

    Peratt, A. L.; Yao, W. F.

    2008-10-01

    A past intense solar outburst and its effect on Earth was proposed by Gold (1962 Pontificiae Acad. Sci. Scr. Varia 25 159) who, along with others, based his hypotheses on strong astronomical and geophysical evidence. The discovery that objects from the Neolithic or Early Bronze Age carry patterns associated with high-current Z-pinches, as would result from an intense plasma impinging Earth, provides a possible insight into the origin and meaning of these ancient symbols produced by humans. Peratt (2003 Trans. Plasma Sci. 31 1192) dealt with the comparison of graphical and radiation data from high-current Z-pinches to petroglyphs, geoglyphs and megaliths. Peratt (2007 Trans. Plasma Sci. 35 778) focused primarily, but not exclusively, on petroglyphs of some 84 different morphologies; pictures found in laboratory experiments and carved on rock. These corresponded to mankind's visual observations of ancient aurora as might be produced if the solar wind had increased at times between one and two orders of magnitude, millennia ago (Gold 1962 Pontificiae Acad. Sci. Scr. Varia 25 159). In Peratt (2007 Trans. Plasma Sci. 35 778), the data were given on the source of light and its temporal change from a current-increasing Z-pinch or dense plasma focus aurora. Orientation and field-of-view data are given as surveyed and contributed from 139 countries, from sites and fields containing several millions of these objects, the latest data coming from a 300 km survey along the Orinoco river basin in Venezuela. In this paper, we include additional petroglyph figures derivable from experiment and computer. This information allows a reconstruction of the auroral form presumably associated with extreme geomagnetic storms and shows, based on existent geophysical evidence, relativistic electron flow inward at Earth's south polar axis and hypervelocity proton impacts around the north polar axis.

  7. Mapping the scientific research on non-point source pollution: a bibliometric analysis.

    PubMed

    Yang, Beibei; Huang, Kai; Sun, Dezhi; Zhang, Yue

    2017-02-01

    A bibliometric analysis was conducted to examine the progress and future research trends of non-point source (NPS) pollution during the years 1991-2015 based on the Science Citation Index Expanded (SCI-Expanded) of Web of Science (WoS). The publications referencing NPS pollution were analyzed including the following aspects: document type, publication language, publication output and characteristics, subject category, source journal, distribution of country and institution, author keywords, etc. The results indicate that the study of NPS pollution demonstrated a sharply increasing trend since 1991. Article and English were the most commonly used document type and language. Environmental sciences and ecology, water resources, and engineering were the top three subject categories. Water science and technology ranked first in distribution of journal, followed by Science of the total environment and Environmental Monitoring and Assessment. The USA took a leading position in both quantity and quality, playing an important role in the research field of NPS pollution, followed by the UK and China. The most productive institution was the Chinese Academy of Sciences (Chinese Acad Sci), followed by Beijing Normal University and US Department of Agriculture's Agricultural Research Service (USDA ARS). The analysis of author keywords indicates that the major hotspots of NPS pollution from 1991 to 2015 contained "water," "model," "agriculture," "nitrogen," "phosphorus," etc. The results provide a comprehensive understanding of NPS pollution research and help readers to establish the future research directions.

  8. Effect of COX-2 (PGE2) and IL-6 on Prostate Cancer Bone Metastases

    DTIC Science & Technology

    2008-02-02

    to stimulate both bone targeting and bone reaction (4). Several factors, such as basic fibroblast growth factor (4), osteocalcin, bone sialoprotein (8...Proc Natl Acad Sci U S A 1990;87:75–9. 8. Huang WC, Xie Z, Konaka H, Sodek J, Zhau HE, Chung LWK. Human osteocalcin and bone sialoprotein medi- ating

  9. Targeted Nanoparticles for Kidney Cancer Therapy

    DTIC Science & Technology

    2012-10-01

    24 hrs. Clonogenic survival was assessed 7-10 days after CNT incubation after plating 200-300 cells/well (Figure 7). Similar trends were seen using... ferritin on angiogenesis. Proc Natl Acad Sci U S A. 2009;106(2):570-5. PMCID: 2626744. 4. Burke A, Ding X, Singh R, Kraft RA, Levi-Polyachenko N, Rylander

  10. Early Detection of Breast Cancer Using Posttranslationally Modified Biomarkers

    DTIC Science & Technology

    2011-03-01

    1 and 2 in Globo H synthesis , Proc Natl Acad Sci U S A 105, 11667-11672. 18. Gilewski, T., Ragupathi, G., Bhuta, S., Williams, L. J., Musselli, C...carmustine and new proline analog of nitrosourea on antioxidant system in breast carcinoma cells (MCF-7), Drug Chem Toxicol 33, 55-63. 34. Galijasevic, S

  11. Possible Effects of Noise from Offshore Oil and Gas Drilling Activities on Marine Mammals: A Survey of the Literature

    DTIC Science & Technology

    1982-01-01

    in Baleen Whales, New York Acad Sci, 188, p 110-141, 1971. 61 Penner, RI and J Kadane, Tursiops Biosonar Detection in Noise, In: Animal Sonar Systems... Biosonar Detection in Noise, In: Animal Sonar Systems, RF Busnel and JF Fish, eds, p 957-959, Plenum Press, 1980. 62. Nishiwake, M and A Sasao, Human

  12. Involvement and Regulation of Heparanase in Prostate Cancer Progression

    DTIC Science & Technology

    2007-02-01

    1995). On the other hand, some promoters are negatively regulated by wt p53. These include MMP-1 (Sun et al., 1999), alpha - fetoprotein (Lee et al...necrosis factor alpha is formed from the extracellular matrix by the enzyme heparanase. Proc Natl Acad Sci U S A. 1995;92: 5037-5041. 29. Zcharia E

  13. Clinical Trial of AC105 (Mg/PEG) for Treatment of Acute Spinal Cord Injury (SCI). Phase 2

    DTIC Science & Technology

    2013-10-01

    glycol with a molecular weight of 3350 Daltons ( PEG 3350 ), is manufactured by Dow Chemical Company and complies with NF, FCC and EurPh requirements...Mg/ PEG ) for Treatment of Acute Spinal Cord Injury (SCI) PRINCIPAL INVESTIGATOR: Andrew Blight, PhD RECIPIENT: Acorda Therapeutics...of AC105 (Mg/ PEG ) for Treatment of Acute Spinal Cord Injury (SCI) 5b. GRANT NUMBER W81XWH-12-2 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) 5d

  14. Methane concentrations in water wells unrelated to proximity to existing oil and gas wells in northeastern Pennsylvania.

    PubMed

    Siegel, Donald I; Azzolina, Nicholas A; Smith, Bert J; Perry, A Elizabeth; Bothun, Rikka L

    2015-04-07

    Recent studies in northeastern Pennsylvania report higher concentrations of dissolved methane in domestic water wells associated with proximity to nearby gas-producing wells [ Osborn et al. Proc. Natl. Acad. Sci. U. S. A. 2011 , 108 , 8172 ] and [ Jackson et al. Proc. Natl. Acad. Sci. U. S. A. , 2013 , 110 , 11250 ]. We test this possible association by using Chesapeake Energy's baseline data set of over 11,300 dissolved methane analyses from domestic water wells, densely arrayed in Bradford and nearby counties (Pennsylvania), and near 661 pre-existing oil and gas wells. The majority of these, 92%, were unconventional wells, drilled with horizontal legs and hydraulically fractured. Our data set is hundreds of times larger than data sets used in prior studies. In contrast to prior findings, we found no statistically significant relationship between dissolved methane concentrations in groundwater from domestic water wells and proximity to pre-existing oil or gas wells. Previous analyses used small sample sets compared to the population of domestic wells available, which may explain the difference in prior findings compared to ours.

  15. MiR-103 alleviates autophagy and apoptosis by regulating SOX2 in LPS-injured PC12 cells and SCI rats.

    PubMed

    Li, Guowei; Chen, Tao; Zhu, Yingxian; Xiao, Xiaoyu; Bu, Juyuan; Huang, Zongwen

    2018-03-01

    Recent studies revealed that microRNAs (miRNAs) may play crucial roles in the responses and pathologic processes of spinal cord injury (SCI). This study aimed to investigate the effect and the molecular basis of miR-103 on LPS-induced injuries in PC12 cells in vitro and SCI rats in vivo . PC12 cells were exposed to LPS to induce cell injuries to mimic the in vitro model of SCI. The expression of miR-103 and SOX2 in PC12 cells were altered by transient transfections. Cell viability and apoptotic cell rate were measured by CCK-8 assay and flow cytometry assay. Furthermore, Western blot analysis was performed to detect the expression levels of apoptosis- and autophagy- related proteins, MAPK/ERK pathway- and JAK/STAT pathway-related proteins. In addition, we also assessed the effect of miR-103 agomir on SCI rats. LPS exposure induced cell injuries in PC12 cells. miR-103 overexpression significantly increased cell viability, reduced cell apoptosis and autophagy, and opposite results were observed in miR-103 inhibition. miR-103 attenuated LPS-induced injuries by indirect upregulation of SOX2. SOX2 overexpression protected PC12 cells against LPS-induced injuries, while SOX2 inhibition expedited LPS-induced cell injuries. Furthermore, miR-103 overexpression inhibited MAPK/ERK pathway and JAK/STAT pathway through upregulation of SOX2. We also found that miR-103 agomir inhibited cell apoptosis and autophagy in SCI rats. This study demonstrates that miR-103 may represent a protective effect against cell apoptosis and autophagy in LPS-injured PC12 cells and SCI rats by upregulation of SOX2 expression.

  16. Developing a spinal cord injury research strategy using a structured process of evidence review and stakeholder dialogue. Part I: rapid review of SCI prioritisation literature.

    PubMed

    Bragge, P; Piccenna, L; Middleton, J W; Williams, S; Creasey, G; Dunlop, S; Brown, D; Gruen, R L

    2015-10-01

    This is a rapid evidence review. The objective of this study was to gain an overview of the volume, nature and findings of studies regarding priorities for spinal cord injury (SCI) research. A worldwide literature search was conducted. Six medical literature databases and Google Scholar were searched for reviews in which the primary aim was to identify SCI research priorities. Two systematic reviews were identified-one of quantitative and one of qualitative studies. The quality of the reviews was variable. Collectively, the reviews identified 31 primary studies; 24 quantitative studies totalling 5262 participants and 7 qualitative studies totalling 120 participants. Despite the difference in research paradigms, there was convergence in review findings in the areas of body impairments and relationships. The vast majority of literature within the reviews focused on the SCI patient perspective. The reviews inform specific research topics and highlight other important research considerations, most notably those pertaining to SCI patients' perspectives on quality of life, which may be of use in determining meaningful research outcome measures. The views of other SCI research stakeholders such as researchers, clinicians, policymakers, funders and carers would help shape a bigger picture of SCI research priorities, ultimately optimising research outputs and translation into clinical practice and health policy change. Review findings informed subsequent activities in developing a regional SCI research strategy, as described in two companion papers. This project was funded by the Victorian Transport Accident Commission and the Australian and New Zealand SCI Network.

  17. What are the best ways to look for extinct or extant life on mars? Thinking outside the box

    NASA Astrophysics Data System (ADS)

    Bada, J. L.; Grunthaner, F.; Mathies, R.

    2003-12-01

    natural field situation such as this should be considered for components for a future Mars mission payload package. If an instrument can not detect the presence of life's organic signature here on Earth, there is no justification for flying this instrument in a payload to Mars! NIH and DOE embarked upon a similar critical competition to development the best methodology to sequence the human genome and this process was dramically successful. NASA's search for possible signs of life on Mars deserves at the same level of critical and competitive decision-making where scientific capability rather than other factors determine what is included in payloads. 1. B. P. Weiss et al, Proc. Natl Acad. Sci USA 97, 1395 (2000). 2. S. A. Benner et al, Proc. Natl Acad. Sci USA 97, 2425 (2000). 3. D. P. Glavin et al, Earth Planet. Sci. Lettrs. 185, 1 (2001).

  18. Reactions of the rat musculoskeletal system to compressive spinal cord injury (SCI) and whole body vibration (WBV) therapy

    PubMed Central

    Schwarz, A.; Pick, C.; Harrach, R.; Stein, G.; Bendella, H.; Ozsoy, O.; Ozsoy, U.; Schoenau, E.; Jaminet, P.; Sarikcioglu, L.; Dunlop, S.; Angelov, D.N.

    2015-01-01

    Traumatic spinal cord injury (SCI) causes a loss of locomotor function with associated compromise of the musculo-skeletal system. Whole body vibration (WBV) is a potential therapy following SCI, but little is known about its effects on the musculo-skeletal system. Here, we examined locomotor recovery and the musculo-skeletal system after thoracic (T7-9) compression SCI in adult rats. Daily WBV was started at 1, 7, 14 and 28 days after injury (WBV1-WBV28 respectively) and continued over a 12-week post-injury period. Intact rats, rats with SCI but no WBV (sham-treated) and a group that received passive flexion and extension (PFE) of their hind limbs served as controls. Compared to sham-treated rats, neither WBV nor PFE improved motor function. Only WBV14 and PFE improved body support. In line with earlier studies we failed to detect signs of soleus muscle atrophy (weight, cross sectional diameter, total amount of fibers, mean fiber diameter) or bone loss in the femur (length, weight, bone mineral density). One possible explanation is that, despite of injury extent, the preservation of some axons in the white matter, in combination with quadripedal locomotion, may provide sufficient trophic and neuronal support for the musculoskeletal system. PMID:26032204

  19. Reactions of the rat musculoskeletal system to compressive spinal cord injury (SCI) and whole body vibration (WBV) therapy.

    PubMed

    Schwarz, A; Pick, C; Harrach, R; Stein, G; Bendella, H; Ozsoy, O; Ozsoy, U; Schoenau, E; Jaminet, P; Sarikcioglu, L; Dunlop, S; Angelov, D N

    2015-06-01

    Traumatic spinal cord injury (SCI) causes a loss of locomotor function with associated compromise of the musculo-skeletal system. Whole body vibration (WBV) is a potential therapy following SCI, but little is known about its effects on the musculo-skeletal system. Here, we examined locomotor recovery and the musculo-skeletal system after thoracic (T7-9) compression SCI in adult rats. Daily WBV was started at 1, 7, 14 and 28 days after injury (WBV1-WBV28 respectively) and continued over a 12-week post-injury period. Intact rats, rats with SCI but no WBV (sham-treated) and a group that received passive flexion and extension (PFE) of their hind limbs served as controls. Compared to sham-treated rats, neither WBV nor PFE improved motor function. Only WBV14 and PFE improved body support. In line with earlier studies we failed to detect signs of soleus muscle atrophy (weight, cross sectional diameter, total amount of fibers, mean fiber diameter) or bone loss in the femur (length, weight, bone mineral density). One possible explanation is that, despite of injury extent, the preservation of some axons in the white matter, in combination with quadripedal locomotion, may provide sufficient trophic and neuronal support for the musculoskeletal system.

  20. Langevin Theory of Anomalous Brownian Motion Made Simple

    ERIC Educational Resources Information Center

    Tothova, Jana; Vasziova, Gabriela; Glod, Lukas; Lisy, Vladimir

    2011-01-01

    During the century from the publication of the work by Einstein (1905 "Ann. Phys." 17 549) Brownian motion has become an important paradigm in many fields of modern science. An essential impulse for the development of Brownian motion theory was given by the work of Langevin (1908 "C. R. Acad. Sci.", Paris 146 530), in which he proposed an…

  1. Genome-wide Analysis of Germline CNPs and SNPs in Prostate Cancer

    DTIC Science & Technology

    2010-03-01

    colorectal adenomas. Proc Natl Acad Sci U S A. 2004 Nov 9;101(45):15992-7. 12) Iliopoulos D, Guler G, Han SY, Druck T, Ottey M, McCorkell KA...SNPs and copy number variation. Nat Genet. 2008 Oct;40(10):1166-74. 17) Qin HR, Iliopoulos D, Semba S, Fabbri M, Druck T, Volinia S, Croce CM

  2. New Organisational Structures and the Transformation of Academic Work

    ERIC Educational Resources Information Center

    Nyhagen, Gigliola Mathisen; Baschung, Lukas

    2013-01-01

    This article will particularly focus on Norway and the consequences for academic work. Frequently in studies of academic work, focus has been on academics' individual autonomy and to what extent the latter is challenged (Altbach in "Ann Am Acad Pol Soc Sci" 448:1-14, 1980; Shattock in "High Educ" 41:27-47, 2001). One of the…

  3. Systematic Characterization of the Molecular Mechanisms That Regulate and Mediate Alternative Lengthening of Telomeres in Breast Carcinoma

    DTIC Science & Technology

    2013-04-01

    2009). 14. L. J. Ng, J. E. Cropley , H. A. Pickett, R. R. Reddel, C. M. Suter, Telomerase activity is associated with an increase in DNA methylation...bodies. Proc Natl Acad Sci U S A 100: 10635–10640. 38. Ng LJ, Cropley JE, Pickett HA, Reddel RR, Suter CM (2009) Telomerase activity is associated with an

  4. Treatment of Neuropathic Pain after SCI with a Catalytic Oxidoreductant

    DTIC Science & Technology

    2014-10-01

    Ashcraft,1 Ping Fan,4 Dewhirst, M. W.,1 David S. Warner,2 Zeljko Vujaskovic,4 Ines Batinic-Haberle1 and Ivan Spasojevic,6* Departments of Radiation...Subcontract project management and oversee the mouse SCI induction OTHER FUNDING SUPPORT DUKE NAME IVAN SPASOJEVICK, PH.D. PROJECT ROLE CO-I...Fan,4 Dewhirst, M. W.,1 David S. Warner,2 Zeljko Vujaskovic,4 Ines Batinic-Haberle1 and Ivan Spasojevic,6* Departments of Radiation Oncology,1

  5. FES-Rowing versus Zoledronic Acid to Improve Bone Health in SCI

    DTIC Science & Technology

    2015-10-01

    although the risk is high in this population of osteoporosis -related bone fracture. This study aims to learn if the severe osteoporosis in lower... Osteoporosis , FES-rowing, zoledronic acid, exercise, bone health 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18. NUMBER OF PAGES 19a...9 Introduction Serious spinal cord injury (SCI) causes osteoporosis in the lower extremities, significantly increasing

  6. Measuring resilience after spinal cord injury: Development, validation and psychometric characteristics of the SCI-QOL Resilience item bank and short form.

    PubMed

    Victorson, David; Tulsky, David S; Kisala, Pamela A; Kalpakjian, Claire Z; Weiland, Brian; Choi, Seung W

    2015-05-01

    To describe the development and psychometric properties of the Spinal Cord Injury--Quality of Life (SCI-QOL) Resilience item bank and short form. Using a mixed-methods design, we developed and tested a resilience item bank through the use of focus groups with individuals with SCI and clinicians with expertise in SCI, cognitive interviews, and item-response theory based analytic approaches, including tests of model fit and differential item functioning (DIF). We tested a 32-item pool at several medical institutions across the United States, including the University of Michigan, Kessler Foundation, the Rehabilitation Institute of Chicago, the University of Washington, Craig Hospital and the James J. Peters/Bronx Department of Veterans Affairs medical center. A total of 717 individuals with SCI completed the Resilience items. A unidimensional model was observed (CFI=0.968; RMSEA=0.074) and measurement precision was good (theta range between -3.1 and 0.9). Ten items were flagged for DIF, however, after examination of effect sizes we found this to be negligible with little practical impact on score estimates. The final calibrated item bank resulted in 21 retained items. This study indicates that the SCI-QOL Resilience item bank represents a psychometrically robust measurement tool. Short form items are also suggested and computer adaptive tests are available.

  7. Family dynamics and psychosocial functioning in children with SCI/D from Colombia, South America

    PubMed Central

    Nicolais, Christina J.; Perrin, Paul B.; Panyavin, Ivan; Nicholls, Elizabeth G.; Olivera Plaza, Silvia Leonor; Quintero, Lorena Medina; Arango-Lasprilla, Juan Carlos

    2016-01-01

    Objective The purpose of this study was to examine the connections between family dynamics and the psychosocial functioning of children with spinal cord injuries and disorders (SCI/D). Design Cross-sectional. Setting Participants were recruited from communities in Neiva, Colombia. Participants Thirty children with SCI/D and their primary caregiver participated. Children were between 8 and 17 years of age, and had sustained their injury at least six months prior to data collection. Interventions NA. Outcome measures Participating children completed measures assessing their own psychosocial functioning (Children's Depression Inventory, Revised Children's Manifest Anxiety Scale-2, Pediatric Quality of Life Inventory), and their primary caregiver completed measures of family dynamics (Family Adaptability and Cohesion Evaluation Scale- Fourth Edition, Family Communication Scale, Family Assessment Device- General Functioning, Family Satisfaction Scale, Relationship-Focused Coping Scale). Results A correlation matrix showed a number of significant bivariate correlations between child and family variables, and three multiple regressions showed that family satisfaction, empathy, and flexibility significantly explained 27% of the variance in child worry; family satisfaction and communication explained 18% of the variance in child social anxiety; and family cohesion and communication explained 23% of the variance in child emotional functioning. Conclusions These findings highlight the importance of rehabilitation professionals considering the association between family dynamics and the psychosocial functioning of children with SCI/D when working with this population. PMID:25582185

  8. Immunogenicity of Sci-B-Vac (a Third-Generation Hepatitis B Vaccine) in HIV-Positive Adults.

    PubMed

    Alon, Danny; Stein, Gideon Y; Hadas-Golan, Vered; Tau, Luba; Brosh, Tal; Turner, Dan

    2017-03-01

    Guidelines recommend hepatitis B virus (HBV) vaccination of all adults positive for human immunodeficiency virus (HIV). Immune responses to single-antigen HBV vaccine among HIV-positive patients are low when compared with HIV-negative adults. Sci-B-Vac™ is a recombinant third-generation HBV that may be advantageous in this population. To examine the immune responses to Sci-B-Vac among HIV-positive adults. We conducted a prospective cohort study involving HIV-positive adults who had negative HBV serology (HBSAg, HBSAb, HBcoreAb). Sci-B-Vac at 10 µg/dose was administered intramuscularly upon recruitment and after 1 and 6 months. HBSAb levels were checked 1 month after each dose; a level > 10 mlU/ml was considered protective. Data regarding age, gender, CD4 level, and viral load were collected. The study group comprised 31 patients. Average CD4 count was 503 ± 281 cells/ml, and average viral load was 44 copies/ml. Median interquartile range (IQR) HBVAb titers after the first, second and third immunizations were 0 (0, 3.5), 30 (6, 126) and 253 (81, 408) mlU/ml. Significant titer elevations were found between the second and third immunizations (P = 0.0003). The rate of patients considered protected was 16% after the first, 65% after the second (P < 0.0001), and 84% after the third dose (P = 0.045). No adverse events were reported. More patients under the age of 40 years responded to the first immunization (28% vs. 0%, P = 0.038). CD4 level had no influence on immunization rates. Sci-B-Vac might achieve better immunization rates among HIV-positive adults compared to the single-antigen vaccine and thus deserves further evaluation in a randomized, double-blind study in this population.

  9. Complete spinal cord injury (SCI) transforms how brain derived neurotrophic factor (BDNF) affects nociceptive sensitization.

    PubMed

    Huang, Yung-Jen; Lee, Kuan H; Grau, James W

    2017-02-01

    Noxious stimulation can induce a lasting increase in neural excitability within the spinal cord (central sensitization) that can promote pain and disrupt adaptive function (maladaptive plasticity). Brain-derived neurotrophic factor (BDNF) is known to regulate the development of plasticity and has been shown to impact the development of spinally-mediated central sensitization. The latter effect has been linked to an alteration in GABA-dependent inhibition. Prior studies have shown that, in spinally transected rats, exposure to regular (fixed spaced) stimulation can counter the development of maladaptive plasticity and have linked this effect to an up-regulation of BDNF. Here it is shown that application of the irritant capsaicin to one hind paw induces enhanced mechanical reactivity (EMR) after spinal cord injury (SCI) and that the induction of this effect is blocked by pretreatment with fixed spaced shock. This protective effect was eliminated if rats were pretreated with the BDNF sequestering antibody TrkB-IgG. Intrathecal (i.t.) application of BDNF prevented, but did not reverse, capsaicin-induced EMR. BDNF also attenuated cellular indices (ERK and pERK expression) of central sensitization after SCI. In uninjured rats, i.t. BDNF enhanced, rather than attenuated, capsaicin-induced EMR and ERK/pERK expression. These opposing effects were related to a transformation in GABA function. In uninjured rats, BDNF reduced membrane-bound KCC2 and the inhibitory effect of the GABA A agonist muscimol. After SCI, BDNF increased KCC2 expression, which would help restore GABAergic inhibition. The results suggest that SCI transforms how BDNF affects GABA function and imply that the clinical usefulness of BDNF will depend upon the extent of fiber sparing. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Genomic and transcriptomic differences in community acquired methicillin resistant Staphylococcus aureus USA300 and USA400 strains.

    PubMed

    Jones, Marcus B; Montgomery, Christopher P; Boyle-Vavra, Susan; Shatzkes, Kenneth; Maybank, Rosslyn; Frank, Bryan C; Peterson, Scott N; Daum, Robert S

    2014-12-19

    Staphylococcus aureus is a human pathogen responsible for substantial morbidity and mortality through its ability to cause a number of human infections including bacteremia, pneumonia and soft tissue infections. Of great concern is the emergence and dissemination of methicillin-resistant Staphylococcus aureus strains (MRSA) that are resistant to nearly all β-lactams. The emergence of the USA300 MRSA genetic background among community associated S. aureus infections (CA-MRSA) in the USA was followed by the disappearance of USA400 CA-MRSA isolates. To gain a greater understanding of the potential fitness advantages and virulence capacity of S. aureus USA300 clones, we performed whole genome sequencing of 15 USA300 and 4 USA400 clinical isolates. A comparison of representative genomes of the USA300 and USA400 pulsotypes indicates a number of differences in mobile genome elements. We examined the in vitro gene expression profiles by microarray hybridization and the in vivo transcriptomes during lung infection in mice of a USA300 and a USA400 MRSA strain by performing complete genome qRT-PCR analysis. The unique presence and increased expression of 6 exotoxins in USA300 (12- to 600-fold) compared to USA400 may contribute to the increased virulence of USA300 clones. Importantly, we also observed the up-regulation of prophage genes in USA300 (compared with USA400) during mouse lung infection (including genes encoded by both prophages ΦSa2usa and ΦSa3usa), suggesting that these prophages may play an important role in vivo by contributing to the elevated virulence characteristic of the USA300 clone. We observed differences in the genetic content of USA300 and USA400 strains, as well as significant differences of in vitro and in vivo gene expression of mobile elements in a lung pneumonia model. This is the first study to document the global transcription differences between USA300 and USA400 strains during both in vitro and in vivo growth.

  11. Foundations of Nuclear Geophysics

    NASA Astrophysics Data System (ADS)

    Herndon, J. M.; Hollenbach, D. F.

    2002-05-01

    , their causes and implications, will be discussed in the presentation. Also, the current state of investigations into additional deep-Earth nuclear fission signatures will be presented. References: J. M. Herndon, Proc. R. Roc. London, Ser. A, 368 (1979) 495; J. Geomagn. Geoelectr. 45 (1993) 423; Proc. R. Soc. London, Ser. A, 445 (1994) 453; Proc. Nat. Acad. Sci. (USA) 93 (1996) 646. Hollenbach, D. F. and J. M. Herndon, Proc. Nat. Acad. Sci. (USA) 98 (2001) 11085.

  12. Multiple mediation path model of pain's cascading influence on physical disability in individuals with SCI from Colombia, South America.

    PubMed

    Perrin, Paul B; Paredes, Alejandra Morlett; Olivera, Silvia Leonor; Lozano, Juan Esteban; Leal, Wendy Tatiana; Ahmad, Usman F; Arango-Lasprilla, Juan Carlos

    2017-01-01

    Research has begun to document the bivariate connections between pain in individuals with spinal cord injury (SCI) and various aspects of health related quality of life (HRQOL), such as fatigue, social functioning, mental health, and physical functioning. The purpose of this study was to construct and test a theoretical path model illuminating the stage-wise and sequential (cascading) HRQOL pathways through which pain increases physical disability in individuals with SCI in a sample from Colombia, South America. It was hypothesized that increased pain would lead to decreased energy, which would lead to decreased mental health and social functioning, which both would lead to emotional role limitations, which finally would lead to physical role limitations. A cross-sectional study assessed individuals with SCI (n = 40) in Neiva, Colombia. Participants completed a measure indexing various aspects of HRQOL. The path model overall showed excellent fit indices, and each individual path within the model was statistically significant. Pain exerted significant indirect effects through all possible mediators in the model, ultimately suggesting that energy, mental health, social functioning, and role limitations-emotional were likely pathways through which pain exerted its effects on physical disability in individuals with SCI. These findings uncover several potential nodes for clinical intervention which if targeted in the context of rehabilitation or outpatient services, could result in salubrious direct and indirect effects reverberating down the theoretical causal chain and ultimately reducing physical disability in individuals with SCI.

  13. SciDAC-Data, A Project to Enabling Data Driven Modeling of Exascale Computing

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mubarak, M.; Ding, P.; Aliaga, L.

    The SciDAC-Data project is a DOE funded initiative to analyze and exploit two decades of information and analytics that have been collected by the Fermilab Data Center on the organization, movement, and consumption of High Energy Physics data. The project will analyze the analysis patterns and data organization that have been used by the NOvA, MicroBooNE, MINERvA and other experiments, to develop realistic models of HEP analysis workflows and data processing. The SciDAC-Data project aims to provide both realistic input vectors and corresponding output data that can be used to optimize and validate simulations of HEP analysis. These simulations aremore » designed to address questions of data handling, cache optimization and workflow structures that are the prerequisites for modern HEP analysis chains to be mapped and optimized to run on the next generation of leadership class exascale computing facilities. We will address the use of the SciDAC-Data distributions acquired from Fermilab Data Center’s analysis workflows and corresponding to around 71,000 HEP jobs, as the input to detailed queuing simulations that model the expected data consumption and caching behaviors of the work running in HPC environments. In particular we describe in detail how the Sequential Access via Metadata (SAM) data handling system in combination with the dCache/Enstore based data archive facilities have been analyzed to develop the radically different models of the analysis of HEP data. We present how the simulation may be used to analyze the impact of design choices in archive facilities.« less

  14. Impact of SciELO and MEDLINE indexing on submissions to Jornal de Pediatria.

    PubMed

    Blank, Danilo; Buchweitz, Claudia; Procianoy, Renato S

    2005-01-01

    To evaluate the impact of SciELO and MEDLINE indexing on the number of articles submitted to Jornal de Pediatria. Analysis of total article submission, submission of articles from foreign countries and acceptance figures in the following periods: stage I - pre-website (Jan 2000-Mar 2001); stage II - website (Apr 2001-Jul 2002); stage III - SciELO (Aug 2002-Aug 2003); stage IV - MEDLINE (Sep 2003-Dec 2004). There was a significant trend toward linear increase in the number of submissions along the study period (p = 0.009). The number of manuscripts submitted in stages I through IV was 184, 240, 297, and 482, respectively. The number of submissions was similar in stages I and II (p = 0.148), but statistically higher in Stage III (p < 0.001 vs. Stage I and p = 0.006 vs. Stage II) and Stage IV (p < 0.001 vs. stages I and II, and p < 0.05 vs. stage III). The rate of article acceptance decreased during the study period. The number of original articles published has been stable since the 2001 March/April issue (n = 10), when the journal reached a printed page limit, leading to stricter judgment criteria and a relative decrease in acceptance rate. The number of foreign submissions in stages I through IV was 1, 2, zero and 17, respectively, with p < 0.001 for the comparison of stage IV with previous stages. SciELO indexing was associated with an increase in Brazilian manuscript submissions to Jornal de Pediatria, whereas MEDLINE indexing led to an increase in both Brazilian and foreign submissions.

  15. The Fulldome Curriculum for the Spitz SciDome Digital Planetarium: Volume 2

    NASA Astrophysics Data System (ADS)

    Bradstreet, David H.; Sanders, S. J.; Huggins, S.

    2014-01-01

    The Spitz Fulldome Curriculum (FDC) for the SciDome digital planetarium ushered in a new and innovative way to present astronomical pedagogy via its use of the unique teaching attributes of the digital planetarium. In the case of the FDC, which uses the ubiquitous Starry Night planetarium software as its driving engine, these engaging and novel teaching techniques have also been made usable to desktop computers and flat-screen video projectors for classroom use. Volume 2 of the FDC introduces exciting new classes and mini-lessons to further enlighten and invigorate students as they struggle with often difficult three dimensional astronomical concepts. Additionally, other topics with related astronomical ties have been created to integrate history into planetarium presentations. One of the strongest advantages of the SciDome is its use of Starry Night as its astronomical engine. With it students can create their own astronomical configurations in the computer lab or at home, using the PC or Mac version. They can then simply load their creations onto the SciDome planetarium system and display them for their classmates on the dome. This poster will discuss and illustrate some of the new content that has been developed for Volume 2. Topics covered in Volume 2 include eclipses, plotting planet locations on a curtate orbit chart by observing their positions in the sky, time and timekeeping (including sidereal day, hour angles, sidereal time, LAST, LMST, time zones and the International Date Line), teaching to the Boy Scout Merit Badge requirements, plotting scale analemmas on the surface of planets and interpreting them, precession, astronomical events in revolutionary Boston, the Lincoln Almanac Trial, eclipsing binaries, lunar librations, a trip through the universe, watching the speed of light move in real time, stellar sizes and the Milky Way.

  16. Measuring resilience after spinal cord injury: Development, validation and psychometric characteristics of the SCI-QOL Resilience item bank and short form

    PubMed Central

    Victorson, David; Tulsky, David S.; Kisala, Pamela A.; Kalpakjian, Claire Z.; Weiland, Brian; Choi, Seung W.

    2015-01-01

    Objective To describe the development and psychometric properties of the Spinal Cord Injury - Quality of Life (SCI-QOL) Resilience item bank and short form. Design Using a mixed-methods design, we developed and tested a resilience item bank through the use of focus groups with individuals with SCI and clinicians with expertise in SCI, cognitive interviews, and item-response theory based analytic approaches, including tests of model fit and differential item functioning (DIF). Setting We tested a 32-item pool at several medical institutions across the United States, including the University of Michigan, Kessler Foundation, the Rehabilitation Institute of Chicago, the University of Washington, Craig Hospital and the James J. Peters/Bronx Department of Veterans Affairs medical center. Participants A total of 717 individuals with SCI completed the Resilience items. Results A unidimensional model was observed (CFI = 0.968; RMSEA = 0.074) and measurement precision was good (theta range between −3.1 and 0.9). Ten items were flagged for DIF, however, after examination of effect sizes we found this to be negligible with little practical impact on score estimates. The final calibrated item bank resulted in 21 retained items. Conclusion This study indicates that the SCI-QOL Resilience item bank represents a psychometrically robust measurement tool. Short form items are also suggested and computer adaptive tests are available. PMID:26010971

  17. Scientific support of SciTech museum exhibits and outreach programs

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Peshkin, M.

    SciTech (Science and Technology Interactive Center) is a small hands-on science museum located in Aurora, Illinois, not far from Argonne National Laboratory. Its constituency includes prosperous suburbs and economically disadvantaged minority communities in Aurora and Chicago. Its mission is to contribute to the country`s scientific literacy initiative by offering hands-on experiences on the museum floor and through outreach programs extended to school children, their teachers, and other groups. Argonne`s participation is focused mainly on the development of exhibits to carry the ideas of modern science and technology to the public. This is an area in which traditional museums are weak,more » but in which SciTech has become a nationally recognized leader with the assistance of Argonne, Fermilab, nearby technological companies, and many volunteer scientists and engineers. We also participate in development and improvement of the museum`s general exhibits and outreach programs. Argonne`s Director, Alan Schriesheim, serves as a member of the museum`s Board of Directors. Murray Peshkin serves part-time as the museum`s Senior Scientist. Dale Henderson serves part-time as an exhibit developer. That work is supported by the Laboratory Director`s discretionary funds. In addition, several members of the Physics Division voluntarily assist with exhibit development and the Division makes facilities available for that effort.« less

  18. SciELO, Scientific Electronic Library Online, a Database of Open Access Journals

    ERIC Educational Resources Information Center

    Meneghini, Rogerio

    2013-01-01

    This essay discusses SciELO, a scientific journal database operating in 14 countries. It covers over 1000 journals providing open access to full text and table sets of scientometrics data. In Brazil it is responsible for a collection of nearly 300 journals, selected along 15 years as the best Brazilian periodicals in natural and social sciences.…

  19. What's Manifest in the History of SciTech: Reflections on The History Manifesto.

    PubMed

    Kevles, Daniel J

    2016-06-01

    Making nuts-and-bolts public policy is not--and never has been--the long suit of professional historians, but general historical work, whatever its durée, has done a good deal to shape discourse on public issues. Jo Guldi and David Armitage neglect that fact, as well as the opinion-shaping influence of history conveyed via nonprint media. They also ignore the large body of scholarship produced in all media during recent decades in the history of science, technology, and science-related medicine (SciTech), even though SciTech itself looms enormously large in the modern era as an instrument of national and international security, a driver of the economy, and a transformer of medicine, public health, and the environment. Much of this scholarship, even though of short durée, can illuminate salient contemporary issues, including innovation; patronage and practice; government and policy; imperialism and globalization; intellectual property; science and religion; and human rights, environment, energy, and disasters.

  20. Inverse Faraday Effect in Hemoglobin Detected by Raman Spectroscopy: An Example of Magnetic Resonance Raman Activity.

    DTIC Science & Technology

    1985-06-03

    d.E - m.H + and is a truncated form of Equ. (9) intepreted according to the diagrammatic perturbation theory approach of Wallace [51]; n is the...A.L., 1972, 3. Chem. Phys. 56, 4073. 87. Gouterman, M., 1973, Ann. N.Y. Acad. Sci. 206, 70. -27- NADC-85074-60 This Page Intentionally Left Blank -28 - FILM -ED 11-85 DTIC

  1. FGF Signaling and Dietary Factors in the Prostate

    DTIC Science & Technology

    2005-03-01

    Signaling 3. Mohammadi, M., Dionne, C. A., Li, W., Li, N., Spivak, T., Honegger, A. M., 25. Spruck, C. H., de Miguel , M. P., Smith, A. P., Ryan, A., Stein...Acad. Sci. U. S. A. 98, 8578-8583 91, 2176-2180 14. Melillo, R. M., Santoro , M., Ong, S. H., Billaud, M., Fusco, A., Hadari, Y. R., 34. Zhang, Y

  2. Exploiting for Breast Cancer Control a Proposed Unified Mechanism for Reduction of Human Breast Cancer Risk by the Hormones of Pregnancy

    DTIC Science & Technology

    2006-05-01

    methyl-1-nitrosourea- Induced Mammary Cancer. Carcinogenesis. 4 (4): 495-497. 3. Rajkumar L., R.C. Guzman, J. Yang, G. Thordarson , F. Talamantes, and...5. Guzman RC, Yang J, Rajkumar L, Thordarson G, Chen X, Nandi S. Hormonal prevention of breast cancer: mimicking the protective effect of pregnancy. Proc Natl Acad Sci U S A. 1999 Mar 2;96(5):2520-5.

  3. Constitutively reduced sensory capacity promotes better recovery after spinal cord-injury (SCI) in blind rats of the dystrophic RCS strain.

    PubMed

    Rink, Svenja; Bendella, Habib; Alsolivany, Kurdin; Meyer, Carolin; Woehler, Aliona; Jansen, Ramona; Isik, Zeynep; Stein, Gregor; Wennmachers, Sina; Nakamura, Makoto; Angelov, Doychin N

    2018-01-01

    We compared functional, electrophysiological and morphological parameters after SCI in two groups of rats Sprague Dawley (SD) rats with normal vision and blind rats from a SD-substrain "Royal College of Surgeons" (SD/RCS) who lose their photoreceptor cells after birth due to a genetic defect in the retinal pigment epithelium. For these animals skin-, intramuscular-, and tendon receptors are major available means to resolve spatial information. The purpose of this study was to check whether increased sensitivity in SD/RCS rats would promote an improved recovery after SCI. All rats were subjected to severe compression of the spinal cord at vertebra Th8, spinal cord segment Th10. Recovery of locomotion was analyzed at 1, 3, 6, 9, and 12 weeks after SCI using video recordings of beam walking and inclined ladder climbing. Five functional parameters were studied: foot-stepping angle (FSA), rump-height index (RHI) estimating paw placement and body weight support, respectively, number of correct ladder steps (CLS) assessing skilled hindlimb movements, the BBB-locomotor score and an established urinary bladder score (BS). Sensitivity tests were followed by electrophysiological measurement of M- and H-wave amplitudes from contractions of the plantar musculature after stimulation of the tibial nerve. The closing morphological measurements included lesion volume and expression of astro- and microglia below the lesion. Numerical assessments of BBB, FSA, BS, lesion volume and GFAP-expression revealed no significant differences between both strains. However, compared to SD-rats, the blind SD/RCS animals significantly improved RHI and CLS by 6 - 12 weeks after SCI. To our surprise the withdrawal latencies in the blind SD/RCS rats were longer and the amplitudes of M- and H-waves lower. The expression of IBA1-immunoreactivity in the lumbar enlargement was lower than in the SD-animals. The longer withdrawal latencies suggest a decreased sensitivity in the blind SD/RCS rats, which

  4. Impact of legal regulations and administrative policies on persons with SCI: identifying potential research priorities through expert interviews.

    PubMed

    Trezzini, Bruno; Phillips, Barbara

    2014-01-01

    To identify research gaps and potential research priorities regarding the impact that legal regulations and administrative policies might have on people with spinal cord injury (SCI) living in Switzerland. We conducted semi-structured interviews with 14 healthcare professionals working for or being associated with the largest SCI clinic in Switzerland. The transcribed interviews were content analyzed, involving qualitative description, and thematic analysis techniques. Four interrelated clusters of issues were corroborated: (1) social insurance, (2) caregiving, (3) work integration, and (4) aging. In addition, two overarching themes were identified: (1) fairness considerations and (2) unavailability of systematic empirical evidence. Work capacity assessment and family caregiving were deemed to be the most pressing research priority areas. Legal frameworks do play both a direct and an indirect role in the lives of people with SCI in Switzerland. This is particularly true with regard to various issues related to the social insurance system, such as family caregiving and work capacity assessment. The salience of these topics is closely related to major sociodemographic and political driving forces, i.e. aging and social insurance reforms. Research directly involving people with SCI is needed to further substantiate and refine the findings of this study. When dealing with issues related to work reintegration, aging, social insurance, and caregiving, rehabilitation professionals should take existing legal frameworks into account. Eligibility criteria for disability benefits may influence the therapy motivation of rehabilitation clients.

  5. Research Report for GeSci Meta-Review of ICT in Education: Phase Two

    ERIC Educational Resources Information Center

    LeBaron, John; McDonough, Elizabeth

    2009-01-01

    This second phase of a comprehensive meta-review of educational ICT research and practice addresses global developments reflected in the research and development literature appearing since 2006. Completed in April 2009, the Phase One (P1) report comprised a synopsis of research related to GeSci's five thematic inquiry priorities. Preliminary…

  6. It is a marathon rather than a sprint: an initial exploration of unmet needs and support preferences of caregivers of children with SCI.

    PubMed

    Ryerson Espino, Susan L; Kelly, Erin H; Rivelli, Anne; Zebracki, Kathy; Vogel, Lawrence C

    2018-03-01

    Focus group study. Explore unmet needs and support preferences of caregivers of youth with spinal cord injury (SCI). One pediatric specialty rehabilitation hospital system in the United States. Four focus groups were conducted with a convenience sample of 26 caregivers who were primarily mothers (96%) and married (65%), and had at least some college education (85%). Children living with SCI were on average 12.8 years old (SD = 3.3, 8-18). The average age of injury was 4.7 years (SD = 4.4, 0-16.2); mean injury duration was 8.2 years (SD = 3.9, 2-16); 77% had paraplegia; and 58% were male. Focus groups were digitally recorded, transcribed verbatim, and coded using thematic analysis and NVivo. Qualitative data highlighted caregiver perspectives on unmet needs relating to two phases of care: acute and rehabilitation vs. current life with SCI, and two kinds of stressors: those associated with SCI and care vs. those related to other areas of the caregivers' lives, especially their families. Caregivers described stressful interactions with care systems and community services, articulated several concerns regarding well-being of family members, and noted that both they and their children with SCI experienced isolation. Caregivers articulated preferences for additional support from professionals and peers. Data suggest the need for ongoing caregiver interventions and strengthened family-centered care systems, including professional assistance navigating health systems and peer support. Intervention development would benefit from further qualitative data collection with additional caregivers of youth with SCI, including multiple family members, and families from more diverse care settings.

  7. SCI Survey to Determine Pressure Ulcer Vulnerability in the Outpatient Population

    DTIC Science & Technology

    2013-10-01

    of transportation, mobility, caregiver status, bowel and bladder continence, level of education , mental health status or illicit drug use. Key...coded a number of variables. For example, we created a new variable: “Good Nutrition ”, reflecting nutritional status using the recorded albumin and...no difference in age, level of education or marital status and presence of PrUs. Violence as the etiology of SCI was more common among those with ≥ 1

  8. A Comprehensive Evaluation of H2SO4 formation from OH and sCI pathways in high BVOC environments

    NASA Astrophysics Data System (ADS)

    Kim, S.; Seco, R.; Park, J. H.; Guenther, A. B.; Smith, J. N.; Kuang, C.; Bustillos, J. O. V.; Tota, J.; Souza, R. A. F. D.

    2014-12-01

    The recently highlighted importance of stabilized Criegee intermediates (sCI) as an oxidant for atmospheric SO2 triggered a number of studies to assess the atmospheric implications of H2SO4 formation from the sCI reaction pathway. In addition, it has not been clear why new particle formation events are not observed in the Amazon rain forest. The mostly widely speculated reason has been a very low H2SO4 level. We will present quantitative assessments of SO2 oxidation by sCI leading to the H2SO4 production using a comprehensive observational dataset from a tropical rainforest study during the GOAmazon field campaign at the T3 site in Manacapuru, Amazonas, Brazil. To our best knowledge, this is the first observation of H2SO4 and OH in Amazon and is unique for all tropical sites due to the accompanying comprehensive gas and aerosol observations such as CO, NOX, SO2, VOCs, and physical and chemical characteristics of aerosols. We will discuss observed H2SO4 levels during the GOAmazon field campaigns to demonstrate 1) H2SO4 formation potential from OH and sCI oxidation pathways by contrasting extremely clean and relatively polluted air masses and 2) the Implications of the observed H2SO4 levels in new particle formation and particle growth events.

  9. Musculoskeletal Model-Guided, Customizable Selection of Shoulder and Elbow Muscles for a C5 SCI Neuroprosthesis

    PubMed Central

    Hincapie, Juan Gabriel; Blana, Dimitra; Chadwick, Edward K.; Kirsch, Robert F.

    2010-01-01

    Individuals with C5/C6 spinal cord injury (SCI) have a number of paralyzed muscles in their upper extremities that can be electrically activated in a coordinated manner to restore function. The selection of a practical subset of paralyzed muscles for stimulation depends on the specific condition of the individual, the functions targeted for restoration, and surgical considerations. This paper presents a musculoskeletal model-based approach for optimizing the muscle set used for functional electrical stimulation (FES) of the shoulder and elbow in this population. Experimentally recorded kinematics from able-bodied subjects served as inputs to a musculoskeletal model of the shoulder and elbow, which was modified to reflect the reduced muscle force capacities of an individual with C5 SCI but also the potential of using FES to activate paralyzed muscles. A large number of inverse dynamic simulations mimicking typical activities of daily living were performed that included 1) muscles with retained voluntary control and 2) many different combinations of stimulated paralyzed muscles. These results indicate that a muscle set consisting of the serratus anterior, infraspinatus and triceps would enable the greatest range of relevant movements. This set will become the initial target in a C5 SCI neuroprosthesis to restore shoulder and elbow function. PMID:18586604

  10. Solubility of pharmaceuticals: A comparison between SciPharma, a PC-SAFT-based approach, and NRTL-SAC

    NASA Astrophysics Data System (ADS)

    Bouillot, Baptiste; Spyriouni, Theodora; Teychené, Sébastien; Biscans, Béatrice

    2017-04-01

    The solubility of seven pharmaceutical compounds (paracetamol, benzoic acid, 4-aminobenzoic acid, salicylic acid, ibuprofen, naproxen and temazepam) in pure and mixed solvents as a function of temperature is calculated with SciPharma, a semi-empirical approach based on PC-SAFT, and the NRTL-SAC model. To conduct a fair comparison between the approaches, the parameters of the compounds were regressed against the same solubility data, chosen to account for hydrophilic, polar and hydrophobic interactions. Only these solubility data were used by both models for predicting solubility in other pure and mixed solvents for which experimental data were available for comparison. A total of 386 pure solvent data points were used for the comparison comprising one or more temperatures per solvent. SciPharma is found to be more accurate than NRTL-SAC on the pure solvent data used especially in the description of the temperature dependence. This is due to the appropriate parameterization of the pharmaceuticals and the temperature-dependent description of the activity coefficient in PC-SAFT. The solubility in mixed solvents is predicted satisfactorily with SciPharma. NRTL-SAC tends to overestimate the solubility in aqueous solutions of alcohols or shows invariable solubility with composition in other cases.

  11. SCiP at 35: an idiosyncratic history of the society for computers in psychology.

    PubMed

    Wolfe, Christopher R

    2006-05-01

    SCiP history may be divided into three eras: the Paleozoic (1971-1982), the Mesozoic (1982-1994), and the Cenozoic (1994-present). Following a list of Secretary-Treasurers, a list of all SCiP Presidents is provided in Table 1. Next I present personal highlights, including the first symposium on psychology and the World-Wide Web; David Rumelhart's mathematical explanation of connectionism; and Stevan Hamad's discussion of "freeing" the journal literature. I observe that a small conference is becoming more intimate and that much of our mission involves figuring out how to conduct high-quality scientific research with consumer-grade electronics. I argue that we are an increasingly international organization, that graduate students are welcome, and that we should become more inclusive in the areas of gender and ethnicity and should make membership more meaningful I conclude by looking ahead and attempting to predict the future.

  12. Measuring self-esteem after spinal cord injury: Development, validation and psychometric characteristics of the SCI-QOL Self-esteem item bank and short form.

    PubMed

    Kalpakjian, Claire Z; Tate, Denise G; Kisala, Pamela A; Tulsky, David S

    2015-05-01

    To describe the development and psychometric properties of the Spinal Cord Injury-Quality of Life (SCI-QOL) Self-esteem item bank. Using a mixed-methods design, we developed and tested a self-esteem item bank through the use of focus groups with individuals with SCI and clinicians with expertise in SCI, cognitive interviews, and item-response theory-(IRT) based analytic approaches, including tests of model fit, differential item functioning (DIF) and precision. We tested a pool of 30 items at several medical institutions across the United States, including the University of Michigan, Kessler Foundation, the Rehabilitation Institute of Chicago, the University of Washington, Craig Hospital, and the James J. Peters/Bronx Department of Veterans Affairs hospital. A total of 717 individuals with SCI completed the self-esteem items. A unidimensional model was observed (CFI=0.946; RMSEA=0.087) and measurement precision was good (theta range between -2.7 and 0.7). Eleven items were flagged for DIF; however, effect sizes were negligible with little practical impact on score estimates. The final calibrated item bank resulted in 23 retained items. This study indicates that the SCI-QOL Self-esteem item bank represents a psychometrically robust measurement tool. Short form items are also suggested and computer adaptive tests are available.

  13. A Novel Approach for Effectively Treating SCI Pain, Improving Opioid Efficacy, and Preventing Opioid-Induced Constipation: Key Role of Toll-Like Receptor 4 (TLR4)

    DTIC Science & Technology

    2016-12-01

    Approved for Public Release; Distribution Unlimited 13. SUPPLEMENTARY NOTES 14. ABSTRACT Spinal cord injury (SCI) is a disabling and costly condition...23 11. Appendices…………………………………………………………. 24 INTRODUCTION   Spinal cord injury (SCI) is a disabling and costly condition... learned everything taught in the renowned Spinal Cord Injury Training Program. Since Gaudet already has training in SCI research, further training

  14. Cell-type specific expression of constitutively-active Rheb promotes regeneration of bulbospinal respiratory axons following cervical SCI.

    PubMed

    Urban, Mark W; Ghosh, Biswarup; Strojny, Laura R; Block, Cole G; Blazejewski, Sara M; Wright, Megan C; Smith, George M; Lepore, Angelo C

    2018-05-01

    Damage to respiratory neural circuitry and consequent loss of diaphragm function is a major cause of morbidity and mortality in individuals suffering from traumatic cervical spinal cord injury (SCI). Repair of CNS axons after SCI remains a therapeutic challenge, despite current efforts. SCI disrupts inspiratory signals originating in the rostral ventral respiratory group (rVRG) of the medulla from their phrenic motor neuron (PhMN) targets, resulting in loss of diaphragm function. Using a rat model of cervical hemisection SCI, we aimed to restore rVRG-PhMN-diaphragm circuitry by stimulating regeneration of injured rVRG axons via targeted induction of Rheb (ras homolog enriched in brain), a signaling molecule that regulates neuronal-intrinsic axon growth potential. Following C2 hemisection, we performed intra-rVRG injection of an adeno-associated virus serotype-2 (AAV2) vector that drives expression of a constitutively-active form of Rheb (cRheb). rVRG neuron-specific cRheb expression robustly increased mTOR pathway activity within the transduced rVRG neuron population ipsilateral to the hemisection, as assessed by levels of phosphorylated ribosomal S6 kinase. By co-injecting our novel AAV2-mCherry/WGA anterograde/trans-synaptic axonal tracer into rVRG, we found that cRheb expression promoted regeneration of injured rVRG axons into the lesion site, while we observed no rVRG axon regrowth with AAV2-GFP control. AAV2-cRheb also significantly reduced rVRG axonal dieback within the intact spinal cord rostral to the lesion. However, cRheb expression did not promote any recovery of ipsilateral hemi-diaphragm function, as assessed by inspiratory electromyography (EMG) burst amplitudes. This lack of functional recovery was likely because regrowing rVRG fibers did not extend back into the caudal spinal cord to synaptically reinnervate PhMNs that we retrogradely-labeled with cholera toxin B from the ipsilateral hemi-diaphragm. Our findings demonstrate that enhancing neuronal

  15. Theoretical Risk and Prevention Model for Secondary Health Conditions and Mortality After SCI: 15 Years of Research

    PubMed Central

    Krause, James S.; Saunders, Lee L.; DiPiro, Nicole D.; Reed, Karla S.

    2013-01-01

    Background: To successfully prevent secondary health conditions (SHCs) and promote longevity after spinal cord injury (SCI), we must first understand the risk factors precipitating their occurrence and develop strategies to address these risk factors. Conceptual models may aid in identifying the nature of SHCs and guide research, clinical practice, and the development of prevention strategies. Objective: Our purpose is to review and refine an existing theoretical risk and prevention model (TRPM) as a means of classifying risk and protective factors for SHCs and mortality after SCI and for identifying points of intervention. Methods: We describe conceptual work within the field of SCI research and SHCs, including a description of the TRPM, a review of research using the TRPM, and conceptual enhancements to the TRPM based on previous research. Conclusions: The enhanced TRPM directs research to the timing and chronicity of the SHCs and their relationship with overall health and physiologic decline. Future research should identify differences in the nature of SHCs, the extent to which they relate to risk and protective factors, and the degree to which they may be prevented with appropriate research-based strategies. PMID:23459002

  16. Segmental isotopic labeling of HIV-1 capsid protein assemblies for solid state NMR.

    PubMed

    Gupta, Sebanti; Tycko, Robert

    2018-02-01

    Recent studies of noncrystalline HIV-1 capsid protein (CA) assemblies by our laboratory and by Polenova and coworkers (Protein Sci 19:716-730, 2010; J Mol Biol 426:1109-1127, 2014; J Biol Chem 291:13098-13112, 2016; J Am Chem Soc 138:8538-8546, 2016; J Am Chem Soc 138:12029-12032, 2016; J Am Chem Soc 134:6455-6466, 2012; J Am Chem Soc 132:1976-1987, 2010; J Am Chem Soc 135:17793-17803, 2013; Proc Natl Acad Sci USA 112:14617-14622, 2015; J Am Chem Soc 138:14066-14075, 2016) have established the capability of solid state nuclear magnetic resonance (NMR) measurements to provide site-specific structural and dynamical information that is not available from other types of measurements. Nonetheless, the relatively high molecular weight of HIV-1 CA leads to congestion of solid state NMR spectra of fully isotopically labeled assemblies that has been an impediment to further progress. Here we describe an efficient protocol for production of segmentally labeled HIV-1 CA samples in which either the N-terminal domain (NTD) or the C-terminal domain (CTD) is uniformly 15 N, 13 C-labeled. Segmental labeling is achieved by trans-splicing, using the DnaE split intein. Comparisons of two-dimensional solid state NMR spectra of fully labeled and segmentally labeled tubular CA assemblies show substantial improvements in spectral resolution. The molecular structure of HIV-1 assemblies is not significantly perturbed by the single Ser-to-Cys substitution that we introduce between NTD and CTD segments, as required for trans-splicing.

  17. DoD Information Security Program and Protection of Sensitive Compartmented Information (SCI)

    DTIC Science & Technology

    2016-04-21

    collateral, special access program, SCI, and controlled unclassified information ( CUI ) within an overarching DoD Information Security Program...classified, safeguarded, and declassified in accordance with References (c), (d), and DoD Manual 5200.01 (Reference (i)). CUI will be identified...Information will not be classified, continue to be maintained as classified, or fail to be declassified, or be designated CUI under any circumstances in

  18. Sleep-Disordered Breathing in Chronic SCI: A Randomized Controlled Trial of Treatment Impact on Cognition, Quality of Life, and Cardiovascular Disease

    DTIC Science & Technology

    2015-10-01

    randomized controlled trial, we will objectively measure sleep disordered breathing ( SDB ) in chronic SCI patients using portable sleep studies, and...systematically evaluate the association between SDB , cognitive performance, mood, pain, and CV measures. We will randomize participants to 4 months of PAP...TERMS SDB , SCI, PAP, CV 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18. NUMBER OF PAGES 19a. NAME OF RESPONSIBLE PERSON USAMRMC a

  19. Sleep Disordered Breathing in Chronic SCI: A Randomized Controlled Trial of Treatment Impact on Cognition, Quality of Life, and Cardiovascular Disease

    DTIC Science & Technology

    2015-11-30

    randomized controlled trial, we will objectively measure sleep disordered breathing ( SDB ) in chronic SCI patients using portable sleep studies, and...systematically evaluate the association between SDB , cognitive performance, mood, pain, and CV measures. We will randomize participants to 4 months of PAP...TERMS SDB , SCI, PAP, CV 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18. NUMBER OF PAGES 19a. NAME OF RESPONSIBLE PERSON USAMRMC a

  20. Platelet Glycoprotein lb-1X and Malignancy

    DTIC Science & Technology

    2011-09-01

    Constitutive production and thrombin-induced release of vascular endothelial growth factor by human megakaryocytes and platelets. Proc Natl Acad Sci...JM, Hakim J, de Prost D. Vascular endothelial growth factor production by fibroblasts in response to factor VIIa binding to tissue factor involves...interactions in vitro. (14) The extrinsic pathway of coagulation triggered by factor VII ( FVII ) and tissue factor can be activated in cancer patients. (15

  1. Biomarkers for PTSD

    DTIC Science & Technology

    2014-07-01

    Molecular evidence of stress- induced acute heart injury in a mouse model simulating posttraumatic stress disorder. Proc Natl Acad Sci U S A. 2014 Feb...obtaining measures aligned with the core neurocognitive domains: IQ, working memory ( auditory /visual), processing speed, verbal memory (immediate...in the test sample and combined sample with a similar pattern for the validation sample. Similarly, performance on tests of auditory and visual

  2. Preclinical Mouse Models of Neurofibromatosis

    DTIC Science & Technology

    2006-10-01

    Patients. Persons with NF1 are predisposed to benign neurofibromas, optic nerve gliomas, and to specific malignant neoplasms . Individuals with NF1...malignant neoplasms seen in NF1 patients include astrocytoma, malignant peripheral nerve sheath tumor (MPNST), pheochromocytoma, and juvenile...Kras in hematopoietic cells initiates a rapidly fatal myeloproliferative disorder. Proc Natl Acad Sci U S A 2004;101(2):597-602. 14. Chan IT, Kutok JL

  3. Pointwise approximation of modified conjugate functions by matrix operators of conjugate Fourier series of [Formula: see text]-periodic functions.

    PubMed

    Kubiak, Mateusz; Łenski, Włodzimierz; Szal, Bogdan

    2018-01-01

    We extend the results of Xh. Z. Krasniqi (Acta Comment. Univ. Tartu Math. 17:89-101, 2013) and the authors (Acta Comment. Univ. Tartu Math. 13:11-24, 2009; Proc. Est. Acad. Sci. 67:50-60, 2018) to the case when considered function is [Formula: see text]-periodic and the measure of approximation depends on r -differences of the entries of the considered matrices.

  4. A Nonlinear Transfer Operator Theorem

    NASA Astrophysics Data System (ADS)

    Pollicott, Mark

    2017-02-01

    In recent papers, Kenyon et al. (Ergod Theory Dyn Syst 32:1567-1584 2012), and Fan et al. (C R Math Acad Sci Paris 349:961-964 2011, Adv Math 295:271-333 2016) introduced a form of non-linear thermodynamic formalism based on solutions to a non-linear equation using matrices. In this note we consider the more general setting of Hölder continuous functions.

  5. Costs and Length of Stay for the Acute Care of Patients with Motor-Complete Spinal Cord Injury Following Cervical Trauma: The Impact of Early Transfer to Specialized Acute SCI Center.

    PubMed

    Richard-Denis, Andréane; Ehrmann Feldman, Debbie; Thompson, Cynthia; Bourassa-Moreau, Étienne; Mac-Thiong, Jean-Marc

    2017-07-01

    Acute spinal cord injury (SCI) centers aim to optimize outcome following SCI. However, there is no timeframe to transfer patients from regional to SCI centers in order to promote cost-efficiency of acute care. Our objective was to compare costs and length of stay (LOS) following early and late transfer to the SCI center. A retrospective cohort study involving 116 individuals was conducted. Group 1 (n = 87) was managed in an SCI center promptly after the trauma, whereas group 2 (n = 29) was transferred to the SCI center only after surgery. Direct comparison and multivariate linear regression analyses were used to assess the relationship between costs, LOS, and timing to transfer to the SCI center. Length of stay was significantly longer for group 2 (median, 93.0 days) as compared with group 1 (median, 40.0 days; P < 10), and average costs were also higher (median, Canadian $17,920.0 vs. $10,521.6; P = 0.004) for group 2, despite similar characteristics. Late transfer to the SCI center was the main predictive factor of longer LOS and increased costs. Early admission to the SCI center was associated with shorter LOS and lower costs for patients sustaining tetraplegia. Early referral to an SCI center before surgery could lower the financial burden for the health care system. Complete the self-assessment activity and evaluation online at http://www.physiatry.org/JournalCME CME OBJECTIVES: Upon completion of this article, the reader should be able to: (1) Determine the optimal timing for transfer of individuals with cervical traumatic spinal cord injury (SCI) in order to decrease acute care resource utilization; (2) Determine benefits of a complete perioperative management in a specialized SCI center; and (3) Identify factors that may influence resource utilization for acute care following motor-complete tetraplegia. Advanced ACCREDITATION: The Association of Academic Physiatrists is accredited by the Accreditation Council for Continuing Medical Education to provide

  6. SciTech Clubs for Girls. [Final report], September 1, 1991--April 30, 1994

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Malamud, E.; Diaz, O.; Cox, J.

    1994-12-31

    The program of SciTech Clubs for Girls and its progress are described. This is a program that promotes the learning of science and mathematics by girls in the age range of 9 to 13 years through the process of building exhibits and learning from local professionals. A list of exhibits and a critique of the program are given.

  7. Measuring self-esteem after spinal cord injury: Development, validation and psychometric characteristics of the SCI-QOL Self-esteem item bank and short form

    PubMed Central

    Kalpakjian, Claire Z.; Tate, Denise G.; Kisala, Pamela A.; Tulsky, David S.

    2015-01-01

    Objective To describe the development and psychometric properties of the Spinal Cord Injury-Quality of Life (SCI-QOL) Self-esteem item bank. Design Using a mixed-methods design, we developed and tested a self-esteem item bank through the use of focus groups with individuals with SCI and clinicians with expertise in SCI, cognitive interviews, and item-response theory- (IRT) based analytic approaches, including tests of model fit, differential item functioning (DIF) and precision. Setting We tested a pool of 30 items at several medical institutions across the United States, including the University of Michigan, Kessler Foundation, the Rehabilitation Institute of Chicago, the University of Washington, Craig Hospital, and the James J. Peters/Bronx Department of Veterans Affairs hospital. Participants A total of 717 individuals with SCI completed the self-esteem items. Results A unidimensional model was observed (CFI = 0.946; RMSEA = 0.087) and measurement precision was good (theta range between −2.7 and 0.7). Eleven items were flagged for DIF; however, effect sizes were negligible with little practical impact on score estimates. The final calibrated item bank resulted in 23 retained items. Conclusion This study indicates that the SCI-QOL Self-esteem item bank represents a psychometrically robust measurement tool. Short form items are also suggested and computer adaptive tests are available. PMID:26010972

  8. Cyclic AMP-dependent regulation of P-type calcium channels expressed in Xenopus oocytes.

    PubMed

    Fournier, F; Bourinet, E; Nargeot, J; Charnet, P

    1993-05-01

    Xenopus oocytes injected with rat cerebellum mRNA, express voltage-dependent calcium channels (VDCC). These were identified as P-type Ca2+ channels by their insensitivity to dihydropyridines and omega-conotoxin and by their blockade by Agelenopsis aperta venom (containing the funnel-web spider toxins: FTX and omega-Aga-IV-A). Coinjection of cerebellar mRNA and antisense oligonucleotide complementary to the dihydropyridine-resistant brain Ca2+ channel, named BI [Mori Y. et al. (1991) Nature 350:398-402] or rbA [Starr T. V. B. et al. (1991) Proc Natl Acad Sci USA 88:5621-5625], strongly reduced the expressed Ba2+ current suggesting that these clones encode a P-type VDCC. The macroscopic Ca2+ channel activity was increased by direct intraoocyte injection of cAMP. This increase in current amplitude was concomitant with a slowing of current inactivation, and was attributed to activation of protein kinase A, since it could be antagonized by a peptidic inhibitor of this enzyme. Positive regulation of P-type VDCC could be of importance in Purkinje neurons and motor nerve terminals where this channel is predominant.

  9. Isolation and characterization of major histocompatibility complex class IIB genes from the nurse shark.

    PubMed

    Bartl, S; Weissman, I L

    1994-01-04

    The major histocompatibility complex (MHC) contains a set of linked genes which encode cell surface proteins involved in the binding of small peptide antigens for their subsequent recognition by T lymphocytes. MHC proteins share structural features and the presence and location of polymorphic residues which play a role in the binding of antigens. In order to compare the structure of these molecules and gain insights into their evolution, we have isolated two MHC class IIB genes from the nurse shark, Ginglymostoma cirratum. Two clones, most probably alleles, encode proteins which differ by 13 amino acids located in the putative antigen-binding cleft. The protein structure and the location of polymorphic residues are similar to their mammalian counterparts. Although these genes appear to encode a typical MHC protein, no T-cell-mediated responses have been demonstrated in cartilaginous fish. The nurse shark represents the most phylogenetically primitive organism in which both class IIA [Kasahara, M., Vazquez, M., Sato, K., McKinney, E.C. & Flajnik, M.F. (1992) Proc. Natl. Acad. Sci USA 89, 6688-6692] and class IIB genes, presumably encoding the alpha/beta heterodimer, have been isolated.

  10. Emergence of robustness in networks of networks

    NASA Astrophysics Data System (ADS)

    Roth, Kevin; Morone, Flaviano; Min, Byungjoon; Makse, Hernán A.

    2017-06-01

    A model of interdependent networks of networks (NONs) was introduced recently [Proc. Natl. Acad. Sci. (USA) 114, 3849 (2017), 10.1073/pnas.1620808114] in the context of brain activation to identify the neural collective influencers in the brain NON. Here we investigate the emergence of robustness in such a model, and we develop an approach to derive an exact expression for the random percolation transition in Erdös-Rényi NONs of this kind. Analytical calculations are in agreement with numerical simulations, and highlight the robustness of the NON against random node failures, which thus presents a new robust universality class of NONs. The key aspect of this robust NON model is that a node can be activated even if it does not belong to the giant mutually connected component, thus allowing the NON to be built from below the percolation threshold, which is not possible in previous models of interdependent networks. Interestingly, the phase diagram of the model unveils particular patterns of interconnectivity for which the NON is most vulnerable, thereby marking the boundary above which the robustness of the system improves with increasing dependency connections.

  11. Resilience and Controllability of Dynamic Collective Behaviors

    PubMed Central

    Komareji, Mohammad; Bouffanais, Roland

    2013-01-01

    The network paradigm is used to gain insight into the structural root causes of the resilience of consensus in dynamic collective behaviors, and to analyze the controllability of the swarm dynamics. Here we devise the dynamic signaling network which is the information transfer channel underpinning the swarm dynamics of the directed interagent connectivity based on a topological neighborhood of interactions. The study of the connectedness of the swarm signaling network reveals the profound relationship between group size and number of interacting neighbors, which is found to be in good agreement with field observations on flock of starlings [Ballerini et al. (2008) Proc. Natl. Acad. Sci. USA, 105: 1232]. Using a dynamical model, we generate dynamic collective behaviors enabling us to uncover that the swarm signaling network is a homogeneous clustered small-world network, thus facilitating emergent outcomes if connectedness is maintained. Resilience of the emergent consensus is tested by introducing exogenous environmental noise, which ultimately stresses how deeply intertwined are the swarm dynamics in the physical and network spaces. The availability of the signaling network allows us to analytically establish for the first time the number of driver agents necessary to fully control the swarm dynamics. PMID:24358209

  12. Network versus portfolio structure in financial systems

    NASA Astrophysics Data System (ADS)

    Kobayashi, Teruyoshi

    2013-10-01

    The question of how to stabilize financial systems has attracted considerable attention since the global financial crisis of 2007-2009. Recently, Beale et al. [Proc. Natl. Acad. Sci. USA 108, 12647 (2011)] demonstrated that higher portfolio diversity among banks would reduce systemic risk by decreasing the risk of simultaneous defaults at the expense of a higher likelihood of individual defaults. In practice, however, a bank default has an externality in that it undermines other banks’ balance sheets. This paper explores how each of these different sources of risk, simultaneity risk and externality, contributes to systemic risk. The results show that the allocation of external assets that minimizes systemic risk varies with the topology of the financial network as long as asset returns have negative correlations. In the model, a well-known centrality measure, PageRank, reflects an appropriately defined “infectiveness” of a bank. An important result is that the most infective bank needs not always to be the safest bank. Under certain circumstances, the most infective node should act as a firewall to prevent large-scale collective defaults. The introduction of a counteractive portfolio structure will significantly reduce systemic risk.

  13. Deformation and stability of surface states in Dirac semimetals

    NASA Astrophysics Data System (ADS)

    Kargarian, Mehdi; Lu, Yuan-Ming; Randeria, Mohit

    2018-04-01

    The unusual surface states of topological semimetals have attracted a lot of attention. Recently, we showed [Proc. Natl. Acad. Sci. USA 113, 8648 (2016), 10.1073/pnas.1524787113] that for a Dirac semimetal (DSM) arising from band inversion, such as Na3Bi and Cd3As2 , the expected double Fermi arcs on the surface are not topologically protected. Quite generally, the arcs deform into states similar to those on the surface of a strong topological insulator. Here we address two questions related to deformation and stability of surface states in DSMs. First, we discuss why certain perturbations, no matter how large, are unable to destroy the double Fermi arcs. We show that this is related to a certain extra (particle-hole) symmetry, which is nongeneric in materials. Second, we discuss situations in which the surface states are completely destroyed without breaking any symmetry or impacting the bulk Dirac nodes. We are not aware of any experimental or density functional theory (DFT) candidates for a material which is a bulk DSM without any surface states, but our results clearly show that this is possible.

  14. Rotation of an immersed cylinder sliding near a thin elastic coating

    NASA Astrophysics Data System (ADS)

    Rallabandi, Bhargav; Saintyves, Baudouin; Jules, Theo; Salez, Thomas; Schönecker, Clarissa; Mahadevan, L.; Stone, Howard A.

    2017-07-01

    It is known that an object translating parallel to a soft wall in a viscous fluid produces hydrodynamic stresses that deform the wall, which in turn results in a lift force on the object. Recent experiments with cylinders sliding under gravity near a soft incline, which confirmed theoretical arguments for the lift force, also reported an unexplained steady-state rotation of the cylinders [B. Saintyves et al., Proc. Natl. Acad. Sci. USA 113, 5847 (2016), 10.1073/pnas.1525462113]. Motivated by these observations, we show, in the lubrication limit, that an infinite cylinder that translates in a viscous fluid parallel to a soft wall at constant speed and separation distance must also rotate in order to remain free of torque. Using the Lorentz reciprocal theorem, we show analytically that for small deformations of the elastic layer, the angular velocity of the cylinder scales with the cube of the sliding speed. These predictions are confirmed numerically. We then apply the theory to the gravity-driven motion of a cylinder near a soft incline and find qualitative agreement with the experimental observations, namely, that a softer elastic layer results in a greater angular speed of the cylinder.

  15. Effects of Silver and Other Metals on the Cytoskeleton

    NASA Technical Reports Server (NTRS)

    Conrad, Gary W.

    1997-01-01

    Directly or indirectly, trace concentrations of silver ion (Ag(+)) stabilize microtubules (Conrad, A.H., et al. Cell Motil. & Cytoskel. 27:117-132), as does taxol (Conrad, A.H., et al. J. Exp. Zool. 262:154-165), an effect with major consequences for cellular shape changes and development. Polymerization of microtubules is gravity-sensitive (Tabony and Job, Proc. Natl. Acad. Sci. USA 89:6948-6952), so trace amounts of Ag(+) may alter cellular ability to respond to gravity. If Ag electrolysis is used to purify water on NASA space vehicles, plants and animals/astronauts will be exposed continuously to Ag(+), a regimen with unknown cellular and developmental consequences. Fertilized eggs of the marine mudsnail, Ilyanassa obsoleta, are the cells in which the effects of A(+) on microtubules were discovered. They distribute visible cytoplasmic contents according to gravity and contain cytoplasmic morphogenetic determinants for heart development. The objectives are to determine if the effects of Ag(+), AU(3+), (of biosensor relevance), or Gd(3+) (inhibitor of some stretch-activated ion channels) on the cytoskeleton (in the presence and absence of mechanical loading) will affect cellular responses to gravity.

  16. Catalytic Activity and Proton Translocation of Reconstituted Respiratory Complex I Monitored by Surface-Enhanced Infrared Absorption Spectroscopy.

    PubMed

    Gutiérrez-Sanz, Oscar; Forbrig, Enrico; Batista, Ana P; Pereira, Manuela M; Salewski, Johannes; Mroginski, Maria A; Götz, Robert; De Lacey, Antonio L; Kozuch, Jacek; Zebger, Ingo

    2018-05-22

    Respiratory complex I (CpI) is a key player in the way organisms obtain energy, being an energy transducer, which couples nicotinamide adenine dinucleotide (NADH)/quinone oxidoreduction with proton translocation by a mechanism that remains elusive so far. In this work, we monitored the function of CpI in a biomimetic, supported lipid membrane system assembled on a 4-aminothiophenol (4-ATP) self-assembled monolayer by surface-enhanced infrared absorption spectroscopy. 4-ATP serves not only as a linker molecule to a nanostructured gold surface but also as pH sensor, as indicated by concomitant density functional theory calculations. In this way, we were able to monitor NADH/quinone oxidoreduction-induced transmembrane proton translocation via the protonation state of 4-ATP, depending on the net orientation of CpI molecules induced by two complementary approaches. An associated change of the amide I/amide II band intensity ratio indicates conformational modifications upon catalysis which may involve movements of transmembrane helices or other secondary structural elements, as suggested in the literature [ Di Luca , Proc. Natl. Acad. Sci. U.S.A. , 2017 , 114 , E6314 - E6321 ].

  17. Influence of temperature and charge effects on thermophoresis of polystyrene beads⋆.

    PubMed

    Syshchyk, Olga; Afanasenkau, Dzmitry; Wang, Zilin; Kriegs, Hartmut; Buitenhuis, Johan; Wiegand, Simone

    2016-12-01

    We study the thermodiffusion behavior of spherical polystyrene beads with a diameter of 25 nm by infrared thermal diffusion Forced Rayleigh Scattering (IR-TDFRS). Similar beads were used to investigate the radial dependence of the Soret coefficient by different authors. While Duhr and Braun (Proc. Natl. Acad. Sci. U.S.A. 104, 9346 (2007)) observed a quadratic radial dependence Braibanti et al. (Phys. Rev. Lett. 100, 108303 (2008)) found a linear radial dependence of the Soret coefficient. We demonstrated that special care needs to be taken to obtain reliable thermophoretic data, because the measurements are very sensitive to surface properties. The colloidal particles were characterized by transmission electron microscopy and dynamic light scattering (DLS) experiments were performed. We carried out systematic thermophoretic measurements as a function of temperature, buffer and surfactant concentration. The temperature dependence was analyzed using an empirical formula. To describe the Debye length dependence we used a theoretical model by Dhont. The resulting surface charge density is in agreement with previous literature results. Finally, we analyze the dependence of the Soret coefficient on the concentration of the anionic surfactant sodium dodecyl sulfate (SDS), applying an empirical thermodynamic approach accounting for chemical contributions.

  18. Kinetic theory of dark solitons with tunable friction.

    PubMed

    Hurst, Hilary M; Efimkin, Dmitry K; Spielman, I B; Galitski, Victor

    2017-05-01

    We study controllable friction in a system consisting of a dark soliton in a one-dimensional Bose-Einstein condensate coupled to a noninteracting Fermi gas. The fermions act as impurity atoms, not part of the original condensate, that scatter off of the soliton. We study semiclassical dynamics of the dark soliton, a particlelike object with negative mass, and calculate its friction coefficient. Surprisingly, it depends periodically on the ratio of interspecies (impurity-condensate) to intraspecies (condensate-condensate) interaction strengths. By tuning this ratio, one can access a regime where the friction coefficient vanishes. We develop a general theory of stochastic dynamics for negative-mass objects and find that their dynamics are drastically different from their positive-mass counterparts: they do not undergo Brownian motion. From the exact phase-space probability distribution function (i.e., in position and velocity), we find that both the trajectory and lifetime of the soliton are altered by friction, and the soliton can undergo Brownian motion only in the presence of friction and a confining potential. These results agree qualitatively with experimental observations by Aycock et al. [Proc. Natl. Acad. Sci. USA 114 , 2503 (2017)] in a similar system with bosonic impurity scatterers.

  19. Nitrogen Monoxide (NO) Storage and Transport by Dinitrosyl-Dithiol-Iron Complexes: Long-lived NO That Is Trafficked by Interacting Proteins*

    PubMed Central

    Suryo Rahmanto, Yohan; Kalinowski, Danuta S.; Lane, Darius J. R.; Lok, Hiu Chuen; Richardson, Vera; Richardson, Des R.

    2012-01-01

    Nitrogen monoxide (NO) markedly affects intracellular iron metabolism, and recent studies have shown that molecules traditionally involved in drug resistance, namely GST and MRP1 (multidrug resistance-associated protein 1), are critical molecular players in this process. This is mediated by interaction of these proteins with dinitrosyl-dithiol-iron complexes (Watts, R. N., Hawkins, C., Ponka, P., and Richardson, D. R. (2006) Proc. Natl. Acad. Sci. U.S.A. 103, 7670–7675; Lok, H. C., Suryo Rahmanto, Y., Hawkins, C. L., Kalinowski, D. S., Morrow, C. S., Townsend, A. J., Ponka, P., and Richardson, D. R. (2012) J. Biol. Chem. 287, 607–618). These complexes are bioavailable, have a markedly longer half-life compared with free NO, and form in cells after an interaction between iron, NO, and glutathione. The generation of dinitrosyl-dithiol-iron complexes acts as a common currency for NO transport and storage by MRP1 and GST P1-1, respectively. Understanding the biological trafficking mechanisms involved in the metabolism of NO is vital for elucidating its many roles in cellular signaling and cytotoxicity and for development of new therapeutic targets. PMID:22262835

  20. Spin-polarized currents generated by magnetic Fe atomic chains.

    PubMed

    Lin, Zheng-Zhe; Chen, Xi

    2014-06-13

    Fe-based devices are widely used in spintronics because of high spin-polarization and magnetism. In this work, freestanding Fe atomic chains, the thinnest wires, were used to generate spin-polarized currents due to the spin-polarized energy bands. By ab initio calculations, the zigzag structure was found to be more stable than the wide-angle zigzag structure and had a higher ratio of spin-up and spin-down currents. By our theoretical prediction, Fe atomic chains have a sufficiently long thermal lifetime only at T ≦̸ 150 K, while C atomic chains are very stable even at T = 1000 K. This means that the spintronic devices based on Fe chains could work only at low temperatures. A system constructed by a short Fe chain sandwiched between two graphene electrodes could be used as a spin-polarized current generator, while a C chain could not be used in this way. The present work may be instructive and meaningful to further practical applications based on recent technical developments on the preparation of metal atomic chains (Proc. Natl. Acad. Sci. USA 107 9055 (2010)).

  1. A combination in-ovo vaccine for avian influenza virus and Newcastle disease virus.

    PubMed

    Steel, John; Burmakina, Svetlana V; Thomas, Colleen; Spackman, Erica; García-Sastre, Adolfo; Swayne, David E; Palese, Peter

    2008-01-24

    The protection of poultry from H5N1 highly pathogenic avian influenza A (HPAI) and Newcastle disease virus (NDV) can be achieved through vaccination, as part of a broader disease control strategy. We have previously generated a recombinant influenza virus expressing, (i) an H5 hemagglutinin protein, modified by the removal of the polybasic cleavage peptide and (ii) the ectodomain of the NDV hemagglutinin-neuraminidase (HN) protein in the place of the ectodomain of influenza neuraminidase (Park MS, et al. Proc Natl Acad Sci USA 2006;103(21):8203-8). Here we show this virus is attenuated in primary normal human bronchial epithelial (NHBE) cell culture, and demonstrate protection of C57BL/6 mice from lethal challenge with an H5 HA-containing influenza virus through immunisation with the recombinant virus. In addition, in-ovo vaccination of 18-day-old embryonated chicken eggs provided 90% and 80% protection against highly stringent lethal challenge by NDV and H5N1 virus, respectively. We propose that this virus has potential as a safe in-ovo live, attenuated, bivalent avian influenza and Newcastle disease virus vaccine.

  2. Reynolds number scaling of pocket events in the viscous sublayer

    NASA Astrophysics Data System (ADS)

    Metzger, M.; Fershtut, A.; Kunkel, C.; Klewicki, J.

    2017-12-01

    Recent findings [X. Wu et al., Proc. Natl. Acad. Sci. USA 114, E5292 (2017), 10.1073/pnas.1704671114] reinforce earlier assertions [e.g., R. Falco, Philos. Trans. R. Soc. London A 336, 103 (1991), 10.1098/rsta.1991.0069] that the sublayer pocket motions play a distinctly important role in near-wall dynamics. In the present study, smoke visualization and axial velocity measurements are combined in order to establish the scaling behavior of pocket events in the viscous sublayer of the turbulent boundary layer. In doing so, an identical analysis methodology is employed over an extensive range of friction Reynolds numbers 388 ≤δ+≤2.2 ×105 . Both the pocket width W and time interval between pocket events T increase logarithmically with Reynolds number when normalized by viscous units. Normalization of W and T by the Taylor microscales evaluated at a wall-normal location of about 100 viscous units, however, appears to successfully remove this Reynolds-number dependence. The present results are discussed in the context of motion formation owing to the three dimensionalization of the near-wall vorticity field and, concomitantly, the recurring perturbation of the viscous sublayer.

  3. High-Resolution Free-Energy Landscape Analysis of α-Helical Protein Folding: HP35 and Its Double Mutant

    PubMed Central

    2013-01-01

    The free-energy landscape can provide a quantitative description of folding dynamics, if determined as a function of an optimally chosen reaction coordinate. Here, we construct the optimal coordinate and the associated free-energy profile for all-helical proteins HP35 and its norleucine (Nle/Nle) double mutant, based on realistic equilibrium folding simulations [Piana et al. Proc. Natl. Acad. Sci. U.S.A.2012, 109, 17845]. From the obtained profiles, we directly determine such basic properties of folding dynamics as the configurations of the minima and transition states (TS), the formation of secondary structure and hydrophobic core during the folding process, the value of the pre-exponential factor and its relation to the transition path times, the relation between the autocorrelation times in TS and minima. We also present an investigation of the accuracy of the pre-exponential factor estimation based on the transition-path times. Four different estimations of the pre-exponential factor for both proteins give k0–1 values of approximately a few tens of nanoseconds. Our analysis gives detailed information about folding of the proteins and can serve as a rigorous common language for extensive comparison between experiment and simulation. PMID:24348206

  4. Generation of circularly polarized XUV and soft-x-ray high-order harmonics by homonuclear and heteronuclear diatomic molecules subject to bichromatic counter-rotating circularly polarized intense laser fields

    NASA Astrophysics Data System (ADS)

    Heslar, John; Telnov, Dmitry A.; Chu, Shih-I.

    2017-12-01

    Recently, studies of bright circularly polarized high-harmonic beams from atoms in the soft-x-ray region as a source for x-ray magnetic circular dichroism measurement in a tabletop-scale setup have received considerable attention. In this paper, we address the problem with molecular targets and perform a detailed quantum study of H2 +, CO, and N2 molecules in bichromatic counter-rotating circularly polarized laser fields where we adopt wavelengths (1300 and 790 nm) and intensities (2 ×1014W /cm2 ) reported in a recent experiment [Proc. Natl. Acad. Sci. USA 112, 14206 (2015), 10.1073/pnas.1519666112]. Our treatment of multiphoton processes in homonuclear and heteronuclear diatomic molecules is nonperturbative and based on the time-dependent density-functional theory for multielectron systems. The calculated radiation spectrum contains doublets of left and right circularly polarized harmonics with high-energy photons in the XUV and soft-x-ray ranges. Our results reveal intriguing and substantially different nonlinear optical responses for homonuclear and heteronuclear diatomic molecules subject to circularly polarized intense laser fields. We study in detail the below- and above-threshold harmonic regions and analyze the ellipticity and phase of the generated harmonic peaks.

  5. High-Resolution Free-Energy Landscape Analysis of α-Helical Protein Folding: HP35 and Its Double Mutant.

    PubMed

    Banushkina, Polina V; Krivov, Sergei V

    2013-12-10

    The free-energy landscape can provide a quantitative description of folding dynamics, if determined as a function of an optimally chosen reaction coordinate. Here, we construct the optimal coordinate and the associated free-energy profile for all-helical proteins HP35 and its norleucine (Nle/Nle) double mutant, based on realistic equilibrium folding simulations [Piana et al. Proc. Natl. Acad. Sci. U.S.A. 2012 , 109 , 17845]. From the obtained profiles, we directly determine such basic properties of folding dynamics as the configurations of the minima and transition states (TS), the formation of secondary structure and hydrophobic core during the folding process, the value of the pre-exponential factor and its relation to the transition path times, the relation between the autocorrelation times in TS and minima. We also present an investigation of the accuracy of the pre-exponential factor estimation based on the transition-path times. Four different estimations of the pre-exponential factor for both proteins give k 0 -1 values of approximately a few tens of nanoseconds. Our analysis gives detailed information about folding of the proteins and can serve as a rigorous common language for extensive comparison between experiment and simulation.

  6. Concerted dihedral rotations give rise to internal friction in unfolded proteins.

    PubMed

    Echeverria, Ignacia; Makarov, Dmitrii E; Papoian, Garegin A

    2014-06-18

    Protein chains undergo conformational diffusion during folding and dynamics, experiencing both thermal kicks and viscous drag. Recent experiments have shown that the corresponding friction can be separated into wet friction, which is determined by the solvent viscosity, and dry friction, where frictional effects arise due to the interactions within the protein chain. Despite important advances, the molecular origins underlying dry friction in proteins have remained unclear. To address this problem, we studied the dynamics of the unfolded cold-shock protein at different solvent viscosities and denaturant concentrations. Using extensive all-atom molecular dynamics simulations we estimated the internal friction time scales and found them to agree well with the corresponding experimental measurements (Soranno et al. Proc. Natl. Acad. Sci. U.S.A. 2012, 109, 17800-17806). Analysis of the reconfiguration dynamics of the unfolded chain further revealed that hops in the dihedral space provide the dominant mechanism of internal friction. Furthermore, the increased number of concerted dihedral moves at physiological conditions suggest that, in such conditions, the concerted motions result in higher frictional forces. These findings have important implications for understanding the folding kinetics of proteins as well as the dynamics of intrinsically disordered proteins.

  7. Variable-free exploration of stochastic models: a gene regulatory network example.

    PubMed

    Erban, Radek; Frewen, Thomas A; Wang, Xiao; Elston, Timothy C; Coifman, Ronald; Nadler, Boaz; Kevrekidis, Ioannis G

    2007-04-21

    Finding coarse-grained, low-dimensional descriptions is an important task in the analysis of complex, stochastic models of gene regulatory networks. This task involves (a) identifying observables that best describe the state of these complex systems and (b) characterizing the dynamics of the observables. In a previous paper [R. Erban et al., J. Chem. Phys. 124, 084106 (2006)] the authors assumed that good observables were known a priori, and presented an equation-free approach to approximate coarse-grained quantities (i.e., effective drift and diffusion coefficients) that characterize the long-time behavior of the observables. Here we use diffusion maps [R. Coifman et al., Proc. Natl. Acad. Sci. U.S.A. 102, 7426 (2005)] to extract appropriate observables ("reduction coordinates") in an automated fashion; these involve the leading eigenvectors of a weighted Laplacian on a graph constructed from network simulation data. We present lifting and restriction procedures for translating between physical variables and these data-based observables. These procedures allow us to perform equation-free, coarse-grained computations characterizing the long-term dynamics through the design and processing of short bursts of stochastic simulation initialized at appropriate values of the data-based observables.

  8. Kinetic theory of dark solitons with tunable friction

    PubMed Central

    Hurst, Hilary M.; Efimkin, Dmitry K.; Spielman, I. B.; Galitski, Victor

    2018-01-01

    We study controllable friction in a system consisting of a dark soliton in a one-dimensional Bose-Einstein condensate coupled to a noninteracting Fermi gas. The fermions act as impurity atoms, not part of the original condensate, that scatter off of the soliton. We study semiclassical dynamics of the dark soliton, a particlelike object with negative mass, and calculate its friction coefficient. Surprisingly, it depends periodically on the ratio of interspecies (impurity-condensate) to intraspecies (condensate-condensate) interaction strengths. By tuning this ratio, one can access a regime where the friction coefficient vanishes. We develop a general theory of stochastic dynamics for negative-mass objects and find that their dynamics are drastically different from their positive-mass counterparts: they do not undergo Brownian motion. From the exact phase-space probability distribution function (i.e., in position and velocity), we find that both the trajectory and lifetime of the soliton are altered by friction, and the soliton can undergo Brownian motion only in the presence of friction and a confining potential. These results agree qualitatively with experimental observations by Aycock et al. [Proc. Natl. Acad. Sci. USA 114, 2503 (2017)] in a similar system with bosonic impurity scatterers. PMID:29744482

  9. Analysis of the structure of complex networks at different resolution levels

    NASA Astrophysics Data System (ADS)

    Arenas, A.; Fernández, A.; Gómez, S.

    2008-05-01

    Modular structure is ubiquitous in real-world complex networks, and its detection is important because it gives insights into the structure-functionality relationship. The standard approach is based on the optimization of a quality function, modularity, which is a relative quality measure for the partition of a network into modules. Recently, some authors (Fortunato and Barthélemy 2007 Proc. Natl Acad. Sci. USA 104 36 and Kumpula et al 2007 Eur. Phys. J. B 56 41) have pointed out that the optimization of modularity has a fundamental drawback: the existence of a resolution limit beyond which no modular structure can be detected even though these modules might have their own entity. The reason is that several topological descriptions of the network coexist at different scales, which is, in general, a fingerprint of complex systems. Here, we propose a method that allows for multiple resolution screening of the modular structure. The method has been validated using synthetic networks, discovering the predefined structures at all scales. Its application to two real social networks allows us to find the exact splits reported in the literature, as well as the substructure beyond the actual split.

  10. Nonlinear nonlocal infrared plasmonic arrays for pump-probe studies on protein monolayers

    NASA Astrophysics Data System (ADS)

    Erramilli, Shyamsunder; Adato, Ronen; Gabel, Alan; Yanik, Ahmet Ali; Altug, Hatice; Hong, Mi K.

    2010-03-01

    Infrared spectroscopy is an exquisite bond-specific tool for studying biomolecules with characteristic vibrational normal modes that serve as a molecular ``fingerprint''. Intrinsic absorption cross-sections for proteins are significant (˜10-19 -10-21 cm^2), although small compared to label-based fluorescence methods. We have shown that carefully designed plasmonic nanoantenna arrays can enhance the vibrational signatures by ˜ 10^5 (Adato et al, Proc Natl Acad Sci USA, 2009). Theoretical modeling combined with polarized FTIR-microscopy show that enhancement is due both to localized effects and nonlocal collective effects, governed by the dielectric properties of silicon and gold nanoantennae, coupled to protein molecules. The resonance properties can be modulated by photoinduced excitation of charge carriers and excitons, causing both a shift in the resonance frequency and a change in the enhancement factor. An ultrafast visible pump laser can then be used to extend visible pump-infrared probe studies to protein molecules even when the molecules lack a chromophore. This provides a toolkit for biophysical studies in which the nonlinear, nonlocal interaction between a 35-fs visible or near-infrared laser and the designed plasmonic nanoantenna arrays are used to study dynamics of protein molecules.

  11. Sindbis virus proteins nsP1 and nsP2 contain homology to nonstructural proteins from several RNA plant viruses.

    PubMed Central

    Ahlquist, P; Strauss, E G; Rice, C M; Strauss, J H; Haseloff, J; Zimmern, D

    1985-01-01

    Although the genetic organization of tobacco mosaic virus (TMV) differs considerably from that of the tripartite viruses (alfalfa mosaic virus [AlMV] and brome mosaic virus [BMV]), all of these RNA plant viruses share three domains of homology among their nonstructural proteins. One such domain, common to the AlMV and BMV 2a proteins and the readthrough portion of TMV p183, is also homologous to the readthrough protein nsP4 of Sindbis virus (Haseloff et al., Proc. Natl. Acad. Sci. U.S.A. 81:4358-4362, 1984). Two more domains are conserved among the AlMV and BMV 1a proteins and TMV p126. We show here that these domains have homology with portions of the Sindbis proteins nsP1 and nsP2, respectively. These results strengthen the view that the four viruses share mechanistic similarities in their replication strategies and may be evolutionarily related. These results also suggest that either the AlMV 1a, BMV 1a, and TMV p126 proteins are multifunctional or Sindbis proteins nsP1 and nsP2 function together as subunits in a single complex. PMID:3968720

  12. Sequential folding of UmuC by the Hsp70 and Hsp60 chaperone complexes of Escherichia coli.

    PubMed

    Petit, M A; Bedale, W; Osipiuk, J; Lu, C; Rajagopalan, M; McInerney, P; Goodman, M F; Echols, H

    1994-09-23

    Replication-blocking lesions generate a signal in Escherichia coli that leads to the induction of the multigene SOS response. Among the SOS-induced genes are umuD and umuC, whose products are necessary for the increased mutation rate in induced bacteria. The mutations are likely to result from replication across the DNA lesion, and such a bypass event has been reconstituted in vitro (Rajagopalan, M., L, C., Woodgate, R., O'Donnel, M., Goodman, M. F., Echols, H. (1992) Proc. Natl. Acad. Sci. U.S.A. 89, 10777-10781). In this work, we show that the chaperone proteins promote the proper folding of UmuC protein in vitro. We treated purified and inactive UmuC with Hsp70 and Hsp60. After Hsp70 treatment, the DNA binding activity of UmuC was recovered, but the ability to promote replication across DNA lesions was not. However, lesion bypass activity was recovered upon further treatment with Hsp60. The biological significance of such a folding pathway for UmuC protein is strengthened by in vivo evidence for a role of DnaK in UV-induced mutagenesis.

  13. Local rules simulation of the kinetics of virus capsid self-assembly.

    PubMed

    Schwartz, R; Shor, P W; Prevelige, P E; Berger, B

    1998-12-01

    A computer model is described for studying the kinetics of the self-assembly of icosahedral viral capsids. Solution of this problem is crucial to an understanding of the viral life cycle, which currently cannot be adequately addressed through laboratory techniques. The abstract simulation model employed to address this is based on the local rules theory of. Proc. Natl. Acad. Sci. USA. 91:7732-7736). It is shown that the principle of local rules, generalized with a model of kinetics and other extensions, can be used to simulate complicated problems in self-assembly. This approach allows for a computationally tractable molecular dynamics-like simulation of coat protein interactions while retaining many relevant features of capsid self-assembly. Three simple simulation experiments are presented to illustrate the use of this model. These show the dependence of growth and malformation rates on the energetics of binding interactions, the tolerance of errors in binding positions, and the concentration of subunits in the examples. These experiments demonstrate a tradeoff within the model between growth rate and fidelity of assembly for the three parameters. A detailed discussion of the computational model is also provided.

  14. 77 FR 6587 - Startek USA, Inc. Alexandria, LA; Startek USA, Inc., Collinsville, VA; Amended Certification...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-02-08

    ... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-75,089; TA-W-75,089A] Startek USA, Inc. Alexandria, LA; Startek USA, Inc., Collinsville, VA; Amended Certification Regarding Eligibility... for Worker Adjustment Assistance on January 26, 2011, applicable to workers of StarTek USA, Inc...

  15. SciStarter 2.0: A Digital Platform to Foster and Study Sustained Engagement in Citizen Science

    NASA Astrophysics Data System (ADS)

    Hoffman, C.

    2016-12-01

    SciStarter is a popular online hotspot for citizen science. As a Match.com meets Amazon for citizen science projects, we connect the millions of citizen scientists to thousands of projects and events, and to the resources they need to participate. These opportunities represent ways for the general public from kids to adults to get involved in scientific research. Recently, SciStarter developed a new digital infrastructure to support sustained engagement in citizen science, and research into the behaviors and motivations of participants. The new digital infrastructure of SciStarter includes contribution tracking tools to make it easier to participate in multiple projects, enhanced GIS information to promote locally relevant projects, an online personal dashboard to keep track of contributions, and the use of these tools (contribution tracking, GIS, dashboard) by project owners and researchers to better understand and respond to the needs and interests of citizen science participants. We will provide an overview of these tools and the research behind their development. We will then explore how these new tools advance citizen science towards a future with more pathways to participatory policymaking, expanded access to informal STEM experiences, and lowered barriers to citizen science. Finally, we will present the research questions that can and will be answered through the site by practitioners in the diverse science and citizen science fields.

  16. Evaluating the Impact of Data Placement to Spark and SciDB with an Earth Science Use Case

    NASA Technical Reports Server (NTRS)

    Doan, Khoa; Oloso, Amidu; Kuo, Kwo-Sen; Clune, Thomas; Yu, Hongfeng; Nelson, Brian; Zhang, Jian

    2016-01-01

    We investigate the impact of data placement for two Big Data technologies, Spark and SciDB, with a use case from Earth Science where data arrays are multidimensional. Simultaneously, this investigation provides an opportunity to evaluate the performance of the technologies involved. Two datastores, HDFS and Cassandra, are used with Spark for our comparison. It is found that Spark with Cassandra performs better than with HDFS, but SciDB performs better yet than Spark with either datastore. The investigation also underscores the value of having data aligned for the most common analysis scenarios in advance on a shared nothing architecture. Otherwise, repartitioning needs to be carried out on the fly, degrading overall performance.

  17. Measurement of K + production cross section by 8 GeV protons using high energy neutrino interactions in the SciBooNE detector

    DOE PAGES

    Cheng, G.

    2011-07-28

    The SciBooNE Collaboration reports K + production cross section and rate measurements using high energy daughter muon neutrino scattering data off the SciBar polystyrene (C 8H 8) target in the SciBooNE detector. The K + mesons are produced by 8 GeV protons striking a beryllium target in Fermilab Booster Neutrino Beam line (BNB). Using observed neutrino and antineutrino events in SciBooNE, we measure d 2σ/dpdΩ = (5.34 ±0.76) mb/(GeV/c x sr) for p + Be =K + + X at mean K + energy of 3.9 GeV and angle (with respect to the proton beam direction) of 3.7 degrees, correspondingmore » to the selected K + sample. Compared to Monte Carlo predictions using previous higher energy K + production measurements, this measurement, which uses the NUANCE neutrino interaction generator, is consistent with a normalization factor of 0.85 ± 0.12. This agreement is evidence that the extrapolation of the higher energy K + measurements to an 8 GeV beam energy using Feynman scaling is valid. This measurement reduces the error on the K + production cross section from 40% to 14%.« less

  18. MRSA USA300 at Alaska Native Medical Center, Anchorage, Alaska, USA, 2000–2006

    PubMed Central

    Rudolph, Karen M.; Hennessy, Thomas W.; Zychowski, Diana L.; Asthi, Karthik; Boyle-Vavra, Susan; Daum, Robert S.

    2012-01-01

    To determine whether methicillin-resistant Staphylococcus aureus (MRSA) USA300 commonly caused infections among Alaska Natives, we examined clinical MRSA isolates from the Alaska Native Medical Center, Anchorage, during 2000–2006. Among Anchorage-region residents, USA300 was a minor constituent among MRSA isolates in 2000–2003 (11/68, 16%); by 2006, USA300 was the exclusive genotype identified (10/10). PMID:22264651

  19. A randomized controlled trial to test the efficacy of the SCI Get Fit Toolkit on leisure-time physical activity behaviour and social-cognitive processes in adults with spinal cord injury.

    PubMed

    Arbour-Nicitopoulos, Kelly P; Sweet, Shane N; Lamontagne, Marie-Eve; Ginis, Kathleen A Martin; Jeske, Samantha; Routhier, François; Latimer-Cheung, Amy E

    2017-01-01

    Single blind, two-group randomized controlled trial. To evaluate the efficacy of the SCI Get Fit Toolkit delivered online on theoretical constructs and moderate-to-vigorous physical activity (MVPA) among adults with SCI. Ontario and Quebec, Canada. Inactive, English- and French-speaking Canadian adults with traumatic SCI with Internet access, and no self-reported cognitive or memory impairments. Participants ( N =90 M age =48.12±11.29 years; 79% male) were randomized to view the SCI Get Fit Toolkit or the Physical Activity Guidelines for adults with SCI (PAG-SCI) online. Primary (intentions) and secondary (outcome expectancies, self-efficacy, planning and MVPA behaviour) outcomes were assessed over a 1-month period. Of the 90 participants randomized, 77 were included in the analyses. Participants viewed the experimental stimuli only briefly, reading the 4-page toolkit for approximately 2.5 min longer than the 1-page guideline document. No condition effects were found for intentions, outcome expectancies, self-efficacy, and planning (ΔR 2 ⩽0.03). Individuals in the toolkit condition were more likely to participate in at least one bout of 20 min of MVPA behaviour at 1-week post-intervention compared to individuals in the guidelines condition (OR=3.54, 95% CI=0.95, 13.17). However, no differences were found when examining change in weekly minutes of MVPA or comparing whether participants met the PAG-SCI. No firm conclusions can be made regarding the impact of the SCI Get Fit Toolkit in comparison to the PAG-SCI on social cognitions and MVPA behaviour. The limited online access to this resource may partially explain these null findings.

  20. Comparison of predicted pesticide concentrations in groundwater from SCI-GROW and PRZM-GW models with historical monitoring data.

    PubMed

    Estes, Tammara L; Pai, Naresh; Winchell, Michael F

    2016-06-01

    A key factor in the human health risk assessment process for the registration of pesticides by the US Environmental Protection Agency (EPA) is an estimate of pesticide concentrations in groundwater used for drinking water. From 1997 to 2011, these estimates were obtained from the EPA empirical model SCI-GROW. Since 2012, these estimates have been obtained from the EPA deterministic model PRZM-GW, which has resulted in a significant increase in estimated groundwater concentrations for many pesticides. Historical groundwater monitoring data from the National Ambient Water Quality Assessment (NAWQA) Program (1991-2014) were compared with predicted groundwater concentrations from both SCI-GROW (v.2.3) and PRZM-GW (v.1.07) for 66 different pesticides of varying environmental fate properties. The pesticide environmental fate parameters associated with over- and underprediction of groundwater concentrations by the two models were evaluated. In general, SCI-GROW2.3 predicted groundwater concentrations were close to maximum historically observed groundwater concentrations. However, for pesticides with soil organic carbon content values below 1000 L kg(-1) and no simulated hydrolysis, PRZM-GW overpredicted, often by greater than 100 ppb. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.