Sample records for acc oxidase transcripts

  1. Steady-state kinetics of substrate binding and iron release in tomato ACC oxidase.

    PubMed

    Thrower, J S; Blalock, R; Klinman, J P

    2001-08-14

    1-Aminocyclopropane-1-carboxylate oxidase (ACC oxidase) catalyzes the last step in the biosynthetic pathway of the plant hormone, ethylene. This unusual reaction results in the oxidative ring cleavage of 1-aminocyclopropane carboxylate (ACC) into ethylene, cyanide, and CO2 and requires ferrous ion, ascorbate, and molecular oxygen for catalysis. A new purification procedure and assay method have been developed for tomato ACC oxidase that result in greatly increased enzymatic activity. This method allowed us to determine the rate of iron release from the enzyme and the effect of the activator, CO2, on this rate. Initial velocity studies support an ordered kinetic mechanism where ACC binds first followed by O2; ascorbate can bind after O2 or possibly before ACC. This kinetic mechanism differs from one recently proposed for the ACC oxidase from avocado.

  2. Expression of ACC oxidase promoter-GUS fusions in tomato and Nicotiana plumbaginifolia regulated by developmental and environmental stimuli.

    PubMed

    Blume, B; Grierson, D

    1997-10-01

    The enzyme ACC oxidase, catalysing the last step in the biosynthesis of the plant hormone ethylene, is encoded by a small multigene family in tomato, comprising three members, LEACO1, LEACO2 and LEACO3. LEACO1 is the major gene expressed during ripening, leaf senescence, and wounding (Barry et al., 1996). To investigate the transcriptional regulation of ACC oxidase gene expression, chimeric fusions between the beta-glucuronidase reporter gene and 97 bp of 5' UTR plus 124, 396 and 1825 bp, respectively, of 5' untranscribed LEACO1 sequence were constructed and introduced into Lycopersicon esculentum (Mill cv. Ailsa Craig) and Nicotiana plumbaginifolia. Analysis of transgenic tomatoes indicated that the region containing nucleotides -124 to +97 of the LEACO1 gene is sufficient to confer a marked increase in GUS activity during fruit ripening, albeit at very low levels. Fusion of 396 and 1825 bp of LEACO1 upstream sequence resulted in strong and specific induction of GUS expression in situations known to be accompanied by enhanced ethylene production. Reporter gene expression was similar to that of the endogenous LEACO1 gene, with major increases especially during fruit ripening, senescence and abscission of leaves and, to a lesser extent, of flowers. Analysis of transgenic N. plumbaginifolia plants confirmed the pattern of LEACO1 promoter activity detected in tomato leaves and flowers. Reporter gene expression was also induced following wounding, treatment with ethylene, and pathogen infection. Histochemical analysis illustrated localized GUS activity in the pericarp of ripening fruit, abscission zones of senescent petioles and unfertilized flowers, and at wound sites. These results demonstrate that ACC oxidase is regulated at the transcriptional level in a wide range of cell types at different developmental stages and in response to several external stimuli.

  3. Global Transcriptomic Analysis of Targeted Silencing of Two Paralogous ACC Oxidase Genes in Banana

    PubMed Central

    Xia, Yan; Kuan, Chi; Chiu, Chien-Hsiang; Chen, Xiao-Jing; Do, Yi-Yin; Huang, Pung-Ling

    2016-01-01

    Among 18 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase homologous genes existing in the banana genome there are two genes, Mh-ACO1 and Mh-ACO2, that participate in banana fruit ripening. To better understand the physiological functions of Mh-ACO1 and Mh-ACO2, two hairpin-type siRNA expression vectors targeting both the Mh-ACO1 and Mh-ACO2 were constructed and incorporated into the banana genome by Agrobacterium-mediated transformation. The generation of Mh-ACO1 and Mh-ACO2 RNAi transgenic banana plants was confirmed by Southern blot analysis. To gain insights into the functional diversity and complexity between Mh-ACO1 and Mh-ACO2, transcriptome sequencing of banana fruits using the Illumina next-generation sequencer was performed. A total of 32,093,976 reads, assembled into 88,031 unigenes for 123,617 transcripts were obtained. Significantly enriched Gene Oncology (GO) terms and the number of differentially expressed genes (DEGs) with GO annotation were ‘catalytic activity’ (1327, 56.4%), ‘heme binding’ (65, 2.76%), ‘tetrapyrrole binding’ (66, 2.81%), and ‘oxidoreductase activity’ (287, 12.21%). Real-time RT-PCR was further performed with mRNAs from both peel and pulp of banana fruits in Mh-ACO1 and Mh-ACO2 RNAi transgenic plants. The results showed that expression levels of genes related to ethylene signaling in ripening banana fruits were strongly influenced by the expression of genes associated with ethylene biosynthesis. PMID:27681726

  4. Inactivation of 1-aminocyclopropane-1-carboxylate oxidase involves oxidative modifications.

    PubMed

    Barlow, J N; Zhang, Z; John, P; Baldwin, J E; Schofield, C J

    1997-03-25

    1-Aminocyclopropane-1-carboxylate (ACC) oxidase catalyzes the final step in the biosynthesis of the plant signaling molecule ethylene. It is a member of the ferrous iron dependent family of oxidases and dioxygenases and is unusual in that it displays a very short half-life under catalytic conditions, typically less than 20 min, and a requirement for CO2 as an activator. The rates of inactivation of purified, recombinant ACC oxidase from tomato under various combinations of substrates and cofactors were measured. Inactivation was relatively slow in the presence of buffer alone (t1/2 > 1 h), but fast in the presence of ferrous iron and ascorbate (t1/2 approximately 10 min). The rate of iron/ascorbate-mediated inactivation was increased by the addition of ACC, unaffected by the addition of CO2 at saturation (supplied as bicarbonate) but decreased by the addition of catalase or ACC + CO2 at saturation (supplied as bicarbonate). Iron/ascorbate-mediated inactivation was accompanied by partial proteolysis as observed by SDS-PAGE analysis. The fragmentation pattern was altered when ACC was also included, suggesting that ACC can bind to ACC oxidase in the absence of bicarbonate. N-terminal sequencing of fragments resulted in identification of an internal cleavage site which we propose is proximate to active-site bound iron. Thus, ACC oxidase inactivates via relatively slow partial unfolding of the catalytically active conformation, oxidative damage mediated via hydrogen peroxide which is catalase protectable and oxidative damage to the active site which results in partial proteolysis and is not catalase protectable.

  5. Analysis of nodule senescence in pea (Pisum sativum L.) using laser microdissection, real-time PCR, and ACC immunolocalization.

    PubMed

    Serova, Tatiana A; Tikhonovich, Igor A; Tsyganov, Viktor E

    2017-05-01

    A delay in the senescence of symbiotic nodules could prolong active nitrogen fixation, resulting in improved crop yield and a reduced need for chemical fertilizers. The molecular genetic mechanisms underlying nodule senescence have not been extensively studied with a view to breeding varieties with delayed nodule senescence. In such studies, plant mutants with the phenotype of premature degradation of symbiotic structures are useful models to elucidate the genetic basis of nodule senescence. Using a dataset from transcriptome analysis of Medicago truncatula Gaertn. nodules and previous studies on pea (Pisum sativum L.) nodules, we developed a set of molecular markers based on genes that are known to be activated during nodule senescence. These genes encode cysteine proteases, a thiol protease, a bZIP transcription factor, enzymes involved in the biosynthesis of ethylene (ACS2 for ACC synthase and ACO1 for ACC oxidase) and ABA (AO3 for aldehyde oxidase), and an enzyme involved in catabolism of gibberellins (GA 2-oxidase). We analyzed the transcript levels of these genes in the nodules of two pea wild-types (cv. Sparkle and line Sprint-2) and two mutant lines, one showing premature nodule senescence (E135F (sym13)) and one showing no morphological signs of symbiotic structure degradation (Sprint-2Fix - (sym31)). Real-time PCR analyses revealed that all of the selected genes showed increased transcript levels during nodule aging in all phenotypes. Remarkably, at 4 weeks after inoculation (WAI), the transcript levels of all analyzed genes were significantly higher in the early senescent nodules of the mutant line E135F (sym13) and in nodules of the mutant Sprint-2Fix - (sym31) than in the active nitrogen-fixing nodules of wild-types. In contrast, the transcript levels of the same genes of both wild-types were significantly increased only at 6 WAI. We evaluated the expression of selected markers in the different histological nodule zones of pea cv. Sparkle and its

  6. Characterization of Cu(II)-reconstituted ACC Oxidase using experimental and theoretical approaches.

    PubMed

    El Bakkali-Tahéri, Nadia; Tachon, Sybille; Orio, Maylis; Bertaina, Sylvain; Martinho, Marlène; Robert, Viviane; Réglier, Marius; Tron, Thierry; Dorlet, Pierre; Simaan, A Jalila

    2017-06-01

    1-Aminocyclopropane-1-carboxylic acid oxidase (ACCO) is a non heme iron(II) containing enzyme that catalyzes the final step of the ethylene biosynthesis in plants. The iron(II) ion is bound in a facial triad composed of two histidines and one aspartate (H177, D179 and H234). Several active site variants were generated to provide alternate binding motifs and the enzymes were reconstituted with copper(II). Continuous wave (cw) and pulsed Electron Paramagnetic Resonance (EPR) spectroscopies as well as Density Functional Theory (DFT) calculations were performed and models for the copper(II) binding sites were deduced. In all investigated enzymes, the copper ion is equatorially coordinated by the two histidine residues (H177 and H234) and probably two water molecules. The copper-containing enzymes are inactive, even when hydrogen peroxide is used in peroxide shunt approach. EPR experiments and DFT calculations were undertaken to investigate substrate's (ACC) binding on the copper ion and the results were used to rationalize the lack of copper-mediated activity. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. [Cloning, expression and transcriptional analysis of biotin carboxyl carrier protein gene (accA) from Amycolatopsis mediterranei U32 ].

    PubMed

    Lu, Jie; Yao, Yufeng; Jiang, Weihong; Jiao, Ruishen

    2003-02-01

    Acetyl CoA carboxylase (EC 6.4.1.2, ACC) catalyzes the ATP-dependent carboxylation of acetyl CoA to yield malonyl CoA, which is the first committed step in fatty acid synthesis. A pair of degenerate PCR primers were designed according to the conserved amino acid sequence of AccA from M. tuberculosis and S. coelicolor. The product of the PCR amplification, a DNA fragment of 250bp was used as a probe for screening the U32 genomic cosmid library and its gene, accA, coding the biotinylated protein subunit of acetyl CoA carboxylase, was successfully cloned from U32. The accA ORF encodes a 598-amino-acid protein with the calculated molecular mass of 63.7kD, with 70.1% of G + C content. A typical Streptomyces RBS sequence, AGGAGG, was found at the - 6 position upstream of the start codon GTG. Analysis of the deduced amino acid sequence showed the presence of biotin-binding site and putative ATP-bicarbonate interaction region, which suggested the U32 AccA may act as a biotin carboxylase as well as a biotin carrier protein. Gene accA was then cloned into the pET28 (b) vector and expressed solubly in E. coli BL21 (DE3) by 0.1 mmol/L IPTG induction. Western blot confirmed the covalent binding of biotin with AccA. Northern blot analyzed transcriptional regulation of accA by 5 different nitrogen sources.

  8. 1-Aminocyclopropane-1-carboxylic acid oxidase reaction mechanism and putative post-translational activities of the ACCO protein

    PubMed Central

    Dilley, David R.; Wang, Zhenyong; Kadirjan-Kalbach, Deena K.; Ververidis, Fillipos; Beaudry, Randolph; Padmanabhan, Kallaithe

    2013-01-01

    1-Aminocyclopropane-1-carboxylic acid (ACC) oxidase (ACCO) catalyses the final step in ethylene biosynthesis converting ACC to ethylene, cyanide, CO2, dehydroascorbate and water with inputs of Fe(II), ascorbate, bicarbonate (as activators) and oxygen. Cyanide activates ACCO. A ‘nest’ comprising several positively charged amino acid residues from the C-terminal α-helix 11 along with Lys158 and Arg299 are proposed as binding sites for ascorbate and bicarbonate to coordinately activate the ACCO reaction. The binding sites for ACC, bicarbonate and ascorbic acid for Malus domestica ACCO1 include Arg175, Arg244, Ser246, Lys158, Lys292, Arg299 and Phe300. Glutamate 297, Phe300 and Glu301 in α-helix 11 are also important for the ACCO reaction. Our proposed reaction pathway incorporates cyanide as an ACCO/Fe(II) ligand after reaction turnover. The cyanide ligand is likely displaced upon binding of ACC and ascorbate to provide a binding site for oxygen. We propose that ACCO may be involved in the ethylene signal transduction pathway not directly linked to the ACCO reaction. ACC oxidase has significant homology with Lycopersicon esculentum cysteine protease LeCp, which functions as a protease and as a regulator of 1-aminocyclopropane-1-carboxylic acid synthase (Acs2) gene expression. ACC oxidase may play a similar role in signal transduction after post-translational processing. ACC oxidase becomes inactivated by fragmentation and apparently has intrinsic protease and transpeptidase activity. ACC oxidase contains several amino acid sequence motifs for putative protein–protein interactions, phosphokinases and cysteine protease. ACC oxidase is subject to autophosphorylaton in vitro and promotes phosphorylation of some apple fruit proteins in a ripening-dependent manner. PMID:24244837

  9. AOX1-Subfamily Gene Members in Olea europaea cv. "Galega Vulgar"-Gene Characterization and Expression of Transcripts during IBA-Induced in Vitro Adventitious Rooting.

    PubMed

    Velada, Isabel; Grzebelus, Dariusz; Lousa, Diana; M Soares, Cláudio; Santos Macedo, Elisete; Peixe, Augusto; Arnholdt-Schmitt, Birgit; G Cardoso, Hélia

    2018-02-17

    Propagation of some Olea europaea L. cultivars is strongly limited due to recalcitrant behavior in adventitious root formation by semi-hardwood cuttings. One example is the cultivar "Galega vulgar". The formation of adventitious roots is considered a morphological response to stress. Alternative oxidase (AOX) is the terminal oxidase of the alternative pathway of the plant mitochondrial electron transport chain. This enzyme is well known to be induced in response to several biotic and abiotic stress situations. This work aimed to characterize the alternative oxidase 1 (AOX1)-subfamily in olive and to analyze the expression of transcripts during the indole-3-butyric acid (IBA)-induced in vitro adventitious rooting (AR) process. OeAOX1a (acc. no. MF410318) and OeAOX1d (acc. no. MF410319) were identified, as well as different transcript variants for both genes which resulted from alternative polyadenylation events. A correlation between transcript accumulation of both OeAOX1a and OeAOX1d transcripts and the three distinct phases (induction, initiation, and expression) of the AR process in olive was observed. Olive AOX1 genes seem to be associated with the induction and development of adventitious roots in IBA-treated explants. A better understanding of the molecular mechanisms underlying the stimulus needed for the induction of adventitious roots may help to develop more targeted and effective rooting induction protocols in order to improve the rooting ability of difficult-to-root cultivars.

  10. AOX1-Subfamily Gene Members in Olea europaea cv. “Galega Vulgar”—Gene Characterization and Expression of Transcripts during IBA-Induced in Vitro Adventitious Rooting

    PubMed Central

    Lousa, Diana; M. Soares, Cláudio; Santos Macedo, Elisete; Arnholdt-Schmitt, Birgit

    2018-01-01

    Propagation of some Olea europaea L. cultivars is strongly limited due to recalcitrant behavior in adventitious root formation by semi-hardwood cuttings. One example is the cultivar ”Galega vulgar”. The formation of adventitious roots is considered a morphological response to stress. Alternative oxidase (AOX) is the terminal oxidase of the alternative pathway of the plant mitochondrial electron transport chain. This enzyme is well known to be induced in response to several biotic and abiotic stress situations. This work aimed to characterize the alternative oxidase 1 (AOX1)-subfamily in olive and to analyze the expression of transcripts during the indole-3-butyric acid (IBA)-induced in vitro adventitious rooting (AR) process. OeAOX1a (acc. no. MF410318) and OeAOX1d (acc. no. MF410319) were identified, as well as different transcript variants for both genes which resulted from alternative polyadenylation events. A correlation between transcript accumulation of both OeAOX1a and OeAOX1d transcripts and the three distinct phases (induction, initiation, and expression) of the AR process in olive was observed. Olive AOX1 genes seem to be associated with the induction and development of adventitious roots in IBA-treated explants. A better understanding of the molecular mechanisms underlying the stimulus needed for the induction of adventitious roots may help to develop more targeted and effective rooting induction protocols in order to improve the rooting ability of difficult-to-root cultivars. PMID:29462998

  11. Real time expression of ACC oxidase and PR-protein genes mediated by Methylobacterium spp. in tomato plants challenged with Xanthomonas campestris pv. vesicatoria.

    PubMed

    Yim, W J; Kim, K Y; Lee, Y W; Sundaram, S P; Lee, Y; Sa, T M

    2014-07-15

    Biotic stress like pathogenic infection increases ethylene biosynthesis in plants and ethylene inhibitors are known to alleviate the severity of plant disease incidence. This study aimed to reduce the bacterial spot disease incidence in tomato plants caused by Xanthomonas campestris pv. vesicatoria (XCV) by modulating stress ethylene with 1-aminocyclopropane-1-carboxylate (ACC) deaminase activity of Methylobacterium strains. Under greenhouse condition, Methylobacterium strains inoculated and pathogen challenged tomato plants had low ethylene emission compared to pathogen infected ones. ACC accumulation and ACC oxidase (ACO) activity with ACO related gene expression increased in XCV infected tomato plants over Methylobacterium strains inoculated plants. Among the Methylobacterium spp., CBMB12 resulted lowest ACO related gene expression (1.46 Normalized Fold Expression), whereas CBMB20 had high gene expression (3.42 Normalized Fold Expression) in pathogen challenged tomato. But a significant increase in ACO gene expression (7.09 Normalized Fold Expression) was observed in the bacterial pathogen infected plants. In contrast, Methylobacterium strains enhanced β-1,3-glucanase and phenylalanine ammonia-lyase (PAL) enzyme activities in pathogen challenged tomato plants. The respective increase in β-1,3-glucanase related gene expressions due to CBMB12, CBMB15, and CBMB20 strains were 66.3, 25.5 and 10.4% higher over pathogen infected plants. Similarly, PAL gene expression was high with 0.67 and 0.30 Normalized Fold Expression, in pathogen challenged tomato plants inoculated with CBMB12 and CBMB15 strains. The results suggest that ethylene is a crucial factor in bacterial spot disease incidence and that methylobacteria with ACC deaminase activity can reduce the disease severity with ultimate pathogenesis-related protein increase in tomato. Copyright © 2014 Elsevier GmbH. All rights reserved.

  12. Identification of a copper(I) intermediate in the conversion of 1-aminocyclopropane carboxylic acid (ACC) into ethylene by Cu(II)-ACC complexes and hydrogen peroxide.

    PubMed

    Ghattas, Wadih; Giorgi, Michel; Mekmouche, Yasmina; Tanaka, Tsunehiro; Rockenbauer, Antal; Réglier, Marius; Hitomi, Yutaka; Simaan, A Jalila

    2008-06-02

    Several Cu(II) complexes with ACC (=1-aminocyclopropane carboxylic acid) or AIB (=aminoisobutyric acid) were prepared using 2,2'-bipyridine, 1,10-phenanthroline, and 2-picolylamine ligands: [Cu(2,2'-bipyridine)(ACC)(H2O)](ClO4) (1a), [Cu(1,10-phenanthroline)(ACC)](ClO4) (2a), [Cu(2-picolylamine)(ACC)](ClO4) (3a), and [Cu(2,2'-bipyridine)(AIB)(H2O)](ClO4) (1b). All of the complexes were characterized by X-ray diffraction analysis. The Cu(II)-ACC complexes are able to convert the bound ACC moiety into ethylene in the presence of hydrogen peroxide, in an "ACC-oxidase-like" activity. A few equivalents of base are necessary to deprotonate H2O2 for optimum activity. The presence of dioxygen lowers the yield of ACC conversion into ethylene by the copper(II) complexes. During the course of the reaction of Cu(II)-ACC complexes with H2O2, brown species (EPR silent and lambda max approximately 435 nm) were detected and characterized as being the Cu(I)-ACC complexes that are obtained upon reduction of the corresponding Cu(II) complexes by the deprotonated form of hydrogen peroxide. The geometry of the Cu(I) species was optimized by DFT calculations that reveal a change from square-planar to tetrahedral geometry upon reduction of the copper ion, in accordance with the observed nonreversibility of the redox process. In situ prepared Cu(I)-ACC complexes were also reacted with hydrogen peroxide, and a high level of ethylene formation was obtained. We propose Cu(I)-OOH as a possible active species for the conversion of ACC into ethylene, the structure of which was examined by DFT calculation.

  13. Characterization and expression analysis of a banana gene encoding 1-aminocyclopropane-1-carboxylate oxidase.

    PubMed

    Huang, P L; Do, Y Y; Huang, F C; Thay, T S; Chang, T W

    1997-04-01

    A cDNA encoding the banana 1-aminocyclopropane-1-carboxylate (ACC) oxidase has previously been isolated from a cDNA library that was constructed by extracting poly(A)+ RNA from peels of ripening banana. This cDNA, designated as pMAO2, has 1,199 bp and contains an open reading frame of 318 amino acids. In order to identify ripening-related promoters of the banana ACC oxidase gene, pMAO2 was used as a probe to screen a banana genomic library constructed in the lambda EMBL3 vector. The banana ACC oxidase MAO2 gene has four exons and three introns, with all of the boundaries between these introns and exons sharing a consensus dinucleotide sequence of GT-AG. The expression of MAO2 gene in banana begins after the onset of ripening (stage 2) and continuous into later stages of the ripening process. The accumulation of MAO2 mRNA can be induced by 1 microliter/l exogenous ethylene, and it reached steady state level when 100 microliters/l exogenous ethylene was present.

  14. Alteration of respiration capacity and transcript accumulation level of alternative oxidase genes in necrosis lines of common wheat.

    PubMed

    Sugie, Atsushi; Murai, Koji; Takumi, Shigeo

    2007-06-01

    Mitochondrial alternative oxidase (AOX) is the terminal oxidase responsible for cyanide-insensitive and salicylhydroxamic acid-sensitive respiration in plants. AOX is a key enzyme of the alternative respiration pathway. To study the effects of necrotic cell death on the mitochondrial function, production of reactive oxygen species (ROS), respiration capacities and accumulation patterns of mitochondria-targeted protein-encoding gene transcripts were compared between wild-type, lesion-mimic mutant and hybrid necrosis wheat plants. Around cells with the necrosis symptom, ROS accumulated abundantly in the intercellular spaces. The ratio of the alternative pathway to the cytochrome pathway was markedly enhanced in the necrotic leaves. Transcripts of a wheat AOX gene, Waox1a, were more abundant in a novel lesion-mimic mutant of common wheat than in the wild-type plants. An increased level of the Waox1a transcripts was also observed in hybrid plants containing Ne1 and Ne2 genes. These results indicated that an increase of the wheat AOX transcript level resulted in enhancement of respiration capacity of the alternative pathway in the necrotic cells.

  15. Effects of the inoculations using bacteria producing ACC deaminase on ethylene metabolism and growth of wheat grown under different soil water contents.

    PubMed

    Zhang, Guozhuang; Sun, Yonglin; Sheng, Hao; Li, Haichao; Liu, Xiping

    2018-04-01

    Crop growth and productivity are often impacted by the increased ethylene content induced by adverse environmental conditions such drought. Inoculations with bacteria producing ACC deaminase is considered as a potential biological approach to improve the growth and tolerance of stressed plants by lowering endogenous ethylene level. In this study, germinated wheat seeds were inoculated using three species of the rhizobacteria, which were isolated from the rhizosphere of wheat growing in dryland, and sown in pots. After three weeks, wheat seedlings were exposed to non-limiting water condition, medium drought and severe drought, respectively, for six weeks. The results showed that, irrespective of rhizobacterial inoculations, decreased soil water contents stimulated wheat ethylene metabolism, which was reflected by the significantly increased activity of ACC synthetase and ACC oxidase, besides an increased content of ACC both in the roots and leaves, and an enhanced capacity of leaves to release ethylene, concomitant with a significant decline in shoot and roots biomass. The inoculations of all three rhizobacterial species under each water condition reduced ACC content in wheat leaves, but effects of the inoculations on ACC synthase and ACC oxidase activity in the leaves and roots, ACC content in the roots, the capacity of leaves to release ethylene, and wheat growth varied with water conditions and bacterial species. Hence, both soil water conditions and rhizobacterial inoculations acted on all the processes of ethylene metabolism, with the former being dominant. The inoculations under non-limiting water condition and medium drought promoted shoot and root growth of wheat plants. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  16. Transcriptional and posttranscriptional regulation of the glycolate oxidase gene in tobacco seedlings.

    PubMed

    Barak, S; Nejidat, A; Heimer, Y; Volokita, M

    2001-03-01

    The roles of light and of the putative plastid signal in glycolate oxidase (GLO) gene expression were investigated in tobacco (Nicotiana tabacum cv. Samsun NN) seedlings during their shift from skotomorphogenic to photomorphogenic development. GLO transcript and enzyme activities were detected in etiolated seedlings. Their respective levels increased three- and six-fold during 96 h of exposure to light. The GLO transcript was almost undetectable in seedlings in which chloroplast development was impaired by photooxidation with the herbicide norflurazon. In transgenic tobacco seedlings, photooxidation inhibited the light-dependent increase in GUS activity when it was placed under the regulation of the GLO promoter P(GLO). However, even under these photooxidative conditions, a continuous increase in GUS activity was observed as compared to etiolated seedlings. When GUS expression was driven by the CaMV 35S promoter (P35S), no apparent difference was observed between etiolated, deetiolated and photooxidized seedlings. These observations indicate that the effects of the putative plastid development signal and light on GUS expression can be separated. Translational yield analysis indicated that the translation of the GUS transcript in P(GLO)::GUS seedlings was enhanced 30-fold over that of the GUS transcript in P35S::GUS seedlings. The overall picture emerging from these results is that in etiolated seedlings GLO transcript, though present at a substantial level, is translated at a low rate. Increased GLO transcription is enhanced, however, in response to signals originating from the developing plastids. GLO gene expression is further enhanced at the translational level by a yet undefined light-dependent mechanism.

  17. ACLY and ACC1 Regulate Hypoxia-Induced Apoptosis by Modulating ETV4 via α-ketoglutarate.

    PubMed

    Keenan, Melissa M; Liu, Beiyu; Tang, Xiaohu; Wu, Jianli; Cyr, Derek; Stevens, Robert D; Ilkayeva, Olga; Huang, Zhiqing; Tollini, Laura A; Murphy, Susan K; Lucas, Joseph; Muoio, Deborah M; Kim, So Young; Chi, Jen-Tsan

    2015-10-01

    In order to propagate a solid tumor, cancer cells must adapt to and survive under various tumor microenvironment (TME) stresses, such as hypoxia or lactic acidosis. To systematically identify genes that modulate cancer cell survival under stresses, we performed genome-wide shRNA screens under hypoxia or lactic acidosis. We discovered that genetic depletion of acetyl-CoA carboxylase (ACACA or ACC1) or ATP citrate lyase (ACLY) protected cancer cells from hypoxia-induced apoptosis. Additionally, the loss of ACLY or ACC1 reduced levels and activities of the oncogenic transcription factor ETV4. Silencing ETV4 also protected cells from hypoxia-induced apoptosis and led to remarkably similar transcriptional responses as with silenced ACLY or ACC1, including an anti-apoptotic program. Metabolomic analysis found that while α-ketoglutarate levels decrease under hypoxia in control cells, α-ketoglutarate is paradoxically increased under hypoxia when ACC1 or ACLY are depleted. Supplementation with α-ketoglutarate rescued the hypoxia-induced apoptosis and recapitulated the decreased expression and activity of ETV4, likely via an epigenetic mechanism. Therefore, ACC1 and ACLY regulate the levels of ETV4 under hypoxia via increased α-ketoglutarate. These results reveal that the ACC1/ACLY-α-ketoglutarate-ETV4 axis is a novel means by which metabolic states regulate transcriptional output for life vs. death decisions under hypoxia. Since many lipogenic inhibitors are under investigation as cancer therapeutics, our findings suggest that the use of these inhibitors will need to be carefully considered with respect to oncogenic drivers, tumor hypoxia, progression and dormancy. More broadly, our screen provides a framework for studying additional tumor cell stress-adaption mechanisms in the future.

  18. ACLY and ACC1 Regulate Hypoxia-Induced Apoptosis by Modulating ETV4 via α-ketoglutarate

    PubMed Central

    Keenan, Melissa M.; Liu, Beiyu; Tang, Xiaohu; Wu, Jianli; Cyr, Derek; Stevens, Robert D.; Ilkayeva, Olga; Huang, Zhiqing; Tollini, Laura A.; Murphy, Susan K.; Lucas, Joseph; Muoio, Deborah M.; Kim, So Young; Chi, Jen-Tsan

    2015-01-01

    In order to propagate a solid tumor, cancer cells must adapt to and survive under various tumor microenvironment (TME) stresses, such as hypoxia or lactic acidosis. To systematically identify genes that modulate cancer cell survival under stresses, we performed genome-wide shRNA screens under hypoxia or lactic acidosis. We discovered that genetic depletion of acetyl-CoA carboxylase (ACACA or ACC1) or ATP citrate lyase (ACLY) protected cancer cells from hypoxia-induced apoptosis. Additionally, the loss of ACLY or ACC1 reduced levels and activities of the oncogenic transcription factor ETV4. Silencing ETV4 also protected cells from hypoxia-induced apoptosis and led to remarkably similar transcriptional responses as with silenced ACLY or ACC1, including an anti-apoptotic program. Metabolomic analysis found that while α-ketoglutarate levels decrease under hypoxia in control cells, α-ketoglutarate is paradoxically increased under hypoxia when ACC1 or ACLY are depleted. Supplementation with α-ketoglutarate rescued the hypoxia-induced apoptosis and recapitulated the decreased expression and activity of ETV4, likely via an epigenetic mechanism. Therefore, ACC1 and ACLY regulate the levels of ETV4 under hypoxia via increased α-ketoglutarate. These results reveal that the ACC1/ACLY-α-ketoglutarate-ETV4 axis is a novel means by which metabolic states regulate transcriptional output for life vs. death decisions under hypoxia. Since many lipogenic inhibitors are under investigation as cancer therapeutics, our findings suggest that the use of these inhibitors will need to be carefully considered with respect to oncogenic drivers, tumor hypoxia, progression and dormancy. More broadly, our screen provides a framework for studying additional tumor cell stress-adaption mechanisms in the future. PMID:26452058

  19. The Jasmonate-Activated Transcription Factor MdMYC2 Regulates ETHYLENE RESPONSE FACTOR and Ethylene Biosynthetic Genes to Promote Ethylene Biosynthesis during Apple Fruit Ripening[OPEN

    PubMed Central

    Xu, Yaxiu; Zhang, Lichao; Ji, Yinglin; Tan, Dongmei; Yuan, Hui

    2017-01-01

    The plant hormone ethylene is critical for ripening in climacteric fruits, including apple (Malus domestica). Jasmonate (JA) promotes ethylene biosynthesis in apple fruit, but the underlying molecular mechanism is unclear. Here, we found that JA-induced ethylene production in apple fruit is dependent on the expression of MdACS1, an ACC synthase gene involved in ethylene biosynthesis. The expression of MdMYC2, encoding a transcription factor involved in the JA signaling pathway, was enhanced by MeJA treatment in apple fruits, and MdMYC2 directly bound to the promoters of both MdACS1 and the ACC oxidase gene MdACO1 and enhanced their transcription. Furthermore, MdMYC2 bound to the promoter of MdERF3, encoding a transcription factor involved in the ethylene-signaling pathway, thereby activating MdACS1 transcription. We also found that MdMYC2 interacted with MdERF2, a suppressor of MdERF3 and MdACS1. This protein interaction prevented MdERF2 from interacting with MdERF3 and from binding to the MdACS1 promoter, leading to increased transcription of MdACS1. Collectively, these results indicate that JA promotes ethylene biosynthesis through the regulation of MdERFs and ethylene biosynthetic genes by MdMYC2. PMID:28550149

  20. Transcriptional regulation of the novel monoamine oxidase renalase: Crucial roles of transcription factors Sp1, STAT3, and ZBP89.

    PubMed

    Sonawane, Parshuram J; Gupta, Vinayak; Sasi, Binu K; Kalyani, Ananthamohan; Natarajan, Bhargavi; Khan, Abrar A; Sahu, Bhavani S; Mahapatra, Nitish R

    2014-11-11

    Renalase, a novel monoamine oxidase, is emerging as an important regulator of cardiovascular, metabolic, and renal diseases. However, the mechanism of transcriptional regulation of this enzyme remains largely unknown. We undertook a systematic analysis of the renalase gene to identify regulatory promoter elements and transcription factors. Computational analysis coupled with transfection of human renalase promoter/luciferase reporter plasmids (5'-promoter-deletion constructs) into various cell types (HEK-293, IMR32, and HepG2) identified two crucial promoter domains at base pairs -485 to -399 and -252 to -150. Electrophoretic mobility shift assays using renalase promoter oligonucleotides with and without potential binding sites for transcription factors Sp1, STAT3, and ZBP89 displayed formation of specific complexes with HEK-293 nuclear proteins. Consistently, overexpression of Sp1, STAT3, and ZBP89 augmented renalase promoter activity; additionally, siRNA-mediated downregulation of Sp1, STAT3, and ZBP89 reduced the level of endogenous renalase transcription as well as the transfected renalase promoter activity. In addition, chromatin immunoprecipitation assays showed in vivo interactions of these transcription factors with renalase promoter. Interestingly, renalase promoter activity was augmented by nicotine and catecholamines; while Sp1 and STAT3 synergistically activated the nicotine-induced effect, Sp1 appeared to enhance epinephrine-evoked renalase transcription. Moreover, renalase transcript levels in mouse models of human essential hypertension were concomitantly associated with endogenous STAT3 and ZBP89 levels, suggesting crucial roles for these transcription factors in regulating renalase gene expression in cardiovascular pathological conditions.

  1. Characterization of Ethylene Biosynthesis Associated with Ripening in Banana Fruit1

    PubMed Central

    Liu, Xuejun; Shiomi, Shinjiro; Nakatsuka, Akira; Kubo, Yasutaka; Nakamura, Reinosuke; Inaba, Akitsugu

    1999-01-01

    We investigated the characteristics of ethylene biosynthesis associated with ripening in banana (Musa sp. [AAA group, Cavendish subgroup] cv Grand Nain) fruit. MA-ACS1 encoding 1-aminocyclopropane-1-carboxylic acid (ACC) synthase in banana fruit was the gene related to the ripening process and was inducible by exogenous ethylene. At the onset of the climacteric period in naturally ripened fruit, ethylene production increased greatly, with a sharp peak concomitant with an increase in the accumulation of MA-ACS1 mRNA, and then decreased rapidly. At the onset of ripening, the in vivo ACC oxidase activity was enhanced greatly, followed by an immediate and rapid decrease. Expression of the MA-ACO1 gene encoding banana ACC oxidase was detectable at the preclimacteric stage, increased when ripening commenced, and then remained high throughout the later ripening stage despite of a rapid reduction in the ACC oxidase activity. This discrepancy between enzyme activity and gene expression of ACC oxidase could be, at least in part, due to reduced contents of ascorbate and iron, cofactors for the enzyme, during ripening. Addition of these cofactors to the incubation medium greatly stimulated the in vivo ACC oxidase activity during late ripening stages. The results suggest that ethylene production in banana fruit is regulated by transcription of MA-ACS1 until climacteric rise and by reduction of ACC oxidase activity possibly through limited in situ availability of its cofactors once ripening has commenced, which in turn characterizes the sharp peak of ethylene production. PMID:10594112

  2. The Jasmonate-Activated Transcription Factor MdMYC2 Regulates ETHYLENE RESPONSE FACTOR and Ethylene Biosynthetic Genes to Promote Ethylene Biosynthesis during Apple Fruit Ripening.

    PubMed

    Li, Tong; Xu, Yaxiu; Zhang, Lichao; Ji, Yinglin; Tan, Dongmei; Yuan, Hui; Wang, Aide

    2017-06-01

    The plant hormone ethylene is critical for ripening in climacteric fruits, including apple ( Malus domestica ). Jasmonate (JA) promotes ethylene biosynthesis in apple fruit, but the underlying molecular mechanism is unclear. Here, we found that JA-induced ethylene production in apple fruit is dependent on the expression of MdACS1 , an ACC synthase gene involved in ethylene biosynthesis. The expression of MdMYC2 , encoding a transcription factor involved in the JA signaling pathway, was enhanced by MeJA treatment in apple fruits, and MdMYC2 directly bound to the promoters of both MdACS1 and the ACC oxidase gene MdACO1 and enhanced their transcription. Furthermore, MdMYC2 bound to the promoter of MdERF3 , encoding a transcription factor involved in the ethylene-signaling pathway, thereby activating MdACS1 transcription. We also found that MdMYC2 interacted with MdERF2, a suppressor of MdERF3 and MdACS1 This protein interaction prevented MdERF2 from interacting with MdERF3 and from binding to the MdACS1 promoter, leading to increased transcription of MdACS1 Collectively, these results indicate that JA promotes ethylene biosynthesis through the regulation of MdERFs and ethylene biosynthetic genes by MdMYC2. © 2017 American Society of Plant Biologists. All rights reserved.

  3. Genetic Profiling Reveals Cross-Contamination and Misidentification of 6 Adenoid Cystic Carcinoma Cell Lines: ACC2, ACC3, ACCM, ACCNS, ACCS and CAC2

    PubMed Central

    Phuchareon, Janyaporn; Ohta, Yoshihito; Woo, Jonathan M.; Eisele, David W.; Tetsu, Osamu

    2009-01-01

    Adenoid cystic carcinoma (ACC) is the second most common malignant neoplasm of the salivary glands. Most patients survive more than 5 years after surgery and postoperative radiation therapy. The 10 year survival rate, however, drops to 40%, due to locoregional recurrences and distant metastases. Improving long-term survival in ACC requires the development of more effective systemic therapies based on a better understanding of the biologic behavior of ACC. Much preclinical research in this field involves the use of cultured cells and, to date, several ACC cell lines have been established. Authentication of these cell lines, however, has not been reported. We performed DNA fingerprint analysis on six ACC cell lines using short tandem repeat (STR) examinations and found that all six cell lines had been contaminated with other cells. ACC2, ACC3, and ACCM were determined to be cervical cancer cells (HeLa cells), whereas the ACCS cell line was composed of T24 urinary bladder cancer cells. ACCNS and CAC2 cells were contaminated with cells derived from non-human mammalian species: the cells labeled ACCNS were mouse cells and the CAC2 cells were rat cells. These observations suggest that future studies using ACC cell lines should include cell line authentication to avoid the use of contaminated or non-human cells. PMID:19557180

  4. Salicylic Acid Regulation of Respiration in Higher Plants: Alternative Oxidase Expression.

    PubMed Central

    Rhoads, DM; McIntosh, L

    1992-01-01

    Alternative respiratory pathway capacity increases during the development of the thermogenic appendix of a voodoo lily inflorescence. The levels of the alternative oxidase proteins increased dramatically between D-4 (4 days prior to the day of anthesis) and D-3 and continued to increase until the day of anthesis (D-day). The level of salicylic acid (SA) in the appendix is very low early on D-1, but increases to a high level in the evening of D-1. Thermogenesis occurs after a few hours of light on D-day. Therefore, the initial accumulation of the alternative oxidase proteins precedes the increase in SA by 3 days, indicating that other regulators may be involved. A 1.6-kb transcript encoding the alternative oxidase precursor protein accumulated to a high level in the appendix tissue by D-1. Application of SA to immature appendix tissue caused an increase in alternative pathway capacity and a dramatic accumulation of the alternative oxidase proteins and the 1.6-kb transcript. Time course experiments showed that the increase in capacity, protein levels, and transcript level corresponded precisely. The response to SA was blocked by cycloheximide or actinomycin D, indicating that de novo transcription and translation are required. However, nuclear, in vitro transcription assays indicated that the accumulation of the 1.6-kb transcript did not result from a simple increase in the rate of transcription of aox1. PMID:12297672

  5. A structural and functional model for the 1-aminocyclopropane-1-carboxylic acid oxidase.

    PubMed

    Sallmann, Madleen; Oldenburg, Fabio; Braun, Beatrice; Réglier, Marius; Simaan, A Jalila; Limberg, Christian

    2015-10-12

    The hitherto most realistic low-molecular-weight analogue for the 1-aminocyclopropane-1-carboxylic acid oxidase (ACCO) is reported. The ACCOs 2-His-1-carboxylate iron(II) active site was mimicked by a TpFe moiety, to which the natural substrate ACC could be bound. The resulting complex [Tp(Me,Ph) FeACC] (1), according to X-ray diffraction analysis performed for the nickel analogue, represents an excellent structural model, featuring ACC coordinated in a bidentate fashion-as proposed for the enzymatic substrate complex-as well as a vacant coordination site that forms the basis for the first successful replication also of the ACCO function: 1 is the first known ACC complex that reacts with O2 to produce ethylene. As a FeOOH species had been suggested as intermediate in the catalytic cycle, H2 O2 was tested as the oxidant, too, and indeed evolution of ethylene proceeded even more rapidly to give 65 % yield. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Characterization of a multicopper oxidase gene cluster in Phanerochaete chrysosporium and evidence of altered splicing of the mco transcripts

    Treesearch

    Luis F. Larrondo; Bernardo Gonzalez; Dan Cullen; Rafael Vicuna

    2004-01-01

    A cluster of multicopper oxidase genes (mco1, mco2, mco3, mco4) from the lignin-degrading basidiomycete Phanerochaete chrysosporium is described. The four genes share the same transcriptional orientation within a 25 kb region. mco1, mco2 and mco3 are tightly grouped, with intergenic regions of 2.3 and 0.8 kb, respectively, whereas mco4 is located 11 kb upstream of mco1...

  7. Molecular cloning, expression, and stress response of the estrogen-related receptor gene (AccERR) from Apis cerana cerana

    NASA Astrophysics Data System (ADS)

    Zhang, Weixing; Zhu, Ming; Zhang, Ge; Liu, Feng; Wang, Hongfang; Guo, Xingqi; Xu, Baohua

    2016-04-01

    Estrogen-related receptor (ERR), which belongs to the nuclear receptor superfamily, has been implicated in diverse physiological processes involving the estrogen signaling pathway. However, little information is available on ERR in Apis cerana cerana. In this report, we isolated the ERR gene and investigated its involvement in antioxidant defense. Quantitative real-time polymerase chain reaction (qPCR) revealed that the highest mRNA expression occurred in eggs during different developmental stages. The expression levels of AccERR were highest in the muscle, followed by the rectum. The predicted transcription factor binding sites in the promoter of AccERR suggested that AccERR potentially functions in early development and in environmental stress responses. The expression of AccERR was induced by cold (4 °C), heat (42 °C), ultraviolet light (UV), HgCl2, and various types of pesticides (phoxim, deltamethrin, triadimefon, and cyhalothrin). Western blot was used to measure the expression levels of AccERR protein. These data suggested that AccERR might play a vital role in abiotic stress responses.

  8. Variable responses of two VlMYBA gene promoters to ABA and ACC in Kyoho grape berries.

    PubMed

    Zhai, Xiawan; Zhang, Yushu; Kai, Wenbin; Liang, Bin; Jiang, Li; Du, Yangwei; Wang, Juan; Sun, Yufei; Leng, Ping

    2017-04-01

    The VlMYBA subfamily of transcription factors has been known to be the functional regulators in anthocyanin biosynthesis in red grapes. In this study, the expressions of the VlMYBA1-2 and VlMYBA 2 genes, and the responses of the VlMYBA1-2/2 promoters to ABA and ACC treatments in Kyoho grape berries are examined through quantitative real-time PCR analysis and the transient expression assay. The results show that the expressions of VlMYBA1-2/2 increase dramatically after véraison and reach their highest levels when the berries are nearly fully ripe. Exogenous ABA promotes the expressions of VlMYBA1-2/2, whereas the ACC treatment increases the expression of VlMYBA2, however, it has no effect on VlMYBA1-2. The ABA treatment has a faster and stronger effect on berry pigmentation than ACC does. The VlMYBA1-2 promoter sequence contains two ABA response elements (ABRE) but no ethylene response element (ERE), whereas the VlMYBA2 promoter sequence contains two ABRE and one ERE in the upstream region of the start codon. The VlMYBA2 promoter can be activated by both ABA (more effective) and ACC, whereas the VlMYBA1-2 promoter can be activated by ABA only. In sum, ABA can promote the coloring of Kyoho grape by the promotion of VlMYBA1-2/2 transcriptions via activating the response of their promoters to ABA, whereas ethylene only regulates VlMYBA2 through the response activation of its promoter to ACC which partially enhances the coloring. Copyright © 2017 Elsevier GmbH. All rights reserved.

  9. Ethylene emission and PR protein synthesis in ACC deaminase producing Methylobacterium spp. inoculated tomato plants (Lycopersicon esculentum Mill.) challenged with Ralstonia solanacearum under greenhouse conditions.

    PubMed

    Yim, Woojong; Seshadri, Sundaram; Kim, Kiyoon; Lee, Gillseung; Sa, Tongmin

    2013-06-01

    Bacteria of genus Methylobacterium have been found to promote plant growth and regulate the level of ethylene in crop plants. This work is aimed to test the induction of defense responses in tomato against bacterial wilt by stress ethylene level reduction mediated by the ACC deaminase activity of Methylobacterium strains. Under greenhouse conditions, the disease index value in Methylobacterium sp. inoculated tomato plants was lower than control plants. Plants treated with Methylobacterium sp. challenge inoculated with Ralstonia solanacearum (RS) showed significantly reduced disease symptoms and lowered ethylene emission under greenhouse condition. The ACC and ACO (1-aminocyclopropane-1-carboxylate oxidase) accumulation in tomato leaves were significantly reduced with Methylobacterium strains inoculation. While ACC oxidase gene expression was found higher in plants treated with R. solanacearum than Methylobacterium sp. treatment, PR proteins related to induced systemic resistance like β-1,3-glucanase, PAL, PO and PPO were increased in Methylobacterium sp. inoculated plants. A significant increase in β-1,3-glucanase and PAL gene expression was found in all the Methylobacterium spp. treatments compared to the R. solanacearum treatment. This study confirms the activity of Methylobacterium sp. in increasing the defense enzymes by modulating the ethylene biosynthesis pathway and suggests the use of methylotrophic bacteria as potential biocontrol agents in tomato cultivation. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  10. Identification of a melatonin receptor type 1A gene ( AccMTNR1A) in Apis cerana cerana and its possible involvement in the response to low temperature stress

    NASA Astrophysics Data System (ADS)

    Li, Guilin; Zhang, Yanming; Ni, Yong; Wang, Ying; Xu, Baohua; Guo, Xingqi

    2018-04-01

    It is known that melatonin plays an indispensable role in the defense against some environment-induced stresses. The melatonin receptor (MTNR) is also closely linked to the environmental stress response in mammals. However, little is known about the function of the MTNR in insects, including honeybees. In this study, we identified a MTNR from Apis cerana cerana named AccMTNR1A, which contained a typical seven-transmembrane domain common to this family of receptors. A subcellular localization analysis showed that AccMTNR1A was localized in the cytomembrane. Additionally, we found that cold stress apparently boosted AccMTNR1A transcription, indicating that AccMTNR1A possibly connects to the cold stress response. The knockdown of AccMTNR1A attenuated the expression level of some genes associated with the cold stress response, suggesting that AccMTNR1A likely plays an analogous role with these genes during low temperature stress response. Moreover, silencing of AccMTNR1A also suppressed the transcription of some antioxidant genes, prompting the possibility that the response of AccMTNR1A to cold stress response may be related to antioxidant signaling pathways. Collectively, the findings presented here provide evidence that AccMTNR1A may play essential roles in protecting Apis cerana cerana from cold stress.

  11. Reduced heart size and increased myocardial fuel substrate oxidation in ACC2 mutant mice

    PubMed Central

    Essop, M. Faadiel; Camp, Heidi S.; Choi, Cheol Soo; Sharma, Saumya; Fryer, Ryan M.; Reinhart, Glenn A.; Guthrie, Patrick H.; Bentebibel, Assia; Gu, Zeiwei; Shulman, Gerald I.; Taegtmeyer, Heinrich; Wakil, Salih J.; Abu-Elheiga, Lutfi

    2008-01-01

    The cardiac-enriched isoform of acetyl-CoA carboxylase (ACC2) is a key regulator of mitochondrial fatty acid (FA) uptake via carnitine palmitoyltransferase 1 (CPT1). To test the hypothesis that oxidative metabolism is upregulated in hearts from animals lacking ACC2 (employing a transgenic Acc2-mutant mouse), we assessed cardiac function in vivo and determined rates of myocardial substrate oxidation ex vivo. When examined by echocardiography, there was no difference in systolic function, but left ventricular mass of the Acc2-mutant (MUT) mouse was significantly reduced (∼25%) compared with wild-types (WT). Reduced activation of the mammalian target of rapamycin (mTOR) and its downstream target p70S6K was found in MUT hearts. Exogenous oxidation rates of oleate were increased ∼22%, and, unexpectedly, exogenous glucose oxidation rates were also increased in MUT hearts. Using a hyperinsulinemic-euglycemic clamp, we found that glucose uptake in MUT hearts was increased by ∼83%. Myocardial triglyceride levels were significantly reduced in MUT vs. WT while glycogen content was the same. In parallel, transcript levels of PPARα and its target genes, pyruvate dehydrogenase kinase-4 (PDK-4), malonyl-CoA decarboxylase (MCD), and mCPT1, were downregulated in MUT mice. In summary, we report that 1) Acc2-mutant hearts exhibit a marked preference for the oxidation of both glucose and FAs coupled with greater utilization of endogenous fuel substrates (triglycerides), 2) attenuated mTOR signaling may result in reduced heart sizes observed in Acc2-mutant mice, and 3) Acc2-mutant hearts displayed normal functional parameters despite a significant decrease in size. PMID:18487439

  12. NAC transcription factor speedy hyponastic growth regulates flooding-induced leaf movement in Arabidopsis.

    PubMed

    Rauf, Mamoona; Arif, Muhammad; Fisahn, Joachim; Xue, Gang-Ping; Balazadeh, Salma; Mueller-Roeber, Bernd

    2013-12-01

    In rosette plants, root flooding (waterlogging) triggers rapid upward (hyponastic) leaf movement representing an important architectural stress response that critically determines plant performance in natural habitats. The directional growth is based on localized longitudinal cell expansion at the lower (abaxial) side of the leaf petiole and involves the volatile phytohormone ethylene (ET). We report the existence of a transcriptional core unit underlying directional petiole growth in Arabidopsis thaliana, governed by the NAC transcription factor speedy hyponastic growth (SHYG). Overexpression of SHYG in transgenic Arabidopsis thaliana enhances waterlogging-triggered hyponastic leaf movement and cell expansion in abaxial cells of the basal petiole region, while both responses are largely diminished in shyg knockout mutants. Expression of several expansin and xyloglucan endotransglycosylase/hydrolase genes encoding cell wall-loosening proteins was enhanced in SHYG overexpressors but lowered in shyg. We identified ACC oxidase5 (ACO5), encoding a key enzyme of ET biosynthesis, as a direct transcriptional output gene of SHYG and found a significantly reduced leaf movement in response to root flooding in aco5 T-DNA insertion mutants. Expression of SHYG in shoot tissue is triggered by root flooding and treatment with ET, constituting an intrinsic ET-SHYG-ACO5 activator loop for rapid petiole cell expansion upon waterlogging.

  13. Ethylene biosynthesis by 1-aminocyclopropane-1-carboxylic acid oxidase: a DFT study.

    PubMed

    Bassan, Arianna; Borowski, Tomasz; Schofield, Christopher J; Siegbahn, Per E M

    2006-11-24

    The reaction catalyzed by the plant enzyme 1-aminocyclopropane-1-carboxylic acid oxidase (ACCO) was investigated by using hybrid density functional theory. ACCO belongs to the non-heme iron(II) enzyme superfamily and carries out the bicarbonate-dependent two-electron oxidation of its substrate ACC (1-aminocyclopropane-1-carboxylic acid) concomitant with the reduction of dioxygen and oxidation of a reducing agent probably ascorbate. The reaction gives ethylene, CO(2), cyanide and two water molecules. A model including the mononuclear iron complex with ACC in the first coordination sphere was used to study the details of O-O bond cleavage and cyclopropane ring opening. Calculations imply that this unusual and complex reaction is triggered by a hydrogen atom abstraction step generating a radical on the amino nitrogen of ACC. Subsequently, cyclopropane ring opening followed by O-O bond heterolysis leads to a very reactive iron(IV)-oxo intermediate, which decomposes to ethylene and cyanoformate with very low energy barriers. The reaction is assisted by bicarbonate located in the second coordination sphere of the metal.

  14. The final step of the ethylene biosynthesis pathway in turnip tops (Brassica rapa): molecular characterization of the 1-aminocyclopropane-1-carboxylate oxidase BrACO1 throughout zygotic embryogenesis and germination of heterogeneous seeds.

    PubMed

    Del Carmen Rodríguez-Gacio, María; Nicolás, Carlos; Matilla, Angel Jesús

    2004-05-01

    In a previous report from the present authors, it was shown that the 1-aminocyclopropane-1-carboxylate (ACC) oxidation may play a crucial role during zygotic embryogenesis of turnip tops seeds. The present study was performed to elucidate the contribution of the silique-wall and seeds in ethylene production during this developmental process. ACC content in the silique wall is only higher than in seeds during the middle phases of zygotic embryogenesis. The ACC-oxidase (ACO) activity peaks in the silique-wall and seeds during the onset of embryogenesis, declining gradually afterwards, being undetectable during desiccation period. Using reverse transcriptase-polymerase chain reaction, one cDNA clone coding for an ACO and called BrACO1, was isolated. The deduced protein for BrACO1 has a molecular weight of 36.8 kDa and a high homology with other crucifer ACOs. The heterologous expression of this cDNA confirmed that BrACO1 is an ACO. The expression of this gene was high during the first phases of silique-wall development, low during the middle phases and undetectable during desiccation. By contrast, BrACO1 transcript was accumulated only in the earliest phases of seed embryogenesis and may participate in the highest ACO activity and ethylene production by seeds at the beginning of embryogenesis. Finally, in this work a correlation between the heterogeneity of Brassica rapa L. cv. Rapa seeds and the ability to oxidize the ACC to ethylene has been demonstrated.

  15. A colorimetric assay of 1-aminocyclopropane-1-carboxylate (ACC) based on ninhydrin reaction for rapid screening of bacteria containing ACC deaminase.

    PubMed

    Li, Z; Chang, S; Lin, L; Li, Y; An, Q

    2011-08-01

    1-Aminocyclopropane-1-carboxylate (ACC) deaminase activity is an efficient marker for bacteria to promote plant growth by lowering ethylene levels in plants. We aim to develop a method for rapidly screening bacteria containing ACC deaminase, based on a colorimetric ninhydrin assay of ACC. A reliable colorimetric ninhydrin assay was developed to quantify ACC using heat-resistant polypropylene chimney-top 96-well PCR plates, having the wells evenly heated in boiling water, preventing accidental contamination from boiling water and limiting evaporation. With this method to measure bacterial consumption of ACC, 44 ACC-utilizing bacterial isolates were rapidly screened out from 311 bacterial isolates that were able to grow on minimal media containing ACC as the sole nitrogen source. The 44 ACC-utilizing bacterial isolates showed ACC deaminase activities and belonged to the genus Burkholderia, Pseudomonas or Herbaspirillum. Determination of bacterial ACC consumption by the PCR-plate ninhydrin-ACC assay is a rapid and efficient method for screening bacteria containing ACC deaminase from a large number of bacterial isolates. The PCR-plate ninhydrin-ACC assay extends the utility of the ninhydrin reaction and enables a rapid screening of bacteria containing ACC deaminase from large numbers of bacterial isolates. © 2011 The Authors. Letters in Applied Microbiology © 2011 The Society for Applied Microbiology.

  16. Identification and characterization of an Apis cerana cerana Delta class glutathione S-transferase gene ( AccGSTD) in response to thermal stress

    NASA Astrophysics Data System (ADS)

    Yan, Huiru; Jia, Haihong; Wang, Xiuling; Gao, Hongru; Guo, Xingqi; Xu, Baohua

    2013-02-01

    Glutathione S-transferases (GSTs) are members of a multifunctional enzyme super family that plays a pivotal role in both insecticide resistance and protection against oxidative stress. In this study, we identified a single-copy gene, AccGSTD, as being a Delta class GST in the Chinese honey bee ( Apis cerana cerana). A predicted antioxidant response element, CREB, was found in the 1,492-bp 5'-flanking region, suggesting that AccGSTD may be involved in oxidative stress response pathways. Real-time PCR and immunolocalization studies demonstrated that AccGSTD exhibited both developmental- and tissue-specific expression patterns. During development, AccGSTD transcript was increased in adults. The AccGSTD expression level was the highest in the honey bee brain. Thermal stress experiments demonstrated that AccGSTD could be significantly upregulated by temperature changes in a time-dependent manner. It is hypothesized that high expression levels might be due to the increased levels of oxidative stress caused by the temperature challenges. Additionally, functional assays of the recombinant AccGSTD protein revealed that AccGSTD has the capability to protect DNA from oxidative damage. Taken together, these data suggest that AccGSTD may be responsible for antioxidant defense in adult honey bees.

  17. Expression Studies of Gibberellin Oxidases in Developing Pumpkin Seeds1

    PubMed Central

    Frisse, Andrea; Pimenta, Maria João; Lange, Theo

    2003-01-01

    Two cDNA clones, 3-ox and 2-ox, have been isolated from developing pumpkin (Cucurbita maxima) embryos that show significant amino acid homology to gibberellin (GA) 3-oxidases and 2-oxidases, respectively. Recombinant fusion protein of clone 3-ox converted GA12-aldehyde, GA12, GA15, GA24, GA25, and GA9 to GA14-aldehyde, GA14, GA37, GA36, GA13, and GA4, respectively. Recombinant 2-ox protein oxidized GA9, GA4, and GA1 to GA51, GA34, and GA8, respectively. Previously cloned GA 7-oxidase revealed additional 3β-hydroxylation activity of GA12. Transcripts of this gene were identified in endosperm and embryo of the developing seed by quantitative reverse transcriptase-polymerase chain reaction and localized in protoderm, root apical meristem, and quiescent center by in situ hybridization. mRNA of the previously cloned GA 20-oxidase from pumpkin seeds was localized in endosperm and in tissues of protoderm, ground meristem, and cotyledons of the embryo. However, transcripts of the recently cloned GA 20-oxidase from pumpkin seedlings were found all over the embryo, and in tissues of the inner seed coat at the micropylar end. Previously cloned GA 2β,3β-hydroxylase mRNA molecules were specifically identified in endosperm tissue. Finally, mRNA molecules of the 3-ox and 2-ox genes were found in the embryo only. 3-ox transcripts were localized in tissues of cotyledons, protoderm, and inner cell layers of the root apical meristem, and 2-ox transcripts were found in all tissues of the embryo except the root tips. These results indicate tissue-specific GA-biosynthetic pathways operating within the developing seed. PMID:12644672

  18. NAC Transcription Factor SPEEDY HYPONASTIC GROWTH Regulates Flooding-Induced Leaf Movement in Arabidopsis[W

    PubMed Central

    Rauf, Mamoona; Arif, Muhammad; Fisahn, Joachim; Xue, Gang-Ping; Balazadeh, Salma; Mueller-Roeber, Bernd

    2013-01-01

    In rosette plants, root flooding (waterlogging) triggers rapid upward (hyponastic) leaf movement representing an important architectural stress response that critically determines plant performance in natural habitats. The directional growth is based on localized longitudinal cell expansion at the lower (abaxial) side of the leaf petiole and involves the volatile phytohormone ethylene (ET). We report the existence of a transcriptional core unit underlying directional petiole growth in Arabidopsis thaliana, governed by the NAC transcription factor SPEEDY HYPONASTIC GROWTH (SHYG). Overexpression of SHYG in transgenic Arabidopsis thaliana enhances waterlogging-triggered hyponastic leaf movement and cell expansion in abaxial cells of the basal petiole region, while both responses are largely diminished in shyg knockout mutants. Expression of several EXPANSIN and XYLOGLUCAN ENDOTRANSGLYCOSYLASE/HYDROLASE genes encoding cell wall–loosening proteins was enhanced in SHYG overexpressors but lowered in shyg. We identified ACC OXIDASE5 (ACO5), encoding a key enzyme of ET biosynthesis, as a direct transcriptional output gene of SHYG and found a significantly reduced leaf movement in response to root flooding in aco5 T-DNA insertion mutants. Expression of SHYG in shoot tissue is triggered by root flooding and treatment with ET, constituting an intrinsic ET-SHYG-ACO5 activator loop for rapid petiole cell expansion upon waterlogging. PMID:24363315

  19. R1, a novel repressor of the human monoamine oxidase A.

    PubMed

    Chen, Kevin; Ou, Xiao-Ming; Chen, Gao; Choi, Si Ho; Shih, Jean C

    2005-03-25

    Monoamine oxidase catalyzes the oxidative deamination of a number of neurotransmitters. A deficiency in monoamine oxidase A results in aggressive behavior in both humans and mice. Studies on the regulation of monoamine oxidase A gene expression have shown that the Sp1 family is important for monoamine oxidase A expression. To search for novel transcription factors, the sequences of three Sp1 sites in the monoamine oxidase A core promoter were used in the yeast one-hybrid system to screen a human cDNA library. A novel repressor, R1 (RAM2), has been cloned. The R1 cDNA encodes a protein with 454 amino acids and an open reading frame at the 5'-end. The transfection of R1 in a human neuroblastoma cell line, SK-N-BE (2)-C, inhibited the monoamine oxidase A promoter and enzymatic activity. The degree of inhibition of monoamine oxidase A by R1 correlated with the level of R1 protein expression. R1 was also found to repress monoamine oxidase A promoter activity within a natural chromatin environment. A gel-shift assay indicated that the endogenous R1 protein in SK-N-BE (2)-C cells interacted with the R1 binding sequence. R1 also bound directly to the natural monoamine oxidase A promoter in vivo as shown by chromatin immunoprecipitation assay. Immunocytochemical analysis showed that R1 was expressed in both cytosol and nucleus, which suggested a role for R1 in transcriptional regulation. Northern blot analysis revealed the presence of endogenous R1 mRNA in human brain and peripheral tissues. Taken together, this study shows that R1 is a novel repressor that inhibits monoamine oxidase A gene expression.

  20. ACC Effectiveness Review, 1999-2002.

    ERIC Educational Resources Information Center

    Wallace, Roslyn, Ed.

    2002-01-01

    These newsletters on Institutional Effectiveness (IE) at Austin Community College (ACC) in Texas include the following articles: (1) "The 'Fast Track'...Students Say It Works!" (2) "Are Students Successfully Completing Distance Learning Courses at ACC?" (3) "Tracking Transfers"; (4) "Math Pilot: Study Skills…

  1. Obesity Drives Th17 Cell Differentiation by Inducing the Lipid Metabolic Kinase, ACC1.

    PubMed

    Endo, Yusuke; Asou, Hikari K; Matsugae, Nao; Hirahara, Kiyoshi; Shinoda, Kenta; Tumes, Damon J; Tokuyama, Hirotake; Yokote, Koutaro; Nakayama, Toshinori

    2015-08-11

    Chronic inflammation due to obesity contributes to the development of metabolic diseases, autoimmune diseases, and cancer. Reciprocal interactions between metabolic systems and immune cells have pivotal roles in the pathogenesis of obesity-associated diseases, although the mechanisms regulating obesity-associated inflammatory diseases are still unclear. In the present study, we performed transcriptional profiling of memory phenotype CD4 T cells in high-fat-fed mice and identified acetyl-CoA carboxylase 1 (ACC1, the gene product of Acaca) as an essential regulator of Th17 cell differentiation in vitro and of the pathogenicity of Th17 cells in vivo. ACC1 modulates the DNA binding of RORγt to target genes in differentiating Th17 cells. In addition, we found a strong correlation between IL-17A-producing CD45RO(+)CD4 T cells and the expression of ACACA in obese subjects. Thus, ACC1 confers the appropriate function of RORγt through fatty acid synthesis and regulates the obesity-related pathology of Th17 cells. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  2. AccR Is a Master Regulator Involved in Carbon Catabolite Repression of the Anaerobic Catabolism of Aromatic Compounds in Azoarcus sp. CIB*

    PubMed Central

    Valderrama, J. Andrés; Shingler, Victoria; Carmona, Manuel; Díaz, Eduardo

    2014-01-01

    Here we characterized the first known transcriptional regulator that accounts for carbon catabolite repression (CCR) control of the anaerobic catabolism of aromatic compounds in bacteria. The AccR response regulator of Azoarcus sp. CIB controls succinate-responsive CCR of the central pathways for the anaerobic catabolism of aromatics by this strain. Phosphorylation of AccR to AccR-P triggers a monomer-to-dimer transition as well as the ability to bind to the target promoter and causes repression both in vivo and in vitro. Substitution of the Asp60 phosphorylation target residue of the N-terminal receiver motif of AccR to a phosphomimic Glu residue generates a constitutively active derivative that behaves as a superrepressor of the target genes. AccR-P binds in vitro to a conserved inverted repeat (ATGCA-N6-TGCAT) present at two different locations within the PN promoter of the bzd genes for anaerobic benzoate degradation. Because the DNA binding-proficient C-terminal domain of AccR is monomeric, we propose an activation mechanism in which phosphorylation of Asp60 of AccR alleviates interdomain repression mediated by the N-terminal domain. The presence of AccR-like proteins encoded in the genomes of other β-proteobacteria of the Azoarcus/Thauera group further suggests that AccR constitutes a master regulator that controls anaerobic CCR in these bacteria. PMID:24302740

  3. A type III ACC synthase, ACS7, is involved in root gravitropism in Arabidopsis thaliana

    PubMed Central

    Chang, Ing-Feng

    2013-01-01

    Ethylene is an important plant hormone that regulates developmental processes in plants. The ethylene biosynthesis pathway is a highly regulated process at both the transcriptional and post-translational level. The transcriptional regulation of these ethylene biosynthesis genes is well known. However, post-translational modifications of the key ethylene biosynthesis enzyme 1-aminocyclopropane-1-carboxylate (ACC) synthase (ACS) are little understood. In vitro kinase assays were conducted on the type III ACS, AtACS7, fusion protein and peptides to determine whether the AtACS7 protein can be phosphorylated by calcium-dependent protein kinase (CDPK). AtACS7 was phosphorylated at Ser216, Thr296, and Ser299 by AtCDPK16 in vitro. To investigate further the function of the ACS7 gene in Arabidopsis, an acs7-1 loss-of-function mutant was isolated. The acs7-1 mutant exhibited less sensitivity to the inhibition of root gravitropism by treatment with the calcium chelator ethylene glycol tetraacetic acid (EGTA). Seedlings were treated with gradient concentrations of ACC. The results showed that a certain concentration of ethylene enhanced the gravity response. Moreover, the acs7-1 mutant was less sensitive to inhibition of the gravity response by treatment with the auxin polar transport inhibitor 1-naphthylphthalamic acid, but exogenous ACC application recovered root gravitropism. Altogether, the results indicate that AtACS7 is involved in root gravitropism in a calcium-dependent manner in Arabidopsis. PMID:23943848

  4. A type III ACC synthase, ACS7, is involved in root gravitropism in Arabidopsis thaliana.

    PubMed

    Huang, Shih-Jhe; Chang, Chia-Lun; Wang, Po-Hsun; Tsai, Min-Chieh; Hsu, Pang-Hung; Chang, Ing-Feng

    2013-11-01

    Ethylene is an important plant hormone that regulates developmental processes in plants. The ethylene biosynthesis pathway is a highly regulated process at both the transcriptional and post-translational level. The transcriptional regulation of these ethylene biosynthesis genes is well known. However, post-translational modifications of the key ethylene biosynthesis enzyme 1-aminocyclopropane-1-carboxylate (ACC) synthase (ACS) are little understood. In vitro kinase assays were conducted on the type III ACS, AtACS7, fusion protein and peptides to determine whether the AtACS7 protein can be phosphorylated by calcium-dependent protein kinase (CDPK). AtACS7 was phosphorylated at Ser216, Thr296, and Ser299 by AtCDPK16 in vitro. To investigate further the function of the ACS7 gene in Arabidopsis, an acs7-1 loss-of-function mutant was isolated. The acs7-1 mutant exhibited less sensitivity to the inhibition of root gravitropism by treatment with the calcium chelator ethylene glycol tetraacetic acid (EGTA). Seedlings were treated with gradient concentrations of ACC. The results showed that a certain concentration of ethylene enhanced the gravity response. Moreover, the acs7-1 mutant was less sensitive to inhibition of the gravity response by treatment with the auxin polar transport inhibitor 1-naphthylphthalamic acid, but exogenous ACC application recovered root gravitropism. Altogether, the results indicate that AtACS7 is involved in root gravitropism in a calcium-dependent manner in Arabidopsis.

  5. Developmental characterization and environmental stress responses of Y-box binding protein 1 gene (AccYB-1) from Apis cerana cerana.

    PubMed

    Li, Guilin; Wang, Lijun; Wang, Ying; Li, Han; Liu, Zhenguo; Wang, Hongfang; Xu, Baohua; Guo, Xingqi

    2018-06-22

    Y-box binding protein 1 (YB-1) is a member of the cold shock domain protein superfamily and is involved in development, environmental stresses and DNA oxidative damage in many organisms. However, the precise functions of YB-1 are still not well understood in various insects, including bees. In the current study, we identified a YB-1 gene in Apis cerana cerana (AccYB-1). The predicted cis-acting elements in the promoter sequence of AccYB-1 indicated its possible roles in development and stress responses. AccYB-1 expression was higher in one-day-old larvae and dark-eyed pupae than in other development stages. Tissue-specific expression analysis showed that the mRNA level of AccYB-1 was higher in the thorax and midgut than in other tissues. The results from real-time PCR showed that AccYB-1 was induced by many environmental stresses. Silencing AccYB-1 downregulated the transcriptional level of some growth- and development-related genes and antioxidant genes and decreased the enzyme activities of several antioxidant-related enzymes, further indicating a possible function of AccYB-1 in growth, development and stress responses. Taken together, our findings suggest that AccYB-1 may play an indispensable role in growth and development and environmental stress responses in Apis cerana cerana. To our knowledge, this is the first paper to explore the role of YB-1 in bees. Copyright © 2018. Published by Elsevier B.V.

  6. Transcriptional profiling reveals elevated CO2 and elevated O3 alter resistance of soybean (Glycine max) to Japanese beetles (Popillia japonica).

    PubMed

    Casteel, Clare L; O'Neill, Bridget F; Zavala, Jorge A; Bilgin, Damla D; Berenbaum, May R; Delucia, Evan H

    2008-04-01

    The accumulation of CO2 and O3 in the troposphere alters phytochemistry which in turn influences the interactions between plants and insects. Using microarray analysis of field-grown soybean (Glycine max), we found that the number of transcripts in the leaves affected by herbivory by Japanese beetles (Popillia japonica) was greater when plants were grown under elevated CO2, elevated O3 and the combination of elevated CO2 plus elevated O3 than when grown in ambient atmosphere. The effect of herbivory on transcription diminished strongly with time (<1% of genes were affected by herbivory after 3 weeks), and elevated CO2 interacted more strongly with herbivory than elevated O3. The majority of transcripts affected by elevated O3 were related to antioxidant metabolism. Constitutive levels and the induction by herbivory of key transcripts associated with defence and hormone signalling were down-regulated under elevated CO2; 1-aminocyclopropane-1-carboxylate (ACC) synthase, lipoxygenase (LOX), allene oxide synthase (AOS), allene oxide cyclase (AOC), chalcone synthase (CHS), polyphenol oxidase (PPO) and cysteine protease inhibitor (CystPI) were lower in abundance compared with levels under ambient conditions. By suppressing the ability to mount an effective defence, elevated CO2 may decrease resistance of soybean to herbivory.

  7. 24 CFR 982.154 - ACC reserve account.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 24 Housing and Urban Development 4 2011-04-01 2011-04-01 false ACC reserve account. 982.154... and PHA Administration of Program § 982.154 ACC reserve account. (a) HUD may establish and maintain an unfunded reserve account for the PHA program from available budget authority under the consolidated ACC...

  8. 24 CFR 982.154 - ACC reserve account.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false ACC reserve account. 982.154... and PHA Administration of Program § 982.154 ACC reserve account. (a) HUD may establish and maintain an unfunded reserve account for the PHA program from available budget authority under the consolidated ACC...

  9. Neuron-specific specificity protein 4 bigenomically regulates the transcription of all mitochondria- and nucleus-encoded cytochrome c oxidase subunit genes in neurons.

    PubMed

    Johar, Kaid; Priya, Anusha; Dhar, Shilpa; Liu, Qiuli; Wong-Riley, Margaret T T

    2013-11-01

    Neurons are highly dependent on oxidative metabolism for their energy supply, and cytochrome c oxidase (COX) is a key energy-generating enzyme in the mitochondria. A unique feature of COX is that it is one of only four proteins in mammalian cells that are bigenomically regulated. Of its thirteen subunits, three are encoded in the mitochondrial genome and ten are nuclear-encoded on nine different chromosomes. The mechanism of regulating this multisubunit, bigenomic enzyme poses a distinct challenge. In recent years, we found that nuclear respiratory factors 1 and 2 (NRF-1 and NRF-2) mediate such bigenomic coordination. The latest candidate is the specificity factor (Sp) family of proteins. In N2a cells, we found that Sp1 regulates all 13 COX subunits. However, we discovered recently that in primary neurons, it is Sp4 and not Sp1 that regulates some of the key glutamatergic receptor subunit genes. The question naturally arises as to the role of Sp4 in regulating COX in primary neurons. The present study utilized multiple approaches, including chromatin immunoprecipitation, promoter mutational analysis, knockdown and over-expression of Sp4, as well as functional assays to document that Sp4 indeed functionally regulate all 13 subunits of COX as well as mitochondrial transcription factors A and B. The present study discovered that among the specificity family of transcription factors, it is the less known neuron-specific Sp4 that regulates the expression of all 13 subunits of mitochondrial cytochrome c oxidase (COX) enzyme in primary neurons. Sp4 also regulates the three mitochondrial transcription factors (TFAM, TFB1M, and TFB2M) and a COX assembly protein SURF-1 in primary neurons. © 2013 International Society for Neurochemistry.

  10. Lattice QCD simulations using the OpenACC platform

    NASA Astrophysics Data System (ADS)

    Majumdar, Pushan

    2016-10-01

    In this article we will explore the OpenACC platform for programming Graphics Processing Units (GPUs). The OpenACC platform offers a directive based programming model for GPUs which avoids the detailed data flow control and memory management necessary in a CUDA programming environment. In the OpenACC model, programs can be written in high level languages with OpenMP like directives. We present some examples of QCD simulation codes using OpenACC and discuss their performance on the Fermi and Kepler GPUs.

  11. Permethrin Induces Overexpression of Cytochrome c Oxidase Subunit 3 in Aedes aegypti

    USDA-ARS?s Scientific Manuscript database

    Using quantitative PCR (QPCR), the relative transcriptional levels of cytochrome c oxidase subunit 3 (CO3) were studied in Aedes aegypti (L.) in response to treatments with acetone, permethrin, or fipronil. The transcriptional levels of CO3 were significantly (p <0.05) higher in acetone-treated Ae. ...

  12. Molecular mechanism of monoamine oxidase A gene regulation under inflammation and ischemia-like conditions: key roles of the transcription factors GATA2, Sp1 and TBP.

    PubMed

    Gupta, Vinayak; Khan, Abrar A; Sasi, Binu K; Mahapatra, Nitish R

    2015-07-01

    Monoamine oxidase A (MAOA) plays important roles in the pathogenesis of several neurological and cardiovascular disorders. The mechanism of transcriptional regulation of MAOA under basal and pathological conditions, however, remains incompletely understood. Here, we report systematic identification and characterization of cis elements and transcription factors that govern the expression of MAOA gene. Extensive computational analysis of MAOA promoter, followed by 5'-promoter deletion/reporter assays, revealed that the -71/-40 bp domain was sufficient for its basal transcription. Gel-shift and chromatin immunoprecipitation assays provided evidence of interactions of the transcription factors GATA-binding protein 2 (GATA2), Sp1 and TATA-binding protein (TBP) with this proximal promoter region. Consistently, over-expression of GATA2, Sp1 and TBP augmented MAOA promoter activity in a coordinated manner. In corroboration, siRNA-mediated down-regulation of GATA2/Sp1/TBP repressed the endogenous MAOA expression as well as transfected MAOA promoter activity. Tumor necrosis factor-α and forskolin activated MAOA transcription that was reversed by Sp1 siRNA; in support, tumor necrosis factor-α- and forskolin-induced activities were enhanced by ectopic over-expression of Sp1. On the other hand, MAOA transcription was diminished upon exposure of neuroblasts or cardiac myoblasts to ischemia-like conditions because of reduced binding of GATA2/Sp1/TBP with MAOA promoter. In conclusion, this study revealed previously unknown roles of GATA2, Sp1 and TBP in modulating MAOA expression under basal as well as pathophysiological conditions such as inflammation and ischemia, thus providing new insights into the molecular basis of aberrant MAOA expression in neuronal/cardiovascular disease states. Dysregulation of monoamine oxidase A (MAOA) have been implicated in several behavioral and neuronal disease states. Here, we identified three crucial transcription factors (GATA2, Sp1 and TBP

  13. Novel functions of the Arabidopsis transcription factor TCP5 in petal development and ethylene biosynthesis.

    PubMed

    van Es, Sam W; Silveira, Sylvia R; Rocha, Diego I; Bimbo, Andrea; Martinelli, Adriana P; Dornelas, Marcelo C; Angenent, Gerco C; Immink, Richard G H

    2018-06-01

    The flowers of most dicotyledons have petals that, together with the sepals, initially protect the reproductive organs. Later during development petals are required to open the flower and to attract pollinators. This diverse set of functions demands tight temporal and spatial regulation of petal development. We studied the functioning of the Arabidopsis thaliana TCP5-like transcription factors (TFs) in petals. Overexpression of TCP5 in petal epidermal cells results in smaller petals, whereas tcp5 tcp13 tcp17 triple knockout lines have wider petals with an increased surface area. Comprehensive expression studies revealed effects of TCP5-like TFs on the expression of genes related to the cell cycle, growth regulation and organ growth. Additionally, the ethylene biosynthesis genes 1-amino-cyclopropane-1-carboxylate (ACC) synthase 2 (ACS2) and ACC oxidase 2 (ACO2) and several ETHYLENE RESPONSE FACTORS (ERFs) are found to be differentially expressed in TCP5 mutant and overexpression lines. Chromatin immunoprecipitation-quantitative PCR showed direct binding of TCP5 to the ACS2 locus in vivo. Ethylene is known to influence cell elongation, and the petal phenotype of the tcp5 tcp13 tcp17 mutant could be complemented by treatment of the plants with an ethylene pathway inhibitor. Taken together, this reveals a novel role for TCP5-like TFs in the regulation of ethylene-mediated petal development and growth. © 2018 The Authors The Plant Journal published by John Wiley & Sons Ltd and Society for Experimental Biology.

  14. Molecular Characterization of the Oxalate Oxidase Involved in the Response of Barley to the Powdery Mildew Fungus1

    PubMed Central

    Zhou, Fasong; Zhang, Ziguo; Gregersen, Per L.; Mikkelsen, Jørn D.; de Neergaard, Eigil; Collinge, David B.; Thordal-Christensen, Hans

    1998-01-01

    Previously we reported that oxalate oxidase activity increases in extracts of barley (Hordeum vulgare) leaves in response to the powdery mildew fungus (Blumeria [syn. Erysiphe] graminis f.sp. hordei) and proposed this as a source of H2O2 during plant-pathogen interactions. In this paper we show that the N terminus of the major pathogen-response oxalate oxidase has a high degree of sequence identity to previously characterized germin-like oxalate oxidases. Two cDNAs were isolated, pHvOxOa, which represents this major enzyme, and pHvOxOb', representing a closely related enzyme. Our data suggest the presence of only two oxalate oxidase genes in the barley genome, i.e. a gene encoding HvOxOa, which possibly exists in several copies, and a single-copy gene encoding HvOxOb. The use of 3′ end gene-specific probes has allowed us to demonstrate that the HvOxOa transcript accumulates to 6 times the level of the HvOxOb transcript in response to the powdery mildew fungus. The transcripts were detected in both compatible and incompatible interactions with a similar accumulation pattern. The oxalate oxidase is found exclusively in the leaf mesophyll, where it is cell wall located. A model for a signal transduction pathway in which oxalate oxidase plays a central role is proposed for the regulation of the hypersensitive response. PMID:9576772

  15. NADPH oxidase-mediated redox signaling promotes oxidative stress resistance and longevity through memo-1 in C. elegans

    PubMed Central

    Ewald, Collin Yvès; Hourihan, John M; Bland, Monet S; Obieglo, Carolin; Katic, Iskra; Moronetti Mazzeo, Lorenza E; Alcedo, Joy; Blackwell, T Keith; Hynes, Nancy E

    2017-01-01

    Transient increases in mitochondrially-derived reactive oxygen species (ROS) activate an adaptive stress response to promote longevity. Nicotinamide adenine dinucleotide phosphate (NADPH) oxidases produce ROS locally in response to various stimuli, and thereby regulate many cellular processes, but their role in aging remains unexplored. Here, we identified the C. elegans orthologue of mammalian mediator of ErbB2-driven cell motility, MEMO-1, as a protein that inhibits BLI-3/NADPH oxidase. MEMO-1 is complexed with RHO-1/RhoA/GTPase and loss of memo-1 results in an enhanced interaction of RHO-1 with BLI-3/NADPH oxidase, thereby stimulating ROS production that signal via p38 MAP kinase to the transcription factor SKN-1/NRF1,2,3 to promote stress resistance and longevity. Either loss of memo-1 or increasing BLI-3/NADPH oxidase activity by overexpression is sufficient to increase lifespan. Together, these findings demonstrate that NADPH oxidase-induced redox signaling initiates a transcriptional response that protects the cell and organism, and can promote both stress resistance and longevity. DOI: http://dx.doi.org/10.7554/eLife.19493.001 PMID:28085666

  16. Elevated Monoamine Oxidase-A Distribution Volume in Borderline Personality Disorder Is Associated With Severity Across Mood Symptoms, Suicidality, and Cognition.

    PubMed

    Kolla, Nathan J; Chiuccariello, Lina; Wilson, Alan A; Houle, Sylvain; Links, Paul; Bagby, R Michael; McMain, Shelley; Kellow, Charis; Patel, Jalpa; Rekkas, Paraskevi V; Pasricha, Suvercha; Meyer, Jeffrey H

    2016-01-15

    Monoamine oxidase-A (MAO-A) is a treatment target in neurodegenerative illness and mood disorders that increases oxidative stress and predisposition toward apoptosis. Increased MAO-A levels in prefrontal cortex (PFC) and anterior cingulate cortex (ACC) occur in rodent models of depressive behavior and human studies of depressed moods. Extreme dysphoria is common in borderline personality disorder (BPD), especially when severe, and the molecular underpinnings of severe BPD are largely unknown. We hypothesized that MAO-A levels in PFC and ACC would be highest in severe BPD and would correlate with symptom magnitude. [(11)C] Harmine positron emission tomography measured MAO-A total distribution volume (MAO-A VT), an index of MAO-A density, in severe BPD subjects (n = 14), moderate BPD subjects (n = 14), subjects with a major depressive episode (MDE) only (n = 14), and healthy control subjects (n = 14). All subjects were female. Severe BPD was associated with greater PFC and ACC MAO-A VT compared with moderate BPD, MDE, and healthy control subjects (multivariate analysis of variance group effect: F6,102 = 5.6, p < .001). In BPD, PFC and ACC MAO-A VT were positively correlated with mood symptoms (PFC: r = .52, p = .005; ACC: r = .53, p = .004) and suicidality (PFC: r = .40, p = .037; ACC: r = .38, p = .046), while hippocampus MAO-A VT was negatively correlated with verbal memory (r = -.44, p = .023). These results suggest that elevated MAO-A VT is associated with multiple indicators of BPD severity, including BPD symptomatology, mood symptoms, suicidality, and neurocognitive impairment. Copyright © 2016 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

  17. Reward salience and risk aversion underlie differential ACC activity in substance dependence

    PubMed Central

    Alexander, William H.; Fukunaga, Rena; Finn, Peter; Brown, Joshua W.

    2015-01-01

    The medial prefrontal cortex, especially the dorsal anterior cingulate cortex (ACC), has long been implicated in cognitive control and error processing. Although the association between ACC and behavior has been established, it is less clear how ACC contributes to dysfunctional behavior such as substance dependence. Evidence from neuroimaging studies investigating ACC function in substance users is mixed, with some studies showing disengagement of ACC in substance dependent individuals (SDs), while others show increased ACC activity related to substance use. In this study, we investigate ACC function in SDs and healthy individuals performing a change signal task for monetary rewards. Using a priori predictions derived from a recent computational model of ACC, we find that ACC activity differs between SDs and controls in factors related to reward salience and risk aversion between SDs and healthy individuals. Quantitative fits of a computational model to fMRI data reveal significant differences in best fit parameters for reward salience and risk preferences. Specifically, the ACC in SDs shows greater risk aversion, defined as concavity in the utility function, and greater attention to rewards relative to reward omission. Furthermore, across participants risk aversion and reward salience are positively correlated. The results clarify the role that ACC plays in both the reduced sensitivity to omitted rewards and greater reward valuation in SDs. Clinical implications of applying computational modeling in psychiatry are also discussed. PMID:26106528

  18. Reward salience and risk aversion underlie differential ACC activity in substance dependence.

    PubMed

    Alexander, William H; Fukunaga, Rena; Finn, Peter; Brown, Joshua W

    2015-01-01

    The medial prefrontal cortex, especially the dorsal anterior cingulate cortex (ACC), has long been implicated in cognitive control and error processing. Although the association between ACC and behavior has been established, it is less clear how ACC contributes to dysfunctional behavior such as substance dependence. Evidence from neuroimaging studies investigating ACC function in substance users is mixed, with some studies showing disengagement of ACC in substance dependent individuals (SDs), while others show increased ACC activity related to substance use. In this study, we investigate ACC function in SDs and healthy individuals performing a change signal task for monetary rewards. Using a priori predictions derived from a recent computational model of ACC, we find that ACC activity differs between SDs and controls in factors related to reward salience and risk aversion between SDs and healthy individuals. Quantitative fits of a computational model to fMRI data reveal significant differences in best fit parameters for reward salience and risk preferences. Specifically, the ACC in SDs shows greater risk aversion, defined as concavity in the utility function, and greater attention to rewards relative to reward omission. Furthermore, across participants risk aversion and reward salience are positively correlated. The results clarify the role that ACC plays in both the reduced sensitivity to omitted rewards and greater reward valuation in SDs. Clinical implications of applying computational modeling in psychiatry are also discussed.

  19. Genetic profile of adenoid cystic carcinomas (ACC) with high-grade transformation versus solid type.

    PubMed

    Costa, Ana Flávia; Altemani, Albina; Vékony, Hedy; Bloemena, Elisabeth; Fresno, Florentino; Suárez, Carlos; Llorente, José Luis; Hermsen, Mario

    2010-01-01

    ACC can occasionally undergo dedifferentiation also referred to as high-grade transformation (ACC-HGT). However, ACC-HGT can also undergo transformation to adenocarcinomas which are not poorly differentiated. ACC-HGT is generally considered to be an aggressive variant of ACC, even more than solid ACC. This study was aimed to describe the genetic changes of ACC-HGT in relation to clinico-pathological features and to compare results to solid ACC. genome-wide DNA copy number changes were analyzed by microarray CGH in ACC-HGT, 4 with transformation into moderately differentiated adenocarcinoma (MDA) and two into poorly differentiated carcinoma (PDC), 5 solid ACC. In addition, Ki-67 index and p53 immunopositivity was assessed. ACC-HGT carried fewer copy number changes compared to solid ACC. Two ACC-HGT cases harboured a breakpoint at 6q23, near the cMYB oncogene. The complexity of the genomic profile concurred with the clinical course of the patient. Among the ACC-HGT, p53 positivity significantly increased from the conventional to the transformed (both MDA and PDC) component. ACC-HGT may not necessarily reflect a more advanced stage of tumor progression, but rather a transformation to another histological form in which the poorly differentiated forms (PDC) presents a genetic complexity similar to the solid ACC.

  20. Genetic profile of adenoid cystic carcinomas (ACC) with high-grade transformation versus solid type.

    PubMed

    Costa, Ana Flávia; Altemani, Albina; Vékony, Hedy; Bloemena, Elisabeth; Fresno, Florentino; Suárez, Carlos; Llorente, José Luis; Hermsen, Mario

    2011-08-01

    ACC can occasionally undergo dedifferentiation also referred to as high-grade transformation (ACC-HGT). However, ACC-HGT can also undergo transformation to adenocarcinomas which are not poorly differentiated. ACC-HGT is generally considered to be an aggressive variant of ACC, even more than solid ACC. This study was aimed to describe the genetic changes of ACC-HGT in relation to clinico-pathological features, and to compare results to solid ACC. Genome wide DNA copy number changes were analyzed by microarray CGH in ACC-HGT, four with transformation into moderately differentiated adenocarcinoma (MDA) and two into poorly differentiated carcinoma (PDC), and five solid ACC. In addition, Ki67 index and p53 immunopositivity was assessed. ACC-HGT carried fewer copy number changes compared to solid ACC. Two ACC-HGT cases harboured a breakpoint at 6q23, near the cMYB oncogene. The complexity of the genomic profile concurred with the clinical course of the patient. Among the ACC-HGT, p53 positivity significantly increased from the conventional to the transformed (both MDA and PDC) component. ACC-HGT may not necessarily reflect a more advanced stage of tumor progression, but rather a transformation to another histological form in which the poorly differentiated forms (PDC) presents a genetic complexity similar to the solid ACC.

  1. Genotype-specific enrichment of ACC deaminase-positive bacteria in winter wheat rhizospheres

    USDA-ARS?s Scientific Manuscript database

    Bacteria that produce ACC deaminase promote plant growth and development by lowering levels of the stress hormone ethylene through deamination of 1-aminocyclopropane-1-carboxylic acid (ACC), the immediate precursor of ethylene. Therefore, it is hypothesized that ACC deaminase positive (ACC+) bacteri...

  2. Mit1 Transcription Factor Mediates Methanol Signaling and Regulates the Alcohol Oxidase 1 (AOX1) Promoter in Pichia pastoris*

    PubMed Central

    Wang, Xiaolong; Wang, Qi; Wang, Jinjia; Bai, Peng; Shi, Lei; Shen, Wei; Zhou, Mian; Zhou, Xiangshan; Zhang, Yuanxing; Cai, Menghao

    2016-01-01

    The alcohol oxidase 1 (AOX1) promoter (PAOX1) of Pichia pastoris is the most powerful and commonly used promoter for driving protein expression. However, mechanisms regulating its transcriptional activity are unclear. Here, we identified a Zn(II)2Cys6-type methanol-induced transcription factor 1 (Mit1) and elucidated its roles in regulating PAOX1 activity in response to glycerol and methanol. Mit1 regulated the expression of many genes involved in methanol utilization pathway, including AOX1, but did not participate in peroxisome proliferation and transportation of peroxisomal proteins during methanol metabolism. Structural analysis of Mit1 by performing domain deletions confirmed its specific and critical role in the strict repression of PAOX1 in glycerol medium. Importantly, Mit1, Mxr1, and Prm1, which positively regulated PAOX1 in response to methanol, were bound to PAOX1 at different sites and did not interact with each other. However, these factors cooperatively activated PAOX1 through a cascade. Mxr1 mainly functioned during carbon derepression, whereas Mit1 and Prm1 functioned during methanol induction, with Prm1 transmitting methanol signal to Mit1 by binding to the MIT1 promoter (PMIT1), thus increasingly expressing Mit1 and subsequently activating PAOX1. PMID:26828066

  3. Urate oxidase is imported into peroxisomes recognizing the C-terminal SKL motif of proteins.

    PubMed

    Miura, S; Oda, T; Funai, T; Ito, M; Okada, Y; Ichiyama, A

    1994-07-01

    Rat liver urate oxidase synthesized from cDNA through coupled transcription and translation was incubated at 26 degrees C for 60 min with purified peroxisomes from rat liver. Urate oxidase was efficiently imported into the peroxisomes, as determined by resistance to externally added proteinase K. The amount of imported urate oxidase increased with time and the import was temperature dependent. A synthetic peptide composed of the C-terminal 10 amino acid residues of acyl-CoA oxidase (the C-terminal tripeptide is Ser-Lys-Leu) inhibited the import of urate oxidase, whereas other peptides, in which the C-terminal Ser-Lys-Leu (SKL) sequence was deleted or mutated, were not effective. Two mutant urate oxidase proteins in which the C-terminal Ser-Arg-Leu (SRL) sequence was deleted or mutated to Ser-Glu-Leu (SEL) were not imported into peroxisomes. With substitution of a lysine residue for arginine in the SRL tripeptide at the C-terminus the import activity was retained. These results show that urate oxidase is important into peroxisomes via a common pathway with acyl-CoA oxidase, and that the C-terminal SRL sequence functions as a peroxisomal-targeting signal.

  4. Dexamethasone but not indomethacin inhibits human phagocyte nicotinamide adenine dinucleotide phosphate oxidase activity by down-regulating expression of genes encoding oxidase components.

    PubMed

    Condino-Neto, A; Whitney, C; Newburger, P E

    1998-11-01

    We investigated the effects of dexamethasone or indomethacin on the NADPH oxidase activity, cytochrome b558 content, and expression of genes encoding the components gp91-phox and p47-phox of the NADPH oxidase system in the human monocytic THP-1 cell line, differentiated with IFN-gamma and TNF-alpha, alone or in combination, for up to 7 days. IFN-gamma and TNF-alpha, alone or in combination, caused a significant up-regulation of the NADPH oxidase system as reflected by an enhancement of the PMA-stimulated superoxide release, cytochrome b558 content, and expression of gp91-phox and p47-phox genes on both days 2 and 7 of cell culture. Noteworthy was the tremendous synergism between IFN-gamma and TNF-alpha for all studied parameters. Dexamethasone down-regulated the NADPH oxidase system of cytokine-differentiated THP-1 cells as assessed by an inhibition on the PMA-stimulated superoxide release, cytochrome b558 content, and expression of the gp91-phox and p47-phox genes. The nuclear run-on assays indicated that dexamethasone down-regulated the NADPH oxidase system at least in part by inhibiting the transcription of gp91-phox and p47-phox genes. Indomethacin inhibited only the PMA-stimulated superoxide release of THP-1 cells differentiated with IFN-gamma and TNF-alpha during 7 days. None of the other parameters was affected by indomethacin. We conclude that dexamethasone down-regulates the NADPH oxidase system at least in part by inhibiting the expression of genes encoding the gp91-phox and p47-phox components of the NADPH oxidase system.

  5. Genetic Profile of Adenoid Cystic Carcinomas (ACC) with High-Grade Transformation versus Solid Type

    PubMed Central

    Costa, Ana Flávia; Altemani, Albina; Vékony, Hedy; Bloemena, Elisabeth; Fresno, Florentino; Suárez, Carlos; Llorente, José Luis; Hermsen, Mario

    2010-01-01

    Background: ACC can occasionally undergo dedifferentiation also referred to as high-grade transformation (ACC-HGT). However, ACC-HGT can also undergo transformation to adenocarcinomas which are not poorly differentiated. ACC-HGT is generally considered to be an aggressive variant of ACC, even more than solid ACC. This study was aimed to describe the genetic changes of ACC-HGT in relation to clinico-pathological features and to compare results to solid ACC. Methods: Genome-wide DNA copy number changes were analyzed by microarray CGH in ACC-HGT, 4 with transformation into moderately differentiated adenocarcinoma (MDA) and two into poorly differentiated carcinoma (PDC), 5 solid ACC. In addition, Ki-67 index and p53 immunopositivity was assessed. Results: ACC-HGT carried fewer copy number changes compared to solid ACC. Two ACC-HGT cases harboured a breakpoint at 6q23, near the cMYB oncogene. The complexity of the genomic profile concurred with the clinical course of the patient. Among the ACC-HGT, p53 positivity significantly increased from the conventional to the transformed (both MDA and PDC) component. Conclusion: ACC-HGT may not necessarily reflect a more advanced stage of tumor progression, but rather a transformation to another histological form in which the poorly differentiated forms (PDC) presents a genetic complexity similar to the solid ACC. PMID:20978318

  6. Asian Care Certificate (ACC): a care quality assurance framework.

    PubMed

    Talaie, Tony

    2018-04-16

    Purpose Quality assuring elderly care through a viable and feasible standard framework is a major challenge for Asian governments. Although several attempts have been made to tackle foreign care worker (FCW) shortage, assuring the quality of the care they provide has been overlooked. The original framework allowed a better control over service quality to assure the elderly about their care according to the agreed standards. The paper aims to discuss these issues. Design/methodology/approach Through several Japanese Governmental meetings, a new Asian Care Certificate (ACC) program is discussed based on the Japanese Care Certificate (JCC). The governments' representatives adopted the JCC to form the ACC, which enables the ACC board to evaluate care workers and to intervene whenever the desired quality level is not achieved. Findings The author describes a new program. The findings of this paper will be confirmed when the ACC is implemented. Practical implications Using the ACC framework, the challenge in providing a high-quality care service using FCWs across Asia would be partly resolved. FCWs' quality of life might also gradually improve especially regarding to their human rights. Originality/value The ACC provides a new framework. Its value is recognized if one considers that many Asian populations are rapidly aging and many governments compromise quality by employing overseas workers to solve care worker shortages.

  7. 24 CFR 985.109 - Default under the Annual Contributions Contract (ACC).

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... Contributions Contract (ACC). 985.109 Section 985.109 Housing and Urban Development REGULATIONS RELATING TO... § 985.109 Default under the Annual Contributions Contract (ACC). HUD may determine that an PHA's failure... required by HUD constitutes a default under the ACC. ...

  8. 24 CFR 985.109 - Default under the Annual Contributions Contract (ACC).

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... Contributions Contract (ACC). 985.109 Section 985.109 Housing and Urban Development Regulations Relating to... § 985.109 Default under the Annual Contributions Contract (ACC). HUD may determine that an PHA's failure... required by HUD constitutes a default under the ACC. ...

  9. Human protoporphyrinogen oxidase: expression, purification, and characterization of the cloned enzyme.

    PubMed Central

    Dailey, T. A.; Dailey, H. A.

    1996-01-01

    Protoporphyrinogen oxidase (E.C.1.3.3.4) catalyzes the oxygen-dependent oxidation of protoporphyrinogen IX to protoporphyrin IX. The enzyme from human placenta has been cloned, sequenced, expressed in Escherichia coli, purified to homogeneity, and characterized. Northern blot analysis of eight different human tissues show evidence for only a single transcript in all tissue types and the size of this transcript is approximately 1.8 kb. The human cDNA has been inserted into an expression vector for E. coli and the protein produced at high levels in these cells. The protein is found in both membrane and cytoplasmic fractions. The enzyme was purified to homogeneity in the presence of detergents using a metal chelate affinity column. The purified protein is a homodimer composed of subunits of molecular weight of 51,000. The enzyme contains one noncovalently bound FAD per dimer, has a monomer extinction coefficient of 48,000 at 270 nm and contains no detectable redox active metals. The apparent K(m) and Kcat for protoporphyrinogen IX are 1.7 microM and 10.5 min-1, respectively. The enzyme does not use coproporphyrinogen III as a substrate and is inhibited by micromolar concentrations of the herbicide acifluorfen. Protein database searches reveal significant homology between protoporphyrinogen oxidase and monoamine oxidase. PMID:8771201

  10. 24 CFR 969.105 - Extension of ACC upon payment of operating subsidy.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 24 Housing and Urban Development 4 2011-04-01 2011-04-01 false Extension of ACC upon payment of... COMPLETION OF DEBT SERVICE § 969.105 Extension of ACC upon payment of operating subsidy. (a) ACC amendment... projects under a particular ACC for a PHA fiscal year beginning after the effective date of this part, the...

  11. 24 CFR 969.105 - Extension of ACC upon payment of operating subsidy.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false Extension of ACC upon payment of... COMPLETION OF DEBT SERVICE § 969.105 Extension of ACC upon payment of operating subsidy. (a) ACC amendment... projects under a particular ACC for a PHA fiscal year beginning after the effective date of this part, the...

  12. ChoG is the main inducible extracellular cholesterol oxidase of Rhodococcus sp. strain CECT3014.

    PubMed

    Fernández de Las Heras, Laura; Mascaraque, Victoria; García Fernández, Esther; Navarro-Llorens, Juana María; Perera, Julián; Drzyzga, Oliver

    2011-07-20

    Cholesterol catabolism has been reported in different bacteria and particularly in several Rhodococcus species, but the genetic of this complex pathway is not yet very well defined. In this work we report the isolation and sequencing of a 9.8 kb DNA fragment of Rhodococcus sp. strain CECT3014, a bacterial strain that we here identify as a Rhodococcus erythropolis strain. In this DNA fragment we found several ORF that are probably involved in steroid catabolism, and choG, a gene encoding a putative cholesterol oxidase whose functional characterization we here report. ChoG protein is a class II cholesterol oxidase with all the structural features of the enzymes of this group. The disruption of the choG gene does not alter the ability of strain CECT3014 cells to grow on cholesterol, but it abolishes the production of extracellular cholesterol oxidase. This later effect is reverted when the mutant cells are transformed with a plasmid expressing choG. We conclude that choG is the gene responsible for the inducible extracellular cholesterol oxidase activity of strain CECT3014. This activity distributes between the cellular membrane and the culture supernatant in a way that suggests it is produced by the same ChoG protein that occurs in two different locations. RT-PCR transcript analysis showed a dual scheme of choG expression: a low constitutive independent transcription, plus a cholesterol induced transcription of choG into a polycistronic kstD-hsd4B-choG mRNA. Copyright © 2010 Elsevier GmbH. All rights reserved.

  13. 24 CFR 882.403 - ACC, housing assistance payments contract, and lease.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 24 Housing and Urban Development 4 2011-04-01 2011-04-01 false ACC, housing assistance payments... Procedures for Moderate Rehabilitation-Basic Policies § 882.403 ACC, housing assistance payments contract, and lease. (a) Maximum Total ACC Commitments. The maximum total annual contribution that may be...

  14. Mit1 Transcription Factor Mediates Methanol Signaling and Regulates the Alcohol Oxidase 1 (AOX1) Promoter in Pichia pastoris.

    PubMed

    Wang, Xiaolong; Wang, Qi; Wang, Jinjia; Bai, Peng; Shi, Lei; Shen, Wei; Zhou, Mian; Zhou, Xiangshan; Zhang, Yuanxing; Cai, Menghao

    2016-03-18

    The alcohol oxidase 1 (AOX1) promoter (P AOX1) of Pichia pastoris is the most powerful and commonly used promoter for driving protein expression. However, mechanisms regulating its transcriptional activity are unclear. Here, we identified a Zn(II)2Cys6-type methanol-induced transcription factor 1 (Mit1) and elucidated its roles in regulating PAOX1 activity in response to glycerol and methanol. Mit1 regulated the expression of many genes involved in methanol utilization pathway, including AOX1, but did not participate in peroxisome proliferation and transportation of peroxisomal proteins during methanol metabolism. Structural analysis of Mit1 by performing domain deletions confirmed its specific and critical role in the strict repression of P AOX1 in glycerol medium. Importantly, Mit1, Mxr1, and Prm1, which positively regulated P AOX1 in response to methanol, were bound to P AOX1 at different sites and did not interact with each other. However, these factors cooperatively activated P AOX1 through a cascade. Mxr1 mainly functioned during carbon derepression, whereas Mit1 and Prm1 functioned during methanol induction, with Prm1 transmitting methanol signal to Mit1 by binding to the MIT1 promoter (P MIT1), thus increasingly expressing Mit1 and subsequently activating P AOX1. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. Portable LQCD Monte Carlo code using OpenACC

    NASA Astrophysics Data System (ADS)

    Bonati, Claudio; Calore, Enrico; Coscetti, Simone; D'Elia, Massimo; Mesiti, Michele; Negro, Francesco; Fabio Schifano, Sebastiano; Silvi, Giorgio; Tripiccione, Raffaele

    2018-03-01

    Varying from multi-core CPU processors to many-core GPUs, the present scenario of HPC architectures is extremely heterogeneous. In this context, code portability is increasingly important for easy maintainability of applications; this is relevant in scientific computing where code changes are numerous and frequent. In this talk we present the design and optimization of a state-of-the-art production level LQCD Monte Carlo application, using the OpenACC directives model. OpenACC aims to abstract parallel programming to a descriptive level, where programmers do not need to specify the mapping of the code on the target machine. We describe the OpenACC implementation and show that the same code is able to target different architectures, including state-of-the-art CPUs and GPUs.

  16. Cloning and Analysis of the Alternative Oxidase Gene of Neurospora Crassa

    PubMed Central

    Li, Q.; Ritzel, R. G.; McLean, LLT.; McIntosh, L.; Ko, T.; Bertrand, H.; Nargang, F. E.

    1996-01-01

    Mitochondria of Neurospora crassa contain a cyanide-resistant alternative respiratory pathway in addition to the cytochrome pathway. The alternative oxidase is present only when electron flow through the cytochrome chain is restricted. Both genomic and cDNA copies for the alternative oxidase gene have been isolated and analyzed. The sequence of the predicted protein is homologous to that of other species. The mRNA for the alternative oxidase is scarce in wild-type cultures grown under normal conditions, but it is abundant in cultures grown in the presence of chloramphenicol, an inhibitor of mitochondrial protein synthesis, or in mutants deficient in mitochondrial cytochromes. Thus, induction of alternative oxidase appears to be at the transcriptional level. Restriction fragment length polymorphism mapping of the isolated gene demonstrated that it is located in a position corresponding to the aod-1 locus. Sequence analysis of mutant aod-1 alleles reveals mutations affecting the coding sequence of the alternative oxidase. The level of aod-1 mRNA in an aod-2 mutant strain that had been grown in the presence of chloramphenicol was reduced several fold relative to wild-type, supporting the hypothesis that the product of aod-2 is required for optimal expression of aod-1. PMID:8770590

  17. Potential Functional Replacement of the Plastidic Acetyl-CoA Carboxylase Subunit (accD) Gene by Recent Transfers to the Nucleus in Some Angiosperm Lineages1[W][OA

    PubMed Central

    Rousseau-Gueutin, Mathieu; Huang, Xun; Higginson, Emily; Ayliffe, Michael; Day, Anil; Timmis, Jeremy N.

    2013-01-01

    Eukaryotic cells originated when an ancestor of the nucleated cell engulfed bacterial endosymbionts that gradually evolved into the mitochondrion and the chloroplast. Soon after these endosymbiotic events, thousands of ancestral prokaryotic genes were functionally transferred from the endosymbionts to the nucleus. This process of functional gene relocation, now rare in eukaryotes, continues in angiosperms. In this article, we show that the chloroplastic acetyl-CoA carboxylase subunit (accD) gene that is present in the plastome of most angiosperms has been functionally relocated to the nucleus in the Campanulaceae. Surprisingly, the nucleus-encoded accD transcript is considerably smaller than the plastidic version, consisting of little more than the carboxylase domain of the plastidic accD gene fused to a coding region encoding a plastid targeting peptide. We verified experimentally the presence of a chloroplastic transit peptide by showing that the product of the nuclear accD fused to green fluorescent protein was imported in the chloroplasts. The nuclear gene regulatory elements that enabled the erstwhile plastidic gene to become functional in the nuclear genome were identified, and the evolution of the intronic and exonic sequences in the nucleus is described. Relocation and truncation of the accD gene is a remarkable example of the processes underpinning endosymbiotic evolution. PMID:23435694

  18. ACC Study Guide Series.

    ERIC Educational Resources Information Center

    Austin Community Coll., TX. Rio Grande Campus.

    Ten one-page instructional guides designed to assist Austin Community College (ACC) students in using the library and in writing research papers are presented in this series. The titles of the guides are: (1) "The Media Collection (We have more than books in the LRC)"; (2) "Encyclopedias"; (3) "Finding Books"; (4)…

  19. Ethylene and 1-Aminocyclopropane-1-carboxylate (ACC) in Plant–Bacterial Interactions

    PubMed Central

    Nascimento, Francisco X.; Rossi, Márcio J.; Glick, Bernard R.

    2018-01-01

    Ethylene and its precursor 1-aminocyclopropane-1-carboxylate (ACC) actively participate in plant developmental, defense and symbiotic programs. In this sense, ethylene and ACC play a central role in the regulation of bacterial colonization (rhizospheric, endophytic, and phyllospheric) by the modulation of plant immune responses and symbiotic programs, as well as by modulating several developmental processes, such as root elongation. Plant-associated bacterial communities impact plant growth and development, both negatively (pathogens) and positively (plant-growth promoting and symbiotic bacteria). Some members of the plant-associated bacterial community possess the ability to modulate plant ACC and ethylene levels and, subsequently, modify plant defense responses, symbiotic programs and overall plant development. In this work, we review and discuss the role of ethylene and ACC in several aspects of plant-bacterial interactions. Understanding the impact of ethylene and ACC in both the plant host and its associated bacterial community is key to the development of new strategies aimed at increased plant growth and protection. PMID:29520283

  20. 24 CFR 969.107 - HUD approval of demolition or disposition before ACC expiration.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... disposition before ACC expiration. 969.107 Section 969.107 Housing and Urban Development Regulations Relating... before ACC expiration. This part is not intended to preclude or restrict the demolition or disposition of... before the ACC Expiration Date. ...

  1. Tone-Evoked Acoustic Change Complex (ACC) Recorded in a Sedated Animal Model.

    PubMed

    Presacco, Alessandro; Middlebrooks, John C

    2018-05-10

    The acoustic change complex (ACC) is a scalp-recorded cortical evoked potential complex generated in response to changes (e.g., frequency, amplitude) in an auditory stimulus. The ACC has been well studied in humans, but to our knowledge, no animal model has been evaluated. In particular, it was not known whether the ACC could be recorded under the conditions of sedation that likely would be necessary for recordings from animals. For that reason, we tested the feasibility of recording ACC from sedated cats in response to changes of frequency and amplitude of pure-tone stimuli. Cats were sedated with ketamine and acepromazine, and subdermal needle electrodes were used to record electroencephalographic (EEG) activity. Tones were presented from a small loudspeaker located near the right ear. Continuous tones alternated at 500-ms intervals between two frequencies or two levels. Neurometric functions were created by recording neural response amplitudes while systematically varying the magnitude of steps in frequency centered in octave frequency around 2, 4, 8, and 16 kHz, all at 75 dB SPL, or in decibel level around 75 dB SPL tested at 4 and 8 kHz. The ACC could be recorded readily under this ketamine/azepromazine sedation. In contrast, ACC could not be recorded reliably under any level of isoflurane anesthesia that was tested. The minimum frequency (expressed as Weber fractions (df/f)) or level steps (expressed in dB) needed to elicit ACC fell in the range of previous thresholds reported in animal psychophysical tests of discrimination. The success in recording ACC in sedated animals suggests that the ACC will be a useful tool for evaluation of other aspects of auditory acuity in normal hearing and, presumably, in electrical cochlear stimulation, especially for novel stimulation modes that are not yet feasible in humans.

  2. 24 CFR 969.106 - ACC extension in absence of current operating subsidy.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false ACC extension in absence of current... COMPLETION OF DEBT SERVICE § 969.106 ACC extension in absence of current operating subsidy. Where Operating Subsidy under an ACC is not approved for payment during a time period which results in extension of the...

  3. 24 CFR 969.106 - ACC extension in absence of current operating subsidy.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 24 Housing and Urban Development 4 2011-04-01 2011-04-01 false ACC extension in absence of current... COMPLETION OF DEBT SERVICE § 969.106 ACC extension in absence of current operating subsidy. Where Operating Subsidy under an ACC is not approved for payment during a time period which results in extension of the...

  4. OpenARC: Extensible OpenACC Compiler Framework for Directive-Based Accelerator Programming Study

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Seyong; Vetter, Jeffrey S

    2014-01-01

    Directive-based, accelerator programming models such as OpenACC have arisen as an alternative solution to program emerging Scalable Heterogeneous Computing (SHC) platforms. However, the increased complexity in the SHC systems incurs several challenges in terms of portability and productivity. This paper presents an open-sourced OpenACC compiler, called OpenARC, which serves as an extensible research framework to address those issues in the directive-based accelerator programming. This paper explains important design strategies and key compiler transformation techniques needed to implement the reference OpenACC compiler. Moreover, this paper demonstrates the efficacy of OpenARC as a research framework for directive-based programming study, by proposing andmore » implementing OpenACC extensions in the OpenARC framework to 1) support hybrid programming of the unified memory and separate memory and 2) exploit architecture-specific features in an abstract manner. Porting thirteen standard OpenACC programs and three extended OpenACC programs to CUDA GPUs shows that OpenARC performs similarly to a commercial OpenACC compiler, while it serves as a high-level research framework.« less

  5. Transcriptional coupling of synaptic transmission and energy metabolism: role of nuclear respiratory factor 1 in co-regulating neuronal nitric oxide synthase and cytochrome c oxidase genes in neurons.

    PubMed

    Dhar, Shilpa S; Liang, Huan Ling; Wong-Riley, Margaret T T

    2009-10-01

    Neuronal activity is highly dependent on energy metabolism; yet, the two processes have traditionally been regarded as independently regulated at the transcriptional level. Recently, we found that the same transcription factor, nuclear respiratory factor 1 (NRF-1) co-regulates an important energy-generating enzyme, cytochrome c oxidase, as well as critical subunits of glutamatergic receptors. The present study tests our hypothesis that the co-regulation extends to the next level of glutamatergic synapses, namely, neuronal nitric oxide synthase, which generates nitric oxide as a downstream signaling molecule. Using in silico analysis, electrophoretic mobility shift assay, chromatin immunoprecipitation, promoter mutations, and NRF-1 silencing, we documented that NRF-1 functionally bound to Nos1, but not Nos2 (inducible) and Nos3 (endothelial) gene promoters. Both COX and Nos1 transcripts were up-regulated by depolarizing KCl treatment and down-regulated by TTX-mediated impulse blockade in neurons. However, NRF-1 silencing blocked the up-regulation of both Nos1 and COX induced by KCl depolarization, and over-expression of NRF-1 rescued both Nos1 and COX transcripts down-regulated by TTX. These findings are consistent with our hypothesis that synaptic neuronal transmission and energy metabolism are tightly coupled at the molecular level.

  6. 24 CFR 882.805 - HA application process, ACC execution, and pre-rehabilitation activities.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 24 Housing and Urban Development 4 2011-04-01 2011-04-01 false HA application process, ACC... § 882.805 HA application process, ACC execution, and pre-rehabilitation activities. (a) Review. When... applications in accordance with the guidelines, rating criteria, and procedures published in the NOFA. (b) ACC...

  7. Aspirin suppresses cardiac fibroblast proliferation and collagen formation through downregulation of angiotensin type 1 receptor transcription

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Xianwei, E-mail: XWang2@UAMS.edu; Lu, Jingjun; Khaidakov, Magomed

    Aspirin (acetyl salicylic acid, ASA) is a common drug used for its analgesic and antipyretic effects. Recent studies show that ASA not only blocks cyclooxygenase, but also inhibits NADPH oxidase and resultant reactive oxygen species (ROS) generation, a pathway that underlies pathogenesis of several ailments, including hypertension and tissue remodeling after injury. In these disease states, angiotensin II (Ang II) activates NADPH oxidase via its type 1 receptor (AT1R) and leads to fibroblast growth and collagen synthesis. In this study, we examined if ASA would inhibit NADPH oxidase activation, upregulation of AT1R transcription, and subsequent collagen generation in mouse cardiacmore » fibroblasts challenged with Ang II. Mouse heart fibroblasts were isolated and treated with Ang II with or without ASA. As expected, Ang II induced AT1R expression, and stimulated cardiac fibroblast growth and collagen synthesis. The AT1R blocker losartan attenuated these effects of Ang II. Similarly to losartan, ASA, and its SA moiety suppressed Ang II-mediated AT1R transcription and fibroblast proliferation as well as expression of collagens and MMPs. ASA also suppressed the expression of NADPH oxidase subunits (p22{sup phox}, p47{sup phox}, p67{sup phox}, NOX2 and NOX4) and ROS generation. ASA did not affect total NF-κB p65, but inhibited its phosphorylation and activation. These observations suggest that ASA inhibits Ang II-induced NADPH oxidase expression, NF-κB activation and AT1R transcription in cardiac fibroblasts, and fibroblast proliferation and collagen expression. The critical role of NADPH oxidase activity in stimulation of AT1R transcription became apparent in experiments where ASA also inhibited AT1R transcription in cardiac fibroblasts challenged with H{sub 2}O{sub 2}. Since SA had similar effect as ASA on AT1R expression, we suggest that ASA's effect is mediated by its SA moiety. -- Highlights: ► Aspirin in therapeutic concentrations decreases mouse cardiac

  8. In vitro synthesis and stabilization of amorphous calcium carbonate (ACC) nanoparticles within liposomes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tester, Chantel C.; Brock, Ryan E.; Wu, Ching-Hsuan

    2012-02-07

    We show that amorphous calcium carbonate (ACC) can be synthesized in phospholipid bilayer vesicles (liposomes). Liposome-encapsulated ACC nanoparticles are stable against aggregation, do not crystallize for at least 20 h, and are ideally suited to investigate the influence of lipid chemistry, particle size, and soluble additives on ACC in situ.

  9. 24 CFR 969.107 - HUD approval of demolition or disposition before ACC expiration.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... disposition before ACC expiration. 969.107 Section 969.107 Housing and Urban Development REGULATIONS RELATING... HOUSING AFTER COMPLETION OF DEBT SERVICE § 969.107 HUD approval of demolition or disposition before ACC..., HUD may authorize a PHA to demolish or dispose of public housing at any time before the ACC Expiration...

  10. The Repeat Sequences and Elevated Substitution Rates of the Chloroplast accD Gene in Cupressophytes

    PubMed Central

    Li, Jia; Su, Yingjuan; Wang, Ting

    2018-01-01

    The plastid accD gene encodes a subunit of the acetyl-CoA carboxylase (ACCase) enzyme. The length of accD gene has been supposed to expand in Cryptomeria japonica, Taiwania cryptomerioides, Cephalotaxus, Taxus chinensis, and Podocarpus lambertii, and the main reason for this phenomenon was the existence of tandemly repeated sequences. However, it is still unknown whether the accD gene length in other cupressophytes has expanded. Here, in order to investigate how widespread this phenomenon was, 18 accD sequences and its surrounding regions of cupressophyte were sequenced and analyzed. Together with 39 GenBank sequence data, our taxon sampling covered all the extant gymnosperm orders. The repetitive elements and substitution rates of accD among 57 gymnosperm species were analyzed, the results show: (1) Reading frame length of accD gene in 18 cupressophytes species has also expanded. (2) Many repetitive elements were identified in accD gene of cupressophyte lineages. (3) The synonymous and non-synonymous substitution rates of accD were accelerated in cupressophytes. (4) accD was located in rearrangement endpoints. These results suggested that repetitive elements may mediate the chloroplast genome rearrangement and accelerated the substitution rates. PMID:29731764

  11. Differential feedback regulation of ethylene biosynthesis in pulp and peel tissues of banana fruit.

    PubMed

    Inaba, Akitsugu; Liu, Xuejun; Yokotani, Naoki; Yamane, Miki; Lu, Wang-Jin; Nakano, Ryohei; Kubo, Yasutaka

    2007-01-01

    The feedback regulation of ethylene biosynthesis in banana [Musa sp. (AAA group, Cavendish subgroup) cv. Grand Nain] fruit was investigated in an attempt to clarify the opposite effect of 1-methylcyclopropene (1-MCP), an ethylene action inhibitor, before and after the onset of ripening. 1-MCP pre-treatment completely prevented the ripening-induced effect of propylene in pre-climacteric banana fruit, whereas treatment after the onset of ripening stimulated ethylene production. In pre-climacteric fruit, higher concentrations of propylene suppressed ethylene production more strongly, despite their earlier ethylene-inducing effect. Exposure of the fruit ripened by propylene to 1-MCP increased ethylene production concomitantly with an increase in 1-aminocyclopropane-1-carboxylate (ACC) synthase activity and ACC content, and prevented a transient decrease in MA-ACS1 transcripts in the pulp tissues. In contrast, in the peel of ripening fruit, 1-MCP prevented the increase in ethylene production and subsequently the ripening process by reduction of the increase in MA-ACS1 and MA-ACO1 transcripts and of ACC synthase and ACC oxidase activities. These results suggest that ethylene biosynthesis in ripening banana fruit may be controlled negatively in the pulp tissue and positively in the peel tissue. This differential regulation by ethylene in pulp and peel tissues was also observed for MA-PL, MA-Exp, and MA-MADS genes.

  12. Recalibration of the ACC/AHA Risk Score in Two Population-Based German Cohorts

    PubMed Central

    de las Heras Gala, Tonia; Geisel, Marie Henrike; Peters, Annette; Thorand, Barbara; Baumert, Jens; Lehmann, Nils; Jöckel, Karl-Heinz; Moebus, Susanne; Erbel, Raimund; Meisinger, Christine

    2016-01-01

    Background The 2013 ACC/AHA guidelines introduced an algorithm for risk assessment of atherosclerotic cardiovascular disease (ASCVD) within 10 years. In Germany, risk assessment with the ESC SCORE is limited to cardiovascular mortality. Applicability of the novel ACC/AHA risk score to the German population has not yet been assessed. We therefore sought to recalibrate and evaluate the ACC/AHA risk score in two German cohorts and to compare it to the ESC SCORE. Methods We studied 5,238 participants from the KORA surveys S3 (1994–1995) and S4 (1999–2001) and 4,208 subjects from the Heinz Nixdorf Recall (HNR) Study (2000–2003). There were 383 (7.3%) and 271 (6.4%) first non-fatal or fatal ASCVD events within 10 years in KORA and in HNR, respectively. Risk scores were evaluated in terms of calibration and discrimination performance. Results The original ACC/AHA risk score overestimated 10-year ASCVD rates by 37% in KORA and 66% in HNR. After recalibration, miscalibration diminished to 8% underestimation in KORA and 12% overestimation in HNR. Discrimination performance of the ACC/AHA risk score was not affected by the recalibration (KORA: C = 0.78, HNR: C = 0.74). The ESC SCORE overestimated by 5% in KORA and by 85% in HNR. The corresponding C-statistic was 0.82 in KORA and 0.76 in HNR. Conclusions The recalibrated ACC/AHA risk score showed strongly improved calibration compared to the original ACC/AHA risk score. Predicting only cardiovascular mortality, discrimination performance of the commonly used ESC SCORE remained somewhat superior to the ACC/AHA risk score. Nevertheless, the recalibrated ACC/AHA risk score may provide a meaningful tool for estimating 10-year risk of fatal and non-fatal cardiovascular disease in Germany. PMID:27732641

  13. Recalibration of the ACC/AHA Risk Score in Two Population-Based German Cohorts.

    PubMed

    de Las Heras Gala, Tonia; Geisel, Marie Henrike; Peters, Annette; Thorand, Barbara; Baumert, Jens; Lehmann, Nils; Jöckel, Karl-Heinz; Moebus, Susanne; Erbel, Raimund; Meisinger, Christine; Mahabadi, Amir Abbas; Koenig, Wolfgang

    2016-01-01

    The 2013 ACC/AHA guidelines introduced an algorithm for risk assessment of atherosclerotic cardiovascular disease (ASCVD) within 10 years. In Germany, risk assessment with the ESC SCORE is limited to cardiovascular mortality. Applicability of the novel ACC/AHA risk score to the German population has not yet been assessed. We therefore sought to recalibrate and evaluate the ACC/AHA risk score in two German cohorts and to compare it to the ESC SCORE. We studied 5,238 participants from the KORA surveys S3 (1994-1995) and S4 (1999-2001) and 4,208 subjects from the Heinz Nixdorf Recall (HNR) Study (2000-2003). There were 383 (7.3%) and 271 (6.4%) first non-fatal or fatal ASCVD events within 10 years in KORA and in HNR, respectively. Risk scores were evaluated in terms of calibration and discrimination performance. The original ACC/AHA risk score overestimated 10-year ASCVD rates by 37% in KORA and 66% in HNR. After recalibration, miscalibration diminished to 8% underestimation in KORA and 12% overestimation in HNR. Discrimination performance of the ACC/AHA risk score was not affected by the recalibration (KORA: C = 0.78, HNR: C = 0.74). The ESC SCORE overestimated by 5% in KORA and by 85% in HNR. The corresponding C-statistic was 0.82 in KORA and 0.76 in HNR. The recalibrated ACC/AHA risk score showed strongly improved calibration compared to the original ACC/AHA risk score. Predicting only cardiovascular mortality, discrimination performance of the commonly used ESC SCORE remained somewhat superior to the ACC/AHA risk score. Nevertheless, the recalibrated ACC/AHA risk score may provide a meaningful tool for estimating 10-year risk of fatal and non-fatal cardiovascular disease in Germany.

  14. Driver's behavioral adaptation to adaptive cruise control (ACC): the case of speed and time headway.

    PubMed

    Bianchi Piccinini, Giulio Francesco; Rodrigues, Carlos Manuel; Leitão, Miguel; Simões, Anabela

    2014-06-01

    The Adaptive Cruise Control is an Advanced Driver Assistance System (ADAS) that allows maintaining given headway and speed, according to settings pre-defined by the users. Despite the potential benefits associated to the utilization of ACC, previous studies warned against negative behavioral adaptations that might occur while driving with the system activated. Unfortunately, up to now, there are no unanimous results about the effects induced by the usage of ACC on speed and time headway to the vehicle in front. Also, few studies were performed including actual users of ACC among the subjects. This research aimed to investigate the effect of the experience gained with ACC on speed and time headway for a group of users of the system. In addition, it explored the impact of ACC usage on speed and time headway for ACC users and regular drivers. A matched sample driving simulator study was planned as a two-way (2×2) repeated measures mixed design, with the experience with ACC as between-subjects factor and the driving condition (with ACC and manually) as within-subjects factor. The results show that the usage of ACC brought a small but not significant reduction of speed and, especially, the maintenance of safer time headways, being the latter result greater for ACC users, probably as a consequence of their experience in using the system. The usage of ACC did not cause any negative behavioral adaptations to the system regarding speed and time headway. Based on this research work, the Adaptive Cruise Control showed the potential to improve road safety for what concerns the speed and the time headway maintained by the drivers. The speed of the surrounding traffic and the minimum time headway settable through the ACC seem to have an important effect on the road safety improvement achievable with the system. Copyright © 2014 Elsevier Ltd. All rights reserved.

  15. The coxBAC Operon Encodes a Cytochrome c Oxidase Required for Heterotrophic Growth in the Cyanobacterium Anabaena variabilis Strain ATCC 29413

    PubMed Central

    Schmetterer, Georg; Valladares, Ana; Pils, Dietmar; Steinbach, Susanne; Pacher, Margit; Muro-Pastor, Alicia M.; Flores, Enrique; Herrero, Antonia

    2001-01-01

    Three genes, coxB, coxA, and coxC, found in a clone from a gene library of the cyanobacterium Anabaena variabilis strain ATCC 29413, were identified by hybridization with an oligonucleotide specific for aa3-type cytochrome c oxidases. Deletion of these genes from the genome of A. variabilis strain ATCC 29413 FD yielded strain CSW1, which displayed no chemoheterotrophic growth and an impaired cytochrome c oxidase activity. Photoautotrophic growth of CSW1, however, was unchanged, even with dinitrogen as the nitrogen source. A higher cytochrome c oxidase activity was detected in membrane preparations from dinitrogen-grown CSW1 than from nitrate-grown CSW1, but comparable activities of respiratory oxygen uptake were found in the wild type and in CSW1. Our data indicate that the identified cox gene cluster is essential for fructose-dependent growth in the dark, but not for growth on dinitrogen, and that other terminal respiratory oxidases are expressed in this cyanobacterium. Transcription analysis showed that coxBAC constitutes an operon which is expressed from two transcriptional start points. The use of one of them was stimulated by fructose. PMID:11591688

  16. ACC oxidase and miRNA 159a, and their involvement in fresh fruit bunch yield (FFB) via sex ratio determination in oil palm.

    PubMed

    Somyong, Suthasinee; Poopear, Supannee; Sunner, Supreet Kaur; Wanlayaporn, Kitti; Jomchai, Nukoon; Yoocha, Thippawan; Ukoskit, Kittipat; Tangphatsornruang, Sithichoke; Tragoonrung, Somvong

    2016-06-01

    Oil palm (Elaeis guineesis Jacq.) is the most productive oil-bearing crop, yielding more oil per area than any other oil-bearing crops. However, there are still efforts to improve oil palm yield, in order to serve consumer and manufacturer demand. Oil palm produces female and male inflorescences in an alternating cycle. So, high sex ratio (SR), the ratio of female inflorescences to the total inflorescences, is a favorable trait in term of increasing yields in oil palm. This study aims to understand the genetic control for SR related traits, such as fresh fruit bunch yield (FFB), by characterizing genes at FFB quantitative trait loci (QTLs) on linkage 10 (chromosome 6) and linkage 15 (chromosome 10). Published oil palm sequences at the FFB QTLs were used to develop gene-based and simple sequence repeat (SSR) markers. We used the multiple QTL analysis model (MQM) to characterize the relationship of new markers with the SR traits in the oil palm population. The RNA expression of the most linked QTL genes was also evaluated in various tissues of oil palm. We identified EgACCO1 (encoding aminocyclopropane carboxylate (ACC) oxidase) at chromosome 10 and EgmiR159a (microRNA 159a) at chromosome 6 to be the most linked QTL genes or determinants for FFB yield and/or female inflorescence number with a phenotype variance explained (PVE) from 10.4 to 15 % and suggest that these play the important roles in sex determination and differentiation in oil palm. The strongest expression of EgACCO1 and the predicted precursor of EgmiR159a was found in ovaries and, to a lesser extent, fruit development. In addition, highly normalized expression of EgmiR159a was found in female flowers. In summary, the QTL analysis and the RNA expression reveal that EgACCO1 and EgmiR159a are the potential genetic factors involved in female flower determination and hence would affect yield in oil palm. However, to clarify how these genetic factors regulate female flower determination, more investigation

  17. Transcriptional regulation of NADPH oxidase isoforms, Nox1 and Nox4, by nuclear factor-{kappa}B in human aortic smooth muscle cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Manea, Adrian, E-mail: adrian.manea@icbp.ro; Tanase, Laurentia I.; Raicu, Monica

    Inflammation-induced changes in the activity and expression of NADPH oxidases (Nox) play a key role in atherogenesis. The molecular mechanisms of Nox regulation are scantily elucidated. Since nuclear factor-{kappa}B (NF-{kappa}B) controls the expression of many genes associated to inflammation-related diseases, in this study we have investigated the role of NF-{kappa}B signaling in the regulation of Nox1 and Nox4 transcription in human aortic smooth muscle cells (SMCs). Cultured cells were exposed to tumor necrosis factor-{alpha} (TNF{alpha}), a potent inducer of both Nox and NF-{kappa}B, up to 24 h. Lucigenin-enhanced chemiluminescence and dichlorofluorescein assays, real-time polymerase chain reaction, and Western blot analysismore » showed that inhibition of NF-{kappa}B pathway reduced significantly the TNF{alpha}-dependent up-regulation of Nox-derived reactive oxygen species production, Nox1 and Nox4 expression. In silico analysis indicated the existence of typical NF-{kappa}B elements in the promoters of Nox1 and Nox4. Transient overexpression of p65/NF-{kappa}B significantly increased the promoter activities of both isoforms. Physical interaction of p65/NF-{kappa}B proteins with the predicted sites was demonstrated by chromatin immunoprecipitation assay. These findings demonstrate that NF-{kappa}B is an essential regulator of Nox1- and Nox4-containing NADPH oxidase in SMCs. Elucidation of the complex relationships between NF-{kappa}B and Nox enzymes may lead to a novel pharmacological strategy to reduce both inflammation and oxidative stress in atherosclerosis and its associated complications.« less

  18. Targeting the Oncogenic Transcriptional Regulator MYB in Adenoid Cystic Carcinoma by Inhibition of IGF1R/AKT Signaling.

    PubMed

    Andersson, Mattias K; Afshari, Maryam K; Andrén, Ywonne; Wick, Michael J; Stenman, Göran

    2017-09-01

    Adenoid cystic carcinoma (ACC) is an aggressive cancer with no curative treatment for patients with recurrent/metastatic disease. The MYB-NFIB gene fusion is the main genomic hallmark and a potential therapeutic target. Oncogenic signaling pathways were studied in cultured cells and/or tumors from 15 ACC patients. Phospho-receptor tyrosine kinase (RTK) arrays were used to study the activity of RTKs. Effects of RTK inhibition on cell proliferation were analyzed with AlamarBlue, sphere assays, and two ACC xenograft models (n = 4-9 mice per group). The molecular effects of MYB-NFIB knockdown and IGF1R inhibition were studied with quantitative polymerase chain reaction, immunoblot, and gene expression microarrays. All statistical tests were two-sided. The MYB-NFIB fusion drives proliferation of ACC cells and is crucial for spherogenesis. Intriguingly, the fusion is regulated through AKT-dependent signaling induced by IGF1R overexpression and is downregulated upon IGF1R-inhibition (% expression of control ± SD = 27.2 ± 1.3, P < .001). MYB-NFIB regulates genes involved in cell cycle control, DNA replication/repair, and RNA processing. The transcriptional program induced by MYB-NFIB affects critical oncogenic mediators normally controlled by MYC and is reversed by pharmacological inhibition of IGF1R. Co-activation of epidermal growth factor receptor (EGFR) and MET promoted proliferation of ACC cells, and combined targeting of IGFR1/EGFR/MET induced differentiation and synergistically inhibited the growth of patient-derived xenografted ACCs (ACCX5M1, % growth of control ± SD = 34.9 ± 20.3, P = .006; ACCX6, % growth of control ± SD = 24.1 ± 17.5, P = .04). MYB-NFIB is an oncogenic driver and a key therapeutic target in ACC that is regulated by AKT-dependent IGF1R signaling. Our studies uncover a new strategy to target an oncogenic transcriptional master regulator and provide new important insights into the biology and treatment of ACC. © The Author

  19. Expression of an estrogen-regulated variant transcript of the peroxisomal branched chain fatty acid oxidase ACOX2 in breast carcinomas.

    PubMed

    Bjørklund, Sunniva Stordal; Kristensen, Vessela N; Seiler, Michael; Kumar, Surendra; Alnæs, Grethe I Grenaker; Ming, Yao; Kerrigan, John; Naume, Bjørn; Sachidanandam, Ravi; Bhanot, Gyan; Børresen-Dale, Anne-Lise; Ganesan, Shridar

    2015-07-17

    Alternate transcripts from a single gene locus greatly enhance the combinatorial flexibility of the human transcriptome. Different patterns of exon usage have been observed when comparing normal tissue to cancers, suggesting that variant transcripts may play a role in the tumor phenotype. Ribonucleic acid-sequencing (RNA-seq) data from breast cancer samples was used to identify an intronic start variant transcript of Acyl-CoA oxidase 2, ACOX2 (ACOX2-i9). Difference in expression between Estrogen Receptor (ER) positive and ER negative patients was assessed by the Wilcoxon rank sum test, and the findings validated in The Cancer Genome Atlas (TCGA) breast cancer dataset (BRCA). ACOX2-i9 expression was also assessed in cell lines using both quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) and Western blot analysis. Knock down by short hairpin RNA (shRNA) and colony formation assays were used to determine whether ACOX2-i9 expression would influence cellular fitness. The effect of ACOX2-i9 expression on patient survival was assessed by the Kaplan-Meier survival function, and association to clinical parameters was analyzed using a Fisher exact test. The expression and translation of ACOX2-i9 into a 25 kDa protein was demonstrated in HepG2 cells as well as in several breast cancer cell lines. shRNA knock down of the ACOX2-i9 variant resulted in decreased cell viability of T47D and MDA-MB 436 cells. Moreover, expression of ACOX2-i9 was shown to be estrogen regulated, being induced by propyl pyrazoletriol and inhibited by tamoxifen and fulvestrant in ER+ T47D and Mcf-7 cells, but not in the ER- MDA-MB 436 cell line. This variant transcript showed expression predominantly in ER-positive breast tumors as assessed in our initial set of 53 breast cancers and further validated in 87 tumor/normal pairs from the TCGA breast cancer dataset, and expression was associated with better outcome in ER positive patients. ACOX2-i9 is specifically enriched in ER+ breast

  20. A biohybrid hydrogel for the urate-responsive release of urate oxidase.

    PubMed

    Geraths, Christian; Daoud-El Baba, Marie; Charpin-El Hamri, Ghislaine; Weber, Wilfried

    2013-10-10

    Functional biomaterials that detect and correct pathological parameters hold high promises for biomedical application. In this study we describe a biohybrid hydrogel that detects elevated concentrations of uric acid and responds by dissolution and the release of uric acid-degrading urate oxidase. This material was synthesized by incorporating PEG-stabilized urate oxidase into a polyacrylamide hydrogel that was crosslinked by the uric acid-sensitive interaction between the uric acid transcription factor HucR and its operator hucO. We characterize the uric acid responsiveness of the material and demonstrate that it can effectively be applied to counteract flares of uric acid in a mouse model. This approach might be a first step towards a biomedical device autonomously managing uric acid burst associated to gouty arthritis and the tumor lysis syndrome. © 2013.

  1. Subchronic glucocorticoids, glutathione depletion and a postpartum model elevate monoamine oxidase a activity in the prefrontal cortex of rats.

    PubMed

    Raitsin, Sofia; Tong, Junchao; Kish, Stephen; Xu, Xin; Magomedova, Lilia; Cummins, Carolyn; Andreazza, Ana C; Scola, Gustavo; Baker, Glen; Meyer, Jeffrey H

    2017-07-01

    Recent human brain imaging studies implicate dysregulation of monoamine oxidase-A (MAO-A), in particular in the prefrontal cortex (PFC) and anterior cingulate cortex (ACC), in the development of major depressive disorder (MDD). This study investigates the influence of four alterations underlying important pathologies of MDD, namely, chronic elevation of glucocorticoid levels, glutathione depletion, changes in female gonadal sex hormones and serotonin concentration fluctuation, on MAO-A and MAO-B activities in rats. Young adult rats exposed chronically to the synthetic glucocorticoid dexamethasone at 0, 0.05, 0.5, and 2.0mg/kg/day (osmotic minipumps) for eight days showed significant dose-dependent increases in activities of MAO-A in PFC (+17%, p<0.001) and ACC (+9%, p<0.01) and MAO-B in PFC (+14%, p<0.001) and increased serotonin turnover in the PFC (+31%, p<0.01), not accounted for by dexamethasone-induced changes in serotonin levels, since neither serotonin depletion nor supplementation affected MAO-A activity. Sub-acute depletion of the major antioxidant glutathione by diethyl maleate (5mmol/kg, i.p.) for three days, which resulted in a 36% loss of glutathione in PFC (p=0.0005), modestly, but significantly, elevated activities of MAO-A in PFC and MAO-B in PFC, ACC and hippocampus (+6-9%, p<0.05). Changes in estrogen and progesterone representing pseudopregnancy were associated with significantly elevated MAO-A activity in the ACC day 4-7 postpartum (10-18%, p<0.05 to p<0.0001) but not the PFC or hippocampus. Hence, our study provides data in support of strategies targeting glucocorticoid and glutathione systems, as well as changes in female sex hormones for normalization of MAO-A activities and thus treatment of mood disorders. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Exogenously induced expression of ethylene biosynthesis, ethylene perception, phospholipase D, and Rboh-oxidase genes in broccoli seedlings

    PubMed Central

    Jakubowicz, Małgorzata; Gałgańska, Hanna; Nowak, Witold; Sadowski, Jan

    2010-01-01

    In higher plants, copper ions, hydrogen peroxide, and cycloheximide have been recognized as very effective inducers of the transcriptional activity of genes encoding the enzymes of the ethylene biosynthesis pathway. In this report, the transcriptional patterns of genes encoding the 1-aminocyclopropane-1-carboxylate synthases (ACSs), 1-aminocyclopropane-1-carboxylate oxidases (ACOs), ETR1, ETR2, and ERS1 ethylene receptors, phospholipase D (PLD)-α1, -α2, -γ1, and -δ, and respiratory burst oxidase homologue (Rboh)-NADPH oxidase-D and -F in response to these inducers in Brassica oleracea etiolated seedlings are shown. ACS1, ACO1, ETR2, PLD-γ1, and RbohD represent genes whose expression was considerably affected by all of the inducers used. The investigations were performed on the seedlings with (i) ethylene insensitivity and (ii) a reduced level of the PLD-derived phosphatidic acid (PA). The general conclusion is that the expression of ACS1, -3, -4, -5, -7, and -11, ACO1, ETR1, ERS1, and ETR2, PLD-γ 1, and RbohD and F genes is undoubtedly under the reciprocal cross-talk of the ethylene and PAPLD signalling routes; both signals affect it in concerted or opposite ways depending on the gene or the type of stimuli. The results of these studies on broccoli seedlings are in agreement with the hypothesis that PA may directly affect the ethylene signal transduction pathway via an inhibitory effect on CTR1 (constitutive triple response 1) activity. PMID:20581125

  3. The ACC strategy in biomineralization: the case of earthworm's amorphous spherulites

    NASA Astrophysics Data System (ADS)

    Briones, Maria J. I.; Alvarez-Otero, Rosa; Méndez, Jesús; Gago Duport, Luis

    2010-05-01

    The occurrence of amorphous calcium carbonate (ACC), an hydrated and highly soluble form of solid CaCO3, seems to be a common feature in all carbonate forming organisms such as mollusks, corals, echinoderms and crustaceans. The ubiquity of ACC in these Ca-carbonate biomineralizing systems, as a precursor of further crystalline phases, has recently open the interesting question about if the formation of an amorphous phase is a necessary step in the calcification process of all organisms and consequently, whether it would be possible to define the "amorphous precursor estategy" as a general mechanism in biomineralization. Neverthelees, although ACC appears to be widespread in these organisms very little is known about its particular role in the biomineralization scheme of the different phyla. The formation of CaCO3 spherulites in the calciferous glands of earthworms is a particular case of calcareous biomineralization involving the presence of ACC as a transient precursor phase [2]. Interestingly, the formation of crystalline carbonates via ACC in these organisms is not connected with skeleton building so it must play another functional role. In addition, the transient transformation stages can be followed by in situ spectrometric techniques and therefore, earthworms provide and adequate model to analyse the mutual interactions between ACC-solvent-and crystalline phases. In this study, we have analysed the morphological and structural transformations from the initial ACC spherulites until the formation of the crystalline phases: vaterite (and/or aragonite) and finally calcite, is accomplished. The characterization of ACC was done by performing in situ FT-IR, together with and HREM and Debye scherrer -XRD. The structural results were interpreted in the light of the histological study of the gland. The geometry of the secretory epithelium of the calciferous gland, as evidenced by TEM [2], shows the presence of irregulary shaped cells with their apical surface

  4. Structure, organization, and transcriptional regulation of a family of copper radical oxidase genes in the lignin-degrading basidiomycete Phanerochaete chrysosporium

    Treesearch

    Amber Vanden Wymelenberg; Grzegorz Sabat; Michael Mozuch; Philip J. Kersten; Dan Cullen; Robert A. Blanchette

    2006-01-01

    The white rot basidiomycete Phanerochaete chrysosporium produces an array of nonspecific extracellular enzymes thought to be involved in lignin degradation, including lignin peroxidases, manganese peroxidases, and the H2O2-generating copper radical oxidase, glyoxal oxidase (GLX). Preliminary analysis of the P. chrysosporium draft genome had identified six sequences...

  5. WRKY Transcription Factors Phosphorylated by MAPK Regulate a Plant Immune NADPH Oxidase in Nicotiana benthamiana[OPEN

    PubMed Central

    Adachi, Hiroaki; Nakano, Takaaki; Miyagawa, Noriko; Ishihama, Nobuaki; Yoshioka, Miki; Katou, Yuri; Yaeno, Takashi

    2015-01-01

    Pathogen attack sequentially confers pattern-triggered immunity (PTI) and effector-triggered immunity (ETI) after sensing of pathogen patterns and effectors by plant immune receptors, respectively. Reactive oxygen species (ROS) play pivotal roles in PTI and ETI as signaling molecules. Nicotiana benthamiana RBOHB, an NADPH oxidase, is responsible for both the transient PTI ROS burst and the robust ETI ROS burst. Here, we show that RBOHB transactivation mediated by MAPK contributes to R3a/AVR3a-triggered ETI (AVR3a-ETI) ROS burst. RBOHB is markedly induced during the ETI and INF1-triggered PTI (INF1-PTI), but not flg22-tiggered PTI (flg22-PTI). We found that the RBOHB promoter contains a functional W-box in the R3a/AVR3a and INF1 signal-responsive cis-element. Ectopic expression of four phospho-mimicking mutants of WRKY transcription factors, which are MAPK substrates, induced RBOHB, and yeast one-hybrid analysis indicated that these mutants bind to the cis-element. Chromatin immunoprecipitation assays indicated direct binding of the WRKY to the cis-element in plants. Silencing of multiple WRKY genes compromised the upregulation of RBOHB, resulting in impairment of AVR3a-ETI and INF1-PTI ROS bursts, but not the flg22-PTI ROS burst. These results suggest that the MAPK-WRKY pathway is required for AVR3a-ETI and INF1-PTI ROS bursts by activation of RBOHB. PMID:26373453

  6. Minimal impact of age and housing temperature on the metabolic phenotype of Acc2-/- mice.

    PubMed

    Brandon, Amanda E; Stuart, Ella; Leslie, Simon J; Hoehn, Kyle L; James, David E; Kraegen, Edward W; Turner, Nigel; Cooney, Gregory J

    2016-03-01

    An important regulator of fatty acid oxidation (FAO) is the allosteric inhibition of CPT-1 by malonyl-CoA produced by the enzyme acetyl-CoA carboxylase 2 (ACC2). Initial studies suggested that deletion of Acc2 (Acacb) increased fat oxidation and reduced adipose tissue mass but in an independently generated strain of Acc2 knockout mice we observed increased whole-body and skeletal muscle FAO and a compensatory increase in muscle glycogen stores without changes in glucose tolerance, energy expenditure or fat mass in young mice (12-16 weeks). The aim of the present study was to determine whether there was any effect of age or housing at thermoneutrality (29 °C; which reduces total energy expenditure) on the phenotype of Acc2 knockout mice. At 42-54 weeks of age, male WT and Acc2(-/-) mice had similar body weight, fat mass, muscle triglyceride content and glucose tolerance. Consistent with younger Acc2(-/-) mice, aged Acc2(-/-) mice showed increased whole-body FAO (24 h average respiratory exchange ratio=0.95±0.02 and 0.92±0.02 for WT and Acc2(-/-) mice respectively, P<0.05) and skeletal muscle glycogen content (+60%, P<0.05) without any detectable change in whole-body energy expenditure. Hyperinsulinaemic-euglycaemic clamp studies revealed no difference in insulin action between groups with similar glucose infusion rates and tissue glucose uptake. Housing Acc2(-/-) mice at 29 °C did not alter body composition, glucose tolerance or the effects of fat feeding compared with WT mice. These results confirm that manipulation of Acc2 may alter FAO in mice, but this has little impact on body composition or insulin action. © 2016 Society for Endocrinology.

  7. Skeletal muscle ACC2 S212 phosphorylation is not required for the control of fatty acid oxidation during exercise.

    PubMed

    O'Neill, Hayley M; Lally, James S; Galic, Sandra; Pulinilkunnil, Thomas; Ford, Rebecca J; Dyck, Jason R B; van Denderen, Bryce J; Kemp, Bruce E; Steinberg, Gregory R

    2015-07-01

    During submaximal exercise fatty acids are a predominant energy source for muscle contractions. An important regulator of fatty acid oxidation is acetyl-CoA carboxylase (ACC), which exists as two isoforms (ACC1 and ACC2) with ACC2 predominating in skeletal muscle. Both ACC isoforms regulate malonyl-CoA production, an allosteric inhibitor of carnitine palmitoyltransferase 1 (CPT-1); the primary enzyme controlling fatty acyl-CoA flux into mitochondria for oxidation. AMP-activated protein kinase (AMPK) is a sensor of cellular energy status that is activated during exercise or by pharmacological agents such as metformin and AICAR. In resting muscle the activation of AMPK with AICAR leads to increased phosphorylation of ACC (S79 on ACC1 and S221 on ACC2), which reduces ACC activity and malonyl-CoA; effects associated with increased fatty acid oxidation. However, whether this pathway is vital for regulating skeletal muscle fatty acid oxidation during conditions of increased metabolic flux such as exercise/muscle contractions remains unknown. To examine this we characterized mice lacking AMPK phosphorylation sites on ACC2 (S212 in mice/S221 in humans-ACC2-knock-in [ACC2-KI]) or both ACC1 (S79) and ACC2 (S212) (ACC double knock-in [ACCD-KI]) during submaximal treadmill exercise and/or ex vivo muscle contractions. We find that surprisingly, ACC2-KI mice had normal exercise capacity and whole-body fatty acid oxidation during treadmill running despite elevated muscle ACC2 activity and malonyl-CoA. Similar results were observed in ACCD-KI mice. Fatty acid oxidation was also maintained in muscles from ACC2-KI mice contracted ex vivo. These findings indicate that pathways independent of ACC phosphorylation are important for regulating skeletal muscle fatty acid oxidation during exercise/muscle contractions. © 2015 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.

  8. ACC Study Guide Series (Revised Edition).

    ERIC Educational Resources Information Center

    Staples, Katherine; And Others

    Designed for the beginning college student who needs to search for information, prepare written assignments, or take tests, the ACC (Austin Community College) Study Guide Series comprises 17 one-page study guides. Printed on card stock with colored headings, the guides are highlighted with cartoon illustrations and are intended to provide…

  9. Ethylene Synthesis Regulated by Biphasic Induction of 1-Aminocyclopropane-1-Carboxylic Acid Synthase and 1-Aminocyclopropane-1-Carboxylic Acid Oxidase Genes Is Required for Hydrogen Peroxide Accumulation and Cell Death in Ozone-Exposed Tomato1

    PubMed Central

    Moeder, Wolfgang; Barry, Cornelius S.; Tauriainen, Airi A.; Betz, Christian; Tuomainen, Jaana; Utriainen, Merja; Grierson, Donald; Sandermann, Heinrich; Langebartels, Christian; Kangasjärvi, Jaakko

    2002-01-01

    We show that above a certain threshold concentration, ozone leads to leaf injury in tomato (Lycopersicon esculentum). Ozone-induced leaf damage was preceded by a rapid increase in 1-aminocyclopropane-1-carboxylic acid (ACC) synthase activity, ACC content, and ethylene emission. Changes in mRNA levels of specific ACC synthase, ACC oxidase, and ethylene receptor genes occurred within 1 to 5 h. Expression of the genes encoding components of ethylene biosynthesis and perception, and biochemistry of ethylene synthesis suggested that ozone-induced ethylene synthesis in tomato is under biphasic control. In transgenic plants containing an LE-ACO1 promoter-β-glucuronidase fusion construct, β-glucuronidase activity increased rapidly at the beginning of the O3 exposure and had a spatial distribution resembling the pattern of extracellular H2O2 production at 7 h, which coincided with the cell death pattern after 24 h. Ethylene synthesis and perception were required for active H2O2 production and cell death resulting in visible tissue damage. The results demonstrate a selective ozone response of ethylene biosynthetic genes and suggest a role for ethylene, in combination with the burst of H2O2 production, in regulating the spread of cell death. PMID:12481074

  10. A first insight into the occurrence and expression of functional amoA and accA genes of autotrophic and ammonia-oxidizing bathypelagic Crenarchaeota of Tyrrhenian Sea

    NASA Astrophysics Data System (ADS)

    Yakimov, Michail M.; Cono, Violetta La; Denaro, Renata

    2009-05-01

    The autotrophic and ammonia-oxidizing crenarchaeal assemblage at offshore site located in the deep Mediterranean (Tyrrhenian Sea, depth 3000 m) water was studied by PCR amplification of the key functional genes involved in energy (ammonia mono-oxygenase alpha subunit, amoA) and central metabolism (acetyl-CoA carboxylase alpha subunit, accA). Using two recently annotated genomes of marine crenarchaeons, an initial set of primers targeting archaeal accA-like genes was designed. Approximately 300 clones were analyzed, of which 100% of amoA library and almost 70% of accA library were unambiguously related to the corresponding genes from marine Crenarchaeota. Even though the acetyl-CoA carboxylase is phylogenetically not well conserved and the remaining clones were affiliated to various bacterial acetyl-CoA/propionyl-CoA carboxylase genes, the pool of archaeal sequences was applied for development of quantitative PCR analysis of accA-like distribution using TaqMan ® methodolgy. The archaeal accA gene fragments, together with alignable gene fragments from the Sargasso Sea and North Pacific Subtropical Gyre (ALOHA Station) metagenome databases, were analyzed by multiple sequence alignment. Two accA-like sequences, found in ALOHA Station at the depth of 4000 m, formed a deeply branched clade with 64% of all archaeal Tyrrhenian clones. No close relatives for residual 36% of clones, except of those recovered from Eastern Mediterranean, was found, suggesting the existence of a specific lineage of the crenarchaeal accA genes in deep Mediterranean water. Alignment of Mediterranean amoA sequences defined four cosmopolitan phylotypes of Crenarchaeota putative ammonia mono-oxygenase subunit A gene occurring in the water sample from the 3000 m depth. Without exception all phylotypes fell into Deep Marine Group I cluster that contain the vast majority of known sequences recovered from global deep-sea environment. Remarkably, three phylotypes accounted for 91% of all Mediterranean

  11. 24 CFR 884.105 - Maximum total ACC commitment and project account (private-owner/PHA projects).

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false Maximum total ACC commitment and..., Scope and Basic Policies § 884.105 Maximum total ACC commitment and project account (private-owner/PHA projects). (a) Maximum total ACC commitment. The maximum total annual contribution that may be contracted...

  12. 24 CFR 884.105 - Maximum total ACC commitment and project account (private-owner/PHA projects).

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 24 Housing and Urban Development 4 2011-04-01 2011-04-01 false Maximum total ACC commitment and..., Scope and Basic Policies § 884.105 Maximum total ACC commitment and project account (private-owner/PHA projects). (a) Maximum total ACC commitment. The maximum total annual contribution that may be contracted...

  13. Extradural Spinal Metastasis of Adenoid Cystic Carcinoma (ACC): A Case Report

    PubMed Central

    Nair, Rajesh; Upadhyaya, Sunil; Nayal, Bhavna; Shetty, Arjun

    2015-01-01

    Adenoid cystic carcinoma (ACC) is a rare malignant tumour of the major salivary glands. It accounts for 10-15% of all salivary gland tumours and 1% of all head and neck tumours. Surgical resection followed by radiation is the choice of treatment for ACC. However, late loco-regional recurrence and metastasis is often seen emphasizing the importance of long-term follow-up. We report an unusual case of extradural metastasis of ACC in the dorsal spine. The primary submandibular gland tumour was resected 11 y back. A recurrence had been detected two years prior to the occurrence of spinal metastasis. Surgical decompression was done which was followed by palliative radiotherapy. Patient is symptomatically better, ambulant and on regular follow-up. PMID:25738073

  14. Structural characterization and regulatory element analysis of the heart isoform of cytochrome c oxidase VIa

    NASA Technical Reports Server (NTRS)

    Wan, B.; Moreadith, R. W.; Blomqvist, C. G. (Principal Investigator)

    1995-01-01

    In order to investigate the mechanism(s) governing the striated muscle-specific expression of cytochrome c oxidase VIaH we have characterized the murine gene and analyzed its transcriptional regulatory elements in skeletal myogenic cell lines. The gene is single copy, spans 689 base pairs (bp), and is comprised of three exons. The 5'-ends of transcripts from the gene are heterogeneous, but the most abundant transcript includes a 5'-untranslated region of 30 nucleotides. When fused to the luciferase reporter gene, the 3.5-kilobase 5'-flanking region of the gene directed the expression of the heterologous protein selectively in differentiated Sol8 cells and transgenic mice, recapitulating the pattern of expression of the endogenous gene. Deletion analysis identified a 300-bp fragment sufficient to direct the myotube-specific expression of luciferase in Sol8 cells. The region lacks an apparent TATA element, and sequence motifs predicted to bind NRF-1, NRF-2, ox-box, or PPAR factors known to regulate other nuclear genes encoding mitochondrial proteins are not evident. Mutational analysis, however, identified two cis-elements necessary for the high level expression of the reporter protein: a MEF2 consensus element at -90 to -81 bp and an E-box element at -147 to -142 bp. Additional E-box motifs at closely located positions were mutated without loss of transcriptional activity. The dependence of transcriptional activation of cytochrome c oxidase VIaH on cis-elements similar to those found in contractile protein genes suggests that the striated muscle-specific expression is coregulated by mechanisms that control the lineage-specific expression of several contractile and cytosolic proteins.

  15. OpenACC performance for simulating 2D radial dambreak using FVM HLLE flux

    NASA Astrophysics Data System (ADS)

    Gunawan, P. H.; Pahlevi, M. R.

    2018-03-01

    The aim of this paper is to investigate the performances of openACC platform for computing 2D radial dambreak. Here, the shallow water equation will be used to describe and simulate 2D radial dambreak with finite volume method (FVM) using HLLE flux. OpenACC is a parallel computing platform based on GPU cores. Indeed, from this research this platform is used to minimize computational time on the numerical scheme performance. The results show the using OpenACC, the computational time is reduced. For the dry and wet radial dambreak simulations using 2048 grids, the computational time of parallel is obtained 575.984 s and 584.830 s respectively for both simulations. These results show the successful of OpenACC when they are compared with the serial time of dry and wet radial dambreak simulations which are collected 28047.500 s and 29269.40 s respectively.

  16. Further studies of auxin and ACC induced feminization in the cucumber plant using ethylene inhibitors

    NASA Technical Reports Server (NTRS)

    Takahashi, H.; Jaffe, M. J.

    1984-01-01

    The present study was designed to establish the role of an essential hormone controlling sex expression in cucumber. A potent anti-ethylene agent, AgNO3, completely inhibited pistillate flower formation caused by IAA, ACC or ethephon. Inhibitors of ethylene biosynthesis, AVG and CoCl2 also suppressed feminization due to exogenous IAA or ACC. Though AVG also suppressed ethephon-induced feminization, this may be due to the second effect of AVG rather than the effect on ACC biosynthesis. These results confirm that ethylene is a major factor regulating feminization and that exogenous auxin induces pistillate flower formation through its stimulation of ethylene production, rather than ACC production.

  17. Accumulation and Transport of 1-Aminocyclopropane-1-Carboxylic Acid (ACC) in Plants: Current Status, Considerations for Future Research and Agronomic Applications

    PubMed Central

    Vanderstraeten, Lisa; Van Der Straeten, Dominique

    2017-01-01

    1-aminocyclopropane-1-carboxylic acid (ACC) is a non-protein amino acid acting as the direct precursor of ethylene, a plant hormone regulating a wide variety of vegetative and developmental processes. ACC is the central molecule of ethylene biosynthesis. The rate of ACC formation differs in response to developmental, hormonal and environmental cues. ACC can be conjugated to three derivatives, metabolized in planta or by rhizobacteria using ACC deaminase, and is transported throughout the plant over short and long distances, remotely leading to ethylene responses. This review highlights some recent advances related to ACC. These include the regulation of ACC synthesis, conjugation and deamination, evidence for a role of ACC as an ethylene-independent signal, short and long range ACC transport, and the identification of a first ACC transporter. Although unraveling the complex mechanism of ACC transport is in its infancy, new questions emerge together with the identification of a first transporter. In the light of the future quest for additional ACC transporters, this review presents perspectives of the novel findings and includes considerations for future research toward applications in agronomy. PMID:28174583

  18. Accumulation and Transport of 1-Aminocyclopropane-1-Carboxylic Acid (ACC) in Plants: Current Status, Considerations for Future Research and Agronomic Applications.

    PubMed

    Vanderstraeten, Lisa; Van Der Straeten, Dominique

    2017-01-01

    1-aminocyclopropane-1-carboxylic acid (ACC) is a non-protein amino acid acting as the direct precursor of ethylene, a plant hormone regulating a wide variety of vegetative and developmental processes. ACC is the central molecule of ethylene biosynthesis. The rate of ACC formation differs in response to developmental, hormonal and environmental cues. ACC can be conjugated to three derivatives, metabolized in planta or by rhizobacteria using ACC deaminase, and is transported throughout the plant over short and long distances, remotely leading to ethylene responses. This review highlights some recent advances related to ACC. These include the regulation of ACC synthesis, conjugation and deamination, evidence for a role of ACC as an ethylene-independent signal, short and long range ACC transport, and the identification of a first ACC transporter. Although unraveling the complex mechanism of ACC transport is in its infancy, new questions emerge together with the identification of a first transporter. In the light of the future quest for additional ACC transporters, this review presents perspectives of the novel findings and includes considerations for future research toward applications in agronomy.

  19. In-depth characterization of the salivary adenoid cystic carcinoma transcriptome with emphasis on dominant cell type.

    PubMed

    Bell, Diana; Bell, Achim H; Bondaruk, Jolanta; Hanna, Ehab Y; Weber, Randall S

    2016-05-15

    Adenoid cystic carcinoma (ACC), 1 of the most common salivary gland malignancies, arises from the intercalated ducts, which are composed of inner ductal epithelial cells and outer myoepithelial cells. The objective of this study was to determine the genomic subtypes of ACC with emphasis on dominant cell type to identify potential specific biomarkers for each subtype and to improve the understanding of this disease. A whole-genome expression study was performed based on 42 primary salivary ACCs and 5 normal salivary glands. RNA from these specimens was subjected to expression profiling with RNA sequencing, and results were analyzed to identify transcripts in epithelial-dominant ACC (E-ACC), myoepithelial-dominant ACC (M-ACC), and all ACC that were expressed differentially compared with the transcripts in normal salivary tissue. In total, the authors identified 430 differentially expressed transcripts that were unique to E-ACC, 392 that were unique to M-ACC, and 424 that were common to both M-ACC and E-ACC. The sets of E-ACC-specific and M-ACC-specific transcripts were sufficiently large to define and differentiate E-ACC from M-ACC. Ingenuity pathway analysis identified known cancer-related genes for 60% of the E-ACC transcripts, 69% of the M-ACC transcripts, and 68% of the transcripts that were common in both E-ACC and M-ACC. Three sets of highly expressed candidate genes-distal-less homeobox 6 (DLX6) for E-ACC; protein keratin 16 (KRT16), SRY box 11 (SOX11), and v-myb avian myeloblastosis viral oncogene homolog (MYB) for M-ACC; and engrailed 1 (EN1) and statherin (STATH), which are common to both E-ACC and M-ACC)-were further validated at the protein level. The current results enabled the authors to identify novel potential therapeutic targets and biomarkers in E-ACC and M-ACC individually, with the implication that EN1, DLX6, and OTX1 (orthodenticle homeobox 1) are potential drivers of these cancers. Cancer 2016;122:1513-22. © 2016 American Cancer Society.

  20. Preliminary results from DIMES: Dispersion in the ACC

    NASA Astrophysics Data System (ADS)

    Balwada, D.; Speer, K.; LaCasce, J. H.; Owens, B.

    2012-04-01

    The Diapycnal and Isopynal Mixing Experiment in the Southern Ocean (DIMES) is a CLIVAR process study designed to study mixing in the Antarctic Circumpolar Current. The experiment includes tracer release, float, and small-scale turbulence components. This presentation will report on some results of the float component, from floats deployed across the ACC in the Southeast Pacific Ocean. These are the first subsurface Lagrangian trajectories from the ACC. Floats were deployed to follow approximately a constant density surface for a period of 1-3 years. To help aid the experimental results virtual floats were advected using AVISO data and basic statistics were derived from both deployed and virtual float trajectories. Experimental design, initial results, comparison to virtual floats and single particle and relative dispersion calculations will be presented.

  1. Human retina-specific amine oxidase (RAO): cDNA cloning, tissue expression, and chromosomal mapping

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Imamura, Yutaka; Kubota, Ryo; Wang, Yimin

    In search of candidate genes for hereditary retinal disease, we have employed a subtractive and differential cDNA cloning strategy and isolated a novel retina-specific cDNA. Nucleotide sequence analysis revealed an open reading frame of 2187 bp, which encodes a 729-amino-acid protein with a calculated molecular mass of 80,644 Da. The putative protein contained a conserved domain of copper amine oxidase, which is found in various species from bacteria to mammals. It showed the highest homology to bovine serum amine oxidase, which is believed to control the level of serum biogenic amines. Northern blot analysis of human adult and fetal tissuesmore » revealed that the protein is expressed abundantly and specifically in retina as a 2.7-kb transcript. Thus, we considered this protein a human retina-specific amine oxidase (RAO). The RAO gene (AOC2) was mapped by fluorescence in situ hybridization to human chromosome 17q21. We propose that AOC2 may be a candidate gene for hereditary ocular diseases. 38 refs., 4 figs.« less

  2. Direct and indirect effects of RNA interference against pyridoxal kinase and pyridoxine 5'-phosphate oxidase genes in Bombyx mori.

    PubMed

    Huang, ShuoHao; Yao, LiLi; Zhang, JianYun; Huang, LongQuan

    2016-08-01

    Vitamin B6 comprises six interconvertible pyridine compounds (vitamers), among which pyridoxal 5'-phosphate is a coenzyme involved in a high diversity of biochemical reactions. Humans and animals obtain B6 vitamers from diet, and synthesize pyridoxal 5'-phosphate by pyridoxal kinase and pyridoxine 5'-phosphate oxidase. Currently, little is known on how pyridoxal 5'-phosphate biosynthesis is regulated, and pyridoxal 5'-phosphate is supplied to meet their requirement in terms of cofactor. Bombyx mori is a large silk-secreting insect, in which protein metabolism is most active, and the vitamin B6 demand is high. In this study, we successfully down-regulated the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase by body cavity injection of synthesized double-stranded small interfering RNA to 5th instar larvae of Bombyx mori, and analyzed the gene transcription levels of pyridoxal 5'-phosphate dependent enzymes, phosphoserine aminotransferase and glutamic-oxaloacetic transaminase. Results show that the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase has a greater impact on the gene transcription of enzymes using pyridoxal 5'-phosphate as a cofactor in Bombyx mori. Our study suggests that pyridoxal 5'-phosphate biosynthesis and dynamic balance may be regulated by genetic networks. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Abundance and diversity of archaeal accA gene in hot springs in Yunnan Province, China.

    PubMed

    Song, Zhao-Qi; Wang, Li; Wang, Feng-Ping; Jiang, Hong-Chen; Chen, Jin-Quan; Zhou, En-Min; Liang, Feng; Xiao, Xiang; Li, Wen-Jun

    2013-09-01

    It has been suggested that archaea carrying the accA gene, encoding the alpha subunit of the acetyl CoA carboxylase, autotrophically fix CO2 using the 3-hydroxypropionate/4-hydroxybutyrate pathway in low-temperature environments (e.g., soils, oceans). However, little new information has come to light regarding the occurrence of archaeal accA genes in high-temperature ecosystems. In this study, we investigated the abundance and diversity of archaeal accA gene in hot springs in Yunnan Province, China, using DNA- and RNA-based phylogenetic analyses and quantitative polymerase chain reaction. The results showed that archaeal accA genes were present and expressed in the investigated Yunnan hot springs with a wide range of temperatures (66-96 °C) and pH (4.3-9.0). The majority of the amplified archaeal accA gene sequences were affiliated with the ThAOA/HWCG III [thermophilic ammonia-oxidizing archaea (AOA)/hot water crenarchaeotic group III]. The archaeal accA gene abundance was very close to that of AOA amoA gene, encoding the alpha subunit of ammonia monooxygenase. These data suggest that AOA in terrestrial hot springs might acquire energy from ammonia oxidation coupled with CO2 fixation using the 3-hydroxypropionate/4-hydroxybutyrate pathway.

  4. An OpenACC-Based Unified Programming Model for Multi-accelerator Systems

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Jungwon; Lee, Seyong; Vetter, Jeffrey S

    2015-01-01

    This paper proposes a novel SPMD programming model of OpenACC. Our model integrates the different granularities of parallelism from vector-level parallelism to node-level parallelism into a single, unified model based on OpenACC. It allows programmers to write programs for multiple accelerators using a uniform programming model whether they are in shared or distributed memory systems. We implement a prototype of our model and evaluate its performance with a GPU-based supercomputer using three benchmark applications.

  5. Involvement of alternative oxidase in the regulation of sensitivity of Sclerotinia sclerotiorum to the fungicides azoxystrobin and procymidone.

    PubMed

    Xu, Ting; Wang, Ya-Ting; Liang, Wu-Sheng; Yao, Fei; Li, Yong-Hong; Li, Dian-Rong; Wang, Hao; Wang, Zheng-Yi

    2013-06-01

    Sclerotinia sclerotiorum is a filamentous fungal pathogen that can infect many economically important crops and vegetables. Alternative oxidase is the terminal oxidase of the alternative respiratory pathway in fungal mitochondria. The function of alternative oxidase was investigated in the regulation of sensitivity of S. sclerotiorum to two commercial fungicides, azoxystrobin and procymidone which have different fungitoxic mechanisms. Two isolates of S. sclerotiorum were sensitive to both fungicides. Application of salicylhydroxamic acid, a specific inhibitor of alternative oxidase, significantly increased the values of effective concentration causing 50% mycelial growth inhibition (EC50) of azoxystrobin to both S. sclerotiorum isolates, whereas notably decreased the EC50 values of procymidone. In mycelial respiration assay azoxystrobin displayed immediate inhibitory effect on cytochrome pathway capacity, but had no immediate effect on alternative pathway capacity. In contrast, procymidone showed no immediate impact on capacities of both cytochrome and alternative pathways in the mycelia. However, alternative oxidase encoding gene (aox) transcript and protein levels, alternative respiration pathway capacity of the mycelia were obviously increased by pre-treatment for 24 h with both azoxystrobin and procymidone. These results indicate that alternative oxidase was involved in the regulation of sensitivity of S. sclerotiorum to the fungicides azoxystrobin and procymidone, and that both fungicides could affect aox gene expression and the alternative respiration pathway capacity development in mycelia of this fungal pathogen.

  6. Airborne Cloud Computing Environment (ACCE)

    NASA Technical Reports Server (NTRS)

    Hardman, Sean; Freeborn, Dana; Crichton, Dan; Law, Emily; Kay-Im, Liz

    2011-01-01

    Airborne Cloud Computing Environment (ACCE) is JPL's internal investment to improve the return on airborne missions. Improve development performance of the data system. Improve return on the captured science data. The investment is to develop a common science data system capability for airborne instruments that encompasses the end-to-end lifecycle covering planning, provisioning of data system capabilities, and support for scientific analysis in order to improve the quality, cost effectiveness, and capabilities to enable new scientific discovery and research in earth observation.

  7. Oxygen control of ethylene biosynthesis during seed development in Arabidopsis thaliana (L.) Heynh

    NASA Technical Reports Server (NTRS)

    Ramonell, K. M.; McClure, G.; Musgrave, M. E.

    2002-01-01

    An unforeseen side-effect on plant growth in reduced oxygen is the loss of seed production at concentrations around 25% atmospheric (50 mmol mol-1 O2). In this study, the model plant Arabidopsis thaliana (L.) Heynh. cv. 'Columbia' was used to investigate the effect of low oxygen on ethylene biosynthesis during seed development. Plants were grown in a range of oxygen concentrations (210 [equal to ambient], 160, 100, 50 and 25 mmol mol-1) with 0.35 mmol mol-1 CO2 in N2. Ethylene in full-sized siliques was sampled using gas chromatography, and viable seed production was determined at maturity. Molecular analysis of ethylene biosynthesis was accomplished using cDNAs encoding 1-aminocyclopropane-1-carboxylic acid (ACC) synthase and ACC oxidase in ribonuclease protection assays and in situ hybridizations. No ethylene was detected in siliques from plants grown at 50 and 25 mmol mol-1 O2. At the same time, silique ACC oxidase mRNA increased three-fold comparing plants grown under the lowest oxygen with ambient controls, whereas ACC synthase mRNA was unaffected. As O2 decreased, tissue-specific patterning of ACC oxidase and ACC synthase gene expression shifted from the embryo to the silique wall. These data demonstrate how low O2 modulates the activity and expression of the ethylene biosynthetic pathway during seed development in Arabidopsis.

  8. Identification and characterization of aldehyde oxidases (AOXs) in the cotton bollworm

    NASA Astrophysics Data System (ADS)

    Xu, Wei; Liao, Yalin

    2017-12-01

    Aldehyde oxidases (AOXs) are a family of metabolic enzymes that oxidize aldehydes into carboxylic acids; therefore, they play critical roles in detoxification and degradation of chemicals. By using transcriptomic and genomic approaches, we successfully identified six putative AOX genes (HarmAOX1-6) from cotton bollworm, Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae). In silico expression profile, reverse transcription (RT)-PCR, and quantitative PCR (qPCR) analyses showed that HarmAOX1 is highly expressed in adult antennae, tarsi, and larval mouthparts, so they may play an important role in degrading plant-derived compounds. HarmAOX2 is highly and specifically expressed in adult antennae, suggesting a candidate pheromone-degrading enzyme (PDE) to inactivate the sex pheromone components (Z)-11-hexadecenal and (Z)-9-hexadecenal. RNA sequencing data further demonstrated that a number of host plants they feed on could significantly upregulate the expression levels of HarmAOX1 in larvae. This study improves our understanding of insect aldehyde oxidases and insect-plant interactions.

  9. Distal truncation of KCC3 in non-French Canadian HMSN/ACC families.

    PubMed

    Salin-Cantegrel, A; Rivière, J-B; Dupré, N; Charron, F M; Shekarabi, M; Karéméra, L; Gaspar, C; Horst, J; Tekin, M; Deda, G; Krause, A; Lippert, M M; Willemsen, M A A P; Jarrar, R; Lapointe, J-Y; Rouleau, G A

    2007-09-25

    Hereditary motor and sensory neuropathy with agenesis of the corpus callosum (HMSN/ACC) is a severe and progressive autosomal recessive polyneuropathy. Mutations in the potassium-chloride cotransporter 3 gene (KCC3) were identified as responsible for HMSN/ACC in the French Canadian (FC) population. In the present study, the authors were interested in finding new mutations in non-FC populations, assessing the activity of mutant proteins and refining genotype-phenotype correlations. The authors screened KCC3 for mutations using direct sequencing in six non-FC HMSN/ACC families. They then assessed the functionality of the most common mutant protein using a flux assay in Xenopus laevis oocytes. The authors identified mutations in exon 22 of KCC3: a novel mutation (del + 2994-3003; E1015X) in one family, as well as a known mutation (3031C-->T; R1011X) found in five unrelated families and associated with two different haplotypes. The function of the cotransporter was abolished, although a limited amount of mutant proteins were correctly localized at the membrane. KCC3 mutations in exon 22 constitute a recurrent mutation site for hereditary motor and sensory neuropathy with agenesis of the corpus callosum (HMSN/ACC), regardless of ethnic origin, and are the most common cause of HMSN/ACC in the non-French Canadian (FC) families analyzed so far. Therefore, for genetic analysis, exon 22 screening should be prioritized in non-FC populations. Finally, the R1011X mutation leads to the abrogation of KCC3's function in Xenopus laevis oocytes, likely due to impaired transit of the cotransporter.

  10. Amphetamine manipulates monoamine oxidase-A level and behavior using theranostic aptamers of transcription factors AP-1/NF-kB.

    PubMed

    Liu, Christina H; Ren, Jiaqian; Liu, Philip K

    2016-02-03

    Monoamine oxidase (MAO) enzymes play a critical role in controlling the catabolism of monoamine neurotransmitters and biogenic trace amines and behavior in humans. However, the mechanisms that regulate MAO are unclear. Several transcription factor proteins are proposed to modulate the transcription of MAO gene, but evidence supporting these hypotheses is controversial. We aimed to investigate the mechanism of gene transcription regulator proteins on amphetamine-induced behavior. We applied aptamers containing a DNA binding sequence, as well as a random sequence (without target) to study the modulation of amphetamine-induced MAO levels and hyperactivity in living mice. We pretreated in adult male C57black6 mice (Taconic Farm, Germantown, NY) (n ≥ 3 litters at a time), 2 to 3 months of age (23 ± 2 gm body weight) with double-stranded (ds) DNA aptamers with sequence specific to activator protein-1 (5ECdsAP1), nuclear factor-kappa beta (5ECdsNF-kB), special protein-1 (5ECdsSP-1) or cyclicAMP responsive element binding (5ECdsCreB) protein binding regions, 5ECdsRan [a random sequence without target], single-stranded AP-1 (5ECssAP-1) (8 nmol DNA per kg) or saline (5 μl, intracerebroventricular [icv] injection) control before amphetamine administration (4 mg/kg, i.p.). We then measured and analyzed locomotor activities and the level of MAO-A and MAO-B activity. In the pathological condition of amphetamine exposure, we showed here that pretreatment with 5ECdsAP1 and 5ECdsNF-kB reversed the decrease of MAO-A activity (p < 0.05, t test), but not activity of the B isomer (MAO-B), in the ventral tegmental area (VTA) and substantia nigra (SN) of C57black6 mice. The change in MAO-A level coincided with a reversed amphetamine-induced restless behavior of mice. Pretreatments with saline, 5ECdsCreB, 5ECdsSP-1, 5ECdsRan or 5ECssAP-1 had no effect. Our data lead us to conclude that elevation of AP-1 or NF-kB indirectly decreases MAO-A protein levels which, in turn

  11. Les grands accélérateurs de particules

    NASA Astrophysics Data System (ADS)

    Patoux, A.; Perot, J.

    1991-02-01

    The different types of accelerators are recalled with emphasis on the most powerful : the synchrotron particle colliders. The use of superconductors in accelerator magnets as well as in RF cavities is discussed. The characteristics of the large accelerators, existing and planned, are given together with the level of industry involvement in their construction. Details concerning superconducting magnets and cryogenic plants are investigated. Finally, detectors, the most important tool for physics, are mentionned. Après avoir rappelé les différents types d'accélérateurs utilisés, l'accent est mis sur les plus puissants, c'est-à-dire les synchrotrons fonctionnant en anneaux de collision. Le rôle des supraconducteurs est analysé aussi bien pour les aimants que pour les cavités accélératrices. Les caractéristiques des principaux accélérateurs existants ou en projet sont données ainsi que l'implication de l'industrie dans leur fabrication. On insiste plus particulièrement sur les aimants supraconducteurs et les installations cryogéniques. Enfin les détecteurs, éléments indispensables à la physique, sont également évoqués.

  12. Precipitation of ACC in liposomes-a model for biomineralization in confined volumes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tester, Chantel C; Wu, Ching-Hsuan; Weigand, Steven

    2013-01-10

    Biomineralizing organisms frequently precipitate minerals in small phospholipid bilayer-delineated compartments. We have established an in vitro model system to investigate the effect of confinement in attoliter to femtoliter volumes on the precipitation of calcium carbonate. In particular, we analyze the growth and stabilization of liposome-encapsulated amorphous calcium carbonate (ACC) nanoparticles using a combination of in situ techniques, cryo-transmission electron microscopy (Cryo-TEM), and small angle X-ray scattering (SAXS). Herein, we discuss ACC nanoparticle growth rate as a function of liposome size, carbon dioxide flux across the liposome membrane, pH, and osmotic pressure. Based on these experiments, we argue that the stabilizationmore » of ACC nanoparticles in liposomes is a consequence of a low nucleation rate (high activation barrier) of crystalline polymorphs of calcium carbonate.« less

  13. The GA5 locus of Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: molecular cloning and functional expression.

    PubMed

    Xu, Y L; Li, L; Wu, K; Peeters, A J; Gage, D A; Zeevaart, J A

    1995-07-03

    The biosynthesis of gibberellins (GAs) after GA12-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11.-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidase gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA53 to GA44 and GA19 to GA20. The Arabidopsis GA 20-oxidase shares 55% identity and > 80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA5 locus of Arabidopsis. The ga5 semidwarf mutant contains a G-->A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Ara-bidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA4 treatment, suggesting end-product repression in the GA biosynthetic pathway.

  14. Impaired Voluntary Control in PTSD: Probing Self-Regulation of the ACC With Real-Time fMRI

    PubMed Central

    Zweerings, Jana; Pflieger, Eliza M.; Mathiak, Krystyna A.; Zvyagintsev, Mikhail; Kacela, Anastasia; Flatten, Guido; Mathiak, Klaus

    2018-01-01

    Background: Post-traumatic stress disorder (PTSD) is characterized by deficits in the self-regulation of cognitions and emotions. Neural networks of emotion regulation may exhibit reduced control mediated by the anterior cingulate cortex (ACC), contributing to aberrant limbic responses in PTSD. Methods: Real-time fMRI neurofeedback (rt-fMRI NF) assessed self-regulation of the ACC in nine patients with PTSD after single trauma exposure and nine matched healthy controls. All participants were instructed to train ACC upregulation on three training days. Results: Both groups achieved regulation, which was associated with wide-spread brain activation encompassing the ACC. Compared to the controls, regulation amplitude and learning rate was lower in patients, correlating with symptom severity. In addition, a frontopolar activation cluster was associated with self-regulation efforts in patients. Conclusions: For the first time, we tested self-regulation of the ACC in patients with PTSD. The observed impairment supports models of ACC-mediated regulation deficits that may contribute to the psychopathology of PTSD. Controlled trials in a larger sample are needed to confirm our findings and to directly investigate whether training of central regulation mechanisms improves emotion regulation in PTSD. PMID:29899712

  15. Impaired Voluntary Control in PTSD: Probing Self-Regulation of the ACC With Real-Time fMRI.

    PubMed

    Zweerings, Jana; Pflieger, Eliza M; Mathiak, Krystyna A; Zvyagintsev, Mikhail; Kacela, Anastasia; Flatten, Guido; Mathiak, Klaus

    2018-01-01

    Background: Post-traumatic stress disorder (PTSD) is characterized by deficits in the self-regulation of cognitions and emotions. Neural networks of emotion regulation may exhibit reduced control mediated by the anterior cingulate cortex (ACC), contributing to aberrant limbic responses in PTSD. Methods: Real-time fMRI neurofeedback (rt-fMRI NF) assessed self-regulation of the ACC in nine patients with PTSD after single trauma exposure and nine matched healthy controls. All participants were instructed to train ACC upregulation on three training days. Results: Both groups achieved regulation, which was associated with wide-spread brain activation encompassing the ACC. Compared to the controls, regulation amplitude and learning rate was lower in patients, correlating with symptom severity. In addition, a frontopolar activation cluster was associated with self-regulation efforts in patients. Conclusions: For the first time, we tested self-regulation of the ACC in patients with PTSD. The observed impairment supports models of ACC-mediated regulation deficits that may contribute to the psychopathology of PTSD. Controlled trials in a larger sample are needed to confirm our findings and to directly investigate whether training of central regulation mechanisms improves emotion regulation in PTSD.

  16. Identification of genes involved in the ACC-mediated control of root cell elongation in Arabidopsis thaliana

    PubMed Central

    2012-01-01

    Background Along the root axis of Arabidopsis thaliana, cells pass through different developmental stages. In the apical meristem repeated cycles of division increase the numbers of cells. Upon leaving the meristem, these cells pass the transition zone where they are physiologically and mechanically prepared to undergo subsequent rapid elongation. During the process of elongation epidermal cells increase their length by 300% in a couple of hours. When elongation ceases, the cells acquire their final size, shape and functions (in the differentiation zone). Ethylene administered as its precursor 1-aminocyclopropane-1-carboxylic acid (ACC) is capable of inhibiting elongation in a concentration-dependent way. Using a microarray analysis, genes and/or processes involved in this elongation arrest are identified. Results Using a CATMA-microarray analysis performed on control and 3h ACC-treated roots, 240 differentially expressed genes were identified. Quantitative Real-Time RT-PCR analysis of the 10 most up and down regulated genes combined with literature search confirmed the accurateness of the analysis. This revealed that inhibition of cell elongation is, at least partly, caused by restricting the events that under normal growth conditions initiate elongation and by increasing the processes that normally stop cellular elongation at the end of the elongation/onset of differentiation zone. Conclusions ACC interferes with cell elongation in the Arabidopsis thaliana roots by inhibiting cells from entering the elongation process and by immediately stimulating the formation of cross-links in cell wall components, diminishing the remaining elongation capacity. From the analysis of the differentially expressed genes, it becomes clear that many genes identified in this response, are also involved in several other kind of stress responses. This suggests that many responses originate from individual elicitors, but that somewhere in the downstream signaling cascade, these are

  17. Identification of a Catalase-Phenol Oxidase in Betalain Biosynthesis in Red Amaranth (Amaranthus cruentus)

    PubMed Central

    Teng, Xiao-Lu; Chen, Ning; Xiao, Xing-Guo

    2016-01-01

    Betalains are a group of nitrogen-containing pigments that color plants in most families of Caryophyllales. Their biosynthesis has long been proposed to begin with hydroxylation of L-tyrosine to L-DOPA through monophenolase activity of tyrosinase, but biochemical evidence in vivo remains lacking. Here we report that a Group 4 catalase, catalase-phenol oxidase (named as AcCATPO), was identified, purified and characterized from leaves of Amaranthus cruentus, a betalain plant. The purified enzyme appeared to be a homotrimeric protein composed of subunits of about 58 kDa, and demonstrated not only the catalase activity toward H2O2, but also the monophenolase activity toward L-tyrosine and diphenolase activity toward L-DOPA. Its catalase and phenol oxidase activities were inhibited by common classic catalase and tyrosinase inhibitors, respectively. All its peptide fragments identified by nano-LC-MS/MS were targeted to catalases, and matched with a cDNA-encoded polypeptide which contains both classic catalase and phenol oxidase active sites. These sites were also present in catalases of non-betalain plants analyzed. AcCATPO transcript abundance was positively correlated with the ratio of betaxanthin to betacyanin in both green and red leaf sectors of A. tricolor. These data shows that the fourth group catalase, catalase-phenol oxidase, is present in plant, and might be involved in betaxanthin biosynthesis. PMID:26779247

  18. [Isolation, identification and characterization of ACC deaminase-containing endophytic bacteria from halophyte Suaeda salsa].

    PubMed

    Teng, Songshan; Liu, Yanping; Zhao, Lei

    2010-11-01

    We Isolated and characterized 1-aminocyclopropane-1-carboxylate (ACC) deaminase-containing endophytic bacteria from halophyte Suaeda salsa to understand the interactions between endophytes and halophyte. ACC deaminase-containing endophytic bacteria were isolated from root, stalk and leaf of Suaeda salsa and were identified based on morphological, physiological-biochemical properties, API and 16S rRNA sequence analysis. Isolates were evaluated for their ACC deaminase, antifungal, protease activity, siderophores and phytohormones, such as indole-3-acetic acid, gibberellic acid and abscisic acid production, as well as atmospheric nitrogen fixation and phosphate solubilization. Four ACC deaminase-containing endophytic bacteria strains named as LP11, SS12, TW1 and TW2 were isolated and identified as Pseudomonas oryzihabitans, Pseudomonas sp., Pantoea agglomerans and Pseudomonas putida respectively. All the strains possessed the phosphate-solubilizing ability and could produce siderophores and phytohormones more or less. None of them could fix atmospheric nitrogen or produce protease. Only strain SS12 showed antagonism against two phytopathogenic fungi viz Fusarium oxysporum f. sp. conglutinans and F. oxysporum f. sp. cucumerinum. ACC deaminase-containing endophytic bacteria of Pseudomonas sp. and Pantoea sp. isolated from halophyte Suaeda salsa have abundant biological characteristics related to plant growth promotion, stress homeostasis regulation and biocontrol activity.

  19. Structure–function characterization reveals new catalytic diversity in the galactose oxidase and glyoxal oxidase family

    PubMed Central

    Yin, DeLu (Tyler); Urresti, Saioa; Lafond, Mickael; Johnston, Esther M.; Derikvand, Fatemeh; Ciano, Luisa; Berrin, Jean-Guy; Henrissat, Bernard; Walton, Paul H.; Davies, Gideon J.; Brumer, Harry

    2015-01-01

    Alcohol oxidases, including carbohydrate oxidases, have a long history of research that has generated fundamental biological understanding and biotechnological applications. Despite a long history of study, the galactose 6-oxidase/glyoxal oxidase family of mononuclear copper-radical oxidases, Auxiliary Activity Family 5 (AA5), is currently represented by only very few characterized members. Here we report the recombinant production and detailed structure–function analyses of two homologues from the phytopathogenic fungi Colletotrichum graminicola and C. gloeosporioides, CgrAlcOx and CglAlcOx, respectively, to explore the wider biocatalytic potential in AA5. EPR spectroscopy and crystallographic analysis confirm a common active-site structure vis-à-vis the archetypal galactose 6-oxidase from Fusarium graminearum. Strikingly, however, CgrAlcOx and CglAlcOx are essentially incapable of oxidizing galactose and galactosides, but instead efficiently catalyse the oxidation of diverse aliphatic alcohols. The results highlight the significant potential of prospecting the evolutionary diversity of AA5 to reveal novel enzyme specificities, thereby informing both biology and applications. PMID:26680532

  20. An ACC Design Method for Achieving Both String Stability and Ride Comfort

    NASA Astrophysics Data System (ADS)

    Yamamura, Yoshinori; Seto, Yoji; Nishira, Hikaru; Kawabe, Taketoshi

    An investigation was made of a method for designing adaptive cruise control (ACC) so as to achieve a headway distance response that feels natural to the driver while at the same time obtaining high levels of both string stability and ride comfort. With this design method, the H∞ norm is adopted as the index of string stability. Additionally, two norms are introduced for evaluating ride comfort and natural vehicle behavior. The relationship between these three norms and headway distance response characteristics was analyzed, and an evaluation method was established for achieving high levels of the various performance characteristics required of ACC. An ACC system designed with this method was evaluated in driving tests conducted on a proving ground course, and the results confirmed that it achieved the targeted levels of string stability, ride comfort and natural vehicle behavior.

  1. Effectiveness of rhizobacteria containing ACC deaminase for growth promotion of peas (Pisum sativum) under drought conditions.

    PubMed

    Zahir, Z A; Munir, A; Asghar, H N; Shaharoona, B; Arshad, M

    2008-05-01

    A series of experiments were conducted to assess the effectiveness of rhizobacteria containing 1-aminocyclopropane- 1-carboxylate (ACC) deaminase for growth promotion of peas under drought conditions. Ten rhizobacteria isolated from the rhizosphere of different crops (peas, wheat, and maize) were screened for their growth promoting ability in peas under axenic condition. Three rhizobacterial isolates, Pseudomonas fluorescens biotype G (ACC-5), P. fluorescens (ACC-14), and P. putida biotype A (Q-7), were selected for pot trial on the basis of their source, ACC deaminase activity, root colonization, and growth promoting activity under axenic conditions. Inoculated and uninoculated (control) seeds of pea cultivar 2000 were sown in pots (4 seeds/pot) at different soil moisture levels (25, 50, 75, and 100% of field capacity). Results revealed that decreasing the soil moisture levels from 100 to 25% of field capacity significantly decreased the growth of peas. However, inoculation of peas with rhizobacteria containing ACC deaminase significantly decreased the "drought stress imposed effects" on growth of peas, although with variable efficacy at different moisture levels. At the lowest soil moisture level (25% field capacity), rhizobacterial isolate Pseudomonas fluorescens biotype G (ACC-5) was found to be more promising compared with the other isolates, as it caused maximum increases in fresh weight, dry weight, root length, shoot length, number of leaves per plant, and water use efficiency on fresh and dry weight basis (45, 150, 92, 45, 140, 46, and 147%, respectively) compared with respective uninoculated controls. It is highly likely that rhizobacteria containing ACC deaminase might have decreased the drought-stress induced ethylene in inoculated plants, which resulted in better growth of plants even at low moisture levels. Therefore, inoculation with rhizobacteria containing ACC deaminase could be helpful in eliminating the inhibitory effects of drought stress on the

  2. [Involvement of hydrogen peroxide in the regulation of coexpression of alternative oxidase and rotenone-insensitive NADH dehydrogenase in tomato leaves and calluses].

    PubMed

    Eprintsev, A T; Mal'tseva, E V; Shatskikh, A S; Popov, V N

    2011-01-01

    The involvement of active oxygen forms in the regulation of the expression of mitochondrial respiratory chain components, which are not related to energy storing, has been in vitro and in vivo studied in Lycopersicum esculentum L. The highest level of transcription of genes encoding alternative oxidase and NADH dehydrogenase has been observed in green tomato leaves. It has been shown that even low H2O2 concentrations activate both aoxlalpha and ndb1 genes, encoding alternative oxidase and external mitochondrial rotenone-insensitive NADH dehydrogenase, respectively. According to our results, in the case of an oxidative stress, alternative oxidase and NADH dehydrogenase are coexpressed in tomato plant tissues, and active oxygen forms serve as the secondary messengers of their coexpression.

  3. NADPH oxidase inhibitors: a patent review.

    PubMed

    Kim, Jung-Ae; Neupane, Ganesh Prasad; Lee, Eung Seok; Jeong, Byeong-Seon; Park, Byung Chul; Thapa, Pritam

    2011-08-01

    NADPH oxidases, a family of multi-subunit enzyme complexes, catalyze the production of reactive oxygen species (ROS), which may contribute to the pathogenesis of a variety of diseases. In addition to the first NADPH oxidase found in phagocytes, four non-phagocytic NADPH oxidase isoforms have been identified, which all differ in their catalytic subunit (Nox1-5) and tissue distribution. This paper provides a comprehensive review of the patent literature on NADPH oxidase inhibitors, small molecule Nox inhibitors, peptides and siRNAs. Since each member of the NADPH oxidase family has great potential as a therapeutic target, several different compounds have been registered as NADPH oxidase inhibitors in the patent literature. As yet, none have gone through clinical trials, and some have not completed preclinical trials, including safety and specificity evaluation. Recently, small molecule pyrazolopyridine and triazolopyrimidine derivatives have been submitted as potent NADPH oxidase inhibitors and reported as first-in-class inhibitors for idiopathic pulmonary fibrosis and acute stroke, respectively. Further clinical efficacy and safety data are warranted to prove their actual clinical utility.

  4. A feasibility study on porting the community land model onto accelerators using OpenACC

    DOE PAGES

    Wang, Dali; Wu, Wei; Winkler, Frank; ...

    2014-01-01

    As environmental models (such as Accelerated Climate Model for Energy (ACME), Parallel Reactive Flow and Transport Model (PFLOTRAN), Arctic Terrestrial Simulator (ATS), etc.) became more and more complicated, we are facing enormous challenges regarding to porting those applications onto hybrid computing architecture. OpenACC appears as a very promising technology, therefore, we have conducted a feasibility analysis on porting the Community Land Model (CLM), a terrestrial ecosystem model within the Community Earth System Models (CESM)). Specifically, we used automatic function testing platform to extract a small computing kernel out of CLM, then we apply this kernel into the actually CLM dataflowmore » procedure, and investigate the strategy of data parallelization and the benefit of data movement provided by current implementation of OpenACC. Even it is a non-intensive kernel, on a single 16-core computing node, the performance (based on the actual computation time using one GPU) of OpenACC implementation is 2.3 time faster than that of OpenMP implementation using single OpenMP thread, but it is 2.8 times slower than the performance of OpenMP implementation using 16 threads. On multiple nodes, MPI_OpenACC implementation demonstrated very good scalability on up to 128 GPUs on 128 computing nodes. This study also provides useful information for us to look into the potential benefits of “deep copy” capability and “routine” feature of OpenACC standards. In conclusion, we believe that our experience on the environmental model, CLM, can be beneficial to many other scientific research programs who are interested to porting their large scale scientific code using OpenACC onto high-end computers, empowered by hybrid computing architecture.« less

  5. The transformation of amorphous calcium carbonate, ACC, to crystalline phases as function of time and temperature.

    NASA Astrophysics Data System (ADS)

    Gies, Hermann; Happel, Marian; Niedermayr, Andrea; Immenhauser, Adrian

    2017-04-01

    We present results from a structural study of the transformation of freeze dried amorphous calcium carbonate, ACC, in crystalline material using pair distribution function analysis, PDF analysis, of X-ray powder diffraction data, XPD data. PDF analysis allows for the analysis of local order of structural subunit in the range between molecular unit (1. and 2. coordination sphere) and long range periodicity as in crystalline materials. ACC was precipitated from aqueous solutions at 298 K and 278 K using different amounts of Mg cations as stabilizer. The samples were immediately separated from the solution and freeze dried. For the transformation study, the samples were heated and analysed using XPD until they were crystallized. The radial distribution obtained from the XPD data were compared to simulated radial distributions of the calcium carbonate polymorphs and their hydrated phases. An ACC precipitated from a solution with Ca:Mg:CO3 = 1:5:4 at 298 K (ration in mmol, pH = 8.2) and freeze dried right after isolation from the solution revealed a close resemblance with ikaite in its local order. Another ACC with Ca:Mg:CO3 = 1:10:1.4 (T = 298, pH = 8.7) showed distinctly different local order resembling monohydrocalcite. Both ACC, however, still had considerable amounts of water dominating the Ca-coordination sphere. During the transformation to calcite, the structural changes in the sample concerned the hydrate water coordinating Ca which was removed and replaced by the carbonate oxygens. The study shows that ACC obtained from different starting solutions show specific local order. Freeze drying leads to solid ACC powder which still contain considerable amounts of hydrate water. Structural subunits are distinct in ACC and different from the crystalline phase. The study supplements recent reports presented by Konrad et al., Purgstaller et al., and Tobler et al.. F. Konrad et al., Cryst. Growth Des. 16, 6310-6317(2016) B. Purgstaller et al., Geochimica et Cosmochimica

  6. Gibberellin metabolism in Vitis vinifera L. during bloom and fruit-set: functional characterization and evolution of grapevine gibberellin oxidases

    PubMed Central

    Giacomelli, Lisa

    2013-01-01

    Gibberellins (GAs) are involved in the regulation of flowering and fruit-set in grapes (Vitis vinifera L.), but the molecular mechanisms behind this process are mostly unknown. In this work, the family of grapevine GA oxidases involved in the biosynthesis and deactivation of GAs was characterized. Six putative GA 20-oxidase (GA20ox), three GA 3-oxidase (GA3ox), and eight GA 2-oxidase (GA2ox) proteins, the latter further divided into five C19-GA 2ox and three C20-GA2ox proteins, were identified. Phylogenetic analyses suggest a common origin of the GA3ox and C19-GA2ox groups and challenge previous evolutionary models. In vitro analysis revealed that all GA3ox and GA20ox enzymes prefer substrates of the non-13-hydroxylation pathway. In addition, ectopic expression of GA2ox genes in Arabidopsis thaliana confirmed the activity of their encoded proteins in vivo. The results show that bioactive GA1 accumulates in opening grapevine flowers, whereas at later developmental stages only GA4 is detected in the setting fruit. By studying the expression pattern of the grapevine GA oxidase genes in different organs, and at different stages of flowering and fruit-set, it is proposed that the pool of bioactive GAs is controlled by a fine regulation of the abundance and localization of GA oxidase transcripts. PMID:24006417

  7. Monitoring apoptosis of TK-GFP-expressing ACC-M cells induced by ACV using FRET technique

    NASA Astrophysics Data System (ADS)

    Xiong, Tao; Zhang, Zhihong; Lin, Juqiang; Yang, Jie; Zeng, Shaoqun; Luo, Qingming

    2006-05-01

    Apoptosis is an evolutionary conserved cellular process that plays an important role during development, but it is also involved in tissue homeostasis and in many diseases. To study the characteristics of suicide gene system of the herpes simplex virus thymidine kinase (HSV-tk) gene in tumor cells and explore the apoptosis phenomena in this system and its effect on the human adenoid cystic carcinoma line ACC-M cell, we detected apoptosis of CD3- (ECFP-CRS-DsRed) and TK-GFP-expressing ACC-M (ACC-M-TK-GFP-CD3) cells induced by acyclovir (ACV) using fluorescence resonance energy transfer (FRET) technique. CD3 is a FRET-based indicator for activity of caspase-3, which is composed of an enhanced cyan fluorescent protein, a caspase-3 sensitive linker, and a red fluorescent protein from Discosoma with efficient maturation property. FRET from ECFP to DsRed could be detected in normal ACC-M-TK-GFP-CD3 cells, and the FRET efficient was remarkably decreased and then disappeared during the cells apoptosis induced by ACV. It was due to the activated caspase-3 cleaved the CD3 fusion protein. In this study, the results suggested that the ACV-induced apoptosis of ACC-M-TK-GFP-CD3 cells was through caspase-3 pathway.

  8. Monitoring apoptosis of TK-GFP-expressing ACC-M cells induced by ACV using FRET technique

    NASA Astrophysics Data System (ADS)

    Xiong, Tao; Zhang, Zhihong; Lin, Juqiang; Yang, Jie; Zeng, Shaoqun; Luo, Qingming

    2006-09-01

    Apoptosis is an evolutionary conserved cellular process that plays an important role during development, but it is also involved in tissue homeostasis and in many diseases. To study the characteristics of suicide gene system of the herpes simplex virus thymidine kinase (HSV-tk) gene in tumor cells and explore the apoptosis phenomena in this system and its effect on the human adenoid cystic carcinoma line ACC-M cell, we detected apoptosis of CD3- (ECFP-CRS-DsRed) and TK-GFP-expressing ACC-M (ACC-M-TK-GFP-CD3) cells induced by acyclovir (ACV) using fluorescence resonance energy transfer (FRET) technique. CD3 is a FRET-based indicator for activity of caspase-3, which is composed of an enhanced cyan fluorescent protein, a caspase-3 sensitive linker, and a red fluorescent protein from Discosoma with efficient maturation property. FRET from ECFP to DsRed could be detected in normal ACC-M-TK-GFP-CD3 cells, and the FRET efficient was remarkably decreased and then disappeared during the cells apoptosis induced by ACV. It was due to the activated caspase-3 cleaved the CD3 fusion protein. In this study, the results suggested that the AVC-induced apoptosis of ACC-M-TK-GFP-CD3 cells was through caspase-3 pathway.

  9. A halotolerant Enterobacter sp. displaying ACC deaminase activity promotes rice seedling growth under salt stress.

    PubMed

    Sarkar, Anumita; Ghosh, Pallab Kumar; Pramanik, Krishnendu; Mitra, Soumik; Soren, Tithi; Pandey, Sanjeev; Mondal, Monohar Hossain; Maiti, Tushar Kanti

    2018-01-01

    Agricultural productivity is proven to be hampered by the synthesis of reactive oxygen species (ROS) and production of stress-induced ethylene under salinity stress. One-aminocyclopropane-1-carboxylic acid (ACC) is the direct precursor of ethylene synthesized by plants. Bacteria possessing ACC deaminase activity can use ACC as a nitrogen source preventing ethylene production. Several salt-tolerant bacterial strains displaying ACC deaminase activity were isolated from rice fields, and their plant growth-promoting (PGP) properties were determined. Among them, strain P23, identified as an Enterobacter sp. based on phenotypic characteristics, matrix-assisted laser desorption ionization-time of flight mass spectrometry data and the 16S rDNA sequence, was selected as the best-performing isolate for several PGP traits, including phosphate solubilization, IAA production, siderophore production, HCN production, etc. Enterobacter sp. P23 was shown to promote rice seedling growth under salt stress, and this effect was correlated with a decrease in antioxidant enzymes and stress-induced ethylene. Isolation of an acdS mutant strain enabled concluding that the reduction in stress-induced ethylene content after inoculation of strain P23 was linked to ACC deaminase activity. Copyright © 2017 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  10. Transcriptional regulation of genes encoding ABA metabolism enzymes during the fruit development and dehydration stress of pear 'Gold Nijisseiki'.

    PubMed

    Dai, Shengjie; Li, Ping; Chen, Pei; Li, Qian; Pei, Yuelin; He, Suihuan; Sun, Yufei; Wang, Ya; Kai, Wenbin; Zhao, Bo; Liao, Yalan; Leng, Ping

    2014-09-01

    To investigate the contribution of abscisic acid (ABA) in pear 'Gold Nijisseiki' during fruit ripening and under dehydration stress, two cDNAs (PpNCED1 and PpNCED2) which encode 9-cis-epoxycarotenoid dioxygenase (NCED) (a key enzyme in ABA biosynthesis), two cDNAs (PpCYP707A1 and PpCYP707A2) which encode 8'-hydroxylase (a key enzyme in the oxidative catabolism of ABA), one cDNA (PpACS3) which encodes 1-aminocyclopropane-1-carboxylic acid (ACC), and one cDNA (PpACO1) which encodes ACC oxidase involved in ethylene biosynthesis were cloned from 'Gold Nijisseiki' fruit. In the pulp, peel and seed, expressions of PpNCED1 and PpNCED2 rose in two stages which corresponded with the increase of ABA levels. The expression of PpCYP707A1 dramatically declined after 60-90 days after full bloom (DAFB) in contrast to the changes of ABA levels during this period, while PpCYP707A2 stayed low during the whole development of fruit. Application of exogenous ABA at 100 DAFB increased the soluble sugar content and the ethylene release but significantly decreased the titratable acid and chlorophyll contents in fruits. When fruits harvested at 100 DAFB were stored in the laboratory (25 °C, 50% relative humidity), the ABA content and the expressions of PpNCED1/2 and PpCYP707A1 in the pulp, peel and seed increased significantly, while ethylene reached its highest value after the maximum peak of ABA accompanied with the expressions of PpACS3 and PpACO1. In sum the endogenous ABA may play an important role in the fruit ripening and dehydration of pear 'Gold Nijisseiki' and the ABA level was regulated mainly by the dynamics of PpNCED1, PpNCED2 and PpCYP707A1 at the transcriptional level. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  11. Cadmium-induced ethylene production and responses in Arabidopsis thaliana rely on ACS2 and ACS6 gene expression

    PubMed Central

    2014-01-01

    Background Anthropogenic activities cause metal pollution worldwide. Plants can absorb and accumulate these metals through their root system, inducing stress as a result of excess metal concentrations inside the plant. Ethylene is a regulator of multiple plant processes, and is affected by many biotic and abiotic stresses. Increased ethylene levels have been observed after exposure to excess metals but it remains unclear how the increased ethylene levels are achieved at the molecular level. In this study, the effects of cadmium (Cd) exposure on the production of ethylene and its precursor 1-aminocyclopropane-1-carboxylic acid (ACC), and on the expression of the ACC Synthase (ACS) and ACC Oxidase (ACO) multigene families were investigated in Arabidopsis thaliana. Results Increased ethylene release after Cd exposure was directly measurable in a system using rockwool-cultivated plants; enhanced levels of the ethylene precursor ACC together with higher mRNA levels of ethylene responsive genes: ACO2, ETR2 and ERF1 also indicated increased ethylene production in hydroponic culture. Regarding underlying mechanisms, it was found that the transcript levels of ACO2 and ACO4, the most abundantly expressed members of the ACO multigene family, were increased upon Cd exposure. ACC synthesis is the rate-limiting step in ethylene biosynthesis, and transcript levels of both ACS2 and ACS6 showed the highest increase and became the most abundant isoforms after Cd exposure, suggesting their importance in the Cd-induced increase of ethylene production. Conclusions Cadmium induced the biosynthesis of ACC and ethylene in Arabidopsis thaliana plants mainly via the increased expression of ACS2 and ACS6. This was confirmed in the acs2-1acs6-1 double knockout mutants, which showed a decreased ethylene production, positively affecting leaf biomass and resulting in a delayed induction of ethylene responsive gene expressions without significant differences in Cd contents between wild-type and

  12. A New Transgenic Mouse Model for Studying the Neurotoxicity of Spermine Oxidase Dosage in the Response to Excitotoxic Injury

    PubMed Central

    Cervelli, Manuela; Bellavia, Gabriella; D'Amelio, Marcello; Cavallucci, Virve; Moreno, Sandra; Berger, Joachim; Nardacci, Roberta; Marcoli, Manuela; Maura, Guido; Piacentini, Mauro; Amendola, Roberto; Cecconi, Francesco; Mariottini, Paolo

    2013-01-01

    Spermine oxidase is a FAD-containing enzyme involved in polyamines catabolism, selectively oxidizing spermine to produce H2O2, spermidine, and 3-aminopropanal. Spermine oxidase is highly expressed in the mouse brain and plays a key role in regulating the levels of spermine, which is involved in protein synthesis, cell division and cell growth. Spermine is normally released by neurons at synaptic sites where it exerts a neuromodulatory function, by specifically interacting with different types of ion channels, and with ionotropic glutamate receptors. In order to get an insight into the neurobiological roles of spermine oxidase and spermine, we have deregulated spermine oxidase gene expression producing and characterizing the transgenic mouse model JoSMOrec, conditionally overexpressing the enzyme in the neocortex. We have investigated the effects of spermine oxidase overexpression in the mouse neocortex by transcript accumulation, immunohistochemical analysis, enzymatic assays and polyamine content in young and aged animals. Transgenic JoSMOrec mice showed in the neocortex a higher H2O2 production in respect to Wild-Type controls, indicating an increase of oxidative stress due to SMO overexpression. Moreover, the response of transgenic mice to excitotoxic brain injury, induced by kainic acid injection, was evaluated by analysing the behavioural phenotype, the immunodistribution of neural cell populations, and the ultrastructural features of neocortical neurons. Spermine oxidase overexpression and the consequently altered polyamine levels in the neocortex affects the cytoarchitecture in the adult and aging brain, as well as after neurotoxic insult. It resulted that the transgenic JoSMOrec mouse line is more sensitive to KA than Wild-Type mice, indicating an important role of spermine oxidase during excitotoxicity. These results provide novel evidences of the complex and critical functions carried out by spermine oxidase and spermine in the mammalian brain. PMID

  13. Targeting NADPH oxidases in vascular pharmacology

    PubMed Central

    Schramm, Agata; Matusik, Paweł; Osmenda, Grzegorz; Guzik, Tomasz J

    2012-01-01

    Oxidative stress is a molecular dysregulation in reactive oxygen species (ROS) metabolism, which plays a key role in the pathogenesis of atherosclerosis, vascular inflammation and endothelial dysfunction. It is characterized by a loss of nitric oxide (NO) bioavailability. Large clinical trials such as HOPE and HPS have not shown a clinical benefit of antioxidant vitamin C or vitamin E treatment, putting into question the role of oxidative stress in cardiovascular disease. A change in the understanding of the molecular nature of oxidative stress has been driven by the results of these trials. Oxidative stress is no longer perceived as a simple imbalance between the production and scavenging of ROS, but as a dysfunction of enzymes involved in ROS production. NADPH oxidases are at the center of these events, underlying the dysfunction of other oxidases including eNOS uncoupling, xanthine oxidase and mitochondrial dysfunction. Thus NADPH oxidases are important therapeutic targets. Indeed, HMG-CoA reductase inhibitors (statins) as well as drugs interfering with the renin-angiotensin-aldosterone system inhibit NADPH oxidase activation and expression. Angiotensin-converting enzyme (ACE) inhibitors, AT1 receptor antagonists (sartans) and aliskiren, as well as spironolactone or eplerenone, have been discussed. Molecular aspects of NADPH oxidase regulation must be considered, while thinking about novel pharmacological targeting of this family of enzymes consisting of several homologs Nox1, Nox2, Nox3, Nox4 and Nox5 in humans. In order to properly design trials of antioxidant therapies, we must develop reliable techniques for the assessment of local and systemic oxidative stress. Classical antioxidants could be combined with novel oxidase inhibitors. In this review, we discuss NADPH oxidase inhibitors such as VAS2870, VAS3947, GK-136901, S17834 or plumbagin. Therefore, our efforts must focus on generating small molecular weight inhibitors of NADPH oxidases, allowing the

  14. Design and optimization of a portable LQCD Monte Carlo code using OpenACC

    NASA Astrophysics Data System (ADS)

    Bonati, Claudio; Coscetti, Simone; D'Elia, Massimo; Mesiti, Michele; Negro, Francesco; Calore, Enrico; Schifano, Sebastiano Fabio; Silvi, Giorgio; Tripiccione, Raffaele

    The present panorama of HPC architectures is extremely heterogeneous, ranging from traditional multi-core CPU processors, supporting a wide class of applications but delivering moderate computing performance, to many-core Graphics Processor Units (GPUs), exploiting aggressive data-parallelism and delivering higher performances for streaming computing applications. In this scenario, code portability (and performance portability) become necessary for easy maintainability of applications; this is very relevant in scientific computing where code changes are very frequent, making it tedious and prone to error to keep different code versions aligned. In this work, we present the design and optimization of a state-of-the-art production-level LQCD Monte Carlo application, using the directive-based OpenACC programming model. OpenACC abstracts parallel programming to a descriptive level, relieving programmers from specifying how codes should be mapped onto the target architecture. We describe the implementation of a code fully written in OpenAcc, and show that we are able to target several different architectures, including state-of-the-art traditional CPUs and GPUs, with the same code. We also measure performance, evaluating the computing efficiency of our OpenACC code on several architectures, comparing with GPU-specific implementations and showing that a good level of performance-portability can be reached.

  15. New insights into the roles of NADPH oxidases in sexual development and ascospore germination in Sordaria macrospora.

    PubMed

    Dirschnabel, Daniela Elisabeth; Nowrousian, Minou; Cano-Domínguez, Nallely; Aguirre, Jesus; Teichert, Ines; Kück, Ulrich

    2014-03-01

    NADPH oxidase (NOX)-derived reactive oxygen species (ROS) act as signaling determinants that induce different cellular processes. To characterize NOX function during fungal development, we utilized the genetically tractable ascomycete Sordaria macrospora. Genome sequencing of a sterile mutant led us to identify the NADPH oxidase encoding nox1 as a gene required for fruiting body formation, regular hyphal growth, and hyphal fusion. These phenotypes are shared by nor1, lacking the NOX regulator NOR1. Further phenotypic analyses revealed a high correlation between increased ROS production and hyphal fusion deficiencies in nox1 and other sterile mutants. A genome-wide transcriptional profiling analysis of mycelia and isolated protoperithecia from wild type and nox1 revealed that nox1 inactivation affects the expression of genes related to cytoskeleton remodeling, hyphal fusion, metabolism, and mitochondrial respiration. Genetic analysis of nox2, lacking the NADPH oxidase 2 gene, nor1, and transcription factor deletion mutant ste12, revealed a strict melanin-dependent ascospore germination defect, indicating a common genetic pathway for these three genes. We report that gsa3, encoding a G-protein α-subunit, and sac1, encoding cAMP-generating adenylate cyclase, act in a separate pathway during the germination process. The finding that cAMP inhibits ascospore germination in a melanin-dependent manner supports a model in which cAMP inhibits NOX2 activity, thus suggesting a link between both pathways. Our results expand the current knowledge on the role of NOX enzymes in fungal development and provide a frame to define upstream and downstream components of the NOX signaling pathways in fungi.

  16. Sulcal Polymorphisms of the IFC and ACC Contribute to Inhibitory Control Variability in Children and Adults

    PubMed Central

    Linzarini, Adriano; Dollfus, Sonia; Etard, Olivier; Orliac, François; Houdé, Olivier

    2018-01-01

    Abstract Inhibitory control (IC) is a core executive function that enables humans to resist habits, temptations, or distractions. IC efficiency in childhood is a strong predictor of academic and professional success later in life. Based on analysis of the sulcal pattern, a qualitative feature of cortex anatomy determined during fetal life and stable during development, we searched for evidence that interindividual differences in IC partly trace back to prenatal processes. Using anatomical magnetic resonance imaging (MRI), we analyzed the sulcal pattern of two key regions of the IC neural network, the dorsal anterior cingulate cortex (ACC) and the inferior frontal cortex (IFC), which limits the inferior frontal gyrus. We found that the sulcal pattern asymmetry of both the ACC and IFC contributes to IC (Stroop score) in children and adults: participants with asymmetrical ACC or IFC sulcal patterns had better IC efficiency than participants with symmetrical ACC or IFC sulcal patterns. Such additive effects of IFC and ACC sulcal patterns on IC efficiency suggest that distinct early neurodevelopmental mechanisms targeting different brain regions likely contribute to IC efficiency. This view shares some analogies with the “common variant–small effect” model in genetics, which states that frequent genetic polymorphisms have small effects but collectively account for a large portion of the variance. Similarly, each sulcal polymorphism has a small but additive effect: IFC and ACC sulcal patterns, respectively, explained 3% and 14% of the variance of the Stroop interference scores. PMID:29527565

  17. Sulcal Polymorphisms of the IFC and ACC Contribute to Inhibitory Control Variability in Children and Adults.

    PubMed

    Tissier, Cloélia; Linzarini, Adriano; Allaire-Duquette, Geneviève; Mevel, Katell; Poirel, Nicolas; Dollfus, Sonia; Etard, Olivier; Orliac, François; Peyrin, Carole; Charron, Sylvain; Raznahan, Armin; Houdé, Olivier; Borst, Grégoire; Cachia, Arnaud

    2018-01-01

    Inhibitory control (IC) is a core executive function that enables humans to resist habits, temptations, or distractions. IC efficiency in childhood is a strong predictor of academic and professional success later in life. Based on analysis of the sulcal pattern, a qualitative feature of cortex anatomy determined during fetal life and stable during development, we searched for evidence that interindividual differences in IC partly trace back to prenatal processes. Using anatomical magnetic resonance imaging (MRI), we analyzed the sulcal pattern of two key regions of the IC neural network, the dorsal anterior cingulate cortex (ACC) and the inferior frontal cortex (IFC), which limits the inferior frontal gyrus. We found that the sulcal pattern asymmetry of both the ACC and IFC contributes to IC (Stroop score) in children and adults: participants with asymmetrical ACC or IFC sulcal patterns had better IC efficiency than participants with symmetrical ACC or IFC sulcal patterns. Such additive effects of IFC and ACC sulcal patterns on IC efficiency suggest that distinct early neurodevelopmental mechanisms targeting different brain regions likely contribute to IC efficiency. This view shares some analogies with the "common variant-small effect" model in genetics, which states that frequent genetic polymorphisms have small effects but collectively account for a large portion of the variance. Similarly, each sulcal polymorphism has a small but additive effect: IFC and ACC sulcal patterns, respectively, explained 3% and 14% of the variance of the Stroop interference scores.

  18. Isolated sulfite oxidase deficiency.

    PubMed

    Rupar, C A; Gillett, J; Gordon, B A; Ramsay, D A; Johnson, J L; Garrett, R M; Rajagopalan, K V; Jung, J H; Bacheyie, G S; Sellers, A R

    1996-12-01

    Isolated sulfite oxidase (SO) deficiency is an autosomal recessively inherited inborn error of sulfur metabolism. In this report of a ninth patient the clinical history, laboratory results, neuropathological findings and a mutation in the sulfite oxidase gene are described. The data from this patient and previously published patients with isolated sulfite oxidase deficiency and molybdenum cofactor deficiency are summarized to characterize this rare disorder. The patient presented neonatally with intractable seizures and did not progress developmentally beyond the neonatal stage. Dislocated lenses were apparent at 2 months. There was increased urine excretion of sulfite and S-sulfocysteine and a decreased concentration of plasma cystine. A lactic acidemia was present for 6 months. Liver sulfite oxidase activity was not detectable but xanthine dehydrogenase activity was normal. The boy died of respiratory failure at 32 months. Neuropathological findings of cortical necrosis and extensive cavitating leukoencephalopathy were reminiscent of those seen in severe perinatal asphyxia suggesting an etiology of energy deficiency. A point mutation that resulted in a truncated protein missing the molybdenum-binding site has been identified.

  19. The GA5 locus of Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: Molecular cloning and functional expression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xu, Yun-Ling; Li, Li; Wu, Keqiang

    1995-07-03

    The biosynthesis of gibberellins (GAs) after GA{sub 12}-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidasemore » gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA{sub 53} to GA{sub 44} and GA{sub 19} to GA{sub 20}. The Arabidopsis GA 20-oxidase shares 55% identity and >80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA locus of Arabidopsis. The ga5 semidwarf mutant contains a G {yields} A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Arabidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA{sub 4} treatment, suggesting end-product repression in the GA biosynthetic pathway. 28 refs., 6

  20. Potential US Population Impact of the 2017 ACC/AHA High Blood Pressure Guideline.

    PubMed

    Muntner, Paul; Carey, Robert M; Gidding, Samuel; Jones, Daniel W; Taler, Sandra J; Wright, Jackson T; Whelton, Paul K

    2018-01-09

    The 2017 American College of Cardiology/American Heart Association (ACC/AHA) Guideline for the Prevention, Detection, Evaluation and Management of High Blood Pressure in Adults provides recommendations for the definition of hypertension, systolic and diastolic blood pressure (BP) thresholds for initiation of antihypertensive medication, and BP target goals. This study sought to determine the prevalence of hypertension, implications of recommendations for antihypertensive medication, and prevalence of BP above the treatment goal among US adults using criteria from the 2017 ACC/AHA guideline and the Seventh Report of the Joint National Committee on Prevention, Detection, Evaluation, and Treatment of High Blood Pressure (JNC7). The authors analyzed data from the 2011 to 2014 National Health and Nutrition Examination Survey (N = 9 623). BP was measured 3 times following a standardized protocol and averaged. Results were weighted to produce US population estimates. According to the 2017 ACC/AHA and JNC7 guidelines, the crude prevalence of hypertension among US adults was 45.6% (95% confidence interval [CI]: 43.6% to 47.6%) and 31.9% (95% CI: 30.1% to 33.7%), respectively, and antihypertensive medication was recommended for 36.2% (95% CI: 34.2% to 38.2%) and 34.3% (95% CI: 32.5% to 36.2%) of US adults, respectively. Nonpharmacological intervention is advised for the 9.4% of US adults with hypertension who are not recommended for antihypertensive medication according to the 2017 ACC/AHA guideline. Among US adults taking antihypertensive medication, 53.4% (95% CI: 49.9% to 56.8%) and 39.0% (95% CI: 36.4% to 41.6%) had BP above the treatment goal according to the 2017 ACC/AHA and JNC7 guidelines, respectively. Compared with the JNC7 guideline, the 2017 ACC/AHA guideline results in a substantial increase in the prevalence of hypertension, a small increase in the percentage of US adults recommended for antihypertensive medication, and more intensive BP lowering for many

  1. Hypoxia-Inducible Factor 1-Regulated Lysyl Oxidase Is Involved in Staphylococcus aureus Abscess Formation

    PubMed Central

    Beerlage, Christiane; Greb, Jessica; Kretschmer, Dorothee; Assaggaf, Mohammad; Trackman, Philip C.; Hansmann, Martin-Leo; Bonin, Michael; Eble, Johannes A.; Peschel, Andreas; Brüne, Bernhard

    2013-01-01

    Hypoxia-inducible factor 1 (HIF-1) is the key transcription factor involved in the adaptation of mammals to hypoxia and plays a crucial role in cancer angiogenesis. Recent evidence suggests a leading role for HIF-1 in various inflammatory and infectious diseases. Here we describe the role of HIF-1 in Staphylococcus aureus infections by investigating the HIF-1-dependent host cell response. For this purpose, transcriptional profiling of HIF-1α-deficient HepG2 and control cells, both infected with Staphylococcus aureus, was performed. Four hours after infection, the expression of 190 genes, 24 of which were regulated via HIF-1, was influenced. LOX (encoding lysyl oxidase) was one of the upregulated genes with a potential impact on the course of S. aureus infection. LOX is an amine oxidase required for biosynthetic cross-linking of extracellular matrix components. LOX was upregulated in vitro in different cell cultures infected with S. aureus and also in vivo, in kidney abscesses of mice intravenously infected with S. aureus and in clinical skin samples from patients with S. aureus infections. Inhibition of LOX by β-aminopropionitrile (BAPN) did not affect the bacterial load in kidneys or blood but significantly influenced abscess morphology and collagenization. Our data provide evidence for a crucial role of HIF-1-regulated LOX in abscess formation. PMID:23649089

  2. NADPH Oxidases in Vascular Pathology

    PubMed Central

    Konior, Anna; Schramm, Agata; Czesnikiewicz-Guzik, Marta

    2014-01-01

    Abstract Significance: Reactive oxygen species (ROS) play a critical role in vascular disease. While there are many possible sources of ROS, nicotinamide adenine dinucleotide phosphate (NADPH) oxidases play a central role. They are a source of “kindling radicals,” which affect other enzymes, such as nitric oxide synthase endothelial nitric oxide synthase or xanthine oxidase. This is important, as risk factors for atherosclerosis (hypertension, diabetes, hypercholesterolemia, and smoking) regulate the expression and activity of NADPH oxidases in the vessel wall. Recent Advances: There are seven isoforms in mammals: Nox1, Nox2, Nox3, Nox4, Nox5, Duox1 and Duox2. Nox1, Nox2, Nox4, and Nox5 are expressed in endothelium, vascular smooth muscle cells, fibroblasts, or perivascular adipocytes. Other homologues have not been found or are expressed at very low levels; their roles have not been established. Nox1/Nox2 promote the development of endothelial dysfunction, hypertension, and inflammation. Nox4 may have a role in protecting the vasculature during stress; however, when its activity is increased, it may be detrimental. Calcium-dependent Nox5 has been implicated in oxidative damage in human atherosclerosis. Critical Issues: NADPH oxidase-derived ROS play a role in vascular pathology as well as in the maintenance of normal physiological vascular function. We also discuss recently elucidated mechanisms such as the role of NADPH oxidases in vascular protection, vascular inflammation, pulmonary hypertension, tumor angiogenesis, and central nervous system regulation of vascular function and hypertension. Future Directions: Understanding the role of individual oxidases and interactions between homologues in vascular disease is critical for efficient pharmacological regulation of vascular NADPH oxidases in both the laboratory and clinical practice. Antioxid. Redox Signal. 20, 2794–2814. PMID:24180474

  3. Influence of Magnesium Content on the Local Structure of Amorphous Calcium Carbonate (ACC): Real Time Determination by In Situ PDF Analysis

    NASA Astrophysics Data System (ADS)

    Mergelsberg, S. T.; Ulrich, R. N.; Michel, F. M.; Dove, P. M.

    2016-12-01

    Calcium carbonate minerals are an essential component in the exoskeletons of crustaceans and mollusks. The onset of exoskeleton mineralization includes the precipitation of amorphous calcium carbonate (ACC) as a reactive intermediate that later transforms to produce diverse structures. Despite the importance of ACC as a critical phase during skeleton formation, the chemical and physical properties are not well characterized at conditions that approximate biological environments. Of particular interest are the solubility of ACC, the short-range structure at the time of formation, and the evolution of ACC structure to final products. Recent advances showing the widespread occurrence of multistep pathways to mineralization in biological and geological settings (De Yoreo et al., 2015) underline the importance of understanding amorphous intermediates. Using quantitative laboratory techniques developed by our research group (Blue et al., 2013; Blue and Dove, 2015; Blue et al., in press), this experimental study quantifies the solubility of ACC in parallel with the physical characterization of the corresponding structure. We measured ACC solubility at specific time points during the precipitation and during its subsequent evolution under the mild pH conditions that approximate biological and environmental conditions. In parallel experiments, structural data were collected from in situ pair distribution function (PDF) analyses were conducted to follow the evolution of individual samples from initial precipitation to final product. The measurements are leading to a quantitative solubility function for ACC with variable Mg contents and an x-ray based understanding of ACC structure in the same particles. We are also finding temporal changes in the short-range order of ACC after precipitation and this order is dependent upon Mg content. Moreover, the data show Mg distribution through the ACC particles is dependent upon total alkalinity. Insights from this study hold promise

  4. Representation of cardiovascular magnetic resonance in the AHA / ACC guidelines.

    PubMed

    von Knobelsdorff-Brenkenhoff, Florian; Pilz, Guenter; Schulz-Menger, Jeanette

    2017-09-25

    Whereas evidence supporting the diagnostic value of cardiovascular magnetic resonance (CMR) has increased, there exists significant worldwide variability in the clinical utilization of CMR. A recent study demonstrated that CMR is represented in the majority of European Society for Cardiology (ESC) guidelines, with a large number of specific recommendations in particular regarding coronary artery disease. To further investigate the gap between the evidence and clinical use of CMR, this study analyzed the role of CMR in the guidelines of the American College of Cardiology (ACC) and American Heart Association (AHA). Twenty-four AHA/ACC original guidelines, updates and new editions, published between 2006 and 2017, were screened for the terms "magnetic", "MRI", "CMR", "MR" and "imaging". Non-cardiovascular MR examinations were excluded. All CMR-related paragraphs and specific recommendations for CMR including the level of evidence (A, B, C) and the class of recommendation (I, IIa, IIb, III) were extracted. Twelve of the 24 guidelines (50.0%) contain specific recommendations regarding CMR. Four guidelines (16.7%) mention CMR in the text only, and 8 (33.3%) do not mention CMR. The 12 guidelines with recommendations for CMR contain in total 65 specific recommendations (31 class-I, 23 class-IIa, 6 class-IIb, 5 class-III). Most recommendations have evidence level C (44/65; 67.7%), followed by level B (21/65; 32.3%). There are no level A recommendations. 22/65 recommendations refer to vascular imaging, 17 to congenital heart disease, 8 to cardiomyopathies, 8 to myocardial stress testing, 5 to left and right ventricular function, 3 to viability, and 2 to valvular heart disease. CMR is represented in two thirds of the AHA/ACC guidelines, which contain a number of specific recommendations for the use of CMR. In a simplified comparison with the ESC guidelines, CMR is less represented in the AHA/ACC guidelines in particular in the field of coronary artery disease.

  5. 24 CFR 982.102 - Allocation of budget authority for renewal of expiring consolidated ACC funding increments.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... renewal of expiring consolidated ACC funding increments. 982.102 Section 982.102 Housing and Urban... ASSISTANCE: HOUSING CHOICE VOUCHER PROGRAM Funding and PHA Application for Funding § 982.102 Allocation of budget authority for renewal of expiring consolidated ACC funding increments. (a) Applicability. This...

  6. 24 CFR 982.102 - Allocation of budget authority for renewal of expiring consolidated ACC funding increments.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... renewal of expiring consolidated ACC funding increments. 982.102 Section 982.102 Housing and Urban... ASSISTANCE: HOUSING CHOICE VOUCHER PROGRAM Funding and PHA Application for Funding § 982.102 Allocation of budget authority for renewal of expiring consolidated ACC funding increments. (a) Applicability. This...

  7. 24 CFR 982.102 - Allocation of budget authority for renewal of expiring consolidated ACC funding increments.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... renewal of expiring consolidated ACC funding increments. 982.102 Section 982.102 Housing and Urban... ASSISTANCE: HOUSING CHOICE VOUCHER PROGRAM Funding and PHA Application for Funding § 982.102 Allocation of budget authority for renewal of expiring consolidated ACC funding increments. (a) Applicability. This...

  8. 24 CFR 982.102 - Allocation of budget authority for renewal of expiring consolidated ACC funding increments.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... renewal of expiring consolidated ACC funding increments. 982.102 Section 982.102 Housing and Urban... ASSISTANCE: HOUSING CHOICE VOUCHER PROGRAM Funding and PHA Application for Funding § 982.102 Allocation of budget authority for renewal of expiring consolidated ACC funding increments. (a) Applicability. This...

  9. 24 CFR 982.102 - Allocation of budget authority for renewal of expiring consolidated ACC funding increments.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... renewal of expiring consolidated ACC funding increments. 982.102 Section 982.102 Housing and Urban... ASSISTANCE: HOUSING CHOICE VOUCHER PROGRAM Funding and PHA Application for Funding § 982.102 Allocation of budget authority for renewal of expiring consolidated ACC funding increments. (a) Applicability. This...

  10. ACCE/ACS National Educator and Leader of the Year Winners: AEC Congratulates These Outstanding Educators

    ERIC Educational Resources Information Center

    Australian Educational Computing, 2012

    2012-01-01

    This article presents the ACCE/ACS National Educator and Leader of the Year winners. Anne Mirtschin is the recipient of the ACCE/ACS 2012 Educator of the Year Award. Mirtschin is an innovative teacher at Hawkesdale P-12 College a small rural school that is isolated culturally and geographically. She uses online tools and technology to create…

  11. Lysyl Oxidase-like-2 (LOXL2) Is a Major Isoform in Chondrocytes and Is Critically Required for Differentiation*

    PubMed Central

    Iftikhar, Mussadiq; Hurtado, Paola; Bais, Manish V.; Wigner, Nate; Stephens, Danielle N.; Gerstenfeld, Louis C.; Trackman, Philip C.

    2011-01-01

    The lysyl oxidase family is made up of five members: lysyl oxidase (LOX) and lysyl oxidase-like 1–4 (LOXL1-LOXL4). All members share conserved C-terminal catalytic domains that provide for lysyl oxidase or lysyl oxidase-like enzyme activity; and more divergent propeptide regions. LOX family enzyme activities catalyze the final enzymatic conversion required for the formation of normal biosynthetic collagen and elastin cross-links. The importance of lysyl oxidase enzyme activity to normal bone development has long been appreciated, but regulation and roles for specific LOX isoforms in bone formation in vivo is largely unexplored. Fracture healing recapitulates aspects of endochondral bone development. The present study first investigated the expression of all LOX isoforms in fracture healing. A remarkable coincidence of LOXL2 expression with the chondrogenic phase of fracture healing was found, prompting more detailed analyses of LOXL2 expression in normal growth plates, and LOXL2 expression and function in developing ATDC5 chondrogenic cells. Data show that LOXL2 is expressed by pre-hypertrophic and hypertrophic chondrocytes in vivo, and that LOXL2 expression is regulated in vitro as a function of chondrocyte differentiation. Moreover, LOXL2 knockdown studies in vitro show that LOXL2 expression is required for ATDC5 chondrocyte cell line differentiation through regulation of SNAIL and SOX9, important transcription factors that control chondrocyte differentiation. Taken together, data provide evidence that LOXL2, like LOX, is a multifunctional protein. LOXL2 promotes chondrocyte differentiation by mechanisms that are likely to include roles as both a regulator and an effector of chondrocyte differentiation. PMID:21071451

  12. Identification of vimentin- and elastin-like transcripts specifically expressed in developing notochord of Atlantic salmon (Salmo salar L.).

    PubMed

    Sagstad, Anita; Grotmol, Sindre; Kryvi, Harald; Krossøy, Christel; Totland, Geir K; Malde, Ketil; Wang, Shou; Hansen, Tom; Wargelius, Anna

    2011-11-01

    The notochord functions as the midline structural element of all vertebrate embryos, and allows movement and growth at early developmental stages. Moreover, during embryonic development, notochord cells produce secreted factors that provide positional and fate information to a broad variety of cells within adjacent tissues, for instance those of the vertebrae, central nervous system and somites. Due to the large size of the embryo, the salmon notochord is useful to study as a model for exploring notochord development. To investigate factors that might be involved in notochord development, a normalized cDNA library was constructed from a mix of notochords from ∼500 to ∼800 day°. From the 1968 Sanger-sequenced transcripts, 22 genes were identified to be predominantly expressed in the notochord compared to other organs of salmon. Twelve of these genes were found to show expressional regulation around mineralization of the notochord sheath; 11 genes were up-regulated and one gene was down-regulated. Two genes were found to be specifically expressed in the notochord; these genes showed similarity to vimentin (acc. no GT297094) and elastin (acc. no GT297478). In-situ results showed that the vimentin- like transcript was expressed in both chordocytes and chordoblasts, whereas the elastin- like transcript was uniquely expressed in the chordoblasts lining the notochordal sheath. In salmon aquaculture, vertebral deformities are a common problem, and some malformations have been linked to the notochord. The expression of identified transcripts provides further insight into processes taking place in the developing notochord, prior to and during the early mineralization period.

  13. Alternative Oxidase Transcription Factors AOD2 and AOD5 of Neurospora crassa Control the Expression of Genes Involved in Energy Production and Metabolism.

    PubMed

    Qi, Zhigang; Smith, Kristina M; Bredeweg, Erin L; Bosnjak, Natasa; Freitag, Michael; Nargang, Frank E

    2017-02-09

    In Neurospora crassa , blocking the function of the standard mitochondrial electron transport chain results in the induction of an alternative oxidase (AOX). AOX transfers electrons directly from ubiquinol to molecular oxygen. AOX serves as a model of retrograde regulation since it is encoded by a nuclear gene that is regulated in response to signals from mitochondria. The N. crassa transcription factors AOD2 and AOD5 are necessary for the expression of the AOX gene. To gain insight into the mechanism by which these factors function, and to determine if they have roles in the expression of additional genes in N. crassa , we constructed strains expressing only tagged versions of the proteins. Cell fractionation experiments showed that both proteins are localized to the nucleus under both AOX inducing and noninducing conditions. Furthermore, chromatin immunoprecipitation and high throughput sequencing (ChIP-seq) analysis revealed that the proteins are bound to the promoter region of the AOX gene under both conditions. ChIP-seq also showed that the transcription factors bind to the upstream regions of a number of genes that are involved in energy production and metabolism. Dependence on AOD2 and AOD5 for the expression of several of these genes was verified by quantitative PCR. The majority of ChIP-seq peaks observed were enriched for both AOD2 and AOD5. However, we also observed occasional sites where one factor appeared to bind preferentially. The most striking of these was a conserved sequence that bound large amounts of AOD2 but little AOD5. This sequence was found within a 310 bp repeat unit that occurs at several locations in the genome. Copyright © 2017 Qi et al.

  14. Development of an EMG-ACC-Based Upper Limb Rehabilitation Training System.

    PubMed

    Ling Liu; Xiang Chen; Zhiyuan Lu; Shuai Cao; De Wu; Xu Zhang

    2017-03-01

    This paper focuses on the development of an upper limb rehabilitation training system designed for use by children with cerebral palsy (CP). It attempts to meet the requirements of in-home training by taking advantage of the combination of portable accelerometers (ACC) and surface electromyography (SEMG) sensors worn on the upper limb to capture functional movements. In the proposed system, the EMG-ACC acquisition device works essentially as wireless game controller, and three rehabilitation games were designed for improving upper limb motor function under a clinician's guidance. The games were developed on the Android platform based on a physical engine called Box2D. The results of a system performance test demonstrated that the developed games can respond to the upper limb actions within 210 ms. Positive questionnaire feedbacks from twenty CP subjects who participated in the game test verified both the feasibility and usability of the system. Results of a long-term game training conducted with three CP subjects demonstrated that CP patients could improve in their game performance through repetitive training, and persistent training was needed to improve and enhance the rehabilitation effect. According to our experimental results, the novel multi-feedback SEMG-ACC-based user interface improved the users' initiative and performance in rehabilitation training.

  15. Characterization of a Flavoprotein Oxidase from Opium Poppy Catalyzing the Final Steps in Sanguinarine and Papaverine Biosynthesis*

    PubMed Central

    Hagel, Jillian M.; Beaudoin, Guillaume A. W.; Fossati, Elena; Ekins, Andrew; Martin, Vincent J. J.; Facchini, Peter J.

    2012-01-01

    Benzylisoquinoline alkaloids are a diverse class of plant specialized metabolites that includes the analgesic morphine, the antimicrobials sanguinarine and berberine, and the vasodilator papaverine. The two-electron oxidation of dihydrosanguinarine catalyzed by dihydrobenzophenanthridine oxidase (DBOX) is the final step in sanguinarine biosynthesis. The formation of the fully conjugated ring system in sanguinarine is similar to the four-electron oxidations of (S)-canadine to berberine and (S)-tetrahydropapaverine to papaverine. We report the isolation and functional characterization of an opium poppy (Papaver somniferum) cDNA encoding DBOX, a flavoprotein oxidase with homology to (S)-tetrahydroprotoberberine oxidase and the berberine bridge enzyme. A query of translated opium poppy stem transcriptome databases using berberine bridge enzyme yielded several candidate genes, including an (S)-tetrahydroprotoberberine oxidase-like sequence selected for heterologous expression in Pichia pastoris. The recombinant enzyme preferentially catalyzed the oxidation of dihydrosanguinarine to sanguinarine but also converted (RS)-tetrahydropapaverine to papaverine and several protoberberine alkaloids to oxidized forms, including (RS)-canadine to berberine. The Km values of 201 and 146 μm for dihydrosanguinarine and the protoberberine alkaloid (S)-scoulerine, respectively, suggested high concentrations of these substrates in the plant. Virus-induced gene silencing to reduce DBOX transcript levels resulted in a corresponding reduction in sanguinarine, dihydrosanguinarine, and papaverine accumulation in opium poppy roots in support of DBOX as a multifunctional oxidative enzyme in BIA metabolism. PMID:23118227

  16. New Insights Into the Roles of NADPH Oxidases in Sexual Development and Ascospore Germination in Sordaria macrospora

    PubMed Central

    Dirschnabel, Daniela Elisabeth; Nowrousian, Minou; Cano-Domínguez, Nallely; Aguirre, Jesus; Teichert, Ines; Kück, Ulrich

    2014-01-01

    NADPH oxidase (NOX)-derived reactive oxygen species (ROS) act as signaling determinants that induce different cellular processes. To characterize NOX function during fungal development, we utilized the genetically tractable ascomycete Sordaria macrospora. Genome sequencing of a sterile mutant led us to identify the NADPH oxidase encoding nox1 as a gene required for fruiting body formation, regular hyphal growth, and hyphal fusion. These phenotypes are shared by ∆nor1, lacking the NOX regulator NOR1. Further phenotypic analyses revealed a high correlation between increased ROS production and hyphal fusion deficiencies in ∆nox1 and other sterile mutants. A genome-wide transcriptional profiling analysis of mycelia and isolated protoperithecia from wild type and ∆nox1 revealed that nox1 inactivation affects the expression of genes related to cytoskeleton remodeling, hyphal fusion, metabolism, and mitochondrial respiration. Genetic analysis of ∆nox2, lacking the NADPH oxidase 2 gene, ∆nor1, and transcription factor deletion mutant ∆ste12, revealed a strict melanin-dependent ascospore germination defect, indicating a common genetic pathway for these three genes. We report that gsa3, encoding a G-protein α-subunit, and sac1, encoding cAMP-generating adenylate cyclase, act in a separate pathway during the germination process. The finding that cAMP inhibits ascospore germination in a melanin-dependent manner supports a model in which cAMP inhibits NOX2 activity, thus suggesting a link between both pathways. Our results expand the current knowledge on the role of NOX enzymes in fungal development and provide a frame to define upstream and downstream components of the NOX signaling pathways in fungi. PMID:24407906

  17. SPERMINE OXIDASE: AN AMINE OXIDASE WITH SPECIFICITY FOR SPERMINE AND SPERMIDINE

    PubMed Central

    Hirsch, James G.

    1953-01-01

    Sheep serum and bovine serum contain an enzyme which brings about a rapid oxidative deamination of certain biological amines. This enzyme differs from previously described amine oxidases in several regards and especially in its substrate specificity. Studies thus far indicate that only spermine and the closely related compound spermidine serve as substrates for the enzyme in sheep serum. For this reason, the enzyme has been named spermine oxidase. Spermine oxidase is active in a variety of fluids of various ionic strength and buffer composition. The reaction takes place between pH 6.0 and pH 8.0 with an optimal rate in the vicinity of neutrality. Under certain conditions, the rate of oxygen consumption during the initial phase of the reaction is independent of the concentration of substrate. The diminution in rate observed during the latter phase of the enzymatic attack appears to be due to an alteration in the kinetics at low concentrations of substrate, or to competitive inhibition by a product of the reaction. Carbonyl reagents almost completely block the action of spermine oxidase, while certain amines and the cyanide ion bring about partial inhibition. Thiol reagents and sequestering compounds do not alter the course of the oxidative process. In the presence of low concentrations of mercuric chloride, the sheep serum-spermine system consumes approximately twice as much oxygen as controls containing no mercuric ion. The mechanism by which the mercuric ion stimulates additional oxygen uptake is obscure. PMID:13052805

  18. Adipogenesis-related increase of semicarbazide-sensitive amine oxidase and monoamine oxidase in human adipocytes.

    PubMed

    Bour, Sandy; Daviaud, Danièle; Gres, Sandra; Lefort, Corinne; Prévot, Danielle; Zorzano, Antonio; Wabitsch, Martin; Saulnier-Blache, Jean-Sébastien; Valet, Philippe; Carpéné, Christian

    2007-08-01

    A strong induction of semicarbazide-sensitive amine oxidase (SSAO) has previously been reported during murine preadipocyte lineage differentiation but it remains unknown whether this emergence also occurs during adipogenesis in man. Our aim was to compare SSAO and monoamine oxidase (MAO) expression during in vitro differentiation of human preadipocytes and in adipose and stroma-vascular fractions of human fat depots. A human preadipocyte cell strain from a patient with Simpson-Golabi-Behmel syndrome was first used to follow amine oxidase expression during in vitro differentiation. Then, human preadipocytes isolated from subcutaneous adipose tissues were cultured under conditions promoting ex vivo adipose differentiation and tested for MAO and SSAO expression. Lastly, human adipose tissue was separated into mature adipocyte and stroma-vascular fractions for analyses of MAO and SSAO at mRNA, protein and activity levels. Both SSAO and MAO were increased from undifferentiated preadipocytes to lipid-laden cells in all the models: 3T3-F442A and 3T3-L1 murine lineages, human SGBS cell strain or human preadipocytes in primary culture. In human subcutaneous adipose tissue, the adipocyte-enriched fraction exhibited seven-fold higher amine oxidase activity and contained three- to seven-fold higher levels of mRNAs encoded by MAO-A, MAO-B, AOC3 and AOC2 genes than the stroma-vascular fraction. MAO-A and AOC3 genes accounted for the majority of their respective MAO and SSAO activities in human adipose tissue. Most of the SSAO and MAO found in adipose tissue originated from mature adipocytes. Although the mechanism and role of adipogenesis-related increase in amine oxidase expression remain to be established, the resulting elevated levels of amine oxidase activities found in human adipocytes may be of potential interest for therapeutic intervention in obesity.

  19. RHON1 mediates a Rho-like activity for transcription termination in plastids of Arabidopsis thaliana.

    PubMed

    Chi, Wei; He, Baoye; Manavski, Nikolay; Mao, Juan; Ji, Daili; Lu, Congming; Rochaix, Jean David; Meurer, Jörg; Zhang, Lixin

    2014-12-01

    Although transcription termination is essential to generate functional RNAs, its underlying molecular mechanisms are still poorly understood in plastids of vascular plants. Here, we show that the RNA binding protein RHON1 participates in transcriptional termination of rbcL (encoding large subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase) in Arabidopsis thaliana. Inactivation of RHON1 leads to enhanced rbcL read-through transcription and to aberrant accD (encoding β-subunit of the acetyl-CoA carboxylase) transcriptional initiation, which may result from inefficient transcription termination of rbcL. RHON1 can bind to the mRNA as well as to single-stranded DNA of rbcL, displays an RNA-dependent ATPase activity, and terminates transcription of rbcL in vitro. These results suggest that RHON1 terminates rbcL transcription using an ATP-driven mechanism similar to that of Rho of Escherichia coli. This RHON1-dependent transcription termination occurs in Arabidopsis but not in rice (Oryza sativa) and appears to reflect a fundamental difference between plastomes of dicotyledonous and monocotyledonous plants. Our results point to the importance and significance of plastid transcription termination and provide insights into its machinery in an evolutionary context. © 2014 American Society of Plant Biologists. All rights reserved.

  20. Various applications of immobilized glucose oxidase and polyphenol oxidase in a conducting polymer matrix.

    PubMed

    Cil, M; Böyükbayram, A E; Kiralp, S; Toppare, L; Yağci, Y

    2007-06-01

    In this study, glucose oxidase and polyphenol oxidase were immobilized in conducting polymer matrices; polypyrrole and poly(N-(4-(3-thienyl methylene)-oxycarbonyl phenyl) maleimide-co-pyrrole) via electrochemical method. Fourier transform infrared and scanning electron microscope were employed to characterize the copolymer of (N-(4-(3-thienyl methylene)-oxycarbonyl phenyl) maleimide) with pyrrole. Kinetic parameters, maximum reaction rate and Michealis-Menten constant, were determined. Effects of temperature and pH were examined for immobilized enzymes. Also, storage and operational stabilities of enzyme electrodes were investigated. Glucose and polyphenol oxidase enzyme electrodes were used for determination of the glucose amount in orange juices and human serum and phenolic amount in red wines, respectively.

  1. Engineered ACC deaminase-expressing free-living cells of Mesorhizobium loti show increased nodulation efficiency and competitiveness on Lotus spp.

    PubMed

    Conforte, Valeria P; Echeverria, Mariela; Sánchez, Cintia; Ugalde, Rodolfo A; Menéndez, Ana B; Lepek, Viviana C

    2010-08-01

    Ethylene inhibits the establishment of symbiosis between rhizobia and legumes. Several rhizobia species express the enzyme ACC deaminase, which degrades the ethylene precursor 1-cyclopropane-1-carboxilate (ACC), leading to reductions in the amount of ethylene evolved by the plant. M. loti has a gene encoding ACC deaminase, but this gene is under the activity of the NifA-RpoN-dependent promoter; thus, it is only expressed inside the nodule. The M. loti structural gene ACC deaminase (acdS) was integrated into the M. loti chromosome under a constitutive promoter activity. The resulting strain induced the formation of a higher number of nodules and was more competitive than the wild-type strain on Lotus japonicus and L. tenuis. These results suggest that the introduction of the ACC deaminase activity within M. loti in a constitutive way could be a novel strategy to increase nodulation competitiveness of the bacteria, which could be useful for the forage inoculants industry.

  2. Establishing the solubility and local structure(s) of Amorphous Calcium Carbonate (ACC): Toward an understanding of invertebrate biomineralization

    NASA Astrophysics Data System (ADS)

    Mergelsberg, S. T.; Ulrich, R. N.; Michel, F. M.; Dove, P. M.

    2017-12-01

    Recent advances in high-resolution imaging show the widespreadd occurrence of multistep pathways to mineralization in biological and geological settings (De Yoreo et al., 2015, Science). For example, carbonate biomineralization often involves precipitation of amorphous calcium carbonate (ACC) as a reactive intermediate that subsequently transforms to crystalline products with diverse structures. Although current carbonate mineral proxies are based upon the composition of final crystalline products, the final signatures may be recording the properties of the initial amorphous phase. Thus, it is critical to establish the physical properties of ACC and understand the factors that influence its evolution to final products at conditions that approximate biological environments. This disconnect limits our ability to build a process-based understanding of when/how minor and trace elements are recorded in mineral composition proxies. In this experimental study, we quantified the chemical and physical properties of ACC and its evolution to final products. We first determined ACC solubility under controlled chemical conditions using a new type of flow-through reactor developed by our research group (Blue and Dove, 2015, GCA; Blue et al., 2017, GCA). The experimental design varied Mg concentration and total alkalinity while maintaining a mild pH that approximates biological environments. ACC solubility was measured at specific time points during the precipitation (from super- and undersaturated conditions) and during its subsequent evolution. Parallel experiments characterized the structure of the corresponding amorphous products using in situ pair distribution function (PDF) and small-angle x-ray scattering (SAXS) analyses. The measurements demonstrate at least two types of ACC can be produced by tuning Mg concentration and alkalinity. Each "phase" exhibits distinct short-range ordering that demonstrates structure-specific solubility. We also find temporal changes in the

  3. ETHY. A theory of fruit climacteric ethylene emission.

    PubMed

    Génard, Michel; Gouble, Barbara

    2005-09-01

    A theory of fruit climacteric ethylene emission was developed and used as the basis of a simulation model called ETHY. According to the theory, the biosynthetic pathway of ethylene is supplied by ATP and is regulated by 1-aminocyclopropane-1-carboxylic acid (ACC) synthase and ACC oxidase. The conjugation of ACC with malonate to form MACC was taken into account as a way to decrease the availability of ACC. Because of the seasonal increase of fruit volume, the dilution of biochemical compounds used in ETHY was taken into account. Finally, the ethylene diffusion across the skin was considered. The theory took into account the effect of temperature and O(2) and CO(2) internal concentrations on ethylene. The model was applied to peach (Prunus persica) fruit over 3 years, several leaf:fruit ratios, and irrigation conditions. An adequate ethylene increase was predicted without considering any increase in respiration during the ripening period, which suggests that the respiratory climacteric may not be required for ripening. Another important result of this study is the high sensitivity of ETHY to the parameters involved in the calculation of ACC oxidase and ACC synthase activities, ATP production, and skin surface and permeability. ETHY was also highly sensitive to changes in fruit growth and temperature.

  4. ETHY. A Theory of Fruit Climacteric Ethylene Emission1

    PubMed Central

    Génard, Michel; Gouble, Barbara

    2005-01-01

    A theory of fruit climacteric ethylene emission was developed and used as the basis of a simulation model called ETHY. According to the theory, the biosynthetic pathway of ethylene is supplied by ATP and is regulated by 1-aminocyclopropane-1-carboxylic acid (ACC) synthase and ACC oxidase. The conjugation of ACC with malonate to form MACC was taken into account as a way to decrease the availability of ACC. Because of the seasonal increase of fruit volume, the dilution of biochemical compounds used in ETHY was taken into account. Finally, the ethylene diffusion across the skin was considered. The theory took into account the effect of temperature and O2 and CO2 internal concentrations on ethylene. The model was applied to peach (Prunus persica) fruit over 3 years, several leaf:fruit ratios, and irrigation conditions. An adequate ethylene increase was predicted without considering any increase in respiration during the ripening period, which suggests that the respiratory climacteric may not be required for ripening. Another important result of this study is the high sensitivity of ETHY to the parameters involved in the calculation of ACC oxidase and ACC synthase activities, ATP production, and skin surface and permeability. ETHY was also highly sensitive to changes in fruit growth and temperature. PMID:16143642

  5. Portable multi-node LQCD Monte Carlo simulations using OpenACC

    NASA Astrophysics Data System (ADS)

    Bonati, Claudio; Calore, Enrico; D'Elia, Massimo; Mesiti, Michele; Negro, Francesco; Sanfilippo, Francesco; Schifano, Sebastiano Fabio; Silvi, Giorgio; Tripiccione, Raffaele

    This paper describes a state-of-the-art parallel Lattice QCD Monte Carlo code for staggered fermions, purposely designed to be portable across different computer architectures, including GPUs and commodity CPUs. Portability is achieved using the OpenACC parallel programming model, used to develop a code that can be compiled for several processor architectures. The paper focuses on parallelization on multiple computing nodes using OpenACC to manage parallelism within the node, and OpenMPI to manage parallelism among the nodes. We first discuss the available strategies to be adopted to maximize performances, we then describe selected relevant details of the code, and finally measure the level of performance and scaling-performance that we are able to achieve. The work focuses mainly on GPUs, which offer a significantly high level of performances for this application, but also compares with results measured on other processors.

  6. Report of the Annual Scientific Session of the American College of Cardiology (ACC) 2018, Orlando.

    PubMed

    Hashimoto, Takuya; Ako, Junya

    2018-04-28

    The 67 th Annual Scientific Session and Expo of the American College of Cardiology (ACC) were held at the Orange County Convention Center, Orlando, from March 10-12, 2018. This meeting offered 2,700 accepted abstracts presented in oral and poster sessions by 2,100 experts and 37 Late-Breaking Clinical Trials and Featured Clinical Research presentations. This report introduces the key presentations and highlights from the ACC 2018 Scientific Session.

  7. Hypoxia-response element (HRE)-directed transcriptional regulation of the rat lysyl oxidase gene in response to cobalt and cadmium.

    PubMed

    Gao, Song; Zhou, Jing; Zhao, Yinzhi; Toselli, Paul; Li, Wande

    2013-04-01

    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5'-ACGTG-3') exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10-100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)-treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at -387/-383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation.

  8. Islet-specific monoamine oxidase A and B expression depends on MafA transcriptional activity and is compromised in type 2 diabetes.

    PubMed

    Ganic, Elvira; Johansson, Jenny K; Bennet, Hedvig; Fex, Malin; Artner, Isabella

    2015-12-25

    Lack or dysfunction of insulin producing β cells results in the development of type 1 and type 2 diabetes mellitus, respectively. Insulin secretion is controlled by metabolic stimuli (glucose, fatty acids), but also by monoamine neurotransmitters, like dopamine, serotonin, and norepinephrine. Intracellular monoamine levels are controlled by monoamine oxidases (Mao) A and B. Here we show that MaoA and MaoB are expressed in mouse islet β cells and that inhibition of Mao activity reduces insulin secretion in response to metabolic stimuli. Moreover, analysis of MaoA and MaoB protein expression in mouse and human type 2 diabetic islets shows a significant reduction of MaoB in type 2 diabetic β cells suggesting that loss of Mao contributes to β cell dysfunction. MaoB expression was also reduced in β cells of MafA-deficient mice, a mouse model for β cell dysfunction, and biochemical studies showed that MafA directly binds to and activates MaoA and MaoB transcriptional control sequences. Taken together, our results show that MaoA and MaoB expression in pancreatic islets is required for physiological insulin secretion and lost in type 2 diabetic mouse and human β cells. These findings demonstrate that regulation of monoamine levels by Mao activity in β cells is pivotal for physiological insulin secretion and that loss of MaoB expression may contribute to the β cell dysfunction in type 2 diabetes. Copyright © 2015 Elsevier Inc. All rights reserved.

  9. The ACCE 2012 Study Tour: Reflections on Reoccurring Themes

    ERIC Educational Resources Information Center

    Clements, Di; Grover, David; Grover, Pam; Hearne, Dominic; Knipe, Steven; Martin, Kim; Pazzi, Georgina; Pollard, Edward; Prestridge, Sarah

    2012-01-01

    Transformational leadership is essential in education as it empowers educators to make positive changes to the way they think, feel and act in improving learning for all. Reflection is a vital element of leading the change process. In relation to participating in the ACCE study tour experience, reflection allows one to sit and think about the…

  10. Molecular Characterization of Lactobacillus plantarum Genes for β-Ketoacyl-Acyl Carrier Protein Synthase III (fabH) and Acetyl Coenzyme A Carboxylase (accBCDA), Which Are Essential for Fatty Acid Biosynthesis

    PubMed Central

    Kiatpapan, Pornpimon; Kobayashi, Hajime; Sakaguchi, Maki; Ono, Hisayo; Yamashita, Mitsuo; Kaneko, Yoshinobu; Murooka, Yoshikatsu

    2001-01-01

    Genes for subunits of acetyl coenzyme A carboxylase (ACC), which is the enzyme that catalyzes the first step in the synthesis of fatty acids in Lactobacillus plantarum L137, were cloned and characterized. We identified six potential open reading frames, namely, manB, fabH, accB, accC, accD, and accA, in that order. Nucleotide sequence analysis suggested that fabH encoded β-ketoacyl-acyl carrier protein synthase III, that the accB, accC, accD, and accA genes encoded biotin carboxyl carrier protein, biotin carboxylase, and the β and α subunits of carboxyltransferase, respectively, and that these genes were clustered. The organization of acc genes was different from that reported for Escherichia coli, for Bacillus subtilis, and for Pseudomonas aeruginosa. E. coli accB and accD mutations were complemented by the L. plantarum accB and accD genes, respectively. The predicted products of all five genes were confirmed by using the T7 expression system in E. coli. The gene product of accB was biotinylated in E. coli. Northern and primer extension analyses demonstrated that the five genes in L. plantarum were regulated polycistronically in an acc operon. PMID:11133475

  11. Population impact of the 2017 ACC/AHA guidelines compared with the 2013 ESH/ESC guidelines for hypertension management.

    PubMed

    Vaucher, Julien; Marques-Vidal, Pedro; Waeber, Gérard; Vollenweider, Peter

    2018-01-01

    Background The 2017 ACC/AHA guidelines on hypertension management recommend the introduction of antihypertensive treatment for patients with new stage 1 hypertension thresholds (130-139/80-89 mm Hg) and with a cardiovascular disease or related condition. We compared the Swiss population and economic impact of antihypertensive treatment of the 2017 ACC/AHA guidelines with the 2013 European guidelines. Methods Analyses were based on 4438 participants (aged 45-85 years; 2448 women) of the CoLaus|PsyCoLaus study recruited between 2014-2017. Participants eligible for antihypertensive treatment according to the 2017 ACC/AHA and 2013 European guidelines were sex and age standardised using the Swiss population for 2016. In addition, we estimated the population-wide annual costs of antihypertensive treatment. Results Individuals eligible for antihypertensive treatment were 40.3% (95% confidence interval 38.5-42.1) and 31.3% (29.7-32.9) according to the 2017 ACC/AHA and 2013 European guidelines, respectively. That difference would translate into approximately 250,000 additional individuals eligible for antihypertensive treatment, corresponding to an additional annual cost of 72.5 million CHF (63.0 million EUR). Conclusion The 2017 ACC/AHA guidelines on the management of hypertension substantially increase the number of individuals eligible for antihypertensive treatment compared to the 2013 European guidelines. While implementation of the 2017 ACC/AHA guidelines is expected to lead to cost reduction by preventing cardiovascular diseases, that reduction might be mitigated by the costs incurred by antihypertensive treatments in a larger proportion of the population.

  12. Increased statin eligibility based on ACC/AHA versus NCEP guidelines for high cholesterol management in Chile.

    PubMed

    Echeverría, Guadalupe; Dussaillant, Catalina; Villarroel, Luis; Rigotti, Attilio

    2016-01-01

    In 2013, the American College of Cardiology and the American Heart Association (ACC/AHA) jointly released new guidelines for cardiovascular risk assessment and cholesterol management that substantially modified the previous recommendations proposed by the National Cholesterol Education Program (NCEP) in 2001. The relative impact of these new guidelines on potential statin use has not been estimated in Latin American populations. To estimate and compare eligibility for statin therapy based on ACC/AHA and NCEP guidelines in adult Chilean population. Using data from the last National Health Survey (2009-2010 NHS), we conducted a cross-sectional analysis in a ​representative sample of the Chilean adult population and calculated the proportion of individuals that would receive statins under each set of guidelines. According to ACC/AHA guidelines, the population eligible for statin treatment increased from 21.7% (NCEP guidelines) to 33.2% (overall 53% increase). This effect was more pronounced among women (29.6% under ACC/AHA vs 15.6% under NCEP) and with those of advanced age (75% of the subjects >60 years of age compared with 46% under NCEP). The newly eligible group included more women and older subjects and individuals with lower LDL cholesterol levels. Compared with NCEP recommendations, the new ACC/AHA guidelines significantly increased the number of Chilean adults eligible for statin therapy. Full implementation of the new recommendations may have important public health implications in Chile and other Latin American countries, as more women and older subjects without cardiovascular disease would qualify for statin treatment. Copyright © 2016 National Lipid Association. Published by Elsevier Inc. All rights reserved.

  13. [Study on garlic oil combined with 5-FU induced apoptosis of adenoid cystic carcinoma cell line ACC-M].

    PubMed

    Wu, Fayin; Zhou, Hefeng; Fan, Zhiying; Zhu, Yawen; Li, Yongye; Yao, Yukun; Ran, Dan

    2014-02-01

    To observe the effect of garlic oil combined with 5-FU induced apoptosis of adenoid cystic carcinoma cell line ACC-M. Human salivary in adenoid cystic carcinoma cell line AC-M was cultured, divided into the experimental group (5-FU group, garlic oil group, garlic oil + 5-FU group) and the control group, to observe the growth activity of tumor cells by MTT methods; to analyse the changes of cell cycle and apoptosis rate by flow cytometry. MTT experiments showed that 5-FU, garlic oil, garlic oil and 5-FU on ACC-M cells have inhibition in different concentration, with the increase of concentration and action time of the rise; Cell cycle analysis showed significant changes in flow cytometry. With the increase of concentration and the acting time, the G0/G1, phase of the cell ratio increased, S had no significant change, but G2/M phase cells decreased. Apoptosis rate display showed garlic oil combined with 5-FU induced apoptosis of ACC-M cells was significantly stronger than single group. Garlic oil can effectively induce the apoptosis of adenoid cystic carcinoma cell line ACC-M. The effect of garlic oil combined with 5-FU on ACC-M cells was stronger than the garlic oil, 5-FU used alone.

  14. Overexpression of ACC gene from oleaginous yeast Lipomyces starkeyi enhanced the lipid accumulation in Saccharomyces cerevisiae with increased levels of glycerol 3-phosphate substrates.

    PubMed

    Wang, Jiancai; Xu, Ronghua; Wang, Ruling; Haque, Mohammad Enamul; Liu, Aizhong

    2016-06-01

    The conversion of acetyl-CoA to malonyl-CoA by acetyl-CoA carboxylase (ACC) is the rate-limiting step in fatty acid biosynthesis. In this study, a gene coding for ACC was isolated and characterized from an oleaginous yeast, Lipomyces starkeyi. Real-time quantitative PCR (qPCR) analysis of L. starkeyi acetyl-CoA carboxylase gene (LsACC1) showed that the expression levels were upregulated with the fast accumulation of lipids. The LsACC1 was co-overexpressed with the glycerol 3-phosphate dehydrogenase gene (GPD1), which regulates lipids biosynthesis by supplying another substrates glycerol 3-phosphate for storage lipid assembly, in the non-oleaginous yeast Saccharomyces cerevisiae. Further, the S. cerevisiae acetyl-CoA carboxylase (ScACC1) was transferred with GPD1 and its function was analyzed in comparison with LsACC1. The results showed that overexpressed LsACC1 and GPD1 resulted in a 63% increase in S. cerevisiae. This study gives new data in understanding of the molecular mechanisms underlying the regulation of fatty acids and lipid biosynthesis in yeasts.

  15. Quantitation of immunoadsorbed flavoprotein oxidases by luminol-mediated chemiluminescence.

    PubMed

    Hinkkanen, A; Maly, F E; Decker, K

    1983-04-01

    The detection of the flavoenzymes 6-hydroxy-L-nicotine oxidase and 6-hydroxy-D-nicotine oxidase at the sub-femtomol level was achieved by coupling the reaction of the immunoadsorbed proteins to the peroxidase-catalysed oxidation of luminol. The H2O2-producing oxidases retained their full activity when bound to the respective immobilized antibodies. This fact allowed the concentration of the enzymes from very dilute solutions and the quantitative assay of their activities in the microU range. Due to strict stereoselectivity and the absence of immunological cross-reactivity, the two flavoproteins could be determined in the same solution. This method was used to measure the 6-hydroxy-D-nicotine oxidase and 6-hydroxy-L-nicotine oxidase activities in Escherichia coli RR1 and different Arthrobacter strains cultured under non-inducing conditions. The same activity ratio of 6-hydroxy-L-nicotine oxidase/6-hydroxy-D-nicotine oxidase as in D L-nicotine-induced cells of A. oxidans was observed in non-induced wild type and in riboflavin-requiring (rf-) mutant cells of this aerob.

  16. Molecular cloning and characterisation of banana fruit polyphenol oxidase.

    PubMed

    Gooding, P S; Bird, C; Robinson, S P

    2001-09-01

    Polyphenol oxidase (PPO; EC 1.10.3.2) is the enzyme thought to be responsible for browning in banana [Musa cavendishii (AAA group, Cavendish subgroup) cv. Williams] fruit. Banana flesh was high in PPO activity throughout growth and ripening. Peel showed high levels of activity early in development but activity declined until ripening started and then remained constant. PPO activity in fruit was not substantially induced after wounding or treatment with 5-methyl jasmonate. Banana flowers and unexpanded leaf roll had high PPO activities with lower activities observed in mature leaves, roots and stem. Four different PPO cDNA clones were amplified from banana fruit (BPO1, BPO11, BPO34 and BPO35). Full-length cDNA and genomic clones were isolated for the most abundant sequence (BPO1) and the genomic clone was found to contain an 85-bp intron. Introns have not been previously found in PPO genes. Northern analysis revealed the presence of BPO1 mRNA in banana flesh early in development but little BPO1 mRNA was detected at the same stage in banana peel. BPO11 transcript was only detected in very young flesh and there was no detectable expression of BPO34 or BPO35 in developing fruit samples. PPO transcripts were also low throughout ripening in both flesh and peel. BPO1 transcripts were readily detected in flowers, stem, roots and leaf roll samples but were not detected in mature leaves. BPO11 showed a similar pattern of expression to BPO1 in these tissues but transcript levels were much lower. BPO34 and BPO35 mRNAs were only detected at a low level in flowers and roots and BPO34 transcript was detected in mature leaves, the only clone to do so. The results suggest that browning of banana fruit during ripening results from release of pre-existing PPO enzyme, which is synthesised very early in fruit development.

  17. Transport of sup 14 C-IAA and sup 14 C-ACC within floral organs of Ipomoea nil

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kiss, H.G.; Maurice, H.R.; Koning, R.E.

    1989-04-01

    The transport of {sup 14}C-IAA {sup 14}C-ACC from agarose donor blocks applied to I. nil filaments their recovery as {sup 14}C-accumulation into floral organs was examined. The accumulation of the isotopes in the corolla tissue was greater when {sup 14}C-ACC was applied than {sup 14}C-IAA in intact isolated flower buds. Greater levels of the isotopes accumulated in the pistil, with minimal levels in receptacle and calyx tissues from isolated buds. With intact buds, greater levels of the isotopes were recovered in pistil, calyx receptacle tissues. This study provides further evidence for the role of the filaments as transport vectors formore » IAA ACC for the production of ethylene.« less

  18. Health Literacy: Readability of ACC/AHA Online Patient Education Material.

    PubMed

    Kapoor, Karan; George, Praveen; Evans, Matthew C; Miller, Weldon J; Liu, Stanley S

    To determine whether the online patient education material offered by the American College of Cardiology (ACC) and the American Heart Association (AHA) is written at a higher level than the 6th-7th grade level recommended by the National Institute of Health (NIH). Online patient education material from each website was subjected to reading grade level (RGL) analysis using the Readability Studio Professional Edition. One-sample t testing was used to compare the mean RGLs obtained from 8 formulas to the NIH-recommended 6.5 grade level and 8th grade national mean. In total, 372 articles from the ACC website and 82 from the AHA were studied. Mean (±SD) RGLs for the 454 articles were 9.6 ± 2.1, 11.2 ± 2.1, 11.9 ± 1.6, 10.8 ± 1.6, 9.7 ± 2.1, 10.8 ± 0.8, 10.5 ± 2.6, and 11.7 ± 3.5 according to the Flesch-Kincaid grade level (FKGL), Simple Measure of Gobbledygook (SMOG Index), Coleman-Liau Index (CLI), Gunning-Fog Index (GFI), New Dale-Chall reading level formula (NDC), FORCAST, Raygor Readability Estimate (RRE), and Fry Graph (Fry), respectively. All analyzed articles had significantly higher RGLs than both the NIH-recommended grade level of 6.5 and the national mean grade level of 8 (p < 0.00625). Patient education material provided on the ACC and AHA websites is written above the NIH-recommended 6.5 grade level and 8th grade national mean reading level. Additional studies are required to demonstrate whether lowering the RGL of this material improves outcomes among patients with cardiovascular disease. © 2017 S. Karger AG, Basel.

  19. Correlation Between Monoamine Oxidase Inhibitors and Anticonvulsants

    PubMed Central

    Dwivedi, Chandradhar; Misra, Radhey S.; Chaudhari, Anshumali; Parmar, Surendra S.

    1980-01-01

    Monoamine oxidase inhibitory and anticonvulsant properties of 2-substituted styryl-6-bromo-3-(4-ethylbenzoate/4 benzhydrazide)-4-quinazoles are studied. All styryl quinazolone esters except compound number 9 exhibited monoamine oxidase inhibitory properties during oxidative deamination of kynuramine. Corresponding hydrazides were found to have relatively higher activity. All these quinazolones were able to protect against pentylenetetrazol induced seizures. These observations in general do not prove that monoamine oxidase inhibitory properties represent the biochemical basis for the anticonvulsant activity of these compounds. PMID:7420438

  20. Development and psychometric evaluation of the Assessment of Core CBT Skills (ACCS): An observation-based tool for assessing cognitive behavioral therapy competence.

    PubMed

    Muse, Kate; McManus, Freda; Rakovshik, Sarah; Thwaites, Richard

    2017-05-01

    This article outlines the development and psychometric evaluation of the Assessment of Core CBT Skills (ACCS) rating scale. The ACCS aims to provide a novel assessment framework to deliver formative and summative feedback regarding therapists' performance within observed cognitive-behavioral treatment sessions, and for therapists to rate and reflect on their own performance. Findings from 3 studies are outlined: (a) a feedback study (n = 66) examining content validity, face validity and usability; (b) a focus group (n = 9) evaluating usability and utility; and (c) an evaluation of the psychometric properties of the ACCS in real world cognitive behavioral therapy (CBT) training and routine clinical practice contexts. Results suggest that the ACCS has good face validity, content validity, and usability and provides a user-friendly tool that is useful for promoting self-reflection and providing formative feedback. Scores on both the self and assessor-rated versions of the ACCS demonstrate good internal consistency, interrater reliability, and discriminant validity. In addition, ACCS scores were found to be correlated with, but distinct from, the Revised Cognitive Therapy Scale (CTS-R) and were comparable to CTS-R scores in terms of internal consistency and discriminant validity. In addition, the ACCS may have advantages over the CTS-R in terms of interrater reliability of scores. The studies also provided insight into areas for refinement and a number of modifications were undertaken to improve the scale. In summary, the ACCS is an appropriate and useful measure of CBT competence that can be used to promote self-reflection and provide therapists with formative and summative feedback. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  1. Waste management facility accident analysis (WASTE ACC) system: software for analysis of waste management alternatives

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kohout, E.F.; Folga, S.; Mueller, C.

    1996-03-01

    This paper describes the Waste Management Facility Accident Analysis (WASTE{underscore}ACC) software, which was developed at Argonne National Laboratory (ANL) to support the US Department of Energy`s (DOE`s) Waste Management (WM) Programmatic Environmental Impact Statement (PEIS). WASTE{underscore}ACC is a decision support and database system that is compatible with Microsoft{reg_sign} Windows{trademark}. It assesses potential atmospheric releases from accidents at waste management facilities. The software provides the user with an easy-to-use tool to determine the risk-dominant accident sequences for the many possible combinations of process technologies, waste and facility types, and alternative cases described in the WM PEIS. In addition, its structure willmore » allow additional alternative cases and assumptions to be tested as part of the future DOE programmatic decision-making process. The WASTE{underscore}ACC system demonstrates one approach to performing a generic, systemwide evaluation of accident risks at waste management facilities. The advantages of WASTE{underscore}ACC are threefold. First, the software gets waste volume and radiological profile data that were used to perform other WM PEIS-related analyses directly from the WASTE{underscore}MGMT system. Second, the system allows for a consistent analysis across all sites and waste streams, which enables decision makers to understand more fully the trade-offs among various policy options and scenarios. Third, the system is easy to operate; even complex scenario runs are completed within minutes.« less

  2. Regulation of tyramine oxidase synthesis in Klebsiella aerogenes.

    PubMed Central

    Okamura, H; Murooka, Y; Harada, T

    1976-01-01

    Tyramine oxidase in Klebsiella aerogenes is highly specific for tyramine, dopamine, octopamine, and norepinephrine, and its synthesis is induced specifically by these compounds. The enzyme is present in a membrane-bound form. The Km value for tyramine is 9 X 10(-4) M. Tyramine oxidase synthesis was subjected to catabolite repression by glucose in the presence of ammonium salts. Addition of cyclic adenosine 3',5'-monophosphate (cAMP) overcame the catabolite repression. A mutant strain, K711, which can produce a high level of beta-galactosidase in the presence of glucose and ammonium chloride, can also synthesize tyramine oxidase and histidase in the presence of inducer in glucose ammonium medium. Catabolite repression of tyramine oxidase synthesis was relieved when the cells were grown under conditions of nitrogen limitation, whereas beta-galactosidase was strongly repressed under these conditions. A cAMP-requiring mutant, MK54, synthesized tyramine oxidase rapidly when tyramine was used as the sole source of nitrogen in the absence of cAMP. However, a glutamine synthetase-constitutive mutant, MK94, failed to synthesize tyramine oxidase in the presence of glucose and ammonium chloride, although it synthesized histidase rapidly under these conditions. These results suggest that catabolite repression of tyramine oxidase synthesis in K. aerogenes is regulated by the intracellular level of cAMP and an unknown cytoplasmic factor that acts independently of cAMP and is formed under conditions of nitrogen limitation. PMID:179974

  3. AMPK activation represses the human gene promoter of the cardiac isoform of acetyl-CoA carboxylase: Role of nuclear respiratory factor-1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Adam, Tasneem; Opie, Lionel H.; Essop, M. Faadiel, E-mail: mfessop@sun.ac.za

    Research highlights: {yields} AMPK inhibits acetyl-CoA carboxylase beta gene promoter activity. {yields} Nuclear respiratory factor-1 inhibits acetyl-CoA carboxylase beta promoter activity. {yields} AMPK regulates acetyl-CoA carboxylase beta at transcriptional level. -- Abstract: The cardiac-enriched isoform of acetyl-CoA carboxylase (ACC{beta}) produces malonyl-CoA, a potent inhibitor of carnitine palmitoyltransferase-1. AMPK inhibits ACC{beta} activity, lowering malonyl-CoA levels and promoting mitochondrial fatty acid {beta}-oxidation. Previously, AMPK increased promoter binding of nuclear respiratory factor-1 (NRF-1), a pivotal transcriptional modulator controlling gene expression of mitochondrial proteins. We therefore hypothesized that NRF-1 inhibits myocardial ACC{beta} promoter activity via AMPK activation. A human ACC{beta} promoter-luciferase construct was transientlymore » transfected into neonatal cardiomyocytes {+-} a NRF-1 expression construct. NRF-1 overexpression decreased ACC{beta} gene promoter activity by 71 {+-} 4.6% (p < 0.001 vs. control). Transfections with 5'-end serial promoter deletions revealed that NRF-1-mediated repression of ACC{beta} was abolished with a pPII{beta}-18/+65-Luc deletion construct. AMPK activation dose-dependently reduced ACC{beta} promoter activity, while NRF-1 addition did not further decrease it. We also investigated NRF-1 inhibition in the presence of upstream stimulatory factor 1 (USF1), a known transactivator of the human ACC{beta} gene promoter. Here NRF-1 blunted USF1-dependent induction of ACC{beta} promoter activity by 58 {+-} 7.5% (p < 0.001 vs. control), reversed with a dominant negative NRF-1 construct. NRF-1 also suppressed endogenous USF1 transcriptional activity by 55 {+-} 6.2% (p < 0.001 vs. control). This study demonstrates that NRF-1 is a novel transcriptional inhibitor of the human ACC{beta} gene promoter in the mammalian heart. Our data extends AMPK regulation of ACC{beta} to the transcriptional

  4. 15-Deoxy-∆12,14-PGJ 2, by activating peroxisome proliferator-activated receptor-gamma, suppresses p22phox transcription to protect brain endothelial cells against hypoxia-induced apoptosis.

    PubMed

    Wu, Jui-Sheng; Tsai, Hsin-Da; Huang, Chien-Yu; Chen, Jin-Jer; Lin, Teng-Nan

    2014-08-01

    15-Deoxy-∆(12,14)-PGJ(2) (15d-PGJ(2)) and thiazolidinedione attenuate reactive oxygen species (ROS) production via a peroxisome proliferator-activated receptor-gamma (PPAR-γ)-dependent pathway. Nonetheless, how PPAR-γ mediates ROS production to ameliorate ischemic brain injury is not clear. Recent studies indicated that nicotinamide adenine dinucleotide phosphate (NADPH) oxidase is the major source of ROS in the vascular system. In the present study, we used an in vitro oxygen-glucose deprivation and reoxygenation (hypoxia reoxygenation [HR]) paradigm to study whether PPAR-γ interacts with NADPH oxidase, thereby regulating ROS formation in cerebral endothelial cells (CECs). With pharmacological (PPAR-γ antagonist GW9662), loss-of-function (PPAR-γ siRNA), and gain-of-function (Ad-PPAR-γ) approaches, we first demonstrated that 15d-PGJ(2) protected HR-treated CECs against ROS-induced apoptosis in a PPAR-γ-dependent manner. Results of promoter and subcellular localization analyses further revealed that 15d-PGJ(2), by activating PPAR-γ, blocked HR-induced NF-κB nuclear translocation, which led to inhibited transcription of the NADPH oxidase subunit p22phox. In summary, we report a novel transrepression mechanism whereby PPAR-γ downregulates hypoxia-activated p22phox transcription and the subsequent NADPH oxidase activation, ROS formation, and CEC apoptosis.

  5. Proteomic changes in the base of chrysanthemum cuttings during adventitious root formation

    PubMed Central

    2013-01-01

    Background A lack of competence to form adventitious roots by cuttings of Chrysanthemum (Chrysanthemum morifolium) is an obstacle for the rapid fixation of elite genotypes. We performed a proteomic analysis of cutting bases of chrysanthemum cultivar ‘Jinba’ during adventitious root formation (ARF) in order to identify rooting ability associated protein and/or to get further insight into the molecular mechanisms controlling adventitious rooting. Results The protein profiles during ARF were analyzed by comparing the 2-DE gels between 0-day-old (just severed from the stock plant) and 5-day-old cutting bases of chrysanthemum. A total of 69 differentially accumulated protein spots (two-fold change; t-test: 95% significance) were excised and analyzed using MALDI-TOF/TOF, among which 42 protein spots (assigned as 24 types of proteins and 7 unknown proteins) were confidently identified using the NCBI database. The results demonstrated that 19% proteins were related to carbohydrate and energy metabolism, 16% to photosynthesis, 10% to protein fate, 7% to plant defense, 6% to cell structure, 7% to hormone related, 3% to nitrate metabolism, 3% to lipid metabolism, 3% to ascorbate biosynthesis and 3% to RNA binding, 23% were unknown proteins. Twenty types of differentially accumulated proteins including ACC oxidase (CmACO) were further analyzed at the transcription level, most of which were in accordance with the results of 2-DE. Moreover, the protein abundance changes of CmACO are supported by western blot experiments. Ethylene evolution was higher during the ARF compared with day 0 after cutting, while silver nitrate, an inhibitor of ethylene synthesis, pretreatment delayed the ARF. It suggested that ACC oxidase plays an important role in ARF of chrysanthemum. Conclusions The proteomic analysis of cutting bases of chrysanthemum allowed us to identify proteins whose expression was related to ARF. We identified auxin-induced protein PCNT115 and ACC oxidase positively or

  6. Ethylene biosynthesis in detached young persimmon fruit is initiated in calyx and modulated by water loss from the fruit.

    PubMed

    Nakano, Ryohei; Ogura, Emi; Kubo, Yasutaka; Inaba, Akitsugu

    2003-01-01

    Persimmon (Diospyros kaki Thunb.) fruit are usually classified as climacteric fruit; however, unlike typical climacteric fruits, persimmon fruit exhibit a unique characteristic in that the younger the stage of fruit detached, the greater the level of ethylene produced. To investigate ethylene induction mechanisms in detached young persimmon fruit, we cloned three cDNAs encoding 1-aminocyclopropane-1-carboxylic acid (ACC) synthase (DK-ACS1, 2, and -3) and two encoding ACC oxidase (DK-ACO1 and -2) genes involved in ethylene biosynthesis, and we analyzed their expression in various fruit tissues. Ethylene production was induced within a few days of detachment in all fruit tissues tested, accompanied by temporally and spatially coordinated expression of all the DK-ACS and DK-ACO genes. In all tissues except the calyx, treatment with 1-methylcyclopropene, an inhibitor of ethylene action, suppressed ethylene production and ethylene biosynthesis-related gene expression. In the calyx, one ACC synthase gene (DK-ACS2) exhibited increased mRNA accumulation accompanied by a large quantity of ethylene production, and treatment of the fruit with 1-methylcyclopropene did not prevent either the accumulation of DK-ACS2 transcripts or ethylene induction. Furthermore, the alleviation of water loss from the fruit significantly delayed the onset of ethylene production and the expression of DK-ACS2 in the calyx. These results indicate that ethylene biosynthesis in detached young persimmon fruit is initially induced in calyx and is modulated by water loss through transcriptional activation of DK-ACS2. The ethylene produced in the calyx subsequently diffuses to other fruit tissues and acts as a secondary signal that stimulates autocatalytic ethylene biosynthesis in these tissues, leading to a burst of ethylene production.

  7. The ability of the 2013 ACC/AHA cardiovascular risk score to identify rheumatoid arthritis patients with high coronary artery calcification scores

    PubMed Central

    Kawai, Vivian K.; Chung, Cecilia P.; Solus, Joseph F.; Oeser, Annette; Raggi, Paolo; Stein, C. Michael

    2014-01-01

    Objective Patients with rheumatoid arthritis (RA) have increased risk of atherosclerotic cardiovascular disease (ASCVD) that is underestimated by the Framingham risk score (FRS). We hypothesized that the 2013 ACC/AHA 10-year risk score would perform better than the FRS and the Reynolds risk score (RRS) in identifying RA patients known to have elevated cardiovascular risk based on high coronary artery calcification (CAC) scores. Methods Among 98 RA patients eligible for risk stratification using the ACC/AHA score we identified 34 patients with high CAC (≥ 300 Agatston units or ≥75th percentile) and compared the ability of the 10-year FRS, RRS and the ACC/AHA risk scores to correctly assign these patients to an elevated risk category. Results All three risk scores were higher in patients with high CAC (P values <0.05). The percentage of patients with high CAC correctly assigned to the elevated risk category was similar among the three scores (FRS 32%, RRS 32%, ACC/AHA 41%) (P=0.233). The c-statistics for the FRS, RRS and ACC/AHA risk scores predicting the presence of high CAC were 0.65, 0.66, and 0.65, respectively. Conclusions The ACC/AHA 10-year risk score does not offer any advantage compared to the traditional FRS and RRS in the identification of RA patients with elevated risk as determined by high CAC. The ACC/AHA risk score assigned almost 60% of patients with high CAC into a low risk category. Risk scores and standard risk prediction models used in the general population do not adequately identify many RA patients with elevated cardiovascular risk. PMID:25371313

  8. NADPH oxidases of the brain: distribution, regulation, and function.

    PubMed

    Infanger, David W; Sharma, Ram V; Davisson, Robin L

    2006-01-01

    The NADPH oxidase is a multi-subunit enzyme that catalyzes the reduction of molecular oxygen to form superoxide (O(2)(-)). While classically linked to the respiratory burst in neutrophils, recent evidence now shows that O(2)(-) (and associated reactive oxygen species, ROS) generated by NADPH oxidase in nonphagocytic cells serves myriad functions in health and disease. An entire new family of NADPH Oxidase (Nox) homologues has emerged, which vary widely in cell and tissue distribution, as well as in function and regulation. A major concept in redox signaling is that while NADPH oxidase-derived ROS are necessary for normal cellular function, excessive oxidative stress can contribute to pathological disease. This certainly is true in the central nervous system (CNS), where normal NADPH oxidase function appears to be required for processes such as neuronal signaling, memory, and central cardiovascular homeostasis, but overproduction of ROS contributes to neurotoxicity, neurodegeneration, and cardiovascular diseases. Despite implications of NADPH oxidase in normal and pathological CNS processes, still relatively little is known about the mechanisms involved. This paper summarizes the evidence for NADPH oxidase distribution, regulation, and function in the CNS, emphasizing the diversity of Nox isoforms and their new and emerging role in neuro-cardiovascular function. In addition, perspectives for future research and novel therapeutic targets are offered.

  9. Gravity Responsive NADH Oxidase of the Plasma Membrane

    NASA Technical Reports Server (NTRS)

    Morre, D. James (Inventor)

    2002-01-01

    A method and apparatus for sensing gravity using an NADH oxidase of the plasma membrane which has been found to respond to unit gravity and low centrifugal g forces. The oxidation rate of NADH supplied to the NADH oxidase is measured and translated to represent the relative gravitational force exerted on the protein. The NADH oxidase of the plasma membrane may be obtained from plant or animal sources or may be produced recombinantly.

  10. Immobilization of Pichia pastoris cells containing alcohol oxidase activity

    PubMed Central

    Maleknia, S; Ahmadi, H; Norouzian, D

    2011-01-01

    Background and Objectives The attempts were made to describe the development of a whole cell immobilization of P. pastoris by entrapping the cells in polyacrylamide gel beads. The alcohol oxidase activity of the whole cell Pichia pastoris was evaluated in comparison with yeast biomass production. Materials and Methods Methylotrophic yeast P. pastoris was obtained from Collection of Standard Microorganisms, Department of Bacterial Vaccines, Pasteur Institute of Iran (CSMPI). Stock culture was maintained on YPD agar plates. Alcohol oxidase was strongly induced by addition of 0.5% methanol as the carbon source. The cells were harvested by centrifugation then permeabilized. Finally the cells were immobilized in polyacrylamide gel beads. The activity of alcohol oxidase was determined by method of Tane et al. Results At the end of the logarithmic phase of cell culture, the alcohol oxidase activity of the whole cell P. Pastoris reached the highest level. In comparison, the alcohol oxidase activity was measured in an immobilized P. pastoris when entrapped in polyacrylamide gel beads. The alcohol oxidase activity of cells was induced by addition of 0.5% methanol as the carbon source. The cells were permeabilized by cetyltrimethylammonium bromide (CTAB) and immobilized. CTAB was also found to increase the gel permeability. Alcohol oxidase activity of immobilized cells was then quantitated by ABTS/POD spectrophotometric method at OD 420. There was a 14% increase in alcohol oxidase activity in immobilized cells as compared with free cells. By addition of 2-butanol as a substrate, the relative activity of alcohol oxidase was significantly higher as compared with other substrates added to the reaction media. Conclusion Immobilization of cells could eliminate lengthy and expensive procedures of enzyme separation and purification, protect and stabilize enzyme activity, and perform easy separation of the enzyme from the reaction media. PMID:22530090

  11. Adolescents with current major depressive disorder show dissimilar patterns of age-related differences in ACC and thalamus

    PubMed Central

    Hagan, Cindy C.; Graham, Julia M.E.; Tait, Roger; Widmer, Barry; van Nieuwenhuizen, Adrienne O.; Ooi, Cinly; Whitaker, Kirstie J.; Simas, Tiago; Bullmore, Edward T.; Lennox, Belinda R.; Sahakian, Barbara J.; Goodyer, Ian M.; Suckling, John

    2015-01-01

    Objective There is little understanding of the neural system abnormalities subserving adolescent major depressive disorder (MDD). In a cross-sectional study we compare currently unipolar depressed with healthy adolescents to determine if group differences in grey matter volume (GMV) were influenced by age and illness severity. Method Structural neuroimaging was performed on 109 adolescents with current MDD and 36 healthy controls, matched for age, gender, and handedness. GMV differences were examined within the anterior cingulate cortex (ACC) and across the whole-brain. The effects of age and self-reported depressive symptoms were also examined in regions showing significant main or interaction effects. Results Whole-brain voxel based morphometry revealed no significant group differences. At the whole-brain level, both groups showed a main effect of age on GMV, although this effect was more pronounced in controls. Significant group-by-age interactions were noted: A significant regional group-by-age interaction was observed in the ACC. GMV in the ACC showed patterns of age-related differences that were dissimilar between adolescents with MDD and healthy controls. GMV in the thalamus showed an opposite pattern of age-related differences in adolescent patients compared to healthy controls. In patients, GMV in the thalamus, but not the ACC, was inversely related with self-reported depressive symptoms. Conclusions The depressed adolescent brain shows dissimilar age-related and symptom-sensitive patterns of GMV differences compared with controls. The thalamus and ACC may comprise neural markers for detecting these effects in youth. Further investigations therefore need to take both age and level of current symptoms into account when disaggregating antecedent neural vulnerabilities for MDD from the effects of MDD on the developing brain. PMID:25685707

  12. Adolescents with current major depressive disorder show dissimilar patterns of age-related differences in ACC and thalamus.

    PubMed

    Hagan, Cindy C; Graham, Julia M E; Tait, Roger; Widmer, Barry; van Nieuwenhuizen, Adrienne O; Ooi, Cinly; Whitaker, Kirstie J; Simas, Tiago; Bullmore, Edward T; Lennox, Belinda R; Sahakian, Barbara J; Goodyer, Ian M; Suckling, John

    2015-01-01

    There is little understanding of the neural system abnormalities subserving adolescent major depressive disorder (MDD). In a cross-sectional study we compare currently unipolar depressed with healthy adolescents to determine if group differences in grey matter volume (GMV) were influenced by age and illness severity. Structural neuroimaging was performed on 109 adolescents with current MDD and 36 healthy controls, matched for age, gender, and handedness. GMV differences were examined within the anterior cingulate cortex (ACC) and across the whole-brain. The effects of age and self-reported depressive symptoms were also examined in regions showing significant main or interaction effects. Whole-brain voxel based morphometry revealed no significant group differences. At the whole-brain level, both groups showed a main effect of age on GMV, although this effect was more pronounced in controls. Significant group-by-age interactions were noted: A significant regional group-by-age interaction was observed in the ACC. GMV in the ACC showed patterns of age-related differences that were dissimilar between adolescents with MDD and healthy controls. GMV in the thalamus showed an opposite pattern of age-related differences in adolescent patients compared to healthy controls. In patients, GMV in the thalamus, but not the ACC, was inversely related with self-reported depressive symptoms. The depressed adolescent brain shows dissimilar age-related and symptom-sensitive patterns of GMV differences compared with controls. The thalamus and ACC may comprise neural markers for detecting these effects in youth. Further investigations therefore need to take both age and level of current symptoms into account when disaggregating antecedent neural vulnerabilities for MDD from the effects of MDD on the developing brain.

  13. Pluripotency transcription factors and Tet1/2 maintain Brd4-independent stem cell identity.

    PubMed

    Finley, Lydia W S; Vardhana, Santosha A; Carey, Bryce W; Alonso-Curbelo, Direna; Koche, Richard; Chen, Yanyang; Wen, Duancheng; King, Bryan; Radler, Megan R; Rafii, Shahin; Lowe, Scott W; Allis, C David; Thompson, Craig B

    2018-05-01

    A robust network of transcription factors and an open chromatin landscape are hallmarks of the naive pluripotent state. Recently, the acetyllysine reader Brd4 has been implicated in stem cell maintenance, but the relative contribution of Brd4 to pluripotency remains unclear. Here, we show that Brd4 is dispensable for self-renewal and pluripotency of embryonic stem cells (ESCs). When maintained in their ground state, ESCs retain transcription factor binding and chromatin accessibility independent of Brd4 function or expression. In metastable ESCs, Brd4 independence can be achieved by increased expression of pluripotency transcription factors, including STAT3, Nanog or Klf4, so long as the DNA methylcytosine oxidases Tet1 and Tet2 are present. These data reveal that Brd4 is not essential for ESC self-renewal. Rather, the levels of pluripotency transcription factor abundance and Tet1/2 function determine the extent to which bromodomain recognition of protein acetylation contributes to the maintenance of gene expression and cell identity.

  14. Hypoxia-Response Element (HRE)–Directed Transcriptional Regulation of the Rat Lysyl Oxidase Gene in Response to Cobalt and Cadmium

    PubMed Central

    Li, Wande

    2013-01-01

    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664

  15. [A novel gene (Aa-accA ) encoding acetyl-CoA carboxyltransferase alpha-subunit of Alkalimonas amylolytica N10 enhances salt and alkali tolerance of Escherichia coli and tobacco BY-2 cells].

    PubMed

    Xian, Mingjie; Zhai, Lei; Zhong, Naiqin; Ma, Yiwei; Xue, Yanfen; Ma, Yanhe

    2013-08-04

    Acetyl-CoA carboxylase (ACC) catalyzes the first step of fatty acid synthesis. In most bacteria, ACC is composed of four subunits encoded by accA, accB, accC, and accD. Of them, accA encodes acetyl-CoA carboxyltransferase alpha-subunit. Our prior work on proteomics of Alkalimonas amylolytica N10 showed that the expression of the Aa-accA has a remarkable response to salt and alkali stress. This research aimed to find out the Aa-accA gene contributing to salt and alkali tolerance. The Aa-accA was amplified by PCR from A. amylolytica N10 and expressed in E. coli K12 host. The effects of Aa-accA expression on the growth of transgenic strains were examined under different NaCl concentration and pH conditions. Transgenic tobacco BY-2 cells harboring Aa-accA were also generated via Agrobacterium-mediated transformation. The viability of BY-2 cells was determined with FDA staining method after salt and alkali shock. The Aa-accA gene product has 318 amino acids and is homologous to the carboxyl transferase domain of acyl-CoA carboxylases. It showed 76% identity with AccA (acetyl-CoA carboxylase carboxyltransferase subunit alpha) from E. coli. Compared to the wild-type strains, transgenic E. coli K12 strain containing Aa-accA showed remarkable growth superiority when grown in increased NaCl concentrations and pH levels. The final cell density of the transgenic strains was 2.6 and 3.5 times higher than that of the control type when they were cultivated in LB medium containing 6% (W/V) NaCl and at pH 9, respectively. Complementary expression of Aa-accA in an accA-depletion E. coli can recover the tolerance of K12 delta accA to salt and alkali stresses to some extent. Similar to the transgenic E. coli, transgenic tobacco BY-2 cells showed higher percentages of viability compared to the wild BY-2 cells under the salt or alkali stress condition. We found that Aa-accA from A. amylolytica N10 overexpression enhances the tolerance of both transgenic E. coli and tobacco BY-2 cells to

  16. Crystal Structure of Alcohol Oxidase from Pichia pastoris

    PubMed Central

    Valerius, Oliver; Feussner, Ivo; Ficner, Ralf

    2016-01-01

    FAD-dependent alcohol oxidases (AOX) are key enzymes of methylotrophic organisms that can utilize lower primary alcohols as sole source of carbon and energy. Here we report the crystal structure analysis of the methanol oxidase AOX1 from Pichia pastoris. The crystallographic phase problem was solved by means of Molecular Replacement in combination with initial structure rebuilding using Rosetta model completion and relaxation against an averaged electron density map. The subunit arrangement of the homo-octameric AOX1 differs from that of octameric vanillyl alcohol oxidase and other dimeric or tetrameric alcohol oxidases, due to the insertion of two large protruding loop regions and an additional C-terminal extension in AOX1. In comparison to other alcohol oxidases, the active site cavity of AOX1 is significantly reduced in size, which could explain the observed preference for methanol as substrate. All AOX1 subunits of the structure reported here harbor a modified flavin adenine dinucleotide, which contains an arabityl chain instead of a ribityl chain attached to the isoalloxazine ring. PMID:26905908

  17. Calcium transport in vesicles energized by cytochrome oxidase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rosier, Randy N.

    1979-01-01

    Experiments on the reconstitution of cytochrome oxidase into phospholipid vesicles were carried out using techniques of selectivity energizing the suspensions with ascorbate and cytochrome c or ascorbate, PMS, and internally trapped cytochrome c. It was found that the K + selective ionophore valinomycin stimulated the rate of respiration of cytochrome oxidase vesicles regardless of the direction of the K + flux across the vesicle membranes. The stimulation occurred in the presence of protonophoric uncouplers and in the complete absence of potassium or in detergent-lysed suspensions. Gramicidin had similar effects and it was determined that the ionophores acted by specific interactionmore » with cytochrome oxidase rather than by the previously assumed collapse of membrane potentials. When hydrophobic proteins and appropriate coupling factors were incorporated into the cytochrome oxidase, vesicles phosphorylation of ADP could be coupled to the oxidation reaction of cytochrome oxidase. Relatively low P:O, representing poor coupling of the system, were problematical and precluded measurements of protonmotive force. However the system was used to study ion translocation.« less

  18. Potential U.S. Population Impact of the 2017 ACC/AHA High Blood Pressure Guideline.

    PubMed

    Muntner, Paul; Carey, Robert M; Gidding, Samuel; Jones, Daniel W; Taler, Sandra J; Wright, Jackson T; Whelton, Paul K

    2018-01-16

    The 2017 American College of Cardiology/American Heart Association (ACC/AHA) Guideline for the Prevention, Detection, Evaluation and Management of High Blood Pressure in Adults provides recommendations for the definition of hypertension, systolic and diastolic blood pressure (BP) thresholds for initiation of antihypertensive medication, and BP target goals. This study sought to determine the prevalence of hypertension, implications of recommendations for antihypertensive medication, and prevalence of BP above the treatment goal among U.S. adults using criteria from the 2017 ACC/AHA guideline and the Seventh Report of the Joint National Committee on Prevention, Detection, Evaluation, and Treatment of High Blood Pressure (JNC7). The authors analyzed data from the 2011 to 2014 National Health and Nutrition Examination Survey (N = 9,623). BP was measured 3 times following a standardized protocol and averaged. Results were weighted to produce U.S. population estimates. According to the 2017 ACC/AHA and JNC7 guidelines, the crude prevalence of hypertension among U.S. adults was 45.6% (95% confidence interval [CI]: 43.6% to 47.6%) and 31.9% (95% CI: 30.1% to 33.7%), respectively, and antihypertensive medication was recommended for 36.2% (95% CI: 34.2% to 38.2%) and 34.3% (95% CI: 32.5% to 36.2%) of U.S. adults, respectively. Nonpharmacological intervention is advised for the 9.4% of U.S. adults with hypertension who are not recommended for antihypertensive medication according to the 2017 ACC/AHA guideline. Among U.S. adults taking antihypertensive medication, 53.4% (95% CI: 49.9% to 56.8%) and 39.0% (95% CI: 36.4% to 41.6%) had BP above the treatment goal according to the 2017 ACC/AHA and JNC7 guidelines, respectively. Compared with the JNC7 guideline, the 2017 ACC/AHA guideline results in a substantial increase in the prevalence of hypertension, a small increase in the percentage of U.S. adults recommended for antihypertensive medication, and more intensive BP

  19. Pacific oyster polyamine oxidase: a protein missing link in invertebrate evolution.

    PubMed

    Cervelli, Manuela; Polticelli, Fabio; Angelucci, Emanuela; Di Muzio, Elena; Stano, Pasquale; Mariottini, Paolo

    2015-05-01

    Polyamine oxidases catalyse the oxidation of polyamines and acetylpolyamines and are responsible for the polyamine interconversion metabolism in animal cells. Polyamine oxidases from yeast can oxidize spermine, N(1)-acetylspermine, and N(1)-acetylspermidine, while in vertebrates two different enzymes, namely spermine oxidase and acetylpolyamine oxidase, specifically catalyse the oxidation of spermine, and N(1)-acetylspermine/N(1)-acetylspermidine, respectively. In this work we proved that the specialized vertebrate spermine and acetylpolyamine oxidases have arisen from an ancestor invertebrate polyamine oxidase with lower specificity for polyamine substrates, as demonstrated by the enzymatic activity of the mollusc polyamine oxidase characterized here. This is the first report of an invertebrate polyamine oxidase, the Pacific oyster Crassostrea gigas (CgiPAO), overexpressed as a recombinant protein. This enzyme was biochemically characterized and demonstrated to be able to oxidase both N(1)-acetylspermine and spermine, albeit with different efficiency. Circular dichroism analysis gave an estimation of the secondary structure content and modelling of the three-dimensional structure of this protein and docking studies highlighted active site features. The availability of this pluripotent enzyme can have applications in crystallographic studies and pharmaceutical biotechnologies, including anticancer therapy as a source of hydrogen peroxide able to induce cancer cell death.

  20. Evolution of cytochrome oxidase, an enzyme older than atmospheric oxygen.

    PubMed

    Castresana, J; Lübben, M; Saraste, M; Higgins, D G

    1994-06-01

    Cytochrome oxidase is a key enzyme in aerobic metabolism. All the recorded eubacterial (domain Bacteria) and archaebacterial (Archaea) sequences of subunits 1 and 2 of this protein complex have been used for a comprehensive evolutionary analysis. The phylogenetic trees reveal several processes of gene duplication. Some of these are ancient, having occurred in the common ancestor of Bacteria and Archaea, whereas others have occurred in specific lines of Bacteria. We show that eubacterial quinol oxidase was derived from cytochrome c oxidase in Gram-positive bacteria and that archaebacterial quinol oxidase has an independent origin. A considerable amount of evidence suggests that Proteobacteria (Purple bacteria) acquired quinol oxidase through a lateral gene transfer from Gram-positive bacteria. The prevalent hypothesis that aerobic metabolism arose several times in evolution after oxygenic photosynthesis, is not sustained by two aspects of the molecular data. First, cytochrome oxidase was present in the common ancestor of Archaea and Bacteria whereas oxygenic photosynthesis appeared in Bacteria. Second, an extant cytochrome oxidase in nitrogen-fixing bacteria shows that aerobic metabolism is possible in an environment with a very low level of oxygen, such as the root nodules of leguminous plants. Therefore, we propose that aerobic metabolism in organisms with cytochrome oxidase has a monophyletic and ancient origin, prior to the appearance of eubacterial oxygenic photosynthetic organisms.

  1. Primary Prevention With Statins: ACC/AHA Risk-Based Approach Versus Trial-Based Approaches to Guide Statin Therapy.

    PubMed

    Mortensen, Martin B; Afzal, Shoaib; Nordestgaard, Børge G; Falk, Erling

    2015-12-22

    Guidelines recommend initiating primary prevention for atherosclerotic cardiovascular disease (ASCVD) with statins based on absolute ASCVD risk assessment. Recently, alternative trial-based and hybrid approaches were suggested for statin treatment eligibility. This study compared these approaches in a direct head-to-head fashion in a contemporary population. The study used the CGPS (Copenhagen General Population Study) with 37,892 subjects aged 40 to 75 years recruited in 2003 to 2008, all free of ASCVD, diabetes, and statin use at baseline. Among the population studied, 42% were eligible for statin therapy according to the 2013 American College of Cardiology/American Heart Association (ACC/AHA) risk assessment and cholesterol treatment guidelines approach, versus 56% with the trial-based approach and 21% with the hybrid approach. Among these statin-eligible subjects, the ASCVD event rate per 1,000 person-years was 9.8, 6.8, and 11.2, respectively. The ACC/AHA-recommended absolute risk score was well calibrated around the 7.5% 10-year ASCVD risk treatment threshold and discriminated better than the trial-based or hybrid approaches. Compared with the ACC/AHA risk-based approach, the net reclassification index for eligibility for statin therapy among 40- to 75-year-old subjects from the CGPS was -0.21 for the trial-based approach and -0.13 for the hybrid approach. The clinical performance of the ACC/AHA risk-based approach for primary prevention of ASCVD with statins was superior to the trial-based and hybrid approaches. Our results indicate that the ACC/AHA guidelines will prevent more ASCVD events than the trial-based and hybrid approaches, while treating fewer people compared with the trial-based approach. Copyright © 2015 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.

  2. Identification of vascular patients at very high risk for recurrent cardiovascular events: validation of the current ACC/AHA very high risk criteria.

    PubMed

    van den Berg, M Johanneke; Bhatt, Deepak L; Kappelle, L Jaap; de Borst, Gert J; Cramer, Maarten J; van der Graaf, Yolanda; Steg, Ph Gabriel; Visseren, Frank L J

    2017-11-14

    To validate and assess performance of the current ACC/AHA very high risk criteria in patients with clinically manifest arterial disease. Data were used from the SMART study (n = 7216) and REACH Registry (n = 48 322), two prospective cohorts of patients with manifest atherosclerotic arterial disease. Prevalence and incidence rates of recurrent major adverse cardiovascular events (MACE) were calculated, according to the ACC/AHA VHR criteria (cardiovascular disease combined with diabetes, smoking, dyslipidaemia, and/or recent recurrent coronary events). Performance of the ACC/AHA criteria was compared with single very high risk factors in terms of C-statistics and Net Reclassification Index. All patients were at VHR according to the ESC guidelines (incidence of recurrent MACE in SMART was 2.4/100PY, with 95% CI 2.3-2.5/100PY and in REACH 5.1/100PY with 95% CI 5.0-5.3/100PY). In SMART 57% of the patients were at VHR according to the ACC/AHA criteria (incidence of recurrent MACE 2.7/100PY, 95% CI 2.5-2.9/100PY) and in REACH this was 64% (5.9/100PY, 95% CI 5.7-6.1/100PY). The C-statistic for the ACC/AHA VHR criteria was 0.53 in REACH and 0.54 in SMART. Very high risk factors with comparable or slightly better performance were eGFR < 45, polyvascular disease and age >70 years. Around two third of the patients meeting the ACC/AHA VHR criteria had a predicted 10-year risk of recurrent MACE <30%. The ACC/AHA VHR criteria have limited discriminative power. Identifying patients with clinically manifest arterial disease at VHR for recurrent vascular events using eGFR <45, polyvascular disease, or age >70 years performs as well as the ACC/AHA VHR criteria. Published on behalf of the European Society of Cardiology. All rights reserved. © The Author 2017. For permissions, please email: journals.permissions@oup.com.

  3. GAD65 Promoter Polymorphism rs2236418 Modulates Harm Avoidance in Women via Inhibition/Excitation Balance in the Rostral ACC.

    PubMed

    Colic, Lejla; Li, Meng; Demenescu, Liliana Ramona; Li, Shija; Müller, Iris; Richter, Anni; Behnisch, Gusalija; Seidenbecher, Constanze I; Speck, Oliver; Schott, Björn H; Stork, Oliver; Walter, Martin

    2018-05-30

    Anxiety disorders are common and debilitating conditions with higher prevalence in women. However, factors that predispose women to anxiety phenotypes are not clarified. Here we investigated potential contribution of the single nucleotide polymorphism rs2236418 in GAD2 gene to changes in regional inhibition/excitation balance, anxiety-like traits, and related neural activity in both sexes. One hundred and five healthy individuals were examined with high-field (7T) multimodal magnetic resonance imaging (MRI); including resting-state functional MRI in combination with assessment of GABA and glutamate (Glu) levels via MR spectroscopy. Regional GABA/Glu levels in anterior cingulate cortex (ACC) subregions were assessed as mediators of gene-personality interaction for the trait harm avoidance and moderation by sex was tested. In AA homozygotes, with putatively lower GAD2 promoter activity, we observed increased intrinsic neuronal activity and higher inhibition/excitation balance in pregenual ACC (pgACC) compared with G carriers. The pgACC drove a significant interaction of genotype, region, and sex, where inhibition/excitation balance was significantly reduced only in female AA carriers. This finding was specific for rs2236418 as other investigated single nucleotide polymorphisms of the GABA synthesis related enzymes ( GAD1 , GAD2 , and GLS ) were not significant. Furthermore, only in women there was a negative association of pgACC GABA/Glu ratios with harm avoidance. A moderated-mediation model revealed that pgACC GABA/Glu also mediated the association between the genotype variant and level of harm avoidance, dependent on sex. Our data thus provide new insights into the neurochemical mechanisms that control emotional endophenotypes in humans and constitute predisposing factors for the development of anxiety disorders in women. SIGNIFICANCE STATEMENT Anxiety disorders are among the most common and burdensome psychiatric disorders, with higher prevalence rates in women

  4. Inhibition of Human Vascular NADPH Oxidase by Apocynin Derived Oligophenols

    PubMed Central

    Mora-Pale, Mauricio; Weïwer, Michel; Yu, Jingjing; Linhardt, Robert J.; Dordick, Jonathan S.

    2009-01-01

    Enzymatic oxidation of apocynin, which may mimic in vivo metabolism, affords a large number of oligomers (apocynin oxidation products, AOP) that inhibit vascular NADPH oxidase. In vitro studies of NADPH oxidase activity were performed to identify active inhibitors, resulting in a trimer hydroxylated quinone (IIIHyQ) that inhibited NADPH oxidase with an IC50 = 31 nM. Apocynin itself possessed minimal inhibitory activity. NADPH oxidase is believed to be inhibited through prevention of the interaction between two NADPH oxidase subunits, p47phox and p22phox. To that end, while apocynin was unable to block the interaction of his-tagged p47phox with a surface immobilized biotinalyted p22phox peptide, the IIIHyQ product strongly interfered with this interaction (apparent IC50 = 1.6 μM). These results provide evidence that peroxidase-catalyzed AOP, which consist of oligomeric phenols and quinones, inhibit critical interactions that are involved in the assembly and activation of human vascular NADPH oxidase. PMID:19523836

  5. Current status of NADPH oxidase research in cardiovascular pharmacology.

    PubMed

    Rodiño-Janeiro, Bruno K; Paradela-Dobarro, Beatriz; Castiñeiras-Landeira, María Isabel; Raposeiras-Roubín, Sergio; González-Juanatey, José R; Alvarez, Ezequiel

    2013-01-01

    The implications of reactive oxygen species in cardiovascular disease have been known for some decades. Rationally, therapeutic antioxidant strategies combating oxidative stress have been developed, but the results of clinical trials have not been as good as expected. Therefore, to move forward in the design of new therapeutic strategies for cardiovascular disease based on prevention of production of reactive oxygen species, steps must be taken on two fronts, ie, comprehension of reduction-oxidation signaling pathways and the pathophysiologic roles of reactive oxygen species, and development of new, less toxic, and more selective nicotinamide adenine dinucleotide phosphate (NADPH) oxidase inhibitors, to clarify both the role of each NADPH oxidase isoform and their utility in clinical practice. In this review, we analyze the value of NADPH oxidase as a therapeutic target for cardiovascular disease and the old and new pharmacologic agents or strategies to prevent NADPH oxidase activity. Some inhibitors and different direct or indirect approaches are available. Regarding direct NADPH oxidase inhibition, the specificity of NADPH oxidase is the focus of current investigations, whereas the chemical structure-activity relationship studies of known inhibitors have provided pharmacophore models with which to search for new molecules. From a general point of view, small-molecule inhibitors are preferred because of their hydrosolubility and oral bioavailability. However, other possibilities are not closed, with peptide inhibitors or monoclonal antibodies against NADPH oxidase isoforms continuing to be under investigation as well as the ongoing search for naturally occurring compounds. Likewise, some different approaches include inhibition of assembly of the NADPH oxidase complex, subcellular translocation, post-transductional modifications, calcium entry/release, electron transfer, and genetic expression. High-throughput screens for any of these activities could provide new

  6. Current status of NADPH oxidase research in cardiovascular pharmacology

    PubMed Central

    Rodiño-Janeiro, Bruno K; Paradela-Dobarro, Beatriz; Castiñeiras-Landeira, María Isabel; Raposeiras-Roubín, Sergio; González-Juanatey, José R; Álvarez, Ezequiel

    2013-01-01

    The implications of reactive oxygen species in cardiovascular disease have been known for some decades. Rationally, therapeutic antioxidant strategies combating oxidative stress have been developed, but the results of clinical trials have not been as good as expected. Therefore, to move forward in the design of new therapeutic strategies for cardiovascular disease based on prevention of production of reactive oxygen species, steps must be taken on two fronts, ie, comprehension of reduction-oxidation signaling pathways and the pathophysiologic roles of reactive oxygen species, and development of new, less toxic, and more selective nicotinamide adenine dinucleotide phosphate (NADPH) oxidase inhibitors, to clarify both the role of each NADPH oxidase isoform and their utility in clinical practice. In this review, we analyze the value of NADPH oxidase as a therapeutic target for cardiovascular disease and the old and new pharmacologic agents or strategies to prevent NADPH oxidase activity. Some inhibitors and different direct or indirect approaches are available. Regarding direct NADPH oxidase inhibition, the specificity of NADPH oxidase is the focus of current investigations, whereas the chemical structure-activity relationship studies of known inhibitors have provided pharmacophore models with which to search for new molecules. From a general point of view, small-molecule inhibitors are preferred because of their hydrosolubility and oral bioavailability. However, other possibilities are not closed, with peptide inhibitors or monoclonal antibodies against NADPH oxidase isoforms continuing to be under investigation as well as the ongoing search for naturally occurring compounds. Likewise, some different approaches include inhibition of assembly of the NADPH oxidase complex, subcellular translocation, post-transductional modifications, calcium entry/release, electron transfer, and genetic expression. High-throughput screens for any of these activities could provide new

  7. Alternative oxidase (AOX) and phenolic metabolism in methyl jasmonate-treated hairy root cultures of Daucus carota L.

    PubMed

    Sircar, Debabrata; Cardoso, Hélia G; Mukherjee, Chiranjit; Mitra, Adinpunya; Arnholdt-Schmitt, Birgit

    2012-05-01

    Methyl-jasmonate (MJ)-treated hairy roots of Daucus carota L. were used to study the influence of alternative oxidase (AOX) in phenylpropanoid metabolism. Phenolic acid accumulation, as well as total flavonoids and lignin content of the MJ-treated hairy roots were decreased by treatment with salicylhydroxamic acid (SHAM), a known inhibitor of AOX. The inhibitory effect of SHAM was concentration dependent. Treatment with propyl gallate (PG), another inhibitor of AOX, also had a similar inhibitory effect on accumulation of phenolic acid, total flavonoids and lignin. The transcript levels of two DcAOX genes (DcAOX2a and DcAOX1a) were monitored at selected post-elicitation time points. A notable rise in the transcript levels of both DcAOX genes was observed preceding the MJ-induced enhanced accumulation of phenolics, flavonoids and lignin. An appreciable increase in phenylalanine ammonia-lyase (PAL) transcript level was also observed prior to enhanced phenolics accumulation. Both DcAOX genes showed differential transcript accumulation patterns after the onset of elicitation. The transcript levels of DcAOX1a and DcAOX2a attained peak at 6hours post elicitation (hpe) and 12hpe, respectively. An increase in the transcript levels of both DcAOX genes preceding the accumulation of phenylpropanoid-derivatives and lignin showed a positive correlation between AOX activity and phenylpropanoid biosynthesis. The results provide important new insight about the influence of AOX in phenylpropanoid biosynthesis. Copyright © 2012 Elsevier GmbH. All rights reserved.

  8. HMSN/ACC truncation mutations disrupt brain-type creatine kinase-dependant activation of K+/Cl- co-transporter 3.

    PubMed

    Salin-Cantegrel, Adèle; Shekarabi, Masoud; Holbert, Sébastien; Dion, Patrick; Rochefort, Daniel; Laganière, Janet; Dacal, Sandra; Hince, Pascale; Karemera, Liliane; Gaspar, Claudia; Lapointe, Jean-Yves; Rouleau, Guy A

    2008-09-01

    The potassium-chloride co-transporter 3 (KCC3) is mutated in hereditary motor and sensory neuropathy with agenesis of the corpus callosum (HMSN/ACC); however, the molecular mechanisms of HMSN/ACC pathogenesis and the exact role of KCC3 in the development of the nervous system remain poorly understood. The functional regulation of this transporter by protein partners is also largely unknown. Using a yeast two-hybrid approach, we discovered that the C-terminal domain (CTD) of KCC3, which is lost in most HMSN/ACC-causing mutations, directly interacts with brain-specific creatine kinase (CK-B), an ATP-generating enzyme that is also a partner of KCC2. The interaction of KCC3 with CK-B was further confirmed by in vitro glutathione S-transferase pull-down assay, followed by sequencing of the pulled-down complexes. In transfected cultured cells, immunofluorescence labeling showed that CK-B co-localizes with wild-type KCC3, whereas the kinase fails to interact with the inactive truncated KCC3. Finally, CK-B's inhibition by DNFB results in reduction of activity of KCC3 in functional assays using Xenopus laevis oocytes. This physical and functional association between the co-transporter and CK-B is, therefore, the first protein-protein interaction identified to be potentially involved in the pathophysiology of HMSN/ACC.

  9. Oxygen activation in flavoprotein oxidases: the importance of being positive.

    PubMed

    Gadda, Giovanni

    2012-04-03

    The oxidation of flavin hydroquinones by O(2) in solution is slow, with second-order rate constants of ~250 M(-1) s(-1). This is due to the obligatory, single-electron transfer that initiates the reaction being thermodynamically unfavored and poorly catalyzed. Notwithstanding considerations of O(2) accessibility to the reaction site, its desolvation and geometry and other factors that can also contribute to further rate acceleration, flavoprotein oxidases must activate O(2) for reaction with flavin hydroquinones to be able to achieve the 100-1000-fold rate enhancements typically observed. Protein positive charges have been identified in glucose oxidase, monomeric sarcosine oxidase, N-methyltryptophan oxidase and fructosamine oxidase that electrostatically stabilize the transition state for the initial single electron transfer that generates the O(2)(-•)/flavin semiquinone radical pair. In choline oxidase despite the presence of three histidines in the active site, the trimethylammonium group of the reaction product provides such an electrostatic stabilization. A nonpolar site proximal to the flavin C(4a) atom in choline oxidase has also been identified, which contributes to the geometry and desolvation of the O(2) reaction site. The relevance of O(2) activation by product charges to other flavoprotein oxidases, such as for example those catalyzing amine oxidations, is discussed in this review. A nonpolar site close to the flavin C(4a) atom and a positive charge is identified through structural analysis in several flavoprotein oxidases. Mutagenesis has disclosed nonpolar sites in O(2)-reducing enzymes that utilize copper/TPQ or iron. It is predicted that classes of O(2)-reducing enzymes utilizing other cofactors also contain a similar catalytic motif.

  10. The First Mammalian Aldehyde Oxidase Crystal Structure

    PubMed Central

    Coelho, Catarina; Mahro, Martin; Trincão, José; Carvalho, Alexandra T. P.; Ramos, Maria João; Terao, Mineko; Garattini, Enrico; Leimkühler, Silke; Romão, Maria João

    2012-01-01

    Aldehyde oxidases (AOXs) are homodimeric proteins belonging to the xanthine oxidase family of molybdenum-containing enzymes. Each 150-kDa monomer contains a FAD redox cofactor, two spectroscopically distinct [2Fe-2S] clusters, and a molybdenum cofactor located within the protein active site. AOXs are characterized by broad range substrate specificity, oxidizing different aldehydes and aromatic N-heterocycles. Despite increasing recognition of its role in the metabolism of drugs and xenobiotics, the physiological function of the protein is still largely unknown. We have crystallized and solved the crystal structure of mouse liver aldehyde oxidase 3 to 2.9 Å. This is the first mammalian AOX whose structure has been solved. The structure provides important insights into the protein active center and further evidence on the catalytic differences characterizing AOX and xanthine oxidoreductase. The mouse liver aldehyde oxidase 3 three-dimensional structure combined with kinetic, mutagenesis data, molecular docking, and molecular dynamics studies make a decisive contribution to understand the molecular basis of its rather broad substrate specificity. PMID:23019336

  11. Partially dissociable roles of OFC and ACC in stimulus-guided and action-guided decision making.

    PubMed

    Khani, Abbas

    2014-05-01

    Recently, the functional specialization of prefrontal areas of the brain, and, specifically, the functional dissociation of the orbitofrontal cortex (OFC) and the anterior cingulate cortex (ACC), during decision making have become a particular focus of research. A number of neuropsychological and lesion studies have shown that the OFC and ACC have dissociable functions in various dimensions of decision making, which are supported by their different anatomical connections. A recent single-neuron study, however, described a more complex picture of the functional dissociation between these two frontal regions during decision making. Here, I discuss the results of that study and consider alternative interpretations in connection with other findings.

  12. CotA, a Multicopper Oxidase from Bacillus pumilus WH4, Exhibits Manganese-Oxidase Activity

    PubMed Central

    Su, Jianmei; Bao, Peng; Bai, Tenglong; Deng, Lin; Wu, Hui; Liu, Fan; He, Jin

    2013-01-01

    Multicopper oxidases (MCOs) are a family of enzymes that use copper ions as cofactors to oxidize various substrates. Previous research has demonstrated that several MCOs such as MnxG, MofA and MoxA can act as putative Mn(II) oxidases. Meanwhile, the endospore coat protein CotA from Bacillus species has been confirmed as a typical MCO. To study the relationship between CotA and the Mn(II) oxidation, the cotA gene from a highly active Mn(II)-oxidizing strain Bacillus pumilus WH4 was cloned and overexpressed in Escherichia coli strain M15. The purified CotA contained approximately four copper atoms per molecule and showed spectroscopic properties typical of blue copper oxidases. Importantly, apart from the laccase activities, the CotA also displayed substantial Mn(II)-oxidase activities both in liquid culture system and native polyacrylamide gel electrophoresis. The optimum Mn(II) oxidase activity was obtained at 53°C in HEPES buffer (pH 8.0) supplemented with 0.8 mM CuCl2. Besides, the addition of o-phenanthroline and EDTA both led to a complete suppression of Mn(II)-oxidizing activity. The specific activity of purified CotA towards Mn(II) was 0.27 U/mg. The Km, Vmax and kcat values towards Mn(II) were 14.85±1.17 mM, 3.01×10−6±0.21 M·min−1 and 0.32±0.02 s−1, respectively. Moreover, the Mn(II)-oxidizing activity of the recombinant E. coli strain M15-pQE-cotA was significantly increased when cultured both in Mn-containing K liquid medium and on agar plates. After 7-day liquid cultivation, M15-pQE-cotA resulted in 18.2% removal of Mn(II) from the medium. Furthermore, the biogenic Mn oxides were clearly observed on the cell surfaces of M15-pQE-cotA by scanning electron microscopy. To our knowledge, this is the first report that provides the direct observation of Mn(II) oxidation with the heterologously expressed protein CotA, Therefore, this novel finding not only establishes the foundation for in-depth study of Mn(II) oxidation mechanisms, but also offers a

  13. Implications of terminal oxidase function in regulation of salicylic acid on soybean seedling photosynthetic performance under water stress.

    PubMed

    Tang, Yanping; Sun, Xin; Wen, Tao; Liu, Mingjie; Yang, Mingyan; Chen, Xuefei

    2017-03-01

    The aim of this study is to investigate whether exogenous application of salicylic acid (SA) could modulate the photosynthetic capacity of soybean seedlings in water stress tolerance, and to clarify the potential functions of terminal oxidase (plastid terminal oxidase (PTOX) and alternative oxidase (AOX)) in SA' s regulation on photosynthesis. The effects of SA and water stress on gas exchange, pigment contents, chlorophyll fluorescence, enzymes (guaiacol peroxidase (POD; EC 1.11.1.7), superoxide dismutase (SOD; EC 1.15.1.1), catalase (CAT; EC 1.11.1.6), ascorbate peroxidase (APX; EC 1.11.1.11) and NADP-malate dehydrogenase (NADP-MDH; EC1.1.1.82)) activity and transcript levels of PTOX, AOX1, AOX2a, AOX2b were examined in a hydroponic cultivation system. Results indicate that water stress significantly decreased the photosynthetic rate (Pn), stomatal conductance (Gs), transpiration rate (E), pigment contents (Chla + b, Chla/b, Car), maximum quantum yield of PSⅡphotochemistry (Fv/Fm), efficiency of excitation capture of open PSⅡcenter (Fv'/Fm'), quantum efficiency of PSⅡphotochemistry (ΦPSⅡ), photochemical quenching (qP), and increased malondialdehyde (MDA) content and the activity of all the enzymes. SA pretreatment led to significant decreases in Ci and MDA content, and increases in Pn, Gs, E, pigment contents, Fv/Fm, Fv'/Fm', ΦPSⅡ, qP, and the activity of all the enzymes. SA treatment and water stress alone significantly up-regulated the expression of PTOX, AOX1 and AOX2b. SA pretreatment further increased the transcript levels of PTOX and AOX2b of soybean seedling under water stress. These results indicate that SA application alleviates the water stress-induced decrease in photosynthesis may mainly through maintaining a lower reactive oxygen species (ROS) level, a greater PSⅡefficiency, and an enhanced alternative respiration and chlororespiration. PTOX and AOX may play important roles in SA-mediated resistance to water stress. Copyright © 2016

  14. Generating disulfides with the quiescin sulfhydryl oxidases

    PubMed Central

    Heckler, Erin J.; Rancy, Pumtiwitt C.; Kodali, Vamsi K.; Thorpe, Colin

    2008-01-01

    The Quiescin-sulfhydryl oxidase (QSOX) family of flavoenzymes catalyzes the direct and facile insertion of disulfide bonds into unfolded reduced proteins with concomitant reduction of oxygen to hydrogen peroxide. This review discusses the chemical mechanism of these enzymes and the involvement of thioredoxin and flavin-binding domains in catalysis. The variability of CxxC motifs in the QSOX family is highlighted and attention is drawn to the steric factors that may promote efficient thiol/disulfide exchange during oxidative protein folding. The varied cellular location of these multi-domain sulfhydryl oxidases is reviewed and potential intracellular and extracellular roles are summarized. Finally, this review identifies important unresolved questions concerning this ancient family of sulfhydryl oxidases. PMID:17980160

  15. Doctors' knowledge, attitudes, and compliance with 2013 ACC/AHA guidelines for prevention of atherosclerotic cardiovascular disease in Singapore.

    PubMed

    Setia, Sajita; Fung, Selwyn Sze-Wang; Waters, David D

    2015-01-01

    There is an unmet need for strategies to prevent atherosclerotic cardiovascular disease in Singapore. The main objective of this study was to investigate Singapore physicians' response to the 2013 American College of Cardiology and American Heart Association (ACC/AHA) guidelines for treatment of cholesterol and their impact on clinical practice. This survey was conducted in two stages, qualitative and quantitative. Physicians were initially screened on the basis of an initial screener questionnaire, and eligible physicians were then included in the study. Qualitative (n=19) and quantitative (n=66) surveys were completed by eligible physicians from Singapore. Physicians were less familiar with the 2013 ACC/AHA guidelines (35%) as compared with the Singapore Ministry of Health (MoH) lipid guidelines 2006 (49%). Of the physicians whose opinion was sought on the ACC/AHA guidelines, more than 50% disagreed with the definition of high-, moderate-, and low-intensity statin therapy; recommendation of atorvastatin 40-80 mg and rosuvastatin 20-40 mg as medications for high-intensity statin therapy; and classification of individuals who would benefit from moderate- to high-intensity statin therapy. Most physicians assumed that Asians may be intolerant to high-intensity statin therapy. Although embracing the 2013 ACC/AHA guidelines in clinical practice is expected to provide better clinical care to patients, our study revealed high reluctance by physicians, especially in the use of high-dose statins. However, ACC/AHA guidelines can be easily adopted in Asia as there is a wealth of data available for atorvastatin in primary and secondary prevention of atherosclerotic cardiovascular disease with similar efficacy and safety profiles in the white and Asian populations.

  16. The ACC/AHA 2013 pooled cohort equations compared to a Korean Risk Prediction Model for atherosclerotic cardiovascular disease.

    PubMed

    Jung, Keum Ji; Jang, Yangsoo; Oh, Dong Joo; Oh, Byung-Hee; Lee, Sang Hoon; Park, Seong-Wook; Seung, Ki-Bae; Kim, Hong-Kyu; Yun, Young Duk; Choi, Sung Hee; Sung, Jidong; Lee, Tae-Yong; Kim, Sung Hi; Koh, Sang Baek; Kim, Moon Chan; Chang Kim, Hyeon; Kimm, Heejin; Nam, Chungmo; Park, Sungha; Jee, Sun Ha

    2015-09-01

    To evaluate the performance of the American College of Cardiology/American Heart Association (ACC/AHA) 2013 Pooled Cohort Equations in the Korean Heart Study (KHS) population and to develop a Korean Risk Prediction Model (KRPM) for atherosclerotic cardiovascular disease (ASCVD) events. The KHS cohort included 200,010 Korean adults aged 40-79 years who were free from ASCVD at baseline. Discrimination, calibration, and recalibration of the ACC/AHA Equations in predicting 10-year ASCVD risk in the KHS cohort were evaluated. The KRPM was derived using Cox model coefficients, mean risk factor values, and mean incidences from the KHS cohort. In the discriminatory analysis, the ACC/AHA Equations' White and African-American (AA) models moderately distinguished cases from non-cases, and were similar to the KRPM: For men, the area under the receiver operating characteristic curve (AUROCs) were 0.727 (White model), 0.725 (AA model), and 0.741 (KRPM); for women, the corresponding AUROCs were 0.738, 0.739, and 0.745. Absolute 10-year ASCVD risk for men in the KHS cohort was overestimated by 56.5% (White model) and 74.1% (AA model), while the risk for women was underestimated by 27.9% (White model) and overestimated by 29.1% (AA model). Recalibration of the ACC/AHA Equations did not affect discriminatory ability but improved calibration substantially, especially in men in the White model. Of the three ASCVD risk prediction models, the KRPM showed best calibration. The ACC/AHA Equations should not be directly applied for ASCVD risk prediction in a Korean population. The KRPM showed best predictive ability for ASCVD risk. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  17. Doctors’ knowledge, attitudes, and compliance with 2013 ACC/AHA guidelines for prevention of atherosclerotic cardiovascular disease in Singapore

    PubMed Central

    Setia, Sajita; Fung, Selwyn Sze-Wang; Waters, David D

    2015-01-01

    Purpose There is an unmet need for strategies to prevent atherosclerotic cardiovascular disease in Singapore. The main objective of this study was to investigate Singapore physicians’ response to the 2013 American College of Cardiology and American Heart Association (ACC/AHA) guidelines for treatment of cholesterol and their impact on clinical practice. Methods This survey was conducted in two stages, qualitative and quantitative. Physicians were initially screened on the basis of an initial screener questionnaire, and eligible physicians were then included in the study. Results Qualitative (n=19) and quantitative (n=66) surveys were completed by eligible physicians from Singapore. Physicians were less familiar with the 2013 ACC/AHA guidelines (35%) as compared with the Singapore Ministry of Health (MoH) lipid guidelines 2006 (49%). Of the physicians whose opinion was sought on the ACC/AHA guidelines, more than 50% disagreed with the definition of high-, moderate-, and low-intensity statin therapy; recommendation of atorvastatin 40–80 mg and rosuvastatin 20–40 mg as medications for high-intensity statin therapy; and classification of individuals who would benefit from moderate- to high-intensity statin therapy. Most physicians assumed that Asians may be intolerant to high-intensity statin therapy. Conclusion Although embracing the 2013 ACC/AHA guidelines in clinical practice is expected to provide better clinical care to patients, our study revealed high reluctance by physicians, especially in the use of high-dose statins. However, ACC/AHA guidelines can be easily adopted in Asia as there is a wealth of data available for atorvastatin in primary and secondary prevention of atherosclerotic cardiovascular disease with similar efficacy and safety profiles in the white and Asian populations. PMID:26082642

  18. Mentoring in 2 + 2 Programs: LISD/ACC 2 + 2 Articulation Project.

    ERIC Educational Resources Information Center

    Center for Occupational Research and Development, Inc., Waco, TX.

    The role of mentoring in the 2 + 2 Instrumentation and Control (I&C) articulation project between the Leander Independent School District (LISD) and Austin Community College (ACC) is discussed in this document. Following a brief history of the origin and function of the mentor, the paper explains the need for the mentoring system in the I&C…

  19. Sound the Alarm: The Effect of Narcissism on Retaliatory Aggression is Moderated by dACC Reactivity to Rejection

    PubMed Central

    Chester, David S.; DeWall, C. Nathan

    2015-01-01

    Objective Narcissists behave aggressively when their egos are threatened by interpersonal insults. This effect has been explained in terms of narcissist’s motivation to reduce the discrepancy between their grandiose self and its threatened version, though no research has directly tested this hypothesis. If this notion is true, the link between narcissism and retaliatory aggression should be moderated by neural structures that subserve discrepancy detection, such as the dorsal anterior cingulate cortex (dACC). This study tested the hypothesis that narcissism would only predict greater retaliatory aggression in response to social rejection when the dACC was recruited by the threat. Method Thirty participants (15 females; MAge=18.86, SD=1.25; 77% White) completed a trait narcissism inventory, were socially accepted and then rejected while undergoing fMRI, and then could behave aggressively towards one of the rejecters by blasting them with unpleasant noise. Results When narcissists displayed greater dACC activation during rejection, they behaved aggressively. But there was only a weak or nonsignificant relation between narcissism and aggression among participants with a blunted dACC response. Conclusions Narcissism’s role in aggressive retaliation to interpersonal threats is likely determined by the extent to which the brain’s discrepancy detector registers the newly-created gap between the grandiose and threatened selves. PMID:25564936

  20. Parametric modulation of reward sequences during a reversal task in ACC and VMPFC but not amygdala and striatum.

    PubMed

    Becker, Michael P I; Nitsch, Alexander M; Hewig, Johannes; Miltner, Wolfgang H R; Straube, Thomas

    2016-12-01

    Several regions of the frontal cortex interact with striatal and amygdala regions to mediate the evaluation of reward-related information and subsequent adjustment of response choices. Recent theories discuss the particular relevance of dorsal anterior cingulate cortex (dACC) for switching behavior; consecutively, ventromedial prefrontal cortex (VMPFC) is involved in mediating exploitative behaviors by tracking reward values unfolding after the behavioral switch. Amygdala, on the other hand, has been implied in coding the valence of stimulus-outcome associations and the ventral striatum (VS) has consistently been shown to code a reward prediction error (RPE). Here, we used fMRI data acquired in humans during a reversal task to parametrically model different sequences of positive feedback in order to unravel differential contributions of these brain regions to the tracking and exploitation of rewards. Parameters from an Optimal Bayesian Learner accurately predicted the divergent involvement of dACC and VMPFC during feedback processing: dACC signaled the first, but not later, presentations of positive feedback, while VMPFC coded trial-by-trial accumulations in reward value. Our results confirm that dACC carries a prominent confirmatory signal during processing of first positive feedback. Amygdala coded positive feedbacks more uniformly, while striatal regions were associated with RPE. Copyright © 2016 Elsevier Inc. All rights reserved.

  1. Comparison of the ACC/AHA and Framingham algorithms to assess cardiovascular risk in HIV-infected patients.

    PubMed

    Pinto Neto, Lauro Ferreira da Silva; Dias, Fernanda Rezende; Bressan, Flavia Feres; Santos, Carolina Rocio Oliveira

    The aim of this study was to compare the predictions of Framingham cardiovascular (CV) risk score (FRS) and the American College of Cardiology/American Heart Association (ACC/AHA) risk score in an HIV outpatient clinic in the city of Vitoria, Espirito Santo, Brazil. In a cross-sectional study 341 HIV infected patients over 40 years old consecutively recruited were interviewed. Cohen's kappa coefficient was used to assess agreement between the two algorithms. 61.3% were stratified as low risk by Framingham score, compared with 54% by ACC/AHA score (Spearman correlation 0.845; p<0.000). Only 26.1% were classified as cardiovascular high risk by Framingham compared to 46% by ACC/AHA score (Kappa=0.745; p<0.039). Only one out of eight patients had cardiovascular high risk by Framingham at the time of a myocardial infarction event registered up to five years before the study period. Both cardiovascular risk scores but especially Framingham underestimated high-risk patients in this HIV-infected population. Copyright © 2017 Sociedade Brasileira de Infectologia. Published by Elsevier Editora Ltda. All rights reserved.

  2. Applicability of the 2013 ACC/AHA Risk Assessment and Cholesterol Treatment Guidelines in the real world: results from a multiethnic case-control study.

    PubMed

    Magnoni, Marco; Berteotti, Martina; Norata, Giuseppe Danilo; Limite, Luca Rosario; Peretto, Giovanni; Cristell, Nicole; Maseri, Attilio; Cianflone, Domenico

    2016-01-01

    The 2013 ACC/AHA cholesterol treatment guidelines have introduced a new cardiovascular risk assessment approach (PCE) and have revisited the threshold for prescribing statins. This study aims to compare the ex ante application of the ACC/AHA and the ATP-III guideline models by using a multiethnic case-control study. ATP-III-FRS and PCE were assessed in 739 patients with first STEMI and 739 age- and gender-matched controls; the proportion of cases and controls that would have been eligible for statin as primary prevention therapy and the discriminatory ability of both models were evaluated. The application of the ACC/AHA compared to the ATP-III model, resulted in an increase in sensitivity [94% (95%CI: 91%-95%) vs. 65% (61%-68%), p< 0.0001], a reduction in specificity [19% (15%-22%) vs. 55% (51%-59%), p< 0.0001] with similar global accuracy [0.56 (0.53-0.59) vs.0.59 (0.57-0.63), p ns]. When stratifying for ethnicity, the accuracy of the ACC/AHA model was higher in Europeans than in Chinese (p = 0.003) and to identified premature STEMI patients within Europeans much better compared to the ATP-III model (p = 0.0289). The application of the ACC/AHA model resulted in a significant reduction of first STEMI patients who would have escaped from preventive treatment. Age and ethnicity affected the accuracy of the ACC/AHA model improving the identification of premature STEMI among Europeans only. Key messages According to the ATP-III guideline model, about one-third of patients with STEMI would not be eligible for primary preventive treatment before STEMI. The application of the new ACC/AHA cholesterol treatment guideline model leads to a significant reduction of the percentage of patients with STEMI who would have been considered at lower risk before the STEMI. The global accuracy of the new ACC/AHA model is higher in the Europeans than in the Chinese and, moreover, among the Europeans, the application of the new ACC/AHA guideline model also improved

  3. The NADPH oxidase inhibitor apocynin induces nitric oxide synthesis via oxidative stress

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Riganti, Chiara; Costamagna, Costanzo; Doublier, Sophie

    We have recently shown that apocynin elicits an oxidative stress in N11 mouse glial cells and other cell types. Here we report that apocynin increased the accumulation of nitrite, the stable derivative of nitric oxide (NO), in the extracellular medium of N11 cell cultures, and the NO synthase (NOS) activity in cell lysates. The increased synthesis of NO was associated with increased expression of inducible NOS (iNOS) mRNA, increased nuclear translocation of the redox-sensitive transcription factor NF-{kappa}B and decreased intracellular level of its inhibitor IkB{alpha}. These effects, accompanied by increased production of H{sub 2}O{sub 2}, were very similar to thosemore » observed after incubation with bacterial lipopolysaccharide (LPS) and were inhibited by catalase. These results suggest that apocynin, similarly to LPS, induces increased NO synthesis by eliciting a generation of reactive oxygen species (ROS), which in turn causes NF-{kappa}B activation and increased expression of iNOS. Therefore, the increased bioavailability of NO reported in the literature after in vivo or in vitro treatments with apocynin might depend, at least partly, on the drug-elicited induction of iNOS, and not only on the inhibition of NADPH oxidase and the subsequent decreased scavenging of NO by oxidase-derived ROS, as it is often supposed.« less

  4. THE PREPARATION AND PROPERTIES OF HIGHLY PURIFIED ASCORBIC ACID OXIDASE

    PubMed Central

    Powers, Wendell H.; Lewis, Stanley; Dawson, Charles R.

    1944-01-01

    1. A method is described for the preparation of a highly purified ascorbic acid oxidase containing 0.24 per cent copper. 2. Using comparable activity measurements, this oxidase is about one and a half times as active on a dry weight basis as the hitherto most highly purified preparation described by Lovett-Janison and Nelson. The latter contained 0.15 per cent copper. 3. The oxidase activity is proportional to the copper content and the proportionality factor is the same as that reported by Lovett-Janison and Nelson. 4. When dialyzed free of salt, the blue concentrated oxidase solutions precipitate a dark green-blue protein which carries the activity. This may be prevented by keeping the concentrated solutions about 0.1 M in Na2HPO4. 5. When highly diluted for activity measurements the oxidase rapidly loses activity (irreversibly) previous to the measurement, unless the dilution is made with a dilute inert protein (gelatin) solution. Therefore activity values obtained using such gelatin-stabilized dilute solutions of the oxidase run considerably higher than values obtained by the Lovett-Janison and Nelson technique. 6. The effect of pH and substrate concentration on the activity of the purified oxidase in the presence and absence of inert protein was studied. PMID:19873382

  5. Amine oxidases as important agents of pathological processes of rhabdomyolysis in rats.

    PubMed

    Gudkova, O O; Latyshko, N V; Shandrenko, S G

    2016-01-01

    In this study we have tested an idea on the important role of amine oxidases (semicarbazide-sensitive amine oxidase, diamine oxidase, polyamine oxidase) as an additional source of oxidative/carbonyl stress under glycerol-induced rhabdomyolysis, since the enhanced formation of reactive oxygen species and reactive carbonyl species in a variety of tissues is linked to various diseases. In our experiments we used the sensitive fluorescent method devised for estimation of amine oxidases activity in the rat kidney and thymus as targeted organs under rhabdomyolysis. We have found in vivo the multiple rises in activity of semicarbazide-sensitive amine oxidase, diamine oxidase, polyamine oxidase (2-4.5 times) in the corresponding cell fractions, whole cells or their lysates at the 3-6th day after glycerol injection. Aberrant antioxidant activities depended on rhabdomyolysis stage and had organ specificity. Additional treatment of animals with metal chelator ‘Unithiol’ adjusted only the activity of antioxidant enzymes but not amine oxidases in both organs. Furthermore the in vitro experiment showed that Fenton reaction (hydrogen peroxide in the presence of iron) products alone had no effect on semicarbazide-sensitive amine oxidase activity in rat liver cell fraction whereas supplementation with methylglyoxal resulted in its significant 2.5-fold enhancement. Combined action of the both agents had additive effect on semicarbazide-sensitive amine oxidase activity. We can assume that biogenic amine and polyamine catabolism by amine oxidases is upregulated by oxidative and carbonyl stress factors directly under rhabdomyolysis progression, and the increase in catabolic products concentration contributes to tissue damage in glycerol-induced acute renal failure and apoptosis stimulation in thymus.

  6. Regulatory role of glycogen synthase kinase 3 for transcriptional activity of ADD1/SREBP1c.

    PubMed

    Kim, Kang Ho; Song, Min Jeong; Yoo, Eung Jae; Choe, Sung Sik; Park, Sang Dai; Kim, Jae Bum

    2004-12-10

    Adipocyte determination- and differentiation-dependent factor 1 (ADD1) plays important roles in lipid metabolism and insulin-dependent gene expression. Because insulin stimulates carbohydrate and lipid synthesis, it would be important to decipher how the transcriptional activity of ADD1/SREBP1c is regulated in the insulin signaling pathway. In this study, we demonstrated that glycogen synthase kinase (GSK)-3 negatively regulates the transcriptional activity of ADD1/SREBP1c. GSK3 inhibitors enhanced a transcriptional activity of ADD1/SREBP1c and expression of ADD1/SREBP1c target genes including fatty acid synthase (FAS), acetyl-CoA carboxylase 1 (ACC1), and steroyl-CoA desaturase 1 (SCD1) in adipocytes and hepatocytes. In contrast, overexpression of GSK3beta down-regulated the transcriptional activity of ADD1/SREBP1c. GSK3 inhibitor-mediated ADD1/SREBP1c target gene activation did not require de novo protein synthesis, implying that GSK3 might affect transcriptional activity of ADD1/SREBP1c at the level of post-translational modification. Additionally, we demonstrated that GSK3 efficiently phosphorylated ADD1/SREBP1c in vitro and in vivo. Therefore, these data suggest that GSK3 inactivation is crucial to confer stimulated transcriptional activity of ADD1/SREBP1c for insulin-dependent gene expression, which would coordinate lipid and glucose metabolism.

  7. Heterologous expression and characterization of mouse spermine oxidase.

    PubMed

    Cervelli, Manuela; Polticelli, Fabio; Federico, Rodolfo; Mariottini, Paolo

    2003-02-14

    Polyamine oxidases are key enzymes responsible of the polyamine interconversion metabolism in animal cells. Recently, a novel enzyme belonging to this class of enzymes has been characterized for its capability to oxidize preferentially spermine and designated as spermine oxidase. This is a flavin adenine dinucleotide-containing enzyme, and it has been expressed both in vitro and in vivo systems. The primary structure of mouse spermine oxidase (mSMO) was deduced from a cDNA clone (Image Clone 264769) recovered by a data base search utilizing the human counterpart of polyamine oxidases, PAOh1. The open reading frame predicts a 555-amino acid protein with a calculated M(r) of 61,852.30, which shows a 95.1% identity with PAOh1. To understand the biochemical properties of mSMO and its structure/function relationship, the mSMO cDNA has been subcloned and expressed in secreted and secreted-tagged forms into Escherichia coli BL21 DE3 cells. The recombinant enzyme shows an optimal pH value of 8.0 and is able to oxidize rapidly spermine to spermidine and 3-aminopropanal and fails to act upon spermidine and N(1)-acetylpolyamines. The purified recombinant-tagged form enzyme (M(r) approximately 68,000) has K(m) and k(cat) values of 90 microm and 4.5 s(-1), respectively, using spermine as substrate at pH 8.0. Molecular modeling of mSMO protein based on maize polyamine oxidase three-dimensional structure suggests that the general features of maize polyamine oxidase active site are conserved in mSMO.

  8. Carbonate mineralization via an amorphous calcium carbonate (ACC) pathway: Tuning polymorph selection by Mg, pH, and mixing environment

    NASA Astrophysics Data System (ADS)

    Dove, P. M.; Blue, C.; Mergelsberg, S. T.; Giuffre, A. J.; Han, N.; De Yoreo, J. J.

    2017-12-01

    Mineral formation by nonclassical processes is widespread with many pathways that include aggregation of nanoparticles, oriented attachment of fully formed crystals, and sequential nucleation/transformation of amorphous phases (De Yoreo et al., 2015, Science). Field observations indicate amorphous calcium carbonate (ACC) can be the initial precipitate when local conditions promote high supersaturations for short time periods. Examples include microbial mats, marine porewaters that undergo pulses of increased alkalinity, closed basin lakes, and sabkhas. The crystalline products exhibit diverse morphologies and complex elemental and isotopic signatures. This study quantifies relationships between solution composition and the crystalline polymorphs that transform from ACC (Blue et al., GCA, 2017). Our experimental design synthesized ACC under controlled conditions for a suite of compositions by tuning input pH, Mg/Ca, and total carbonate concentration. ACC products were allowed to transform within output suspensions under stirred or quiescent mixing while characterizing the polymorph and composition of evolving solutions and solids. We find that ACC transforms to crystalline polymorphs with a systematic relationship to solution composition to give a quantitative framework based upon solution aMg2+/aCa2+ and aCO32-/aCa2+. We also measure a polymorph-specific evolution of pH and Mg/Ca during the transformation that indicates the initial polymorph to form. Pathway is further modulated by stirring versus quiescent conditions. The findings reconcile discrepancies among previous studies of ACC to crystalline products and supports claims that monohydrocalcite may be an overlooked, transient phase during formation of some aragonite and calcite deposits. Organic additives and extreme pH are not required to tune composition and polymorph. Insights from this study reiterate the need to revisit long-standing dogmas regarding controls on CaCO3 polymorph selection. Classical models

  9. Putting together a plasma membrane NADH oxidase: a tale of three laboratories.

    PubMed

    Löw, Hans; Crane, Frederick L; Morré, D James

    2012-11-01

    The observation that high cellular concentrations of NADH were associated with low adenylate cyclase activity led to a search for the mechanism of the effect. Since cyclase is in the plasma membrane, we considered the membrane might have a site for NADH action, and that NADH might be oxidized at that site. A test for NADH oxidase showed very low activity, which could be increased by adding growth factors. The plasma membrane oxidase was not inhibited by inhibitors of mitochondrial NADH oxidase such as cyanide, rotenone or antimycin. Stimulation of the plasma membrane oxidase by iso-proterenol or triiodothyronine was different from lack of stimulation in endoplasmic reticulum. After 25 years of research, three components of a trans membrane NADH oxidase have been discovered. Flavoprotein NADH coenzyme Q reductases (NADH cytochrome b reductase) on the inside, coenzyme Q in the middle, and a coenzyme Q oxidase on the outside as a terminal oxidase. The external oxidase segment is a copper protein with unique properties in timekeeping, protein disulfide isomerase and endogenous NADH oxidase activity, which affords a mechanism for control of cell growth by the overall NADH oxidase and the remarkable inhibition of oxidase activity and growth of cancer cells by a wide range of anti-tumor drugs. A second trans plasma membrane electron transport system has been found in voltage dependent anion channel (VDAC), which has NADH ferricyanide reductase activity. This activity must be considered in relation to ferricyanide stimulation of growth and increased VDAC antibodies in patients with autism. Copyright © 2012 Elsevier Ltd. All rights reserved.

  10. Oxidative Stress by Monoamine Oxidase-A Impairs Transcription Factor EB Activation and Autophagosome Clearance, Leading to Cardiomyocyte Necrosis and Heart Failure.

    PubMed

    Santin, Yohan; Sicard, Pierre; Vigneron, François; Guilbeau-Frugier, Céline; Dutaur, Marianne; Lairez, Olivier; Couderc, Bettina; Manni, Diego; Korolchuk, Viktor I; Lezoualc'h, Frank; Parini, Angelo; Mialet-Perez, Jeanne

    2016-07-01

    In heart failure (HF), mitochondrial quality control and autophagy are progressively impaired, but the role of oxidative stress in this process and its underlying mechanism remain to be defined. By degrading norepinephrine and serotonin, the mitochondrial enzyme, monoamine oxidase-A (MAO-A), is a potent source of reactive oxygen species (ROS) in the heart and its activation leads to the persistence of mitochondrial damage. In this study, we analyzed the consequences of ROS generation by MAO-A on the autophagy-lysosome pathway in the heart. Cardiomyocyte-driven expression of MAO-A in mice led to mitochondrial fission and translocation of Drp1 and Parkin in the mitochondrial compartment. Ventricles from MAO-A transgenic mice displayed accumulation of LC3-positive autophagosomes, together with p62 and ubiquitylated proteins, indicating impairment of autophagy. In vitro adenoviral delivery of MAO-A in cardiomyocytes and the consequent generation of ROS blocked autophagic flux with accumulation of LC3II, p62, and ubiquitylated proteins, leading to mitochondrial fission and cell necrosis. In addition, MAO-A activation induced accumulation of lysosomal proteins, cathepsin D and Lamp1, reduced lysosomal acidification, and blocked the nuclear translocation of transcription factor-EB (TFEB), a master regulator of autophagy and lysosome biogenesis. Most interestingly, overexpression of TFEB attenuated autophagosome buildup, mitochondrial fission, cardiomyocyte death, and HF associated with MAO-A activation. This study unravels a new link between MAO-dependent H2O2 production and lysosomal dysfunction. Altogether, our findings demonstrate that the MAO-A/H2O2 axis has a negative impact on the elimination and recycling of mitochondria through the autophagy-lysosome pathway, which participates in cardiomyocyte death and HF. Antioxid. Redox Signal. 25, 10-27.

  11. In Situ Enzymatically Generated Photoswitchable Oxidase Mimetics and Their Application for Colorimetric Detection of Glucose Oxidase.

    PubMed

    Cao, Gen-Xia; Wu, Xiu-Ming; Dong, Yu-Ming; Li, Zai-Jun; Wang, Guang-Li

    2016-07-09

    In this study, a simple and amplified colorimetric assay is developed for the detection of the enzymatic activity of glucose oxidase (GOx) based on in situ formation of a photoswitchable oxidase mimetic of PO₄(3-)-capped CdS quantum dots (QDs). GOx catalyzes the oxidation of 1-thio-β-d-glucose to give 1-thio-β-d-gluconic acid which spontaneously hydrolyzes to β-d-gluconic acid and H₂S; the generated H₂S instantly reacts with Cd(2+) in the presence of Na₃PO₄ to give PO₄(3-)-stabilized CdS QDs in situ. Under visible-light (λ ≥ 400 nm) stimulation, the PO₄(3-)-capped CdS QDs are a new style of oxidase mimic derived by producing some active species, such as h⁺, (•)OH, O₂(•-) and a little H₂O₂, which can oxidize the typical substrate (3,3,5,5-tetramethylbenzydine (TMB)) with a color change. Based on the GOx-triggered growth of the oxidase mimetics of PO₄(3-)-capped CdS QDs in situ, we developed a simple and amplified colorimetric assay to probe the enzymatic activity of GOx. The proposed method allowed the detection of the enzymatic activity of GOx over the range from 25 μg/L to 50 mg/L with a low detection limit of 6.6 μg/L. We believe the PO₄(3-)-capped CdS QDs generated in situ with photo-stimulated enzyme-mimicking activity may find wide potential applications in biosensors.

  12. Differences in activity of cytochrome C oxidase in brain between sleep and wakefulness.

    PubMed

    Nikonova, Elena V; Vijayasarathy, Camasamudram; Zhang, Lin; Cater, Jacqueline R; Galante, Raymond J; Ward, Stephen E; Avadhani, Narayan G; Pack, Allan I

    2005-01-01

    Increased mRNA level of subunit 1 cytochrome c oxidase (COXI) during wakefulness and after short-term sleep deprivation has been described in brain. We hypothesized that this might contribute to increased activity of cytochrome oxidase (COX) enzyme during wakefulness, as part of the mechanisms to provide sufficient amounts of adenosine triphosphate to meet increased neuronal energy demands. COX activity was measured in isolated mitochondria from different brain regions in groups of rats with 3 hours of spontaneous sleep, 3 hours of spontaneous wake, and 3 hours of sleep deprivation. The group with 3 hours of spontaneous wake was added to delineate the circadian component of changes in the enzyme activity. Northern blot analysis was performed to examine the mRNA levels of 2 subunits of the enzyme COXI and COXIV, encoded by mitochondrial and nuclear DNA, respectively. Laboratory of Biochemistry, Department of Animal Biology, and Center for Sleep and Respiratory Neurobiology, University of Pennsylvania. 2-month-old male Fischer rats (N = 21) implanted for polygraphic recording. For COX activity, there was a main effect by analysis of variance of experimental group (P < .0001) with significant increases in COX activity in wake and sleep-deprived groups as compared to the sleep group. A main effect of brain region was also significant (P < .001). There was no difference between brain regions in the degree of increase in enzyme activity in wakefulness. Both COXI and COXIV mRNA were increased with wakefulness as compared to sleep. There is an increase in COX activity after both 3 hours of spontaneous wake and 3 hours of sleep deprivation as compared with 3 hours of spontaneous sleep in diverse brain regions, which could be, in part, explained by the increased levels of bigenomic transcripts of the enzyme. This likely contributes to increased adenosine triphosphate production during wakefulness. ADP, adenosine diphosphate; ATP, adenosine triphosphate; COXI, cytochrome c

  13. GATEWAY Report Brief: Tunable-White Lighting at the ACC Care Center

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    None, None

    Summary of a GATEWAY program report that documented the performance of tunable-white LED lighting systems installed in several spaces within the ACC Care Center, a senior-care facility in Sacramento, CA. The project results included energy savings and improved lighting quality, as well as other possible health-related benefits that may have been attributable, at least in part, to the lighting changes.

  14. After-Ripening Induced Transcriptional Changes of Hormonal Genes in Wheat Seeds: The Cases of Brassinosteroids, Ethylene, Cytokinin and Salicylic Acid

    PubMed Central

    Yao, Zhen; Jordan, Mark C.; Park, Seokhoon; Ayele, Belay T.

    2014-01-01

    Maintenance and release of seed dormancy is regulated by plant hormones; their levels and seed sensitivity being the critical factors. This study reports transcriptional regulation of brassinosteroids (BR), ethylene (ET), cytokinin (CK) and salicylic acid (SA) related wheat genes by after-ripening, a period of dry storage that decays dormancy. Changes in the expression of hormonal genes due to seed after-ripening did not occur in the anhydrobiotic state but rather in the hydrated state. After-ripening induced dormancy decay appears to be associated with imbibition mediated increase in the synthesis and signalling of BR, via transcriptional activation of de-etiolated2, dwarf4 and brassinosteroid signaling kinase, and repression of brassinosteroid insensitive 2. Our analysis is also suggestive of the significance of increased ET production, as reflected by enhanced transcription of 1-aminocyclopropane-1-carboxylic acid oxidase in after-ripened seeds, and tight regulation of seed response to ET in regulating dormancy decay. Differential transcriptions of lonely guy, zeatin O-glucosyltransferases and cytokinin oxidases, and pseudo-response regulator between dormant and after-ripened seeds implicate CK in the regulation of seed dormancy in wheat. Our analysis also reflects the association of dormancy decay in wheat with seed SA level and NPR independent SA signaling that appear to be regulated transcriptionally by phenylalanine ammonia lyase, and whirly and suppressor of npr1 inducible1 genes, respectively. Co-expression clustering of the hormonal genes implies the significance of synergistic and antagonistic interaction between the different plant hormones in regulating wheat seed dormancy. These results contribute to further our understanding of the molecular features controlling seed dormancy in wheat. PMID:24498132

  15. Ethylene Biosynthesis in Detached Young Persimmon Fruit Is Initiated in Calyx and Modulated by Water Loss from the Fruit1

    PubMed Central

    Nakano, Ryohei; Ogura, Emi; Kubo, Yasutaka; Inaba, Akitsugu

    2003-01-01

    Persimmon (Diospyros kaki Thunb.) fruit are usually classified as climacteric fruit; however, unlike typical climacteric fruits, persimmon fruit exhibit a unique characteristic in that the younger the stage of fruit detached, the greater the level of ethylene produced. To investigate ethylene induction mechanisms in detached young persimmon fruit, we cloned three cDNAs encoding 1-aminocyclopropane-1-carboxylic acid (ACC) synthase (DK-ACS1, 2, and -3) and two encoding ACC oxidase (DK-ACO1 and -2) genes involved in ethylene biosynthesis, and we analyzed their expression in various fruit tissues. Ethylene production was induced within a few days of detachment in all fruit tissues tested, accompanied by temporally and spatially coordinated expression of all the DK-ACS and DK-ACO genes. In all tissues except the calyx, treatment with 1-methylcyclopropene, an inhibitor of ethylene action, suppressed ethylene production and ethylene biosynthesis-related gene expression. In the calyx, one ACC synthase gene (DK-ACS2) exhibited increased mRNA accumulation accompanied by a large quantity of ethylene production, and treatment of the fruit with 1-methylcyclopropene did not prevent either the accumulation of DK-ACS2 transcripts or ethylene induction. Furthermore, the alleviation of water loss from the fruit significantly delayed the onset of ethylene production and the expression of DK-ACS2 in the calyx. These results indicate that ethylene biosynthesis in detached young persimmon fruit is initially induced in calyx and is modulated by water loss through transcriptional activation of DK-ACS2. The ethylene produced in the calyx subsequently diffuses to other fruit tissues and acts as a secondary signal that stimulates autocatalytic ethylene biosynthesis in these tissues, leading to a burst of ethylene production. PMID:12529535

  16. A novel proteolytic processing of prolysyl oxidase

    PubMed Central

    Atsawasuwan, Phimon; Mochida, Yoshiyuki; Katafuchi, Michitsuna; Tokutomi, Kentaro; Mocanu, Viorel; Parker, Carol E.; Yamauchi, Mitsuo

    2012-01-01

    Lysyl oxidase (LOX) is an amine oxidase that is critical for the stability of connective tissues. The secreted proLOX is enzymatically quiescent and is activated through proteolytic cleavage between residue Gly162 and Asp163 (residue numbers according to the mouse LOX) by bone morphogenetic protein (BMP)-1 gene products. Here we report a novel processing of proLOX identified in vitro and in vivo. Two forms of mature LOX were identified and characterized by their immunoreactivity to specific antibodies, amine oxidase activity and mass spectrometry. One form was identified as a well characterized BMP-1 processed LOX protein. Another was found to be a truncated form of LOX (tLOX) resulting from the cleavage at the carboxy terminus of Arg192. The tLOX still appeared to retain amine oxidase activity. The results from the proLOX gene deletion and mutation experiments indicated that the processing occurs independent of the cleavage of proLOX by BMP-1 gene products and likely requires the presence of LOX propeptide. These results indicate that proLOX could be processed by two different mechanisms producing two forms of active LOX. PMID:21591931

  17. A novel proteolytic processing of prolysyl oxidase.

    PubMed

    Atsawasuwan, Phimon; Mochida, Yoshiyuki; Katafuchi, Michitsuna; Tokutomi, Kentaro; Mocanu, Viorel; Parker, Carol E; Yamauchi, Mitsuo

    2011-01-01

    Lysyl oxidase (LOX) is an amine oxidase that is critical for the stability of connective tissues. The secreted proLOX is enzymatically quiescent and is activated through proteolytic cleavage between residues Gly(162) and Asp(163) (residue numbers according to the mouse LOX) by bone morphogenetic protein (BMP)-1 gene products. Here we report a novel processing of proLOX identified in vitro and in vivo. Two forms of mature LOX were identified and characterized by their immunoreactivity to specific antibodies, amine oxidase activity, and mass spectrometry. One form was identified as a well-characterized BMP-1 processed LOX protein. Another was found to be a truncated form of LOX resulting from the cleavage at the carboxy terminus of Arg(192). The truncated form of LOX still appeared to retain amine oxidase activity. The results from the proLOX gene deletion and mutation experiments indicated that the processing occurs independent of the cleavage of proLOX by BMP-1 gene products and likely requires the presence of LOX propeptide. These results indicate that proLOX could be processed by two different mechanisms producing two forms of active LOX.

  18. Exploiting algal NADPH oxidase for biophotovoltaic energy

    DOE PAGES

    Anderson, Alexander; Laohavisit, Anuphon; Blaby, Ian K.; ...

    2015-01-29

    Photosynthetic microbes exhibit light-dependent electron export across the cell membrane, which can generate electricity in biological photovoltaic (BPV) devices. How electrons are exported remains to be determined; the identification of mechanisms would help selection or generation of photosynthetic microbes capable of enhanced electrical output. We show that plasma membrane NADPH oxidase activity is a significant component of light-dependent generation of electricity by the unicellular green alga Chlamydomonas reinhardtii. NADPH oxidases export electrons across the plasma membrane to form superoxide anion from oxygen. The C. reinhardtii mutant lacking the NADPH oxidase encoded by RBO1 is impaired in both extracellular superoxide anionmore » production and current generation in a BPV device. Complementation with the wild-type gene restores both capacities, demonstrating the role of the enzyme in electron export. Monitoring light-dependent extracellular superoxide production with a colorimetric assay is shown to be an effective way of screening for electrogenic potential of candidate algal strains. Furthermore, the results show that algal NADPH oxidases are important for superoxide anion production and open avenues for optimizing the biological component of these devices.« less

  19. NADPH oxidases: novel therapeutic targets for neurodegenerative diseases.

    PubMed

    Gao, Hui-Ming; Zhou, Hui; Hong, Jau-Shyong

    2012-06-01

    Oxidative stress is a key pathologic factor in neurodegenerative diseases such as Alzheimer and Parkinson diseases (AD, PD). The failure of free-radical-scavenging antioxidants in clinical trials pinpoints an urgent need to identify and to block major sources of oxidative stress in neurodegenerative diseases. As a major superoxide-producing enzyme complex in activated phagocytes, phagocyte NADPH oxidase (PHOX) is essential for host defense. However, recent preclinical evidence has underscored a pivotal role of overactivated PHOX in chronic neuroinflammation and progressive neurodegeneration. Deficiency in PHOX subunits mitigates neuronal damage induced by diverse insults/stresses relevant to neurodegenerative diseases. More importantly, suppression of PHOX activity correlates with reduced neuronal impairment in models of neurodegenerative diseases. The discovery of PHOX and non-phagocyte NADPH oxidases in astroglia and neurons further reinforces the crucial role of NADPH oxidases in oxidative stress-mediated chronic neurodegeneration. Thus, proper modulation of NADPH oxidase activity might hold therapeutic potential for currently incurable neurodegenerative diseases. Published by Elsevier Ltd.

  20. Pulse-radiolysis studies on the interaction of one-electron reduced species with blue oxidases. Reduction of type-2-copper-depleted ascorbate oxidase.

    PubMed

    O'Neill, P; Fielden, E M; Avigliano, L; Marcozzi, G; Ballini, A; Agrò, F

    1984-08-15

    The interaction of one-electron reduced metronidazole (ArNO2.-) with native and Type-2-copper-depleted ascorbate oxidase were studied in buffered aqueous solution at pH 6.0 and 7.4 by using the technique of pulse radiolysis. With ArNO2.-, reduction of Type 1 copper of the native enzyme and of the Type-2-copper-depleted ascorbate oxidase occurs via a bimolecular step and at the same rate. Whereas the native protein accepts, in the absence of O2, 6-7 reducing equivalents, Type-2-copper-depleted ascorbate oxidase accepts only 3 reducing equivalents with stoichiometric reduction of Type 1 copper. On reaction of O2.- with ascorbate oxidase under conditions of [O2.-] much greater than [ascorbate oxidase], removal of Type 2 copper results in reduction of all the Type 1 copper atoms, in contrast with reduction of the equivalent of only one Type 1 copper atom in the holoprotein. From observations at 610 nm, the rate of reduction of ascorbate oxidase by O2.- is not dependent on the presence of Type 2 copper. For the holoprotein, no significant optical-absorption changes were observed at 330 nm. It is proposed that electrons enter the protein via Type 1 copper in a rate-determining step followed by a fast intramolecular transfer of electrons within the protein. For the Type-2-copper-depleted protein, intramolecular transfer within the protein, however, is slow or does not occur. In the presence of O2, it is also suggested that re-oxidation of the partially reduced holoprotein occurs at steady state, as inferred from the observations at 330 nm and 610 nm. The role of Type 2 copper in ascorbate oxidase is discussed in terms of its involvement in redistribution of electrons within the protein or structural considerations.

  1. Supramolecular organization of cytochrome c oxidase- and alternative oxidase-dependent respiratory chains in the filamentous fungus Podospora anserina.

    PubMed

    Krause, Frank; Scheckhuber, Christian Q; Werner, Alexandra; Rexroth, Sascha; Reifschneider, Nicole H; Dencher, Norbert A; Osiewacz, Heinz D

    2004-06-18

    To elucidate the molecular basis of the link between respiration and longevity, we have studied the organization of the respiratory chain of a wild-type strain and of two long-lived mutants of the filamentous fungus Podospora anserina. This established aging model is able to respire by either the standard or the alternative pathway. In the latter pathway, electrons are directly transferred from ubiquinol to the alternative oxidase and thus bypass complexes III and IV. We show that the cytochrome c oxidase pathway is organized according to the mammalian "respirasome" model (Schägger, H., and Pfeiffer, K. (2000) EMBO J. 19, 1777-1783). In contrast, the alternative pathway is composed of distinct supercomplexes of complexes I and III (i.e. I(2) and I(2)III(2)), which have not been described so far. Enzymatic analysis reveals distinct functional properties of complexes I and III belonging to either cytochrome c oxidase- or alternative oxidase-dependent pathways. By a gentle colorless-native PAGE, almost all of the ATP synthases from mitochondria respiring by either pathway were preserved in the dimeric state. Our data are of significance for the understanding of both respiratory pathways as well as lifespan control and aging.

  2. Sound the Alarm: The Effect of Narcissism on Retaliatory Aggression Is Moderated by dACC Reactivity to Rejection.

    PubMed

    Chester, David S; DeWall, C Nathan

    2016-06-01

    Narcissists behave aggressively when their egos are threatened by interpersonal insults. This effect has been explained in terms of narcissists' motivation to reduce the discrepancy between their grandiose self and its threatened version, though no research has directly tested this hypothesis. If this notion is true, the link between narcissism and retaliatory aggression should be moderated by neural structures that subserve discrepancy detection, such as the dorsal anterior cingulate cortex (dACC). This study tested the hypothesis that narcissism would only predict greater retaliatory aggression in response to social rejection when the dACC was recruited by the threat. Thirty participants (15 females; Mage  = 18.86, SD = 1.25; 77% White) completed a trait narcissism inventory, were socially accepted and then rejected while undergoing fMRI, and then could behave aggressively toward one of the rejecters by blasting him or her with unpleasant noise. When narcissists displayed greater dACC activation during rejection, they behaved aggressively. But there was only a weak or nonsignificant relation between narcissism and aggression among participants with a blunted dACC response. Narcissism's role in aggressive retaliation to interpersonal threats is likely determined by the extent to which the brain's discrepancy detector registers the newly created gap between the grandiose and threatened selves. © 2015 Wiley Periodicals, Inc.

  3. ACCE Study Tour to ISTE2011 (San Francisco, New York, Washington, Philadelphia)

    ERIC Educational Resources Information Center

    Gronn, Donna; Romeo, Geoff

    2011-01-01

    In June/July this year a group of 28 educators from across Australia travelled to the US on the 2011 ACCE ISTE Study Tour. The group comprised a very broad section of educators--primary, secondary and tertiary classroom teachers, ICT coordinators, managers, private consultants and regional office managers. The government, catholic and independent…

  4. In vitro study of 6-mercaptopurine oxidation catalysed by aldehyde oxidase and xanthine oxidase.

    PubMed

    Rashidi, Mohammad-Reza; Beedham, Christine; Smith, John S; Davaran, Soodabeh

    2007-08-01

    In spite of over 40 years of clinical use of 6-mercaptopurine, many aspects of complex pharmacology and metabolism of this drug remain unclear. It is thought that 6-mercaptopurine is oxidized to 6-thiouric acid through 6-thioxanthine or 8-oxo-6-mercaptopurine by one of two molybdenum hydroxylases, xanthine oxidase (XO), however, the role of other molybdenum hydroxylase, aldehyde oxidase (AO), in the oxidation of 6-mercaptopurine and possible interactions of AO substrates and inhibitors has not been investigated in more details. In the present study, the role of AO and XO in the oxidation of 6- mercaptopurine has been investigated. 6-mercaptopurine was incubated with bovine milk xanthine oxidase or partially purified guinea pig liver molybdenum hydroxylase fractions in the absence and presence of XO and AO inhibitor/substrates, and the reactions were monitored by spectrophotometric and HPLC methods. According to the results obtained from the inhibition studies, it is more likely that 6- mercaptopurine is oxidized to 6-thiouric acid via 6-thioxanthine rather than 8-oxo-6-mercaptopurine. The first step which is the rate limiting step is catalyzed solely by XO, whereas both XO and AO are involved in the oxidation of 6-thioxanthine to 6-thiouric acid.

  5. Discovery of a Xylooligosaccharide Oxidase from Myceliophthora thermophila C1.

    PubMed

    Ferrari, Alessandro R; Rozeboom, Henriëtte J; Dobruchowska, Justyna M; van Leeuwen, Sander S; Vugts, Aniek S C; Koetsier, Martijn J; Visser, Jaap; Fraaije, Marco W

    2016-11-04

    By inspection of the predicted proteome of the fungus Myceliophthora thermophila C1 for vanillyl-alcohol oxidase (VAO)-type flavoprotein oxidases, a putative oligosaccharide oxidase was identified. By homologous expression and subsequent purification, the respective protein could be obtained. The protein was found to contain a bicovalently bound FAD cofactor. By screening a large number of carbohydrates, several mono- and oligosaccharides could be identified as substrates. The enzyme exhibits a strong substrate preference toward xylooligosaccharides; hence it is named xylooligosaccharide oxidase (XylO). Chemical analyses of the product formed upon oxidation of xylobiose revealed that the oxidation occurs at C1, yielding xylobionate as product. By elucidation of several XylO crystal structures (in complex with a substrate mimic, xylose, and xylobiose), the residues that tune the unique substrate specificity and regioselectivity could be identified. The discovery of this novel oligosaccharide oxidase reveals that the VAO-type flavoprotein family harbors oxidases tuned for specific oligosaccharides. The unique substrate profile of XylO hints at a role in the degradation of xylan-derived oligosaccharides by the fungus M. thermophila C1. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. How effective are the ESC/EAS and 2013 ACC/AHA guidelines in treating dyslipidemia? Lessons from a lipid clinic.

    PubMed

    Barkas, Fotios; Milionis, Haralampos; Kostapanos, Michael S; Mikhailidis, Dimitri P; Elisaf, Moses; Liberopoulos, Evangelos

    2015-02-01

    There is a paucity of data regarding the attainment of lipid-lowering treatment goals according to the recent American College of Cardiology/American Heart Association (ACC/AHA) guidelines. The aim of the present study was to assess how applicable these 2013 recommendations are in the setting of an Outpatient University Hospital Lipid Clinic. This was a retrospective (from 1999 to 2013) observational study including 1000 consecutive adults treated for hyperlipidemia and followed up for ≥3 years. Comparisons for the applicability of current European Society of Cardiology/European Atherosclerosis Society (ESC/EAS) and recent ACC/AHA guidelines were performed. Achievement rates of low density lipoprotein cholesterol (LDL-C) targets set by ESC/EAS were 21%, 44% and 62% among patients at very high, high and moderate cardiovascular risk, respectively, receiving statin monotherapy. Among individuals on high-intensity statins only 47% achieved the anticipated ≥50% LDL-C reduction, i.e. the ACC/AHA target. The corresponding rate was significantly greater among those on statin + ezetimibe (76%, p < 0.05). Likewise, higher rates of LDL-C target attainment according to ESC/EAS guidelines were observed in patients on statin + ezetimibe compared with statin monotherapy (37, 50 and 71% for the three risk groups, p < 0.05 for the very high risk group). The application of the ACC/AHA guidelines may be associated with undertreatment of high risk patients due to suboptimal LDL-C response to high-intensity statins in clinical practice. Adding ezetimibe substantially increases the rate of the ESC/EAS LDL-C target achievement together with the rate of LDL-C lowering response suggested by the ACC/AHA.

  7. The Allende multicompound chondrule (ACC)—Chondrule formation in a local super-dense region of the early solar system

    NASA Astrophysics Data System (ADS)

    Bischoff, Addi; Wurm, Gerhard; Chaussidon, Marc; Horstmann, Marian; Metzler, Knut; Weyrauch, Mona; Weinauer, Julia

    2017-05-01

    In Allende, a very complex compound chondrule (Allende compound chondrule; ACC) was found consisting of at least 16 subchondrules (14 siblings and 2 independents). Its overall texture can roughly be described as a barred olivine object (BO). The BO texture is similar in all siblings, but does not exist in the two independents, which appear as relatively compact olivine-rich units. Because of secondary alteration of pristine Allende components and the ACC in particular, only limited predictions can be made concerning the original compositions of the colliding melt droplets. Based on textural and mineralogical characteristics, the siblings must have been formed on a very short time scale in a dense, local environment. This is also supported by oxygen isotope systematics showing similar compositions for all 16 subchondrules. Furthermore, the ACC subchondrules are isotopically distinct from typical Allende chondrules, indicating formation in or reaction with a more 16O-poor reservoir. We modeled constraints on the particle density required at the ACC formation location, using textural, mineral-chemical, and isotopic observations on this multicompound chondrule to define melt droplet collision conditions. In this context, we discuss the possible relationship between the formation of complex chondrules and the formation of macrochondrules and cluster chondrites. While macrochondrules may have formed under similar or related conditions as complex chondrules, cluster chondrites certainly require different formation conditions. Cluster chondrites represent a mixture of viscously deformed, seemingly young chondrules of different chemical and textural types and a population of older chondrules. Concerning the formation of ACC calculations suggest the existence of very local, kilometer-sized, and super-dense chondrule-forming regions with extremely high solid-to-gas mass ratios of 1000 or more.

  8. Stability of spermine oxidase to thermal and chemical denaturation: comparison with bovine serum amine oxidase.

    PubMed

    Cervelli, Manuela; Leonetti, Alessia; Cervoni, Laura; Ohkubo, Shinji; Xhani, Marla; Stano, Pasquale; Federico, Rodolfo; Polticelli, Fabio; Mariottini, Paolo; Agostinelli, Enzo

    2016-10-01

    Spermine oxidase (SMOX) is a flavin-containing enzyme that specifically oxidizes spermine to produce spermidine, 3-aminopropanaldehyde and hydrogen peroxide. While no crystal structure is available for any mammalian SMOX, X-ray crystallography showed that the yeast Fms1 polyamine oxidase has a dimeric structure. Based on this scenario, we have investigated the quaternary structure of the SMOX protein by native gel electrophoresis, which revealed a composite gel band pattern, suggesting the formation of protein complexes. All high-order protein complexes are sensitive to reducing conditions, showing that disulfide bonds were responsible for protein complexes formation. The major gel band other than the SMOX monomer is the covalent SMOX homodimer, which was disassembled by increasing the reducing conditions, while being resistant to other denaturing conditions. Homodimeric and monomeric SMOXs are catalytically active, as revealed after gel staining for enzymatic activity. An engineered SMOX mutant deprived of all but two cysteine residues was prepared and characterized experimentally, resulting in a monomeric species. High-sensitivity differential scanning calorimetry of SMOX was compared with that of bovine serum amine oxidase, to analyse their thermal stability. Furthermore, enzymatic activity assays and fluorescence spectroscopy were used to gain insight into the unfolding process.

  9. POLYAMINE OXIDASE 1 from rice (Oryza sativa) is a functional ortholog of Arabidopsis POLYAMINE OXIDASE 5.

    PubMed

    Liu, Taibo; Wook Kim, Dong; Niitsu, Masaru; Berberich, Thomas; Kusano, Tomonobu

    2014-01-01

    POLYAMINE OXIDASE 1 (OsPAO1), from rice (Oryza sativa), and POLYAMINE OXIDASE 5 (AtPAO5), from Arabidopsis (Arabidopsis thaliana), are enzymes sharing high identity at the amino acid level and with similar characteristics, such as polyamine specificity and pH preference; furthermore, both proteins localize to the cytosol. A loss-of-function Arabidopsis mutant, Atpao5-2, was hypersensitive to low doses of exogenous thermospermine but this phenotype could be rescued by introduction of the wild-type AtPAO5 gene. Introduction of OsPAO1, under the control of a constitutive promoter, into Atpao5-2 mutants also restored normal thermospermine sensitivity, allowing growth in the presence of low levels of thermospermine, along with a concomitant decrease in thermospermine content in plants. By contrast, introduction of OsPAO3, which encodes a peroxisome-localized polyamine oxidase, into Atpao5-2 plants could not rescue any of the mutant phenotypes in the presence of thermospermine. These results suggest that OsPAO1 is the functional ortholog of AtPAO5.

  10. Aurone synthase is a catechol oxidase with hydroxylase activity and provides insights into the mechanism of plant polyphenol oxidases

    PubMed Central

    Molitor, Christian; Mauracher, Stephan Gerhard

    2016-01-01

    Tyrosinases and catechol oxidases belong to the family of polyphenol oxidases (PPOs). Tyrosinases catalyze the o-hydroxylation and oxidation of phenolic compounds, whereas catechol oxidases were so far defined to lack the hydroxylation activity and catalyze solely the oxidation of o-diphenolic compounds. Aurone synthase from Coreopsis grandiflora (AUS1) is a specialized plant PPO involved in the anabolic pathway of aurones. We present, to our knowledge, the first crystal structures of a latent plant PPO, its mature active and inactive form, caused by a sulfation of a copper binding histidine. Analysis of the latent proenzyme’s interface between the shielding C-terminal domain and the main core provides insights into its activation mechanisms. As AUS1 did not accept common tyrosinase substrates (tyrosine and tyramine), the enzyme is classified as a catechol oxidase. However, AUS1 showed hydroxylase activity toward its natural substrate (isoliquiritigenin), revealing that the hydroxylase activity is not correlated with the acceptance of common tyrosinase substrates. Therefore, we propose that the hydroxylase reaction is a general functionality of PPOs. Molecular dynamics simulations of docked substrate–enzyme complexes were performed, and a key residue was identified that influences the plant PPO’s acceptance or rejection of tyramine. Based on the evidenced hydroxylase activity and the interactions of specific residues with the substrates during the molecular dynamics simulations, a novel catalytic reaction mechanism for plant PPOs is proposed. The presented results strongly suggest that the physiological role of plant catechol oxidases were previously underestimated, as they might hydroxylate their—so far unknown—natural substrates in vivo. PMID:26976571

  11. Tuning the light in senior care: Evaluating a trial LED lighting system at the ACC Care Center in Sacramento, CA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Davis, Robert G.; Wilkerson, Andrea M.

    This report summarizes the results from a trial installation of light-emitting diode (LED) lighting systems in several spaces within the ACC Care Center in Sacramento, CA. The Sacramento Municipal Utility District (SMUD) coordinated the project and invited the U.S. Department of Energy (DOE) to document the performance of the LED lighting systems as part of a GATEWAY evaluation. DOE tasked the Pacific Northwest National Laboratory (PNNL) to conduct the investigation. SMUD and ACC staff coordinated and completed the design and installation of the LED systems, while PNNL and SMUD staff evaluated the photometric performance of the systems. ACC staff alsomore » track behavioral and health measures of the residents; some of those results are reported here, although PNNL staff were not directly involved in collecting or interpreting those data. The trial installation took place in a double resident room and a single resident room, and the corridor that connects those (and other) rooms to the central nurse station. Other spaces in the trial included the nurse station, a common room called the family room located near the nurse station, and the ACC administrator’s private office.« less

  12. Reduced AMPK-ACC and mTOR signaling in muscle from older men, and effect of resistance exercise

    PubMed Central

    Li, Mengyao; Verdijk, Lex B.; Sakamoto, Kei; Ely, Brian; van Loon, Luc J.C.; Musi, Nicolas

    2012-01-01

    AMP-activated protein kinase (AMPK) is a key energy-sensitive enzyme that controls numerous metabolic and cellular processes. Mammalian target of rapamycin (mTOR) is another energy/nutrient-sensitive kinase that controls protein synthesis and cell growth. In this study we determined whether older versus younger men have alterations in the AMPK and mTOR pathways in skeletal muscle, and examined the effect of a long term resistance type exercise training program on these signaling intermediaries. Older men had decreased AMPKα2 activity and lower phosphorylation of AMPK and its downstream signaling substrate acetyl-CoA carboxylase (ACC). mTOR phosphylation also was reduced in muscle from older men. Exercise training increased AMPKα1 activity in older men, however, AMPKα2 activity, and the phosphorylation of AMPK, ACC and mTOR, were not affected. In conclusion, older men have alterations in the AMPK-ACC and mTOR pathways in muscle. In addition, prolonged resistance type exercise training induces an isoform-selective up regulation of AMPK activity. PMID:23000302

  13. Reduced AMPK-ACC and mTOR signaling in muscle from older men, and effect of resistance exercise.

    PubMed

    Li, Mengyao; Verdijk, Lex B; Sakamoto, Kei; Ely, Brian; van Loon, Luc J C; Musi, Nicolas

    2012-01-01

    AMP-activated protein kinase (AMPK) is a key energy-sensitive enzyme that controls numerous metabolic and cellular processes. Mammalian target of rapamycin (mTOR) is another energy/nutrient-sensitive kinase that controls protein synthesis and cell growth. In this study we determined whether older versus younger men have alterations in the AMPK and mTOR pathways in skeletal muscle, and examined the effect of a long term resistance type exercise training program on these signaling intermediaries. Older men had decreased AMPKα2 activity and lower phosphorylation of AMPK and its downstream signaling substrate acetyl-CoA carboxylase (ACC). mTOR phosphylation also was reduced in muscle from older men. Exercise training increased AMPKα1 activity in older men, however, AMPKα2 activity, and the phosphorylation of AMPK, ACC and mTOR, were not affected. In conclusion, older men have alterations in the AMPK-ACC and mTOR pathways in muscle. In addition, prolonged resistance type exercise training induces an isoform-selective up regulation of AMPK activity. Published by Elsevier Ireland Ltd.

  14. Deciphering the role of NADPH oxidase in complex interactions between maize (Zea mays L.) genotypes and cereal aphids.

    PubMed

    Sytykiewicz, Hubert

    2016-07-22

    Plant NADPH oxidases (NOXs) encompass a group of membrane-bound enzymes participating in formation of reactive oxygen species (ROS) under physiological conditions as well as in response to environmental stressors. The purpose of the survey was to unveil the role of NADPH oxidase in pro-oxidative responses of maize (Zea mays L.) seedling leaves exposed to cereal aphids' infestation. The impact of apteral females of bird cherry-oat aphid (Rhopalosiphum padi L.) and grain aphid (Sitobion avenae F.) feeding on expression levels of all four NADPH oxidase genes (rbohA, rbohB, rbohC, rbohD) and total activity of NOX enzyme in maize plants were investigated. In addition, inhibitory effect of diphenylene iodonium (DPI) pre-treatment on NOX activity and hydrogen peroxide content in aphid-stressed maize seedlings was studied. Leaf infestation biotests were accomplished on 14-day-old seedlings representing two aphid-resistant varieties (Ambrozja and Waza) and two aphid-susceptible ones (Tasty Sweet and Złota Karłowa). Insects' attack led to profound upregulation of rbohA and rbohD genes in tested host plants, lower elevations were noted in level of rbohB mRNA, whereas abundance of rbohC transcript was not significantly altered. It was uncovered aphid-induced enhancement of NOX activity in examined plants. Higher increases in expression of all investigated rboh genes and activity of NADPH oxidase occurred in tissues of more resistant maize cultivars than in susceptible ones. Furthermore, DPI treatment resulted in strong reduction of NOX activity and H2O2 accumulation in aphid-infested Z. mays plants, thus evidencing circumstantial role of the enzyme in insect-elicited ROS generation. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. Isolation and expression of three gibberellin 20-oxidase cDNA clones from Arabidopsis.

    PubMed

    Phillips, A L; Ward, D A; Uknes, S; Appleford, N E; Lange, T; Huttly, A K; Gaskin, P; Graebe, J E; Hedden, P

    1995-07-01

    Using degenerate oligonucleotide primers based on a pumpkin (Cucurbita maxima) gibberellin (GA) 20-oxidase sequence, six different fragments of dioxygenase genes were amplified by polymerase chain reaction from arabidopsis thaliana genomic DNA. One of these was used to isolate two different full-length cDNA clones, At2301 and At2353, from shoots of the GA-deficient Arabidopsis mutant ga1-2. A third, related clone, YAP169, was identified in the Database of Expressed Sequence Tags. The cDNA clones were expressed in Escherichia coli as fusion proteins, each of which oxidized GA12 at C-20 to GA15, GA24, and the C19 compound GA9, a precursor of bioactive GAs; the C20 tricarboxylic acid compound GA25 was formed as a minor product. The expression products also oxidized the 13-hydroxylated substrate GA53, but less effectively than GA12. The three cDNAs hybridized to mRNA species with tissue-specific patterns of accumulation, with At2301 being expressed in stems and inflorescences, At2353 in inflorescences and developing siliques, and YAP169 in siliques only. In the floral shoots of the ga1-2 mutant, transcript levels corresponding to each cDNA decreased dramatically after GA3 application, suggesting that GA biosynthesis may be controlled, at least in part, through down-regulation of the expression of the 20-oxidase genes.

  16. 1-Aminocyclopropane-1-carboxylic acid (ACC) deaminase-containing rhizobacteria protect Ocimum sanctum plants during waterlogging stress via reduced ethylene generation.

    PubMed

    Barnawal, Deepti; Bharti, Nidhi; Maji, Deepamala; Chanotiya, Chandan Singh; Kalra, Alok

    2012-09-01

    Ocimum sanctum grown as rain-fed crop, is known to be poorly adapted to waterlogged conditions. Many a times the crop suffers extreme damages because of anoxia and excessive ethylene generation due to waterlogging conditions present under heavy rain. The usefulness of 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase-containing plant growth promoting rhizobacteria was investigated under waterlogging stress. The comparison of herb yield and stress induced biochemical changes of waterlogged and non-waterlogged plants with and without ACC deaminase-containing microbiological treatments were monitored in this study. Ten plant growth promoting rhizobacteria strains containing ACC-deaminase were isolated and characterized. Four selected isolates Fd2 (Achromobacter xylosoxidans), Bac5 (Serratia ureilytica), Oci9 (Herbaspirillum seropedicae) and Oci13 (Ochrobactrum rhizosphaerae) had the potential to protect Ocimum plants from flood induced damage under waterlogged glass house conditions. Pot experiments were conducted to evaluate the potential of these ACC deaminase-containing selected strains for reducing the yield losses caused by waterlogging conditions. Bacterial treatments protected plants from waterlogging induced detrimental changes like stress ethylene production, reduced chlorophyll concentration, higher lipid peroxidation, proline concentration and reduced foliar nutrient uptake. Fd2 (A. xylosoxidans) induced maximum waterlogging tolerance as treated waterlogged plants recorded maximum growth and herb yield (46.5% higher than uninoculated waterlogged plants) with minimum stress ethylene levels (53% lower ACC concentration as compared to waterlogged plants without bacterial inoculation) whereas under normal non-waterlogged conditions O. rhizosphaerae was most effective in plant growth promotion. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  17. Three-dimensional organization of three-domain copper oxidases: A review

    NASA Astrophysics Data System (ADS)

    Zhukhlistova, N. E.; Zhukova, Yu. N.; Lyashenko, A. V.; Zaĭtsev, V. N.; Mikhaĭlov, A. M.

    2008-01-01

    “Blue” copper-containing proteins are multidomain proteins that utilize a unique redox property of copper ions. Among other blue multicopper oxidases, three-domain oxidases belong to the group of proteins that exhibit a wide variety of compositions in amino acid sequences, functions, and occurrences in organisms. This paper presents a review of the data obtained from X-ray diffraction investigations of the three-dimensional structures of three-domain multicopper oxidases, such as the ascorbate oxidase catalyzing oxidation of ascorbate to dehydroascorbate and its three derivatives; the multicopper oxidase CueO (the laccase homologue); the laccases isolated from the basidiomycetes Coprinus cinereus, Trametes versicolor, Coriolus zonatus, Cerrena maxima, and Rigidoporus lignosus and the ascomycete Melanocarpus albomyces; and the bacterial laccases CotA from the endospore coats of Bacillus subtilis. A comparison of the molecular structures of the laccases of different origins demonstrates that, structurally, these objects are highly conservative. This obviously indicates that the catalytic activity of the enzymes under consideration is characterized by similar mechanisms.

  18. NADPH OXIDASE: STRUCTURE AND ACTIVATION MECHANISMS (REVIEW). NOTE I.

    PubMed

    Filip-Ciubotaru, Florina; Manciuc, Carmen; Stoleriu, Gabriela; Foia, Liliana

    2016-01-01

    NADPH oxidase (nicotinamide adenine dinucleotide phosphate-oxidase), with its generically termed NOX isoforms, is the major source of ROS (reactive oxigen species) in biological systems. ROS are small oxygen-derived molecules with an important role in various biological processes (physiological or pathological). If under physiological conditions some processes are beneficial and necessary for life, under pathophysiological conditions they are noxious, harmful. NADPH oxidases are present in phagocytes and in a wide variety of nonphagocytic cells. The enzyme generates superoxide by transferring electrons from NADPH inside the cell across the membrane and coupling them to molecular oxygen to produce superoxide anion, a reactive free-radical. Structurally, NADPH oxidase is a multicomponent enzyme which includes two integral membrane proteins, glycoprotein gp9 1 Phox and adaptor protein p22(phox), which together form the heterodimeric flavocytochrome b558 that constitutes the core of the enzyme. During the resting state, the multidomain regulatory subunits p40P(phox), p47(phox), p67(Phox) are located in the cytosol organized as a complex. The activation of phagocytic NADPH oxidase occurs through a complex series of protein interactions.

  19. The NADPH-oxidase AtRbohI plays a positive role in drought-stress response in Arabidopsis thaliana

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    He, Huan; Yan, Jingwei; Yu, Xiaoyun

    As the major resource of reactive oxygen species (ROS), the NADPH oxidases (Rbohs) have been shown to play important roles in plant cells under normal growth and stress conditions. Although many family members of Rbohs were studied, little is known about the function of RbohI in Arabidopsis thaliana. Here, we report that exogenous ABA application decreases RbohI expression and mannitol significantly increases RbohI expression at transcript level. The RbohI transcripts were strongly detected in dry seeds and roots. The loss-of-function mutant rbohI exhibited sensitivity to ABA and mannitol stress during germination. Furthermore, the lateral root growth of rbohI was severelymore » inhibited after treatment with mannitol stress. Overexpression of RbohI in Arabidopsis significantly improves the drought tolerance. Moreover, more H 2O 2 accumulated in RbohI overexpressors than in wild type plants in response to mannitol stress. Our conclusion is that AtRbohI functions in drought-stress response in Arabidopsis thaliana.« less

  20. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  1. Expression and Chloroplast Targeting of Cholesterol Oxidase in Transgenic Tobacco Plants

    PubMed Central

    Corbin, David R.; Grebenok, Robert J.; Ohnmeiss, Thomas E.; Greenplate, John T.; Purcell, John P.

    2001-01-01

    Cholesterol oxidase represents a novel type of insecticidal protein with potent activity against the cotton boll weevil (Anthonomus grandis grandis Boheman). We transformed tobacco (Nicotiana tabacum) plants with the cholesterol oxidase choM gene and expressed cytosolic and chloroplast-targeted versions of the ChoM protein. Transgenic leaf tissues expressing cholesterol oxidase exerted insecticidal activity against boll weevil larvae. Our results indicate that cholesterol oxidase can metabolize phytosterols in vivo when produced cytosolically or when targeted to chloroplasts. The transgenic plants exhibiting cytosolic expression accumulated low levels of saturated sterols known as stanols, and displayed severe developmental aberrations. In contrast, the transgenic plants expressing chloroplast-targeted cholesterol oxidase maintained a greater accumulation of stanols, and appeared phenotypically and developmentally normal. These results are discussed within the context of plant sterol distribution and metabolism. PMID:11457962

  2. Comparative effectiveness of ACC-deaminase and/or nitrogen-fixing rhizobacteria in promotion of maize (Zea mays L.) growth under lead pollution.

    PubMed

    Hassan, Waseem; Bano, Rizwana; Bashir, Farhat; David, Julie

    2014-09-01

    Lead (Pb) pollution is appearing as an alarming threat nowadays. Excessive Pb concentrations in agricultural soils result in minimizing the soil fertility and health which affects the plant growth and leads to decrease in crop production. Plant growth promoting rhizobacteria (PGPR) are beneficial bacteria which can protect the plants against many abiotic stresses, and enhance the growth. The study aimed to identify important rhizobacterial strains by using the 1-aminocyclopropane-1-carboxylate (ACC) enrichment technique and examine their inoculation effects in the growth promotion of maize, under Pb pollution. A pot experiment was conducted and six rhizobacterial isolates were used. Pb was added to 2 kg soil in each pot (with 4 seeds/pot) using Pb(NO3)2 at the rate of 0, 100, 200, 300, and 400 mg kg(-1) Pb with three replications in completely randomized design. Rhizobacterial isolates performed significantly better under all Pb levels, i.e., 100 to 400 Pb mg kg(-1) soil, compared to control. Comparing the efficacy of the rhizobacterial isolates under different Pb levels, rhizobacterial isolates having both ACC-deaminase and nitrogen-fixing activities (AN8 and AN12) showed highest increase in terms of the physical, chemical and enzymatic growth parameters of maize, followed by the rhizobacterial isolates having ACC-deaminase activity only (ACC5 and ACC8), and then the nitrogen-fixing rhizobia (Azotobacter and RN5). However, the AN8 isolate showed maximum efficiency, and highest shoot and root length (14.2 and 6.1 cm), seedling fresh and dry weights (1.91 and 0.14 g), chlorophyll a, b, and carotenoids (24.1, 30.2 and 77.7 μg/l), protein (0.82 mg/g), proline (3.42 μmol/g), glutathione S-transferase, peroxidase and catalase (12.3, 4.2 and 7.2 units/mg protein), while the lowest Pb uptake in the shoot and root (0.83 and 0.48 mg/kg) were observed under this rhizobial isolate at the highest Pb level (i.e., 400 Pb mg kg(-1) soil). The results revealed that PGPR

  3. Comparative Activity-Based Flavin-Dependent Oxidase Profiling.

    PubMed

    Krysiak, Joanna; Breinbauer, Rolf

    2017-01-01

    Activity-based protein profiling (ABPP) has become a powerful chemoproteomic technology allowing for the dissection of complex ligand-protein interactions in their native cellular environment. One of the biggest challenges for ABPP is the extension of the proteome coverage. In this chapter a new ABPP strategy dedicated to monoamine oxidases (MAO) is presented. These enzymes are representative examples of flavin-dependent oxidases, playing a crucial role in the regulation of nervous system signaling.

  4. Multidomain flavin-dependent sulfhydryl oxidases.

    PubMed

    Coppock, Donald L; Thorpe, Colin

    2006-01-01

    Eukaryotic flavin-dependent sulfhydryl oxidases catalyze oxidative protein folding with the generation of disulfides and the reduction of oxygen to hydrogen peroxide. This review deals principally with the Quiescinsulfhydryl oxidases (QSOX) that are found in multiple forms in multicellular organisms and singly in a number of protozoan parasites. QSOX is an ancient fusion of thioredoxin domains and an FAD-binding module, ERV1/ALR. Interdomain disulfide exchanges transmit reducing equivalents from substrates to the flavin cofactor and thence to molecular oxygen. The in vitro substrate specificity of avian QSOX1 and the likely substrates of QSOXs in vivo are discussed. The location of QSOX immunoreactivity and mRNA expression levels in human cells and tissues is reviewed. Generally, there is a marked association of QSOX1 expression with cell types that have a high secretory load of disulfide-containing peptides and proteins. The abundance of sulfhydryl oxidases in the islets of Langerhans suggests that oxidative protein folding may directly contribute to the oxidative stress believed to be a factor in the progression to type II diabetes. Finally, the structure and mechanism of QSOX proteins is compared to their smaller stand-alone cousins: yeast ERV1p and ERV2p, the mammalian augmenter of liver regeneration (ALR), and the viral ALR homologs.

  5. Effect of contraceptive steroids on monoamine oxidase activity

    PubMed Central

    Southgate, Jennifer; Collins, G. G. S.; Pryse-Davies, J.; Sandler, M.

    1969-01-01

    Cyclical variations in monoamine oxidase activity during the human menstrual cycle, specific to the endometrium and modified in women undergoing contraceptive steroid treatment, may reflect changes in hormonal environment. Treatment of rats with individual constituents of the contraceptive pill causes analogous changes: oestrogens inhibit and progestogens potentiate uterine monoamine oxidase activity. ImagesFig. 2Fig. 3

  6. The hemibiotrophic cacao pathogen Moniliophthora perniciosa depends on a mitochondrial alternative oxidase for biotrophic development

    PubMed Central

    Thomazella, Daniela P T; Teixeira, Paulo José P L; Oliveira, Halley C; Saviani, Elzira E; Rincones, Johana; Toni, Isabella M; Reis, Osvaldo; Garcia, Odalys; Meinhardt, Lyndel W; Salgado, Ione; Pereira, Gonçalo A G

    2012-01-01

    The tropical pathogen Moniliophthora perniciosa causes witches’ broom disease in cacao. As a hemibiotrophic fungus, it initially colonizes the living host tissues (biotrophic phase), and later grows over the dead plant (necrotrophic phase). Little is known about the mechanisms that promote these distinct fungal phases or mediate the transition between them. An alternative oxidase gene (Mp-aox) was identified in the M. perniciosa genome and its expression was analyzed througout the fungal life cycle. In addition, the effects of inhibitors of the cytochrome-dependent respiratory chain (CRC) and alternative oxidase (AOX) were evaluated on the in vitro development of M. perniciosa. Larger numbers of Mp-aox transcripts were observed in the biotrophic hyphae, which accordingly showed elevated sensitivity to AOX inhibitors. More importantly, the inhibition of CRC prevented the transition from the biotrophic to the necrotrophic phase, and the combined use of a CRC and AOX inhibitor completely halted fungal growth. On the basis of these results, a novel mechanism is presented in which AOX plays a role in the biotrophic development of M. perniciosa and regulates the transition to its necrotrophic stage. Strikingly, this model correlates well with the infection strategy of animal pathogens, particularly Trypanosoma brucei, which uses AOX as a strategy for pathogenicity. PMID:22443281

  7. The 2013 ACC/AHA 10-year atherosclerotic cardiovascular disease risk index is better than SCORE and QRisk II in rheumatoid arthritis: is it enough?

    PubMed

    Ozen, Gulsen; Sunbul, Murat; Atagunduz, Pamir; Direskeneli, Haner; Tigen, Kursat; Inanc, Nevsun

    2016-03-01

    To determine the ability of the new American College of Cardiology and American Heart Association (ACC/AHA) 10-year atherosclerotic cardiovascular disease (ASCVD) risk algorithm in detecting high cardiovascular (CV) risk, RA patients identified by carotid ultrasonography (US) were compared with Systematic Coronary Risk Evaluation (SCORE) and QRisk II algorithms. SCORE, QRisk II, 2013 ACC/AHA 10-year ASCVD risk and EULAR recommended modified versions were calculated in 216 RA patients. In sonographic evaluation, carotid intima-media thickness >0.90 mm and/or carotid plaques were used as the gold standard test for subclinical atherosclerosis and high CV risk (US+). Eleven (5.1%), 15 (6.9%) and 44 (20.4%) patients were defined as having high CV risk according to SCORE, QRisk II and ACC/AHA 10-year ASCVD risk, respectively. Fifty-two (24.1%) patients were US + and of those, 8 (15.4%), 7 (13.5%) and 23 (44.2%) patients were classified as high CV risk according to SCORE, QRisk II and ACC/AHA 10-year ASCVD risk, respectively. The ACC/AHA 10-year ASCVD risk index better identified US + patients than SCORE and QRisk II (P < 0.0001). With EULAR modification, reclassification from moderate to high risk occurred only in two, five and seven patients according to SCORE, QRisk II and ACC/AHA 10-year ASCVD risk, respectively. The 2013 ACC/AHA 10-year ASCVD risk estimator was better than the SCORE and QRisk II indices in RA, but still failed to identify 55% of high risk patients. Furthermore adjustment of threshold and EULAR modification did not work well. © The Author 2015. Published by Oxford University Press on behalf of the British Society for Rheumatology. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  8. Plasma diamine oxidase levels in pregnancy complicated by threatened abortion.

    PubMed Central

    Legge, M; Duff, G B

    1981-01-01

    Plasma diamine oxidase levels were assayed in 66 patients who presented with pregnancy complicated by threatened abortion. Levels within the normal range were associated with continuing pregnancies, whereas levels below the normal range were associated with subsequent abortion. Among those patients in whom gestation was greater than eight weeks, 66.6% of diamine oxidase levels correctly predicted the pregnancy outcome. Assay of the diamine oxidase levels at eight weeks of gestation or less gave little useful information. PMID:6785320

  9. Plasma diamine oxidase levels in pregnancy complicated by threatened abortion.

    PubMed

    Legge, M; Duff, G B

    1981-02-01

    Plasma diamine oxidase levels were assayed in 66 patients who presented with pregnancy complicated by threatened abortion. Levels within the normal range were associated with continuing pregnancies, whereas levels below the normal range were associated with subsequent abortion. Among those patients in whom gestation was greater than eight weeks, 66.6% of diamine oxidase levels correctly predicted the pregnancy outcome. Assay of the diamine oxidase levels at eight weeks of gestation or less gave little useful information.

  10. Expression of Ascorbic Acid Oxidase in Zucchini Squash (Cucurbita pepo L.).

    PubMed

    Lin, L S; Varner, J E

    1991-05-01

    The expression of ascorbic acid oxidase was studied in zucchini squash (Cucurbita pepo L.), one of the most abundant natural sources of the enzyme. In the developing fruit, specific activity of ascorbic acid oxidase was highest between 4 and 6 days after anthesis. Protein and mRNA levels followed the same trend as enzyme activity. Highest growth rate of the fruit occurred before 6 days after anthesis. Within a given fruit, ascorbic acid oxidase activity and mRNA level were highest in the epidermis, and lowest in the central placental region. In leaf tissue, ascorbic acid oxidase activity was higher in young leaves, and very low in old leaves. Within a given leaf, enzyme activity was highest in the fast-growing region (approximately the lower third of the blade), and lowest in the slow-growing region (near leaf apex). High expression of ascorbic acid oxidase at a stage when rapid growth is occurring (in both fruits and leaves), and localization of the enzyme in the fruit epidermis, where cells are under greatest tension during rapid growth in girth, suggest that ascorbic acid oxidase might be involved in reorganization of the cell wall to allow for expansion. Based on the known chemistry of dehydroascorbic acid, the end product of the ascorbic acid oxidase-catalyzed reaction, we have proposed several hypotheses to explain how dehydroascorbic acid might cause cell wall "loosening."

  11. Brain-derived neurotrophic factor (BDNF) in the rostral anterior cingulate cortex (rACC) contributes to neuropathic spontaneous pain-related aversion via NR2B receptors.

    PubMed

    Zhang, Le; Wang, Gongming; Ma, Jinben; Liu, Chengxiao; Liu, Xijiang; Zhan, Yufeng; Zhang, Mengyuan

    2016-10-01

    The rostral anterior cingulate cortex (rACC) plays an important role in pain affect. Previous investigations have reported that the rACC mediates the negative affective component of inflammatory pain and contributed to the aversive state of nerve injury-induced neuropathic pain. Brain-derived neurotrophic factor (BDNF), an activity-dependent neuromodulator in the adult brain, is believed to play a role in the development and maintenance of inflammatory and neuropathic pain in the spinal cord. However, whether and how BDNF in the rACC regulates pain-related aversion due to peripheral nerve injury is largely unknown. Behaviorally, using conditioned place preference (CPP) training in rats, which is thought to reveal spontaneous pain-related aversion, we found that CPP was acquired following spinal clonidine in rats with partial sciatic nerve transection. Importantly, BDNF was upregulated within the rACC in of rats with nerve injury and enhanced the CPP acquisition, while a local injection of a BDNF-tropomyosin receptor kinase B (TrkB) antagonist into the rACC completely blocked this process. Finally, we demonstrated that the BDNF/TrkB pathway exerted its function by activating the NR2B receptor, which is widely accepted to be a crucial factor contributing to pain affect. In conclusion, our results demonstrate that the BDNF/TrkB-mediated signaling pathway in the rACC is involved in the development of neuropathic spontaneous pain-related aversion and that this process is dependent upon activation of NR2B receptors. These findings suggest that suppression of the BDNF-related signaling pathway in the rACC may provide a novel strategy to overcome pain-related aversion. Copyright © 2016 Elsevier Inc. All rights reserved.

  12. Structure-function relationships in the evolutionary framework of spermine oxidase.

    PubMed

    Cervelli, Manuela; Salvi, Daniele; Polticelli, Fabio; Amendola, Roberto; Mariottini, Paolo

    2013-06-01

    Spermine oxidase is a FAD-dependent enzyme that specifically oxidizes spermine, and plays a central role in the highly regulated catabolism of polyamines in vertebrates. The spermine oxidase substrate is specifically spermine, a tetramine that plays mandatory roles in several cell functions, such as DNA synthesis, cellular proliferation, modulation of ion channels function, cellular signalling, nitric oxide synthesis and inhibition of immune responses. The oxidative products of spermine oxidase activity are spermidine, H2O2 and the aldehyde 3-aminopropanal that spontaneously turns into acrolein. In this study the reconstruction of the phylogenetic relationships among spermine oxidase proteins from different vertebrate taxa allowed to infer their molecular evolutionary history, and assisted in elucidating the conservation of structural and functional properties of this enzyme family. The amino acid residues, which have been hypothesized or demonstrated to play a pivotal role in the enzymatic activity, and substrate specificity are here analysed to obtain a comprehensive and updated view of the structure-function relationships in the evolution of spermine oxidase.

  13. Three-dimensional organization of three-domain copper oxidases: A review

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhukhlistova, N. E., E-mail: amm@ns.crys.ras.ru; Zhukova, Yu. N.; Lyashenko, A. V.

    2008-01-15

    'Blue' copper-containing proteins are multidomain proteins that utilize a unique redox property of copper ions. Among other blue multicopper oxidases, three-domain oxidases belong to the group of proteins that exhibit a wide variety of compositions in amino acid sequences, functions, and occurrences in organisms. This paper presents a review of the data obtained from X-ray diffraction investigations of the three-dimensional structures of three-domain multicopper oxidases, such as the ascorbate oxidase catalyzing oxidation of ascorbate to dehydroascorbate and its three derivatives; the multicopper oxidase CueO (the laccase homologue); the laccases isolated from the basidiomycetes Coprinus cinereus, Trametes versicolor, Coriolus zonatus, Cerrenamore » maxima, and Rigidoporus lignosus and the ascomycete Melanocarpus albomyces; and the bacterial laccases CotA from the endospore coats of Bacillus subtilis. A comparison of the molecular structures of the laccases of different origins demonstrates that, structurally, these objects are highly conservative. This obviously indicates that the catalytic activity of the enzymes under consideration is characterized by similar mechanisms.« less

  14. In vitro transcription in the presence of DNA oligonucleotides can generate strong anomalous initiation sites.

    PubMed

    Chow, C W; Clark, M P; Rinaldo, J E; Chalkley, R

    1996-03-01

    In the present study, we have explored an unexpected observation in transcription initiation that is mediated by single-stranded oligonucleotides. Initially, our goal was to understand the function of different upstream regulatory elements/initiation sites in the rat xanthine dehydrogenase/oxidase (XDH/XO) promoter. We performed in vitro transcription with HeLa nuclear extracts in the presence of different double-stranded oligonucleotides against upstream elements as competitors. A new and unusual transcription initiation site was detected by primer extension. This new initiation site maps to the downstream region of the corresponding competitor. Subsequent analyses have indicated that the induction of a new transcription initiation site is anomalous which is due to the presence of a small amount of single-stranded oligonucleotide in the competitor. We found that this anomalous initiation site is insensitive to the orientation of the promoter and requires only a small amount of single-stranded oligonucleotide (< 2-fold molar excess relative to template). We surmise that a complementary interaction between the single-stranded oligonucleotide and transiently denatured promoter template may be responsible for this sequence-specific transcription initiation artifact. To study the regulation of transcription initiation by in vitro transcription approaches, we propose that one should probe the effect of removing transacting factors by adding an excess of a cognate oligonucleotide which does not bear exact sequence identity to the template.

  15. Catalase deficiency may complicate urate oxidase (rasburicase) therapy.

    PubMed

    Góth, László; Bigler, N William

    2007-09-01

    Patients with low (inherited and acquired) catalase activities who are treated with infusion of uric acid oxidase because they are at risk of tumour lysis syndrome may experience very high concentrations of hydrogen peroxide. They may suffer from methemoglobinaemia and haemolytic anaemia which may be attributed either to deficiency of glucose-6-phosphate dehydrogenase or to other unknown circumstances. Data have not been reported from catalase deficient patients who were treated with uric acid oxidase. It may be hypothesized that their decreased blood catalase could lead to the increased concentration of hydrogen peroxide which may cause haemolysis and formation of methemoglobin. Blood catalase activity should be measured for patients at risk of tumour lysis syndrome prior to uric acid oxidase treatment.

  16. A comparison of native GPU computing versus OpenACC for implementing flow-routing algorithms in hydrological applications

    NASA Astrophysics Data System (ADS)

    Rueda, Antonio J.; Noguera, José M.; Luque, Adrián

    2016-02-01

    In recent years GPU computing has gained wide acceptance as a simple low-cost solution for speeding up computationally expensive processing in many scientific and engineering applications. However, in most cases accelerating a traditional CPU implementation for a GPU is a non-trivial task that requires a thorough refactorization of the code and specific optimizations that depend on the architecture of the device. OpenACC is a promising technology that aims at reducing the effort required to accelerate C/C++/Fortran code on an attached multicore device. Virtually with this technology the CPU code only has to be augmented with a few compiler directives to identify the areas to be accelerated and the way in which data has to be moved between the CPU and GPU. Its potential benefits are multiple: better code readability, less development time, lower risk of errors and less dependency on the underlying architecture and future evolution of the GPU technology. Our aim with this work is to evaluate the pros and cons of using OpenACC against native GPU implementations in computationally expensive hydrological applications, using the classic D8 algorithm of O'Callaghan and Mark for river network extraction as case-study. We implemented the flow accumulation step of this algorithm in CPU, using OpenACC and two different CUDA versions, comparing the length and complexity of the code and its performance with different datasets. We advance that although OpenACC can not match the performance of a CUDA optimized implementation (×3.5 slower in average), it provides a significant performance improvement against a CPU implementation (×2-6) with by far a simpler code and less implementation effort.

  17. [Respiratory oxidases: the enzymes which use most of the oxygen which living things breathe].

    PubMed

    Toledo-Cuevas, E M

    1997-01-01

    The respiratory oxidases are the last enzymes of the aerobic respiratory chain. They catalize the reduction of molecular oxygen to water, with generation of an electrochemical gradient useful for the energy demanding cellular processes. Most of the oxidases belong to the heme-copper superfamily. They possess a heme-copper center, constituted of a high spin heme and a CuB center, where the reduction of oxygen takes place and probably where the link to proton pumping is located. The superfamily is divided in two classes: the quinol- and the cytochrome c-oxidases. The latter are divided in the aa3 and the cbb3-type cytochrome c oxidases. The main difference between quinol- and the aa3-type cytochrome c-oxidases is the CuA center, which is absent in the quinol oxidases. The cbb3-type cytochrome oxidases have the binuclear center, but lack the CuA center. They also does not have the classical subunits II and III. These differences seem not to affect the oxygen reduction or the proton pumping. Probably the oxidases have evolved from some denitrification enzymes and prior the photosynthetic process. Also is possible that the cbb3-type cytochrome oxidases or others very similar have been the first oxidases to appear.

  18. Identification of the alternative terminal oxidase of higher plant mitochondria

    PubMed Central

    Elthon, Thomas E.; McIntosh, Lee

    1987-01-01

    In addition to cytochrome oxidase, plant mitochondria have a second terminal oxidase called the alternative oxidase. The alternative oxidase is of great interest in that energy is not conserved when electrons flow through it. The potential energy of the system is thus lost as heat, and, in plants with high levels of the alternative oxidase, this results in thermogenesis. We have purified the alternative oxidase from mitochondria of the thermogenic spadix of Sauromatum guttatum and have identified its polypeptide constituents by using polyclonal antibodies. A 166-fold purification was achieved through a combination of cation-exchange (carboxymethyl-Sepharose) and hydrophobic-interaction (phenyl-Sepharose) chromatography. Polyclonal antibodies raised to the CM-Sepharose fractions readily immunoprecipitated alternative oxidase activity and immunoprecipitated four of the proteins that copurify with the activity. These proteins have apparent molecular masses of 37, 36, 35.5, and 35 kDa. Polyclonal antibodies raised individually to the 37-, 36-, and 35.5- plus 35-kDa proteins cross-reacted with all of these proteins, indicating the presence of common antigenic sites. The 37-kDa protein appears to be constitutive in Sauromatum, whereas expression of the 36- and 35-kDa proteins was correlated with presence of alternative pathway activity. The 35.5-kDa protein appears with loss of alternative pathway activity during senescence, indicating that this protein may be a degradation product of the 36-kDa protein. Binding of anti-36-kDa protein antibodies to total mitochondrial protein blots of five plant species indicated that similar proteins were always present when alternative pathway activity was observed. Images PMID:16593898

  19. RESIDENT IMPLEMENTATION OF THE 2007 ACC/AHA GUIDELINES ON PREOPERATIVE CARDIAC EVALUATION IN NON-CARDIAC SURGERY PATIENTS: IS CLINICAL EXPERIENCE ENOUGH?

    PubMed

    Amhaz, Hassan H; Kuo, Ruth; Chidiac, Elie J; Pallekonda, Vinay; Fuleihan, Samir F; McKelvey, George; Kaddoum, Romeo N

    2015-06-01

    Preoperative evaluation of surgical patients is important, as perioperative complications are associated with increased mortality. Specialties including anesthesiology, internal medicine, cardiology, and surgery are involved in the evaluation and management of these patients. This institutional study investigated the residents' knowledge of the 2007 American College of Cardiology/American Heart Association (ACC/AHA) guidelines on perioperative evaluation of patients undergoing non-cardiac surgery. This pilot study used a web-based survey questionnaire to assess resident's knowledge of the 2007 ACC/AHA guidelines through individual steps and corresponding branch point(s) in twelve clinical scenarios. Additionally, residents were asked if they were aware of, or if they had received lectures on ACC/AHA guidelines. Staff anesthesiologists with training in cardiac and intensive care medicine validated the scenarios. A total of 104 resident participants were surveyed including 35 anesthesiology residents, 41 internal medicine residents, 20 surgery residents, and 8 cardiology fellows. Awareness of the 2007 ACC/AHA guidelines by specialty was: anesthesiology (85%), internal medicine (97.6%), cardiology (100%), and surgery (70%). Only 54.3% of anesthesiology, 31.7% of internal medicine, 100% of cardiology, and 10% of surgery residents stated they received lectures. The overall mean score achieved on the eleven scenarios was 50.4% for anesthesiology, 47.0% for internal medicine, 55.7% for cardiology, and 42.3% for surgery. Although the majority of residents were aware of the 2007 ACC/AHA guidelines, fewer received lectures and regardless of specialty, implementation of these guidelines was poor. There exists significant room for improvement in the understanding of preoperative assessment of non-cardiac surgery patients.

  20. Molecular and Biochemical Characterization of a Cytokinin Oxidase from Maize1

    PubMed Central

    Bilyeu, Kristin D.; Cole, Jean L.; Laskey, James G.; Riekhof, Wayne R.; Esparza, Thomas J.; Kramer, Michelle D.; Morris, Roy O.

    2001-01-01

    It is generally accepted that cytokinin oxidases, which oxidatively remove cytokinin side chains to produce adenine and the corresponding isopentenyl aldehyde, play a major role in regulating cytokinin levels in planta. Partially purified fractions of cytokinin oxidase from various species have been studied for many years, but have yet to clearly reveal the properties of the enzyme or to define its biological significance. Details of the genomic organization of the recently isolated maize (Zea mays) cytokinin oxidase gene (ckx1) and some of its Arabidopsis homologs are now presented. Expression of an intronless ckx1 in Pichia pastoris allowed production of large amounts of recombinant cytokinin oxidase and facilitated detailed kinetic and cofactor analysis and comparison with the native enzyme. The enzyme is a flavoprotein containing covalently bound flavin adenine dinucleotide, but no detectable heavy metals. Expression of the oxidase in maize tissues is described. PMID:11154345

  1. Gene expression analyses in tomato near isogenic lines provide evidence for ethylene and abscisic acid biosynthesis fine-tuning during arbuscular mycorrhiza development.

    PubMed

    Fracetto, Giselle Gomes Monteiro; Peres, Lázaro Eustáquio Pereira; Lambais, Marcio Rodrigues

    2017-07-01

    Plant responses to the environment and microorganisms, including arbuscular mycorrhizal fungi, involve complex hormonal interactions. It is known that abscisic acid (ABA) and ethylene may be involved in the regulation of arbuscular mycorrhiza (AM) and that part of the detrimental effects of ABA deficiency in plants is due to ethylene overproduction. In this study, we aimed to determine whether the low susceptibility to mycorrhizal colonization in ABA-deficient mutants is due to high levels of ethylene and whether AM development is associated with changes in the steady-state levels of transcripts of genes involved in the biosynthesis of ethylene and ABA. For that, tomato (Solanum lycopersicum) ethylene overproducer epinastic (epi) mutant and the ABA-deficient notabilis (not) and sitiens (sit) mutants, in the same Micro-Tom (MT) genetic background, were inoculated with Rhizophagus clarus, and treated with the ethylene biosynthesis inhibitor aminoethoxyvinylglycine (AVG). The development of AM, as well as the steady-state levels of transcripts involved in ethylene (LeACS2, LeACO1 and LeACO4) and ABA (LeNCED) biosynthesis, was determined. The intraradical colonization in epi, not and sit mutants was significantly reduced compared to MT. The epi mutant completely restored the mycorrhizal colonization to the levels of MT with the application of 10 µM of AVG, probably due to the inhibition of the ACC synthase gene expression. The steady-state levels of LeACS2 and LeACO4 transcripts were induced in mycorrhizal roots of MT, whereas the steady-state levels of LeACO1 and LeACO4 transcripts were significantly induced in sit, and the steady-state levels of LeNCED transcripts were significantly induced in all genotypes and in mycorrhizal roots of epi mutants treated with AVG. The reduced mycorrhizal colonization in sit mutants seems not to be limited by ethylene production via ACC oxidase regulation. Both ethylene overproduction and ABA deficiency impaired AM fungal

  2. Functional mechanism of neuroprotection by inhibitors of type B monoamine oxidase in Parkinson's disease.

    PubMed

    Naoi, Makoto; Maruyama, Wakako

    2009-08-01

    Neuroprotective therapy has been proposed for age-related neurodegenerative disorders, including Parkinson's disease. Inhibitors of type B monoamine oxidase (MAOB-Is), rasagiline and (-)deprenyl, are the most promising candidate neuroprotective drugs. Clinical trials of rasagiline in patients with Parkinson's disease suggest that rasagiline may have some disease-modifying effects. Results using animal and cellular models have proved that the MAOB-Is protect neurons by the intervention of 'intrinsic' mitochondrial apoptotic cascade and the induction of prosurvival antiapoptotic Bcl-2 and neurotrophic factors. Rasagiline-related MAOB-Is prevent mitochondrial permeability transition induced by various insults and activation of subsequent apoptotic cascades: cytochrome c release, casapase activation, and condensation and fragmentation of nuclear DNA. MAOB-Is increase transcription of prosurvival genes through activating the nuclear transcription factor-(NF) system. Rasagiline increases the protein and mRNA levels of GDNF in dopaminergic SH-SY5Y cells, whereas (-)deprenyl increases those of BDNF. Systemic administration of (-)deprenyl and rasagiline increases these neurotrophic factors in the cerebrospinal fluid from patients with Parkinson's disease and nonhuman primates. This review presents recent advances in our understanding of the neuroprotection offered by MAOB-Is and possible evaluation of neuroprotective efficacy in clinical samples is discussed.

  3. Cytochrome c oxidase rather than cytochrome c is a major determinant of mitochondrial respiratory capacity in skeletal muscle of aged rats: role of carnitine and lipoic acid.

    PubMed

    Tamilselvan, Jayavelu; Sivarajan, Kumarasamy; Anusuyadevi, Muthuswamy; Panneerselvam, Chinnakkannu

    2007-09-01

    The release of mitochondrial cytochrome c followed by activation of caspase cascade has been reported with aging in various tissues, whereas little is known about the caspase-independent pathway involved in mitochondrial dysfunction. To determine the functional impact of cytochrome c loss on mitochondrial respiratory capacity, we monitored NADH redox transitions and oxygen consumption in isolated skeletal muscle mitochondria of 4- and 24-month-old rats in the presence and absence of exogenous cytochrome c; and assessed the efficacy of cosupplementation of carnitine and lipoic acid on age-related alteration in mitochondrial respiration. The loss of mitochondrial cytochrome c with age was accompanied with alteration in respiratory transition, which in turn was not rescued by exogenous addition of cytochrome c to isolated mitochondria. The analysis of mitochondrial and nuclear-encoded cytochrome c oxidase subunits suggests that the decreased levels of cytochrome c oxidase may be attributed for the irresponsiveness to exogenously added cytochrome c on mitochondrial respiratory transitions, possibly through reduction of upstream electron carriers. Oral supplementation of carnitine and lipoic acid to aged rats help to maintaining the mitochondrial oxidative capacity by regulating the release of cytochrome c and improves cytochrome c oxidase transcript levels. Thus, carnitine and lipoic acid supplementation prevents the loss of cytochrome c and their associated decline in cytochrome c oxidase activity; thereby, effectively attenuating any putative decrease in cellular energy and redox status with age.

  4. Human molybdopterin synthase gene: identification of a bicistronic transcript with overlapping reading frames.

    PubMed Central

    Stallmeyer, B; Drugeon, G; Reiss, J; Haenni, A L; Mendel, R R

    1999-01-01

    A universal molybdenum-containing cofactor (MoCo) is essential for the activity of all human molybdoenzymes, including sulphite oxidase. The free cofactor is highly unstable, and all organisms share a similar biosynthetic pathway. The involved enzymes exhibit homologies, even between bacteria and humans. We have exploited these homologies to isolate a cDNA for the heterodimeric molybdopterin (MPT)-synthase. This enzyme is necessary for the conversion of an unstable precursor into molybdopterin, the organic moiety of MoCo. The corresponding transcript shows a bicistronic structure, encoding the small and large subunits of the MPT-synthase in two different open reading frames (ORFs) that overlap by 77 nucleotides. In various human tissues, only one size of mRNA coinciding with the bicistronic transcript was detected. In vitro translation and mutagenesis experiments demonstrated that each ORF is translated independently, leading to the synthesis of a 10-kDa protein and a 21-kDa protein for the small and large subunits, respectively, and indicated that the 3'-proximal ORF of the bicistronic transcript is translated by leaky scanning. PMID:10053003

  5. 21 CFR 866.2420 - Oxidase screening test for gonorrhea.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Oxidase screening test for gonorrhea. 866.2420 Section 866.2420 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2420 Oxidase...

  6. 21 CFR 866.2420 - Oxidase screening test for gonorrhea.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Oxidase screening test for gonorrhea. 866.2420 Section 866.2420 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2420 Oxidase...

  7. 21 CFR 866.2420 - Oxidase screening test for gonorrhea.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Oxidase screening test for gonorrhea. 866.2420 Section 866.2420 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2420 Oxidase...

  8. 21 CFR 866.2420 - Oxidase screening test for gonorrhea.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Oxidase screening test for gonorrhea. 866.2420 Section 866.2420 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2420 Oxidase...

  9. 21 CFR 866.2420 - Oxidase screening test for gonorrhea.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Oxidase screening test for gonorrhea. 866.2420 Section 866.2420 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2420 Oxidase...

  10. Identification of a Third Mn(II) Oxidase Enzyme in Pseudomonas putida GB-1

    PubMed Central

    Smesrud, Logan; Tebo, Bradley M.

    2016-01-01

    ABSTRACT The oxidation of soluble Mn(II) to insoluble Mn(IV) is a widespread bacterial activity found in a diverse array of microbes. In the Mn(II)-oxidizing bacterium Pseudomonas putida GB-1, two Mn(II) oxidase genes, named mnxG and mcoA, were previously identified; each encodes a multicopper oxidase (MCO)-type enzyme. Expression of these two genes is positively regulated by the response regulator MnxR. Preliminary investigation into putative additional regulatory pathways suggested that the flagellar regulators FleN and FleQ also regulate Mn(II) oxidase activity; however, it also revealed the presence of a third, previously uncharacterized Mn(II) oxidase activity in P. putida GB-1. A strain from which both of the Mn(II) oxidase genes and fleQ were deleted exhibited low levels of Mn(II) oxidase activity. The enzyme responsible was genetically and biochemically identified as an animal heme peroxidase (AHP) with domain and sequence similarity to the previously identified Mn(II) oxidase MopA. In the ΔfleQ strain, P. putida GB-1 MopA is overexpressed and secreted from the cell, where it actively oxidizes Mn. Thus, deletion of fleQ unmasked a third Mn(II) oxidase activity in this strain. These results provide an example of an Mn(II)-oxidizing bacterium utilizing both MCO and AHP enzymes. IMPORTANCE The identity of the Mn(II) oxidase enzyme in Pseudomonas putida GB-1 has been a long-standing question in the field of bacterial Mn(II) oxidation. In the current work, we demonstrate that P. putida GB-1 employs both the multicopper oxidase- and animal heme peroxidase-mediated pathways for the oxidation of Mn(II), rendering this model organism relevant to the study of both types of Mn(II) oxidase enzymes. The presence of three oxidase enzymes in P. putida GB-1 deepens the mystery of why microorganisms oxidize Mn(II) while providing the field with the tools necessary to address this question. The initial identification of MopA as a Mn(II) oxidase in this strain required the

  11. The first mammalian aldehyde oxidase crystal structure: insights into substrate specificity.

    PubMed

    Coelho, Catarina; Mahro, Martin; Trincão, José; Carvalho, Alexandra T P; Ramos, Maria João; Terao, Mineko; Garattini, Enrico; Leimkühler, Silke; Romão, Maria João

    2012-11-23

    Aldehyde oxidases have pharmacological relevance, and AOX3 is the major drug-metabolizing enzyme in rodents. The crystal structure of mouse AOX3 with kinetics and molecular docking studies provides insights into its enzymatic characteristics. Differences in substrate and inhibitor specificities can be rationalized by comparing the AOX3 and xanthine oxidase structures. The first aldehyde oxidase structure represents a major advance for drug design and mechanistic studies. Aldehyde oxidases (AOXs) are homodimeric proteins belonging to the xanthine oxidase family of molybdenum-containing enzymes. Each 150-kDa monomer contains a FAD redox cofactor, two spectroscopically distinct [2Fe-2S] clusters, and a molybdenum cofactor located within the protein active site. AOXs are characterized by broad range substrate specificity, oxidizing different aldehydes and aromatic N-heterocycles. Despite increasing recognition of its role in the metabolism of drugs and xenobiotics, the physiological function of the protein is still largely unknown. We have crystallized and solved the crystal structure of mouse liver aldehyde oxidase 3 to 2.9 Å. This is the first mammalian AOX whose structure has been solved. The structure provides important insights into the protein active center and further evidence on the catalytic differences characterizing AOX and xanthine oxidoreductase. The mouse liver aldehyde oxidase 3 three-dimensional structure combined with kinetic, mutagenesis data, molecular docking, and molecular dynamics studies make a decisive contribution to understand the molecular basis of its rather broad substrate specificity.

  12. [Oxygen and the superoxide anion. Modulation of NADPH oxidase?].

    PubMed

    Delbosc, S; Cristol, J P; Descomps, B; Chénard, J; Sirois, P

    2001-01-01

    Oxidative stress which results from an imbalance between oxidant production and antioxidant defense mechanisms can promote modifications of lipids, proteins and nucleic acids. This review focuses on the different pathways leading to Reactive Oxygen Species (ROS) production in particular on NADPH oxidase activation. This enzyme is localized in numerous cells including phagocytes and vascular cells and composed of membrane and cytosolic sub-units. The activation of the NADPH oxidase is largely involved in inflammation associated diseases such as asthma, Systemic Inflammatory Response Syndrome and aging associated diseases such as atherosclerosis and neurodeneratives diseases. The modulation of NADPH oxidase could be a way to limit or prevent the development of these diseases.

  13. Aiding and abetting roles of NOX oxidases in cellular transformation

    PubMed Central

    Block, Karen; Gorin, Yves

    2013-01-01

    NADPH oxidases of the NADPH oxidase (NOX) family are dedicated reactive oxygen species-generating enzymes that broadly and specifically regulate redox-sensitive signalling pathways that are involved in cancer development and progression. They act at specific cellular membranes and microdomains through the activation of oncogenes and the inactivation of tumour suppressor proteins. In this Review, we discuss primary targets and redox-linked signalling systems that are influenced by NOX-derived ROS, and the biological role of NOX oxidases in the aetiology of cancer. PMID:22918415

  14. Inhibition of monoamine oxidase A increases recovery after experimental cardiac arrest.

    PubMed

    Vuohelainen, Vilma; Hämäläinen, Mari; Paavonen, Timo; Karlsson, Sari; Moilanen, Eeva; Mennander, Ari

    2015-10-01

    Perioperative myocardial infarction (MI) with ischaemia-reperfusion injury (IRI) is a devastating entity occurring in 1-2% of patients after cardiac surgery. The molecular pathway leading to myocardial cellular destruction after MI may include monoamine oxidases. We experimentally investigated whether moclobemide, a monoamine oxidase inhibitor, enhances myocardial recovery after cardiac arrest and MI. Fifty-six syngeneic Fischer rats underwent heterotopic cardiac transplantation to induce reversible IRI after cardiac arrest. Twenty-eight rats also underwent permanent ligation of the left anterior descending coronary artery to induce MI after cardiac arrest. Twenty-eight rats with or without MI were treated with subcutaneous moclobemide 10 mg/kg/day. Methods used to study myocardial recovery were microdialysis for intramyocardial metabolism, histology and quantitative reverse-transcription polymerase chain reaction for high-mobility group box-1 (HMGB1), haeme oxygenase-1 (HO-1), interleukin-6, hypoxia-inducible factor 1α and macrophages (CD68). Pyruvate increased in MI treated with moclobemide versus IRI with moclobemide (29.19 ± 7.64 vs 13.86 ± 8.49 µM, P = 0.028), reflecting metabolic activity after cardiac arrest and reperfusion. Myocardial inflammation increased in MI compared with IRI after 1 h (0.80 ± 0.56 vs 0, point score units [PSUs], P = 0.003), but decreased after 5 days in MI treated with moclobemide versus MI alone (0.80 ± 0.83 vs 2.00 ± 0.70, PSU, P = 0.033). Expressions of HMGB1, CD68 and HO-1 decreased in MI treated with moclobemide versus MI alone (1.33 ± 0.20 vs 1.75 ± 0.24, fold changes [FCs], P = 0.028; 5.15 ± 1.10 vs 9.59 ± 2.75, FC, P = 0.050; 10.41 ± 4.17 vs 21.28 ± 10.01, FC, P = 0.047), indicating myocardial recovery and increased cellularity of remote intramyocardial arteries. Moclobemide enhances myocardial recovery after cardiac arrest and MI; inhibition of remote myocardial changes may be achieved by targeting treatment

  15. Ethylene regulates Apple (Malus x domestica) fruit softening through a dose x time-dependent mechanism and through differential sensitivities and dependencies of cell wall-modifying genes.

    PubMed

    Ireland, Hilary S; Gunaseelan, Kularajathevan; Muddumage, Ratnasiri; Tacken, Emma J; Putterill, Jo; Johnston, Jason W; Schaffer, Robert J

    2014-05-01

    In fleshy fruit species that have a strong requirement for ethylene to ripen, ethylene is synthesized autocatalytically, producing increasing concentrations as the fruits ripen. Apple fruit with the ACC OXIDASE 1 (ACO1) gene suppressed cannot produce ethylene autocatalytically at ripening. Using these apple lines, an ethylene sensitivity dependency model was previously proposed, with traits such as softening showing a high dependency for ethylene as well as low sensitivity. In this study, it is shown that the molecular control of fruit softening is a complex process, with different cell wall-related genes being independently regulated and exhibiting differential sensitivities to and dependencies on ethylene at the transcriptional level. This regulation is controlled through a dose × time mechanism, which results in a temporal transcriptional response that would allow for progressive cell wall disassembly and thus softening. This research builds on the sensitivity dependency model and shows that ethylene-dependent traits can progress over time to the same degree with lower levels of ethylene. This suggests that a developmental clock measuring cumulative ethylene controls the fruit ripening process.

  16. NADPH Oxidase Activation Contributes to Heavy Ion Irradiation–Induced Cell Death

    PubMed Central

    Wang, Yupei; Liu, Qing; Zhao, Weiping; Zhou, Xin; Miao, Guoying; Sun, Chao

    2017-01-01

    Increased oxidative stress plays an important role in heavy ion radiation–induced cell death. The mechanism involved in the generation of elevated reactive oxygen species (ROS) is not fully illustrated. Here we show that NADPH oxidase activation is closely related to heavy ion radiation–induced cell death via excessive ROS generation. Cell death and cellular ROS can be greatly reduced in irradiated cancer cells with the preincubation of diphenyleneiodium, an inhibitor of NADPH oxidase. Most of the NADPH oxidase (NOX) family proteins (NOX1, NOX2, NOX3, NOX4, and NOX5) showed increased expression after heavy ion irradiation. Meanwhile, the cytoplasmic subunit p47phox was translocated to the cell membrane and localized with NOX2 to form reactive NADPH oxidase. Our data suggest for the first time that ROS generation, as mediated by NADPH oxidase activation, could be an important contributor to heavy ion irradiation–induced cell death. PMID:28473742

  17. Immobilization of xanthine oxidase on a polyaniline silicone support.

    PubMed

    Nadruz, W; Marques, E T; Azevedo, W M; Lima-Filho, J L; Carvalho, L B

    1996-03-01

    A polyaniline silicone support to immobilize xanthine oxidase is proposed as a reactor coil to monitor the action of xanthine oxidase on hypoxanthine, xanthine and 6-mercaptopurine. A purified xanthine oxidase immobilized on this support lost 80% of the initial activity after 12 min of use. Co-immobilization of superoxide dismutase and catalase increased the stability of immobilized xanthine oxidase so that the derivative maintained 79% of its initial activity after 4.6 h of continuous use in which 1.5 mumol purine bases were converted by the immobilized enzyme system. There is no evidence of either polyaniline or protein leaching from the coil during 3 h of continuous use. When solutions (10 ml) of hypoxanthine, xanthine and 6-mercaptopurine were circulated individually through the xanthine oxidase-superoxide dismutase-catalase-polyaniline coil (1 mm internal diameter and 3 m in length, 3 ml internal volume) activities of 8.12, 11.17 and 1.09 nmol min-1 coil-1, respectively, were obtained. The advantages of the reactor configuration and the redox properties of the polymer, particularly with respect to immobilized oxidoreductases, make this methodology attractive for similar enzyme systems. This immobilized enzyme system using polyaniline-silicone as support converted 6-mercaptopurine to 6-thiouric acid with equal efficiency as resins based on polyacrylamide and polyamide 11.

  18. Breadfruit (Artocarpus altilis) gibberellin 2-oxidase genes in stem elongation and abiotic stress response.

    PubMed

    Zhou, Yuchan; Underhill, Steven J R

    2016-01-01

    Breadfruit (Artocarpus altilis) is a traditional staple tree crop in the Oceania. Susceptibility to windstorm damage is a primary constraint on breadfruit cultivation. Significant tree loss due to intense tropical windstorm in the past decades has driven a widespread interest in developing breadfruit with dwarf stature. Gibberellin (GA) is one of the most important determinants of plant height. GA 2-oxidase is a key enzyme regulating the flux of GA through deactivating biologically active GAs in plants. As a first step toward understanding the molecular mechanism of growth regulation in the species, we isolated a cohort of four full-length GA2-oxidase cDNAs, AaGA2ox1- AaGA2ox4 from breadfruit. Sequence analysis indicated the deduced proteins encoded by these AaGA2oxs clustered together under the C19 GA2ox group. Transcripts of AaGA2ox1, AaGA2ox2 and AaGA2ox3 were detected in all plant organs, but exhibited highest level in source leaves and stems. In contrast, transcript of AaGA2ox4 was predominantly expressed in roots and flowers, and displayed very low expression in leaves and stems. AaGA2ox1, AaGA2ox2 and AaGA2ox3, but not AaGA2ox4 were subjected to GA feedback regulation where application of exogenous GA3 or gibberellin biosynthesis inhibitor, paclobutrazol was shown to manipulate the first internode elongation of breadfruit. Treatments of drought or high salinity increased the expression of AaGA2ox1, AaGA2ox2 and AaGA2ox4. But AaGA2ox3 was down-regulated under salt stress. The function of AaGA2oxs is discussed with particular reference to their role in stem elongation and involvement in abiotic stress response in breadfruit. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  19. Variations of the Antarctic Circumpolar Current (ACC) in the Kerguelen Sector during the Last Deglaciation : sedimentological and geochemical evidences

    NASA Astrophysics Data System (ADS)

    Bout-Roumazeilles, V.; Beny, F.; Mazaud, A.; Michel, E.; Crosta, X.; Davies, G. R.; Bory, A. J. M.

    2017-12-01

    High-resolution sedimentological and geochemical records were obtained from two sediment cores recovered by the French R/V Marion Dufresne during the INDIEN-SUD-ACC cruises near the sub-Antarctic Kerguelen Islands (49°S). This area is ideal to record past oceanic and atmospheric changes in the Southern Ocean because they are currently located in the northern branch of the Antarctic Circumpolar Current and under the direct influence of Southern Hemisphere Westerly wind belt. This study focuses on the last termination, with specific emphasis on the impact of severe climatic events (Heinrich Stadial 1, Antarctic Cold Reversal, Younger Dryas) onto the ocean-atmospheric exchange. Results indicates that most of the sediment is derived from the Kerguelen Plateau, characterized by high smectite content. Periodically, a minor contribution of Antarctica is noticeable. In particular, illite variations suggest fast and short northward incursions of Antarctic Bottom Water, probably formed in the Prydz Bay during the last glaciation. Grainsize repartition combined to magnetic parameters show a southward migration of the ACC and the fronts associated from the beginning of the deglaciation, which is consistent with Southern Hemisphere climate variations. On the opposite, it highlights an asynchronous decrease of the ACC strength, with a large drop during the Antarctic Cold Reversal when atmospheric CO2 increase was slowed down. Thus, at least in the studied area, the ACC strength and the Antarctic Climate were not synchronous during the last deglaciation.

  20. Cytotoxicity of polyamines to Amoeba proteus: role of polyamine oxidase.

    PubMed

    Schenkel, E; Dubois, J G; Helson-Cambier, M; Hanocq, M

    1996-02-01

    It has been shown that oxidation of polyamines by polyamine oxidases can produce toxic compounds (H2O2, aldehydes, ammonia) and that the polyamine oxidase-polyamine system is implicated, in vitro, in the death of several parasites. Using Amoeba proteus as an in vitro model, we studied the cytotoxicity to these cells of spermine, spermidine, their acetyl derivatives, and their hypothetical precursors. Spermine and N1-acetylspermine were more toxic than emetine, an amoebicidal reference drug. Spermine presented a short-term toxicity, but a 48-h contact time was necessary for the high toxicity of spermidine. The uptake by Amoeba cells of the different polyamines tested was demonstrated. On the other hand, a high polyamine oxidase activity was identified in Amoeba proteus crude extract. Spermine (theoretical 100%) and N1-acetylspermine (64%) were the best substrates at pH 9.5, while spermidine, its acetyl derivatives, and putrescine were very poorly oxidized by this enzyme (3-20%). Spermine oxidase activity was inhibited by phenylhydrazine (nil) and isoniazid (approximately 50%). Mepacrine did not inhibit the enzyme activity at pH 8. Neither monoamine nor diamine oxidase activity (approximately 10%) was found. It must be emphasized that spermine, the best enzyme substrate, is the most toxic polyamine. This finding suggests that knowledge of polyamine oxidase specificity can be used to modulate the cytotoxicity of polyamine derivatives. Amoeba proteus was revealed as a simple model for investigation of the connection between cytotoxicity and enzyme activity.

  1. Simple, high-yield purification of xanthine oxidase from bovine milk.

    PubMed

    Ozer, N; Müftüoglu, M; Ataman, D; Ercan, A; Ogüs, I H

    1999-05-13

    Xanthine oxidase, a commercially important enzyme with a wide area of application, was extracted from fresh milk, without added preservatives, using toluene and heat. The short purification procedure, with high yield, consisted of extraction, ammonium sulfate fractionation, and DEAE-Sepharose (fast flow) column chromatography. Xanthine oxidase was eluted as a single activity peak from the column using a buffer gradient. The purification fold, specific activity and yield for the purified xanthine oxidase were 328, 10.161 U/mg and 69%, respectively. The enzyme was concentrated by ultrafiltration, although 31% of the activity was lost during concentration, no change in specific activity was observed. Activity and protein gave coincident staining bands on native polyacrylamide gels. The intensity and the number of bands were dependent on the oxidative state(s) of the enzyme; reduction by 2-mercaptoethanol decreased the intensity of the slow-moving bands and increased the intensity of the fastest-moving band. Following sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), two major bands (molecular masses of 152 and 131 kDa) were observed, accounting for > or = 95% of xanthine oxidase. Native- and SDS-PAGE showed that the purified xanthine oxidase becomes a heterodimer due to endogenous proteases.

  2. Association of DNA methylation and monoamine oxidase A gene expression in the brains of different dog breeds.

    PubMed

    Eo, JungWoo; Lee, Hee-Eun; Nam, Gyu-Hwi; Kwon, Yun-Jeong; Choi, Yuri; Choi, Bong-Hwan; Huh, Jae-Won; Kim, Minkyu; Lee, Sang-Eun; Seo, Bohyun; Kim, Heui-Soo

    2016-04-15

    The monoamine oxidase A (MAOA) gene is an important candidate gene for human behavior that encodes an enzyme regulating the metabolism of key neurotransmitters. The regulatory mechanisms of the MAOA gene in dogs are yet to be elucidated. We measured MAOA gene transcription and analyzed the VNTR genotype and methylation status of the gene promoter region in different dog breeds to determine whether MAOA expression is correlated with the MAOA genotype or epigenetic modification in dogs. We found brain-specific expression of the MAOA gene and different transcription levels in different dog breeds including Beagle, Sapsaree, and German shepherd, and also a robust association of the DNA methylation of the gene promoter with mRNA levels. However, the 90 bp tandem repeats that we observed near the transcription start site were not variable, indicating no correlation with canine MAOA activity. These results show that differential DNA methylation in the MAOA promoter region may affect gene expression by modulating promoter activity. Moreover, the distinctive patterns of MAOA expression and DNA methylation may be involved in breed-specific or individual behavioral characteristics, such as aggression, because behavioral phenotypes are related to different physiological and neuroendocrine responses. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Deciphering of the Dual oxidase (Nox family) gene from kuruma shrimp, Marsupenaeus japonicus: full-length cDNA cloning and characterization.

    PubMed

    Inada, Mari; Kihara, Keisuke; Kono, Tomoya; Sudhakaran, Raja; Mekata, Tohru; Sakai, Masahiro; Yoshida, Terutoyo; Itami, Toshiaki

    2013-02-01

    In many physiological processes, including the innate immune system, free radicals such as nitric oxide (NO) and reactive oxygen species (ROS) play significant roles. In humans, 2 homologs of Dual oxidases (Duox) generate hydrogen peroxide (H(2)O(2)), which is a type of ROS. Here, we report the identification and characterization of a Duox from kuruma shrimp, Marsupenaeus japonicus. The full-length cDNA sequence of the M. japonicus Dual oxidase (MjDuox) gene contains 4695 bp and was generated using reverse transcriptase-polymerase chain reaction (RT-PCR) and random amplification of cDNA ends (RACE). The open reading frame of MjDuox encodes a protein of 1498 amino acids with an estimated mass of 173 kDa. In a homology analysis using amino acid sequences, MjDuox exhibited 69.3% sequence homology with the Duox of the red flour beetle, Tribolium castaneum. A transcriptional analysis revealed that the MjDuox mRNA is highly expressed in the gills of healthy kuruma shrimp. In the gills, MjDuox expression reached its peak 60 h after injection with WSSV and decreased to its normal level at 72 h. In gene knockdown experiments of free radical-generating enzymes, the survival rates decreased during the early stages of a white spot syndrome virus (WSSV) infection following the knockdown of the NADPH oxidase (MjNox) or MjDuox genes. In the present study, the identification, cloning and gene knockdown of the kuruma shrimp MjDuox are reported. Duoxes have been identified in vertebrates and some insects; however, few reports have investigated Duoxes in crustaceans. This study is the first to identify and clone a Dual oxidase from a crustacean species. Copyright © 2012 Elsevier Ltd. All rights reserved.

  4. Assay Methods for ACS Activity and ACS Phosphorylation by MAP Kinases In Vitro and In Vivo.

    PubMed

    Han, Xiaomin; Li, Guojing; Zhang, Shuqun

    2017-01-01

    Ethylene, a gaseous phytohormone, has profound effects on plant growth, development, and adaptation to the environment. Ethylene-regulated processes begin with the induction of ethylene biosynthesis. There are two key steps in ethylene biosynthesis. The first is the biosynthesis of 1-aminocyclopropane-1-carboxylic acid (ACC) from S-Adenosyl-Methionine (SAM), a common precursor in many metabolic pathways, which is catalyzed by ACC synthase (ACS). The second is the oxidative cleavage of ACC to form ethylene under the action of ACC oxidase (ACO). ACC biosynthesis is the committing and generally the rate-limiting step in ethylene biosynthesis. As a result, characterizing the cellular ACS activity and understanding its regulation are important. In this chapter, we detail the methods used to measure, (1) the enzymatic activity of both recombinant and native ACS proteins, and (2) the phosphorylation of ACS protein by mitogen-activated protein kinases (MAPKs) in vivo and in vitro.

  5. Urate Oxidase Purification by Salting-in Crystallization: Towards an Alternative to Chromatography

    PubMed Central

    Giffard, Marion; Ferté, Natalie; Ragot, François; El Hajji, Mohamed; Castro, Bertrand; Bonneté, Françoise

    2011-01-01

    Background Rasburicase (Fasturtec® or Elitek®, Sanofi-Aventis), the recombinant form of urate oxidase from Aspergillus flavus, is a therapeutic enzyme used to prevent or decrease the high levels of uric acid in blood that can occur as a result of chemotherapy. It is produced by Sanofi-Aventis and currently purified via several standard steps of chromatography. This work explores the feasibility of replacing one or more chromatography steps in the downstream process by a crystallization step. It compares the efficacy of two crystallization techniques that have proven successful on pure urate oxidase, testing them on impure urate oxidase solutions. Methodology/Principal Findings Here we investigate the possibility of purifying urate oxidase directly by crystallization from the fermentation broth. Based on attractive interaction potentials which are known to drive urate oxidase crystallization, two crystallization routes are compared: a) by increased polymer concentration, which induces a depletion attraction and b) by decreased salt concentration, which induces attractive interactions via a salting-in effect. We observe that adding polymer, a very efficient way to crystallize pure urate oxidase through the depletion effect, is not an efficient way to grow crystals from impure solution. On the other hand, we show that dialysis, which decreases salt concentration through its strong salting-in effect, makes purification of urate oxidase from the fermentation broth possible. Conclusions The aim of this study is to compare purification efficacy of two crystallization methods. Our findings show that crystallization of urate oxidase from the fermentation broth provides purity comparable to what can be achieved with one chromatography step. This suggests that, in the case of urate oxidase, crystallization could be implemented not only for polishing or concentration during the last steps of purification, but also as an initial capture step, with minimal changes to the

  6. Construction of Mutant Glucose Oxidases with Increased Dye-Mediated Dehydrogenase Activity

    PubMed Central

    Horaguchi, Yohei; Saito, Shoko; Kojima, Katsuhiro; Tsugawa, Wakako; Ferri, Stefano; Sode, Koji

    2012-01-01

    Mutagenesis studies on glucose oxidases (GOxs) were conducted to construct GOxs with reduced oxidase activity and increased dehydrogenase activity. We focused on two representative GOxs, of which crystal structures have already been reported—Penicillium amagasakiense GOx (PDB ID; 1gpe) and Aspergillus niger GOx (PDB ID; 1cf3). We constructed oxygen-interacting structural models for GOxs, and predicted the residues responsible for oxidative half reaction with oxygen on the basis of the crystal structure of cholesterol oxidase as well as on the fact that both enzymes are members of the glucose/methanol/choline (GMC) oxidoreductase family. Rational amino acid substitution resulted in the construction of an engineered GOx with drastically decreased oxidase activity and increased dehydrogenase activity, which was higher than that of the wild-type enzyme. As a result, the dehydrogenase/oxidase ratio of the engineered enzyme was more than 11-fold greater than that of the wild-type enzyme. These results indicate that alteration of the dehydrogenase/oxidase activity ratio of GOxs is possible by introducing a mutation into the putative functional residues responsible for oxidative half reaction with oxygen of these enzymes, resulting in a further increased dehydrogenase activity. This is the first study reporting the alteration of GOx electron acceptor preference from oxygen to an artificial electron acceptor. PMID:23203056

  7. Structure of caa(3) cytochrome c oxidase--a nature-made enzyme-substrate complex.

    PubMed

    Noor, Mohamed Radzi; Soulimane, Tewfik

    2013-05-01

    Aerobic respiration, the energetically most favorable metabolic reaction, depends on the action of terminal oxidases that include cytochrome c oxidases. The latter forms a part of the heme-copper oxidase superfamily and consists of three different families (A, B, and C types). The crystal structures of all families have now been determined, allowing a detailed structural comparison from evolutionary and functional perspectives. The A2-type oxidase, exemplified by the Thermus thermophilus caa(3) oxidase, contains the substrate cytochrome c covalently bound to the enzyme complex. In this article, we highlight the various features of caa(3) enzyme and provide a discussion of their importance, including the variations in the proton and electron transfer pathways.

  8. The Importance of NADPH Oxidases and Redox Signaling in Angiogenesis

    PubMed Central

    Prieto-Bermejo, Rodrigo; Hernández-Hernández, Angel

    2017-01-01

    Eukaryotic cells have to cope with the constant generation of reactive oxygen species (ROS). Although the excessive production of ROS might be deleterious for cell biology, there is a plethora of evidence showing that moderate levels of ROS are important for the control of cell signaling and gene expression. The family of the nicotinamide adenine dinucleotide phosphate oxidases (NADPH oxidases or Nox) has evolved to produce ROS in response to different signals; therefore, they fulfil a central role in the control of redox signaling. The role of NADPH oxidases in vascular physiology has been a field of intense study over the last two decades. In this review we will briefly analyze how ROS can regulate signaling and gene expression. We will address the implication of NADPH oxidases and redox signaling in angiogenesis, and finally, the therapeutic possibilities derived from this knowledge will be discussed. PMID:28505091

  9. Degradation of oxalate in rats implanted with immobilized oxalate oxidase.

    PubMed

    Raghavan, K G; Tarachand, U

    1986-01-20

    Accumulation of oxalate leads to hyperoxaluria and calcium oxalate nephrolithiasis in man. Since oxalate is a metabolic end product in mammals, the feasibility of its enzymic degradation has been tested in vivo in rats by administering exogenous oxalate oxidase. Oxalate oxidase, isolated from banana fruit peels, in its native form was found to be non-active at the physiological pH of the recipient animal. However, its functional viability in the recipient animal was ensured by its prior binding with ethylenemaleic anhydride, thus shifting its pH activity curve towards the alkaline range. Rats implanted with dialysis membrane capsules containing such immobilized oxalate oxidase in their peritoneal cavities effectively metabolized intraperitoneally injected [14C]oxalate as well as its precursor [14C]glyoxalate. The implantation of capsules containing coentrapped multienzyme preparations of oxalate oxidase, catalase and peroxidase led to a further degradation of administered [14C]oxalate in rats.

  10. Potentiation of motor sub-networks for motor control but not working memory: Interaction of dACC and SMA revealed by resting-state directed functional connectivity

    PubMed Central

    Diwadkar, Vaibhav A.; Asemi, Avisa; Burgess, Ashley; Chowdury, Asadur; Bressler, Steven L.

    2017-01-01

    The dorsal Anterior Cingulate Cortex (dACC) and the Supplementary Motor Area (SMA) are known to interact during motor coordination behavior. We previously discovered that the directional influences underlying this interaction in a visuo-motor coordination task are asymmetric, with the dACC→SMA influence being significantly greater than that in the reverse direction. To assess the specificity of this effect, here we undertook an analysis of the interaction between dACC and SMA in two distinct contexts. In addition to the motor coordination task, we also assessed these effects during a (n-back) working memory task. We applied directed functional connectivity analysis to these two task paradigms, and also to the rest condition of each paradigm, in which rest blocks were interspersed with task blocks. We report here that the previously known asymmetric interaction between dACC and SMA, with dACC→SMA dominating, was significantly larger in the motor coordination task than the memory task. Moreover the asymmetry between dACC and SMA was reversed during the rest condition of the motor coordination task, but not of the working memory task. In sum, the dACC→SMA influence was significantly greater in the motor task than the memory task condition, and the SMA→dACC influence was significantly greater in the motor rest than the memory rest condition. We interpret these results as suggesting that the potentiation of motor sub-networks during the motor rest condition supports the motor control of SMA by dACC during the active motor task condition. PMID:28278267

  11. What's next for dyslipidemia management? The 2013 ACC/AHA Guidelines, the NLA recommendations, and beyond.

    PubMed

    Waite, Laura H; Phan, Yvonne L; Spinler, Sarah A

    2016-01-01

    To compare and contrast the 2013 American College of Cardiology (ACC)/American Heart Association (AHA) Guidelines and the 2014/2015 National Lipid Association (NLA) Recommendations for Management of Dyslipidemia in the context of evolving evidence. Guidelines from the National Cholesterol Education Program (NCEP), ACC/AHA, and NLA; recent clinical trials involving non-statin therapies. Not applicable. At the authors' discretion, preference was given to references focusing on guidelines and recent clinical trials involving dyslipidemia management. In late 2013, the ACC/AHA released guidelines on the treatment of blood cholesterol to reduce risk for atherosclerotic cardiovascular disease (ASCVD) in adults. Reflecting contemporary evidence-based literature, low-density lipoprotein cholesterol (LDL-C) and non-high-density lipoprotein cholesterol (non-HDL-C) numeric treatment goals were eliminated, and a new method of risk assessment (the Pooled Cohort Equations) was recommended. The guidelines emphasized lipid lowering in 4 patient populations proven to benefit from statin therapy, recommending moderate to high-intensity statin dosing, with no additional drug therapies and limited ongoing monitoring. Clinical controversies ignited by these guidelines led to the publication of recommendations by the NLA in 2014 and 2015. Part 1 of the NLA recommendations incorporated parts of both the ATP III guidelines and the 2013 ACC/AHA guidelines along with updated original recommendations. These recommendations provided numeric LDL-C, non-HDL-C, and apolipoprotein B treatment goals and potential additional ASCVD risk factors, with stepwise risk assessment based on traditional cardiac risk factors and multiple assessment tools. In addition to statins, the 2014 NLA recommendations highlighted the benefit of additional or alternative lipid-lowering therapies. Part 2 of the NLA recommendations expanded the guidance for treatment of special populations and prioritized ezetimibe as a

  12. Knockdown of Polyphenol Oxidase Gene Expression in Potato (Solanum tuberosum L.) with Artificial MicroRNAs.

    PubMed

    Chi, Ming; Bhagwat, Basdeo; Tang, Guiliang; Xiang, Yu

    2016-01-01

    It is of great importance and interest to develop crop varieties with low polyphenol oxidase (PPO) activity for the food industry because PPO-mediated oxidative browning is a main cause of post-harvest deterioration and quality loss of fresh produce and processed foods. We recently demonstrated that potato tubers with reduced browning phenotypes can be produced by inhibition of the expression of several PPO gene isoforms using artificial microRNA (amiRNA) technology. The approach introduces a single type of 21-nucleotide RNA population to guide silencing of the PPO gene transcripts in potato tissues. Some advantages of the technology are: small RNA molecules are genetically transformed, off-target gene silencing can be avoided or minimized at the stage of amiRNA designs, and accuracy and efficiency of the processes can be detected at every step using molecular biological techniques. Here we describe the methods for transformation and regeneration of potatoes with amiRNA vectors, detection of the expression of amiRNAs, identification of the cleaved product of the target gene transcripts, and assay of the expression level of PPO gene isoforms in potatoes.

  13. Multilayered Polyelectrolyte Microcapsules: Interaction with the Enzyme Cytochrome C Oxidase

    PubMed Central

    Pastorino, Laura; Dellacasa, Elena; Noor, Mohamed R.; Soulimane, Tewfik; Bianchini, Paolo; D'Autilia, Francesca; Antipov, Alexei; Diaspro, Alberto; Tofail, Syed A. M.; Ruggiero, Carmelina

    2014-01-01

    Cell-sized polyelectrolyte capsules functionalized with a redox-driven proton pump protein were assembled for the first time. The interaction of polyelectrolyte microcapsules, fabricated by electrostatic layer-by-layer assembly, with cytochrome c oxidase molecules was investigated. We found that the cytochrome c oxidase retained its functionality, that the functionalized microcapsules interacting with cytochrome c oxidase were permeable and that the permeability characteristics of the microcapsule shell depend on the shell components. This work provides a significant input towards the fabrication of an integrated device made of biological components and based on specific biomolecular functions and properties. PMID:25372607

  14. Identification in Marinomonas mediterranea of a novel quinoprotein with glycine oxidase activity.

    PubMed

    Campillo-Brocal, Jonatan Cristian; Lucas-Elio, Patricia; Sanchez-Amat, Antonio

    2013-08-01

    A novel enzyme with lysine-epsilon oxidase activity was previously described in the marine bacterium Marinomonas mediterranea. This enzyme differs from other l-amino acid oxidases in not being a flavoprotein but containing a quinone cofactor. It is encoded by an operon with two genes lodA and lodB. The first one codes for the oxidase, while the second one encodes a protein required for the expression of the former. Genome sequencing of M. mediterranea has revealed that it contains two additional operons encoding proteins with sequence similarity to LodA. In this study, it is shown that the product of one of such genes, Marme_1655, encodes a protein with glycine oxidase activity. This activity shows important differences in terms of substrate range and sensitivity to inhibitors to other glycine oxidases previously described which are flavoproteins synthesized by Bacillus. The results presented in this study indicate that the products of the genes with different degrees of similarity to lodA detected in bacterial genomes could constitute a reservoir of different oxidases. © 2013 The Authors. Microbiology Open published by John Wiley & Sons Ltd.

  15. Antioxidative properties of the essential oil from Pinus mugo.

    PubMed

    Grassmann, Johanna; Hippeli, Susanne; Vollmann, Renate; Elstner, Erich F

    2003-12-17

    The essential oil from Pinus mugo (PMEO) was tested on its antioxidative capacity. For this purpose, several biochemical test systems were chosen (e.g., the Fenton System, the xanthine oxidase assay, or the copper-induced oxidation of low-density lipoprotein (LDL)). The results show that there is moderate or weak antioxidative activity when tested in aqueous environments, like in the Fenton system, xanthine oxidase induced superoxide radical formation, or in the HOCl driven fragmentation of 1-aminocyclopropane-1-carboxylic acid (ACC). In contrast, when tested in more lipophilic environments (e.g., the ACC-cleavage by activated neutrophils in whole blood) the PMEO exhibits good antioxidative activity. PMEO does also show good antioxidative capacity in another lipophilic test system (i.e., the copper induced oxidation of LDL). Some components of PMEO (i.e., Delta(3)-carene, camphene, alpha-pinene, (+)-limonene and terpinolene) were also tested. As the PMEO, they showed weak or no antioxidant activity in aqueous environments, but some of them were effective antioxidants regarding ACC-cleavage by activated neutrophils in whole blood or copper-induced LDL-oxidation. Terpinolene, a minor component of PMEO, exhibited remarkable protection against LDL-oxidation.

  16. Functional expression of amine oxidase from Aspergillus niger (AO-I) in Saccharomyces cerevisiae.

    PubMed

    Kolaríková, Katerina; Galuszka, Petr; Sedlárová, Iva; Sebela, Marek; Frébort, Ivo

    2009-01-01

    The aim of this work was to prepare recombinant amine oxidase from Aspergillus niger after overexpressing in yeast. The yeast expression vector pDR197 that includes a constitutive PMA1 promoter was used for the expression in Saccharomyces cerevisiae. Recombinant amine oxidase was extracted from the growth medium of the yeast, purified to homogeneity and identified by activity assay and MALDI-TOF peptide mass fingerprinting. Similarity search in the newly published A. niger genome identified six genes coding for copper amine oxidase, two of them corresponding to the previously described enzymes AO-I a methylamine oxidase and three other genes coding for FAD amine oxidases. Thus, A. niger possesses an enormous metabolic gear to grow on amine compounds and thus support its saprophytic lifestyle.

  17. NecroX-7 prevents oxidative stress-induced cardiomyopathy by inhibition of NADPH oxidase activity in rats

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Park, Joonghoon; Park, Eok; Ahn, Bong-Hyun

    2012-08-15

    Oxidative stress is one of the causes of cardiomyopathy. In the present study, NecroXs, novel class of mitochondrial ROS/RNS scavengers, were evaluated for cardioprotection in in vitro and in vivo model, and the putative mechanism of the cardioprotection of NecroX-7 was investigated by global gene expression profiling and subsequent biochemical analysis. NecroX-7 prevented tert-butyl hydroperoxide (tBHP)-induced death of H9C2 rat cardiomyocytes at EC{sub 50} = 0.057 μM. In doxorubicin (DOX)-induced cardiomyopathy in rats, NecroX-7 significantly reduced the plasma levels of creatine kinase (CK-MB) and lactate dehydrogenase (LDH) which were increased by DOX treatment (p < 0.05). Microarray analysis revealed thatmore » 21 genes differentially expressed in tBHP-treated H9C2 cells were involved in ‘Production of reactive oxygen species’ (p = 0.022), and they were resolved by concurrent NecroX-7 treatment. Gene-to-gene networking also identified that NecroX-7 relieved cell death through Ncf1/p47phox and Rac2 modulation. In subsequent biochemical analysis, NecroX-7 inhibited NADPH oxidase (NOX) activity by 53.3% (p < 0.001). These findings demonstrate that NecroX-7, in part, provides substantial protection of cardiomyopathy induced by tBHP or DOX via NOX-mediated cell death. -- Highlights: ► NecroX-7 prevented tert-butyl hydroperoxide-induced in vitro cardiac cell death. ► NecroX-7 ameliorated doxorubicin-induced in vivo cardiomyopathy. ► NecroX-7 prevented oxidative stress and necrosis-enriched transcriptional changes. ► NecroX-7 effectively inhibited NADPH oxidase activation. ► Cardioprotection of Necro-7 was brought on by modulation of NADPH oxidase activity.« less

  18. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum

    PubMed Central

    Xin, Shan; Tao, Chengcheng; Li, Hongbin

    2016-01-01

    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5’-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5’-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5’ truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence

  19. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

    PubMed

    Xin, Shan; Tao, Chengcheng; Li, Hongbin

    2016-01-01

    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a

  20. Cyanide-insensitive quinol oxidase (CIO) from Gluconobacter oxydans is a unique terminal oxidase subfamily of cytochrome bd.

    PubMed

    Miura, Hiroshi; Mogi, Tatsushi; Ano, Yoshitaka; Migita, Catharina T; Matsutani, Minenosuke; Yakushi, Toshiharu; Kita, Kiyoshi; Matsushita, Kazunobu

    2013-06-01

    Cyanide-insensitive terminal quinol oxidase (CIO) is a subfamily of cytochrome bd present in bacterial respiratory chain. We purified CIO from the Gluconobacter oxydans membranes and characterized its properties. The air-oxidized CIO showed some or weak peaks of reduced haemes b and of oxygenated and ferric haeme d, differing from cytochrome bd. CO- and NO-binding difference spectra suggested that haeme d serves as the ligand-binding site of CIO. Notably, the purified CIO showed an extraordinary high ubiquinol-1 oxidase activity with the pH optimum of pH 5-6. The apparent Vmax value of CIO was 17-fold higher than that of G. oxydans cytochrome bo3. In addition, compared with Escherichia coli cytochrome bd, the quinol oxidase activity of CIO was much more resistant to cyanide, but sensitive to azide. The Km value for O2 of CIO was 7- to 10-fold larger than that of G. oxydans cytochrome bo3 or E. coli cytochrome bd. Our results suggest that CIO has unique features attributable to the structure and properties of the O2-binding site, and thus forms a new sub-group distinct from cytochrome bd. Furthermore, CIO of acetic acid bacteria may play some specific role for rapid oxidation of substrates under acidic growth conditions.

  1. A plant spermine oxidase/dehydrogenase regulated by the proteasome and polyamines.

    PubMed

    Ahou, Abdellah; Martignago, Damiano; Alabdallah, Osama; Tavazza, Raffaela; Stano, Pasquale; Macone, Alberto; Pivato, Micaela; Masi, Antonio; Rambla, Jose L; Vera-Sirera, Francisco; Angelini, Riccardo; Federico, Rodolfo; Tavladoraki, Paraskevi

    2014-04-01

    Polyamine oxidases (PAOs) are flavin-dependent enzymes involved in polyamine catabolism. In Arabidopsis five PAO genes (AtPAO1-AtPAO5) have been identified which present some common characteristics, but also important differences in primary structure, substrate specificity, subcellular localization, and tissue-specific expression pattern, differences which may suggest distinct physiological roles. In the present work, AtPAO5, the only so far uncharacterized AtPAO which is specifically expressed in the vascular system, was partially purified from 35S::AtPAO5-6His Arabidopsis transgenic plants and biochemically characterized. Data presented here allow AtPAO5 to be classified as a spermine dehydrogenase. It is also shown that AtPAO5 oxidizes the polyamines spermine, thermospermine, and N(1)-acetylspermine, the latter being the best in vitro substrate of the recombinant enzyme. AtPAO5 also oxidizes these polyamines in vivo, as was evidenced by analysis of polyamine levels in the 35S::AtPAO5-6His Arabidopsis transgenic plants, as well as in a loss-of-function atpao5 mutant. Furthermore, subcellular localization studies indicate that AtPAO5 is a cytosolic protein undergoing proteasomal control. Positive regulation of AtPAO5 expression by polyamines at the transcriptional and post-transcriptional level is also shown. These data provide new insights into the catalytic properties of the PAO gene family and the complex regulatory network controlling polyamine metabolism.

  2. Determination of Monoamine Oxidase A and B Activity in Long-Term Treated Patients With Parkinson Disease.

    PubMed

    Müller, Thomas; Riederer, Peter; Grünblatt, Edna

    Biogenic amines and monoamine oxidase inhibitors influence peripheral monoamine oxidase enzyme activity in chronic levodopa/dopa decarboxylase inhibitor-treated patients with Parkinson disease. Rasagiline is an irreversible inhibitor of monoamine oxidase B. Safinamide blocks this isoenzyme in a reversible fashion. The aim of this study was to determine monoamine oxidase A (plasma) and B (platelets) enzyme activity in long-term levodopa-treated patients without and with additional oral intake of 50- or 100-mg safinamide or 1-mg rasagiline or first-time intake of rasagiline. Monoamine oxidase A enzyme activity did not differ between all groups. Patients on rasagiline or safinamide showed lower monoamine oxidase-B enzyme activity compared with patients without monoamine oxidase B inhibitor intake. No impact of the number of previous oral levodopa intakes was found. Rasagiline and safinamide did not essentially differ in terms of inhibition of monoamine oxidase B despite their different pharmacology regarding reversibility of monoamine oxidase B inhibition. In view of the observed, considerable heterogeneity of enzyme activities, we suggest to determine activities of monoamine oxidase A and B to reduce the risk for tyramine-induced hypertension and the serotonergic syndrome during chronic therapy with rasagiline or safinamide.

  3. Platinum Nanoparticles: Efficient and Stable Catechol Oxidase Mimetics.

    PubMed

    Liu, Yi; Wu, Haohao; Chong, Yu; Wamer, Wayne G; Xia, Qingsu; Cai, Lining; Nie, Zhihong; Fu, Peter P; Yin, Jun-Jie

    2015-09-09

    Although enzyme-like nanomaterials have been extensively investigated over the past decade, most research has focused on the peroxidase-like, catalase-like, or SOD-like activity of these nanomaterials. Identifying nanomaterials having oxidase-like activities has received less attention. In this study, we demonstrate that platinum nanoparticles (Pt NPs) exhibit catechol oxidase-like activity, oxidizing polyphenols into the corresponding o-quinones. Four unique approaches are employed to demonstrate the catechol oxidase-like activity exerted by Pt NPs. First, UV-vis spectroscopy is used to monitor the oxidation of polyphenols catalyzed by Pt NPs. Second, the oxidized products of polyphenols are identified by ultrahigh-performance liquid chromatography (UHPLC) separation followed by high-resolution mass spectrometry (HRMS) identification. Third, electron spin resonance (ESR) oximetry techniques are used to confirm the O2 consumption during the oxidation reaction. Fourth, the intermediate products of semiquinone radicals formed during the oxidation of polyphenols are determined by ESR using spin stabilization. These results indicate Pt NPs possess catechol oxidase-like activity. Because polyphenols and related bioactive substances have been explored as potent antioxidants that could be useful for the prevention of cancer and cardiovascular diseases, and Pt NPs have been widely used in the chemical industry and medical science, it is essential to understand the potential effects of Pt NPs for altering or influencing the antioxidant activity of polyphenols.

  4. Involvement of NADPH oxidase isoforms in the production of O2- manipulated by ABA in the senescing leaves of early-senescence-leaf (esl) mutant rice (Oryza sativa).

    PubMed

    Li, Zhaowei; Wang, Fubiao; Zhao, Qian; Liu, Jianchao; Cheng, Fangmin

    2018-01-01

    In this study, the differences in reactive oxygen species (ROS) generation and abscisic acid (ABA) accumulation in senescing leaves were investigated by early-senescence-leaf (esl) mutant and its wild type, to clarify the relationship among ABA levels, ROS generation, and NADPH oxidase (Nox) in senescing leaves of rice (Oryza sativa). The temporal expression levels of OsNox isoforms in senescing leaves and their expression patterns in response to ABA treatment were determined through quantitative real-time reverse transcription PCR (qRT-PCR). Results showed that the flag leaf of the esl mutant generated more O2- concentrations and accumulated higher ABA levels than the wild-type cultivar did in the grain-filling stage. Exogenous ABA treatment induced O2- generation; however, it was depressed by diphenyleneiodonium chloride (DPI) pretreatment in the detached leaf segments. This finding suggested the involvement of NADPH oxidase in ABA-induced O2- generation. The esl mutant exhibited significantly higher expression of OsNox2, OsNox5, OsNox6, and OsNox7 in the initial of grain-filling stage, followed by sharply decrease. The transcriptional levels of OsNox1, OsNox3, and OsFR07 in the flag leaf of the esl mutant were significantly lower than those in the wild-type cultivar. The expression levels of OsNox2, OsNox5, OsNox6, and OsNox7 were significantly enhanced by exogenous ABA treatments. The enhanced expression levels of OsNox2 and OsNox6 were dependent on the duration of ABA treatment. The inducible expression levels of OsNox5 and OsNox7 were dependent on ABA concentrations. By contrast, exogenous ABA treatment severely repressed the transcripts of OsNox1, OsNox3, and OsFR07 in the detached leaf segments. Therefore, OsNox2, OsNox5, OsNox6, and OsNox7 were probably involved in the ABA-induced O2- generation in the initial stage of leaf senescence. Subsequently, other oxidases activated in deteriorating cells were associated with ROS generation and accumulation in the

  5. Bienzyme biosensors for glucose, ethanol and putrescine built on oxidase and sweet potato peroxidase.

    PubMed

    Castillo, Jaime; Gáspár, Szilveszter; Sakharov, Ivan; Csöregi, Elisabeth

    2003-05-01

    Amperometric biosensors for glucose, ethanol, and biogenic amines (putrescine) were constructed using oxidase/peroxidase bienzyme systems. The H(2)O(2) produced by the oxidase in reaction with its substrate is converted into a measurable signal via a novel peroxidase purified from sweet potato peels. All developed biosensors are based on redox hydrogels formed of oxidases (glucose oxidase, alcohol oxidase, or amine oxidase) and the newly purified sweet potato peroxidase (SPP) cross-linked to a redox polymer. The developed electrodes were characterized (sensitivity, stability, and performances in organic medium) and compared with similarly built ones using the 'classical' horseradish peroxidase (HRP). The SPP-based electrodes displayed higher sensitivity and better detection limit for putrescine than those using HRP and were also shown to retain their activity in organic phase much better than the HPR based ones. The importance of attractive or repulsive electrostatic interactions between the peroxidases and oxidases (determined by their isoelectric points) were found to play an important role in the sensitivity of the obtained sensors.

  6. PROLINE OXIDASES IN HANSENULA SUBPELLICULOSA

    PubMed Central

    Ling, Chung-Mei; Hedrick, L. R.

    1964-01-01

    Ling, Chung-Mei (Illinois Institute of Technology, Chicago), and L. R. Hedrick. Proline oxidases in Hansenula subpelliculosa. J. Bacteriol. 87:1462–1470. 1964—Cells of Hansenula subpelliculosa can use l-proline as a carbon and a nitrogen source after a 6- to 8-hr induction period. However, they cannot use l-glutamate as both nitrogen and carbon sources unless the induction period is of several days' duration. Two l-proline oxidases were demonstrated in the mitochondrial preparation of this yeast. One forms the product Δ′-pyrroline-2-carboxylic acid (P2C), which is in equilibrium with α-keto-δ-amino-valeric acid; the other forms the product Δ′-pyrroline-5-carboxylic acid (P5C), which is in equilibrium with glutamic-γ-semialdehyde. The first-mentioned enzyme is induced when l-proline is the carbon source; the second appears to be constitutive, and is probably associated with the use of l-proline as a nitrogen source. The P2C-forming enzyme is specific for the l isomer of proline, and is inactive against l-hydroxyproline. The enzyme activity is at its peak when the mitochondria are prepared from logarithmically grown cells, and is rapidly reduced after cells reach the stationary phase of growth. Kinetic studies with varying concentrations of substrate indicate a Michaelis-Menten constant of 2.45 × 10−2m. Paper chromatographic studies, chemical tests with H2O2, sensitivity to freezing, and spectral measurements indicate that proline oxidase from H. subpelliculosa mitochondria forms a product from l-proline which is like, if not identical to, P2C formed by the action of sheep kidney d-proline oxidase upon dl-proline. The soluble portion of the cell extract contains NAD+ enzymes which use either P2C (α-keto-δ-amino-valeric acid) or P5C (glutamic-γ-semialdehyde) as substrates. No glutamic dehydrogenase activity could be detected when l-glutamic acid and the nicotinamide adenine dinucleotide (NAD+) cofactor were added to the supernatant solution with the

  7. The increasing role of monoamine oxidase type B inhibitors in Parkinson's disease therapy.

    PubMed

    Elmer, Lawrence W; Bertoni, John M

    2008-11-01

    The role of monoamine oxidase type B inhibitors in the treatment of Parkinson's disease has expanded with the new monoamine oxidase B inhibitor rasagiline and a new formulation, selegiline oral disintegrating tablets. As primary therapy in early disease monoamine oxidase B inhibitors reduce motor disability and delay the need for levodopa. In more advanced disease requiring levodopa, adjunctive monoamine oxidase B inhibitors reduce 'off' time and may improve gait and freezing. Rasagiline and selegiline oral disintegrating tablets may reduce the safety risks associated with the amfetamine and methamfetamine metabolites of conventional oral selegiline while retaining or improving therapeutic efficacy. Articles were identified by searches of PubMed and searches on the Internet and reviewed. All articles and other referenced materials were retrieved using the keywords 'Parkinson's disease', 'treatment' and 'monoamine oxidase B inhibitor' and were published between 1960 and 2007, with older references selected for historical significance. Only papers published in English were reviewed. Accumulating data support the use of monoamine oxidase B inhibitors as monotherapy for early and mild Parkinson's disease and as adjunctive therapy for more advanced Parkinson's disease with levodopa-associated motor fluctuations. The recently released monoamine oxidase B inhibitor rasagiline and a new formulation, selegiline oral disintegrating tablets, have potential advantages over conventional oral selegiline.

  8. Photoaffinity labeling of protoporphyrinogen oxidase, the molecular target of diphenylether-type herbicides.

    PubMed

    Camadro, J M; Matringe, M; Thome, F; Brouillet, N; Mornet, R; Labbe, P

    1995-05-01

    Diphenylether-type herbicides are extremely potent inhibitors of protoporphyrinogen oxidase, a membrane-bound enzyme involved in the heme and chlorophyll biosynthesis pathways. Tritiated acifluorfen and a diazoketone derivative of tritiated acifluorfen were specifically bound to a single class of high-affinity binding sites on yeast mitochondrial membranes with apparent dissociation constants of 7 nM and 12.5 nM, respectively. The maximum density of specific binding sites, determined by Scatchard analysis, was 3 pmol.mg-1 protein. Protoporphyrinogen oxidase specific activity was estimated to be 2500 nmol protoporphyrinogen oxidized h-1.mol-1 enzyme. The diazoketone derivative of tritiated acifluorfen was used to specifically photolabel yeast protoporphyrinogen oxidase. The specifically labeled polypeptide in wild-type mitochondrial membranes had an apparent molecular mass of 55 kDa, identical to the molecular mass of the purified enzyme. This photolabeled polypeptide was not detected in a protoporphyrinogen-oxidase-deficient yeast strain, but the membranes contained an equivalent amount of inactive immunoreactive protoporphyrinogen oxidase protein.

  9. The regulation of mitochondrial transcription factor A (Tfam) expression during skeletal muscle cell differentiation.

    PubMed

    Collu-Marchese, Melania; Shuen, Michael; Pauly, Marion; Saleem, Ayesha; Hood, David A

    2015-05-19

    The ATP demand required for muscle development is accommodated by elevations in mitochondrial biogenesis, through the co-ordinated activities of the nuclear and mitochondrial genomes. The most important transcriptional activator of the mitochondrial genome is mitochondrial transcription factor A (Tfam); however, the regulation of Tfam expression during muscle differentiation is not known. Thus, we measured Tfam mRNA levels, mRNA stability, protein expression and localization and Tfam transcription during the progression of muscle differentiation. Parallel 2-fold increases in Tfam protein and mRNA were observed, corresponding with 2-3-fold increases in mitochondrial content. Transcriptional activity of a 2051 bp promoter increased during this differentiation period and this was accompanied by a 3-fold greater Tfam mRNA stabilization. Interestingly, truncations of the promoter at 1706 bp, 978 bp and 393 bp promoter all exhibited 2-3-fold higher transcriptional activity than the 2051 bp construct, indicating the presence of negative regulatory elements within the distal 350 bp of the promoter. Activation of AMP kinase augmented Tfam transcription within the proximal promoter, suggesting the presence of binding sites for transcription factors that are responsive to cellular energy state. During differentiation, the accumulating Tfam protein was progressively distributed to the mitochondrial matrix where it augmented the expression of mtDNA and COX (cytochrome c oxidase) subunit I, an mtDNA gene product. Our data suggest that, during muscle differentiation, Tfam protein levels are regulated by the availability of Tfam mRNA, which is controlled by both transcription and mRNA stability. Changes in energy state and Tfam localization also affect Tfam expression and action in differentiating myotubes. © 2015 Authors.

  10. Amine oxidase from lentil seedlings: energetic domains and effect of temperature on activity.

    PubMed

    Moosavi-Nejad, S Z; Rezaei-Tavirani, M; Padiglia, A; Floris, G; Moosavi-Movahedi, A A

    2001-07-01

    Copper/TPQ amine oxidases from mammalian and plant sources have shown many differences in substrate specificity and molecular properties. In this work the activity of lentil seedling amine oxidase was followed at various temperatures in 100 mM potassium phosphate buffer, pH 7, using benzylamine as substrate. The discontinuous Arrhenius plot of lentil amine oxidase showed two distinct phases with a jump between them. Thermal denaturation of the enzyme, using differential scanning calorimetry under the same experimental conditions, showed a transition at the same temperature ranges in the absence of substrate, indicating the occurrence of conformational changes, with an enthalpy change of about 175.9 kJ/mole. The temperature-induced changes of the activity of lentil amine oxidase are compared with those of bovine serum amine oxidase (taken from the literature).

  11. 2013 ACC/AHA versus 2004 NECP ATP III Guidelines in the Assignment of Statin Treatment in a Korean Population with Subclinical Coronary Atherosclerosis.

    PubMed

    Jung, Chang Hee; Lee, Min Jung; Kang, Yu Mi; Yang, Dong Hyun; Kang, Joon-Won; Kim, Eun Hee; Park, Duk-Woo; Park, Joong-Yeol; Kim, Hong-Kyu; Lee, Woo Je

    2015-01-01

    The usefulness of the 2013 ACC/AHA guidelines for the management of blood cholesterol in the Asian population remains controversial. In this study, we investigated whether eligibility for statin therapy determined by the 2013 ACC/AHA guidelines is better aligned with the presence of subclinical coronary atherosclerosis detected by CCTA (coronary computed tomography angiography) compared to the previously recommended 2004 NCEP ATP III guidelines. We collected the data from 5,837 asymptomatic subjects who underwent CCTA using MDCT during routine health examinations. Based on risk factor assessment and lipid data, we determined guideline-based eligibility for statin therapy according to the 2013 ACC/AHA and 2004 NCEP ATP III guidelines. We defined the presence and severity of subclinical coronary atherosclerosis detected in CCTA according to the presence of significant coronary artery stenosis (defined as >50% stenosis), plaques, and the degree of coronary calcification. As compared to the 2004 ATP III guidelines, a significantly higher proportion of subjects with significant coronary stenosis (61.8% vs. 33.8%), plaques (52.3% vs. 24.7%), and higher CACS (CACS >100, 63.6% vs. 26.5%) was assigned to statin therapy using the 2013 ACC/AHA guidelines (P < .001 for all variables). The area under the curves of the pooled cohort equation of the new guidelines in detecting significant stenosis, plaques, and higher CACS were significantly higher than those of the Framingham risk calculator. Compared to the previous ATP III guidelines, the 2013 ACC/AHA guidelines were more sensitive in identifying subjects with subclinical coronary atherosclerosis detected by CCTA in an Asian population.

  12. Purification of the Alpha Glycerophosphate Oxidase from African Trypanosomes

    DTIC Science & Technology

    1987-02-02

    oxidase (GPO). This enzyme has not been purified or characterize in detail. Inhibition of this enzyme coupled with inhibition of the anaerobic...more manageable afterwards and remained in the procedure although it only slightly increased the yield. The stability of the solubilized enzyme was...whether the detergent was added during the assay or in the solubilization procedure. However, the successful assay for the enzyme was ubiquinol oxidase

  13. Molecular Cloning and Characterization of Apricot Fruit Polyphenol Oxidase

    PubMed Central

    Chevalier, Tony; de Rigal, David; Mbéguié-A-Mbéguié, Didier; Gauillard, Frédéric; Richard-Forget, Florence; Fils-Lycaon, Bernard R.

    1999-01-01

    A reverse transcriptase-polymerase chain reaction experiment was done to synthesize a homologous polyphenol oxidase (PPO) probe from apricot (Prunus armeniaca var Bergeron) fruit. This probe was further used to isolate a full-length PPO cDNA, PA-PPO (accession no. AF020786), from an immature-green fruit cDNA library. PA-PPO is 2070 bp long and contains a single open reading frame encoding a PPO precursor peptide of 597 amino acids with a calculated molecular mass of 67.1 kD and an isoelectric point of 6.84. The mature protein has a predicted molecular mass of 56.2 kD and an isoelectric point of 5.84. PA-PPO belongs to a multigene family. The gene is highly expressed in young, immature-green fruit and is turned off early in the ripening process. The ratio of PPO protein to total proteins per fruit apparently remains stable regardless of the stage of development, whereas PPO specific activity peaks at the breaker stage. These results suggest that, in addition to a transcriptional control of PPO expression, other regulation factors such as translational and posttranslational controls also occur. PMID:10198084

  14. NADPH oxidase mediates depressive behavior induced by chronic stress in mice.

    PubMed

    Seo, Ji-Seon; Park, Jin-Young; Choi, Juli; Kim, Tae-Kyung; Shin, Joo-Hyun; Lee, Ja-Kyeong; Han, Pyung-Lim

    2012-07-11

    Stress is a potent risk factor for depression, yet the underlying mechanism is not clearly understood. In the present study, we explored the mechanism of development and maintenance of depression in a stress-induced animal model. Mice restrained for 2 h daily for 14 d showed distinct depressive behavior, and the altered behavior persisted for >3 months in the absence of intervention. Acute restraint induced a surge of oxidative stress in the brain, and stress-induced oxidative stress progressively increased with repetition of stress. In vitro, the stress hormone glucocorticoid generated superoxide via upregulation of NADPH oxidase. Consistently, repeated restraints increased the expression of the key subunits of NADPH oxidase, p47phox and p67phox, in the brain. Moreover, stressed brains markedly upregulated the expression of p47phox to weak restress evoked in the poststress period, and this molecular response was reminiscent of amplified ROS surge to restress. Pharmacological inhibition of NADPH oxidase by the NADPH oxidase inhibitor apocynin during the stress or poststress period completely blocked depressive behavior. Consistently, heterozygous p47phox knock-out mice (p47phox(+/-)) or molecular inhibition of p47phox with Lenti shRNA-p47phox in the hippocampus suppressed depressive behavior. These results suggest that repeated stress promotes depressive behavior through the upregulation of NADPH oxidase and the resultant metabolic oxidative stress, and that the inhibition of NADPH oxidase provides beneficial antidepression effects.

  15. Direct Identification of a Bacterial Manganese(II) Oxidase, the Multicopper Oxidase MnxG, from Spores of Several Different Marine Bacillus Species▿ †

    PubMed Central

    Dick, Gregory J.; Torpey, Justin W.; Beveridge, Terry J.; Tebo, Bradley M.

    2008-01-01

    Microorganisms catalyze the formation of naturally occurring Mn oxides, but little is known about the biochemical mechanisms of this important biogeochemical process. We used tandem mass spectrometry to directly analyze the Mn(II)-oxidizing enzyme from marine Bacillus spores, identified as an Mn oxide band with an in-gel activity assay. Nine distinct peptides recovered from the Mn oxide band of two Bacillus species were unique to the multicopper oxidase MnxG, and one peptide was from the small hydrophobic protein MnxF. No other proteins were detected in the Mn oxide band, indicating that MnxG (or a MnxF/G complex) directly catalyzes biogenic Mn oxide formation. The Mn(II) oxidase was partially purified and found to be resistant to many proteases and active even at high concentrations of sodium dodecyl sulfate. Comparative analysis of the genes involved in Mn(II) oxidation from three diverse Bacillus species revealed a complement of conserved Cu-binding regions not present in well-characterized multicopper oxidases. Our results provide the first direct identification of a bacterial enzyme that catalyzes Mn(II) oxidation and suggest that MnxG catalyzes two sequential one-electron oxidations from Mn(II) to Mn(III) and from Mn(III) to Mn(IV), a novel type of reaction for a multicopper oxidase. PMID:18165363

  16. The voltage dependence of NADPH oxidase reveals why phagocytes need proton channels

    NASA Astrophysics Data System (ADS)

    DeCoursey, Thomas E.; Morgan, Deri; Cherny, Vladimir V.

    2003-04-01

    The enzyme NADPH oxidase in phagocytes is important in the body's defence against microbes: it produces superoxide anions (O2-, precursors to bactericidal reactive oxygen species). Electrons move from intracellular NADPH, across a chain comprising FAD (flavin adenine dinucleotide) and two haems, to reduce extracellular O2 to O2-. NADPH oxidase is electrogenic, generating electron current (Ie) that is measurable under voltage-clamp conditions. Here we report the complete current-voltage relationship of NADPH oxidase, the first such measurement of a plasma membrane electron transporter. We find that Ie is voltage-independent from -100mV to >0mV, but is steeply inhibited by further depolarization, and is abolished at about +190mV. It was proposed that H+ efflux mediated by voltage-gated proton channels compensates Ie, because Zn2+ and Cd2+ inhibit both H+ currents and O2- production. Here we show that COS-7 cells transfected with four NADPH oxidase components, but lacking H+ channels, produce O2- in the presence of Zn2+ concentrations that inhibit O2- production in neutrophils and eosinophils. Zn2+ does not inhibit NADPH oxidase directly, but through effects on H+ channels. H+ channels optimize NADPH oxidase function by preventing membrane depolarization to inhibitory voltages.

  17. Nucleic Acid Homologies Among Oxidase-Negative Moraxella Species

    PubMed Central

    Johnson, John L.; Anderson, Robert S.; Ordal, Erling J.

    1970-01-01

    The deoxyribonucleic acid (DNA) base composition and DNA homologies of more than 40 strains of oxidase-negative Moraxella species were determined. These bacteria have also been identified as belonging to the Mima-Herellea-Acinetobacter group and the Bacterium anitratum group, as well as to several other genera including Achromobacter and Alcaligenes. The DNA base content of these strains ranged from 40 to 46% guanine plus cytosine. DNA–DNA competition experiments distinguished five groups whose members were determined by showing 50% or more homology to one of the reference strains: B. anitratum type B5W, Achromobacter haemolyticus var. haemolyticus, Alcaligenes haemolysans, Achromobacter metalcaligenes, and Moraxella lwoffi. A sixth group comprised those strains showing less than 50% homology to any of the reference strains. Negligible homology was found between strains of oxidase-negative and oxidase-positive Moraxella species in DNA–DNA competition experiments. However, evidence of a distant relationship between the two groups was obtained in competition experiments by using ribosomal ribonucleic acid. PMID:5413826

  18. A functional polymorphism of the MAOA gene is associated with neural responses to induced anger control.

    PubMed

    Denson, Thomas F; Dobson-Stone, Carol; Ronay, Richard; von Hippel, William; Schira, Mark M

    2014-07-01

    Aggressiveness is highly heritable. Recent experimental work has linked individual differences in a functional polymorphism of the monoamine oxidase-A gene (MAOA) to anger-driven aggression. Other work has implicated the dorsal ACC (dACC) in cognitive-emotional control and the amygdala in emotional arousal. The present imaging genetics study investigated dACC and amygdala reactivity to induced anger control as a function of MAOA genotype. A research assistant asked 38 healthy male undergraduates to control their anger in response to an insult by a rude experimenter. Men with the low-expression allele showed increased dACC and amygdala activation after the insult, but men with the high-expression allele did not. Both dACC and amygdala activation independently mediated the relationship between MAOA genotype and self-reported anger control. Moreover, following the insult, men with the high-functioning allele showed functional decoupling between the amygdala and dACC, but men with the low-functioning allele did not. These results suggest that heightened dACC and amygdala activation and their connectivity are neuroaffective mechanisms underlying anger control in participants with the low-functioning allele of the MAOA gene.

  19. [Activation of the alternative oxidase of Yarrowia lipolytica by adenosine 5'-monophosphate].

    PubMed

    Medentsev, A G; Arinbasarova, A Iu; Smirnova, N M; Akimenko, V K

    2004-01-01

    The study of the effect of nucleoside phosphates on the activity of cyanide-resistant oxidase in the mitochondria and the submitochondrial particles of Yarrowia lipolytica showed that adenosine monophosphate (5'-AMP, AMP) did not stimulate the respiration of the intact mitochondria. The incubation of the mitochondria at room temperature (25 degrees C) for 3-5 h or their treatment with ultrasound, phospholipase A, and detergent Triton X-100 at a low temperature inactivated the cyanide-resistant alternative oxidase. The inactivated alternative oxidase could be reactivated by AMP. The reactivating effect of AMP was enhanced by azolectin. Some other nucleoside phosphates also showed reactivating ability in the following descending order. AMP = GMP > GDP > GTP > XMP > IMP. The apparent reaction rate constant Km for AMP upon the reactivation of the alternative oxidase of mitochondria treated with Triton X-100 or incubated at 25 degrees C was 12.5 and 20 microM, respectively. The Km for AMP upon the reactivation of the alternative oxidase of submitochondrial particles was 15 microM. During the incubation of yeast cells under conditions promoting the development of alternative oxidase, the content of adenine nucleotides (AMP, ADP, and ATP) in the cells and their respiration tended to decrease. The subsequent addition of cyanide to the cells activated their respiration, diminished the intracellular content of ATP three times, and augmented the content of AMP five times. These data suggest that the stimulation of cell respiration by cyanide may be due to the activation of alternative oxidase by AMP.

  20. Involvement of NADPH oxidases in alkali burn-induced corneal injury.

    PubMed

    Gu, Xue-Jun; Liu, Xian; Chen, Ying-Ying; Zhao, Yao; Xu, Man; Han, Xiao-Jian; Liu, Qiu-Ping; Yi, Jing-Lin; Li, Jing-Ming

    2016-07-01

    Chemical burns are a major cause of corneal injury. Oxidative stress, inflammatory responses and neovascularization after the chemical burn aggravate corneal damage, and lead to loss of vision. Although NADPH oxidases (Noxs) play a crucial role in the production of reactive oxygen species (ROS), the role of Noxs in chemical burn-induced corneal injury remains to be elucidated. In the present study, the transcription and expression of Noxs in corneas were examined by RT-qPCR, western blot analysis and immunofluorescence staining. It was found that alkali burns markedly upregulated the transcription and expression of Nox2 and Nox4 in human or mouse corneas. The inhibition of Noxs by diphenyleneiodonium (DPI) or apocynin (Apo) effectively attenuated alkali burn-induced ROS production and decreased 3-nitrotyrosine (3-NT) protein levels in the corneas. In addition, Noxs/CD11b double‑immunofluorescence staining indicated that Nox2 and Nox4 were partially co-localized with CD11b. DPI or Apo prevented the infiltration of CD11b-positive inflammatory cells, and inhibited the transcription of inflammatory cytokines following alkali burn-induced corneal injury. In our mouse model of alkali burn-induced corneal injury, corneal neovascularization (CNV) occurred on day 3, and it affected 50% of the whole area of the cornea on day 7, and on day 14, CNV coverage of the cornea reached maximum levels. DPI or Apo effectively attenuated alkali burn‑induced CNV and decreased the mRNA levels of angiogenic factors, including vascular endothelial growth factor (VEGF), VEGF receptors and matrix metalloproteinases (MMPs). Taken together, our data indicate that Noxs play a role in alkali burn-induced corneal injury by regulating oxidative stress, inflammatory responses and CNV, and we thus suggest that Noxs are a potential therapeutic target in the future treatment of chemical-induced corneal injury.

  1. The 2013 ACC/AHA cardiovascular prevention guidelines improve alignment of statin therapy with coronary atherosclerosis as detected by coronary computed tomography angiography.

    PubMed

    Pursnani, Amit; Mayrhofer, Thomas; Ferencik, Maros; Hoffmann, Udo

    2014-11-01

    The recently released 2013 ACC/AHA guidelines for management of blood cholesterol have substantially increased the number of adults who are eligible for preventive statin therapy. We sought to determine whether eligibility for statin therapy as determined by the 2013 ACC/AHA guideline recommendation is better aligned with the actual presence of coronary artery disease (CAD) as detected by coronary CT angiography (CCTA) when compared to prior guidelines including the 2004 NCEP ATP III and 2011 ESC/EAS guidelines. In this secondary analysis of the prospective observational ROMICAT I (Rule Out Myocardial Infarction with Computer Assisted Tomography) cohort study, we included all men and women aged 40-79 years presenting with acute chest pain but not diagnosed with acute coronary syndrome nor on admission statin. Based on risk factor assessment and lipid data, we determined guideline-based eligibility for statin therapy by the 2013 ACC/AHA, the 2004 NCEP ATP III, and the 2011 ESC/EAS guidelines. We determined the presence and severity of CAD as detected by CCTA. The 2013 ACC/AHA algorithm identified nearly twice as many individuals as eligible for statins (n = 77/189; 41%) as compared to the 2004 ATP III criteria: (n = 41/189; 22%), (p < .0001) In addition, the 2013 ACC/AHA guidelines were more sensitive for treatment of CCTA-detected CAD than the 2004 ATP III guidelines [53.4% (42.5-64.1) vs 27.3% (18.3-37.8), p < .001] and the 2011 ESC/EAE guidelines [53.4% (42.5-64.1) vs 34.1% (24.3-45.0), p < .001]. However, the specificity of these guidelines was modestly reduced compared to the 2004 ATP III guidelines [70.3 (60.4-79.0) vs 83.2 (74.4-89.9), p < .001] and the 2011 ESC/EAE guidelines [70.3 (60.4-79.0) vs 86.1 (77.8-92.2), p < .001], suggesting increased treatment of subjects without CCTA-detected CAD. Overall, the 2013 ACC/AHA guidelines are more sensitive to identify patients who have CAD detected by CCTA eligible for statin therapy as compared with prior

  2. The 2013 ACC/AHA Cardiovascular Prevention Guidelines Improve Alignment of Statin Therapy with Coronary Atherosclerosis As Detected by Coronary Computed Tomography Angiography

    PubMed Central

    Pursnani, Amit; Mayrhofer, Thomas; Ferencik, Maros; Hoffmann, Udo

    2018-01-01

    The recently released 2013 ACC/AHA guidelines for management of blood cholesterol have substantially increased the number of adults who are eligible for preventive statin therapy. We sought to determine whether eligibility for statin therapy as determined by the 2013 ACC/AHA guideline recommendation is better aligned with the actual presence of coronary artery disease (CAD) as detected by coronary CT angiography (CCTA) when compared to prior guidelines including the 2004 NCEP ATP III and 2011 ESC/EAS guidelines. In this secondary analysis of the prospective observational ROMICAT I (Rule Out Myocardial Infarction with Computer Assisted Tomography) cohort study, we included all men and women aged 40–79 years presenting with acute chest pain but not diagnosed with acute coronary syndrome nor on admission statin. Based on risk factor assessment and lipid data, we determined guideline-based eligibility for statin therapy by the 2013 ACC/AHA, the 2004 NCEP ATP II, and the 2011 ESC/EAS guidelines. We determined the presence and severity of CAD as detected by CCTA. The 2013 ACC/AHA algorithm identified nearly twice as many individuals as eligible for statins (n=77/189; 41%) as compared to the 2004 ATPIII criteria: (n=41/189; 22%), (P<.0001) In addition, the 2013 ACC/AHA guidelines were more sensitive for treatment of CCTA-detected CAD than the 2004 ATP III guidelines [53.4% (42.5–64.1) vs 27.3% (18.3–37.8), p<.001] and the 2011 ESC/EAE guidelines [53.4% (42.5–64.1) vs 34.1% (24.3–45.0), p<.001]. However, the specificity of these guidelines was modestly reduced compared to the 2004 ATP III guidelines [70.3 (60.4–79.0) vs 83.2 (74.4–89.9), p<.001] and the 2011 ESC/EAE guidelines [70.3 (60.4–79.0) vs 86.1 (77.8–92.2), p<.001], suggesting increased treatment of subjects without CCTA-detected CAD. Overall, the 2013 ACC/AHA guidelines are more sensitive to identify patients who have CAD detected by CCTA eligible for statin therapy as compared with prior

  3. Systemic Manifestations in Pyridox(am)ine 5'-Phosphate Oxidase Deficiency.

    PubMed

    Guerriero, Réjean M; Patel, Archana A; Walsh, Brian; Baumer, Fiona M; Shah, Ankoor S; Peters, Jurriaan M; Rodan, Lance H; Agrawal, Pankaj B; Pearl, Phillip L; Takeoka, Masanori

    2017-11-01

    Pyridoxine is converted to its biologically active form pyridoxal-5-phosphate (P5P) by the enzyme pyridox(am)ine 5'-phosphate oxidase and serves as a cofactor in nearly 200 reactions in the central nervous system. Pyridox(am)ine 5'-phosphate oxidase deficiency leads to P5P dependent epilepsy, typically a neonatal- or infantile-onset epileptic encephalopathy treatable with P5P or in some cases, pyridoxine. Following identification of retinopathy in a patient with pyridox(am)ine 5'-phosphate oxidase deficiency that was reversible with P5P therapy, we describe the systemic manifestations of pyridox(am)ine 5'-phosphate oxidase deficiency. A series of six patients with homozygous mutations of PNPO, the gene coding pyridox(am)ine 5'-phosphate oxidase, were evaluated in our center over the course of two years for phenotyping of neurological and systemic manifestations. Five of six were born prematurely, three had anemia and failure to thrive, and two had elevated alkaline phosphatase. A movement disorder was observed in two children, and a reversible retinopathy was observed in the most severely affected infant. All patients had neonatal-onset epilepsy and were on a continuum of developmental delay to profound encephalopathy. Electroencephalographic features included background slowing and disorganization, absent sleep features, and multifocal and generalized epileptiform discharges. All the affected probands carried a homozygous PNPO mutation (c.674 G>T, c.686 G>A and c.352G>A). In addition to the well-described epileptic encephalopathy, pyridox(am)ine 5'-phosphate oxidase deficiency causes a range of neurological and systemic manifestations. A movement disorder, developmental delay, and encephalopathy, as well as retinopathy, anemia, and failure to thrive add to the broadening clinical spectrum of P5P dependent epilepsy. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. CE-ACCE: The Cloud Enabled Advanced sCience Compute Environment

    NASA Astrophysics Data System (ADS)

    Cinquini, L.; Freeborn, D. J.; Hardman, S. H.; Wong, C.

    2017-12-01

    Traditionally, Earth Science data from NASA remote sensing instruments has been processed by building custom data processing pipelines (often based on a common workflow engine or framework) which are typically deployed and run on an internal cluster of computing resources. This approach has some intrinsic limitations: it requires each mission to develop and deploy a custom software package on top of the adopted framework; it makes use of dedicated hardware, network and storage resources, which must be specifically purchased, maintained and re-purposed at mission completion; and computing services cannot be scaled on demand beyond the capability of the available servers.More recently, the rise of Cloud computing, coupled with other advances in containerization technology (most prominently, Docker) and micro-services architecture, has enabled a new paradigm, whereby space mission data can be processed through standard system architectures, which can be seamlessly deployed and scaled on demand on either on-premise clusters, or commercial Cloud providers. In this talk, we will present one such architecture named CE-ACCE ("Cloud Enabled Advanced sCience Compute Environment"), which we have been developing at the NASA Jet Propulsion Laboratory over the past year. CE-ACCE is based on the Apache OODT ("Object Oriented Data Technology") suite of services for full data lifecycle management, which are turned into a composable array of Docker images, and complemented by a plug-in model for mission-specific customization. We have applied this infrastructure to both flying and upcoming NASA missions, such as ECOSTRESS and SMAP, and demonstrated deployment on the Amazon Cloud, either using simple EC2 instances, or advanced AWS services such as Amazon Lambda and ECS (EC2 Container Services).

  5. Xanthine Oxidase Induces Foam Cell Formation through LOX-1 and NLRP3 Activation.

    PubMed

    Dai, Yao; Cao, Yongxiang; Zhang, Zhigao; Vallurupalli, Srikanth; Mehta, Jawahar L

    2017-02-01

    Xanthine oxidase catalyzes the oxidation of xanthine to uric acid. This process generates excessive reactive oxygen species (ROS) that play an important role in atherogenesis. Recent studies show that LRR and PYD domains-containing protein 3 (NLRP3), a component of the inflammasome, may be involved in the formation of foam cells, a hallmark of atherosclerosis. This study was designed to study the role of various scavenger receptors and NLRP3 inflammasome in xanthine oxidase and uric acid-induced foam cell formation. Human vascular smooth muscle cells (VSMCs) and THP-1 macrophages were treated with xanthine oxidase or uric acid. Xanthine oxidase treatment (of both VSMCs and THP-1 cells) resulted in foam cell formation in concert with generation of ROS and expression of cluster of differentiation 36 (CD36) and oxidized low density lipoprotein (lectin-like) receptor 1 (LOX-1), but not of scavenger receptor A (SRA). Uric acid treatment resulted in foam cell formation, ROS generation and expression of CD36, but not of LOX-1 or SRA. Further, treatment of cells with xanthine oxidase, but not uric acid, activated NLRP3 and its downstream pro-inflammatory signals- caspase-1, interleukin (IL)-1β and IL-18. Blockade of LOX-1 or NLRP3 inflammasome with specific siRNAs reduced xanthine oxidase-induced foam cell formation, ROS generation and activation of NLRP3 and downstream signals. Xanthine oxidase induces foam cell formation in large part through activation of LOX-1 - NLRP3 pathway in both VSMCs and THP-1 cells, but uric acid-induced foam cell formation is exclusively through CD36 pathway. Further, LOX-1 activation is upstream of NLRP3 activation. Graphical Abstract Steps in the formation of foam cells in response to xanthine oxidase and uric acid. Xanthine oxidase stimulates LOX-1 expression on the cell membrane of macrophages and vascular smooth muscle cells (VSMCs) and increases generation of ROS, which activate NLRP3 inflammasome and downstream pro

  6. Protein structural development of threadfin bream ( Nemipterus spp.) surimi gels induced by glucose oxidase.

    PubMed

    Wang, Lei; Fan, Daming; Fu, Lulu; Jiao, Xidong; Huang, Jianlian; Zhao, Jianxin; Yan, Bowen; Zhou, Wenguo; Zhang, Wenhai; Ye, Weijian; Zhang, Hao

    2018-01-01

    This study investigated the effect of glucose oxidase on the gel properties of threadfin bream surimi. The gel strength of surimi increased with the addition of 0.5‰ glucose oxidase after two-step heating. Based on the results of the chemical interactions, the hydrophobic interaction and disulfide bond of glucose oxidase-treated surimi samples increased compared with the control samples at the gelation temperature and gel modori temperature. The surface hydrophobicity of samples with glucose oxidase and glucose increased significantly ( p < 0.05) and total sulfhydryl groups decreased significantly ( p < 0.05). The analysis of Raman spectroscopy shows that the addition of glucose oxidase induced more α-helixes to turn into a more elongated random and flocculent structure. Glucose oxidase changes the secondary structure of the surimi protein, making more proteins depolarize and stretch and causing actomyosin to accumulate to each other, resulting in the formation of surimi gel.

  7. Optimization of ACC system spacing policy on curved highway

    NASA Astrophysics Data System (ADS)

    Ma, Jun; Qian, Kun; Gong, Zaiyan

    2017-05-01

    The paper optimizes the original spacing policy when adopting VTH (Variable Time Headway), proposes to introduce the road curve curvature K to the spacing policy to cope with following the wrong vehicle or failing to follow the vehicle owing to the radar limitation of curve in ACC system. By utilizing MATLAB/Simulink, automobile longitudinal dynamics model is established. At last, the paper sets up such three common cases as the vehicle ahead runs at a uniform velocity, an accelerated velocity and hits the brake suddenly, simulates these cases on the curve with different curvature, analyzes the curve spacing policy in the perspective of safety and vehicle following efficiency and draws the conclusion whether the optimization scheme is effective or not.

  8. NADPH Oxidase as a Therapeutic Target for Oxalate Induced Injury in Kidneys

    PubMed Central

    Peck, Ammon B.; Khan, Saeed R.

    2013-01-01

    A major role of the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase family of enzymes is to catalyze the production of superoxides and other reactive oxygen species (ROS). These ROS, in turn, play a key role as messengers in cell signal transduction and cell cycling, but when they are produced in excess they can lead to oxidative stress (OS). Oxidative stress in the kidneys is now considered a major cause of renal injury and inflammation, giving rise to a variety of pathological disorders. In this review, we discuss the putative role of oxalate in producing oxidative stress via the production of reactive oxygen species by isoforms of NADPH oxidases expressed in different cellular locations of the kidneys. Most renal cells produce ROS, and recent data indicate a direct correlation between upregulated gene expressions of NADPH oxidase, ROS, and inflammation. Renal tissue expression of multiple NADPH oxidase isoforms most likely will impact the future use of different antioxidants and NADPH oxidase inhibitors to minimize OS and renal tissue injury in hyperoxaluria-induced kidney stone disease. PMID:23840917

  9. 2013 ACC/AHA Cholesterol Guideline Versus 2004 NCEP ATP III Guideline in the Prediction of Coronary Artery Calcification Progression in a Korean Population.

    PubMed

    Cho, Yun Kyung; Jung, Chang Hee; Kang, Yu Mi; Hwang, Jenie Yoonoo; Kim, Eun Hee; Yang, Dong Hyun; Kang, Joon-Won; Park, Joong-Yeol; Kim, Hong-Kyu; Lee, Woo Je

    2016-08-19

    Since the release of the 2013 American College of Cardiology/American Heart Association (ACC/AHA) guidelines, significant controversy has surrounded the applicability of the new cholesterol guidelines and the Pooled Cohort Equations. In this present study, we investigated whether eligibility for statin therapy determined by the 2013 ACC/AHA guidelines on the management of blood cholesterol is better aligned with the progression of coronary artery calcification (CAC) detected by coronary computed tomography angiography (CCTA) than the previously recommended 2004 National Cholesterol Education Program (NCEP) Adult Treatment Panel (ATP) III guidelines. We enrolled 1246 asymptomatic participants who underwent repeated CAC score measurement during routine health examinations. The CAC score progression was defined as either incident CAC in a population free of CAC at baseline or increase ≥2.5 units between the baseline and final square root of CAC scores participants who had detectable CAC at baseline examination. Application of the ACC/AHA guidelines to the study population increased the proportion of statin-eligible subjects from 20.5% (according to ATP III) to 54.7%. Statin-eligible subjects, as defined by ACC/AHA guidelines, showed a higher odds ratio for CAC score progression than those considered statin eligible according to ATP III guidelines (2.73 [95% CI, 2.07-3.61] vs 2.00 [95% CI, 1.49-2.68]). Compared with the ATP III guidelines, the new ACC/AHA guidelines result in better discrimination of subjects with cardiovascular risk detected by CAC score progression in an Asian population. © 2016 The Authors. Published on behalf of the American Heart Association, Inc., by Wiley Blackwell.

  10. 2013 ACC/AHA versus 2004 NECP ATP III Guidelines in the Assignment of Statin Treatment in a Korean Population with Subclinical Coronary Atherosclerosis

    PubMed Central

    Kang, Yu Mi; Yang, Dong Hyun; Kang, Joon-Won; Kim, Eun Hee; Park, Duk-Woo; Park, Joong-Yeol; Kim, Hong-Kyu; Lee, Woo Je

    2015-01-01

    Background The usefulness of the 2013 ACC/AHA guidelines for the management of blood cholesterol in the Asian population remains controversial. In this study, we investigated whether eligibility for statin therapy determined by the 2013 ACC/AHA guidelines is better aligned with the presence of subclinical coronary atherosclerosis detected by CCTA (coronary computed tomography angiography) compared to the previously recommended 2004 NCEP ATP III guidelines. Methods We collected the data from 5,837 asymptomatic subjects who underwent CCTA using MDCT during routine health examinations. Based on risk factor assessment and lipid data, we determined guideline-based eligibility for statin therapy according to the 2013 ACC/AHA and 2004 NCEP ATP III guidelines. We defined the presence and severity of subclinical coronary atherosclerosis detected in CCTA according to the presence of significant coronary artery stenosis (defined as >50% stenosis), plaques, and the degree of coronary calcification. Results As compared to the 2004 ATP III guidelines, a significantly higher proportion of subjects with significant coronary stenosis (61.8% vs. 33.8%), plaques (52.3% vs. 24.7%), and higher CACS (CACS >100, 63.6% vs. 26.5%) was assigned to statin therapy using the 2013 ACC/AHA guidelines (P < .001 for all variables). The area under the curves of the pooled cohort equation of the new guidelines in detecting significant stenosis, plaques, and higher CACS were significantly higher than those of the Framingham risk calculator. Conclusions Compared to the previous ATP III guidelines, the 2013 ACC/AHA guidelines were more sensitive in identifying subjects with subclinical coronary atherosclerosis detected by CCTA in an Asian population. PMID:26372638

  11. Assessing driver's mental representation of Adaptive Cruise Control (ACC) and its possible effects on behavioural adaptations.

    PubMed

    Piccinini, Giulio Francesco; Simões, Anabela; Rodrigues, Carlos Manuel; Leitão, Miguel

    2012-01-01

    The introduction of Adaptive Cruise Control (ACC) could be very helpful for making the longitudinal driving task more comfortable for the drivers and, as a consequence, it could have a global beneficial effect on road safety. However, before or during the usage of the device, due to several reasons, drivers might generate in their mind incomplete or flawed mental representations about the fundamental operation principles of ACC; hence, the resulting usage of the device might be improper, negatively affecting the human-machine interaction and cooperation and, in some cases, leading to negative behavioural adaptations to the system that might neutralise the desirable positive effects on road safety. Within this context, this paper will introduce the methodology which has been developed in order to analyse in detail the topic and foresee, in the future, adequate actions for the recovery of inaccurate mental representations of the system.

  12. [Experimental rationale for the parameters of a rapid method for oxidase activity determination].

    PubMed

    Butorina, N N

    2010-01-01

    Experimental rationale is provided for the parameters of a rapid (1-2-min) test to concurrently determine the oxidase activity of all bacteria grown on the membrane filter after water filtration. Oxidase reagents that are the aqueous solutions of tetramethyl-p-phenylenediamine dihydrochloride and demethyl-p-phenylenediamine dihydrochloride have been first ascertained to exert no effect on the viability and enzymatic activity of bacteria after one-hour contact. An algorithm has been improved for the rapid oxidase activity test: the allowable time for bacteria to contact oxidase reagents and procedures for minimizing the effect on bacterial biochemical activity following the contact. An accelerated method based on lactose medium with tergitol 7 and Endo agar has been devised to determine coliform bacteria, by applying the rapid oxidase test: the time of a final response is 18-24 hours. The method has been included into GOST 52426-2005.

  13. Heterologous production and characterization of two glyoxal oxidases from Pycnoporus cinnabarinus

    Treesearch

    Marianne Daou; François Piumi; Daniel Cullen; Eric Record; Craig B. Faulds

    2016-01-01

    The genome of the white rot fungus Pycnoporus cinnabarinus includes a large number of genes encoding enzymes implicated in lignin degradation. Among these, three genes are predicted to encode glyoxal oxidase, an enzyme previously isolated from Phanerochaete chrysosporium. The glyoxal oxidase of P. chrysosporium...

  14. The Burden of Statin Therapy based on ACC/AHA and NCEP ATP-III Guidelines: An Iranian Survey of Non-Communicable Diseases Risk Factors.

    PubMed

    Asgari, Samaneh; Abdi, Hengameh; Hezaveh, Alireza Mahdavi; Moghisi, Alireza; Etemad, Koorosh; Beni, Hassan Riahi; Khalili, Davood

    2018-03-21

    To compare the burden of statin therapy according to the Third Adult Treatment Panel (ATP-III) and the American College of Cardiology/American Heart Association (ACC/AHA) guidelines the Survey of Risk Factors of Non-Communicable Disease (SuRFNCD)-2011of Iran was used. A survey analysis associated with sex and age categorization was run. Of total 3496 persons (1322 men) aged 40-70 years, based on the ACC/AHA guidelines, about 46.5% were eligible to receive moderate- to high-intensity statin therapy. Based on the ATP-III guidelines, 17.0% were considered as needing statin drugs. Among adults aged <60 years, the proportion of those who were eligible for statin therapy was higher (38.3%) according to the ACC/AHA guidelines compared to the ATP-III guidelines (15.2%), a difference more prominent in adults aged ≥60 years (85.2% versus 25.0%). Agreement between the two guidelines was low (kappa: 0.32). Compared to the ATP-III guidelines, the ACC/AHA guidelines increase the number of adults eligible for statin therapy in an Iraninan population from 2.5 million to 7.0 million people according to the 2011 census, specifically in those aged ≥ 60 years, a finding in agreement with those of studies from different countries.

  15. Expression of recombinant AccMRJP1 protein from royal jelly of Chinese honeybee in Pichia pastoris and its proliferation activity in an insect cell line

    USDA-ARS?s Scientific Manuscript database

    Main royal jelly protein 1 (MRJP1) is the most abundant member of the main royal jelly protein (MRJP) family among honeybees. Mature MRJP1 cDNA of the Chinese honeybee (Apis cerana cerana MRJP1, or AccMRJP1) was expressed in Pichia pastoris. SDS-PAGE showed that recombinant AccMRJP1 was identical in...

  16. Polyamines and ethylene interact in rice grains in response to soil drying during grain filling.

    PubMed

    Chen, Tingting; Xu, Yunji; Wang, Jingchao; Wang, Zhiqin; Yang, Jianchang; Zhang, Jianhua

    2013-05-01

    This study tested the hypothesis that the interaction between polyamines and ethylene may mediate the effects of soil drying on grain filling of rice (Oryza sativa L.). Two rice cultivars were pot grown. Three treatments, well-watered, moderate soil drying (MD), and severe soil drying (SD), were imposed from 8 d post-anthesis until maturity. The endosperm cell division rate, grain-filling rate, and grain weight of earlier flowering superior spikelets showed no significant differences among the three treatments. However, those of the later flowering inferior spikelets were significantly increased under MD and significantly reduced under SD when compared with those which were well watered. The two cultivars showed the same tendencies. MD increased the contents of free spermidine (Spd) and free spermine (Spm), the activities of S-adenosyl-L-methionine decarboxylase and Spd synthase, and expression levels of polyamine synthesis genes, and decreased the ethylene evolution rate, the contents of 1-aminocylopropane-1-carboxylic acid (ACC) and hydrogen peroxide, the activities of ACC synthase, ACC oxidase, and polyamine oxidase, and the expression levels of ethylene synthesis genes in inferior spikelets. SD exhibited the opposite effects. Application of Spd, Spm, or an inhibitor of ethylene synthesis to rice panicles significantly reduced ethylene and ACC levels, but significantly increased Spd and Spm contents, grain-filling rate, and grain weight of inferior spikelets. The results were reversed when ACC or an inhibitor of Spd and Spm synthesis was applied. The results suggest that a potential metabolic interaction between polyamines and ethylene biosynthesis responds to soil drying and mediates the grain filling of inferior spikelets in rice.

  17. Phospholipid alterations in cardiac sarcoplasmic reticulum induced by xanthine oxidase: contamination of commercial preparations of xanthine oxidase by phospholipase A/sub 2/

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gamache, D.A.; Kornberg, L.J.; Bartolf, M.

    1986-05-01

    Incubation of cardiac sarcoplasmic reticulum with xanthine oxidase alone at pH 7.0 resulted in a loss of lipid phosphorus that was potentiated by the addition of xanthine. Using autoclaved E.coli with 1-/sup 14/C-oleate in the 2-acyl position of membrane phospholipids, the authors demonstrate that many, but not all, commercial preparations of xanthine oxidase contain significant phospholipase A/sub 2/ (PLA/sub 2/) activity (64.3-545.6 nmols/min/mg). The PLA/sub 2/ was maximally active in the neutral-alkaline pH range, was Ca/sup 2 +/-dependent, and was unaffected by the addition of xanthine. PLA/sub 2/ activity was totally inhibited by 1mM EDTA whereas radical production by optimalmore » concentrations of xanthine/xanthine oxidase (X/XO) was unaffected by EDTA. Chromatographically purified xanthine oxidase (Sigma Grade III) contained high levels of PLA/sub 2/ activity (64.3 nmols/min/mg) compared to endogenous levels of neutral-active, Ca/sup 2 +/-dependent PLA/sub 2/ measured in various tissue homogenates (less than or equal to 0.5 nmols/ min/mg). Because X/XO mixtures are used extensively to study oxygen free radical-induced cell injury and membrane phospholipid alterations, the presence of a potent extracellular PLA/sub 2/ may have influenced previously published reports, and such studies should be interpreted cautiously.« less

  18. A Biochemical Approach to Study the Role of the Terminal Oxidases in Aerobic Respiration in Shewanella oneidensis MR-1

    PubMed Central

    Le Laz, Sébastien; Kpebe, Arlette; Bauzan, Marielle; Lignon, Sabrina; Rousset, Marc; Brugna, Myriam

    2014-01-01

    The genome of the facultative anaerobic γ-proteobacterium Shewanella oneidensis MR-1 encodes for three terminal oxidases: a bd-type quinol oxidase and two heme-copper oxidases, a A-type cytochrome c oxidase and a cbb 3-type oxidase. In this study, we used a biochemical approach and directly measured oxidase activities coupled to mass-spectrometry analysis to investigate the physiological role of the three terminal oxidases under aerobic and microaerobic conditions. Our data revealed that the cbb 3-type oxidase is the major terminal oxidase under aerobic conditions while both cbb 3-type and bd-type oxidases are involved in respiration at low-O2 tensions. On the contrary, the low O2-affinity A-type cytochrome c oxidase was not detected in our experimental conditions even under aerobic conditions and would therefore not be required for aerobic respiration in S. oneidensis MR-1. In addition, the deduced amino acid sequence suggests that the A-type cytochrome c oxidase is a ccaa 3-type oxidase since an uncommon extra-C terminal domain contains two c-type heme binding motifs. The particularity of the aerobic respiratory pathway and the physiological implication of the presence of a ccaa 3-type oxidase in S. oneidensis MR-1 are discussed. PMID:24466040

  19. Phenol oxidase activity in secondary transformed peat-moorsh soils

    NASA Astrophysics Data System (ADS)

    Styła, K.; Szajdak, L.

    2009-04-01

    The chemical composition of peat depends on the geobotanical conditions of its formation and on the depth of sampling. The evolution of hydrogenic peat soils is closely related to the genesis of peat and to the changes in water conditions. Due to a number of factors including oscillation of ground water level, different redox potential, changes of aerobic conditions, different plant communities, and root exudes, and products of the degradation of plant remains, peat-moorsh soils may undergo a process of secondary transformation conditions (Sokolowska et al. 2005; Szajdak et al. 2007). Phenol oxidase is one of the few enzymes able to degrade recalcitrant phenolic materials as lignin (Freeman et al. 2004). Phenol oxidase enzymes catalyze polyphenol oxidation in the presence of oxygen (O2) by removing phenolic hydrogen or hydrogenes to from radicals or quinines. These products undergo nucleophilic addition reactions in the presence or absence of free - NH2 group with the eventual production of humic acid-like polymers. The presence of phenol oxidase in soil environments is important in the formation of humic substances a desirable process because the carbon is stored in a stable form (Matocha et al. 2004). The investigations were carried out on the transect of peatland 4.5 km long, located in the Agroecological Landscape Park host D. Chlapowski in Turew (40 km South-West of Poznań, West Polish Lowland). The sites of investigation were located along Wyskoć ditch. The following material was taken from four chosen sites marked as Zbechy, Bridge, Shelterbelt and Hirudo in two layers: cartel (0-50cm) and cattle (50-100cm). The object of this study was to characterize the biochemical properties by the determination of the phenol oxidize activity in two layers of the four different peat-moors soils used as meadow. The phenol oxidase activity was determined spectrophotometrically by measuring quinone formation at λmax=525 nm with catechol as substrate by method of Perucci

  20. Mechanism of retinoic acid-induced transcription: histone code, DNA oxidation and formation of chromatin loops.

    PubMed

    Zuchegna, Candida; Aceto, Fabiana; Bertoni, Alessandra; Romano, Antonella; Perillo, Bruno; Laccetti, Paolo; Gottesman, Max E; Avvedimento, Enrico V; Porcellini, Antonio

    2014-01-01

    Histone methylation changes and formation of chromatin loops involving enhancers, promoters and 3' end regions of genes have been variously associated with active transcription in eukaryotes. We have studied the effect of activation of the retinoic A receptor, at the RARE-promoter chromatin of CASP9 and CYP26A1 genes, 15 and 45 min following RA exposure, and we found that histone H3 lysines 4 and 9 are demethylated by the lysine-specific demethylase, LSD1 and by the JMJ-domain containing demethylase, D2A. The action of the oxidase (LSD1) and a dioxygenase (JMJD2A) in the presence of Fe++ elicits an oxidation wave that locally modifies the DNA and recruits the enzymes involved in base and nucleotide excision repair (BER and NER). These events are essential for the formation of chromatin loop(s) that juxtapose the RARE element with the 5' transcription start site and the 3' end of the genes. The RARE bound-receptor governs the 5' and 3' end selection and directs the productive transcription cycle of RNA polymerase. These data mechanistically link chromatin loops, histone methylation changes and localized DNA repair with transcription. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Growth rate regulation of Escherichia coli acetyl coenzyme A carboxylase, which catalyzes the first committed step of lipid biosynthesis.

    PubMed Central

    Li, S J; Cronan, J E

    1993-01-01

    Acetyl coenzyme A (CoA) carboxylase catalyzes the synthesis of malonyl-CoA, the first intermediate of fatty acid synthesis. The Escherichia coli enzyme is encoded by four subunits located at three different positions on the E. coli chromosome. The accBC genes lie in a small operon at min 72, whereas accA and accD are located at min 4.3 and 50, respectively. We examined the expression of the genes that encode the E. coli acetyl-CoA carboxylase subunits (accA, accBC, and accD) under a variety of growth conditions by quantitative Northern (RNA) blot analysis. We found a direct correlation between the levels of transcription of the acc genes and the rate of cellular growth. Consistent results were also obtained upon nutritional upshift and downshift experiments and upon dilution of stationary-phase cultures into fresh media. We also determined the 5' end of the accA and accD mRNAs by primer extension and did transcriptional fusion analysis of the previously reported accBC promoter. Several interesting features were found in the promoter regions of these genes, including a bent DNA sequence and an open reading frame within the unusually long leader mRNA of the accBC operon, potential stem-loop structures in the accA and accD mRNA leader regions, and a stretch of GC-rich sequences followed by AT-rich sequences common to all three promoters. In addition, both accA and accD are located in complex gene clusters. For example, the accA promoter was localized within the upstream polC gene (which encodes the DNA polymerase III catalytic subunit), suggesting that additional regulatory mechanisms exist. Images PMID:7678242

  2. Assessment of Anterior Cingulate Cortex (ACC) and Left Cerebellar Metabolism in Asperger's Syndrome with Proton Magnetic Resonance Spectroscopy (MRS).

    PubMed

    Goji, Aya; Ito, Hiromichi; Mori, Kenji; Harada, Masafumi; Hisaoka, Sonoka; Toda, Yoshihiro; Mori, Tatsuo; Abe, Yoko; Miyazaki, Masahito; Kagami, Shoji

    2017-01-01

    Proton magnetic resonance spectroscopy (1H MRS) is a noninvasive neuroimaging method to quantify biochemical metabolites in vivo and it can serve as a powerful tool to monitor neurobiochemical profiles in the brain. Asperger's syndrome (AS) is a type of autism spectrum disorder, which is characterized by impaired social skills and restrictive, repetitive patterns of interest and activities, while intellectual levels and language skills are relatively preserved. Despite clinical aspects have been well-characterized, neurometabolic profiling in the brain of AS remains to be clear. The present study used proton magnetic resonance spectroscopy (1H MRS) to investigate whether pediatric AS is associated with measurable neurometabolic abnormalities that can contribute new information on the neurobiological underpinnings of the disorder. Study participants consisted of 34 children with AS (2-12 years old; mean age 5.2 (±2.0); 28 boys) and 19 typically developed children (2-11 years old; mean age 5.6 (±2.6); 12 boys) who served as the normal control group. The 1H MRS data were obtained from two regions of interest: the anterior cingulate cortex (ACC) and left cerebellum. In the ACC, levels of N-acetylaspartate (NAA), total creatine (tCr), total choline-containing compounds (tCho) and myo-Inositol (mI) were significantly decreased in children with AS compared to controls. On the other hand, no significant group differences in any of the metabolites were found in the left cerebellum. Neither age nor sex accounted for the metabolic findings in the regions. The finding of decreased levels of NAA, tCr, tCho, and mI in the ACC but not in left cerebellar voxels in the AS, suggests a lower ACC neuronal density in the present AS cohort compared to controls.

  3. Design, synthesis and molecular modeling of aloe-emodin derivatives as potent xanthine oxidase inhibitors.

    PubMed

    Shi, Da-Hua; Huang, Wei; Li, Chao; Liu, Yu-Wei; Wang, Shi-Fan

    2014-03-21

    A series of aloe-emodin derivatives were synthesized and evaluated as xanthine oxidase inhibitors. Among them, four aloe-emodin derivatives showed significant inhibitory activities against xanthine oxidase. The compound 4,5-dihydroxy-9,10-dioxo-9,10-dihydroanthracene-2-carbaldehyde (A1) possessed the best xanthine oxidase inhibitory activity with IC50 of 2.79 μM. Lineweaver-Burk plot analysis revealed that A1 acted as a mixed-type inhibitor for xanthine oxidase. The docking study revealed that the molecule A1 had strong interactions with the active site of xanthine oxidase and this result was in agreement with kinetic study. Consequently, compound A1 is a new-type candidate for further development for the treatment of gout. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  4. Supplementary biochemical tests useful for the differentiation of oxidase positive staphylococci.

    PubMed

    Stepanović, Srdjan; Dakić, Ivana; Hauschild, Tomasz; Vuković, Dragana; Morrison, Donald; Jezek, Petr; Cirković, Ivana; Petrás, Petr

    2007-06-01

    Differentiation of the oxidase positive staphylococci, Staphylococcus sciuri, Staphylococcus lentus, Staphylococcus vitulinus and Staphylococcus fleurettii, based on tributyrin, urease, caseinase, gelatinase and DNase activity is described. These tests may be used for preliminary identification of oxidase positive isolates of staphylococci resulting in more accurate identification of these species.

  5. NADPH oxidases: new kids on the block.

    PubMed

    Geiszt, Miklós

    2006-07-15

    Reactive oxygen species (ROS) play a pivotal role in many physiological processes including host defense, hormone biosynthesis, fertilization and cellular signaling. Altered production of ROS has been implicated in the development of immunodeficiency, hypothyroidism and cardiovascular pathologies. In the last few years, several enzymes were identified at the molecular level, which are now thought to be responsible for ROS production observed in diverse tissues. These enzymes show a high degree of homology to the phagocytic NADPH oxidase and are now designated the Nox family of NADPH oxidases. This review updates our knowledge on six new members of the Nox family: Nox1, Nox3, Nox4, Nox5, Duox1 and Duox2.

  6. CAC Score Improves Coronary and CV Risk Assessment Above Statin Indication by ESC and AHA/ACC Primary Prevention Guidelines.

    PubMed

    Mahabadi, Amir A; Möhlenkamp, Stefan; Lehmann, Nils; Kälsch, Hagen; Dykun, Iryna; Pundt, Noreen; Moebus, Susanne; Jöckel, Karl-Heinz; Erbel, Raimund

    2017-02-01

    The aim of this study was to assess the difference in indication for statin therapy by European Society of Cardiology (ESC) versus American Heart Association/American College of Cardiology (AHA/ACC) guidelines and to quantify the potential additional role of coronary artery calcification (CAC) score over updated guidelines in a primary prevention cohort. Recently, ESC and AHA/ACC updated the guidelines regarding statin therapy in primary prevention. In 3,745 subjects (59 ± 8 years of age, 47% men) from the population based longitudinal Heinz Nixdorf Recall cohort study without cardiovascular disease or lipid-lowering therapy at baseline CAC score was assessed between 2000 and 2003. Subjects remained unaware of their initial CAC score. Statin indication was determined according to 2012 ESC and 2013 AHA/ACC guidelines based on subjects individual baseline characteristics. The frequency of statin recommendation was lower according to ESC compared to AHA/ACC guidelines (34% vs. 56%; p < 0.0001), whereas low CAC score (<100) was common in subjects with statin indication by both guidelines (59% for ESC, 62% for AHA/ACC). During 10.4 ± 2.0 years of follow-up, 131 myocardial infarctions occurred. For ESC recommendations, CAC score differentiated risk for subjects without (1.0 [95% confidence interval (CI): 0.4 to 1.5] vs. 6.5 [95% CI: 4.1 to 8.9] coronary events per 1,000 person-years for CAC 0 vs. ≥100) and with statin indication (2.6 [95% CI: 0.6 to 4.7] vs. 9.9 [95% CI: 7.3 to 12.5] per 1,000 person-years for CAC 0 vs. ≥100). Likewise, CAC score stratified proportions experiencing events subjects with statin indication according to AHA/ACC (2.7 [95% CI: 1.1 to 4.2] vs. 9.1 [95% CI: 7.0 to 11.0] per 1,000 person-years for CAC 0 vs. ≥100), whereas event rate in subjects without statin indication was low (1.1 [95% CI: 0.65 to 1.68] per 1,000 person-years). Current ESC and AHA/ACC guidelines lead to markedly different recommendation regarding statin therapy in a

  7. Monocyte and macrophage-targeted NADPH oxidase mediates antifungal host defense and regulation of acute inflammation in mice

    PubMed Central

    Grimm, Melissa J.; Vethanayagam, R. Robert; Almyroudis, Nikolaos G.; Dennis, Carly G.; Khan, A. Nazmul H.; D’Auria, Anthony; Singel, Kelly L.; Davidson, Bruce A.; Knight, Paul R.; Blackwell, Timothy S.; Hohl, Tobias M.; Mansour, Michael K.; Vyas, Jatin M.; Röhm, Marc; Urban, Constantin F.; Kelkka, Tiina; Holmdahl, Rikard; Segal, Brahm H.

    2013-01-01

    Chronic granulomatous disease, an inherited disorder of the NADPH oxidase in which phagocytes are defective in the generation of superoxide anion and downstream reactive oxidant species, is characterized by severe bacterial and fungal infections and excessive inflammation. Although NADPH oxidase isoforms exist in several lineages, reactive oxidant generation is greatest in neutrophils, where NADPH oxidase has been deemed vital for pathogen killing. In contrast, the function and importance of NADPH oxidase in macrophages are less clear. Therefore, we evaluated susceptibility to pulmonary aspergillosis in globally NADPH oxidase-deficient mice versus transgenic mice with monocyte/macrophage-targeted NADPH oxidase activity. We found that the lethal inoculum was more than 100-fold greater in transgenic versus globally NADPH oxidase-deficient mice. Consistent with these in vivo results, NADPH oxidase in mouse alveolar macrophages limited germination of phagocytosed Aspergillus fumigatus spores. Finally, globally NADPH oxidase-deficient mice developed exuberant neutrophilic lung inflammation and pro-inflammatory cytokine responses to zymosan, a fungal cell wall-derived product composed principally of particulate beta-glucans, whereas inflammation in transgenic and wildtype mice was mild and transient. Together, our studies identify a central role for monocyte/macrophage NADPH oxidase in controlling fungal infection and in limiting acute lung inflammation. PMID:23509361

  8. Comparison of Recommended Eligibility for Primary Prevention Statin Therapy Based on the US Preventive Services Task Force Recommendations vs the ACC/AHA Guidelines.

    PubMed

    Pagidipati, Neha J; Navar, Ann Marie; Mulder, Hillary; Sniderman, Allan D; Peterson, Eric D; Pencina, Michael J

    2017-04-18

    There are important differences among guideline recommendations for using statin therapy in primary prevention. New recommendations from the US Preventive Services Task Force (USPSTF) emphasize therapy based on the presence of 1 or more cardiovascular disease (CVD) risk factors and a 10-year global CVD risk of 10% or greater. To determine the difference in eligibility for primary prevention statin treatment among US adults, assuming full application of USPSTF recommendations compared with the American College of Cardiology/American Heart Association (ACC/AHA) guidelines. National Health and Nutrition Examination Survey (NHANES) data (2009-2014) were used to assess statin eligibility under the 2016 USPSTF recommendations vs the 2013 ACC/AHA cholesterol guidelines among a nationally representative sample of 3416 US adults aged 40 to 75 years with fasting lipid data and triglyceride levels of 400 mg/dL or less, without prior CVD. The 2016 USPSTF recommendations vs 2013 ACC/AHA guidelines. Eligibility for primary prevention statin therapy. Among the US primary prevention population represented by 3416 individuals in NHANES, the median weighted age was 53 years (interquartile range, 46-61), and 53% (95% CI, 52%-55%) were women. Along with the 21.5% (95% CI, 19.3%-23.7%) of patients who reported currently taking lipid-lowering medication, full implementation of the USPSTF recommendations would be associated with initiation of statin therapy in an additional 15.8% (95% CI, 14.0%-17.5%) of patients, compared with an additional 24.3% (95% CI, 22.3%-26.3%) of patients who would be recommended for statin initiation under full implementation of the 2013 ACC/AHA guidelines. Among the 8.9% of individuals in the primary prevention population who would be recommended for statins by ACC/AHA guidelines but not by USPSTF recommendations, 55% would be adults aged 40 to 59 years with a mean 30-year cardiovascular risk greater than 30%, and 28% would have diabetes. In this sample of US

  9. Effect of mitoguazone on polyamine oxidase activity in rat liver.

    PubMed

    Ferioli, Maria Elena; Berselli, Debora; Caimi, Samuela

    2004-12-01

    Mitoguazone is a known inhibitor of polyamine biosynthesis through competitive inhibition of S-adenosylmethionine decarboxylase. A recent renewed interest in mitoguazone as an antineoplastic agent prompted us to investigate the effect of the drug on polyamine catabolism in rat liver, since the organ plays an important role in detoxification mechanisms. Thus, the purpose of this work was to evaluate the effect of in vivo mitoguazone administration on polyamine catabolic enzymes. In particular, our interest was directed to the changes in polyamine oxidase activity, since this enzyme has been recently confirmed to exert important functions that until now were underestimated. Mitoguazone administration induced hepatic polyamine oxidase activity starting at 4 h after administration, and the enzyme returned to basal levels 96 h after treatment. The changes in enzyme activity were accompanied by changes in putrescine concentrations, which increased starting at 4 h until 72 h after treatment. We also evaluated the activity of the newly identified spermine oxidase, which was not significantly changed by mitoguazone treatment. Therefore, we hypothesized that the enzyme involved in mitoguazone response of the liver is the polyamine oxidase, which acts on acetylated polyamines as substrate.

  10. Oxidase-functionalized Fe(3)O(4) nanoparticles for fluorescence sensing of specific substrate.

    PubMed

    Liu, Cheng-Hao; Tseng, Wei-Lung

    2011-10-03

    This study reports the development of a reusable, single-step system for the detection of specific substrates using oxidase-functionalized Fe(3)O(4) nanoparticles (NPs) as a bienzyme system and using amplex ultrared (AU) as a fluorogenic substrate. In the presence of H(2)O(2), the reaction pH between Fe(3)O(4) NPs and AU was similar to the reaction of oxidase and the substrate. The catalytic activity of Fe(3)O(4) NPs with AU was nearly unchanged following modification with poly(diallyldimethylammonium chloride) (PDDA). Based on these features, we prepared a composite of PDDA-modified Fe(3)O(4) NPs and oxidase for the quantification of specific substrates through the H(2)O(2)-mediated oxidation of AU. By monitoring fluorescence intensity at 587 nm of oxidized AU, the minimum detectable concentrations of glucose, galactose, and choline were found to be 3, 2, and 20 μM using glucose oxidase-Fe(3)O(4), galactose oxidase-Fe(3)O(4), and choline oxidase-Fe(3)O(4) composites, respectively. The identification of glucose in blood was selected as the model to validate the applicability of this proposed method. Copyright © 2011 Elsevier B.V. All rights reserved.

  11. A Mycobacterium tuberculosis Cytochrome bd Oxidase Mutant Is Hypersensitive to Bedaquiline

    PubMed Central

    Hartman, Travis E.

    2014-01-01

    ABSTRACT The new medicinal compound bedaquiline (BDQ) kills Mycobacterium tuberculosis by inhibiting F1Fo-ATP synthase. BDQ is bacteriostatic for 4 to 7 days and kills relatively slowly compared to other frontline tuberculosis (TB) drugs. Here we show that killing with BDQ can be improved significantly by inhibiting cytochrome bd oxidase, a non-proton-pumping terminal oxidase. BDQ was instantly bactericidal against a cytochrome bd oxidase null mutant of M. tuberculosis, and the rate of killing was increased by more than 50%. We propose that this exclusively bacterial enzyme should be a high-priority target for new drug discovery. PMID:25028424

  12. Plasma amine oxidase activities in Norrie disease patients with an X-chromosomal deletion affecting monoamine oxidase.

    PubMed

    Murphy, D L; Sims, K B; Karoum, F; Garrick, N A; de la Chapelle, A; Sankila, E M; Norio, R; Breakefield, X O

    1991-01-01

    Two individuals with an X-chromosomal deletion were recently found to lack the genes encoding monoamine oxidase type A (MAO-A) and MAO-B. This abnormality was associated with almost total (90%) reductions in the oxidatively deaminated urinary metabolites of the MAO-A substrate, norepinephrine, and with marked (100-fold) increases in an MAO-B substrate, phenylethylamine, confirming systemic functional consequences of the genetic enzyme deficiency. However, urinary concentrations of the deaminated metabolites of dopamine and serotonin (5-HT) were essentially normal. To investigate other deaminating systems besides MAO-A and MAO-B that might produce these metabolites of dopamine and 5-HT, we examined plasma amine oxidase (AO) activity in these two patients and two additional patients with the same X-chromosomal deletion. Normal plasma AO activity was found in all four Norrie disease-deletion patients, in four patients with classic Norrie disease without a chromosomal deletion, and in family members of patients from both groups. Marked plasma amine metabolite abnormalities and essentially absent platelet MAO-B activity were found in all four Norrie disease-deletion patients, but in none of the other subjects in the two comparison groups. These results indicate that plasma AO is encoded by gene(s) independent of those for MAO-A and MAO-B, and raise the possibility that plasma AO, and perhaps the closely related tissue AO, benzylamine oxidase, as well as other atypical AOs or MAOs encoded independently from MAO-A and MAO-B may contribute to the oxidative deamination of dopamine and 5-HT in humans.

  13. NADPH oxidase activation in neutrophils: Role of the Phosphorylation of its subunits.

    PubMed

    Belambri, Sahra A; Rolas, Loïc; Raad, Houssam; Hurtado-Nedelec, Margarita; Dang, Pham My-Chan; El-Benna, Jamel

    2018-05-14

    Neutrophils are key cells of innate immunity and during inflammation. Upon activation, they produce large amounts of superoxide anion (O 2 -. ) and ensuing reactive oxygen species (ROS) to kill phagocytized microbes. The enzyme responsible for O 2 -. production is called the phagocyte NADPH oxidase. This is a multicomponent enzyme system that becomes active after assembly of four cytosolic proteins (p47 phox , p67 phox , p40 phox and Rac2) with the transmembrane proteins (p22 phox and gp91 phox , which form the cytochrome b 558 ). gp91 phox represents the catalytic subunit of the NADPH oxidase and is also called NOX2. NADPH oxidase-derived ROS are essential for microbial killing and innate immunity; however, excessive ROS production induces tissue injury and prolonged inflammatory reactions that contribute to inflammatory diseases. Thus, NADPH oxidase activation must be tightly regulated in time and space in order to limit ROS production. NADPH oxidase activation is regulated by several processes such as phosphorylation of its components, exchange of GDP/GTP on Rac2 and binding of p47 phox and p40 phox to phospholipids. This review aims to provide new insights into the role of the phosphorylation of the NADPH oxidase components, i.e., gp91 phox , p22 phox , p47 phox , p67 phox and p40 phox , in the activation of this enzyme. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  14. Use of bacterial acc deaminase to increase oil (especially poly aromatic hydrocarbons) phytoremediation efficiency for maize (zea mays) seedlings.

    PubMed

    Rezvani Borujeni, Samira; Khavazi, Kazem; Asgharzadeh, Ahmad; Rezvani Borujeni, Iraj

    2018-04-16

    Oil presence in soil, as a stressor, reduces phytoremediation efficiency through an increase in the plant stress ethylene. Bacterial 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase, as a plant stress ethylene reducer, was employed to increase oil phytoremediation efficiency. For this purpose, the ability of ACC deaminase-producing Pseudomonas strains to grow in oil-polluted culture media and withstand various concentrations of oil and also their ability to reduce plant stress ethylene and enhance some growth characteristics of maize and finally their effects on increasing phytoremediation efficiency of poly aromatic hydrocarbons (PAHs) in soil were investigated. Based on the results, of tested strains just P9 and P12 were able to perform oil degradation. Increasing oil concentration from 0 to 10% augmented these two strains population, 15.7% and 12.9%, respectively. The maximum increase in maize growth was observed in presence of P12 strain. Results of high-performance liquid chromatography (HPLC) revealed that PAHs phytoremediation efficiency was higher for inoculated seeds than uninoculated. The highest plant growth and PAHs removal percentage (74.9%) from oil-polluted soil was observed in maize inoculated with P12. These results indicate the significance of ACC deaminase producing bacteria in alleviation of plant stress ethylene in oil-polluted soils and increasing phytoremediation efficiency of such soils.

  15. Safety assessment of bacterial choline oxidase protein introduced in transgenic crops for tolerance against abiotic stress.

    PubMed

    Singh, Abinav K; Singh, Bhanu P; Prasad, G B K S; Gaur, Shailendra N; Arora, Naveen

    2008-12-24

    Genetically modified crops have resistance to abiotic stress by introduction of choline oxidase protein. In the present study, the safety of choline oxidase protein derived from Arthrobacter globiformis was assessed for toxicity and allergenicity. The protein was stable at 90 degrees C for 1 h. Toxicity studies of choline oxidase in mice showed no significant difference (p > 0.05) from control in terms of growth, body weight, food consumption, and blood biochemical indices. Histology of gut tissue of mice fed protein showed normal gastric mucosal lining and villi in jejunum and ileum sections. Specific IgE in serum and IL-4 release in splenic culture supernatant were low in choline oxidase treated mice, comparable to control. Intravenous challenge with choline oxidase did not induce any adverse reaction, unlike ovalbumin group mice. Histology of lung tissues from choline oxidase sensitized mice showed normal airways, whereas ovalbumin-sensitized mice showed inflamed airways with eosinophilic infiltration and bronchoconstriction. ELISA carried out with food allergic patients' sera revealed no significant IgE affinity with choline oxidase. Also, choline oxidase did not show any symptoms of toxicity and allergenicity in mice.

  16. NADPH oxidases as novel pharmacologic targets against influenza A virus infection.

    PubMed

    Vlahos, Ross; Selemidis, Stavros

    2014-12-01

    Influenza A viruses represent a major global health care challenge, with imminent pandemics, emerging antiviral resistance, and long lag times for vaccine development, raising a pressing need for novel pharmacologic strategies that ideally target the pathology irrespective of the infecting strain. Reactive oxygen species (ROS) pervade all facets of cell biology with both detrimental and protective properties. Indeed, there is compelling evidence that activation of the NADPH oxidase 2 (NOX2) isoform of the NADPH oxidase family of ROS-producing enzymes promotes lung oxidative stress, inflammation, injury, and dysfunction resulting from influenza A viruses of low to high pathogenicity, as well as impeding virus clearance. By contrast, the dual oxidase isoforms produce ROS that provide vital protective antiviral effects for the host. In this review, we propose that inhibitors of NOX2 are better alternatives than broad-spectrum antioxidant approaches for treatment of influenza pathologies, for which clinical efficacy may have been limited owing to poor bioavailability and inadvertent removal of beneficial ROS. Finally, we briefly describe the current suite of NADPH oxidase inhibitors and the molecular features of the NADPH oxidase enzymes that could be exploited by drug discovery for development of more specific and novel inhibitors to prevent or treat disease caused by influenza. Copyright © 2014 by The American Society for Pharmacology and Experimental Therapeutics.

  17. Root respiratory burst oxidase homologue-dependent H2O2 production confers salt tolerance on a grafted cucumber by controlling Na+ exclusion and stomatal closure

    PubMed Central

    Niu, Mengliang; Huang, Yuan; Sun, Shitao; Sun, Jingyu; Cao, Haishun; Shabala, Sergey

    2018-01-01

    Abstract Plant salt tolerance can be improved by grafting onto salt-tolerant rootstocks. However, the underlying signaling mechanisms behind this phenomenon remain largely unknown. To address this issue, we used a range of physiological and molecular techniques to study responses of self-grafted and pumpkin-grafted cucumber plants exposed to 75 mM NaCl stress. Pumpkin grafting significantly increased the salt tolerance of cucumber plants, as revealed by higher plant dry weight, chlorophyll content and photochemical efficiency (Fv/Fm), and lower leaf Na+ content. Salinity stress resulted in a sharp increase in H2O2 production, reaching a peak 3 h after salt treatment in the pumpkin-grafted cucumber. This enhancement was accompanied by elevated relative expression of respiratory burst oxidase homologue (RBOH) genes RbohD and RbohF and a higher NADPH oxidase activity. However, this increase was much delayed in the self-grafted plants, and the difference between the two grafting combinations disappeared after 24 h. The decreased leaf Na+ content of pumpkin-grafted plants was achieved by higher Na+ exclusion in roots, which was driven by the Na+/H+ antiporter energized by the plasma membrane H+-ATPase, as evidenced by the higher plasma membrane H+-ATPase activity and higher transcript levels for PMA and SOS1. In addition, early stomatal closure was also observed in the pumpkin-grafted cucumber plants, reducing water loss and maintaining the plant’s hydration status. When pumpkin-grafted plants were pretreated with an NADPH oxidase inhibitor, diphenylene iodonium (DPI), the H2O2 level decreased significantly, to the level found in self-grafted plants, resulting in the loss of the salt tolerance. Inhibition of the NADPH oxidase-mediated H2O2 signaling in the root also abolished a rapid stomatal closure in the pumpkin-grafted plants. We concluded that the pumpkin-grafted cucumber plants increase their salt tolerance via a mechanism involving the root-sourced respiratory

  18. The rhizobacterium Variovorax paradoxus 5C-2, containing ACC deaminase, promotes growth and development of Arabidopsis thaliana via an ethylene-dependent pathway

    PubMed Central

    Dodd, Ian C.

    2013-01-01

    Many plant-growth-promoting rhizobacteria (PGPR) associated with plant roots contain the enzyme 1-aminocyclopropane-1-carboxylate (ACC) deaminase and can metabolize ACC, the immediate precursor of the plant hormone ethylene, thereby decreasing plant ethylene production and increasing plant growth. However, relatively few studies have explicitly linked ethylene emission and/or action to growth promotion in these plant–microbe interactions. This study examined effects of the PGPR Variovorax paradoxus 5C-2 containing ACC deaminase on the growth and development of Arabidopsis thaliana using wild-type (WT) plants and several ethylene-related mutants (etr1-1, ein2-1, and eto1-1). Soil inoculation with V. paradoxus 5C-2 promoted growth (leaf area and shoot biomass) of WT plants and the ethylene-overproducing mutant eto1-1, and also enhanced floral initiation of WT plants by 2.5 days. However, these effects were not seen in ethylene-insensitive mutants (etr1-1 and ein2-1) even though bacterial colonization of the root system was similar. Furthermore, V. paradoxus 5C-2 decreased ACC concentrations of rosette leaves of WT plants by 59% and foliar ethylene emission of both WT plants and eto1-1 mutants by 42 and 37%, respectively. Taken together, these results demonstrate that a fully functional ethylene signal transduction pathway is required for V. paradoxus 5C-2 to stimulate leaf growth and flowering of A. thaliana. PMID:23404897

  19. The rhizobacterium Variovorax paradoxus 5C-2, containing ACC deaminase, promotes growth and development of Arabidopsis thaliana via an ethylene-dependent pathway.

    PubMed

    Chen, Lin; Dodd, Ian C; Theobald, Julian C; Belimov, Andrey A; Davies, William J

    2013-04-01

    Many plant-growth-promoting rhizobacteria (PGPR) associated with plant roots contain the enzyme 1-aminocyclopropane-1-carboxylate (ACC) deaminase and can metabolize ACC, the immediate precursor of the plant hormone ethylene, thereby decreasing plant ethylene production and increasing plant growth. However, relatively few studies have explicitly linked ethylene emission and/or action to growth promotion in these plant-microbe interactions. This study examined effects of the PGPR Variovorax paradoxus 5C-2 containing ACC deaminase on the growth and development of Arabidopsis thaliana using wild-type (WT) plants and several ethylene-related mutants (etr1-1, ein2-1, and eto1-1). Soil inoculation with V. paradoxus 5C-2 promoted growth (leaf area and shoot biomass) of WT plants and the ethylene-overproducing mutant eto1-1, and also enhanced floral initiation of WT plants by 2.5 days. However, these effects were not seen in ethylene-insensitive mutants (etr1-1 and ein2-1) even though bacterial colonization of the root system was similar. Furthermore, V. paradoxus 5C-2 decreased ACC concentrations of rosette leaves of WT plants by 59% and foliar ethylene emission of both WT plants and eto1-1 mutants by 42 and 37%, respectively. Taken together, these results demonstrate that a fully functional ethylene signal transduction pathway is required for V. paradoxus 5C-2 to stimulate leaf growth and flowering of A. thaliana.

  20. The cytochrome oxidase subunit I and subunit III genes in Oenothera mitochondria are transcribed from identical promoter sequences

    PubMed Central

    Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel

    1987-01-01

    Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332

  1. A Comparative Analysis of the Integration of Faith and Learning between ACSI and ACCS Accredited Schools

    ERIC Educational Resources Information Center

    Peterson, Daniel Carl

    2012-01-01

    The purpose of this descriptive quantitative study was to analyze and compare the integration of faith and learning occurring in Christian schools accredited by the Association of Christian Schools International (ACSI) and classical Christian schools accredited by the Association of Classical and Christian Schools (ACCS). ACSI represents the…

  2. Activation of monoamine oxidase isotypes by prolonged intake of aluminum in rat brain.

    PubMed

    Huh, Jae-Wan; Choi, Myung-Min; Lee, Jang Han; Yang, Seung-Ju; Kim, Mi Jung; Choi, Jene; Lee, Kwan Ho; Lee, Jong Eun; Cho, Sung-Woo

    2005-10-01

    Rats were fed 100 microM aluminum maltolate for one year in their drinking water. Brain aluminum contents have increased 4.2-fold in the aluminum-treated group, whereas no significant changes in the body weight, brain weight, and brain protein content were observed. Long-term aluminum feeding induced apoptosis as assessed by the terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling method and showed activatory effects on the catalytic efficiency (kcat/KM) of monoamine oxidase-A and monoamine oxidase-B up to 1.9- and 3.8-fold, respectively. The expression level of monoamine oxidase isotypes on the Western blot remained unchanged between the two groups, suggesting a change in post-translational regulation of the activities of monoamine oxidase isotypes by long-term aluminum feeding.

  3. Protection from cyanide-induced brain injury by the Nrf2 transcriptional activator carnosic acid.

    PubMed

    Zhang, Dongxian; Lee, Brian; Nutter, Anthony; Song, Paul; Dolatabadi, Nima; Parker, James; Sanz-Blasco, Sara; Newmeyer, Traci; Ambasudhan, Rajesh; McKercher, Scott R; Masliah, Eliezer; Lipton, Stuart A

    2015-06-01

    Cyanide is a life-threatening, bioterrorist agent, preventing cellular respiration by inhibiting cytochrome c oxidase, resulting in cardiopulmonary failure, hypoxic brain injury, and death within minutes. However, even after treatment with various antidotes to protect cytochrome oxidase, cyanide intoxication in humans can induce a delayed-onset neurological syndrome that includes symptoms of Parkinsonism. Additional mechanisms are thought to underlie cyanide-induced neuronal damage, including generation of reactive oxygen species. This may account for the fact that antioxidants prevent some aspects of cyanide-induced neuronal damage. Here, as a potential preemptive countermeasure against a bioterrorist attack with cyanide, we tested the CNS protective effect of carnosic acid (CA), a pro-electrophilic compound found in the herb rosemary. CA crosses the blood-brain barrier to up-regulate endogenous antioxidant enzymes via activation of the Nrf2 transcriptional pathway. We demonstrate that CA exerts neuroprotective effects on cyanide-induced brain damage in cultured rodent and human-induced pluripotent stem cell-derived neurons in vitro, and in vivo in various brain areas of a non-Swiss albino mouse model of cyanide poisoning that simulates damage observed in the human brain. Cyanide, a potential bioterrorist agent, can produce a chronic delayed-onset neurological syndrome that includes symptoms of Parkinsonism. Here, cyanide poisoning treated with the proelectrophillic compound carnosic acid, results in reduced neuronal cell death in both in vitro and in vivo models through activation of the Nrf2/ARE transcriptional pathway. Carnosic acid is therefore a potential treatment for the toxic central nervous system (CNS) effects of cyanide poisoning. ARE, antioxidant responsive element; Nrf2 (NFE2L2, Nuclear factor (erythroid-derived 2)-like 2). © 2015 International Society for Neurochemistry.

  4. Selenium delays tomato fruit ripening by inhibiting ethylene biosynthesis and enhancing the antioxidant defense system.

    PubMed

    Zhu, Zhu; Chen, Yanli; Shi, Guoqing; Zhang, Xueji

    2017-03-15

    The antioxidant activity of selenium (Se) detoxifies reactive oxygen species (ROS) in plants and animals. In the present study, we elucidated the mechanism underlying Se induced fruit development and ripening. Our study showed that foliar pretreatment with 1mgL -1 sodium selenate effectively delayed fruit ripening and maintained fruit quality. Gene expression studies revealed that the repression of ethylene biosynthetic genes 1-aminocyclopropane-1-carboxylic acid (ACC) synthase and ACC oxidase decreased ethylene production and respiration rate. Moreover, Se treatment probably boosted the antioxidant defense system to reduce ROS generation and membrane damage. The enhanced antioxidative effect was attributed to higher glutathione content and increased activity of enzymes such as glutathione peroxidase and glutathione reductase. The upregulation of respiratory burst oxidase homologue genes in tomato fruit may also contribute to the enhanced antioxidative effect. Selenium treatment represents a promising strategy for delaying ripening and extending the shelf life of tomato fruit. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Purification, characterization and decolorization of bilirubin oxidase from Myrothecium verrucaria 3.2190

    USDA-ARS?s Scientific Manuscript database

    Myrothecium verrucaria 3.2190 is a nonligninolytic fungus that produces bilirubin oxidase. Both Myrothecium verrucaria and the extracellular bilirubin oxidase were tested for their ability to decolorize indigo carmine. The biosorption and biodegradation of the dye were detected during the process of...

  6. Towards rational therapy with monoamine oxidase inhibitors.

    PubMed

    Tyrer, P

    1976-04-01

    A rational approach to the use of monoamine oxidase inhibitors (MAOIs) is outlined. Patients suitable for treatment cannot be classified adequately using conventional diagnostic labels. They include those with primary symptoms of hypochondriasis, agoraphobia and social phobias, irritability, somatic anxiety and anergia; those with primary depressed mood, guilt, ideas of reference and personality disorders seldom respond. There is great variation in the interval between the first administration of these drugs and clinical response, and this may account for the inconsistencies in published trials. The type of drug and its dose may affect rate of response, as may biochemical factors, including acetylator and monoamine oxidase status. To obtain maximum benefit, a course of therapy with MAOIs should last for several months.

  7. In vivo low-level light therapy increases cytochrome oxidase in skeletal muscle.

    PubMed

    Hayworth, Christopher R; Rojas, Julio C; Padilla, Eimeira; Holmes, Genevieve M; Sheridan, Eva C; Gonzalez-Lima, F

    2010-01-01

    Low-level light therapy (LLLT) increases survival of cultured cells, improves behavioral recovery from neurodegeneration and speeds wound healing. These beneficial effects are thought to be mediated by upregulation of mitochondrial proteins, especially the respiratory enzyme cytochrome oxidase. However, the effects of in vivo LLLT on cytochrome oxidase in intact skeletal muscle have not been previously investigated. We used a sensitive method for enzyme histochemistry of cytochrome oxidase to examine the rat temporalis muscle 24 h after in vivo LLLT. The findings showed for the first time that in vivo LLLT induced a dose- and fiber type-dependent increase in cytochrome oxidase in muscle fibers. LLLT was particularly effective at enhancing the aerobic capacity of intermediate and red fibers. The findings suggest that LLLT may enhance the oxidative energy metabolic capacity of different types of muscle fibers, and that LLLT may be used to enhance the aerobic potential of skeletal muscle.

  8. Mammalian monoamine-oxidizing enzymes, with special reference to benzylamine oxidase in human tissues.

    PubMed

    Lewinsohn, R

    1984-01-01

    A review is presented of the monoamine-oxidizing enzymes with special reference to the activity of benzylamine oxidase (BzAO) in human tissues. Methods of study of amine oxidases, properties (chiefly of BzAO) and some problems concerning substrate and inhibitor specificity and multiple forms of monoamine oxidase (MAO) are surveyed. The substrate specificity of human plasma BzAO is compared with that of amine-oxidizing enzymes in plasma or serum of other species. Correlations of plasma BzAO and platelet MAO activity with clinical findings are discussed. The distribution of amine oxidase activities in solid human tissues is reviewed, in particular BzAO in blood vessels and richly-vascularized tissues, as well as kinetic constants and altered patterns of activity of BzAO in human atherosclerosis. Activities of the amine oxidases in non-vascular smooth muscle, in cultured cells, and in various tissues related to human gestation, are discussed. The present knowledge of BzAO is discussed in terms of its possible clinical relevance to several human disease states, and the importance of the enzyme in the human body.

  9. Herbivore-plant interactions: mixed-function oxidases and secondary plant substances.

    PubMed

    Brattsten, L B; Wilkinson, C F; Eisner, T

    1977-06-17

    The mixed-function oxidases of a polyphagous insect larva (the southern armyworm, Spodoptera eridania) were found to be induced by a diversity of secondary plant substances. The induction proceeds rapidly and in response to a small quantity of secondary substance. Following induction, the larva is less susceptible to dietary poisoning. It is argued that mixed-function oxidases play a major role in protecting herbivores against chemical stress from secondary plant substances.

  10. Protection from cyanide-induced brain injury by the Nrf2 transcriptional activator carnosic acid

    PubMed Central

    Zhang, Dongxian; Lee, Brian; Nutter, Anthony; Song, Paul; Dolatabadi, Nima; Parker, James; Sanz-Blasco, Sara; Newmeyer, Traci; Ambasudhan, Rajesh; McKercher, Scott R.; Masliah, Eliezer; Lipton, Stuart A.

    2015-01-01

    Cyanide is a life threatening, bioterrorist agent, preventing cellular respiration by inhibiting cytochrome c oxidase, resulting in cardiopulmonary failure, hypoxic brain injury, and death within minutes. However, even after treatment with various antidotes to protect cytochrome oxidase, cyanide intoxication in humans can induce a delayed-onset neurological syndrome that includes symptoms of Parkinsonism. Additional mechanisms are thought to underlie cyanide-induced neuronal damage, including generation of reactive oxygen species (ROS). This may account for the fact that antioxidants prevent some aspects of cyanide-induced neuronal damage. Here, as a potential preemptive countermeasure against a bioterrorist attack with cyanide, we tested the CNS protective effect of carnosic acid (CA), a pro-electrophilic compound found in the herb rosemary. CA crosses the blood-brain-barrier to upregulate endogenous antioxidant enzymes via activation of the Nrf2 transcriptional pathway. We demonstrate that CA exerts neuroprotective effects on cyanide-induced brain damage in cultured rodent and human induced pluripotent stem cell (hiPSC)-derived neurons in vitro, and in vivo in various brain areas of a non-Swiss albino (NSA) mouse model of cyanide poisoning that simulates damage observed in the human brain. PMID:25692407

  11. The new "intermediate risk" group: a comparative analysis of the new 2013 ACC/AHA risk assessment guidelines versus prior guidelines in men.

    PubMed

    Blaha, Michael J; Dardari, Zeina A; Blumenthal, Roger S; Martin, Seth S; Nasir, Khurram; Al-Mallah, Mouaz H

    2014-11-01

    The 2013 ACC/AHA Report on the Assessment of Cardiovascular (CVD) Risk redefined "intermediate risk". We sought to critically compare the intermediate risk groups identified by prior guidelines and the new ACC/AHA guidelines. We analyzed data from 30,005 adult men free of known CVD from a large, multi-ethnic study of middle-aged adults. The Framingham Risk Score was calculated using published equations, and CVD risk was calculated using the new ACC/AHA Pooled Cohort Equations Risk Estimator. We first compared the size and characteristics of the intermediate risk group identified by the old (ATP III, 10-20% 10-year CHD risk) and new guidelines (5-7.4% 10-year CVD risk). We then defined time-to-high-risk as the length of time an individual patient resides in the intermediate risk group before progressing to high risk status based on advancing age alone. The mean age of the study population was 53 ± 13 years, and 24% were African-American. Patients identified as intermediate risk by the new ACC/AHA Guidelines were younger and more likely to be African-American and have lower risk factor burden (all p < 0.05). The new intermediate risk group was just 37% the size of the traditional ATP III intermediate risk group, while the new high risk group was 103% larger. Under the new guidelines, men remain intermediate risk for an average of just 3 years, compared to 8 years under the prior guidelines (63% shorter time-to-high-risk, p < 0.05), before progressing to high risk based on advancing age alone. The new 2013 ACC/AHA risk assessment guidelines produce a markedly smaller, lower absolute risk, and more temporary "intermediate risk" group. These findings reshape the modern understanding of "intermediate risk", and have distinct implications for risk assessment, clinical decision making, and pharmacotherapy in primary prevention. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  12. ACC/AHA guidelines superior to ESC/EAS guidelines for primary prevention with statins in non-diabetic Europeans: the Copenhagen General Population Study.

    PubMed

    Mortensen, Martin Bødtker; Nordestgaard, Børge G; Afzal, Shoaib; Falk, Erling

    2017-02-21

    We compared the 2013 American College of Cardiology/American Heart Association (ACC/AHA) and the 2016 European Society of Cardiology/European Atherosclerosis Society (ESC/EAS) guidelines on prevention of atherosclerotic cardiovascular disease (ASCVD) using different risk prediction models [US Pooled Cohort Equations (US-PCE for any ASCVD) and European Systematic COronary Risk Evaluation system (European-SCORE for fatal ASCVD)] and different statin eligibility criteria. We examined 44 889 individuals aged 40-75 recruited in 2003-09 in the Copenhagen General Population Study, all free of ASCVD, diabetes, and statin use at baseline. We detected 2217 any ASCVD events and 199 fatal ASCVD events through 2014. The predicted-to-observed event ratio was 1.2 using US-PCE for any ASCVD and 5.0 using European-SCORE for fatal ASCVD. The US-PCE, but not the European-SCORE, was well-calibrated around decision thresholds for statin therapy. For a Class I recommendation, 42% of individuals qualified for statins using the ACC/AHA guidelines vs. 6% with the ESC/EAS guidelines. Using ACC/AHA- vs. ESC/EAS-defined statin eligibility led to a substantial gain in sensitivity (+62% for any ASCVD and +76% for fatal ASCVD) with a smaller loss in specificity (-35% for any ASCVD and -36% for fatal ASCVD). Similar differences between the ACC/AHA and ESC/EAS guidelines were found for men and women separately, and for Class IIa recommendations. The sensitivity and specificity of a US-PCE risk of 5% were similar to those of a European-SCORE risk of 1.4%, whereas a US-PCE risk of 7.5% was similar to a European-SCORE risk of 2.4%. The ACC/AHA guidelines were superior to the ESC/EAS guidelines for primary prevention of ASCVD, that is, for accurately assigning statin therapy to those who would benefit. © The Author 2016. Published by Oxford University Press on behalf of the European Society of Cardiology

  13. ACC/AHA guidelines superior to ESC/EAS guidelines for primary prevention with statins in non-diabetic Europeans: the Copenhagen General Population Study

    PubMed Central

    Mortensen, Martin Bødtker; Nordestgaard, Børge G.; Afzal, Shoaib; Falk, Erling

    2017-01-01

    Abstract Aim We compared the 2013 American College of Cardiology/American Heart Association (ACC/AHA) and the 2016 European Society of Cardiology/European Atherosclerosis Society (ESC/EAS) guidelines on prevention of atherosclerotic cardiovascular disease (ASCVD) using different risk prediction models [US Pooled Cohort Equations (US-PCE for any ASCVD) and European Systematic COronary Risk Evaluation system (European-SCORE for fatal ASCVD)] and different statin eligibility criteria. Methods and results We examined 44 889 individuals aged 40–75 recruited in 2003–09 in the Copenhagen General Population Study, all free of ASCVD, diabetes, and statin use at baseline. We detected 2217 any ASCVD events and 199 fatal ASCVD events through 2014. The predicted-to-observed event ratio was 1.2 using US-PCE for any ASCVD and 5.0 using European-SCORE for fatal ASCVD. The US-PCE, but not the European-SCORE, was well-calibrated around decision thresholds for statin therapy. For a Class I recommendation, 42% of individuals qualified for statins using the ACC/AHA guidelines vs. 6% with the ESC/EAS guidelines. Using ACC/AHA- vs. ESC/EAS-defined statin eligibility led to a substantial gain in sensitivity (+62% for any ASCVD and +76% for fatal ASCVD) with a smaller loss in specificity (−35% for any ASCVD and −36% for fatal ASCVD). Similar differences between the ACC/AHA and ESC/EAS guidelines were found for men and women separately, and for Class IIa recommendations. The sensitivity and specificity of a US-PCE risk of 5% were similar to those of a European-SCORE risk of 1.4%, whereas a US-PCE risk of 7.5% was similar to a European-SCORE risk of 2.4%. Conclusions The ACC/AHA guidelines were superior to the ESC/EAS guidelines for primary prevention of ASCVD, that is, for accurately assigning statin therapy to those who would benefit. PMID:28363217

  14. Snake Venom L-Amino Acid Oxidases: Trends in Pharmacology and Biochemistry

    PubMed Central

    Izidoro, Luiz Fernando M.; Sobrinho, Juliana C.; Mendes, Mirian M.; Costa, Tássia R.; Grabner, Amy N.; Rodrigues, Veridiana M.; da Silva, Saulo L.; Zanchi, Fernando B.; Zuliani, Juliana P.; Fernandes, Carla F. C.; Calderon, Leonardo A.; Stábeli, Rodrigo G.; Soares, Andreimar M.

    2014-01-01

    L-amino acid oxidases are enzymes found in several organisms, including venoms of snakes, where they contribute to the toxicity of ophidian envenomation. Their toxicity is primarily due to enzymatic activity, but other mechanisms have been proposed recently which require further investigation. L-amino acid oxidases exert biological and pharmacological effects, including actions on platelet aggregation and the induction of apoptosis, hemorrhage, and cytotoxicity. These proteins present a high biotechnological potential for the development of antimicrobial, antitumor, and antiprotozoan agents. This review provides an overview of the biochemical properties and pharmacological effects of snake venom L-amino acid oxidases, their structure/activity relationship, and supposed mechanisms of action described so far. PMID:24738050

  15. NADPH Oxidase-Driven Phagocyte Recruitment Controls Candida albicans Filamentous Growth and Prevents Mortality

    PubMed Central

    Brothers, Kimberly M.; Gratacap, Remi L.; Barker, Sarah E.; Newman, Zachary R.; Norum, Ashley; Wheeler, Robert T.

    2013-01-01

    Candida albicans is a human commensal and clinically important fungal pathogen that grows as both yeast and hyphal forms during human, mouse and zebrafish infection. Reactive oxygen species (ROS) produced by NADPH oxidases play diverse roles in immunity, including their long-appreciated function as microbicidal oxidants. Here we demonstrate a non-traditional mechanistic role of NADPH oxidase in promoting phagocyte chemotaxis and intracellular containment of fungi to limit filamentous growth. We exploit the transparent zebrafish model to show that failed NADPH oxidase-dependent phagocyte recruitment to C. albicans in the first four hours post-infection permits fungi to germinate extracellularly and kill the host. We combine chemical and genetic tools with high-resolution time-lapse microscopy to implicate both phagocyte oxidase and dual-specific oxidase in recruitment, suggesting that both myeloid and non-myeloid cells promote chemotaxis. We show that early non-invasive imaging provides a robust tool for prognosis, strongly connecting effective early immune response with survival. Finally, we demonstrate a new role of a key regulator of the yeast-to-hyphal switching program in phagocyte-mediated containment, suggesting that there are species-specific methods for modulation of NADPH oxidase-independent immune responses. These novel links between ROS-driven chemotaxis and fungal dimorphism expand our view of a key host defense mechanism and have important implications for pathogenesis. PMID:24098114

  16. In vitro binding of Sorghum bicolor transcription factors ABI4 and ABI5 to a conserved region of a GA 2-OXIDASE promoter: possible role of this interaction in the expression of seed dormancy.

    PubMed

    Cantoro, Renata; Crocco, Carlos Daniel; Benech-Arnold, Roberto Luis; Rodríguez, María Verónica

    2013-12-01

    The precise adjustment of the timing of dormancy release according to final grain usage is still a challenge for many cereal crops. Grain sorghum [Sorghum bicolor (L.) Moench] shows wide intraspecific variability in dormancy level and susceptibility to pre-harvest sprouting (PHS). Both embryo sensitivity to abscisic acid (ABA) and gibberellin (GA) metabolism play an important role in the expression of dormancy of the developing sorghum grain. In previous works, it was shown that, simultaneously with a greater embryo sensitivity to ABA and higher expression of SbABA-INSENSITIVE 4 (SbABI4) and SbABA-INSENSITIVE 5 (SbABI5), dormant grains accumulate less active GA4 due to a more active GA catabolism. In this work, it is demonstrated that the ABA signalling components SbABI4 and SbABI5 interact in vitro with a fragment of the SbGA 2-OXIDASE 3 (SbGA2ox3) promoter containing an ABA-responsive complex (ABRC). Both transcription factors were able to bind the promoter, although not simultaneously, suggesting that they might compete for the same cis-acting regulatory sequences. A biological role for these interactions in the expression of dormancy of sorghum grains is proposed: either SbABI4 and/or SbABI5 activate transcription of the SbGA2ox3 gene in vivo and promote SbGA2ox3 protein accumulation; this would result in active degradation of GA4, thus preventing germination of dormant grains. A comparative analysis of the 5'-regulatory region of GA2oxs from both monocots and dicots is also presented; conservation of the ABRC in closely related GA2oxs from Brachypodium distachyon and rice suggest that these species might share the same regulatory mechanism as proposed for grain sorghum.

  17. Alternative oxidase: a respiratory electron transport chain pathway essential for maintaining photosynthetic performance during drought stress.

    PubMed

    Vanlerberghe, Greg C; Martyn, Greg D; Dahal, Keshav

    2016-07-01

    Photosynthesis and respiration are the hubs of energy metabolism in plants. Drought strongly perturbs photosynthesis as a result of both diffusive limitations resulting from stomatal closure, and in some cases biochemical limitations that are associated with a reduced abundance of key photosynthetic components. The effects of drought on respiration, particularly respiration in the light (RL ), are less understood. The plant mitochondrial electron transport chain includes a non-energy conserving terminal oxidase called alternative oxidase (AOX). Several studies have shown that drought increases AOX transcript, protein and maximum capacity. Here we review recent studies comparing wild-type (WT) tobacco to transgenic lines with altered AOX protein amount. Specifically during drought, RL was compromised in AOX knockdown plants and enhanced in AOX overexpression plants, compared with WT. Significantly, these differences in RL were accompanied by dramatic differences in photosynthetic performance. Knockdown of AOX increased the susceptibility of photosynthesis to drought-induced biochemical limitations, while overexpression of AOX delayed the development of such biochemical limitations, compared with WT. Overall, the results indicate that AOX is essential to maintaining RL during drought, and that this non-energy conserving respiration maintains photosynthesis during drought by promoting energy balance in the chloroplast. This review also outlines several areas for future research, including the possibility that enhancement of non-energy conserving respiratory electron sinks may be a useful biotechnological approach to increase plant performance during stress. © 2016 Scandinavian Plant Physiology Society.

  18. A Novel Colletotrichum graminicola Raffinose Oxidase in the AA5 Family

    PubMed Central

    Mollerup, Filip; Parikka, Kirsti; Koutaniemi, Sanna; Boer, Harry; Juvonen, Minna; Master, Emma; Tenkanen, Maija; Kruus, Kristiina

    2017-01-01

    ABSTRACT We describe here the identification and characterization of a copper radical oxidase from auxiliary activities family 5 (AA5_2) that was distinguished by showing preferential activity toward raffinose. Despite the biotechnological potential of carbohydrate oxidases from family AA5, very few members have been characterized. The gene encoding raffinose oxidase from Colletotrichum graminicola (CgRaOx; EC 1.1.3.−) was identified utilizing a bioinformatics approach based on the known modular structure of a characterized AA5_2 galactose oxidase. CgRaOx was expressed in Pichia pastoris, and the purified enzyme displayed the highest activity on the trisaccharide raffinose, whereas the activity on the disaccharide melibiose was three times lower and more than ten times lower activity was detected on d-galactose at a 300 mM substrate concentration. Thus, the substrate preference of CgRaOx was distinguished clearly from the substrate preferences of the known galactose oxidases. The site of oxidation for raffinose was studied by 1H nuclear magnetic resonance and mass spectrometry, and we confirmed that the hydroxyl group at the C-6 position was oxidized to an aldehyde and that in addition uronic acid was produced as a side product. A new electrospray ionization mass spectrometry method for the identification of C-6 oxidized products was developed, and the formation mechanism of the uronic acid was studied. CgRaOx presented a novel activity pattern in the AA5 family. IMPORTANCE Currently, there are only a few characterized members of the CAZy AA5 protein family. These enzymes are interesting from an application point of view because of their ability to utilize the cheap and abundant oxidant O2 without the requirement of complex cofactors such as FAD or NAD(P). Here, we present the identification and characterization of a novel AA5 member from Colletotrichum graminicola. As discussed in the present study, the bioinformatics approach using the modular structure of

  19. Comparison of Adherence to the 2013 ACC/AHA Cholesterol Guideline in a Teaching Versus Nonteaching Outpatient Clinic.

    PubMed

    Cheng-Lai, Angela; Snead, Jessica; Ng, Christina; Verges, Caroline; Chung, Philip

    2018-04-01

    Little information is available regarding prescribers' adherence rate to the 2013 American College of Cardiology (ACC)/American Heart Association (AHA) cholesterol guideline, especially that from a teaching versus a nonteaching setting. We aim to evaluate adherence rates to the 2013 ACC/AHA cholesterol guideline in a teaching versus a nonteaching practice site. In addition, the impact of a pharmacist-led seminar on adherence rate to the guideline was assessed. This study is a 2-part retrospective chart review. Part 1 consists of patients who were initiated on statin therapy between December 2013 and November 2014. Patients were analyzed to determine if they received concordant statin therapy as recommended by the guideline. For the second part, we evaluated the impact of a seminar on the adherence rate to the guideline. Of the 325 patients who received a statin prescription, 233 were included in the study. Prescriber adherence to the guideline was 42.9%, which was significantly lower than the 65.8% observed in a study previously conducted at a teaching outpatient clinic ( P < 0.0001). For the second part of our study, prescriber adherence to the guideline 3 months before the pharmacist-led seminar was 53.5%, and this adherence rate remained virtually unchanged at 54.2% at 3 months after the educational session. The overall adherence rate to the 2013 ACC/AHA cholesterol guideline from this nonteaching outpatient clinic was significantly lower than that previously observed in a teaching outpatient clinic. The single pharmacist-led seminar did not significantly affect prescribers' adherence rate to the guideline.

  20. Identification and expression analysis of a putative fatty acidbinding protein gene in the Asian honeybee, Apis cerana cerana.

    PubMed

    Yu, Xiaoli; Kang, Mingjiang; Liu, Li; Guo, Xingqi; Xu, Baohua

    2013-01-01

    Fatty acid-binding proteins (FABPs) play pivotal roles in cellular signaling, gene transcription, and lipid metabolism in vertebrates and invertebrates. In this study, a putative FABP gene, referred to as AccFABP, was isolated from the Asian honeybee, Apis cerana cerana Fabricius (Hymenoptera: Apidae). The full-length cDNA consisted of 725 bp, and encoded a protein of 204 amino acids. Homology and phylogenetic analysis indicated that AccFABP was a member of the FABP multifamily. The genomic structure of this gene, which was common among FABP multifamily members, spanned 1,900 bp, and included four exons and three introns. Gene expression analysis revealed that AccFABP was highly expressed in the dark-pigmented phase of pupal development, with peak expression observed in the fat bodies of the dark-pigmented phase pupae. The AccFABP transcripts in the fat body were upregulated by exposure to dietary fatty acids such as conjugated linoleic acid, docosahexaenoic acid, and arachidonic acid. Transcription factor binding sites for Caudal-Related Homeobox and functional CCAAT/enhancer binding site, which were respectively associated with tissue expression and lipid metabolism, were detected in the 5' promoter sequence. The evidence provided in the present study suggests that AccFABP may regulate insect growth and development, and lipid metabolism.

  1. Proposed structural basis of interaction of piperine and related compounds with monoamine oxidases.

    PubMed

    Rahman, Taufiq; Rahmatullah, Mohammed

    2010-01-15

    Several studies have revealed piperine and a few related compounds as potent inhibitors of monoamine oxidases without delineating the underlying mechanism. Using in silico modelling, we propose a structural basis of such activity by showing that these compounds can successfully dock into the inhibitor binding pockets of human monoamine oxidase isoforms with predicted affinities comparable to some known inhibitors. The results therefore suggest that piperine can be a promising lead for developing novel monoamine oxidase inhibitors. Copyright 2009 Elsevier Ltd. All rights reserved.

  2. Targeting NADPH oxidase decreases oxidative stress in the transgenic sickle cell mouse penis.

    PubMed

    Musicki, Biljana; Liu, Tongyun; Sezen, Sena F; Burnett, Arthur L

    2012-08-01

    Sickle cell disease (SCD) is a state of chronic vasculopathy characterized by endothelial dysfunction and increased oxidative stress, but the sources and mechanisms responsible for reactive oxygen species (ROS) production in the penis are unknown. We evaluated whether SCD activates NADPH oxidase, induces endothelial nitric oxide synthase (eNOS) uncoupling, and decreases antioxidants in the SCD mouse penis. We further tested the hypothesis that targeting NADPH oxidase decreases oxidative stress in the SCD mouse penis. SCD transgenic (sickle) mice were used as an animal model of SCD. Hemizygous (hemi) mice served as controls. Mice received an NADPH oxidase inhibitor apocynin (10 mM in drinking water) or vehicle. Penes were excised at baseline for molecular studies. Markers of oxidative stress (4-hydroxy-2-nonenal [HNE]), sources of ROS (eNOS uncoupling and NADPH oxidase subunits p67(phox) , p47(phox) , and gp91(phox) ), and enzymatic antioxidants (superoxide dismutase [SOD]1, SOD2, catalase, and glutathione peroxidase-1 [GPx1]) were measured by Western blot in penes. Sources of ROS, oxidative stress, and enzymatic antioxidants in the SCD penis. Relative to hemi mice, SCD increased (P<0.05) protein expression of NADPH oxidase subunits p67(phox) , p47(phox) , and gp91(phox) , 4-HNE-modified proteins, induced eNOS uncoupling, and reduced Gpx1 expression in the penis. Apocynin treatment of sickle mice reversed (P<0.05) the abnormalities in protein expressions of p47(phox) , gp91(phox) (but not p67(phox) ) and 4-HNE, but only slightly (P>0.05) prevented eNOS uncoupling in the penis. Apocynin treatment of hemi mice did not affect any of these parameters. NADPH oxidase and eNOS uncoupling are sources of oxidative stress in the SCD penis; decreased GPx1 further contributes to oxidative stress. Inhibition of NADPH oxidase upregulation decreases oxidative stress, implying a major role for NADPH oxidase as a ROS source and a potential target for improving vascular function in

  3. Targeting NADPH Oxidase Decreases Oxidative Stress in the Transgenic Sickle Cell Mouse Penis

    PubMed Central

    Musicki, Biljana; Liu, Tongyun; Sezen, Sena F.; Burnett, Arthur L.

    2012-01-01

    Introduction Sickle cell disease (SCD) is a state of chronic vasculopathy characterized by endothelial dysfunction and increased oxidative stress, but the sources and mechanisms responsible for reactive oxygen species (ROS) production in the penis are unknown. Aims We evaluated whether SCD activates NADPH oxidase, induces endothelial nitric oxide synthase (eNOS) uncoupling, and decreases antioxidants in the SCD mouse penis. We further tested the hypothesis that targeting NADPH oxidase decreases oxidative stress in the SCD mouse penis. Methods SCD transgenic (sickle) mice were used as an animal model of SCD. Hemizygous (hemi) mice served as controls. Mice received an NADPH oxidase inhibitor apocynin (10 mM in drinking water) or vehicle. Penes were excised at baseline for molecular studies. Markers of oxidative stress (4-hydroxy-2-nonenal [HNE]), sources of ROS (eNOS uncoupling and NADPH oxidase subunits p67phox, p47phox, and gp91phox), and enzymatic antioxidants (superoxide dismutase [SOD]1, SOD2, catalase, and glutathione peroxidase-1 [GPx1]) were measured by Western blot in penes. Main Outcome Measures Sources of ROS, oxidative stress, and enzymatic antioxidants in the SCD penis. Results Relative to hemi mice, SCD increased (P < 0.05) protein expression of NADPH oxidase subunits p67phox, p47phox, and gp91phox, 4-HNE-modified proteins, induced eNOS uncoupling, and reduced Gpx1 expression in the penis. Apocynin treatment of sickle mice reversed (P < 0.05) the abnormalities in protein expressions of p47phox, gp91phox (but not p67phox) and 4-HNE, but only slightly (P > 0.05) prevented eNOS uncoupling in the penis. Apocynin treatment of hemi mice did not affect any of these parameters. Conclusion NADPH oxidase and eNOS uncoupling are sources of oxidative stress in the SCD penis; decreased GPx1 further contributes to oxidative stress. Inhibition of NADPH oxidase upregulation decreases oxidative stress, implying a major role for NADPH oxidase as a ROS source and a

  4. 1-MCP EFFECTS ON ANTIOXIDANT ACTIVITY AND GENE EXPRESSION OF ACC-SYNTHASE AND ACC-OXIDASE IN COTTON FLOWERS

    USDA-ARS?s Scientific Manuscript database

    Cotton remains an important cash crop for farmers in the southern United States. When temperatures rise above 32oC the in vivo fertilization efficiency of cotton is reduced resulting in decreased seed production and potentially decreased yields. Under stress, the plant hormone ethylene is manufact...

  5. Multi-Copper Oxidases and Human Iron Metabolism

    PubMed Central

    Vashchenko, Ganna; MacGillivray, Ross T. A.

    2013-01-01

    Multi-copper oxidases (MCOs) are a small group of enzymes that oxidize their substrate with the concomitant reduction of dioxygen to two water molecules. Generally, multi-copper oxidases are promiscuous with regards to their reducing substrates and are capable of performing various functions in different species. To date, three multi-copper oxidases have been detected in humans—ceruloplasmin, hephaestin and zyklopen. Each of these enzymes has a high specificity towards iron with the resulting ferroxidase activity being associated with ferroportin, the only known iron exporter protein in humans. Ferroportin exports iron as Fe2+, but transferrin, the major iron transporter protein of blood, can bind only Fe3+ effectively. Iron oxidation in enterocytes is mediated mainly by hephaestin thus allowing dietary iron to enter the bloodstream. Zyklopen is involved in iron efflux from placental trophoblasts during iron transfer from mother to fetus. Release of iron from the liver relies on ferroportin and the ferroxidase activity of ceruloplasmin which is found in blood in a soluble form. Ceruloplasmin, hephaestin and zyklopen show distinctive expression patterns and have unique mechanisms for regulating their expression. These features of human multi-copper ferroxidases can serve as a basis for the precise control of iron efflux in different tissues. In this manuscript, we review the biochemical and biological properties of the three human MCOs and discuss their potential roles in human iron homeostasis. PMID:23807651

  6. Prenatal iron deficiency and monoamine oxidase A (MAOA) polymorphisms: combined risk for later cognitive performance in rhesus monkeys.

    PubMed

    Golub, Mari; Hogrefe, Casey

    2014-03-01

    Monoamine oxidase A (MAOA) gene polymorphisms resulting in high and low transcription rates are associated with individual differences in reward efficacy and response inhibition. Iron deficiency (ID) is the most frequent single-nutrient deficiency worldwide, and prenatal ID has recently been shown to carry a risk for lower mental development scores in infants. In this study, a potential interaction of MAOA genotype and prenatal ID was studied in young male rhesus monkeys. Cognitive tasks, including problem solving, responsiveness to reward and attention, were used to characterize the potential interaction of these two fetal risks. ID was induced by feeding rhesus monkey dams an iron-deficient (10 ppm, ID) or an iron-sufficient (100 ppm, IS) diet during gestation (n = 10/group). Subgroups of the ID and IS diet offspring had low-MAOA or high-MAOA transcription rate polymorphisms. ID combined with low-MAOA genotype showed distinctive effects on reward preference and problem solving while ID in hi-MAOA juveniles modified response inhibition. Given the incidence of ID and MAOA polymorphisms in humans, this interaction could be a significant determinant of cognitive performance.

  7. Function of the Pyruvate Oxidase-Lactate Oxidase Cascade in Interspecies Competition between Streptococcus oligofermentans and Streptococcus mutans

    PubMed Central

    Liu, Lei

    2012-01-01

    Complex interspecies interactions occur constantly between oral commensals and the opportunistic pathogen Streptococcus mutans in dental plaque. Previously, we showed that oral commensal Streptococcus oligofermentans possesses multiple enzymes for H2O2 production, especially lactate oxidase (Lox), allowing it to out-compete S. mutans. In this study, through extensive biochemical and genetic studies, we identified a pyruvate oxidase (pox) gene in S. oligofermentans. A pox deletion mutant completely lost Pox activity, while ectopically expressed pox restored activity. Pox was determined to produce most of the H2O2 in the earlier growth phase and log phase, while Lox mainly contributed to H2O2 production in stationary phase. Both pox and lox were expressed throughout the growth phase, while expression of the lox gene increased by about 2.5-fold when cells entered stationary phase. Since lactate accumulation occurred to a large degree in stationary phase, the differential Pox- and Lox-generated H2O2 can be attributed to differential gene expression and substrate availability. Interestingly, inactivation of pox causes a dramatic reduction in H2O2 production from lactate, suggesting a synergistic action of the two oxidases in converting lactate into H2O2. In an in vitro two-species biofilm experiment, the pox mutant of S. oligofermentans failed to inhibit S. mutans even though lox was active. In summary, S. oligofermentans develops a Pox-Lox synergy strategy to maximize its H2O2 formation so as to win the interspecies competition. PMID:22287002

  8. Expected impact of applying new 2013 AHA/ACC cholesterol guidelines criteria on the recommended lipid target achievement after acute coronary syndromes.

    PubMed

    Gencer, Baris; Auer, Reto; Nanchen, David; Räber, Lorenz; Klingenberg, Roland; Carballo, David; Blum, Manuel; Vogt, Pierre; Carballo, Sebastian; Meyer, Philippe; Matter, Christian M; Windecker, Stephan; Lüscher, Thomas F; Mach, François; Rodondi, Nicolas

    2015-03-01

    2013 AHA/ACC guidelines on the treatment of cholesterol advised to tailor high-intensity statin after ACS, while previous ATP-III recommended titration of statin to reach low-density lipoprotein cholesterol (LDL-C) targets. We simulated the impact of this change of paradigm on the achievement of recommended targets. Among a prospective cohort study of consecutive patients hospitalized for ACS from 2009 to 2012 at four Swiss university hospitals, we analyzed 1602 patients who survived one year after recruitment. Targets based on the previous guidelines approach was defined as (1) achievement of LDL-C target < 1.8 mmol/l, (2) reduction of LDL-C ≥ 50% or (3) intensification of statin in patients who did not reach LDL-C targets. Targets based on the 2013 AHA/ACC guidelines approach was defined as the maximization of statin therapy at high-intensity in patients aged ≤75 years and moderate- or high-intensity statin in patients >75 years. 1578 (99%) patients were prescribed statin at discharge, with 1120 (70%) at high-intensity. 1507 patients (94%) reported taking statin at one year, with 909 (57%) at high-intensity. Among 482 patients discharged with sub-maximal statin, intensification of statin was only observed in 109 patients (23%). 773 (47%) patients reached the previous LDL-C targets, while 1014 (63%) reached the 2013 AHA/ACC guidelines targetsone year after ACS (p value < 0.001). The application of the new 2013 AHA/ACC guidelines criteria would substantially increase the proportion of patients achieving recommended lipid targets one year after ACS. Clinical trial number, NCT01075868. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  9. Translational Identification of Transcriptional Signatures of Major Depression and Antidepressant Response

    PubMed Central

    Hervé, Mylène; Bergon, Aurélie; Le Guisquet, Anne-Marie; Leman, Samuel; Consoloni, Julia-Lou; Fernandez-Nunez, Nicolas; Lefebvre, Marie-Noëlle; El-Hage, Wissam; Belzeaux, Raoul; Belzung, Catherine; Ibrahim, El Chérif

    2017-01-01

    Major depressive disorder (MDD) is a highly prevalent mental illness whose therapy management remains uncertain, with more than 20% of patients who do not achieve response to antidepressants. Therefore, identification of reliable biomarkers to predict response to treatment will greatly improve MDD patient medical care. Due to the inaccessibility and lack of brain tissues from living MDD patients to study depression, researches using animal models have been useful in improving sensitivity and specificity of identifying biomarkers. In the current study, we used the unpredictable chronic mild stress (UCMS) model and correlated stress-induced depressive-like behavior (n = 8 unstressed vs. 8 stressed mice) as well as the fluoxetine-induced recovery (n = 8 stressed and fluoxetine-treated mice vs. 8 unstressed and fluoxetine-treated mice) with transcriptional signatures obtained by genome-wide microarray profiling from whole blood, dentate gyrus (DG), and the anterior cingulate cortex (ACC). Hierarchical clustering and rank-rank hypergeometric overlap (RRHO) procedures allowed us to identify gene transcripts with variations that correlate with behavioral profiles. As a translational validation, some of those transcripts were assayed by RT-qPCR with blood samples from 10 severe major depressive episode (MDE) patients and 10 healthy controls over the course of 30 weeks and four visits. Repeated-measures ANOVAs revealed candidate trait biomarkers (ARHGEF1, CMAS, IGHMBP2, PABPN1 and TBC1D10C), whereas univariate linear regression analyses uncovered candidates state biomarkers (CENPO, FUS and NUBP1), as well as prediction biomarkers predictive of antidepressant response (CENPO, NUBP1). These data suggest that such a translational approach may offer new leads for clinically valid panels of biomarkers for MDD. PMID:28848385

  10. Monoamine oxidase A gene promoter methylation and transcriptional downregulation in an offender population with antisocial personality disorder.

    PubMed

    Checknita, D; Maussion, G; Labonté, B; Comai, S; Tremblay, R E; Vitaro, F; Turecki, N; Bertazzo, A; Gobbi, G; Côté, G; Turecki, G

    2015-03-01

    Antisocial personality disorder (ASPD) is characterised by elevated impulsive aggression and increased risk for criminal behaviour and incarceration. Deficient activity of the monoamine oxidase A (MAOA) gene is suggested to contribute to serotonergic system dysregulation strongly associated with impulsive aggression and antisocial criminality. To elucidate the role of epigenetic processes in altered MAOA expression and serotonin regulation in a population of incarcerated offenders with ASPD compared with a healthy non-incarcerated control population. Participants were 86 incarcerated participants with ASPD and 73 healthy controls. MAOA promoter methylation was compared between case and control groups. We explored the functional impact of MAOA promoter methylation on gene expression in vitro and blood 5-HT levels in a subset of the case group. Results suggest that MAOA promoter hypermethylation is associated with ASPD and may contribute to downregulation of MAOA gene expression, as indicated by functional assays in vitro, and regression analysis with whole-blood serotonin levels in offenders with ASPD. These results are consistent with prior literature suggesting MAOA and serotonergic dysregulation in antisocial populations. Our results offer the first evidence suggesting epigenetic mechanisms may contribute to MAOA dysregulation in antisocial offenders. Royal College of Psychiatrists.

  11. The substrate oxidation mechanism of pyranose 2-oxidase and other related enzymes in the glucose-methanol-choline superfamily.

    PubMed

    Wongnate, Thanyaporn; Chaiyen, Pimchai

    2013-07-01

    Enzymes in the glucose-methanol-choline (GMC) oxidoreductase superfamily catalyze the oxidation of an alcohol moiety to the corresponding aldehyde. In this review, the current understanding of the sugar oxidation mechanism in the reaction of pyranose 2-oxidase (P2O) is highlighted and compared with that of other enzymes in the GMC family for which structural and mechanistic information is available, including glucose oxidase, choline oxidase, cholesterol oxidase, cellobiose dehydrogenase, aryl-alcohol oxidase, and pyridoxine 4-oxidase. Other enzymes in the family that have been newly discovered or for which less information is available are also discussed. A large primary kinetic isotope effect was observed for the flavin reduction when 2-d-D-glucose was used as a substrate, but no solvent kinetic isotope effect was detected for the flavin reduction step. The reaction of P2O is consistent with a hydride transfer mechanism in which there is stepwise formation of d-glucose alkoxide prior to the hydride transfer. Site-directed mutagenesis of P2O and pH-dependence studies indicated that His548 is a catalytic base that facilitates the deprotonation of C2-OH in D-glucose. This finding agrees with the current mechanistic model for aryl-alcohol oxidase, glucose oxidase, cellobiose dehydrogenase, methanol oxidase, and pyridoxine 4-oxidase, but is different from that of cholesterol oxidase and choline oxidase. Although all of the GMC enzymes share similar structural folding and use the hydride transfer mechanism for flavin reduction, they appear to have subtle differences in the fine-tuned details of how they catalyze substrate oxidation. © 2013 The Authors Journal compilation © 2013 FEBS.

  12. Direct comparison of gluco-oligosaccharide oxidase variants and glucose oxidase: substrate range and H2O2 stability.

    PubMed

    Vuong, Thu V; Foumani, Maryam; MacCormick, Benjamin; Kwan, Rachel; Master, Emma R

    2016-11-21

    Glucose oxidase (GO) activity is generally restricted to glucose and is susceptible to inactivation by H 2 O 2 . By comparison, the Y300A variant of gluco-oligosaccharide oxidase (GOOX) from Sarocladium strictum showed broader substrate range and higher H 2 O 2 stability. Specifically, Y300A exhibited up to 40 times higher activity on all tested sugars except glucose, compared to GO. Moreover, fusion of the Y300A variant to a family 22 carbohydrate binding module from Clostridium thermocellum (CtCBM22A) nearly doubled its catalytic efficiency on glucose, while retaining significant activity on oligosaccharides. In the presence of 200 mM of H 2 O 2 , the recombinant CtCBM22A_Y300A retained 80% of activity on glucose and 100% of activity on cellobiose, the preferred substrate for this enzyme. By contrast, a commercial glucose oxidase reported to contain ≤0.1 units catalase/ mg protein, retained 60% activity on glucose under the same conditions. GOOX variants appear to undergo a different mechanism of inactivation, as a loss of histidine instead of methionine was observed after H 2 O 2 incubation. The addition of CtCBM22A also promoted functional binding of the fusion enzyme to xylan, facilitating its simultaneous purification and immobilization using edible oat spelt xylan, which might benefit the usage of this enzyme preparation in food and baking applications.

  13. Size-selective QD@MOF core-shell nanocomposites for the highly sensitive monitoring of oxidase activities.

    PubMed

    Wang, Ke; Li, Nan; Zhang, Jing; Zhang, Zhiqi; Dang, Fuquan

    2017-01-15

    In this work, we proposed a novel and facile method to monitor oxidase activities based on size-selective fluorescent quantum dot (QD)@metal-organic framework (MOF) core-shell nanocomposites (CSNCPs). The CSNCPs were synthesized from ZIF-8 and CdTe QDs in aqueous solution in 40min at room temperature with stirring. The prepared CdTe@ZIF-8 CSNCPs , which have excellent water dispersibility and stability, displays distinct fluorescence responses to hole scavengers of different molecular sizes (e.g., H 2 O 2 , substrate, and oxidase) due to the aperture limitation of the ZIF-8 shell. H 2 O 2 can efficiently quench the fluorescence of CdTe@ZIF-8 CSNCPs over a linearity range of 1-100nM with a detection limit of 0.29nM, whereas large molecules such as substrate and oxidase have very little effect on its fluorescence. Therefore, the highly sensitive detection of oxidase activities was achieved by monitoring the fluorescence quenching of CdTe@ZIF-8 CSNCPs by H 2 O 2 produced in the presence of substrate and oxidase, which is proportional to the oxidase activities. The linearity ranges of the uricase and glucose oxidase activity are 0.1-50U/L and 1-100U/L, respectively, and their detection limits are 0.024U/L and 0.26U/L, respectively. Therefore, the current QD@MOF CSNCPs based sensing system is a promising, widely applicable means of monitoring oxidase activities in biochemical research. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. The influence of abscisic acid on the ethylene biosynthesis pathway in the functioning of the flower abscission zone in Lupinus luteus.

    PubMed

    Wilmowicz, Emilia; Frankowski, Kamil; Kućko, Agata; Świdziński, Michał; de Dios Alché, Juan; Nowakowska, Anna; Kopcewicz, Jan

    2016-11-01

    Flower abscission is a highly regulated developmental process activated in response to exogenous (e.g. changing environmental conditions) and endogenous stimuli (e.g. phytohormones). Ethylene (ET) and abscisic acid (ABA) are very effective stimulators of flower abortion in Lupinus luteus, which is a widely cultivated species in Poland, Australia and Mediterranean countries. In this paper, we show that artificial activation of abscission by flower removal caused an accumulation of ABA in the abscission zone (AZ). Moreover, the blocking of that phytohormone's biosynthesis by NDGA (nordihydroguaiaretic acid) decreased the number of abscised flowers. However, the application of NBD - an inhibitor of ET action - reversed the stimulatory effect of ABA on flower abscission, indicating that ABA itself is not sufficient to turn on the organ separation. Our analysis revealed that exogenous ABA significantly accelerated the transcriptional activity of the ET biosynthesis genes ACC synthase (LlACS) and oxidase (LlACO), and moreover, strongly increased the level of 1-aminocyclopropane-1-carboxylic acid (ACC) - ET precursor, which was specifically localized within AZ cells. We cannot exclude the possibility that ABA mediates flower abscission processes by enhancing the ET biosynthesis rate. The findings of our study will contribute to the overall basic knowledge on the phytohormone-regulated generative organs abscission in L. luteus. Copyright © 2016 Elsevier GmbH. All rights reserved.

  15. Involvement of NADPH oxidase isoforms in the production of O2− manipulated by ABA in the senescing leaves of early-senescence-leaf (esl) mutant rice (Oryza sativa)

    PubMed Central

    Wang, Fubiao; Zhao, Qian; Liu, Jianchao; Cheng, Fangmin

    2018-01-01

    In this study, the differences in reactive oxygen species (ROS) generation and abscisic acid (ABA) accumulation in senescing leaves were investigated by early-senescence-leaf (esl) mutant and its wild type, to clarify the relationship among ABA levels, ROS generation, and NADPH oxidase (Nox) in senescing leaves of rice (Oryza sativa). The temporal expression levels of OsNox isoforms in senescing leaves and their expression patterns in response to ABA treatment were determined through quantitative real-time reverse transcription PCR (qRT-PCR). Results showed that the flag leaf of the esl mutant generated more O2- concentrations and accumulated higher ABA levels than the wild-type cultivar did in the grain-filling stage. Exogenous ABA treatment induced O2- generation; however, it was depressed by diphenyleneiodonium chloride (DPI) pretreatment in the detached leaf segments. This finding suggested the involvement of NADPH oxidase in ABA-induced O2- generation. The esl mutant exhibited significantly higher expression of OsNox2, OsNox5, OsNox6, and OsNox7 in the initial of grain-filling stage, followed by sharply decrease. The transcriptional levels of OsNox1, OsNox3, and OsFR07 in the flag leaf of the esl mutant were significantly lower than those in the wild-type cultivar. The expression levels of OsNox2, OsNox5, OsNox6, and OsNox7 were significantly enhanced by exogenous ABA treatments. The enhanced expression levels of OsNox2 and OsNox6 were dependent on the duration of ABA treatment. The inducible expression levels of OsNox5 and OsNox7 were dependent on ABA concentrations. By contrast, exogenous ABA treatment severely repressed the transcripts of OsNox1, OsNox3, and OsFR07 in the detached leaf segments. Therefore, OsNox2, OsNox5, OsNox6, and OsNox7 were probably involved in the ABA-induced O2- generation in the initial stage of leaf senescence. Subsequently, other oxidases activated in deteriorating cells were associated with ROS generation and accumulation in the

  16. Impact of the New ACC/AHA Guidelines on the Treatment of High Blood Cholesterol in a Managed Care Setting.

    PubMed

    Tran, Josephine N; Caglar, Toros; Stockl, Karen M; Lew, Heidi C; Solow, Brian K; Chan, Paul S

    2014-11-01

    In November 2013, the American College of Cardiology (ACC) and the American Heart Association (AHA) together issued new guidelines for the treatment of patients with high cholesterol, providing a new paradigm for the management of cholesterol in the primary and secondary prevention of coronary artery disease. To examine the impact of the 2013 ACC/AHA cholesterol treatment guidelines on pharmacy utilization of cholesterol-lowering drugs in a real-world managed care setting. Pharmacy claims from OptumRx, a national pharmacy benefit management provider, for the period between January 1, 2013, and December 31, 2013 (baseline period), were used to identify candidates for cholesterol-lowering therapy and to estimate the number of potential patients who will be starting or intensifying statin therapy based on the updated cholesterol treatment guidelines. Potential candidates for cholesterol-lowering treatments included patients with diabetes or hypertension aged 40 to 75 years who were not already receiving a cholesterol-lowering medication, as well as patients receiving cholesterol-lowering therapies during the baseline period. The baseline cholesterol-lowering medication market share was used to project changes in pharmacy utilization over the next 3 years. Based on the 2013 ACC/AHA cholesterol treatment guidelines, there will be a 25% increase in the proportion of the overall population that is treated with statins over the next 3 years, increasing from 3,909,407 (27.7%) patients to 4,892,668 (34.7%) patients. The largest proportion of the increase in statin utilization is projected to be for primary prevention in patients aged 40 to 75 years who were not receiving any cholesterol-lowering treatment at baseline. These projected changes will increase the overall number of statin prescriptions by 25% and will decrease the number of nonstatin cholesterol-lowering medication prescriptions by 68% during the next 3 years. The new 2013 ACC/AHA cholesterol treatment guidelines

  17. Neovascularization in an arterio-venous loop-containing tissue engineering chamber: role of NADPH oxidase

    PubMed Central

    Jiang, F; Zhang, G; Hashimoto, I; Kumar, B S; Bortolotto, S; Morrison, W A; Dusting, G J

    2008-01-01

    Using an in vivo arterio-venous loop-containing tissue-engineering chamber, we have created a variety of vascularized tissue blocks, including functional myocardium. The viability of the transplanted cells is limited by the rate of neovascularization in the chamber. A Nox2-containing nicotinamide adenine dinucleotide phosphate (NADPH) oxidase is thought to have a critical role in ischaemic angiogenesis. In this study we investigated whether NADPH oxidase is involved in the neovascularization process in the tissue-engineering chamber. New blood vessels originating from the venous and the arterial ends of the loop could be identified after 3 days, and the vessel density (by lectin staining) peaked after 7 days and was maintained for at least 14 days. This was accompanied by granulation tissue formation and concomitant increase in the mRNA level of Nox4 NADPH oxidase. Although the total level of Nox2 mRNA in the chamber tissue decreased from day 3 to day 7, immunohistochemistry identified a strong expression of Nox2 in the endothelial cells of the new vessels. In human microvascular endothelial cells, the NADPH oxidase inhibitor apocynin reduced NADPH oxidase activity and inhibited the angiogenic responses in vitro. Local treatment with the NADPH oxidase inhibitors apocynin or gp91ds-tat peptide significantly suppressed the vessel growth in the chamber. In conclusion, NADPH oxidase-dependent redox signalling is important for neovascularization in this novel tissue-engineering chamber in vivo, and boosting this signalling might be a new approach to extending vascularization and tissue growth. PMID:19012731

  18. Recent advances in Parkinson's disease therapy: use of monoamine oxidase inhibitors.

    PubMed

    Henchcliffe, Claire; Schumacher, H Christian; Burgut, F Tuna

    2005-11-01

    Monoamine oxidase inhibitors inhibit dopamine metabolism and are therefore effective in treating Parkinson's disease, a condition associated with progressive striatal dopamine deficiency secondary to degeneration of dopaminergic neurons in the substantia nigra. Selegiline is currently the most widely used monoamine oxidase-B inhibitor for Parkinson's disease, but has a low and variable bioavailability, and is metabolized to L-methamphetamine and L-amphetamine that carry a risk for potential neurotoxicity. There are two new approaches that circumvent these potential disadvantages. First, selegiline orally disintegrating tablets provide a novel delivery form of selegiline, avoiding first pass metabolism by rapid absorption through the oral mucosa, thus leading to significantly lower plasma concentrations of L-metamphetamine and L-amphetamine. Selegiline orally disintegrating tablets prove to be clinically effective and safe in patients with moderately advanced Parkinson's disease. Second, rasagiline is a new monoamine oxidase inhibitor, without known neurotoxic metabolites. In large clinical trials, rasagiline proves effective as monotherapy in early Parkinson's disease, as well as adjunctive therapy to levodopa in advanced disease. Clinical data suggest, in addition, a disease-modifying effect of rasagiline that may correlate with neuroprotective activity of monoamine oxidase-B inhibitors in animal models of Parkinson's disease.

  19. Insights into proton translocation in cbb3 oxidase from MD simulations.

    PubMed

    Carvalheda, Catarina A; Pisliakov, Andrei V

    2017-05-01

    Heme-copper oxidases are membrane protein complexes that catalyse the final step of the aerobic respiration, namely the reduction of oxygen to water. The energy released during catalysis is coupled to the active translocation of protons across the membrane, which contributes to the establishment of an electrochemical gradient that is used for ATP synthesis. The distinctive C-type (or cbb 3 ) cytochrome c oxidases, which are mostly present in proteobacteria, exhibit a number of unique structural and functional features, including high catalytic activity at low oxygen concentrations. At the moment, the functioning mechanism of C-type oxidases, in particular the proton transfer/pumping mechanism presumably via a single proton channel, is still poorly understood. In this work we used all-atom molecular dynamics simulations and continuum electrostatics calculations to obtain atomic-level insights into the hydration and dynamics of a cbb 3 oxidase. We provide the details of the water dynamics and proton transfer pathways for both the "chemical" and "pumped" protons, and show that formation of protonic connections is strongly affected by the protonation state of key residues, namely H243, E323 and H337. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Inheritance of polyphenol oxidase activity in wheat breeding lines derived from matings of low polyphenol oxidase parents

    USDA-ARS?s Scientific Manuscript database

    Polyphenol oxidase (PPO) in grain plays a major role in time-dependent discoloration of wheat (Triticum aestivum L.) products, especially fresh noodles. Breeding wheat cultivars with low or nil PPO activity can reduce the undesirable product darkening. The low PPO line PI 117635 was crossed to two...

  1. NADPH Oxidase-Dependent Signaling in Endothelial Cells: Role in Physiology and Pathophysiology

    PubMed Central

    Ushio-Fukai, Masuko; Malik, Asrar B.

    2009-01-01

    Abstract Reactive oxygen species (ROS) including superoxide (O2·−) and hydrogen peroxide (H2O2) are produced endogenously in response to cytokines, growth factors; G-protein coupled receptors, and shear stress in endothelial cells (ECs). ROS function as signaling molecules to mediate various biological responses such as gene expression, cell proliferation, migration, angiogenesis, apoptosis, and senescence in ECs. Signal transduction activated by ROS, “oxidant signaling,” has received intense investigation. Excess amount of ROS contribute to various pathophysiologies, including endothelial dysfunction, atherosclerosis, hypertension, diabetes, and acute respiratory distress syndrome (ARDS). The major source of ROS in EC is a NADPH oxidase. The prototype phagaocytic NADPH oxidase is composed of membrane-bound gp91phox and p22hox, as well as cytosolic subunits such as p47phox, p67phox and small GTPase Rac. In ECs, in addition to all the components of phagocytic NADPH oxidases, homologues of gp91phox (Nox2) including Nox1, Nox4, and Nox5 are expressed. The aim of this review is to provide an overview of the emerging area of ROS derived from NADPH oxidase and oxidant signaling in ECs linked to physiological and pathophysiological functions. Understanding these mechanisms may provide insight into the NADPH oxidase and oxidant signaling components as potential therapeutic targets. Antioxid. Redox Signal. 11, 791–810. PMID:18783313

  2. Fish oil improves lipid profile in juvenile rats with intrauterine growth retardation by altering the transcriptional expression of lipid-related hepatic genes.

    PubMed

    Chen, Lian-Hui; Liang, Li; Fang, Yan-Lan; Wang, Ying-Min; Zhu, Wei-Fen

    2016-10-01

    To determine whether maternal intrauterine undernutrition and post-weaning fish oil intake influence lipid profile in juvenile offspring, and explore the possible mechanisms at transcriptional levels. After weaning, 32 control offspring and 24 intrauterine growth retardation (IUGR) offspring were randomly allocated to standard chow or fish oil diet. At 10 weeks, fasting plasma glucose, triglycerides, total cholesterol and expressions of related hepatic genes were examined. IUGR offspring without catch-up growth tended to develop hyperglycemia, dyslipidemia and hepatic steatosis. Down-regulation of CPT-1 and LDLR at transcriptional levels were found in IUGR offspring. Early short-term fish oil intervention reversed these unfavorable changes in juvenile rats with IUGR. The mechanisms might be mediated by decreased expression of ACC-1, increased expression of CPT-1, LDLR and ABCG5. These data suggest that IUGR offspring already present lipid abnormality in juvenile stage, and early short-term fish oil consumption is beneficial to prevent these unfavorable changes.

  3. Baseline Blood Pressure, the 2017 ACC/AHA High Blood Pressure Guidelines, and Long-Term Cardiovascular Risk in SPRINT.

    PubMed

    Vaduganathan, Muthiah; Pareek, Manan; Qamar, Arman; Pandey, Ambarish; Olsen, Michael H; Bhatt, Deepak L

    2018-02-05

    The 2017 American College of Cardiology (ACC)/American Heart Association (AHA) guidelines include lower thresholds to define hypertension than previous guidelines. Little is known about the impact of these guideline changes in patients with or at high risk for cardiovascular disease. In this exploratory analysis using baseline blood pressure assessments in Systolic Blood Pressure Intervention Trial (SPRINT), we evaluated the prevalence and associated cardiovascular prognosis of patients newly reclassified with hypertension based on the 2017 ACC/AHA (systolic blood pressure ≥130 mm Hg or diastolic blood pressure ≥80 mm Hg) compared with the Seventh Report of the Joint National Committee on Prevention, Detection, Evaluation and Treatment of High Blood Pressure (JNC 7) guidelines (systolic blood pressure ≥140 mm Hg or diastolic blood pressure ≥90 mm Hg). The primary endpoint was the composite of myocardial infarction, other acute coronary syndromes, stroke, heart failure, or cardiovascular death. In 4683 patients assigned to the standard treatment arm of SPRINT, 2328 (49.7%) met hypertension thresholds by JNC 7 guidelines, and another 1424 (30.4%) were newly reclassified as having hypertension based on the 2017 ACC/AHA guidelines. Over 3.3-year median follow-up, 319 patients experienced the primary endpoint (87 of whom were newly reclassified with hypertension based on the revised guidelines). Patients with hypertension based on prior guidelines compared with those newly identified with hypertension based on the new guidelines had similar risk of the primary endpoint (2.3 [95% confidence interval {CI}, 2.0-2.7] vs 2.0 [95% CI, 1.6-2.4] events per 100 patient-years; adjusted HR, 1.10 [95% CI, 0.84-1.44]; P = .48). The 2017 ACC/AHA high blood pressure guidelines are expected to significantly increase the prevalence of patients with hypertension (perhaps to a greater extent in higher-risk patient cohorts compared with the general population) and

  4. A Chemogenomic Screen Reveals Novel Snf1p/AMPK Independent Regulators of Acetyl-CoA Carboxylase.

    PubMed

    Bozaquel-Morais, Bruno L; Madeira, Juliana B; Venâncio, Thiago M; Pacheco-Rosa, Thiago; Masuda, Claudio A; Montero-Lomeli, Monica

    2017-01-01

    Acetyl-CoA carboxylase (Acc1p) is a key enzyme in fatty acid biosynthesis and is essential for cell viability. To discover new regulators of its activity, we screened a Saccharomyces cerevisiae deletion library for increased sensitivity to soraphen A, a potent Acc1p inhibitor. The hits identified in the screen (118 hits) were filtered using a chemical-phenotype map to exclude those associated with pleiotropic drug resistance. This enabled the identification of 82 ORFs that are genetic interactors of Acc1p. The main functional clusters represented by these hits were "transcriptional regulation", "protein post-translational modifications" and "lipid metabolism". Further investigation of the "transcriptional regulation" cluster revealed that soraphen A sensitivity is poorly correlated with ACC1 transcript levels. We also studied the three top unknown ORFs that affected soraphen A sensitivity: SOR1 (YDL129W), SOR2 (YIL092W) and SOR3 (YJR039W). Since the C18/C16 ratio of lipid acyl lengths reflects Acc1p activity levels, we evaluated this ratio in the three mutants. Deletion of SOR2 and SOR3 led to reduced acyl lengths, suggesting that Acc1p is indeed down-regulated in these strains. Also, these mutants showed no differences in Snf1p/AMPK activation status and deletion of SNF1 in these backgrounds did not revert soraphen A sensitivity completely. Furthermore, plasmid maintenance was reduced in sor2Δ strain and this trait was shared with 18 other soraphen A sensitive hits. In summary, our screen uncovered novel Acc1p Snf1p/AMPK-independent regulators.

  5. Impact of SO(2) on Arabidopsis thaliana transcriptome in wildtype and sulfite oxidase knockout plants analyzed by RNA deep sequencing.

    PubMed

    Hamisch, Domenica; Randewig, Dörte; Schliesky, Simon; Bräutigam, Andrea; Weber, Andreas P M; Geffers, Robert; Herschbach, Cornelia; Rennenberg, Heinz; Mendel, Ralf R; Hänsch, Robert

    2012-12-01

    High concentrations of sulfur dioxide (SO(2) ) as an air pollutant, and its derivative sulfite, cause abiotic stress that can lead to cell death. It is currently unknown to what extent plant fumigation triggers specific transcriptional responses. To address this question, and to test the hypothesis that sulfite oxidase (SO) is acting in SO(2) detoxification, we compared Arabidopsis wildtype (WT) and SO knockout lines (SO-KO) facing the impact of 600 nl l(-1) SO(2) , using RNAseq to quantify absolute transcript abundances. These transcriptome data were correlated to sulfur metabolism-related enzyme activities and metabolites obtained from identical samples in a previous study. SO-KO plants exhibited remarkable and broad regulative responses at the mRNA level, especially in transcripts related to sulfur metabolism enzymes, but also in those related to stress response and senescence. Focusing on SO regulation, no alterations were detectable in the WT, whereas in SO-KO plants we found up-regulation of two splice variants of the SO gene, although this gene is not functional in this line. Our data provide evidence for the highly specific coregulation between SO and sulfur-related enzymes like APS reductase, and suggest two novel candidates for involvement in SO(2) detoxification: an apoplastic peroxidase, and defensins as putative cysteine mass storages. © 2012 The Authors. New Phytologist © 2012 New Phytologist Trust.

  6. Increased xanthine oxidase during labour--implications for oxidative stress.

    PubMed

    Many, A; Roberts, J M

    1997-11-01

    Xanthine dehydrogenase/oxidase (XDH/XO) produces uric acid. When in the oxidase form, this production is coupled with the generation of free radicals. Hypoxia-reperfusion enhances conversion of XDH to XO. Since the placenta is exposed to short periods of hypoxia reperfusion during labour, 17 placentae of pregnancy terminated by elective caesarean section and five placentae of pregnancies terminated by caesarean section during labour were examined for XDH/XO activity. It was found that XO activity was higher in the placentae of labouring women (P = 0.003), which suggests that labour enhances conversion of XDH to XO, facilitating free radical production.

  7. A Conserved Steroid Binding Site in Cytochrome c Oxidase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Qin, Ling; Mills, Denise A.; Buhrow, Leann

    2010-09-02

    Micromolar concentrations of the bile salt deoxycholate are shown to rescue the activity of an inactive mutant, E101A, in the K proton pathway of Rhodobacter sphaeroides cytochrome c oxidase. A crystal structure of the wild-type enzyme reveals, as predicted, deoxycholate bound with its carboxyl group at the entrance of the K path. Since cholate is a known potent inhibitor of bovine oxidase and is seen in a similar position in the bovine structure, the crystallographically defined, conserved steroid binding site could reveal a regulatory site for steroids or structurally related molecules that act on the essential K proton path.

  8. Production of a new D-amino acid oxidase from the fungus Fusarium oxysporum.

    PubMed

    Gabler, M; Fischer, L

    1999-08-01

    The fungus Fusarium oxysporum produced a D-amino acid oxidase (EC 1. 4.3.3) in a medium containing glucose as the carbon and energy source and ammonium sulfate as the nitrogen source. The specific D-amino acid oxidase activity was increased up to 12.5-fold with various D-amino acids or their corresponding derivatives as inducers. The best inducers were D-alanine (2.7 microkat/g of dry biomass) and D-3-aminobutyric acid (2.6 microkat/g of dry biomass). The addition of zinc ions was necessary to permit the induction of peroxisomal D-amino acid oxidase. Bioreactor cultivations were performed on a 50-liter scale, yielding a volumetric D-amino acid oxidase activity of 17 microkat liter(-1) with D-alanine as an inducer. Under oxygen limitation, the volumetric activity was increased threefold to 54 microkat liter(-1) (3,240 U liter(-1)).

  9. Implications of the 2013 ACC/AHA cholesterol guidelines on contemporary clinical practice for patients with atherosclerotic coronary and peripheral arterial disease.

    PubMed

    Gunasekaran, Prasad; Jeevanantham, Vinodh; Sharma, Suresh; Thapa, Rashmi; Gupta, Kamal

    Cholesterol management guidelines from the American College of Cardiology/American Heart Association (ACC/AHA-2013) recommend fixed statin dosing (dose depends on age ≤ or >75years) compared to the earlier adult treatment panel III (ATPIII) guidelines which recommended specific low-density lipoprotein-cholesterol (LDL-C) targets. Clinical implications of this recommendation are not known. We retrospectively compared cholesterol levels and statin utilization across cohorts with coronary artery disease (CAD) (n=9563), peripheral arterial disease (PAD) (n=596) and CAD+PAD (n=975) by applying both guidelines. The percentage of patients who achieved guideline-specific targets using 2013 ACC/AHA (use of moderate/high intensity statins) or ATPIII guidelines (LDL-C<100mg/dl) was compared between all groups. Using both guidelines, the PAD only group demonstrated lower utilization and lower statin doses than the CAD or CAD+PAD groups. When applying the ACC/AHA guidelines, more patients in the CAD only group (age ≤75 years) were considered at goal as compared to the ATPIII guidelines (92.2% vs. 75%), primarily driven by the group placed on moderate/high intensity statins but had an LDL-C level >100mg/dl. Application of the ACC/AHA guidelines results in a higher percentage of patients considered to be 'at goal' when compared to the ATP III guidelines without changes in clinical practice. This is due to patients ≤75 years old on adequate statin doses but still have LDL-C levels >100mg/dl, thereby raising concerns that physicians may not pursue alternate LDL reduction strategies since they are now considered at goal despite LDL-C >100mg/dl. Lipid management of PAD patients remains sub-optimal as compared to CAD and CAD+PAD. Copyright © 2017. Published by Elsevier B.V.

  10. Decreased Integrity, Content, and Increased Transcript Level of Mitochondrial DNA Are Associated with Keratoconus

    PubMed Central

    Hao, Xiao-Dan; Chen, Zhao-Li; Qu, Ming-Li; Zhao, Xiao-Wen; Li, Su-Xia; Chen, Peng

    2016-01-01

    Oxidative stress may play an important role in the pathogenesis of keratoconus (KC). Mitochondrial DNA (mtDNA) is involved in mitochondrial function, and the mtDNA content, integrity, and transcript level may affect the generation of reactive oxygen species (ROS) and be involved in the pathogenesis of KC. We designed a case-control study to research the relationship between KC and mtDNA integrity, content and transcription. One-hundred ninety-eight KC corneas and 106 normal corneas from Chinese patients were studied. Quantitative real-time PCR was used to measure the relative mtDNA content, transcript levels of mtDNA and related genes. Long-extension PCR was used to detect mtDNA damage. ROS, mitochondrial membrane potential and ATP were measured by respective assay kit, and Mito-Tracker Green was used to label the mitochondria. The relative mtDNA content of KC corneas was significantly lower than that of normal corneas (P = 9.19×10−24), possibly due to decreased expression of the mitochondrial transcription factor A (TFAM) gene (P = 3.26×10−3). In contrast, the transcript levels of mtDNA genes were significantly increased in KC corneas compared with normal corneas (NADH dehydrogenase subunit 1 [ND1]: P = 1.79×10−3; cytochrome c oxidase subunit 1 [COX1]: P = 1.54×10−3; NADH dehydrogenase subunit 1, [ND6]: P = 4.62×10−3). The latter may be the result of increased expression levels of mtDNA transcription-related genes mitochondrial RNA polymerase (POLRMT) (P = 2.55×10−4) and transcription factor B2 mitochondrial (TFB2M) (P = 7.88×10−5). KC corneas also had increased mtDNA damage (P = 3.63×10−10), higher ROS levels, and lower mitochondrial membrane potential and ATP levels compared with normal corneas. Decreased integrity, content and increased transcript level of mtDNA are associated with KC. These changes may affect the generation of ROS and play a role in the pathogenesis of KC. PMID:27783701

  11. Reconstituted high-density lipoprotein suppresses leukocyte NADPH oxidase activation by disrupting lipid rafts.

    PubMed

    Peshavariya, Hitesh; Dusting, Gregory J; Di Bartolo, Belinda; Rye, Kerry-Anne; Barter, Philip J; Jiang, Fan

    2009-08-01

    Reconstituted discoidal high-density lipoprotein (rHDL) has potent vascular protective actions. Native HDL suppresses cellular generation of reactive oxygen species, whereas this antioxidant effect of rHDL is less clear. This study examined the effects of rHDL on NADPH oxidase, a major source of cellular superoxide generation, in both leukocytes and human umbilical vein endothelial cells. Superoxide was measured with lucigenin-enhanced chemiluminescence. Expression of NADPH oxidase sub-units was determined by real-time PCR. Pre-treatment of HL-60 cells with rHDL (10 and 25 microM) for 1 h significantly reduced phorbol 12-myristate 13-acetate-stimulated superoxide production. Treatment with rHDL for up to 24 h did not change the mRNA expression of NADPH oxidase sub-units. In HL-60 cells, depletion of cholesterol from the plasma membrane by methyl-beta-cyclodextrin mimicked the effect of rHDL, whereas cholesterol repletion blunted the effects of rHDL. Treatment with rHDL induced disruption of the lipid raft structures and blunted PMA-induced redistribution of p47phox into lipid rafts. In contrast, treatment of endothelial cells with rHDL for up to 18 h had no effect on either basal or tumour necrosis factor-alpha-stimulated NADPH oxidase activity, but markedly suppressed the cytokine-induced expression of proinflammatory adhesion molecules. The results suggest that rHDL inhibits NADPH oxidase activation in leukocytes, probably by interrupting the assembly of NADPH oxidase sub-units at the lipid rafts. This effect may contribute to the vascular protective actions of rHDL against inflammation-mediated oxidative damage.

  12. Modeling the adsorption of metal ions (Cu 2+, Ni 2+, Pb 2+) onto ACCs using surface complexation models

    NASA Astrophysics Data System (ADS)

    Faur-Brasquet, Catherine; Reddad, Zacaria; Kadirvelu, Krishna; Le Cloirec, Pierre

    2002-08-01

    Activated carbon cloths (ACCs), whose efficiency has been demonstrated for microorganics adsorption from water, were here studied in the removal of metal ions from aqueous solution. Two ACCs are investigated, they are characterized in terms of porosity parameters (BET specific surface area, percentage of microporosity) and chemical characteristics (acidic surface groups, acidity constants, point of zero charge). A first part consists in the experimental study of three metal ions removal (Cu 2+, Ni 2+ and Pb 2+) in a batch reactor. Isotherms modeling by Freundlich and Brunauer-Emmett-Teller (BET) equations enables the following adsorption order: Cu 2+>Ni 2+>Pb 2+ to be determined for adsorption capacities on a molar basis. It may be related to adsorbates characteristics in terms of electronegativity and ionic radius. The influence of adsorbent's microporosity is also shown. Adsorption experiments carried out for pH values ranging from 2 to 10 demonstrate: (i) an adsorption occurring below the precipitation pH; (ii) the strong influence of pH, with a decrease of electrostatic repulsion due to the formation of less charged hydrolyzed species coupled with a decrease of activated carbon surface charge as pH increases. The second part focuses on the modeling of adsorption versus the pH experimental data by the diffuse layer model (DLM) using Fiteql software. The model is efficient to describe the system behavior in the pH range considered. Regarding complexation constants, they show the following affinity for ACC: Pb 2+>Cu 2+>Ni 2+. They are related to initial concentrations used for the three metal ions.

  13. Neuropsychological correlates of transcription factor AP-2Beta, and its interaction with COMT and MAOA in healthy females.

    PubMed

    Schabram, Ina; Eggermann, Thomas; Siegel, Steven J; Gründer, Gerhard; Zerres, Klaus; Vernaleken, Ingo

    2013-01-01

    The transcription factor AP-2β has been shown to impact clinical and neuropsychological properties. Apparently, it regulates the transcription of genes that code for molecules which are part of the catecholaminergic transmission system. This investigation focuses on possible effects of the transcription factor AP-2β intron 2 polymorphism on cognitive performance parameters. This hypothesis-driven investigation examined the effects and interactions of the transcription factor AP-2β intron 2 polymorphism, the Val158Met catechol-O-methyltransferase (COMT) polymorphism, and the variable number of tandem repeat polymorphism of monoamine oxidase A (MAOA) on cognitive performance parameters within a group of 200 healthy women (age: mean ± SD, 23.93 ± 3.33 years). The AP-2β polymorphism significantly influenced cognitive performance (in particular, the Trail Making Test part B), whereas the MAOA and COMT polymorphisms did not. However, there was an interaction effect of the AP-2β × MAOA × COMT genotypes on the decision bias β of the degraded-stimulus version of the continuous performance task. Only the Val158Met COMT polymorphism showed an influence on personality questionnaires (openness and self-transcendence; NEO Five-Factor Inventory, Temperament and Character Inventory). The transcription factor AP-2β intron 2 polymorphism had more influence on cognition than the MAOA and COMT polymorphisms. Possibly, the AP-2β genotype might influence cognition through pathways other than those that regulate MAOA and COMT transcription. Interactions of transcription factor AP-2β, COMT, and MAOA polymorphisms suggest higher leverage effects of transcription factor AP-2β in subjects with high dopamine availability. Copyright © 2013 S. Karger AG, Basel.

  14. Importance of the alternative oxidase (AOX) pathway in regulating cellular redox and ROS homeostasis to optimize photosynthesis during restriction of the cytochrome oxidase pathway in Arabidopsis thaliana

    PubMed Central

    Vishwakarma, Abhaypratap; Tetali, Sarada Devi; Selinski, Jennifer; Scheibe, Renate; Padmasree, Kollipara

    2015-01-01

    Background and Aims The importance of the alternative oxidase (AOX) pathway, particularly AOX1A, in optimizing photosynthesis during de-etiolation, under elevated CO2, low temperature, high light or combined light and drought stress is well documented. In the present study, the role of AOX1A in optimizing photosynthesis was investigated when electron transport through the cytochrome c oxidase (COX) pathway was restricted at complex III. Methods Leaf discs of wild-type (WT) and aox1a knock-out mutants of Arabidopsis thaliana were treated with antimycin A (AA) under growth-light conditions. To identify the impact of AOX1A deficiency in optimizing photosynthesis, respiratory O2 uptake and photosynthesis-related parameters were measured along with changes in redox couples, reactive oxygen species (ROS), lipid peroxidation and expression levels of genes related to respiration, the malate valve and the antioxidative system. Key Results In the absence of AA, aox1a knock-out mutants did not show any difference in physiological, biochemical or molecular parameters compared with WT. However, after AA treatment, aox1a plants showed a significant reduction in both respiratory O2 uptake and NaHCO3-dependent O2 evolution. Chlorophyll fluorescence and P700 studies revealed that in contrast to WT, aox1a knock-out plants were incapable of maintaining electron flow in the chloroplastic electron transport chain, and thereby inefficient heat dissipation (low non-photochemical quenching) was observed. Furthermore, aox1a mutants exhibited significant disturbances in cellular redox couples of NAD(P)H and ascorbate (Asc) and consequently accumulation of ROS and malondialdehyde (MDA) content. By contrast, WT plants showed a significant increase in transcript levels of CSD1, CAT1, sAPX, COX15 and AOX1A in contrast to aox1a mutants. Conclusions These results suggest that AOX1A plays a significant role in sustaining the chloroplastic redox state and energization to optimize photosynthesis by

  15. An updated patent review: xanthine oxidase inhibitors for the treatment of hyperuricemia and gout (2011-2015).

    PubMed

    Ojha, Ritu; Singh, Jagjeet; Ojha, Anu; Singh, Harbinder; Sharma, Sahil; Nepali, Kunal

    2017-03-01

    Xanthine oxidase (XO) is a versatile molybdoflavoprotein, widely distributed, occurring in milk, kidney, lung, heart, and vascular endothelium. Catalysis by XO to produce uric acid and reactive oxygen species leads to many diseases. Anti hyperuricemic therapy by xanthine oxidase inhibitors has been mainly employed for the treatment of gout. Area covered: This review covers the patent literature (2011-2015) and also presents the interesting strategies/rational approaches employed for the design of xanthine oxidase inhibitors reported recently. Expert opinion: Recent literature indicates that various non purine scaffolds have been extensively investigated for xanthine oxidase inhibition. The significant potential endowed by heteroaryl based compounds, in particularly fused heterocycles clearly highlights their clinical promise and the need for detailed investigation. Studies by various research groups have also revealed that the flavone framework is open for isosteric replacements and structural modifications for yielding potent non purine xanthine oxidase inhibitors. In addition, various plant extracts recently reported to possess significant xanthine oxidase inhibitory potential presents enough promise to initiate a screening program for the identification of other plant extracts and phytoconstituents possessing inhibitory potential towards the enzyme.

  16. NADPH Oxidase versus Mitochondria-Derived ROS in Glucose-Induced Apoptosis of Pericytes in Early Diabetic Retinopathy

    PubMed Central

    Mustapha, Nik M.; Tarr, Joanna M.; Kohner, Eva M.; Chibber, Rakesh

    2010-01-01

    Objectives. Using apocynin (inhibitor of NADPH oxidase), and Mitoquinol 10 nitrate (MitoQ; mitochondrial-targeted antioxidant), we addressed the importance of mitochondria versus NADPH oxidase-derived ROS in glucose-induced apoptosis of pericytes. Methods. NADPH oxidase was localised using Western blot analysis and cytochrome C reduction assay. Apoptosis was detected by measuring caspase-3 activity. Intracellular glucose concentration, ROS formation and Nε-(carboxymethyl) lysine (CML) content were measured using Amplex Red assay kit, dihydroethidium (DHE), and competitive immunoabsorbant enzyme-linked assay (ELISA), respectively. Results. NADPH oxidase was localised in the cytoplasm of pericytes suggesting ROS production within intracellular compartments. High glucose (25 mM) significantly increased apoptosis, intracellular glucose concentration, and CML content. Apoptosis was associated with increased gp91phox expression, activity of NADPH oxidase, and intracellular ROS production. Apocynin and not MitoQ significantly blunted the generation of ROS, formation of intracellular CML and apoptosis. Conclusions. NADPH oxidase and not mitochondria-derived ROS is responsible for the accelerated apoptosis of pericytes in diabetic retinopathy. PMID:20652059

  17. Genetics Home Reference: isolated sulfite oxidase deficiency

    MedlinePlus

    ... Metabolic Disorders (CLIMB) March of Dimes: Amino Acid Metabolism Disorders The Compassionate Friends GeneReviews (1 link) Isolated Sulfite Oxidase Deficiency ClinicalTrials.gov (1 link) ClinicalTrials.gov Scientific Articles on PubMed (1 link) PubMed OMIM (1 link) ...

  18. Purification, characterization and amino acid content of cholesterol oxidase produced by Streptomyces aegyptia NEAE 102.

    PubMed

    El-Naggar, Noura El-Ahmady; Deraz, Sahar F; Soliman, Hoda M; El-Deeb, Nehal M; El-Shweihy, Nancy M

    2017-03-29

    There is an increasing demand on cholesterol oxidase for its various industrial and clinical applications. The current research was focused on extracellular cholesterol oxidase production under submerged fermentation by a local isolate previously identified as Streptomyces aegyptia NEAE 102. The crude enzyme extract was purified by two purification steps, protein precipitation using ammonium sulfate followed by ion exchange chromatography using DEAE Sepharose CL-6B. The kinetic parameters of purified cholesterol oxidase from Streptomyces aegyptia NEAE 102 were studied. The best conditions for maximum cholesterol oxidase activity were found to be 105 min of incubation time, an initial pH of 7 and temperature of 37 °C. The optimum substrate concentration was found to be 0.4 mM. The higher thermal stability behavior of cholesterol oxidase was at 50 °C. Around 63.86% of the initial activity was retained by the enzyme after 20 min of incubation at 50 °C. The apparent molecular weight of the purified enzyme as sized by sodium dodecyl sulphate-polyacryalamide gel electrophoresis was approximately 46 KDa. On DEAE Sepharose CL-6B column cholesterol oxidase was purified to homogeneity with final specific activity of 16.08 U/mg protein and 3.14-fold enhancement. The amino acid analysis of the purified enzyme produced by Streptomyces aegyptia NEAE 102 illustrated that, cholesterol oxidase is composed of 361 residues with glutamic acid as the most represented amino acid with concentration of 11.49 μg/mL. Taking into account the extracellular production, wide pH tolerance, thermal stability and shelf life, cholesterol oxidase produced by Streptomyces aegyptia NEAE 102 suggested that the enzyme could be industrially useful.

  19. Support for a history-dependent predictive model of dACC activity in producing the bivalency effect: an event-related potential study.

    PubMed

    Grundy, John G; Shedden, Judith M

    2014-05-01

    In the present study, we examine electrophysiological correlates of factors influencing an adjustment in cognitive control known as the bivalency effect. During task-switching, the occasional presence of bivalent stimuli in a block of univalent trials is enough to elicit a response slowing on all subsequent univalent trials. Bivalent stimuli can be congruent or incongruent with respect to the response afforded by the irrelevant stimulus feature. Here we show that the incongruent bivalency effect, the congruent bivalency effect, and an effect of a simple violation of expectancy are captured at a frontal ERP component (between 300 and 550ms) associated with ACC activity, and that the unexpectedness effect is distinguished from both congruent and incongruent bivalency effects at an earlier component (100-120ms) associated with the temporal parietal junction. We suggest that the frontal component reflects the dACC's role in predicting future cognitive load based on recent history. In contrast, the posterior component may index early visual feature extraction in response to bivalent stimuli that cue currently ongoing tasks; dACC activity may trigger the temporal parietal activity only when specific task cueing is involved and not for simple violations of expectancy. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. Interactions between the R2R3-MYB Transcription Factor, AtMYB61, and Target DNA Binding Sites

    PubMed Central

    Prouse, Michael B.; Campbell, Malcolm M.

    2013-01-01

    Despite the prominent roles played by R2R3-MYB transcription factors in the regulation of plant gene expression, little is known about the details of how these proteins interact with their DNA targets. For example, while Arabidopsis thaliana R2R3-MYB protein AtMYB61 is known to alter transcript abundance of a specific set of target genes, little is known about the specific DNA sequences to which AtMYB61 binds. To address this gap in knowledge, DNA sequences bound by AtMYB61 were identified using cyclic amplification and selection of targets (CASTing). The DNA targets identified using this approach corresponded to AC elements, sequences enriched in adenosine and cytosine nucleotides. The preferred target sequence that bound with the greatest affinity to AtMYB61 recombinant protein was ACCTAC, the AC-I element. Mutational analyses based on the AC-I element showed that ACC nucleotides in the AC-I element served as the core recognition motif, critical for AtMYB61 binding. Molecular modelling predicted interactions between AtMYB61 amino acid residues and corresponding nucleotides in the DNA targets. The affinity between AtMYB61 and specific target DNA sequences did not correlate with AtMYB61-driven transcriptional activation with each of the target sequences. CASTing-selected motifs were found in the regulatory regions of genes previously shown to be regulated by AtMYB61. Taken together, these findings are consistent with the hypothesis that AtMYB61 regulates transcription from specific cis-acting AC elements in vivo. The results shed light on the specifics of DNA binding by an important family of plant-specific transcriptional regulators. PMID:23741471

  1. KDM1A triggers androgen-induced miRNA transcription via H3K4me2 demethylation and DNA oxidation.

    PubMed

    Yang, Shu; Zhang, Jiyuan; Zhang, Yalong; Wan, Xuechao; Zhang, Congzhe; Huang, Xiaohui; Huang, Wenhua; Pu, Honglei; Pei, Chaohan; Wu, Hai; Huang, Yan; Huang, Shengdong; Li, Yao

    2015-06-15

    Androgen receptor (AR) is a ligand dependent transcription factor that regulates the transcription of target genes. AR activity is closely involved in the maintenance and progression of prostate cancer. After the binding with androgen, AR moves into nucleus and binds to DNA sequence containing androgen response elements (ARE). Flavin-dependent monoamine oxidase KDM1A is necessary for AR driven transcription while the mechanism remains unclear. The association between androgen-dependent transcription and oxidation was tested through pharmaceutical inhibitions and siRNA knockdown of DNA oxidation repair components in prostate cancer cells. The recruitment of involved proteins and the histone methylation dynamics on ARE region was explored by chromatin immunoprecipitation (ChIP). Oxidation inhibition reduced AR dependent expression of KLK3, TMPRSS2, hsa-miR-125b2, and hsa-miR-133b. And such reduction could be restored by H2 O2 treatment. KDM1A recruitment and H3K4me2 demethylation on ARE regions, which produce H2 O2 , are associated with AR targets transcription. AR targets transcription and coupled oxidation recruit 8-oxoguanine-DNA glycosylase (OGG1) and the nuclease APEX1 to ARE regions. Such recruitment depends on KDM1A, and is necessary for AR targets transcription. Our work underlined the importance of histone demethylation and DNA oxidation/repairing machinery in androgen-dependent transcription. The present finds have implications for research into new druggable targets for prostate cancer relying on the cascade of AR activity regulation. © 2015 Wiley Periodicals, Inc.

  2. Comparison of statin eligibility according to the Adult Treatment Panel III, ACC/AHA blood cholesterol guideline, and presence of carotid plaque by ultrasound in Mexican mestizo patients with rheumatoid arthritis.

    PubMed

    Galarza-Delgado, Dionicio A; Azpiri-Lopez, Jose R; Colunga-Pedraza, Iris J; Cardenas-de la Garza, Jesus A; Vera-Pineda, Raymundo; Garcia-Colunga, Judith I; Arvizu-Rivera, Rosa I; Martinez-Moreno, Adrian; Villarreal-Perez, Jesus Z; Elizondo-Riojas, Guillermo; Garza Elizondo, Mario A

    2016-11-01

    Atherosclerotic cardiovascular disease (ASCVD) is the leading cause of death in rheumatoid arthritis (RA) patients. Guidelines of the American College of Cardiology and the American Heart Association (ACC/AHA) 2013 and the Adult Treatment Panel III (ATP-III) differ in their strategies to recommend initiation of statin therapy. The presence of carotid plaque (CP) by carotid ultrasound is an indication to begin statin therapy. We aimed to compare the recommendation to initiate statin therapy according to the ACC/AHA 2013 guidelines, ATP-III guidelines, and CP by carotid ultrasound. We then carried out an observational, cross-sectional study of 62 statin-naive Mexican mestizo RA patients, aged 40 to 75, who fulfilled the 1987 or 2010 ACR/European League Against Rheumatism (EULAR) classification criteria. CP was evaluated with B-mode ultrasound. Cohen's kappa (k) was used to assess agreement between ACC/AHA 2013 guidelines, ATP-III guidelines, and the presence of CP, considering a p < 0.05 as statistically significant. Agreement was classified as slight (0.01-0.20), fair (0.21-0.40), moderate (0.41-0.60), substantial (0.61-0.80), and an almost perfect agreement (0.81-1.00). Slight agreement (k = 0.096) was found when comparing statin recommendation between CP and ATP-III. Fair agreement (k = 0.242) was revealed between ACC/AHA 2013 and ATP-III. Comparison between ACC/AHA 2013 and CP showed moderate agreement (k = 0.438). ACC/AHA 2013 guidelines could be an adequate and cost-effective tool to evaluate the need of statin therapy in Mexican mestizo RA patients, with moderate agreement with the presence of CP by ultrasound.

  3. PKC delta and NADPH oxidase in retinoic acid-induced neuroblastoma cell differentiation.

    PubMed

    Nitti, Mariapaola; Furfaro, Anna Lisa; Cevasco, Claudia; Traverso, Nicola; Marinari, Umberto Maria; Pronzato, Maria Adelaide; Domenicotti, Cinzia

    2010-05-01

    The role of reactive oxygen species (ROS) in the regulation of signal transduction processes has been well established in many cell types and recently the fine tuning of redox signalling in neurons received increasing attention. With regard to this, the involvement of NADPH oxidase (NOX) in neuronal pathophysiology has been proposed but deserves more investigation. In the present study, we used SH-SY5Y neuroblastoma cells to analyse the role of NADPH oxidase in retinoic acid (RA)-induced differentiation, pointing out the involvement of protein kinase C (PKC) delta in the activation of NOX. Retinoic acid induces neuronal differentiation as revealed by the increased expression of MAP2, the decreased cell doubling rate, and the gain in neuronal morphological features and these events are accompanied by the increased expression level of PKC delta and p67(phox), one of the components of NADPH oxidase. Using DPI to inhibit NOX activity we show that retinoic acid acts through this enzyme to induce morphological changes linked to the differentiation. Moreover, using rottlerin to inhibit PKC delta or transfection experiments to overexpress it, we show that retinoic acid acts through this enzyme to induce MAP2 expression and to increase p67(phox) membrane translocation leading to NADPH oxidase activation. These findings identify the activation of PKC delta and NADPH oxidase as crucial steps in RA-induced neuroblastoma cell differentiation. 2010 Elsevier Inc. All rights reserved.

  4. Structural insights into electron transfer in caa3-type cytochrome oxidase

    PubMed Central

    Lyons, Joseph A.; Aragão, David; Slattery, Orla; Pisliakov, Andrei V.; Soulimane, Tewfik; Caffrey, Martin

    2012-01-01

    Summary Paragraph Cytochrome c oxidase is a member of the heme copper oxidase superfamily (HCO)1. HCOs function as the terminal enzymes in the respiratory chain of mitochondria and aerobic prokaryotes, coupling molecular oxygen reduction to transmembrane proton pumping. Integral to the enzyme’s function is the transfer of electrons from cytochrome c to the oxidase via a transient association of the two proteins. Electron entry and exit are proposed to occur from the same site on cytochrome c2–4. Here we report the crystal structure of the caa3-type cytochrome oxidase from Thermus thermophilus, which has a covalently tethered cytochrome c domain. Crystals were grown in a bicontinuous mesophase using a synthetic short-chain monoacylglycerol as the hosting lipid. From the electron density map, at 2.36 Å resolution, a novel integral membrane subunit and a native glycoglycerophospholipid embedded in the complex were identified. Contrary to previous electron transfer mechanisms observed for soluble cytochrome c, the structure reveals the architecture of the electron transfer complex for the fused cupredoxin/cytochrome c domain which implicates different sites on cytochrome c for electron entry and exit. Support for an alternative to the classical proton gate characteristic of this HCO class is presented. PMID:22763450

  5. Regulation of Wheat Seed Dormancy by After-Ripening Is Mediated by Specific Transcriptional Switches That Induce Changes in Seed Hormone Metabolism and Signaling

    PubMed Central

    Kanno, Yuri; Jordan, Mark C.; Kamiya, Yuji; Seo, Mitsunori; Ayele, Belay T.

    2013-01-01

    Treatments that promote dormancy release are often correlated with changes in seed hormone content and/or sensitivity. To understand the molecular mechanisms underlying the role of after-ripening (seed dry storage) in triggering hormone related changes and dormancy decay in wheat (Triticum aestivum), temporal expression patterns of genes related to abscisic acid (ABA), gibberellin (GA), jasmonate and indole acetic acid (IAA) metabolism and signaling, and levels of the respective hormones were examined in dormant and after-ripened seeds in both dry and imbibed states. After-ripening mediated developmental switch from dormancy to germination appears to be associated with declines in seed sensitivity to ABA and IAA, which are mediated by transcriptional repressions of PROTEIN PHOSPHATASE 2C, SNF1-RELATED PROTEIN KINASE2, ABA INSENSITIVE5 and LIPID PHOSPHATE PHOSPHTASE2, and AUXIN RESPONSE FACTOR and RELATED TO UBIQUITIN1 genes. Transcriptomic analysis of wheat seed responsiveness to ABA suggests that ABA inhibits the germination of wheat seeds partly by repressing the transcription of genes related to chromatin assembly and cell wall modification, and activating that of GA catabolic genes. After-ripening induced seed dormancy decay in wheat is also associated with the modulation of seed IAA and jasmonate contents. Transcriptional control of members of the ALLENE OXIDE SYNTHASE, 3-KETOACYL COENZYME A THIOLASE, LIPOXYGENASE and 12-OXOPHYTODIENOATE REDUCTASE gene families appears to regulate seed jasmonate levels. Changes in the expression of GA biosynthesis genes, GA 20-OXIDASE and GA 3-OXIDASE, in response to after-ripening implicate this hormone in enhancing dormancy release and germination. These findings have important implications in the dissection of molecular mechanisms underlying regulation of seed dormancy in cereals. PMID:23437172

  6. Monoamine oxidase A mediates prostate tumorigenesis and cancer metastasis

    PubMed Central

    Wu, Jason Boyang; Shao, Chen; Li, Xiangyan; Li, Qinlong; Hu, Peizhen; Shi, Changhong; Li, Yang; Chen, Yi-Ting; Yin, Fei; Liao, Chun-Peng; Stiles, Bangyan L.; Zhau, Haiyen E.; Shih, Jean C.; Chung, Leland W.K.

    2014-01-01

    Tumors from patients with high-grade aggressive prostate cancer (PCa) exhibit increased expression of monoamine oxidase A (MAOA), a mitochondrial enzyme that degrades monoamine neurotransmitters and dietary amines. Despite the association between MAOA and aggressive PCa, it is unclear how MAOA promotes PCa progression. Here, we found that MAOA functions to induce epithelial-to-mesenchymal transition (EMT) and stabilize the transcription factor HIF1α, which mediates hypoxia through an elevation of ROS, thus enhancing growth, invasiveness, and metastasis of PCa cells. Knockdown and overexpression of MAOA in human PCa cell lines indicated that MAOA induces EMT through activation of VEGF and its coreceptor neuropilin-1. MAOA-dependent activation of neuropilin-1 promoted AKT/FOXO1/TWIST1 signaling, allowing FOXO1 binding at the TWIST1 promoter. Importantly, the MAOA-dependent HIF1α/VEGF-A/FOXO1/TWIST1 pathway was activated in high-grade PCa specimens, and knockdown of MAOA reduced or even eliminated prostate tumor growth and metastasis in PCa xenograft mouse models. Pharmacological inhibition of MAOA activity also reduced PCa xenograft growth in mice. Moreover, high MAOA expression in PCa tissues correlated with worse clinical outcomes in PCa patients. These findings collectively characterize the contribution of MAOA in PCa pathogenesis and suggest that MAOA has potential as a therapeutic target in PCa. PMID:24865426

  7. Monoamine oxidase A mediates prostate tumorigenesis and cancer metastasis.

    PubMed

    Wu, Jason Boyang; Shao, Chen; Li, Xiangyan; Li, Qinlong; Hu, Peizhen; Shi, Changhong; Li, Yang; Chen, Yi-Ting; Yin, Fei; Liao, Chun-Peng; Stiles, Bangyan L; Zhau, Haiyen E; Shih, Jean C; Chung, Leland W K

    2014-07-01

    Tumors from patients with high-grade aggressive prostate cancer (PCa) exhibit increased expression of monoamine oxidase A (MAOA), a mitochondrial enzyme that degrades monoamine neurotransmitters and dietary amines. Despite the association between MAOA and aggressive PCa, it is unclear how MAOA promotes PCa progression. Here, we found that MAOA functions to induce epithelial-to-mesenchymal transition (EMT) and stabilize the transcription factor HIF1α, which mediates hypoxia through an elevation of ROS, thus enhancing growth, invasiveness, and metastasis of PCa cells. Knockdown and overexpression of MAOA in human PCa cell lines indicated that MAOA induces EMT through activation of VEGF and its coreceptor neuropilin-1. MAOA-dependent activation of neuropilin-1 promoted AKT/FOXO1/TWIST1 signaling, allowing FOXO1 binding at the TWIST1 promoter. Importantly, the MAOA-dependent HIF1α/VEGF-A/FOXO1/TWIST1 pathway was activated in high-grade PCa specimens, and knockdown of MAOA reduced or even eliminated prostate tumor growth and metastasis in PCa xenograft mouse models. Pharmacological inhibition of MAOA activity also reduced PCa xenograft growth in mice. Moreover, high MAOA expression in PCa tissues correlated with worse clinical outcomes in PCa patients. These findings collectively characterize the contribution of MAOA in PCa pathogenesis and suggest that MAOA has potential as a therapeutic target in PCa.

  8. Crystal Structures of Intermediates in the Nitroalkane Oxidase Reaction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Heroux, A.; Bozinovski, D; Valley, M

    2009-01-01

    The flavoenzyme nitroalkane oxidase is a member of the acyl-CoA dehydrogenase superfamily. Nitroalkane oxidase catalyzes the oxidation of neutral nitroalkanes to nitrite and the corresponding aldehydes or ketones. Crystal structures to 2.2 {angstrom} resolution or better of enzyme complexes with bound substrates and of a trapped substrate-flavin adduct are described. The D402N enzyme has no detectable activity with neutral nitroalkanes. The structure of the D402N enzyme crystallized in the presence of 1-nitrohexane or 1-nitrooctane shows the presence of the substrate in the binding site. The aliphatic chain of the substrate extends into a tunnel leading to the enzyme surface. Themore » oxygens of the substrate nitro group interact both with amino acid residues and with the 2'-hydroxyl of the FAD. When nitroalkane oxidase oxidizes nitroalkanes in the presence of cyanide, an electrophilic flavin imine intermediate can be trapped (Valley, M. P., Tichy, S. E., and Fitzpatrick, P. F. (2005) J. Am. Chem. Soc. 127, 2062-2066). The structure of the enzyme trapped with cyanide during oxidation of 1-nitrohexane shows the presence of the modified flavin. A continuous hydrogen bond network connects the nitrogen of the CN-hexyl-FAD through the FAD 2'-hydroxyl to a chain of water molecules extending to the protein surface. Together, our complementary approaches provide strong evidence that the flavin cofactor is in the appropriate oxidation state and correlates well with the putative intermediate state observed within each of the crystal structures. Consequently, these results provide important structural descriptions of several steps along the nitroalkane oxidase reaction cycle.« less

  9. A gene encoding the plant-like alternative oxidase is present in Phytomonas but absent in Leishmania spp.

    PubMed

    Van Hellemond, J J; Simons, B; Millenaar, F F; Tielens, A G

    1998-01-01

    The constituents of the respiratory chain are believed to differ among the trypanosomatids; bloodstream stages of African trypanosomes and Phytomonas promastigotes oxidize ubiquinol by a ubiquinol:oxygen oxidoreductase, also known as alternative oxidase, whereas Leishmania spp. oxidize ubiquinol via a classic cytochrome-containing respiratory chain. The molecular basis for this elementary difference in ubiquinol oxidation by the mitochondrial electron-transport chain in distinct trypanosomatids was investigated. The presence of a gene encoding the plant-like alternative oxidase could be demonstrated in Phytomonas and Trypanosoma brucei, trypanosomatids that are known to contain alternative oxidase activity. Our results further demonstrated that Leishmania spp. lack a gene encoding the plant-like alternative oxidase, and therefore, all stages of Leishmania spp. will lack the alternative oxidase protein. The observed fundamental differences between the respiratory chains of distinct members of the trypanosomatid family are thus caused by the presence or absence of a gene encoding the plant-like alternative oxidase.

  10. Androgen receptor and monoamine oxidase polymorphism in wild bonobos

    PubMed Central

    Garai, Cintia; Furuichi, Takeshi; Kawamoto, Yoshi; Ryu, Heungjin; Inoue-Murayama, Miho

    2014-01-01

    Androgen receptor gene (AR), monoamine oxidase A gene (MAOA) and monoamine oxidase B gene (MAOB) have been found to have associations with behavioral traits, such as aggressiveness, and disorders in humans. However, the extent to which similar genetic effects might influence the behavior of wild apes is unclear. We examined the loci AR glutamine repeat (ARQ), AR glycine repeat (ARG), MAOA intron 2 dinucleotide repeat (MAin2) and MAOB intron 2 dinucleotide repeat (MBin2) in 32 wild bonobos, Pan paniscus, and compared them with those of chimpanzees, Pan troglodytes, and humans. We found that bonobos were polymorphic on the four loci examined. Both loci MAin2 and MBin2 in bonobos showed a higher diversity than in chimpanzees. Because monoamine oxidase influences aggressiveness, the differences between the polymorphisms of MAin2 and MBin2 in bonobos and chimpanzees may be associated with the differences in aggression between the two species. In order to understand the evolution of these loci and AR, MAOA and MAOB in humans and non-human primates, it would be useful to conduct future studies focusing on the potential association between aggressiveness, and other personality traits, and polymorphisms documented in bonobos. PMID:25606465

  11. Ultrafine carbon particles promote rotenone-induced dopamine neuronal loss through activating microglial NADPH oxidase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Yinxi; Liu, Dan; Zhang, Huifeng

    Background: Atmospheric ultrafine particles (UFPs) and pesticide rotenone were considered as potential environmental risk factors for Parkinson's disease (PD). However, whether and how UFPs alone and in combination with rotenone affect the pathogenesis of PD remains largely unknown. Methods: Ultrafine carbon black (ufCB, a surrogate of UFPs) and rotenone were used individually or in combination to determine their roles in chronic dopaminergic (DA) loss in neuron-glia, and neuron-enriched, mix-glia cultures. Immunochemistry using antibody against tyrosine hydroxylase was performed to detect DA neuronal loss. Measurement of extracellular superoxide and intracellular reactive oxygen species (ROS) were performed to examine activation of NADPHmore » oxidase. Genetic deletion and pharmacological inhibition of NADPH oxidase and MAC-1 receptor in microglia were employed to examine their role in DA neuronal loss triggered by ufCB and rotenone. Results: In rodent midbrain neuron-glia cultures, ufCB and rotenone alone caused neuronal death in a dose-dependent manner. In particularly, ufCB at doses of 50 and 100 μg/cm{sup 2} induced significant loss of DA neurons. More importantly, nontoxic doses of ufCB (10 μg/cm{sup 2}) and rotenone (2 nM) induced synergistic toxicity to DA neurons. Microglial activation was essential in this process. Furthermore, superoxide production from microglial NADPH oxidase was critical in ufCB/rotenone-induced neurotoxicity. Studies in mix-glia cultures showed that ufCB treatment activated microglial NADPH oxidase to induce superoxide production. Firstly, ufCB enhanced the expression of NADPH oxidase subunits (gp91{sup phox}, p47{sup phox} and p40{sup phox}); secondly, ufCB was recognized by microglial surface MAC-1 receptor and consequently promoted rotenone-induced p47{sup phox} and p67{sup phox} translocation assembling active NADPH oxidase. Conclusion: ufCB and rotenone worked in synergy to activate NADPH oxidase in microglia, leading to

  12. Analysis of cellulase and polyphenol oxidase production by southern pine beetle associated fungi

    Treesearch

    Abduvali Valiev; Zumrut B. Ogel; Dier D. Klepzig

    2009-01-01

    In this study, the production of extracellular enzymes by fungi associated with southern pine beetle was investigated for the first time. Cellulase and polyphenol oxidase production were analyzed for three beetle associated fungi. Only the mutualistic symbiont Entomocorticium sp. A was found to produce cellulases and polyphenol oxidase....

  13. Inhibition of the NADPH oxidase regulates HO-1 expression in chronic myeloid leukemia

    PubMed Central

    Singh, Melissa M.; Irwin, Mary E.; Gao, Yin; Ban, Kechen; Shi, Ping; Arlinghaus, Ralph B.; Amin, Hesham M.; Chandra, Joya

    2011-01-01

    Background Patients with blast crisis phase chronic myelogeneous leukemia (CML) have poor response to tyrosine kinase inhibitors designed to inhibit the BCR-ABL1 oncogene. Recent work has shown that heme oxygenase 1 (HO-1) expression is increased in BCR-ABL1 expressing cells and that inhibition of HO-1 in CML leads to reduced cellular growth suggesting HO-1 may be a plausible target for therapy. Here we sought to clarify the mechanism of HO-1 overexpression and the role of the NADPH oxidase as a contributor to this mechanism in CML. Methods HO-1 expression was evaluated in CML bone marrow specimens from patients in various stages of disease, in a transplant based model for CML and in CML cell lines. Chemical and genetic inhibition of the NADPH oxidase was carried out in CML cells. Results Blast crisis CML patient specimens displayed higher levels of HO-1 staining than chronic or accelerated phase. HO-1 upregulation in BCR-ABL1 expressing cells was suppressed by diphenyliodonium (DPI), a chemical inhibitor of the NADPH oxidase. Targeting the NADPH oxidase through RNAi to Rac1, a dominant negative Rac1 construct or an inhibitor of Rac1 activity also blunted HO-1 protein expression. Moreover, inhibition of the NADPH oxidase by RNAi directed towards p47phox similarly abrogated HO-1 levels. Conclusion BCR-ABL1 expression upregulates HO-1, a survival factor for CML cells. This upregulation is more pronounced in blast crisis CML relative to early stage disease and is mediated by the NADPH oxidase components Rac1 and p47phox. Expression of p47phox is increased in BCR-ABL1 expressing cells. PMID:22139798

  14. Stepwise Hydrogen Atom and Proton Transfers in Dioxygen Reduction by Aryl-Alcohol Oxidase.

    PubMed

    Carro, Juan; Ferreira, Patricia; Martínez, Angel T; Gadda, Giovanni

    2018-03-20

    The mechanism of dioxygen reduction by the flavoenzyme aryl-alcohol oxidase was investigated with kinetic isotope, viscosity, and pL (pH/pD) effects in rapid kinetics experiments by stopped-flow spectrophotometry of the oxidative half-reaction of the enzyme. Double mixing of the enzyme in a stopped-flow spectrophotometer with [α- 2 H 2 ]- p-methoxybenzyl alcohol and oxygen at varying aging times established a slow rate constant of 0.0023 s -1 for the wash-out of the D atom from the N5 atom of the reduced flavin. Thus, the deuterated substrate could be used to probe the cleavage of the N-H bond of the reduced flavin in the oxidative half-reaction. A significant and pH-independent substrate kinetic isotope effect (KIE) of 1.5 between pH 5.0 and 8.0 demonstrated that H transfer is partially limiting the oxidative half-reaction of the enzyme; a negligible solvent KIE of 1.0 between pD 5.0 and 8.0 proved a fast H + transfer reaction that does not contribute to determining the flavin oxidation rates. Thus, a mechanism for dioxygen reduction in which the H atom originating from the reduced flavin and a H + from a solvent exchangeable site are transferred in separate kinetic steps is proposed. The spectroscopic and kinetic data presented also showed a lack of stabilization of transient flavin intermediates. The substantial differences in the mechanistic details of O 2 reduction by aryl-alcohol oxidase with respect to other alcohol oxidases like choline oxidase, pyranose 2-oxidase, and glucose oxidase further demonstrate the high level of versatility of the flavin cofactor in flavoenzymes.

  15. Functional Assembly of Soluble and Membrane Recombinant Proteins of Mammalian NADPH Oxidase Complex.

    PubMed

    Souabni, Hajer; Ezzine, Aymen; Bizouarn, Tania; Baciou, Laura

    2017-01-01

    Activation of phagocyte cells from an innate immune system is associated with a massive consumption of molecular oxygen to generate highly reactive oxygen species (ROS) as microbial weapons. This is achieved by a multiprotein complex, the so-called NADPH oxidase. The activity of phagocyte NADPH oxidase relies on an assembly of more than five proteins, among them the membrane heterodimer named flavocytochrome b 558 (Cytb 558 ), constituted by the tight association of the gp91 phox (also named Nox2) and p22 phox proteins. The Cytb 558 is the membrane catalytic core of the NADPH oxidase complex, through which the reducing equivalent provided by NADPH is transferred via the associated prosthetic groups (one flavin and two hemes) to reduce dioxygen into superoxide anion. The other major proteins (p47 phox , p67 phox , p40 phox , Rac) requisite for the complex activity are cytosolic proteins. Thus, the NADPH oxidase functioning relies on a synergic multi-partner assembly that in vivo can be hardly studied at the molecular level due to the cell complexity. Thus, a cell-free assay method has been developed to study the NADPH oxidase activity that allows measuring and eventually quantifying the ROS generation based on optical techniques following reduction of cytochrome c. This setup is a valuable tool for the identification of protein interactions, of crucial components and additives for a functional enzyme. Recently, this method was improved by the engineering and the production of a complete recombinant NADPH oxidase complex using the combination of purified proteins expressed in bacterial and yeast host cells. The reconstitution into artificial membrane leads to a fully controllable system that permits fine functional studies.

  16. NADPH oxidases in the arbuscular mycorrhizal symbiosis.

    PubMed

    Belmondo, Simone; Calcagno, Cristina; Genre, Andrea; Puppo, Alain; Pauly, Nicolas; Lanfranco, Luisa

    2016-01-01

    Plant NADPH oxidases are the major source of reactive oxygen species (ROS) that plays key roles as both signal and stressor in several plant processes, including defense responses against pathogens. ROS accumulation in root cells during arbuscular mycorrhiza (AM) development has raised the interest in understanding how ROS-mediated defense programs are modulated during the establishment of this mutualistic interaction. We have recently analyzed the expression pattern of 5 NADPH oxidase (also called RBOH) encoding genes in Medicago truncatula, showing that only one of them (MtRbohE) is specifically upregulated in arbuscule-containing cells. In line with this result, RNAi silencing of MtRbohE generated a strong alteration in root colonization, with a significant reduction in the number of arbusculated cells. On this basis, we propose that MtRBOHE-mediated ROS production plays a crucial role in the intracellular accommodation of arbuscules.

  17. NADPH oxidases in the arbuscular mycorrhizal symbiosis

    PubMed Central

    Belmondo, Simone; Calcagno, Cristina; Genre, Andrea; Puppo, Alain; Pauly, Nicolas; Lanfranco, Luisa

    2016-01-01

    ABSTRACT Plant NADPH oxidases are the major source of reactive oxygen species (ROS) that plays key roles as both signal and stressor in several plant processes, including defense responses against pathogens. ROS accumulation in root cells during arbuscular mycorrhiza (AM) development has raised the interest in understanding how ROS-mediated defense programs are modulated during the establishment of this mutualistic interaction. We have recently analyzed the expression pattern of 5 NADPH oxidase (also called RBOH) encoding genes in Medicago truncatula, showing that only one of them (MtRbohE) is specifically upregulated in arbuscule-containing cells. In line with this result, RNAi silencing of MtRbohE generated a strong alteration in root colonization, with a significant reduction in the number of arbusculated cells. On this basis, we propose that MtRBOHE-mediated ROS production plays a crucial role in the intracellular accommodation of arbuscules. PMID:27018627

  18. Xanthine oxidase biosensor for monitoring meat spoilage

    NASA Astrophysics Data System (ADS)

    Vanegas, D. C.; Gomes, C.; McLamore, E. S.

    2014-05-01

    In this study, we have designed an electrochemical biosensor for real-time detection of specific biomarkers of bacterial metabolism related to meat spoilage (hypoxanthine and xanthine). The selective biosensor was developed by assembling a `sandwich' of nanomaterials and enzymes on a platinum-iridium electrode (1.6 mm tip diameter). The materials deposited on the sensor tip include amorphous platinum nanoclusters (i.e. Pt black), reduced graphene oxide, nanoceria, and xanthine oxidase. Xanthine oxidase was encapsulated in laponite hydrogel and used for the biorecognition of hypoxanthine and xanthine (two molecules involved in the rotting of meat by spoilage microorganisms). The developed biosensor demonstrated good electrochemical performance toward xanthine with sensitivity of 2.14 +/- 1.48 μA/mM, response time of 5.2 +/- 1.5 sec, lower detection limit of 150 +/- 39 nM, and retained at least 88% of its activity after 7 days of continuous use.

  19. A role for NADPH oxidase 4 in the activation of vascular endothelial cells by oxidized phospholipids

    PubMed Central

    Lee, Sangderk; Gharavi, Nima M.; Honda, Henry; Chang, Irene; Kim, Brandon; Jen, Nelson; Li, Rongsong; Zimman, Alejandro; Berliner, Judith A.

    2009-01-01

    Previous studies from our group have demonstrated that oxidized 1-palmitoyl-2-arachidonyl-sn-glycerol-3-phosphocholine (Ox-PAPC) activates over 1000 genes in human aortic endothelial cell (HAEC). Prominent among these are genes regulating inflammation, cholesterol homeostasis, antioxidant enzymes, and the unfolded protein response. Previous studies from our lab and others suggested that transcriptional regulation by Ox-PAPC may be controlled, at least in part, by reactive oxygen species (ROS). We now present evidence that Ox-PAPC activation of NADPH oxidase 4 (NOX4) is responsible for the regulation of two of these important groups of genes: those controlling inflammation and sterol regulation. Our data demonstrate that Ox-PAPC increases reactive oxygen species formation in HAEC as seen by DCF fluorescence. NOX4 is the major molecule responsible for this increase since downregulation of NOX4 and its components (p22phox and rac1) blocked the Ox-PAPC effect. Our data show that Ox-PAPC did not change NOX4 transcription levels but did induce recruitment of rac1 to the membrane for NOX4 activation. We present evidence that vascular endothelial growth factor receptor 2 (VEGFR2) activation is responsible for rac1 recruitment to the membrane. Finally, we demonstrate that knockdown of NOX4 and its components rac1 and p22phox decrease Ox-PAPC induction of inflammatory and sterol regulatory genes, but do not affect Ox-PAPC transcriptional regulation of other gene of antioxidant and unfolded protein response. In summary, we have identified a VEGFR2/NOX4 regulatory pathway by which Ox-PAPC controls important endothelial functions. PMID:19375500

  20. Annual Outcomes With Transcatheter Valve Therapy: From the STS/ACC TVT Registry.

    PubMed

    Holmes, David R; Nishimura, Rick A; Grover, Frederick L; Brindis, Ralph G; Carroll, John D; Edwards, Fred H; Peterson, Eric D; Rumsfeld, John S; Shahian, David M; Thourani, Vinod H; Tuzcu, E Murat; Vemulapalli, Sreekanth; Hewitt, Kathleen; Michaels, Joan; Fitzgerald, Susan; Mack, Michael J

    2016-02-01

    The Society of Thoracic Surgeons (STS)/American College of Cardiology (ACC) Transcatheter Valve Therapy (TVT) Registry has been a joint initiative of the STS and the ACC in concert with multiple stakeholders. The TVT Registry has important information regarding patient selection, delivery of care, science, education, and research in the field of structural valvular heart disease. This report provides an overview on current U.S. TVT practice and trends. The emphasis is on demographics, in-hospital procedural characteristics, and outcomes of patients having transcatheter aortic valve replacement (TAVR) performed at 348 U.S. centers. The TVT Registry captured 26,414 TAVR procedures as of December 31, 2014. Temporal trends between 2012 and 2013 versus 2014 were compared. Comparison of the 2 time periods reveals that TAVR patients remain elderly (mean age 82 years), with multiple comorbidities, reflected by a high mean STS predicted risk of mortality (STS PROM) for surgical valve replacement (8.34%), were highly symptomatic (New York Heart Association functional class III/IV in 82.5%), frail (slow 5-m walk test in 81.6%), and have poor self-reported health status (median baseline Kansas City Cardiomyopathy Questionnaire score of 39.1). Procedure performance is changing, with an increased use of moderate sedation (from 1.6% to 5.1%) and increase in femoral access using percutaneous techniques (66.8% in 2014). Vascular complication rates are decreasing (from 5.6% to 4.2%), whereas site-reported stroke rates remain stable at 2.2%. The TVT Registry provides important information on characteristics and outcomes of TAVR in contemporary U.S. clinical practice. It can be used to identify trends in practice and opportunities for quality improvement.

  1. Oxoferryl-porphyrin radical catalytic intermediate in cytochrome bd oxidases protects cells from formation of reactive oxygen species.

    PubMed

    Paulus, Angela; Rossius, Sebastiaan Gijsbertus Hendrik; Dijk, Madelon; de Vries, Simon

    2012-03-16

    The quinol-linked cytochrome bd oxidases are terminal oxidases in respiration. These oxidases harbor a low spin heme b(558) that donates electrons to a binuclear heme b(595)/heme d center. The reaction with O(2) and subsequent catalytic steps of the Escherichia coli cytochrome bd-I oxidase were investigated by means of ultra-fast freeze-quench trapping followed by EPR and UV-visible spectroscopy. After the initial binding of O(2), the O-O bond is heterolytically cleaved to yield a kinetically competent heme d oxoferryl porphyrin π-cation radical intermediate (compound I) magnetically interacting with heme b(595). Compound I accumulates to 0.75-0.85 per enzyme in agreement with its much higher rate of formation (~20,000 s(-1)) compared with its rate of decay (~1,900 s(-1)). Compound I is next converted to a short lived heme d oxoferryl intermediate (compound II) in a phase kinetically matched to the oxidation of heme b(558) before completion of the reaction. The results indicate that cytochrome bd oxidases like the heme-copper oxidases break the O-O bond in a single four-electron transfer without a peroxide intermediate. However, in cytochrome bd oxidases, the fourth electron is donated by the porphyrin moiety rather than by a nearby amino acid. The production of reactive oxygen species by the cytochrome bd oxidase was below the detection level of 1 per 1000 turnovers. We propose that the two classes of terminal oxidases have mechanistically converged to enzymes in which the O-O bond is broken in a single four-electron transfer reaction to safeguard the cell from the formation of reactive oxygen species.

  2. Loss of the smallest subunit of cytochrome c oxidase, COX8A, causes Leigh-like syndrome and epilepsy.

    PubMed

    Hallmann, Kerstin; Kudin, Alexei P; Zsurka, Gábor; Kornblum, Cornelia; Reimann, Jens; Stüve, Burkhard; Waltz, Stephan; Hattingen, Elke; Thiele, Holger; Nürnberg, Peter; Rüb, Cornelia; Voos, Wolfgang; Kopatz, Jens; Neumann, Harald; Kunz, Wolfram S

    2016-02-01

    Isolated cytochrome c oxidase (complex IV) deficiency is one of the most frequent respiratory chain defects in humans and is usually caused by mutations in proteins required for assembly of the complex. Mutations in nuclear-encoded structural subunits are very rare. In a patient with Leigh-like syndrome presenting with leukodystrophy and severe epilepsy, we identified a homozygous splice site mutation in COX8A, which codes for the ubiquitously expressed isoform of subunit VIII, the smallest nuclear-encoded subunit of complex IV. The mutation, affecting the last nucleotide of intron 1, leads to aberrant splicing, a frame-shift in the highly conserved exon 2, and decreased amount of the COX8A transcript. The loss of the wild-type COX8A protein severely impairs the stability of the entire cytochrome c oxidase enzyme complex and manifests in isolated complex IV deficiency in skeletal muscle and fibroblasts, similar to the frequent c.845_846delCT mutation in the assembly factor SURF1 gene. Stability and activity of complex IV could be rescued in the patient's fibroblasts by lentiviral expression of wild-type COX8A. Our findings demonstrate that COX8A is indispensable for function of human complex IV and its mutation causes human disease. © The Author (2015). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  3. Immunological comparison of sulfite oxidase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pollock, V.; Barber, M.J.

    1991-03-11

    Polyclonal antibodies (rabbit), elicited against FPLC-purified chicken and rat liver sulfite oxidase (SO), have been examined for inhibition and binding to purified chicken (C), rat (R), bovine (B), alligator (A) and shark (S) liver enzymes. Anti-CSO IgG cross-reacted with all five enzymes, with varying affinities, in the order CSO=ASO{gt}RSO{gt}BSO{gt}SSO. Anti-ROS IgG also cross-reacted with all five enzymes in the order RSO{gt}CSO=ASO{gt}BSO{gt}SSO. Anti-CSO IgG inhibited sulfite:cyt. c reductase (S:CR), sulfite:ferricyanide reductase (S:FR) and sulfite:dichlorophenolindophenol reductase (S:DR) activities of CSO to different extents (S:CR{gt}S:FR=S:DR). Similar differential inhibition was found for anti-ROS IgG and RSO S:CR, S:FR and S:DR activities. Anti-CSO IgG inhibitedmore » S:CR activities in the order CSO=ASO{much gt}SSO{gt}BSO. RSO was uninhibited. For anti-RSO IgG the inhibition order was RSO{gt}SSO{gt}BSO{gt}ASO. CSO was uninhibited. Anti-CSO and RSO IgGs partially inhibited Chlorella nitrate reductase (NR). Minor cross-reactivity was found for xanthine oxidase. Common antigenic determinants for all five SO's and NR are indicated.« less

  4. Glutamate Excitotoxicity Linked to Spermine Oxidase Overexpression.

    PubMed

    Pietropaoli, Stefano; Leonetti, Alessia; Cervetto, Chiara; Venturini, Arianna; Mastrantonio, Roberta; Baroli, Giulia; Persichini, Tiziana; Colasanti, Marco; Maura, Guido; Marcoli, Manuela; Mariottini, Paolo; Cervelli, Manuela

    2018-02-03

    Excitotoxic stress has been associated with several different neurological disorders, and it is one of the main causes of neuronal degeneration and death. To identify new potential proteins that could represent key factors in excitotoxic stress and to study the relationship between polyamine catabolism and excitotoxic damage, a novel transgenic mouse line overexpressing spermine oxidase enzyme in the neocortex (Dach-SMOX) has been engineered. These transgenic mice are more susceptible to excitotoxic injury and display a higher oxidative stress, highlighted by 8-Oxo-2'-deoxyguanosine increase and activation of defense mechanisms, as demonstrated by the increase of nuclear factor erythroid 2-related factor 2 (Nrf-2) in the nucleus. In Dach-SMOX astrocytes and neurons, an alteration of the phosphorylated and non-phosphorylated subunits of glutamate receptors increases the kainic acid response in these mice. Moreover, a decrease in excitatory amino acid transporters and an increase in the system x c - transporter, a Nrf-2 target, was observed. Sulfasalazine, a system x c - transporter inhibitor, was shown to revert the increased susceptibility of Dach-SMOX mice treated with kainic acid. We demonstrated that astrocytes play a crucial role in this process: neuronal spermine oxidase overexpression resulted in an alteration of glutamate excitability, in glutamate uptake and efflux in astrocytes involved in the synapse. Considering the involvement of oxidative stress in many neurodegenerative diseases, Dach-SMOX transgenic mouse can be considered as a suitable in vivo genetic model to study the involvement of spermine oxidase in excitotoxicity, which can be considered as a possible therapeutic target.

  5. Design, synthesis and biological evaluation of novel xanthine oxidase inhibitors bearing a 2-arylbenzo[b]furan scaffold.

    PubMed

    Tang, Hong-Jin; Li, Wei; Zhou, Mei; Peng, Li-Ying; Wang, Jin-Xin; Li, Jia-Huang; Chen, Jun

    2018-05-10

    Xanthine oxidase, which catalyzes the oxidative reaction of hypoxanthine and xanthine into uric acid, is a key enzyme to the pathogenesis of hyperuricemia and gout. In this study, for the purpose of discovering novel xanthine oxidase (XO) inhibitors, a series of 2-arylbenzo[b]furan derivatives (3a-3d, 4a-4o and 6a-6d) were designed and synthesized. All these compounds were evaluated their xanthine oxidase inhibitory and antioxidant activities by using in vitro enzymatic assay and cellular model. The results showed that a majority of the designed compounds exhibited potent xanthine oxidase inhibitory effects and antioxidant activities, and compound 4a emerged as the most potent xanthine oxidase inhibitor (IC 50  = 4.45 μM). Steady-state kinetic measurements of the inhibitor 4a with the bovine milk xanthine oxidase indicated a mixed type inhibition with 3.52 μM K i and 13.14 μM K is , respectively. The structure-activity relationship analyses have also been presented. Compound 4a exhibited the potent hypouricemic effect in the potassium oxonate-induced hyperuricemic mice model. A molecular docking study of compound 4a was performed to gain an insight into its binding mode with xanthine oxidase. These results highlight the identification of a new class of xanthine oxidase inhibitors that have potential to be more efficacious in treatment of gout. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  6. A decade of crystallization drops: Crystallization of the cbb3 cytochrome c oxidase from Pseudomonas stutzeri

    PubMed Central

    Buschmann, Sabine; Richers, Sebastian; Ermler, Ulrich; Michel, Hartmut

    2014-01-01

    The cbb3 cytochrome c oxidases are distant members of the superfamily of heme copper oxidases. These terminal oxidases couple O2 reduction with proton transport across the plasma membrane and, as a part of the respiratory chain, contribute to the generation of an electrochemical proton gradient. Compared with other structurally characterized members of the heme copper oxidases, the recently determined cbb3 oxidase structure at 3.2 Å resolution revealed significant differences in the electron supply system, the proton conducting pathways and the coupling of O2 reduction to proton translocation. In this paper, we present a detailed report on the key steps for structure determination. Improvement of the protein quality was achieved by optimization of the number of lipids attached to the protein as well as the separation of two cbb3 oxidase isoenzymes. The exchange of n-dodecyl-β-d-maltoside for a precisely defined mixture of two α-maltosides and decanoylsucrose as well as the choice of the crystallization method had a most profound impact on crystal quality. This report highlights problems frequently encountered in membrane protein crystallization and offers meaningful approaches to improve crystal quality. PMID:24488923

  7. A decade of crystallization drops: crystallization of the cbb3 cytochrome c oxidase from Pseudomonas stutzeri.

    PubMed

    Buschmann, Sabine; Richers, Sebastian; Ermler, Ulrich; Michel, Hartmut

    2014-04-01

    The cbb3 cytochrome c oxidases are distant members of the superfamily of heme copper oxidases. These terminal oxidases couple O2 reduction with proton transport across the plasma membrane and, as a part of the respiratory chain, contribute to the generation of an electrochemical proton gradient. Compared with other structurally characterized members of the heme copper oxidases, the recently determined cbb3 oxidase structure at 3.2 Å resolution revealed significant differences in the electron supply system, the proton conducting pathways and the coupling of O2 reduction to proton translocation. In this paper, we present a detailed report on the key steps for structure determination. Improvement of the protein quality was achieved by optimization of the number of lipids attached to the protein as well as the separation of two cbb3 oxidase isoenzymes. The exchange of n-dodecyl-β-D-maltoside for a precisely defined mixture of two α-maltosides and decanoylsucrose as well as the choice of the crystallization method had a most profound impact on crystal quality. This report highlights problems frequently encountered in membrane protein crystallization and offers meaningful approaches to improve crystal quality. © 2014 The Protein Society.

  8. Age-related ultrastructural and monoamine oxidase changes in the rat optic nerve.

    PubMed

    Taurone, S; Ripandelli, G; Minni, A; Lattanzi, R; Miglietta, S; Pepe, N; Fumagalli, L; Micera, A; Pastore, F S; Artico, M

    2016-01-01

    The aim of this paper is to study the morphology and the distribution of the monoamine oxidase enzymatic system in the optic nerve of 4 month-old Wistar (young) and 28 month-old Wistar (old) rats. The optic nerve was harvested from 20 young and old rats. The segment of optic nerve was divided longitudinally into two pieces, each 0.1 mm in length. The first piece was used for transmission electron microscopy. The second piece was stained with histochemical reaction for monoamine oxidase. The agerelated changes in the optic nerve of rats include micro-anatomical details, ultrastructure and monoamine oxidase histochemical staining. A strong decrease of the thin nerve fibers and a swelling of the thick ones can be observed in optic nerve fibers of old rats. Increased monoamine oxidase histochemical staining of the optic nerve of aged rats is well demonstrated. The increase of meningeal shealth and the decrease of thin nerve fibers of the optic nerve in old rats are well documented. Morphological, ultrastructural and histochemical changes observed in optic nerve fibers of the old rats show a close relation with aging.

  9. Abnormal kinetic behavior of cytochrome oxidase in a case of Leigh disease.

    PubMed Central

    Glerum, M; Robinson, B H; Spratt, C; Wilson, J; Patrick, D

    1987-01-01

    Cultured skin fibroblasts from a child with fatal lacticacidemia displayed an abnormally high lactate:pyruvate ratio of 77:1, compared with control values of 22:1-27:1. When protease-treated isolated mitochondria were used, activity of the respiratory-chain enzymes was found to be approximately 60% of normal, and adenosine triphosphate synthesis was found to be normal with all substrates tested. In mitochondria prepared by means of digitonin treatment, adenosine triphosphate synthesis was depressed with all substrates tested, suggesting a defect in the operation of the cytochrome oxidase complex. In disrupted whole cells from the patient, cytochrome oxidase activity was 56% of the activity in the control cell line with the lowest activity. In the presence of a twofold excess of oxidized cytochrome c, patient cells showed 31% of the activity in controls. Cytochrome oxidase activity in both sonicated whole-cell preparations and in sonicated mitochondria displayed abnormal kinetics with regard to the substrate-reduced cytochrome c, which was particularly evident in the presence of excess oxidized cytochrome c. We believe that kinetically abnormal cytochrome oxidase complex is responsible for the biochemical and clinical abnormalities present in this patient. PMID:2821802

  10. Genetics Home Reference: cytochrome c oxidase deficiency

    MedlinePlus

    ... are caused by mutations in genes found within nuclear DNA; however, in some rare instances, mutations in genes located within mtDNA cause this condition. The genes associated with cytochrome c oxidase deficiency are involved in energy production in mitochondria through a process called oxidative ...

  11. Glycosylation site-targeted PEGylation of glucose oxidase retains native enzymatic activity.

    PubMed

    Ritter, Dustin W; Roberts, Jason R; McShane, Michael J

    2013-04-10

    Targeted PEGylation of glucose oxidase at its glycosylation sites was investigated to determine the effect on enzymatic activity, as well as the bioconjugate's potential in an optical biosensing assay. Methoxy-poly(ethylene glycol)-hydrazide (4.5kDa) was covalently coupled to periodate-oxidized glycosylation sites of glucose oxidase from Aspergillus niger. The bioconjugate was characterized using gel electrophoresis, liquid chromatography, mass spectrometry, and dynamic light scattering. Gel electrophoresis data showed that the PEGylation protocol resulted in a drastic increase (ca. 100kDa) in the apparent molecular mass of the protein subunit, with complete conversion to the bioconjugate; liquid chromatography data corroborated this large increase in molecular size. Mass spectrometry data proved that the extent of PEGylation was six poly(ethylene glycol) chains per glucose oxidase dimer. Dynamic light scattering data indicated the absence of higher-order oligomers in the PEGylated GOx sample. To assess stability, enzymatic activity assays were performed in triplicate at multiple time points over the course of 29 days in the absence of glucose, as well as before and after exposure to 5% w/v glucose for 24h. At a confidence level of 95%, the bioconjugate's performance was statistically equivalent to native glucose oxidase in terms of activity retention over the 29 day time period, as well as following the 24h glucose exposure. Finally, the bioconjugate was entrapped within a poly(2-hydroxyethyl methacrylate) hydrogel containing an oxygen-sensitive phosphor, and the construct was shown to respond approximately linearly with a 220±73% signal change (n=4, 95% confidence interval) over the physiologically-relevant glucose range (i.e., 0-400mg/dL); to our knowledge, this represents the first demonstration of PEGylated glucose oxidase incorporated into an optical biosensing assay. Copyright © 2013 Elsevier Inc. All rights reserved.

  12. NADPH Oxidase Inhibition Improves Neurological Outcomes in Surgically-Induced Brain Injury

    PubMed Central

    Lo, Wendy; Bravo, Thomas; Jadhav, Vikram; Zhang, John H.; Tang, Jiping

    2007-01-01

    Neurosurgical procedures can result in brain injury by various means including direct trauma, hemorrhage, retractor stretch, and electrocautery. This surgically-induced brain injury (SBI) can cause post-operative complications such as brain edema. By creating a mouse model of SBI, we tested whether NADPH oxidase, an important reactive oxygen species producing enzyme, is involved in SBI using transgenic mice lacking gp91phox subunit of NADPH oxidase (gp91phox KO) and apocynin, a specific inhibitor of NADPH oxidase. Neurological function and brain edema were evaluated at 24 hours post-SBI in gp91phox KO and wild-type littermates grouped into SBI and sham-surgery groups. Alternatively, mice were grouped into vehicle- and apocynin-treated (5mg/kg, i.p. 30 minutes before SBI) groups. Oxidative stress indicated by lipid peroxidation (LPO) was measured at 3 and 24 hours post SBI. The gp91phox KO mice, but not the apocynin-treated mice showed significantly improved neurological scores. Brain edema was observed in both gp91phox KO and wild-type groups after SBI; however, there was no significant difference between these two groups. Brain edema was also not affected by apocynin-pretreatment. LPO levels were significantly higher in SBI group in both gp91phox KO and wild-type groups as compared to sham group. A trend, although without statistical significance, was noted towards attenuation of LPO in the gp91phox KO animals as compared to wild-type group. LPO levels were significantly attenuated at 3 hours post-SBI by apocynin pretreatment but not at 24 hours post-SBI. These results suggest that chronic and acute inhibition of NADPH oxidase activity does not reduce brain edema after SBI. Long-term inhibition of NADPH oxidase, however improves neurological functions after SBI. PMID:17317004

  13. Gene cloning and heterologous expression of pyranose 2-oxidase from the brown-rot fungus, Gloeophyllum trabeum

    Treesearch

    Diane Dietrich; Casey Crooks

    2009-01-01

    A pyranose 2-oxidase gene from the brown-rot basidiomycete Gloeophyllum trabeum was isolated using homology-based degenerate PCR. The gene structure was determined and compared to that of several pyranose 2-oxidases cloned from white-rot fungi. The G. trabeum pyranose 2-oxidase gene consists of 16 coding exons with canonical promoter CAAT and TATA elements in the 5’UTR...

  14. Lipid levels are associated with a regulatory polymorphism of the monoamine oxidase-A gene promoter (MAOA-uVNTR).

    PubMed

    Brummett, Beverly H; Boyle, Stephen H; Siegler, Ilene C; Zuchner, Stephan; Ashley-Koch, Allison; Williams, Redford B

    2008-02-01

    The monoamine oxidase-A (MAOA) gene plays a vital role in the metabolism of neurotransmitters, e.g, serotonin, norepinephrine, and dopamine. A polymorphism in the promoter region (MAOA-uVNTR) affects transcriptional efficiency. Allelic variation in MAOA-uVNTR has been associated with body mass index (BMI). We extended previous work by examining relations among this polymorphism and serum lipid levels. The sample consisted of 74 males enrolled in a study of caregivers for relatives with dementia. Regression models, adjusted for age, race, group status (caregiver/control), and cholesterol lowering medication (yes/no), were used to examine associations between high verses low MAOA-uVNTR activity alleles and total cholesterol, HDL, LDL, VLDL, LDL/HDL ratio, triglycerides, and BMI. Higher total cholesterol (p<0.03), LDL/HDL ratio (p<0.01), triglycerides (p<0.02), and VLDL (p<0.02) were associated with low activity MAOA-uVNTR alleles. HDL and LDL were modestly related to MAOA-uVNTR activity, however, they did not reach the conventional significance level (p<0.07 and p<0.10, respectively). BMI (p<0.74) was unrelated to MAOA-uVNTR transcription. The present findings suggest that MAOA-uVNTR may influence lipid levels and individuals with less active alleles are at increased health risk.

  15. Plant sterol biosynthesis: identification of two distinct families of sterol 4alpha-methyl oxidases.

    PubMed Central

    Darnet, Sylvain; Rahier, Alain

    2004-01-01

    In plants, the conversion of cycloartenol into functional phytosterols requires the removal of the two methyl groups at C-4 by an enzymic complex including a sterol 4alpha-methyl oxidase (SMO). We report the cloning of candidate genes for SMOs in Arabidopsis thaliana, belonging to two distinct families termed SMO1 and SMO2 and containing three and two isoforms respectively. SMO1 and SMO2 shared low sequence identity with each other and were orthologous to the ERG25 gene from Saccharomyces cerevisiae which encodes the SMO. The plant SMO amino acid sequences possess all the three histidine-rich motifs (HX3H, HX2HH and HX2HH), characteristic of the small family of membrane-bound non-haem iron oxygenases that are involved in lipid oxidation. To elucidate the precise functions of SMO1 and SMO2 gene families, we have reduced their expression by using a VIGS (virus-induced gene silencing) approach in Nicotiana benthamiana. SMO1 and SMO2 cDNA fragments were inserted into a viral vector and N. benthamiana inoculated with the viral transcripts. After silencing with SMO1, a substantial accumulation of 4,4-dimethyl-9beta,19-cyclopropylsterols (i.e. 24-methylenecycloartanol) was obtained, whereas qualitative and quantitative levels of 4alpha-methylsterols were not affected. In the case of silencing with SMO2, a large accumulation of 4alpha-methyl-Delta7-sterols (i.e. 24-ethylidenelophenol and 24-ethyllophenol) was found, with no change in the levels of 4,4-dimethylsterols. These clear and distinct biochemical phenotypes demonstrate that, in contrast with animals and fungi, in photosynthetic eukaryotes, these two novel families of cDNAs are coding two distinct types of C-4-methylsterol oxidases controlling the level of 4,4-dimethylsterol and 4alpha-methylsterol precursors respectively. PMID:14653780

  16. Polyamine oxidase activity in rats treated with mitoguazone: specific and permanent decrease in thymus.

    PubMed

    Ferioli, M E; Armanni, A

    2003-01-01

    To extend the knowledge on the role of polyamine oxidase in thymus physiology, we evaluated the in vivo effect of the polyamine biosynthetic pathway inhibitor mitoguazone. The drug markedly and permanently decreased the enzyme activity in the organ, in which the level of putrescine also decreased at the later times observed. A byproduct of the reaction catalyzed by polyamine oxidase is hydrogen peroxide, a well known inducer of apoptosis. The decrease in polyamine oxidase activity, with the consequent decrease in hydrogen peroxide production, is correlated with a positive effect on thymus physiology. Since mitoguazone has been successfully employed in patients with AIDS-related diseases, in which the reconstitution of the immune function is a favorable prognostic index, we hypothesized that mitoguazone may have the thymus as target organ, and that the decrease in polyamine oxidase activity may have a role in the positive effect of the drug.

  17. Resveratrol protects vascular endothelial cells from high glucose-induced apoptosis through inhibition of NADPH oxidase activation-driven oxidative stress.

    PubMed

    Chen, Feng; Qian, Li-Hua; Deng, Bo; Liu, Zhi-Min; Zhao, Ying; Le, Ying-Ying

    2013-09-01

    Hyperglycemia-induced oxidative stress has been implicated in diabetic vascular complications in which NADPH oxidase is a major source of reactive oxygen species (ROS) generation. Resveratrol is a naturally occurring polyphenol, which has vasoprotective effects in diabetic animal models and inhibits high glucose (HG)-induced oxidative stress in endothelial cells. We aimed to examine whether HG-induced NADPH oxidase activation and ROS production contribute to glucotoxicity to endothelial cells and the effect of resveratrol on glucotoxicity. Using a murine brain microvascular endothelial cell line bEnd3, we found that NADPH oxidase inhibitor (apocynin) and resveratrol both inhibited HG-induced endothelial cell apoptosis. HG-induced elevation of NADPH oxidase activity and production of ROS were inhibited by apocynin, suggesting that HG induces endothelial cell apoptosis through NADPH oxidase-mediated ROS production. Mechanistic studies revealed that HG upregulated NADPH oxidase subunit Nox1 but not Nox2, Nox4, and p22(phox) expression through NF-κB activation, which resulted in elevation of NADPH oxidase activity and consequent ROS production. Resveratrol prevented HG-induced endothelial cell apoptosis through inhibiting HG-induced NF-κB activation, NADPH oxidase activity elevation, and ROS production. HG induces endothelial cell apoptosis through NF-κB/NADPH oxidase/ROS pathway, which was inhibited by resveratrol. Our findings provide new potential therapeutic targets against brain vascular complications of diabetes. © 2013 John Wiley & Sons Ltd.

  18. Oxoferryl-Porphyrin Radical Catalytic Intermediate in Cytochrome bd Oxidases Protects Cells from Formation of Reactive Oxygen Species*

    PubMed Central

    Paulus, Angela; Rossius, Sebastiaan Gijsbertus Hendrik; Dijk, Madelon; de Vries, Simon

    2012-01-01

    The quinol-linked cytochrome bd oxidases are terminal oxidases in respiration. These oxidases harbor a low spin heme b558 that donates electrons to a binuclear heme b595/heme d center. The reaction with O2 and subsequent catalytic steps of the Escherichia coli cytochrome bd-I oxidase were investigated by means of ultra-fast freeze-quench trapping followed by EPR and UV-visible spectroscopy. After the initial binding of O2, the O–O bond is heterolytically cleaved to yield a kinetically competent heme d oxoferryl porphyrin π-cation radical intermediate (compound I) magnetically interacting with heme b595. Compound I accumulates to 0.75–0.85 per enzyme in agreement with its much higher rate of formation (∼20,000 s−1) compared with its rate of decay (∼1,900 s−1). Compound I is next converted to a short lived heme d oxoferryl intermediate (compound II) in a phase kinetically matched to the oxidation of heme b558 before completion of the reaction. The results indicate that cytochrome bd oxidases like the heme-copper oxidases break the O–O bond in a single four-electron transfer without a peroxide intermediate. However, in cytochrome bd oxidases, the fourth electron is donated by the porphyrin moiety rather than by a nearby amino acid. The production of reactive oxygen species by the cytochrome bd oxidase was below the detection level of 1 per 1000 turnovers. We propose that the two classes of terminal oxidases have mechanistically converged to enzymes in which the O–O bond is broken in a single four-electron transfer reaction to safeguard the cell from the formation of reactive oxygen species. PMID:22287551

  19. Diesel Exhaust Particulate Extracts Inhibit Transcription of Nuclear Respiratory Factor-1 and Cell Viability in Human Umbilical Vein Endothelial Cells

    PubMed Central

    Mattingly, Kathleen A.; Klinge, Carolyn M.

    2011-01-01

    Endothelial dysfunction precedes cardiovascular disease and is accompanied by mitochondrial dysfunction. Here we tested the hypothesis that diesel exhaust particulate extracts (DEPEs), prepared from a truck run at different speeds and engine loads, would inhibit genomic estrogen receptor activation of nuclear respiratory factor-1 (NRF-1) transcription in human umbilical vein endothelial cells (HUVECs). Additionally, we examined how DEPEs affect NRF-1 regulated TFAM expression and, in turn, Tfam-regulated mtDNA-encoded cytochrome c oxidase subunit I (COI, MTCO1) and NADH dehydrogenase subunit I (NDI) expression as well as cell proliferation and viability. We report that 17β-estradiol (E2), 4-hydroxytamoxifen (4-OHT), and raloxifene increased NRF-1 transcription in HUVECs in an ER-dependent manner. DEPEs inhibited NRF-1 transcription and this suppression was not ablated by concomitant treatment with E2, 4-OHT, or raloxifene, indicating that the effect was not due to inhibition of ER activity. While E2 increased HUVEC proliferation and viability, DEPEs inhibited viability but not proliferation. Resveratrol increased NRF-1 transcription in an ER-dependent manner in HUVECs, and ablated DEPE inhibition of basal NRF-1 expression. Given that NRF-1 is a key nuclear transcription factor regulating genes involved in mitochondrial activity and biogenesis, these data suggest that DEPEs may adversely affect mitochondrial function leading to endothelial dysfunction and resveratrol may block these effects. PMID:22105178

  20. Structure-Based Alteration of Substrate Specificity and Catalytic Activity of Sulfite Oxidase from Sulfite Oxidation to Nitrate Reduction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Qiu, James A.; Wilson, Heather L.; Rajagopalan, K.V.

    Eukaryotic sulfite oxidase is a dimeric protein that contains the molybdenum cofactor and catalyzes the metabolically essential conversion of sulfite to sulfate as the terminal step in the metabolism of cysteine and methionine. Nitrate reductase is an evolutionarily related molybdoprotein in lower organisms that is essential for growth on nitrate. In this study, we describe human and chicken sulfite oxidase variants in which the active site has been modified to alter substrate specificity and activity from sulfite oxidation to nitrate reduction. On the basis of sequence alignments and the known crystal structure of chicken sulfite oxidase, two residues are conservedmore » in nitrate reductases that align with residues in the active site of sulfite oxidase. On the basis of the crystal structure of yeast nitrate reductase, both positions were mutated in human sulfite oxidase and chicken sulfite oxidase. The resulting double-mutant variants demonstrated a marked decrease in sulfite oxidase activity but gained nitrate reductase activity. An additional methionine residue in the active site was proposed to be important in nitrate catalysis, and therefore, the triple variant was also produced. The nitrate reducing ability of the human sulfite oxidase triple mutant was nearly 3-fold greater than that of the double mutant. To obtain detailed structural data for the active site of these variants, we introduced the analogous mutations into chicken sulfite oxidase to perform crystallographic analysis. The crystal structures of the Mo domains of the double and triple mutants were determined to 2.4 and 2.1 {angstrom} resolution, respectively.« less