Sample records for accompanying electron motion

  1. Chaotic Motion of Relativistic Electrons Driven by Whistler Waves

    NASA Technical Reports Server (NTRS)

    Khazanov, G. V.; Telnikhin, A. A.; Kronberg, Tatiana K.

    2007-01-01

    Canonical equations governing an electron motion in electromagnetic field of the whistler mode waves propagating along the direction of an ambient magnetic field are derived. The physical processes on which the equations of motion are based .are identified. It is shown that relativistic electrons interacting with these fields demonstrate chaotic motion, which is accompanied by the particle stochastic heating and significant pitch angle diffusion. Evolution of distribution functions is described by the Fokker-Planck-Kolmogorov equations. It is shown that the whistler mode waves could provide a viable mechanism for stochastic energization of electrons with energies up to 50 MeV in the Jovian magnetosphere.

  2. Imaging electronic motions by ultrafast electron diffraction

    NASA Astrophysics Data System (ADS)

    Shao, Hua-Chieh; Starace, Anthony F.

    2017-08-01

    Recently ultrafast electron diffraction and microscopy have reached unprecedented temporal resolution, and transient structures with atomic precision have been observed in various reactions. It is anticipated that these extraordinary advances will soon allow direct observation of electronic motions during chemical reactions. We therefore performed a series of theoretical investigations and simulations to investigate the imaging of electronic motions in atoms and molecules by ultrafast electron diffraction. Three prototypical electronic motions were considered for hydrogen atoms. For the case of a breathing mode, the electron density expands and contracts periodically, and we show that the time-resolved scattering intensities reflect such changes of the charge radius. For the case of a wiggling mode, the electron oscillates from one side of the nucleus to the other, and we show that the diffraction images exhibit asymmetric angular distributions. The last case is a hybrid mode that involves both breathing and wiggling motions. Owing to the demonstrated ability of ultrafast electrons to image these motions, we have proposed to image a coherent population transfer in lithium atoms using currently available femtosecond electron pulses. A frequency-swept laser pulse adiabatically drives the valence electron of a lithium atom from the 2s to 2p orbitals, and a time-delayed electron pulse maps such motion. Our simulations show that the diffraction images reflect this motion both in the scattering intensities and the angular distributions.

  3. Air motions accompanying the development of a planetary wave critical layer

    NASA Technical Reports Server (NTRS)

    Salby, Murry L.; O'Sullivan, Donal; Callaghan, Patrick; Garcia, Rolando R.

    1990-01-01

    The horizontal air motions accompanying the development of a planetary wave critical layer are presently investigated on the sphere, in terms of wave amplitude, the characteristics of the zonal flow, and dissipation. While attention is given to adiabatic motions, which should furnish an upper bound on the redistribution of conserved quantities by eddy stirring, nonconservative processes may be important in determining how large a role eddy stirring actually plays in the redistribution of atmospheric constituents. Nonconservative processes may also influence tracer distributions by directly affecting dynamics.

  4. Imaging Action Potential in Single Mammalian Neurons by Tracking the Accompanying Sub-Nanometer Mechanical Motion.

    PubMed

    Yang, Yunze; Liu, Xian-Wei; Wang, Hui; Yu, Hui; Guan, Yan; Wang, Shaopeng; Tao, Nongjian

    2018-03-28

    Action potentials in neurons have been studied traditionally by intracellular electrophysiological recordings and more recently by the fluorescence detection methods. Here we describe a label-free optical imaging method that can measure mechanical motion in single cells with a sub-nanometer detection limit. Using the method, we have observed sub-nanometer mechanical motion accompanying the action potential in single mammalian neurons by averaging the repeated action potential spikes. The shape and width of the transient displacement are similar to those of the electrically recorded action potential, but the amplitude varies from neuron to neuron, and from one region of a neuron to another, ranging from 0.2-0.4 nm. The work indicates that action potentials may be studied noninvasively in single mammalian neurons by label-free imaging of the accompanying sub-nanometer mechanical motion.

  5. Lumbopelvic motion during seated hip flexion in subjects with low-back pain accompanying limited hip flexion.

    PubMed

    Kim, Si-hyun; Kwon, Oh-yun; Yi, Chung-hwi; Cynn, Heon-seock; Ha, Sung-min; Park, Kyue-nam

    2014-01-01

    Limited hip flexion may lead to a poor lumbopelvic motion during seated active hip flexion in people with low-back pain (LBP). The purpose of this study was to compare lumbopelvic motion during seated hip flexion between subjects with and without LBP accompanying limited hip flexion. Fifteen patients with LBP accompanying limited hip flexion and 16 healthy subjects were recruited. The subjects performed seated hip flexion with the dominant leg three times. A three-dimensional motion-analysis system was used to measure lumbopelvic motion during seated hip flexion. During seated active hip flexion, the angle of hip flexion was significantly lower in patients with LBP accompanying limited hip flexion (17.4 ± 4.4 in the LBP group, 20.8 ± 2.6 in the healthy group; t = 2.63, p = 0.014). The angle of the lumbar flexion (4.8 ± 2.2 in the LBP group, 2.6 ± 2.0 in the healthy group; t = -2.96, p = 0.006) and posterior pelvic tilting (5.0 ± 2.6 in the LBP group, 2.9 ± 2.0 in the healthy group; t = 2.48 p = 0.019), however, were significantly greater in patients with this condition. The results of this study suggest that limited hip flexion in LBP can contribute to excessive lumbar flexion and posterior pelvic tilting during hip flexion in the sitting position. Further studies are required to confirm whether improving the hip flexion range of motion can reduce excessive lumbar flexion in patients with LBP accompanying limited hip flexion.

  6. Real-time observation of valence electron motion.

    PubMed

    Goulielmakis, Eleftherios; Loh, Zhi-Heng; Wirth, Adrian; Santra, Robin; Rohringer, Nina; Yakovlev, Vladislav S; Zherebtsov, Sergey; Pfeifer, Thomas; Azzeer, Abdallah M; Kling, Matthias F; Leone, Stephen R; Krausz, Ferenc

    2010-08-05

    The superposition of quantum states drives motion on the atomic and subatomic scales, with the energy spacing of the states dictating the speed of the motion. In the case of electrons residing in the outer (valence) shells of atoms and molecules which are separated by electronvolt energies, this means that valence electron motion occurs on a subfemtosecond to few-femtosecond timescale (1 fs = 10(-15) s). In the absence of complete measurements, the motion can be characterized in terms of a complex quantity, the density matrix. Here we report an attosecond pump-probe measurement of the density matrix of valence electrons in atomic krypton ions. We generate the ions with a controlled few-cycle laser field and then probe them through the spectrally resolved absorption of an attosecond extreme-ultraviolet pulse, which allows us to observe in real time the subfemtosecond motion of valence electrons over a multifemtosecond time span. We are able to completely characterize the quantum mechanical electron motion and determine its degree of coherence in the specimen of the ensemble. Although the present study uses a simple, prototypical open system, attosecond transient absorption spectroscopy should be applicable to molecules and solid-state materials to reveal the elementary electron motions that control physical, chemical and biological properties and processes.

  7. Local ion direction of motion and electron flow in a magnetically insulated diode

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maron, Y.; Litwin, C.

    Ion motion in the acceleration region of a magnetically insulated ion diode and electron flux to the anode are studied locally. Two classes of slowly growing ion deflections are observed, indicating the presence of transverse electric fields in the diode gap. A simple model, which treates the diode as an emitting surface perturbed away from planarity, is offered to infer profiles of the electric field. These profiles are consistent with the observation that one of the ion-deflection classes is associated with a significant fraction of the increases of the electron flux to the anode. The inferred growth rates of themore » perturbations suggest that the observed ion deflections are caused by a nonuniform expansion of the anode plasma. The transverse electric fields associated with the perturbations constitute a significant (as much as 20%) fraction of the diode accelerating field. Short duration ion deflections accompanied by intense electron bursts to the anode are also observed. The data suggest that these deflections and the electron bursts originate at processes in the cathode plasma.« less

  8. Imaging electron motion in graphene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bhandari, Sagar; Westervelt, Robert M.

    A cooled scanning probe microscope (SPM) is an ideal tool to image electronic motion in graphene: the SPM tip acts as a scanning gate, which interacts with the electron gas below. We introduce the technique using our group's previous work on imaging electron flow from a quantum point contact in a GaAs 2DEG and tuning an InAs quantum dot in an InAs/InP nanowire. Carriers in graphene have very different characteristics: electrons and holes travel at a constant speed with no bandgap, and they pass through potential barriers via Klein tunneling. In this paper, we review the extension of SPM imagingmore » techniques to graphene. We image the cyclotron orbits passing between two narrow contacts in a single-atomic-layer graphene device in a perpendicular magnetic field. Magnetic focusing produces a peak in transmission between the contacts when the cyclotron diameter is equal to the contact spacing. The charged SPM tip deflects electrons passing from one contact to the other, changing the transmission when it interrupts the flow. By displaying the change in transmission as the tip is raster scanned above the sample, an image of flow is obtained. In addition, we have developed a complementary technique to image electronic charge using a cooled scanning capacitance microscope (SCM) that uses a sensitive charge preamplifier near the SPM tip to achieve a charge noise level 0.13 e Hz -1/2 with high spatial resolution 100 nm. The cooled SPM and SCM can be used to probe the motion of electrons on the nanoscale in graphene devices.« less

  9. Imaging electron motion in graphene

    DOE PAGES

    Bhandari, Sagar; Westervelt, Robert M.

    2017-01-05

    A cooled scanning probe microscope (SPM) is an ideal tool to image electronic motion in graphene: the SPM tip acts as a scanning gate, which interacts with the electron gas below. We introduce the technique using our group's previous work on imaging electron flow from a quantum point contact in a GaAs 2DEG and tuning an InAs quantum dot in an InAs/InP nanowire. Carriers in graphene have very different characteristics: electrons and holes travel at a constant speed with no bandgap, and they pass through potential barriers via Klein tunneling. In this paper, we review the extension of SPM imagingmore » techniques to graphene. We image the cyclotron orbits passing between two narrow contacts in a single-atomic-layer graphene device in a perpendicular magnetic field. Magnetic focusing produces a peak in transmission between the contacts when the cyclotron diameter is equal to the contact spacing. The charged SPM tip deflects electrons passing from one contact to the other, changing the transmission when it interrupts the flow. By displaying the change in transmission as the tip is raster scanned above the sample, an image of flow is obtained. In addition, we have developed a complementary technique to image electronic charge using a cooled scanning capacitance microscope (SCM) that uses a sensitive charge preamplifier near the SPM tip to achieve a charge noise level 0.13 e Hz -1/2 with high spatial resolution 100 nm. The cooled SPM and SCM can be used to probe the motion of electrons on the nanoscale in graphene devices.« less

  10. Energy-resolved coherent diffraction from laser-driven electronic motion in atoms

    NASA Astrophysics Data System (ADS)

    Shao, Hua-Chieh; Starace, Anthony F.

    2017-10-01

    We investigate theoretically the use of energy-resolved ultrafast electron diffraction to image laser-driven electronic motion in atoms. A chirped laser pulse is used to transfer the valence electron of the lithium atom from the ground state to the first excited state. During this process, the electronic motion is imaged by 100-fs and 1-fs electron pulses in energy-resolved diffraction measurements. Simulations show that the angle-resolved spectra reveal the time evolution of the energy content and symmetry of the electronic state. The time-dependent diffraction patterns are further interpreted in terms of the momentum transfer. For the case of incident 1-fs electron pulses, the rapid 2 s -2 p quantum beat motion of the target electron is imaged as a time-dependent asymmetric oscillation of the diffraction pattern.

  11. Automatic solar image motion measurements. [electronic disk flux monitoring

    NASA Technical Reports Server (NTRS)

    Colgate, S. A.; Moore, E. P.

    1975-01-01

    The solar seeing image motion has been monitored electronically and absolutely with a 25 cm telescope at three sites along the ridge at the southern end of the Magdalena Mountains west of Socorro, New Mexico. The uncorrelated component of the variations of the optical flux from two points at opposite limbs of the solar disk was continually monitored in 3 frequencies centered at 0.3, 3 and 30 Hz. The frequency band of maximum signal centered at 3 Hz showed the average absolute value of image motion to be somewhat less than 2sec. The observer estimates of combined blurring and image motion were well correlated with electronically measured image motion, but the observer estimates gave a factor 2 larger value.

  12. Imaging the motion of electrons across semiconductor heterojunctions.

    PubMed

    Man, Michael K L; Margiolakis, Athanasios; Deckoff-Jones, Skylar; Harada, Takaaki; Wong, E Laine; Krishna, M Bala Murali; Madéo, Julien; Winchester, Andrew; Lei, Sidong; Vajtai, Robert; Ajayan, Pulickel M; Dani, Keshav M

    2017-01-01

    Technological progress since the late twentieth century has centred on semiconductor devices, such as transistors, diodes and solar cells. At the heart of these devices is the internal motion of electrons through semiconductor materials due to applied electric fields or by the excitation of photocarriers. Imaging the motion of these electrons would provide unprecedented insight into this important phenomenon, but requires high spatial and temporal resolution. Current studies of electron dynamics in semiconductors are generally limited by the spatial resolution of optical probes, or by the temporal resolution of electronic probes. Here, by combining femtosecond pump-probe techniques with spectroscopic photoemission electron microscopy, we imaged the motion of photoexcited electrons from high-energy to low-energy states in a type-II 2D InSe/GaAs heterostructure. At the instant of photoexcitation, energy-resolved photoelectron images revealed a highly non-equilibrium distribution of photocarriers in space and energy. Thereafter, in response to the out-of-equilibrium photocarriers, we observed the spatial redistribution of charges, thus forming internal electric fields, bending the semiconductor bands, and finally impeding further charge transfer. By assembling images taken at different time-delays, we produced a movie lasting a few trillionths of a second of the electron-transfer process in the photoexcited type-II heterostructure-a fundamental phenomenon in semiconductor devices such as solar cells. Quantitative analysis and theoretical modelling of spatial variations in the movie provide insight into future solar cells, 2D materials and other semiconductor devices.

  13. Imaging the motion of electrons across semiconductor heterojunctions

    NASA Astrophysics Data System (ADS)

    Man, Michael K. L.; Margiolakis, Athanasios; Deckoff-Jones, Skylar; Harada, Takaaki; Wong, E. Laine; Krishna, M. Bala Murali; Madéo, Julien; Winchester, Andrew; Lei, Sidong; Vajtai, Robert; Ajayan, Pulickel M.; Dani, Keshav M.

    2017-01-01

    Technological progress since the late twentieth century has centred on semiconductor devices, such as transistors, diodes and solar cells. At the heart of these devices is the internal motion of electrons through semiconductor materials due to applied electric fields or by the excitation of photocarriers. Imaging the motion of these electrons would provide unprecedented insight into this important phenomenon, but requires high spatial and temporal resolution. Current studies of electron dynamics in semiconductors are generally limited by the spatial resolution of optical probes, or by the temporal resolution of electronic probes. Here, by combining femtosecond pump-probe techniques with spectroscopic photoemission electron microscopy, we imaged the motion of photoexcited electrons from high-energy to low-energy states in a type-II 2D InSe/GaAs heterostructure. At the instant of photoexcitation, energy-resolved photoelectron images revealed a highly non-equilibrium distribution of photocarriers in space and energy. Thereafter, in response to the out-of-equilibrium photocarriers, we observed the spatial redistribution of charges, thus forming internal electric fields, bending the semiconductor bands, and finally impeding further charge transfer. By assembling images taken at different time-delays, we produced a movie lasting a few trillionths of a second of the electron-transfer process in the photoexcited type-II heterostructure—a fundamental phenomenon in semiconductor devices such as solar cells. Quantitative analysis and theoretical modelling of spatial variations in the movie provide insight into future solar cells, 2D materials and other semiconductor devices.

  14. Watching the electronic motions driven by a conical intersection

    NASA Astrophysics Data System (ADS)

    Jonas, David

    2007-03-01

    In chemistry, the fastest electronic rearrangements proceed through ``conical intersections'' between electronic potential energy surfaces. With sufficiently short pulses, the electronic motion can be isolated by polarized excitation of aligned electronic wavepackets at a conical intersection. Polarized femtosecond probing reveals signatures of electronic wavepacket motion (due to the energy gaps) and of electron transfer between orbitals (due to the couplings) driven by the conical intersection. After exciting a D4h symmetry silicon naphthalocyanine molecule onto a Jahn-Teller conical intersection in the first excited state, electronic motions cause a ˜100 fs drop in the pump-probe polarization anisotropy. The polarized vibrational modulations of the signal can be used to deduce the symmetry and stabilization energies for each vibration. The initial decay of the polarization anisotropy can be quantitatively predicted from these vibrational parameters. Both coupling and energy gap variations are important on the ˜100 fs timescale. A 1 meV stabilization drives electrons from orbital to orbital in 100 fs, and the theory indicates that a chemically reactive conical intersection with 1000x greater stabilization energy could cause electronic equilibration within 2 fs. We have recently carried out experiments on a nominally D2h symmetry free-base naphthalocyanine for which the splitting between x and y polarized transitions is not resolved in the linear spectrum. For this molecule, the anisotropy also decays on a similar timescale and exhibits damped modulations whose origin (vibrational or electronic) has not yet been determined. The role of the central protons and nominal D2h symmetry in the electronic dynamics will be discussed.

  15. Effects of target plasma electron-electron collisions on correlated motion of fragmented protons.

    PubMed

    Barriga-Carrasco, Manuel D

    2006-02-01

    The objective of the present work is to examined the effects of plasma target electron-electron collisions on H2 + protons traversing it. Specifically, the target is deuterium in a plasma state with temperature Te=10 eV and density n=10(23) cm(-3), and proton velocities are vp=vth, vp=2vth, and vp=3vth, where vth is the electron thermal velocity of the target plasma. Proton interactions with plasma electrons are treated by means of the dielectric formalism. The interactions among close protons through plasma electronic medium are called vicinage forces. It is checked that these forces always screen the Coulomb explosions of the two fragmented protons from the same H2 + ion decreasing their relative distance. They also align the interproton vector along the motion direction, and increase the energy loss of the two protons at early dwell times while for longer times the energy loss tends to the value of two isolated protons. Nevertheless, vicinage forces and effects are modified by the target electron collisions. These collisions enhance the calculated self-stopping and vicinage forces over the collisionless results. Regarding proton correlated motion, when these collisions are included, the interproton vector along the motion direction overaligns at slower proton velocities (vp=vth) and misaligns for faster ones (vp=2vth, vp=3vth). They also contribute to a great extend to increase the energy loss of the fragmented H2 + ion. This later effect is more significant in reducing projectile velocity.

  16. 41 CFR 60-30.8 - Motions; disposition of motions.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... the Administrative Law Judge. If made before or after the hearing itself, the motions shall be in writing. If made at the hearing, motions may be stated orally; but the Administrative Law Judge may... motion. Unless otherwise ordered by the Administrative Law Judge, written motions shall be accompanied by...

  17. 41 CFR 60-30.8 - Motions; disposition of motions.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... the Administrative Law Judge. If made before or after the hearing itself, the motions shall be in writing. If made at the hearing, motions may be stated orally; but the Administrative Law Judge may... motion. Unless otherwise ordered by the Administrative Law Judge, written motions shall be accompanied by...

  18. 41 CFR 60-30.8 - Motions; disposition of motions.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... the Administrative Law Judge. If made before or after the hearing itself, the motions shall be in writing. If made at the hearing, motions may be stated orally; but the Administrative Law Judge may... motion. Unless otherwise ordered by the Administrative Law Judge, written motions shall be accompanied by...

  19. 41 CFR 60-30.8 - Motions; disposition of motions.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... the Administrative Law Judge. If made before or after the hearing itself, the motions shall be in writing. If made at the hearing, motions may be stated orally; but the Administrative Law Judge may... motion. Unless otherwise ordered by the Administrative Law Judge, written motions shall be accompanied by...

  20. 41 CFR 60-30.8 - Motions; disposition of motions.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... the Administrative Law Judge. If made before or after the hearing itself, the motions shall be in writing. If made at the hearing, motions may be stated orally; but the Administrative Law Judge may... motion. Unless otherwise ordered by the Administrative Law Judge, written motions shall be accompanied by...

  1. Intrinsic Magnetic Flux of the Electron's Orbital and Spin Motion

    NASA Astrophysics Data System (ADS)

    Wan, K. K.; Saglam, M.

    2006-06-01

    In analogy with the fact that there are magnetic moments associated respectively with the electron's orbital and spin motion in an atom we present several analyses on a proposal to introduce a concept of intrinsic magnetic flux associated with the electron's orbital and spin motion. It would be interesting to test or to demonstrate Faraday's and Lenz's laws of electromagnetic induction arising directly from the flux change due to transition of states in an atom and to examine applications of this concept of intrinsic flux.

  2. Imaging the motion of electrons in 2D semiconductor heterostructures

    NASA Astrophysics Data System (ADS)

    Dani, Keshav

    Technological progress since the late 20th century has centered on semiconductor devices, such as transistors, diodes, and solar cells. At the heart of these devices, is the internal motion of electrons through semiconductor materials due to applied electric fields or by the excitation of photocarriers. Imaging the motion of these electrons would provide unprecedented insight into this important phenomenon, but requires high spatial and temporal resolution. Current studies of electron dynamics in semiconductors are generally limited by the spatial resolution of optical probes, or by the temporal resolution of electronic probes. In this talk, we combine femtosecond pump-probe techniques with spectroscopic photoemission electron microscopy to image the motion of photoexcited electrons from high-energy to low-energy states in a 2D InSe/GaAs heterostructure exhibiting a type-II band alignment. At the instant of photoexcitation, energy-resolved photoelectron images reveal a highly non-equilibrium distribution of photocarriers in space and energy. Thereafter, in response to the out-of-equilibrium photocarriers, we observe the spatial redistribution of charges, thus forming internal electric fields, bending the semiconductor bands, and finally impeding further charge transfer. By assembling images taken at different time-delays, we make a movie lasting a few tens of picoseconds of the electron transfer process in the photoexcited type-II heterostructure - a fundamental phenomenon in semiconductor devices like solar cells. Quantitative analysis and theoretical modeling of spatial variations in the video provide insight into future solar cells, electron dynamics in 2D materials, and other semiconductor devices.

  3. Correlated electron-nuclear dissociation dynamics: classical versus quantum motion

    NASA Astrophysics Data System (ADS)

    Schaupp, Thomas; Albert, Julian; Engel, Volker

    2017-01-01

    We investigate the coupled electron-nuclear dynamics in a model system which undergoes dissociation. In choosing different initial conditions, the cases of adiabatic and non-adiabatic dissociation are realized. We treat the coupled electronic and nuclear motion in the complete configuration space so that classically, no surface hopping procedures have to be incorporated in the case that more than a single adiabatic electronic state is populated during the fragmentation. Due to the anharmonic interaction potential, it is expected that classical mechanics substantially deviate from quantum mechanics. However, we provide examples where the densities and fragmentation yields obtained from the two treatments are in astonishingly strong agreement in the case that one starts in the electronic ground state initially. As expected, larger deviations are found if one starts in electronically excited states where trajectories are sampled from the more spatially extended electronic wave function. In that case, higher initial energies are accessed, and the motion proceeds in regions with increasing degree of anharmonicity. Contribution to the Topical Issue "Dynamics of Molecular Systems (MOLEC 2016)", edited by Alberto Garcia-Vela, Luis Banares and Maria Luisa Senent.

  4. Correlated motion of electrons in the He atom irradiated with coherent light

    NASA Astrophysics Data System (ADS)

    Someda, Kiyohiko

    2018-05-01

    Correlated motion of electrons in the He atom irradiated with linearly polarised light is discussed. Mixing of the 2pz orbital into the 1s orbital is interpreted as motion of an electron along the z-axis. The transitions to the configurations (1s)(2pz) and (2pz)(2pz) from (1s)(1s) are described by using 1s-2pz hybridised orbitals with variable coefficients of hybridisation, in other words, by using the Thouless parameters. The quasi-eigenstates of the atom in stationary light are obtained on the basis of the Floquet formalism, and the behaviour of the Thouless parameters is analysed. Trajectories of time evolution of the Thouless parameters are found to be useful to grasp the motion of electrons. Shapes of the trajectories are classified into four modes: (1) two electrons try to stay away from each other due to Coulomb repulsion, (2) one of the electrons is solely driven to run, (3) two electrons are driven to travel together and (4) two electrons run anti-parallel with each other. The conditions of intensity and frequency of light causing these four modes are clarified and summarised in a kind of phase diagram.

  5. Scalable sensing electronics towards a motion capture suit

    NASA Astrophysics Data System (ADS)

    Xu, Daniel; Gisby, Todd A.; Xie, Shane; Anderson, Iain A.

    2013-04-01

    Being able to accurately record body motion allows complex movements to be characterised and studied. This is especially important in the film or sport coaching industry. Unfortunately, the human body has over 600 skeletal muscles, giving rise to multiple degrees of freedom. In order to accurately capture motion such as hand gestures, elbow or knee flexion and extension, vast numbers of sensors are required. Dielectric elastomer (DE) sensors are an emerging class of electroactive polymer (EAP) that is soft, lightweight and compliant. These characteristics are ideal for a motion capture suit. One challenge is to design sensing electronics that can simultaneously measure multiple sensors. This paper describes a scalable capacitive sensing device that can measure up to 8 different sensors with an update rate of 20Hz.

  6. Communication: Adiabatic and non-adiabatic electron-nuclear motion: Quantum and classical dynamics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Albert, Julian; Kaiser, Dustin; Engel, Volker

    2016-05-07

    Using a model for coupled electronic-nuclear motion we investigate the range from negligible to strong non-adiabatic coupling. In the adiabatic case, the quantum dynamics proceeds in a single electronic state, whereas for strong coupling a complete transition between two adiabatic electronic states takes place. It is shown that in all coupling regimes the short-time wave-packet dynamics can be described using ensembles of classical trajectories in the phase space spanned by electronic and nuclear degrees of freedom. We thus provide an example which documents that the quantum concept of non-adiabatic transitions is not necessarily needed if electronic and nuclear motion ismore » treated on the same footing.« less

  7. Poincaré analysis of wave motion in ultrarelativistic electron-ion plasmas.

    PubMed

    Lehmann, G; Spatschek, K H

    2011-03-01

    Based on a relativistic Maxwell-fluid description, the existence of ultrarelativistic laser-induced periodic waves in an electron-ion plasma is investigated. Within a one-dimensional propagation geometry nonlinear coupling of the electromagnetic and electrostatic components occurs that makes the fourth-order problem nonintegrable. A Hamiltonian description is derived, and the manifolds of periodic solutions are studied by Poincaré section plots. The influence of ion motion is investigated in different intensity regimes. For ultrarelativistic laser intensities the phase-space structures change significantly compared to the weakly relativistic case. Ion motion becomes very important such that finally electron-ion plasmas in the far-ultrarelativistic regime behave similarly to electron-positron plasmas. The characteristic new types of periodic solutions of the system are identified and discussed.

  8. Electron spin-echo techniques for the study of protein motion

    NASA Astrophysics Data System (ADS)

    Kar, Leela; Johnson, Michael E.; Bowman, Michael K.

    Electron spin-echo (ESE) spectroscopy has been used to make the first direct measurements of spin-spin relaxation times of a spin-labeled protein at physiological temperatures. Results from experiments using maleimide-labeled deoxygenated hemoglobin (dHb) from individuals homozygous for sickle cell anemia (dHbS) have been compared with those from control experiments using dHb from normal adults (dHbA). Hb "immobilized" by ammonium sulfate precipitation and by siloxane polymer entrapment have been studied for a suitable "rigid" reference. Two-dimensional ESE (2D-ESE) experiments have been performed using all of these systems. The 2D contour plots show that 2D-ESE is sensitive to the slow motion of dHbS polymers and can differentiate it from both that of immobilized Hb and of HbA molecules in solution at the same temperature and concentration. More importantly, the 2D-ESE technique enables one to select for slower motion and thereby extract the dHbS polymer signal from the total signal generated by the heterogeneous system containing dHbS molecules in solution as well as in the polymer. Computer simulations using current slow motional theories show that detailed motional and structural information may be obtained by such studies. The considerable potential of 2D-ESE spectroscopy in the study of macromolecular motion is illustrated by comparing 2D-ESE with the nonlinear technique of saturation transfer electron paramagnetic resonance.

  9. Fractional Brownian motion of an Al nanosphere in liquid Al-Si alloy under electron-beam irradiation

    NASA Astrophysics Data System (ADS)

    Yokota, Takeshi; Howe, J. M.; Jesser, W. A.; Murayama, M.

    2004-05-01

    Fractional forces and Brownian motion are expected to govern the behavior of nanoscale metallic solids in liquids, but such systems have not been studied. We investigated the motion of a crystalline Al nanosphere inside a partially molten Al-Si alloy particle, using an electron beam to both stimulate and observe the motion of the nanosphere. The irregular motion observed was quantified as antipersistant fractional Brownian motion. Analysis of possible phenomena contributing to the motion demonstrates that the incident electrons provide the fractional force that moves the Al nanosphere and that gravity and the oxide shell on the partially molten particle cause the antipersistant behavior.

  10. Random walk study of electron motion in helium in crossed electromagnetic fields

    NASA Technical Reports Server (NTRS)

    Englert, G. W.

    1972-01-01

    Random walk theory, previously adapted to electron motion in the presence of an electric field, is extended to include a transverse magnetic field. In principle, the random walk approach avoids mathematical complexity and concomitant simplifying assumptions and permits determination of energy distributions and transport coefficients within the accuracy of available collisional cross section data. Application is made to a weakly ionized helium gas. Time of relaxation of electron energy distribution, determined by the random walk, is described by simple expressions based on energy exchange between the electron and an effective electric field. The restrictive effect of the magnetic field on electron motion, which increases the required number of collisions per walk to reach a terminal steady state condition, as well as the effect of the magnetic field on electron transport coefficients and mean energy can be quite adequately described by expressions involving only the Hall parameter.

  11. Chaotic Electron Motion Caused by Sidebands in Free Electron Lasers

    DTIC Science & Technology

    1988-10-27

    sideband. The total vector potential is then, A (z,t) = (1) •w (e~ )ri(krZ-Wr t) l(ksZ-Wst)] -c’-[(ex-iey)AweZ% _+V-(ex+iey)Are ikrzwr _) (ex+iey)Ase... light c, ignoring the small correction of order w 2/W 2 from the dielectric contribution of the beam. Electrostatic contributions to the fields are...mass to me and the vector potentials according to ai=IeIAi/mec2 the dimensionless Hamiltonian describing the electron motion in the fields of Eq. (1

  12. Correlating electronic and vibrational motions in charge transfer systems

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Khalil, Munira

    2014-06-27

    The goal of this research program was to measure coupled electronic and nuclear motions during photoinduced charge transfer processes in transition metal complexes by developing and using novel femtosecond spectroscopies. The scientific highlights and the resulting scientific publications from the DOE supported work are outlined in the technical report.

  13. Time-dependent many-body treatment of electron-boson dynamics: Application to plasmon-accompanied photoemission

    NASA Astrophysics Data System (ADS)

    Schüler, M.; Berakdar, J.; Pavlyukh, Y.

    2016-02-01

    Recent experiments access the time-resolved photoelectron signal originating from plasmon satellites in correlated materials and address their buildup and decay in real time. Motivated by these developments, we present the Kadanoff-Baym formalism for the nonequilibrium time evolution of interacting fermions and bosons. In contrast to the fermionic case, the bosons are described by second-order differential equations. Solution of the bosonic Kadanoff-Baym equations—which is the central ingredient of this work—requires substantial modification of the usual two-times electronic propagation scheme. The solution is quite general and can be applied to a number of problems, such as the interaction of electrons with quantized photons, phonons, and other bosonic excitations. Here the formalism is applied to the photoemission from a deep core hole accompanied by plasmon excitation. We compute the time-resolved photoelectron spectra and discuss the effects of intrinsic and extrinsic electron energy losses and their interference.

  14. Ultrafast electronic dynamics driven by nuclear motion

    NASA Astrophysics Data System (ADS)

    Vendrell, Oriol

    2016-05-01

    The transfer of electrical charge on a microscopic scale plays a fundamental role in chemistry, in biology, and in technological applications. In this contribution, we will discuss situations in which nuclear motion plays a central role in driving the electronic dynamics of photo-excited or photo-ionized molecular systems. In particular, we will explore theoretically the ultrafast transfer of a double electron hole between the functional groups of glycine after K-shell ionization and subsequent Auger decay. Although a large energy gap of about 15 eV initially exists between the two electronic states involved and coherent electronic dynamics play no role in the hole transfer, we will illustrate how the double hole can be transferred within 3 to 4 fs between both functional ends of the glycine molecule driven solely by specific nuclear displacements and non-Born-Oppenheimer effects. This finding challenges the common wisdom that nuclear dynamics of the molecular skeleton are unimportant for charge transfer processes at the few-femtosecond time scale and shows that they can even play a prominent role. We thank the Hamburg Centre for Ultrafast Imaging and the Volkswagen Foundation for financial support.

  15. Relativistic electron motion in cylindrical waveguide with strong guiding magnetic field and high power microwave

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wu, Ping; Science and Technology on High Power Microwave Laboratory, Northwest Institute of Nuclear Technology, Xi'an 710024; Sun, Jun

    2015-06-15

    In O-type high power microwave (HPM) devices, the annular relativistic electron beam is constrained by a strong guiding magnetic field and propagates through an interaction region to generate HPM. Some papers believe that the E × B drift of electrons may lead to beam breakup. This paper simplifies the interaction region with a smooth cylindrical waveguide to research the radial motion of electrons under conditions of strong guiding magnetic field and TM{sub 01} mode HPM. The single-particle trajectory shows that the radial electron motion presents the characteristic of radial guiding-center drift carrying cyclotron motion. The radial guiding-center drift is spatiallymore » periodic and is dominated by the polarization drift, not the E × B drift. Furthermore, the self fields of the beam space charge can provide a radial force which may pull electrons outward to some extent but will not affect the radial polarization drift. Despite the radial drift, the strong guiding magnetic field limits the drift amplitude to a small value and prevents beam breakup from happening due to this cause.« less

  16. Electric fields, electron production, and electron motion at the stripper foil in the Los Alamos Proton Storage Ring

    NASA Astrophysics Data System (ADS)

    Plum, M.

    The beam instability at the Los Alamos Proton Storage Ring (PSR) most likely involves coupled oscillations between electrons and protons. For this instability to occur, there must be a strong source of electrons. Investigation of the various sources of electrons in the PSR had begun. Copious electron production is expected in the injection section because this section contains the stripper foil. This foil is mounted near the center of the beam pipe, and both circulating and injected protons pass through it, thus allowing ample opportunity for electron production. This paper discusses various mechanisms for electron production, beam-induced electric fields, and electron motion in the vicinity of the foil.

  17. Communication: Vibrational and vibronic coherences in the two dimensional spectroscopy of coupled electron-nuclear motion.

    PubMed

    Albert, Julian; Falge, Mirjam; Gomez, Sandra; Sola, Ignacio R; Hildenbrand, Heiko; Engel, Volker

    2015-07-28

    We theoretically investigate the photon-echo spectroscopy of coupled electron-nuclear quantum dynamics. Two situations are treated. In the first case, the Born-Oppenheimer (adiabatic) approximation holds. It is then possible to interpret the two-dimensional (2D) spectra in terms of vibrational motion taking place in different electronic states. In particular, pure vibrational coherences which are related to oscillations in the time-dependent third-order polarization can be identified. This concept fails in the second case, where strong non-adiabatic coupling leads to the breakdown of the Born-Oppenheimer-approximation. Then, the 2D-spectra reveal a complicated vibronic structure and vibrational coherences cannot be disentangled from the electronic motion.

  18. Communication: Vibrational and vibronic coherences in the two dimensional spectroscopy of coupled electron-nuclear motion

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Albert, Julian; Falge, Mirjam; Hildenbrand, Heiko

    2015-07-28

    We theoretically investigate the photon-echo spectroscopy of coupled electron-nuclear quantum dynamics. Two situations are treated. In the first case, the Born-Oppenheimer (adiabatic) approximation holds. It is then possible to interpret the two-dimensional (2D) spectra in terms of vibrational motion taking place in different electronic states. In particular, pure vibrational coherences which are related to oscillations in the time-dependent third-order polarization can be identified. This concept fails in the second case, where strong non-adiabatic coupling leads to the breakdown of the Born-Oppenheimer-approximation. Then, the 2D-spectra reveal a complicated vibronic structure and vibrational coherences cannot be disentangled from the electronic motion.

  19. Modeling of the motion of automobile elastic wheel in real-time for creation of wheeled vehicles motion control electronic systems

    NASA Astrophysics Data System (ADS)

    Balakina, E. V.; Zotov, N. M.; Fedin, A. P.

    2018-02-01

    Modeling of the motion of the elastic wheel of the vehicle in real-time is used in the tasks of constructing different models in the creation of wheeled vehicles motion control electronic systems, in the creation of automobile stand-simulators etc. The accuracy and the reliability of simulation of the parameters of the wheel motion in real-time when rolling with a slip within the given road conditions are determined not only by the choice of the model, but also by the inaccuracy and instability of the numerical calculation. It is established that the inaccuracy and instability of the calculation depend on the size of the step of integration and the numerical method being used. The analysis of these inaccuracy and instability when wheel rolling with a slip was made and recommendations for reducing them were developed. It is established that the total allowable range of steps of integration is 0.001.0.005 s; the strongest instability is manifested in the calculation of the angular and linear accelerations of the wheel; the weakest instability is manifested in the calculation of the translational velocity of the wheel and moving of the center of the wheel; the instability is less at large values of slip angle and on more slippery surfaces. A new method of the average acceleration is suggested, which allows to significantly reduce (up to 100%) the manifesting of instability of the solution in the calculation of all parameters of motion of the elastic wheel for different braking conditions and for the entire range of steps of integration. The results of research can be applied to the selection of control algorithms in vehicles motion control electronic systems and in the testing stand-simulators

  20. Verification of the Rigidity of the Coulomb Field in Motion

    NASA Astrophysics Data System (ADS)

    Blinov, S. V.; Bulyzhenkov, I. É.

    2018-06-01

    Laplace, analyzing the stability of the Solar System, was the first to calculate that the velocity of the motion of force fields can significantly exceed the velocity of light waves. In electrodynamics, the Coulomb field should rigidly accompany its source for instantaneous force action in distant regions. Such rigid motion was recently inferred from experiments at the Frascati Beam Test Facility with short beams of relativistic electrons. The comments of the authors on their observations are at odds with the comments of theoreticians on retarded potentials, which motivates a detailed study of the positions of both sides. Predictions of measurements, based on the Lienard-Wiechert potentials, are used to propose an unambiguous scheme for testing the rigidity of the Coulomb field. Realization of the proposed experimental scheme could independently refute or support the assertions of the Italian physicists regarding the rigid motion of Coulomb fields and likewise the nondual field approach to macroscopic reality.

  1. The equation-of-motion coupled cluster method for triple electron attached states

    NASA Astrophysics Data System (ADS)

    Musiał, Monika; Olszówka, Marta; Lyakh, Dmitry I.; Bartlett, Rodney J.

    2012-11-01

    The initial implementation of the triple electron attachment (TEA) equation-of-motion (EOM) coupled cluster (CC) method is presented, aiming at the description of electronic states with three open shell electrons outside a suitably chosen closed shell vacuum. In particular, such an approach can be used for describing dissociation of chemical bonds predominantly formed by three valence electrons, for example, in LiC and NaC molecules. Both ground and excited states are considered while rigorously maintaining the correct spin value. The preliminary results show a correct asymptotic behavior of the dissociation curves. At the same time, we emphasize that a chemically accurate description will require an extension of the minimal TEA-EOM-CC model introduced here, analogous to those already used in the double ionization potential and double electron attachment methods.

  2. Diffraction contrast as a sensitive indicator of femtosecond sub-nanoscale motion in ultrafast transmission electron microscopy

    NASA Astrophysics Data System (ADS)

    Cremons, Daniel R.; Schliep, Karl B.; Flannigan, David J.

    2013-09-01

    With ultrafast transmission electron microscopy (UTEM), access can be gained to the spatiotemporal scales required to directly visualize rapid, non-equilibrium structural dynamics of materials. This is achieved by operating a transmission electron microscope (TEM) in a stroboscopic pump-probe fashion by photoelectrically generating coherent, well-timed electron packets in the gun region of the TEM. These probe photoelectrons are accelerated down the TEM column where they travel through the specimen before reaching a standard, commercially-available CCD detector. A second laser pulse is used to excite (pump) the specimen in situ. Structural changes are visualized by varying the arrival time of the pump laser pulse relative to the probe electron packet at the specimen. Here, we discuss how ultrafast nanoscale motions of crystalline materials can be visualized and precisely quantified using diffraction contrast in UTEM. Because diffraction contrast sensitively depends upon both crystal lattice orientation as well as incoming electron wavevector, minor spatial/directional variations in either will produce dynamic and often complex patterns in real-space images. This is because sections of the crystalline material that satisfy the Laue conditions may be heterogeneously distributed such that electron scattering vectors vary over nanoscale regions. Thus, minor changes in either crystal grain orientation, as occurs during specimen tilting, warping, or anisotropic expansion, or in the electron wavevector result in dramatic changes in the observed diffraction contrast. In this way, dynamic contrast patterns observed in UTEM images can be used as sensitive indicators of ultrafast specimen motion. Further, these motions can be spatiotemporally mapped such that direction and amplitude can be determined.

  3. Proposed imaging of the ultrafast electronic motion in samples using x-ray phase contrast.

    PubMed

    Dixit, Gopal; Slowik, Jan Malte; Santra, Robin

    2013-03-29

    Tracing the motion of electrons has enormous relevance to understanding ubiquitous phenomena in ultrafast science, such as the dynamical evolution of the electron density during complex chemical and biological processes. Scattering of ultrashort x-ray pulses from an electronic wave packet would appear to be the most obvious approach to image the electronic motion in real time and real space with the notion that such scattering patterns, in the far-field regime, encode the instantaneous electron density of the wave packet. However, recent results by Dixit et al. [Proc. Natl. Acad. Sci. U.S.A. 109, 11636 (2012)] have put this notion into question and have shown that the scattering in the far-field regime probes spatiotemporal density-density correlations. Here, we propose a possible way to image the instantaneous electron density of the wave packet via ultrafast x-ray phase contrast imaging. Moreover, we show that inelastic scattering processes, which plague ultrafast scattering in the far-field regime, do not contribute in ultrafast x-ray phase contrast imaging as a consequence of an interference effect. We illustrate our general findings by means of a wave packet that lies in the time and energy range of the dynamics of valence electrons in complex molecular and biological systems. This present work offers a potential to image not only instantaneous snapshots of nonstationary electron dynamics, but also the laplacian of these snapshots which provide information about the complex bonding and topology of the charge distributions in the systems.

  4. Proposed Imaging of the Ultrafast Electronic Motion in Samples using X-Ray Phase Contrast

    NASA Astrophysics Data System (ADS)

    Dixit, Gopal; Slowik, Jan Malte; Santra, Robin

    2013-03-01

    Tracing the motion of electrons has enormous relevance to understanding ubiquitous phenomena in ultrafast science, such as the dynamical evolution of the electron density during complex chemical and biological processes. Scattering of ultrashort x-ray pulses from an electronic wave packet would appear to be the most obvious approach to image the electronic motion in real time and real space with the notion that such scattering patterns, in the far-field regime, encode the instantaneous electron density of the wave packet. However, recent results by Dixit et al. [Proc. Natl. Acad. Sci. U.S.A. 109, 11 636 (2012)] have put this notion into question and have shown that the scattering in the far-field regime probes spatiotemporal density-density correlations. Here, we propose a possible way to image the instantaneous electron density of the wave packet via ultrafast x-ray phase contrast imaging. Moreover, we show that inelastic scattering processes, which plague ultrafast scattering in the far-field regime, do not contribute in ultrafast x-ray phase contrast imaging as a consequence of an interference effect. We illustrate our general findings by means of a wave packet that lies in the time and energy range of the dynamics of valence electrons in complex molecular and biological systems. This present work offers a potential to image not only instantaneous snapshots of nonstationary electron dynamics, but also the Laplacian of these snapshots which provide information about the complex bonding and topology of the charge distributions in the systems.

  5. Local Dynamic Stability Assessment of Motion Impaired Elderly Using Electronic Textile Pants.

    PubMed

    Liu, Jian; Lockhart, Thurmon E; Jones, Mark; Martin, Tom

    2008-10-01

    A clear association has been demonstrated between gait stability and falls in the elderly. Integration of wearable computing and human dynamic stability measures into home automation systems may help differentiate fall-prone individuals in a residential environment. The objective of the current study was to evaluate the capability of a pair of electronic textile (e-textile) pants system to assess local dynamic stability and to differentiate motion-impaired elderly from their healthy counterparts. A pair of e-textile pants comprised of numerous e-TAGs at locations corresponding to lower extremity joints was developed to collect acceleration, angular velocity and piezoelectric data. Four motion-impaired elderly together with nine healthy individuals (both young and old) participated in treadmill walking with a motion capture system simultaneously collecting kinematic data. Local dynamic stability, characterized by maximum Lyapunov exponent, was computed based on vertical acceleration and angular velocity at lower extremity joints for the measurements from both e-textile and motion capture systems. Results indicated that the motion-impaired elderly had significantly higher maximum Lyapunov exponents (computed from vertical acceleration data) than healthy individuals at the right ankle and hip joints. In addition, maximum Lyapunov exponents assessed by the motion capture system were found to be significantly higher than those assessed by the e-textile system. Despite the difference between these measurement techniques, attaching accelerometers at the ankle and hip joints was shown to be an effective sensor configuration. It was concluded that the e-textile pants system, via dynamic stability assessment, has the potential to identify motion-impaired elderly.

  6. Motion direction discrimination training reduces perceived motion repulsion.

    PubMed

    Jia, Ke; Li, Sheng

    2017-04-01

    Participants often exaggerate the perceived angular separation between two simultaneously presented motion stimuli, which is referred to as motion repulsion. The overestimation helps participants differentiate between the two superimposed motion directions, yet it causes the impairment of direction perception. Since direction perception can be refined through perceptual training, we here attempted to investigate whether the training of a direction discrimination task changes the amount of motion repulsion. Our results showed a direction-specific learning effect, which was accompanied by a reduced amount of motion repulsion both for the trained and the untrained directions. The reduction of the motion repulsion disappeared when the participants were trained on a luminance discrimination task (control experiment 1) or a speed discrimination task (control experiment 2), ruling out any possible interpretation in terms of adaptation or training-induced attentional bias. Furthermore, training with a direction discrimination task along a direction 150° away from both directions in the transparent stimulus (control experiment 3) also had little effect on the amount of motion repulsion, ruling out the contribution of task learning. The changed motion repulsion observed in the main experiment was consistent with the prediction of the recurrent model of perceptual learning. Therefore, our findings demonstrate that training in direction discrimination can benefit the precise direction perception of the transparent stimulus and provide new evidence for the recurrent model of perceptual learning.

  7. Motion of a virtual cathode in a cylindrical channel with electron beam transport in the “compressed” state

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Belomyttsev, S. Ya.; Grishkov, A. A.; Tsygankov, R. V.

    2014-03-15

    This paper studies the motion of a virtual cathode in a two-section drift tube with the formation and breakup of the “compressed” state of an electron beam. Experimental arrangements to intercept part of the injected current during the voltage pulse and to provide virtual cathode motion toward the collector are proposed. The arrangements were implemented on the SINUS-7 high-current electron accelerator. Theoretical and experimental dependences of the virtual cathode velocity on the injected current and cathode voltage are presented. The experimental data on virtual cathode motion agree with its theoretical model based on analytical solutions of equations assisted by computermore » simulation with the PIC code KARAT. The results of the work demonstrate the feasibility of controlling the virtual cathode motion which can be used in collective ion acceleration and microwave generation.« less

  8. Phonon assisted carrier motion on the Wannier-Stark ladder

    NASA Astrophysics Data System (ADS)

    Cheung, Alfred; Berciu, Mona

    2014-03-01

    It is well known that at zero temperature and in the absence of electron-phonon coupling, the presence of an electric field leads to localization of carriers residing in a single band of finite bandwidth. In this talk, we will present an implementation of the self-consistent Born approximation (SCBA) to study the effect of weak electron-phonon coupling on the motion of a carrier in a biased system. At moderate and strong electron-phonon coupling, we supplement the SCBA, describing the string of phonons left behind by the carrier, with the momentum average approximation to describe the phonon cloud that accompanies the resulting polaron. We find that coupling to the lattice delocalizes the carrier, as expected, although long-lived resonances resulting from the Wannier-Stark states of the polaron may appear in certain regions of the parameter space. We end with a discussion of how our method can be improved to model disorder, other types of electron-phonon coupling, and electron-hole pair dissociation in a biased system.

  9. Three axis electronic flight motion simulator real time control system design and implementation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gao, Zhiyuan; Miao, Zhonghua, E-mail: zhonghua-miao@163.com; Wang, Xiaohua

    2014-12-15

    A three axis electronic flight motion simulator is reported in this paper including the modelling, the controller design as well as the hardware implementation. This flight motion simulator could be used for inertial navigation test and high precision inertial navigation system with good dynamic and static performances. A real time control system is designed, several control system implementation problems were solved including time unification with parallel port interrupt, high speed finding-zero method of rotary inductosyn, zero-crossing management with continuous rotary, etc. Tests were carried out to show the effectiveness of the proposed real time control system.

  10. Three axis electronic flight motion simulator real time control system design and implementation.

    PubMed

    Gao, Zhiyuan; Miao, Zhonghua; Wang, Xuyong; Wang, Xiaohua

    2014-12-01

    A three axis electronic flight motion simulator is reported in this paper including the modelling, the controller design as well as the hardware implementation. This flight motion simulator could be used for inertial navigation test and high precision inertial navigation system with good dynamic and static performances. A real time control system is designed, several control system implementation problems were solved including time unification with parallel port interrupt, high speed finding-zero method of rotary inductosyn, zero-crossing management with continuous rotary, etc. Tests were carried out to show the effectiveness of the proposed real time control system.

  11. Accompanying coordinate expansion and recurrence relation method using a transfer relation scheme for electron repulsion integrals with high angular momenta and long contractions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hayami, Masao; Seino, Junji; Nakai, Hiromi, E-mail: nakai@waseda.jp

    An efficient algorithm for the rapid evaluation of electron repulsion integrals is proposed. The present method, denoted by accompanying coordinate expansion and transferred recurrence relation (ACE-TRR), is constructed using a transfer relation scheme based on the accompanying coordinate expansion and recurrence relation method. Furthermore, the ACE-TRR algorithm is extended for the general-contraction basis sets. Numerical assessments clarify the efficiency of the ACE-TRR method for the systems including heavy elements, whose orbitals have long contractions and high angular momenta, such as f- and g-orbitals.

  12. Mapping molecular motions leading to charge delocalization with ultrabright electrons

    NASA Astrophysics Data System (ADS)

    Sciaini, German

    2014-05-01

    Ultrafast diffraction has broken the barrier to atomic exploration by combining the atomic spatial resolution of diffraction techniques with the temporal resolution of ultrafast spectroscopy. X-ray free electron lasers, slicing techniques and femtosecond laser-driven X-ray and electron sources have been successfully applied for the study of ultrafast structural dynamics in a variety of samples. Yet, the application of fs-diffraction to the study of rather sensitive organic molecular crystals remains unexplored. Organic crystals are composed by weak scattering centres, often present low melting points, poor heat conductivity and are, typically, radiation sensitive. Low repetition rates (about tens of Hertz) are therefore required to overcome accumulative heating effects from the laser excitation that can degrade the sample and mask the structural dynamics. This imparts tremendous constraints on source brightness to acquire enough diffraction data before adverse photo-degradation effects have played a non-negligible role in the crystalline structure. We implemented ultra-bright femtosecond electron diffraction to obtain a movie of the relevant molecular motions driving the photo-induced insulator-to-metal phase transition in the organic charge-transfer salt (EDO-TTF)2PF6. On the first few picoseconds (0 - 10 ps) the structural evolution, well-described by three main reaction coordinates, reaches a transient intermediate state (TIS). Model structural refinement calculations indicate that fast sliding of flat EDO-TTF molecules with consecutive motion of PF6 counter-ions drive the formation of TS instead of the expected flattening of initially bent EDO-TTF moieties which seems to evolve through a slower thermal pathway that brings the system into a final high temperature-type state. These findings establish the potential of ultrabright femtosecond electron sources for probing the primary processes governing structural dynamics with atomic resolution in labile systems

  13. Mapping atomic motions with ultrabright electrons: towards fundamental limits in space-time resolution.

    PubMed

    Manz, Stephanie; Casandruc, Albert; Zhang, Dongfang; Zhong, Yinpeng; Loch, Rolf A; Marx, Alexander; Hasegawa, Taisuke; Liu, Lai Chung; Bayesteh, Shima; Delsim-Hashemi, Hossein; Hoffmann, Matthias; Felber, Matthias; Hachmann, Max; Mayet, Frank; Hirscht, Julian; Keskin, Sercan; Hada, Masaki; Epp, Sascha W; Flöttmann, Klaus; Miller, R J Dwayne

    2015-01-01

    The long held objective of directly observing atomic motions during the defining moments of chemistry has been achieved based on ultrabright electron sources that have given rise to a new field of atomically resolved structural dynamics. This class of experiments requires not only simultaneous sub-atomic spatial resolution with temporal resolution on the 100 femtosecond time scale but also has brightness requirements approaching single shot atomic resolution conditions. The brightness condition is in recognition that chemistry leads generally to irreversible changes in structure during the experimental conditions and that the nanoscale thin samples needed for electron structural probes pose upper limits to the available sample or "film" for atomic movies. Even in the case of reversible systems, the degree of excitation and thermal effects require the brightest sources possible for a given space-time resolution to observe the structural changes above background. Further progress in the field, particularly to the study of biological systems and solution reaction chemistry, requires increased brightness and spatial coherence, as well as an ability to tune the electron scattering cross-section to meet sample constraints. The electron bunch density or intensity depends directly on the magnitude of the extraction field for photoemitted electron sources and electron energy distribution in the transverse and longitudinal planes of electron propagation. This work examines the fundamental limits to optimizing these parameters based on relativistic electron sources using re-bunching cavity concepts that are now capable of achieving 10 femtosecond time scale resolution to capture the fastest nuclear motions. This analysis is given for both diffraction and real space imaging of structural dynamics in which there are several orders of magnitude higher space-time resolution with diffraction methods. The first experimental results from the Relativistic Electron Gun for Atomic

  14. Motion sickness severity and physiological correlates during repeated exposures to a rotating optokinetic drum

    NASA Technical Reports Server (NTRS)

    Hu, Senqi; Grant, Wanda F.; Stern, Robert M.; Koch, Kenneth L.

    1991-01-01

    Fifty-two subjects were exposed to a rotating optokinetic drum. Ten of these subjects who became motion sick during the first session completed two additional sessions. Subjects' symptoms of motion sickness, perception of self-motion, electrogastrograms (EGGs), heart rate, mean successive differences of R-R intervals (RRI), and skin conductance were recorded for each session. The results from the first session indicated that the development of motion sickness was accompanied by increased EGG 4-9 cpm activity (gastric tachyarrhythmia), decreased mean succesive differences of RRI, increased skin conductance levels, and increased self-motion perception. The results from the subjects who had three repeated sessions showed that 4-9 cpm EGG activity, skin conductance levels, perception of self-motion, and symptoms of motion sickness all increased significantly during the drum rotation period of the first session, but increased significantly less during the following sessions. Mean successive differences of RRI decreased significantly during the drum rotation period for the first session, but decreased significantly less during the following sessions. Results show that the development of motion sickness is accompanied by an increase in gastric tachyarrhythmia, and an increase in sympathetic activity and a decrease in parasympathetic activity, and that adaptation to motion sickness is accompanied by the recovery of autonomic nervous system balance.

  15. Visual and Non-Visual Contributions to the Perception of Object Motion during Self-Motion

    PubMed Central

    Fajen, Brett R.; Matthis, Jonathan S.

    2013-01-01

    Many locomotor tasks involve interactions with moving objects. When observer (i.e., self-)motion is accompanied by object motion, the optic flow field includes a component due to self-motion and a component due to object motion. For moving observers to perceive the movement of other objects relative to the stationary environment, the visual system could recover the object-motion component – that is, it could factor out the influence of self-motion. In principle, this could be achieved using visual self-motion information, non-visual self-motion information, or a combination of both. In this study, we report evidence that visual information about the speed (Experiment 1) and direction (Experiment 2) of self-motion plays a role in recovering the object-motion component even when non-visual self-motion information is also available. However, the magnitude of the effect was less than one would expect if subjects relied entirely on visual self-motion information. Taken together with previous studies, we conclude that when self-motion is real and actively generated, both visual and non-visual self-motion information contribute to the perception of object motion. We also consider the possible role of this process in visually guided interception and avoidance of moving objects. PMID:23408983

  16. Molecular Electronic Angular Motion Transducer Broad Band Self-Noise.

    PubMed

    Zaitsev, Dmitry; Agafonov, Vadim; Egorov, Egor; Antonov, Alexander; Shabalina, Anna

    2015-11-20

    Modern molecular electronic transfer (MET) angular motion sensors combine high technical characteristics with low cost. Self-noise is one of the key characteristics which determine applications for MET sensors. However, until the present there has not been a model describing the sensor noise in the complete operating frequency range. The present work reports the results of an experimental study of the self-noise level of such sensors in the frequency range of 0.01-200 Hz. Based on the experimental data, a theoretical model is developed. According to the model, self-noise is conditioned by thermal hydrodynamic fluctuations of the operating fluid flow in the frequency range of 0.01-2 Hz. At the frequency range of 2-100 Hz, the noise power spectral density has a specific inversely proportional dependence of the power spectral density on the frequency that could be attributed to convective processes. In the high frequency range of 100-200 Hz, the noise is conditioned by the voltage noise of the electronics module input stage operational amplifiers and is heavily reliant to the sensor electrical impedance. The presented results allow a deeper understanding of the molecular electronic sensor noise nature to suggest the ways to reduce it.

  17. Molecular Electronic Angular Motion Transducer Broad Band Self-Noise

    PubMed Central

    Zaitsev, Dmitry; Agafonov, Vadim; Egorov, Egor; Antonov, Alexander; Shabalina, Anna

    2015-01-01

    Modern molecular electronic transfer (MET) angular motion sensors combine high technical characteristics with low cost. Self-noise is one of the key characteristics which determine applications for MET sensors. However, until the present there has not been a model describing the sensor noise in the complete operating frequency range. The present work reports the results of an experimental study of the self-noise level of such sensors in the frequency range of 0.01–200 Hz. Based on the experimental data, a theoretical model is developed. According to the model, self-noise is conditioned by thermal hydrodynamic fluctuations of the operating fluid flow in the frequency range of 0.01–2 Hz. At the frequency range of 2–100 Hz, the noise power spectral density has a specific inversely proportional dependence of the power spectral density on the frequency that could be attributed to convective processes. In the high frequency range of 100–200 Hz, the noise is conditioned by the voltage noise of the electronics module input stage operational amplifiers and is heavily reliant to the sensor electrical impedance. The presented results allow a deeper understanding of the molecular electronic sensor noise nature to suggest the ways to reduce it. PMID:26610502

  18. Anti-correlated spectral motion in bisphthalocyanines: evidence for vibrational modulation of electronic mixing.

    PubMed

    Prall, Bradley S; Parkinson, Dilworth Y; Ishikawa, Naoto; Fleming, Graham R

    2005-12-08

    We exploit a coherently excited nuclear wave packet to study nuclear motion modulation of electronic structure in a metal bridged phthalocyanine dimer, lutetium bisphthalocyanine, which displays two visible absorption bands. We find that the nuclear coordinate influences the energies of the underlying exciton and charge resonance states as well as their interaction; the interplay of the various couplings creates unusual anti-correlated spectral motion in the two bands. Excited state relaxation dynamics are the same regardless of which transition is pumped, with decay time constants of 1.5 and 11 ps. The dynamics are analyzed using a three-state kinetic model after relaxation from one or two additional states faster than the experimental time resolution of 50-100 fs.

  19. Structure and electronic properties of ion pairs accompanying cyclic morpholinium cation and alkylphosphite anion based ionic liquids

    NASA Astrophysics Data System (ADS)

    Verma, Prakash L.; Singh, Priti; Gejji, Shridhar P.

    2017-07-01

    Molecular insights for the formation of ion pairs accompanying the cyclic ammonium cation based room temperature ionic liquids (RTILs) composed of alkyl substituted N-methylmorpholinium (RMMor) and alkylphosphite [(Rsbnd O)2PHdbnd O] (Rdbnd ethyl, butyl, hexyl, octyl) anion have been derived from the M06-2x level of theory. Electronic structures, binding energies, and spectral characteristics of the ion pairs underlying these RTILs have been characterized. The ion pair formation is largely governed by Csbnd H⋯O and other intermolecular interactions. Calculated binding energies increase with the increasing alkyl chain on either cation or alkylphosphite anion. The cation-anion binding reveals signature in the frequency down-(red) shift of the characteristic anionic Pdbnd O stretching whereas the Psbnd H stretching exhibits a shift in the opposite direction in vibrational spectra which has further been rationalized through molecular electron density topography. Correlations of measured electrochemical stability with the separation of frontier orbital energies and binding energies in the ion pairs have further been established.

  20. Analysis of Methods to Excite Head-Tail Motion Within the Cornell Electron Storage Ring

    NASA Astrophysics Data System (ADS)

    Gendler, Naomi; Billing, Mike; Shanks, Jim

    The main accelerator complex at Cornell consists of two rings around which electrons and positrons move: the synchrotron, where the particles are accelerated to 5 GeV, and the Storage Ring, where the particles circulate a ta Þxed energy, guided by quadrupole and dipole magnets, with a steady energy due to a sinusoidal voltage source. Keeping the beam stable in the Storage Ring is crucial for its lifetime. A long-lasting, invariable beam means more accurate experiments, as well as brighter, more focused X-rays for use in the Cornell High Energy Synchrotron Source (CHESS). The stability of the electron and positron beams in the Cornell Electron Storage Ring (CESR) is important for the development of accelerators and for usage of the beam in X-ray science and accelerator physics. Bunch oscillations tend to enlarge the beam's cross section, making it less stable. We believe that one such oscillation is ``head-tail motion,'' where the bunch rocks back and forth on a pivot located at the central particle. In this project, we write a simulation of the bunch that induces head-tail motion with a vertical driver. We also excite this motion physically in the storage ring, and observe a deÞnite head-tail signal. In the experiment, we saw a deÞnite persistence of the drive-damp signal within a small band around the head-tail frequency, indicating that the head-tail frequency is a natural vertical mode of the bunch that was being excited. The signal seen in the experiment matched the signal seen in the simulation to within an order of magnitude.

  1. Audio Implementation of Still and Motion Pictures. Final Report.

    ERIC Educational Resources Information Center

    Allen, William H.; And Others

    An experiment comparing the pedagogical effectiveness of five different modes of audio narration in motion and still pictures showed only small differences in sixth graders' learning. Ten experimental groups were formed in which the 351 subjects viewed motion pictures and still slides accompanied by supplementary, redundant, directive,…

  2. Extracellular matrix motion and early morphogenesis

    PubMed Central

    Loganathan, Rajprasad; Rongish, Brenda J.; Smith, Christopher M.; Filla, Michael B.; Czirok, Andras; Bénazéraf, Bertrand

    2016-01-01

    For over a century, embryologists who studied cellular motion in early amniotes generally assumed that morphogenetic movement reflected migration relative to a static extracellular matrix (ECM) scaffold. However, as we discuss in this Review, recent investigations reveal that the ECM is also moving during morphogenesis. Time-lapse studies show how convective tissue displacement patterns, as visualized by ECM markers, contribute to morphogenesis and organogenesis. Computational image analysis distinguishes between cell-autonomous (active) displacements and convection caused by large-scale (composite) tissue movements. Modern quantification of large-scale ‘total’ cellular motion and the accompanying ECM motion in the embryo demonstrates that a dynamic ECM is required for generation of the emergent motion patterns that drive amniote morphogenesis. PMID:27302396

  3. Initial Atomic Motion Immediately Following Femtosecond-Laser Excitation in Phase-Change Materials.

    PubMed

    Matsubara, E; Okada, S; Ichitsubo, T; Kawaguchi, T; Hirata, A; Guan, P F; Tokuda, K; Tanimura, K; Matsunaga, T; Chen, M W; Yamada, N

    2016-09-23

    Despite the fact that phase-change materials are widely used for data storage, no consensus exists on the unique mechanism of their ultrafast phase change and its accompanied large and rapid optical change. By using the pump-probe observation method combining a femtosecond optical laser and an x-ray free-electron laser, we substantiate experimentally that, in both GeTe and Ge_{2}Sb_{2}Te_{5} crystals, rattling motion of mainly Ge atoms takes place with keeping the off-center position just after femtosecond-optical-laser irradiation, which eventually leads to a higher symmetry or disordered state. This very initial rattling motion in the undistorted lattice can be related to instantaneous optical change due to the loss of resonant bonding that characterizes GeTe-based phase change materials. Based on the amorphous structure derived by first-principles molecular dynamics simulation, we infer a plausible ultrafast amorphization mechanism via nonmelting.

  4. Extracellular matrix motion and early morphogenesis.

    PubMed

    Loganathan, Rajprasad; Rongish, Brenda J; Smith, Christopher M; Filla, Michael B; Czirok, Andras; Bénazéraf, Bertrand; Little, Charles D

    2016-06-15

    For over a century, embryologists who studied cellular motion in early amniotes generally assumed that morphogenetic movement reflected migration relative to a static extracellular matrix (ECM) scaffold. However, as we discuss in this Review, recent investigations reveal that the ECM is also moving during morphogenesis. Time-lapse studies show how convective tissue displacement patterns, as visualized by ECM markers, contribute to morphogenesis and organogenesis. Computational image analysis distinguishes between cell-autonomous (active) displacements and convection caused by large-scale (composite) tissue movements. Modern quantification of large-scale 'total' cellular motion and the accompanying ECM motion in the embryo demonstrates that a dynamic ECM is required for generation of the emergent motion patterns that drive amniote morphogenesis. © 2016. Published by The Company of Biologists Ltd.

  5. Electronic excitations and self-trapping of electrons and holes in CaSO4

    NASA Astrophysics Data System (ADS)

    Kudryavtseva, I.; Klopov, M.; Lushchik, A.; Lushchik, Ch; Maaroos, A.; Pishtshev, A.

    2014-04-01

    A first-principles study of the electronic properties of a CaSO4 anhydrite structural phase has been performed. A theoretical estimation for the fundamental band gap (p → s transitions) is Eg = 9.6 eV and a proper threshold for p → d transitions is Epd = 10.8 eV. These values agree with the data obtained for a set of CaSO4 doped with Gd3+, Dy3+, Tm3+ and Tb3+ ions using the methods of low-temperature highly sensitive luminescence and thermoactivation spectroscopy. The results are consistent with theoretical predictions of a possible low-temperature self-trapping of oxygen p-holes. The hopping diffusion of hole polarons starts above ˜40 K and is accompanied by a ˜50-60 K peak of thermally stimulated luminescence of RE3+ ions caused due to the recombination of hole polarons with the electrons localized at RE3+. There is no direct evidence of the self-trapping of heavy d-electrons, however, one can argue that their motion rather differs from that of conduction s-electrons.

  6. Trapping boundary and field-line motion during geomagnetic storms.

    NASA Technical Reports Server (NTRS)

    Kaufmann, R. L.; Horng, J.-T.; Konradi, A.

    1972-01-01

    Observation that the high-latitude trapping boundary for 20-keV electrons and 100-keV protons became very thin in the early morning hours during two intense substorms. The gradients were too steep to be maintained by drifting particles, so they must have been produced locally over the nightside of the earth. The flux gradient is seen to move at speeds in excess of 100 km/sec. Plasma appears to move away from the tail and around the earth at these high speeds during the sudden expansion phases of the substorms. The rapid plasma motion requires the presence of fluctuating electric fields that sometimes exceed 50 to 100 mV/m at a geomagnetic latitude of 30 deg on the L = 5 field line. These observations fit best into a model that contains two field-aligned sheet currents. The high electric fields that accompany the rapid plasma flow can produce nonadiabatic acceleration of 0.1- to 1-MeV electrons and protons.

  7. [Comprehension of emotions accompanied by everyday actions: comparison of biological-motion pictures with real-person pictures].

    PubMed

    Higashiyama, Atsuki; Imoto, Hisato; Tsuinashi, Seiichi

    2005-12-01

    Forty participants viewed and interpreted videotapes that were composed of displays representing different human actions (e.g., running and washing hands) and emotions (pleasant, neutral, and unpleasant). Half the videotapes were usual movies of real persons and the other videotapes were biological motions as produced by 22 light points on a human body in otherwise total darkness. In each display, an expert or a novice played a series of large or small body actions under each emotion. We found that (1) pleasant-unpleasant feeling was well discriminated in the real-person displays and in the biological motion display of large body actions, but it was less discriminated in the biological-motion displays of small body actions, (2) actions by experts were rated to be pleasant, and (3) actions were successfully identified for the real displays of large actions by experts, but they were poorly identified for the biological-motion displays of small body actions by novices. These results suggested that the observers correctly judged the emotion of players that was represented through suitable actions.

  8. Quasicharacteristic radiation of relativistic electrons at orientation motion in lithium halides crystals along charged planes and axes

    NASA Astrophysics Data System (ADS)

    Maksyuta, N. V.; Vysotskii, V. I.; Efimenko, S. V.

    2016-07-01

    The paper deals with the investigation of the orientation motion of relativistic electrons in charged (111) planes and charged [110] axes of lithium halides ionic crystals of LiF, LiCl, LiBr and LiI. On the basis of these investigations the spectra of quasicharacteristic radiation for the electron beams with various Lorentz-factors both in planar and axial cases have been calculated numerically.

  9. Stochastic particle instability for electron motion in combined helical wiggler, radiation, and longitudinal wave fields

    NASA Astrophysics Data System (ADS)

    Davidson, Ronald C.; McMullin, Wayne A.

    1982-07-01

    The relativistic motion of an electron is calculated in the combined fields of a transverse helical wiggler field (axial wavelength is λ0=2πk0) and the constant-amplitude, circularly polarized primary electromagnetic wave (δBT,ω,k) propagating in the z direction. For particle velocity near the beat-wave phase velocity ω(k+k0) of the primary wave, it is shown that the presence of a second, moderate-amplitude longitudinal wave (δÊL,ω,k) or transverse electromagnetic wave (δB2,ω2,k2) can lead to stochastic particle instability in which particles trapped near the separatrix of the primary wave undergo a systematic departure from the potential well. The condition for onset of instability is calculated, and the importance of these results for free-electron-laser (FEL) application is discussed. For development of long-pulse or steady-state free-electron lasers, the maintenance of beam integrity for an extended period of time will be of considerable practical importance. The fact that the presence of secondary, moderate-amplitude longitudinal or transverse electromagnetic waves can destroy coherent motion for certain classes of beam particles moving with velocity near ω(k+k0) may lead to a degradation of beam quality and concomitant modification of FEL emission properties.

  10. Thon rings from amorphous ice and implications of beam-induced Brownian motion in single particle electron cryo-microscopy.

    PubMed

    McMullan, G; Vinothkumar, K R; Henderson, R

    2015-11-01

    We have recorded dose-fractionated electron cryo-microscope images of thin films of pure flash-frozen amorphous ice and pre-irradiated amorphous carbon on a Falcon II direct electron detector using 300 keV electrons. We observe Thon rings [1] in both the power spectrum of the summed frames and the sum of power spectra from the individual frames. The Thon rings from amorphous carbon images are always more visible in the power spectrum of the summed frames whereas those of amorphous ice are more visible in the sum of power spectra from the individual frames. This difference indicates that while pre-irradiated carbon behaves like a solid during the exposure, amorphous ice behaves like a fluid with the individual water molecules undergoing beam-induced motion. Using the measured variation in the power spectra amplitude with number of electrons per image we deduce that water molecules are randomly displaced by a mean squared distance of ∼1.1 Å(2) for every incident 300 keV e(-)/Å(2). The induced motion leads to an optimal exposure with 300 keV electrons of 4.0 e(-)/Å(2) per image with which to observe Thon rings centred around the strong 3.7 Å scattering peak from amorphous ice. The beam-induced movement of the water molecules generates pseudo-Brownian motion of embedded macromolecules. The resulting blurring of single particle images contributes an additional term, on top of that from radiation damage, to the minimum achievable B-factor for macromolecular structure determination. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  11. Classical Coset Hamiltonian for the Electronic Motion and its Application to Anderson Localization and Hammett Equation

    NASA Astrophysics Data System (ADS)

    Xing, Guan; Wu, Guo-Zhen

    2001-02-01

    A classical coset Hamiltonian is introduced for the system of one electron in multi-sites. By this Hamiltonian, the dynamical behaviour of the electronic motion can be readily simulated. The simulation reproduces the retardation of the electron density decay in a lattice with site energies randomly distributed - an analogy with Anderson localization. This algorithm is also applied to reproduce the Hammett equation which relates the reaction rate with the property of the substitutions in the organic chemical reactions. The advantages and shortcomings of this algorithm, as contrasted with traditional quantum methods such as the molecular orbital theory, are also discussed.

  12. Global plastic surgeons images depicted in motion pictures.

    PubMed

    Hwang, Se Jin; Park, Sowhey; Hwang, Kun

    2013-03-01

    Motion pictures are made to entertain and enlighten people, but they are viewed differently by different people. What one considers to be a tearjerker may induce giggles in another. We have gained added interest in this because our professional pictures contain plastic surgery in their venue. We have recently reviewed 21 motion pictures that were made from 1928 to 2006 and that includes plastic surgical procedures in their content. As a habit, we tried to analyze them from a surgical point of view. About one third (35.7%) of the patients were criminals, whereas 14.3% of them were spies. One third of the procedures were done by illegitimate "surgeons," whereas a quarter of the procedures (25%) were performed by renowned surgeons. Surgeons who were in love with the patients did the rest (25%) of the operations. The complication rate was 14.3%; the surgery was successful in 85.7% of cases, but were the patients happy with the results? This was not the case in the movies. Only 7.7% were happy; 14.5 % of them were eminently unhappy. Why the discrepancy? It is difficult to analyze the minds of the people in the film, but considering that the majority of the characters in the films were rather unsavory, one may deduce that a crooked mind functions differently. Motion pictures have advanced greatly in the past several decades with the advent of improved mechanical and electronic devices, and plastic surgery as also advanced in tandem. This surgical field has become a common procedure in our daily life. It is readily available and mostly painless. However, the public sees it in only one way, that is, that the performing physicians are highly compensated. Very few consider the efforts and the suffering that accompanies each and every surgical procedure as it is performed. Perhaps, it is too much to hope for a day that will come when we will see a film that portrays the mental anguish that accompanies each and every procedure the plastic surgeon makes.

  13. Direct Visualization of Valence Electron Motion Using Strong-Field Photoelectron Holography

    NASA Astrophysics Data System (ADS)

    He, Mingrui; Li, Yang; Zhou, Yueming; Li, Min; Cao, Wei; Lu, Peixiang

    2018-03-01

    Watching the valence electron move in molecules on its intrinsic timescale has been one of the central goals of attosecond science and it requires measurements with subatomic spatial and attosecond temporal resolutions. The time-resolved photoelectron holography in strong-field tunneling ionization holds the promise to access this realm. However, it remains to be a challenging task hitherto. Here we reveal how the information of valence electron motion is encoded in the hologram of the photoelectron momentum distribution (PEMD) and develop a novel approach of retrieval. As a demonstration, applying it to the PEMDs obtained by solving the time-dependent Schrödinger equation for the prototypical molecule H2+ , the attosecond charge migration is directly visualized with picometer spatial and attosecond temporal resolutions. Our method represents a general approach for monitoring attosecond charge migration in more complex polyatomic and biological molecules, which is one of the central tasks in the newly emerging attosecond chemistry.

  14. Direct Visualization of Valence Electron Motion Using Strong-Field Photoelectron Holography.

    PubMed

    He, Mingrui; Li, Yang; Zhou, Yueming; Li, Min; Cao, Wei; Lu, Peixiang

    2018-03-30

    Watching the valence electron move in molecules on its intrinsic timescale has been one of the central goals of attosecond science and it requires measurements with subatomic spatial and attosecond temporal resolutions. The time-resolved photoelectron holography in strong-field tunneling ionization holds the promise to access this realm. However, it remains to be a challenging task hitherto. Here we reveal how the information of valence electron motion is encoded in the hologram of the photoelectron momentum distribution (PEMD) and develop a novel approach of retrieval. As a demonstration, applying it to the PEMDs obtained by solving the time-dependent Schrödinger equation for the prototypical molecule H_{2}^{+}, the attosecond charge migration is directly visualized with picometer spatial and attosecond temporal resolutions. Our method represents a general approach for monitoring attosecond charge migration in more complex polyatomic and biological molecules, which is one of the central tasks in the newly emerging attosecond chemistry.

  15. 10 CFR 2.323 - Motions.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 10 Energy 1 2012-01-01 2012-01-01 false Motions. 2.323 Section 2.323 Energy NUCLEAR REGULATORY... and served on all parties to the proceeding. (b) Form and content. Unless made orally on-the-record... accompanied by any affidavits or other evidence relied on, and, as appropriate, a proposed form of order. A...

  16. 10 CFR 2.323 - Motions.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 10 Energy 1 2011-01-01 2011-01-01 false Motions. 2.323 Section 2.323 Energy NUCLEAR REGULATORY... and served on all parties to the proceeding. (b) Form and content. Unless made orally on-the-record... accompanied by any affidavits or other evidence relied on, and, as appropriate, a proposed form of order. A...

  17. Heat- and electron-beam-induced transport of gold particles into silicon oxide and silicon studied by in situ high-resolution transmission electron microscopy.

    PubMed

    Biskupek, Johannes; Kaiser, Ute; Falk, Fritz

    2008-06-01

    In this study, we describe the transport of gold (Au) nanoparticles from the surface into crystalline silicon (Si) covered by silicon oxide (SiO(2)) as revealed by in situ high-resolution transmission electron microscopy. Complete crystalline Au nanoparticles sink through the SiO(2) layer into the Si substrate when high-dose electron irradiation is applied and temperature is raised above 150 degrees C. Above temperatures of 250 degrees C, the Au nanoparticles finally dissolve into fragments accompanied by crystallization of the amorphized Si substrate around these fragments. The transport process is explained by a wetting process followed by Stokes motion. Modelling this process yields boundaries for the interface energies involved.

  18. Inelastic electron tunneling mediated by a molecular quantum rotator

    NASA Astrophysics Data System (ADS)

    Sugimoto, Toshiki; Kunisada, Yuji; Fukutani, Katsuyuki

    2017-12-01

    Inelastic electron tunneling (IET) accompanying nuclear motion is not only of fundamental physical interest but also has strong impacts on chemical and biological processes in nature. Although excitation of rotational motion plays an important role in enhancing electric conductance at a low bias, the mechanism of rotational excitation remains veiled. Here, we present a basic theoretical framework of IET that explicitly takes into consideration quantum angular momentum, focusing on a molecular H2 rotator trapped in a nanocavity between two metallic electrodes as a model system. It is shown that orientationally anisotropic electrode-rotator coupling is the origin of angular-momentum exchange between the electron and molecule; we found that the anisotropic coupling imposes rigorous selection rules in rotational excitation. In addition, rotational symmetry breaking induced by the anisotropic potential lifts the degeneracy of the energy level of the degenerated rotational state of the quantum rotator and tunes the threshold bias voltage that triggers rotational IET. Our theoretical results provide a paradigm for physical understanding of the rotational IET process and spectroscopy, as well as molecular-level design of electron-rotation coupling in nanoelectronics.

  19. Measuring mandibular motions

    NASA Technical Reports Server (NTRS)

    Dimeff, J.; Rositano, S.; Taylor, R. C.

    1977-01-01

    Mandibular motion along three axes is measured by three motion transducers on floating yoke that rests against mandible. System includes electronics to provide variety of outputs for data display and processing. Head frame is strapped to test subject's skull to provide fixed point of reference for transducers.

  20. Hyperspherical nuclear motion of H3 + and D3 + in the electronic triplet state, a 3Sigmau +.

    PubMed

    Ferreira, Tiago Mendes; Alijah, Alexander; Varandas, António J C

    2008-02-07

    The potential energy surface of H(3) (+) in the lowest electronic triplet state, a (3)Sigma(u) (+), shows three equivalent minima at linear nuclear configurations. The vibrational levels of H(3) (+) and D(3) (+) on this surface can therefore be described as superimposed linear molecule states. Owing to such a superposition, each vibrational state characterized by quantum numbers of an isolated linear molecule obtains a one- and a two-dimensional component. The energy splittings between the two components have now been rationalized within a hyperspherical picture. It is shown that nuclear motion along the hyperangle phi mainly accounts for the splittings and provides upper bounds. This hyperspherical motion can be considered an extension of the antisymmetric stretching motion of the individual linear molecule.

  1. Ion Motion Induced Emittance Growth of Matched Electron Beams in Plasma Wakefields.

    PubMed

    An, Weiming; Lu, Wei; Huang, Chengkun; Xu, Xinlu; Hogan, Mark J; Joshi, Chan; Mori, Warren B

    2017-06-16

    Plasma-based acceleration is being considered as the basis for building a future linear collider. Nonlinear plasma wakefields have ideal properties for accelerating and focusing electron beams. Preservation of the emittance of nano-Coulomb beams with nanometer scale matched spot sizes in these wakefields remains a critical issue due to ion motion caused by their large space charge forces. We use fully resolved quasistatic particle-in-cell simulations of electron beams in hydrogen and lithium plasmas, including when the accelerated beam has different emittances in the two transverse planes. The projected emittance initially grows and rapidly saturates with a maximum emittance growth of less than 80% in hydrogen and 20% in lithium. The use of overfocused beams is found to dramatically reduce the emittance growth. The underlying physics that leads to the lower than expected emittance growth is elucidated.

  2. Domain wall motion in ferroelectrics: Barkhausen noise

    NASA Astrophysics Data System (ADS)

    Shur, V.; Rumyantsev, E.; Kozhevnikov, V.; Nikolaeva, E.; Shishkin, E.

    2002-03-01

    The switching current noise has been recorded during polarization reversal in single-crystalline gadolinium molybdate (GMO) and lithium tantalate (LT). Analysis of Barkhausen noise (BN) data allows to classify the noise types by determination of the critical indexes and fractal dimensions. BN is manifested as the short pulses during the polarization reversal. We have analyzed the BN data recorded in GMO and LT with various types of controlled domain structure. The data treatment in terms of probability distribution of duration, area and energy of individual pulses reveals the critical behavior typical for the fractal records in time. We used the Fourier transform and Hurst's rescaled range analysis for obtaining the Hurst factor, fractal dimension and classifying the noise types. We investigated by computer simulation the mechanism of sideways motion of 180O domain wall by nucleation at the wall taking into account the nuclei-nuclei interaction. It was shown that the moving domain walls display the fractal shape and their motion is accompanied by Flicker noise, which is in accord with experimental data. The research was made possible in part by Programs "Basic Research in Russian Universities" and "Priority Research in High School. Electronics", by Grant No. 01-02-17443 of RFBR, by Award No.REC-005 of CRDF.

  3. Time-resolved photoelectron spectroscopy of IR-driven electron dynamics in a charge transfer model system.

    PubMed

    Falge, Mirjam; Fröbel, Friedrich Georg; Engel, Volker; Gräfe, Stefanie

    2017-08-02

    If the adiabatic approximation is valid, electrons smoothly adapt to molecular geometry changes. In contrast, as a characteristic of diabatic dynamics, the electron density does not follow the nuclear motion. Recently, we have shown that the asymmetry in time-resolved photoelectron spectra serves as a tool to distinguish between these dynamics [Falge et al., J. Phys. Chem. Lett., 2012, 3, 2617]. Here, we investigate the influence of an additional, moderately intense infrared (IR) laser field, as often applied in attosecond time-resolved experiments, on such asymmetries. This is done using a simple model for coupled electronic-nuclear motion. We calculate time-resolved photoelectron spectra and their asymmetries and demonstrate that the spectra directly map the bound electron-nuclear dynamics. From the asymmetries, we can trace the IR field-induced population transfer and both the field-driven and intrinsic (non-)adiabatic dynamics. This holds true when considering superposition states accompanied by electronic coherences. The latter are observable in the asymmetries for sufficiently short XUV pulses to coherently probe the coupled states. It is thus documented that the asymmetry is a measure for phases in bound electron wave packets and non-adiabatic dynamics.

  4. Bifurcation theory applied to aircraft motions

    NASA Technical Reports Server (NTRS)

    Hui, W. H.; Tobak, M.

    1985-01-01

    Bifurcation theory is used to analyze the nonlinear dynamic stability characteristics of single-degree-of-freedom motions of an aircraft or a flap about a trim position. The bifurcation theory analysis reveals that when the bifurcation parameter, e.g., the angle of attack, is increased beyond a critical value at which the aerodynamic damping vanishes, a new solution representing finite-amplitude periodic motion bifurcates from the previously stable steady motion. The sign of a simple criterion, cast in terms of aerodynamic properties, determines whether the bifurcating solution is stable (supercritical) or unstable (subcritical). For the pitching motion of a flap-plate airfoil flying at supersonic/hypersonic speed, and for oscillation of a flap at transonic speed, the bifurcation is subcritical, implying either that exchanges of stability between steady and periodic motion are accompanied by hysteresis phenomena, or that potentially large aperiodic departures from steady motion may develop. On the other hand, for the rolling oscillation of a slender delta wing in subsonic flight (wing rock), the bifurcation is found to be supercritical. This and the predicted amplitude of the bifurcation periodic motion are in good agreement with experiments.

  5. Bifurcation theory applied to aircraft motions

    NASA Technical Reports Server (NTRS)

    Hui, W. H.; Tobak, M.

    1985-01-01

    The bifurcation theory is used to analyze the nonlinear dynamic stability characteristics of single-degree-of-freedom motions of an aircraft or a flap about a trim position. The bifurcation theory analysis reveals that when the bifurcation parameter, e.g., the angle of attack, is increased beyond a critical value at which the aerodynamic damping vanishes, a new solution representing finite-amplitude periodic motion bifurcates from the previously stable steady motion. The sign of a simple criterion, cast in terms of aerodynamic properties, determines whether the bifurcating solution is stable (supercritical) or unstable (critical). For the pitching motion of a flap-plate airfoil flying at supersonic/hypersonic speed, and for oscillation of a flap at transonic speed, the bifurcation is subcritical, implying either that exchanges of stability between steady and periodic motion are accompanied by hysteresis phenomena, or that potentially large aperiodic departures from steady motion may develop. On the other hand, for the rolling oscillation of a slender delta wing in subsonic flight (wing rock), the bifurcation is found to be supercritical. This and the predicted amplitude of the bifurcation periodic motion are in good agreement with the experiments.

  6. Ion Motion Induced Emittance Growth of Matched Electron Beams in Plasma Wakefields

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    An, Weiming; Lu, Wei; Huang, Chengkun

    2017-06-14

    Plasma-based acceleration is being considered as the basis for building a future linear collider. Nonlinear plasma wakefields have ideal properties for accelerating and focusing electron beams. Preservation of the emittance of nano-Coulomb beams with nanometer scale matched spot sizes in these wakefields remains a critical issue due to ion motion caused by their large space charge forces. We use fully resolved quasistatic particle-in-cell simulations of electron beams in hydrogen and lithium plasmas, including when the accelerated beam has different emittances in the two transverse planes. The projected emittance initially grows and rapidly saturates with a maximum emittance growth of lessmore » than 80% in hydrogen and 20% in lithium. The use of overfocused beams is found to dramatically reduce the emittance growth. In conclusion, the underlying physics that leads to the lower than expected emittance growth is elucidated.« less

  7. The Mechanism of Atomization Accompanying Solid Injection

    NASA Technical Reports Server (NTRS)

    Castleman, R A , Jr

    1933-01-01

    A brief historical and descriptive account of solid injection is followed by a detailed review of the available theoretical and experimental data that seem to throw light on the mechanism of this form of atomization. It is concluded that this evidence indicates that (1) the atomization accompanying solid injection occurs at the surface of the liquid after it issues as a solid stream from the orifice; and (2) that such atomization has a mechanism physically identical with the atomization which takes place in an air stream, both being due merely to the formation, at the gas-liquid interface, of fine ligaments under the influence of the relative motion of gas and liquid, and to their collapse, under the influence of surface tension, to form the drops in the spray.

  8. Lexical, Syntactic, and Semantic-Geometric Factors in the Acquisition of Motion Predicates

    ERIC Educational Resources Information Center

    Skordos, Dimitrios; Papafragou, Anna

    2014-01-01

    We report a study that explored the mechanisms used in hypothesizing meanings for novel motion predicates (verbs and prepositions) cross-linguistically. Motion stimuli were presented to English- and Greek-speaking adults and preschoolers accompanied by (a) a novel intransitive verb, (b) a novel transitive verb, (c) a novel transitive preposition,…

  9. Objective Motion Cueing Criteria Investigation Based on Three Flight Tasks

    NASA Technical Reports Server (NTRS)

    Zaal, Petrus M. T.; Schroeder, Jeffery A.; Chung, William W.

    2015-01-01

    This paper intends to help establish fidelity criteria to accompany the simulator motion system diagnostic test specified by the International Civil Aviation Organization. Twelve air- line transport pilots flew three tasks in the NASA Vertical Motion Simulator under four different motion conditions. The experiment used three different hexapod motion configurations, each with a different tradeoff between motion filter gain and break frequency, and one large motion configuration that utilized as much of the simulator's motion space as possible. The motion condition significantly affected: 1) pilot motion fidelity ratings, and sink rate and lateral deviation at touchdown for the approach and landing task, 2) pilot motion fidelity ratings, roll deviations, maximum pitch rate, and number of stick shaker activations in the stall task, and 3) heading deviation after an engine failure in the takeoff task. Significant differences in pilot-vehicle performance were used to define initial objective motion cueing criteria boundaries. These initial fidelity boundaries show promise but need refinement.

  10. Probing and Exploiting the Interplay between Nuclear and Electronic Motion in Charge Transfer Processes.

    PubMed

    Delor, Milan; Sazanovich, Igor V; Towrie, Michael; Weinstein, Julia A

    2015-04-21

    The Born-Oppenheimer approximation refers to the assumption that the nuclear and electronic wave functions describing a molecular system evolve and can be determined independently. It is now well-known that this approximation often breaks down and that nuclear-electronic (vibronic) coupling contributes greatly to the ultrafast photophysics and photochemistry observed in many systems ranging from simple molecules to biological organisms. In order to probe vibronic coupling in a time-dependent manner, one must use spectroscopic tools capable of correlating the motions of electrons and nuclei on an ultrafast time scale. Recent developments in nonlinear multidimensional electronic and vibrational spectroscopies allow monitoring both electronic and structural factors with unprecedented time and spatial resolution. In this Account, we present recent studies from our group that make use of different variants of frequency-domain transient two-dimensional infrared (T-2DIR) spectroscopy, a pulse sequence combining electronic and vibrational excitations in the form of a UV-visible pump, a narrowband (12 cm(-1)) IR pump, and a broadband (400 cm(-1)) IR probe. In the first example, T-2DIR is used to directly compare vibrational dynamics in the ground and relaxed electronic excited states of Re(Cl)(CO)3(4,4'-diethylester-2,2'-bipyridine) and Ru(4,4'-diethylester-2,2'-bipyridine)2(NCS)2, prototypical charge transfer complexes used in photocatalytic CO2 reduction and electron injection in dye-sensitized solar cells. The experiments show that intramolecular vibrational redistribution (IVR) and vibrational energy transfer (VET) are up to an order of magnitude faster in the triplet charge transfer excited state than in the ground state. These results show the influence of electronic arrangement on vibrational coupling patterns, with direct implications for vibronic coupling mechanisms in charge transfer excited states. In the second example, we show unambiguously that electronic and

  11. Open architecture CMM motion controller

    NASA Astrophysics Data System (ADS)

    Chang, David; Spence, Allan D.; Bigg, Steve; Heslip, Joe; Peterson, John

    2001-12-01

    Although initially the only Coordinate Measuring Machine (CMM) sensor available was a touch trigger probe, technological advances in sensors and computing have greatly increased the variety of available inspection sensors. Non-contact laser digitizers and analog scanning touch probes require very well tuned CMM motion control, as well as an extensible, open architecture interface. This paper describes the implementation of a retrofit CMM motion controller designed for open architecture interface to a variety of sensors. The controller is based on an Intel Pentium microcomputer and a Servo To Go motion interface electronics card. Motor amplifiers, safety, and additional interface electronics are housed in a separate enclosure. Host Signal Processing (HSP) is used for the motion control algorithm. Compared to the usual host plus DSP architecture, single CPU HSP simplifies integration with the various sensors, and implementation of software geometric error compensation. Motion control tuning is accomplished using a remote computer via 100BaseTX Ethernet. A Graphical User Interface (GUI) is used to enter geometric error compensation data, and to optimize the motion control tuning parameters. It is shown that this architecture achieves the required real time motion control response, yet is much easier to extend to additional sensors.

  12. Extensive domain motion and electron transfer in the human electron transferring flavoprotein.medium chain Acyl-CoA dehydrogenase complex.

    PubMed

    Toogood, Helen S; van Thiel, Adam; Basran, Jaswir; Sutcliffe, Mike J; Scrutton, Nigel S; Leys, David

    2004-07-30

    The crystal structure of the human electron transferring flavoprotein (ETF).medium chain acyl-CoA dehydrogenase (MCAD) complex reveals a dual mode of protein-protein interaction, imparting both specificity and promiscuity in the interaction of ETF with a range of structurally distinct primary dehydrogenases. ETF partitions the functions of partner binding and electron transfer between (i) the recognition loop, which acts as a static anchor at the ETF.MCAD interface, and (ii) the highly mobile redox active FAD domain. Together, these enable the FAD domain of ETF to sample a range of conformations, some compatible with fast interprotein electron transfer. Disorders in amino acid or fatty acid catabolism can be attributed to mutations at the protein-protein interface. Crucially, complex formation triggers mobility of the FAD domain, an induced disorder that contrasts with general models of protein-protein interaction by induced fit mechanisms. The subsequent interfacial motion in the MCAD.ETF complex is the basis for the interaction of ETF with structurally diverse protein partners. Solution studies using ETF and MCAD with mutations at the protein-protein interface support this dynamic model and indicate ionic interactions between MCAD Glu(212) and ETF Arg alpha(249) are likely to transiently stabilize productive conformations of the FAD domain leading to enhanced electron transfer rates between both partners.

  13. Hand motion modeling for psychology analysis in job interview using optical flow-history motion image: OF-HMI

    NASA Astrophysics Data System (ADS)

    Khalifa, Intissar; Ejbali, Ridha; Zaied, Mourad

    2018-04-01

    To survive the competition, companies always think about having the best employees. The selection is depended on the answers to the questions of the interviewer and the behavior of the candidate during the interview session. The study of this behavior is always based on a psychological analysis of the movements accompanying the answers and discussions. Few techniques are proposed until today to analyze automatically candidate's non verbal behavior. This paper is a part of a work psychology recognition system; it concentrates in spontaneous hand gesture which is very significant in interviews according to psychologists. We propose motion history representation of hand based on an hybrid approach that merges optical flow and history motion images. The optical flow technique is used firstly to detect hand motions in each frame of a video sequence. Secondly, we use the history motion images (HMI) to accumulate the output of the optical flow in order to have finally a good representation of the hand`s local movement in a global temporal template.

  14. Single-electron thermal noise

    NASA Astrophysics Data System (ADS)

    Nishiguchi, Katsuhiko; Ono, Yukinori; Fujiwara, Akira

    2014-07-01

    We report the observation of thermal noise in the motion of single electrons in an ultimately small dynamic random access memory (DRAM). The nanometer-scale transistors that compose the DRAM resolve the thermal noise in single-electron motion. A complete set of fundamental tests conducted on this single-electron thermal noise shows that the noise perfectly follows all the aspects predicted by statistical mechanics, which include the occupation probability, the law of equipartition, a detailed balance, and the law of kT/C. In addition, the counting statistics on the directional motion (i.e., the current) of the single-electron thermal noise indicate that the individual electron motion follows the Poisson process, as it does in shot noise.

  15. Single-electron thermal noise.

    PubMed

    Nishiguchi, Katsuhiko; Ono, Yukinori; Fujiwara, Akira

    2014-07-11

    We report the observation of thermal noise in the motion of single electrons in an ultimately small dynamic random access memory (DRAM). The nanometer-scale transistors that compose the DRAM resolve the thermal noise in single-electron motion. A complete set of fundamental tests conducted on this single-electron thermal noise shows that the noise perfectly follows all the aspects predicted by statistical mechanics, which include the occupation probability, the law of equipartition, a detailed balance, and the law of kT/C. In addition, the counting statistics on the directional motion (i.e., the current) of the single-electron thermal noise indicate that the individual electron motion follows the Poisson process, as it does in shot noise.

  16. Smelling directions: Olfaction modulates ambiguous visual motion perception

    PubMed Central

    Kuang, Shenbing; Zhang, Tao

    2014-01-01

    Senses of smells are often accompanied by simultaneous visual sensations. Previous studies have documented enhanced olfactory performance with concurrent presence of congruent color- or shape- related visual cues, and facilitated visual object perception when congruent smells are simultaneously present. These visual object-olfaction interactions suggest the existences of couplings between the olfactory pathway and the visual ventral processing stream. However, it is not known if olfaction can modulate visual motion perception, a function that is related to the visual dorsal stream. We tested this possibility by examining the influence of olfactory cues on the perceptions of ambiguous visual motion signals. We showed that, after introducing an association between motion directions and olfactory cues, olfaction could indeed bias ambiguous visual motion perceptions. Our result that olfaction modulates visual motion processing adds to the current knowledge of cross-modal interactions and implies a possible functional linkage between the olfactory system and the visual dorsal pathway. PMID:25052162

  17. Impulsive effects of phase-locked pulse pairs on nuclear motion in the electronic ground state

    NASA Astrophysics Data System (ADS)

    Cina, J. A.; Smith, T. J.

    1993-06-01

    The nonlinear effects of ultrashort phase-locked electronically resonant pulse pairs on the ground state nuclear motion are investigated theoretically. The pulse-pair propagator, momentum impulse, and displacement are determined in the weak field limit for pulse pairs separated by a time delay short on a nuclear time scale. Possible application to large amplitude vibrational excitation of the 104 cm-1 mode of α-perylene is considered and comparisons are made to other Raman excitation methods.

  18. Focus: Two-dimensional electron-electron double resonance and molecular motions: The challenge of higher frequencies

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Franck, John M.; Chandrasekaran, Siddarth; Dzikovski, Boris

    2015-06-07

    The development, applications, and current challenges of the pulsed ESR technique of two-dimensional Electron-Electron Double Resonance (2D ELDOR) are described. This is a three-pulse technique akin to 2D Exchange Nuclear Magnetic Resonance, but involving electron spins, usually in the form of spin-probes or spin-labels. As a result, it required the extension to much higher frequencies, i.e., microwaves, and much faster time scales, with π/2 pulses in the 2-3 ns range. It has proven very useful for studying molecular dynamics in complex fluids, and spectral results can be explained by fitting theoretical models (also described) that provide a detailed analysis ofmore » the molecular dynamics and structure. We discuss concepts that also appear in other forms of 2D spectroscopy but emphasize the unique advantages and difficulties that are intrinsic to ESR. Advantages include the ability to tune the resonance frequency, in order to probe different motional ranges, while challenges include the high ratio of the detection dead time vs. the relaxation times. We review several important 2D ELDOR studies of molecular dynamics. (1) The results from a spin probe dissolved in a liquid crystal are followed throughout the isotropic → nematic → liquid-like smectic → solid-like smectic → crystalline phases as the temperature is reduced and are interpreted in terms of the slowly relaxing local structure model. Here, the labeled molecule is undergoing overall motion in the macroscopically aligned sample, as well as responding to local site fluctuations. (2) Several examples involving model phospholipid membranes are provided, including the dynamic structural characterization of the boundary lipid that coats a transmembrane peptide dimer. Additionally, subtle differences can be elicited for the phospholipid membrane phases: liquid disordered, liquid ordered, and gel, and the subtle effects upon the membrane, of antigen cross-linking of receptors on the surface of plasma

  19. Focus: Two-dimensional electron-electron double resonance and molecular motions: The challenge of higher frequencies.

    PubMed

    Franck, John M; Chandrasekaran, Siddarth; Dzikovski, Boris; Dunnam, Curt R; Freed, Jack H

    2015-06-07

    The development, applications, and current challenges of the pulsed ESR technique of two-dimensional Electron-Electron Double Resonance (2D ELDOR) are described. This is a three-pulse technique akin to 2D Exchange Nuclear Magnetic Resonance, but involving electron spins, usually in the form of spin-probes or spin-labels. As a result, it required the extension to much higher frequencies, i.e., microwaves, and much faster time scales, with π/2 pulses in the 2-3 ns range. It has proven very useful for studying molecular dynamics in complex fluids, and spectral results can be explained by fitting theoretical models (also described) that provide a detailed analysis of the molecular dynamics and structure. We discuss concepts that also appear in other forms of 2D spectroscopy but emphasize the unique advantages and difficulties that are intrinsic to ESR. Advantages include the ability to tune the resonance frequency, in order to probe different motional ranges, while challenges include the high ratio of the detection dead time vs. the relaxation times. We review several important 2D ELDOR studies of molecular dynamics. (1) The results from a spin probe dissolved in a liquid crystal are followed throughout the isotropic → nematic → liquid-like smectic → solid-like smectic → crystalline phases as the temperature is reduced and are interpreted in terms of the slowly relaxing local structure model. Here, the labeled molecule is undergoing overall motion in the macroscopically aligned sample, as well as responding to local site fluctuations. (2) Several examples involving model phospholipid membranes are provided, including the dynamic structural characterization of the boundary lipid that coats a transmembrane peptide dimer. Additionally, subtle differences can be elicited for the phospholipid membrane phases: liquid disordered, liquid ordered, and gel, and the subtle effects upon the membrane, of antigen cross-linking of receptors on the surface of plasma membrane

  20. Focus: Two-dimensional electron-electron double resonance and molecular motions: The challenge of higher frequencies

    NASA Astrophysics Data System (ADS)

    Franck, John M.; Chandrasekaran, Siddarth; Dzikovski, Boris; Dunnam, Curt R.; Freed, Jack H.

    2015-06-01

    The development, applications, and current challenges of the pulsed ESR technique of two-dimensional Electron-Electron Double Resonance (2D ELDOR) are described. This is a three-pulse technique akin to 2D Exchange Nuclear Magnetic Resonance, but involving electron spins, usually in the form of spin-probes or spin-labels. As a result, it required the extension to much higher frequencies, i.e., microwaves, and much faster time scales, with π/2 pulses in the 2-3 ns range. It has proven very useful for studying molecular dynamics in complex fluids, and spectral results can be explained by fitting theoretical models (also described) that provide a detailed analysis of the molecular dynamics and structure. We discuss concepts that also appear in other forms of 2D spectroscopy but emphasize the unique advantages and difficulties that are intrinsic to ESR. Advantages include the ability to tune the resonance frequency, in order to probe different motional ranges, while challenges include the high ratio of the detection dead time vs. the relaxation times. We review several important 2D ELDOR studies of molecular dynamics. (1) The results from a spin probe dissolved in a liquid crystal are followed throughout the isotropic → nematic → liquid-like smectic → solid-like smectic → crystalline phases as the temperature is reduced and are interpreted in terms of the slowly relaxing local structure model. Here, the labeled molecule is undergoing overall motion in the macroscopically aligned sample, as well as responding to local site fluctuations. (2) Several examples involving model phospholipid membranes are provided, including the dynamic structural characterization of the boundary lipid that coats a transmembrane peptide dimer. Additionally, subtle differences can be elicited for the phospholipid membrane phases: liquid disordered, liquid ordered, and gel, and the subtle effects upon the membrane, of antigen cross-linking of receptors on the surface of plasma membrane

  1. 7 CFR 283.30 - Cross motions for summary judgment.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ....30 Agriculture Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE... address the issues raised by the pleadings and may be supported by declarations. Motions and accompanying briefs in support of summary judgment shall not exceed 35 pages excluding exhibits unless otherwise...

  2. Direct observation of X-ray induced atomic motion using scanning tunneling microscope combined with synchrotron radiation.

    PubMed

    Saito, Akira; Tanaka, Takehiro; Takagi, Yasumasa; Hosokawa, Hiromasa; Notsu, Hiroshi; Ohzeki, Gozo; Tanaka, Yoshihito; Kohmura, Yoshiki; Akai-Kasaya, Megumi; Ishikawa, Tetsuya; Kuwahara, Yuji; Kikuta, Seishi; Aono, Masakazu

    2011-04-01

    X-ray induced atomic motion on a Ge(111)-c(2 x 8) clean surface at room temperature was directly observed with atomic resolution using a synchrotron radiation (SR)-based scanning tunneling microscope (STM) system under ultra high vacuum condition. The atomic motion was visualized as a tracking image by developing a method to merge the STM images before and after X-ray irradiation. Using the tracking image, the atomic mobility was found to be strongly affected by defects on the surface, but was not dependent on the incident X-ray energy, although it was clearly dependent on the photon density. The atomic motion can be attributed to surface diffusion, which might not be due to core-excitation accompanied with electronic transition, but a thermal effect by X-ray irradiation. The crystal surface structure was possible to break even at a lower photon density than the conventionally known barrier. These results can alert X-ray studies in the near future about sample damage during measurements, while suggesting the possibility of new applications. Also the obtained results show a new availability of the in-situ SR-STM system.

  3. Limitation of activities of daily living accompanying reduced neck mobility after laminoplasty preserving or reattaching the semispinalis cervicis into axis.

    PubMed

    Takeuchi, Kazunari; Yokoyama, Toru; Ono, Atsushi; Numasawa, Takuya; Wada, Kanichiro; Itabashi, Taito; Toh, Satoshi

    2008-03-01

    Although difficulties with neck mobility often interfere with patients' activities of daily living (ADL) after cervical laminoplasty, there was no detailed study on the relation between the limitations of ADL accompanying postoperative reduced neck mobility and the cervical posterior approach. The aim of this study was to compare retrospectively the frequency of limitations of ADL accompanying neck mobility after laminoplasty preserving the semispinalis cervicis inserted into the C2 spinous process with that after laminoplasty reattaching the muscle to C2. Forty-nine patients after C4-C7 laminoplasty with C3 laminectomy preserving the semispinalis cervicis inserted into C2 (Group A) and 24 patients after C3-C7 laminoplasty reattaching the muscle (Group B) were evaluated. The frequency of postoperative limitations of ADL accompanying each of three neck movements of extension, flexion and rotation were investigated. The postoperative O-C7 angles at extension and flexion was measured on lateral extension and flexion radiographs of the cervical spine, respectively. The postoperative cervical range of motion in rotation was measured in the cranial view using a digital camera. Frequency of limitations of ADL accompanying extension was lower (P = 0.037) in Group A (2%) than in Group B (17%). Frequency of limitations of ADL accompanying flexion was similar in Group A (8%) and Group B (4%). Frequency of limitations of ADL accompanying rotation was lower (P = 0.031) in Group A (12%) than in Group B (33%). Average O-C7 angle at extension was significantly larger (P = 0.002) in Group A (147 degrees ) than in Group B (136 degrees ). Average O-C7 angle at flexion was similar in Group A (93 degrees ) and Group B (91 degrees ). Average range of motion in rotation was significantly larger (P = 0.004) in Group A (110 degrees ) than in Group B (91 degrees ). This retrospective study suggested that the frequency of limitations of ADL accompanying neck extension or rotation was lower

  4. Integrative cortical dysfunction and pervasive motion perception deficit in fragile X syndrome.

    PubMed

    Kogan, C S; Bertone, A; Cornish, K; Boutet, I; Der Kaloustian, V M; Andermann, E; Faubert, J; Chaudhuri, A

    2004-11-09

    Fragile X syndrome (FXS) is associated with neurologic deficits recently attributed to the magnocellular pathway of the lateral geniculate nucleus. To test the hypotheses that FXS individuals 1) have a pervasive visual motion perception impairment affecting neocortical circuits in the parietal lobe and 2) have deficits in integrative neocortical mechanisms necessary for perception of complex stimuli. Psychophysical tests of visual motion and form perception defined by either first-order (luminance) or second-order (texture) attributes were used to probe early and later occipito-temporal and occipito-parietal functioning. When compared to developmental- and age-matched controls, FXS individuals displayed severe impairments in first- and second-order motion perception. This deficit was accompanied by near normal perception for first-order form stimuli but not second-order form stimuli. Impaired visual motion processing for first- and second-order stimuli suggests that both early- and later-level neurologic function of the parietal lobe are affected in Fragile X syndrome (FXS). Furthermore, this deficit likely stems from abnormal input from the magnocellular compartment of the lateral geniculate nucleus. Impaired visual form and motion processing for complex visual stimuli with normal processing for simple (i.e., first-order) form stimuli suggests that FXS individuals have normal early form processing accompanied by a generalized impairment in neurologic mechanisms necessary for integrating all early visual input.

  5. Diagnostic value and cost-effectiveness of good quality digital images accompanying electronic referrals for suspected skin malignancies.

    PubMed

    Ng, Michael F Y; Stevenson, J Howard

    2011-04-01

    The aim of this study was to investigate the outcome and cost-effectiveness of good and poor quality photographs accompanying the electronic referrals for suspected skin malignancies. A retrospective study of 100 patients, divided into 2 groups, 50 with good quality photographs and 50 with poor quality photographs. Patients with no digital images, or who failed to attend, or patients with incomplete notes were excluded from the study. The treatment pathway, waiting times, and estimated cost between the 2 groups were compared. Good photographs were more likely to be treated at the 1-Stop Clinic (P = 0.05). Good images had a better positive predictive value than poor quality images (62.55% vs. 42.86%). Good quality images are more accurate than poor quality images in triaging of patients, and thus more effective in facilitating the treatment of malignant lesions timely. Good quality photographs allow a delayed appropriate treatment of benign lesions. This increases the safety for patients in a queue in a rationed health care system, and improves patient flow.

  6. Intertwined electron-nuclear motion in frustrated double ionization in driven heteronuclear molecules

    NASA Astrophysics Data System (ADS)

    Vilà, A.; Zhu, J.; Scrinzi, A.; Emmanouilidou, A.

    2018-03-01

    We study frustrated double ionization (FDI) in a strongly-driven heteronuclear molecule HeH+ and compare with H2. We compute the probability distribution of the sum of the final kinetic energies of the nuclei for strongly-driven HeH+. We find that this distribution has more than one peak for strongly-driven HeH+, a feature we do not find to be present for strongly-driven H2. Moreover, we compute the probability distribution of the principal quantum number n of FDI. We find that this distribution has several peaks for strongly-driven HeH+, while the respective distribution has one main peak and a ‘shoulder’ at lower principal quantum numbers n for strongly-driven H2. Surprisingly, we find this feature to be a clear signature of the intertwined electron-nuclear motion.

  7. Example-Based Automatic Music-Driven Conventional Dance Motion Synthesis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xu, Songhua; Fan, Rukun; Geng, Weidong

    We introduce a novel method for synthesizing dance motions that follow the emotions and contents of a piece of music. Our method employs a learning-based approach to model the music to motion mapping relationship embodied in example dance motions along with those motions' accompanying background music. A key step in our method is to train a music to motion matching quality rating function through learning the music to motion mapping relationship exhibited in synchronized music and dance motion data, which were captured from professional human dance performance. To generate an optimal sequence of dance motion segments to match with amore » piece of music, we introduce a constraint-based dynamic programming procedure. This procedure considers both music to motion matching quality and visual smoothness of a resultant dance motion sequence. We also introduce a two-way evaluation strategy, coupled with a GPU-based implementation, through which we can execute the dynamic programming process in parallel, resulting in significant speedup. To evaluate the effectiveness of our method, we quantitatively compare the dance motions synthesized by our method with motion synthesis results by several peer methods using the motions captured from professional human dancers' performance as the gold standard. We also conducted several medium-scale user studies to explore how perceptually our dance motion synthesis method can outperform existing methods in synthesizing dance motions to match with a piece of music. These user studies produced very positive results on our music-driven dance motion synthesis experiments for several Asian dance genres, confirming the advantages of our method.« less

  8. Equation of motion coupled cluster methods for electron attachment and ionization potential in polyacenes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bhaskaran-Nair, Kiran; Kowalski, Karol; Jarrell, Mark

    2015-11-05

    Polyacenes have attracted considerable attention due to their use in organic based optoelectronic materials. Polyacenes are polycyclic aromatic hydrocarbons composed of fused benzene rings. Key to understanding and design of new functional materials is an understanding of their excited state properties starting with their electron affinity (EA) and ionization potential (IP). We have developed a highly accurate and com- putationally e*fficient EA/IP equation of motion coupled cluster singles and doubles (EA/IP-EOMCCSD) method that is capable of treating large systems and large basis set. In this study we employ the EA/IP-EOMCCSD method to calculate the electron affinity and ionization potential ofmore » naphthalene, anthracene, tetracene, pentacene, hex- acene and heptacene. We have compared our results with other previous theoretical studies and experimental data. Our EA/IP results are in very good agreement with experiment and when compared with the other theoretical investigations our results represent the most accurate calculations as compared to experiment.« less

  9. Watching Electrons at Conical Intersections and Funnels

    NASA Astrophysics Data System (ADS)

    Jonas, David M.; Smith, Eric R.; Peters, William K.; Kitney, Katherine A.

    2009-06-01

    The electronic motion at conical intersections and funnels is probed after polarized excitation of aligned electronic wavepackets. The pulses have bandwidth sufficient to observe vibrations mainly through their effect on the electrons. Vibrational symmetry can be identified by the polarization anisotropy of vibrational quantum beats. The polarized transients show signatures of electronic wavepacket motion (due to the energy gaps) and of electron transfer between orbitals (due to the couplings) driven by the conical intersection. For a conical intersection in a four-fold symmetric symmetry silicon naphthalocyanine molecule, electronic motions on a 100 fs timescale are driven by couplings of 1 meV. In the lower symmetry free-base naphthalocyanine, the conical intersection may be missed or missing (conical funnel), and the motions are nearly as rapid, but electronic equilibration is incomplete for red-edge excitation. These experiments probe non-adiabatic electronic dynamics with near-zero nuclear momentum - the electronic motions are determined by the principal slopes of the conical intersection and the width of the vibrational wavepacket.

  10. Precipitation of energetic magnetospheric electrons and accompanying solar wind characteristics

    NASA Astrophysics Data System (ADS)

    Bazilevskaya, G. A.; Kalinin, M. S.; Kvashnin, A. N.; Krainev, M. B.; Makhmutov, V. S.; Svirzhevskaya, A. K.; Svirzhevsky, N. S.; Stozhkov, Yu. I.; Balabin, Yu. V.; Gvozdevsky, B. B.

    2017-03-01

    From 1957 up to the present time, the Lebedev Physical Institute (LPI) has performed regular monitoring of ionizing radiation in the Earth's atmosphere. There are cases when the X-ray radiation generated by energetic magnetospheric electrons penetrates the atmosphere and is observed at polar latitudes. The vast majority of these events occurs against the background of high-velocity solar wind streams, while magnetospheric perturbations related to interplanetary coronal mass ejections (ICMEs) are noneffective for precipitation. It is shown in the paper that ICMEs do not cause acceleration of a sufficient amount of electrons in the magnetosphere. Favorable conditions for acceleration and subsequent scattering of electrons into the loss cone are created by magnetic storms with an extended recovery phase and with sufficiently frequent periods of negative Bz component of the interplanetary magnetic field (IMF). Such geomagnetic perturbations are typical for storms associated with high-velocity solar wind streams.

  11. Corkscrew Motion of an Electron Beam due to Coherent Variations in Accelerating Potentials

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ekdahl, Carl August

    2016-09-13

    Corkscrew motion results from the interaction of fluctuations of beam electron energy with accidental magnetic dipoles caused by misalignment of the beam transport solenoids. Corkscrew is a serious concern for high-current linear induction accelerators (LIA). A simple scaling law for corkscrew amplitude derived from a theory based on a constant-energy beam coasting through a uniform magnetic field has often been used to assess LIA vulnerability to this effect. We use a beam dynamics code to verify that this scaling also holds for an accelerated beam in a non-uniform magnetic field, as in a real accelerator. Results of simulations with thismore » code are strikingly similar to measurements on one of the LIAs at Los Alamos National Laboratory.« less

  12. Laser pulse control of ultrafast heterogeneous electron transfer: a computational study.

    PubMed

    Wang, Luxia; May, Volkhard

    2004-10-22

    Laser pulse control of the photoinduced 90 fs charge injection from perylene into the conduction band of TiO2 is studied theoretically. The approach accounts for the electronic-ground state of the dye, the first excited state, the ionized state formed after charge injection, and the continuum of the electronic states in the conduction band, all defined vs a single reaction coordinate. To address different control tasks optimal control theory is combined with a full quantum dynamical description of the electron-vibrational motion accompanying the charge injection process. First it is proved in which way the charge injection time can be changed by tailored laser pulses. In a second step a pump-dump scheme from the perylene ground state to the first excited electronic state and back to the ground state is discussed. Because of the strong coupling of the excited perylene state to the band continuum of TiO2 this control task is more suited to an experimental test than the direct control of the charge injection.

  13. Equations of motion for a flexible spacecraft-lumped parameter idealization

    NASA Technical Reports Server (NTRS)

    Storch, Joel; Gates, Stephen

    1982-01-01

    The equations of motion for a flexible vehicle capable of arbitrary translational and rotational motions in inertial space accompanied by small elastic deformations are derived in an unabridged form. The vehicle is idealized as consisting of a single rigid body with an ensemble of mass particles interconnected by massless elastic structure. The internal elastic restoring forces are quantified in terms of a stiffness matrix. A transformation and truncation of elastic degrees of freedom is made in the interest of numerical integration efficiency. Deformation dependent terms are partitioned into a hierarchy of significance. The final set of motion equations are brought to a fully assembled first order form suitable for direct digital implementation. A FORTRAN program implementing the equations is given and its salient features described.

  14. Perception of Biological Motion in Schizophrenia and Healthy Individuals: A Behavioral and fMRI Study

    PubMed Central

    Kim, Jejoong; Park, Sohee; Blake, Randolph

    2011-01-01

    Background Anomalous visual perception is a common feature of schizophrenia plausibly associated with impaired social cognition that, in turn, could affect social behavior. Past research suggests impairment in biological motion perception in schizophrenia. Behavioral and functional magnetic resonance imaging (fMRI) experiments were conducted to verify the existence of this impairment, to clarify its perceptual basis, and to identify accompanying neural concomitants of those deficits. Methodology/Findings In Experiment 1, we measured ability to detect biological motion portrayed by point-light animations embedded within masking noise. Experiment 2 measured discrimination accuracy for pairs of point-light biological motion sequences differing in the degree of perturbation of the kinematics portrayed in those sequences. Experiment 3 measured BOLD signals using event-related fMRI during a biological motion categorization task. Compared to healthy individuals, schizophrenia patients performed significantly worse on both the detection (Experiment 1) and discrimination (Experiment 2) tasks. Consistent with the behavioral results, the fMRI study revealed that healthy individuals exhibited strong activation to biological motion, but not to scrambled motion in the posterior portion of the superior temporal sulcus (STSp). Interestingly, strong STSp activation was also observed for scrambled or partially scrambled motion when the healthy participants perceived it as normal biological motion. On the other hand, STSp activation in schizophrenia patients was not selective to biological or scrambled motion. Conclusion Schizophrenia is accompanied by difficulties discriminating biological from non-biological motion, and associated with those difficulties are altered patterns of neural responses within brain area STSp. The perceptual deficits exhibited by schizophrenia patients may be an exaggerated manifestation of neural events within STSp associated with perceptual errors made by

  15. Body motion for powering biomedical devices.

    PubMed

    Romero, Edwar; Warrington, Robert O; Neuman, Michael R

    2009-01-01

    Kinetic energy harvesting has been demonstrated as a useful technique for powering portable electronic devices. Body motion can be used to generate energy to power small electronic devices for biomedical applications. These scavengers can recharge batteries, extending their operation lifetime or even replace them. This paper addresses the generation of energy from human activities. An axial flux generator is presented using body motion for powering miniature biomedical devices. This generator presents a gear-shaped planar coil and a multipole NdFeB permanent magnet (PM) ring with an attached eccentric weight. The device generates energy by electromagnetic induction on the planar coil when subject to a changing magnetic flux due to the generator oscillations produced by body motion. A 1.5 cm(3) prototype has generated 3.9 microW of power while walking with the generator placed laterally on the ankle.

  16. 19 CFR 148.4 - Accompanying articles.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 19 Customs Duties 2 2011-04-01 2011-04-01 false Accompanying articles. 148.4 Section 148.4 Customs... (CONTINUED) PERSONAL DECLARATIONS AND EXEMPTIONS General Provisions § 148.4 Accompanying articles. (a) Generally. Articles shall be considered as accompanying a passenger or brought in by him if the articles...

  17. 19 CFR 148.4 - Accompanying articles.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 19 Customs Duties 2 2012-04-01 2012-04-01 false Accompanying articles. 148.4 Section 148.4 Customs... (CONTINUED) PERSONAL DECLARATIONS AND EXEMPTIONS General Provisions § 148.4 Accompanying articles. (a) Generally. Articles shall be considered as accompanying a passenger or brought in by him if the articles...

  18. 19 CFR 148.4 - Accompanying articles.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 19 Customs Duties 2 2014-04-01 2014-04-01 false Accompanying articles. 148.4 Section 148.4 Customs... (CONTINUED) PERSONAL DECLARATIONS AND EXEMPTIONS General Provisions § 148.4 Accompanying articles. (a) Generally. Articles shall be considered as accompanying a passenger or brought in by him if the articles...

  19. 19 CFR 148.4 - Accompanying articles.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 19 Customs Duties 2 2013-04-01 2013-04-01 false Accompanying articles. 148.4 Section 148.4 Customs... (CONTINUED) PERSONAL DECLARATIONS AND EXEMPTIONS General Provisions § 148.4 Accompanying articles. (a) Generally. Articles shall be considered as accompanying a passenger or brought in by him if the articles...

  20. 19 CFR 148.4 - Accompanying articles.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Accompanying articles. 148.4 Section 148.4 Customs... (CONTINUED) PERSONAL DECLARATIONS AND EXEMPTIONS General Provisions § 148.4 Accompanying articles. (a) Generally. Articles shall be considered as accompanying a passenger or brought in by him if the articles...

  1. 12 CFR 269b.444 - Objection to conduct of hearing; other motions during hearing.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... the hearing, including any objection to the introduction of evidence, or any other motion during the... accompanied by a short statement of the grounds for such objection, and included in the record. No such...

  2. Decreased susceptibility to motion sickness during exposure to visual inversion in microgravity

    NASA Technical Reports Server (NTRS)

    Lackner, James R.; Dizio, Paul

    1991-01-01

    Head and body movements made in microgravity tend to bring on symptoms of motion sickness. Such head movements, relative to comparable ones made on earth, are accompanied by unusual combinations of semicircular canal and otolith activity owing to the unloading of the otoliths in 0G. Head movements also bring on symptoms of motion sickness during exposure to visual inversion (or reversal) on earth because the vestibulo-ocular reflex is rendered anti-compensatory. Here, evidence is presented that susceptibility to motion sickness during exposure to visual inversion is decreased in a 0G relative to 1G force background. This difference in susceptibility appears related to the alteration in otolith function in 0G. Some implications of this finding for the etiology of space motion sickness are described.

  3. Effect of the quantum zero-point atomic motion on the optical and electronic properties of diamond and trans-polyacetylene.

    PubMed

    Cannuccia, Elena; Marini, Andrea

    2011-12-16

    The quantum zero-point motion of the carbon atoms is shown to induce strong effects on the optical and electronic properties of diamond and trans-polyacetylene, a conjugated polymer. By using an ab initio approach, we interpret the subgap states experimentally observed in diamond in terms of entangled electron-phonon states. These states also appear in trans-polyacetylene causing the formation of strong structures in the band structure that even call into question the accuracy of the band theory. This imposes a critical revision of the results obtained for carbon-based nanostructures by assuming the atoms frozen in their equilibrium positions. © 2011 American Physical Society

  4. Ultrafast electron microscopy integrated with a direct electron detection camera.

    PubMed

    Lee, Young Min; Kim, Young Jae; Kim, Ye-Jin; Kwon, Oh-Hoon

    2017-07-01

    In the past decade, we have witnessed the rapid growth of the field of ultrafast electron microscopy (UEM), which provides intuitive means to watch atomic and molecular motions of matter. Yet, because of the limited current of the pulsed electron beam resulting from space-charge effects, observations have been mainly made to periodic motions of the crystalline structure of hundreds of nanometers or higher by stroboscopic imaging at high repetition rates. Here, we develop an advanced UEM with robust capabilities for circumventing the present limitations by integrating a direct electron detection camera for the first time which allows for imaging at low repetition rates. This approach is expected to promote UEM to a more powerful platform to visualize molecular and collective motions and dissect fundamental physical, chemical, and materials phenomena in space and time.

  5. Diffusive motion with nonlinear friction: apparently Brownian.

    PubMed

    Goohpattader, Partho S; Chaudhury, Manoj K

    2010-07-14

    We study the diffusive motion of a small object placed on a solid support using an inertial tribometer. With an external bias and a Gaussian noise, the object slides accompanied with a fluctuation of displacement that exhibits unique characteristics at different powers of the noise. While it exhibits a fluidlike motion at high powers, a stick-slip motion occurs at a low power. Below a critical power, no motion is observed. The signature of a nonlinear friction is evident in this type of stochastic motion both in the reduced mobility in comparison to that governed by a linear kinematic (Stokes-Einstein-like) friction and in the non-Gaussian probability distribution of the displacement fluctuation. As the power of the noise increases, the effect of the nonlinearity appears to play a lesser role, so that the displacement fluctuation becomes more Gaussian. When the distribution is exponential, it also exhibits an asymmetry with its skewness increasing with the applied bias. A new finding of this study is that the stochastic velocities of the object are so poorly correlated that its diffusivity is much lower than either the linear or the nonlinear friction cases studied by de Gennes [J. Stat. Phys. 119, 953 (2005)]. The mobilities at different powers of the noise together with the estimated variances of velocity fluctuations follow an Einstein-like relation.

  6. Using Lasers and X-rays to Reveal the Motion of Atoms and Electrons (LBNL Summer Lecture Series)

    ScienceCinema

    Schoenlein, Robert [Deputy Director, Advanced Light Source

    2017-12-09

    Summer Lecture Series 2009: The ultrafast motion of atoms and electrons lies at the heart of chemical reactions, advanced materials with exotic properties, and biological processes such as the first event in vision. Bob Schoenlein, Deputy Director for Science at the Advanced Light Source, will discuss how such processes are revealed by using laser pulses spanning a millionth of a billionth of a second, and how a new generation of light sources will bring the penetrating power of x-rays to the world of ultrafast science.

  7. Using Lasers and X-rays to Reveal the Motion of Atoms and Electrons (LBNL Summer Lecture Series)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schoenlein, Robert

    2009-07-07

    Summer Lecture Series 2009: The ultrafast motion of atoms and electrons lies at the heart of chemical reactions, advanced materials with exotic properties, and biological processes such as the first event in vision. Bob Schoenlein, Deputy Director for Science at the Advanced Light Source, will discuss how such processes are revealed by using laser pulses spanning a millionth of a billionth of a second, and how a new generation of light sources will bring the penetrating power of x-rays to the world of ultrafast science.

  8. Using Lasers and X-rays to Reveal the Motion of Atoms and Electrons (LBNL Summer Lecture Series)

    ScienceCinema

    Schoenlein, Robert [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Advanced Light Source (ALS), Materials Sciences Division and Chemical Sciences Division

    2018-05-07

    Summer Lecture Series 2009: The ultrafast motion of atoms and electrons lies at the heart of chemical reactions, advanced materials with exotic properties, and biological processes such as the first event in vision. Bob Schoenlein, Deputy Director for Science at the Advanced Light Source, will discuss how such processes are revealed by using laser pulses spanning a millionth of a billionth of a second, and how a new generation of light sources will bring the penetrating power of x-rays to the world of ultrafast science.

  9. Expansion of Shockley stacking fault observed by scanning electron microscope and partial dislocation motion in 4H-SiC

    NASA Astrophysics Data System (ADS)

    Yamashita, Yoshifumi; Nakata, Ryu; Nishikawa, Takeshi; Hada, Masaki; Hayashi, Yasuhiko

    2018-04-01

    We studied the dynamics of the expansion of a Shockley-type stacking fault (SSF) with 30° Si(g) partial dislocations (PDs) using a scanning electron microscope. We observed SSFs as dark lines (DLs), which formed the contrast at the intersection between the surface and the SSF on the (0001) face inclined by 8° from the surface. We performed experiments at different electron-beam scanning speeds, observing magnifications, and irradiation areas. The results indicated that the elongation of a DL during one-frame scanning depended on the time for which the electron beam irradiated the PD segment in the frame of view. From these results, we derived a formula to express the velocity of the PD using the elongation rate of the corresponding DL during one-frame scanning. We also obtained the result that the elongation velocity of the DL was not influenced by changing the direction in which the electron beam irradiates the PD. From this result, we deduced that the geometrical kink motion of the PD was enhanced by diffusing carriers that were generated by the electron-beam irradiation.

  10. Rotary-To-Axial Motion Converter For Valve

    NASA Technical Reports Server (NTRS)

    Reinicke, Robert H.; Mohtar, Rafic

    1991-01-01

    Nearly frictionless mechanism converts rotary motion into axial motion. Designed for use in electronically variable pressure-regulator valve. Changes rotary motion imparted by motor into translation that opens and closes valve poppet. Cables spaced equidistantly around edge of fixed disk support movable disk. As movable disk rotated, cables twist, lifting it. When rotated in opposite direction, cables untwist, lowering it. Spider disk helps to prevent cables from tangling. Requires no lubrication and insensitive to contamination in fluid flowing through valve.

  11. Study of Complex Plasmas with Magnetic Dipoles

    DTIC Science & Technology

    2017-10-10

    variety of collective behavior manifested in a plasma, especially oscillations or waves characterized by high frequency accompanied by the motion of...behavior manifested in a plasma, especially oscillations or waves characterized by high frequency accompanied by the motion of electrons and/or ions...particles characterized by extremely low frequency modes and the collection of plasma particles characterized by high frequency modes. The interaction of

  12. Physical chemistry: Molecular motion watched

    NASA Astrophysics Data System (ADS)

    Siwick, Bradley; Collet, Eric

    2013-04-01

    A laser pulse can switch certain crystals from an insulating phase to a highly conducting phase. The ultrafast molecular motions that drive the transition have been directly observed using electron diffraction. See Letter p.343

  13. Electron Acceleration and Efficiency in Nonthermal Gamma-Ray Sources

    NASA Astrophysics Data System (ADS)

    Bykov, A. M.; Meszaros, P.

    1996-04-01

    In energetic nonthermal sources such as gamma-ray bursts, active galactic nuclei, or galactic jets, etc., one expects both relativistic and transrelativistic shocks accompanied by violent motions of moderately relativistic plasma. We present general considerations indicating that these sites are electron and positron accelerators leading to a modified power-law spectrum. The electron (or e+/-) energy index is very hard, ~ gamma -1 or flatter, up to a comoving frame break energy gamma *, and becomes steeper above that. In the example of gamma-ray bursts, the Lorentz factor reaches gamma * ~ 103 for e+/- accelerated by the internal shock ensemble on subhydrodynamical timescales. For pairs accelerated on hydrodynamical timescales in the external shocks, similar hard spectra are obtained, and the break Lorentz factor can be as high as gamma * <~ 105. Radiation from the nonthermal electrons produces photon spectra with shapes and characteristic energies in qualitative agreement with observed generic gamma-ray burst and blazar spectra. The scenario described here provides a plausible way to solve one of the crucial problems of nonthermal high-energy sources, namely, the efficient transfer of energy from the proton flow to an appropriate nonthermal lepton component.

  14. Influence of the turbulent motion on the chiral magnetic effect in the early universe

    NASA Astrophysics Data System (ADS)

    Dvornikov, Maxim; Semikoz, Victor B.

    2017-02-01

    We study the magnetohydrodynamics of relativistic plasmas accounting for the chiral magnetic effect (CME). To take into account the evolution of the plasma velocity, obeying the Navier-Stokes equation, we approximate it by the Lorentz force accompanied by the phenomenological drag time parameter. On the basis of this ansatz, we obtain the contributions of both the turbulence effects, resulting from the dynamo term, and the magnetic field instability, caused by the CME, to the evolution of the magnetic field governed by the modified Faraday equation. In this way, we explore the evolution of the magnetic field energy and the magnetic helicity density spectra in the early Universe plasma. We find that the right-left electron asymmetry is enhanced by the turbulent plasma motion in a strong seed magnetic field compared to the pure CME case studied earlier for the hot Universe plasma in the same broken phase.

  15. Equation-of-motion coupled cluster method for high spin double electron attachment calculations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Musiał, Monika, E-mail: musial@ich.us.edu.pl; Lupa, Łukasz; Kucharski, Stanisław A.

    The new formulation of the equation-of-motion (EOM) coupled cluster (CC) approach applicable to the calculations of the double electron attachment (DEA) states for the high spin components is proposed. The new EOM equations are derived for the high spin triplet and quintet states. In both cases the new equations are easier to solve but the substantial simplification is observed in the case of quintets. Out of 21 diagrammatic terms contributing to the standard DEA-EOM-CCSDT equations for the R{sub 2} and R{sub 3} amplitudes only four terms survive contributing to the R{sub 3} part. The implemented method has been applied tomore » the calculations of the excited states (singlets, triplets, and quintets) energies of the carbon and silicon atoms and potential energy curves for selected states of the Na{sub 2} (triplets) and B{sub 2} (quintets) molecules.« less

  16. Computerized analysis and duplication of mandibular motion.

    PubMed

    Knap, F J; Abler, J H; Richardson, B L

    1975-05-01

    A new digital system has been devised to analyze and duplicate jaw motion. The arrangement of the electronic system offers a range of versatility which includes graphic as well as numerical data analysis. The duplicator linkage is identical to the sensor linkage which, together with an accurate model transfer system, results in an encouraging level of accuracy in jaw-motion duplication. The data collected from normal subjects should offer some new knowledge in the normal motions of the mandible as well as establish a reference for comparison with abnormal masticatory function.

  17. Deep proton tunneling in the electronically adiabatic and non-adiabatic limits: Comparison of the quantum and classical treatment of donor-acceptor motion in a protein environment

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Benabbas, Abdelkrim; Salna, Bridget; Sage, J. Timothy

    2015-03-21

    Analytical models describing the temperature dependence of the deep tunneling rate, useful for proton, hydrogen, or hydride transfer in proteins, are developed and compared. Electronically adiabatic and non-adiabatic expressions are presented where the donor-acceptor (D-A) motion is treated either as a quantized vibration or as a classical “gating” distribution. We stress the importance of fitting experimental data on an absolute scale in the electronically adiabatic limit, which normally applies to these reactions, and find that vibrationally enhanced deep tunneling takes place on sub-ns timescales at room temperature for typical H-bonding distances. As noted previously, a small room temperature kinetic isotopemore » effect (KIE) does not eliminate deep tunneling as a major transport channel. The quantum approach focuses on the vibrational sub-space composed of the D-A and hydrogen atom motions, where hydrogen bonding and protein restoring forces quantize the D-A vibration. A Duschinsky rotation is mandated between the normal modes of the reactant and product states and the rotation angle depends on the tunneling particle mass. This tunnel-mass dependent rotation contributes substantially to the KIE and its temperature dependence. The effect of the Duschinsky rotation is solved exactly to find the rate in the electronically non-adiabatic limit and compared to the Born-Oppenheimer (B-O) approximation approach. The B-O approximation is employed to find the rate in the electronically adiabatic limit, where we explore both harmonic and quartic double-well potentials for the hydrogen atom bound states. Both the electronically adiabatic and non-adiabatic rates are found to diverge at high temperature unless the proton coupling includes the often neglected quadratic term in the D-A displacement from equilibrium. A new expression is presented for the electronically adiabatic tunnel rate in the classical limit for D-A motion that should be useful to experimentalists

  18. Deep proton tunneling in the electronically adiabatic and non-adiabatic limits: comparison of the quantum and classical treatment of donor-acceptor motion in a protein environment.

    PubMed

    Benabbas, Abdelkrim; Salna, Bridget; Sage, J Timothy; Champion, Paul M

    2015-03-21

    Analytical models describing the temperature dependence of the deep tunneling rate, useful for proton, hydrogen, or hydride transfer in proteins, are developed and compared. Electronically adiabatic and non-adiabatic expressions are presented where the donor-acceptor (D-A) motion is treated either as a quantized vibration or as a classical "gating" distribution. We stress the importance of fitting experimental data on an absolute scale in the electronically adiabatic limit, which normally applies to these reactions, and find that vibrationally enhanced deep tunneling takes place on sub-ns timescales at room temperature for typical H-bonding distances. As noted previously, a small room temperature kinetic isotope effect (KIE) does not eliminate deep tunneling as a major transport channel. The quantum approach focuses on the vibrational sub-space composed of the D-A and hydrogen atom motions, where hydrogen bonding and protein restoring forces quantize the D-A vibration. A Duschinsky rotation is mandated between the normal modes of the reactant and product states and the rotation angle depends on the tunneling particle mass. This tunnel-mass dependent rotation contributes substantially to the KIE and its temperature dependence. The effect of the Duschinsky rotation is solved exactly to find the rate in the electronically non-adiabatic limit and compared to the Born-Oppenheimer (B-O) approximation approach. The B-O approximation is employed to find the rate in the electronically adiabatic limit, where we explore both harmonic and quartic double-well potentials for the hydrogen atom bound states. Both the electronically adiabatic and non-adiabatic rates are found to diverge at high temperature unless the proton coupling includes the often neglected quadratic term in the D-A displacement from equilibrium. A new expression is presented for the electronically adiabatic tunnel rate in the classical limit for D-A motion that should be useful to experimentalists working near

  19. Stroboscopic Goggles for Reduction of Motion Sickness

    NASA Technical Reports Server (NTRS)

    Reschke, M. F.; Somers, Jeffrey T.

    2005-01-01

    A device built around a pair of electronic shutters has been demonstrated to be effective as a prototype of stroboscopic goggles or eyeglasses for preventing or reducing motion sickness. The momentary opening of the shutters helps to suppress a phenomenon that is known in the art as retinal slip and is described more fully below. While a number of different environmental factors can induce motion sickness, a common factor associated with every known motion environment is sensory confusion or sensory mismatch. Motion sickness is a product of misinformation arriving at a central point in the nervous system from the senses from which one determines one s spatial orientation. When information from the eyes, ears, joints, and pressure receptors are all in agreement as to one s orientation, there is no motion sickness. When one or more sensory input(s) to the brain is not expected, or conflicts with what is anticipated, the end product is motion sickness. Normally, an observer s eye moves, compensating for the anticipated effect of motion, in such a manner that the image of an object moving relatively to an observer is held stationary on the retina. In almost every known environment that induces motion sickness, a change in the gain (in the signal-processing sense of gain ) of the vestibular system causes the motion of the eye to fail to hold images stationary on the retina, and the resulting motion of the images is termed retinal slip. The present concept of stroboscopic goggles or eyeglasses (see figure) is based on the proposition that prevention of retinal slip, and hence, the prevention of sensory mismatch, can be expected to reduce the tendency toward motion sickness. A device according to this concept helps to prevent retinal slip by providing snapshots of the visual environment through electronic shutters that are brief enough that each snapshot freezes the image on each retina. The exposure time for each snapshot is less than 5 ms. In the event that a higher

  20. Quantifying the effect of non-Larmor motion of electrons on the pressure tensor

    NASA Astrophysics Data System (ADS)

    Che, H.; Schiff, C.; Le, G.; Dorelli, J. C.; Giles, B. L.; Moore, T. E.

    2018-03-01

    In space plasma, various effects of magnetic reconnection and turbulence cause the electron motion to significantly deviate from their Larmor orbits. Collectively these orbits affect the electron velocity distribution function and lead to the appearance of the "non-gyrotropic" elements in the pressure tensor. Quantification of this effect has important applications in space and laboratory plasma, one of which is tracing the electron diffusion region (EDR) of magnetic reconnection in space observations. Three different measures of agyrotropy of pressure tensor have previously been proposed, namely, A ∅ e , Dng, and Q. The multitude of contradictory measures has caused confusion within the community. We revisit the problem by considering the basic properties an agyrotropy measure should have. We show that A ∅ e , Dng, and Q are all defined based on the sum of the principle minors (i.e., the rotation invariant I2) of the pressure tensor. We discuss in detail the problems of I2-based measures and explain why they may produce ambiguous and biased results. We introduce a new measure AG constructed based on the determinant of the pressure tensor (i.e., the rotation invariant I3) which does not suffer from the problems of I2-based measures. We compare AG with other measures in 2- and 3-dimension particle-in-cell magnetic reconnection simulations and show that AG effectively trace the EDR of reconnection in both Harris and force-free current sheets. On the other hand, A ∅ e does not show prominent peaks in the EDR and part of the separatrix in the force-free reconnection simulations, demonstrating that A ∅ e does not measure all the non-gyrotropic effects in this case and is not suitable for studying magnetic reconnection in more general situations other than Harris sheet reconnection.

  1. Independent Deficits of Visual Word and Motion Processing in Aging and Early Alzheimer's Disease

    PubMed Central

    Velarde, Carla; Perelstein, Elizabeth; Ressmann, Wendy; Duffy, Charles J.

    2013-01-01

    We tested whether visual processing impairments in aging and Alzheimer's disease (AD) reflect uniform posterior cortical decline, or independent disorders of visual processing for reading and navigation. Young and older normal controls were compared to early AD patients using psychophysical measures of visual word and motion processing. We find elevated perceptual thresholds for letters and word discrimination from young normal controls, to older normal controls, to early AD patients. Across subject groups, visual motion processing showed a similar pattern of increasing thresholds, with the greatest impact on radial pattern motion perception. Combined analyses show that letter, word, and motion processing impairments are independent of each other. Aging and AD may be accompanied by independent impairments of visual processing for reading and navigation. This suggests separate underlying disorders and highlights the need for comprehensive evaluations to detect early deficits. PMID:22647256

  2. AMUC: Associated Motion capture User Categories.

    PubMed

    Norman, Sally Jane; Lawson, Sian E M; Olivier, Patrick; Watson, Paul; Chan, Anita M-A; Dade-Robertson, Martyn; Dunphy, Paul; Green, Dave; Hiden, Hugo; Hook, Jonathan; Jackson, Daniel G

    2009-07-13

    The AMUC (Associated Motion capture User Categories) project consisted of building a prototype sketch retrieval client for exploring motion capture archives. High-dimensional datasets reflect the dynamic process of motion capture and comprise high-rate sampled data of a performer's joint angles; in response to multiple query criteria, these data can potentially yield different kinds of information. The AMUC prototype harnesses graphic input via an electronic tablet as a query mechanism, time and position signals obtained from the sketch being mapped to the properties of data streams stored in the motion capture repository. As well as proposing a pragmatic solution for exploring motion capture datasets, the project demonstrates the conceptual value of iterative prototyping in innovative interdisciplinary design. The AMUC team was composed of live performance practitioners and theorists conversant with a variety of movement techniques, bioengineers who recorded and processed motion data for integration into the retrieval tool, and computer scientists who designed and implemented the retrieval system and server architecture, scoped for Grid-based applications. Creative input on information system design and navigation, and digital image processing, underpinned implementation of the prototype, which has undergone preliminary trials with diverse users, allowing identification of rich potential development areas.

  3. Plasma-chemical processes accompanying discharge in air excited by a microwave beam

    NASA Astrophysics Data System (ADS)

    Askar'ian, G. A.; Batanov, G. M.; Gritsinin, S. I.; Kossyi, I. A.; Kostinskii, A. Iu.

    1990-11-01

    Experimental results are presented on plasma-chemical processes of nitrogen oxidation and ozone production accompanying microwave discharge in dry air and in nitrogen-oxygen mixtures. The degree of nitrogen oxidation and the energy expenditure toward the formation of oxides as a function of discharge conditions are established. The experimental results can be explained by assuming oxidation reactions of electron-excited metastable nitrogen molecules by oxygen atoms. Low ozone concentrations in the discharge indicate a significant energy input into the gas.

  4. Self-powering/self-cleaning electronic-skin basing on PVDF/TiO2 nanofibers for actively detecting body motion and degrading organic pollutants

    NASA Astrophysics Data System (ADS)

    Dong, Chuanyi; Fu, Yongming; Zang, Weili; He, Haoxuan; Xing, Lili; Xue, Xinyu

    2017-09-01

    A flexible self-powering/self-cleaning electronic-skin (e-skin) for actively detecting body motion and degrading organic pollutants has been fabricated from PVDF/TiO2 nanofibers. PVDF/TiO2 nanofibers are synthesized by high voltage electrospinning method. The e-skin can be driven by external mechanical vibration, and actively output piezoelectric impulse. The outputting piezoelectric voltage can be significantly influenced by different applied deformation, acting as both the body-motion-detecting signal and the electricity power for driving the device. The e-skin can detect various body motions, such as pressing, stretching, bending finger and clenching fist. The e-skin also has distinct self-cleaning characteristic through piezo-photocatalytic coupling process. The photocatalytic activity of TiO2 and the piezoelectric effect of PVDF are coupled in a single physical/chemical process, which can efficiently degrade organic pollutants on the e-skin. For example, methylene blue (MB) can be completely degraded within 40 min under UV/ultrasonic irradiation. The present results could provoke a possible new research direction for realizing self-powering multifunctional e-skin.

  5. Electron-nuclear corellations for photoinduced dynamics in molecular dimers

    NASA Astrophysics Data System (ADS)

    Kilin, Dmitri S.; Pereversev, Yuryi V.; Prezhdo, Oleg V.

    2003-03-01

    Ultrafast photoinduced dynamics of electronic excitation in molecular dimers is drastically affected by dynamic reorganization of of inter- and intra- molecular nuclear configuration modelled by quantized nuclear degree of freedom [1]. The dynamics of the electronic population and nuclear coherence is analyzed with help of both numerical solution of the chain of coupled differential equations for mean coordinate, population inversion, electronic-vibrational correlation etc.[2] and by propagating the Gaussian wavepackets in relevant adiabatic potentials. Intriguing results were obtained in the approximation of small energy difference and small change of nuclear equilibrium configuration for excited electronic states. In the limiting case of resonance between electronic states energy difference and frequency of the nuclear mode these results have been justified by comparison to exactly solvable Jaynes-Cummings model. It has been found that the photoinduced processes in dimer are arranged according to their time scales:(i) fast scale of nuclear motion,(ii) intermediate scale of dynamical redistribution of electronic population between excited states as well as growth and dynamics of electronic -nuclear correlation,(iii) slow scale of electronic population approaching to the quasiequilibrium distribution, decay of electronic-nuclear correlation, and diminishing the amplitude of mean coordinate oscillations, accompanied by essential growth of the nuclear coordinate dispersion associated with the overall nuclear wavepacket width. Demonstrated quantum-relaxational features of photoinduced vibronic dinamical processess in molecular dimers are obtained by simple method, applicable to large biological systems with many degrees of freedom. [1] J. A. Cina, D. S. Kilin, T. S. Humble, J. Chem. Phys. (2003) in press. [2] O. V. Prezhdo, J. Chem. Phys. 117, 2995 (2002).

  6. Motion of glossy objects does not promote separation of lighting and surface colour

    PubMed Central

    2017-01-01

    The surface properties of an object, such as texture, glossiness or colour, provide important cues to its identity. However, the actual visual stimulus received by the eye is determined by both the properties of the object and the illumination. We tested whether operational colour constancy for glossy objects (the ability to distinguish changes in spectral reflectance of the object, from changes in the spectrum of the illumination) was affected by rotational motion of either the object or the light source. The different chromatic and geometric properties of the specular and diffuse reflections provide the basis for this discrimination, and we systematically varied specularity to control the available information. Observers viewed animations of isolated objects undergoing either lighting or surface-based spectral transformations accompanied by motion. By varying the axis of rotation, and surface patterning or geometry, we manipulated: (i) motion-related information about the scene, (ii) relative motion between the surface patterning and the specular reflection of the lighting, and (iii) image disruption caused by this motion. Despite large individual differences in performance with static stimuli, motion manipulations neither improved nor degraded performance. As motion significantly disrupts frame-by-frame low-level image statistics, we infer that operational constancy depends on a high-level scene interpretation, which is maintained in all conditions. PMID:29291113

  7. Rapid and coordinated processing of global motion images by local clusters of retinal ganglion cells.

    PubMed

    Matsumoto, Akihiro; Tachibana, Masao

    2017-01-01

    Even when the body is stationary, the whole retinal image is always in motion by fixational eye movements and saccades that move the eye between fixation points. Accumulating evidence indicates that the brain is equipped with specific mechanisms for compensating for the global motion induced by these eye movements. However, it is not yet fully understood how the retina processes global motion images during eye movements. Here we show that global motion images evoke novel coordinated firing in retinal ganglion cells (GCs). We simultaneously recorded the firing of GCs in the goldfish isolated retina using a multi-electrode array, and classified each GC based on the temporal profile of its receptive field (RF). A moving target that accompanied the global motion (simulating a saccade following a period of fixational eye movements) modulated the RF properties and evoked synchronized and correlated firing among local clusters of the specific GCs. Our findings provide a novel concept for retinal information processing during eye movements.

  8. Electron dynamics surrounding the X line in asymmetric magnetic reconnection

    NASA Astrophysics Data System (ADS)

    Zenitani, S.; Hasegawa, H.; Nagai, T.

    2017-12-01

    Electron dynamics surrounding the X line in magnetopause-type asymmetric reconnection is investigated using a two-dimensional particle-in-cell simulation. We study electron properties of three characteristic regions in the vicinity of the X line. The fluid properties, velocity distribution functions (VDFs), and orbits are studied and cross-compared. On the magnetospheric side of the X line, the normal electric field enhances the electron meandering motion from the magnetosheath side. The motion leads to a crescent-shaped component in the electron VDF, in agreement with recent studies. On the magnetosheath side of the X line, the magnetic field line is so stretched in the third dimension that its curvature radius is comparable with typical electron Larmor radius. The electron motion becomes nonadiabatic, and therefore the electron idealness is no longer expected to hold. Around the middle of the outflow regions, the electron nonidealness is coincident with the region of the nonadiabatic motion. Finally, we introduce a finite-time mixing fraction (FTMF) to evaluate electron mixing. The FTMF marks the magnetospheric side of the X line, where the nonideal energy dissipation occurs.

  9. Electronic Delocalization, Vibrational Dynamics and Energy Transfer in Organic Chromophores

    DOE PAGES

    Nelson, Tammie Renee; Fernandez Alberti, Sebastian; Roitberg, Adrian; ...

    2017-06-12

    The efficiency of materials developed for solar energy and technological applications depends on the interplay between molecular architecture and light-induced electronic energy redistribution. The spatial localization of electronic excitations is very sensitive to molecular distortions. Vibrational nuclear motions can couple to electronic dynamics driving changes in localization. The electronic energy transfer among multiple chromophores arises from several distinct mechanisms that can give rise to experimentally measured signals. Atomistic simulations of coupled electron-vibrational dynamics can help uncover the nuclear motions directing energy flow. Through careful analysis of excited state wave function evolution and a useful fragmenting of multichromophore systems, through-bond transportmore » and exciton hopping (through-space) mechanisms can be distinguished. Such insights are crucial in the interpretation of fluorescence anisotropy measurements and can aid materials design. Finally, this Perspective highlights the interconnected vibrational and electronic motions at the foundation of nonadiabatic dynamics where nuclear motions, including torsional rotations and bond vibrations, drive electronic transitions.« less

  10. Tilts in strong ground motion

    USGS Publications Warehouse

    Graizer, V.

    2006-01-01

    Most instruments used in seismological practice to record ground motion are pendulum seismographs, velocigraphs, or accelerographs. In most cases it is assumed that seismic instruments are only sensitive to the translational motion of the instrument's base. In this study the full equation of pendulum motion, including the inputs of rotations and tilts, is considered. It is shown that tilting the accelerograph's base can severely impact its response to the ground motion. The method of tilt evaluation using uncorrected strong-motion accelerograms was first suggested by Graizer (1989), and later tested in several laboratory experiments with different strong-motion instruments. The method is based on the difference in the tilt sensitivity of the horizontal and vertical pendulums. The method was applied to many of the strongest records of the Mw 6.7 Northridge earthquake of 1994. Examples are shown when relatively large tilts of up to a few degrees occurred during strong earthquake ground motion. Residual tilt extracted from the strong-motion record at the Pacoima Dam-Upper Left Abutment reached 3.1?? in N45??E direction, and was a result of local earthquake-induced tilting due to high-amplitude shaking. This value is in agreement with the residual tilt measured by using electronic level a few days after the earthquake. The method was applied to the building records from the Northridge earthquake. According to the estimates, residual tilt reached 2.6?? on the ground floor of the 12-story Hotel in Ventura. Processing of most of the strongest records of the Northridge earthquake shows that tilts, if happened, were within the error of the method, or less than about 0.5??.

  11. Social norms of accompanied young children and observed crossing behaviors.

    PubMed

    Rosenbloom, Tova; Sapir-Lavid, Yael; Hadari-Carmi, Ofri

    2009-01-01

    Social norms for accompanied young children and crossing behaviors were examined in two studies conducted in an Ultra-Orthodox Jewish community in Israel. In Study 1, road behaviors of young children crossing with and without accompaniment and older children were observed, and the actual social norm for accompanied school children younger than 9-years-old was examined. In Study 2, the perceived norm of accompaniment was tested by questionnaires. Young children who crossed without accompaniment exhibited poorer crossing skills compared to older children and to young children crossing with accompaniment. In the four locations observed, the actual accompaniment rate ranged between 15%-60%. The perceived social norm for child accompaniment was lower than the actual norm. The discussion refers to both theoretical issues and their practical implications.

  12. Neural mechanisms underlying sensitivity to reverse-phi motion in the fly.

    PubMed

    Leonhardt, Aljoscha; Meier, Matthias; Serbe, Etienne; Eichner, Hubert; Borst, Alexander

    2017-01-01

    Optical illusions provide powerful tools for mapping the algorithms and circuits that underlie visual processing, revealing structure through atypical function. Of particular note in the study of motion detection has been the reverse-phi illusion. When contrast reversals accompany discrete movement, detected direction tends to invert. This occurs across a wide range of organisms, spanning humans and invertebrates. Here, we map an algorithmic account of the phenomenon onto neural circuitry in the fruit fly Drosophila melanogaster. Through targeted silencing experiments in tethered walking flies as well as electrophysiology and calcium imaging, we demonstrate that ON- or OFF-selective local motion detector cells T4 and T5 are sensitive to certain interactions between ON and OFF. A biologically plausible detector model accounts for subtle features of this particular form of illusory motion reversal, like the re-inversion of turning responses occurring at extreme stimulus velocities. In light of comparable circuit architecture in the mammalian retina, we suggest that similar mechanisms may apply even to human psychophysics.

  13. Programming Chemical Reaction Networks Using Intramolecular Conformational Motions of DNA.

    PubMed

    Lai, Wei; Ren, Lei; Tang, Qian; Qu, Xiangmeng; Li, Jiang; Wang, Lihua; Li, Li; Fan, Chunhai; Pei, Hao

    2018-06-22

    The programmable regulation of chemical reaction networks (CRNs) represents a major challenge toward the development of complex molecular devices performing sophisticated motions and functions. Nevertheless, regulation of artificial CRNs is generally energy- and time-intensive as compared to natural regulation. Inspired by allosteric regulation in biological CRNs, we herein develop an intramolecular conformational motion strategy (InCMS) for programmable regulation of DNA CRNs. We design a DNA switch as the regulatory element to program the distance between the toehold and branch migration domain. The presence of multiple conformational transitions leads to wide-range kinetic regulation spanning over 4 orders of magnitude. Furthermore, the process of energy-cost-free strand exchange accompanied by conformational change discriminates single base mismatches. Our strategy thus provides a simple yet effective approach for dynamic programming of complex CRNs.

  14. Phospholipid bilayer relaxation dynamics as revealed by the pulsed electron-electron double resonance of spin labels

    NASA Astrophysics Data System (ADS)

    Syryamina, V. N.; Dzuba, S. A.

    2012-10-01

    Electron paramagnetic resonance (EPR) spectroscopy in the form of pulsed electron-electron double resonance (ELDOR) was applied to 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) phospholipid bilayers containing lipids that were spin-labeled at different carbon positions along the lipid acyl chain. Pulsed ELDOR detects motionally induced spin flips of nitrogen nuclei in the nitroxide spin labels, which manifests itself as magnetization transfer (MT) in the nitroxide EPR spectrum. The MT effect was observed over a wide temperature range (100-225 K) on a microsecond time scale. In line with a previous study on molecular glasses [N. P. Isaev and S. A. Dzuba, J. Chem. Phys. 135, 094508 (2011), 10.1063/1.3633241], the motions that induce MT effect were suggested to have the same nature as those in dielectric secondary (β) Johari-Goldstein fast relaxation. The results were compared with literature dielectric relaxation data for POPC bilayers, revealing some common features. Molecular motions resulting in MT are faster for deeper spin labels in the membrane interior. The addition of cholesterol to the bilayer suppresses the lipid motions near the steroid nucleus and accelerates the lipid motions beyond the steroid nucleus, in the bilayer interior. This finding was attributed to the lipid acyl chains being more ordered near the steroid nucleus and less ordered in the bilayer interior. The motions are absent in dry lipids, indicating that the motions are determined by intermolecular interactions in the bilayer.

  15. Ionic-Electronic Ambipolar Transport in Metal Halide Perovskites: Can Electronic Conductivity Limit Ionic Diffusion?

    PubMed

    Kerner, Ross A; Rand, Barry P

    2018-01-04

    Ambipolar transport describes the nonequilibrium, coupled motion of positively and negatively charged particles to ensure that internal electric fields remain small. It is commonly invoked in the semiconductor community where the motion of excess electrons and holes drift and diffuse together. However, the concept of ambipolar transport is not limited to semiconductor physics. Materials scientists working on ion conducting ceramics understand ambipolar transport dictates the coupled diffusion of ions and the rate is limited by the ion with the lowest diffusion coefficient. In this Perspective, we review a third application of ambipolar transport relevant to mixed ionic-electronic conducting materials for which the motion of ions is expected to be coupled to electronic carriers. In this unique situation, the ambipolar diffusion model has been successful at explaining the photoenhanced diffusion of metal ions in chalcogenide glasses and other properties of materials. Recent examples of photoenhanced phenomena in metal halide perovskites are discussed and indicate that mixed ionic-electronic ambipolar transport is similarly important for a deep understanding of these emerging materials.

  16. 9 CFR 93.409 - Articles accompanying ruminants.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 9 Animals and Animal Products 1 2011-01-01 2011-01-01 false Articles accompanying ruminants. 93.409 Section 93.409 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT...; REQUIREMENTS FOR MEANS OF CONVEYANCE AND SHIPPING CONTAINERS Ruminants § 93.409 Articles accompanying ruminants...

  17. 9 CFR 93.409 - Articles accompanying ruminants.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Articles accompanying ruminants. 93.409 Section 93.409 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT...; REQUIREMENTS FOR MEANS OF CONVEYANCE AND SHIPPING CONTAINERS Ruminants § 93.409 Articles accompanying ruminants...

  18. 9 CFR 93.409 - Articles accompanying ruminants.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 9 Animals and Animal Products 1 2014-01-01 2014-01-01 false Articles accompanying ruminants. 93.409 Section 93.409 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT...; REQUIREMENTS FOR MEANS OF CONVEYANCE AND SHIPPING CONTAINERS Ruminants § 93.409 Articles accompanying ruminants...

  19. 9 CFR 93.409 - Articles accompanying ruminants.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 9 Animals and Animal Products 1 2012-01-01 2012-01-01 false Articles accompanying ruminants. 93.409 Section 93.409 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT...; REQUIREMENTS FOR MEANS OF CONVEYANCE AND SHIPPING CONTAINERS Ruminants § 93.409 Articles accompanying ruminants...

  20. 9 CFR 93.409 - Articles accompanying ruminants.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 9 Animals and Animal Products 1 2013-01-01 2013-01-01 false Articles accompanying ruminants. 93.409 Section 93.409 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT...; REQUIREMENTS FOR MEANS OF CONVEYANCE AND SHIPPING CONTAINERS Ruminants § 93.409 Articles accompanying ruminants...

  1. Energetic electron bursts in the plasma sheet and their relation with BBFs

    NASA Astrophysics Data System (ADS)

    Duan, A. Y.; Cao, J. B.; Dunlop, M.; Wang, Z. Q.

    2014-11-01

    We studied energetic electron bursts (EEBs) (40-250 keV) in the plasma sheet (PS) and their relation to bursty bulk flows (BBFs) using the data recorded by Cluster from 2001 to 2009. The EEBs in the PS can be classified into four types. Three types of EEBs are dispersionless, including EEBs accompanied with BBFs (V > 250 km/s) but without dipolarization front (DF); EEBs accompanied with both dipolarization front (DF) and BBF; and EEBs accompanied with DF and fast flow with V < 250 km/s. One type of EEB, i.e., EEBs not accompanied with BBFs and DFs, is dispersed. The energetic electrons (40-130 keV) can be easily transported earthward by BBFs due to the strong dawn-dusk electric field embedded in BBFs. The DFs in BBFs can produce energetic electrons (40 to 250 keV). For the EEBs with DF and BBFs, the superposed epoch analyses show that the increase of energetic electron flux has two phases: gradual increase phase before DF and rapid increase phase concurrent with DF. In the PS around x = -18 RE, 60%-70% of EEBs are accompanied with BBFs, indicating that although hitherto there have been various acceleration mechanisms of energetic electrons, most of the energetic electrons in the PS are related with magnetic reconnection, and they are produced either directly by magnetic reconnection or indirectly by the DFs within BBFs. In the BBF's braking region of -12 RE < x < -10 RE, 20% of EEBs are accompanied with BBFs. The corresponding ratio between EEBs and BBFs shows a dawn-dusk asymmetry.

  2. 16 CFR 1500.125 - Labeling requirements for accompanying literature.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 16 Commercial Practices 2 2011-01-01 2011-01-01 false Labeling requirements for accompanying literature. 1500.125 Section 1500.125 Commercial Practices CONSUMER PRODUCT SAFETY COMMISSION FEDERAL... REGULATIONS § 1500.125 Labeling requirements for accompanying literature. When any accompanying literature...

  3. 16 CFR 1500.125 - Labeling requirements for accompanying literature.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 16 Commercial Practices 2 2014-01-01 2014-01-01 false Labeling requirements for accompanying literature. 1500.125 Section 1500.125 Commercial Practices CONSUMER PRODUCT SAFETY COMMISSION FEDERAL... REGULATIONS § 1500.125 Labeling requirements for accompanying literature. When any accompanying literature...

  4. 16 CFR 1500.125 - Labeling requirements for accompanying literature.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 16 Commercial Practices 2 2012-01-01 2012-01-01 false Labeling requirements for accompanying literature. 1500.125 Section 1500.125 Commercial Practices CONSUMER PRODUCT SAFETY COMMISSION FEDERAL... REGULATIONS § 1500.125 Labeling requirements for accompanying literature. When any accompanying literature...

  5. 16 CFR 1500.125 - Labeling requirements for accompanying literature.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 16 Commercial Practices 2 2010-01-01 2010-01-01 false Labeling requirements for accompanying literature. 1500.125 Section 1500.125 Commercial Practices CONSUMER PRODUCT SAFETY COMMISSION FEDERAL... REGULATIONS § 1500.125 Labeling requirements for accompanying literature. When any accompanying literature...

  6. Motion sickness is linked to nystagmus-related trigeminal brain stem input: a new hypothesis.

    PubMed

    Gupta, Vinod Kumar

    2005-01-01

    Motion sickness is a common and distressing but poorly understood syndrome associated with nausea/vomiting and autonomic nervous system accompaniments that develops in the air or space as well as on sea or land. A bidirectional aetiologic link prevails between migraine and motion-sickness. Motion sickness provokes jerk nystagmus induced by both optokinetic and vestibular stimulation. Fixation of gaze or closure of eyes generally prevents motion sickness while vestibular otolithic function is eliminated in microgravity of space, indicating a predominant pathogenetic role for visuo-sensory input. Scopolamine, dimenhydrinate, and promethazine reduce motion-related nystagmus. Contraction of extraocular muscles generates proprioceptive neural traffic and can provoke an ocular hypertensive response. It is proposed that repetitive contractions of the extraocular muscles during motion-related jerk nystagmus rapidly augment brain stem afferent input by increasing proprioceptive neural traffic through connections of the oculomotor nerves with the ophthalmic nerve in the lateral wall of the cavernous sinus as well as by raising the intraocular pressure thereby stimulating anterior segment ocular trigeminal nerve fibers. This verifiable hypothesis defines the pathophysiological basis of individual susceptibility to motion sickness, elucidates the preventive mechanism of gaze fixation or ocular closure, advances the aetiologic link between MS and migraine, rationalizes the mechanism of known preventive drugs, and explores new therapeutic possibilities.

  7. 9 CFR 93.307 - Articles accompanying horses.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 9 Animals and Animal Products 1 2011-01-01 2011-01-01 false Articles accompanying horses. 93.307 Section 93.307 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF... FOR MEANS OF CONVEYANCE AND SHIPPING CONTAINERS Horses § 93.307 Articles accompanying horses. No...

  8. 9 CFR 93.208 - Articles accompanying poultry.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 9 Animals and Animal Products 1 2011-01-01 2011-01-01 false Articles accompanying poultry. 93.208 Section 93.208 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF... FOR MEANS OF CONVEYANCE AND SHIPPING CONTAINERS Poultry § 93.208 Articles accompanying poultry. No...

  9. 9 CFR 93.307 - Articles accompanying horses.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Articles accompanying horses. 93.307 Section 93.307 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF... FOR MEANS OF CONVEYANCE AND SHIPPING CONTAINERS Horses § 93.307 Articles accompanying horses. No...

  10. 9 CFR 93.208 - Articles accompanying poultry.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 9 Animals and Animal Products 1 2012-01-01 2012-01-01 false Articles accompanying poultry. 93.208 Section 93.208 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF... FOR MEANS OF CONVEYANCE AND SHIPPING CONTAINERS Poultry § 93.208 Articles accompanying poultry. No...

  11. 9 CFR 93.307 - Articles accompanying horses.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 9 Animals and Animal Products 1 2012-01-01 2012-01-01 false Articles accompanying horses. 93.307 Section 93.307 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF... FOR MEANS OF CONVEYANCE AND SHIPPING CONTAINERS Horses § 93.307 Articles accompanying horses. No...

  12. 9 CFR 93.508 - Articles accompanying swine.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 9 Animals and Animal Products 1 2013-01-01 2013-01-01 false Articles accompanying swine. 93.508 Section 93.508 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF... FOR MEANS OF CONVEYANCE AND SHIPPING CONTAINERS Swine § 93.508 Articles accompanying swine. No litter...

  13. 9 CFR 93.508 - Articles accompanying swine.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 9 Animals and Animal Products 1 2011-01-01 2011-01-01 false Articles accompanying swine. 93.508 Section 93.508 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF... FOR MEANS OF CONVEYANCE AND SHIPPING CONTAINERS Swine § 93.508 Articles accompanying swine. No litter...

  14. 9 CFR 93.508 - Articles accompanying swine.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 9 Animals and Animal Products 1 2012-01-01 2012-01-01 false Articles accompanying swine. 93.508 Section 93.508 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF... FOR MEANS OF CONVEYANCE AND SHIPPING CONTAINERS Swine § 93.508 Articles accompanying swine. No litter...

  15. 9 CFR 93.208 - Articles accompanying poultry.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 9 Animals and Animal Products 1 2014-01-01 2014-01-01 false Articles accompanying poultry. 93.208 Section 93.208 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF... FOR MEANS OF CONVEYANCE AND SHIPPING CONTAINERS Poultry § 93.208 Articles accompanying poultry. No...

  16. 9 CFR 93.208 - Articles accompanying poultry.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Articles accompanying poultry. 93.208 Section 93.208 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF... FOR MEANS OF CONVEYANCE AND SHIPPING CONTAINERS Poultry § 93.208 Articles accompanying poultry. No...

  17. 9 CFR 93.508 - Articles accompanying swine.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 9 Animals and Animal Products 1 2014-01-01 2014-01-01 false Articles accompanying swine. 93.508 Section 93.508 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF... FOR MEANS OF CONVEYANCE AND SHIPPING CONTAINERS Swine § 93.508 Articles accompanying swine. No litter...

  18. 9 CFR 93.208 - Articles accompanying poultry.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 9 Animals and Animal Products 1 2013-01-01 2013-01-01 false Articles accompanying poultry. 93.208 Section 93.208 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF... FOR MEANS OF CONVEYANCE AND SHIPPING CONTAINERS Poultry § 93.208 Articles accompanying poultry. No...

  19. 9 CFR 93.307 - Articles accompanying horses.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 9 Animals and Animal Products 1 2013-01-01 2013-01-01 false Articles accompanying horses. 93.307 Section 93.307 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF... FOR MEANS OF CONVEYANCE AND SHIPPING CONTAINERS Horses § 93.307 Articles accompanying horses. No...

  20. 9 CFR 93.307 - Articles accompanying horses.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 9 Animals and Animal Products 1 2014-01-01 2014-01-01 false Articles accompanying horses. 93.307 Section 93.307 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF... FOR MEANS OF CONVEYANCE AND SHIPPING CONTAINERS Horses § 93.307 Articles accompanying horses. No...

  1. 9 CFR 93.508 - Articles accompanying swine.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Articles accompanying swine. 93.508 Section 93.508 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF... FOR MEANS OF CONVEYANCE AND SHIPPING CONTAINERS Swine § 93.508 Articles accompanying swine. No litter...

  2. Two types of electron events in solar flares

    NASA Technical Reports Server (NTRS)

    Daibog, E. I.; Kurt, V. G.; Logachev, Y. I.; Stolpovsky, V. G.

    1985-01-01

    The fluxes and spectra of the flare electrons measured on board Venera-I3 and I4 space probes are compared with the parameters of the hard (E sub x approximately 55 keV) and thermal X-ray bursts. The electron flux amplitude has been found to correlate with flare importance in the thermal X-ray range (r approximately 0.8). The following two types of flare events have been found in the electron component of SCR. The electron flux increase is accompanied by a hard X-ray burst and the electron spectrum index in the approximately 25 to 200 keV energy range is gamma approximately 2 to 3. The electron flux increase is not accompanied by a hard X-ray burst and the electron spectrum is softer (Delta gamma approximately 0.7 to 1.0).

  3. Small-amplitude backbone motions of the spin-labeled lipopeptide trichogin GA IV in a lipid membrane as revealed by electron spin echo.

    PubMed

    Syryamina, Victoria N; Isaev, Nikolay P; Peggion, Cristina; Formaggio, Fernando; Toniolo, Claudio; Raap, Jan; Dzuba, Sergei A

    2010-09-30

    Trichogin GA IV is a lipopeptide antibiotic of fungal origin, which is known to be able to modify the membrane permeability. TOAC nitroxide spin-labeled analogues of this membrane active peptide were investigated in hydrated bilayers of 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) by electron spin echo (ESE) spectroscopy. Because the TOAC nitroxide spin label is rigidly attached to the peptide backbone, it may report on the backbone orientational dynamics. The ESE signal in this system is observed below ∼150 K. Previously, three-pulse stimulated ESE was found to be sensitive to two types of orientational motion of spin-labeled POPC lipid bilayers at these temperatures. The first type is fast stochastic librations, with a correlation time on the nanosecond scale (which also manifests itself in a two-pulse primary ESE experiment). The second type is slow millisecond inertial rotations. In the present work, we find that at low molar peptide to lipid ratio (1:200), where the individual peptide molecules are randomly distributed at the membrane surface, the spin labels show only a fast type of motion. At the high molar peptide to lipid ratio (1:20), a slow motion is also observed. Because at this high concentration trichogin GA IV is known to change its orientation from the in-plane topology to the transmembrane disposition, the observed onset of a slow motion may be safely attributed to the dynamics of peptides, which are elongated along the lipid molecules of the membrane. The possible interrelation between this backbone rotational motion of the peptide antibiotic and the membrane leakage is discussed.

  4. Impaired Activation of Visual Attention Network for Motion Salience Is Accompanied by Reduced Functional Connectivity between Frontal Eye Fields and Visual Cortex in Strabismic Amblyopia

    PubMed Central

    Wang, Hao; Crewther, Sheila G.; Liang, Minglong; Laycock, Robin; Yu, Tao; Alexander, Bonnie; Crewther, David P.; Wang, Jian; Yin, Zhengqin

    2017-01-01

    Strabismic amblyopia is now acknowledged to be more than a simple loss of acuity and to involve alterations in visually driven attention, though whether this applies to both stimulus-driven and goal-directed attention has not been explored. Hence we investigated monocular threshold performance during a motion salience-driven attention task involving detection of a coherent dot motion target in one of four quadrants in adult controls and those with strabismic amblyopia. Psychophysical motion thresholds were impaired for the strabismic amblyopic eye, requiring longer inspection time and consequently slower target speed for detection compared to the fellow eye or control eyes. We compared fMRI activation and functional connectivity between four ROIs of the occipital-parieto-frontal visual attention network [primary visual cortex (V1), motion sensitive area V5, intraparietal sulcus (IPS) and frontal eye fields (FEF)], during a suprathreshold version of the motion-driven attention task, and also a simple goal-directed task, requiring voluntary saccades to targets randomly appearing along a horizontal line. Activation was compared when viewed monocularly by controls and the amblyopic and its fellow eye in strabismics. BOLD activation was weaker in IPS, FEF and V5 for both tasks when viewing through the amblyopic eye compared to viewing through the fellow eye or control participants' non-dominant eye. No difference in V1 activation was seen between the amblyopic and fellow eye, nor between the two eyes of control participants during the motion salience task, though V1 activation was significantly less through the amblyopic eye than through the fellow eye and control group non-dominant eye viewing during the voluntary saccade task. Functional correlations of ROIs within the attention network were impaired through the amblyopic eye during the motion salience task, whereas this was not the case during the voluntary saccade task. Specifically, FEF showed reduced functional

  5. Unbalanced field RF electron gun

    DOEpatents

    Hofler, Alicia

    2013-11-12

    A design for an RF electron gun having a gun cavity utilizing an unbalanced electric field arrangement. Essentially, the electric field in the first (partial) cell has higher field strength than the electric field in the second (full) cell of the electron gun. The accompanying method discloses the use of the unbalanced field arrangement in the operation of an RF electron gun in order to accelerate an electron beam.

  6. The fourth age of quantum chemistry: molecules in motion.

    PubMed

    Császár, Attila G; Fábri, Csaba; Szidarovszky, Tamás; Mátyus, Edit; Furtenbacher, Tibor; Czakó, Gábor

    2012-01-21

    Developments during the last two decades in nuclear motion theory made it possible to obtain variational solutions to the time-independent, nuclear-motion Schrödinger equation of polyatomic systems as "exact" as the potential energy surface (PES) is. Nuclear motion theory thus reached a level whereby this branch of quantum chemistry started to catch up with the well developed and widely applied other branch, electronic structure theory. It seems to be fair to declare that we are now in the fourth age of quantum chemistry, where the first three ages are principally defined by developments in electronic structure techniques (G. Richards, Nature, 1979, 278, 507). In the fourth age we are able to incorporate into our quantum chemical treatment the motion of nuclei in an exact fashion and, for example, go beyond equilibrium molecular properties and compute accurate, temperature-dependent, effective properties, thus closing the gap between measurements and electronic structure computations. In this Perspective three fundamental algorithms for the variational solution of the time-independent nuclear-motion Schrödinger equation employing exact kinetic energy operators are presented: one based on tailor-made Hamiltonians, one on the Eckart-Watson Hamiltonian, and one on a general internal-coordinate Hamiltonian. It is argued that the most useful and most widely applicable procedure is the third one, based on a Hamiltonian containing a kinetic energy operator written in terms of internal coordinates and an arbitrary embedding of the body-fixed frame of the molecule. This Hamiltonian makes it feasible to treat the nuclear motions of arbitrary quantum systems, irrespective of whether they exhibit a single well-defined minimum or not, and of arbitrary reduced-dimensional models. As a result, molecular spectroscopy, an important field for the application of nuclear motion theory, has almost black-box-type tools at its disposal. Variational nuclear motion computations, based on

  7. Motion of 1/3⟨111⟩ dislocations on Σ3 {112} twin boundaries in nanotwinned copper

    NASA Astrophysics Data System (ADS)

    Lu, N.; Du, K.; Lu, L.; Ye, H. Q.

    2014-01-01

    The atomic structure of Σ3 {112} ITBs in nanotwinned Cu is investigated by using aberration-corrected high resolution transmission electron microscopy (HRTEM) and in situ HRTEM observations. The Σ3 {112} ITBs are consisted of periodically repeated three partial dislocations. The in situ HRTEM results show that 1/3[111] partial dislocation moves on the Σ3 {112} incoherent twin boundary (ITB), which was accompanied by a migration of the ITB. A dislocation reaction mechanism is proposed for the motion of 1/3[111] Frank partial dislocation, in which the 1/3[111] partial dislocation exchanges its position with twin boundary dislocations in sequence. In this way, the 1/3[111] dislocation can move on the incoherent twin boundary in metals with low stacking fault energy. Meanwhile, the ITB will migrate in its normal direction accordingly. These results provide insight into the reaction mechanism of 1/3[111] dislocations and ITBs and the associated migration of ITBs.

  8. Electron beam deflection control system of a welding and surface modification installation

    NASA Astrophysics Data System (ADS)

    Koleva, E.; Dzharov, V.; Gerasimov, V.; Tsvetkov, K.; Mladenov, G.

    2018-03-01

    In the present work, we examined the patterns of the electron beam motion when controlling the transverse with respect to the axis of the beam homogeneous magnetic field created by the coils of the deflection system the electron gun. During electron beam processes, the beam motion is determined the process type (welding, surface modification, etc.), the technological mode, the design dimensions of the electron gun and the shape of the processed samples. The electron beam motion is defined by the cumulative action of two cosine-like control signals generated by a functional generator. The signal control is related to changing the amplitudes, frequencies and phases (phase differences) of the generated voltages. We realized the motion control by applying a graphical user interface developed by us and an Arduino Uno programmable microcontroller. The signals generated were calibrated using experimental data from the available functional generator. The free and precise motion on arbitrary trajectories determines the possible applications of an electron beam process to carrying out various scientific research tasks in material processing.

  9. Motion Recognition and Modifying Motion Generation for Imitation Robot Based on Motion Knowledge Formation

    NASA Astrophysics Data System (ADS)

    Okuzawa, Yuki; Kato, Shohei; Kanoh, Masayoshi; Itoh, Hidenori

    A knowledge-based approach to imitation learning of motion generation for humanoid robots and an imitative motion generation system based on motion knowledge learning and modification are described. The system has three parts: recognizing, learning, and modifying parts. The first part recognizes an instructed motion distinguishing it from the motion knowledge database by the continuous hidden markov model. When the motion is recognized as being unfamiliar, the second part learns it using locally weighted regression and acquires a knowledge of the motion. When a robot recognizes the instructed motion as familiar or judges that its acquired knowledge is applicable to the motion generation, the third part imitates the instructed motion by modifying a learned motion. This paper reports some performance results: the motion imitation of several radio gymnastics motions.

  10. The fiber optic gyroscope - a portable rotational ground motion sensor

    NASA Astrophysics Data System (ADS)

    Wassermann, J. M.; Bernauer, F.; Guattari, F.; Igel, H.

    2016-12-01

    It was already shown that a portable broadband rotational ground motion sensor will have large impact on several fields of seismological research such as volcanology, marine geophysics, seismic tomography and planetary seismology. Here, we present results of tests and experiments with one of the first broadband rotational motion sensors available. BlueSeis-3A, is a fiber optic gyroscope (FOG) especially designed for the needs of seismology, developed by iXBlue, France, in close collaboration with researchers financed by the European Research council project ROMY (Rotational motions - a new observable for seismology). We first present the instrument characteristics which were estimated by different standard laboratory tests, e.g. self noise using operational range diagrams or Allan deviation. Next we present the results of a field experiment which was designed to demonstrate the value of a 6C measurement (3 components of translation and 3 components of rotation). This field test took place at Mt. Stromboli volcano, Italy, and is accompanied by seismic array installation to proof the FOG output against more commonly known array derived rotation. As already shown with synthetic data an additional direct measurement of three components of rotation can reduce the ambiguity in source mechanism estimation and can be taken to correct for dynamic tilt of the translational sensors (i.e. seismometers). We can therefore demonstrate that the deployment of a weak motion broadband rotational motion sensor is in fact producing superior results by a reduction of the number of deployed instruments.

  11. Ultrafast large-amplitude relocation of electronic charge in ionic crystals

    PubMed Central

    Zamponi, Flavio; Rothhardt, Philip; Stingl, Johannes; Woerner, Michael; Elsaesser, Thomas

    2012-01-01

    The interplay of vibrational motion and electronic charge relocation in an ionic hydrogen-bonded crystal is mapped by X-ray powder diffraction with a 100 fs time resolution. Photoexcitation of the prototype material KH2PO4 induces coherent low-frequency motions of the PO4 tetrahedra in the electronically excited state of the crystal while the average atomic positions remain unchanged. Time-dependent maps of electron density derived from the diffraction data demonstrate an oscillatory relocation of electronic charge with a spatial amplitude two orders of magnitude larger than the underlying vibrational lattice motions. Coherent longitudinal optical and tranverse optical phonon motions that dephase on a time scale of several picoseconds, drive the charge relocation, similar to a soft (transverse optical) mode driven phase transition between the ferro- and paraelectric phase of KH2PO4. PMID:22431621

  12. Two-dimensional electronic spectra from the hierarchical equations of motion method: Application to model dimers

    NASA Astrophysics Data System (ADS)

    Chen, Liping; Zheng, Renhui; Shi, Qiang; Yan, YiJing

    2010-01-01

    We extend our previous study of absorption line shapes of molecular aggregates using the Liouville space hierarchical equations of motion (HEOM) method [L. P. Chen, R. H. Zheng, Q. Shi, and Y. J. Yan, J. Chem. Phys. 131, 094502 (2009)] to calculate third order optical response functions and two-dimensional electronic spectra of model dimers. As in our previous work, we have focused on the applicability of several approximate methods related to the HEOM method. We show that while the second order perturbative quantum master equations are generally inaccurate in describing the peak shapes and solvation dynamics, they can give reasonable peak amplitude evolution even in the intermediate coupling regime. The stochastic Liouville equation results in good peak shapes, but does not properly describe the excited state dynamics due to the lack of detailed balance. A modified version of the high temperature approximation to the HEOM gives the best agreement with the exact result.

  13. Column-by-column observation of dislocation motion in CdTe: Dynamic scanning transmission electron microscopy

    NASA Astrophysics Data System (ADS)

    Li, Chen; Zhang, Yu-Yang; Pennycook, Timothy J.; Wu, Yelong; Lupini, Andrew R.; Paudel, Naba; Pantelides, Sokrates T.; Yan, Yanfa; Pennycook, Stephen J.

    2016-10-01

    The dynamics of partial dislocations in CdTe have been observed at the atomic scale using aberration-corrected scanning transmission electron microscopy (STEM), allowing the mobility of different dislocations to be directly compared: Cd-core Shockley partial dislocations are more mobile than Te-core partials, and dislocation cores with unpaired columns have higher mobility than those without unpaired columns. The dynamic imaging also provides insight into the process by which the dislocations glide. Dislocations with dangling bonds on unpaired columns are found to be more mobile because the dangling bonds mediate the bond exchanges required for the dislocations to move. Furthermore, a screw dislocation has been resolved to dissociate into a Shockley partial-dislocation pair along two different directions, revealing a way for the screw dislocation to glide in the material. The results show that dynamic STEM imaging has the potential to uncover the details of dislocation motion not easily accessible by other means.

  14. The influence hydrogen atom addition has on charge switching during motion of the metal atom in endohedral Ca@C60H4 isomers

    PubMed Central

    Raggi, G.; Besley, E.; Stace, A. J.

    2016-01-01

    Density functional theory has been applied in a study of charge transfer between an endohedral calcium atom and the fullerene cage in Ca@C60H4 and [Ca@C60H4]+ isomers. Previous calculations on Ca@C60 have shown that the motion of calcium within a fullerene is accompanied by large changes in electron density on the carbon cage. Based on this observation, it has been proposed that a tethered endohedral fullerene might form the bases of a nanoswitch. Through the addition of hydrogen atoms to one hemisphere of the cage it is shown that, when compared with Ca@C60, asymmetric and significantly reduced energy barriers can be generated with respect to motion of the calcium atom. It is proposed that hydrogen atom addition to a fullerene might offer a route for creating a bi-stable nanoswitch that can be fine-tuned through the selection of an appropriate isomer and number of atoms attached to the cage of an endohedral fullerene. This article is part of the themed issue ‘Fullerenes: past, present and future, celebrating the 30th anniversary of Buckminster Fullerene’. PMID:27501967

  15. A novel yet effective motion artefact reduction method for continuous physiological monitoring

    NASA Astrophysics Data System (ADS)

    Alzahrani, A.; Hu, S.; Azorin-Peris, V.; Kalawsky, R.; Zhang, X.; Liu, C.

    2014-03-01

    This study presents a non-invasive and wearable optical technique to continuously monitor vital human signs as required for personal healthcare in today's increasing ageing population. The study has researched an effective way to capture human critical physiological parameters, i.e., oxygen saturation (SaO2%), heart rate, respiration rate, body temperature, heart rate variability by a closely coupled wearable opto-electronic patch sensor (OEPS) together with real-time and secure wireless communication functionalities. The work presents the first step of this research; an automatic noise cancellation method using a 3-axes MEMS accelerometer to recover signals corrupted by body movement which is one of the biggest sources of motion artefacts. The effects of these motion artefacts have been reduced by an enhanced electronic design and development of self-cancellation of noise and stability of the sensor. The signals from the acceleration and the opto-electronic sensor are highly correlated thus leading to the desired pulse waveform with rich bioinformatics signals to be retrieved with reduced motion artefacts. The preliminary results from the bench tests and the laboratory setup demonstrate that the goal of the high performance wearable opto-electronics is viable and feasible.

  16. Neural mechanisms underlying sensitivity to reverse-phi motion in the fly

    PubMed Central

    Meier, Matthias; Serbe, Etienne; Eichner, Hubert; Borst, Alexander

    2017-01-01

    Optical illusions provide powerful tools for mapping the algorithms and circuits that underlie visual processing, revealing structure through atypical function. Of particular note in the study of motion detection has been the reverse-phi illusion. When contrast reversals accompany discrete movement, detected direction tends to invert. This occurs across a wide range of organisms, spanning humans and invertebrates. Here, we map an algorithmic account of the phenomenon onto neural circuitry in the fruit fly Drosophila melanogaster. Through targeted silencing experiments in tethered walking flies as well as electrophysiology and calcium imaging, we demonstrate that ON- or OFF-selective local motion detector cells T4 and T5 are sensitive to certain interactions between ON and OFF. A biologically plausible detector model accounts for subtle features of this particular form of illusory motion reversal, like the re-inversion of turning responses occurring at extreme stimulus velocities. In light of comparable circuit architecture in the mammalian retina, we suggest that similar mechanisms may apply even to human psychophysics. PMID:29261684

  17. Visual Motion Processing Subserves Faster Visuomotor Reaction in Badminton Players.

    PubMed

    Hülsdünker, Thorben; Strüder, Heiko K; Mierau, Andreas

    2017-06-01

    Athletes participating in ball or racquet sports have to respond to visual stimuli under critical time pressure. Previous studies used visual contrast stimuli to determine visual perception and visuomotor reaction in athletes and nonathletes; however, ball and racquet sports are characterized by motion rather than contrast visual cues. Because visual contrast and motion signals are processed in different cortical regions, this study aimed to determine differences in perception and processing of visual motion between athletes and nonathletes. Twenty-five skilled badminton players and 28 age-matched nonathletic controls participated in this study. Using a 64-channel EEG system, we investigated visual motion perception/processing in the motion-sensitive middle temporal (MT) cortical area in response to radial motion of different velocities. In a simple visuomotor reaction task, visuomotor transformation in Brodmann area 6 (BA6) and BA4 as well as muscular activation (EMG onset) and visuomotor reaction time (VMRT) were investigated. Stimulus- and response-locked potentials were determined to differentiate between perceptual and motor-related processes. As compared with nonathletes, athletes showed earlier EMG onset times (217 vs 178 ms, P < 0.001), accompanied by a faster VMRT (274 vs 243 ms, P < 0.001). Furthermore, athletes showed an earlier stimulus-locked peak activation of MT (200 vs 182 ms, P = 0.002) and BA6 (161 vs 137 ms, P = 0.009). Response-locked peak activation in MT was later in athletes (-7 vs 26 ms, P < 0.001), whereas no group differences were observed in BA6 and BA4. Multiple regression analyses with stimulus- and response-locked cortical potentials predicted EMG onset (r = 0.83) and VMRT (r = 0.77). The athletes' superior visuomotor performance in response to visual motion is primarily related to visual perception and, to a minor degree, to motor-related processes.

  18. Low-Temperature Scanning Capacitance Probe for Imaging Electron Motion

    NASA Astrophysics Data System (ADS)

    Bhandari, S.; Westervelt, R. M.

    2014-12-01

    Novel techniques to probe electronic properties at the nanoscale can shed light on the physics of nanoscale devices. In particular, studying the scattering of electrons from edges and apertures at the nanoscale and imaging the electron profile in a quantum dot, have been of interest [1]. In this paper, we present the design and implementation of a cooled scanning capacitance probe that operates at liquid He temperatures to image electron waves in nanodevices. The conducting tip of a scanned probe microscope is held above the nanoscale structure, and an applied sample-to-tip voltage creates an image charge that is measured by a cooled charge amplifier [2] adjacent to the tip. The circuit is based on a low-capacitance, high- electron-mobility transistor (Fujitsu FHX35X). The input is a capacitance bridge formed by a low capacitance pinched-off HEMT transistor and tip-sample capacitance. We have achieved low noise level (0.13 e/VHz) and high spatial resolution (100 nm) for this technique, which promises to be a useful tool to study electronic behavior in nanoscale devices.

  19. Multi-point Measurements of Relativistic Electrons in the Magnetosphere

    NASA Astrophysics Data System (ADS)

    Li, X.; Selesnick, R.; Baker, D. N.; Blake, J. B.; Schiller, Q.; Blum, L. W.; Zhao, H.; Jaynes, A. N.; Kanekal, S.

    2014-12-01

    We take an advantage of five different DC electric field measurements in the plasma sheet available from the EFW double probe experiment, EDI electron drift instrument, CODIF and HIA ion spectrometers, and PEACE electron spectrometer on the four Cluster spacecraft. The calibrated observations of the three spectrometers are used to determine the proton and electron velocity moments. The velocity moments can be used to estimate the proton and electron drift velocity and furthermore the DC electric field, assuming that the electron and proton velocity perpendicular to the magnetic field is dominated by the ExB drift motion. Naturally when ions and electrons do not perform a proper drift motion, which can happen in the plasma sheet, the estimated DC electric field from ion and electron motion is not correct. However, surprisingly often the DC electric fields estimated from electron and ion motions are identical suggesting that this field is a real DC electric field around the measurement point. As the measurement techniques are so different, it is quite plausible that when two different measurements yield the same DC electric field, it is the correct field. All five measurements of the DC electric field are usually not simultaneously available, especially on Cluster 2 where CODIF and HIA are not operational, or on Cluster 4 where EDI is off. In this presentation we investigate DC electric field in various transient plasma sheet events such as dipolarization events and BBF's and how the five measurements agree or disagree. There are plenty of important issues that are considered, e.g., (1) what kind of DC electric fields exist in such events and what are their spatial scales, (2) do electrons and ions perform ExB drift motions in these events, and (3) how well the instruments have been calibrated.

  20. Iterative motion compensation approach for ultrasonic thermal imaging

    NASA Astrophysics Data System (ADS)

    Fleming, Ioana; Hager, Gregory; Guo, Xiaoyu; Kang, Hyun Jae; Boctor, Emad

    2015-03-01

    As thermal imaging attempts to estimate very small tissue motion (on the order of tens of microns), it can be negatively influenced by signal decorrelation. Patient's breathing and cardiac cycle generate shifts in the RF signal patterns. Other sources of movement could be found outside the patient's body, like transducer slippage or small vibrations due to environment factors like electronic noise. Here, we build upon a robust displacement estimation method for ultrasound elastography and we investigate an iterative motion compensation algorithm, which can detect and remove non-heat induced tissue motion at every step of the ablation procedure. The validation experiments are performed on laboratory induced ablation lesions in ex-vivo tissue. The ultrasound probe is either held by the operator's hand or supported by a robotic arm. We demonstrate the ability to detect and remove non-heat induced tissue motion in both settings. We show that removing extraneous motion helps unmask the effects of heating. Our strain estimation curves closely mirror the temperature changes within the tissue. While previous results in the area of motion compensation were reported for experiments lasting less than 10 seconds, our algorithm was tested on experiments that lasted close to 20 minutes.

  1. 77 FR 71187 - Greenwood County; Notice of Application for Amendment of License and Soliciting Comments, Motions...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-11-29

    ...; Notice of Application for Amendment of License and Soliciting Comments, Motions To Intervene, and... comments, motions to intervene, and protests: December 24, 2012. All documents may be filed electronically...-099) on any comments or motions filed. The Commission's Rules of Practice and Procedure require all...

  2. Freestanding Triboelectric Nanogenerator Enables Noncontact Motion-Tracking and Positioning.

    PubMed

    Guo, Huijuan; Jia, Xueting; Liu, Lue; Cao, Xia; Wang, Ning; Wang, Zhong Lin

    2018-04-24

    Recent development of interactive motion-tracking and positioning technologies is attracting increasing interests in many areas, such as wearable electronics, intelligent electronics, and the internet of things. For example, the so-called somatosensory technology can afford users strong empathy of immersion and realism due to their consistent interaction with the game. Here, we report a noncontact self-powered positioning and motion-tracking system based on a freestanding triboelectric nanogenerator (TENG). The TENG was fabricated by a nanoengineered surface in the contact-separation mode with the use of a free moving human body (hands or feet) as the trigger. The poly(tetrafluoroethylene) (PTFE) arrays based interactive interface can give an output of 222 V from casual human motions. Different from previous works, this device also responses to a small action at certain heights of 0.01-0.11 m from the device with a sensitivity of about 315 V·m -1 , so that the mechanical sensing is possible. Such a distinctive noncontact sensing feature promotes a wide range of potential applications in smart interaction systems.

  3. Non-iterative triple excitations in equation-of-motion coupled-cluster theory for electron attachment with applications to bound and temporary anions.

    PubMed

    Jagau, Thomas-C

    2018-01-14

    The impact of residual electron correlation beyond the equation-of-motion coupled-cluster singles and doubles (EOM-CCSD) approximation on positions and widths of electronic resonances is investigated. To establish a method that accomplishes this task in an economical manner, several approaches proposed for the approximate treatment of triple excitations are reviewed with respect to their performance in the electron attachment (EA) variant of EOM-CC theory. The recently introduced EOM-CCSD(T)(a)* method [D. A. Matthews and J. F. Stanton, J. Chem. Phys. 145, 124102 (2016)], which includes non-iterative corrections to the reference and the target states, reliably reproduces vertical attachment energies from EOM-EA-CC calculations with single, double, and full triple excitations in contrast to schemes in which non-iterative corrections are applied only to the target states. Applications of EOM-EA-CCSD(T)(a)* augmented by a complex absorbing potential (CAP) to several temporary anions illustrate that shape resonances are well described by EOM-EA-CCSD, but that residual electron correlation often makes a non-negligible impact on their positions and widths. The positions of Feshbach resonances, on the other hand, are significantly improved when going from CAP-EOM-EA-CCSD to CAP-EOM-EA-CCSD(T)(a)*, but the correct energetic order of the relevant electronic states is still not achieved.

  4. Non-iterative triple excitations in equation-of-motion coupled-cluster theory for electron attachment with applications to bound and temporary anions

    NASA Astrophysics Data System (ADS)

    Jagau, Thomas-C.

    2018-01-01

    The impact of residual electron correlation beyond the equation-of-motion coupled-cluster singles and doubles (EOM-CCSD) approximation on positions and widths of electronic resonances is investigated. To establish a method that accomplishes this task in an economical manner, several approaches proposed for the approximate treatment of triple excitations are reviewed with respect to their performance in the electron attachment (EA) variant of EOM-CC theory. The recently introduced EOM-CCSD(T)(a)* method [D. A. Matthews and J. F. Stanton, J. Chem. Phys. 145, 124102 (2016)], which includes non-iterative corrections to the reference and the target states, reliably reproduces vertical attachment energies from EOM-EA-CC calculations with single, double, and full triple excitations in contrast to schemes in which non-iterative corrections are applied only to the target states. Applications of EOM-EA-CCSD(T)(a)* augmented by a complex absorbing potential (CAP) to several temporary anions illustrate that shape resonances are well described by EOM-EA-CCSD, but that residual electron correlation often makes a non-negligible impact on their positions and widths. The positions of Feshbach resonances, on the other hand, are significantly improved when going from CAP-EOM-EA-CCSD to CAP-EOM-EA-CCSD(T)(a)*, but the correct energetic order of the relevant electronic states is still not achieved.

  5. The accompanying adult: authority to give consent in the UK.

    PubMed

    Lal, Seema Madhur Lata; Parekh, Susan; Mason, Carol; Roberts, Graham

    2007-05-01

    Children may be accompanied by various people when attending for dental treatment. Before treatment is started, there is a legal requirement that the operator obtain informed consent for the proposed procedure. In the case of minors, the person authorized to give consent (parental responsibility) is usually a parent. To ascertain if accompanying persons of children attending the Department of Paediatric Dentistry at the Eastman Dental Hospital, London were empowered to give consent for the child's dental treatment. A total of 250 accompanying persons of children attending were selected, over a 6-month period. A questionnaire was used to establish whether the accompanying person(s) were authorized to give consent. The study showed that 12% of accompanying persons had no legal authority to give consent for the child's dental treatment. Clinicians need to be aware of the status of persons accompanying children to ensure valid consent is obtained.

  6. 16 CFR § 1500.125 - Labeling requirements for accompanying literature.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 16 Commercial Practices 2 2013-01-01 2013-01-01 false Labeling requirements for accompanying literature. § 1500.125 Section § 1500.125 Commercial Practices CONSUMER PRODUCT SAFETY COMMISSION FEDERAL... REGULATIONS § 1500.125 Labeling requirements for accompanying literature. When any accompanying literature...

  7. The 3-axis Dynamic Motion Simulator (DMS) system

    NASA Technical Reports Server (NTRS)

    1975-01-01

    A three-axis dynamic motion simulator (DMS) consisting of a test table with three degrees of freedom and an electronics control system was designed, constructed, delivered, and tested. Documentation, as required in the Data Requirements List (DRL), was also provided.

  8. Marketing Violent Entertainment to Children: A One-Year Follow-Up Review of Industry Practices in the Motion Picture, Music Recording and Electronic Game Industries. A Report to Congress.

    ERIC Educational Resources Information Center

    Federal Trade Commission, Washington, DC.

    In a report issued in September 2000, the Federal Trade Commission reported that the motion picture, music recording, and electronic game segments of the entertainment industry intentionally promoted products to children that warranted parent cautions. This report responds to the request of the Senate Commerce Committee by focusing on advertising…

  9. Measuring Conformational Dynamics of Single Biomolecules Using Nanoscale Electronic Devices

    NASA Astrophysics Data System (ADS)

    Akhterov, Maxim V.; Choi, Yongki; Sims, Patrick C.; Olsen, Tivoli J.; Gul, O. Tolga; Corso, Brad L.; Weiss, Gregory A.; Collins, Philip G.

    2014-03-01

    Molecular motion can be a rate-limiting step of enzyme catalysis, but motions are typically too quick to resolve with fluorescent single molecule techniques. Recently, we demonstrated a label-free technique that replaced fluorophores with nano-electronic circuits to monitor protein motions. The solid-state electronic technique used single-walled carbon nanotube (SWNT) transistors to monitor conformational motions of a single molecule of T4 lysozyme while processing its substrate, peptidoglycan. As lysozyme catalyzes the hydrolysis of glycosidic bonds, two protein domains undergo 8 Å hinge bending motion that generates an electronic signal in the SWNT transistor. We describe improvements to the system that have extended our temporal resolution to 2 μs . Electronic recordings at this level of detail directly resolve not just transitions between open and closed conformations but also the durations for those transition events. Statistical analysis of many events determines transition timescales characteristic of enzyme activity and shows a high degree of variability within nominally identical chemical events. The high resolution technique can be readily applied to other complex biomolecules to gain insights into their kinetic parameters and catalytic function.

  10. Modeling and visualization of carrier motion in organic films by optical second harmonic generation and Maxwell-displacement current

    NASA Astrophysics Data System (ADS)

    Iwamoto, Mitsumasa; Manaka, Takaaki; Taguchi, Dai

    2015-09-01

    The probing and modeling of carrier motions in materials as well as in electronic devices is a fundamental research subject in science and electronics. According to the Maxwell electromagnetic field theory, carriers are a source of electric field. Therefore, by probing the dielectric polarization caused by the electric field arising from moving carriers and dipoles, we can find a way to visualize the carrier motions in materials and in devices. The techniques used here are an electrical Maxwell-displacement current (MDC) measurement and a novel optical method based on the electric field induced optical second harmonic generation (EFISHG) measurement. The MDC measurement probes changes of induced charge on electrodes, while the EFISHG probes nonlinear polarization induced in organic active layers due to the coupling of electron clouds of molecules and electro-magnetic waves of an incident laser beam in the presence of a DC field caused by electrons and holes. Both measurements allow us to probe dynamical carrier motions in solids through the detection of dielectric polarization phenomena originated from dipolar motions and electron transport. In this topical review, on the basis of Maxwell’s electro-magnetism theory of 1873, which stems from Faraday’s idea, the concept for probing electron and hole transport in solids by using the EFISHG is discussed in comparison with the conventional time of flight (TOF) measurement. We then visualize carrier transit in organic devices, i.e. organic field effect transistors, organic light emitting diodes, organic solar cells, and others. We also show that visualizing an EFISHG microscopic image is a novel way for characterizing anisotropic carrier transport in organic thin films. We also discuss the concept of the detection of rotational dipolar motions in monolayers by means of the MDC measurement, which is capable of probing the change of dielectric spontaneous polarization formed by dipoles in organic monolayers. Finally we

  11. Study on feasibility of laser reflective tomography with satellite-accompany

    NASA Astrophysics Data System (ADS)

    Gu, Yu; Hu, Yi-hua; Hao, Shi-qi; Gu, You-lin; Zhao, Nan-xiang; Wang, Yang-yang

    2015-10-01

    Laser reflective tomography is a long-range, high-resolution active detection technology, whose advantage is that the spatial resolution is unrelated with the imaging distance. Accompany satellite is a specific satellite around the target spacecraft with encircling movement. When using the accompany satellite to detect the target aircraft, multi-angle echo data can be obtained with the application of reflective tomography imaging. The feasibility of such detection working mode was studied in this article. Accompany orbit model was established with horizontal circular fleet and the parameters of accompany flight was defined. The simulation of satellite-to-satellite reflective tomography imaging with satellite-accompany was carried out. The operating mode of reflective tomographic data acquisition from monostatic laser radar was discussed and designed. The flight period, which equals to the all direction received data consuming time, is one of the important accompany flight parameters. The azimuth angle determines the plane of image formation while the elevation angle determines the projection direction. Both of the azimuth and elevation angles guide the satellite attitude stability controller in order to point the laser radar spot on the target. The influences of distance between accompany satellite and target satellite on tomographic imaging consuming time was analyzed. The influences of flight period, azimuth angle and elevation angle on tomographic imaging were analyzed as well. Simulation results showed that the satellite-accompany laser reflective tomography is a feasible and effective method to the satellite-to-satellite detection.

  12. Antiphase Fermi-surface modulations accompanying displacement excitation in a parent compound of iron-based superconductors

    NASA Astrophysics Data System (ADS)

    Okazaki, Kozo; Suzuki, Hakuto; Suzuki, Takeshi; Yamamoto, Takashi; Someya, Takashi; Ogawa, Yu; Okada, Masaru; Fujisawa, Masami; Kanai, Teruto; Ishii, Nobuhisa; Itatani, Jiro; Nakajima, Masamichi; Eisaki, Hiroshi; Fujimori, Atsushi; Shin, Shik

    2018-03-01

    We investigate the transient electronic structure of BaFe2As2 , a parent compound of iron-based superconductors, by time- and angle-resolved photoemission spectroscopy. In order to probe the entire Brillouin zone, we utilize extreme ultraviolet photons and observe photoemission intensity oscillation with the frequency of the A1 g phonon which is antiphase between the zone-centered hole Fermi surfaces (FSs) and zone-cornered electron FSs. We attribute the antiphase behavior to the warping in one of the zone-centered hole FSs accompanying the displacement of the pnictogen height and find that this displacement is the same direction as that induced by substitution of P for As, where superconductivity is induced by a structural modification without carrier doping in this system.

  13. Analysis of achievable disturbance attenuation in a precision magnetically-suspended motion control system

    NASA Technical Reports Server (NTRS)

    Kuzin, Alexander V.; Holmes, Michael L.; Behrouzjou, Roxana; Trumper, David L.

    1994-01-01

    The results of the analysis of the achievable disturbance attenuation to get an Angstrom motion control resolution and macroscopic travel in a precision magnetically-suspended motion control system are presented in this paper. Noise sources in the transducers, electronics, and mechanical vibrations are used to develop the control design.

  14. Self-Motion Perception and Motion Sickness

    NASA Technical Reports Server (NTRS)

    Fox, Robert A.

    1991-01-01

    Motion sickness typically is considered a bothersome artifact of exposure to passive motion in vehicles of conveyance. This condition seldom has significant impact on the health of individuals because it is of brief duration, it usually can be prevented by simply avoiding the eliciting condition and, when the conditions that produce it are unavoidable, sickness dissipates with continued exposure. The studies conducted examined several aspects of motion sickness in animal models. A principle objective of these studies was to investigate the neuroanatomy that is important in motion sickness with the objectives of examining both the utility of putative models and defining neural mechanisms that are important in motion sickness.

  15. Who accompanies children to a dental hospital appointment?

    PubMed

    Virdee, P K; Rodd, H D

    2007-06-01

    To determine who accompanies paediatric dental patients to their appointments, in a teaching hospital setting. Data were recorded prospectively for children attending the Paediatric Dentistry clinic of the Charles Clifford Dental Hospital, Sheffield, England, over 4 months which included two school holiday periods. The data were recorded on a standardised data collection sheet, which included age and gender of the patient; number/s of accompanying adults and children and their relationship to the patient; the appointment session and appointment type. A total of 394 paediatric dental visits were recorded. Patients were of a mean age of 10 (range 1-17 years). Most visits were for treatment (44.7%) and review (39.8%), with a much smaller proportion being new patient assessments (8.9%) and emergency appointments (6.6%). The numbers of afternoon and morning sessions recorded were approximately similar and 35% of the visits were recorded in a school holiday day. The majority of patients attended with at least one parent (91.6%). A parent was most likely to attend a new patient assessment (97.1%) or review visit (94.3%). Parental presence was less likely for treatment (89%) and least likely for emergency visits (84%). Most patients attended with their mother (62.1%). Patients were less frequently accompanied by parents (13.1%), their father (12.1%) and one or both grandparents (4.3%). Smaller proportions were accompanied by older siblings, a step parent, other relatives or foster carers. Two patients attended unaccompanied. The time of day, or whether it was a school holiday period or not, did not influence parental presence or the numbers of adults accompanying patients. However the additional presence of other children (non patients) was more likely on morning sessions and during school holidays. One way analysis of variance (ANOVA), an independent sample t-test or chi-squared tests were undertaken as appropriate to determine whether there were any significant

  16. Hydrodynamics of electrons in graphene.

    PubMed

    Lucas, Andrew; Fong, Kin Chung

    2018-02-07

    Generic interacting many-body quantum systems are believed to behave as classical fluids on long time and length scales. Due to rapid progress in growing exceptionally pure crystals, we are now able to experimentally observe this collective motion of electrons in solid-state systems, including graphene. We present a review of recent progress in understanding the hydrodynamic limit of electronic motion in graphene, written for physicists from diverse communities. We begin by discussing the 'phase diagram' of graphene, and the inevitable presence of impurities and phonons in experimental systems. We derive hydrodynamics, both from a phenomenological perspective and using kinetic theory. We then describe how hydrodynamic electron flow is visible in electronic transport measurements. Although we focus on graphene in this review, the broader framework naturally generalizes to other materials. We assume only basic knowledge of condensed matter physics, and no prior knowledge of hydrodynamics.

  17. Hydrodynamics of electrons in graphene

    NASA Astrophysics Data System (ADS)

    Lucas, Andrew; Chung Fong, Kin

    2018-02-01

    Generic interacting many-body quantum systems are believed to behave as classical fluids on long time and length scales. Due to rapid progress in growing exceptionally pure crystals, we are now able to experimentally observe this collective motion of electrons in solid-state systems, including graphene. We present a review of recent progress in understanding the hydrodynamic limit of electronic motion in graphene, written for physicists from diverse communities. We begin by discussing the ‘phase diagram’ of graphene, and the inevitable presence of impurities and phonons in experimental systems. We derive hydrodynamics, both from a phenomenological perspective and using kinetic theory. We then describe how hydrodynamic electron flow is visible in electronic transport measurements. Although we focus on graphene in this review, the broader framework naturally generalizes to other materials. We assume only basic knowledge of condensed matter physics, and no prior knowledge of hydrodynamics.

  18. Orbital electron capture by the nucleus

    NASA Technical Reports Server (NTRS)

    Bambynek, W.; Behrens, H.; Chen, M. H.; Crasemann, B.; Fitzpatrick, M. L.; Ledingham, K. W. D.; Genz, H.; Mutterer, M.; Intemann, R. L.

    1976-01-01

    The theory of nuclear electron capture is reviewed in the light of current understanding of weak interactions. Experimental methods and results regarding capture probabilities, capture ratios, and EC/Beta(+) ratios are summarized. Radiative electron capture is discussed, including both theory and experiment. Atomic wave function overlap and electron exchange effects are covered, as are atomic transitions that accompany nuclear electron capture. Tables are provided to assist the reader in determining quantities of interest for specific cases.

  19. Beam-induced motion correction for sub-megadalton cryo-EM particles.

    PubMed

    Scheres, Sjors Hw

    2014-08-13

    In electron cryo-microscopy (cryo-EM), the electron beam that is used for imaging also causes the sample to move. This motion blurs the images and limits the resolution attainable by single-particle analysis. In a previous Research article (Bai et al., 2013) we showed that correcting for this motion by processing movies from fast direct-electron detectors allowed structure determination to near-atomic resolution from 35,000 ribosome particles. In this Research advance article, we show that an improved movie processing algorithm is applicable to a much wider range of specimens. The new algorithm estimates straight movement tracks by considering multiple particles that are close to each other in the field of view, and models the fall-off of high-resolution information content by radiation damage in a dose-dependent manner. Application of the new algorithm to four data sets illustrates its potential for significantly improving cryo-EM structures, even for particles that are smaller than 200 kDa. Copyright © 2014, Scheres.

  20. Internal twisting motion dependent conductance of an aperiodic DNA molecule

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta

    The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less

  1. How to Measure Physical Motion and the Impact of Individualized Feedback in the Field of Rehabilitation of Geriatric Trauma Patients.

    PubMed

    Altenbuchner, Amelie; Haug, Sonja; Kretschmer, Rainer; Weber, Karsten

    2018-01-01

    This preparatory study accelerates an implementation of individualized monitoring and feedback of physical motion using conventional motion trackers in the rehabilitation process of geriatric trauma patients. Regaining mobility is accompanied with improved quality of life in persons of very advanced age recovering from fragility fractures. Quantitative survey of regaining physical mobility provides recommendations for action on how to use motion trackers effectively in a clinical geriatric setting. Method mix of quantitative and qualitative interdisciplinary and mutual complementary research approaches (sociology, health research, philosophy/ethics, medical informatics, nursing science, gerontology and physical therapy). While validating motion tracker use in geriatric traumatology preliminary data are used to develop a target group oriented motion feedback. In addition measurement accuracy of a questionnaire about quality of life of multimorbid geriatric patients (FLQM) is tested. Implementing a new technology in a complex clinical setting needs to be based on a strong theoretical background but will not succeed without careful field testing.

  2. Marketing Violent Entertainment to Children: A Twenty-One Month Follow-Up Review of Industry Practices in the Motion Picture, Music Recording and Electronic Game Industries. A Report to Congress.

    ERIC Educational Resources Information Center

    Federal Trade Commission, Washington, DC.

    In a report issued in September 2000, the Federal Trade Commission contended that the motion picture, music recording, and electronic game industries had engaged in widespread marketing of violent movies, music, and games to children inconsistent with their own parental advisories and undermining parents attempts to make informed decisions about…

  3. Influence of Visual Motion, Suggestion, and Illusory Motion on Self-Motion Perception in the Horizontal Plane.

    PubMed

    Rosenblatt, Steven David; Crane, Benjamin Thomas

    2015-01-01

    A moving visual field can induce the feeling of self-motion or vection. Illusory motion from static repeated asymmetric patterns creates a compelling visual motion stimulus, but it is unclear if such illusory motion can induce a feeling of self-motion or alter self-motion perception. In these experiments, human subjects reported the perceived direction of self-motion for sway translation and yaw rotation at the end of a period of viewing set visual stimuli coordinated with varying inertial stimuli. This tested the hypothesis that illusory visual motion would influence self-motion perception in the horizontal plane. Trials were arranged into 5 blocks based on stimulus type: moving star field with yaw rotation, moving star field with sway translation, illusory motion with yaw, illusory motion with sway, and static arrows with sway. Static arrows were used to evaluate the effect of cognitive suggestion on self-motion perception. Each trial had a control condition; the illusory motion controls were altered versions of the experimental image, which removed the illusory motion effect. For the moving visual stimulus, controls were carried out in a dark room. With the arrow visual stimulus, controls were a gray screen. In blocks containing a visual stimulus there was an 8s viewing interval with the inertial stimulus occurring over the final 1s. This allowed measurement of the visual illusion perception using objective methods. When no visual stimulus was present, only the 1s motion stimulus was presented. Eight women and five men (mean age 37) participated. To assess for a shift in self-motion perception, the effect of each visual stimulus on the self-motion stimulus (cm/s) at which subjects were equally likely to report motion in either direction was measured. Significant effects were seen for moving star fields for both translation (p = 0.001) and rotation (p<0.001), and arrows (p = 0.02). For the visual motion stimuli, inertial motion perception was shifted in the

  4. Effect of the track potential on the motion and energy flow of secondary electrons created from heavy-ion irradiation

    NASA Astrophysics Data System (ADS)

    Moribayashi, Kengo

    2018-05-01

    Using simulations, we have evaluated the effect of the track potential on the motion and energy flow of secondary electrons, with the goal of determining the spatial distribution of energy deposition due to irradiation with heavy ions. We have simulated this effect as a function of the mean path τ between the incident ion-impact-ionization events at ion energies Eion. Here, the track potential is the potential formed from electric field near this incident ion path. The simulations indicate that this effect is mainly determined by τ and hardly depends on Eion. To understand heavy ion beam science more deeply and to reduce the time required by simulations, we have proposed simple approximation methods that almost reproduce the simulation results here.

  5. 4D electron tomography.

    PubMed

    Kwon, Oh-Hoon; Zewail, Ahmed H

    2010-06-25

    Electron tomography provides three-dimensional (3D) imaging of noncrystalline and crystalline equilibrium structures, as well as elemental volume composition, of materials and biological specimens, including those of viruses and cells. We report the development of 4D electron tomography by integrating the fourth dimension (time resolution) with the 3D spatial resolution obtained from a complete tilt series of 2D projections of an object. The different time frames of tomograms constitute a movie of the object in motion, thus enabling studies of nonequilibrium structures and transient processes. The method was demonstrated using carbon nanotubes of a bracelet-like ring structure for which 4D tomograms display different modes of motion, such as breathing and wiggling, with resonance frequencies up to 30 megahertz. Applications can now make use of the full space-time range with the nanometer-femtosecond resolution of ultrafast electron tomography.

  6. 4D Electron Tomography

    NASA Astrophysics Data System (ADS)

    Kwon, Oh-Hoon; Zewail, Ahmed H.

    2010-06-01

    Electron tomography provides three-dimensional (3D) imaging of noncrystalline and crystalline equilibrium structures, as well as elemental volume composition, of materials and biological specimens, including those of viruses and cells. We report the development of 4D electron tomography by integrating the fourth dimension (time resolution) with the 3D spatial resolution obtained from a complete tilt series of 2D projections of an object. The different time frames of tomograms constitute a movie of the object in motion, thus enabling studies of nonequilibrium structures and transient processes. The method was demonstrated using carbon nanotubes of a bracelet-like ring structure for which 4D tomograms display different modes of motion, such as breathing and wiggling, with resonance frequencies up to 30 megahertz. Applications can now make use of the full space-time range with the nanometer-femtosecond resolution of ultrafast electron tomography.

  7. Current-controlled unidirectional edge-meron motion

    NASA Astrophysics Data System (ADS)

    Xing, Xiangjun; Pong, Philip W. T.; Zhou, Yan

    2016-11-01

    In order to address many of the challenges and bottlenecks currently experienced by traditional charge-based technologies, various alternatives are being actively explored to provide potential solutions of device miniaturization and scaling in the post-Moore's-law era. Amongst these alternatives, spintronic physics and devices have recently attracted rapidly increasing interest by exploiting the additional degree of electrons-spin. For example, magnetic domain-wall racetrack-memory and logic devices have been realized via manipulating domain-wall motion. As compared to domain-wall-based devices, magnetic skyrmions have the advantages of ultrasmall size (typically 5-100 nm in diameter), facile current-driven motion, topological stability, and peculiar emergent electrodynamics, promising for next-generation electronics applications in the post-Moore's-law regime. Here, a magnetic meron device, which behaves similarly to a PN-junction diode, is demonstrated for the first time, by tailoring the current-controlled unidirectional motion of edge-merons (i.e., fractional skyrmions) in a nanotrack with interfacial Dzyaloshinskii-Moriya interaction. The working principles of the meron device, theoretically predicted from the Thiele equation for topological magnetic objects, are further verified using micromagnetic simulations. The present study has revealed the topology-independent transport property of different magnetic objects and is expected to open the vista toward integrated composite circuitry (with unified data storage and processing) based on a single magnetic chip, as the meron device can be used, either as a building block to develop complex logic components or as a signal controller to interconnect skyrmion, domain-wall, and even spin-wave devices.

  8. Motion effects in multistatic millimeter-wave imaging systems

    NASA Astrophysics Data System (ADS)

    Schiessl, Andreas; Ahmed, Sherif Sayed; Schmidt, Lorenz-Peter

    2013-10-01

    At airport security checkpoints, authorities are demanding improved personnel screening devices for increased security. Active mm-wave imaging systems deliver the high quality images needed for reliable automatic detection of hidden threats. As mm-wave imaging systems assume static scenarios, motion effects caused by movement of persons during the screening procedure can degrade image quality, so very short measurement time is required. Multistatic imaging array designs and fully electronic scanning in combination with digital beamforming offer short measurement time together with high resolution and high image dynamic range, which are critical parameters for imaging systems used for passenger screening. In this paper, operational principles of such systems are explained, and the performance of the imaging systems with respect to motion within the scenarios is demonstrated using mm-wave images of different test objects and standing as well as moving persons. Electronic microwave imaging systems using multistatic sparse arrays are suitable for next generation screening systems, which will support on the move screening of passengers.

  9. Pigmentary glaucoma accompanied by Usher syndrome.

    PubMed

    Koucheki, Behrooz; Jalali, Kamran Hodjat

    2012-08-01

    To report a case of pigmentary glaucoma (PG) accompanied by Usher syndrome. Case report. The results were presented after standard ocular examination, visual field test, anterior segment and fundus photography, electroretinography, and otolaryngology consultation were conducted. Typical retinitis pigmentosa, flat electroretinography, congenital sensorineural hearing loss, high intraocular pressure, Krukenberg spindle, iris concavity, radial iris transillumination defect, severe pigment deposition on the trabecular meshwork, and glaucomatous optic nerve damage were indicative of PG accompanied by Usher syndrome. In some rare cases, PG may coexist with Usher syndrome. Common findings of Usher syndrome, including night blindness, impaired vision, visual field defects, and retinal changes may distract the clinician from considering the diagnosis of glaucoma. Such association should be borne in mind to make a timely diagnosis and treatment possible.

  10. Self Motion Perception and Motion Sickness

    NASA Technical Reports Server (NTRS)

    Fox, Robert A. (Principal Investigator)

    1991-01-01

    The studies conducted in this research project examined several aspects of motion sickness in animal models. A principle objective of these studies was to investigate the neuroanatomy that is important in motion sickness with the objectives of examining both the utility of putative models and defining neural mechanisms that are important in motion sickness.

  11. Ultrafast equilibration of excited electrons in dynamical simulations.

    PubMed

    Lin, Zhibin; Allen, Roland E

    2009-12-02

    In our density-functional-based simulations of materials responding to femtosecond-scale laser pulses, we have observed a potentially useful phenomenon: the excited electrons automatically equilibrate to a Fermi-Dirac distribution within ∼100 fs, solely because of their coupling to the nuclear motion, even though the resulting electronic temperature is one to two orders of magnitude higher than the kinetic temperature defined by the nuclear motion. Microscopic simulations like these can then provide the separate electronic and kinetic temperatures, chemical potentials, pressures, and nonhydrostatic stresses as input for studies on larger lengths and timescales.

  12. 5 CFR 581.203 - Information minimally required to accompany legal process.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... accompany legal process. 581.203 Section 581.203 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT... Process § 581.203 Information minimally required to accompany legal process. (a) Sufficient identifying information must accompany the legal process in order to enable processing by the governmental entity named...

  13. 5 CFR 581.203 - Information minimally required to accompany legal process.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... accompany legal process. 581.203 Section 581.203 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT... Process § 581.203 Information minimally required to accompany legal process. (a) Sufficient identifying information must accompany the legal process in order to enable processing by the governmental entity named...

  14. 5 CFR 581.203 - Information minimally required to accompany legal process.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... accompany legal process. 581.203 Section 581.203 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT... Process § 581.203 Information minimally required to accompany legal process. (a) Sufficient identifying information must accompany the legal process in order to enable processing by the governmental entity named...

  15. 5 CFR 581.203 - Information minimally required to accompany legal process.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... accompany legal process. 581.203 Section 581.203 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT... Process § 581.203 Information minimally required to accompany legal process. (a) Sufficient identifying information must accompany the legal process in order to enable processing by the governmental entity named...

  16. 5 CFR 581.203 - Information minimally required to accompany legal process.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... accompany legal process. 581.203 Section 581.203 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT... Process § 581.203 Information minimally required to accompany legal process. (a) Sufficient identifying information must accompany the legal process in order to enable processing by the governmental entity named...

  17. Measuring mechanical motion with a single spin

    NASA Astrophysics Data System (ADS)

    Bennett, S. D.; Kolkowitz, S.; Unterreithmeier, Q. P.; Rabl, P.; Bleszynski Jayich, A. C.; Harris, J. G. E.; Lukin, M. D.

    2012-12-01

    We study theoretically the measurement of a mechanical oscillator using a single two-level system as a detector. In a recent experiment, we used a single electronic spin associated with a nitrogen-vacancy center in diamond to probe the thermal motion of a magnetized cantilever at room temperature (Kolkowitz et al 2012 Science 335 1603). Here, we present a detailed analysis of the sensitivity limits of this technique, as well as the possibility to measure the zero-point motion of the oscillator. Further, we discuss the issue of measurement backaction in sequential measurements and find that although backaction heating can occur, it does not prohibit the detection of zero-point motion. Throughout the paper, we focus on the experimental implementation of a nitrogen-vacancy center coupled to a magnetic cantilever; however, our results are applicable to a wide class of spin-oscillator systems. The implications for the preparation of nonclassical states of a mechanical oscillator are also discussed.

  18. Impaired joint motion and contractures in callus distraction and segment transport: a retrospective data analysis.

    PubMed

    Zak, Lukas; Wozasek, Gerald E

    2013-11-01

    The temporary loss of motion of adjacent joints is a common complication after distraction osteogenesis of the lower limb. The aim of this study was to investigate the incidence of tendon contracture and impaired joint motion of the knee and/or ankle joint during and after callus distraction with a ring fixator. Twenty patients (2 female, 18 male, average age: 36 years) were surgically treated for callus distraction and segment transport with an external ring fixator after traumatic bone loss in 21 lower limbs. The impaired joint motion of the adjacent joints during and after treatment was evaluated. During treatment, we observed the free range of motion (ROM) of the ankle joint in 4 cases (19 %), restricted motion in 11 cases (52 %), and complete loss of motion in 6 cases (33 %). After treatment,free ROM was observed in 12 cases (57 %), impaired motion in 3 cases (14 %), and fixed joint position in 6 cases (29 %, 2 arthrodesis). This represents an improvement of motion in eight cases (38 %) and an impairment in two cases (10 %). In 11 cases, the ROM remained unchanged. During treatment, six restrictions in extension (24 %) and five (33 %) restrictions in flexion occurred in the knee joint, ultimately resulting in one loss of extension and three losses of flexion after frame removal. The impairment of joint motion during bone lengthening with an external ring fixator in the lower extremity occurs in most cases at the ankle joint. Various treatment options are available to address tendon shortening, but accompanying physiotherapy may prevent or moderate its onset.

  19. Stopping power of an electron gas with anisotropic temperature

    NASA Astrophysics Data System (ADS)

    Khelemelia, O. V.; Kholodov, R. I.

    2016-04-01

    A general theory of motion of a heavy charged particle in the electron gas with an anisotropic velocity distribution is developed within the quantum-field method. The analytical expressions for the dielectric susceptibility and the stopping power of the electron gas differs in no way from well-known classic formulas in the approximation of large and small velocities. Stopping power of the electron gas with anisotropic temperature in the framework of the quantum-field method is numerically calculated for an arbitrary angle between directions of the motion of the projectile particle and the electron beam. The results of the numerical calculations are compared with the dielectric model approach.

  20. Collective atomic scattering and motional effects in a dense coherent medium

    PubMed Central

    Bromley, S. L.; Zhu, B.; Bishof, M.; Zhang, X.; Bothwell, T.; Schachenmayer, J.; Nicholson, T. L.; Kaiser, R.; Yelin, S. F.; Lukin, M. D.; Rey, A. M.; Ye, J.

    2016-01-01

    We investigate collective emission from coherently driven ultracold 88Sr atoms. We perform two sets of experiments using a strong and weak transition that are insensitive and sensitive, respectively, to atomic motion at 1 μK. We observe highly directional forward emission with a peak intensity that is enhanced, for the strong transition, by >103 compared with that in the transverse direction. This is accompanied by substantial broadening of spectral lines. For the weak transition, the forward enhancement is substantially reduced due to motion. Meanwhile, a density-dependent frequency shift of the weak transition (∼10% of the natural linewidth) is observed. In contrast, this shift is suppressed to <1% of the natural linewidth for the strong transition. Along the transverse direction, we observe strong polarization dependences of the fluorescence intensity and line broadening for both transitions. The measurements are reproduced with a theoretical model treating the atoms as coherent, interacting radiating dipoles. PMID:26984643

  1. Positional control of plasmonic fields and electron emission

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Word, R. C.; Fitzgerald, J. P. S.; Könenkamp, R., E-mail: rkoe@pdx.edu

    2014-09-15

    We report the positional control of plasmonic fields and electron emission in a continuous gap antenna structure of sub-micron size. We show experimentally that a nanoscale area of plasmon-enhanced electron emission can be motioned by changing the polarization of an exciting optical beam of 800 nm wavelength. Finite-difference calculations are presented to support the experiments and to show that the plasmon-enhanced electric field distribution of the antenna can be motioned precisely and predictively.

  2. Critical thinking of student nurses during clinical accompaniment.

    PubMed

    Uys, B Y; Meyer, S M

    2005-08-01

    The purpose of this study was to investigate the methods of clinical accompaniment used by clinical facilitators in practice. The findings of the study also reflected facilitators' perceptions regarding critical thinking and the facilitation thereof. A quantitative research design was used. A literature study was conducted to identify the methods of accompaniment that facilitate critical thinking. Data was collected by means of a questionnaire developed for that purpose. Making a content-related validity judgment, and involving seven clinical facilitators in an academic institution, ensured the validity of the questionnaire. The results of the study indicated that various clinical methods of accompaniment were used. To a large extent, these methods correlated with those discussed in the literature review. The researcher further concluded that the concepts 'critical thinking' and 'facilitation' were not interpreted correctly by the respondents, and would therefore not be implemented in a proper manner in nursing practice. Furthermore, it seemed evident that tutor-driven learning realised more often than student-driven learning. In this regard, the requirement of outcomes-based education was not satisfied. The researcher is therefore of the opinion that a practical programme for the development of critical thinking skills during clinical accompaniment must be developed within the framework of outcomes-based education.

  3. Ocular myasthenia gravis accompanied by anosmia.

    PubMed

    Chen, Ying; Wang, Li; Zhou, Li; Gao, Ying

    2016-02-01

    We report a case of ocular myasthenia gravis (MG) accompanied by anosmia. A 76-year-old man had idiopathic anosmia of 2-year duration. Four months before consultation, he began to have drooping in the right upper eyelid along with muscle soreness, distension, and pain in the nape. His tongue was dark-red with a thin and white coating; his pulse was wiry and slippery. According to Traditional Chinese Medicine, eyelid drooping and anosmia are the main signs of liver constraint and spleen deficiency. In Western Medicine, the diagnosis was ocular MG and idiopathic anosmia. Our patient, along with the literature, suggests that anosmia may be an early symptom before MG. MG accompanied by anosmia could be a special subtype of MG according to antibody production and symptoms.

  4. Early Blindness Results in Developmental Plasticity for Auditory Motion Processing within Auditory and Occipital Cortex

    PubMed Central

    Jiang, Fang; Stecker, G. Christopher; Boynton, Geoffrey M.; Fine, Ione

    2016-01-01

    Early blind subjects exhibit superior abilities for processing auditory motion, which are accompanied by enhanced BOLD responses to auditory motion within hMT+ and reduced responses within right planum temporale (rPT). Here, by comparing BOLD responses to auditory motion in hMT+ and rPT within sighted controls, early blind, late blind, and sight-recovery individuals, we were able to separately examine the effects of developmental and adult visual deprivation on cortical plasticity within these two areas. We find that both the enhanced auditory motion responses in hMT+ and the reduced functionality in rPT are driven by the absence of visual experience early in life; neither loss nor recovery of vision later in life had a discernable influence on plasticity within these areas. Cortical plasticity as a result of blindness has generally be presumed to be mediated by competition across modalities within a given cortical region. The reduced functionality within rPT as a result of early visual loss implicates an additional mechanism for cross modal plasticity as a result of early blindness—competition across different cortical areas for functional role. PMID:27458357

  5. Restoration of non-uniform exposure motion blurred image

    NASA Astrophysics Data System (ADS)

    Luo, Yuanhong; Xu, Tingfa; Wang, Ningming; Liu, Feng

    2014-11-01

    Restoring motion-blurred image is the key technologies in the opto-electronic detection system. The imaging sensors such as CCD and infrared imaging sensor, which are mounted on the motion platforms, quickly move together with the platforms of high speed. As a result, the images become blur. The image degradation will cause great trouble for the succeeding jobs such as objects detection, target recognition and tracking. So the motion-blurred images must be restoration before detecting motion targets in the subsequent images. On the demand of the real weapon task, in order to deal with targets in the complex background, this dissertation uses the new theories in the field of image processing and computer vision to research the new technology of motion deblurring and motion detection. The principle content is as follows: 1) When the prior knowledge about degradation function is unknown, the uniform motion blurred images are restored. At first, the blur parameters, including the motion blur extent and direction of PSF(point spread function), are estimated individually in domain of logarithmic frequency. The direction of PSF is calculated by extracting the central light line of the spectrum, and the extent is computed by minimizing the correction between the fourier spectrum of the blurred image and a detecting function. Moreover, in order to remove the strip in the deblurred image, windows technique is employed in the algorithm, which makes the deblurred image clear. 2) According to the principle of infrared image non-uniform exposure, a new restoration model for infrared blurred images is developed. The fitting of infrared image non-uniform exposure curve is performed by experiment data. The blurred images are restored by the fitting curve.

  6. The Role of Motion Concepts in Understanding Non-Motion Concepts

    PubMed Central

    Khatin-Zadeh, Omid; Banaruee, Hassan; Khoshsima, Hooshang; Marmolejo-Ramos, Fernando

    2017-01-01

    This article discusses a specific type of metaphor in which an abstract non-motion domain is described in terms of a motion event. Abstract non-motion domains are inherently different from concrete motion domains. However, motion domains are used to describe abstract non-motion domains in many metaphors. Three main reasons are suggested for the suitability of motion events in such metaphorical descriptions. Firstly, motion events usually have high degrees of concreteness. Secondly, motion events are highly imageable. Thirdly, components of any motion event can be imagined almost simultaneously within a three-dimensional space. These three characteristics make motion events suitable domains for describing abstract non-motion domains, and facilitate the process of online comprehension throughout language processing. Extending the main point into the field of mathematics, this article discusses the process of transforming abstract mathematical problems into imageable geometric representations within the three-dimensional space. This strategy is widely used by mathematicians to solve highly abstract and complex problems. PMID:29240715

  7. Computational Motion Phantoms and Statistical Models of Respiratory Motion

    NASA Astrophysics Data System (ADS)

    Ehrhardt, Jan; Klinder, Tobias; Lorenz, Cristian

    Breathing motion is not a robust and 100 % reproducible process, and inter- and intra-fractional motion variations form an important problem in radiotherapy of the thorax and upper abdomen. A widespread consensus nowadays exists that it would be useful to use prior knowledge about respiratory organ motion and its variability to improve radiotherapy planning and treatment delivery. This chapter discusses two different approaches to model the variability of respiratory motion. In the first part, we review computational motion phantoms, i.e. computerized anatomical and physiological models. Computational phantoms are excellent tools to simulate and investigate the effects of organ motion in radiation therapy and to gain insight into methods for motion management. The second part of this chapter discusses statistical modeling techniques to describe the breathing motion and its variability in a population of 4D images. Population-based models can be generated from repeatedly acquired 4D images of the same patient (intra-patient models) and from 4D images of different patients (inter-patient models). The generation of those models is explained and possible applications of those models for motion prediction in radiotherapy are exemplified. Computational models of respiratory motion and motion variability have numerous applications in radiation therapy, e.g. to understand motion effects in simulation studies, to develop and evaluate treatment strategies or to introduce prior knowledge into the patient-specific treatment planning.

  8. Transverse beam motion on the second axis of the dual axis radiographic hydrodynamic test facility

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Caporaso, G J; Chen, Y J; Fawley, W M

    1999-03-23

    The accelerator on the second-axis of the Dual-Axis Radiographic Hydrodynamic Test (DARHT-II) facility will generate a 20 MeV, 2-4 kA, 2 µs long electron beam with an energy variation {<=} ± 0.5%. Four short current pulses with various lengths will be selected out of this 2 µs long current pulse and delivered to an x-ray converter target. The DARHT-II radiographic resolution requires these electron pulses to be focused to sub-millimeter spots on Bremsstrahlung targets with peak-to-peak transverse beam motion less than a few hundred microns. We have modeled the transverse beam motion, including the beam breakup instability, corkscrew motion, transversemore » resistive wall instability and beam induced transverse deflection in the kicker system, from the DARHT-II injector exit to the x-ray converter target. Simulations show that the transverse motion at the x-ray converters satisfies the DARHT-II radiographic requirements.« less

  9. Electron work function-a promising guiding parameter for material design.

    PubMed

    Lu, Hao; Liu, Ziran; Yan, Xianguo; Li, Dongyang; Parent, Leo; Tian, Harry

    2016-04-14

    Using nickel added X70 steel as a sample material, we demonstrate that electron work function (EWF), which largely reflects the electron behavior of materials, could be used as a guide parameter for material modification or design. Adding Ni having a higher electron work function to X70 steel brings more "free" electrons to the steel, leading to increased overall work function, accompanied with enhanced e(-)-nuclei interactions or higher atomic bond strength. Young's modulus and hardness increase correspondingly. However, the free electron density and work function decrease as the Ni content is continuously increased, accompanied with the formation of a second phase, FeNi3, which is softer with a lower work function. The decrease in the overall work function corresponds to deterioration of the mechanical strength of the steel. It is expected that EWF, a simple but fundamental parameter, may lead to new methodologies or supplementary approaches for metallic materials design or tailoring on a feasible electronic base.

  10. Electron work function–a promising guiding parameter for material design

    PubMed Central

    Lu, Hao; Liu, Ziran; Yan, Xianguo; Li, Dongyang; Parent, Leo; Tian, Harry

    2016-01-01

    Using nickel added X70 steel as a sample material, we demonstrate that electron work function (EWF), which largely reflects the electron behavior of materials, could be used as a guide parameter for material modification or design. Adding Ni having a higher electron work function to X70 steel brings more “free” electrons to the steel, leading to increased overall work function, accompanied with enhanced e−–nuclei interactions or higher atomic bond strength. Young’s modulus and hardness increase correspondingly. However, the free electron density and work function decrease as the Ni content is continuously increased, accompanied with the formation of a second phase, FeNi3, which is softer with a lower work function. The decrease in the overall work function corresponds to deterioration of the mechanical strength of the steel. It is expected that EWF, a simple but fundamental parameter, may lead to new methodologies or supplementary approaches for metallic materials design or tailoring on a feasible electronic base. PMID:27074974

  11. Registration of Large Motion Blurred Images

    DTIC Science & Technology

    2016-05-09

    in handling the dynamics of the capturing system, for example, a drone. CMOS sensors , used in recent times, when employed in these cameras produce...handling the dynamics of the capturing system, for example, a drone. CMOS sensors , used in recent times, when employed in these cameras produce two types...blur in the captured image when there is camera motion during exposure. However, contemporary CMOS sensors employ an electronic rolling shutter (RS

  12. The effect of intermediate-scale motions on line formation. [sawtooth and sine motions in solar atmosphere

    NASA Technical Reports Server (NTRS)

    Shine, R. A.

    1975-01-01

    The problem of LTE and non-LTE line formation in the presence of nonthermal velocity fields with geometric scales between the microscopic and macroscopic limits is investigated in the cases of periodic sinusoidal and sawtooth waves. For a fixed source function (the LTE case), it is shown that time-averaged line profiles progress smoothly from the microscopic to the macroscopic limits as the geometric scale of the motions increases, that the sinusoidal motions produce symmetric time-averaged profiles, and that the sawtooth motions cause a redshift. In several idealized non-LTE cases, it is found that intermediate-scale velocity fields can significantly increase the surface source functions and line-core intensities. Calculations are made for a two-level atom in an isothermal atmosphere for a range of velocity scales and non-LTE coupling parameters and also for a two-level atom and a four-level representation of Na I line formation in the Harvard-Smithsonian Reference Atmosphere (1971) solar model. It is found that intermediate-scale velocity fields in the solar atmosphere could explain the central intensities of the Na I D lines and other strong absorption lines without invoking previously suggested high electron densities.

  13. Quantification and visualization of coordination during non-cyclic upper extremity motion.

    PubMed

    Fineman, Richard A; Stirling, Leia A

    2017-10-03

    There are many design challenges in creating at-home tele-monitoring systems that enable quantification and visualization of complex biomechanical behavior. One such challenge is robustly quantifying joint coordination in a way that is intuitive and supports clinical decision-making. This work defines a new measure of coordination called the relative coordination metric (RCM) and its accompanying normalization schemes. RCM enables quantification of coordination during non-constrained discrete motions. Here RCM is applied to a grasping task. Fifteen healthy participants performed a reach, grasp, transport, and release task with a cup and a pen. The measured joint angles were then time-normalized and the RCM time-series were calculated between the shoulder-elbow, shoulder-wrist, and elbow-wrist. RCM was normalized using four differing criteria: the selected joint degree of freedom, angular velocity, angular magnitude, and range of motion. Percent time spent in specified RCM ranges was used asa composite metric and was evaluated for each trial. RCM was found to vary based on: (1) chosen normalization scheme, (2) the stage within the task, (3) the object grasped, and (4) the trajectory of the motion. The RCM addresses some of the limitations of current measures of coordination because it is applicable to discrete motions, does not rely on cyclic repetition, and uses velocity-based measures. Future work will explore clinically relevant differences in the RCM as it is expanded to evaluate different tasks and patient populations. Copyright © 2017. Published by Elsevier Ltd.

  14. Simulation of Oscillatory Domain Wall Motion Driven by Spin Waves in Nanostrip with Perpendicular Magnetic Anisotropy

    NASA Astrophysics Data System (ADS)

    Lee, Shang Fan; Chang, Liang Juan; Spintronics Laboratory Team

    2014-03-01

    We numerically investigate the spin waves (SW) induced domain wall (DW) oscillatory motion in a nanostrip with perpendicular magnetic anisotropy by means of micromagnetic simulation. SW carries spin angular momentum and can interact with DWs via Spin Transfer Torque (STT). Propagating SW can drive a DW motion depending on the in-plane tilt angle φ of the wall magnetization. We calculate the instantaneous velocity of DWs as a function of φwith different SW frequency f. We find that the DW motion under propagating SW depends not only on the frequencies f, but also on the in-plane tilt angle φ. The nanostrip considered is 50 nm wide and 4000 nm long. A DW at the center is subjected to a SW source 500 nm apart on the left with amplitude in the transverse direction and varying frequency f. The motions of the DW induced by the SW are accompanied by in-plane rotation of magnetization of DW. Once rotated by 90 degrees, the DW shows a backward motion towards the SW source. The oscillatory amplitude and frequency of the DW motion is analyzed. A phase diagram will be presented. This study provides new perspectives for the control and manipulation of DW in a nanostrip. Financial supports by Academia Sinica and National Science Council are acknowledged

  15. Astrometric detectability of systems with unseen companions: effects of the Earth orbital motion

    NASA Astrophysics Data System (ADS)

    Butkevich, Alexey G.

    2018-06-01

    The astrometric detection of an unseen companion is based on an analysis of the apparent motion of its host star around the system's barycentre. Systems with an orbital period close to 1 yr may escape detection if the orbital motion of their host stars is observationally indistinguishable from the effects of parallax. Additionally, an astrometric solution may produce a biased parallax estimation for such systems. We examine the effects of the orbital motion of the Earth on astrometric detectability in terms of a correlation between the Earth's orbital position and the position of the star relative to its system barycentre. The χ2 statistic for parallax estimation is calculated analytically, leading to expressions that relate the decrease in detectability and accompanying parallax bias to the position correlation function. The impact of the Earth's motion critically depends on the exoplanet's orbital period, diminishing rapidly as the period deviates from 1 yr. Selection effects against 1-yr-period systems is, therefore, expected. Statistical estimation shows that the corresponding loss of sensitivity results in a typical 10 per cent increase in the detection threshold. Consideration of eccentric orbits shows that the Earth's motion has no effect on detectability for e≳ 0.5. The dependence of the detectability on other parameters, such as orbital phases and inclination of the orbital plane to the ecliptic, are smooth and monotonic because they are described by simple trigonometric functions.

  16. 9 CFR 93.314 - Horses, certification, and accompanying equipment.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ..., certification, and accompanying equipment. (a) Horses offered for importation from any part of the world shall... region of origin, or if exported from Mexico, shall be accompanied either by such a certificate or by a... were imported from regions affected with CEM. (b) If a horse is presented for importation from a region...

  17. Interaction of Perceptual Grouping and Crossmodal Temporal Capture in Tactile Apparent-Motion

    PubMed Central

    Chen, Lihan; Shi, Zhuanghua; Müller, Hermann J.

    2011-01-01

    Previous studies have shown that in tasks requiring participants to report the direction of apparent motion, task-irrelevant mono-beeps can “capture” visual motion perception when the beeps occur temporally close to the visual stimuli. However, the contributions of the relative timing of multimodal events and the event structure, modulating uni- and/or crossmodal perceptual grouping, remain unclear. To examine this question and extend the investigation to the tactile modality, the current experiments presented tactile two-tap apparent-motion streams, with an SOA of 400 ms between successive, left-/right-hand middle-finger taps, accompanied by task-irrelevant, non-spatial auditory stimuli. The streams were shown for 90 seconds, and participants' task was to continuously report the perceived (left- or rightward) direction of tactile motion. In Experiment 1, each tactile stimulus was paired with an auditory beep, though odd-numbered taps were paired with an asynchronous beep, with audiotactile SOAs ranging from −75 ms to 75 ms. Perceived direction of tactile motion varied systematically with audiotactile SOA, indicative of a temporal-capture effect. In Experiment 2, two audiotactile SOAs—one short (75 ms), one long (325 ms)—were compared. The long-SOA condition preserved the crossmodal event structure (so the temporal-capture dynamics should have been similar to that in Experiment 1), but both beeps now occurred temporally close to the taps on one side (even-numbered taps). The two SOAs were found to produce opposite modulations of apparent motion, indicative of an influence of crossmodal grouping. In Experiment 3, only odd-numbered, but not even-numbered, taps were paired with auditory beeps. This abolished the temporal-capture effect and, instead, a dominant percept of apparent motion from the audiotactile side to the tactile-only side was observed independently of the SOA variation. These findings suggest that asymmetric crossmodal grouping leads to an

  18. Metastatic Basal cell carcinoma accompanying gorlin syndrome.

    PubMed

    Bilir, Yeliz; Gokce, Erkan; Ozturk, Banu; Deresoy, Faik Alev; Yuksekkaya, Ruken; Yaman, Emel

    2014-01-01

    Gorlin-Goltz syndrome or basal cell nevus syndrome is an autosomal dominant syndrome characterized by skeletal anomalies, numerous cysts observed in the jaw, and multiple basal cell carcinoma of the skin, which may be accompanied by falx cerebri calcification. Basal cell carcinoma is the most commonly skin tumor with slow clinical course and low metastatic potential. Its concomitance with Gorlin syndrome, resulting from a mutation in a tumor suppressor gene, may substantially change morbidity and mortality. A 66-year-old male patient with a history of recurrent basal cell carcinoma was presented with exophthalmus in the left eye and the lesions localized in the left lateral orbita and left zygomatic area. His physical examination revealed hearing loss, gapped teeth, highly arched palate, and frontal prominence. Left orbital mass, cystic masses at frontal and ethmoidal sinuses, and multiple pulmonary nodules were detected at CT scans. Basal cell carcinoma was diagnosed from biopsy of ethmoid sinus. Based on the clinical and typical radiological characteristics (falx cerebri calcification, bifid costa, and odontogenic cysts), the patient was diagnosed with metastatic skin basal cell carcinoma accompanied by Gorlin syndrome. Our case is a basal cell carcinoma with aggressive course accompanying a rarely seen syndrome.

  19. Model of electron pairs in electron-doped cuprates

    NASA Astrophysics Data System (ADS)

    Singh, R. J.; Khan, Shakeel

    2016-07-01

    In the order parameter of hole-doped cuprate superconductors in the pseudogap phase, two holes enter the order parameter from opposite sides and pass through various CuO2 cells jumping from one O2- to the other under the influence of magnetic field offered by the Cu2+ ions in that CuO2 cell and thus forming hole pairs. In the pseudogap phase of electron-doped cuprates, two electrons enter the order parameter at Cu2+ sites from opposite ends and pass from one Cu2+ site to the diagonally opposite Cu2+ site. Following this type of path, they are subjected to high magnetic fields from various Cu2+ ions in that cell. They do not travel from one Cu2+ site to the other along straight path but by helical path. As they pass through the diagonal, they face high to low to very high magnetic field. Therefore, frequency of helical motion and pitch goes on changing with the magnetic field. Just before reaching the Cu2+ ions at the exit points of all the cells, the pitch of the helical motion is enormously decreased and thus charge density at these sites is increased. So the velocity of electrons along the diagonal path is decreased. Consequently, transition temperature of electron-doped cuprates becomes less than that of hole-doped cuprates. Symmetry of the order parameter of the electron-doped cuprates has been found to be of 3dx2-y2 + iS type. It has been inferred that internal magnetic field inside the order parameter reconstructs the Fermi surface, which is requisite for superconductivity to take place. Electron pairs formed in the pseudogap phase are the precursors of superconducting order parameter when cooled below Tc.

  20. Electron Solvation in Two Dimensions

    NASA Astrophysics Data System (ADS)

    Miller, A. D.; Bezel, I.; Gaffney, K. J.; Garrett-Roe, S.; Liu, S. H.; Szymanski, P.; Harris, C. B.

    2002-08-01

    Ultrafast two-photon photoemission has been used to study electron solvation at two-dimensional metal/polar-adsorbate interfaces. The molecular motion that causes the excess electron solvation is manifested as a dynamic shift in the electronic energy. Although the initially excited electron is delocalized in the plane of the interface, interactions with the adsorbate can lead to its localization. A method for determining the spatial extent of the localized electron in the plane of the interface has been developed. This spatial extent was measured to be on the order of a single adsorbate molecule.

  1. A Bio-Inspired, Motion-Based Analysis of Crowd Behavior Attributes Relevance to Motion Transparency, Velocity Gradients, and Motion Patterns

    PubMed Central

    Raudies, Florian; Neumann, Heiko

    2012-01-01

    The analysis of motion crowds is concerned with the detection of potential hazards for individuals of the crowd. Existing methods analyze the statistics of pixel motion to classify non-dangerous or dangerous behavior, to detect outlier motions, or to estimate the mean throughput of people for an image region. We suggest a biologically inspired model for the analysis of motion crowds that extracts motion features indicative for potential dangers in crowd behavior. Our model consists of stages for motion detection, integration, and pattern detection that model functions of the primate primary visual cortex area (V1), the middle temporal area (MT), and the medial superior temporal area (MST), respectively. This model allows for the processing of motion transparency, the appearance of multiple motions in the same visual region, in addition to processing opaque motion. We suggest that motion transparency helps to identify “danger zones” in motion crowds. For instance, motion transparency occurs in small exit passages during evacuation. However, motion transparency occurs also for non-dangerous crowd behavior when people move in opposite directions organized into separate lanes. Our analysis suggests: The combination of motion transparency and a slow motion speed can be used for labeling of candidate regions that contain dangerous behavior. In addition, locally detected decelerations or negative speed gradients of motions are a precursor of danger in crowd behavior as are globally detected motion patterns that show a contraction toward a single point. In sum, motion transparency, image speeds, motion patterns, and speed gradients extracted from visual motion in videos are important features to describe the behavioral state of a motion crowd. PMID:23300930

  2. Effects of surface motion and electron-hole pair excitations in CO2 dissociation and scattering on Ni(100)

    NASA Astrophysics Data System (ADS)

    Luo, Xuan; Zhou, Xueyao; Jiang, Bin

    2018-05-01

    The energy transfer between different channels is an important aspect in chemical reactions at surfaces. We investigate here in detail the energy transfer dynamics in a prototypical system, i.e., reactive and nonreactive scattering of CO2 on Ni(100), which is related to heterogeneous catalytic processes with Ni-based catalysts for CO2 reduction. On the basis of our earlier nine-dimensional potential energy surface for CO2/Ni(100), dynamical calculations have been done using the generalized Langevin oscillator (GLO) model combined with local density friction approximation (LDFA), in which the former accounts for the surface motion and the latter accounts for the low-energy electron-hole pair (EHP) excitation. In spite of its simplicity, it is found that the GLO model yields quite satisfactory results, including the significant energy loss and product energy disposal, trapping, and steering dynamics, all of which agree well with the ab initio molecular dynamics ones where many surface atoms are explicitly involved with high computational cost. However, the GLO model fails to describe the reactivity enhancement due to the lattice motion because it intrinsically does not incorporate the variance of barrier height on the surface atom displacement. On the other hand, in LDFA, the energy transferred to EHPs is found to play a minor role and barely alter the dynamics, except for slightly reducing the dissociation probabilities. In addition, vibrational state-selected dissociative sticking probabilities are calculated and previously observed strong mode specificity is confirmed. Our work suggests that further improvement of the GLO model is needed to consider the lattice-induced barrier lowering.

  3. Ageostrophic winds and vertical motion fields accompanying upper level jet streak propagation during the Red River Valley tornado outbreak

    NASA Technical Reports Server (NTRS)

    Moore, J. T.; Squires, M. F.

    1982-01-01

    Preliminary results are shown relating the ageostrophic wind field, through the terms of a semigeostrophic wind equation (assuming adiabatic conditions and the geostrophic momentum approximation) to both air parcel trajectories and their vertical motion fields computed from the parcels' displacement on isentropic surfaces, with respect to pressure. The analysis of results considers both upper-level (324 K) ageostrophic fields and low-level (304 K) fields. Preliminary results tend to support Uccellini and Johnson's (1979) hypothesis concerning upper-level-jet/low-level-jet (ULJ/LLJ) coupling in the exit region of the ULJ. Future plans are described briefly for research intended to clarify the mechanism behind ULJ streak propagation, LLJ development and their relationship to the initiation of severe convection.

  4. IGRT/ART phantom with programmable independent rib cage and tumor motion

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Haas, Olivier C. L., E-mail: o.haas@coventry.ac.uk; Mills, John A.; Land, Imke

    2014-02-15

    Purpose: This paper describes the design and experimental evaluation of the Methods and Advanced Equipment for Simulation and Treatment in Radiation Oncology (MAESTRO) thorax phantom, a new anthropomorphic moving ribcage combined with a 3D tumor positioning system to move target inserts within static lungs. Methods: The new rib cage design is described and its motion is evaluated using Vicon Nexus, a commercial 3D motion tracking system. CT studies at inhale and exhale position are used to study the effect of rib motion and tissue equivalence. Results: The 3D target positioning system and the rib cage have millimetre accuracy. Each axismore » of motion can reproduce given trajectories from files or individually programmed sinusoidal motion in terms of amplitude, period, and phase shift. The maximum rib motion ranges from 7 to 20 mm SI and from 0.3 to 3.7 mm AP with LR motion less than 1 mm. The repeatability between cycles is within 0.16 mm root mean square error. The agreement between CT electron and mass density for skin, ribcage, spine hard and inner bone as well as cartilage is within 3%. Conclusions: The MAESTRO phantom is a useful research tool that produces programmable 3D rib motions which can be synchronized with 3D internal target motion. The easily accessible static lungs enable the use of a wide range of inserts or can be filled with lung tissue equivalent and deformed using the target motion system.« less

  5. [Motion sickness in motion: from carsickness to cybersickness].

    PubMed

    Bos, J E; van Leeuwen, R B; Bruintjes, T D

    2018-01-01

    - Motion sickness is not a disorder, but a normal response to a non-normal situation in which movement plays a central role, such as car travel, sailing, flying, or virtual reality.- Almost anyone can suffer from motion sickness, as long as at least one of the organs of balance functions. If neither of the organs of balance functions the individual will not suffer from carsickness, seasickness, airsickness, nor from cybersickness. - 'Cybersickness' is a form of motion sickness that is stimulated by artificial moving images such as in videogames. Because we are now exposed more often and for longer periods of time to increasingly realistic artificial images, doctors will also encounter cases of motion sickness more often. - The basis for motion sickness is the vestibular system, which can be modulated by visual-vestibular conflicts, i.e. when the movements seen by the eyes are not the same as those experienced by the organs of balance.- Antihistamines can be effective against motion sickness in everyday situations such as car travel if taken before departure, but the effectiveness of medication for motion sickness is limited.

  6. Motion streaks in fast motion rivalry cause orientation-selective suppression.

    PubMed

    Apthorp, Deborah; Wenderoth, Peter; Alais, David

    2009-05-14

    We studied binocular rivalry between orthogonally translating arrays of random Gaussian blobs and measured the strength of rivalry suppression for static oriented probes. Suppression depth was quantified by expressing monocular probe thresholds during dominance relative to thresholds during suppression. Rivalry between two fast motions or two slow motions was compared in order to test the suggestion that fast-moving objects leave oriented "motion streaks" due to temporal integration (W. S. Geisler, 1999). If fast motions do produce motion streaks, then fast motion rivalry might also entail rivalry between the orthogonal streak orientations. We tested this using a static oriented probe that was aligned either parallel to the motion trajectory (hence collinear with the "streaks") or was orthogonal to the trajectory, predicting that rivalry suppression would be greater for parallel probes, and only for rivalry between fast motions. Results confirmed that suppression depth did depend on probe orientation for fast motion but not for slow motion. Further experiments showed that threshold elevations for the oriented probe during suppression exhibited clear orientation tuning. However, orientation-tuned elevations were also present during dominance, suggesting within-channel masking as the basis of the extra-deep suppression. In sum, the presence of orientation-dependent suppression in fast motion rivalry is consistent with the "motion streaks" hypothesis.

  7. Motion Controlled Gait Enhancing Mobile Shoe for Rehabilitation

    PubMed Central

    Handzic, Ismet; Vasudevan, Erin V.; Reed, Kyle B.

    2011-01-01

    Walking on a split-belt treadmill, which has two belts that can be run at different speeds, has been shown to improve walking patterns post-stroke. However, these improvements are only temporarily retained once individuals transition to walking over ground. We hypothesize that longer-lasting effects would be observed if the training occurred during natural walking over ground, as opposed to on a treadmill. In order to study such long-term effects, we have developed a mobile and portable device which can simulate the same gait altering movements experienced on a split-belt treadmill. The new motion controlled gait enhancing mobile shoe improves upon the previous version’s drawbacks. This version of the GEMS has motion that is continuous, smooth, and regulated with on-board electronics. A vital component of this new design is the Archimedean spiral wheel shape that redirects the wearer’s downward force into a horizontal backward motion. The design is passive and does not utilize any motors. Its motion is regulated only by a small magnetic particle brake. Further experimentation is needed to evaluate the long-term after-effects. PMID:22275620

  8. Simulation results of corkscrew motion in DARHT-II

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chan, K. D.; Ekdahl, C. A.; Chen, Y. J.

    2003-01-01

    DARHT-II, the second axis of the Dual-Axis Radiographic Hydrodynamics Test Facility, is being commissioned. DARHT-II is a linear induction accelerator producing 2-microsecond electron beam pulses at 20 MeV and 2 kA. These 2-microsecond pulses will be chopped into four short pulses to produce time resolved x-ray images. Radiographic application requires the DARHT-II beam to have excellent beam quality, and it is important to study various beam effects that may cause quality degradation of a DARHT-II beam. One of the beam dynamic effects under study is 'corkscrew' motion. For corkscrew motion, the beam centroid is deflected off axis due to misalignmentsmore » of the solenoid magnets. The deflection depends on the beam energy variation, which is expected to vary by {+-}0.5% during the 'flat-top' part of a beam pulse. Such chromatic aberration will result in broadening of beam spot size. In this paper, we will report simulation results of our study of corkscrew motion in DARHT-II. Sensitivities of beam spot size to various accelerator parameters and the strategy for minimizing corkscrew motion will be described. Measured magnet misalignment is used in the simulation.« less

  9. Thermo-Electron Ballistic Coolers or Heaters

    NASA Technical Reports Server (NTRS)

    Choi, Sang H.

    2003-01-01

    Electronic heat-transfer devices of a proposed type would exploit some of the quantum-wire-like, pseudo-superconducting properties of single-wall carbon nanotubes or, optionally, room-temperature-superconducting polymers (RTSPs). The devices are denoted thermo-electron ballistic (TEB) coolers or heaters because one of the properties that they exploit is the totally or nearly ballistic (dissipation or scattering free) transport of electrons. This property is observed in RTSPs and carbon nanotubes that are free of material and geometric defects, except under conditions in which oscillatory electron motions become coupled with vibrations of the nanotubes. Another relevant property is the high number density of electrons passing through carbon nanotubes -- sufficient to sustain electron current densities as large as 100 MA/square cm. The combination of ballistic motion and large current density should make it possible for TEB devices to operate at low applied potentials while pumping heat at rates several orders of magnitude greater than those of thermoelectric devices. It may also enable them to operate with efficiency close to the Carnot limit. In addition, the proposed TEB devices are expected to operate over a wider temperature range

  10. Theory of Current-Driven Domain Wall Motion

    NASA Astrophysics Data System (ADS)

    Tatara, Gen

    2004-03-01

    Current-induced motion of a domain wall is studied starting from a microscopic Hamiltonian with an exchange interaction between conduction electrons and spins of the wall [1]. With a key observation that the position X and the angle φ0 the wall magnetization forms with the easy plane are the proper collective coordinates to describe its dynamics, it follows straightforwardly that the electric current affects the wall motion in two different ways, in agreement with Berger's pioneering observations[2]. The first is as a force, or momentum transfer, due to the reflection of conduction electrons. This force is proportional to the charge current j and wall resistivity ρ_w, and hence becomes important in thin walls. The other is as a spin torque or spin transfer[3], which is dominant for thick walls where the spin of conduction electron follows the magnetization adiabatically. The motion of a domain wall under a steady current is studied in two limiting cases. In the adiabatic case, we show that even without a pinning force, there is a threshold spin current, j_s^cr∝ K_⊥λ, below which the wall does not move (K_⊥ and λ being the hard-axis magnetic anisotropy and wall thickness, respectively). Below the threshold, the transferred angular momentum is used to shift φ0 and not to the wall motion. The pinning potential V0 affects j_s^cr only if it is very strong, V0 > K_⊥/α, where α is the damping parameter in the Landau-Lifshits-Gilbert equation. Therefore, the critical current for the adiabatic wall does not suffer very much from weak pinning, which is consistent with experimental observations[4]. The wall velocity after depinning is found to be ∝[(j_s/j_s^cr)^2-1]^1/2. In the case of thin wall, driven by a force ∝ ρw j, the critical current density is given by j^cr∝ V_0/ρ_w. In nanocontacts, this is estimated to be ˜ 10^7[A/m^2]. This small critical current would be advantageous for device application. [1] G.Tatara and H.Kohno, cond-mat/0308464

  11. Representing motion in a static image: constraints and parallels in art, science, and popular culture.

    PubMed

    Cutting, James E

    2002-01-01

    Representing motion in a picture is a challenge to artists, scientists, and all other imagemakers. Moreover, it presents a problem that will not go away with electronic and digital media, because often the pedagogical purpose of the representation of motion is more important than the motion itself. All satisfactory solutions evoke motion-for example, dynamic balance (or broken symmetry), stroboscopic sequences, affine shear (or forward lean), and photographic blur-but they also typically sacrifice the accuracy of the motion represented, a solution often unsuitable for science. Vector representations superimposed on static images allow for accuracy, but are not applicable to all situations. Workable solutions are almost certainly case specific and subject to continual evolution through exploration by imagemakers.

  12. Motion onset does not capture attention when subsequent motion is "smooth".

    PubMed

    Sunny, Meera Mary; von Mühlenen, Adrian

    2011-12-01

    Previous research on the attentional effects of moving objects has shown that motion per se does not capture attention. However, in later studies it was argued that the onset of motion does capture attention. Here, we show that this motion-onset effect critically depends on motion jerkiness--that is, the rate at which the moving stimulus is refreshed. Experiment 1 used search displays with a static, a motion-onset, and an abrupt-onset stimulus, while systematically varying the refresh rate of the moving stimulus. The results showed that motion onset only captures attention when subsequent motion is jerky (8 and 17 Hz), not when it is smooth (33 and 100 Hz). Experiment 2 replaced motion onset with continuous motion, showing that motion jerkiness does not affect how continuous motion is processed. These findings do not support accounts that assume a special role for motion onset, but they are in line with the more general unique-event account.

  13. Metastatic Basal Cell Carcinoma Accompanying Gorlin Syndrome

    PubMed Central

    Bilir, Yeliz; Gokce, Erkan; Ozturk, Banu; Deresoy, Faik Alev; Yuksekkaya, Ruken; Yaman, Emel

    2014-01-01

    Gorlin-Goltz syndrome or basal cell nevus syndrome is an autosomal dominant syndrome characterized by skeletal anomalies, numerous cysts observed in the jaw, and multiple basal cell carcinoma of the skin, which may be accompanied by falx cerebri calcification. Basal cell carcinoma is the most commonly skin tumor with slow clinical course and low metastatic potential. Its concomitance with Gorlin syndrome, resulting from a mutation in a tumor suppressor gene, may substantially change morbidity and mortality. A 66-year-old male patient with a history of recurrent basal cell carcinoma was presented with exophthalmus in the left eye and the lesions localized in the left lateral orbita and left zygomatic area. His physical examination revealed hearing loss, gapped teeth, highly arched palate, and frontal prominence. Left orbital mass, cystic masses at frontal and ethmoidal sinuses, and multiple pulmonary nodules were detected at CT scans. Basal cell carcinoma was diagnosed from biopsy of ethmoid sinus. Based on the clinical and typical radiological characteristics (falx cerebri calcification, bifid costa, and odontogenic cysts), the patient was diagnosed with metastatic skin basal cell carcinoma accompanied by Gorlin syndrome. Our case is a basal cell carcinoma with aggressive course accompanying a rarely seen syndrome. PMID:25506011

  14. Refinement of Objective Motion Cueing Criteria Investigation Based on Three Flight Tasks

    NASA Technical Reports Server (NTRS)

    Zaal, Petrus M. T.; Schroeder, Jeffery A.; Chung, William W.

    2017-01-01

    The objective of this paper is to refine objective motion cueing criteria for commercial transport simulators based on pilots' performance in three flying tasks. Actuator hardware and software algorithms determine motion cues. Today, during a simulator qualification, engineers objectively evaluate only the hardware. Pilot inspectors subjectively assess the overall motion cueing system (i.e., hardware plus software); however, it is acknowledged that pinpointing any deficiencies that might arise to either hardware or software is challenging. ICAO 9625 has an Objective Motion Cueing Test (OMCT), which is now a required test in the FAA's part 60 regulations for new devices, evaluating the software and hardware together; however, it lacks accompanying fidelity criteria. Hosman has documented OMCT results for a statistical sample of eight simulators which is useful, but having validated criteria would be an improvement. In a previous experiment, we developed initial objective motion cueing criteria that this paper is trying to refine. Sinacori suggested simple criteria which are in reasonable agreement with much of the literature. These criteria often necessitate motion displacements greater than most training simulators can provide. While some of the previous work has used transport aircraft in their studies, the majority used fighter aircraft or helicopters. Those that used transport aircraft considered degraded flight characteristics. As a result, earlier criteria lean more towards being sufficient, rather than necessary, criteria for typical transport aircraft training applications. Considering the prevalence of 60-inch, six-legged hexapod training simulators, a relevant question is "what are the necessary criteria that can be used with the ICAO 9625 diagnostic?" This study adds to the literature as follows. First, it examines well-behaved transport aircraft characteristics, but in three challenging tasks. The tasks are equivalent to the ones used in our previous

  15. Control of energy sweep and transverse beam motion in induction linacs

    NASA Astrophysics Data System (ADS)

    Turner, W. C.

    1991-05-01

    Recent interest in the electron induction accelerator has focussed on its application as a driver for high power radiation sources; free electron laser (FEL), relativistic klystron (RK) and cyclotron autoresonance maser (CARM). In the microwave regime where many successful experiments have been carried out, typical beam parameters are: beam energy 1 to 10 MeV, current 1 to 3 kA and pulse width 50 nsec. Radiation source applications impose conditions on electron beam quality, as characterized by three parameters; energy sweep, transverse beam motion and brightness. These conditions must be maintained for the full pulse duration to assure high efficiency conversion of beam power to radiation. The microwave FEL that has been analyzed in the greatest detail requires energy sweep less than (+ or -) 1 pct., transverse beam motion less than (+ or -) 1 mm and brightness approx. 1 x 10(exp 8)A/sq m sq rad. In the visible region the requirements on these parameters become roughly an order of magnitude more strigent. With the ETAII accelerator at LLNL the requirements were achieved for energy sweep, transverse beam motion and brightness. The recent data and the advances that have made the improved beam quality possible are discussed. The most important advances are: understanding of focussing magnetic field errors and improvements in alignment of the magnetic axis, a redesign of the high voltage pulse distribution system between the magnetic compression modulators and the accelerator cells, and exploitation of a beam tuning algorithm for minimizing transverse beam motion. The prospects are briefly described for increasing the pulse repetition frequency to the range of 5 kHz and a delayed feedback method of regulating beam energy over very long pulse bursts, thus making average power megawatt level microwave sources at 140 GHz and above a possibility.

  16. A case of peribiliary cysts accompanying bile duct carcinoma

    PubMed Central

    Miura, Fumihiko; Takada, Tadahiro; Amano, Hodaka; Yoshida, Masahiro; Isaka, Takahiro; Toyota, Naoyuki; Wada, Keita; Takagi, Kenji; Kato, Kenichiro

    2006-01-01

    A rare case of peribiliary cysts accompanying bile duct carcinoma is presented. A 54-year-old man was diagnosed as having lower bile duct carcinoma and peribiliary cysts by diagnostic imaging. He underwent pylorus preserving pancreatoduodenectomy. As for the peribiliary cysts, a course of observation was taken. Over surgery due to misdiagnosis of patients with biliary malignancy accompanied by peribiliary cysts should be avoided. PMID:16874882

  17. Markerless motion estimation for motion-compensated clinical brain imaging

    NASA Astrophysics Data System (ADS)

    Kyme, Andre Z.; Se, Stephen; Meikle, Steven R.; Fulton, Roger R.

    2018-05-01

    Motion-compensated brain imaging can dramatically reduce the artifacts and quantitative degradation associated with voluntary and involuntary subject head motion during positron emission tomography (PET), single photon emission computed tomography (SPECT) and computed tomography (CT). However, motion-compensated imaging protocols are not in widespread clinical use for these modalities. A key reason for this seems to be the lack of a practical motion tracking technology that allows for smooth and reliable integration of motion-compensated imaging protocols in the clinical setting. We seek to address this problem by investigating the feasibility of a highly versatile optical motion tracking method for PET, SPECT and CT geometries. The method requires no attached markers, relying exclusively on the detection and matching of distinctive facial features. We studied the accuracy of this method in 16 volunteers in a mock imaging scenario by comparing the estimated motion with an accurate marker-based method used in applications such as image guided surgery. A range of techniques to optimize performance of the method were also studied. Our results show that the markerless motion tracking method is highly accurate (<2 mm discrepancy against a benchmarking system) on an ethnically diverse range of subjects and, moreover, exhibits lower jitter and estimation of motion over a greater range than some marker-based methods. Our optimization tests indicate that the basic pose estimation algorithm is very robust but generally benefits from rudimentary background masking. Further marginal gains in accuracy can be achieved by accounting for non-rigid motion of features. Efficiency gains can be achieved by capping the number of features used for pose estimation provided that these features adequately sample the range of head motion encountered in the study. These proof-of-principle data suggest that markerless motion tracking is amenable to motion-compensated brain imaging and holds

  18. Classifying Motion.

    ERIC Educational Resources Information Center

    Duzen, Carl; And Others

    1992-01-01

    Presents a series of activities that utilizes a leveling device to classify constant and accelerated motion. Applies this classification system to uniform circular motion and motion produced by gravitational force. (MDH)

  19. Motion Pattern Encapsulation for Data-Driven Constraint-Based Motion Editing

    NASA Astrophysics Data System (ADS)

    Carvalho, Schubert R.; Boulic, Ronan; Thalmann, Daniel

    The growth of motion capture systems have contributed to the proliferation of human motion database, mainly because human motion is important in many applications, ranging from games entertainment and films to sports and medicine. However, the captured motions normally attend specific needs. As an effort for adapting and reusing captured human motions in new tasks and environments and improving the animator's work, we present and discuss a new data-driven constraint-based animation system for interactive human motion editing. This method offers the compelling advantage that it provides faster deformations and more natural-looking motion results compared to goal-directed constraint-based methods found in the literature.

  20. Current induced domain wall motion and tilting in Pt/Co/Ta structures with perpendicular magnetic anisotropy in the presence of the Dyzaloshinskii–Moriya interaction

    NASA Astrophysics Data System (ADS)

    Yun, Jijun; Li, Dong; Cui, Baoshan; Guo, Xiaobin; Wu, Kai; Zhang, Xu; Wang, Yupei; Mao, Jian; Zuo, Yalu; Xi, Li

    2018-04-01

    Current induced domain wall motion (CIDWM) was studied in Pt/Co/Ta structures with perpendicular magnetic anisotropy and the Dyzaloshinskii–Moriya interaction (DMI) by the spin-orbit torque (SOT). We measured the strength of DMI and SOT efficiency in Pt/Co/Ta with the variation of the thickness of Ta using a current induced hysteresis loop shift method. The results indicate that the DMI stabilizes a chiral Néel-type domain wall (DW), and the DW motion can be driven by the enhanced large SOT generated from Pt and Ta with opposite signs of spin Hall angle in Pt/Co/Ta stacks. The CIDWM velocity, which is 104 times larger than the field driven DW velocity, obeys a creep law, and reaches around tens of meters per second with current density of ~106 A cm‑2. We also found that the Joule heating accompanied with current also accelerates the DW motion. Meanwhile, a domain wall tilting was observed, which increases with current density increasing. These results can be explained by the spin Hall effect generated from both heavy metals Pt and Ta, inherent DMI, and the current accompanying Joule heating effect. Our results could provide some new designing prospects to move multiple DWs by SOT for achieving racetrack memories.

  1. 7 CFR 319.37-12 - Prohibited articles accompanying restricted articles.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 5 2010-01-01 2010-01-01 false Prohibited articles accompanying restricted articles... Stock, Plants, Roots, Bulbs, Seeds, and Other Plant Products 1,2 § 319.37-12 Prohibited articles accompanying restricted articles. A restricted article for importation into the United States shall not be...

  2. 7 CFR 319.37-12 - Prohibited articles accompanying restricted articles.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 5 2011-01-01 2011-01-01 false Prohibited articles accompanying restricted articles... Stock, Plants, Roots, Bulbs, Seeds, and Other Plant Products 1,2 § 319.37-12 Prohibited articles accompanying restricted articles. A restricted article for importation into the United States shall not be...

  3. Study of the transverse beam motion in the DARHT Phase II accelerator

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, Yu-Jiuan; Fawley, W M; Houck, T L

    1998-08-20

    The accelerator for the second-axis of the Dual Axis Radiographic Hydrodynamic Test (DARHT) facility will accelerate a 4-kA, 3-MeV, 2--µs long electron current pulse to 20 MeV. The energy variation of the beam within the flat-top portion of the current pulse is (plus or equal to) 0.5%. The performance of the DARHT Phase II radiographic machine requires the transverse beam motion to be much less than the beam spot size which is about 1.5 mm diameter on the x-ray converter. In general, the leading causes of the transverse beam motion in an accelerator are the beam breakup instability (BBU) andmore » the corkscrew motion. We have modeled the transverse beam motion in the DARHT Phase II accelerator with various magnetic tunes and accelerator cell configurations by using the BREAKUP code. The predicted sensitivity of corkscrew motion and BBU growth to different tuning algorithms will be presented.« less

  4. Sensitive and Flexible Polymeric Strain Sensor for Accurate Human Motion Monitoring

    PubMed Central

    Khan, Hassan; Kottapalli, Ajay; Asadnia, Mohsen

    2018-01-01

    Flexible electronic devices offer the capability to integrate and adapt with human body. These devices are mountable on surfaces with various shapes, which allow us to attach them to clothes or directly onto the body. This paper suggests a facile fabrication strategy via electrospinning to develop a stretchable, and sensitive poly (vinylidene fluoride) nanofibrous strain sensor for human motion monitoring. A complete characterization on the single PVDF nano fiber has been performed. The charge generated by PVDF electrospun strain sensor changes was employed as a parameter to control the finger motion of the robotic arm. As a proof of concept, we developed a smart glove with five sensors integrated into it to detect the fingers motion and transfer it to a robotic hand. Our results shows that the proposed strain sensors are able to detect tiny motion of fingers and successfully run the robotic hand. PMID:29389851

  5. Following an electron bunch for free electron laser

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    None

    2012-01-01

    A video artist's ultra-slow-motion impression of an APEX-style electron gun firing a continuous train of electron bunches into a superconducting linear accelerator (in reality this would happen a million times a second). As they approach the speed of light the bunches contract, maintaining beam quality. After acceleration, the electron bunches are diverted into one or more undulators, the key components of free electron lasers. Oscillating back and forth in the changing magnetic field, they create beams of structured x-ray pulses. Before entering the experimental areas the electron bunches are diverted to a beam dump. (Animation created by Illumina Visual, http://www.illuminavisual.com/,more » for Lawrence Berkeley National Laboratory. Music for this excerpt, "Feeling Dark (Behind The Mask)" is by 7OOP3D http://ccmixter.org/files/7OOP3D/29126 and is licensed under a Creative Commons license: http://creativecommons.org/licenses/by-nc/3.0/)« less

  6. Effects of the reconnection electric field on crescent electron distribution functions in asymmetric guide field reconnection

    NASA Astrophysics Data System (ADS)

    Bessho, N.; Chen, L. J.; Hesse, M.; Wang, S.

    2017-12-01

    In asymmetric reconnection with a guide field in the Earth's magnetopause, electron motion in the electron diffusion region (EDR) is largely affected by the guide field, the Hall electric field, and the reconnection electric field. The electron motion in the EDR is neither simple gyration around the guide field nor simple meandering motion across the current sheet. The combined meandering motion and gyration has essential effects on particle acceleration by the in-plane Hall electric field (existing only in the magnetospheric side) and the out-of-plane reconnection electric field. We analyze electron motion and crescent-shaped electron distribution functions in the EDR in asymmetric guide field reconnection, and perform 2-D particle-in-cell (PIC) simulations to elucidate the effect of reconnection electric field on electron distribution functions. Recently, we have analytically expressed the acceleration effect due to the reconnection electric field on electron crescent distribution functions in asymmetric reconnection without a guide field (Bessho et al., Phys. Plasmas, 24, 072903, 2017). We extend the theory to asymmetric guide field reconnection, and predict the crescent bulge in distribution functions. Assuming 1D approximation of field variations in the EDR, we derive the time period of oscillatory electron motion (meandering + gyration) in the EDR. The time period is expressed as a hybrid of the meandering period and the gyro period. Due to the guide field, electrons not only oscillate along crescent-shaped trajectories in the velocity plane perpendicular to the antiparallel magnetic fields, but also move along parabolic trajectories in the velocity plane coplanar with magnetic field. The trajectory in the velocity space gradually shifts to the acceleration direction by the reconnection electric field as multiple bounces continue. Due to the guide field, electron distributions for meandering particles are bounded by two paraboloids (or hyperboloids) in the

  7. 31 CFR 560.507 - Accompanied baggage authorized.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... the United States directly or indirectly from Iran are authorized to import into the United States... Iran are authorized to export from the United States accompanied baggage normally incident to travel...

  8. 31 CFR 560.507 - Accompanied baggage authorized.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... the United States directly or indirectly from Iran are authorized to import into the United States... Iran are authorized to export from the United States accompanied baggage normally incident to travel...

  9. Motion Analysis System for Instruction of Nihon Buyo using Motion Capture

    NASA Astrophysics Data System (ADS)

    Shinoda, Yukitaka; Murakami, Shingo; Watanabe, Yuta; Mito, Yuki; Watanuma, Reishi; Marumo, Mieko

    The passing on and preserving of advanced technical skills has become an important issue in a variety of fields, and motion analysis using motion capture has recently become popular in the research of advanced physical skills. This research aims to construct a system having a high on-site instructional effect on dancers learning Nihon Buyo, a traditional dance in Japan, and to classify Nihon Buyo dancing according to style, school, and dancer's proficiency by motion analysis. We have been able to study motion analysis systems for teaching Nihon Buyo now that body-motion data can be digitized and stored by motion capture systems using high-performance computers. Thus, with the aim of developing a user-friendly instruction-support system, we have constructed a motion analysis system that displays a dancer's time series of body motions and center of gravity for instructional purposes. In this paper, we outline this instructional motion analysis system based on three-dimensional position data obtained by motion capture. We also describe motion analysis that we performed based on center-of-gravity data obtained by this system and motion analysis focusing on school and age group using this system.

  10. 22 CFR 40.102 - Guardian required to accompany excluded alien.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 22 Foreign Relations 1 2011-04-01 2011-04-01 false Guardian required to accompany excluded alien. 40.102 Section 40.102 Foreign Relations DEPARTMENT OF STATE VISAS REGULATIONS PERTAINING TO BOTH... Guardian required to accompany excluded alien. INA 212(a)(9)(B) is not applicable at the time of visa...

  11. 22 CFR 40.102 - Guardian required to accompany excluded alien.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 22 Foreign Relations 1 2012-04-01 2012-04-01 false Guardian required to accompany excluded alien. 40.102 Section 40.102 Foreign Relations DEPARTMENT OF STATE VISAS REGULATIONS PERTAINING TO BOTH... Guardian required to accompany excluded alien. INA 212(a)(9)(B) is not applicable at the time of visa...

  12. 22 CFR 40.102 - Guardian required to accompany excluded alien.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 22 Foreign Relations 1 2014-04-01 2014-04-01 false Guardian required to accompany excluded alien. 40.102 Section 40.102 Foreign Relations DEPARTMENT OF STATE VISAS REGULATIONS PERTAINING TO BOTH... Guardian required to accompany excluded alien. INA 212(a)(9)(B) is not applicable at the time of visa...

  13. 22 CFR 40.102 - Guardian required to accompany excluded alien.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 22 Foreign Relations 1 2013-04-01 2013-04-01 false Guardian required to accompany excluded alien. 40.102 Section 40.102 Foreign Relations DEPARTMENT OF STATE VISAS REGULATIONS PERTAINING TO BOTH... Guardian required to accompany excluded alien. INA 212(a)(9)(B) is not applicable at the time of visa...

  14. 22 CFR 40.102 - Guardian required to accompany excluded alien.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Guardian required to accompany excluded alien. 40.102 Section 40.102 Foreign Relations DEPARTMENT OF STATE VISAS REGULATIONS PERTAINING TO BOTH... Guardian required to accompany excluded alien. INA 212(a)(9)(B) is not applicable at the time of visa...

  15. 30 CFR 250.212 - What information must accompany the EP?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... management information required by § 250.226; (o) Environmental impact analysis information required by § 250... 30 Mineral Resources 2 2011-07-01 2011-07-01 false What information must accompany the EP? 250.212... and Information Contents of Exploration Plans (ep) § 250.212 What information must accompany the EP...

  16. Modeling depth from motion parallax with the motion/pursuit ratio

    PubMed Central

    Nawrot, Mark; Ratzlaff, Michael; Leonard, Zachary; Stroyan, Keith

    2014-01-01

    The perception of unambiguous scaled depth from motion parallax relies on both retinal image motion and an extra-retinal pursuit eye movement signal. The motion/pursuit ratio represents a dynamic geometric model linking these two proximal cues to the ratio of depth to viewing distance. An important step in understanding the visual mechanisms serving the perception of depth from motion parallax is to determine the relationship between these stimulus parameters and empirically determined perceived depth magnitude. Observers compared perceived depth magnitude of dynamic motion parallax stimuli to static binocular disparity comparison stimuli at three different viewing distances, in both head-moving and head-stationary conditions. A stereo-viewing system provided ocular separation for stereo stimuli and monocular viewing of parallax stimuli. For each motion parallax stimulus, a point of subjective equality (PSE) was estimated for the amount of binocular disparity that generates the equivalent magnitude of perceived depth from motion parallax. Similar to previous results, perceived depth from motion parallax had significant foreshortening. Head-moving conditions produced even greater foreshortening due to the differences in the compensatory eye movement signal. An empirical version of the motion/pursuit law, termed the empirical motion/pursuit ratio, which models perceived depth magnitude from these stimulus parameters, is proposed. PMID:25339926

  17. Internal Electric Field Modulation in Molecular Electronic Devices by Atmosphere and Mobile Ions.

    PubMed

    Chandra Mondal, Prakash; Tefashe, Ushula M; McCreery, Richard L

    2018-06-13

    The internal potential profile and electric field are major factors controlling the electronic behavior of molecular electronic junctions consisting of ∼1-10 nm thick layers of molecules oriented in parallel between conducting contacts. The potential profile is assumed linear in the simplest cases, but can be affected by internal dipoles, charge polarization, and electronic coupling between the contacts and the molecular layer. Electrochemical processes in solutions or the solid state are entirely dependent on modification of the electric field by electrolyte ions, which screen the electrodes and form the ionic double layers that are fundamental to electrode kinetics and widespread applications. The current report investigates the effects of mobile ions on nominally solid-state molecular junctions containing aromatic molecules covalently bonded between flat, conducting carbon surfaces, focusing on changes in device conductance when ions are introduced into an otherwise conventional junction design. Small changes in conductance were observed when a polar molecule, acetonitrile, was present in the junction, and a large decrease of conductance was observed when both acetonitrile (ACN) and lithium ions (Li + ) were present. Transient experiments revealed that conductance changes occur on a microsecond-millisecond time scale, and are accompanied by significant alteration of device impedance and temperature dependence. A single molecular junction containing lithium benzoate could be reversibly transformed from symmetric current-voltage behavior to a rectifier by repetitive bias scans. The results are consistent with field-induced reorientation of acetonitrile molecules and Li + ion motion, which screen the electrodes and modify the internal potential profile and provide a potentially useful means to dynamically alter junction electronic behavior.

  18. NoRMCorre: An online algorithm for piecewise rigid motion correction of calcium imaging data.

    PubMed

    Pnevmatikakis, Eftychios A; Giovannucci, Andrea

    2017-11-01

    Motion correction is a challenging pre-processing problem that arises early in the analysis pipeline of calcium imaging data sequences. The motion artifacts in two-photon microscopy recordings can be non-rigid, arising from the finite time of raster scanning and non-uniform deformations of the brain medium. We introduce an algorithm for fast Non-Rigid Motion Correction (NoRMCorre) based on template matching. NoRMCorre operates by splitting the field of view (FOV) into overlapping spatial patches along all directions. The patches are registered at a sub-pixel resolution for rigid translation against a regularly updated template. The estimated alignments are subsequently up-sampled to create a smooth motion field for each frame that can efficiently approximate non-rigid artifacts in a piecewise-rigid manner. Existing approaches either do not scale well in terms of computational performance or are targeted to non-rigid artifacts arising just from the finite speed of raster scanning, and thus cannot correct for non-rigid motion observable in datasets from a large FOV. NoRMCorre can be run in an online mode resulting in comparable to or even faster than real time motion registration of streaming data. We evaluate its performance with simple yet intuitive metrics and compare against other non-rigid registration methods on simulated data and in vivo two-photon calcium imaging datasets. Open source Matlab and Python code is also made available. The proposed method and accompanying code can be useful for solving large scale image registration problems in calcium imaging, especially in the presence of non-rigid deformations. Copyright © 2017 The Author(s). Published by Elsevier B.V. All rights reserved.

  19. Time-motion analysis of clinical nursing documentation during implementation of an electronic operating room management system for ophthalmic surgery.

    PubMed

    Read-Brown, Sarah; Sanders, David S; Brown, Anna S; Yackel, Thomas R; Choi, Dongseok; Tu, Daniel C; Chiang, Michael F

    2013-01-01

    Efficiency and quality of documentation are critical in surgical settings because operating rooms are a major source of revenue, and because adverse events may have enormous consequences. Electronic health records (EHRs) have potential to impact surgical volume, quality, and documentation time. Ophthalmology is an ideal domain to examine these issues because procedures are high-throughput and demand efficient documentation. This time-motion study examines nursing documentation during implementation of an EHR operating room management system in an ophthalmology department. Key findings are: (1) EHR nursing documentation time was significantly worse during early implementation, but improved to a level near but slightly worse than paper baseline, (2) Mean documentation time varied significantly among nurses during early implementation, and (3) There was no decrease in operating room turnover time or surgical volume after implementation. These findings have important implications for ambulatory surgery departments planning EHR implementation, and for research in system design.

  20. Does the Company of a Dog Influence Affective Response to Exercise? Using Ecological Momentary Assessment to Study Dog-Accompanied Physical Activity.

    PubMed

    Liao, Yue; Solomon, Olga; Dunton, Genevieve F

    2017-09-01

    This study used ecological momentary assessment (EMA), a real-time self-report strategy, to examine (1) whether dog owners were more likely to be physically active when they were with their dogs and (2) whether being with a dog amplifies positive and dampens negative affective response during physical activity. Electronic EMA surveys for 12 days. Free-living. Seventy-one adult dog owners. The EMA survey included 1 question about current activity, 3 questions about positive affect (Cronbach α = .837), 4 questions about negative affect (Cronbach α = .865), and 1 question about the presence of dog. Multilevel modeling. The company of a dog did not increase the likelihood of being active versus sedentary at any given EMA prompt. However, greater positive affect during physical activity was reported in the company of a dog. Negative affect did not differ between active and sedentary activity, regardless of being with a dog or not. This study demonstrates the utility of electronic EMA as a promising methodology to study dog-accompanied physical activity. Future studies may use EMA to collect further contextual information about dog-accompanied activity to inform the development of innovative physical activity interventions.

  1. Dual motion valve with single motion input

    NASA Technical Reports Server (NTRS)

    Belew, Robert (Inventor)

    1987-01-01

    A dual motion valve includes two dual motion valve assemblies with a rotary input which allows the benefits of applying both rotary and axial motion to a rotary sealing element with a plurality of ports. The motion of the rotary sealing element during actuation provides axial engagement of the rotary sealing element with a stationary valve plate which also has ports. Fluid passages are created through the valve when the ports of the rotary sealing element are aligned with the ports of the stationary valve plate. Alignment is achieved through rotation of the rotary sealing element with respect to the stationary valve plate. The fluid passages provide direct paths which minimize fluid turbulence created in the fluid as it passes through the valve.

  2. Planar regions of GaAs (001) prepared by Ga droplet motion

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zheng, Changxi, E-mail: changxi.zheng@monash.edu; Tang, Wen-Xin; Jesson, David E., E-mail: jessonDE@cardiff.ac.uk

    2016-07-15

    The authors describe a simple method for obtaining planar regions of GaAs (001) suitable for surface science studies. The technique, which requires no buffer layer growth, atomic hydrogen source, or the introduction of As flux, employs controllable Ga droplet motion to create planar trail regions during Langmuir evaporation. Low-energy electron microscopy/diffraction techniques are applied to monitor the droplet motion and characterize the morphology and the surface reconstruction. It is found that the planar regions exhibit atomic flatness at the level of a high-quality buffer layer.

  3. Positrons vs electrons channeling in silicon crystal: energy levels, wave functions and quantum chaos manifestations

    NASA Astrophysics Data System (ADS)

    Shul'ga, N. F.; Syshchenko, V. V.; Tarnovsky, A. I.; Solovyev, I. I.; Isupov, A. Yu.

    2018-01-01

    The motion of fast electrons through the crystal during axial channeling could be regular and chaotic. The dynamical chaos in quantum systems manifests itself in both statistical properties of energy spectra and morphology of wave functions of the individual stationary states. In this report, we investigate the axial channeling of high and low energy electrons and positrons near [100] direction of a silicon crystal. This case is particularly interesting because of the fact that the chaotic motion domain occupies only a small part of the phase space for the channeling electrons whereas the motion of the channeling positrons is substantially chaotic for the almost all initial conditions. The energy levels of transverse motion, as well as the wave functions of the stationary states, have been computed numerically. The group theory methods had been used for classification of the computed eigenfunctions and identification of the non-degenerate and doubly degenerate energy levels. The channeling radiation spectrum for the low energy electrons has been also computed.

  4. Cryo-tomography Tilt-series Alignment with Consideration of the Beam-induced Sample Motion

    PubMed Central

    Fernandez, Jose-Jesus; Li, Sam; Bharat, Tanmay A. M.; Agard, David A.

    2018-01-01

    Recent evidence suggests that the beam-induced motion of the sample during tilt-series acquisition is a major resolution-limiting factor in electron cryo-tomography (cryoET). It causes suboptimal tilt-series alignment and thus deterioration of the reconstruction quality. Here we present a novel approach to tilt-series alignment and tomographic reconstruction that considers the beam-induced sample motion through the tilt-series. It extends the standard fiducial-based alignment approach in cryoET by introducing quadratic polynomials to model the sample motion. The model can be used during reconstruction to yield a motion-compensated tomogram. We evaluated our method on various datasets with different sample sizes. The results demonstrate that our method could be a useful tool to improve the quality of tomograms and the resolution in cryoET. PMID:29410148

  5. Nonlinear transport behavior of low dimensional electron systems

    NASA Astrophysics Data System (ADS)

    Zhang, Jingqiao

    is a result of a nontrivial distribution function of the electrons induced by the DC electric field. We compare our results with a theory proposed recently. The comparison allows us to find the quantum scattering time of 2D electron gas at high temperatures, in a regime, where previous methods were not successful. In addition, we observed a zero differential resistance state (ZDRS) in response to a direct current above a threshold value I > Ith applied to a two-dimensional system of electrons at low temperatures in a strong magnetic field. Entry into the ZDRS, which is not observable above several Kelvins, is accompanied by a sharp dip in the differential resistance. Additional analysis reveals instability of the electrons for I > Ith and an inhomogeneous, non-stationary pattern of the electric current. We suggest that the dominant mechanism leading to the new electron state is the redistribution of electrons in energy space induced by the direct current. Finally, we present the results of rectification of microwave radiation generated by an asymmetric, ballistic dot at different frequencies (1-40GHz), temperatures (0.3K-6K) and magnetic fields. A strong reduction of the microwave rectification is found in magnetic fields at which the cyclotron radius of electron orbits at the Fermi level is smaller than the size of the dot. With respect to the magnetic field, both symmetric and anti-symmetric contributions to the directed transport are presented in this thesis. The symmetric part of the rectified voltage changes significantly with microwave frequency o at otauf ≥ 1, where tau f is the time of a ballistic electron flight across the dot. The results lead consistently toward the ballistic origin of the effect, and can be explained by the strong nonlocal electron response to the microwave electric field, which affects both the speed and the direction of the electron motion inside the dot.

  6. Motion of the plasma critical layer during relativistic-electron laser interaction with immobile and comoving ion plasma for ion accelerationa)

    NASA Astrophysics Data System (ADS)

    Sahai, Aakash A.

    2014-05-01

    We analyze the motion of the plasma critical layer by two different processes in the relativistic-electron laser-plasma interaction regime (a0>1). The differences are highlighted when the critical layer ions are stationary in contrast to when they move with it. Controlling the speed of the plasma critical layer in this regime is essential for creating low-β traveling acceleration structures of sufficient laser-excited potential for laser ion accelerators. In Relativistically Induced Transparency Acceleration (RITA) scheme, the heavy plasma-ions are fixed and only trace-density light-ions are accelerated. The relativistic critical layer and the acceleration structure move longitudinally forward by laser inducing transparency through apparent relativistic increase in electron mass. In the Radiation Pressure Acceleration (RPA) scheme, the whole plasma is longitudinally pushed forward under the action of the laser radiation pressure, possible only when plasma ions co-propagate with the laser front. In RPA, the acceleration structure velocity critically depends upon plasma-ion mass in addition to the laser intensity and plasma density. In RITA, mass of the heavy immobile plasma-ions does not affect the speed of the critical layer. Inertia of the bared immobile ions in RITA excites the charge separation potential, whereas RPA is not possible when ions are stationary.

  7. Motion of the plasma critical layer during relativistic-electron laser interaction with immobile and comoving ion plasma for ion acceleration

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sahai, Aakash A., E-mail: aakash.sahai@gmail.com

    2014-05-15

    We analyze the motion of the plasma critical layer by two different processes in the relativistic-electron laser-plasma interaction regime (a{sub 0}>1). The differences are highlighted when the critical layer ions are stationary in contrast to when they move with it. Controlling the speed of the plasma critical layer in this regime is essential for creating low-β traveling acceleration structures of sufficient laser-excited potential for laser ion accelerators. In Relativistically Induced Transparency Acceleration (RITA) scheme, the heavy plasma-ions are fixed and only trace-density light-ions are accelerated. The relativistic critical layer and the acceleration structure move longitudinally forward by laser inducing transparencymore » through apparent relativistic increase in electron mass. In the Radiation Pressure Acceleration (RPA) scheme, the whole plasma is longitudinally pushed forward under the action of the laser radiation pressure, possible only when plasma ions co-propagate with the laser front. In RPA, the acceleration structure velocity critically depends upon plasma-ion mass in addition to the laser intensity and plasma density. In RITA, mass of the heavy immobile plasma-ions does not affect the speed of the critical layer. Inertia of the bared immobile ions in RITA excites the charge separation potential, whereas RPA is not possible when ions are stationary.« less

  8. Kikuchi ultrafast nanodiffraction in four-dimensional electron microscopy

    PubMed Central

    Yurtsever, Aycan; Zewail, Ahmed H.

    2011-01-01

    Coherent atomic motions in materials can be revealed using time-resolved X-ray and electron Bragg diffraction. Because of the size of the beam used, typically on the micron scale, the detection of nanoscale propagating waves in extended structures hitherto has not been reported. For elastic waves of complex motions, Bragg intensities contain all polarizations and they are not straightforward to disentangle. Here, we introduce Kikuchi diffraction dynamics, using convergent-beam geometry in an ultrafast electron microscope, to selectively probe propagating transverse elastic waves with nanoscale resolution. It is shown that Kikuchi band shifts, which are sensitive only to the tilting of atomic planes, reveal the resonance oscillations, unit cell angular amplitudes, and the polarization directions. For silicon, the observed wave packet temporal envelope (resonance frequency of 33 GHz), the out-of-phase temporal behavior of Kikuchi’s edges, and the magnitude of angular amplitude (0.3 mrad) and polarization elucidate the nature of the motion: one that preserves the mass density (i.e., no compression or expansion) but leads to sliding of planes in the antisymmetric shear eigenmode of the elastic waveguide. As such, the method of Kikuchi diffraction dynamics, which is unique to electron imaging, can be used to characterize the atomic motions of propagating waves and their interactions with interfaces, defects, and grain boundaries at the nanoscale. PMID:21245348

  9. Motion transparency: making models of motion perception transparent.

    PubMed

    Snowden; Verstraten

    1999-10-01

    In daily life our visual system is bombarded with motion information. We see cars driving by, flocks of birds flying in the sky, clouds passing behind trees that are dancing in the wind. Vision science has a good understanding of the first stage of visual motion processing, that is, the mechanism underlying the detection of local motions. Currently, research is focused on the processes that occur beyond the first stage. At this level, local motions have to be integrated to form objects, define the boundaries between them, construct surfaces and so on. An interesting, if complicated case is known as motion transparency: the situation in which two overlapping surfaces move transparently over each other. In that case two motions have to be assigned to the same retinal location. Several researchers have tried to solve this problem from a computational point of view, using physiological and psychophysical results as a guideline. We will discuss two models: one uses the traditional idea known as 'filter selection' and the other a relatively new approach based on Bayesian inference. Predictions from these models are compared with our own visual behaviour and that of the neural substrates that are presumed to underlie these perceptions.

  10. Electron dynamics in a plasma focus. [electron acceleration

    NASA Technical Reports Server (NTRS)

    Hohl, F.; Gary, S. P.; Winters, P. A.

    1977-01-01

    Results are presented of a numerical integration of the three-dimensional relativistic equations of motion of electrons subject to given electric and magnetic fields deduced from experiments. Fields due to two different models are investigated. For the first model, the fields are those due to a circular distribution of axial current filaments. As the current filaments collapse toward the axis, large azimuthal magnetic and axial electric fields are induced. These fields effectively heat the electrons to a temperature of approximately 8 keV and accelerate electrons within the radius of the filaments to high axial velocities. Similar results are obtained for the current-reduction phase of focus formation. For the second model, the fields are those due to a uniform current distribution. Both the current-reduction and the compression phases were studied. These is little heating or acceleration of electrons during the compression phase because the electrons are tied to the magnetic field. However, during the current-reduction phase, electrons near the axis are accelerated toward the center electrode and reach energies of 100 keV. A criterion is obtained which limits the runaway electron current to about 400 A.

  11. Chemical Gradients on Graphene to Drive Droplet Motion

    DTIC Science & Technology

    2013-05-09

    the flexibility of carbon chemistry, graphene provides many options in designing such gradients. Moreover, to effectively move a liquid droplet, the...surface chemistry gradientmust be both continuous (x and y direction) and uniform in the direc - tion perpendicular to the droplet motion (y direction) to...directing the transport of liquid droplets. This work demonstrates that with careful consideration of the surface chem- istry, electron beam-generated

  12. 5 CFR 582.203 - Information minimally required to accompany legal process.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... accompany legal process. 582.203 Section 582.203 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS COMMERCIAL GARNISHMENT OF FEDERAL EMPLOYEES' PAY Service of Legal Process § 582.203 Information minimally required to accompany legal process. (a) Sufficient identifying...

  13. 5 CFR 582.203 - Information minimally required to accompany legal process.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... accompany legal process. 582.203 Section 582.203 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS COMMERCIAL GARNISHMENT OF FEDERAL EMPLOYEES' PAY Service of Legal Process § 582.203 Information minimally required to accompany legal process. (a) Sufficient identifying...

  14. 5 CFR 582.203 - Information minimally required to accompany legal process.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... accompany legal process. 582.203 Section 582.203 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS COMMERCIAL GARNISHMENT OF FEDERAL EMPLOYEES' PAY Service of Legal Process § 582.203 Information minimally required to accompany legal process. (a) Sufficient identifying...

  15. 5 CFR 582.203 - Information minimally required to accompany legal process.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... accompany legal process. 582.203 Section 582.203 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS COMMERCIAL GARNISHMENT OF FEDERAL EMPLOYEES' PAY Service of Legal Process § 582.203 Information minimally required to accompany legal process. (a) Sufficient identifying...

  16. 5 CFR 582.203 - Information minimally required to accompany legal process.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... accompany legal process. 582.203 Section 582.203 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS COMMERCIAL GARNISHMENT OF FEDERAL EMPLOYEES' PAY Service of Legal Process § 582.203 Information minimally required to accompany legal process. (a) Sufficient identifying...

  17. Slow motion in films and video clips: Music influences perceived duration and emotion, autonomic physiological activation and pupillary responses.

    PubMed

    Wöllner, Clemens; Hammerschmidt, David; Albrecht, Henning

    2018-01-01

    Slow motion scenes are ubiquitous in screen-based audiovisual media and are typically accompanied by emotional music. The strong effects of slow motion on observers are hypothetically related to heightened emotional states in which time seems to pass more slowly. These states are simulated in films and video clips, and seem to resemble such experiences in daily life. The current study investigated time perception and emotional response to media clips containing decelerated human motion, with or without music using psychometric and psychophysiological testing methods. Participants were presented with slow-motion scenes taken from commercial films, ballet and sports footage, as well as the same scenes converted to real-time. Results reveal that slow-motion scenes, compared to adapted real-time scenes, led to systematic underestimations of duration, lower perceived arousal but higher valence, lower respiration rates and smaller pupillary diameters. The presence of music compared to visual-only presentations strongly affected results in terms of higher accuracy in duration estimates, higher perceived arousal and valence, higher physiological activation and larger pupillary diameters, indicating higher arousal. Video genre affected responses in addition. These findings suggest that perceiving slow motion is not related to states of high arousal, but rather affects cognitive dimensions of perceived time and valence. Music influences these experiences profoundly, thus strengthening the impact of stretched time in audiovisual media.

  18. A multistage motion vector processing method for motion-compensated frame interpolation.

    PubMed

    Huang, Ai- Mei; Nguyen, Truong Q

    2008-05-01

    In this paper, a novel, low-complexity motion vector processing algorithm at the decoder is proposed for motion-compensated frame interpolation or frame rate up-conversion. We address the problems of having broken edges and deformed structures in an interpolated frame by hierarchically refining motion vectors on different block sizes. Our method explicitly considers the reliability of each received motion vector and has the capability of preserving the structure information. This is achieved by analyzing the distribution of residual energies and effectively merging blocks that have unreliable motion vectors. The motion vector reliability information is also used as a prior knowledge in motion vector refinement using a constrained vector median filter to avoid choosing identical unreliable one. We also propose using chrominance information in our method. Experimental results show that the proposed scheme has better visual quality and is also robust, even in video sequences with complex scenes and fast motion.

  19. Age and sex differences in ranges of motion and motion patterns.

    PubMed

    Hwang, Jaejin; Jung, Myung-Chul

    2015-01-01

    This study investigated the effects of age and sex on joint ranges of motion (ROMs) and motion patterns. Forty participants performed 18 motions using eight body segments at self-selected speeds. Older subjects showed smaller ROMs than younger subjects for 11 motions; the greatest difference in ROM was 44.9% for eversion/inversion of the foot. Older subjects also required more time than younger subjects to approach the peak angular velocity for six motions. In contrast, sex significantly affected ROMs but not motion patterns. Male subjects exhibited smaller ROMs than female subjects for four motions; the greatest sex-dependent difference in ROM was 29.7% for ulnar/radial deviation of the hand. The age and sex effects depended on the specific segments used and motions performed, possibly because of differences in anatomical structures and frequencies of use of the joints in habitual physical activities between the groups.

  20. Suppressing beam-centroid motion in a long-pulse linear induction accelerator

    NASA Astrophysics Data System (ADS)

    Ekdahl, Carl; Abeyta, E. O.; Archuleta, R.; Bender, H.; Broste, W.; Carlson, C.; Cook, G.; Frayer, D.; Harrison, J.; Hughes, T.; Johnson, J.; Jacquez, E.; McCuistian, B. Trent; Montoya, N.; Nath, S.; Nielsen, K.; Rose, C.; Schulze, M.; Smith, H. V.; Thoma, C.; Tom, C. Y.

    2011-12-01

    The second axis of the dual-axis radiography of hydrodynamic testing (DARHT) facility produces up to four radiographs within an interval of 1.6μs. It does this by slicing four micropulses out of a 2-μs long electron beam pulse and focusing them onto a bremsstrahlung converter target. The 1.8-kA beam pulse is created by a dispenser cathode diode and accelerated to more than 16 MeV by the unique DARHT Axis-II linear induction accelerator (LIA). Beam motion in the accelerator would be a problem for multipulse flash radiography. High-frequency motion, such as from beam-breakup (BBU) instability, would blur the individual spots. Low-frequency motion, such as produced by pulsed-power variation, would produce spot-to-spot differences. In this article, we describe these sources of beam motion, and the measures we have taken to minimize it. Using the methods discussed, we have reduced beam motion at the accelerator exit to less than 2% of the beam envelope radius for the high-frequency BBU, and less than 1/3 of the envelope radius for the low-frequency sweep.

  1. Time-Motion Analysis of Clinical Nursing Documentation During Implementation of an Electronic Operating Room Management System for Ophthalmic Surgery

    PubMed Central

    Read-Brown, Sarah; Sanders, David S.; Brown, Anna S.; Yackel, Thomas R.; Choi, Dongseok; Tu, Daniel C.; Chiang, Michael F.

    2013-01-01

    Efficiency and quality of documentation are critical in surgical settings because operating rooms are a major source of revenue, and because adverse events may have enormous consequences. Electronic health records (EHRs) have potential to impact surgical volume, quality, and documentation time. Ophthalmology is an ideal domain to examine these issues because procedures are high-throughput and demand efficient documentation. This time-motion study examines nursing documentation during implementation of an EHR operating room management system in an ophthalmology department. Key findings are: (1) EHR nursing documentation time was significantly worse during early implementation, but improved to a level near but slightly worse than paper baseline, (2) Mean documentation time varied significantly among nurses during early implementation, and (3) There was no decrease in operating room turnover time or surgical volume after implementation. These findings have important implications for ambulatory surgery departments planning EHR implementation, and for research in system design. PMID:24551402

  2. Seeing cilia: imaging modalities for ciliary motion and clinical connections.

    PubMed

    Peabody, Jacelyn E; Shei, Ren-Jay; Bermingham, Brent M; Phillips, Scott E; Turner, Brett; Rowe, Steven M; Solomon, George M

    2018-06-01

    The respiratory tract is lined with multiciliated epithelial cells that function to move mucus and trapped particles via the mucociliary transport apparatus. Genetic and acquired ciliopathies result in diminished mucociliary clearance, contributing to disease pathogenesis. Recent innovations in imaging technology have advanced our understanding of ciliary motion in health and disease states. Application of imaging modalities including transmission electron microscopy, high-speed video microscopy, and micron-optical coherence tomography could improve diagnostics and be applied for precision medicine. In this review, we provide an overview of ciliary motion, imaging modalities, and ciliopathic diseases of the respiratory system including primary ciliary dyskinesia, cystic fibrosis, chronic obstructive pulmonary disease, and idiopathic pulmonary fibrosis.

  3. Controlling the motion of multiple objects on a Chladni plate

    NASA Astrophysics Data System (ADS)

    Zhou, Quan; Sariola, Veikko; Latifi, Kourosh; Liimatainen, Ville

    2016-09-01

    The origin of the idea of moving objects by acoustic vibration can be traced back to 1787, when Ernst Chladni reported the first detailed studies on the aggregation of sand onto nodal lines of a vibrating plate. Since then and to this date, the prevailing view has been that the particle motion out of nodal lines is random, implying uncontrollability. But how random really is the out-of-nodal-lines motion on a Chladni plate? Here we show that the motion is sufficiently regular to be statistically modelled, predicted and controlled. By playing carefully selected musical notes, we can control the position of multiple objects simultaneously and independently using a single acoustic actuator. Our method allows independent trajectory following, pattern transformation and sorting of multiple miniature objects in a wide range of materials, including electronic components, water droplets loaded on solid carriers, plant seeds, candy balls and metal parts.

  4. Separation of Singing Voice from Music Accompaniment for Monaural Recordings

    DTIC Science & Technology

    2005-09-01

    Directory: pub/tech-report/2005 File in pdf format: TR61.pdf Separation of Singing Voice from Music Accompaniment for Monaural Recordings Yipeng Li...Abstract Separating singing voice from music accompaniment is very useful in many applications, such as lyrics recognition and alignment, singer...identification, and music information retrieval. Although speech separation has been extensively studied for decades, singing voice separation has been little

  5. A head motion estimation algorithm for motion artifact correction in dental CT imaging

    NASA Astrophysics Data System (ADS)

    Hernandez, Daniel; Elsayed Eldib, Mohamed; Hegazy, Mohamed A. A.; Hye Cho, Myung; Cho, Min Hyoung; Lee, Soo Yeol

    2018-03-01

    A small head motion of the patient can compromise the image quality in a dental CT, in which a slow cone-beam scan is adopted. We introduce a retrospective head motion estimation method by which we can estimate the motion waveform from the projection images without employing any external motion monitoring devices. We compute the cross-correlation between every two successive projection images, which results in a sinusoid-like displacement curve over the projection view when there is no patient motion. However, the displacement curve deviates from the sinusoid-like form when patient motion occurs. We develop a method to estimate the motion waveform with a single parameter derived from the displacement curve with aid of image entropy minimization. To verify the motion estimation method, we use a lab-built micro-CT that can emulate major head motions during dental CT scans, such as tilting and nodding, in a controlled way. We find that the estimated motion waveform conforms well to the actual motion waveform. To further verify the motion estimation method, we correct the motion artifacts with the estimated motion waveform. After motion artifact correction, the corrected images look almost identical to the reference images, with structural similarity index values greater than 0.81 in the phantom and rat imaging studies.

  6. Evaluation of modal pushover-based scaling of one component of ground motion: Tall buildings

    USGS Publications Warehouse

    Kalkan, Erol; Chopra, Anil K.

    2012-01-01

    Nonlinear response history analysis (RHA) is now increasingly used for performance-based seismic design of tall buildings. Required for nonlinear RHAs is a set of ground motions selected and scaled appropriately so that analysis results would be accurate (unbiased) and efficient (having relatively small dispersion). This paper evaluates accuracy and efficiency of recently developed modal pushover–based scaling (MPS) method to scale ground motions for tall buildings. The procedure presented explicitly considers structural strength and is based on the standard intensity measure (IM) of spectral acceleration in a form convenient for evaluating existing structures or proposed designs for new structures. Based on results presented for two actual buildings (19 and 52 stories, respectively), it is demonstrated that the MPS procedure provided a highly accurate estimate of the engineering demand parameters (EDPs), accompanied by significantly reduced record-to-record variability of the responses. In addition, the MPS procedure is shown to be superior to the scaling procedure specified in the ASCE/SEI 7-05 document.

  7. Note on in situ (scanning) transmission electron microscopy study of liquid samples.

    PubMed

    Jiang, Nan

    2017-08-01

    Liquid cell (scanning) transmission electron microscopy has been developed rapidly, using amorphous SiN x membranes as electron transparent windows. The current interpretations of electron beam effects are mainly based on radiolytic processes. In this note, additional effects of the electric field due to electron-beam irradiation are discussed. The electric field can be produced by the charge accumulation due to the emission of secondary and Auger electrons. Besides various beam-induced phenomena, such as nanoparticle precipitation and gas bubble formation and motion, two other effects need to be considered; one is the change of Gibbs free energy of nucleation and the other is the violation of Brownian motion due to ion drifting driven by the electric field. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. 30 CFR 250.228 - What administrative information must accompany the EP?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What administrative information must accompany the EP? 250.228 Section 250.228 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE... Contents of Exploration Plans (ep) § 250.228 What administrative information must accompany the EP? The...

  9. Directional Limits on Motion Transparency Assessed Through Colour-Motion Binding.

    PubMed

    Maloney, Ryan T; Clifford, Colin W G; Mareschal, Isabelle

    2018-03-01

    Motion-defined transparency is the perception of two or more distinct moving surfaces at the same retinal location. We explored the limits of motion transparency using superimposed surfaces of randomly positioned dots defined by differences in motion direction and colour. In one experiment, dots were red or green and we varied the proportion of dots of a single colour that moved in a single direction ('colour-motion coherence') and measured the threshold direction difference for discriminating between two directions. When colour-motion coherences were high (e.g., 90% of red dots moving in one direction), a smaller direction difference was required to correctly bind colour with direction than at low coherences. In another experiment, we varied the direction difference between the surfaces and measured the threshold colour-motion coherence required to discriminate between them. Generally, colour-motion coherence thresholds decreased with increasing direction differences, stabilising at direction differences around 45°. Different stimulus durations were compared, and thresholds were higher at the shortest (150 ms) compared with the longest (1,000 ms) duration. These results highlight different yet interrelated aspects of the task and the fundamental limits of the mechanisms involved: the resolution of narrowly separated directions in motion processing and the local sampling of dot colours from each surface.

  10. A retractable electron emitter for the creation of unperturbed pure electron plasmas.

    PubMed

    Berkery, John W; Pedersen, Thomas Sunn; Sampedro, Luis

    2007-01-01

    A retractable electron emitter has been constructed for the creation of unperturbed pure electron plasmas on magnetic surfaces in the Columbia Non-neutral Torus stellarator. The previous method of electron emission using emitters mounted on stationary rods limited the confinement time to 20 ms. A pneumatically driven system that can retract from the magnetic axis to the last closed flux surface in less than 20 ms while filling the surfaces with electrons was designed. The motion of the retractable emitter was modeled with a system of dynamical equations. The measured position versus time of the emitter agrees well with the model and the fastest axis-to-edge retraction was measured to be 20 ms with 40 psig helium gas driving the pneumatic piston.

  11. A tunable few electron triple quantum dot

    NASA Astrophysics Data System (ADS)

    Gaudreau, L.; Kam, A.; Granger, G.; Studenikin, S. A.; Zawadzki, P.; Sachrajda, A. S.

    2009-11-01

    In this paper, we report on a tunable few electron lateral triple quantum dot design. The quantum dot potentials are arranged in series. The device is aimed at studies of triple quantum dot properties where knowing the exact number of electrons is important as well as quantum information applications involving electron spin qubits. We demonstrate tuning strategies for achieving required resonant conditions such as quadruple points where all three quantum dots are on resonance. We find that in such a device resonant conditions at specific configurations are accompanied by complex charge transfer behavior.

  12. MotionExplorer: exploratory search in human motion capture data based on hierarchical aggregation.

    PubMed

    Bernard, Jürgen; Wilhelm, Nils; Krüger, Björn; May, Thorsten; Schreck, Tobias; Kohlhammer, Jörn

    2013-12-01

    We present MotionExplorer, an exploratory search and analysis system for sequences of human motion in large motion capture data collections. This special type of multivariate time series data is relevant in many research fields including medicine, sports and animation. Key tasks in working with motion data include analysis of motion states and transitions, and synthesis of motion vectors by interpolation and combination. In the practice of research and application of human motion data, challenges exist in providing visual summaries and drill-down functionality for handling large motion data collections. We find that this domain can benefit from appropriate visual retrieval and analysis support to handle these tasks in presence of large motion data. To address this need, we developed MotionExplorer together with domain experts as an exploratory search system based on interactive aggregation and visualization of motion states as a basis for data navigation, exploration, and search. Based on an overview-first type visualization, users are able to search for interesting sub-sequences of motion based on a query-by-example metaphor, and explore search results by details on demand. We developed MotionExplorer in close collaboration with the targeted users who are researchers working on human motion synthesis and analysis, including a summative field study. Additionally, we conducted a laboratory design study to substantially improve MotionExplorer towards an intuitive, usable and robust design. MotionExplorer enables the search in human motion capture data with only a few mouse clicks. The researchers unanimously confirm that the system can efficiently support their work.

  13. Efficient electron heating in relativistic shocks and gamma-ray-burst afterglow.

    PubMed

    Gedalin, M; Balikhin, M A; Eichler, D

    2008-02-01

    Electrons in shocks are efficiently energized due to the cross-shock potential, which develops because of differential deflection of electrons and ions by the magnetic field in the shock front. The electron energization is necessarily accompanied by scattering and thermalization. The mechanism is efficient in both magnetized and nonmagnetized relativistic electron-ion shocks. It is proposed that the synchrotron emission from the heated electrons in a layer of strongly enhanced magnetic field is responsible for gamma-ray-burst afterglows.

  14. Collisionless electron heating in inductively coupled discharges

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shaing, K.C.; Aydemir, A.Y.

    1996-07-01

    A kinetic theory of collisionless electron heating is developed for inductively coupled discharges with a finite height L. The novel effect associated with the finite-length system is the resonance between the bounce motion of the electrons and the wave frequency, leading to enhanced heating. The theory is in agreement with results of particle simulations.

  15. Beyond Orbital-Motion-Limited theory effects for dust transport in tokamaks

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Delzanno, Gian Luca; Tang, Xianzhu

    Dust transport in tokamaks is very important for ITER. Can many kilograms of dust really accumulate in the device? Can the dust survive? The conventional dust transport model is based on Orbital-Motion-Limited theory (OML). But OML can break in the limit where the dust grain becomes positively charged due to electron emission processes because it overestimates the dust collected power. An OML + approximation of the emitted electrons trapped/passing boundary is shown to be in good agreement with PIC simulations.

  16. Role of the kinematics of probing electrons in electron energy-loss spectroscopy of solid surfaces

    NASA Astrophysics Data System (ADS)

    Nazarov, V. U.; Silkin, V. M.; Krasovskii, E. E.

    2016-01-01

    Inelastic scattering of electrons incident on a solid surface is determined by two properties: (i) electronic response of the target system and (ii) the detailed quantum-mechanical motion of the projectile electron inside and in the vicinity of the target. We emphasize the equal importance of the second ingredient, pointing out the fundamental limitations of the conventionally used theoretical description of the electron energy-loss spectroscopy (EELS) in terms of the "energy-loss functions." Our approach encompasses the dipole and impact scattering as specific cases, with the emphasis on the quantum-mechanical treatment of the probe electron. Applied to the high-resolution EELS of Ag surface, our theory largely agrees with recent experiments, while some instructive exceptions are rationalized.

  17. Smoothing Motion Estimates for Radar Motion Compensation.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Doerry, Armin W.

    2017-07-01

    Simple motion models for complex motion environments are often not adequate for keeping radar data coherent. Eve n perfect motion samples appli ed to imperfect models may lead to interim calculations e xhibiting errors that lead to degraded processing results. Herein we discuss a specific i ssue involving calculating motion for groups of pulses, with measurements only available at pulse-group boundaries. - 4 - Acknowledgements This report was funded by General A tomics Aeronautical Systems, Inc. (GA-ASI) Mission Systems under Cooperative Re search and Development Agre ement (CRADA) SC08/01749 between Sandia National Laboratories and GA-ASI. General Atomics Aeronautical Systems, Inc.more » (GA-ASI), an affilia te of privately-held General Atomics, is a leading manufacturer of Remotely Piloted Aircraft (RPA) systems, radars, and electro-optic and rel ated mission systems, includin g the Predator(r)/Gray Eagle(r)-series and Lynx(r) Multi-mode Radar.« less

  18. 49 CFR 591.6 - Documents accompanying declarations.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... SAFETY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION (CONTINUED) IMPORTATION OF VEHICLES AND EQUIPMENT SUBJECT TO FEDERAL SAFETY, BUMPER AND THEFT PREVENTION STANDARDS § 591.6 Documents accompanying... public roads, or that the equipment item was not manufactured for use on a motor vehicle or is not an...

  19. Perception of Elasticity in the Kinetic Illusory Object with Phase Differences in Inducer Motion

    PubMed Central

    Masuda, Tomohiro; Sato, Kazuki; Murakoshi, Takuma; Utsumi, Ken; Kimura, Atsushi; Shirai, Nobu; Kanazawa, So; Yamaguchi, Masami K.; Wada, Yuji

    2013-01-01

    Background It is known that subjective contours are perceived even when a figure involves motion. However, whether this includes the perception of rigidity or deformation of an illusory surface remains unknown. In particular, since most visual stimuli used in previous studies were generated in order to induce illusory rigid objects, the potential perception of material properties such as rigidity or elasticity in these illusory surfaces has not been examined. Here, we elucidate whether the magnitude of phase difference in oscillation influences the visual impressions of an object's elasticity (Experiment 1) and identify whether such elasticity perceptions are accompanied by the shape of the subjective contours, which can be assumed to be strongly correlated with the perception of rigidity (Experiment 2). Methodology/Principal Findings In Experiment 1, the phase differences in the oscillating motion of inducers were controlled to investigate whether they influenced the visual impression of an illusory object's elasticity. The results demonstrated that the impression of the elasticity of an illusory surface with subjective contours was systematically flipped with the degree of phase difference. In Experiment 2, we examined whether the subjective contours of a perceived object appeared linear or curved using multi-dimensional scaling analysis. The results indicated that the contours of a moving illusory object were perceived as more curved than linear in all phase-difference conditions. Conclusions/Significance These findings suggest that the phase difference in an object's motion is a significant factor in the material perception of motion-related elasticity. PMID:24205281

  20. Ultrafast Electron Diffraction: How It Works

    ScienceCinema

    None

    2018-01-16

    A new technology at SLAC uses high-energy electrons to unravel motions in materials that are faster than a tenth of a trillionth of a second, opening up new research opportunities in ultrafast science.

  1. Ultrafast Electron Diffraction: How It Works

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    None

    2015-08-05

    A new technology at SLAC uses high-energy electrons to unravel motions in materials that are faster than a tenth of a trillionth of a second, opening up new research opportunities in ultrafast science.

  2. Seeing blur: 'motion sharpening' without motion.

    PubMed Central

    Georgeson, Mark A; Hammett, Stephen T

    2002-01-01

    It is widely supposed that things tend to look blurred when they are moving fast. Previous work has shown that this is true for sharp edges but, paradoxically, blurred edges look sharper when they are moving than when stationary. This is 'motion sharpening'. We show that blurred edges also look up to 50% sharper when they are presented briefly (8-24 ms) than at longer durations (100-500 ms) without motion. This argues strongly against high-level models of sharpening based specifically on compensation for motion blur. It also argues against a recent, low-level, linear filter model that requires motion to produce sharpening. No linear filter model can explain our finding that sharpening was similar for sinusoidal and non-sinusoidal gratings, since linear filters can never distort sine waves. We also conclude that the idea of a 'default' assumption of sharpness is not supported by experimental evidence. A possible source of sharpening is a nonlinearity in the contrast response of early visual mechanisms to fast or transient temporal changes, perhaps based on the magnocellular (M-cell) pathway. Our finding that sharpening is not diminished at low contrast sets strong constraints on the nature of the nonlinearity. PMID:12137571

  3. Chaotic Motions in the Real Fuzzy Electronic Circuits

    DTIC Science & Technology

    2012-12-30

    field of secure communications, the original source should be blended with other complex signals. Chaotic signals are one of the good sources to be...Takagi-Sugeno (T-S) fuzzy chaotic systems on electronic circuit. In the research field of secure communications, the original source should be blended ...model. The overall fuzzy model of the system is achieved by fuzzy blending of the linear system models. Consider a continuous-time nonlinear dynamic

  4. Dynamical backaction cooling with free electrons.

    PubMed

    Niguès, A; Siria, A; Verlot, P

    2015-09-18

    The ability to cool single ions, atomic ensembles, and more recently macroscopic degrees of freedom down to the quantum ground state has generated considerable progress and perspectives in fundamental and technological science. These major advances have been essentially obtained by coupling mechanical motion to a resonant electromagnetic degree of freedom in what is generally known as laser cooling. Here, we experimentally demonstrate the first self-induced coherent cooling mechanism that is not mediated by an electromagnetic resonance. Using a focused electron beam, we report a 50-fold reduction of the motional temperature of a nanowire. Our result primarily relies on the sub-nanometre confinement of the electron beam and generalizes to any delayed and spatially confined interaction, with important consequences for near-field microscopy and fundamental nanoscale dissipation mechanisms.

  5. Dynamical backaction cooling with free electrons

    PubMed Central

    Niguès, A.; Siria, A.; Verlot, P.

    2015-01-01

    The ability to cool single ions, atomic ensembles, and more recently macroscopic degrees of freedom down to the quantum ground state has generated considerable progress and perspectives in fundamental and technological science. These major advances have been essentially obtained by coupling mechanical motion to a resonant electromagnetic degree of freedom in what is generally known as laser cooling. Here, we experimentally demonstrate the first self-induced coherent cooling mechanism that is not mediated by an electromagnetic resonance. Using a focused electron beam, we report a 50-fold reduction of the motional temperature of a nanowire. Our result primarily relies on the sub-nanometre confinement of the electron beam and generalizes to any delayed and spatially confined interaction, with important consequences for near-field microscopy and fundamental nanoscale dissipation mechanisms. PMID:26381454

  6. Electron correlation in real time.

    PubMed

    Sansone, Giuseppe; Pfeifer, Thomas; Simeonidis, Konstantinos; Kuleff, Alexander I

    2012-02-01

    Electron correlation, caused by the interaction among electrons in a multielectron system, manifests itself in all states of matter. A complete theoretical description of interacting electrons is challenging; different approximations have been developed to describe the fundamental aspects of the correlation that drives the evolution of simple (few-electron systems in atoms/molecules) as well as complex (multielectron wave functions in atoms, molecules, and solids) systems. Electron correlation plays a key role in the relaxation mechanisms that characterize excited states of neutral or ionized atoms and molecules populated by absorption of extreme ultraviolet (XUV) or X-ray radiation. The dynamics of these states can lead to different processes such as Fano resonance and Auger decay in atoms or interatomic Coulombic decay or charge migration in molecules and clusters. Many of these relaxation mechanisms are ubiquitous in nature and characterize the interaction of complex systems, such as biomolecules, adsorbates on surfaces, and hydrogen-bonded clusters, with XUV light. These mechanisms evolve typically on the femtosecond (1 fs=10(-15) s) or sub-femtosecond timescale. The experimental availability of few-femtosecond and attosecond (1 as=10(-18) s) XUV pulses achieved in the last 10 years offers, for the first time, the opportunity to excite and probe in time these dynamics giving the possibility to trace and control multielectron processes. The generation of ultrashort XUV radiation has triggered the development and application of spectroscopy techniques that can achieve time resolution well into the attosecond domain, thereby offering information on the correlated electronic motion and on the correlation between electron and nuclear motion. A deeper understanding of how electron correlation works could have a large impact in several research fields, such as biochemistry and biology, and trigger important developments in the design and optimization of electronic

  7. Single particle and collective behavior of electrons in a diamagnetic Kepler trap

    NASA Astrophysics Data System (ADS)

    Godino, Joseph L.

    2001-10-01

    The Diamagnetic Kepler Trap (DKT) is a potential energy well that arises from a static Coulomb potential in a superimposed uniform magnetic field. Our goal is to study the single particle and collective behavior of electrons in a DKT. We have three principal reasons for doing so. First, trajectories of a single electron in a DKT can exhibit chaotic motion. The transition from regular to chaotic motion is theoretically interesting and we want to understand how this occurs. Second, we want to understand the behavior of a system of electrons in a laboratory realization of a DKT. In this situation, we have a many particle system of electrons and ions that move under the influence of external potentials in a neutral background gas. Under these conditions, trapped electrons exhibit collective modes of oscillation. Finally, by understanding the behavior of the trapped electrons we believe that we may be able to develop the DKT into an ion beam source. Due to the complexity of the DKT, we break our investigation into three parts. First, we conduct a theoretical and computational study of the motion of a single electron in a DKT. To enhance our understanding, we develop a simple model of the DKT that retains the significant properties of the exact system while permitting us to go further with our theoretical analysis. We develop a solution to the model equations of motion, which provide us with additional insight into the behavior of trajectories near the chaotic transition. Second, we characterize the behavior of trapped electrons in our experimental DKT. We present a set of measurements showing the collective oscillations. In addition, when we operate the DKT at magnetic fields greater than 100 gauss, we observe a columnar plasma beam emerging from the trap that we also characterize. Finally, we simulate the dynamics of the electrons and ions in a DKT. Here we include their interactions with the neutral background gas, boundary effects and space charge. We use the

  8. 39 CFR 320.7 - Suspension for advertisements accompanying parcels or periodicals.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 39 Postal Service 1 2010-07-01 2010-07-01 false Suspension for advertisements accompanying parcels or periodicals. 320.7 Section 320.7 Postal Service UNITED STATES POSTAL SERVICE RESTRICTIONS ON PRIVATE CARRIAGE OF LETTERS SUSPENSION OF THE PRIVATE EXPRESS STATUTES § 320.7 Suspension for advertisements accompanying parcels or periodicals. (a) Th...

  9. 41 CFR 101-25.110-3 - Tires accompanying new motor vehicles.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Tires accompanying new...-GENERAL 25.1-General Policies § 101-25.110-3 Tires accompanying new motor vehicles. The tire... vehicle manufacturer or his designee to maintain a record of tires on or in each vehicle shipped by him...

  10. Electron residual energy due to stochastic heating in field-ionized plasma

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Khalilzadeh, Elnaz; The Plasma Physics and Fusion Research School, Tehran; Yazdanpanah, Jam, E-mail: jamal.yazdan@gmail.com

    2015-11-15

    The electron residual energy originated from the stochastic heating in under-dense field-ionized plasma is investigated here. Initially, the optical response of plasma is modeled by using two counter-propagating electromagnetic waves. In this case, the solution of motion equation of a single electron indicates that by including the ionization, the electron with higher residual energy compared with that without ionization could be obtained. In agreement with chaotic nature of the motion, it is found that the electron residual energy will be significantly changed by applying a minor change in the initial conditions. Extensive kinetic 1D-3V particle-in-cell simulations have been performed inmore » order to resolve full plasma reactions. In this way, two different regimes of plasma behavior are observed by varying the pulse length. The results indicate that the amplitude of scattered fields in a proper long pulse length is high enough to act as a second counter-propagating wave and trigger the stochastic electron motion. On the contrary, the analyses of intensity spectrum reveal the fact that the dominant scattering mechanism tends to Thomson rather than Raman scattering by increasing the pulse length. A covariant formalism is used to describe the plasma heating so that it enables us to measure electron temperature inside and outside of the pulse region.« less

  11. Priming with real motion biases visual cortical response to bistable apparent motion

    PubMed Central

    Zhang, Qing-fang; Wen, Yunqing; Zhang, Deng; She, Liang; Wu, Jian-young; Dan, Yang; Poo, Mu-ming

    2012-01-01

    Apparent motion quartet is an ambiguous stimulus that elicits bistable perception, with the perceived motion alternating between two orthogonal paths. In human psychophysical experiments, the probability of perceiving motion in each path is greatly enhanced by a brief exposure to real motion along that path. To examine the neural mechanism underlying this priming effect, we used voltage-sensitive dye (VSD) imaging to measure the spatiotemporal activity in the primary visual cortex (V1) of awake mice. We found that a brief real motion stimulus transiently biased the cortical response to subsequent apparent motion toward the spatiotemporal pattern representing the real motion. Furthermore, intracellular recording from V1 neurons in anesthetized mice showed a similar increase in subthreshold depolarization in the neurons representing the path of real motion. Such short-term plasticity in early visual circuits may contribute to the priming effect in bistable visual perception. PMID:23188797

  12. Measurements of Long-range Electronic Correlations During Femtosecond Diffraction Experiments Performed on Nanocrystals of Buckminsterfullerene

    PubMed Central

    Ryan, Rebecca A.; Williams, Sophie; Martin, Andrew V.; Dilanian, Ruben A.; Darmanin, Connie; Putkunz, Corey T.; Wood, David; Streltsov, Victor A.; Jones, Michael W.M.; Gaffney, Naylyn; Hofmann, Felix; Williams, Garth J.; Boutet, Sebastien; Messerschmidt, Marc; Seibert, M. Marvin; Curwood, Evan K.; Balaur, Eugeniu; Peele, Andrew G.; Nugent, Keith A.; Quiney, Harry M.; Abbey, Brian

    2017-01-01

    The precise details of the interaction of intense X-ray pulses with matter are a topic of intense interest to researchers attempting to interpret the results of femtosecond X-ray free electron laser (XFEL) experiments. An increasing number of experimental observations have shown that although nuclear motion can be negligible, given a short enough incident pulse duration, electronic motion cannot be ignored. The current and widely accepted models assume that although electrons undergo dynamics driven by interaction with the pulse, their motion could largely be considered 'random'. This would then allow the supposedly incoherent contribution from the electronic motion to be treated as a continuous background signal and thus ignored. The original aim of our experiment was to precisely measure the change in intensity of individual Bragg peaks, due to X-ray induced electronic damage in a model system, crystalline C60. Contrary to this expectation, we observed that at the highest X-ray intensities, the electron dynamics in C60 were in fact highly correlated, and over sufficiently long distances that the positions of the Bragg reflections are significantly altered. This paper describes in detail the methods and protocols used for these experiments, which were conducted both at the Linac Coherent Light Source (LCLS) and the Australian Synchrotron (AS) as well as the crystallographic approaches used to analyse the data. PMID:28872125

  13. Measurements of Long-range Electronic Correlations During Femtosecond Diffraction Experiments Performed on Nanocrystals of Buckminsterfullerene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ryan, Rebecca A.; Williams, Sophie; Martin, Andrew V.

    The precise details of the interaction of intense X-ray pulses with matter are a topic of intense interest to researchers attempting to interpret the results of femtosecond X-ray free electron laser (XFEL) experiments. An increasing number of experimental observations have shown that although nuclear motion can be negligible, given a short enough incident pulse duration, electronic motion cannot be ignored. The current and widely accepted models assume that although electrons undergo dynamics driven by interaction with the pulse, their motion could largely be considered 'random'. This would then allow the supposedly incoherent contribution from the electronic motion to be treatedmore » as a continuous background signal and thus ignored. The original aim of our experiment was to precisely measure the change in intensity of individual Bragg peaks, due to X-ray induced electronic damage in a model system, crystalline C 60. Contrary to this expectation, we observed that at the highest X-ray intensities, the electron dynamics in C 60 were in fact highly correlated, and over sufficiently long distances that the positions of the Bragg reflections are significantly altered. Our paper describes in detail the methods and protocols used for these experiments, which were conducted both at the Linac Coherent Light Source (LCLS) and the Australian Synchrotron (AS) as well as the crystallographic approaches used to analyse the data.« less

  14. Measurements of Long-range Electronic Correlations During Femtosecond Diffraction Experiments Performed on Nanocrystals of Buckminsterfullerene

    DOE PAGES

    Ryan, Rebecca A.; Williams, Sophie; Martin, Andrew V.; ...

    2017-08-22

    The precise details of the interaction of intense X-ray pulses with matter are a topic of intense interest to researchers attempting to interpret the results of femtosecond X-ray free electron laser (XFEL) experiments. An increasing number of experimental observations have shown that although nuclear motion can be negligible, given a short enough incident pulse duration, electronic motion cannot be ignored. The current and widely accepted models assume that although electrons undergo dynamics driven by interaction with the pulse, their motion could largely be considered 'random'. This would then allow the supposedly incoherent contribution from the electronic motion to be treatedmore » as a continuous background signal and thus ignored. The original aim of our experiment was to precisely measure the change in intensity of individual Bragg peaks, due to X-ray induced electronic damage in a model system, crystalline C 60. Contrary to this expectation, we observed that at the highest X-ray intensities, the electron dynamics in C 60 were in fact highly correlated, and over sufficiently long distances that the positions of the Bragg reflections are significantly altered. Our paper describes in detail the methods and protocols used for these experiments, which were conducted both at the Linac Coherent Light Source (LCLS) and the Australian Synchrotron (AS) as well as the crystallographic approaches used to analyse the data.« less

  15. Coupling between overall rotational diffusion and domain motions in proteins and its effect on dielectric spectra.

    PubMed

    Ryabov, Yaroslav

    2015-09-01

    In this work, we formulate a closed-form solution of the model of a semirigid molecule for the case of fluctuating and reorienting molecular electric dipole moment. We illustrate with numeric calculations the impact of protein domain motions on dielectric spectra using the example of the 128 kDa protein dimer of Enzyme I. We demonstrate that the most drastic effect occurs for situations when the characteristic time of protein domain dynamics is comparable to the time of overall molecular rotational diffusion. We suggest that protein domain motions could be a possible explanation for the high-frequency contribution that accompanies the major relaxation dispersion peak in the dielectric spectra of protein aqueous solutions. We propose that the presented computational methodology could be used for the simultaneous analysis of dielectric spectroscopy and nuclear magnetic resonance data. Proteins 2015; 83:1571-1581. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

  16. 31 CFR 538.511 - Accompanied baggage authorized.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 31 Money and Finance:Treasury 3 2013-07-01 2013-07-01 false Accompanied baggage authorized. 538.511 Section 538.511 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued... only articles that are necessary for personal use incident to travel, are not intended for any other...

  17. 31 CFR 538.511 - Accompanied baggage authorized.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 31 Money and Finance:Treasury 3 2014-07-01 2014-07-01 false Accompanied baggage authorized. 538.511 Section 538.511 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued... only articles that are necessary for personal use incident to travel, are not intended for any other...

  18. 31 CFR 538.511 - Accompanied baggage authorized.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 31 Money and Finance:Treasury 3 2011-07-01 2011-07-01 false Accompanied baggage authorized. 538.511 Section 538.511 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued... only articles that are necessary for personal use incident to travel, are not intended for any other...

  19. 31 CFR 538.511 - Accompanied baggage authorized.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Accompanied baggage authorized. 538.511 Section 538.511 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued... only articles that are necessary for personal use incident to travel, are not intended for any other...

  20. 31 CFR 538.511 - Accompanied baggage authorized.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 31 Money and Finance:Treasury 3 2012-07-01 2012-07-01 false Accompanied baggage authorized. 538.511 Section 538.511 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued... only articles that are necessary for personal use incident to travel, are not intended for any other...

  1. Model of vertical plasma motion during the current quench

    NASA Astrophysics Data System (ADS)

    Breizman, Boris; Kiramov, Dmitrii

    2017-10-01

    Tokamak disruptions impair plasma position control, which allows the plasma column to move and hit the wall. These detrimental events enhance thermal and mechanical loads due to halo currents and runaway electron losses. Their fundamental understanding and prevention is one of the high-priority items for ITER. As commonly observed in experiments, the disruptive plasma tends to move vertically, and the timescale of this motion is rather resistive than Alfvenic. These observations suggest that the plasma column is nearly force-free during its vertical motion. In fact, the force-free constraint is already used in disruption simulators. In this work, we consider a geometrically simple system that mimics the tokamak plasma surrounded by the conducting structures. Using this model, we highlight the underlying mechanism of the vertical displacement events during the current quench phase of plasma disruption. We also address a question of ideal MHD stability of the plasma during its resistive motion. Work supported by the U.S. Department of Energy Contracts DEFG02-04ER54742 and DE-SC0016283.

  2. Joint PET-MR respiratory motion models for clinical PET motion correction

    NASA Astrophysics Data System (ADS)

    Manber, Richard; Thielemans, Kris; Hutton, Brian F.; Wan, Simon; McClelland, Jamie; Barnes, Anna; Arridge, Simon; Ourselin, Sébastien; Atkinson, David

    2016-09-01

    Patient motion due to respiration can lead to artefacts and blurring in positron emission tomography (PET) images, in addition to quantification errors. The integration of PET with magnetic resonance (MR) imaging in PET-MR scanners provides complementary clinical information, and allows the use of high spatial resolution and high contrast MR images to monitor and correct motion-corrupted PET data. In this paper we build on previous work to form a methodology for respiratory motion correction of PET data, and show it can improve PET image quality whilst having minimal impact on clinical PET-MR protocols. We introduce a joint PET-MR motion model, using only 1 min per PET bed position of simultaneously acquired PET and MR data to provide a respiratory motion correspondence model that captures inter-cycle and intra-cycle breathing variations. In the model setup, 2D multi-slice MR provides the dynamic imaging component, and PET data, via low spatial resolution framing and principal component analysis, provides the model surrogate. We evaluate different motion models (1D and 2D linear, and 1D and 2D polynomial) by computing model-fit and model-prediction errors on dynamic MR images on a data set of 45 patients. Finally we apply the motion model methodology to 5 clinical PET-MR oncology patient datasets. Qualitative PET reconstruction improvements and artefact reduction are assessed with visual analysis, and quantitative improvements are calculated using standardised uptake value (SUVpeak and SUVmax) changes in avid lesions. We demonstrate the capability of a joint PET-MR motion model to predict respiratory motion by showing significantly improved image quality of PET data acquired before the motion model data. The method can be used to incorporate motion into the reconstruction of any length of PET acquisition, with only 1 min of extra scan time, and with no external hardware required.

  3. Motion-based prediction explains the role of tracking in motion extrapolation.

    PubMed

    Khoei, Mina A; Masson, Guillaume S; Perrinet, Laurent U

    2013-11-01

    During normal viewing, the continuous stream of visual input is regularly interrupted, for instance by blinks of the eye. Despite these frequents blanks (that is the transient absence of a raw sensory source), the visual system is most often able to maintain a continuous representation of motion. For instance, it maintains the movement of the eye such as to stabilize the image of an object. This ability suggests the existence of a generic neural mechanism of motion extrapolation to deal with fragmented inputs. In this paper, we have modeled how the visual system may extrapolate the trajectory of an object during a blank using motion-based prediction. This implies that using a prior on the coherency of motion, the system may integrate previous motion information even in the absence of a stimulus. In order to compare with experimental results, we simulated tracking velocity responses. We found that the response of the motion integration process to a blanked trajectory pauses at the onset of the blank, but that it quickly recovers the information on the trajectory after reappearance. This is compatible with behavioral and neural observations on motion extrapolation. To understand these mechanisms, we have recorded the response of the model to a noisy stimulus. Crucially, we found that motion-based prediction acted at the global level as a gain control mechanism and that we could switch from a smooth regime to a binary tracking behavior where the dot is tracked or lost. Our results imply that a local prior implementing motion-based prediction is sufficient to explain a large range of neural and behavioral results at a more global level. We show that the tracking behavior deteriorates for sensory noise levels higher than a certain value, where motion coherency and predictability fail to hold longer. In particular, we found that motion-based prediction leads to the emergence of a tracking behavior only when enough information from the trajectory has been accumulated

  4. Unsupervised motion-based object segmentation refined by color

    NASA Astrophysics Data System (ADS)

    Piek, Matthijs C.; Braspenning, Ralph; Varekamp, Chris

    2003-06-01

    For various applications, such as data compression, structure from motion, medical imaging and video enhancement, there is a need for an algorithm that divides video sequences into independently moving objects. Because our focus is on video enhancement and structure from motion for consumer electronics, we strive for a low complexity solution. For still images, several approaches exist based on colour, but these lack in both speed and segmentation quality. For instance, colour-based watershed algorithms produce a so-called oversegmentation with many segments covering each single physical object. Other colour segmentation approaches exist which somehow limit the number of segments to reduce this oversegmentation problem. However, this often results in inaccurate edges or even missed objects. Most likely, colour is an inherently insufficient cue for real world object segmentation, because real world objects can display complex combinations of colours. For video sequences, however, an additional cue is available, namely the motion of objects. When different objects in a scene have different motion, the motion cue alone is often enough to reliably distinguish objects from one another and the background. However, because of the lack of sufficient resolution of efficient motion estimators, like the 3DRS block matcher, the resulting segmentation is not at pixel resolution, but at block resolution. Existing pixel resolution motion estimators are more sensitive to noise, suffer more from aperture problems or have less correspondence to the true motion of objects when compared to block-based approaches or are too computationally expensive. From its tendency to oversegmentation it is apparent that colour segmentation is particularly effective near edges of homogeneously coloured areas. On the other hand, block-based true motion estimation is particularly effective in heterogeneous areas, because heterogeneous areas improve the chance a block is unique and thus decrease the

  5. Electron transmission through a steel capillary

    NASA Astrophysics Data System (ADS)

    Maljković, J. B.; Borka, D.; Ranković, M. Lj.; Marinković, B. P.; Milosavljević, A. R.; Lemell, C.; Tőkési, K.

    2018-05-01

    The transmission of low-energy electrons through a macroscopic steel capillary has been investigated both experimentally and theoretically. The length of the steel capillary was L = 19.5 mm and the inner diameter was d = 0.9 mm. The kinetic energy distribution of electrons transmitted through the steel capillary was recorded for a tilt angle of ψ = 2.6 ° of the incident electron beam with respect to the capillary axis. Accompanying simulations based on classical transport theory reproduce the experimental data to a high degree of agreement. Transmission for other tilt angles has also been simulated to investigate the influence of the tilt angle on the guiding efficiency.

  6. Active Motion Control of Tetrahymena pyriformis by Galvanotaxis and Geotaxis

    NASA Astrophysics Data System (ADS)

    Kim, Jihoon; Byun, Doyoung; Kim, Min Jun

    2013-11-01

    Recently, there has been increasing interest in the swimming behavior of microorganisms and biologically inspired micro-robots. These microorganisms naturally accompanied by complex motions. Therefore it is important to understand the flow characteristics as well as control mechanisms. One of eukaryotic cells, the protozoa are a diverse group of unicellular organisms, many of which are motile cilia. Motile cilia are cover on the surface of cell in large numbers and beat in oriented waves. Sequential beating motions of a single cilium form metachronal strokes, producing a propagation wave, and therefore the body is achieved propulsion force. So preliminary studies are achieved to understand the flow induced by swimming microorganisms. Based on hydrodynamic results, the follow study of a few micro-scale protozoa cell, such as the Tetrahymena pyriformis, has provided active or passive control into several external stimuli. In typical control methods, the galvanotaxis and geotaxis were adopted active and passive control, respectively. The validation of galvanotaxis is used DC and AC voltage. In terms of geotaxis, corrugated microstructures were used to control in the microchannel. This research was supported by the Ministry of Education, Science and Technology (MEST, 2011-0016461), National Science Foundation (NSF) CMMI Control Systems Program (#1000255) and Army Research Office (W911NF-11-1-0490).

  7. Is Diaphragm Motion a Good Surrogate for Liver Tumor Motion?

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yang, Juan; School of Information Science and Engineering, Shandong University, Jinan, Shandong; Cai, Jing

    Purpose: To evaluate the relationship between liver tumor motion and diaphragm motion. Methods and Materials: Fourteen patients with hepatocellular carcinoma (10 of 14) or liver metastases (4 of 14) undergoing radiation therapy were included in this study. All patients underwent single-slice cine–magnetic resonance imaging simulations across the center of the tumor in 3 orthogonal planes. Tumor and diaphragm motion trajectories in the superior–inferior (SI), anterior–posterior (AP), and medial–lateral (ML) directions were obtained using an in-house-developed normalized cross-correlation–based tracking technique. Agreement between the tumor and diaphragm motion was assessed by calculating phase difference percentage, intraclass correlation coefficient, and Bland-Altman analysis (Diff).more » The distance between the tumor and tracked diaphragm area was analyzed to understand its impact on the correlation between the 2 motions. Results: Of all patients, the mean (±standard deviation) phase difference percentage values were 7.1% ± 1.1%, 4.5% ± 0.5%, and 17.5% ± 4.5% in the SI, AP, and ML directions, respectively. The mean intraclass correlation coefficient values were 0.98 ± 0.02, 0.97 ± 0.02, and 0.08 ± 0.06 in the SI, AP, and ML directions, respectively. The mean Diff values were 2.8 ± 1.4 mm, 2.4 ± 1.1 mm, and 2.2 ± 0.5 mm in the SI, AP, and ML directions, respectively. Tumor and diaphragm motions had high concordance when the distance between the tumor and tracked diaphragm area was small. Conclusions: This study showed that liver tumor motion had good correlation with diaphragm motion in the SI and AP directions, indicating diaphragm motion in the SI and AP directions could potentially be used as a reliable surrogate for liver tumor motion.« less

  8. Electron Technology: ELTE 2016

    NASA Astrophysics Data System (ADS)

    Pisarkiewicz, Tadeusz; Kucewicz, Wojciech

    2016-12-01

    In this paper we present a review of research results and technical accomplishments presented by researchers from technical universities, governmental institutes and research companies during the XIIth Scientific Conference Electron Technology, ELTE 2016. This review is based on materials presented at four topical conference sessions: Microelectronics and Nanoelectronics, Photonics, Materials and Technologies, and Microsystems and also on materials presented by invited speakers at two dedicated sessions. Oral sessions were accompanied by the poster sessions. In effect about 50 papers gathered in this volume reflect the topics discussed at the Conference. A short description of technological and measurement possibilities in the laboratories of Academic Centre for Materials and Nanotechnology and also in the Department of Electronics of the Faculty of Computer Science, Electronics and Telecommunications AGH UST are given.

  9. Can walking motions improve visually induced rotational self-motion illusions in virtual reality?

    PubMed

    Riecke, Bernhard E; Freiberg, Jacob B; Grechkin, Timofey Y

    2015-02-04

    Illusions of self-motion (vection) can provide compelling sensations of moving through virtual environments without the need for complex motion simulators or large tracked physical walking spaces. Here we explore the interaction between biomechanical cues (stepping along a rotating circular treadmill) and visual cues (viewing simulated self-rotation) for providing stationary users a compelling sensation of rotational self-motion (circular vection). When tested individually, biomechanical and visual cues were similarly effective in eliciting self-motion illusions. However, in combination they yielded significantly more intense self-motion illusions. These findings provide the first compelling evidence that walking motions can be used to significantly enhance visually induced rotational self-motion perception in virtual environments (and vice versa) without having to provide for physical self-motion or motion platforms. This is noteworthy, as linear treadmills have been found to actually impair visually induced translational self-motion perception (Ash, Palmisano, Apthorp, & Allison, 2013). Given the predominant focus on linear walking interfaces for virtual-reality locomotion, our findings suggest that investigating circular and curvilinear walking interfaces offers a promising direction for future research and development and can help to enhance self-motion illusions, presence and immersion in virtual-reality systems. © 2015 ARVO.

  10. Motion-plane dependency of the range of dart throw motion and the effects of tendon action due to finger extrinsic muscles during the motion.

    PubMed

    Mitsukane, Masahiro; Sekiya, Noboru; Kamono, Arinori; Nakabo, Tohru

    2018-03-01

    [Purpose] To clarify the motion-plane dependency of the range of dart throw motion and the effects of tendon action due to long finger flexors and extensors during the motion. [Subjects and Methods] Forty healthy subjects attended the experiment, and the active range of wrist motion in seven motion planes was measured with an originally designed apparatus. [Results] The reliability of the measurement was acceptable. The range of dart throw motion depended on the motion planes, with a maximum at around the motion plane of 45° from the sagittal plane (45° of pronation). The tendon action of long finger muscles was shown in dart throw motion except in 45° of pronation. [Conclusion] Motion-plane dependency of the range of dart throw motion exists in healthy subjects. The absence of tendon action due to finger extrinsic muscles in dart throw motion at 45° might be one of the causes of the advantage of dart throw motion.

  11. 31 CFR 545.507 - Accompanied baggage authorized.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Accompanied baggage authorized. 545.507 Section 545.507 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued... that are necessary for personal use incident to travel, that are not intended for any other person or...

  12. 31 CFR 560.507 - Accompanied baggage authorized.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 31 Money and Finance:Treasury 3 2012-07-01 2012-07-01 false Accompanied baggage authorized. 560.507 Section 560.507 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued... for personal use incident to travel, not intended for any other person or for sale, and are not...

  13. Long term performance of wearable transducer for motion energy harvesting

    NASA Astrophysics Data System (ADS)

    McGarry, Scott A.; Behrens, Sam

    2010-04-01

    Personal electronic devices such as cell phones, GPS and MP3 players have traditionally depended on battery energy storage technologies for operation. By harvesting energy from a person's motion, these devices may achieve greater run times without increasing the mass or volume of the electronic device. Through the use of a flexible piezoelectric transducer such as poly-vinylidene fluoride (PVDF), and integrating it into a person's clothing, it becomes a 'wearable transducer'. As the PVDF transducer is strained during the person's routine activities, it produces an electrical charge which can then be harvested to power personal electronic devices. Existing wearable transducers have shown great promise for personal motion energy harvesting applications. However, they are presently physically bulky and not ergonomic for the wearer. In addition, there is limited information on the energy harvesting performance for wearable transducers, especially under realistic conditions and for extended cyclic force operations - as would be experienced when worn. In this paper, we present experimental results for a wearable PVDF transducer using a person's measured walking force profile, which is then cycled for a prolonged period of time using an experimental apparatus. Experimental results indicate that after an initial drop in performance, the transducer energy harvesting performance does not substantially deteriorate over time, as less than 10% degradation was observed. Longevity testing is still continuing at CSIRO.

  14. Curves from Motion, Motion from Curves

    DTIC Science & Technology

    2000-01-01

    De linearum curvarum cum lineis rectis comparatione dissertatio geometrica - an appendix to a treatise by de Lalouv~re (this was the only publication... correct solution to the problem of motion in the gravity of a permeable rotating Earth, considered by Torricelli (see §3). If the Earth is a homogeneous...in 1686, which contains the correct solution as part of a remarkably comprehensive theory of orbital motions under centripetal forces. It is a

  15. People can understand descriptions of motion without activating visual motion brain regions

    PubMed Central

    Dravida, Swethasri; Saxe, Rebecca; Bedny, Marina

    2013-01-01

    What is the relationship between our perceptual and linguistic neural representations of the same event? We approached this question by asking whether visual perception of motion and understanding linguistic depictions of motion rely on the same neural architecture. The same group of participants took part in two language tasks and one visual task. In task 1, participants made semantic similarity judgments with high motion (e.g., “to bounce”) and low motion (e.g., “to look”) words. In task 2, participants made plausibility judgments for passages describing movement (“A centaur hurled a spear … ”) or cognitive events (“A gentleman loved cheese …”). Task 3 was a visual motion localizer in which participants viewed animations of point-light walkers, randomly moving dots, and stationary dots changing in luminance. Based on the visual motion localizer we identified classic visual motion areas of the temporal (MT/MST and STS) and parietal cortex (inferior and superior parietal lobules). We find that these visual cortical areas are largely distinct from neural responses to linguistic depictions of motion. Motion words did not activate any part of the visual motion system. Motion passages produced a small response in the right superior parietal lobule, but none of the temporal motion regions. These results suggest that (1) as compared to words, rich language stimuli such as passages are more likely to evoke mental imagery and more likely to affect perceptual circuits and (2) effects of language on the visual system are more likely in secondary perceptual areas as compared to early sensory areas. We conclude that language and visual perception constitute distinct but interacting systems. PMID:24009592

  16. Reduction of beam corkscrew motion on the ETAII linear induction accelerator

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Turner, W.C.; Allen, S.L.; Brand, H.R.

    1990-09-04

    The ETAII linear induction accelerator (6MeV, 3kA, 70ns) is designed to drive a microwave free electron laser (FEL) and demonstrate the front end accelerator technology for a shorter wavelength FEL. Performance to date has been limited by beam corkscrew motion that is driven by energy sweep and misalignment of the solenoidal focusing magnets. Modifications to the pulse power distribution system and magnetic alignment are expected to reduce the radius of corkscrew motion from its present value of 1 cm to less than 1 mm. The modifications have so far been carried out on the first 2.7 MeV (injector plus 20more » accelerator cells) and experiments are beginning. In this paper we will present calculations of central flux line alignment, beam corkscrew motion and beam brightness that are anticipated with the modified ETAII. 10 refs., 4 figs., 1 tab.« less

  17. Electron Heating and the Farley-Buneman Instability in the Solar Chromosphere

    NASA Astrophysics Data System (ADS)

    Buchert, Stephan

    Convective motion in the solar chromosphere has generally more than enough energy to po-tentially explain observed heating, but the possible dissipation mechanisms disserve more con-sideration. When, driven by electric fields, neutrals and ions move at different fluid velocities, like it happens in the Earth's thermosphere, then ion-neutral collisions cause friction and Joule heating. Because of a relatively short neutral-ion collision time in the chromosphere, neutral motion is expected to follow the ions within less than a tenth of a second, canceling any elec-tric fields in the reference frame of the neutral gas. Thus only overshooting slip motion from Alfven waves with correspondigly high frequencies can cause frictional heating. In the Earth's lower thermosphere another mechanism, the Farley-Buneman instability, causes quite intense electron heating when the ExB velocity exceeds the ion-acoustic speed. Similar conditions can occur in the chromosphere as well, but again only due to overshooting motion. We have mod-eled electron heating from the Farley-Buneman instability in the chromosphere, assuming that the instability heats similar as in the Earth's ionosphere, but electrons are cooled by collisions with H atoms instead of atmospheric molecules. Then electron temperatures can become very high and the enhancements are eventually limited by radiative losses. Observed ubiquitous and persistent UV emission of the solar chromosphere could so be explained by the Farley-Buneman instability, if the emissions in reality are intermittent with time scales less than a second.

  18. Human comfort response to random motions with a dominant pitching motion

    NASA Technical Reports Server (NTRS)

    Stone, R. W., Jr.

    1980-01-01

    The effects of random pitching velocities on passenger ride comfort response were examined on the NASA Langley Visual Motion Simulator. The effects of power spectral density shape and frequency ranges from 0 to 2 Hz were studied. The subjective rating data and the physical motion data obtained are presented. No attempt at interpretation or detailed analysis of the data is made. Motions in all degrees of freedom existed as well as the intended pitching motion, because of the characteristics of the simulator. These unwanted motions may have introduced some interactive effects on passenger responses which should be considered in any analysis of the data.

  19. 30 CFR 250.221 - What environmental monitoring information must accompany the EP?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 2 2011-07-01 2011-07-01 false What environmental monitoring information must... monitoring information must accompany the EP? The following environmental monitoring information, as applicable, must accompany your EP: (a) Monitoring systems. A description of any existing and planned...

  20. Concept and design philosophy of a person-accompanying robot

    NASA Astrophysics Data System (ADS)

    Mizoguchi, Hiroshi; Shigehara, Takaomi; Goto, Yoshiyasu; Hidai, Ken-ichi; Mishima, Taketoshi

    1999-01-01

    This paper proposes a person accompanying robot as a novel human collaborative robot. The person accompanying robot is such legged mobile robot that is possible to follow the person utilizing its vision. towards future aging society, human collaboration and human support are required as novel applications of robots. Such human collaborative robots share the same space with humans. But conventional robots are isolated from humans and lack the capability to observe humans. Study on human observing function of robot is crucial to realize novel robot such as service and pet robot. To collaborate and support humans properly human collaborative robot must have capability to observe and recognize humans. Study on human observing function of robot is crucial to realize novel robot such as service and pet robot. The authors are currently implementing a prototype of the proposed accompanying robot.As a base for the human observing function of the prototype robot, we have realized face tracking utilizing skin color extraction and correlation based tracking. We also develop a method for the robot to pick up human voice clearly and remotely by utilizing microphone arrays. Results of these preliminary study suggest feasibility of the proposed robot.

  1. Real-time implementation of an interactive jazz accompaniment system

    NASA Astrophysics Data System (ADS)

    Deshpande, Nikhil

    Modern computational algorithms and digital signal processing (DSP) are able to combine with human performers without forced or predetermined structure in order to create dynamic and real-time accompaniment systems. With modern computing power and intelligent algorithm layout and design, it is possible to achieve more detailed auditory analysis of live music. Using this information, computer code can follow and predict how a human's musical performance evolves, and use this to react in a musical manner. This project builds a real-time accompaniment system to perform together with live musicians, with a focus on live jazz performance and improvisation. The system utilizes a new polyphonic pitch detector and embeds it in an Ableton Live system - combined with Max for Live - to perform elements of audio analysis, generation, and triggering. The system also relies on tension curves and information rate calculations from the Creative Artificially Intuitive and Reasoning Agent (CAIRA) system to help understand and predict human improvisation. These metrics are vital to the core system and allow for extrapolated audio analysis. The system is able to react dynamically to a human performer, and can successfully accompany the human as an entire rhythm section.

  2. Attention and apparent motion.

    PubMed

    Horowitz, T; Treisman, A

    1994-01-01

    Two dissociations between short- and long-range motion in visual search are reported. Previous research has shown parallel processing for short-range motion and apparently serial processing for long-range motion. This finding has been replicated and it has also been found that search for short-range targets can be impaired both by using bicontrast stimuli, and by prior adaptation to the target direction of motion. Neither factor impaired search in long-range motion displays. Adaptation actually facilitated search with long-range displays, which is attributed to response-level effects. A feature-integration account of apparent motion is proposed. In this theory, short-range motion depends on specialized motion feature detectors operating in parallel across the display, but subject to selective adaptation, whereas attention is needed to link successive elements when they appear at greater separations, or across opposite contrasts.

  3. Example-based human motion denoising.

    PubMed

    Lou, Hui; Chai, Jinxiang

    2010-01-01

    With the proliferation of motion capture data, interest in removing noise and outliers from motion capture data has increased. In this paper, we introduce an efficient human motion denoising technique for the simultaneous removal of noise and outliers from input human motion data. The key idea of our approach is to learn a series of filter bases from precaptured motion data and use them along with robust statistics techniques to filter noisy motion data. Mathematically, we formulate the motion denoising process in a nonlinear optimization framework. The objective function measures the distance between the noisy input and the filtered motion in addition to how well the filtered motion preserves spatial-temporal patterns embedded in captured human motion data. Optimizing the objective function produces an optimal filtered motion that keeps spatial-temporal patterns in captured motion data. We also extend the algorithm to fill in the missing values in input motion data. We demonstrate the effectiveness of our system by experimenting with both real and simulated motion data. We also show the superior performance of our algorithm by comparing it with three baseline algorithms and to those in state-of-art motion capture data processing software such as Vicon Blade.

  4. A multi-channel opto-electronic sensor to accurately monitor heart rate against motion artefact during exercise.

    PubMed

    Alzahrani, Abdullah; Hu, Sijung; Azorin-Peris, Vicente; Barrett, Laura; Esliger, Dale; Hayes, Matthew; Akbare, Shafique; Achart, Jérôme; Kuoch, Sylvain

    2015-10-12

    This study presents the use of a multi-channel opto-electronic sensor (OEPS) to effectively monitor critical physiological parameters whilst preventing motion artefact as increasingly demanded by personal healthcare. The aim of this work was to study how to capture the heart rate (HR) efficiently through a well-constructed OEPS and a 3-axis accelerometer with wireless communication. A protocol was designed to incorporate sitting, standing, walking, running and cycling. The datasets collected from these activities were processed to elaborate sport physiological effects. t-test, Bland-Altman Agreement (BAA), and correlation to evaluate the performance of the OEPS were used against Polar and Mio-Alpha HR monitors. No differences in the HR were found between OEPS, and either Polar or Mio-Alpha (both p > 0.05); a strong correlation was found between Polar and OEPS (r: 0.96, p < 0.001); the bias of BAA 0.85 bpm, the standard deviation (SD) 9.20 bpm, and the limits of agreement (LOA) from -17.18 bpm to +18.88 bpm. For the Mio-Alpha and OEPS, a strong correlation was found (r: 0.96, p < 0.001); the bias of BAA 1.63 bpm, SD 8.62 bpm, LOA from -15.27 bpm to +18.58 bpm. These results demonstrate the OEPS to be capable of carrying out real time and remote monitoring of heart rate.

  5. Multiple-stage ambiguity in motion perception reveals global computation of local motion directions.

    PubMed

    Rider, Andrew T; Nishida, Shin'ya; Johnston, Alan

    2016-12-01

    The motion of a 1D image feature, such as a line, seen through a small aperture, or the small receptive field of a neural motion sensor, is underconstrained, and it is not possible to derive the true motion direction from a single local measurement. This is referred to as the aperture problem. How the visual system solves the aperture problem is a fundamental question in visual motion research. In the estimation of motion vectors through integration of ambiguous local motion measurements at different positions, conventional theories assume that the object motion is a rigid translation, with motion signals sharing a common motion vector within the spatial region over which the aperture problem is solved. However, this strategy fails for global rotation. Here we show that the human visual system can estimate global rotation directly through spatial pooling of locally ambiguous measurements, without an intervening step that computes local motion vectors. We designed a novel ambiguous global flow stimulus, which is globally as well as locally ambiguous. The global ambiguity implies that the stimulus is simultaneously consistent with both a global rigid translation and an infinite number of global rigid rotations. By the standard view, the motion should always be seen as a global translation, but it appears to shift from translation to rotation as observers shift fixation. This finding indicates that the visual system can estimate local vectors using a global rotation constraint, and suggests that local motion ambiguity may not be resolved until consistencies with multiple global motion patterns are assessed.

  6. Attomicroscopy: from femtosecond to attosecond electron microscopy

    NASA Astrophysics Data System (ADS)

    Hassan, Mohammed Th

    2018-02-01

    In the last decade, the development of ultrafast electron diffraction (UED) and microscopy (UEM) have enabled the imaging of atomic motion in real time and space. These pivotal table-top tools opened the door for a vast range of applications in different areas of science spanning chemistry, physics, materials science, and biology. We first discuss the basic principles and recent advancements, including some of the important applications, of both UED and UEM. Then, we discuss the recent advances in the field that have enhanced the spatial and temporal resolutions, where the latter, is however, still limited to a few hundreds of femtoseconds, preventing the imaging of ultrafast dynamics of matter lasting few tens of femtoseconds. Then, we present our new optical gating approach for generating an isolated 30 fs electron pulse with sufficient intensity to attain a temporal resolution on the same time scale. This achievement allows, for the first time, imaging the electron dynamics of matter. Finally, we demonstrate the feasibility of the optical gating approach to generate an isolated attosecond electron pulse, utilizing our recently demonstrated optical attosecond laser pulse, which paves the way for establishing the field of ‘Attomicroscopy’, ultimately enabling us to image the electron motion in action.

  7. Brownian motion of massive skyrmions in magnetic thin films

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Troncoso, Roberto E., E-mail: r.troncoso.c@gmail.com; Núñez, Álvaro S., E-mail: alnunez@dfi.uchile.cl

    2014-12-15

    We report on the thermal effects on the motion of current-driven massive magnetic skyrmions. The reduced equation for the motion of skyrmion has the form of a stochastic generalized Thiele’s equation. We propose an ansatz for the magnetization texture of a non-rigid single skyrmion that depends linearly with the velocity. By using this ansatz it is found that the skyrmion mass tensor is closely related to intrinsic skyrmion parameters, such as Gilbert damping, skyrmion-charge and dissipative force. We have found an exact expression for the average drift velocity as well as the mean-square velocity of the skyrmion. The longitudinal andmore » transverse mobility of skyrmions for small spin-velocity of electrons is also determined and found to be independent of the skyrmion mass.« less

  8. 30 CFR 550.221 - What environmental monitoring information must accompany the EP?

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 30 Mineral Resources 2 2013-07-01 2013-07-01 false What environmental monitoring information must... Information Contents of Exploration Plans (ep) § 550.221 What environmental monitoring information must accompany the EP? The following environmental monitoring information, as applicable, must accompany your EP...

  9. 30 CFR 250.221 - What environmental monitoring information must accompany the EP?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What environmental monitoring information must... Contents of Exploration Plans (ep) § 250.221 What environmental monitoring information must accompany the EP? The following environmental monitoring information, as applicable, must accompany your EP: (a...

  10. 30 CFR 550.221 - What environmental monitoring information must accompany the EP?

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 30 Mineral Resources 2 2014-07-01 2014-07-01 false What environmental monitoring information must... Information Contents of Exploration Plans (ep) § 550.221 What environmental monitoring information must accompany the EP? The following environmental monitoring information, as applicable, must accompany your EP...

  11. 30 CFR 550.221 - What environmental monitoring information must accompany the EP?

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 30 Mineral Resources 2 2012-07-01 2012-07-01 false What environmental monitoring information must... Information Contents of Exploration Plans (ep) § 550.221 What environmental monitoring information must accompany the EP? The following environmental monitoring information, as applicable, must accompany your EP...

  12. MotionFlow: Visual Abstraction and Aggregation of Sequential Patterns in Human Motion Tracking Data.

    PubMed

    Jang, Sujin; Elmqvist, Niklas; Ramani, Karthik

    2016-01-01

    Pattern analysis of human motions, which is useful in many research areas, requires understanding and comparison of different styles of motion patterns. However, working with human motion tracking data to support such analysis poses great challenges. In this paper, we propose MotionFlow, a visual analytics system that provides an effective overview of various motion patterns based on an interactive flow visualization. This visualization formulates a motion sequence as transitions between static poses, and aggregates these sequences into a tree diagram to construct a set of motion patterns. The system also allows the users to directly reflect the context of data and their perception of pose similarities in generating representative pose states. We provide local and global controls over the partition-based clustering process. To support the users in organizing unstructured motion data into pattern groups, we designed a set of interactions that enables searching for similar motion sequences from the data, detailed exploration of data subsets, and creating and modifying the group of motion patterns. To evaluate the usability of MotionFlow, we conducted a user study with six researchers with expertise in gesture-based interaction design. They used MotionFlow to explore and organize unstructured motion tracking data. Results show that the researchers were able to easily learn how to use MotionFlow, and the system effectively supported their pattern analysis activities, including leveraging their perception and domain knowledge.

  13. A telemedicine instrument for Internet-based home monitoring of thoracoabdominal motion in patients with respiratory diseases

    NASA Astrophysics Data System (ADS)

    da Silva Junior, Evert Pereira; Esteves, Guilherme Pompeu; Dames, Karla Kristine; Melo, Pedro Lopes de

    2011-01-01

    Changes in thoracoabdominal motion are highly prevalent in patients with chronic respiratory diseases. Home care services that use telemedicine techniques and Internet-based monitoring have the potential to improve the management of these patients. However, there is no detailed description in the literature of a system for Internet-based monitoring of patients with disturbed thoracoabdominal motion. The purpose of this work was to describe the development of a new telemedicine instrument for Internet-based home monitoring of thoracoabdominal movement. The instrument directly measures changes in the thorax and abdomen circumferences and transfers data through a transmission control protocol/Internet protocol connection. After the design details are described, the accuracy of the electronic and software processing units of the instrument is evaluated by using electronic signals simulating normal subjects and individuals with thoracoabdominal motion disorders. The results obtained during in vivo studies on normal subjects simulating thoracoabdominal motion disorders showed that this new system is able to detect a reduction in abdominal movement that is associated with abnormal thoracic breathing (p < 0.0001) and the reduction in thoracic movement during abnormal abdominal breathing (p < 0.005). Simulated asynchrony in thoracoabdominal motion was also adequately detected by the system (p < 0.0001). The experimental results obtained for patients with respiratory diseases were in close agreement with the expected values, providing evidence that this instrument can be a useful tool for the evaluation of thoracoabdominal motion. The Internet transmission tests showed that the acquisition and analysis of the thoracoabdominal motion signals can be performed remotely. The user can also receive medical recommendations. The proposed system can be used in a spectrum of telemedicine scenarios, which can reduce the costs of assistance offered to patients with respiratory diseases.

  14. Measurements of three-dimensional shape and sound-induced motion of the chinchilla tympanic membrane

    PubMed Central

    Rosowski, John J; Dobrev, Ivo; Khaleghi, Morteza; Lu, Weina; Cheng, Jeffrey Tao; Harrington, Ellery; Furlong, Cosme

    2013-01-01

    Opto-electronic computer holographic measurements were made of the tympanic membrane (TM) in cadaveric chinchillas. Measurements with two laser wavelengths were used to compute the 3D-shape of the TM. Single laser wavelength measurements locked to eight distinct phases of a tonal stimulus were used to determine the magnitude and the relative phase of the surface displacements. These measurements were made at over 250,000 points on the TM surface. The measured motions contained spatial phase variations consistent with relatively low-order (large spatial frequency) modal motions and smaller magnitude higher-order (smaller spatial frequency) motions that appear to travel, but may also be explained by losses within the membrane. The measurement of shape and thin shell theory allowed us to separate the measured motions into those components orthogonal to the plane of the tympanic ring, and those components within the plane of the tympanic ring based on the 3D-shape. The predicted in-plane motion components are generally smaller than the out-of-plane perpendicular component of motion. Since the derivation of in-plane and out-of plane depended primarily on the membrane shape, the relative sizes of the predicted motion components did not vary with frequency. PMID:23247058

  15. The HAMP Signal Relay Domain Adopts Multiple Conformational States through Collective Piston and Tilt Motions

    PubMed Central

    Zhu, Lizhe; Bolhuis, Peter G.; Vreede, Jocelyne

    2013-01-01

    The HAMP domain is a linker region in prokaryotic sensor proteins and relays input signals to the transmitter domain and vice versa. Functional as a dimer, the structure of HAMP shows a parallel coiled-coil motif comprising four helices. To date, it is unclear how HAMP can relay signals from one domain to another, although several models exist. In this work, we use molecular simulation to test the hypothesis that HAMP adopts different conformations, one of which represents an active, signal-relaying configuration, and another an inactive, resting state. We first performed molecular dynamics simulation on the prototype HAMP domain Af1503 from Archaeoglobus fulgidus. We explored its conformational space by taking the structure of the A291F mutant disabling HAMP activity as a starting point. These simulations revealed additional conformational states that differ in the tilt angles between the helices as well as the relative piston shifts of the helices relative to each other. By enhancing the sampling in a metadynamics set up, we investigated three mechanistic models for HAMP signal transduction. Our results indicate that HAMP can access additional conformational states characterized by piston motion. Furthermore, the piston motion of the N-terminal helix of one monomer is directly correlated with the opposite piston motion of the C-terminal helix of the other monomer. The change in piston motion is accompanied by a change in tilt angle between the monomers, thus revealing that HAMP exhibits a collective motion, i.e. a combination of changes in tilt angles and a piston-like displacement. Our results provide insights into the conformational changes that underlie the signaling mechanism involving HAMP. PMID:23468603

  16. Learning Motion Features for Example-Based Finger Motion Estimation for Virtual Characters

    NASA Astrophysics Data System (ADS)

    Mousas, Christos; Anagnostopoulos, Christos-Nikolaos

    2017-09-01

    This paper presents a methodology for estimating the motion of a character's fingers based on the use of motion features provided by a virtual character's hand. In the presented methodology, firstly, the motion data is segmented into discrete phases. Then, a number of motion features are computed for each motion segment of a character's hand. The motion features are pre-processed using restricted Boltzmann machines, and by using the different variations of semantically similar finger gestures in a support vector machine learning mechanism, the optimal weights for each feature assigned to a metric are computed. The advantages of the presented methodology in comparison to previous solutions are the following: First, we automate the computation of optimal weights that are assigned to each motion feature counted in our metric. Second, the presented methodology achieves an increase (about 17%) in correctly estimated finger gestures in comparison to a previous method.

  17. Real-time intra-fraction-motion tracking using the treatment couch: a feasibility study

    NASA Astrophysics Data System (ADS)

    D'Souza, Warren D.; Naqvi, Shahid A.; Yu, Cedric X.

    2005-09-01

    Significant differences between planned and delivered treatments may occur due to respiration-induced tumour motion, leading to underdosing of parts of the tumour and overdosing of parts of the surrounding critical structures. Existing methods proposed to counter tumour motion include breath-holds, gating and MLC-based tracking. Breath-holds and gating techniques increase treatment time considerably, whereas MLC-based tracking is limited to two dimensions. We present an alternative solution in which a robotic couch moves in real time in response to organ motion. To demonstrate proof-of-principle, we constructed a miniature adaptive couch model consisting of two movable platforms that simulate tumour motion and couch motion, respectively. These platforms were connected via an electronic feedback loop so that the bottom platform responded to the motion of the top platform. We tested our model with a seven-field step-and-shoot delivery case in which we performed three film-based experiments: (1) static geometry, (2) phantom-only motion and (3) phantom motion with simulated couch motion. Our measurements demonstrate that the miniature couch was able to compensate for phantom motion to the extent that the dose distributions were practically indistinguishable from those in static geometry. Motivated by this initial success, we investigated a real-time couch compensation system consisting of a stereoscopic infra-red camera system interfaced to a robotic couch known as the Hexapod™, which responds in real time to any change in position detected by the cameras. Optical reflectors placed on a solid water phantom were used as surrogates for motion. We tested the effectiveness of couch-based motion compensation for fixed fields and a dynamic arc delivery cases. Due to hardware limitations, we performed film-based experiments (1), (2) and (3), with the robotic couch at a phantom motion period and dose rate of 16 s and 100 MU min-1, respectively. Analysis of film measurements

  18. Dissociation of Self-Motion and Object Motion by Linear Population Decoding That Approximates Marginalization.

    PubMed

    Sasaki, Ryo; Angelaki, Dora E; DeAngelis, Gregory C

    2017-11-15

    We use visual image motion to judge the movement of objects, as well as our own movements through the environment. Generally, image motion components caused by object motion and self-motion are confounded in the retinal image. Thus, to estimate heading, the brain would ideally marginalize out the effects of object motion (or vice versa), but little is known about how this is accomplished neurally. Behavioral studies suggest that vestibular signals play a role in dissociating object motion and self-motion, and recent computational work suggests that a linear decoder can approximate marginalization by taking advantage of diverse multisensory representations. By measuring responses of MSTd neurons in two male rhesus monkeys and by applying a recently-developed method to approximate marginalization by linear population decoding, we tested the hypothesis that vestibular signals help to dissociate self-motion and object motion. We show that vestibular signals stabilize tuning for heading in neurons with congruent visual and vestibular heading preferences, whereas they stabilize tuning for object motion in neurons with discrepant preferences. Thus, vestibular signals enhance the separability of joint tuning for object motion and self-motion. We further show that a linear decoder, designed to approximate marginalization, allows the population to represent either self-motion or object motion with good accuracy. Decoder weights are broadly consistent with a readout strategy, suggested by recent computational work, in which responses are decoded according to the vestibular preferences of multisensory neurons. These results demonstrate, at both single neuron and population levels, that vestibular signals help to dissociate self-motion and object motion. SIGNIFICANCE STATEMENT The brain often needs to estimate one property of a changing environment while ignoring others. This can be difficult because multiple properties of the environment may be confounded in sensory signals

  19. Dissociation of Self-Motion and Object Motion by Linear Population Decoding That Approximates Marginalization

    PubMed Central

    Sasaki, Ryo; Angelaki, Dora E.

    2017-01-01

    We use visual image motion to judge the movement of objects, as well as our own movements through the environment. Generally, image motion components caused by object motion and self-motion are confounded in the retinal image. Thus, to estimate heading, the brain would ideally marginalize out the effects of object motion (or vice versa), but little is known about how this is accomplished neurally. Behavioral studies suggest that vestibular signals play a role in dissociating object motion and self-motion, and recent computational work suggests that a linear decoder can approximate marginalization by taking advantage of diverse multisensory representations. By measuring responses of MSTd neurons in two male rhesus monkeys and by applying a recently-developed method to approximate marginalization by linear population decoding, we tested the hypothesis that vestibular signals help to dissociate self-motion and object motion. We show that vestibular signals stabilize tuning for heading in neurons with congruent visual and vestibular heading preferences, whereas they stabilize tuning for object motion in neurons with discrepant preferences. Thus, vestibular signals enhance the separability of joint tuning for object motion and self-motion. We further show that a linear decoder, designed to approximate marginalization, allows the population to represent either self-motion or object motion with good accuracy. Decoder weights are broadly consistent with a readout strategy, suggested by recent computational work, in which responses are decoded according to the vestibular preferences of multisensory neurons. These results demonstrate, at both single neuron and population levels, that vestibular signals help to dissociate self-motion and object motion. SIGNIFICANCE STATEMENT The brain often needs to estimate one property of a changing environment while ignoring others. This can be difficult because multiple properties of the environment may be confounded in sensory signals

  20. Imaging Electron Motion in a Few Layer MoS2 Device

    NASA Astrophysics Data System (ADS)

    Bhandari, S.; Wang, K.; Watanabe, K.; Taniguchi, T.; Kim, P.; Westervelt, R. M.

    2017-06-01

    Ultrathin sheets of MoS2 are a newly discovered 2D semiconductor that holds great promise for nanoelectronics. Understanding the pattern of current flow will be crucial for developing devices. In this talk, we present images of current flow in MoS2 obtained with a Scanned Probe Microscope (SPM) cooled to 4 K. We previously used this technique to image electron trajectories in GaAs/AlGaAs heterostructures and graphene. The charged SPM tip is held just above the sample surface, creating an image charge inside the device that scatters electrons. By measuring the change in resistance ΔR while the tip is raster scanned above the sample, an image of electron flow is obtained. We present images of electron flow in an MoS2 device patterned into a hall bar geometry. A three-layer MoS2 sheet is encased by two hBN layers, top and bottom, and patterned into a hall-bar with multilayer graphene contacts. An SPM image shows the current flow pattern from the wide contact at the end of the device for a Hall density n = 1.3×1012 cm-2. The SPM tip tends to block flow, increasing the resistance R. The pattern of flow was also imaged for a narrow side contact on the sample. At density n = 5.4×1011 cm-2; the pattern seen in the SPM image is similar to the wide contact. The ability to image electron flow promises to be very useful for the development of ultrathin devices from new 2D materials.

  1. Accuracy and Tuning of Flow Parsing for Visual Perception of Object Motion During Self-Motion

    PubMed Central

    Niehorster, Diederick C.

    2017-01-01

    How do we perceive object motion during self-motion using visual information alone? Previous studies have reported that the visual system can use optic flow to identify and globally subtract the retinal motion component resulting from self-motion to recover scene-relative object motion, a process called flow parsing. In this article, we developed a retinal motion nulling method to directly measure and quantify the magnitude of flow parsing (i.e., flow parsing gain) in various scenarios to examine the accuracy and tuning of flow parsing for the visual perception of object motion during self-motion. We found that flow parsing gains were below unity for all displays in all experiments; and that increasing self-motion and object motion speed did not alter flow parsing gain. We conclude that visual information alone is not sufficient for the accurate perception of scene-relative motion during self-motion. Although flow parsing performs global subtraction, its accuracy also depends on local motion information in the retinal vicinity of the moving object. Furthermore, the flow parsing gain was constant across common self-motion or object motion speeds. These results can be used to inform and validate computational models of flow parsing. PMID:28567272

  2. Peroneal tendon displacement accompanying intra-articular calcaneal fractures.

    PubMed

    Toussaint, Rull James; Lin, Darius; Ehrlichman, Lauren K; Ellington, J Kent; Strasser, Nicholas; Kwon, John Y

    2014-02-19

    Peroneal tendon displacement (subluxation or dislocation) accompanying an intra-articular calcaneal fracture is often undetected and under-treated. The goals of this study were to determine (1) the prevalence of peroneal tendon displacement accompanying intra-articular calcaneal fractures, (2) the association of tendon displacement with fracture classifications, (3) the association of tendon displacement with heel width, and (4) the rate of missed diagnosis of the tendon displacement on radiographs and computed tomography (CT) scans and the resulting treatment rate. A retrospective radiographic review of all calcaneal fractures presenting at three institutions from June 30, 2006, to June 30, 2011, was performed. CT imaging of 421 intra-articular calcaneal fractures involving the posterior facet was available for review. The prevalence of peroneal tendon displacement was noted and its associations with fracture classification and heel width were evaluated. Peroneal tendon displacement was identified in 118 (28.0%) of the 421 calcaneal fracture cases. The presence of tendon displacement was significantly associated with joint-depression fractures compared with tongue-type fractures (p < 0.001). Only twelve (10.2%) of the 118 cases of peroneal tendon displacement had been identified in the radiology reports. Although sixty-five (55.1%) of the fractures with tendon displacement had been treated with internal fixation, the tendon displacement was treated surgically in only seven (10.8%) of these cases. Analysis of CT images showed a 28% prevalence of peroneal tendon displacement accompanying intra-articular calcaneal fractures. Surgeons and radiologists are encouraged to consider this association.

  3. Exploration of momentum evolution and three-dimensional localization in recombined electron wave packets

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zeibel, J. G.; Jones, R. R.

    2003-08-01

    Picosecond ''half-cycle'' pulses (HCPs) have been used to produce electronic wave packets by recombining photoelectrons with their parent ions. The time-dependent momentum distributions of the bound wave packets are probed using a second HCP and the impulsive momentum retrieval (IMR) method. For a given delay between the initial photoionization event and the HCP recombination, classical trajectory simulations predict pronounced periodic wave packet motion for a restricted range of recombining HCP amplitudes. This motion is characterized by the repeated formation and collapse of a highly localized spike in the three-dimensional electron probability density at a large distance from the nucleus. Ourmore » experiments confirm that oscillatory wave packet motion occurs only for certain recombination ''kick'' strengths. Moreover, the measured time-dependent momentum distributions are consistent with the predicted formation of a highly localized electron packet. We demonstrate a variation of the IMR in which amplitude modulation of the HCP probe field is employed to suppress noise and allow for a more direct recovery of electron momentum from experimental ionization data.« less

  4. Standardization proposal of soft tissue artefact description for data sharing in human motion measurements.

    PubMed

    Cereatti, Andrea; Bonci, Tecla; Akbarshahi, Massoud; Aminian, Kamiar; Barré, Arnaud; Begon, Mickael; Benoit, Daniel L; Charbonnier, Caecilia; Dal Maso, Fabien; Fantozzi, Silvia; Lin, Cheng-Chung; Lu, Tung-Wu; Pandy, Marcus G; Stagni, Rita; van den Bogert, Antonie J; Camomilla, Valentina

    2017-09-06

    Soft tissue artefact (STA) represents one of the main obstacles for obtaining accurate and reliable skeletal kinematics from motion capture. Many studies have addressed this issue, yet there is no consensus on the best available bone pose estimator and the expected errors associated with relevant results. Furthermore, results obtained by different authors are difficult to compare due to the high variability and specificity of the phenomenon and the different metrics used to represent these data. Therefore, the aim of this study was twofold: firstly, to propose standards for description of STA; and secondly, to provide illustrative STA data samples for body segments in the upper and lower extremities and for a range of motor tasks specifically, level walking, stair ascent, sit-to-stand, hip- and knee-joint functional movements, cutting motion, running, hopping, arm elevation and functional upper-limb movements. The STA dataset includes motion of the skin markers measured in vivo and ex vivo using stereophotogrammetry as well as motion of the underlying bones measured using invasive or bio-imaging techniques (i.e., X-ray fluoroscopy or MRI). The data are accompanied by a detailed description of the methods used for their acquisition, with information given about their quality as well as characterization of the STA using the proposed standards. The availability of open-access and standard-format STA data will be useful for the evaluation and development of bone pose estimators thus contributing to the advancement of three-dimensional human movement analysis and its translation into the clinical practice and other applications. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Correlation-based motion vector processing with adaptive interpolation scheme for motion-compensated frame interpolation.

    PubMed

    Huang, Ai-Mei; Nguyen, Truong

    2009-04-01

    In this paper, we address the problems of unreliable motion vectors that cause visual artifacts but cannot be detected by high residual energy or bidirectional prediction difference in motion-compensated frame interpolation. A correlation-based motion vector processing method is proposed to detect and correct those unreliable motion vectors by explicitly considering motion vector correlation in the motion vector reliability classification, motion vector correction, and frame interpolation stages. Since our method gradually corrects unreliable motion vectors based on their reliability, we can effectively discover the areas where no motion is reliable to be used, such as occlusions and deformed structures. We also propose an adaptive frame interpolation scheme for the occlusion areas based on the analysis of their surrounding motion distribution. As a result, the interpolated frames using the proposed scheme have clearer structure edges and ghost artifacts are also greatly reduced. Experimental results show that our interpolated results have better visual quality than other methods. In addition, the proposed scheme is robust even for those video sequences that contain multiple and fast motions.

  6. Vibrational motions associated with primary processes in bacteriorhodopsin studied by coherent infrared emission spectroscopy.

    PubMed

    Groma, Géza I; Colonna, Anne; Martin, Jean-Louis; Vos, Marten H

    2011-03-16

    The primary energetic processes driving the functional proton pump of bacteriorhodopsin take place in the form of complex molecular dynamic events after excitation of the retinal chromophore into the Franck-Condon state. These early events include a strong electronic polarization, skeletal stretching, and all-trans-to-13-cis isomerization upon formation of the J intermediate. The effectiveness of the photoreaction is ensured by a conical intersection between the electronic excited and ground states, providing highly nonadiabatic coupling to nuclear motions. Here, we study real-time vibrational coherences associated with these motions by analyzing light-induced infrared emission from oriented purple membranes in the 750-1400 cm(-)(1) region. The experimental technique applied is based on second-order femtosecond difference frequency generation on macroscopically ordered samples that also yield information on phase and direction of the underlying motions. Concerted use of several analysis methods resulted in the isolation and characterization of seven different vibrational modes, assigned as C-C stretches, out-of-plane methyl rocks, and hydrogen out-of-plane wags, whereas no in-plane H rock was found. Based on their lifetimes and several other criteria, we deduce that the majority of the observed modes take place on the potential energy surface of the excited electronic state. In particular, the direction sensitivity provides experimental evidence for large intermediate distortions of the retinal plane during the excited-state isomerization process. Copyright © 2011 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  7. A Method of Calculating Motion Error in a Linear Motion Bearing Stage

    PubMed Central

    Khim, Gyungho; Park, Chun Hong; Oh, Jeong Seok

    2015-01-01

    We report a method of calculating the motion error of a linear motion bearing stage. The transfer function method, which exploits reaction forces of individual bearings, is effective for estimating motion errors; however, it requires the rail-form errors. This is not suitable for a linear motion bearing stage because obtaining the rail-form errors is not straightforward. In the method described here, we use the straightness errors of a bearing block to calculate the reaction forces on the bearing block. The reaction forces were compared with those of the transfer function method. Parallelism errors between two rails were considered, and the motion errors of the linear motion bearing stage were measured and compared with the results of the calculations, revealing good agreement. PMID:25705715

  8. Electron microscopy of electromagnetic waveforms.

    PubMed

    Ryabov, A; Baum, P

    2016-07-22

    Rapidly changing electromagnetic fields are the basis of almost any photonic or electronic device operation. We report how electron microscopy can measure collective carrier motion and fields with subcycle and subwavelength resolution. A collimated beam of femtosecond electron pulses passes through a metamaterial resonator that is previously excited with a single-cycle electromagnetic pulse. If the probing electrons are shorter in duration than half a field cycle, then time-frozen Lorentz forces distort the images quasi-classically and with subcycle time resolution. A pump-probe sequence reveals in a movie the sample's oscillating electromagnetic field vectors with time, phase, amplitude, and polarization information. This waveform electron microscopy can be used to visualize electrodynamic phenomena in devices as small and fast as available. Copyright © 2016, American Association for the Advancement of Science.

  9. 30 CFR 250.223 - What mitigation measures information must accompany the EP?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What mitigation measures information must accompany the EP? 250.223 Section 250.223 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE... Contents of Exploration Plans (ep) § 250.223 What mitigation measures information must accompany the EP? (a...

  10. 30 CFR 250.222 - What lease stipulations information must accompany the EP?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What lease stipulations information must accompany the EP? 250.222 Section 250.222 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE... Contents of Exploration Plans (ep) § 250.222 What lease stipulations information must accompany the EP? A...

  11. Restoration of Full Shoulder Range of Motion After Application of the Fascial Distortion Model.

    PubMed

    Boucher, Joshua D; Figueroa, Jose

    2018-05-01

    Decreased active and passive range of motion (ROM) accompanied by pain in the shoulder is a common presentation for patients with frozen shoulder, and it can be difficult to restore normal function. Through the fascial distortion model, physicians can apply a manual technique to rapidly and effectively increase ROM and decrease pain. A 28-year-old man presented 18 months after sustaining a shoulder hyperextension injury. On active and passive ROM examination, he had approximately 90° of shoulder abduction and moderately reduced internal rotation associated with 8/10 pain. After 2 applications of the fascial distortion model, his shoulder restored to full abduction and internal rotation with no pain.

  12. Predictive local receptive fields based respiratory motion tracking for motion-adaptive radiotherapy.

    PubMed

    Yubo Wang; Tatinati, Sivanagaraja; Liyu Huang; Kim Jeong Hong; Shafiq, Ghufran; Veluvolu, Kalyana C; Khong, Andy W H

    2017-07-01

    Extracranial robotic radiotherapy employs external markers and a correlation model to trace the tumor motion caused by the respiration. The real-time tracking of tumor motion however requires a prediction model to compensate the latencies induced by the software (image data acquisition and processing) and hardware (mechanical and kinematic) limitations of the treatment system. A new prediction algorithm based on local receptive fields extreme learning machines (pLRF-ELM) is proposed for respiratory motion prediction. All the existing respiratory motion prediction methods model the non-stationary respiratory motion traces directly to predict the future values. Unlike these existing methods, the pLRF-ELM performs prediction by modeling the higher-level features obtained by mapping the raw respiratory motion into the random feature space of ELM instead of directly modeling the raw respiratory motion. The developed method is evaluated using the dataset acquired from 31 patients for two horizons in-line with the latencies of treatment systems like CyberKnife. Results showed that pLRF-ELM is superior to that of existing prediction methods. Results further highlight that the abstracted higher-level features are suitable to approximate the nonlinear and non-stationary characteristics of respiratory motion for accurate prediction.

  13. Human comfort response to dominant random motions in longitudinal modes of aircraft motion

    NASA Technical Reports Server (NTRS)

    Stone, R. W., Jr.

    1980-01-01

    The effects of random vertical and longitudinal accelerations and pitching velocity passenger ride comfort responses were examined on the NASA Langley Visual Motion Simulator. Effects of power spectral density shape were studied for motions where the peak was between 0 and 2 Hz. The subjective rating data and the physical motion data obtained are presented without interpretation or detailed analysis. There existed motions in all other degrees of freedom as well as the particular pair of longitudinal airplane motions studied. These unwanted motions, caused by the characteristics of the simulator may have introduced some interactive effects on passenger responses.

  14. 12 CFR 19.23 - Motions.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... argument may be held on written motions except as otherwise directed by the administrative law judge... administrative law judge directs that such motion be reduced to writing. (c) Filing of motions. Motions must be... motion. The administrative law judge shall not rule on any oral or written motion before each party has...

  15. 12 CFR 19.23 - Motions.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... argument may be held on written motions except as otherwise directed by the administrative law judge... administrative law judge directs that such motion be reduced to writing. (c) Filing of motions. Motions must be... motion. The administrative law judge shall not rule on any oral or written motion before each party has...

  16. 12 CFR 19.23 - Motions.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... argument may be held on written motions except as otherwise directed by the administrative law judge... administrative law judge directs that such motion be reduced to writing. (c) Filing of motions. Motions must be... motion. The administrative law judge shall not rule on any oral or written motion before each party has...

  17. 12 CFR 19.23 - Motions.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... argument may be held on written motions except as otherwise directed by the administrative law judge... administrative law judge directs that such motion be reduced to writing. (c) Filing of motions. Motions must be... motion. The administrative law judge shall not rule on any oral or written motion before each party has...

  18. 12 CFR 19.23 - Motions.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... argument may be held on written motions except as otherwise directed by the administrative law judge... administrative law judge directs that such motion be reduced to writing. (c) Filing of motions. Motions must be... motion. The administrative law judge shall not rule on any oral or written motion before each party has...

  19. Electronic Commerce, Digital Information, and the Firm.

    ERIC Educational Resources Information Center

    Rosenbaum, Howard

    2000-01-01

    Discussion of the social context of electronic commerce (ecommerce) focuses on information imperatives, or rules that are critical for ecommerce firms. Concludes with a discussion of the organizational changes that can be expected to accompany the incorporation of these imperatives into the mission and core business processes of ecommerce firms.…

  20. Required number of records for ASCE/SEI 7 ground-motion scaling procedure

    USGS Publications Warehouse

    Reyes, Juan C.; Kalkan, Erol

    2011-01-01

    , it is demonstrated that the ASCE/SEI 7 scaling procedure is overly conservative if fewer than seven ground-motions are employed. Utilizing seven or more randomly selected records provides a more accurate estimate of the EDPs accompanied by reduced record-to-record variability of the responses. Consistency in accuracy and efficiency is achieved only if records are selected on the basis of their spectral shape and A(Tn).

  1. Effect of normalized plasma frequency on electron phase-space orbits in a free-electron laser

    NASA Astrophysics Data System (ADS)

    Ji, Yu-Pin; Wang, Shi-Jian; Xu, Jing-Yue; Xu, Yong-Gen; Liu, Xiao-Xu; Lu, Hong; Huang, Xiao-Li; Zhang, Shi-Chang

    2014-02-01

    Irregular phase-space orbits of the electrons are harmful to the electron-beam transport quality and hence deteriorate the performance of a free-electron laser (FEL). In previous literature, it was demonstrated that the irregularity of the electron phase-space orbits could be caused in several ways, such as varying the wiggler amplitude and inducing sidebands. Based on a Hamiltonian model with a set of self-consistent differential equations, it is shown in this paper that the electron-beam normalized plasma frequency functions not only couple the electron motion with the FEL wave, which results in the evolution of the FEL wave field and a possible power saturation at a large beam current, but also cause the irregularity of the electron phase-space orbits when the normalized plasma frequency has a sufficiently large value, even if the initial energy of the electron is equal to the synchronous energy or the FEL wave does not reach power saturation.

  2. 76 FR 44926 - Renewal of Declaration Regarding Emergency Use of Doxycycline Hyclate Tablets Accompanied by...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-07-27

    ... Emergency Use of Doxycycline Hyclate Tablets Accompanied by Emergency Use Information and Amendment To... hyclate tablets accompanied by emergency use information subject to the terms of any authorization issued... authorization of the emergency use of doxycycline hyclate tablets accompanied by emergency use information...

  3. 75 FR 61489 - Renewal of Declaration Regarding Emergency Use of Doxycycline Hyclate Tablets Accompanied by...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-05

    ... Emergency Use of Doxycycline Hyclate Tablets Accompanied by Emergency Use Information AGENCY: Office of the... the authorization of emergency use of doxycycline hyclate tablets accompanied by emergency use... authorization of the emergency use of doxycycline hyclate tablets accompanied by emergency use information...

  4. Human joint motion estimation for electromyography (EMG)-based dynamic motion control.

    PubMed

    Zhang, Qin; Hosoda, Ryo; Venture, Gentiane

    2013-01-01

    This study aims to investigate a joint motion estimation method from Electromyography (EMG) signals during dynamic movement. In most EMG-based humanoid or prosthetics control systems, EMG features were directly or indirectly used to trigger intended motions. However, both physiological and nonphysiological factors can influence EMG characteristics during dynamic movements, resulting in subject-specific, non-stationary and crosstalk problems. Particularly, when motion velocity and/or joint torque are not constrained, joint motion estimation from EMG signals are more challenging. In this paper, we propose a joint motion estimation method based on muscle activation recorded from a pair of agonist and antagonist muscles of the joint. A linear state-space model with multi input single output is proposed to map the muscle activity to joint motion. An adaptive estimation method is proposed to train the model. The estimation performance is evaluated in performing a single elbow flexion-extension movement in two subjects. All the results in two subjects at two load levels indicate the feasibility and suitability of the proposed method in joint motion estimation. The estimation root-mean-square error is within 8.3% ∼ 10.6%, which is lower than that being reported in several previous studies. Moreover, this method is able to overcome subject-specific problem and compensate non-stationary EMG properties.

  5. Dynamic Theory of Relativistic Electrons Stochastic Heating by Whistler Mode Waves with Application to the Earth Magnetosphere

    NASA Technical Reports Server (NTRS)

    Khazanov, G. V.; Tel'nikhin, A. A.; Kronberg, T. K.

    2007-01-01

    In the Hamiltonian approach an electron motion in a coherent packet of the whistler mode waves propagating along the direction of an ambient magnetic field is studied. The physical processes by which these particles are accelerated to high energy are established. Equations governing a particle motion were transformed in to a closed pair of nonlinear difference equations. The solutions of these equations have shown there exists the energetic threshold below that the electron motion is regular, and when the initial energy is above the threshold an electron moves stochastically. Particle energy spectra and pitch angle electron scattering are described by the Fokker-Planck-Kolmogorov equations. Calculating the stochastic diffusion of electrons due to a spectrum of whistler modes is presented. The parametric dependence of the diffusion coefficients on the plasma particle density, magnitude of wave field, and the strength of magnetic field is studies. It is shown that significant pitch angle diffusion occurs for the Earth radiation belt electrons with energies from a few keV up to a few MeV.

  6. Electron heating in quasi-perpendicular shocks - A Monte Carlo simulation

    NASA Technical Reports Server (NTRS)

    Veltri, Pierluigi; Mangeney, Andre; Scudder, Jack D.

    1990-01-01

    To study the problem of electron heating in quasi-perpendicular shocks, under the combined effects of 'reversible' motion, in the shock electric potential and magnetic field, and wave-particle interactions a diffusion equation was derived, in the drift (adiabatic) approximation and it was solved by using a Monte Carlo method. The results show that most of the observations can be explained within this framework. The simulation has also definitively shown that the electron parallel temperature is determined by the dc electromagnetic field and not by any wave particle induced heating. Wave-particle interactions are effective in smoothing out the large gradients in phase space produced by the 'reversible' motion of the electrons, thus producing a 'cooling' of the electrons. Some constraints on the wave-particle interaction process may be obtained from a detailed comparison between the simulation and observations. In particular, it appears that the adiabatic approximation must be violated in order to explain the observed evolution of the perpendicular temperature.

  7. Novel Out-Coupling Techniques for Terahertz Free Electron Lasers

    DTIC Science & Technology

    2012-06-01

    4  1.   FEL “ Pendulum ” Equation and Electron Dynamics .......................4  2.   FEL...4 B. FEL THEORY 1. FEL “ Pendulum ” Equation and Electron Dynamics The dynamics of electron motion as it passes through the undulator are governed...I.5, then the FEL “ pendulum equation” is derived , (I.7) where is the dimensionless laser field amplitude[1]. From this, it is shown that changes

  8. A Rare Entity: Bilateral First Rib Fractures Accompanying Bilateral Scapular Fractures.

    PubMed

    Gulbahar, Gultekin; Kaplan, Tevfik; Turker, Hasan Bozkurt; Gundogdu, Ahmet Gokhan; Han, Serdar

    2015-01-01

    First rib fractures are scarce due to their well-protected anatomic locations. Bilateral first rib fractures accompanying bilateral scapular fractures are very rare, although they may be together with scapular and clavicular fractures. According to our knowledge, no case of bilateral first rib fractures accompanying bilateral scapular fractures has been reported, so we herein discussed the diagnosis, treatment, and complications of bone fractures due to thoracic trauma in bias of this rare entity.

  9. A Rare Entity: Bilateral First Rib Fractures Accompanying Bilateral Scapular Fractures

    PubMed Central

    Gulbahar, Gultekin; Kaplan, Tevfik; Turker, Hasan Bozkurt; Gundogdu, Ahmet Gokhan; Han, Serdar

    2015-01-01

    First rib fractures are scarce due to their well-protected anatomic locations. Bilateral first rib fractures accompanying bilateral scapular fractures are very rare, although they may be together with scapular and clavicular fractures. According to our knowledge, no case of bilateral first rib fractures accompanying bilateral scapular fractures has been reported, so we herein discussed the diagnosis, treatment, and complications of bone fractures due to thoracic trauma in bias of this rare entity. PMID:26175916

  10. Objects in Motion

    ERIC Educational Resources Information Center

    Damonte, Kathleen

    2004-01-01

    One thing scientists study is how objects move. A famous scientist named Sir Isaac Newton (1642-1727) spent a lot of time observing objects in motion and came up with three laws that describe how things move. This explanation only deals with the first of his three laws of motion. Newton's First Law of Motion says that moving objects will continue…

  11. Investigation of visually induced motion sickness in dynamic 3D contents based on subjective judgment, heart rate variability, and depth gaze behavior.

    PubMed

    Wibirama, Sunu; Hamamoto, Kazuhiko

    2014-01-01

    Visually induced motion sickness (VIMS) is an important safety issue in stereoscopic 3D technology. Accompanying subjective judgment of VIMS with objective measurement is useful to identify not only biomedical effects of dynamic 3D contents, but also provoking scenes that induce VIMS, duration of VIMS, and user behavior during VIMS. Heart rate variability and depth gaze behavior are appropriate physiological indicators for such objective observation. However, there is no information about relationship between subjective judgment of VIMS, heart rate variability, and depth gaze behavior. In this paper, we present a novel investigation of VIMS based on simulator sickness questionnaire (SSQ), electrocardiography (ECG), and 3D gaze tracking. Statistical analysis on SSQ data shows that nausea and disorientation symptoms increase as amount of dynamic motions increases (nausea: p<;0.005; disorientation: p<;0.05). To reduce VIMS, SSQ and ECG data suggest that user should perform voluntary gaze fixation at one point when experiencing vertical motion (up or down) and horizontal motion (turn left and right) in dynamic 3D contents. Observation of 3D gaze tracking data reveals that users who experienced VIMS tended to have unstable depth gaze than ones who did not experience VIMS.

  12. The Early Development of Electronic pH Meters

    ERIC Educational Resources Information Center

    Hines, Wallis G.; de Levie, Robert

    2010-01-01

    A 19-year-old undergraduate at the University of Chicago, Kenneth Goode, in 1921 came up with the idea of an electronic pH meter, worked out some of its initial problems, and set in motion an international scientific effort that culminated in the current, wide availability of electronic pH meters. Except for the replacement of vacuum tubes by…

  13. Motion of the guest ion as precursor to the first-order phase transition in the cage system GdB6

    NASA Astrophysics Data System (ADS)

    Iwasa, Kazuaki; Igarashi, Ryosuke; Saito, Kotaro; Laulhé, Claire; Orihara, Toshihiko; Kunii, Satoru; Kuwahara, Keitaro; Nakao, Hironori; Murakami, Youichi; Iga, Fumitoshi; Sera, Masafumi; Tsutsui, Satoshi; Uchiyama, Hiroshi; Baron, Alfred Q. R.

    2011-12-01

    The motion of guest Gd ions in oversized boron cages in GdB6 was investigated from phonon spectra measurements obtained by inelastic x-ray scattering. The measured phonon modes soften by about 10% from 300 K down to TN=16 K, in particular, the longitudinal phonon for the propagation vector q1=(1/2,0,0) that characterizes the distorted structure below TN. Besides, the dispersion relation curves show kinklike anomalies at qk=(0.38,0.38,0). The observed results imply that the motion of the guest Gd ion interplays with the f electrons magnetoelastically and with carriers via Fermi surface nesting. The anomalous properties previously reported for this material far above TN originate from the strong electron-phonon coupling, which causes the motion of guest ions as precursors to the first-order phase transition.

  14. Ionization of pyridine: Interplay of orbital relaxation and electron correlation.

    PubMed

    Trofimov, A B; Holland, D M P; Powis, I; Menzies, R C; Potts, A W; Karlsson, L; Gromov, E V; Badsyuk, I L; Schirmer, J

    2017-06-28

    The valence shell ionization spectrum of pyridine was studied using the third-order algebraic-diagrammatic construction approximation scheme for the one-particle Green's function and the outer-valence Green's function method. The results were used to interpret angle resolved photoelectron spectra recorded with synchrotron radiation in the photon energy range of 17-120 eV. The lowest four states of the pyridine radical cation, namely, 2 A 2 (1a 2 -1 ), 2 A 1 (7a 1 -1 ), 2 B 1 (2b 1 -1 ), and 2 B 2 (5b 2 -1 ), were studied in detail using various high-level electronic structure calculation methods. The vertical ionization energies were established using the equation-of-motion coupled-cluster approach with single, double, and triple excitations (EOM-IP-CCSDT) and the complete basis set extrapolation technique. Further interpretation of the electronic structure results was accomplished using Dyson orbitals, electron density difference plots, and a second-order perturbation theory treatment for the relaxation energy. Strong orbital relaxation and electron correlation effects were shown to accompany ionization of the 7a 1 orbital, which formally represents the nonbonding σ-type nitrogen lone-pair (nσ) orbital. The theoretical work establishes the important roles of the π-system (π-π* excitations) in the screening of the nσ-hole and of the relaxation of the molecular orbitals in the formation of the 7a 1 (nσ) -1 state. Equilibrium geometric parameters were computed using the MP2 (second-order Møller-Plesset perturbation theory) and CCSD methods, and the harmonic vibrational frequencies were obtained at the MP2 level of theory for the lowest three cation states. The results were used to estimate the adiabatic 0-0 ionization energies, which were then compared to the available experimental and theoretical data. Photoelectron anisotropy parameters and photoionization partial cross sections, derived from the experimental spectra, were compared to predictions obtained

  15. Electron dynamics in Hall thruster

    NASA Astrophysics Data System (ADS)

    Marini, Samuel; Pakter, Renato

    2015-11-01

    Hall thrusters are plasma engines those use an electromagnetic fields combination to confine electrons, generate and accelerate ions. Widely used by aerospace industries those thrusters stand out for its simple geometry, high specific impulse and low demand for electric power. Propulsion generated by those systems is due to acceleration of ions produced in an acceleration channel. The ions are generated by collision of electrons with propellant gas atoms. In this context, we can realize how important is characterizing the electronic dynamics. Using Hamiltonian formalism, we derive the electron motion equation in a simplified electromagnetic fields configuration observed in hall thrusters. We found conditions those must be satisfied by electromagnetic fields to have electronic confinement in acceleration channel. We present configurations of electromagnetic fields those maximize propellant gas ionization and thus make propulsion more efficient. This work was supported by CNPq.

  16. Motions of Celestial Bodies; Computer simulations

    NASA Astrophysics Data System (ADS)

    Butikov, Eugene

    2014-10-01

    This book is written for a wide range of graduate and undergraduate students studying various courses in physics and astronomy. It is accompanied by the award winning educational software package 'Planets and Satellites' developed by the author. This text, together with the interactive software, is intended to help students learn and understand the fundamental concepts and the laws of physics as they apply to the fascinating world of the motions of natural and artificial celestial bodies. The primary aim of the book is the understanding of the foundations of classical and modern physics, while their application to celestial mechanics is used to illustrate these concepts. The simulation programs create vivid and lasting impressions of the investigated phenomena, and provide students and their instructors with a powerful tool which enables them to explore basic concepts that are difficult to study and teach in an abstract conventional manner. Students can work with the text and software at a pace they can enjoy, varying parameters of the simulated systems. Each section of the textbook is supplied with questions, exercises, and problems. Using some of the suggested simulation programs, students have an opportunity to perform interesting mini-research projects in physics and astronomy.

  17. Motion interference analysis and optimal control of an electronic controlled bamboo-dance mechanism

    NASA Astrophysics Data System (ADS)

    Liu, Xiaohong; Xu, Liang; Hu, Xiaobin

    2017-08-01

    An electric bamboo-dance mechanism was designed and developed to realize mechanism of automation and mechanization. For coherent and fluent motion, ANSYS finite element analysis was applied on movement interference. Static structural method was used for analyzing dynamic deflection and deformation of the slender rod, while modal analysis was applied on frequency analysis to avoid second deformation caused by resonance. Therefore, the deformation in vertical and horizontal direction was explored and reasonable optimization was taken to avoid interference.

  18. Electron energy and electron trajectories in an inverse free-electron laser accelerator based on a novel electrostatic wiggler

    NASA Astrophysics Data System (ADS)

    Nikrah, M.; Jafari, S.

    2016-06-01

    We expand here a theory of a high-gradient laser-excited electron accelerator based on an inverse free-electron laser (inverse-FEL), but with innovations in the structure and design. The electrostatic wiggler used in our scheme, namely termed the Paul wiggler, is generated by segmented cylindrical electrodes with applied oscillatory voltages {{V}\\text{osc}}(t) over {{90}\\circ} segments. The inverse-FEL interaction can be described by the equations that govern the electron motion in the combined fields of both the laser pulse and Paul wiggler field. A numerical study of electron energy and electron trajectories has been made using the fourth-order Runge-Kutta method. The results indicate that the electron attains a considerable energy at short distances in this device. It is found that if the electron has got sufficient suitable wiggler amplitude intensities, it can not only gain higher energy in longer distances, but also can retain it even after the passing of the laser pulse. In addition, the results reveal that the electron energy gains different peaks for different initial axial velocities, so that a suitable small initial axial velocity of e-beam produces substantially high energy gain. With regard to the transverse confinement of the electron beam in a Paul wiggler, there is no applied axial guide magnetic field in this device.

  19. Highly stretchable and wearable graphene strain sensors with controllable sensitivity for human motion monitoring.

    PubMed

    Park, Jung Jin; Hyun, Woo Jin; Mun, Sung Cik; Park, Yong Tae; Park, O Ok

    2015-03-25

    Because of their outstanding electrical and mechanical properties, graphene strain sensors have attracted extensive attention for electronic applications in virtual reality, robotics, medical diagnostics, and healthcare. Although several strain sensors based on graphene have been reported, the stretchability and sensitivity of these sensors remain limited, and also there is a pressing need to develop a practical fabrication process. This paper reports the fabrication and characterization of new types of graphene strain sensors based on stretchable yarns. Highly stretchable, sensitive, and wearable sensors are realized by a layer-by-layer assembly method that is simple, low-cost, scalable, and solution-processable. Because of the yarn structures, these sensors exhibit high stretchability (up to 150%) and versatility, and can detect both large- and small-scale human motions. For this study, wearable electronics are fabricated with implanted sensors that can monitor diverse human motions, including joint movement, phonation, swallowing, and breathing.

  20. The cooperative voltage sensor motion that gates a potassium channel.

    PubMed

    Pathak, Medha; Kurtz, Lisa; Tombola, Francesco; Isacoff, Ehud

    2005-01-01

    The four arginine-rich S4 helices of a voltage-gated channel move outward through the membrane in response to depolarization, opening and closing gates to generate a transient ionic current. Coupling of voltage sensing to gating was originally thought to operate with the S4s moving independently from an inward/resting to an outward/activated conformation, so that when all four S4s are activated, the gates are driven to open or closed. However, S4 has also been found to influence the cooperative opening step (Smith-Maxwell et al., 1998a), suggesting a more complex mechanism of coupling. Using fluorescence to monitor structural rearrangements in a Shaker channel mutant, the ILT channel (Ledwell and Aldrich, 1999), that energetically isolates the steps of activation from the cooperative opening step, we find that opening is accompanied by a previously unknown and cooperative movement of S4. This gating motion of S4 appears to be coupled to the internal S6 gate and to two forms of slow inactivation. Our results suggest that S4 plays a direct role in gating. While large transmembrane rearrangements of S4 may be required to unlock the gating machinery, as proposed before, it appears to be the gating motion of S4 that drives the gates to open and close.

  1. The Cooperative Voltage Sensor Motion that Gates a Potassium Channel

    PubMed Central

    Pathak, Medha; Kurtz, Lisa; Tombola, Francesco; Isacoff, Ehud

    2005-01-01

    The four arginine-rich S4 helices of a voltage-gated channel move outward through the membrane in response to depolarization, opening and closing gates to generate a transient ionic current. Coupling of voltage sensing to gating was originally thought to operate with the S4s moving independently from an inward/resting to an outward/activated conformation, so that when all four S4s are activated, the gates are driven to open or closed. However, S4 has also been found to influence the cooperative opening step (Smith-Maxwell et al., 1998a), suggesting a more complex mechanism of coupling. Using fluorescence to monitor structural rearrangements in a Shaker channel mutant, the ILT channel (Ledwell and Aldrich, 1999), that energetically isolates the steps of activation from the cooperative opening step, we find that opening is accompanied by a previously unknown and cooperative movement of S4. This gating motion of S4 appears to be coupled to the internal S6 gate and to two forms of slow inactivation. Our results suggest that S4 plays a direct role in gating. While large transmembrane rearrangements of S4 may be required to unlock the gating machinery, as proposed before, it appears to be the gating motion of S4 that drives the gates to open and close. PMID:15623895

  2. Form and motion make independent contributions to the response to biological motion in occipitotemporal cortex.

    PubMed

    Thompson, James C; Baccus, Wendy

    2012-01-02

    Psychophysical and computational studies have provided evidence that both form and motion cues are used in the perception of biological motion. However, neuroimaging and neurophysiological studies have suggested that the neural processing of actions in temporal cortex might rely on form cues alone. Here we examined the contribution of form and motion to the spatial pattern of response to biological motion in ventral and lateral occipitotemporal cortex, using functional magnetic resonance imaging (fMRI) and multivoxel pattern analysis (MVPA). We found that selectivity to intact versus scrambled biological motion in lateral occipitotemporal cortex was correlated with selectivity for bodies and not for motion. However, this appeared to be due to the fact that subtracting scrambled from intact biological motion removes any contribution of local motion cues. Instead, we found that form and motion made independent contributions to the spatial pattern of responses to biological motion in lateral occipitotemporal regions MT, MST, and the extrastriate body area. The motion contribution was position-dependent, and consistent with the representation of contra- and ipsilateral visual fields in MT and MST. In contrast, only form contributed to the response to biological motion in the fusiform body area, with a bias towards central versus peripheral presentation. These results indicate that the pattern of response to biological motion in ventral and lateral occipitotemporal cortex reflects the linear combination of responses to form and motion. Copyright © 2011 Elsevier Inc. All rights reserved.

  3. 40 CFR 164.60 - Motions.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... Administrative Law Judge shall rule upon all motions filed or made prior to the filing of his initial or... 40 Protection of Environment 25 2012-07-01 2012-07-01 false Motions. 164.60 Section 164.60... (Other Than Expedited Hearings) Motions § 164.60 Motions. (a) General. All motions, except those made...

  4. 40 CFR 164.60 - Motions.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... Administrative Law Judge shall rule upon all motions filed or made prior to the filing of his initial or... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Motions. 164.60 Section 164.60... (Other Than Expedited Hearings) Motions § 164.60 Motions. (a) General. All motions, except those made...

  5. 40 CFR 164.60 - Motions.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... Administrative Law Judge shall rule upon all motions filed or made prior to the filing of his initial or... 40 Protection of Environment 24 2011-07-01 2011-07-01 false Motions. 164.60 Section 164.60... (Other Than Expedited Hearings) Motions § 164.60 Motions. (a) General. All motions, except those made...

  6. 40 CFR 164.60 - Motions.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... Administrative Law Judge shall rule upon all motions filed or made prior to the filing of his initial or... 40 Protection of Environment 24 2014-07-01 2014-07-01 false Motions. 164.60 Section 164.60... (Other Than Expedited Hearings) Motions § 164.60 Motions. (a) General. All motions, except those made...

  7. 40 CFR 164.60 - Motions.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... Administrative Law Judge shall rule upon all motions filed or made prior to the filing of his initial or... 40 Protection of Environment 25 2013-07-01 2013-07-01 false Motions. 164.60 Section 164.60... (Other Than Expedited Hearings) Motions § 164.60 Motions. (a) General. All motions, except those made...

  8. Integrals of motion for one-dimensional Anderson localized systems

    DOE PAGES

    Modak, Ranjan; Mukerjee, Subroto; Yuzbashyan, Emil A.; ...

    2016-03-02

    Anderson localization is known to be inevitable in one-dimension for generic disordered models. Since localization leads to Poissonian energy level statistics, we ask if localized systems possess ‘additional’ integrals of motion as well, so as to enhance the analogy with quantum integrable systems. Weanswer this in the affirmative in the present work. We construct a set of nontrivial integrals of motion for Anderson localized models, in terms of the original creation and annihilation operators. These are found as a power series in the hopping parameter. The recently found Type-1 Hamiltonians, which are known to be quantum integrable in a precisemore » sense, motivate our construction.Wenote that these models can be viewed as disordered electron models with infinite-range hopping, where a similar series truncates at the linear order.Weshow that despite the infinite range hopping, all states but one are localized.Wealso study the conservation laws for the disorder free Aubry–Andre model, where the states are either localized or extended, depending on the strength of a coupling constant.Weformulate a specific procedure for averaging over disorder, in order to examine the convergence of the power series. Using this procedure in the Aubry–Andre model, we show that integrals of motion given by our construction are well-defined in localized phase, but not so in the extended phase. Lastly, we also obtain the integrals of motion for a model with interactions to lowest order in the interaction.« less

  9. Integrals of motion for one-dimensional Anderson localized systems

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Modak, Ranjan; Mukerjee, Subroto; Yuzbashyan, Emil A.

    Anderson localization is known to be inevitable in one-dimension for generic disordered models. Since localization leads to Poissonian energy level statistics, we ask if localized systems possess ‘additional’ integrals of motion as well, so as to enhance the analogy with quantum integrable systems. Weanswer this in the affirmative in the present work. We construct a set of nontrivial integrals of motion for Anderson localized models, in terms of the original creation and annihilation operators. These are found as a power series in the hopping parameter. The recently found Type-1 Hamiltonians, which are known to be quantum integrable in a precisemore » sense, motivate our construction.Wenote that these models can be viewed as disordered electron models with infinite-range hopping, where a similar series truncates at the linear order.Weshow that despite the infinite range hopping, all states but one are localized.Wealso study the conservation laws for the disorder free Aubry–Andre model, where the states are either localized or extended, depending on the strength of a coupling constant.Weformulate a specific procedure for averaging over disorder, in order to examine the convergence of the power series. Using this procedure in the Aubry–Andre model, we show that integrals of motion given by our construction are well-defined in localized phase, but not so in the extended phase. Lastly, we also obtain the integrals of motion for a model with interactions to lowest order in the interaction.« less

  10. Integrals of motion for one-dimensional Anderson localized systems

    NASA Astrophysics Data System (ADS)

    Modak, Ranjan; Mukerjee, Subroto; Yuzbashyan, Emil A.; Shastry, B. Sriram

    2016-03-01

    Anderson localization is known to be inevitable in one-dimension for generic disordered models. Since localization leads to Poissonian energy level statistics, we ask if localized systems possess ‘additional’ integrals of motion as well, so as to enhance the analogy with quantum integrable systems. We answer this in the affirmative in the present work. We construct a set of nontrivial integrals of motion for Anderson localized models, in terms of the original creation and annihilation operators. These are found as a power series in the hopping parameter. The recently found Type-1 Hamiltonians, which are known to be quantum integrable in a precise sense, motivate our construction. We note that these models can be viewed as disordered electron models with infinite-range hopping, where a similar series truncates at the linear order. We show that despite the infinite range hopping, all states but one are localized. We also study the conservation laws for the disorder free Aubry-Andre model, where the states are either localized or extended, depending on the strength of a coupling constant. We formulate a specific procedure for averaging over disorder, in order to examine the convergence of the power series. Using this procedure in the Aubry-Andre model, we show that integrals of motion given by our construction are well-defined in localized phase, but not so in the extended phase. Finally, we also obtain the integrals of motion for a model with interactions to lowest order in the interaction.

  11. Motion Simulator

    NASA Technical Reports Server (NTRS)

    2000-01-01

    Visitors to StenniSphere can feel the motion of a ride to Mars with a ride on StenniSphere's full motion simulator. The simulator is the only attraction at StenniSphere for which there is a charge. Adult rides are $4 and children ride for $3. Group discounts are also available.

  12. Reduction of Circulating Neutrophils Precedes and Accompanies Type 1 Diabetes

    PubMed Central

    Valle, Andrea; Giamporcaro, Gian Maria; Scavini, Marina; Stabilini, Angela; Grogan, Pauline; Bianconi, Eleonora; Sebastiani, Guido; Masini, Matilde; Maugeri, Norma; Porretti, Laura; Bonfanti, Riccardo; Meschi, Franco; De Pellegrin, Maurizio; Lesma, Arianna; Rossini, Silvano; Piemonti, Lorenzo; Marchetti, Piero; Dotta, Francesco; Bosi, Emanuele; Battaglia, Manuela

    2013-01-01

    Human type 1 diabetes (T1D) is an autoimmune disease associated with major histocompatibility complex polymorphisms, β-cell autoantibodies, and autoreactive T cells. However, there is increasing evidence that innate cells may also play critical roles in T1D. We aimed to monitor peripheral immune cells in early stages of T1D (i.e., in healthy autoantibody-positive subjects) and in more advanced phases of the disease (i.e., at disease onset and years after diagnosis). We found a mild but significant and reproducible peripheral neutropenia that both precedes and accompanies the onset of T1D. This reduction was not due to peripheral neutrophil cell death, impaired differentiation, or the presence of anti-neutrophil antibodies. Neutrophils were observed by electron microscopy and immunohistochemical analysis in the exocrine pancreas of multiorgan donors with T1D (both at onset and at later stages of the disease) and not in that of multiorgan donors with type 2 diabetes or nondiabetic donors. These pancreas-infiltrating neutrophils mainly localized at the level of very small blood vessels. Our findings suggest the existence of a hitherto unrecognized clinical phenotype that might reflect unexplored pathogenic pathways underlying T1D. PMID:23349491

  13. How electronic dynamics with Pauli exclusion produces Fermi-Dirac statistics.

    PubMed

    Nguyen, Triet S; Nanguneri, Ravindra; Parkhill, John

    2015-04-07

    It is important that any dynamics method approaches the correct population distribution at long times. In this paper, we derive a one-body reduced density matrix dynamics for electrons in energetic contact with a bath. We obtain a remarkable equation of motion which shows that in order to reach equilibrium properly, rates of electron transitions depend on the density matrix. Even though the bath drives the electrons towards a Boltzmann distribution, hole blocking factors in our equation of motion cause the electronic populations to relax to a Fermi-Dirac distribution. These factors are an old concept, but we show how they can be derived with a combination of time-dependent perturbation theory and the extended normal ordering of Mukherjee and Kutzelnigg for a general electronic state. The resulting non-equilibrium kinetic equations generalize the usual Redfield theory to many-electron systems, while ensuring that the orbital occupations remain between zero and one. In numerical applications of our equations, we show that relaxation rates of molecules are not constant because of the blocking effect. Other applications to model atomic chains are also presented which highlight the importance of treating both dephasing and relaxation. Finally, we show how the bath localizes the electron density matrix.

  14. Correlation induced electron-hole asymmetry in quasi- two-dimensional iridates.

    PubMed

    Pärschke, Ekaterina M; Wohlfeld, Krzysztof; Foyevtsova, Kateryna; van den Brink, Jeroen

    2017-09-25

    The resemblance of crystallographic and magnetic structures of the quasi-two-dimensional iridates Ba 2 IrO 4 and Sr 2 IrO 4 to La 2 CuO 4 points at an analogy to cuprate high-Tc superconductors, even if spin-orbit coupling is very strong in iridates. Here we examine this analogy for the motion of a charge (hole or electron) added to the antiferromagnetic ground state. We show that correlation effects render the hole and electron case in iridates very different. An added electron forms a spin polaron, similar to the cuprates, but the situation of a removed electron is far more complex. Many-body 5d 4 configurations form which can be singlet and triplet states of total angular momentum that strongly affect the hole motion. This not only has ramifications for the interpretation of (inverse-)photoemission experiments but also demonstrates that correlation physics renders electron- and hole-doped iridates fundamentally different.Some iridate compounds such as Sr 2 IrO 4 have electronic and atomic structures similar to quasi-2D copper oxides, raising the prospect of high temperature superconductivity. Here, the authors show that there is significant electron-hole asymmetry in iridates, contrary to expectations from the cuprates.

  15. Transient tidal eddy motion in the western Gulf of Maine, part 1: Primary structure

    NASA Astrophysics Data System (ADS)

    Brown, W. S.; Marques, G. M.

    2013-07-01

    Outer Zone subregion (33m) bottom current lateral shear and water column stretching/squashing was significant in modulating the eddy motion. We conclude that the transient eddy motions in the GSC region are phase eddies that accompany the change of tide across the GSC and are (1) generated by bottom stress gradients in the shallower nearshore - an issue which needs to be better understood for improved future forecasting.

  16. What motion is: William Neile and the laws of motion.

    PubMed

    Kemeny, Max

    2017-07-01

    In 1668-1669 William Neile and John Wallis engaged in a protracted correspondence regarding the nature of motion. Neile was unhappy with the laws of motion that had been established by the Royal Society in three papers published in 1668, deeming them not explanations of motion at all, but mere descriptions. Neile insisted that science could not be informative without a discussion of causes, meaning that Wallis's purely kinematic account of collision could not be complete. Wallis, however, did not consider Neile's objections to his work to be serious. Rather than engage in a discussion of the proper place of natural philosophy in science, Wallis decided to show how Neile's preferred treatment of motion lead to absurd conclusions. This dispute is offered as a case study of dispute resolution within the early Royal Society.

  17. Early Improper Motion Detection in Golf Swings Using Wearable Motion Sensors: The First Approach

    PubMed Central

    Stančin, Sara; Tomažič, Sašo

    2013-01-01

    This paper presents an analysis of a golf swing to detect improper motion in the early phase of the swing. Led by the desire to achieve a consistent shot outcome, a particular golfer would (in multiple trials) prefer to perform completely identical golf swings. In reality, some deviations from the desired motion are always present due to the comprehensive nature of the swing motion. Swing motion deviations that are not detrimental to performance are acceptable. This analysis is conducted using a golfer's leading arm kinematic data, which are obtained from a golfer wearing a motion sensor that is comprised of gyroscopes and accelerometers. Applying the principal component analysis (PCA) to the reference observations of properly performed swings, the PCA components of acceptable swing motion deviations are established. Using these components, the motion deviations in the observations of other swings are examined. Any unacceptable deviations that are detected indicate an improper swing motion. Arbitrarily long observations of an individual player's swing sequences can be included in the analysis. The results obtained for the considered example show an improper swing motion in early phase of the swing, i.e., the first part of the backswing. An early detection method for improper swing motions that is conducted on an individual basis provides assistance for performance improvement. PMID:23752563

  18. Early improper motion detection in golf swings using wearable motion sensors: the first approach.

    PubMed

    Stančin, Sara; Tomažič, Sašo

    2013-06-10

    This paper presents an analysis of a golf swing to detect improper motion in the early phase of the swing. Led by the desire to achieve a consistent shot outcome, a particular golfer would (in multiple trials) prefer to perform completely identical golf swings. In reality, some deviations from the desired motion are always present due to the comprehensive nature of the swing motion. Swing motion deviations that are not detrimental to performance are acceptable. This analysis is conducted using a golfer's leading arm kinematic data, which are obtained from a golfer wearing a motion sensor that is comprised of gyroscopes and accelerometers. Applying the principal component analysis (PCA) to the reference observations of properly performed swings, the PCA components of acceptable swing motion deviations are established. Using these components, the motion deviations in the observations of other swings are examined. Any unacceptable deviations that are detected indicate an improper swing motion. Arbitrarily long observations of an individual player's swing sequences can be included in the analysis. The results obtained for the considered example show an improper swing motion in early phase of the swing, i.e., the first part of the backswing. An early detection method for improper swing motions that is conducted on an individual basis provides assistance for performance improvement.

  19. Motion of Fullerenes around Topological Defects on Metals: Implications for the Progress of Molecular Scale Devices.

    PubMed

    Nirmalraj, Peter; Daly, Ronan; Martin, Nazario; Thompson, Damien

    2017-03-08

    Research on motion of molecules in the presence of thermal noise is central for progress in two-terminal molecular scale electronic devices. However, it is still unclear what influence imperfections in bottom metal electrode surface can have on molecular motion. Here, we report a two-layer crowding study, detailing the early stages of surface motion of fullerene molecules on Au(111) with nanoscale pores in a n-tetradecane chemical environment. The motion of the fullerenes is directed by crowding of the underlying n-tetradecane molecules around the pore fringes at the liquid-solid interface. We observe in real-space the growth of molecular populations around different pore geometries. Supported by atomic-scale modeling, our findings extend the established picture of molecular crowding by revealing that trapped solvent molecules serve as prime nucleation sites at nanopore fringes.

  20. Coupled beam motion in a storage ring with crab cavities

    DOE PAGES

    Huang, Xiaobiao

    2016-02-16

    We studied the coupled beam motion in a storage ring between the transverse and longitudinal directions introduced by crab cavities. Analytic form of the linear decoupling transformation is derived. Also, the equilibrium bunch distribution in an electron storage ring with a crab cavity is given, including contribution to the eigen-emittance induced by the crab cavity. Furthermore, application to the short pulse generation scheme using crab cavities [1] is considered.

  1. 40 CFR 305.23 - Motions.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 28 2014-07-01 2014-07-01 false Motions. 305.23 Section 305.23... Motions. (a) General. All motions, except those made orally on the record during a hearing, shall: be in... motions shall be served as provided by § 305.5(b)(2)(i). (b) Response to motions. A party's response to...

  2. Modeling respiratory motion for reducing motion artifacts in 4D CT images.

    PubMed

    Zhang, Yongbin; Yang, Jinzhong; Zhang, Lifei; Court, Laurence E; Balter, Peter A; Dong, Lei

    2013-04-01

    Four-dimensional computed tomography (4D CT) images have been recently adopted in radiation treatment planning for thoracic and abdominal cancers to explicitly define respiratory motion and anatomy deformation. However, significant image distortions (artifacts) exist in 4D CT images that may affect accurate tumor delineation and the shape representation of normal anatomy. In this study, the authors present a patient-specific respiratory motion model, based on principal component analysis (PCA) of motion vectors obtained from deformable image registration, with the main goal of reducing image artifacts caused by irregular motion during 4D CT acquisition. For a 4D CT image set of a specific patient, the authors calculated displacement vector fields relative to a reference phase, using an in-house deformable image registration method. The authors then used PCA to decompose each of the displacement vector fields into linear combinations of principal motion bases. The authors have demonstrated that the regular respiratory motion of a patient can be accurately represented by a subspace spanned by three principal motion bases and their projections. These projections were parameterized using a spline model to allow the reconstruction of the displacement vector fields at any given phase in a respiratory cycle. Finally, the displacement vector fields were used to deform the reference CT image to synthesize CT images at the selected phase with much reduced image artifacts. The authors evaluated the performance of the in-house deformable image registration method using benchmark datasets consisting of ten 4D CT sets annotated with 300 landmark pairs that were approved by physicians. The initial large discrepancies across the landmark pairs were significantly reduced after deformable registration, and the accuracy was similar to or better than that reported by state-of-the-art methods. The proposed motion model was quantitatively validated on 4D CT images of a phantom and a

  3. Rational design of crystal contact-free space in protein crystals for analyzing spatial distribution of motions within protein molecules.

    PubMed

    Matsuoka, Rei; Shimada, Atsushi; Komuro, Yasuaki; Sugita, Yuji; Kohda, Daisuke

    2016-03-01

    Contacts with neighboring molecules in protein crystals inevitably restrict the internal motions of intrinsically flexible proteins. The resultant clear electron densities permit model building, as crystallographic snapshot structures. Although these still images are informative, they could provide biased pictures of the protein motions. If the mobile parts are located at a site lacking direct contacts in rationally designed crystals, then the amplitude of the movements can be experimentally analyzed. We propose a fusion protein method, to create crystal contact-free space (CCFS) in protein crystals and to place the mobile parts in the CCFS. Conventional model building fails when large amplitude motions exist. In this study, the mobile parts appear as smeared electron densities in the CCFS, by suitable processing of the X-ray diffraction data. We applied the CCFS method to a highly mobile presequence peptide bound to the mitochondrial import receptor, Tom20, and a catalytically relevant flexible segment in the oligosaccharyltransferase, AglB. These two examples demonstrated the general applicability of the CCFS method to the analysis of the spatial distribution of motions within protein molecules. © 2016 The Protein Society.

  4. Accompaniment and Quality in Childcare Services: The Emergence of a Culture of Professionalization

    ERIC Educational Resources Information Center

    Pirard, Florence; Barbier, Jean-Marie

    2012-01-01

    This article addresses various educational cultures observed today in a variety of training and professional development contexts in the field of early childhood education. The paper also analyses methods of developing and implementing training or professional "accompaniment". This notion of "accompaniment" has been developed…

  5. Tracking 3-D body motion for docking and robot control

    NASA Technical Reports Server (NTRS)

    Donath, M.; Sorensen, B.; Yang, G. B.; Starr, R.

    1987-01-01

    An advanced method of tracking three-dimensional motion of bodies has been developed. This system has the potential to dynamically characterize machine and other structural motion, even in the presence of structural flexibility, thus facilitating closed loop structural motion control. The system's operation is based on the concept that the intersection of three planes defines a point. Three rotating planes of laser light, fixed and moving photovoltaic diode targets, and a pipe-lined architecture of analog and digital electronics are used to locate multiple targets whose number is only limited by available computer memory. Data collection rates are a function of the laser scan rotation speed and are currently selectable up to 480 Hz. The tested performance on a preliminary prototype designed for 0.1 in accuracy (for tracking human motion) at a 480 Hz data rate includes a worst case resolution of 0.8 mm (0.03 inches), a repeatability of plus or minus 0.635 mm (plus or minus 0.025 inches), and an absolute accuracy of plus or minus 2.0 mm (plus or minus 0.08 inches) within an eight cubic meter volume with all results applicable at the 95 percent level of confidence along each coordinate region. The full six degrees of freedom of a body can be computed by attaching three or more target detectors to the body of interest.

  6. Puzzle maker in SmB6: accompany-type valence fluctuation state

    NASA Astrophysics Data System (ADS)

    Wu, Qi; Sun, Liling

    2017-11-01

    In recent years, studying the Kondo insulator SmB6, a strongly correlated electron material that has been puzzling the community for decades, has again become an attractive topic due to the discovery of its unusual metallic surface state coexisting with the bulk insulating state. Many efforts have been made to understand the microphysics in SmB6, but some puzzles that have been hotly debated and argued have not been solved. In this article, based on the latest progress made in our high-pressure studies on SmB6 and the accumulating results reported by other groups, we propose a notion named the ‘accompany-type valence fluctuation state’, which possibly coexists with the bulk Kondo insulating ground state of SmB6. We expect that this notion could be taken as a common starting point for understanding in a unified way most of the low-temperature phenomena observed by different experimental investigations on SmB6, thus promoting the deciphering of the puzzles. We also expect that this notion could attract rigorous theoretical interpretation and further experimental investigation, or stimulate better thinking on the physics in SmB6.

  7. Quality control procedures for dynamic treatment delivery techniques involving couch motion.

    PubMed

    Yu, Victoria Y; Fahimian, Benjamin P; Xing, Lei; Hristov, Dimitre H

    2014-08-01

    In this study, the authors introduce and demonstrate quality control procedures for evaluating the geometric and dosimetric fidelity of dynamic treatment delivery techniques involving treatment couch motion synchronous with gantry and multileaf collimator (MLC). Tests were designed to evaluate positional accuracy, velocity constancy and accuracy for dynamic couch motion under a realistic weight load. A test evaluating the geometric accuracy of the system in delivering treatments over complex dynamic trajectories was also devised. Custom XML scripts that control the Varian TrueBeam™ STx (Serial #3) axes in Developer Mode were written to implement the delivery sequences for the tests. Delivered dose patterns were captured with radiographic film or the electronic portal imaging device. The couch translational accuracy in dynamic treatment mode was 0.01 cm. Rotational accuracy was within 0.3°, with 0.04 cm displacement of the rotational axis. Dose intensity profiles capturing the velocity constancy and accuracy for translations and rotation exhibited standard deviation and maximum deviations below 3%. For complex delivery involving MLC and couch motions, the overall translational accuracy for reproducing programmed patterns was within 0.06 cm. The authors conclude that in Developer Mode, TrueBeam™ is capable of delivering dynamic treatment delivery techniques involving couch motion with good geometric and dosimetric fidelity.

  8. Kinetics of Electrons from Plasma Discharge in a Latent Track Region Induced by Swift Heavy ION Irradiation

    NASA Astrophysics Data System (ADS)

    Minárik, Stanislav

    2015-08-01

    While passing swift heavy ion through a material structure, it produces a region of radiation affected material which is known as a "latent track". Scattering motions of electrons interacting with a swift heavy ion are dominant in the latent track region. These phenomena include the electron impurity and phonon scattering processes modified by the interaction with the ion projectile as well as the Coulomb scattering between two electrons. In this paper, we provide detailed derivation of a 3D Boltzmann scattering equation for the description of the relative scattering motion of such electrons. Phase-space distribution function for this non-equilibrioum system of scattering electrons can be found by the solution of mentioned equation.

  9. Motion Cueing Algorithm Development: New Motion Cueing Program Implementation and Tuning

    NASA Technical Reports Server (NTRS)

    Houck, Jacob A. (Technical Monitor); Telban, Robert J.; Cardullo, Frank M.; Kelly, Lon C.

    2005-01-01

    A computer program has been developed for the purpose of driving the NASA Langley Research Center Visual Motion Simulator (VMS). This program includes two new motion cueing algorithms, the optimal algorithm and the nonlinear algorithm. A general description of the program is given along with a description and flowcharts for each cueing algorithm, and also descriptions and flowcharts for subroutines used with the algorithms. Common block variable listings and a program listing are also provided. The new cueing algorithms have a nonlinear gain algorithm implemented that scales each aircraft degree-of-freedom input with a third-order polynomial. A description of the nonlinear gain algorithm is given along with past tuning experience and procedures for tuning the gain coefficient sets for each degree-of-freedom to produce the desired piloted performance. This algorithm tuning will be needed when the nonlinear motion cueing algorithm is implemented on a new motion system in the Cockpit Motion Facility (CMF) at the NASA Langley Research Center.

  10. Pitch Angle Scattering of Upgoing Electron Beams in Jupiter's Polar Regions by Whistler Mode Waves

    NASA Astrophysics Data System (ADS)

    Elliott, S. S.; Gurnett, D. A.; Kurth, W. S.; Clark, G.; Mauk, B. H.; Bolton, S. J.; Connerney, J. E. P.; Levin, S. M.

    2018-02-01

    The Juno spacecraft's Jupiter Energetic-particle Detector Instrument has observed field-aligned, unidirectional (upgoing) electron beams throughout most of Jupiter's entire polar cap region. The Waves instrument detected intense broadband whistler mode emissions occurring in the same region. In this paper, we investigate the pitch angle scattering of the upgoing electron beams due to interactions with the whistler mode waves. Profiles of intensity versus pitch angle for electron beams ranging from 2.53 to 7.22 Jovian radii show inconsistencies with the expected adiabatic invariant motion of the electrons. It is believed that the observed whistler mode waves perturb the electron motion and scatter them away from the magnetic field line. The diffusion equation has been solved by using diffusion coefficients which depend on the magnetic intensity of the whistler mode waves.

  11. Nuclear spatial delocalization silences electron density oscillations in 2-phenyl-ethyl-amine (PEA) and 2-phenylethyl-N,N-dimethylamine (PENNA) cations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jenkins, Andrew J.; Vacher, Morgane; Bearpark, Michael J.

    2016-03-14

    We simulate electron dynamics following ionization in 2-phenyl-ethyl-amine and 2-phenylethyl-N,N-dimethylamine as examples of systems where 3 coupled cationic states are involved. We study two nuclear effects on electron dynamics: (i) coupled electron-nuclear motion and (ii) nuclear spatial delocalization as a result of the zero-point energy in the neutral molecule. Within the Ehrenfest approximation, our calculations show that the coherent electron dynamics in these molecules is not lost as a result of coupled electron-nuclear motion. In contrast, as a result of nuclear spatial delocalization, dephasing of the oscillations occurs on a time scale of only a few fs, long before anymore » significant nuclear motion can occur. The results have been rationalized using a semi-quantitative model based upon the gradients of the potential energy surfaces.« less

  12. Dynamic visual attention: motion direction versus motion magnitude

    NASA Astrophysics Data System (ADS)

    Bur, A.; Wurtz, P.; Müri, R. M.; Hügli, H.

    2008-02-01

    Defined as an attentive process in the context of visual sequences, dynamic visual attention refers to the selection of the most informative parts of video sequence. This paper investigates the contribution of motion in dynamic visual attention, and specifically compares computer models designed with the motion component expressed either as the speed magnitude or as the speed vector. Several computer models, including static features (color, intensity and orientation) and motion features (magnitude and vector) are considered. Qualitative and quantitative evaluations are performed by comparing the computer model output with human saliency maps obtained experimentally from eye movement recordings. The model suitability is evaluated in various situations (synthetic and real sequences, acquired with fixed and moving camera perspective), showing advantages and inconveniences of each method as well as preferred domain of application.

  13. Computer Literacy: Handbook to Accompany VESL Vocabulary Cards.

    ERIC Educational Resources Information Center

    Siefer, Nancy; Lenhart, Debra

    This manual is one of four self-contained components of a larger handbook designed to assist secondary and postsecondary instructors and support staff in meeting the needs of limited-English-proficiency (LEP) students in vocational training programs. Together with an accompanying set of vocational English as a second language (VESL) vocabulary…

  14. Recovery of Near-Fault Ground Motion by Introducing Rotational Motions

    NASA Astrophysics Data System (ADS)

    Chiu, H. C.

    2014-12-01

    Near-fault ground motion is the key data to seismologists for revealing the seismic faulting and earthquake physics and strong-motion data is the only near-fault seismogram that can keep on-scale recording in a major earthquake. Unfortunately, this type of data might be contaminated by the rotation induced effects such as the centrifugal acceleration and the gravity effects. We analyze these effects based on a set of collocated rotation-translation data of small to moderate earthquakes. Results show these rotation effects could be negligible in small ground motion, but they might have a radical growing in the near-fault/extremely large ground motions. In order to extract more information from near-fault seismogram for improving our understating of seismic faulting and earthquake physics, it requires six-component collocated rotation-translation records to reduce or remove these effects.

  15. Ultrafast Imaging of Electronic Motion in Atoms and Molecules

    DTIC Science & Technology

    2016-01-12

    pulses were measured with a home-made faraday cup and laser-triggered streak camera, respectively. Both are retractable and can measure the beam in...100 fs. The charge and duration of the electron pulses were measured with a home-made faraday cup and laser-triggered streak camera, respectively... faraday cup and laser-triggered streak camera, respectively. Both are retractable and can measure the beam in-situ. The gun was shown to generate pulses

  16. Mode-selective vibrational modulation of charge transport in organic electronic devices

    NASA Astrophysics Data System (ADS)

    Bakulin, Artem A.; Lovrincic, Robert; Yu, Xi; Selig, Oleg; Bakker, Huib J.; Rezus, Yves L. A.; Nayak, Pabitra K.; Fonari, Alexandr; Coropceanu, Veaceslav; Brédas, Jean-Luc; Cahen, David

    2015-08-01

    The soft character of organic materials leads to strong coupling between molecular, nuclear and electronic dynamics. This coupling opens the way to influence charge transport in organic electronic devices by exciting molecular vibrational motions. However, despite encouraging theoretical predictions, experimental realization of such approach has remained elusive. Here we demonstrate experimentally that photoconductivity in a model organic optoelectronic device can be modulated by the selective excitation of molecular vibrations. Using an ultrafast infrared laser source to create a coherent superposition of vibrational motions in a pentacene/C60 photoresistor, we observe that excitation of certain modes in the 1,500-1,700 cm-1 region leads to photocurrent enhancement. Excited vibrations affect predominantly trapped carriers. The effect depends on the nature of the vibration and its mode-specific character can be well described by the vibrational modulation of intermolecular electronic couplings. This presents a new tool for studying electron-phonon coupling and charge dynamics in (bio)molecular materials.

  17. A Pursuit Theory Account for the Perception of Common Motion in Motion Parallax.

    PubMed

    Ratzlaff, Michael; Nawrot, Mark

    2016-09-01

    The visual system uses an extraretinal pursuit eye movement signal to disambiguate the perception of depth from motion parallax. Visual motion in the same direction as the pursuit is perceived nearer in depth while visual motion in the opposite direction as pursuit is perceived farther in depth. This explanation of depth sign applies to either an allocentric frame of reference centered on the fixation point or an egocentric frame of reference centered on the observer. A related problem is that of depth order when two stimuli have a common direction of motion. The first psychophysical study determined whether perception of egocentric depth order is adequately explained by a model employing an allocentric framework, especially when the motion parallax stimuli have common rather than divergent motion. A second study determined whether a reversal in perceived depth order, produced by a reduction in pursuit velocity, is also explained by this model employing this allocentric framework. The results show than an allocentric model can explain both the egocentric perception of depth order with common motion and the perceptual depth order reversal created by a reduction in pursuit velocity. We conclude that an egocentric model is not the only explanation for perceived depth order in these common motion conditions. © The Author(s) 2016.

  18. Real-Time Robust Tracking for Motion Blur and Fast Motion via Correlation Filters

    PubMed Central

    Xu, Lingyun; Luo, Haibo; Hui, Bin; Chang, Zheng

    2016-01-01

    Visual tracking has extensive applications in intelligent monitoring and guidance systems. Among state-of-the-art tracking algorithms, Correlation Filter methods perform favorably in robustness, accuracy and speed. However, it also has shortcomings when dealing with pervasive target scale variation, motion blur and fast motion. In this paper we proposed a new real-time robust scheme based on Kernelized Correlation Filter (KCF) to significantly improve performance on motion blur and fast motion. By fusing KCF and STC trackers, our algorithm also solve the estimation of scale variation in many scenarios. We theoretically analyze the problem for CFs towards motions and utilize the point sharpness function of the target patch to evaluate the motion state of target. Then we set up an efficient scheme to handle the motion and scale variation without much time consuming. Our algorithm preserves the properties of KCF besides the ability to handle special scenarios. In the end extensive experimental results on benchmark of VOT datasets show our algorithm performs advantageously competed with the top-rank trackers. PMID:27618046

  19. Real-Time Robust Tracking for Motion Blur and Fast Motion via Correlation Filters.

    PubMed

    Xu, Lingyun; Luo, Haibo; Hui, Bin; Chang, Zheng

    2016-09-07

    Visual tracking has extensive applications in intelligent monitoring and guidance systems. Among state-of-the-art tracking algorithms, Correlation Filter methods perform favorably in robustness, accuracy and speed. However, it also has shortcomings when dealing with pervasive target scale variation, motion blur and fast motion. In this paper we proposed a new real-time robust scheme based on Kernelized Correlation Filter (KCF) to significantly improve performance on motion blur and fast motion. By fusing KCF and STC trackers, our algorithm also solve the estimation of scale variation in many scenarios. We theoretically analyze the problem for CFs towards motions and utilize the point sharpness function of the target patch to evaluate the motion state of target. Then we set up an efficient scheme to handle the motion and scale variation without much time consuming. Our algorithm preserves the properties of KCF besides the ability to handle special scenarios. In the end extensive experimental results on benchmark of VOT datasets show our algorithm performs advantageously competed with the top-rank trackers.

  20. Motion-based nearest vector metric for reference frame selection in the perception of motion.

    PubMed

    Agaoglu, Mehmet N; Clarke, Aaron M; Herzog, Michael H; Ögmen, Haluk

    2016-05-01

    We investigated how the visual system selects a reference frame for the perception of motion. Two concentric arcs underwent circular motion around the center of the display, where observers fixated. The outer (target) arc's angular velocity profile was modulated by a sine wave midflight whereas the inner (reference) arc moved at a constant angular speed. The task was to report whether the target reversed its direction of motion at any point during its motion. We investigated the effects of spatial and figural factors by systematically varying the radial and angular distances between the arcs, and their relative sizes. We found that the effectiveness of the reference frame decreases with increasing radial- and angular-distance measures. Drastic changes in the relative sizes of the arcs did not influence motion reversal thresholds, suggesting no influence of stimulus form on perceived motion. We also investigated the effect of common velocity by introducing velocity fluctuations to the reference arc as well. We found no effect of whether or not a reference frame has a constant motion. We examined several form- and motion-based metrics, which could potentially unify our findings. We found that a motion-based nearest vector metric can fully account for all the data reported here. These findings suggest that the selection of reference frames for motion processing does not result from a winner-take-all process, but instead, can be explained by a field whose strength decreases with the distance between the nearest motion vectors regardless of the form of the moving objects.

  1. Induced rotational motion with nonabutting inducing and induced stimuli: implications regarding two forms of induced motion.

    PubMed

    Reinhardt-Rutland, A H

    2003-07-01

    Induced motion is the illusory motion of a static stimulus in the opposite direction to a moving stimulus. Two types of induced motion have been distinguished: (a) when the moving stimulus is distant from the static stimulus and undergoes overall displacement, and (b) when the moving stimulus is pattern viewed within fixed boundaries that abut the static stimulus. Explanations of the 1st type of induced motion refer to mediating phenomena, such as vection, whereas the 2nd type is attributed to local processing by motion-sensitive neurons. The present research was directed to a display that elicited induced rotational motion with the characteristics of both types of induced motion: the moving stimulus lay within fixed boundaries, but the inducing and induced stimuli were distant from each other. The author investigated the properties that distinguished the two types of induced motion. In 3 experiments, induced motion persisted indefinitely, interocular transfer of the aftereffect of induced motion was limited to about 20%, and the time-course of the aftereffect of induced motion could not be attributed to vection. Those results were consistent with fixed-boundary induced motion. However, they could not be explained by local processing. Instead, the results might reflect the detection of object motion within a complex flow-field that resulted from the observer's motion.

  2. Stochastic ground motion simulation

    USGS Publications Warehouse

    Rezaeian, Sanaz; Xiaodan, Sun; Beer, Michael; Kougioumtzoglou, Ioannis A.; Patelli, Edoardo; Siu-Kui Au, Ivan

    2014-01-01

    Strong earthquake ground motion records are fundamental in engineering applications. Ground motion time series are used in response-history dynamic analysis of structural or geotechnical systems. In such analysis, the validity of predicted responses depends on the validity of the input excitations. Ground motion records are also used to develop ground motion prediction equations(GMPEs) for intensity measures such as spectral accelerations that are used in response-spectrum dynamic analysis. Despite the thousands of available strong ground motion records, there remains a shortage of records for large-magnitude earthquakes at short distances or in specific regions, as well as records that sample specific combinations of source, path, and site characteristics.

  3. Effect of respiratory motion on internal radiation dosimetry

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xie, Tianwu; Zaidi, Habib, E-mail: habib.zaidi@hcuge.ch; Geneva Neuroscience Center, Geneva University, Geneva CH-1205

    Purpose: Estimation of the radiation dose to internal organs is essential for the assessment of radiation risks and benefits to patients undergoing diagnostic and therapeutic nuclear medicine procedures including PET. Respiratory motion induces notable internal organ displacement, which influences the absorbed dose for external exposure to radiation. However, to their knowledge, the effect of respiratory motion on internal radiation dosimetry has never been reported before. Methods: Thirteen computational models representing the adult male at different respiratory phases corresponding to the normal respiratory cycle were generated from the 4D dynamic XCAT phantom. Monte Carlo calculations were performed using the MCNP transportmore » code to estimate the specific absorbed fractions (SAFs) of monoenergetic photons/electrons, the S-values of common positron-emitting radionuclides (C-11, N-13, O-15, F-18, Cu-64, Ga-68, Rb-82, Y-86, and I-124), and the absorbed dose of {sup 18}F-fluorodeoxyglucose ({sup 18}F-FDG) in 28 target regions for both the static (average of dynamic frames) and dynamic phantoms. Results: The self-absorbed dose for most organs/tissues is only slightly influenced by respiratory motion. However, for the lung, the self-absorbed SAF is about 11.5% higher at the peak exhale phase than the peak inhale phase for photon energies above 50 keV. The cross-absorbed dose is obviously affected by respiratory motion for many combinations of source-target pairs. The cross-absorbed S-values for the heart contents irradiating the lung are about 7.5% higher in the peak exhale phase than the peak inhale phase for different positron-emitting radionuclides. For {sup 18}F-FDG, organ absorbed doses are less influenced by respiratory motion. Conclusions: Respiration-induced volume variations of the lungs and the repositioning of internal organs affect the self-absorbed dose of the lungs and cross-absorbed dose between organs in internal radiation dosimetry. The dynamic

  4. Novel true-motion estimation algorithm and its application to motion-compensated temporal frame interpolation.

    PubMed

    Dikbas, Salih; Altunbasak, Yucel

    2013-08-01

    In this paper, a new low-complexity true-motion estimation (TME) algorithm is proposed for video processing applications, such as motion-compensated temporal frame interpolation (MCTFI) or motion-compensated frame rate up-conversion (MCFRUC). Regular motion estimation, which is often used in video coding, aims to find the motion vectors (MVs) to reduce the temporal redundancy, whereas TME aims to track the projected object motion as closely as possible. TME is obtained by imposing implicit and/or explicit smoothness constraints on the block-matching algorithm. To produce better quality-interpolated frames, the dense motion field at interpolation time is obtained for both forward and backward MVs; then, bidirectional motion compensation using forward and backward MVs is applied by mixing both elegantly. Finally, the performance of the proposed algorithm for MCTFI is demonstrated against recently proposed methods and smoothness constraint optical flow employed by a professional video production suite. Experimental results show that the quality of the interpolated frames using the proposed method is better when compared with the MCFRUC techniques.

  5. Attraction of posture and motion-trajectory elements of conspecific biological motion in medaka fish.

    PubMed

    Shibai, Atsushi; Arimoto, Tsunehiro; Yoshinaga, Tsukasa; Tsuchizawa, Yuta; Khureltulga, Dashdavaa; Brown, Zuben P; Kakizuka, Taishi; Hosoda, Kazufumi

    2018-06-05

    Visual recognition of conspecifics is necessary for a wide range of social behaviours in many animals. Medaka (Japanese rice fish), a commonly used model organism, are known to be attracted by the biological motion of conspecifics. However, biological motion is a composite of both body-shape motion and entire-field motion trajectory (i.e., posture or motion-trajectory elements, respectively), and it has not been revealed which element mediates the attractiveness. Here, we show that either posture or motion-trajectory elements alone can attract medaka. We decomposed biological motion of the medaka into the two elements and synthesized visual stimuli that contain both, either, or none of the two elements. We found that medaka were attracted by visual stimuli that contain at least one of the two elements. In the context of other known static visual information regarding the medaka, the potential multiplicity of information regarding conspecific recognition has further accumulated. Our strategy of decomposing biological motion into these partial elements is applicable to other animals, and further studies using this technique will enhance the basic understanding of visual recognition of conspecifics.

  6. Motion-Matching: A Challenge Game to Generate Motion Concepts

    ERIC Educational Resources Information Center

    Schuster, David; Adams, Betty; Brookes, David; Milner-Bolotin, Marina; Undreiu, Adriana

    2009-01-01

    Motion is a topic that is taught from elementary grades through to university at various levels of sophistication. It is an area that can be challenging for learning in a conceptually meaningful way, and formal kinematics instruction can sometimes seem dry and boring. Thus, the nature of students' initial introduction to motion is important in…

  7. Self-propelled motion of Au-Si droplets on Si(111) mediated by monoatomic step dissolution

    NASA Astrophysics Data System (ADS)

    Curiotto, S.; Leroy, F.; Cheynis, F.; Müller, P.

    2015-02-01

    By Low Energy Electron Microscopy, we show that the spontaneous motion of gold droplets on silicon (111) is chemically driven: the droplets tend to dissolve silicon monoatomic steps to reach the temperature-dependent Au-Si equilibrium stoichiometry. According to the droplet size, the motion details are different. In the first stages of Au deposition small droplets nucleate at steps and move continuously on single terraces. The droplets temporarily pin at each step they meet during their motion. During pinning, the growing droplets become supersaturated in Au. They depin from the steps when a notch nucleate on the upper step. Then the droplets climb up and locally dissolve the Si steps, leaving behind them deep tracks formed by notched steps. Measurements of the dissolution rate and the displacement lengths enable us to describe quantitatively the motion mechanism, also in terms of anisotropy of Si dissolution kinetics. Scaling laws for the droplet position as a function of time are proposed: x ∝ tn with 1/3 < n < 2/3.

  8. Space motion sickness

    NASA Technical Reports Server (NTRS)

    Homick, J. L.

    1979-01-01

    Research on the etiology, prediction, treatment and prevention of space motion sickness, designed to minimize the impact of this syndrome which was experienced frequently and with severity by individuals on the Skylab missions, on Space Shuttle crews is reviewed. Theories of the cause of space motion sickness currently under investigation by NASA include sensory conflict, which argues that motion sickness symptoms result from a mismatch between the total pattern of information from the spatial senses and that stored from previous experiences, and fluid shift, based upon the redistribution of bodily fluids that occurs upon continued exposure to weightlessness. Attempts are underway to correlate space motion sickness susceptibility to different provocative environments, vestibular and nonvestibular responses, and the rate of acquisition and length of retention of sensory adaptation. Space motion sickness countermeasures under investigation include various drug combinations, of which the equal combination of promethazine and ephedrine has been found to be as effective as the scopolomine and dexedrine combination, and vestibular adaptation and biofeedback training and autogenic therapy.

  9. Three-dimensional motion aftereffects reveal distinct direction-selective mechanisms for binocular processing of motion through depth.

    PubMed

    Czuba, Thaddeus B; Rokers, Bas; Guillet, Kyle; Huk, Alexander C; Cormack, Lawrence K

    2011-09-26

    Motion aftereffects are historically considered evidence for neuronal populations tuned to specific directions of motion. Despite a wealth of motion aftereffect studies investigating 2D (frontoparallel) motion mechanisms, there is a remarkable dearth of psychophysical evidence for neuronal populations selective for the direction of motion through depth (i.e., tuned to 3D motion). We compared the effects of prolonged viewing of unidirectional motion under dichoptic and monocular conditions and found large 3D motion aftereffects that could not be explained by simple inheritance of 2D monocular aftereffects. These results (1) demonstrate the existence of neurons tuned to 3D motion as distinct from monocular 2D mechanisms, (2) show that distinct 3D direction selectivity arises from both interocular velocity differences and changing disparities over time, and (3) provide a straightforward psychophysical tool for further probing 3D motion mechanisms. © ARVO

  10. Three-dimensional motion aftereffects reveal distinct direction-selective mechanisms for binocular processing of motion through depth

    PubMed Central

    Czuba, Thaddeus B.; Rokers, Bas; Guillet, Kyle; Huk, Alexander C.; Cormack, Lawrence K.

    2013-01-01

    Motion aftereffects are historically considered evidence for neuronal populations tuned to specific directions of motion. Despite a wealth of motion aftereffect studies investigating 2D (frontoparallel) motion mechanisms, there is a remarkable dearth of psychophysical evidence for neuronal populations selective for the direction of motion through depth (i.e., tuned to 3D motion). We compared the effects of prolonged viewing of unidirectional motion under dichoptic and monocular conditions and found large 3D motion aftereffects that could not be explained by simple inheritance of 2D monocular aftereffects. These results (1) demonstrate the existence of neurons tuned to 3D motion as distinct from monocular 2D mechanisms, (2) show that distinct 3D direction selectivity arises from both interocular velocity differences and changing disparities over time, and (3) provide a straightforward psychophysical tool for further probing 3D motion mechanisms. PMID:21945967

  11. Quantum Nuclear Dynamics Pumped and Probed by Ultrafast Polarization Controlled Steering of a Coherent Electronic State in LiH.

    PubMed

    Nikodem, Astrid; Levine, R D; Remacle, F

    2016-05-19

    The quantum wave packet dynamics following a coherent electronic excitation of LiH by an ultrashort, polarized, strong one-cycle infrared optical pulse is computed on several electronic states using a grid method. The coupling to the strong field of the pump and the probe pulses is included in the Hamiltonian used to solve the time-dependent Schrodinger equation. The polarization of the pump pulse allows us to control the localization in time and in space of the nonequilibrium coherent electronic motion and the subsequent nuclear dynamics. We show that transient absorption, resulting from the interaction of the total molecular dipole with the electric fields of the pump and the probe, is a very versatile probe of the different time scales of the vibronic dynamics. It allows probing both the ultrashort, femtosecond time scale of the electronic coherences as well as the longer dozens of femtoseconds time scales of the nuclear motion on the excited electronic states. The ultrafast beatings of the electronic coherences in space and in time are shown to be modulated by the different periods of the nuclear motion.

  12. Visual search for motion-form conjunctions: is form discriminated within the motion system?

    PubMed

    von Mühlenen, A; Müller, H J

    2001-06-01

    Motion-form conjunction search can be more efficient when the target is moving (a moving 45 degrees tilted line among moving vertical and stationary 45 degrees tilted lines) rather than stationary. This asymmetry may be due to aspects of form being discriminated within a motion system representing only moving items, whereas discrimination of stationary items relies on a static form system (J. Driver & P. McLeod, 1992). Alternatively, it may be due to search exploiting differential motion velocity and direction signals generated by the moving-target and distractor lines. To decide between these alternatives, 4 experiments systematically varied the motion-signal information conveyed by the moving target and distractors while keeping their form difference salient. Moving-target search was found to be facilitated only when differential motion-signal information was available. Thus, there is no need to assume that form is discriminated within the motion system.

  13. Real-time soft tissue motion estimation for lung tumors during radiotherapy delivery.

    PubMed

    Rottmann, Joerg; Keall, Paul; Berbeco, Ross

    2013-09-01

    To provide real-time lung tumor motion estimation during radiotherapy treatment delivery without the need for implanted fiducial markers or additional imaging dose to the patient. 2D radiographs from the therapy beam's-eye-view (BEV) perspective are captured at a frame rate of 12.8 Hz with a frame grabber allowing direct RAM access to the image buffer. An in-house developed real-time soft tissue localization algorithm is utilized to calculate soft tissue displacement from these images in real-time. The system is tested with a Varian TX linear accelerator and an AS-1000 amorphous silicon electronic portal imaging device operating at a resolution of 512 × 384 pixels. The accuracy of the motion estimation is verified with a dynamic motion phantom. Clinical accuracy was tested on lung SBRT images acquired at 2 fps. Real-time lung tumor motion estimation from BEV images without fiducial markers is successfully demonstrated. For the phantom study, a mean tracking error <1.0 mm [root mean square (rms) error of 0.3 mm] was observed. The tracking rms accuracy on BEV images from a lung SBRT patient (≈20 mm tumor motion range) is 1.0 mm. The authors demonstrate for the first time real-time markerless lung tumor motion estimation from BEV images alone. The described system can operate at a frame rate of 12.8 Hz and does not require prior knowledge to establish traceable landmarks for tracking on the fly. The authors show that the geometric accuracy is similar to (or better than) previously published markerless algorithms not operating in real-time.

  14. Algorithm for quantum-mechanical finite-nuclear-mass variational calculations of atoms with two p electrons using all-electron explicitly correlated Gaussian basis functions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sharkey, Keeper L.; Pavanello, Michele; Bubin, Sergiy

    2009-12-15

    A new algorithm for calculating the Hamiltonian matrix elements with all-electron explicitly correlated Gaussian functions for quantum-mechanical calculations of atoms with two p electrons or a single d electron have been derived and implemented. The Hamiltonian used in the approach was obtained by rigorously separating the center-of-mass motion and it explicitly depends on the finite mass of the nucleus. The approach was employed to perform test calculations on the isotopes of the carbon atom in their ground electronic states and to determine the finite-nuclear-mass corrections for these states.

  15. Effects of auditory information on self-motion perception during simultaneous presentation of visual shearing motion

    PubMed Central

    Tanahashi, Shigehito; Ashihara, Kaoru; Ujike, Hiroyasu

    2015-01-01

    Recent studies have found that self-motion perception induced by simultaneous presentation of visual and auditory motion is facilitated when the directions of visual and auditory motion stimuli are identical. They did not, however, examine possible contributions of auditory motion information for determining direction of self-motion perception. To examine this, a visual stimulus projected on a hemisphere screen and an auditory stimulus presented through headphones were presented separately or simultaneously, depending on experimental conditions. The participant continuously indicated the direction and strength of self-motion during the 130-s experimental trial. When the visual stimulus with a horizontal shearing rotation and the auditory stimulus with a horizontal one-directional rotation were presented simultaneously, the duration and strength of self-motion perceived in the opposite direction of the auditory rotation stimulus were significantly longer and stronger than those perceived in the same direction of the auditory rotation stimulus. However, the auditory stimulus alone could not sufficiently induce self-motion perception, and if it did, its direction was not consistent within each experimental trial. We concluded that auditory motion information can determine perceived direction of self-motion during simultaneous presentation of visual and auditory motion information, at least when visual stimuli moved in opposing directions (around the yaw-axis). We speculate that the contribution of auditory information depends on the plausibility and information balance of visual and auditory information. PMID:26113828

  16. Motion capture for human motion measuring by using single camera with triangle markers

    NASA Astrophysics Data System (ADS)

    Takahashi, Hidenori; Tanaka, Takayuki; Kaneko, Shun'ichi

    2005-12-01

    This study aims to realize a motion capture for measuring 3D human motions by using single camera. Although motion capture by using multiple cameras is widely used in sports field, medical field, engineering field and so on, optical motion capture method with one camera is not established. In this paper, the authors achieved a 3D motion capture by using one camera, named as Mono-MoCap (MMC), on the basis of two calibration methods and triangle markers which each length of side is given. The camera calibration methods made 3D coordinates transformation parameter and a lens distortion parameter with Modified DLT method. The triangle markers enabled to calculate a coordinate value of a depth direction on a camera coordinate. Experiments of 3D position measurement by using the MMC on a measurement space of cubic 2 m on each side show an average error of measurement of a center of gravity of a triangle marker was less than 2 mm. As compared with conventional motion capture method by using multiple cameras, the MMC has enough accuracy for 3D measurement. Also, by putting a triangle marker on each human joint, the MMC was able to capture a walking motion, a standing-up motion and a bending and stretching motion. In addition, a method using a triangle marker together with conventional spherical markers was proposed. Finally, a method to estimate a position of a marker by measuring the velocity of the marker was proposed in order to improve the accuracy of MMC.

  17. Motion Simulation Research Related Short Term Training Attachment to TARDEC

    DTIC Science & Technology

    2013-04-01

    CASSI group has five main areas of focus, which are, ground vehicle power and mobility , vehicle electronics and architecture, intelligent ground...control, steering as well as seats can all be changed to mock the necessary vehicle. Originally it was designed for a High Mobility Multipurpose Wheeled...necessary outputs to the motion base. SimCreator is a software package, similar to SimuLink. Most of the backend coding is done in C++. RTI accounts

  18. A Generalized-Compliant-Motion Primitive

    NASA Technical Reports Server (NTRS)

    Backes, Paul G.

    1993-01-01

    Computer program bridges gap between planning and execution of compliant robotic motions developed and installed in control system of telerobot. Called "generalized-compliant-motion primitive," one of several task-execution-primitive computer programs, which receives commands from higher-level task-planning programs and executes commands by generating required trajectories and applying appropriate control laws. Program comprises four parts corresponding to nominal motion, compliant motion, ending motion, and monitoring. Written in C language.

  19. Orbit-attitude coupled motion around small bodies: Sun-synchronous orbits with Sun-tracking attitude motion

    NASA Astrophysics Data System (ADS)

    Kikuchi, Shota; Howell, Kathleen C.; Tsuda, Yuichi; Kawaguchi, Jun'ichiro

    2017-11-01

    The motion of a spacecraft in proximity to a small body is significantly perturbed due to its irregular gravity field and solar radiation pressure. In such a strongly perturbed environment, the coupling effect of the orbital and attitude motions exerts a large influence that cannot be neglected. However, natural orbit-attitude coupled dynamics around small bodies that are stationary in both orbital and attitude motions have yet to be observed. The present study therefore investigates natural coupled motion that involves both a Sun-synchronous orbit and Sun-tracking attitude motion. This orbit-attitude coupled motion enables a spacecraft to maintain its orbital geometry and attitude state with respect to the Sun without requiring active control. Therefore, the proposed method can reduce the use of an orbit and attitude control system. This paper first presents analytical conditions to achieve Sun-synchronous orbits and Sun-tracking attitude motion. These analytical solutions are then numerically propagated based on non-linear coupled orbit-attitude equations of motion. Consequently, the possibility of implementing Sun-synchronous orbits with Sun-tracking attitude motion is demonstrated.

  20. The Global Education Practicum: Perspectives from Accompanying Academics

    ERIC Educational Resources Information Center

    Lang, Catherine; Cacciattolo, Marcelle; Kidman, Gillian

    2017-01-01

    The benefits of international education experiences for students are well documented. The effect on the individual of international experiences has been researched and theorised by authors for at least the last 20 years. In this paper the experiences of three academics who accompanied pre-service teachers on a 3 week international practicum are…