Sample records for acetic acid bacterial

  1. Antibiofilm Properties of Acetic Acid

    PubMed Central

    Bjarnsholt, Thomas; Alhede, Morten; Jensen, Peter Østrup; Nielsen, Anne K.; Johansen, Helle Krogh; Homøe, Preben; Høiby, Niels; Givskov, Michael; Kirketerp-Møller, Klaus

    2015-01-01

    Bacterial biofilms are known to be extremely tolerant toward antibiotics and other antimicrobial agents. These biofilms cause the persistence of chronic infections. Since antibiotics rarely resolve these infections, the only effective treatment of chronic infections is surgical removal of the infected implant, tissue, or organ and thereby the biofilm. Acetic acid is known for its antimicrobial effect on bacteria in general, but has never been thoroughly tested for its efficacy against bacterial biofilms. In this article, we describe complete eradication of both Gram-positive and Gram-negative biofilms using acetic acid both as a liquid and as a dry salt. In addition, we present our clinical experience of acetic acid treatment of chronic wounds. In conclusion, we here present the first comprehensive in vitro and in vivo testing of acetic acid against bacterial biofilms. PMID:26155378

  2. Comparison of Cultivable Acetic Acid Bacterial Microbiota in Organic and Conventional Apple Cider Vinegar.

    PubMed

    Štornik, Aleksandra; Skok, Barbara; Trček, Janja

    2016-03-01

    Organic apple cider vinegar is produced from apples that go through very restricted treatment in orchard. During the first stage of the process, the sugars from apples are fermented by yeasts to cider. The produced ethanol is used as a substrate by acetic acid bacteria in a second separated bioprocess. In both, the organic and conventional apple cider vinegars the ethanol oxidation to acetic acid is initiated by native microbiota that survived alcohol fermentation. We compared the cultivable acetic acid bacterial microbiota in the production of organic and conventional apple cider vinegars from a smoothly running oxidation cycle of a submerged industrial process. In this way we isolated and characterized 96 bacteria from organic and 72 bacteria from conventional apple cider vinegar. Using the restriction analysis of the PCR-amplified 16S-23S rRNA gene ITS regions, we identified four different Hae III and five different Hpa II restriction profiles for bacterial isolates from organic apple cider vinegar. Each type of restriction profile was further analyzed by sequence analysis of the 16S-23S rRNA gene ITS regions, resulting in identification of the following species: Acetobacter pasteurianus (71.90%), Acetobacter ghanensis (12.50%), Komagataeibacter oboediens (9.35%) and Komagataeibacter saccharivorans (6.25%). Using the same analytical approach in conventional apple cider vinegar, we identified only two different Hae III and two different Hpa II restriction profiles of the 16S‒23S rRNA gene ITS regions, which belong to the species Acetobacter pasteurianus (66.70%) and Komagataeibacter oboediens (33.30%). Yeasts that are able to resist 30 g/L of acetic acid were isolated from the acetic acid production phase and further identified by sequence analysis of the ITS1-5.8S rDNA‒ITS2 region as Candida ethanolica , Pichia membranifaciens and Saccharomycodes ludwigii . This study has shown for the first time that the bacterial microbiota for the industrial production of

  3. Comparison of Cultivable Acetic Acid Bacterial Microbiota in Organic and Conventional Apple Cider Vinegar

    PubMed Central

    Štornik, Aleksandra; Skok, Barbara

    2016-01-01

    Summary Organic apple cider vinegar is produced from apples that go through very restricted treatment in orchard. During the first stage of the process, the sugars from apples are fermented by yeasts to cider. The produced ethanol is used as a substrate by acetic acid bacteria in a second separated bioprocess. In both, the organic and conventional apple cider vinegars the ethanol oxidation to acetic acid is initiated by native microbiota that survived alcohol fermentation. We compared the cultivable acetic acid bacterial microbiota in the production of organic and conventional apple cider vinegars from a smoothly running oxidation cycle of a submerged industrial process. In this way we isolated and characterized 96 bacteria from organic and 72 bacteria from conventional apple cider vinegar. Using the restriction analysis of the PCR-amplified 16S−23S rRNA gene ITS regions, we identified four different HaeIII and five different HpaII restriction profiles for bacterial isolates from organic apple cider vinegar. Each type of restriction profile was further analyzed by sequence analysis of the 16S−23S rRNA gene ITS regions, resulting in identification of the following species: Acetobacter pasteurianus (71.90%), Acetobacter ghanensis (12.50%), Komagataeibacter oboediens (9.35%) and Komagataeibacter saccharivorans (6.25%). Using the same analytical approach in conventional apple cider vinegar, we identified only two different HaeIII and two different HpaII restriction profiles of the 16S‒23S rRNA gene ITS regions, which belong to the species Acetobacter pasteurianus (66.70%) and Komagataeibacter oboediens (33.30%). Yeasts that are able to resist 30 g/L of acetic acid were isolated from the acetic acid production phase and further identified by sequence analysis of the ITS1−5.8S rDNA‒ITS2 region as Candida ethanolica, Pichia membranifaciens and Saccharomycodes ludwigii. This study has shown for the first time that the bacterial microbiota for the industrial

  4. Simultaneous production of acetic and gluconic acids by a thermotolerant Acetobacter strain during acetous fermentation in a bioreactor.

    PubMed

    Mounir, Majid; Shafiei, Rasoul; Zarmehrkhorshid, Raziyeh; Hamouda, Allal; Ismaili Alaoui, Mustapha; Thonart, Philippe

    2016-02-01

    The activity of bacterial strains significantly influences the quality and the taste of vinegar. Previous studies of acetic acid bacteria have primarily focused on the ability of bacterial strains to produce high amounts of acetic acid. However, few studies have examined the production of gluconic acid during acetous fermentation at high temperatures. The production of vinegar at high temperatures by two strains of acetic acid bacteria isolated from apple and cactus fruits, namely AF01 and CV01, respectively, was evaluated in this study. The simultaneous production of gluconic and acetic acids was also examined in this study. Biochemical and molecular identification based on a 16s rDNA sequence analysis confirmed that these strains can be classified as Acetobacter pasteurianus. To assess the ability of the isolated strains to grow and produce acetic acid and gluconic acid at high temperatures, a semi-continuous fermentation was performed in a 20-L bioreactor. The two strains abundantly grew at a high temperature (41°C). At the end of the fermentation, the AF01 and CV01 strains yielded acetic acid concentrations of 7.64% (w/v) and 10.08% (w/v), respectively. Interestingly, CV01 was able to simultaneously produce acetic and gluconic acids during acetic fermentation, whereas AF01 mainly produced acetic acid. In addition, CV01 was less sensitive to ethanol depletion during semi-continuous fermentation. Finally, the enzymatic study showed that the two strains exhibited high ADH and ALDH enzyme activity at 38°C compared with the mesophilic reference strain LMG 1632, which was significantly susceptible to thermal inactivation. Copyright © 2015 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  5. Analysis of Bacterial Diversity During Acetic Acid Fermentation of Tianjin Duliu Aged Vinegar by 454 Pyrosequencing.

    PubMed

    Peng, Qian; Yang, Yanping; Guo, Yanyun; Han, Ye

    2015-08-01

    The vinegar pei harbors complex bacterial communities. Prior studies revealing the bacterial diversity involved were mainly conducted by culture-dependent methods and PCR-DGGE. In this study, 454 pyrosequencing was used to investigate the bacterial communities in vinegar pei during the acetic acid fermentation (AAF) of Tianjin Duliu aged vinegar (TDAV). The results showed that there were 7 phyla and 24 families existing in the vinegar pei, with 2 phyla (Firmicutes, Protebacteria) and 4 families (Lactobacillaceae, Acetobacteracae, Enterobacteriaceae, Chloroplast) predominating. The genus-level identification revealed that 9 genera were the relatively stable, consistent components in different stages of AAF, including the most abundant genus Lactobacillus followed by Acetobacter and Serratia. Additionally, the bacterial community in the early fermentation stage was more complex than those in the later stages, indicating that the accumulation of organic acids provided an appropriate environment to filter unwanted bacteria and to accelerate the growth of required ones. This study provided basic information of bacterial patterns in vinegar pei and relevant changes during AAF of TDAV, and could be used as references in the following study on the implementation of starter culture as well as the improvement of AAF process.

  6. Bacterial dynamics and metabolite changes in solid-state acetic acid fermentation of Shanxi aged vinegar.

    PubMed

    Li, Sha; Li, Pan; Liu, Xiong; Luo, Lixin; Lin, Weifeng

    2016-05-01

    Solid-state acetic acid fermentation (AAF), a natural or semi-controlled fermentation process driven by reproducible microbial communities, is an important technique to produce traditional Chinese cereal vinegars. Highly complex microbial communities and metabolites are involved in traditional Chinese solid-state AAF, but the association between microbiota and metabolites during this process are still poorly understood. In this study, we performed amplicon 16S rRNA gene sequencing on the Illumina MiSeq platform, PCR-denaturing gradient gel electrophoresis, and metabolite analysis to trace the bacterial dynamics and metabolite changes under AAF process. A succession of bacterial assemblages was observed during the AAF process. Lactobacillales dominated all the stages. However, Acetobacter species in Rhodospirillales were considerably accelerated during AAF until the end of fermentation. Quantitative PCR results indicated that the biomass of total bacteria showed a "system microbe self-domestication" process in the first 3 days, and then peaked at the seventh day before gradually decreasing until the end of AAF. Moreover, a total of 88 metabolites, including 8 organic acids, 16 free amino acids, and 66 aroma compounds were detected during AAF. Principal component analysis and cluster analyses revealed the high correlation between the dynamics of bacterial community and metabolites.

  7. Acetate accumulation enhances mixed culture fermentation of biomass to lactic acid.

    PubMed

    Khor, Way Cern; Roume, Hugo; Coma, Marta; Vervaeren, Han; Rabaey, Korneel

    2016-10-01

    Lactic acid is a high-in-demand chemical, which can be produced through fermentation of lignocellulosic feedstock. However, fermentation of complex substrate produces a mixture of products at efficiencies too low to justify a production process. We hypothesized that the background acetic acid concentration plays a critical role in lactic acid yield; therefore, its retention via selective extraction of lactic acid or its addition would improve overall lactic acid production and eliminate net production of acetic acid. To test this hypothesis, we added 10 g/L of acetate to fermentation broth to investigate its effect on products composition and concentration and bacterial community evolution using several substrate-inoculum combinations. With rumen fluid inoculum, lactate concentrations increased by 80 ± 12 % (cornstarch, p < 0.05) and 16.7 ± 0.4 % (extruded grass, p < 0.05) while with pure culture inoculum (Lactobacillus delbrueckii and genetically modified (GM) Escherichia coli), a 4 to 23 % increase was observed. Using rumen fluid inoculum, the bacterial community was enriched within 8 days to >69 % lactic acid bacteria (LAB), predominantly Lactobacillaceae. Higher acetate concentration promoted a more diverse LAB population, especially on non-inoculated bottles. In subsequent tests, acetate was added in a semi-continuous percolation system with grass as substrate. These tests confirmed our findings producing lactate at concentrations 26 ± 5 % (p < 0.05) higher than the control reactor over 20 days operation. Overall, our work shows that recirculating acetate has the potential to boost lactic acid production from waste biomass to levels more attractive for application.

  8. Overview on mechanisms of acetic acid resistance in acetic acid bacteria.

    PubMed

    Wang, Bin; Shao, Yanchun; Chen, Fusheng

    2015-02-01

    Acetic acid bacteria (AAB) are a group of gram-negative or gram-variable bacteria which possess an obligate aerobic property with oxygen as the terminal electron acceptor, meanwhile transform ethanol and sugar to corresponding aldehydes, ketones and organic acids. Since the first genus Acetobacter of AAB was established in 1898, 16 AAB genera have been recorded so far. As the main producer of a world-wide condiment, vinegar, AAB have evolved an elegant adaptive system that enables them to survive and produce a high concentration of acetic acid. Some researches and reviews focused on mechanisms of acid resistance in enteric bacteria and made the mechanisms thoroughly understood, while a few investigations did in AAB. As the related technologies with proteome, transcriptome and genome were rapidly developed and applied to AAB research, some plausible mechanisms conferring acetic acid resistance in some AAB strains have been published. In this review, the related mechanisms of AAB against acetic acid with acetic acid assimilation, transportation systems, cell morphology and membrane compositions, adaptation response, and fermentation conditions will be described. Finally, a framework for future research for anti-acid AAB will be provided.

  9. Acetic acid production from food wastes using yeast and acetic acid bacteria micro-aerobic fermentation.

    PubMed

    Li, Yang; He, Dongwei; Niu, Dongjie; Zhao, Youcai

    2015-05-01

    In this study, yeast and acetic acid bacteria strains were adopted to enhance the ethanol-type fermentation resulting to a volatile fatty acids yield of 30.22 g/L, and improve acetic acid production to 25.88 g/L, with food wastes as substrate. In contrast, only 12.81 g/L acetic acid can be obtained in the absence of strains. The parameters such as pH, oxidation reduction potential and volatile fatty acids were tested and the microbial diversity of different strains and activity of hydrolytic ferment were investigated to reveal the mechanism. The optimum pH and oxidation reduction potential for the acetic acid production were determined to be at 3.0-3.5 and -500 mV, respectively. Yeast can convert organic matters into ethanol, which is used by acetic acid bacteria to convert the organic wastes into acetic acid. The acetic acid thus obtained from food wastes micro-aerobic fermentation liquid could be extracted by distillation to get high-pure acetic acid.

  10. [Physiological response to acetic acid stress of Acetobacter pasteuranus during vinegar fermentation].

    PubMed

    Qi, Zhengliang; Yang, Hailin; Xia, Xiaole; Wang, Wu; Leng, Yunwei; Yu, Xiaobin; Quan, Wu

    2014-03-04

    The aim of the study is to propose a dynamic acetic acid resistance mechanism through analysis on response of cellular morphology, physiology and metabolism of A. pasteurianus CICIM B7003 during vinegar fermentation. Vinegar fermentation was carried out in a Frings 9 L acetator by strain B7003 and cultures were sampled at different cellular growth phases. Simultaneously, percentage of capsular polysaccharide versus dry cells weight, ratio of unsaturated fatty acids to saturated fatty acids, transcription of acetic acid resistance genes, activity of alcohol respiratory chain enzymes and ATPase were detected for these samples to assay the responses of bacterial morphology, physiology and metabolism. When acetic acid was existed, no obvious capsular polysaccharide was secreted by cells. As vinegar fermentation proceeding, percentage of capsular polysaccharide versus dry cells weight was reduced from 2.5% to 0.89%. Ratio of unsaturated fatty acids to saturated fatty acids was increased obviously which can improve membrane fluidity. Also transcription level of acetic acid resistance genes was promoted. Interestingly, activity of alcohol respiratory chain and ATPase was not inhibited but promoted obviously with acetic acid accumulation which could provide enough energy for acetic acid resistance mechanism. On the basis of the results obtained from the experiment, A. pasteurianus CICIM B7003 relies mainly on the cooperation of changes of extracellular capsular polysaccharide and membrane fatty acids, activation of acid resistance genes transcription, enhancement of activity of alcohol respiratory chain and rapid energy production to tolerate acidic environment.

  11. Acetobacter pasteurianus metabolic change induced by initial acetic acid to adapt to acetic acid fermentation conditions.

    PubMed

    Zheng, Yu; Zhang, Renkuan; Yin, Haisong; Bai, Xiaolei; Chang, Yangang; Xia, Menglei; Wang, Min

    2017-09-01

    Initial acetic acid can improve the ethanol oxidation rate of acetic acid bacteria for acetic acid fermentation. In this work, Acetobacter pasteurianus was cultured in ethanol-free medium, and energy production was found to increase by 150% through glucose consumption induced by initial acetic acid. However, oxidation of ethanol, instead of glucose, became the main energy production pathway when upon culturing ethanol containing medium. Proteome assay was used to analyze the metabolism change induced by initial acetic acid, which provided insight into carbon metabolic and energy regulation of A. pasteurianus to adapt to acetic acid fermentation conditions. Results were further confirmed by quantitative real-time PCR. In summary, decreased intracellular ATP as a result of initial acetic acid inhibition improved the energy metabolism to produce more energy and thus adapt to the acetic acid fermentation conditions. A. pasteurianus upregulated the expression of enzymes related to TCA and ethanol oxidation to improve the energy metabolism pathway upon the addition of initial acetic acid. However, enzymes involved in the pentose phosphate pathway, the main pathway of glucose metabolism, were downregulated to induce a change in carbon metabolism. Additionally, the enhancement of alcohol dehydrogenase expression promoted ethanol oxidation and strengthened the acetification rate, thereby producing a strong proton motive force that was necessary for energy production and cell tolerance to acetic acid.

  12. Acetic acid fermentation of acetobacter pasteurianus: relationship between acetic acid resistance and pellicle polysaccharide formation.

    PubMed

    Kanchanarach, Watchara; Theeragool, Gunjana; Inoue, Taketo; Yakushi, Toshiharu; Adachi, Osao; Matsushita, Kazunobu

    2010-01-01

    Acetobacter pasteurianus strains IFO3283, SKU1108, and MSU10 were grown under acetic acid fermentation conditions, and their growth behavior was examined together with their capacity for acetic acid resistance and pellicle formation. In the fermentation process, the cells became aggregated and covered by amorphous materials in the late-log and stationary phases, but dispersed again in the second growth phase (due to overoxidation). The morphological change in the cells was accompanied by changes in sugar contents, which might be related to pellicle polysaccharide formation. To determine the relationship between pellicle formation and acetic acid resistance, a pellicle-forming R strain and a non-forming S strain were isolated, and their fermentation ability and acetic acid diffusion activity were compared. The results suggest that pellicle formation is directly related to acetic acid resistance ability, and thus is important to acetic acid fermentation in these A. pasteurianus strains.

  13. Oxidation of indole-3-acetic acid and oxindole-3-acetic acid to 2,3-dihydro-7-hydroxy-2-oxo-1H indole-3-acetic acid-7'-O-beta-D-glucopyranoside in Zea mays seedlings

    NASA Technical Reports Server (NTRS)

    Nonhebel, H. M.; Bandurski, R. S.

    1984-01-01

    Radiolabeled oxindole-3-acetic acid was metabolized by roots, shoots, and caryopses of dark grown Zea mays seedlings to 2,3-dihydro-7-hydroxy-2-oxo-1H indole-3-acetic acid-7'-O-beta-D-glycopyranoside with the simpler name of 7-hydroxyoxindole-3-acetic acid-glucoside. This compound was also formed from labeled indole-3-acetic acid supplied to intact seedlings and root segments. The glucoside of 7-hydroxyoxindole-3-acetic acid was also isolated as an endogenous compound in the caryopses and shoots of 4-day-old seedlings. It accumulates to a level of 4.8 nanomoles per plant in the kernel, more than 10 times the amount of oxindole-3-acetic acid. In the shoot it is present at levels comparable to that of oxindole-3-acetic acid and indole-3-acetic acid (62 picomoles per shoot). We conclude that 7-hydroxyoxindole-3-acetic acid-glucoside is a natural metabolite of indole-3-acetic acid in Z. mays seedlings. From the data presented in this paper and in previous work, we propose the following route as the principal catabolic pathway for indole-3-acetic acid in Zea seedlings: Indole-3-acetic acid --> Oxindole-3-acetic acid --> 7-Hydroxyoxindole-3-acetic acid --> 7-Hydroxyoxindole-3-acetic acid-glucoside.

  14. Change in the plasmid copy number in acetic acid bacteria in response to growth phase and acetic acid concentration.

    PubMed

    Akasaka, Naoki; Astuti, Wiwik; Ishii, Yuri; Hidese, Ryota; Sakoda, Hisao; Fujiwara, Shinsuke

    2015-06-01

    Plasmids pGE1 (2.5 kb), pGE2 (7.2 kb), and pGE3 (5.5 kb) were isolated from Gluconacetobacter europaeus KGMA0119, and sequence analyses revealed they harbored 3, 8, and 4 genes, respectively. Plasmid copy numbers (PCNs) were determined by real-time quantitative PCR at different stages of bacterial growth. When KGMA0119 was cultured in medium containing 0.4% ethanol and 0.5% acetic acid, PCN of pGE1 increased from 7 copies/genome in the logarithmic phase to a maximum of 12 copies/genome at the beginning of the stationary phase, before decreasing to 4 copies/genome in the late stationary phase. PCNs for pGE2 and pGE3 were maintained at 1-3 copies/genome during all phases of growth. Under a higher concentration of ethanol (3.2%) the PCN for pGE1 was slightly lower in all the growth stages, and those of pGE2 and pGE3 were unchanged. In the presence of 1.0% acetic acid, PCNs were higher for pGE1 (10 copies/genome) and pGE3 (6 copies/genome) during the logarithmic phase. Numbers for pGE2 did not change, indicating that pGE1 and pGE3 increase their PCNs in response to acetic acid. Plasmids pBE2 and pBE3 were constructed by ligating linearized pGE2 and pGE3 into pBR322. Both plasmids were replicable in Escherichia coli, Acetobacter pasteurianus and G. europaeus, highlighting their suitability as vectors for acetic acid bacteria. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  15. Effect of acetic acid on ethanol production by Zymomonas mobilis mutant strains through continuous adaptation.

    PubMed

    Liu, Yu-Fan; Hsieh, Chia-Wen; Chang, Yao-Sheng; Wung, Being-Sun

    2017-08-01

    Acetic acid is a predominant by-product of lignocellulosic biofuel process, which inhibits microbial biocatalysts. Development of bacterial strains that are tolerant to acetic acid is challenging due to poor understanding of the underlying molecular mechanisms. In this study, we generated and characterized two acetic acid-tolerant strains of Zymomonas mobilis using N-methyl-N'-nitro-N-nitrosoguanidine (NTG)-acetate adaptive breeding. Two mutants, ZMA-142 and ZMA-167, were obtained, showing a significant growth rate at a concentration of 244 mM sodium acetate, while the growth of Z. mobilis ATCC 31823 were completely inhibited in presence of 195 mM sodium acetate. Our data showed that acetate-tolerance of ZMA-167 was attributed to a co-transcription of nhaA from ZMO0117, whereas the co-transcription was absent in ATCC 31823 and ZMA-142. Moreover, ZMA-142 and ZMA-167 exhibited a converstion rate (practical ethanol yield to theorical ethanol yield) of 90.16% and 86% at 195 mM acetate-pH 5 stress condition, respectively. We showed that acid adaptation of ZMA-142 and ZMA-167 to 146 mM acetate increased ZMA-142 and ZMA-167 resulted in an increase in ethanol yield by 32.21% and 21.16% under 195 mM acetate-pH 5 stress condition, respectively. The results indicate the acetate-adaptive seed culture of acetate-tolerant strains, ZMA-142 and ZMA-167, could enhance the ethanol production during fermentation.

  16. Measurement of the rates of oxindole-3-acetic acid turnover, and indole-3-acetic acid oxidation in Zea mays seedlings

    NASA Technical Reports Server (NTRS)

    Nonhebel, H. M.; Bandurski, R. S. (Principal Investigator)

    1986-01-01

    Oxindole-3-acetic acid is the principal catabolite of indole-3-acetic acid in Zea mays seedlings. In this paper measurements of the turnover of oxindole-3-acetic acid are presented and used to calculate the rate of indole-3-acetic acid oxidation. [3H]Oxindole-3-acetic acid was applied to the endosperm of Zea mays seedlings and allowed to equilibrate for 24 h before the start of the experiment. The subsequent decrease in its specific activity was used to calculate the turnover rate. The average half-life of oxindole-3-acetic acid in the shoots was found to be 30 h while that in the kernels had an average half-life of 35h. Using previously published values of the pool sizes of oxindole-3-acetic acid in shoots and kernels from seedlings of the same age and variety, and grown under the same conditions, the rate of indole-3-acetic acid oxidation was calculated to be 1.1 pmol plant-1 h-1 in the shoots and 7.1 pmol plant-1 h-1 in the kernels.

  17. Mechanism of Indole-3-acetic Acid Conjugation

    PubMed Central

    Goren, Raphael; Bukovac, Martin J.; Flore, James A.

    1974-01-01

    Formation of indole-3-acetic acid-aspartate in detached primary leaves of cowpea (Vigna sinensis Endl.) floating on 14C-indole-3-acetic acid (3 μc; 3.15 μm, phosphate-citrate buffer, pH 4.75), almost doubled when leaves were pretreated with 31.5 μm12C-indole-3-acetic acid for 17 hr and then transferred to 14C-indole-3-acetic acid for 4 hours as compared with leaves preincubated in buffer only. When leaves were preincubated with ethylene (11.0 and 104 μl/l) instead of 12C-indole-3-acetic acid, no induction of indole-3-acetylaspartic acid formation was observed, and the rate of indole-3-acetylaspartic acid formation decreased as compared with control leaves. Rhizobitoxine (1.87 μm) inhibited indole-3-acetic acid-induced ethylene production but did not prevent the formation of indole-3-acetylaspartic acid. In view of the similarity of these results and those previously obtained with α-naphthaleneacetic acid, it is concluded that ethylene has no role in the auxin-induced indole-3-acetylaspartic acid formation in cowpea leaves. PMID:16658669

  18. Oxidation of indole-3-acetic acid to oxindole-3-acetic acid by an enzyme preparation from Zea mays

    NASA Technical Reports Server (NTRS)

    Reinecke, D. M.; Bandurski, R. S.

    1988-01-01

    Indole-3-acetic acid is oxidized to oxindole-3-acetic acid by Zea mays tissue extracts. Shoot, root, and endosperm tissues have enzyme activities of 1 to 10 picomoles per hour per milligram protein. The enzyme is heat labile, is soluble, and requires oxygen for activity. Cofactors of mixed function oxygenase, peroxidase, and intermolecular dioxygenase are not stimulatory to enzymic activity. A heat-stable, detergent-extractable component from corn enhances enzyme activity 6- to 10-fold. This is the first demonstration of the in vitro enzymic oxidation of indole-3-acetic acid to oxindole-3-acetic acid in higher plants.

  19. Different temperatures select distinctive acetic acid bacteria species and promotes organic acids production during Kombucha tea fermentation.

    PubMed

    De Filippis, Francesca; Troise, Antonio Dario; Vitaglione, Paola; Ercolini, Danilo

    2018-08-01

    Kombucha is a traditional beverage produced by tea fermentation, carried out by a symbiotic consortium of bacteria and yeasts. Acetic Acid Bacteria (AAB) usually dominate the bacterial community of Kombucha, driving the fermentative process. The consumption of this beverage was often associated to beneficial effects for the health, due to its antioxidant and detoxifying properties. We characterized bacterial populations of Kombucha tea fermented at 20 or 30 °C by using culture-dependent and -independent methods and monitored the concentration of gluconic and glucuronic acids, as well as of total polyphenols. We found significant differences in the microbiota at the two temperatures. Moreover, different species of Gluconacetobacter were selected, leading to a differential abundance of gluconic and glucuronic acids. Copyright © 2018 Elsevier Ltd. All rights reserved.

  20. Measurement and correlation of the solubility of gossypol acetic acid and gossypol acetic acid of optical activity in different solvents

    NASA Astrophysics Data System (ADS)

    Zhang, B.; Tang, H.; Liu, X. Y.; Zhai, X.; Yao, X. C.

    2018-01-01

    The equilibrium method was used to measure the solubility of gossypol acetic acid and gossypol acetic acid of optical activity in isopropyl alcohol, ethanol, acetic acid and ethyl acetate at temperature from 288.15 to 315.15. The Empirical equation and the Apelblat equation model were adopted to correlate the experimental data. For gossypol acetic acid, the root-mean-square deviations (RMSD) were observed in the range of 0.023-4.979 and 0.0112-0.614 for the Empirical equation and the Apelblat equation, respectively. For gossypol acetic acid of optical activity, the RMSD were observed in the range of 0.021-2.211 and 0.021-2.243 for the Empirical equation and the Apelblat equation, individually. And the maximum relative average deviation was 7.5%. Both equations offered an accurate mathematical expression of the experimental results. The calculated solubility showed a good relationship with the experimental solubility for most of solvents. This study provided valuable datas not only for optimizing the process of purification of gossypol acetic acid of optical activity in industry but also for further theoretical studies.

  1. Alcohols enhance the rate of acetic acid diffusion in S. cerevisiae: biophysical mechanisms and implications for acetic acid tolerance.

    PubMed

    Lindahl, Lina; Genheden, Samuel; Faria-Oliveira, Fábio; Allard, Stefan; Eriksson, Leif A; Olsson, Lisbeth; Bettiga, Maurizio

    2017-12-01

    Microbial cell factories with the ability to maintain high productivity in the presence of weak organic acids, such as acetic acid, are required in many industrial processes. For example, fermentation media derived from lignocellulosic biomass are rich in acetic acid and other weak acids. The rate of diffusional entry of acetic acid is one parameter determining the ability of microorganisms to tolerance the acid. The present study demonstrates that the rate of acetic acid diffusion in S. cerevisiae is strongly affected by the alcohols ethanol and n-butanol. Ethanol of 40 g/L and n-butanol of 8 g/L both caused a 65% increase in the rate of acetic acid diffusion, and higher alcohol concentrations caused even greater increases. Molecular dynamics simulations of membrane dynamics in the presence of alcohols demonstrated that the partitioning of alcohols to the head group region of the lipid bilayer causes a considerable increase in the membrane area, together with reduced membrane thickness and lipid order. These changes in physiochemical membrane properties lead to an increased number of water molecules in the membrane interior, providing biophysical mechanisms for the alcohol-induced increase in acetic acid diffusion rate. n-butanol affected S. cerevisiae and the cell membrane properties at lower concentrations than ethanol, due to greater and deeper partitioning in the membrane. This study demonstrates that the rate of acetic acid diffusion can be strongly affected by compounds that partition into the cell membrane, and highlights the need for considering interaction effects between compounds in the design of microbial processes.

  2. Alcohols enhance the rate of acetic acid diffusion in S. cerevisiae: biophysical mechanisms and implications for acetic acid tolerance

    PubMed Central

    Lindahl, Lina; Genheden, Samuel; Faria-Oliveira, Fábio; Allard, Stefan; Eriksson, Leif A.; Olsson, Lisbeth; Bettiga, Maurizio

    2017-01-01

    Microbial cell factories with the ability to maintain high productivity in the presence of weak organic acids, such as acetic acid, are required in many industrial processes. For example, fermentation media derived from lignocellulosic biomass are rich in acetic acid and other weak acids. The rate of diffusional entry of acetic acid is one parameter determining the ability of microorganisms to tolerance the acid. The present study demonstrates that the rate of acetic acid diffusion in S. cerevisiae is strongly affected by the alcohols ethanol and n-butanol. Ethanol of 40 g/L and n-butanol of 8 g/L both caused a 65% increase in the rate of acetic acid diffusion, and higher alcohol concentrations caused even greater increases. Molecular dynamics simulations of membrane dynamics in the presence of alcohols demonstrated that the partitioning of alcohols to the head group region of the lipid bilayer causes a considerable increase in the membrane area, together with reduced membrane thickness and lipid order. These changes in physiochemical membrane properties lead to an increased number of water molecules in the membrane interior, providing biophysical mechanisms for the alcohol-induced increase in acetic acid diffusion rate. n-butanol affected S. cerevisiae and the cell membrane properties at lower concentrations than ethanol, due to greater and deeper partitioning in the membrane. This study demonstrates that the rate of acetic acid diffusion can be strongly affected by compounds that partition into the cell membrane, and highlights the need for considering interaction effects between compounds in the design of microbial processes. PMID:29354649

  3. Omics analysis of acetic acid tolerance in Saccharomyces cerevisiae.

    PubMed

    Geng, Peng; Zhang, Liang; Shi, Gui Yang

    2017-05-01

    Acetic acid is an inhibitor in industrial processes such as wine making and bioethanol production from cellulosic hydrolysate. It causes energy depletion, inhibition of metabolic enzyme activity, growth arrest and ethanol productivity losses in Saccharomyces cerevisiae. Therefore, understanding the mechanisms of the yeast responses to acetic acid stress is essential for improving acetic acid tolerance and ethanol production. Although 329 genes associated with acetic acid tolerance have been identified in the Saccharomyces genome and included in the database ( http://www.yeastgenome.org/observable/resistance_to_acetic_acid/overview ), the cellular mechanistic responses to acetic acid remain unclear in this organism. Post-genomic approaches such as transcriptomics, proteomics, metabolomics and chemogenomics are being applied to yeast and are providing insight into the mechanisms and interactions of genes, proteins and other components that together determine complex quantitative phenotypic traits such as acetic acid tolerance. This review focuses on these omics approaches in the response to acetic acid in S. cerevisiae. Additionally, several novel strains with improved acetic acid tolerance have been engineered by modifying key genes, and the application of these strains and recently acquired knowledge to industrial processes is also discussed.

  4. Modification of wheat starch with succinic acid/acetic anhydride and azelaic acid/acetic anhydride mixtures I. Thermophysical and pasting properties.

    PubMed

    Subarić, Drago; Ačkar, Durđica; Babić, Jurislav; Sakač, Nikola; Jozinović, Antun

    2014-10-01

    The aim of this research was to investigate the influence of modification with succinic acid/acetic anhydride and azelaic acid/acetic anhydride mixtures on thermophysical and pasting properties of wheat starch. Starch was isolated from two wheat varieties and modified with mixtures of succinic acid and acetic anhydride, and azelaic acid and acetic anhydride in 4, 6 and 8 % (w/w). Thermophysical, pasting properties, swelling power, solubility and amylose content of modified starches were determined. The results showed that modifications with mixtures of afore mentioned dicarboxylic acids with acetic anhydride decreased gelatinisation and pasting temperatures. Gelatinisation enthalpy of Golubica starch increased, while of Srpanjka starch decreased by modifications. Retrogradation after 7 and 14 day-storage at 4 °C decreased after modifications of both starches. Maximum, hot and cold paste viscosity of both starches increased, while stability during shearing at high temperatures decreased. % setback of starches modified with azelaic acid/acetic anhydride mixture decreased. Swelling power and solubility of both starches increased by both modifications.

  5. Survival mechanism of Escherichia coli O157:H7 against combined treatment with acetic acid and sodium chloride.

    PubMed

    Lee, Sun-Young; Kang, Dong-Hyun

    2016-05-01

    The combination of salt and acid is commonly used in the production of many foods, including pickles and fermented foods. However, in our previous studies, the addition of salt significantly reduced the inhibitory effect of acetic acid on Escherichia coli O157:H7 in laboratory media and pickled cucumbers. Therefore, this study was conducted to determine the mechanism by which salt confers resistance against acetic acid in E. coli O157:H7. The addition of high concentrations (up to 9% or 15% [w/v]) of salt increased the resistance of E. coli O157:H7 to acetic acid treatment. Combined treatment with acetic acid and salt showed varying results among different bacterial strains (an antagonistic effect for E. coli O157:H7 and Shigella and a synergistic effect for Listeria monocytogenes and Staphylococcus aureus). The addition of salt increased the cytoplasmic pH of E. coli O157:H7, but decreased the cytoplasmic pH of L. monocytogenes and S. aureus on treatment with acetic acid. Therefore, the addition of salt increases the acid resistance of E. coli O157:H7 possibly by increasing its acid resistance response and consequently preventing the acidification of its cytoplasm by organic acids. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Screening of mercury-resistant and indole-3-acetic acid producing bacterial-consortium for growth promotion of Cicer arietinum L.

    PubMed

    Amin, Aatif; Latif, Zakia

    2017-03-01

    Mercury resistant (Hg R ) bacteria were screened from industrial effluents and effluents-polluted rhizosphere soils near to districts Kasur and Sheikhupura, Pakistan. Out of 60 isolates, three bacterial strains, Bacillus sp. AZ-1, Bacillus cereus AZ-2, and Enterobacter cloacae AZ-3 showed Hg-resistance as 20 μg ml -1 of HgCl 2 and indole-3-acetic acid (IAA) production as 8-38 μg ml -1 . Biochemical and molecular characterization of selected bacteria was confirmed by 16S ribotyping. Mercury resistant genes merA, merB, and merE of mer operon in Bacillus spp. were checked by PCR amplification. The merE gene involved in the transportation of elemental mercury (Hg 0 ) via cell membrane was first time cloned into pHLV vector and transformed in C43(DE3) Escherichia coli cells. The recombinant plasmid (pHLMerE) was expressed and purified by nickel (Ni +2 ) affinity chromatography. Chromatographic techniques viz. thin layer chromatography (TLC), high performance liquid chromatography (HPLC), and Gas chromatography-mass spectrometry (GC-MS) confirmed the presence of Indole-3-acetic acid (IAA) in supernatant of selected bacteria. The strain E. cloacae AZ-3 detoxified 88% of mercury (Hg +2 ) from industrial effluent (p < 0.05) after immobilization in Na-alginate beads. Finally, Hg-resistant and IAA producing bacterial consortium of two strains, Bacillus sp. AZ-1 and E. cloacae AZ-3, inoculated in mercury amended soil with 20 μg ml -1 HgCl 2 resulted 80, 22, 64, 116, 50, 75, 30, and 100% increase as compared to control plants in seed germination, shoot and root length, shoot and root fresh weight, number of pods per plant, number of seeds and weight of seeds, respectively, of chickpea (Cicer arietinum L.) in pot experiments (p < 0.05). © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Biodiversity of yeasts, lactic acid bacteria and acetic acid bacteria in the fermentation of "Shanxi aged vinegar", a traditional Chinese vinegar.

    PubMed

    Wu, Jia Jia; Ma, Ying Kun; Zhang, Fen Fen; Chen, Fu Sheng

    2012-05-01

    Shanxi aged vinegar is a famous traditional Chinese vinegar made from several kinds of cereal by spontaneous solid-state fermentation techniques. In order to get a comprehensive understanding of culturable microorganism's diversity present in its fermentation, the indigenous microorganisms including 47 yeast isolates, 28 lactic acid bacteria isolates and 58 acetic acid bacteria isolates were recovered in different fermenting time and characterized based on a combination of phenotypic and genotypic approaches including inter-delta/PCR, PCR-RFLP, ERIC/PCR analysis, as well as 16S rRNA and 26S rRNA partial gene sequencing. In the alcoholic fermentation, the dominant yeast species Saccharomyces (S.) cerevisiae (96%) exhibited low phenotypic and genotypic diversity among the isolates, while Lactobacillus (Lb.) fermentum together with Lb. plantarum, Lb. buchneri, Lb. casei, Pediococcus (P.) acidilactici, P. pentosaceus and Weissella confusa were predominated in the bacterial population at the same stage. Acetobacter (A.) pasteurianus showing great variety both in genotypic and phenotypic tests was the dominant species (76%) in the acetic acid fermentation stage, while the other acetic acid bacteria species including A. senegalensis, A. indonesiensis, A. malorum and A. orientalis, as well as Gluconobacter (G.) oxydans were detected at initial point of alcoholic and acetic acid fermentation stage respectively. Copyright © 2011 Elsevier Ltd. All rights reserved.

  8. Syntrophic acetate oxidation in two-phase (acid-methane) anaerobic digesters.

    PubMed

    Shimada, T; Morgenroth, E; Tandukar, M; Pavlostathis, S G; Smith, A; Raskin, L; Kilian, R E

    2011-01-01

    The microbial processes involved in two-phase anaerobic digestion were investigated by operating a laboratory-scale acid-phase (AP) reactor and analyzing two full-scale, two-phase anaerobic digesters operated under mesophilic (35 °C) conditions. The digesters received a blend of primary sludge and waste activated sludge (WAS). Methane levels of 20% in the laboratory-scale reactor indicated the presence of methanogenic activity in the AP. A phylogenetic analysis of an archaeal 16S rRNA gene clone library of one of the full-scale AP digesters showed that 82% and 5% of the clones were affiliated with the orders Methanobacteriales and Methanosarcinales, respectively. These results indicate that substantial levels of aceticlastic methanogens (order Methanosarcinales) were not maintained at the low solids retention times and acidic conditions (pH 5.2-5.5) of the AP, and that methanogenesis was carried out by hydrogen-utilizing methanogens of the order Methanobacteriales. Approximately 43, 31, and 9% of the archaeal clones from the methanogenic phase (MP) digester were affiliated with the orders Methanosarcinales, Methanomicrobiales, and Methanobacteriales, respectively. A phylogenetic analysis of a bacterial 16S rRNA gene clone library suggested the presence of acetate-oxidizing bacteria (close relatives of Thermacetogenium phaeum, 'Syntrophaceticus schinkii,' and Clostridium ultunense). The high abundance of hydrogen consuming methanogens and the presence of known acetate-oxidizing bacteria suggest that acetate utilization by acetate oxidizing bacteria in syntrophic interaction with hydrogen-utilizing methanogens was an important pathway in the second-stage of the two-phase digestion, which was operated at high ammonium-N concentrations (1.0 and 1.4 g/L). A modified version of the IWA Anaerobic Digestion Model No. 1 (ADM1) with extensions for syntrophic acetate oxidation and weak-acid inhibition adequately described the dynamic profiles of volatile acid production

  9. Biotechnological applications of acetic acid bacteria.

    PubMed

    Raspor, Peter; Goranovic, Dusan

    2008-01-01

    The acetic acid bacteria (AAB) have important roles in food and beverage production, as well as in the bioproduction of industrial chemicals. In recent years, there have been major advances in understanding their taxonomy, molecular biology, and physiology, and in methods for their isolation and identification. AAB are obligate aerobes that oxidize sugars, sugar alcohols, and ethanol with the production of acetic acid as the major end product. This special type of metabolism differentiates them from all other bacteria. Recently, the AAB taxonomy has been strongly rearranged as new techniques using 16S rRNA sequence analysis have been introduced. Currently, the AAB are classified in ten genera in the family Acetobacteriaceae. AAB can not only play a positive role in the production of selected foods and beverages, but they can also spoil other foods and beverages. AAB occur in sugar- and alcohol-enriched environments. The difficulty of cultivation of AAB on semisolid media in the past resulted in poor knowledge of the species present in industrial processes. The first step of acetic acid production is the conversion of ethanol from a carbohydrate carried out by yeasts, and the second step is the oxidation of ethanol to acetic acid carried out by AAB. Vinegar is traditionally the product of acetous fermentation of natural alcoholic substrates. Depending on the substrate, vinegars can be classified as fruit, starch, or spirit substrate vinegars. Although a variety of bacteria can produce acetic acid, mostly members of Acetobacter, Gluconacetobacter, and Gluconobacter are used commercially. Industrial vinegar manufacturing processes fall into three main categories: slow processes, quick processes, and submerged processes. AAB also play an important role in cocoa production, which represents a significant means of income for some countries. Microbial cellulose, produced by AAB, possesses some excellent physical properties and has potential for many applications. Other

  10. Sequential injection redox or acid-base titration for determination of ascorbic acid or acetic acid.

    PubMed

    Lenghor, Narong; Jakmunee, Jaroon; Vilen, Michael; Sara, Rolf; Christian, Gary D; Grudpan, Kate

    2002-12-06

    Two sequential injection titration systems with spectrophotometric detection have been developed. The first system for determination of ascorbic acid was based on redox reaction between ascorbic acid and permanganate in an acidic medium and lead to a decrease in color intensity of permanganate, monitored at 525 nm. A linear dependence of peak area obtained with ascorbic acid concentration up to 1200 mg l(-1) was achieved. The relative standard deviation for 11 replicate determinations of 400 mg l(-1) ascorbic acid was 2.9%. The second system, for acetic acid determination, was based on acid-base titration of acetic acid with sodium hydroxide using phenolphthalein as an indicator. The decrease in color intensity of the indicator was proportional to the acid content. A linear calibration graph in the range of 2-8% w v(-1) of acetic acid with a relative standard deviation of 4.8% (5.0% w v(-1) acetic acid, n=11) was obtained. Sample throughputs of 60 h(-1) were achieved for both systems. The systems were successfully applied for the assays of ascorbic acid in vitamin C tablets and acetic acid content in vinegars, respectively.

  11. Computerized image analysis for acetic acid induced intraepithelial lesions

    NASA Astrophysics Data System (ADS)

    Li, Wenjing; Ferris, Daron G.; Lieberman, Rich W.

    2008-03-01

    Cervical Intraepithelial Neoplasia (CIN) exhibits certain morphologic features that can be identified during a visual inspection exam. Immature and dysphasic cervical squamous epithelium turns white after application of acetic acid during the exam. The whitening process occurs visually over several minutes and subjectively discriminates between dysphasic and normal tissue. Digital imaging technologies allow us to assist the physician analyzing the acetic acid induced lesions (acetowhite region) in a fully automatic way. This paper reports a study designed to measure multiple parameters of the acetowhitening process from two images captured with a digital colposcope. One image is captured before the acetic acid application, and the other is captured after the acetic acid application. The spatial change of the acetowhitening is extracted using color and texture information in the post acetic acid image; the temporal change is extracted from the intensity and color changes between the post acetic acid and pre acetic acid images with an automatic alignment. The imaging and data analysis system has been evaluated with a total of 99 human subjects and demonstrate its potential to screening underserved women where access to skilled colposcopists is limited.

  12. Effect of acetic acid on citric acid fermentation in an integrated citric acid-methane fermentation process.

    PubMed

    Xu, Jian; Chen, Yang-Qiu; Zhang, Hong-Jian; Tang, Lei; Wang, Ke; Zhang, Jian-Hua; Chen, Xu-Sheng; Mao, Zhong-Gui

    2014-09-01

    An integrated citric acid-methane fermentation process was proposed to solve the problem of extraction wastewater in citric acid fermentation process. Extraction wastewater was treated by anaerobic digestion and then recycled for the next batch of citric acid fermentation to eliminate wastewater discharge and reduce water resource consumption. Acetic acid as an intermediate product of methane fermentation was present in anaerobic digestion effluent. In this study, the effect of acetic acid on citric acid fermentation was investigated and results showed that lower concentration of acetic acid could promote Aspergillus niger growth and citric acid production. 5-Cyano-2,3-ditolyl tetrazolium chloride (CTC) staining was used to quantify the activity of A. niger cells, and the results suggested that when acetic acid concentration was above 8 mM at initial pH 4.5, the morphology of A. niger became uneven and the part of the cells' activity was significantly reduced, thereby resulting in deceasing of citric acid production. Effects of acetic acid on citric acid fermentation, as influenced by initial pH and cell number in inocula, were also examined. The result indicated that inhibition by acetic acid increased as initial pH declined and was rarely influenced by cell number in inocula.

  13. Acetic acid removal from corn stover hydrolysate using ethyl acetate and the impact on Saccharomyces cerevisiae bioethanol fermentation.

    PubMed

    Aghazadeh, Mahdieh; Ladisch, Michael R; Engelberth, Abigail S

    2016-07-08

    Acetic acid is introduced into cellulose conversion processes as a consequence of composition of lignocellulose feedstocks, causing significant inhibition of adapted, genetically modified and wild-type S. cerevisiae in bioethanol fermentation. While adaptation or modification of yeast may reduce inhibition, the most effective approach is to remove the acetic acid prior to fermentation. This work addresses liquid-liquid extraction of acetic acid from biomass hydrolysate through a pathway that mitigates acetic acid inhibition while avoiding the negative effects of the extractant, which itself may exhibit inhibition. Candidate solvents were selected using simulation results from Aspen Plus™, based on their ability to extract acetic acid which was confirmed by experimentation. All solvents showed varying degrees of toxicity toward yeast, but the relative volatility of ethyl acetate enabled its use as simple vacuum evaporation could reduce small concentrations of aqueous ethyl acetate to minimally inhibitory levels. The toxicity threshold of ethyl acetate, in the presence of acetic acid, was found to be 10 g L(-1) . The fermentation was enhanced by extracting 90% of the acetic acid using ethyl acetate, followed by vacuum evaporation to remove 88% removal of residual ethyl acetate along with 10% of the broth. NRRL Y-1546 yeast was used to demonstrate a 13% increase in concentration, 14% in ethanol specific production rate, and 11% ethanol yield. This study demonstrated that extraction of acetic acid with ethyl acetate followed by evaporative removal of ethyl acetate from the raffinate phase has potential to significantly enhance ethanol fermentation in a corn stover bioethanol facility. © 2016 American Institute of Chemical Engineers Biotechnol. Prog., 32:929-937, 2016. © 2016 American Institute of Chemical Engineers.

  14. Genetic dissection of acetic acid tolerance in Saccharomyces cerevisiae.

    PubMed

    Geng, Peng; Xiao, Yin; Hu, Yun; Sun, Haiye; Xue, Wei; Zhang, Liang; Shi, Gui-Yang

    2016-09-01

    Dissection of the hereditary architecture underlying Saccharomyces cerevisiae tolerance to acetic acid is essential for ethanol fermentation. In this work, a genomics approach was used to dissect hereditary variations in acetic acid tolerance between two phenotypically different strains. A total of 160 segregants derived from these two strains were obtained. Phenotypic analysis indicated that the acetic acid tolerance displayed a normal distribution in these segregants, and suggested that the acetic acid tolerant traits were controlled by multiple quantitative trait loci (QTLs). Thus, 220 SSR markers covering the whole genome were used to detect QTLs of acetic acid tolerant traits. As a result, three QTLs were located on chromosomes 9, 12, and 16, respectively, which explained 38.8-65.9 % of the range of phenotypic variation. Furthermore, twelve genes of the candidates fell into the three QTL regions by integrating the QTL analysis with candidates of acetic acid tolerant genes. These results provided a novel avenue to obtain more robust strains.

  15. Spontaneous organic cocoa bean box fermentations in Brazil are characterized by a restricted species diversity of lactic acid bacteria and acetic acid bacteria.

    PubMed

    Papalexandratou, Zoi; Vrancken, Gino; De Bruyne, Katrien; Vandamme, Peter; De Vuyst, Luc

    2011-10-01

    Spontaneous organic cocoa bean box fermentations were carried out on two different farms in Brazil. Physical parameters, microbial growth, bacterial species diversity [mainly lactic acid bacteria (LAB) and acetic acid bacteria (AAB)], and metabolite kinetics were monitored, and chocolates were produced from the fermented dry cocoa beans. The main end-products of the catabolism of the pulp substrates (glucose, fructose, and citric acid) by yeasts, LAB, and AAB were ethanol, lactic acid, mannitol, and/or acetic acid. Lactobacillus fermentum and Acetobacter pasteurianus were the predominating bacterial species of the fermentations as revealed through (GTG)(5)-PCR fingerprinting of isolates and PCR-DGGE of 16S rRNA gene PCR amplicons of DNA directly extracted from fermentation samples. Fructobacillus pseudoficulneus, Lactobacillus plantarum, and Acetobacter senegalensis were among the prevailing species during the initial phase of the fermentations. Also, three novel LAB species were found. This study emphasized the possible participation of Enterobacteriaceae in the cocoa bean fermentation process. Tatumella ptyseos and Tatumella citrea were the prevailing enterobacterial species in the beginning of the fermentations as revealed by 16S rRNA gene-PCR-DGGE. Finally, it turned out that control over a restricted bacterial species diversity during fermentation through an ideal post-harvest handling of the cocoa beans will allow the production of high-quality cocoa and chocolates produced thereof, independent of the fermentation method or farm. Copyright © 2011 Elsevier Ltd. All rights reserved.

  16. Kinetics of Ethyl Acetate Synthesis Catalyzed by Acidic Resins

    ERIC Educational Resources Information Center

    Antunes, Bruno M.; Cardoso, Simao P.; Silva, Carlos M.; Portugal, Ines

    2011-01-01

    A low-cost experiment to carry out the second-order reversible reaction of acetic acid esterification with ethanol to produce ethyl acetate is presented to illustrate concepts of kinetics and reactor modeling. The reaction is performed in a batch reactor, and the acetic acid concentration is measured by acid-base titration versus time. The…

  17. 21 CFR 862.1390 - 5-Hydroxyindole acetic acid/serotonin test system.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false 5-Hydroxyindole acetic acid/serotonin test system... Test Systems § 862.1390 5-Hydroxyindole acetic acid/serotonin test system. (a) Identification. A 5-hydroxyindole acetic acid/serotonin test system is a device intended to measure 5-hydroxyindole acetic acid...

  18. 21 CFR 862.1390 - 5-Hydroxyindole acetic acid/serotonin test system.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false 5-Hydroxyindole acetic acid/serotonin test system... Test Systems § 862.1390 5-Hydroxyindole acetic acid/serotonin test system. (a) Identification. A 5-hydroxyindole acetic acid/serotonin test system is a device intended to measure 5-hydroxyindole acetic acid...

  19. 21 CFR 862.1390 - 5-Hydroxyindole acetic acid/serotonin test system.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false 5-Hydroxyindole acetic acid/serotonin test system... Test Systems § 862.1390 5-Hydroxyindole acetic acid/serotonin test system. (a) Identification. A 5-hydroxyindole acetic acid/serotonin test system is a device intended to measure 5-hydroxyindole acetic acid...

  20. 21 CFR 862.1390 - 5-Hydroxyindole acetic acid/serotonin test system.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false 5-Hydroxyindole acetic acid/serotonin test system... Test Systems § 862.1390 5-Hydroxyindole acetic acid/serotonin test system. (a) Identification. A 5-hydroxyindole acetic acid/serotonin test system is a device intended to measure 5-hydroxyindole acetic acid...

  1. Fermentation of lignocellulosic sugars to acetic acid by Moorella thermoacetica.

    PubMed

    Ehsanipour, Mandana; Suko, Azra Vajzovic; Bura, Renata

    2016-06-01

    A systematic study of bioconversion of lignocellulosic sugars to acetic acid by Moorella thermoacetica (strain ATCC 39073) was conducted. Four different water-soluble fractions (hydrolysates) obtained after steam pretreatment of lignocellulosic biomass were selected and fermented to acetic acid in batch fermentations. M. thermoacetica can effectively ferment xylose and glucose in hydrolysates from wheat straw, forest residues, switchgrass, and sugarcane straw to acetic acid. Xylose and glucose were completely utilized, with xylose being consumed first. M. thermoacetica consumed up to 62 % of arabinose, 49 % galactose and 66 % of mannose within 72 h of fermentation in the mixture of lignocellulosic sugars. The highest acetic acid yield was obtained from sugarcane straw hydrolysate, with 71 % of theoretical yield based on total sugars (17 g/L acetic acid from 24 g/L total sugars). The lowest acetic acid yield was observed in forest residues hydrolysate, with 39 % of theoretical yield based on total sugars (18 g/L acetic acid from 49 g/L total sugars). Process derived compounds from steam explosion pretreatment, including 5-hydroxymethylfurfural (0.4 g/L), furfural (0.1 g/L) and total phenolics (3 g/L), did not inhibit microbial growth and acetic acid production yield. This research identified two major factors that adversely affected acetic acid yield in all hydrolysates, especially in forest residues: (i) glucose to xylose ratio and (ii) incomplete consumption of arabinose, galactose and mannose. For efficient bioconversion of lignocellulosic sugars to acetic acid, it is imperative to have an appropriate balance of sugars in a hydrolysate. Hence, the choice of lignocellulosic biomass and steam pretreatment design are fundamental steps for the industrial application of this process.

  2. Improvement of acetic acid tolerance of Saccharomyces cerevisiae using a zinc-finger-based artificial transcription factor and identification of novel genes involved in acetic acid tolerance.

    PubMed

    Ma, Cui; Wei, Xiaowen; Sun, Cuihuan; Zhang, Fei; Xu, Jianren; Zhao, Xinqing; Bai, Fengwu

    2015-03-01

    Acetic acid is present in cellulosic hydrolysate as a potent inhibitor, and the superior acetic acid tolerance of Saccharomyces cerevisiae ensures good cell viability and efficient ethanol production when cellulosic raw materials are used as substrates. In this study, a mutant strain of S. cerevisiae ATCC4126 (Sc4126-M01) with improved acetic acid tolerance was obtained through screening strains transformed with an artificial zinc finger protein transcription factor (ZFP-TF) library. Further analysis indicated that improved acetic acid tolerance was associated with improved catalase (CAT) activity. The ZFP coding sequence associated with the improved phenotype was identified, and real-time RT-PCR analysis revealed that three of the possible genes involved in the enhanced acetic acid tolerance regulated by this ZFP-TF, namely YFL040W, QDR3, and IKS1, showed decreased transcription levels in Sc4126-M01 in the presence of acetic acid, compared to those in the control strain. Sc4126-M01 mutants having QDR3 and IKS1 deletion (ΔQDR3 and ΔIKS1) exhibited higher acetic acid tolerance than the wild-type strain under acetic acid treatment. Glucose consumption rate and ethanol productivity in the presence of 5 g/L acetic acid were improved in the ΔQDR3 mutant compared to the wild-type strain. Our studies demonstrated that the synthetic ZFP-TF library can be used to improve acetic acid tolerance of S. cerevisiae and that the employment of an artificial transcription factor can facilitate the exploration of novel functional genes involved in stress tolerance of S. cerevisiae.

  3. Development of Acetic Acid Removal Technology for the UREX+Process

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Robert M. Counce; Jack S. Watson

    2009-06-30

    It is imperative that acetic acid is removed from a waste stream in the UREX+process so that nitric acid can be recycled and possible interference with downstreatm steps can be avoidec. Acetic acid arises from acetohydrozamic acid (AHA), and is used to suppress plutonium in the first step of the UREX+process. Later, it is hydrolyzed into hydroxyl amine nitrate and acetic acid. Many common separation technologies were examined, and solvent extraction was determined to be the best choice under process conditions. Solvents already used in the UREX+ process were then tested to determine if they would be sufficient for themore » removal of acetic acid. The tributyl phosphage (TBP)-dodecane diluent, used in both UREX and NPEX, was determined to be a solvent system that gave sufficient distribution coefficients for acetic acid in addition to a high separation factor from nitric acid.« less

  4. Tested Demonstrations: Buffer Capacity of Various Acetic Acid-Sodium Acetate Systems: A Lecture Experiment.

    ERIC Educational Resources Information Center

    Donahue, Craig J.; Panek, Mary G.

    1985-01-01

    Background information and procedures are provided for a lecture experiment which uses indicators to illustrate the concept of differing buffer capacities by titrating acetic acid/sodium acetate buffers with 1.0 molar hydrochloric acid and 1.0 molar sodium hydroxide. A table with data used to plot the titration curve is included. (JN)

  5. Production of itaconic acid from acetate by engineering acid-tolerant Escherichia coli W.

    PubMed

    Noh, Myung Hyun; Lim, Hyun Gyu; Woo, Sung Hwa; Song, Jinyi; Jung, Gyoo Yeol

    2018-03-01

    Utilization of abundant and cheap carbon sources can effectively reduce the production cost and enhance the economic feasibility. Acetate is a promising carbon source to achieve cost-effective microbial processes. In this study, we engineered an Escherichia coli strain to produce itaconic acid from acetate. As acetate is known to inhibit cell growth, we initially screened for a strain with a high tolerance to 10 g/L of acetate in the medium, and the W strain was selected as the host. Subsequently, the WC strain was obtained by overexpression of cad (encoding cis-aconitate decarboxylase) using a synthetic promoter and 5' UTR. However, the WC strain produced only 0.13 g/L itaconic acid because of low acetate uptake. To improve the production, the acetate assimilating pathway and glyoxylate shunt pathway were amplified by overexpression of pathway genes as well as its deregulation. The resulting strain, WCIAG4 produced 3.57 g/L itaconic acid (16.1% of theoretical maximum yield) after 88 hr of fermentation with rapid acetate assimilation. These efforts support that acetate can be a potential feedstock for biochemical production with engineered E. coli. © 2017 Wiley Periodicals, Inc.

  6. Acetic acid in aged vinegar affects molecular targets for thrombus disease management.

    PubMed

    Jing, Li; Yanyan, Zhang; Junfeng, Fan

    2015-08-01

    To elucidate the mechanism underlying the action of dietary vinegar on antithrombotic activity, acetic acid, the main acidic component of dietary vinegar, was used to determine antiplatelet and fibrinolytic activity. The results revealed that acetic acid significantly inhibits adenosine diphosphate (ADP)-, collagen-, thrombin-, and arachidonic acid (AA)-induced platelet aggregation. Acetic acid (2.00 mM) reduced AA-induced platelet aggregation to approximately 36.82 ± 1.31%, and vinegar (0.12 mL L(-1)) reduced the platelet aggregation induced by AA to 30.25 ± 1.34%. Further studies revealed that acetic acid exerts its effects by inhibiting cyclooxygenase-1 and the formation of thromboxane-A2. Organic acids including acetic acid, formic acid, lactic acid, citric acid, and malic acid also showed fibrinolytic activity; specifically, the fibrinolytic activity of acetic acid amounted to 1.866 IU urokinase per mL. Acetic acid exerted its fibrinolytic activity by activating plasminogen during fibrin crossing, thus leading to crosslinked fibrin degradation by the activated plasmin. These results suggest that organic acids in dietary vinegar play important roles in the prevention and cure of cardiovascular diseases.

  7. Characterization of Acetic Acid Bacteria in Traditional Acetic Acid Fermentation of Rice Vinegar (Komesu) and Unpolished Rice Vinegar (Kurosu) Produced in Japan

    PubMed Central

    Nanda, Kumiko; Taniguchi, Mariko; Ujike, Satoshi; Ishihara, Nobuhiro; Mori, Hirotaka; Ono, Hisayo; Murooka, Yoshikatsu

    2001-01-01

    Bacterial strains were isolated from samples of Japanese rice vinegar (komesu) and unpolished rice vinegar (kurosu) fermented by the traditional static method. Fermentations have never been inoculated with a pure culture since they were started in 1907. A total of 178 isolates were divided into groups A and B on the basis of enterobacterial repetitive intergenic consensus-PCR and random amplified polymorphic DNA fingerprinting analyses. The 16S ribosomal DNA sequences of strains belonging to each group showed similarities of more than 99% with Acetobacter pasteurianus. Group A strains overwhelmingly dominated all stages of fermentation of both types of vinegar. Our results indicate that appropriate strains of acetic acid bacteria have spontaneously established almost pure cultures during nearly a century of komesu and kurosu fermentation. PMID:11157275

  8. L-Lactic acid production from glycerol coupled with acetic acid metabolism by Enterococcus faecalis without carbon loss.

    PubMed

    Murakami, Nao; Oba, Mana; Iwamoto, Mariko; Tashiro, Yukihiro; Noguchi, Takuya; Bonkohara, Kaori; Abdel-Rahman, Mohamed Ali; Zendo, Takeshi; Shimoda, Mitsuya; Sakai, Kenji; Sonomoto, Kenji

    2016-01-01

    Glycerol is a by-product in the biodiesel production process and considered as one of the prospective carbon sources for microbial fermentation including lactic acid fermentation, which has received considerable interest due to its potential application. Enterococcus faecalis isolated in our laboratory produced optically pure L-lactic acid from glycerol in the presence of acetic acid. Gas chromatography-mass spectrometry analysis using [1, 2-(13)C2] acetic acid proved that the E. faecalis strain QU 11 was capable of converting acetic acid to ethanol during lactic acid fermentation of glycerol. This indicated that strain QU 11 restored the redox balance by oxidizing excess NADH though acetic acid metabolism, during ethanol production, which resulted in lactic acid production from glycerol. The effects of pH control and substrate concentration on lactic acid fermentation were also investigated. Glycerol and acetic acid concentrations of 30 g/L and 10 g/L, respectively, were expected to be appropriate for lactic acid fermentation of glycerol by strain QU 11 at a pH of 6.5. Furthermore, fed-batch fermentation with 30 g/L glycerol and 10 g/L acetic acid wholly exhibited the best performance including lactic acid production (55.3 g/L), lactic acid yield (0.991 mol-lactic acid/mol-glycerol), total yield [1.08 mol-(lactic acid and ethanol)]/mol-(glycerol and acetic acid)], and total carbon yield [1.06 C-mol-(lactic acid and ethanol)/C-mol-(glycerol and acetic acid)] of lactic acid and ethanol. In summary, the strain QU 11 successfully produced lactic acid from glycerol with acetic acid metabolism, and an efficient fermentation system was established without carbon loss. Copyright © 2015 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  9. Free acetate production by rat hepatocytes during peroxisomal fatty acid and dicarboxylic acid oxidation.

    PubMed

    Leighton, F; Bergseth, S; Rørtveit, T; Christiansen, E N; Bremer, J

    1989-06-25

    The fate of the acetyl-CoA units released during peroxisomal fatty acid oxidation was studied in isolated hepatocytes from normal and peroxisome-proliferated rats. Ketogenesis and hydrogen peroxide generation were employed as indicators of mitochondrial and peroxisomal fatty acid oxidation, respectively. Butyric and hexanoic acids were employed as mitochondrial substrates, 1, omega-dicarboxylic acids as predominantly peroxisomal substrates, and lauric acid as a substrate for both mitochondria and peroxisomes. Ketogenesis from dicarboxylic acids was either absent or very low in normal and peroxisome-proliferated hepatocytes, but free acetate release was detected at rates that could account for all the acetyl-CoA produced in peroxisomes by dicarboxylic and also by monocarboxylic acids. Mitochondrial fatty acid oxidation also led to free acetate generation but at low rates relative to ketogenesis. The origin of the acetate released was confirmed employing [1-14C]dodecanedioic acid. Thus, the activity of peroxisomes might contribute significantly to the free acetate generation known to occur during fatty acid oxidation in rats and possibly also in humans.

  10. Proteome analysis of Acetobacter pasteurianus during acetic acid fermentation.

    PubMed

    Andrés-Barrao, Cristina; Saad, Maged M; Chappuis, Marie-Louise; Boffa, Mauro; Perret, Xavier; Ortega Pérez, Ruben; Barja, François

    2012-03-16

    Acetic acid bacteria (AAB) are Gram-negative, strictly aerobic microorganisms that show a unique resistance to ethanol (EtOH) and acetic acid (AcH). Members of the Acetobacter and Gluconacetobacter genera are capable of transforming EtOH into AcH via the alcohol dehydrogenase (ADH) and aldehyde dehydrogenase (ALDH) enzymes and are used for the industrial production of vinegar. Several mechanisms have been proposed to explain how AAB resist high concentrations of AcH, such as the assimilation of acetate through the tricarboxylic acid (TCA) cycle, the export of acetate by various transporters and modifications of the outer membrane. However, except for a few acetate-specific proteins, little is known about the global proteome responses to AcH. In this study, we used 2D-DIGE to compare the proteome of Acetobacter pasteurianus LMG 1262(T) when growing in glucose or ethanol and in the presence of acetic acid. Interesting protein spots were selected using the ANOVA p-value of 0.05 as threshold and 1.5-fold as the minimal level of differential expression, and a total of 53 proteins were successfully identified. Additionally, the size of AAB was reduced by approximately 30% in length as a consequence of the acidity. A modification in the membrane polysaccharides was also revealed by PATAg specific staining. Copyright © 2011 Elsevier B.V. All rights reserved.

  11. Effect of acetic acid on lipid accumulation by glucose-fed activated sludge cultures

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mondala, Andro; Hernandez, Rafael; French, Todd

    2012-01-01

    The effect of acetic acid, a lignocellulose hydrolysis by-product, on lipid accumulation by activated sludge cultures grown on glucose was investigated. This was done to assess the possible application of lignocellulose as low-cost and renewable fermentation substrates for biofuel feedstock production. Results: Biomass yield was reduced by around 54% at a 2 g L -1 acetic acid dosage but was increased by around 18% at 10 g L -1 acetic acid dosage relative to the control run. The final gravimetric lipid contents at 2 and 10 g L -1 acetic acid levels were 12.5 + 0.7% and 8.8 + 3.2%more » w/w, respectively, which were lower than the control (17.8 + 2.8% w/w). However, biodiesel yields from activated sludge grown with acetic acid (5.6 + 0.6% w/w for 2 g L -1 acetic acid and 4.2 + 3.0% w/w for 10 g L -1 acetic acid) were higher than in raw activated sludge (1-2% w/w). The fatty acid profiles of the accumulated lipids were similar with conventional plant oil biodiesel feedstocks. Conclusions: Acetic acid enhanced biomass production by activated sludge at high levels but reduced lipid production. Further studies are needed to enhance acetic acid utilization by activated sludge microorganisms for lipid biosynthesis.« less

  12. Catalysis of the Carbonylation of Alcohols to Carboxylic Acids Including Acetic Acid Synthesis from Methanol.

    ERIC Educational Resources Information Center

    Forster, Denis; DeKleva, Thomas W.

    1986-01-01

    Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)

  13. Genome-wide identification of Saccharomyces cerevisiae genes required for tolerance to acetic acid.

    PubMed

    Mira, Nuno P; Palma, Margarida; Guerreiro, Joana F; Sá-Correia, Isabel

    2010-10-25

    Acetic acid is a byproduct of Saccharomyces cerevisiae alcoholic fermentation. Together with high concentrations of ethanol and other toxic metabolites, acetic acid may contribute to fermentation arrest and reduced ethanol productivity. This weak acid is also a present in lignocellulosic hydrolysates, a highly interesting non-feedstock substrate in industrial biotechnology. Therefore, the better understanding of the molecular mechanisms underlying S. cerevisiae tolerance to acetic acid is essential for the rational selection of optimal fermentation conditions and the engineering of more robust industrial strains to be used in processes in which yeast is explored as cell factory. The yeast genes conferring protection against acetic acid were identified in this study at a genome-wide scale, based on the screening of the EUROSCARF haploid mutant collection for susceptibility phenotypes to this weak acid (concentrations in the range 70-110 mM, at pH 4.5). Approximately 650 determinants of tolerance to acetic acid were identified. Clustering of these acetic acid-resistance genes based on their biological function indicated an enrichment of genes involved in transcription, internal pH homeostasis, carbohydrate metabolism, cell wall assembly, biogenesis of mitochondria, ribosome and vacuole, and in the sensing, signalling and uptake of various nutrients in particular iron, potassium, glucose and amino acids. A correlation between increased resistance to acetic acid and the level of potassium in the growth medium was found. The activation of the Snf1p signalling pathway, involved in yeast response to glucose starvation, is demonstrated to occur in response to acetic acid stress but no evidence was obtained supporting the acetic acid-induced inhibition of glucose uptake. Approximately 490 of the 650 determinants of tolerance to acetic acid identified in this work are implicated, for the first time, in tolerance to this weak acid. These are novel candidate genes for genetic

  14. Effects of acetic acid on the viability of Ascaris lumbricoides eggs

    PubMed Central

    Beyhan, Yunus E.; Yilmaz, Hasan; Hokelek, Murat

    2016-01-01

    Objectives: To investigate the effects of acetic acid on durable Ascaris lumbricoides (A. lumbricoides) eggs to determine the effective concentration of vinegar and the implementation period to render the consumption of raw vegetables more reliable. Methods: This experimental study was performed in May 2015 in the Parasitology Laboratory, Faculty of Medicine, Yuzuncu Yil University, Van, Turkey. The A. lumbricoides eggs were divided into 2 groups. Eggs in the study group were treated with 1, 3, 5, and 10% acetic acid concentrations, and eggs in the control group were treated with Eosin. The eggs’ viability was observed at the following points in time during the experiment: 0, 10, 15, 20, 30, 45, and 60 minutes. Results: The 1% acetic acid was determined insufficient on the viability of Ascaris eggs. At the 30th minute, 3% acetic acid demonstrated 95% effectiveness, and at 5% concentration, all eggs lost their viability. Treatment of acetic acid at the ratio of 4.8% in 30 minutes, or a ratio of 4.3% in 60 minutes is required for full success of tretment. Conclusion: Since Ascaris eggs have 3 layers and are very resistant, the acetic acid concentration, which can be effective on these eggs are thought to be effective also on many other parasitic agents. In order to attain an active protection, after washing the vegetables, direct treatment with a vinegar containing 5% acetic acid for 30 minutes is essential. PMID:26905351

  15. An ability of endophytic bacteria from nutgrass (cyperus rotundus) from lafau beach of north nias in producing indole acetic acid and in solubilizing phosphate

    NASA Astrophysics Data System (ADS)

    Zega, Atriani; Suryanto, Dwi; Yurnaliza

    2018-03-01

    Endophytic bacteria have taken much attention for their potency to promote plant growth. This study was aimed to isolate endophytic bacteria from nutgrass (Cyperus rotundus) and to examine their potency in producing indole acetic acid (IAA) and in solubilizing phosphate. Isolation of endophytic bacteria was done by slicing and sterilizing root, stem, and leaf sample surface with alcohol 70% and sodium hypochlorite 2%, followed by incubation of the sliced samples in nutrient agar medium. Morphological characterization and simple biochemical tests were performed on bacterial isolates. All bacterial isolates were examined for their ability to produce indole acetic acid and to solubilize phosphate. Three isolates (AZ5, AZ12 and AZ6) out of fifteen indicated the ability to produce indole acetic acid and to solubilize phosphate. IAA producing test using spectrophotometry method showed that AZ5, AZ12,and AZ6 produce more IAA with concentration of 49,91, 48,18, and 44,45 ppm, respectively. Phosphate solubilizing test using Pikovskaya agar medium showed that the three isolates were able to solubilize phosphate with index of 6.27, 3,31, and 3.41 respectively.

  16. Scaleable production and separation of fermentation-derived acetic acid. Final CRADA report.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Snyder, S. W.; Energy Systems

    2010-02-08

    Half of U.S. acetic acid production is used in manufacturing vinyl acetate monomer (VAM) and is economical only in very large production plants. Nearly 80% of the VAM is produced by methanol carbonylation, which requires high temperatures and exotic construction materials and is energy intensive. Fermentation-derived acetic acid production allows for small-scale production at low temperatures, significantly reducing the energy requirement of the process. The goal of the project is to develop a scaleable production and separation process for fermentation-derived acetic acid. Synthesis gas (syngas) will be fermented to acetic acid, and the fermentation broth will be continuously neutralized withmore » ammonia. The acetic acid product will be recovered from the ammonium acid broth using vapor-based membrane separation technology. The process is summarized in Figure 1. The two technical challenges to success are selecting and developing (1) microbial strains that efficiently ferment syngas to acetic acid in high salt environments and (2) membranes that efficiently separate ammonia from the acetic acid/water mixture and are stable at high enough temperature to facilitate high thermal cracking of the ammonium acetate salt. Fermentation - Microbial strains were procured from a variety of public culture collections (Table 1). Strains were incubated and grown in the presence of the ammonium acetate product and the fastest growing cultures were selected and incubated at higher product concentrations. An example of the performance of a selected culture is shown in Figure 2. Separations - Several membranes were considered. Testing was performed on a new product line produced by Sulzer Chemtech (Germany). These are tubular ceramic membranes with weak acid functionality (see Figure 3). The following results were observed: (1) The membranes were relatively fragile in a laboratory setting; (2) Thermally stable {at} 130 C in hot organic acids; (3) Acetic acid rejection > 99%; and

  17. Occurrence and metabolism of 7-hydroxy-2-indolinone-3-acetic acid in Zea mays

    NASA Technical Reports Server (NTRS)

    Lewer, P.; Bandurski, R. S.

    1987-01-01

    7-Hydroxy-2-indolinone-3-acetic acid was identified as a catabolite of indole-3-acetic acid in germinating kernels of Zea mays and found to be present in amounts of ca 3.1 nmol/kernel. 7-Hydroxy-2-indolinone-3-acetic acid was shown to be a biosynthetic intermediate between 2-indolinone-3-acetic acid and 7-hydroxy-2-indolinone-3-acetic acid-7'-O-glucoside in both kernels and roots of Zea mays. Further metabolism of 7-hydroxy-2-[5-3H]-indolinone-3-acetic acid-7'-O-glucoside occurred to yield tritiated water plus, as yet, uncharacterized products.

  18. Aqueous-Phase Acetic Acid Ketonization over Monoclinic Zirconia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cai, Qiuxia; Lopez-Ruiz, Juan A.; Cooper, Alan R.

    The effect of aqueous phase on the acetic acid ketonization over monoclinic zirconia has been investigated using first-principles based density functional theory (DFT) calculations. To capture the aqueous phase chemistry over the solid zirconia catalyst surface, the aqueous phase is represented by 111 explicit water molecules with a liquid water density of 0.93 g/cm3 and the monoclinic zirconia is modeled by the most stable surface structure . The dynamic nature of aqueous phase/ interface was studied using ab initio molecular dynamics simulation, indicating that nearly half of the surface Zr sites are occupied by either adsorbed water molecules or hydroxylmore » groups at 550 K. DFT calculations show that the adsorption process of acetic acid from the liquid water phase to the surface is nearly thermodynamically neutral with a Gibbs free energy of -2.3 kJ/mol although the adsorption strength of acetic acid on the surface in aqueous phase is much stronger than in vapor phase. Therefore it is expected that the adsorption of acetic acid will dramatically affects aqueous phase ketonization reactivity over the monoclinic zirconia catalyst. Using the same ketonization mechanism via the β-keto acid intermediate, we have compared acetic acid ketonization to acetone in both vapor and aqueous phases. Our DFT calculation results show although the rate-determining step of the β-keto acid formation via the C-C coupling is not pronouncedly affected, the presence of liquid water molecules will dramatically affect dehydrogenation and hydrogenation steps via proton transfer mechanism. This work was financially supported by the United States Department of Energy (DOE)’s Bioenergy Technologies Office (BETO) and performed at the Pacific Northwest National Laboratory (PNNL). PNNL is a multi-program national laboratory operated for DOE by Battelle Memorial Institute. Computing time and advanced catalyst characterization use was granted by a user proposal at the William R. Wiley

  19. Detection of CIN by naked eye visualization after application of acetic acid.

    PubMed

    Londhe, M; George, S S; Seshadri, L

    1997-06-01

    A prospective study was undertaken to determine the sensitivity and specificity of acetic application to the cervix followed by naked eye visualization as a screening test for detection of cervical intraepithelial neoplasia. Three hundred and seventy two sexually active woman in the reproductive age group were studied. All the women underwent Papanicolaou test, acetic acid test and colposcopy. One hundred and seventy five woman were acetic acid test negative, 197 women were acetic acid test positive. The sensitivity of acetic acid test was 72.4%, specificity 54% and false negative rate 15.2%, as compared to papanicolaou test which had a sensitivity of 13.2%, specificity of 96.3% and false negative rate of 24.4%. The advantage of the acetic acid test lies in its easy technique, low cost and high sensitivity which are important factors for determining the efficacy of any screening programme in developing countries.

  20. Acetic acid bacteria: A group of bacteria with versatile biotechnological applications.

    PubMed

    Saichana, Natsaran; Matsushita, Kazunobu; Adachi, Osao; Frébort, Ivo; Frebortova, Jitka

    2015-11-01

    Acetic acid bacteria are gram-negative obligate aerobic bacteria assigned to the family Acetobacteraceae of Alphaproteobacteria. They are members of the genera Acetobacter, Gluconobacter, Gluconacetobacter, Acidomonas, Asaia, Kozakia, Swaminathania, Saccharibacter, Neoasaia, Granulibacter, Tanticharoenia, Ameyamaea, Neokomagataea, and Komagataeibacter. Many strains of Acetobacter and Komagataeibacter have been known to possess high acetic acid fermentation ability as well as the acetic acid and ethanol resistance, which are considered to be useful features for industrial production of acetic acid and vinegar, the commercial product. On the other hand, Gluconobacter strains have the ability to perform oxidative fermentation of various sugars, sugar alcohols, and sugar acids leading to the formation of several valuable products. Thermotolerant strains of acetic acid bacteria were isolated in order to serve as the new strains of choice for industrial fermentations, in which the cooling costs for maintaining optimum growth and production temperature in the fermentation vessels could be significantly reduced. Genetic modifications by adaptation and genetic engineering were also applied to improve their properties, such as productivity and heat resistance. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. Overexpression of acetyl-CoA synthetase in Saccharomyces cerevisiae increases acetic acid tolerance

    PubMed Central

    Ding, Jun; Holzwarth, Garrett; Penner, Michael H.; Patton-Vogt, Jana; Bakalinsky, Alan T.

    2015-01-01

    Acetic acid-mediated inhibition of the fermentation of lignocellulose-derived sugars impedes development of plant biomass as a source of renewable ethanol. In order to overcome this inhibition, the capacity of Saccharomyces cerevisiae to synthesize acetyl-CoA from acetic acid was increased by overexpressing ACS2 encoding acetyl-coenzyme A synthetase. Overexpression of ACS2 resulted in higher resistance to acetic acid as measured by an increased growth rate and shorter lag phase relative to a wild-type control strain, suggesting that Acs2-mediated consumption of acetic acid during fermentation contributes to acetic acid detoxification. PMID:25673654

  2. Extractive fermentation of acetic acid

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Busche, R.M.

    1991-12-31

    In this technoeconomic evaluation of the manufacture of acetic acid by fermentation, the use of the bacterium: Acetobacter suboxydans from the old vinegar process was compared with expected performance of the newer Clostridium thermoaceticum bacterium. Both systems were projected to operate as immobilized cells in a continuous, fluidized bed bioreactor, using solvent extraction to recover the product. Acetobacter metabolizes ethanol aerobically to produce acid at 100 g/L in a low pH medium. This ensures that the product is in the form of a concentrated extractable free acid, rather than as an unextractable salt. Unfortunately, yields from glucose by way ofmore » the ethanol fermentation are poor, but near the biological limits of the organisms involved. Conversely, C. thermoaceticum is a thermophilic anaerobe that operates at high fermentation rates on glucose at neutral pH to produce acetate salts directly in substantially quantitative yields. However, it is severely inhibited by product, which restricts concentration to a dilute 20 g/L. An improved Acetobacter system operating with recycled cells at 50 g/L appears capable of producing acid at $0.38/lb, as compared with a $0.29/lb price for synthetic acid. However, this system has only a limited margin for process improvement. The present Clostridium system cannot compete, since the required selling price would be $0.42/lb. However, if the organism could be adapted to tolerate higher product concentrations at acid pH, selling price could be reduced to $0.22/lb, or about 80% of the price of synthetic acid.« less

  3. Gas chromatography/isotope ratio mass spectrometry: analysis of methanol, ethanol and acetic acid by direct injection of aqueous alcoholic and acetic acid samples.

    PubMed

    Ai, Guomin; Sun, Tong; Dong, Xiuzhu

    2014-08-15

    Methanol, ethanol, and acetic acid are not easily extracted from aqueous samples and are susceptible to isotope fractionation in gas chromatography/isotope ratio mass spectrometry (GC/IRMS) analysis. Developing a direct dilution GC/IRMS method for aqueous samples, by adjusting the sample concentrations in common solvents to be similar to each other and using a fixed GC split ratio, is very convenient and important because any linearity effects caused by amount-dependent isotope fractionation can be avoided. The suitability of acetonitrile and acetone solvents for the GC/IRMS analysis of pure methanol, ethanol and acetic acid, and commercial liquor and vinegar samples was evaluated using n-hexane and water as control solvents. All the solvents including water were separated from the analyte on a HP-INNOWAX column and were diverted away from the combustion interface. The influence of liquor matrix on the ethanol GC/IRMS analyses was evaluated by adding pure ethanol to liquor samples. Acetonitrile and acetone gave similar δ(13) C values for pure ethanol and pure acetic acid to those obtained in water and n-hexane, and also gave similar δ(13) C values of ethanol in liquor and acetic acid in white vinegar to that obtained in water. For methanol analysis, acetonitrile and refined acetone gave similar δ(13) C values to that obtained in water, but n-hexane was not a suitable solvent. In addition, isotopic fractionation caused by solvent and solute interactions was observed. We recommend using acetonitrile for the GC/IRMS analysis of aqueous alcoholic samples, and acetone for the analysis of aqueous acetic acid samples. This direct dilution method can provide high accurate and precise GC/IRMS analysis of the relative changes in δ(13) C values of methanol, ethanol, and acetic acid. Copyright © 2014 John Wiley & Sons, Ltd.

  4. Effect of salt addition on acid resistance response of Escherichia coli O157:H7 against acetic acid.

    PubMed

    Bae, Young-Min; Lee, Sun-Young

    2017-08-01

    A combination of salt and acid is commonly used in the production of many foods, such as pickles and fermented foods. However, in our previous studies, addition of salt significantly reduced the inhibitory effect of acetic acid against E. coli O157:H7 in laboratory media and pickled cucumbers. Therefore, this study was conducted to determine the effect of salt addition on the acid resistance (AR) response of E. coli O157:H7 after treatment with acetic acid. The combined effect of acetic acid and salt showed different results depending on media tested. Organic compounds such as yeast extract and tryptone were required to observe the antagonistic effect of salt and acetic acid in combination. However, use of an rpoS mutant or addition of chloramphenicol resulted in no changes in the antagonistic effect of acetic acid and salt. The addition of glutamate to phosphate buffer significantly increased the survival levels of E. coli O157:H7 after the acetic acid treatment; however, the survival levels were lower than those after the treatment with acetic acid alone. Thus, the addition of salt may increase the AR response of E. coli O157:H7; however, these survival mechanisms were not proven clearly. Therefore, further studies need to be performed to better understand the antagonism of acetic acid salt against E. coli O157:H7. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Effects of Formic or Acetic Acid on the Storage Quality
 of Mixed Air-Dried Corn Stover and Cabbage Waste,
and Microbial Community Analysis.

    PubMed

    Ren, Haiwei; Wang, Cong; Fan, Wenguang; Zhang, Bingyun; Li, Zhizhong; Li, Dong

    2018-03-01

    A mixture of air-dried corn stover and cabbage waste was ensiled to preserve lignocellulosic biomass for use as biofuel. Furthermore, the effects of different fresh mass fractions (0.3 and 0.6%) of formic or acetic acid on the mixed silage quality were evaluated to guarantee its quality. The application of formic or acetic acid prior to mixing the silage led to higher water-soluble carbohydrate fractions than the negative control, indicating that both acids contributed to preservation of water-soluble carbohydrates during storage for 170 days. The dry matter content was also increased after storage from 90 to 170 days. It was found that the content of neutral and acid detergent fibre, cellulose and holocellulose (the sum of cellulose and hemicellulose) in mixed silage treated with formic or acetic acid was significantly lower than that obtained in the negative control. The pH and the ratio of ammoniacal nitrogen to total nitrogen in mixed silage treated with acetic acid also significantly decreased. Furthermore, the addition of formic or acetic acid significantly weakened the fermentation intensity of lactic acid, depending on the ratio of lactic to acetic acid, as well as the ratio of lactic acid to total organic acids. The number of bacterial species and their relative abundance shifted during silage mixing, wherein microbial communities at phylum level mainly consisted of Proteobacteria and Firmicutes. The dominant bacteria were also observed to shift from Lactobacillus and Enterobacter in presilage biomass to Lactobacillus and Paralactobacillus . Specifically, Enterobacter disappeared after 130 days of storage. In conclusion, the addition of a low dose of acetic acid to fresh mass (0.3%) could effectively improve the fermentation quality and is conducive to the preservation of the organic components.

  6. Effects of Ethanol and Other Alkanols on Transport of Acetic Acid in Saccharomyces cerevisiae

    PubMed Central

    Casal, Margarida; Cardoso, Helena; Leão, Cecília

    1998-01-01

    In glucose-grown cells of Saccharomyces cerevisiae IGC 4072, acetic acid enters only by simple diffusion of the undissociated acid. In these cells, ethanol and other alkanols enhanced the passive influx of labelled acetic acid. The influx of the acid followed first-order kinetics with a rate constant that increased exponentially with the alcohol concentration, and an exponential enhancement constant for each alkanol was estimated. The intracellular concentration of labelled acetic acid was also enhanced by alkanols, and the effect increased exponentially with alcohol concentration. Acetic acid is transported across the plasma membrane of acetic acid-, lactic acid-, and ethanol-grown cells by acetate-proton symports. We found that in these cells ethanol and butanol inhibited the transport of labelled acetic acid in a noncompetitive way; the maximum transport velocity decreased with alcohol concentration, while the affinity of the system for acetate was not significantly affected by the alcohol. Semilog plots of Vmax versus alcohol concentration yielded straight lines with negative slopes from which estimates of the inhibition constant for each alkanol could be obtained. The intracellular concentration of labelled acid was significantly reduced in the presence of ethanol or butanol, and the effect increased with the alcohol concentration. We postulate that the absence of an operational carrier for acetate in glucose-grown cells of S. cerevisiae, combined with the relatively high permeability of the plasma membrane for the undissociated acid and the inability of the organism to metabolize acetic acid, could be one of the reasons why this species exhibits low tolerance to acidic environments containing ethanol. PMID:9464405

  7. Interaction effects of lactic acid and acetic acid at different temperatures on ethanol production by Saccharomyces cerevisiae in corn mash.

    PubMed

    Graves, Tara; Narendranath, Neelakantam V; Dawson, Karl; Power, Ronan

    2007-01-01

    The combined effects of lactic acid and acetic acid on ethanol production by S. cerevisiae in corn mash, as influenced by temperature, were examined. Duplicate full factorial experiments (three lactic acid concentrations x three acetic acid concentrations) were performed to evaluate the interaction between lactic and acetic acids on the ethanol production of yeast at each of the three temperatures, 30, 34, and 37 degrees C. Corn mash at 30% dry solids adjusted to pH 4 after lactic and acetic acid addition was used as the substrate. Ethanol production rates and final ethanol concentrations decreased (P<0.001) progressively as the concentration of combined lactic and acetic acids in the corn mash increased and the temperature was raised from 30 to 37 degrees C. At 30 degrees C, essentially no ethanol was produced after 96 h when 0.5% w/v acetic acid was present in the mash (with 0.5, 2, and 4% w/v lactic acid). At 34 and 37 degrees C, the final concentrations of ethanol produced by the yeast were noticeably reduced by the presence of 0.3% w/v acetic acid and >or=2% w/v lactic acid. It can be concluded that, as in previous studies with defined media, lactic acid and acetic acid act synergistically to reduce ethanol production by yeast in corn mash. In addition, the inhibitory effects of combined lactic and acetic acid in corn mash were more apparent at elevated temperatures.

  8. Overexpression of acetyl-CoA synthetase in Saccharomyces cerevisiae increases acetic acid tolerance.

    PubMed

    Ding, Jun; Holzwarth, Garrett; Penner, Michael H; Patton-Vogt, Jana; Bakalinsky, Alan T

    2015-01-01

    Acetic acid-mediated inhibition of the fermentation of lignocellulose-derived sugars impedes development of plant biomass as a source of renewable ethanol. In order to overcome this inhibition, the capacity of Saccharomyces cerevisiae to synthesize acetyl-CoA from acetic acid was increased by overexpressing ACS2 encoding acetyl-coenzyme A synthetase. Overexpression of ACS2 resulted in higher resistance to acetic acid as measured by an increased growth rate and shorter lag phase relative to a wild-type control strain, suggesting that Acs2-mediated consumption of acetic acid during fermentation contributes to acetic acid detoxification. © FEMS 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  9. Performance of dairy cows fed high levels of acetic acid or ethanol.

    PubMed

    Daniel, J L P; Amaral, R C; Sá Neto, A; Cabezas-Garcia, E H; Bispo, A W; Zopollatto, M; Cardoso, T L; Spoto, M H F; Santos, F A P; Nussio, L G

    2013-01-01

    Ethanol and acetic acid are common end products from silages. The main objective of this study was to determine whether high concentrations of ethanol or acetic acid in total mixed ration would affect performance in dairy cows. Thirty mid-lactation Holstein cows were grouped in 10 blocks and fed one of the following diets for 7 wk: (1) control (33% Bermuda hay + 67% concentrates), (2) ethanol [control diet + 5% ethanol, dry matter (DM) basis], or (3) acetic acid (control diet + 5% acetic acid, DM basis). Ethanol and acetic acid were diluted in water (1:2) and sprayed onto total mixed rations twice daily before feeding. An equal amount of water was mixed with the control ration. To adapt animals to these treatments, cows were fed only half of the treatment dose during the first week of study. Cows fed ethanol yielded more milk (37.9 kg/d) than those fed the control (35.8 kg/d) or acetic acid (35.3 kg/d) diets, mainly due to the higher DM intake (DMI; 23.7, 22.2, and 21.6 kg/d, respectively). The significant diet × week interaction for DMI, mainly during wk 2 and 3 (when acetic acid reached the full dose), was related to the decrease in DMI observed for the acetic acid treatment. There was a diet × week interaction in excretion of milk energy per DMI during wk 2 and 3, due to cows fed acetic acid sustained milk yield despite lower DMI. Energy efficiency was similar across diets. Blood metabolites (glucose, insulin, nonesterified fatty acids, ethanol, and γ-glutamyl transferase activity) and sensory characteristics of milk were not affected by these treatments. Animal performance suggested similar energy value for the diet containing ethanol compared with other diets. Rumen conversion of ethanol to acetate and a concomitant increase in methane production might be a plausible explanation for the deviation of the predicted energy value based on the heat of combustion. Therefore, the loss of volatile compounds during the drying process in the laboratory should be

  10. Acetic Acid Causes Endoplasmic Reticulum Stress and Induces the Unfolded Protein Response in Saccharomyces cerevisiae

    PubMed Central

    Kawazoe, Nozomi; Kimata, Yukio; Izawa, Shingo

    2017-01-01

    Since acetic acid inhibits the growth and fermentation ability of Saccharomyces cerevisiae, it is one of the practical hindrances to the efficient production of bioethanol from a lignocellulosic biomass. Although extensive information is available on yeast response to acetic acid stress, the involvement of endoplasmic reticulum (ER) and unfolded protein response (UPR) has not been addressed. We herein demonstrated that acetic acid causes ER stress and induces the UPR. The accumulation of misfolded proteins in the ER and activation of Ire1p and Hac1p, an ER-stress sensor and ER stress-responsive transcription factor, respectively, were induced by a treatment with acetic acid stress (>0.2% v/v). Other monocarboxylic acids such as propionic acid and sorbic acid, but not lactic acid, also induced the UPR. Additionally, ire1Δ and hac1Δ cells were more sensitive to acetic acid than wild-type cells, indicating that activation of the Ire1p-Hac1p pathway is required for maximum tolerance to acetic acid. Furthermore, the combination of mild acetic acid stress (0.1% acetic acid) and mild ethanol stress (5% ethanol) induced the UPR, whereas neither mild ethanol stress nor mild acetic acid stress individually activated Ire1p, suggesting that ER stress is easily induced in yeast cells during the fermentation process of lignocellulosic hydrolysates. It was possible to avoid the induction of ER stress caused by acetic acid and the combined stress by adjusting extracellular pH. PMID:28702017

  11. Efficacy of Acetic Acid against Listeria monocytogenes Attached to Poultry Skin during Refrigerated Storage

    PubMed Central

    Gonzalez-Fandos, Elena; Herrera, Barbara

    2014-01-01

    This work evaluates the effect of acetic acid dipping on the growth of L. monocytogenes on poultry legs stored at 4 °C for eight days. Fresh inoculated chicken legs were dipped into either a 1% or 2% acetic acid solution (v/v) or distilled water (control). Changes in mesophiles, psychrotrophs, Enterobacteriaceae counts and sensorial characteristics (odor, color, texture and overall appearance) were also evaluated. The shelf life of the samples washed with acetic acid was extended by at least two days over the control samples washed with distilled water. L. monocytogenes counts before decontamination were 5.57 log UFC/g, and after treatment with 2% acetic acid (Day 0), L. monocytogenes counts were 4.47 log UFC/g. Legs washed with 2% acetic acid showed a significant (p < 0.05) inhibitory effect on L. monocytogenes compared to control legs, with a decrease of about 1.31 log units after eight days of storage. Sensory quality was not adversely affected by acetic acid. This study demonstrates that while acetic acid did reduce populations of L. monocytogenes on meat, it did not completely inactivate the pathogen. The application of acetic acid may be used as an additional hurdle contributing to extend the shelf life of raw poultry and reducing populations of L. monocytogenes. PMID:28234335

  12. Endogenous lycopene improves ethanol production under acetic acid stress in Saccharomyces cerevisiae.

    PubMed

    Pan, Shuo; Jia, Bin; Liu, Hong; Wang, Zhen; Chai, Meng-Zhe; Ding, Ming-Zhu; Zhou, Xiao; Li, Xia; Li, Chun; Li, Bing-Zhi; Yuan, Ying-Jin

    2018-01-01

    Acetic acid, generated from the pretreatment of lignocellulosic biomass, is a significant obstacle for lignocellulosic ethanol production. Reactive oxidative species (ROS)-mediated cell damage is one of important issues caused by acetic acid. It has been reported that decreasing ROS level can improve the acetic acid tolerance of Saccharomyces cerevisiae . Lycopene is known as an antioxidant. In the study, we investigated effects of endogenous lycopene on cell growth and ethanol production of S. cerevisiae in acetic acid media. By accumulating endogenous lycopene during the aerobic fermentation of the seed stage, the intracellular ROS level of strain decreased to 1.4% of that of the control strain during ethanol fermentation. In the ethanol fermentation system containing 100 g/L glucose and 5.5 g/L acetic acid, the lag phase of strain was 24 h shorter than that of control strain. Glucose consumption rate and ethanol titer of yPS002 got to 2.08 g/L/h and 44.25 g/L, respectively, which were 2.6- and 1.3-fold of the control strain. Transcriptional changes of INO1 gene and CTT1 gene confirmed that endogenous lycopene can decrease oxidative stress and improve intracellular environment. Biosynthesis of endogenous lycopene is first associated with enhancing tolerance to acetic acid in S. cerevisiae . We demonstrate that endogenous lycopene can decrease intracellular ROS level caused by acetic acid, thus increasing cell growth and ethanol production. This work innovatively   puts forward a new strategy for second generation bioethanol production during lignocellulosic fermentation.

  13. Improvement in HPLC separation of acetic acid and levulinic acid in the profiling of biomass hydrolysate.

    PubMed

    Xie, Rui; Tu, Maobing; Wu, Yonnie; Adhikari, Sushil

    2011-04-01

    5-Hydroxymethylfurfural (HMF) and furfural could be separated by the Aminex HPX-87H column chromatography, however, the separation and quantification of acetic acid and levulinic acid in biomass hydrolysate have been difficult with this method. In present study, the HPLC separation of acetic acid and levulinic acid on Aminex HPX-87H column has been investigated by varying column temperature, flow rate, and sulfuric acid content in the mobile phase. The column temperature was found critical in resolving acetic acid and levulinic acid. The resolution for two acids increased dramatically from 0.42 to 1.86 when the column temperature was lowered from 60 to 30 °C. So did the capacity factors for levulinic acid that was increased from 1.20 to 1.44 as the column temperature dropped. The optimum column temperature for the separation was found at 45 °C. Variation in flow rate and sulfuric acid concentration improved not as much as the column temperature did. Published by Elsevier Ltd.

  14. Improving the acetic acid tolerance and fermentation of Acetobacter pasteurianus by nucleotide excision repair protein UvrA.

    PubMed

    Zheng, Yu; Wang, Jing; Bai, Xiaolei; Chang, Yangang; Mou, Jun; Song, Jia; Wang, Min

    2018-05-21

    Acetic acid bacteria (AAB) are widely used in acetic acid fermentation due to their remarkable ability to oxidize ethanol and high tolerance against acetic acid. In Acetobacter pasteurianus, nucleotide excision repair protein UvrA was up-regulated 2.1 times by acetic acid when compared with that without acetic acid. To study the effects of UvrA on A. pasteurianus acetic acid tolerance, uvrA knockout strain AC2005-ΔuvrA, uvrA overexpression strain AC2005 (pMV24-uvrA), and the control strain AC2005 (pMV24), were constructed. One percent initial acetic acid was almost lethal to AC2005-ΔuvrA. However, the biomass of the UvrA overexpression strain was higher than that of the control under acetic acid concentrations. After 6% acetic acid shock for 20 and 40 min, the survival ratios of AC2005 (pMV24-uvrA) were 2 and 0.12%, respectively; however, they were 1.5 and 0.06% for the control strain AC2005 (pMV24). UvrA overexpression enhanced the acetification rate by 21.7% when compared with the control. The enzymes involved in ethanol oxidation and acetic acid tolerance were up-regulated during acetic acid fermentation due to the overexpression of UvrA. Therefore, in A. pasteurianus, UvrA could be induced by acetic acid and is related with the acetic acid tolerance by protecting the genome against acetic acid to ensure the protein expression and metabolism.

  15. Metabolic engineering of Clostridium tyrobutyricum for enhanced butyric acid production with high butyrate/acetate ratio.

    PubMed

    Suo, Yukai; Ren, Mengmeng; Yang, Xitong; Liao, Zhengping; Fu, Hongxin; Wang, Jufang

    2018-05-01

    Butyric acid fermentation by Clostridium couples with the synthesis of acetic acid. But the presence of acetic acid reduces butyric acid yield and increases separation and purification costs of butyric acid. Hence, enhancing the butyrate/acetate ratio is important for economical butyric acid production. This study indicated that enhancing the acetyl-CoA to butyrate flux by overexpression of both the butyryl-CoA/acetate CoA transferase (cat1) and crotonase (crt) genes in C. tyrobutyricum could significantly reduce acetic acid concentration. Fed-batch fermentation of ATCC 25755/cat1 + crt resulted in increased butyrate/acetate ratio of 15.76 g/g, which was 2.24-fold higher than that of the wild-type strain. Furthermore, in order to simultaneously increase the butyrate/acetate ratio, butyric acid concentration and productivity, the recombinant strain ATCC 25755/ppcc (co-expression of 6-phosphofructokinase (pfkA) gene, pyruvate kinase (pykA) gene, cat1, and crt) was constructed. Consequently, ATCC 25755/ppcc produced more butyric acid (46.8 vs. 35.0 g/L) with a higher productivity (0.83 vs. 0.49 g/L·h) and butyrate/acetate ratio (13.22 vs. 7.22 g/g) as compared with the wild-type strain in batch fermentation using high glucose concentration (120 g/L). This study demonstrates that enhancing the acetyl-CoA to butyrate flux is an effective way to reduce acetic acid production and increase butyrate/acetate ratio.

  16. Thermal decarboxylation of acetic acid: Implications for origin of natural gas

    USGS Publications Warehouse

    Kharaka, Y.K.; Carothers, W.W.; Rosenbauer, R.J.

    1983-01-01

    Laboratory experiments on the thermal decarboxylation of solutions of acetic acid at 200??C and 300??C were carried out in hydrothermal equipment allowing for on-line sampling of both the gas and liquid phases for chemical and stable-carbon-isotope analyses. The solutions had ambient pH values between 2.5 and 7.1; pH values and the concentrations of the various acetate species at the conditions of the experiments were computed using a chemical model. Results show that the concentrations of acetic acid, and not total acetate in solution, control the reaction rates which follow a first order equation based on decreasing concentrations of acetic acid with time. The decarboxylation rates at 200??C (1.81 ?? 10-8 per second) and 300??C (8.17 ?? 10-8 per second) and the extrapolated rates at lower temperatures are relatively high. The activation energy of decarboxylation is only 8.1 kcal/mole. These high decarboxylation rates, together with the distribution of short-chained aliphatic acid anions in formation waters, support the hypothesis that acid anions are precursors for an important portion of natural gas. Results of the ??13C values of CO2, CH4, and total acetate show a reasonably constant fractionation factor of about 20 permil between CO2 and CH4 at 300??C. The ??13C values of CO2 and CH4 are initially low and become higher as decarboxylation increases. ?? 1983.

  17. Unravelling the contribution of lactic acid bacteria and acetic acid bacteria to cocoa fermentation using inoculated organisms.

    PubMed

    Ho, Van Thi Thuy; Fleet, Graham H; Zhao, Jian

    2018-08-20

    Cocoa beans (Theobroma cacao L.) are the raw material for chocolate production. Fermentation of the bean pulp by microorganisms is essential for developing the precursors of chocolate flavour. Currently, the cocoa fermentation is still conducted by an uncontrolled traditional process via a consortium of indigenous species of yeasts, lactic acid bacteria and acetic acid bacteria. Although the essential contribution of yeasts to the production of good quality beans and, typical chocolate character is generally agreed, the roles of lactic acid bacteria and acetic acid bacteria are less certain. The objective of this study was to investigate the contribution of LAB and AAB in cocoa bean fermentation by conducting small scale laboratory fermentations under aseptic conditions, inoculated with different groups of microorganisms previously isolated from spontaneous cocoa fermentations. The inoculation protocols were: (1) four yeasts Hanseniaspora guilliermondii, Pichia kudriavzevii, Kluyveromyces marxianus and Saccharomyces cerevisiae; (2) four yeasts plus the lactic acid bacteria Lactobacillus plantarum and Lactobacillus fermentum; (3) four yeasts plus the acetic acid bacteria Acetobacter pasteurianus and Gluconobacter frateuri and (4) four yeasts plus two lactic acid bacteria and two acetic acid bacteria. Only the inoculated species were detected in the microbiota of their respective fermentations. Beans from the inoculated fermentations showed no significant differences in colour, shell weights and concentrations of residual sugars, alcohols and esters (p>0.05), but they were slightly different in contents of lactic acid and acetic acid (p<0.05). All beans were fully brown and free of mould. Residual sugar levels were less than 2.6 mg/g while the shell contents and ethanol were in the range of 11-13.4% and 4.8-7 mg/g, respectively. Beans fermented in the presence of LAB contained higher levels of lactic acid (0.6-1.2 mg/g) whereas higher concentrations of acetic acid

  18. Effects of Oxygen Availability on Acetic Acid Tolerance and Intracellular pH in Dekkera bruxellensis.

    PubMed

    Capusoni, Claudia; Arioli, Stefania; Zambelli, Paolo; Moktaduzzaman, M; Mora, Diego; Compagno, Concetta

    2016-08-01

    The yeast Dekkera bruxellensis, associated with wine and beer production, has recently received attention, because its high ethanol and acid tolerance enables it to compete with Saccharomyces cerevisiae in distilleries that produce fuel ethanol. We investigated how different cultivation conditions affect the acetic acid tolerance of D. bruxellensis We analyzed the ability of two strains (CBS 98 and CBS 4482) exhibiting different degrees of tolerance to grow in the presence of acetic acid under aerobic and oxygen-limited conditions. We found that the concomitant presence of acetic acid and oxygen had a negative effect on D. bruxellensis growth. In contrast, incubation under oxygen-limited conditions resulted in reproducible growth kinetics that exhibited a shorter adaptive phase and higher growth rates than those with cultivation under aerobic conditions. This positive effect was more pronounced in CBS 98, the more-sensitive strain. Cultivation of CBS 98 cells under oxygen-limited conditions improved their ability to restore their intracellular pH upon acetic acid exposure and to reduce the oxidative damage to intracellular macromolecules caused by the presence of acetic acid. This study reveals an important role of oxidative stress in acetic acid tolerance in D. bruxellensis, indicating that reduced oxygen availability can protect against the damage caused by the presence of acetic acid. This aspect is important for optimizing industrial processes performed in the presence of acetic acid. This study reveals an important role of oxidative stress in acetic acid tolerance in D. bruxellensis, indicating that reduced oxygen availability can have a protective role against the damage caused by the presence of acetic acid. This aspect is important for the optimization of industrial processes performed in the presence of acetic acid. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  19. Effects of Oxygen Availability on Acetic Acid Tolerance and Intracellular pH in Dekkera bruxellensis

    PubMed Central

    Capusoni, Claudia; Arioli, Stefania; Zambelli, Paolo; Moktaduzzaman, M.; Mora, Diego

    2016-01-01

    ABSTRACT The yeast Dekkera bruxellensis, associated with wine and beer production, has recently received attention, because its high ethanol and acid tolerance enables it to compete with Saccharomyces cerevisiae in distilleries that produce fuel ethanol. We investigated how different cultivation conditions affect the acetic acid tolerance of D. bruxellensis. We analyzed the ability of two strains (CBS 98 and CBS 4482) exhibiting different degrees of tolerance to grow in the presence of acetic acid under aerobic and oxygen-limited conditions. We found that the concomitant presence of acetic acid and oxygen had a negative effect on D. bruxellensis growth. In contrast, incubation under oxygen-limited conditions resulted in reproducible growth kinetics that exhibited a shorter adaptive phase and higher growth rates than those with cultivation under aerobic conditions. This positive effect was more pronounced in CBS 98, the more-sensitive strain. Cultivation of CBS 98 cells under oxygen-limited conditions improved their ability to restore their intracellular pH upon acetic acid exposure and to reduce the oxidative damage to intracellular macromolecules caused by the presence of acetic acid. This study reveals an important role of oxidative stress in acetic acid tolerance in D. bruxellensis, indicating that reduced oxygen availability can protect against the damage caused by the presence of acetic acid. This aspect is important for optimizing industrial processes performed in the presence of acetic acid. IMPORTANCE This study reveals an important role of oxidative stress in acetic acid tolerance in D. bruxellensis, indicating that reduced oxygen availability can have a protective role against the damage caused by the presence of acetic acid. This aspect is important for the optimization of industrial processes performed in the presence of acetic acid. PMID:27235432

  20. Drug resistance marker-aided genome shuffling to improve acetic acid tolerance in Saccharomyces cerevisiae.

    PubMed

    Zheng, Dao-Qiong; Wu, Xue-Chang; Wang, Pin-Mei; Chi, Xiao-Qin; Tao, Xiang-Lin; Li, Ping; Jiang, Xin-Hang; Zhao, Yu-Hua

    2011-03-01

    Acetic acid existing in a culture medium is one of the most limiting constraints in yeast growth and viability during ethanol fermentation. To improve acetic acid tolerance in Saccharomyces cerevisiae strains, a drug resistance marker-aided genome shuffling approach with higher screen efficiency of shuffled mutants was developed in this work. Through two rounds of genome shuffling of ultraviolet mutants derived from the original strain 308, we obtained a shuffled strain YZ2, which shows significantly faster growth and higher cell viability under acetic acid stress. Ethanol production of YZ2 (within 60 h) was 21.6% higher than that of 308 when 0.5% (v/v) acetic acid was added to fermentation medium. Membrane integrity, higher in vivo activity of the H+-ATPase, and lower oxidative damage after acetic acid treatment are the possible reasons for the acetic acid-tolerance phenotype of YZ2. These results indicated that this novel genome shuffling approach is powerful to rapidly improve the complex traits of industrial yeast strains.

  1. Synthesis of acetic acid via methanol hydrocarboxylation with CO2 and H2

    PubMed Central

    Qian, Qingli; Zhang, Jingjing; Cui, Meng; Han, Buxing

    2016-01-01

    Acetic acid is an important bulk chemical that is currently produced via methanol carbonylation using fossil based CO. Synthesis of acetic acid from the renewable and cheap CO2 is of great importance, but state of the art routes encounter difficulties, especially in reaction selectivity and activity. Here we report a route to produce acetic acid from CO2, methanol and H2. The reaction can be efficiently catalysed by Ru–Rh bimetallic catalyst using imidazole as the ligand and LiI as the promoter in 1,3-dimethyl-2-imidazolidinone (DMI) solvent. It is confirmed that methanol is hydrocarboxylated into acetic acid by CO2 and H2, which accounts for the outstanding reaction results. The reaction mechanism is proposed based on the control experiments. The strategy opens a new way for acetic acid production and CO2 transformation, and represents a significant progress in synthetic chemistry. PMID:27165850

  2. Synthesis of acetic acid via methanol hydrocarboxylation with CO2 and H2.

    PubMed

    Qian, Qingli; Zhang, Jingjing; Cui, Meng; Han, Buxing

    2016-05-11

    Acetic acid is an important bulk chemical that is currently produced via methanol carbonylation using fossil based CO. Synthesis of acetic acid from the renewable and cheap CO2 is of great importance, but state of the art routes encounter difficulties, especially in reaction selectivity and activity. Here we report a route to produce acetic acid from CO2, methanol and H2. The reaction can be efficiently catalysed by Ru-Rh bimetallic catalyst using imidazole as the ligand and LiI as the promoter in 1,3-dimethyl-2-imidazolidinone (DMI) solvent. It is confirmed that methanol is hydrocarboxylated into acetic acid by CO2 and H2, which accounts for the outstanding reaction results. The reaction mechanism is proposed based on the control experiments. The strategy opens a new way for acetic acid production and CO2 transformation, and represents a significant progress in synthetic chemistry.

  3. A novel fermentation pathway in an Escherichia coli mutant producing succinic acid, acetic acid, and ethanol.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Donnelly, M. I.; Millard, C. S.; Clark, D. P.

    1998-04-01

    Escherichia coli strain NZN111, which is unable to grow fermentatively because of insertional inactivation of the genes encoding pyruvate: formate lyase and the fermentative lactate dehydrogenase, gave rise spontaneously to a chromosomal mutation that restored its ability to ferment glucose. The mutant strain, named AFP111, fermented glucose more slowly than did its wild-type ancestor, strain W1485, and generated a very different spectrum of products. AFP111 produced succinic acid, acetic acid, and ethanol in proportions of approx 2:1:1. Calculations of carbon and electron balances accounted fully for the observed products; 1 mol of glucose was converted to 1 mol of succinicmore » acid and 0.5 mol each of acetic acid and ethanol. The data support the emergence in E.coli of a novel succinic acid:acetic acid:ethanol fermentation pathway.« less

  4. Trehalose accumulation enhances tolerance of Saccharomyces cerevisiae to acetic acid.

    PubMed

    Yoshiyama, Yoko; Tanaka, Koichi; Yoshiyama, Kohei; Hibi, Makoto; Ogawa, Jun; Shima, Jun

    2015-02-01

    Trehalose confers protection against various environmental stresses on yeast cells. In this study, trehalase gene deletion mutants that accumulate trehalose at high levels showed significant stress tolerance to acetic acid. The enhancement of trehalose accumulation can thus be considered a target in the breeding of acetic acid-tolerant yeast strains. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  5. Biosynthesis of the Halogenated Auxin, 4-Chloroindole-3-Acetic Acid1[W][OA

    PubMed Central

    Tivendale, Nathan D.; Davidson, Sandra E.; Davies, Noel W.; Smith, Jason A.; Dalmais, Marion; Bendahmane, Abdelhafid I.; Quittenden, Laura J.; Sutton, Lily; Bala, Raj K.; Le Signor, Christine; Thompson, Richard; Horne, James; Reid, James B.; Ross, John J.

    2012-01-01

    Seeds of several agriculturally important legumes are rich sources of the only halogenated plant hormone, 4-chloroindole-3-acetic acid. However, the biosynthesis of this auxin is poorly understood. Here, we show that in pea (Pisum sativum) seeds, 4-chloroindole-3-acetic acid is synthesized via the novel intermediate 4-chloroindole-3-pyruvic acid, which is produced from 4-chlorotryptophan by two aminotransferases, TRYPTOPHAN AMINOTRANSFERASE RELATED1 and TRYPTOPHAN AMINOTRANSFERASE RELATED2. We characterize a tar2 mutant, obtained by Targeting Induced Local Lesions in Genomes, the seeds of which contain dramatically reduced 4-chloroindole-3-acetic acid levels as they mature. We also show that the widespread auxin, indole-3-acetic acid, is synthesized by a parallel pathway in pea. PMID:22573801

  6. Application of acetate, lactate, and fumarate as electron donors in microbial fuel cell

    NASA Astrophysics Data System (ADS)

    Vasyliv, Oresta M.; Bilyy, Oleksandr I.; Ferensovych, Yaroslav P.; Hnatush, Svitlana O.

    2013-09-01

    Microbial fuel cells (MFCs) are devices that use bacteria as the catalysts to oxidize organic and inorganic matter and generate current. Up to now, several classes of extracellular electron transfer mechanisms have been elucidated for various microorganisms. Shewanellaceae and Geobacteraceae families include the most of model exoelectrogenic microorganisms. Desulfuromonas acetoxidans bacterium inhabits aquatic sedimental sulfur-containing environments and is philogenetically close to representatives of Geobacteraceae family. Two chamber microbial fuel cell (0.3 l volume) was constructed with application of D. acetoxidans IMV B-7384 as anode biocatalyst. Acetic, lactic and fumaric acids were separately applied as organic electron donors for bacterial growth in constructed MFC. Bacterial cultivation in MFC was held during twenty days. Lactate oxidation caused electric power production with the highest value up to 0.071 mW on 64 hour of D. acetoxidans IMV B-7384 growth. Addition of acetic and fumaric acids into bacterial growth medium caused maximal power production up to 0.075 and 0.074 mW respectively on the 40 hour of their growth. Increasing of incubation time up to twentieth day caused decrease of generated electric power till 0.018 mW, 0.042 mW and 0.047 mW under usage of lactic, acetic and fumaric acids respectively by investigated bacteria. Power generation by D. acetoxidans IMV B-7384 was more stabile and durable under application of acetic and fumaric acids as electron donors in constructed MFC, than under addition of lactic acid in the same concentration into the growth medium.

  7. Pretreatment of corn stover with diluted acetic acid for enhancement of acidogenic fermentation.

    PubMed

    Zhao, Xu; Wang, Lijuan; Lu, Xuebin; Zhang, Shuting

    2014-04-01

    A Box-Behnken design of response surface method was used to optimize acetic acid-catalyzed hydrothermal pretreatment of corn stover, in respect to acid concentration (0.05-0.25%), treatment time (5-15 min) and reaction temperature (180-210°C). Acidogenic fermentations with different initial pH and hydrolyzates were also measured to evaluate the optimal pretreatment conditions for maximizing acid production. The results showed that pretreatment with 0.25% acetic acid at 191°C for 7.74 min was found to be the most optimal condition for pretreatment of corn stover under which the production of acids can reach the highest level. Acidogenic fermentation with the hydrolyzate of pretreatment at the optimal condition at the initial pH=5 was shown to be butyric acid type fermentation, producing 21.84 g acetic acid, 7.246 g propionic acid, 9.170 butyric acid and 1.035 g isovaleric acid from 100g of corn stover in 900 g of water containing 2.25 g acetic acid. Copyright © 2014 Elsevier Ltd. All rights reserved.

  8. Physiological responses of insects to microbial fermentation products: Insights from the interactions between Drosophila and acetic acid.

    PubMed

    Kim, Geonho; Huang, Jia Hsin; McMullen, John G; Newell, Peter D; Douglas, Angela E

    2018-04-01

    Acetic acid is a fermentation product of many microorganisms, including some that inhabit the food and guts of Drosophila. Here, we investigated the effect of dietary acetic acid on oviposition and larval performance of Drosophila. At all concentrations tested (0.34-3.4%), acetic acid promoted egg deposition by mated females in no-choice assays; and females preferred to oviposit on diet with acetic acid relative to acetic acid-free diet. However, acetic acid depressed larval performance, particularly extending the development time of both larvae colonized with the bacterium Acetobacter pomorum and axenic (microbe-free) larvae. The larvae may incur an energetic cost associated with dissipating the high acid load on acetic acid-supplemented diets. This effect was compounded by suppressed population growth of A. pomorum on the 3.4% acetic acid diet, such that the gnotobiotic Drosophila on this diet displayed traits characteristic of axenic Drosophila, specifically reduced developmental rate and elevated lipid content. It is concluded that acetic acid is deleterious to larval Drosophila, and hypothesized that acetic acid may function as a reliable cue for females to oviposit in substrates bearing microbial communities that promote larval nutrition. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Radiofrequency Thermal Ablation: Increase in Lesion Diameter with Continuous Acetic Acid Infusion

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lubienski, Andreas; Duex, Markus; Lubienski, Katrin

    Purpose. To evaluate the influence of continuous infusion of acetic acid 50% during radiofrequency ablation (RFA) on the size of the thermal lesion produced. Methods. Radiofrequency (RF) was applied to excised bovine liver by using an expandable needle electrode with 10 retractable tines (LeVeen Needle Electrode, RadioTherapeutics, Sunnyvale, CA) connected to a commercially available RF generator (RF 2000, RadioTherapeutics, Sunnyvale, CA). Experiments were performed using three different treatment modalities: RF only (n = 15), RF with continuous saline 0.9% infusion (n = 15), and RF with continuous acetic acid 50% infusion (n = 15). RF duration, power output, tissue impedance,more » and time to a rapid rise in impedance were recorded. The ablated lesions were evaluated both macroscopically and histologically. Results. The ablated lesions appeared as spherical or ellipsoid, well-demarcated pale areas with a surrounding brown rim with both RF only and RF plus saline 0.9% infusion. In contrast, thermolesions generated with RF in combination with acetic acid 50% infusion were irregular in shape and the central portion was jelly-like. Mean diameter of the coagulation necrosis was 22.3 {+-} 2.1 mm (RF only), 29.2 {+-} 4.8 mm (RF + saline 0.9%) and 30.7 {+-} 5.7 mm (RF + acetic acid 50%), with a significant increase in the RF plus saline 0.9% and RF plus acetic acid 50% groups compared with RF alone. Time to a rapid rise in impedance was significantly prolonged in the RF plus saline 0.9% and RF plus acetic acid 50% groups compared with RF alone. Conclusions. A combination of RF plus acetic acid 50% infusion is able to generate larger thermolesions than RF only or RF combined with saline 0.9% infusion.« less

  10. Acetic acid bacteria in traditional balsamic vinegar: phenotypic traits relevant for starter cultures selection.

    PubMed

    Gullo, Maria; Giudici, Paolo

    2008-06-30

    This review focuses on acetic acid bacteria in traditional balsamic vinegar process. Although several studies are available on acetic acid bacteria ecology, metabolism and nutritional requirements, their activity as well as their technological traits in homemade vinegars as traditional balsamic vinegar is not well known. The basic technology to oxidise cooked grape must to produce traditional balsamic vinegar is performed by the so called "seed-vinegar" that is a microbiologically undefined starter culture obtained from spontaneous acetification of previous raw material. Selected starter cultures are the main technological improvement in order to innovate traditional balsamic vinegar production but until now they are rarely applied. To develop acetic acid bacteria starter cultures, selection criteria have to take in account composition of raw material, acetic acid bacteria metabolic activities, applied technology and desired characteristics of the final product. For traditional balsamic vinegar, significative phenotypical traits of acetic acid bacteria have been highlighted. Basic traits are: ethanol preferred and efficient oxidation, fast rate of acetic acid production, tolerance to high concentration of acetic acid, no overoxidation and low pH resistance. Specific traits are tolerance to high sugar concentration and to a wide temperature range. Gluconacetobacter europaeus and Acetobacter malorum strains can be evaluated to develop selected starter cultures since they show one or more suitable characters.

  11. Point mutation of H3/H4 histones affects acetic acid tolerance in Saccharomyces cerevisiae.

    PubMed

    Liu, Xiangyong; Zhang, Xiaohua; Zhang, Zhaojie

    2014-10-10

    The molecular mechanism of acetic acid tolerance in yeast remains unclear despite of its importance for efficient cellulosic ethanol production. In this study, we examined the effects of histone H3/H4 point mutations on yeast acetic acid tolerance by comprehensively screening a histone H3/H4 mutant library. A total of 24 histone H3/H4 mutants (six acetic acid resistant and 18 sensitive) were identified. Compared to the wild-type strain, the histone acetic acid-resistant mutants exhibited improved ethanol fermentation performance under acetic acid stress. Genome-wide transcriptome analysis revealed that changes in the gene expression in the acetic acid-resistant mutants H3 K37A and H4 K16Q were mainly related to energy production, antioxidative stress. Our results provide novel insights into yeast acetic acid tolerance on the basis of histone, and suggest a novel approach to improve ethanol production by altering the histone H3/H4 sequences. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Isolation of acetic, propionic and butyric acid-forming bacteria from biogas plants.

    PubMed

    Cibis, Katharina Gabriela; Gneipel, Armin; König, Helmut

    2016-02-20

    In this study, acetic, propionic and butyric acid-forming bacteria were isolated from thermophilic and mesophilic biogas plants (BGP) located in Germany. The fermenters were fed with maize silage and cattle or swine manure. Furthermore, pressurized laboratory fermenters digesting maize silage were sampled. Enrichment cultures for the isolation of acid-forming bacteria were grown in minimal medium supplemented with one of the following carbon sources: Na(+)-dl-lactate, succinate, ethanol, glycerol, glucose or a mixture of amino acids. These substrates could be converted by the isolates to acetic, propionic or butyric acid. In total, 49 isolates were obtained, which belonged to the phyla Firmicutes, Tenericutes or Thermotogae. According to 16S rRNA gene sequences, most isolates were related to Clostridium sporosphaeroides, Defluviitoga tunisiensis and Dendrosporobacter quercicolus. Acetic, propionic or butyric acid were produced in cultures of isolates affiliated to Bacillus thermoamylovorans, Clostridium aminovalericum, Clostridium cochlearium/Clostridium tetani, C. sporosphaeroides, D. quercicolus, Proteiniborus ethanoligenes, Selenomonas bovis and Tepidanaerobacter sp. Isolates related to Thermoanaerobacterium thermosaccharolyticum produced acetic, butyric and lactic acid, and isolates related to D. tunisiensis formed acetic acid. Specific primer sets targeting 16S rRNA gene sequences were designed and used for real-time quantitative PCR (qPCR). The isolates were physiologically characterized and their role in BGP discussed. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Disease notes - Bacterial root rot

    USDA-ARS?s Scientific Manuscript database

    Bacterial root rot initiated by lactic acid bacteria, particularly Leuconostoc, occurs every year in Idaho sugarbeet fields. Hot fall weather seems to make the problem worse. Although Leuconostoc initiates the rot, other bacteria and yeast frequently invade the tissue as well. The acetic acid bac...

  14. Additive postprandial blood glucose-attenuating and satiety-enhancing effect of cinnamon and acetic acid.

    PubMed

    Mettler, Samuel; Schwarz, Isaline; Colombani, Paolo C

    2009-10-01

    Cinnamon and vinegar or acetic acid were reported to reduce the postprandial blood glucose response. We hypothesized that the combination of these substances might result in an additive effect. Therefore, we determined the 2-hour postprandial blood glucose and satiety response to a milk rice meal supplemented with either cinnamon or acetic acid on their own or in combination. Subjects (n = 27) consumed the meal on 4 occasions as either pure (control trial), with 4 g cinnamon, 28 mmol acetic acid, or the combination of cinnamon + acetic acid. Blood glucose and satiety were assessed before eating and 15, 30, 45, 60, 90, and 120 minutes postprandially. At 15 minutes, the combination of cinnamon + acetic acid resulted in a significantly reduced blood glucose concentration compared with the control meal (P = .021). The incremental area under the blood glucose response curve over 120 minutes did, however, not differ between the trials (P = .539). The satiety score of the cinnamon + acetic acid trial was significantly higher than that in the control trial at 15 (P = .024) and 30 minutes (P = .024), but the incremental area under the curve of the satiety response did not differ (P = .116) between the trials. In conclusion, the significant effect of the combination of cinnamon and acetic acid on blood glucose and satiety immediately after meal intake indicated an additive effect of the 2 substances. Whether larger doses of cinnamon and acetic acid may result in a more substantial additive effect on blood glucose or satiety remains to be investigated.

  15. The Genealogical Tree of Ethanol: Gas-phase Formation of Glycolaldehyde, Acetic Acid, and Formic Acid

    NASA Astrophysics Data System (ADS)

    Skouteris, Dimitrios; Balucani, Nadia; Ceccarelli, Cecilia; Vazart, Fanny; Puzzarini, Cristina; Barone, Vincenzo; Codella, Claudio; Lefloch, Bertrand

    2018-02-01

    Despite the harsh conditions of the interstellar medium, chemistry thrives in it, especially in star-forming regions where several interstellar complex organic molecules (iCOMs) have been detected. Yet, how these species are synthesized is a mystery. The majority of current models claim that this happens on interstellar grain surfaces. Nevertheless, evidence is mounting that neutral gas-phase chemistry plays an important role. In this paper, we propose a new scheme for the gas-phase synthesis of glycolaldehyde, a species with a prebiotic potential and for which no gas-phase formation route was previously known. In the proposed scheme, the ancestor is ethanol and the glycolaldehyde sister species are acetic acid (another iCOM with unknown gas-phase formation routes) and formic acid. For the reactions of the new scheme with no available data, we have performed electronic structure and kinetics calculations deriving rate coefficients and branching ratios. Furthermore, after a careful review of the chemistry literature, we revised the available chemical networks, adding and correcting several reactions related to glycolaldehyde, acetic acid, and formic acid. The new chemical network has been used in an astrochemical model to predict the abundance of glycolaldehyde, acetic acid, and formic acid. The predicted abundance of glycolaldehyde depends on the ethanol abundance in the gas phase and is in excellent agreement with the measured one in hot corinos and shock sites. Our new model overpredicts the abundance of acetic acid and formic acid by about a factor of 10, which might imply a yet incomplete reaction network.

  16. Tolerance to acetic acid is improved by mutations of the TATA-binding protein gene.

    PubMed

    An, Jieun; Kwon, Hyeji; Kim, Eunjung; Lee, Young Mi; Ko, Hyeok Jin; Park, Hongjae; Choi, In-Geol; Kim, Sooah; Kim, Kyoung Heon; Kim, Wankee; Choi, Wonja

    2015-03-01

    Screening a library of overexpressing mutant alleles of the TATA-binding gene SPT15 yielded two Saccharomyces cerevisiae strains (MRRC 3252 and 3253) with enhanced tolerance to acetic acid. They were also tolerant to propionic acid and hydrogen peroxide. Transcriptome profile analysis identified 58 upregulated genes and 106 downregulated genes in MRRC 3252. Stress- and protein synthesis-related transcription factors were predominantly enriched in the upregulated and downregulated genes respectively. Eight deletion mutants for some of the highly downregulated genes were acetic acid-tolerant. The level of intracellular reactive oxygen species was considerably lessened in MRRC 3252 and 3253 upon exposure to acetic acid. Metabolome profile analysis revealed that intracellular concentrations of 5 and 102 metabolites were increased and decreased, respectively, in MRRC 3252, featuring a large increase of urea and a significant decrease of amino acids. The dur1/2Δmutant, in which the urea degradation gene DUR1/2 is deleted, displayed enhanced tolerance to acetic acid. Enhanced tolerance to acetic acid was also observed on the medium containing a low concentration of amino acids. Taken together, this study identified two SPT15 alleles, nine gene deletions and low concentration of amino acids in the medium that confer enhanced tolerance to acetic acid. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

  17. Culture medium optimization for acetic acid production by a persimmon vinegar-derived bacterium.

    PubMed

    Kim, Jin-Nam; Choo, Jong-Sok; Wee, Young-Jung; Yun, Jong-Sun; Ryu, Hwa-Won

    2005-01-01

    A new acetic acid-producing microorganism, Acetobacter sp. RKY4, was isolated from Korean traditional persimmon vinegar, and we optimized the culture medium for acetic acid production from ethanol using the newly isolated Acetobacter sp. RKY4. The optimized culture medium for acetic acid production using this microorganism was found to be 40 g/L ethanol, 10 g/L glycerol, 10 g/L corn steep liquor, 0.5 g/L MgSO4.7H2O, and 1.0 g/L (NH4)H2PO4. Acetobacter sp. RKY4 produced 47.1 g/L of acetic acid after 48 h of fermentation in a 250 mL Erlenmeyer flask containing 50 mL of the optimized medium.

  18. Producing Acetic Acid of Acetobacter pasteurianus by Fermentation Characteristics and Metabolic Flux Analysis.

    PubMed

    Wu, Xuefeng; Yao, Hongli; Liu, Qing; Zheng, Zhi; Cao, Lili; Mu, Dongdong; Wang, Hualin; Jiang, Shaotong; Li, Xingjiang

    2018-03-19

    The acetic acid bacterium Acetobacter pasteurianus plays an important role in acetic acid fermentation, which involves oxidation of ethanol to acetic acid through the ethanol respiratory chain under specific conditions. In order to obtain more suitable bacteria for the acetic acid industry, A. pasteurianus JST-S screened in this laboratory was compared with A. pasteurianus CICC 20001, a current industrial strain in China, to determine optimal fermentation parameters under different environmental stresses. The maximum total acid content of A. pasteurianus JST-S was 57.14 ± 1.09 g/L, whereas that of A. pasteurianus CICC 20001 reached 48.24 ± 1.15 g/L in a 15-L stir stank. Metabolic flux analysis was also performed to compare the reaction byproducts. Our findings revealed the potential value of the strain in improvement of industrial vinegar fermentation.

  19. Sclerotherapy of renal cysts using acetic acid: a comparison with ethanol sclerotherapy.

    PubMed

    Cho, D S; Ahn, H S; Kim, S I; Kim, Y S; Kim, S J; Jeon, G S; Won, J H

    2008-12-01

    This study compared percutaneous sclerotherapy using 50% acetic acid with that using 99% ethanol for patients with simple renal cysts. The study included 72 simple renal cysts in 64 patients (male/female ratio = 31/33; age range, 31-75 years). Under fluoroscopic guidance, the cyst fluid was aspirated completely. Sclerotherapy was then performed using 50% acetic acid for 32 cysts and 99% ethanol for 40 cysts. The volumes of each renal cyst before and after sclerotherapy were compared using ultrasonography or CT. Medical records were reviewed to analyse any complications. The mean follow-up period was 21.5 months (range, 3-75 months). The mean remnant volume of the cyst after sclerotherapy was 2.6% of the initial volume in the acetic acid group and 14.0% in the ethanol group. The rates of complete remission, partial remission and treatment failure were 90.6%, 9.4% and 0%, respectively, in the acetic acid group, and 60.0%, 30.0% and 10.0%, respectively, in the ethanol group. There were no complications related to sclerotherapy in either group. In conclusion, acetic acid is a safe and effective sclerosing agent, with clinical results superior to those of ethanol, and is an alternative to ethanol for sclerotherapy of renal cysts.

  20. Determination of tertiary amines and salts of organic acids in acetic acid by catalytic thermometric titration.

    PubMed

    Vajgand, V J; Gaál, F F

    1967-03-01

    A new method of determination of tertiary amines and salts of organic adds in acetic acid solution, to which about 2 % of water and 8% acetic anhydride are added, is described. After the equivalence point, the excess of perchloric acid catalyses the exothermic reaction of water with acetic anhydride. The end-point is determined from the graph of temperature against volume of added titrant. If a slightly soluble compound is produced during the titration, the precision of the new method is superior to that of the potentiometric method.

  1. 21 CFR 184.1005 - Acetic acid.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... other food categories. The ingredient may also be used in boiler water additives at levels not to exceed... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Acetic acid. 184.1005 Section 184.1005 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN...

  2. Properties of Acetate Kinase Isozymes and a Branched-Chain Fatty Acid Kinase from a Spirochete

    PubMed Central

    Harwood, Caroline S.; Canale-Parola, Ercole

    1982-01-01

    Spirochete MA-2, which is anaerobic, ferments glucose, forming acetate as a major product. The spirochete also ferments (but does not utilize as growth substrates) small amounts of l-leucine, l-isoleucine, and l-valine, forming the branched-chain fatty acids isovalerate, 2-methylbutyrate, and isobutyrate, respectively, as end products. Energy generated through the fermentation of these amino acids is utilized to prolong cell survival under conditions of growth substrate starvation. A branched-chain fatty acid kinase and two acetate kinase isozymes were resolved from spirochete MA-2 cell extracts. Kinase activity was followed by measuring the formation of acyl phosphate from fatty acid and ATP. The branched-chain fatty acid kinase was active with isobutyrate, 2-methylbutyrate, isovalerate, butyrate, valerate, or propionate as a substrate but not with acetate as a substrate. The acetate kinase isozymes were active with acetate and propionate as substrates but not with longer-chain fatty acids as substrates. The acetate kinase isozymes and the branched-chain fatty acid kinase differed in nucleoside triphosphate and cation specificities. Each acetate kinase isozyme had an apparent molecular weight of approximately 125,000, whereas the branched-chain fatty acid kinase had a molecular weight of approximately 76,000. These results show that spirochete MA-2 synthesizes a branched-chain fatty acid kinase specific for leucine, isoleucine, and valine fermentation. It is likely that a phosphate branched-chain amino acids is also synthesized by spirochete MA-2. Thus, in spirochete MA-2, physiological mechanisms have evolved which serve specifically to generate maintenance energy from branched-chain amino acids. PMID:6288660

  3. The Key to Acetate: Metabolic Fluxes of Acetic Acid Bacteria under Cocoa Pulp Fermentation-Simulating Conditions

    PubMed Central

    Adler, Philipp; Frey, Lasse Jannis; Berger, Antje; Bolten, Christoph Josef; Hansen, Carl Erik

    2014-01-01

    Acetic acid bacteria (AAB) play an important role during cocoa fermentation, as their main product, acetate, is a major driver for the development of the desired cocoa flavors. Here, we investigated the specialized metabolism of these bacteria under cocoa pulp fermentation-simulating conditions. A carefully designed combination of parallel 13C isotope labeling experiments allowed the elucidation of intracellular fluxes in the complex environment of cocoa pulp, when lactate and ethanol were included as primary substrates among undefined ingredients. We demonstrate that AAB exhibit a functionally separated metabolism during coconsumption of two-carbon and three-carbon substrates. Acetate is almost exclusively derived from ethanol, while lactate serves for the formation of acetoin and biomass building blocks. Although this is suboptimal for cellular energetics, this allows maximized growth and conversion rates. The functional separation results from a lack of phosphoenolpyruvate carboxykinase and malic enzymes, typically present in bacteria to interconnect metabolism. In fact, gluconeogenesis is driven by pyruvate phosphate dikinase. Consequently, a balanced ratio of lactate and ethanol is important for the optimum performance of AAB. As lactate and ethanol are individually supplied by lactic acid bacteria and yeasts during the initial phase of cocoa fermentation, respectively, this underlines the importance of a well-balanced microbial consortium for a successful fermentation process. Indeed, AAB performed the best and produced the largest amounts of acetate in mixed culture experiments when lactic acid bacteria and yeasts were both present. PMID:24837393

  4. The key to acetate: metabolic fluxes of acetic acid bacteria under cocoa pulp fermentation-simulating conditions.

    PubMed

    Adler, Philipp; Frey, Lasse Jannis; Berger, Antje; Bolten, Christoph Josef; Hansen, Carl Erik; Wittmann, Christoph

    2014-08-01

    Acetic acid bacteria (AAB) play an important role during cocoa fermentation, as their main product, acetate, is a major driver for the development of the desired cocoa flavors. Here, we investigated the specialized metabolism of these bacteria under cocoa pulp fermentation-simulating conditions. A carefully designed combination of parallel 13C isotope labeling experiments allowed the elucidation of intracellular fluxes in the complex environment of cocoa pulp, when lactate and ethanol were included as primary substrates among undefined ingredients. We demonstrate that AAB exhibit a functionally separated metabolism during coconsumption of two-carbon and three-carbon substrates. Acetate is almost exclusively derived from ethanol, while lactate serves for the formation of acetoin and biomass building blocks. Although this is suboptimal for cellular energetics, this allows maximized growth and conversion rates. The functional separation results from a lack of phosphoenolpyruvate carboxykinase and malic enzymes, typically present in bacteria to interconnect metabolism. In fact, gluconeogenesis is driven by pyruvate phosphate dikinase. Consequently, a balanced ratio of lactate and ethanol is important for the optimum performance of AAB. As lactate and ethanol are individually supplied by lactic acid bacteria and yeasts during the initial phase of cocoa fermentation, respectively, this underlines the importance of a well-balanced microbial consortium for a successful fermentation process. Indeed, AAB performed the best and produced the largest amounts of acetate in mixed culture experiments when lactic acid bacteria and yeasts were both present.

  5. Plasmonic-based colorimetric and spectroscopic discrimination of acetic and butyric acids produced by different types of Escherichia coli through the different assembly structures formation of gold nanoparticles.

    PubMed

    La, Ju A; Lim, Sora; Park, Hyo Jeong; Heo, Min-Ji; Sang, Byoung-In; Oh, Min-Kyu; Cho, Eun Chul

    2016-08-24

    We present a plasmonic-based strategy for the colourimetric and spectroscopic differentiation of various organic acids produced by bacteria. The strategy is based on our discovery that particular concentrations of dl-lactic, acetic, and butyric acids induce different assembly structures, colours, and optical spectra of gold nanoparticles. We selected wild-type (K-12 W3110) and genetically-engineered (JHL61) Escherichia coli (E. coli) that are known to primarily produce acetic and butyric acid, respectively. Different assembly structures and optical properties of gold nanoparticles were observed when different organic acids, obtained after the removal of acid-producing bacteria, were mixed with gold nanoparticles. Moreover, at moderate cell concentrations of K-12 W3110 E. coli, which produce sufficient amounts of acetic acid to induce the assembly of gold nanoparticles, a direct estimate of the number of bacteria was possible based on time-course colour change observations of gold nanoparticle aqueous suspensions. The plasmonic-based colourimetric and spectroscopic methods described here may enable onsite testing for the identification of organic acids produced by bacteria and the estimation of bacterial numbers, which have applications in health and environmental sciences. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Influence of ultrasound on the heterogeneous Fenton-like oxidation of acetic acid.

    PubMed

    Cihanoğlu, Aydın; Gündüz, Gönül; Dükkancı, Meral

    2017-11-01

    The main objective of this study is to investigate the effect of ultrasound on the heterogeneous Fenton-like oxidation of acetic acid, which is one of the most resistant carboxylic acids to oxidation. For this purpose, firstly, the degradation of acetic acid was examined by using ultrasound alone and the effects of different parameters such as: type of sonication system, ultrasonic power, and addition of H 2 O 2 were investigated on the degradation of acetic acid. There was no chemical oxygen demand (COD) reduction in the presence of sonication alone. In the presence of the heterogeneous Fenton-like oxidation process alone, at 303 K, COD reduction reached only 7.1% after 2 h of reaction. However, the combination of the heterogeneous Fenton-like oxidation process with ultrasound increased the COD reduction from 7.1% to 25.5% after 2 h of reaction in an ultrasonic bath operated at 40 kHz, while the COD reduction only increased from 7.1% to 8.9% in the ultrasonic reactor operated at 850 kHz. This result indicates that the hybrid process of ultrasound and heterogeneous Fenton-like oxidation is a promising process to degrade acetic acid.

  7. Butyric acid production from softwood hydrolysate by acetate-consuming Clostridium sp. S1 with high butyric acid yield and selectivity.

    PubMed

    Kim, Minsun; Kim, Ki-Yeon; Lee, Kyung Min; Youn, Sung Hun; Lee, Sun-Mi; Woo, Han Min; Oh, Min-Kyu; Um, Youngsoon

    2016-10-01

    The aim of this work was to study the butyric acid production from softwood hydrolysate by acetate-consuming Clostridium sp. S1. Results showed that Clostridium sp. S1 produced butyric acid by simultaneously utilizing glucose and mannose in softwood hydrolysate and, more remarkably, it consumed acetic acid in hydrolysate. Clostridium sp. S1 utilized each of glucose, mannose, and xylose as well as mixed sugars simultaneously with partially repressed xylose utilization. When softwood (Japanese larch) hydrolysate containing glucose and mannose as the main sugars was used, Clostridium sp. S1 produced 21.17g/L butyric acid with the yield of 0.47g/g sugar and the selectivity of 1 (g butyric acid/g total acids) owing to the consumption of acetic acid in hydrolysate. The results demonstrate potential of Clostridium sp. S1 to produce butyric acid selectively and effectively from hydrolysate not only by utilizing mixed sugars simultaneously but also by converting acetic acid to butyric acid. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Granisetron ameliorates acetic acid-induced colitis in rats.

    PubMed

    Fakhfouri, Gohar; Rahimian, Reza; Daneshmand, Ali; Bahremand, Arash; Rasouli, Mohammad Reza; Dehpour, Ahmad Reza; Mehr, Shahram Ejtemaei; Mousavizadeh, Kazem

    2010-04-01

    Inflammatory bowel disease (IBD) is a chronically relapsing inflammation of the gastrointestinal tract, of which the definite etiology remains ambiguous. Considering the adverse effects and incomplete efficacy of currently administered drugs, it is indispensable to explore new candidates with more desirable therapeutic profiles. 5-HT( 3) receptor antagonists have shown analgesic and anti-inflammatory properties in vitro and in vivo. This study aims to investigate granisetron, a 5-HT( 3) receptor antagonist, in acetic acid-induced rat colitis and probable involvement of 5-HT(3) receptors. Colitis was rendered by instillation of 1 mL of 4% acetic acid (vol/vol) and after 1 hour, granisetron (2 mg/kg), dexamethasone (1 mg/kg), meta-chlorophenylbiguanide (mCPBG, 5 mg/kg), a 5-HT( 3) receptor agonist, or granisetron + mCPBG was given intraperitoneally. Twenty-four hours following colitis induction, animals were sacrificed and distal colons were assessed macroscopically, histologically and biochemically (malondialdehyde, myeloperoxidase, tumor necrosis factor-alpha, interleukin-1 beta and interleukin-6). Granisetron or dexamethasone significantly (p < .05) improved macroscopic and histologic scores, curtailed myeloperoxidase activity and diminished colonic levels of inflammatory cytokines and malondialdehyde. The protective effects of granisetron were reversed by concurrent administration of mCPBG. Our data suggests that the salutary effects of granisetron in acetic acid colitis could be mediated by 5-HT(3) receptors.

  9. [Comparative genomics and evolutionary analysis of CRISPR loci in acetic acid bacteria].

    PubMed

    Xia, Kai; Liang, Xin-le; Li, Yu-dong

    2015-12-01

    The clustered regularly interspaced short palindromic repeat (CRISPR) is a widespread adaptive immunity system that exists in most archaea and many bacteria against foreign DNA, such as phages, viruses and plasmids. In general, CRISPR system consists of direct repeat, leader, spacer and CRISPR-associated sequences. Acetic acid bacteria (AAB) play an important role in industrial fermentation of vinegar and bioelectrochemistry. To investigate the polymorphism and evolution pattern of CRISPR loci in acetic acid bacteria, bioinformatic analyses were performed on 48 species from three main genera (Acetobacter, Gluconacetobacter and Gluconobacter) with whole genome sequences available from the NCBI database. The results showed that the CRISPR system existed in 32 species of the 48 strains studied. Most of the CRISPR-Cas system in AAB belonged to type I CRISPR-Cas system (subtype E and C), but type II CRISPR-Cas system which contain cas9 gene was only found in the genus Acetobacter and Gluconacetobacter. The repeat sequences of some CRISPR were highly conserved among species from different genera, and the leader sequences of some CRISPR possessed conservative motif, which was associated with regulated promoters. Moreover, phylogenetic analysis of cas1 demonstrated that they were suitable for classification of species. The conservation of cas1 genes was associated with that of repeat sequences among different strains, suggesting they were subjected to similar functional constraints. Moreover, the number of spacer was positively correlated with the number of prophages and insertion sequences, indicating the acetic acid bacteria were continually invaded by new foreign DNA. The comparative analysis of CRISR loci in acetic acid bacteria provided the basis for investigating the molecular mechanism of different acetic acid tolerance and genome stability in acetic acid bacteria.

  10. Effect of manganese ions on ethanol fermentation by xylose isomerase expressing Saccharomyces cerevisiae under acetic acid stress.

    PubMed

    Ko, Ja Kyong; Um, Youngsoon; Lee, Sun-Mi

    2016-12-01

    The efficient fermentation of lignocellulosic hydrolysates in the presence of inhibitors is highly desirable for bioethanol production. Among the inhibitors, acetic acid released during the pretreatment of lignocellulose negatively affects the fermentation performance of biofuel producing organisms. In this study, we evaluated the inhibitory effects of acetic acid on glucose and xylose fermentation by a high performance engineered strain of xylose utilizing Saccharomyces cerevisiae, SXA-R2P-E, harboring a xylose isomerase based pathway. The presence of acetic acid severely decreased the xylose fermentation performance of this strain. However, the acetic acid stress was alleviated by metal ion supplementation resulting in a 52% increased ethanol production rate under 2g/L of acetic acid stress. This study shows the inhibitory effect of acetic acid on an engineered isomerase-based xylose utilizing strain and suggests a simple but effective method to improve the co-fermentation performance under acetic acid stress for efficient bioethanol production. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Properties of MgB 2 superconductor chemically treated by acetic acid

    NASA Astrophysics Data System (ADS)

    Hušeková, K.; Hušek, I.; Kováč, P.; Kulich, M.; Dobročka, E.; Štrbík, V.

    2010-03-01

    Commercial Alfa Aesar MgB 2 powder was chemically treated by acetic acid with the aim of MgO removing. Single-core MgB 2/Fe ex situ wires have been made by powder-in-tube (PIT) process using the powders treated with different acid concentration. All samples were annealed in argon at 950 °C/0.5 h. Differences in transition temperatures and critical currents of acetic acid treated MgB 2 are related to the normal state resistivity, effective carbon substitution from the organic solvent and the active area fraction (grain-connectivity).

  12. Deletion of acetate transporter gene ADY2 improved tolerance of Saccharomyces cerevisiae against multiple stresses and enhanced ethanol production in the presence of acetic acid.

    PubMed

    Zhang, Mingming; Zhang, Keyu; Mehmood, Muhammad Aamer; Zhao, Zongbao Kent; Bai, Fengwu; Zhao, Xinqing

    2017-12-01

    The aim of this work was to study the effects of deleting acetate transporter gene ADY2 on growth and fermentation of Saccharomyces cerevisiae in the presence of inhibitors. Comparative transcriptome analysis revealed that three genes encoding plasma membrane carboxylic acid transporters, especially ADY2, were significantly downregulated under the zinc sulfate addition condition in the presence of acetic acid stress, and the deletion of ADY2 improved growth of S. cerevisiae under acetic acid, ethanol and hydrogen peroxide stresses. Consistently, a concomitant increase in ethanol production by 14.7% in the presence of 3.6g/L acetic acid was observed in the ADY2 deletion mutant of S. cerevisiae BY4741. Decreased intracellular acetic acid, ROS accumulation, and plasma membrane permeability were observed in the ADY2 deletion mutant. These findings would be useful for developing robust yeast strains for efficient ethanol production. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Impact of acetic acid concentration, application volume, and adjuvants on weed control efficacy

    USDA-ARS?s Scientific Manuscript database

    Vinegar has been identified as a potential organic herbicide, yet additional information is needed to determine the influence of acetic acid concentration, application volume, and adjuvants on weed control. Acetic acid is a contact herbicide, injuring and killing plants by first destroying the cell ...

  14. Improved Acetic Acid Resistance in Saccharomyces cerevisiae by Overexpression of the WHI2 Gene Identified through Inverse Metabolic Engineering

    PubMed Central

    Chen, Yingying; Stabryla, Lisa

    2016-01-01

    Development of acetic acid-resistant Saccharomyces cerevisiae is important for economically viable production of biofuels from lignocellulosic biomass, but the goal remains a critical challenge due to limited information on effective genetic perturbation targets for improving acetic acid resistance in the yeast. This study employed a genomic-library-based inverse metabolic engineering approach to successfully identify a novel gene target, WHI2 (encoding a cytoplasmatic globular scaffold protein), which elicited improved acetic acid resistance in S. cerevisiae. Overexpression of WHI2 significantly improved glucose and/or xylose fermentation under acetic acid stress in engineered yeast. The WHI2-overexpressing strain had 5-times-higher specific ethanol productivity than the control in glucose fermentation with acetic acid. Analysis of the expression of WHI2 gene products (including protein and transcript) determined that acetic acid induced endogenous expression of Whi2 in S. cerevisiae. Meanwhile, the whi2Δ mutant strain had substantially higher susceptibility to acetic acid than the wild type, suggesting the important role of Whi2 in the acetic acid response in S. cerevisiae. Additionally, overexpression of WHI2 and of a cognate phosphatase gene, PSR1, had a synergistic effect in improving acetic acid resistance, suggesting that Whi2 might function in combination with Psr1 to elicit the acetic acid resistance mechanism. These results improve our understanding of the yeast response to acetic acid stress and provide a new strategy to breed acetic acid-resistant yeast strains for renewable biofuel production. PMID:26826231

  15. Fermentative utilization of glycerol residue for the production of acetic acid

    NASA Astrophysics Data System (ADS)

    Irvan; Trisakti, B.; Hasibuan, R.; Joli, M.

    2018-02-01

    Glycerol residue, frequently known as pitch, is a waste produced from the downstream product of crude glycerine distillation. With the increasing need of pure glycerine in the world, the glycerol residue produced is also increasing. Glycerol residue is a solid waste at room temperature, highly alkaline (pH > 13), corrosive, and categorized as hazardous and poisonous waste. In this research, acetic acid was produced from glycerol residue through the anaerobic fermentation process by using purple non-sulphur photosynthetic bacteria. The purpose of this study was to find out the influence of concentration change of glycerol residue on time and to find out the possibility of glycerol residue to be utilized as acetic acid. In this research, at first 400 g of glycerol residue was diluted with 200 ml of distilled water to change the glycerine phase, from solid to liquid at room temperature, acidified by using hydrochloric acid until pH 2. The top layer formed was fatty acid and triglycerides that should be removed. Meanwhile, the bottom layer was diluted glycerol residue which was then neutralized with caustic soda. To produce acetic acid, glycerol residue with various concentrations, salt, and purple non-sulphur photosynthetic bacteria were put together into a 100 ml bottle which had been previously sterilized, then incubated for four weeks under the light of 40-watt bulb. The result showed that on the 28th day of fermentation, the produced acetic acid were 0.28, 1.85, and 0.2% (w/w) by using glycerine with the concentration of 0.5, 1.0, and 1.5% (w/w), respectively.

  16. Sphingolipid biosynthesis upregulation by TOR Complex 2-Ypk1 signaling during yeast adaptive response to acetic acid stress

    PubMed Central

    Guerreiro, Joana F.; Muir, Alexander; Ramachandran, Subramaniam; Thorner, Jeremy; Sá-Correia, Isabel

    2016-01-01

    Acetic acid-induced inhibition of yeast growth and metabolism limits the productivity of industrial fermentation processes, especially when lignocellulosic hydrolysates are used as feedstock in industrial biotechnology. Tolerance to acetic acid of food spoilage yeasts is also a problem in the preservation of acidic foods and beverages. Thus, understanding the molecular mechanisms underlying adaptation and tolerance to acetic acid stress is increasingly important in industrial biotechnology and the food industry. Prior genetic screens for S. cerevisiae mutants with increased sensitivity to acetic acid identified loss-of-function mutations in the YPK1 gene, which encodes a protein kinase activated by the Target of Rapamycin (TOR) Complex 2 (TORC2). We show here by several independent criteria that TORC2-Ypk1 signaling is stimulated in response to acetic acid stress. Moreover, we demonstrate that TORC2-mediated Ypk1 phosphorylation and activation is necessary for acetic acid tolerance, and occurs independently of Hrk1, a protein kinase previously implicated in the cellular response to acetic acid. In addition, we show that TORC2-Ypk1-mediated activation of L-serine: palmitoyl-CoA acyltransferase, the enzyme complex that catalyzes the first committed step of sphingolipid biosynthesis, is required for acetic acid tolerance. Furthermore, analysis of the sphingolipid pathway using inhibitors and mutants indicates that it is production of certain complex sphingolipids that contributes to conferring acetic acid tolerance. Consistent with that conclusion, promoting sphingolipid synthesis by adding exogenous long-chain base precursor phytosphingosine to the growth medium enhanced acetic acid tolerance. Thus, appropriate modulation of the TORC2-Ypk1-sphingolipid axis in industrial yeast strains may have utility in improving fermentations of acetic acid-containing feedstocks. PMID:27671892

  17. Effects of acetic acid, ethanol, and SO(2) on the removal of volatile acidity from acidic wines by two Saccharomyces cerevisiae commercial strains.

    PubMed

    Vilela-Moura, Alice; Schuller, Dorit; Mendes-Faia, Arlete; Côrte-Real, Manuela

    2010-07-01

    Herein, we report the influence of different combinations of initial concentration of acetic acid and ethanol on the removal of acetic acid from acidic wines by two commercial Saccharomyces cerevisiae strains S26 and S29. Both strains reduced the volatile acidity of an acidic wine (1.0 gl(-1) acetic acid and 11% (v/v) ethanol) by 78% and 48%, respectively. Acetic acid removal by strains S26 and S29 was associated with a decrease in ethanol concentration of 0.7 and 1.2% (v/v), respectively. Strain S26 revealed better removal efficiency due to its higher tolerance to stress factors imposed by acidic wines. Sulfur dioxide (SO(2)) in the concentration range 95-170 mg l(-1)inhibits the ability of both strains to reduce the volatile acidity of the acidic wine used under our experimental conditions. Therefore, deacidification should be carried out either in wines stabilized by filtration or in wines with SO(2)concentrations up to 70 mg l(-1). Deacidification of wines with the better performing strain S26 was associated with changes in the concentration of volatile compounds. The most pronounced increase was observed for isoamyl acetate (banana) and ethyl hexanoate (apple, pineapple), with an 18- and 25-fold increment, respectively, to values above the detection threshold. The acetaldehyde concentration of the deacidified wine was 2.3 times higher, and may have a detrimental effect on the wine aroma. Moreover, deacidification led to increased fatty acids concentration, but still within the range of values described for spontaneous fermentations, and with apparently no negative impact on the organoleptical properties.

  18. Tuning the properties of polyhydroxybutyrate films using acetic acid via solvent casting

    NASA Astrophysics Data System (ADS)

    Anbukarasu, Preetam; Sauvageau, Dominic; Elias, Anastasia

    2015-12-01

    Biodegradable polyhydroxybutyrate (PHB) films were fabricated using acetic acid as an alternative to common solvents such as chloroform. The PHB films were prepared using a solvent casting process at temperatures ranging from 80 °C to 160 °C. The crystallinity, mechanical properties and surface morphology of the films cast at different temperatures were characterized and compared to PHB films cast using chloroform as a solvent. Results revealed that the properties of the PHB film varied considerably with solvent casting temperature. In general, samples processed with acetic acid at low temperatures had comparable mechanical properties to PHB cast using chloroform. This acetic acid based method is environmentally friendly, cost efficient and allows more flexible processing conditions and broader ranges of polymer properties than traditional methods.

  19. Improved Acetic Acid Resistance in Saccharomyces cerevisiae by Overexpression of the WHI2 Gene Identified through Inverse Metabolic Engineering.

    PubMed

    Chen, Yingying; Stabryla, Lisa; Wei, Na

    2016-01-29

    Development of acetic acid-resistant Saccharomyces cerevisiae is important for economically viable production of biofuels from lignocellulosic biomass, but the goal remains a critical challenge due to limited information on effective genetic perturbation targets for improving acetic acid resistance in the yeast. This study employed a genomic-library-based inverse metabolic engineering approach to successfully identify a novel gene target, WHI2 (encoding a cytoplasmatic globular scaffold protein), which elicited improved acetic acid resistance in S. cerevisiae. Overexpression of WHI2 significantly improved glucose and/or xylose fermentation under acetic acid stress in engineered yeast. The WHI2-overexpressing strain had 5-times-higher specific ethanol productivity than the control in glucose fermentation with acetic acid. Analysis of the expression of WHI2 gene products (including protein and transcript) determined that acetic acid induced endogenous expression of Whi2 in S. cerevisiae. Meanwhile, the whi2Δ mutant strain had substantially higher susceptibility to acetic acid than the wild type, suggesting the important role of Whi2 in the acetic acid response in S. cerevisiae. Additionally, overexpression of WHI2 and of a cognate phosphatase gene, PSR1, had a synergistic effect in improving acetic acid resistance, suggesting that Whi2 might function in combination with Psr1 to elicit the acetic acid resistance mechanism. These results improve our understanding of the yeast response to acetic acid stress and provide a new strategy to breed acetic acid-resistant yeast strains for renewable biofuel production. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  20. Formation of biologically relevant carboxylic acids during the gamma irradiation of acetic acid

    NASA Technical Reports Server (NTRS)

    Negron-Mendoza, A.; Ponnamperuma, C.

    1976-01-01

    Irradiation of aqueous solutions of acetic acid with gamma rays produced several carboxylic acids in small yield. Their identification was based on the technique of gas chromatography combined with mass spectrometry. Some of these acids are Krebs Cycle intermediates. Their simultaneous formation in experiments simulating the primitive conditions on the earth suggests that metabolic pathways may have had their origin in prebiotic chemical processes.

  1. Mentha longifolia protects against acetic-acid induced colitis in rats.

    PubMed

    Murad, Hussam A S; Abdallah, Hossam M; Ali, Soad S

    2016-08-22

    Mentha longifolia L (Wild Mint or Habak) (ML) is used in traditional medicine in treatment of many gastrointestinal disorders. This study aimed to evaluate potential protecting effect of ML and its major constituent, eucalyptol, against acetic acid-induced colitis in rats, a model of human inflammatory bowel disease (IBD). Rats were divided into ten groups (n=8) given orally for three days (mg/kg/day) the following: normal control, acetic acid-induced colitis (un-treated, positive control), vehicle (DMSO), sulfasalazine (500), ML extract (100, 500, 1000), and eucalyptol (100, 200, 400). After 24h-fasting, two ML of acetic acid (3%) was administered intrarectally. On the fifth day, serum and colonic biochemical markers, and histopathological changes were evaluated. Colitis significantly increased colonic myeloperoxidase activity and malonaldehyde level, and serum tumor necrosis factor-α, interleukin-6, and malonaldehyde levels while significantly decreased colonic and serum glutathione levels. All treatments (except ML 100, ML 1000, and eucalyptol 100) significantly reversed these changes where eucalyptol (400) showed the highest activity in a dose-dependent manner. The colitis-induced histopathological changes were mild in sulfasalazine and eucalyptol 400 groups, moderate in ML 500 and eucalyptol 200 groups, and severe in ML 100, ML 1000, and eucalyptol 100 groups nearly similar to colitis-untreated rats. ML (in moderate doses) and eucalyptol (dose-dependently) exerted protective effects against acetic acid-induced colitis in rats possibly through antioxidant and antiinflammatory properties suggesting a potential benefit in treatments of IBD. To our knowledge this is the first report addressing this point. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  2. Deletion of JJJ1 improves acetic acid tolerance and bioethanol fermentation performance of Saccharomyces cerevisiae strains.

    PubMed

    Wu, Xuechang; Zhang, Lijie; Jin, Xinna; Fang, Yahong; Zhang, Ke; Qi, Lei; Zheng, Daoqiong

    2016-07-01

    To improve tolerance to acetic acid that is present in lignocellulosic hydrolysates and affects bioethanol production by Saccharomyces cerevisiae. Saccharomyces cerevisiae strains with improved tolerance to acetic acid were obtained through deletion of the JJJ1 gene. The lag phase of the JJJ1 deletion mutant BYΔJJJ1 was ~16 h shorter than that of the parent strain, BY4741, when the fermentation medium contained 4.5 g acetic acid/l. Additionally, the specific ethanol production rate of BYΔJJJ1 was increased (0.057 g/g h) compared to that of the parent strain (0.051 g/g h). Comparative transcription and physiological analyses revealed higher long chain fatty acid, trehalose, and catalase contents might be critical factors responsible for the acetic acid resistance of JJJ1 knockout strains. JJJ1 deletion improves acetic acid tolerance and ethanol fermentation performance of S. cerevisiae.

  3. Steam Reforming of Acetic Acid over Co-Supported Catalysts: Coupling Ketonization for Greater Stability

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Davidson, Stephen D.; Spies, Kurt A.; Mei, Donghai

    We report on the markedly improved stability of a novel 2-bed catalytic system, as compared to a conventional 1-bed steam reforming catalyst, for the production of H2 from acetic acid. The 2-bed catalytic system comprises of i) a basic oxide ketonization catalyst for the conversion of acetic acid to acetone, and a ii) Co-based steam reforming catalyst, both catalytic beds placed in sequence within the same unit operation. Steam reforming catalysts are particularly prone to catalytic deactivation when steam reforming acetic acid, used here as a model compound for the aqueous fraction of bio-oil. Catalysts comprising MgAl2O4, ZnO, CeO2, andmore » activated carbon (AC) both with and without Co-addition were evaluated for conversion of acetic acid and acetone, its ketonization product, in the presence of steam. It was found that over the bare oxide support only ketonization activity was observed and coke deposition was minimal. With addition of Co to the oxide support steam reforming activity was facilitated and coke deposition was significantly increased. Acetone steam reforming over the same Co-supported catalysts demonstrated more stable performance and with less coke deposition than with acetic acid feedstock. DFT analysis suggests that over Co surface CHxCOO species are more favorably formed from acetic acid versus acetone. These CHxCOO species are strongly bound to the Co catalyst surface and could explain the higher propensity for coke formation from acetic acid. Based on these findings, in order to enhance stability of the steam reforming catalyst a dual-bed (2-bed) catalyst system was implemented. Comparing the 2-bed and 1-bed (Co-supported catalyst only) systems under otherwise identical reaction conditions the 2-bed demonstrated significantly improved stability and coke deposition was decreased by a factor of 4.« less

  4. Employing natural reagents from turmeric and lime for acetic acid determination in vinegar sample.

    PubMed

    Supharoek, Sam-Ang; Ponhong, Kraingkrai; Siriangkhawut, Watsaka; Grudpan, Kate

    2018-04-01

    A simple, rapid and environmentally friendly sequential injection analysis system employing natural extract reagents was developed for the determination of acetic acid following an acid-base reaction in the presence of an indicator. Powdered lime and turmeric were utilized as the natural base and indicator, respectively. Mixing lime and turmeric produced an orange to reddish-brown color solution which absorbed the maximum wavelength at 455 nm, with absorbance decreasing with increasing acetic acid concentration. Influential parameters including lime and turmeric concentrations, reagent and sample aspirated volumes, mixing coil length and dispensing flow rate were investigated and optimized. A standard calibration graph was plotted for 0-5.0 mmol/L acetic acid with r 2  = 0.9925. Relative standard deviations (RSD) at 2.0 and 4.0 mmol/L acetic acid were less than 3% (n = 7), with limit of detection (LOD) and limit of quantification (LOQ) at 0.12 and 0.24 mmol/L, respectively. The method was successfully applied to assay acetic acid concentration in cooking vinegar samples. Results achieved were not significantly different from those obtained following a batchwise standard AOAC titration method. Copyright © 2017. Published by Elsevier B.V.

  5. ReaxFF molecular dynamics simulation of intermolecular structure formation in acetic acid-water mixtures at elevated temperatures and pressures

    NASA Astrophysics Data System (ADS)

    Sengul, Mert Y.; Randall, Clive A.; van Duin, Adri C. T.

    2018-04-01

    The intermolecular structure formation in liquid and supercritical acetic acid-water mixtures was investigated using ReaxFF-based molecular dynamics simulations. The microscopic structures of acetic acid-water mixtures with different acetic acid mole fractions (1.0 ≥ xHAc ≥ 0.2) at ambient and critical conditions were examined. The potential energy surface associated with the dissociation of acetic acid molecules was calculated using a metadynamics procedure to optimize the dissociation energy of ReaxFF potential. At ambient conditions, depending on the acetic acid concentration, either acetic acid clusters or water clusters are dominant in the liquid mixture. When acetic acid is dominant (0.4 ≤ xHAc), cyclic dimers and chain structures between acetic acid molecules are present in the mixture. Both structures disappear at increased water content of the mixture. It was found by simulations that the acetic acid molecules released from these dimer and chain structures tend to stay in a dipole-dipole interaction. These structural changes are in agreement with the experimental results. When switched to critical conditions, the long-range interactions (e.g., second or fourth neighbor) disappear and the water-water and acetic acid-acetic acid structural formations become disordered. The simulated radial distribution function for water-water interactions is in agreement with experimental and computational studies. The first neighbor interactions between acetic acid and water molecules are preserved at relatively lower temperatures of the critical region. As higher temperatures are reached in the critical region, these interactions were observed to weaken. These simulations indicate that ReaxFF molecular dynamics simulations are an appropriate tool for studying supercritical water/organic acid mixtures.

  6. Microbiological preservation of cucumbers for bulk storage using acetic acid and food preservatives.

    PubMed

    Pérez-Díaz, I M; McFeeters, R F

    2008-08-01

    Microbial growth did not occur when cucumbers were preserved without a thermal process by storage in solutions containing acetic acid, sodium benzoate, and calcium chloride to maintain tissue firmness. The concentrations of acetic acid and sodium benzoate required to ensure preservation were low enough so that stored cucumbers could be converted to the finished product without the need to wash out and discard excess acid or preservative. Since no thermal process was required, this method of preservation would be applicable for storing cucumbers in bulk containers. Acid tolerant pathogens died off in less than 24 h with the pH, acetic acid, and sodium benzoate concentrations required to assure the microbial stability of cucumbers stored at 30 degrees C. Potassium sorbate as a preservative in this application was not effective. Yeast growth was observed when sulfite was used as a preservative.

  7. Microbial process for the preparation of acetic acid, as well as solvent for its extraction from the fermentation broth

    DOEpatents

    Gaddy, James L.; Clausen, Edgar C.; Ko, Ching-Whan; Wade, Leslie E.; Wikstrom, Carl V.

    2007-03-27

    A modified water-immiscible solvent useful in the extraction of acetic acid from aqueous streams is a substantially pure mixture of isomers of highly branched di-alkyl amines. Solvent mixtures formed of such a modified solvent with a desired co-solvent, preferably a low boiling hydrocarbon, are useful in the extraction of acetic acid from aqueous gaseous streams. An anaerobic microbial fermentation process for the production of acetic acid employs such solvents, under conditions which limit amide formation by the solvent and thus increase the efficiency of acetic acid recovery. Methods for the direct extraction of acetic acid and the extractive fermentation of acetic acid also employ the modified solvents and increase efficiency of acetic acid production. Such increases in efficiency are also obtained where the energy source for the microbial fermentation contains carbon dioxide and the method includes a carbon dioxide stripping step prior to extraction of acetic acid in solvent.

  8. Microbial process for the preparation of acetic acid, as well as solvent for its extraction from the fermentation broth

    DOEpatents

    Gaddy, James L.; Clausen, Edgar C.; Ko, Ching-Whan; Wade, Leslie E.; Wikstrom, Carl V.

    2004-06-22

    A modified water-immiscible solvent useful in the extraction of acetic acid from aqueous streams is a substantially pure mixture of isomers of highly branched di-alkyl amines. Solvent mixtures formed of such a modified solvent with a desired co-solvent, preferably a low boiling hydrocarbon, are useful in the extraction of acetic acid from aqueous gaseous streams. An anaerobic microbial fermentation process for the production of acetic acid employs such solvents, under conditions which limit amide formation by the solvent and thus increase the efficiency of acetic acid recovery. Methods for the direct extraction of acetic acid and the extractive fermentation of acetic acid also employ the modified solvents and increase efficiency of acetic acid production. Such increases in efficiency are also obtained where the energy source for the microbial fermentation contains carbon dioxide and the method includes a carbon dioxide stripping step prior to extraction of acetic acid in solvent.

  9. Tuning the properties of polyhydroxybutyrate films using acetic acid via solvent casting

    PubMed Central

    Anbukarasu, Preetam; Sauvageau, Dominic; Elias, Anastasia

    2015-01-01

    Biodegradable polyhydroxybutyrate (PHB) films were fabricated using acetic acid as an alternative to common solvents such as chloroform. The PHB films were prepared using a solvent casting process at temperatures ranging from 80 °C to 160 °C. The crystallinity, mechanical properties and surface morphology of the films cast at different temperatures were characterized and compared to PHB films cast using chloroform as a solvent. Results revealed that the properties of the PHB film varied considerably with solvent casting temperature. In general, samples processed with acetic acid at low temperatures had comparable mechanical properties to PHB cast using chloroform. This acetic acid based method is environmentally friendly, cost efficient and allows more flexible processing conditions and broader ranges of polymer properties than traditional methods. PMID:26640089

  10. Comparison of acetic acid and ethanol sclerotherapy for simple renal cysts: clinical experience with 86 patients.

    PubMed

    Cho, Young Jun; Shin, Ji Hoon

    2016-01-01

    To compare the efficacy and treatment session numbers of acetic acid to that of ethanol sclerotherapy for the treatment of simple renal cysts. Between February 2004 and June 2013, 86 patients with simple renal cysts underwent percutaneous aspiration and injection of 50 %-acetic-acid (42 cysts) and 95 %-ethanol (44 cysts). The patient demographics, volume reduction rate, number of treatment sessions, and complications were then analyzed. The volume reduction rate was 94.1 ± 7.6 % in the 50 %-acetic acid group and 94.7 ± 11.7 % in the 95 %-ethanol group, and without a statistical difference. The rates of complete remission, partial remission, and no response were 57.1, 42.9 and 0 %, respectively, for the acetic acid group, and 70.5, 25.0, and 4.5 %, respectively, for the ethanol group. No statistical difference was observed between the two groups. Compared to the acetic acid group, the ethanol group had a higher number of treatment sessions, i.e. 1.10 ± 0.30 in the acetic acid group and 1.80 ± 0.79 in the ethanol group. Mild flank pain was a minor complication that occurred in both groups. Acetic acid seems to have equivalent sclerosing effects on simple renal cysts compared with those of ethanol despites of fewer treatment sessions.

  11. Effect of acetic acid in recycling water on ethanol production for cassava in an integrated ethanol-methane fermentation process.

    PubMed

    Yang, Xinchao; Wang, Ke; Zhang, Jianhua; Tang, Lei; Mao, Zhonggui

    2016-11-01

    Recently, the integrated ethanol-methane fermentation process has been studied to prevent wastewater pollution. However, when the anaerobic digestion reaction runs poorly, acetic acid will accumulate in the recycling water. In this paper, we studied the effect of low concentration of acetic acid (≤25 mM) on ethanol fermentation at different initial pH values (4.2, 5.2 or 6.2). At an initial pH of 4.2, ethanol yields increased by 3.0% and glycerol yields decreased by 33.6% as the acetic acid concentration was increased from 0 to 25 mM. Raising the concentration of acetic acid to 25 mM increased the buffering capacity of the medium without obvious effects on biomass production in the cassava medium. Acetic acid was metabolized by Saccharomyces cerevisiae for the reason that the final concentration of acetic acid was 38.17% lower than initial concentration at pH 5.2 when 25 mM acetic acid was added. These results confirmed that a low concentration of acetic acid in the process stimulated ethanol fermentation. Thus, reducing the acetic acid concentration to a controlled low level is more advantageous than completely removing it.

  12. Effect of organic acids production and bacterial community on the possible mechanism of phosphorus solubilization during composting with enriched phosphate-solubilizing bacteria inoculation.

    PubMed

    Wei, Yuquan; Zhao, Yue; Shi, Mingzi; Cao, Zhenyu; Lu, Qian; Yang, Tianxue; Fan, Yuying; Wei, Zimin

    2018-01-01

    Enriched phosphate-solubilizing bacteria (PSB) agent were acquired by domesticated cultivation, and inoculated into kitchen waste composting in different stages. The effect of different treatments on organic acids production, tricalcium phosphate (TCP) solubilization and their relationship with bacterial community were investigated during composting. Our results pointed out that inoculation affected pH, total acidity and the production of oxalic, lactic, citric, succinic, acetic and formic acids. We also found a strong advantage in the solubilization of TCP and phosphorus (P) availability for PSB inoculation especially in the cooling stage. Redundancy analysis and structural equation models demonstrated inoculation by different methods changed the correlation of the bacterial community composition with P fractions as well as organic acids, and strengthened the cooperative function related to P transformation among species during composting. Finally, we proposed a possible mechanism of P solubilization with enriched PSB inoculation, which was induced by bacterial community and organic acids production. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Guiding principle for crystalline Si photovoltaic modules with high tolerance to acetic acid

    NASA Astrophysics Data System (ADS)

    Masuda, Atsushi; Hara, Yukiko

    2018-04-01

    A guiding principle for highly reliable crystalline Si photovoltaic modules, especially those with high tolerance to acetic acid generated by hydrolysis reaction between water vapor and an ethylene-vinyl acetate (EVA) encapsulant, is proposed. Degradation behavior evaluated by the damp heat test strongly depends on Ag finger electrodes and also EVA encapsulants. The acetic acid concentration in EVA on the glass side directly determines the degradation behavior. The most important factor for high tolerance is the type of Ag finger electrode materials when using an EVA encapsulant. Photovoltaic modules using newly developed crystalline Si cells with improved Ag finger electrode materials keep their maximum power of 80% of the initial value even after the damp heat test at 85 °C and 85% relative humidity for 10000 h. The pattern of dark regions in electroluminescence images is also discussed on the basis of the dynamics of acetic acid in the modules.

  14. Microbial process for the preparation of acetic acid as well as solvent for its extraction from the fermentation broth

    DOEpatents

    Gaddy, James L.; Clausen, Edgar C.; Ko, Ching-Whan; Wade, Leslie E.; Wikstrom, Carl V.

    2006-07-11

    A modified water-immiscible solvent useful in the extraction of acetic acid from aqueous streams is a substantially pure mixture of isomers of highly branched di-alkyl amines. This solvent is substantially devoid of mono-alkyl amines and alcohols. Solvent mixtures formed of such a modified solvent with a desired cosolvent, preferably a low boiling hydrocarbon which forms an azeotrope with water are useful in the extraction of acetic acid from aqueous gaseous streams. An anaerobic microbial fermentation process for the production of acetic acid employs such solvents, under conditions which limit amide formation by the solvent and thus increase the efficiency of acetic acid recovery. Methods for the direct extraction of acetic acid and the extractive fermentation of acetic acid also employ the modified solvents and increase efficiency of acetic acid production. Such increases in efficiency are also obtained where the energy source for the microbial fermentation contains carbon dioxide and the method includes a carbon dioxide stripping step prior to extraction of acetic acid in solvent.

  15. Microbial process for the preparation of acetic acid as well as solvent for its extraction from the fermentation broth

    DOEpatents

    Gaddy, James L.; Clausen, Edgar C.; Ko, Ching-Whan; Wade, Leslie E.; Wikstrom, Carl V.

    2002-01-01

    A modified water-immiscible solvent useful in the extraction of acetic acid from aqueous streams is a substantially pure mixture of isomers of highly branched di-alkyl amines. This solvent is substantially devoid of mono-alkyl amines and alcohols. Solvent mixtures formed of such a modified solvent with a desired cosolvent, preferably a low boiling hydrocarbon which forms an azeotrope with water are useful in the extraction of acetic acid from aqueous gaseous streams. An anaerobic microbial fermentation process for the production of acetic acid employs such solvents, under conditions which limit amide formation by the solvent and thus increase the efficiency of acetic acid recovery. Methods for the direct extraction of acetic acid and the extractive fermentation of acetic acid also employ the modified solvents and increase efficiency of acetic acid production. Such increases in efficiency are also obtained where the energy source for the microbial fermentation contains carbon dioxide and the method includes a carbon dioxide stripping step prior to extraction of acetic acid in solvent.

  16. Mutants of the pentose-fermenting yeast Pachysolen tannophilus tolerant to hardwood spent sulfite liquor and acetic acid.

    PubMed

    Harner, Nicole K; Bajwa, Paramjit K; Habash, Marc B; Trevors, Jack T; Austin, Glen D; Lee, Hung

    2014-01-01

    A strain development program was initiated to improve the tolerance of the pentose-fermenting yeast Pachysolen tannophilus to inhibitors in lignocellulosic hydrolysates. Several rounds of UV mutagenesis followed by screening were used to select for mutants of P. tannophilus NRRL Y2460 with improved tolerance to hardwood spent sulfite liquor (HW SSL) and acetic acid in separate selection lines. The wild type (WT) strain grew in 50 % (v/v) HW SSL while third round HW SSL mutants (designated UHW301, UHW302 and UHW303) grew in 60 % (v/v) HW SSL, with two of these isolates (UHW302 and UHW303) being viable and growing, respectively, in 70 % (v/v) HW SSL. In defined liquid media containing acetic acid, the WT strain grew in 0.70 % (w/v) acetic acid, while third round acetic acid mutants (designated UAA301, UAA302 and UAA303) grew in 0.80 % (w/v) acetic acid, with one isolate (UAA302) growing in 0.90 % (w/v) acetic acid. Cross-tolerance of HW SSL-tolerant mutants to acetic acid and vice versa was observed with UHW303 able to grow in 0.90 % (w/v) acetic acid and UAA302 growing in 60 % (v/v) HW SSL. The UV-induced mutants retained the ability to ferment glucose and xylose to ethanol in defined media. These mutants of P. tannophilus are of considerable interest for bioconversion of the sugars in lignocellulosic hydrolysates to ethanol.

  17. Comparative Indole-3-Acetic Acid Levels in the Slender Pea and Other Pea Phenotypes 1

    PubMed Central

    Law, David M.; Davies, Peter J.

    1990-01-01

    Free indole-3-acetic acid levels were measured by gas chromatography-mass spectrometry in three ultra-tall `slender' Pisum sativum L. lines differing in gibberellin content. Measurements were made for apices and stem elongation zones of light-grown plants and values were compared with wild-type, dwarf, and nana phenotypes in which internode length is genetically regulated, purportedly via the gibberellin level. Indole-3-acetic acid levels of growing stems paralleled growth rates in all lines, and were high in all three slender genotypes. Growth was inhibited by p-chlorophenoxyisobutyric acid, demonstrating the requirement of auxin activity for stem elongation, and also by the ethylene precursor 1-aminocyclopropane-1-carboxylic acid. It is concluded that the slender phenotype may arise from constant activation of a gibberellin receptor or transduction chain event leading directly or indirectly to elevated levels of indole-3-acetic acid, and that increased indole-3-acetic acid levels are a significant factor in the promotion of stem elongation. PMID:16667653

  18. Dynamic microbial succession of Shanxi aged vinegar and its correlation with flavor metabolites during different stages of acetic acid fermentation.

    PubMed

    Zhu, Yunping; Zhang, Feifei; Zhang, Chengnan; Yang, Li; Fan, Guangsen; Xu, Youqiang; Sun, Baoguo; Li, Xiuting

    2018-06-05

    Shanxi aged vinegar (SAV), one of the famous Chinese vinegars, is produced by multispecies solid-state fermentation in which the acetic acid fermentation stage (AAF) is especially important. However, how bacterial succession and their metabolites change along with the different stages of AAF is still poorly understood. In this study, we investigated the dynamic bacterial succession and flavor formation in three batches of SAV using high-throughput sequencing and metabolomics approaches. It is interesting to find that AAF can be divided into three stages based on its bacterial community succession (early stage, days 0-4; medium stage, days 5-21; and later stage, days 22-26). Pantoea, Pediococcus, Lactococcus and Rhizobium played an important role in the early stage; Lactobacillus was dominant in the medium stage (67.72%); and Acetobacter, Komagataeibacter and Kroppenstedtia were the key bacteria in the later stage. A total of seven organic acids and 42 volatile constituents (esters, alcohol, ketones and aldehydes) were detected during the AAF. Spearman correlation analysis showed a significant correlation between the bacterial community and these flavor metabolites during the AAF of the SAV. This is the first report to explore the relationships between volatile flavor metabolites and bacterial community succession by a three-staged method and provide theoretical support for a flavor formation mechanism in traditional SAV.

  19. Bacterial fatty acid metabolism in modern antibiotic discovery.

    PubMed

    Yao, Jiangwei; Rock, Charles O

    2017-11-01

    Bacterial fatty acid synthesis is essential for many pathogens and different from the mammalian counterpart. These features make bacterial fatty acid synthesis a desirable target for antibiotic discovery. The structural divergence of the conserved enzymes and the presence of different isozymes catalyzing the same reactions in the pathway make bacterial fatty acid synthesis a narrow spectrum target rather than the traditional broad spectrum target. Furthermore, bacterial fatty acid synthesis inhibitors are single-targeting, rather than multi-targeting like traditional monotherapeutic, broad-spectrum antibiotics. The single-targeting nature of bacterial fatty acid synthesis inhibitors makes overcoming fast-developing, target-based resistance a necessary consideration for antibiotic development. Target-based resistance can be overcome through multi-targeting inhibitors, a cocktail of single-targeting inhibitors, or by making the single targeting inhibitor sufficiently high affinity through a pathogen selective approach such that target-based mutants are still susceptible to therapeutic concentrations of drug. Many of the pathogens requiring new antibiotic treatment options encode for essential bacterial fatty acid synthesis enzymes. This review will evaluate the most promising targets in bacterial fatty acid metabolism for antibiotic therapeutics development and review the potential and challenges in advancing each of these targets to the clinic and circumventing target-based resistance. This article is part of a Special Issue entitled: Bacterial Lipids edited by Russell E. Bishop. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Acetic Acid Detection Threshold in Synthetic Wine Samples of a Portable Electronic Nose

    PubMed Central

    Macías, Miguel Macías; Manso, Antonio García; Orellana, Carlos Javier García; Velasco, Horacio Manuel González; Caballero, Ramón Gallardo; Chamizo, Juan Carlos Peguero

    2013-01-01

    Wine quality is related to its intrinsic visual, taste, or aroma characteristics and is reflected in the price paid for that wine. One of the most important wine faults is the excessive concentration of acetic acid which can cause a wine to take on vinegar aromas and reduce its varietal character. Thereby it is very important for the wine industry to have methods, like electronic noses, for real-time monitoring the excessive concentration of acetic acid in wines. However, aroma characterization of alcoholic beverages with sensor array electronic noses is a difficult challenge due to the masking effect of ethanol. In this work, in order to detect the presence of acetic acid in synthetic wine samples (aqueous ethanol solution at 10% v/v) we use a detection unit which consists of a commercial electronic nose and a HSS32 auto sampler, in combination with a neural network classifier (MLP). To find the characteristic vector representative of the sample that we want to classify, first we select the sensors, and the section of the sensors response curves, where the probability of detecting the presence of acetic acid will be higher, and then we apply Principal Component Analysis (PCA) such that each sensor response curve is represented by the coefficients of its first principal components. Results show that the PEN3 electronic nose is able to detect and discriminate wine samples doped with acetic acid in concentrations equal or greater than 2 g/L. PMID:23262483

  1. Recovery of acetic acid from dilute aqueous solutions using catalytic dehydrative esterification with ethanol.

    PubMed

    Yagyu, Daisuke; Ohishi, Tetsuo; Igarashi, Takeshi; Okumura, Yoshikuni; Nakajo, Tetsuo; Mori, Yuichiro; Kobayashi, Shū

    2013-03-01

    We have developed a direct esterification of aqueous acetic acid with ethanol (molar ratio=1:1) catalyzed by polystyrene-supported or homogeneous sulfonic acids toward the recovery of acetic acid from wastewater in chemical plants. The equilibrium yield was significantly increased by the addition of toluene, which had a high ability to extract ethyl acetate from the aqueous phase. It was shown that low-loading and alkylated polystyrene-supported sulfonic acid efficiently accelerated the reaction. These results suggest that the construction of hydrophobic reaction environments in water was critical in improving the chemical yield. Addition of inorganic salts was also effective for the reaction under not only biphasic conditions (toluene-water) but also toluene-free conditions, because the mutual solubility of ethyl acetate and water was suppressed by the salting-out effect. Among the tested salts, CaCl(2) was found to be the most suitable for this reaction system. Copyright © 2012 Elsevier Ltd. All rights reserved.

  2. Measurement of formic acid, acetic acid and hydroxyacetaldehyde, hydrogen peroxide, and methyl peroxide in air by chemical ionization mass spectrometry: airborne method development

    NASA Astrophysics Data System (ADS)

    Treadaway, Victoria; Heikes, Brian G.; McNeill, Ashley S.; Silwal, Indira K. C.; O'Sullivan, Daniel W.

    2018-04-01

    A chemical ionization mass spectrometry (CIMS) method utilizing a reagent gas mixture of O2, CO2, and CH3I in N2 is described and optimized for quantitative gas-phase measurements of hydrogen peroxide (H2O2), methyl peroxide (CH3OOH), formic acid (HCOOH), and the sum of acetic acid (CH3COOH) and hydroxyacetaldehyde (HOCH2CHO; also known as glycolaldehyde). The instrumentation and methodology were designed for airborne in situ field measurements. The CIMS quantification of formic acid, acetic acid, and hydroxyacetaldehyde used I- cluster formation to produce and detect the ion clusters I-(HCOOH), I-(CH3COOH), and I-(HOCH2CHO), respectively. The CIMS also produced and detected I- clusters with hydrogen peroxide and methyl peroxide, I-(H2O2) and I-(CH3OOH), though the sensitivity was lower than with the O2- (CO2) and O2- ion clusters, respectively. For that reason, while the I- peroxide clusters are presented, the focus is on the organic acids. Acetic acid and hydroxyacetaldehyde were found to yield equivalent CIMS responses. They are exact isobaric compounds and indistinguishable in the CIMS used. Consequently, their combined signal is referred to as the acetic acid equivalent sum. Within the resolution of the quadrupole used in the CIMS (1 m/z), ethanol and 1- and 2-propanol were potential isobaric interferences to the measurement of formic acid and the acetic acid equivalent sum, respectively. The CIMS response to ethanol was 3.3 % that of formic acid and the response to either 1- or 2-propanol was 1 % of the acetic acid response; therefore, the alcohols were not considered to be significant interferences to formic acid or the acetic acid equivalent sum. The multi-reagent ion system was successfully deployed during the Front Range Air Pollution and Photochemistry Éxperiment (FRAPPÉ) in 2014. The combination of FRAPPÉ and laboratory calibrations allowed for the post-mission quantification of formic acid and the acetic acid equivalent sum observed during

  3. Staphylococcus aureus Tissue Infection During Sepsis Is Supported by Differential Use of Bacterial or Host-Derived Lipoic Acid

    PubMed Central

    Alonzo, Francis

    2016-01-01

    To thrive in diverse environments, bacteria must shift their metabolic output in response to nutrient bioavailability. In many bacterial species, such changes in metabolic flux depend upon lipoic acid, a cofactor required for the activity of enzyme complexes involved in glycolysis, the citric acid cycle, glycine catabolism, and branched chain fatty acid biosynthesis. The requirement of lipoic acid for metabolic enzyme activity necessitates that bacteria synthesize the cofactor and/or scavenge it from environmental sources. Although use of lipoic acid is a conserved phenomenon, the mechanisms behind its biosynthesis and salvage can differ considerably between bacterial species. Furthermore, low levels of circulating free lipoic acid in mammals underscore the importance of lipoic acid acquisition for pathogenic microbes during infection. In this study, we used a genetic approach to characterize the mechanisms of lipoic acid biosynthesis and salvage in the bacterial pathogen Staphylococcus aureus and evaluated the requirements for both pathways during murine sepsis. We determined that S. aureus lipoic acid biosynthesis and salvage genes exist in an arrangement that directly links redox stress response and acetate biosynthesis genes. In addition, we found that lipoic acid salvage is dictated by two ligases that facilitate growth and lipoylation in distinct environmental conditions in vitro, but that are fully compensatory for survival in vivo. Upon infection of mice, we found that de novo biosynthesis or salvage promotes S. aureus survival in a manner that depends upon the infectious site. In addition, when both lipoic acid biosynthesis and salvage are blocked S. aureus is rendered avirulent, implying an inability to induce lipoic acid-independent metabolic programs to promote survival. Together, our results define the major pathways of lipoic acid biosynthesis and salvage in S. aureus and support the notion that bacterial nutrient acquisition schemes are instrumental

  4. Staphylococcus aureus Tissue Infection During Sepsis Is Supported by Differential Use of Bacterial or Host-Derived Lipoic Acid.

    PubMed

    Zorzoli, Azul; Grayczyk, James P; Alonzo, Francis

    2016-10-01

    To thrive in diverse environments, bacteria must shift their metabolic output in response to nutrient bioavailability. In many bacterial species, such changes in metabolic flux depend upon lipoic acid, a cofactor required for the activity of enzyme complexes involved in glycolysis, the citric acid cycle, glycine catabolism, and branched chain fatty acid biosynthesis. The requirement of lipoic acid for metabolic enzyme activity necessitates that bacteria synthesize the cofactor and/or scavenge it from environmental sources. Although use of lipoic acid is a conserved phenomenon, the mechanisms behind its biosynthesis and salvage can differ considerably between bacterial species. Furthermore, low levels of circulating free lipoic acid in mammals underscore the importance of lipoic acid acquisition for pathogenic microbes during infection. In this study, we used a genetic approach to characterize the mechanisms of lipoic acid biosynthesis and salvage in the bacterial pathogen Staphylococcus aureus and evaluated the requirements for both pathways during murine sepsis. We determined that S. aureus lipoic acid biosynthesis and salvage genes exist in an arrangement that directly links redox stress response and acetate biosynthesis genes. In addition, we found that lipoic acid salvage is dictated by two ligases that facilitate growth and lipoylation in distinct environmental conditions in vitro, but that are fully compensatory for survival in vivo. Upon infection of mice, we found that de novo biosynthesis or salvage promotes S. aureus survival in a manner that depends upon the infectious site. In addition, when both lipoic acid biosynthesis and salvage are blocked S. aureus is rendered avirulent, implying an inability to induce lipoic acid-independent metabolic programs to promote survival. Together, our results define the major pathways of lipoic acid biosynthesis and salvage in S. aureus and support the notion that bacterial nutrient acquisition schemes are instrumental

  5. 75 FR 40736 - Acetic Acid; Exemption from the Requirement of a Tolerance

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-07-14

    ... known as the citric acid (Ref. 1.) or krebs cycle (Ref. 2.), which is the chemical activity in all cells... as antibiotics, antibacterials and antimicrobials. Acetic acid is also the main acid in vinegars, and...

  6. Protective effect of natural honey against acetic acid-induced colitis in rats.

    PubMed

    Mahgoub, A A; el-Medany, A H; Hagar, H H; Sabah, D M

    2002-01-01

    The protective effects of natural honey against acetic acid-induced colitis were investigated in rats. Honey and glucose, fructose, sucrose, maltose mixture were administered, orally and rectally, daily for a period of 4 days. Induction of colitis was done on the third day using 3% acetic acid. Animals were killed on day 4 two hours after administration of the dose and colonic biopsies were taken for macroscopic scoring, histopathological and biochemical studies. Honey dose-dependently afforded protection against acetic acid-induced colonic damage. There was almost 100% protection with the highest dose (5 g/kg) used while glucose, fructose, sucrose, maltose mixture produced no significant protective effect. Also, honey prevented the depletion of the antioxidant enzymes reduced glutathione and catalase and restored the lipid peroxide malondialdehyde towards normal levels. Further studies are required to explore the active ingredients responsible for the antioxidant effect of honey and its therapeutic potential in humans.

  7. Cellulose acetate layer effect toward aluminium corrosion rate in hydrochloric acid media

    NASA Astrophysics Data System (ADS)

    Andarany, K. S.; Sagir, A.; Ahmad, A.; Deni, S. K.; Gunawan, W.

    2017-09-01

    Corrosion occurs due to the oxidation and reduction reactions between the material and its environment. The oxidation reaction defined as reactions that produce electrons and reduction is between two elements that bind the electrons. Corrosion cannot be inevitable in life both within the industry and household. Corrosion cannot eliminate but can be control. According to the voltaic table, Aluminum is a metal that easily corroded. This study attempts to characterize the type of corrosion by using a strong acid media (HCl). Experiment using a strong acid (HCl), at a low concentration that occurs is pitting corrosion, whereas at high concentrations that occurs is corrosion erosion. One of prevention method is by using a coating method. An efforts are made to slow the rate of corrosion is by coating the metal with “cellulose acetate” (CA). cellulose acetate consisted of cellulose powder dissolved in 99% acetic acid, and then applied to the aluminum metal. Soaking experiments using hydrochloric acid, cellulose acetate is able to slow down the corrosion rate of 47 479%.

  8. Candida zemplinina can reduce acetic acid produced by Saccharomyces cerevisiae in sweet wine fermentations.

    PubMed

    Rantsiou, Kalliopi; Dolci, Paola; Giacosa, Simone; Torchio, Fabrizio; Tofalo, Rosanna; Torriani, Sandra; Suzzi, Giovanna; Rolle, Luca; Cocolin, Luca

    2012-03-01

    In this study we investigated the possibility of using Candida zemplinina, as a partner of Saccharomyces cerevisiae, in mixed fermentations of must with a high sugar content, in order to reduce its acetic acid production. Thirty-five C. zemplinina strains, which were isolated from different geographic regions, were molecularly characterized, and their fermentation performances were determined. Five genetically different strains were selected for mixed fermentations with S. cerevisiae. Two types of inoculation were carried out: coinoculation and sequential inoculation. A balance between the two species was generally observed for the first 6 days, after which the levels of C. zemplinina started to decrease. Relevant differences were observed concerning the consumption of sugars, the ethanol and glycerol content, and acetic acid production, depending on which strain was used and which type of inoculation was performed. Sequential inoculation led to the reduction of about half of the acetic acid content compared to the pure S. cerevisiae fermentation, but the ethanol and glycerol amounts were also low. A coinoculation with selected combinations of S. cerevisiae and C. zemplinina resulted in a decrease of ~0.3 g of acetic acid/liter, while maintaining high ethanol and glycerol levels. This study demonstrates that mixed S. cerevisiae and C. zemplinina fermentation could be applied in sweet wine fermentation to reduce the production of acetic acid, connected to the S. cerevisiae osmotic stress response.

  9. Evaluation of fermentation kinetics of acid-treated corn cob hydrolysate for xylose fermentation in the presence of acetic acid by Pichia stipitis.

    PubMed

    Kashid, Mohan; Ghosalkar, Anand

    2017-08-01

    The efficient utilization of lignocellulosic biomass for ethanol production depends on the fermentability of the biomass hydrolysate obtained after pretreatment. In this work we evaluated the kinetics of ethanol production from xylose using Pichia stipitis in acid-treated corn cob hydrolysate. Acetic acid is one of the main inhibitors in corn cob hydrolysate that negatively impacts kinetics of xylose fermentation by P. stipitis. Unstructured kinetic model has been formulated that describes cell mass growth and ethanol production as a function of xylose, oxygen, ethanol, and acetic acid concentration. Kinetic parameters were estimated under different operating conditions affecting xylose fermentation. This is the first report on kinetics of xylose fermentation by P. stipitis which includes inhibition of acetic acid on growth and product formation. In the presence of acetic acid in the hydrolysate, the model accurately predicted reduction in maximum specific growth rate (from 0.23 to 0.15 h -1 ) and increase in ethanol yield per unit biomass (from 3 to 6.2 gg -1 ), which was also observed during experimental trials. Presence of acetic acid in the fermentation led to significant reduction in the cell growth rate, reduction in xylose consumption and ethanol production rate. The developed model accurately described physiological state of P. stipitis during corn cob hydrolysate fermentation. Proposed model can be used to predict the influence of xylose, ethanol, oxygen, and acetic acid concentration on cell growth and ethanol productivity in industrial fermentation.

  10. Osmoadaptation of wine yeast (Saccharomyces cerevisiae) during Icewine fermentation leads to high levels of acetic acid.

    PubMed

    Heit, C; Martin, S J; Yang, F; Inglis, D L

    2018-06-01

    Volatile acidity (VA) production along with gene expression patterns, encoding enzymes involved in both acetic acid production and utilization, were investigated to relate gene expression patterns to the production of undesired VA during Icewine fermentation. Icewine juice and diluted Icewine juice were fermented using the Saccharomyces cerevisiae wine yeast K1-V1116. Acetic acid production increased sixfold during the Icewine fermentation vs the diluted juice condition, while ethyl acetate production increased 2·4-fold in the diluted fermentation relative to the Icewine. Microarray analysis profiled the transcriptional response of K1-V1116 under both conditions. ACS1 and ACS2 were downregulated 19·0-fold and 11·2-fold, respectively, in cells fermenting Icewine juice compared to diluted juice. ALD3 expression was upregulated 14·6-fold, and gene expressions involved in lipid and ergosterol synthesis decreased during Icewine fermentation. Decreased expression of ACS1 and ACS2 together with increased ALD3 expression contributes to the higher acetic acid and lower ethyl acetate levels generated by K1-V1116 fermenting under hyperosmotic stress. This work represents a more comprehensive understanding of how and why commercial wine yeast respond at the transcriptional and metabolic level during fermentation of Icewine juice, and how these responses contribute to increased acetic acid and decreased ethyl acetate production. © 2018 The Society for Applied Microbiology.

  11. Mechanisms leading to oligomers and SOA through aqueous photooxidation: insights from OH radical oxidation of acetic acid and methylglyoxal

    NASA Astrophysics Data System (ADS)

    Tan, Y.; Lim, Y. B.; Altieri, K. E.; Seitzinger, S. P.; Turpin, B. J.

    2012-01-01

    Previous experiments have demonstrated that the aqueous OH radical oxidation of methylglyoxal produces low volatility products including pyruvate, oxalate and oligomers. These products are found predominantly in the particle phase in the atmosphere, suggesting that methylglyoxal is a precursor of secondary organic aerosol (SOA). Acetic acid plays a central role in the aqueous oxidation of methylglyoxal and it is a ubiquitous product of gas phase photochemistry, making it a potential "aqueous" SOA precursor in its own right. However, the fate of acetic acid upon aqueous-phase oxidation is not well understood. In this research, acetic acid (20 μM-10 mM) was oxidized by OH radicals, and pyruvic acid and methylglyoxal experimental samples were analyzed using new analytical methods, in order to better understand the formation of SOA from acetic acid and methylglyoxal. Glyoxylic, glycolic, and oxalic acids formed from acetic acid and OH radicals. In contrast to the aqueous OH radical oxidation of methylglyoxal, the aqueous OH radical oxidation of acetic acid did not produce succinic acid and oligomers. This suggests that the methylgloxal-derived oligomers do not form through the acid catalyzed esterification pathway proposed previously. Using results from these experiments, radical mechanisms responsible for oligomer formation from methylglyoxal oxidation in clouds and wet aerosols are proposed. The importance of acetic acid/acetate as an SOA precursor is also discussed. We hypothesize that this and similar chemistry is central to the daytime formation of oligomers in wet aerosols.

  12. [Effect of acetic acid, furfural and 5-hydroxymethylfurfural on production of 2,3-butanediol by Klebsiella oxytoca].

    PubMed

    Wu, Jing; Cheng, Keke; Li, Wenying; Feng, Jie; Zhang, Jian'an

    2013-03-01

    To get the tolerability and consumption of Klebsiella oxytoca on major inhibitors in lignocelluloses hydrolysate, we studied the effect of acetic acid, furfural and 5-hydroxymethylfurfural on production of 2,3-butanediol by Klebsiella oxytoca. The metabolites of furfural and 5-hydroxymethylfurfural were measured. The results show that when acetic acid, furfural and 5-hydroxymethylfurfural was individually added, tolerance threshold for Klebsiella oxytoca was 30 g/L, 4 g/L and 5 g/L, respectively. Acetic acid was likely used as substrate to produce 2,3-butanediol. The yield of 2,3-butanediol increased when acetic acid concentration was lower than 30 g/L. In the fermentation, more than 70% 5-hydroxymethylfurfural was converted to 2,5-furandimethanol. All furfural and the rest of 5-hydroxymethylfurfural were metabolized by Klebsiella oxytoca. It showed that in the detoxification process of 2,3-butanediol production using lignocelluloses hydrolysate, furfural should be given priority to remove and a certain concentration of acetic acid is not need to removal.

  13. Loxoprofen inhibits facilitated micturition reflex induced by acetic acid urinary bladder infusion of the rats.

    PubMed

    Shinozaki, Sachiyo; Saito, Motoaki; Kawatani, Masahito

    2005-02-01

    Prostaglandins (PGs) are well known as one of the chemical mediators of inflammation. Nonsteroidal anti-inflammatory drugs (NSAIDs), PG synthesis inhibitors, are used for anti-nociception and/or anti-inflammation. We examine the effect of loxoprofen, an NSAID, on micturiton in acetic acid-induced bladder inflammation of the rats. In cystometrogram study with saline infusion into the urinary bladder, loxoprofen did not alter the interval of bladder contraction (IC, 107% of the control). IC was shortened by acetic acid infusion (65% of the control) and loxoprofen prolonged the IC (162% of acetic acid infused period). This prolonged IC was approximately same as the control. Loxoprofen did not alter the threshold pressure and the maximal voiding pressure. These data suggest that PGE2 might not play a part of normal micturition and may play a part of the micturition reflex during acetic acid infusion. That is, loxoprofen might be useful for pathological hyperreflex of the micturition.

  14. Prevention of acetic acid-induced colitis by desferrithiocin analogs in a rat model.

    PubMed

    Bergeron, Raymond J; Wiegand, Jan; Weimar, William R; Nguyen, John Nhut; Sninsky, Charles A

    2003-02-01

    Iron contributes significantly to the formation of reactive oxygen species via the Fenton reaction. Therefore, we assessed whether a series of desferrithiocin analogs, both carboxylic acids and hydroxamates, could (1) either promote or diminish the iron-mediated oxidation of ascorbate, (2) quench a model radical species, 2,2'-azinobis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS+), and (3) when applied topically, prevent acetic acid-induced colitis in rats. Surprisingly, most of the desferrithiocin analogs inhibited the Fenton reaction to an approximately equivalent degree; however, substantial differences were observed in the capacity of the analogs to scavenge the model radical cation. Four carboxylic acid desferrithiocin analogs and their respective N-methylhydroxamates were tested along with desferrioxamine and Rowasa, a currently accepted topical therapeutic agent for inflammatory bowel disease (IBD), in a rodent model of acetic acid-induced colitis. The colonic damage was quantitated by two independent measurements. Although neither radical scavenging nor prevention of Fenton chemistry was a definitive predictor of in vivo efficacy, the overall trend is that desferrithiocin analogs substituted with an N-methylhydroxamate in the place of the carboxylic acid are both better free radical scavengers and more active against acetic acid-induced colitis. These results represent an intriguing alternative avenue to the development of improved IBD therapeutic agents.

  15. Mechanisms leading to oligomers and SOA through aqueous photooxidation: insights from OH radical oxidation of acetic acid

    NASA Astrophysics Data System (ADS)

    Tan, Y.; Lim, Y. B.; Altieri, K. E.; Seitzinger, S. P.; Turpin, B. J.

    2011-06-01

    Previous experiments have demonstrated that the aqueous OH radical oxidation of methylglyoxal produces low volatility products including oxalate and oligomers. These products are found predominantly in the particle phase in the atmosphere, suggesting that methylglyoxal is a precursor of secondary organic aerosol (SOA). Acetic acid is an important intermediate in aqueous methylglyoxal oxidation and a ubiquitous product of gas phase photochemistry, making it a potential "aqueous" SOA precursor in its own right. Altieri et al. (2008) proposed that acetic acid was the precursor of oligoesters observed in methylglyoxal oxidation. However, the fate of acetic acid upon aqueous-phase oxidation is not well understood. In this research, acetic acid at concentrations relevant to atmospheric waters (20 μM-10 mM) was oxidized by OH radical. Products were analyzed by ion chromatography (IC), electrospray ionization mass spectrometry (ESI-MS), and IC-ESI-MS. The formation of glyoxylic, glycolic, and oxalic acids were observed. In contrast to methylglyoxal oxidation, succinic acid and oligomers were not detected. Using results from these and methylglyoxal + OH radical experiments, radical mechanisms responsible for oligomer formation from methylglyoxal oxidation in clouds and wet aerosols are proposed. The importance of acetic acid/acetate as an SOA precursor is also discussed. We hypothesize that this and similar chemistry is central to the daytime formation of oligomers in wet aerosols.

  16. Acetic Acid Bacteria and the Production and Quality of Wine Vinegar

    PubMed Central

    Torija, María Jesús; García-Parrilla, María del Carmen; Troncoso, Ana María

    2014-01-01

    The production of vinegar depends on an oxidation process that is mainly performed by acetic acid bacteria. Despite the different methods of vinegar production (more or less designated as either “fast” or “traditional”), the use of pure starter cultures remains far from being a reality. Uncontrolled mixed cultures are normally used, but this review proposes the use of controlled mixed cultures. The acetic acid bacteria species determine the quality of vinegar, although the final quality is a combined result of technological process, wood contact, and aging. This discussion centers on wine vinegar and evaluates the effects of these different processes on its chemical and sensory properties. PMID:24574887

  17. Ruthenium recovery from acetic acid industrial effluent using chemically stable and high-performance polyethylenimine-coated polysulfone-Escherichia coli biomass composite fibers.

    PubMed

    Kim, Sok; Choi, Yoon-E; Yun, Yeoung-Sang

    2016-08-05

    Recovery of precious metal ions from waste effluents is of high concern. In general, ruthenium (Ru) is used in the Cativa process as promoter for carbonylation catalyst and discharged into acetic acid effluent. In the present work, we have designed and developed polyethylenimine-coated polysulfone-bacterial biomass composite fiber (PEI-PSBF) to recover Ru from industrial effluent. The sorbent was manufactured by electrostatic attachment of polyethylenimine (PEI) to the surface of polysulfone-biomass composite fiber (PSBF), which was prepared through spinning of the mixture of polysulfone and Escherichia coli biomass in N,N-dimethylformamide (DMF) into water. Developed PEI-PSBF was highly stable in the acetic acid effluent. The maximum sorption capacity of the developed sorbent PEI-PSBF, coated with PEI (with M.W. of 75,000), was 121.28±13.15mg/g, which was much higher than those of ion exchange resins, TP214, Amberjet 4200, and M500. The PEI-PSBF could be successfully applied in the flow-through column system, showing 120 beds of breakthrough volume. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. 40 CFR 721.304 - Acetic acid, [(5-chloro-8-quinolinyl)oxy-], 1-methyl hexyl ester.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 31 2011-07-01 2011-07-01 false Acetic acid, [(5-chloro-8-quinolinyl)oxy-], 1-methyl hexyl ester. 721.304 Section 721.304 Protection of Environment ENVIRONMENTAL... Significant New Uses for Specific Chemical Substances § 721.304 Acetic acid, [(5-chloro-8-quinolinyl)oxy-], 1...

  19. Influence of levan-producing acetic acid bacteria on buckwheat-sourdough breads.

    PubMed

    Ua-Arak, Tharalinee; Jakob, Frank; Vogel, Rudi F

    2017-08-01

    Buckwheat sourdoughs supplemented with molasses as natural sucrose source were fermented with levan-producing Gluconobacter (G.) albidus TMW 2.1191 and Kozakia (K.) baliensis NBRC 16680. Cell growth, concomitant levan and low-molecular-weight metabolite production were monitored. Sourdough breads were prepared with different sourdoughs from both strains (24, 30 and 48 h fermentation, respectively) and analyzed with respect to bread volume, crumb hardness and sensory characteristics. During fermentation, levan, acetic and gluconic acids were increasingly produced, while spontaneously co-growing lactic acid bacteria additionally formed acetic and lactic acids. Sourdoughs from both strains obtained upon 24 h of fermentation significantly improved the bread sensory and quality, including higher specific volume as well as lower crumb hardness. Buckwheat doughs containing isolated levan, with similar molecular size and mass compared to in situ produced levan in the sourdough at 48 h, verified the positive effect of levan on bread quality. However, the positive effects of levan were masked to a certain extent by the impact from the natural acidification during fermentations. While levan-producing acetic acid bacteria are a promising alternative for the development of clean-label gluten-free breads without the need of additives, an appropriate balance between acidification and levan production (amount and structure) must be reached. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Translocation of radiolabeled indole-3-acetic acid and indole-3-acetyl-myo-inositol from kernel to shoot of Zea mays L

    NASA Technical Reports Server (NTRS)

    Chisnell, J. R.; Bandurski, R. S.

    1988-01-01

    Either 5-[3H]indole-3-acetic acid (IAA) or 5-[3H]indole-3-acetyl-myo-inositol was applied to the endosperm of kernels of dark-grown Zea mays seedlings. The distribution of total radioactivity, radiolabeled indole-3-acetic acid, and radiolabeled ester conjugated indole-3-acetic acid, in the shoots was then determined. Differences were found in the distribution and chemical form of the radiolabeled indole-3-acetic acid in the shoot depending upon whether 5-[3H]indole-3-acetic acid or 5-[3H]indole-3-acetyl-myo-inositol was applied to the endosperm. We demonstrated that indole-3-acetyl-myo-inositol applied to the endosperm provides both free and ester conjugated indole-3-acetic acid to the mesocotyl and coleoptile. Free indole-3-acetic acid applied to the endosperm supplies some of the indole-3-acetic acid in the mesocotyl but essentially no indole-3-acetic acid to the coleoptile or primary leaves. It is concluded that free IAA from the endosperm is not a source of IAA for the coleoptile. Neither radioactive indole-3-acetyl-myo-inositol nor IAA accumulates in the tip of the coleoptile or the mesocotyl node and thus these studies do not explain how the coleoptile tip controls the amount of IAA in the shoot.

  1. Single and combined effects of acetic acid, furfural, and sugars on the growth of the pentose-fermenting yeast Meyerozyma guilliermondii.

    PubMed

    Perna, Michelle Dos Santos Cordeiro; Bastos, Reinaldo Gaspar; Ceccato-Antonini, Sandra Regina

    2018-02-01

    The tolerance of the pentose-fermenting yeast Meyerozyma guilliermondii to the inhibitors released after the biomass hydrolysis, such as acetic acid and furfural, was surveyed. We first verified the effects of acetic acid and cell concentrations and initial pH on the growth of a M. guilliermondii strain in a semi-synthetic medium containing acetic acid as the sole carbon source. Second, the single and combined effects of furfural, acetic acid, and sugars (xylose, arabinose, and glucose) on the sugar uptake, cell growth, and ethanol production were also analysed. Growth inhibition occurred in concentrations higher than 10.5 g l -1 acetic acid and initial pH 3.5. The maximum specific growth rate (µ) was 0.023 h -1 and the saturation constant (ks) was 0.75 g l -1 acetic acid. Initial cell concentration also influenced µ. Acetic acid (initial concentration 5 g l -1 ) was co-consumed with sugars even in the presence of 20 mg l -1 furfural without inhibition to the yeast growth. The yeast grew and fermented sugars in a sugar-based medium with acetic acid and furfural in concentrations much higher than those usually found in hemicellulosic hydrolysates.

  2. Reactivity and reaction intermediates for acetic acid adsorbed on CeO 2(111)

    DOE PAGES

    Calaza, Florencia C.; Chen, Tsung -Liang; Mullins, David R.; ...

    2015-05-02

    Adsorption and reaction of acetic acid on a CeO 2(1 1 1) surface was studied by a combination of ultra-highvacuum based methods including temperature desorption spectroscopy (TPD), soft X-ray photoelectronspectroscopy (sXPS), near edge X-ray absorption spectroscopy (NEXAFS) and reflection absorption IRspectroscopy (RAIRS), together with density functional theory (DFT) calculations. TPD shows that thedesorption products are strongly dependent upon the initial oxidation state of the CeO 2 surface, includingselectivity between acetone and acetaldehyde products. The combination of sXPS and NEXAFS demon-strate that acetate forms upon adsorption at low temperature and is stable to above 500 K, above whichpoint ketene, acetone andmore » acetic acid desorb. Furthermore, DFT and RAIRS show that below 500 K, bridge bondedacetate coexists with a moiety formed by adsorption of an acetate at an oxygen vacancy, formed bywater desorption.« less

  3. Inactivation of the transcription factor mig1 (YGL035C) in Saccharomyces cerevisiae improves tolerance towards monocarboxylic weak acids: acetic, formic and levulinic acid.

    PubMed

    Balderas-Hernández, Victor E; Correia, Kevin; Mahadevan, Radhakrishnan

    2018-06-06

    Toxic concentrations of monocarboxylic weak acids present in lignocellulosic hydrolyzates affect cell integrity and fermentative performance of Saccharomyces cerevisiae. In this work, we report the deletion of the general catabolite repressor Mig1p as a strategy to improve the tolerance of S. cerevisiae towards inhibitory concentrations of acetic, formic or levulinic acid. In contrast with the wt yeast, where the growth and ethanol production were ceased in presence of acetic acid 5 g/L or formic acid 1.75 g/L (initial pH not adjusted), the m9 strain (Δmig1::kan) produced 4.06 ± 0.14 and 3.87 ± 0.06 g/L of ethanol, respectively. Also, m9 strain tolerated a higher concentration of 12.5 g/L acetic acid (initial pH adjusted to 4.5) without affecting its fermentative performance. Moreover, m9 strain produced 33% less acetic acid and 50-70% less glycerol in presence of weak acids, and consumed acetate and formate as carbon sources under aerobic conditions. Our results show that the deletion of Mig1p provides a single gene deletion target for improving the acid tolerance of yeast strains significantly.

  4. Glyphosate has limited short-term effects on commensal bacterial community composition in the gut environment due to sufficient aromatic amino acid levels.

    PubMed

    Nielsen, Lene Nørby; Roager, Henrik M; Casas, Mònica Escolà; Frandsen, Henrik L; Gosewinkel, Ulrich; Bester, Kai; Licht, Tine Rask; Hendriksen, Niels Bohse; Bahl, Martin Iain

    2018-02-01

    Recently, concerns have been raised that residues of glyphosate-based herbicides may interfere with the homeostasis of the intestinal bacterial community and thereby affect the health of humans or animals. The biochemical pathway for aromatic amino acid synthesis (Shikimate pathway), which is specifically inhibited by glyphosate, is shared by plants and numerous bacterial species. Several in vitro studies have shown that various groups of intestinal bacteria may be differently affected by glyphosate. Here, we present results from an animal exposure trial combining deep 16S rRNA gene sequencing of the bacterial community with liquid chromatography mass spectrometry (LC-MS) based metabolic profiling of aromatic amino acids and their downstream metabolites. We found that glyphosate as well as the commercial formulation Glyfonova ® 450 PLUS administered at up to fifty times the established European Acceptable Daily Intake (ADI = 0.5 mg/kg body weight) had very limited effects on bacterial community composition in Sprague Dawley rats during a two-week exposure trial. The effect of glyphosate on prototrophic bacterial growth was highly dependent on the availability of aromatic amino acids, suggesting that the observed limited effect on bacterial composition was due to the presence of sufficient amounts of aromatic amino acids in the intestinal environment. A strong correlation was observed between intestinal concentrations of glyphosate and intestinal pH, which may partly be explained by an observed reduction in acetic acid produced by the gut bacteria. We conclude that sufficient intestinal levels of aromatic amino acids provided by the diet alleviates the need for bacterial synthesis of aromatic amino acids and thus prevents an antimicrobial effect of glyphosate in vivo. It is however possible that the situation is different in cases of human malnutrition or in production animals. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  5. Adaptive Response and Tolerance to Acetic Acid in Saccharomyces cerevisiae and Zygosaccharomyces bailii: A Physiological Genomics Perspective.

    PubMed

    Palma, Margarida; Guerreiro, Joana F; Sá-Correia, Isabel

    2018-01-01

    Acetic acid is an important microbial growth inhibitor in the food industry; it is used as a preservative in foods and beverages and is produced during normal yeast metabolism in biotechnological processes. Acetic acid is also a major inhibitory compound present in lignocellulosic hydrolysates affecting the use of this promising carbon source for sustainable bioprocesses. Although the molecular mechanisms underlying Saccharomyces cerevisiae response and adaptation to acetic acid have been studied for years, only recently they have been examined in more detail in Zygosaccharomyces bailii . However, due to its remarkable tolerance to acetic acid and other weak acids this yeast species is a major threat in the spoilage of acidic foods and beverages and considered as an interesting alternative cell factory in Biotechnology. This review paper emphasizes genome-wide strategies that are providing global insights into the molecular targets, signaling pathways and mechanisms behind S. cerevisiae and Z. bailii tolerance to acetic acid, and extends this information to other weak acids whenever relevant. Such comprehensive perspective and the knowledge gathered in these two yeast species allowed the identification of candidate molecular targets, either for the design of effective strategies to overcome yeast spoilage in acidic foods and beverages, or for the rational genome engineering to construct more robust industrial strains. Examples of successful applications are provided.

  6. Adaptive Response and Tolerance to Acetic Acid in Saccharomyces cerevisiae and Zygosaccharomyces bailii: A Physiological Genomics Perspective

    PubMed Central

    Palma, Margarida; Guerreiro, Joana F.; Sá-Correia, Isabel

    2018-01-01

    Acetic acid is an important microbial growth inhibitor in the food industry; it is used as a preservative in foods and beverages and is produced during normal yeast metabolism in biotechnological processes. Acetic acid is also a major inhibitory compound present in lignocellulosic hydrolysates affecting the use of this promising carbon source for sustainable bioprocesses. Although the molecular mechanisms underlying Saccharomyces cerevisiae response and adaptation to acetic acid have been studied for years, only recently they have been examined in more detail in Zygosaccharomyces bailii. However, due to its remarkable tolerance to acetic acid and other weak acids this yeast species is a major threat in the spoilage of acidic foods and beverages and considered as an interesting alternative cell factory in Biotechnology. This review paper emphasizes genome-wide strategies that are providing global insights into the molecular targets, signaling pathways and mechanisms behind S. cerevisiae and Z. bailii tolerance to acetic acid, and extends this information to other weak acids whenever relevant. Such comprehensive perspective and the knowledge gathered in these two yeast species allowed the identification of candidate molecular targets, either for the design of effective strategies to overcome yeast spoilage in acidic foods and beverages, or for the rational genome engineering to construct more robust industrial strains. Examples of successful applications are provided. PMID:29515554

  7. Global insights into acetic acid resistance mechanisms and genetic stability of Acetobacter pasteurianus strains by comparative genomics

    NASA Astrophysics Data System (ADS)

    Wang, Bin; Shao, Yanchun; Chen, Tao; Chen, Wanping; Chen, Fusheng

    2015-12-01

    Acetobacter pasteurianus (Ap) CICC 20001 and CGMCC 1.41 are two acetic acid bacteria strains that, because of their strong abilities to produce and tolerate high concentrations of acetic acid, have been widely used to brew vinegar in China. To globally understand the fermentation characteristics, acid-tolerant mechanisms and genetic stabilities, their genomes were sequenced. Genomic comparisons with 9 other sequenced Ap strains revealed that their chromosomes were evolutionarily conserved, whereas the plasmids were unique compared with other Ap strains. Analysis of the acid-tolerant metabolic pathway at the genomic level indicated that the metabolism of some amino acids and the known mechanisms of acetic acid tolerance, might collaboratively contribute to acetic acid resistance in Ap strains. The balance of instability factors and stability factors in the genomes of Ap CICC 20001 and CGMCC 1.41 strains might be the basis for their genetic stability, consistent with their stable industrial performances. These observations provide important insights into the acid resistance mechanism and the genetic stability of Ap strains and lay a foundation for future genetic manipulation and engineering of these two strains.

  8. Global insights into acetic acid resistance mechanisms and genetic stability of Acetobacter pasteurianus strains by comparative genomics.

    PubMed

    Wang, Bin; Shao, Yanchun; Chen, Tao; Chen, Wanping; Chen, Fusheng

    2015-12-22

    Acetobacter pasteurianus (Ap) CICC 20001 and CGMCC 1.41 are two acetic acid bacteria strains that, because of their strong abilities to produce and tolerate high concentrations of acetic acid, have been widely used to brew vinegar in China. To globally understand the fermentation characteristics, acid-tolerant mechanisms and genetic stabilities, their genomes were sequenced. Genomic comparisons with 9 other sequenced Ap strains revealed that their chromosomes were evolutionarily conserved, whereas the plasmids were unique compared with other Ap strains. Analysis of the acid-tolerant metabolic pathway at the genomic level indicated that the metabolism of some amino acids and the known mechanisms of acetic acid tolerance, might collaboratively contribute to acetic acid resistance in Ap strains. The balance of instability factors and stability factors in the genomes of Ap CICC 20001 and CGMCC 1.41 strains might be the basis for their genetic stability, consistent with their stable industrial performances. These observations provide important insights into the acid resistance mechanism and the genetic stability of Ap strains and lay a foundation for future genetic manipulation and engineering of these two strains.

  9. Metal-Organic Frameworks for Cultural Heritage Preservation: The Case of Acetic Acid Removal.

    PubMed

    Dedecker, Kevin; Pillai, Renjith S; Nouar, Farid; Pires, João; Steunou, Nathalie; Dumas, Eddy; Maurin, Guillaume; Serre, Christian; Pinto, Moisés L

    2018-04-25

    The removal of low concentrations of acetic acid from indoor air at museums poses serious preservation problems that the current adsorbents cannot easily address owing to their poor affinity for acetic acid and/or their low adsorption selectivity versus water. In this context, a series of topical water-stable metal-organic frameworks (MOFs) with different pore sizes, topologies, hydrophobic characters, and functional groups was explored through a joint experimental-computational exploration. We demonstrate how a subtle combination of sufficient hydrophobicity and optimized host-guest interactions allows one to overcome the challenge of capturing traces of this very polar volatile organic compound in the presence of humidity. The optimal capture of acetic acid was accomplished with MOFs that do not show polar groups in the inorganic node or have lipophilic but polar (e.g., perfluoro) groups functionalized to the organic linkers, that is, the best candidates from the list of explored MOFs are MIL-140B and UiO-66-2CF 3 . These two MOFs present the appropriate pore size to favor a high degree of confinement, together with organic spacers that allow an enhancement of the van der Waals interactions with the acetic acid. We establish in this work that MOFs can be a viable solution to this highly challenging problem in cultural heritage protection, which is a new field of application for this type of hybrid materials.

  10. Removal of dicyclohexyl acetic acid from aqueous solution using ultrasound, ozone and their combination.

    PubMed

    Kumar, Pardeep; Headley, John; Peru, Kerry; Bailey, Jon; Dalai, Ajay

    2014-01-01

    Naphthenic acids are a complex mixture of organic components, some of which include saturated alkyl-substituted cycloaliphatic carboxylic acids and acyclic aliphatic acids. They are naturally found in hydrocarbon deposits like oil sand, petroleum, bitumen and crude oil. In this study, the oxidation of a relatively high molecular weight naphthenic acid (Dicyclohexyl acetic acid) was investigated using ozonation, ultrasonication and hydrogen peroxide alone and their combinations. Effects on oxidation of dicyclohexyl acetic acid (DAA) were measured for different concentrations of ozone ranging between 0.7 to 3.3 mg L(-1) and pH in the range 6 to 10. Ultrasonication and hydrogen peroxide alone were not effective to oxidize dicyclohexyl acetic acid, but combining ultrasonication with H2O2 had a significant effect on oxidation of dicyclohexyl acetic acid with maximum removal reaching to 84 ± 2.2% with 81 ± 2.1% reduction in chemical oxygen demand (COD). Synergistic effects were observed for combining ultrasonication with ozonation and resulted in 100% DAA removal with 98 ± 0.8% reduction in COD within 15 min at 3.3 mg L(-1) ozone concentration and 130 Watts ultrasonication power. The reaction conditions obtained for the maximum oxidation of DAA and COD removal were used for the degradation of naphthenic acids mixture extracted from oil sands process water (OSPW). The percentage oxidation of NAs mixture extracted from OSPW was 89.3 ± 1.1% in ozonation and combined ozonation and ultrasonication, but COD removal observed was 65 ± 1.2% and 78 ± 1.4% for ozonation and combined ozonation and ultrasonication treatments, respectively.

  11. Antimicrobial properties and mechanism of volatile isoamyl acetate, a main flavour component of Japanese sake (Ginjo-shu).

    PubMed

    Ando, H; Kurata, A; Kishimoto, N

    2015-04-01

    To evaluate the antimicrobial properties of the main Ginjo-flavour components of sake, volatile isoamyl acetate and isoamyl alcohol. Volatile isoamyl acetate and isoamyl alcohol both inhibited growth of the five yeast and 10 bacterial test strains. The minimum inhibitory dose and minimum bactericidal (fungicidal) dose of isoamyl acetate were higher than those of isoamyl alcohol. Escherichia coli and Acetobacter aceti were markedly sensitive to isoamyl acetate and isoamyl alcohol. In E. coli exposed to isoamyl acetate for 5 h, changes in expression were noted in proteins involved in sugar metabolism (MalE, MglB, TalB and PtsI), tricarboxylic acid cycle (AceA, Pfl and AcnB) and protein synthesis (EF-Tu, EF-G, and GlyS). Expression of acid and alcohol stress-response proteins was altered in E. coli exposed to isoamyl acetate. Esterase activity was detected in E. coli, suggesting that isoamyl acetate was hydrolyzed to acetic acid and isoamyl alcohol. Acetic acid and isoamyl alcohol damaged E. coli cell membranes and inactivated membrane proteins, impairing respiration. Volatile isoamyl acetate and isoamyl alcohol were effective in inactivating various micro-organisms, and antimicrobial mechanism of volatile isoamyl acetate against E. coli was clarified based on proteome analysis. To the best of our knowledge, this is the first report to examine the antimicrobial mechanism of volatile organic compound using proteome analysis combining two-dimensional difference gel electrophoresis with peptide mass fingerprinting. © 2015 The Society for Applied Microbiology.

  12. Lipidomic Profiling of Saccharomyces cerevisiae and Zygosaccharomyces bailii Reveals Critical Changes in Lipid Composition in Response to Acetic Acid Stress

    PubMed Central

    Riezman, Howard; Olsson, Lisbeth; Bettiga, Maurizio

    2013-01-01

    When using microorganisms as cell factories in the production of bio-based fuels or chemicals from lignocellulosic hydrolysate, inhibitory concentrations of acetic acid, released from the biomass, reduce the production rate. The undissociated form of acetic acid enters the cell by passive diffusion across the lipid bilayer, mediating toxic effects inside the cell. In order to elucidate a possible link between lipid composition and acetic acid stress, the present study presents detailed lipidomic profiling of the major lipid species found in the plasma membrane, including glycerophospholipids, sphingolipids and sterols, in Saccharomyces cerevisiae (CEN.PK 113_7D) and Zygosaccharomyces bailii (CBS7555) cultured with acetic acid. Detailed physiological characterization of the response of the two yeasts to acetic acid has also been performed in aerobic batch cultivations using bioreactors. Physiological characterization revealed, as expected, that Z. bailii is more tolerant to acetic acid than S. cerevisiae. Z. bailii grew at acetic acid concentrations above 24 g L−1, while limited growth of S. cerevisiae was observed after 11 h when cultured with only 12 g L−1 acetic acid. Detailed lipidomic profiling using electrospray ionization, multiple-reaction-monitoring mass spectrometry (ESI-MRM-MS) showed remarkable changes in the glycerophospholipid composition of Z. bailii, including an increase in saturated glycerophospholipids and considerable increases in complex sphingolipids in both S. cerevisiae (IPC 6.2×, MIPC 9.1×, M(IP)2C 2.2×) and Z. bailii (IPC 4.9×, MIPC 2.7×, M(IP)2C 2.7×), when cultured with acetic acid. In addition, the basal level of complex sphingolipids was significantly higher in Z. bailii than in S. cerevisiae, further emphasizing the proposed link between lipid saturation, high sphingolipid levels and acetic acid tolerance. The results also suggest that acetic acid tolerance is associated with the ability of a given strain to generate large

  13. Effects of urea and acetic acid on the heme axial ligation structure of ferric myoglobin at very acidic pH.

    PubMed

    Droghetti, Enrica; Sumithran, Suganya; Sono, Masanori; Antalík, Marián; Fedurco, Milan; Dawson, John H; Smulevich, Giulietta

    2009-09-01

    The heme iron coordination of ferric myoglobin (Mb) in the presence of 9.0M urea and 8.0M acetic acid at acidic pH values has been probed by electronic absorption, magnetic circular dichroism and resonance Raman spectroscopic techniques. Unlike Mb at pH 2.0, where heme is not released from the protein despite the acid denaturation and the loss of the axial ligand, upon increasing the concentration of either urea or acetic acid, a spin state change is observed, and a novel, non-native six-coordinated high-spin species prevails, where heme is released from the protein.

  14. Antibacterial Activity of Ethyl Acetate the Extract of Noni Fruit (Morinda citrifolia L.) Against Bacterial Spoilage in Fish

    NASA Astrophysics Data System (ADS)

    Nugraheni, E. R.; Adriani, G. R.; Munawaroh, H.

    2017-04-01

    Noni fruit (Morinda citrifolia L.) contains compounds that have potential as antibacterial agent. Antibacterial compounds produced noni fruit (M. citrifolia L.) can inhibit bacterial growth. This study was conducted to test the antibacterial activity of ethyl acetate extract of noni fruit (M. citrifolia L.) against spoilage bacterial in fish. Pseudomonas aeruginosa, Bacillus cereus, Escherichia coli, Klebsiella oxytoca, and Enterobacter aerogenes isolates and examine antibacterial phytochemical profile. Extraction of noni compounds was done by maceration, followed by partition with ethyl acetate to obtain the soluble and insoluble ethyl acetate fraction. Previews result show that the ethyl acetate extract had very strong activity. Extraction process continued by separation and isolation used preparative thin layer chromatography method, so that obtained five isolates and mark them as A, B, C, D and E. Antibacterial activity assay performed on isolates A, B, C, D, and E with 20 and 30% concentration. The test results showed that isolates A could not be inhibit the growth of bacteria, isolates B, C, D, and E has antibacterial activity with weak to strong inhibition. Isolate B had the greatest inhibition activity against the B. cereus, whereas isolates E had the greatest inhibition activity against P. aeroginosa. MIC (Minimum Inhibitor Concentration) and MBC (Minimum Bactericidal Concentration) test result showed that MIC and MBC values could not be determined. Analysis of compounds by TLC showed that isolate B suspected contains coumarin or flavonoids compounds that have antibacterial activity.

  15. Measurement of the isotope ratio of acetic acid in vinegar by HS-SPME-GC-TC/C-IRMS.

    PubMed

    Hattori, Ryota; Yamada, Keita; Shibata, Hiroki; Hirano, Satoshi; Tajima, Osamu; Yoshida, Naohiro

    2010-06-23

    Acetic acid is the main ingredient of vinegar, and the worth of vinegar often depends on the fermentation of raw materials. In this study, we have developed a simple and rapid method for discriminating the fermentation of the raw materials of vinegar by measuring the hydrogen and carbon isotope ratio of acetic acid using head space solid-phase microextraction (HS-SPME) combined with gas chromatography-high temperature conversion or combustion-isotope ratio mass spectrometry (GC-TC/C-IRMS). The measurement of acetic acid in vinegar by this method was possible with repeatabilities (1sigma) of +/-5.0 per thousand for hydrogen and +/-0.4 per thousand for carbon, which are sufficient to discriminate the origin of acetic acid. The fermentation of raw materials of several vinegars was evaluated by this method.

  16. Profile of preoperative fecal organic acids closely predicts the incidence of postoperative infectious complications after major hepatectomy with extrahepatic bile duct resection: Importance of fecal acetic acid plus butyric acid minus lactic acid gap.

    PubMed

    Yokoyama, Yukihiro; Mizuno, Takashi; Sugawara, Gen; Asahara, Takashi; Nomoto, Koji; Igami, Tsuyoshi; Ebata, Tomoki; Nagino, Masato

    2017-10-01

    To investigate the association between preoperative fecal organic acid concentrations and the incidence of postoperative infectious complications in patients undergoing major hepatectomy with extrahepatic bile duct resection for biliary malignancies. The fecal samples of 44 patients were collected before undergoing hepatectomy with bile duct resection for biliary malignancies. The concentrations of fecal organic acids, including acetic acid, butyric acid, and lactic acid, and representative fecal bacteria were measured. The perioperative clinical characteristics and the concentrations of fecal organic acids were compared between patients with and without postoperative infectious complications. Among 44 patients, 13 (30%) developed postoperative infectious complications. Patient age and intraoperative bleeding were significantly greater in patients with postoperative infectious complications compared with those without postoperative infectious complications. The concentrations of fecal acetic acid and butyric acid were significantly less, whereas the concentration of fecal lactic acid tended to be greater in the patients with postoperative infectious complications. The calculated gap between the concentrations of fecal acetic acid plus butyric acid minus lactic acid gap was less in the patients with postoperative infectious complications (median 43.5 vs 76.1 μmol/g of feces, P = .011). Multivariate analysis revealed that an acetic acid plus butyric acid minus lactic acid gap <60 μmol/g was an independent risk factor for postoperative infectious complications with an odds ratio of 15.6; 95% confidence interval 1.8-384.1. The preoperative fecal organic acid profile (especially low acetic acid, low butyric acid, and high lactic acid) had a clinically important impact on the incidence of postoperative infectious complications in patients undergoing major hepatectomy with extrahepatic bile duct resection. Copyright © 2017. Published by Elsevier Inc.

  17. Coproduction of acetic acid and electricity by application of microbial fuel cell technology to vinegar fermentation.

    PubMed

    Tanino, Takanori; Nara, Youhei; Tsujiguchi, Takuya; Ohshima, Takayuki

    2013-08-01

    The coproduction of a useful material and electricity via a novel application of microbial fuel cell (MFC) technology to oxidative fermentation was investigated. We focused on vinegar production, i.e., acetic acid fermentation, as an initial and model useful material that can be produced by oxidative fermentation in combination with MFC technology. The coproduction of acetic acid and electricity by applying MFC technology was successfully demonstrated by the simultaneous progress of acetic acid fermentation and electricity generation through a series of repeated batch fermentations. Although the production rate of acetic acid was very small, it increased with the number of repeated batch fermentations that were conducted. We obtained nearly identical (73.1%) or larger (89.9%) acetic acid yields than that typically achieved by aerated fermentation (75.8%). The open-cycle voltages measured before and after fermentation increased with the total fermentation time and reached a maximum value of 0.521 V prior to the third batch fermentation. The maximum current and power densities measured in this study (19.1 μA/cm² and 2.47 μW/cm², respectively) were obtained after the second batch fermentation. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  18. Process design of SSCF for ethanol production from steam-pretreated, acetic-acid-impregnated wheat straw.

    PubMed

    Bondesson, Pia-Maria; Galbe, Mats

    2016-01-01

    Pretreatment is an important step in the production of ethanol from lignocellulosic material. Using acetic acid together with steam pretreatment allows the positive effects of an acid catalyst to be retained, while avoiding the negative environmental effects associated with sulphuric acid. Acetic acid is also formed during the pretreatment and hydrolysis of hemicellulose, and is a known inhibitor that may impair fermentation at high concentrations. The purpose of this study was to improve ethanol production from glucose and xylose in steam-pretreated, acetic-acid-impregnated wheat straw by process design of simultaneous saccharification and co-fermentation (SSCF), using a genetically modified pentose fermenting yeast strain Saccharomyces cerevisiae . Ethanol was produced from glucose and xylose using both the liquid fraction and the whole slurry from pretreated materials. The highest ethanol concentration achieved was 37.5 g/L, corresponding to an overall ethanol yield of 0.32 g/g based on the glucose and xylose available in the pretreated material. To obtain this concentration, a slurry with a water-insoluble solids (WIS) content of 11.7 % was used, using a fed-batch SSCF strategy. A higher overall ethanol yield (0.36 g/g) was obtained at 10 % WIS. Ethanol production from steam-pretreated, acetic-acid-impregnated wheat straw through SSCF with a pentose fermenting S. cerevisiae strain was successfully demonstrated. However, the ethanol concentration was too low and the residence time too long to be suitable for large-scale applications. It is hoped that further process design focusing on the enzymatic conversion of cellulose to glucose will allow the combination of acetic acid pretreatment and co-fermentation of glucose and xylose.

  19. Calibration and intercomparison of acetic acid measurements using proton transfer reaction mass spectrometry (PTR-MS)

    USGS Publications Warehouse

    Haase, K.B.; Keene, W.C.; Pszenny, A.A.P.; Mayne, H.R.; Talbot, R.W.; Sive, B.C.

    2012-01-01

    Acetic acid is one of the most abundant organic acids in the ambient atmosphere, with maximum mixing ratios reaching into the tens of parts per billion by volume (ppbv) range. The identities and associated magnitudes of the major sources and sinks for acetic acid are poorly characterized, due in part to the limitation in available measurement techniques. This paper demonstrates that Proton Transfer Reaction Mass Spectrometry (PTR-MS) can reliably quantify acetic acid vapor in ambient air. Three different PTR-MS configurations were calibrated at low ppbv mixing ratios using permeation tubes, which yielded calibration factors between 7.0 and 10.9 normalized counts per second per ppbv (ncps ppbv−1) at a drift tube field strength of 132 townsend (Td). Detection limits ranged from 0.06 to 0.32 ppbv with dwell times of 5 s. These calibration factors showed negligible humidity dependence. Using the experimentally determined calibration factors, PTR-MS measurements of acetic acid during the International Consortium for Atmospheric Research on Transport and Transformation (ICARTT) campaign were validated against results obtained using Mist Chambers coupled with Ion Chromatography (MC/IC). An orthogonal least squares linear regression of paired data yielded a slope of 1.14 ± 0.06 (2σ), an intercept of 0.049 ± 20 (2σ) ppbv, and an R2 of 0.78. The median mixing ratio of acetic acid on Appledore Island, ME during the ICARTT campaign was 0.530 ± 0.025 ppbv with a minimum of 0.075 ± 0.004 ppbv, and a maximum of 3.555 ± 0.171 ppbv.

  20. 21 CFR 175.350 - Vinyl acetate/crotonic acid copolymer.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Vinyl acetate/crotonic acid copolymer. 175.350 Section 175.350 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) INDIRECT FOOD ADDITIVES: ADHESIVES AND COMPONENTS OF...

  1. Dynamics of three organic acids (malic, acetic and succinic acid) in sunflower exposed to cadmium and lead.

    PubMed

    Niu, Zhixin; Li, Xiaodong; Sun, Lina; Sun, Tieheng

    2013-01-01

    Sunflower (Helianthus annuus L.) has been considered as a good candidate for bioaccumulation of heavy metals. In the present study, sunflower was used to enrich the cadmium and lead in sand culture during 90 days. Biomass, Cd and Pb uptake, three organic acids and pH in cultures were investigated. Results showed that the existence of Cd and Pb showed different interactions on the organic acids exudation. In single Cd treatments, malic and acetic acids in Cd10 showed an incremental tendency with time. In the mixed treatments of Cd and Pb, malic acids increased when 10 and 40 mg x L(-1) Cd were added into Pb50, but acetic acids in Pb50 were inhibited by Cd addition. The Cd10 supplied in Pb10 stimulated the secretion of malic and succinic acids. Moreover, the Cd or Pb uptake in sunflower showed various correlations with pH and some organic acids, which might be due to the fact that the Cd and Pb interfere with the organic acids secretion in rhizosphere of sunflower, and the changes of organic acids altered the form and bioavailability of Cd and Pb in cultures conversely.

  2. Comparative Genomics of Acetobacterpasteurianus Ab3, an Acetic Acid Producing Strain Isolated from Chinese Traditional Rice Vinegar Meiguichu.

    PubMed

    Xia, Kai; Li, Yudong; Sun, Jing; Liang, Xinle

    2016-01-01

    Acetobacter pasteurianus, an acetic acid resistant bacterium belonging to alpha-proteobacteria, has been widely used to produce vinegar in the food industry. To understand the mechanism of its high tolerance to acetic acid and robust ability of oxidizing ethanol to acetic acid (> 12%, w/v), we described the 3.1 Mb complete genome sequence (including 0.28 M plasmid sequence) with a G+C content of 52.4% of A. pasteurianus Ab3, which was isolated from the traditional Chinese rice vinegar (Meiguichu) fermentation process. Automatic annotation of the complete genome revealed 2,786 protein-coding genes and 73 RNA genes. The comparative genome analysis among A. pasteurianus strains revealed that A. pasteurianus Ab3 possesses many unique genes potentially involved in acetic acid resistance mechanisms. In particular, two-component systems or toxin-antitoxin systems may be the signal pathway and modulatory network in A. pasteurianus to cope with acid stress. In addition, the large numbers of unique transport systems may also be related to its acid resistance capacity and cell fitness. Our results provide new clues to understanding the underlying mechanisms of acetic acid resistance in Acetobacter species and guiding industrial strain breeding for vinegar fermentation processes.

  3. The CgHaa1-Regulon Mediates Response and Tolerance to Acetic Acid Stress in the Human Pathogen Candida glabrata

    PubMed Central

    Bernardo, Ruben T.; Cunha, Diana V.; Wang, Can; Pereira, Leonel; Silva, Sónia; Salazar, Sara B.; Schröder, Markus S.; Okamoto, Michiyo; Takahashi-Nakaguchi, Azusa; Chibana, Hiroji; Aoyama, Toshihiro; Sá-Correia, Isabel; Azeredo, Joana; Butler, Geraldine; Mira, Nuno Pereira

    2016-01-01

    To thrive in the acidic vaginal tract, Candida glabrata has to cope with high concentrations of acetic acid. The mechanisms underlying C. glabrata tolerance to acetic acid at low pH remain largely uncharacterized. In this work, the essential role of the CgHaa1 transcription factor (encoded by ORF CAGL0L09339g) in the response and tolerance of C. glabrata to acetic acid is demonstrated. Transcriptomic analysis showed that CgHaa1 regulates, directly or indirectly, the expression of about 75% of the genes activated under acetic acid stress. CgHaa1-activated targets are involved in multiple physiological functions including membrane transport, metabolism of carbohydrates and amino acids, regulation of the activity of the plasma membrane H+-ATPase, and adhesion. Under acetic acid stress, CgHaa1 increased the activity and the expression of the CgPma1 proton pump and contributed to increased colonization of vaginal epithelial cells by C. glabrata. CgHAA1, and two identified CgHaa1-activated targets, CgTPO3 and CgHSP30, are herein demonstrated to be determinants of C. glabrata tolerance to acetic acid. The protective effect of CgTpo3 and of CgHaa1 was linked to a role of these proteins in reducing the accumulation of acetic acid inside C. glabrata cells. In response to acetic acid stress, marked differences were found in the regulons controlled by CgHaa1 and by its S. cerevisiae ScHaa1 ortholog, demonstrating a clear divergent evolution of the two regulatory networks. The results gathered in this study significantly advance the understanding of the molecular mechanisms underlying the success of C. glabrata as a vaginal colonizer. PMID:27815348

  4. Global insights into acetic acid resistance mechanisms and genetic stability of Acetobacter pasteurianus strains by comparative genomics

    PubMed Central

    Wang, Bin; Shao, Yanchun; Chen, Tao; Chen, Wanping; Chen, Fusheng

    2015-01-01

    Acetobacter pasteurianus (Ap) CICC 20001 and CGMCC 1.41 are two acetic acid bacteria strains that, because of their strong abilities to produce and tolerate high concentrations of acetic acid, have been widely used to brew vinegar in China. To globally understand the fermentation characteristics, acid-tolerant mechanisms and genetic stabilities, their genomes were sequenced. Genomic comparisons with 9 other sequenced Ap strains revealed that their chromosomes were evolutionarily conserved, whereas the plasmids were unique compared with other Ap strains. Analysis of the acid-tolerant metabolic pathway at the genomic level indicated that the metabolism of some amino acids and the known mechanisms of acetic acid tolerance, might collaboratively contribute to acetic acid resistance in Ap strains. The balance of instability factors and stability factors in the genomes of Ap CICC 20001 and CGMCC 1.41 strains might be the basis for their genetic stability, consistent with their stable industrial performances. These observations provide important insights into the acid resistance mechanism and the genetic stability of Ap strains and lay a foundation for future genetic manipulation and engineering of these two strains. PMID:26691589

  5. Co-production of functional xylooligosaccharides and fermentable sugars from corncob with effective acetic acid prehydrolysis.

    PubMed

    Zhang, Hongyu; Xu, Yong; Yu, Shiyuan

    2017-06-01

    A novel and green approach for the coproduction of xylooligosaccharides (XOS), in terms of a series of oligosaccharide components from xylobiose to xylohexose, and fermentable sugars was developed using the prehydrolysis of acetic acid that was fully recyclable and environmentally friendly, followed by enzymatic hydrolysis. Compared to hydrochloric acid and sulfuric acid, acetic acid hydrolysis provided the highest XOS yield of 45.91% and the highest enzymatic hydrolysis yield. More than 91% conversion of cellulose was achieved in a batch-hydrolysis using only a cellulase loading of 20FPU/g cellulose and even a high solid loading of 20% without any special strategies. The acetic acid pretreated corncob should be washed adequately before saccharification to achieve complete hydrolysis. Consequently, a mass balance analysis showed that 139.8g XOS, 328.1g glucose, 25.1g cellobiose, and 147.8g xylose were produced from 1000g oven dried raw corncob. Copyright © 2017. Published by Elsevier Ltd.

  6. New insights into the mechanisms of acetic acid resistance in Acetobacter pasteurianus using iTRAQ-dependent quantitative proteomic analysis.

    PubMed

    Xia, Kai; Zang, Ning; Zhang, Junmei; Zhang, Hong; Li, Yudong; Liu, Ye; Feng, Wei; Liang, Xinle

    2016-12-05

    Acetobacter pasteurianus is the main starter in rice vinegar manufacturing due to its remarkable abilities to resist and produce acetic acid. Although several mechanisms of acetic acid resistance have been proposed and only a few effector proteins have been identified, a comprehensive depiction of the biological processes involved in acetic acid resistance is needed. In this study, iTRAQ-based quantitative proteomic analysis was adopted to investigate the whole proteome of different acidic titers (3.6, 7.1 and 9.3%, w/v) of Acetobacter pasteurianus Ab3 during the vinegar fermentation process. Consequently, 1386 proteins, including 318 differentially expressed proteins (p<0.05), were identified. Compared to that in the low titer circumstance, cells conducted distinct biological processes under high acetic acid stress, where >150 proteins were differentially expressed. Specifically, proteins involved in amino acid metabolic processes and fatty acid biosynthesis were differentially expressed, which may contribute to the acetic acid resistance of Acetobacter. Transcription factors, two component systems and toxin-antitoxin systems were implicated in the modulatory network at multiple levels. In addition, the identification of proteins involved in redox homeostasis, protein metabolism, and the cell envelope suggested that the whole cellular system is mobilized in response to acid stress. These findings provide a differential proteomic profile of acetic acid resistance in Acetobacter pasteurianus and have potential application to highly acidic rice vinegar manufacturing. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Plasma membrane proteins Yro2 and Mrh1 are required for acetic acid tolerance in Saccharomyces cerevisiae.

    PubMed

    Takabatake, Akiko; Kawazoe, Nozomi; Izawa, Shingo

    2015-03-01

    Yro2 and its paralogous protein Mrh1 of Saccharomyces cerevisiae have seven predicted transmembrane domains and predominantly localize to the plasma membrane. Their physiological functions and regulation of gene expression have not yet been elucidated in detail. We herein demonstrated that MRH1 was constitutively expressed, whereas the expression of YRO2 was induced by acetic acid stress and entering the stationary phase. Fluorescence microscopic analysis revealed that Mrh1 and Yro2 were distributed as small foci in the plasma membrane under acetic acid stress conditions. The null mutants of these genes (mrh1∆, yro2∆, and mrh1∆yro2∆) showed delayed growth and a decrease in the productivity of ethanol in the presence of acetic acid, indicating that Yro2 and Mrh1 are involved in tolerance to acetic acid stress.

  8. Vinegar Production from Jabuticaba (Myrciaria jaboticaba) Fruit Using Immobilized Acetic Acid Bacteria

    PubMed Central

    Silva, Monique Suela; Cristina de Souza, Angélica; Magalhăes-Guedes, Karina Teixeira; Ribeiro, Fernanda Severo de Rezende; Schwan, Rosane Freitas

    2016-01-01

    Summary Cell immobilization comprises the retention of metabolically active cells inside a polymeric matrix. In this study, the production of jabuticaba (Myrciaria jaboticaba) vinegar using immobilized Acetobacter aceti and Gluconobacter oxydans cells is proposed as a new method to prevent losses of jabuticaba fruit surplus. The pulp of jabuticaba was processed and Saccharomyces cerevisiae CCMA 0200 was used to ferment the must for jabuticaba wine production. Sugars, alcohols (ethanol and glycerol) and organic acids were assayed by high-performance liquid chromatography. Volatile compounds were determined by gas chromatography-flame ionization detector. The ethanol content of the produced jabuticaba wine was approx. 74.8 g/L (9.5% by volume) after 168 h of fermentation. Acetic acid fermentation for vinegar production was performed using a mixed culture of immobilized A. aceti CCT 0190 and G. oxydans CCMA 0350 cells. The acetic acid yield was 74.4% and productivity was 0.29 g/(L·h). The vinegar had particularly high concentrations of citric (6.67 g/L), malic (7.02 g/L) and succinic (5.60 g/L) acids. These organic acids give a suitable taste and flavour to the vinegar. Seventeen compounds (aldehydes, higher alcohols, terpene, acetate, diether, furans, acids, ketones and ethyl esters) were identified in the jabuticaba vinegar. In conclusion, vinegar was successfully produced from jabuticaba fruits using yeast and immobilized mixed cultures of A. aceti and G. oxydans. To the best of our knowledge, this is the first study to use mixed culture of immobilized cells for the production of jabuticaba vinegar. PMID:27956867

  9. Vinegar Production from Jabuticaba (Myrciaria jaboticaba) Fruit Using Immobilized Acetic Acid Bacteria.

    PubMed

    Dias, Disney Ribeiro; Silva, Monique Suela; Cristina de Souza, Angélica; Magalhăes-Guedes, Karina Teixeira; Ribeiro, Fernanda Severo de Rezende; Schwan, Rosane Freitas

    2016-09-01

    Cell immobilization comprises the retention of metabolically active cells inside a polymeric matrix. In this study, the production of jabuticaba ( Myrciaria jaboticaba ) vinegar using immobilized Acetobacter aceti and Gluconobacter oxydans cells is proposed as a new method to prevent losses of jabuticaba fruit surplus. The pulp of jabuticaba was processed and Saccharomyces cerevisiae CCMA 0200 was used to ferment the must for jabuticaba wine production. Sugars, alcohols (ethanol and glycerol) and organic acids were assayed by high-performance liquid chromatography. Volatile compounds were determined by gas chromatography-flame ionization detector. The ethanol content of the produced jabuticaba wine was approx. 74.8 g/L (9.5% by volume) after 168 h of fermentation. Acetic acid fermentation for vinegar production was performed using a mixed culture of immobilized A. aceti CCT 0190 and G. oxydans CCMA 0350 cells. The acetic acid yield was 74.4% and productivity was 0.29 g/(L·h). The vinegar had particularly high concentrations of citric (6.67 g/L), malic (7.02 g/L) and succinic (5.60 g/L) acids. These organic acids give a suitable taste and flavour to the vinegar. Seventeen compounds (aldehydes, higher alcohols, terpene, acetate, diether, furans, acids, ketones and ethyl esters) were identified in the jabuticaba vinegar. In conclusion, vinegar was successfully produced from jabuticaba fruits using yeast and immobilized mixed cultures of A. aceti and G. oxydans . To the best of our knowledge, this is the first study to use mixed culture of immobilized cells for the production of jabuticaba vinegar.

  10. Effective Trapping of Fruit Flies with Cultures of Metabolically Modified Acetic Acid Bacteria

    PubMed Central

    Ishii, Yuri; Akasaka, Naoki; Goda, Itsuko; Sakoda, Hisao

    2015-01-01

    Acetoin in vinegar is an attractant to fruit flies when combined with acetic acid. To make vinegar more effective in attracting fruit flies with increased acetoin production, Komagataeibacter europaeus KGMA0119 was modified by specific gene disruption of the acetohydroxyacid isomeroreductase gene (ilvC). A previously constructed mutant lacking the putative ligand-sensing region in the leucine-responsive regulatory protein (KeLrp, encoded by Kelrp) was also used. The ilvC and Kelrp disruptants (KGMA5511 and KGMA7203, respectively) produced greater amounts of acetoin (KGMA5511, 0.11%; KGMA7203, 0.13%) than the wild-type strain KGMA0119 (0.069%). KGMA7203 produced a trace amount of isobutyric acid (0.007%), but the other strains did not. These strains produced approximately equal amounts of acetic acid (0.7%). The efficiency of fruit fly attraction was investigated with cultured Drosophila melanogaster. D. melanogaster flies (approximately 1,500) were released inside a cage (2.5 m by 2.5 m by 1.5 m) and were trapped with a device containing vinegar and a sticky sheet. The flies trapped on the sticky sheet were counted. The cell-free supernatant from KGMA7203 culture captured significantly more flies (19.36 to 36.96% of released flies) than did KGMA0119 (3.25 to 11.40%) and KGMA5511 (6.87 to 21.50%) cultures. Contrastingly, a 0.7% acetic acid solution containing acetoin (0.13%) and isobutyric acid (0.007%), which mimicked the KGMA7203 supernatant, captured significantly fewer flies (0.88 to 4.57%). Furthermore, the KGMA0119 supernatant with additional acetoin (0.13%) and isobutyric acid (0.007%) captured slightly more flies than the original KGMA0119 supernatant but fewer than the KGMA7203 supernatant, suggesting that the synergistic effects of acetic acid, acetoin, isobutyric acid, and unidentified metabolites achieved the efficient fly trapping of the KGMA7203 supernatant. PMID:25595769

  11. The Effect of Acid Pre-Treatment using Acetic Acid and Nitric Acid in The Production of Biogas from Rice Husk during Solid State Anaerobic Digestion (SS-AD)

    NASA Astrophysics Data System (ADS)

    Nugraha, Winardi Dwi; Syafrudin; Keumala, Cut Fadhila; Matin, Hasfi Hawali Abdul; Budiyono

    2018-02-01

    Pretreatment during biogas production aims to assist in degradation of lignin contained in the rice husk. In this study, pretreatment which is used are acid and biological pretreatment. Acid pretreatment was performed using acetic acid and nitric acid with a variety levels of 3% and 5%. While biological pretreatment as a control variable. Acid pretreatment was conducted by soaking the rice straw for 24 hours with acid variation. The study was conducted using Solid State Anaerobic Digestion (SS-AD) with 21% TS. Biogas production was measured using water displacement method every two days for 60 days at room temperature conditions. The results showed that acid pretreatment gave an effect on the production of biogas yield. The yield of the biogas produced by pretreatment of acetic acid of 5% and 3% was 43.28 and 45.86 ml/gr.TS. While the results without pretreatment biogas yield was 29.51 ml/gr.TS. The results yield biogas produced by pretreatment using nitric acid of 5% and 3% was 12.14 ml/gr.TS and 21.85 ml/gr.TS. Results biogas yield with acetic acid pretreatment was better than the biogas yield results with nitric acid pretreatment.

  12. 1-11C-acetate as a PET radiopharmaceutical for imaging fatty acid synthase expression in prostate cancer.

    PubMed

    Vāvere, Amy L; Kridel, Steven J; Wheeler, Frances B; Lewis, Jason S

    2008-02-01

    Although it is accepted that the metabolic fate of 1-(11)C-acetate is different in tumors than in myocardial tissue because of different clearance patterns, the exact pathway has not been fully elucidated. For decades, fatty acid synthesis has been quantified in vitro by the incubation of cells with (14)C-acetate. Fatty acid synthase (FAS) has been found to be overexpressed in prostate carcinomas, as well as other cancers, and it is possible that imaging with 1-(11)C-acetate could be a marker for its expression. In vitro and in vivo uptake experiments in prostate tumor models with 1-(11)C-acetate were performed both with and without blocking of fatty acid synthesis with either C75, an inhibitor of FAS, or 5-(tetradecyloxy)-2-furoic acid (TOFA), an inhibitor of acetyl-CoA carboxylase (ACC). FAS levels were measured by Western blot and immunohistochemical techniques for comparison. In vitro studies in 3 different prostate tumor models (PC-3, LNCaP, and 22Rv1) demonstrated blocking of 1-(11)C-acetate accumulation after treatment with both C75 and TOFA. This was further shown in vivo in PC-3 and LNCaP tumor-bearing mice after a single treatment with C75. A positive correlation between 1-(11)C-acetate uptake into the solid tumors and FAS expression levels was found. Extensive involvement of the fatty acid synthesis pathway in 1-(11)C-acetate uptake in prostate tumors was confirmed, leading to a possible marker for FAS expression in vivo by noninvasive PET.

  13. Radiolysis of aqueous solutions of acetic acid in the presence of Na-montmorillonite

    NASA Technical Reports Server (NTRS)

    Navarro-Gonzalez, R.; Negron-Mendoza, A.; Ramos, S.; Ponnamperuma, C.

    1990-01-01

    The gamma-irradiation of 0.8 mol dm-3 aqueous, oxygen-free acetic acid solutions was investigated in the presence or absence of Na-montmorillonite. H2, CH4, CO, CO2, and several polycarboxylic acids were formed in all systems. The primary characteristics observed in the latter system were: (1) Higher yield of the decomposition of acetic acid; (2) Lower yield of the formation of polycarboxylic acids; (3) No effect on the formation of methane; (4) Higher yield of the formation of carbon dioxide; and (5) The reduction of Fe3+ in the octahedral sites of Na-montmorillonite. A possible reaction scheme was proposed to account for the observed changes. The results are important in understanding heterogeneous processes in radiation catalysis and might be significant to prebiotic chemistry.

  14. Acetic acid induces Sch9p-dependent translocation of Isc1p from the endoplasmic reticulum into mitochondria.

    PubMed

    Rego, António; Cooper, Katrina F; Snider, Justin; Hannun, Yusuf A; Costa, Vítor; Côrte-Real, Manuela; Chaves, Susana R

    2018-06-01

    Changes in sphingolipid metabolism have been linked to modulation of cell fate in both yeast and mammalian cells. We previously assessed the role of sphingolipids in cell death regulation using a well characterized yeast model of acetic acid-induced regulated cell death, finding that Isc1p, inositol phosphosphingolipid phospholipase C, plays a pro-death role in this process. Indeed, isc1∆ mutants exhibited a higher resistance to acetic acid associated with reduced mitochondrial alterations. Here, we show that Isc1p is regulated by Sch9p under acetic acid stress, since both single and double mutants lacking Isc1p or/and Sch9p have the same resistant phenotype, and SCH9 deletion leads to a higher retention of Isc1p in the endoplasmic reticulum upon acetic acid exposure. We also found that the higher resistance of all mutants correlates with higher levels of endogenous mitochondrial phosphorylated long chain bases (LCBPs), suggesting that changing the sphingolipid balance in favour of LCBPs in mitochondria results in increased survival to acetic acid. In conclusion, our results suggest that Sch9p pathways modulate acetic acid-induced cell death, through the regulation of Isc1p cellular distribution, thus affecting the sphingolipid balance that regulates cell fate. Copyright © 2018 Elsevier B.V. All rights reserved.

  15. Synthesizing Pt nanoparticles in the presence of methylamine: Impact of acetic acid treatment in the electrocatalytic activity of formic acid oxidation

    NASA Astrophysics Data System (ADS)

    Ooi, M. D. Johan; Aziz, A. Abdul

    2017-05-01

    Surfactant removal from the surface of platinum nanoparticles prepared by solution based method is a prerequisite process to accomplish a high catalytic activity for electrochemical reactions. Here, we report a possible approach of combining acid acetic with thermal treatment for improving catalytic performance of formic acid oxidation. This strategy involves conversion of amine to amide in acetic acid followed by surfactant removal via subsequent thermal treatment at 85 °C. This combined activation technique produced monodisperse nanoparticle with the size of 3 to 5 nm with enhanced formic acid oxidation activity, particularly in perchloric acid solution. Pt treated in 1 h of acetic acid and heat treatment of 9 h shows high electrochemical surface area value (27.6 m2/g) compares to Pt without activation (16.6 m2/g). The treated samples also exhibit high current stability of 0.3 mA/cm2 compares to the as-prepared mA/cm2). Shorter duration of acid wash and longer duration of heating process result in high electrocatalytic activity. This work demonstrates a possible technique in improving catalytic activity of platinum nanoparticles synthesized using methylamine as surfactant.

  16. Iron dissolution of dust source materials during simulated acidic processing: the effect of sulfuric, acetic, and oxalic acids.

    PubMed

    Chen, Haihan; Grassian, Vicki H

    2013-09-17

    Atmospheric organic acids potentially display different capacities in iron (Fe) mobilization from atmospheric dust compared with inorganic acids, but few measurements have been made on this comparison. We report here a laboratory investigation of Fe mobilization of coal fly ash, a representative Fe-containing anthropogenic aerosol, and Arizona test dust, a reference source material for mineral dust, in pH 2 sulfuric acid, acetic acid, and oxalic acid, respectively. The effects of pH and solar radiation on Fe dissolution have also been explored. The relative capacities of these three acids in Fe dissolution are in the order of oxalic acid > sulfuric acid > acetic acid. Oxalate forms mononuclear bidentate ligand with surface Fe and promotes Fe dissolution to the greatest extent. Photolysis of Fe-oxalate complexes further enhances Fe dissolution with the concomitant degradation of oxalate. These results suggest that ligand-promoted dissolution of Fe may play a more significant role in mobilizing Fe from atmospheric dust compared with proton-assisted processing. The role of atmospheric organic acids should be taken into account in global-biogeochemical modeling to better access dissolved atmospheric Fe deposition flux at the ocean surface.

  17. Method for construction of bacterial strains with increased succinic acid production

    DOEpatents

    Donnelly, Mark I.; Sanville-Millard, Cynthia; Chatterjee, Ranjini

    2000-01-01

    A fermentation process for producing succinic acid is provided comprising selecting a bacterial strain that does not produce succinic acid in high yield, disrupting the normal regulation of sugar metabolism of said bacterial strain, and combining the mutant bacterial strain and selected sugar in anaerobic conditions to facilitate production of succinic acid. Also provided is a method for changing low yield succinic acid producing bacteria to high yield succinic acid producing bacteria comprising selecting a bacterial strain having a phosphotransferase system and altering the phosphotransferase system so as to allow the bacterial strain to simultaneously metabolize different sugars.

  18. Comparative Genomics of Acetobacterpasteurianus Ab3, an Acetic Acid Producing Strain Isolated from Chinese Traditional Rice Vinegar Meiguichu

    PubMed Central

    Xia, Kai; Li, Yudong; Sun, Jing; Liang, Xinle

    2016-01-01

    Acetobacter pasteurianus, an acetic acid resistant bacterium belonging to alpha-proteobacteria, has been widely used to produce vinegar in the food industry. To understand the mechanism of its high tolerance to acetic acid and robust ability of oxidizing ethanol to acetic acid (> 12%, w/v), we described the 3.1 Mb complete genome sequence (including 0.28 M plasmid sequence) with a G+C content of 52.4% of A. pasteurianus Ab3, which was isolated from the traditional Chinese rice vinegar (Meiguichu) fermentation process. Automatic annotation of the complete genome revealed 2,786 protein-coding genes and 73 RNA genes. The comparative genome analysis among A. pasteurianus strains revealed that A. pasteurianus Ab3 possesses many unique genes potentially involved in acetic acid resistance mechanisms. In particular, two-component systems or toxin-antitoxin systems may be the signal pathway and modulatory network in A. pasteurianus to cope with acid stress. In addition, the large numbers of unique transport systems may also be related to its acid resistance capacity and cell fitness. Our results provide new clues to understanding the underlying mechanisms of acetic acid resistance in Acetobacter species and guiding industrial strain breeding for vinegar fermentation processes. PMID:27611790

  19. Mild oxidation of methane to methanol or acetic acid on supported isolated rhodium catalysts

    NASA Astrophysics Data System (ADS)

    Shan, Junjun; Li, Mengwei; Allard, Lawrence F.; Lee, Sungsik; Flytzani-Stephanopoulos, Maria

    2017-11-01

    An efficient and direct method of catalytic conversion of methane to liquid methanol and other oxygenates would be of considerable practical value. However, it remains an unsolved problem in catalysis, as typically it involves expensive or corrosive oxidants or reaction media that are not amenable to commercialization. Although methane can be directly converted to methanol using molecular oxygen under mild conditions in the gas phase, the process is either stoichiometric (and therefore requires a water extraction step) or is too slow and low-yielding to be practical. Methane could, in principle, also be transformed through direct oxidative carbonylation to acetic acid, which is commercially obtained through methane steam reforming, methanol synthesis, and subsequent methanol carbonylation on homogeneous catalysts. However, an effective catalyst for the direct carbonylation of methane to acetic acid, which might enable the economical small-scale utilization of natural gas that is currently flared or stranded, has not yet been reported. Here we show that mononuclear rhodium species, anchored on a zeolite or titanium dioxide support suspended in aqueous solution, catalyse the direct conversion of methane to methanol and acetic acid, using oxygen and carbon monoxide under mild conditions. We find that the two products form through independent pathways, which allows us to tune the conversion: three-hour-long batch-reactor tests conducted at 150 degrees Celsius, using either the zeolite-supported or the titanium-dioxide-supported catalyst, yield around 22,000 micromoles of acetic acid per gram of catalyst, or around 230 micromoles of methanol per gram of catalyst, respectively, with selectivities of 60-100 per cent. We anticipate that these unusually high activities, despite still being too low for commercial application, may guide the development of optimized catalysts and practical processes for the direct conversion of methane to methanol, acetic acid and other useful

  20. Mild oxidation of methane to methanol or acetic acid on supported isolated rhodium catalysts

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shan, Junjun; Li, Mengwei; Allard, Lawrence F.

    An efficient and direct method of catalytic conversion of methane to liquid methanol and other oxygenates would be of considerable practical value. However, it remains an unsolved problem in catalysis, as typically it involves expensive or corrosive oxidants or reaction media(5-8) that are not amenable to commercialization. Although methane can be directly converted to methanol using molecular oxygen under mild conditions in the gas phase, the process is either stoichiometric (and therefore requires a water extraction step) or is too slow and low-yielding to be practical. Methane could, in principle, also be transformed through direct oxidative carbonylation to acetic acid,more » which is commercially obtained through methane steam reforming, methanol synthesis, and subsequent methanol carbonylation on homogeneous catalysts. However, an effective catalyst for the direct carbonylation of methane to acetic acid, which might enable the economical small-scale utilization of natural gas that is currently flared or stranded, has not yet been reported. Here we show that mononuclear rhodium species, anchored on a zeolite or titanium dioxide support suspended in aqueous solution, catalyse the direct conversion of methane to methanol and acetic acid, using oxygen and carbon monoxide under mild conditions. Here, we find that the two products form through independent pathways, which allows us to tune the conversion: three-hour-long batch-reactor tests conducted at 150 degrees Celsius, using either the zeolitesupported or the titanium-dioxide-supported catalyst, yield around 22,000 micromoles of acetic acid per gram of catalyst, or around 230 micromoles of methanol per gram of catalyst, respectively, with selectivities of 60-100 per cent. Finally, we anticipate that these unusually high activities, despite still being too low for commercial application, may guide the development of optimized catalysts and practical processes for the direct conversion of methane to methanol

  1. Mild oxidation of methane to methanol or acetic acid on supported isolated rhodium catalysts

    DOE PAGES

    Shan, Junjun; Li, Mengwei; Allard, Lawrence F.; ...

    2017-11-30

    An efficient and direct method of catalytic conversion of methane to liquid methanol and other oxygenates would be of considerable practical value. However, it remains an unsolved problem in catalysis, as typically it involves expensive or corrosive oxidants or reaction media(5-8) that are not amenable to commercialization. Although methane can be directly converted to methanol using molecular oxygen under mild conditions in the gas phase, the process is either stoichiometric (and therefore requires a water extraction step) or is too slow and low-yielding to be practical. Methane could, in principle, also be transformed through direct oxidative carbonylation to acetic acid,more » which is commercially obtained through methane steam reforming, methanol synthesis, and subsequent methanol carbonylation on homogeneous catalysts. However, an effective catalyst for the direct carbonylation of methane to acetic acid, which might enable the economical small-scale utilization of natural gas that is currently flared or stranded, has not yet been reported. Here we show that mononuclear rhodium species, anchored on a zeolite or titanium dioxide support suspended in aqueous solution, catalyse the direct conversion of methane to methanol and acetic acid, using oxygen and carbon monoxide under mild conditions. Here, we find that the two products form through independent pathways, which allows us to tune the conversion: three-hour-long batch-reactor tests conducted at 150 degrees Celsius, using either the zeolitesupported or the titanium-dioxide-supported catalyst, yield around 22,000 micromoles of acetic acid per gram of catalyst, or around 230 micromoles of methanol per gram of catalyst, respectively, with selectivities of 60-100 per cent. Finally, we anticipate that these unusually high activities, despite still being too low for commercial application, may guide the development of optimized catalysts and practical processes for the direct conversion of methane to methanol

  2. Experimental investigation of thermodynamic properties of binary mixture of acetic acid + n-butanol and acetic acid + water at temperature from 293.15 K to 343.15 K

    NASA Astrophysics Data System (ADS)

    Paul, M. Danish John; Shruthi, N.; Anantharaj, R.

    2018-04-01

    The derived thermodynamic properties like excess molar volume, partial molar volume, excess partial molar volume and apparent volume of binary mixture of acetic acid + n-butanolandacetic acid + water has been investigated using measured density of mixtures at temperatures from 293.15 K to 343.15.

  3. N-(6-Methylpyridin-2-yl)mesitylenesulfonamide and acetic acid--a salt, a cocrystal or both?

    PubMed

    Pan, Fangfang; Kalf, Irmgard; Englert, Ulli

    2015-08-01

    In the solid obtained from N-(6-methylpyridin-2-yl)mesitylenesulfonamide and acetic acid, the constituents interact via two N-H···O hydrogen bonds. The H atom situated in one of these short contacts is disordered over two positions: one of these positions is formally associated with an adduct of the neutral sulfonamide molecule and the neutral acetic acid molecule, and corresponds to a cocrystal, while the alternative site is associated with salt formation between a protonated sulfonamide molecule and deprotonated acetic acid molecule. Site-occupancy refinements and electron densities from difference Fourier maps suggest a trend with temperature, albeit of limited significance; the cocrystal is more relevant at 100 K, whereas the intensity data collected at room temperature match the description as cocrystal and salt equally well.

  4. Isolation and characterization of esters of indole-3-acetic acid from the liquid endosperm of the horse chestnut (Aesculus species)

    NASA Technical Reports Server (NTRS)

    Domagalski, W.; Schulze, A.; Bandurski, R. S.

    1987-01-01

    Esters of indole-3-acetic acid were extracted and purified from the liquid endosperm of immature fruits of various species of the horse chestnut (Aesculus parviflora, A. baumanni, A. pavia rubra, and A. pavia humulis). The liquid endosperm contained, at least 12 chromatographically distinct esters. One of these compounds was purified and characterized as an ester of indole-3-acetic acid and myo-inositol. A second compound was found to be an ester of indole-3-acetic acid and the disaccharide rutinose (glucosyl-rhamnose). A third compound was partially characterized as an ester of indole-3-acetic acid and a desoxyaminohexose.

  5. The sensitivity of the yeast, Saccharomyces cerevisiae, to acetic acid is influenced by DOM34 and RPL36A.

    PubMed

    Samanfar, Bahram; Shostak, Kristina; Moteshareie, Houman; Hajikarimlou, Maryam; Shaikho, Sarah; Omidi, Katayoun; Hooshyar, Mohsen; Burnside, Daniel; Márquez, Imelda Galván; Kazmirchuk, Tom; Naing, Thet; Ludovico, Paula; York-Lyon, Anna; Szereszewski, Kama; Leung, Cindy; Jin, Jennifer Yixin; Megarbane, Rami; Smith, Myron L; Babu, Mohan; Holcik, Martin; Golshani, Ashkan

    2017-01-01

    The presence of acetic acid during industrial alcohol fermentation reduces the yield of fermentation by imposing additional stress on the yeast cells. The biology of cellular responses to stress has been a subject of vigorous investigations. Although much has been learned, details of some of these responses remain poorly understood. Members of heat shock chaperone HSP proteins have been linked to acetic acid and heat shock stress responses in yeast. Both acetic acid and heat shock have been identified to trigger different cellular responses including reduction of global protein synthesis and induction of programmed cell death. Yeast HSC82 and HSP82 code for two important heat shock proteins that together account for 1-2% of total cellular proteins. Both proteins have been linked to responses to acetic acid and heat shock. In contrast to the overall rate of protein synthesis which is reduced, the expression of HSC82 and HSP82 is induced in response to acetic acid stress. In the current study we identified two yeast genes DOM34 and RPL36A that are linked to acetic acid and heat shock sensitivity. We investigated the influence of these genes on the expression of HSP proteins. Our observations suggest that Dom34 and RPL36A influence translation in a CAP-independent manner.

  6. Short-Chain Fatty Acid Acetate Stimulates Adipogenesis and Mitochondrial Biogenesis via GPR43 in Brown Adipocytes.

    PubMed

    Hu, Jiamiao; Kyrou, Ioannis; Tan, Bee K; Dimitriadis, Georgios K; Ramanjaneya, Manjunath; Tripathi, Gyanendra; Patel, Vanlata; James, Sean; Kawan, Mohamed; Chen, Jing; Randeva, Harpal S

    2016-05-01

    Short-chain fatty acids play crucial roles in a range of physiological functions. However, the effects of short-chain fatty acids on brown adipose tissue have not been fully investigated. We examined the role of acetate, a short-chain fatty acid formed by fermentation in the gut, in the regulation of brown adipocyte metabolism. Our results show that acetate up-regulates adipocyte protein 2, peroxisomal proliferator-activated receptor-γ coactivator-1α, and uncoupling protein-1 expression and affects the morphological changes of brown adipocytes during adipogenesis. Moreover, an increase in mitochondrial biogenesis was observed after acetate treatment. Acetate also elicited the activation of ERK and cAMP response element-binding protein, and these responses were sensitive to G(i/o)-type G protein inactivator, Gβγ-subunit inhibitor, phospholipase C inhibitor, and MAPK kinase inhibitor, indicating a role for the G(i/o)βγ/phospholipase C/protein kinase C/MAPK kinase signaling pathway in these responses. These effects of acetate were mimicked by treatment with 4-chloro-α-(1-methylethyl)-N-2-thiazolylbenzeneacetamide, a synthetic G protein-coupled receptor 43 (GPR43) agonist and were impaired in GPR43 knockdown cells. Taken together, our results indicate that acetate may have important physiological roles in brown adipocytes through the activation of GPR43.

  7. Metabolism of indole-3-acetic acid by orange (Citrus sinensis) flavedo tissue during fruit development.

    PubMed

    Chamarro, J; Ostin, A; Sandberg, G

    2001-05-01

    [5-3H, 1'-14C, 13C6, 12C] Indole-3-acetic acid (IAA), was applied to the flavedo (epicarp) of intact orange fruits at different stages of development. After incubation in the dark, at 25 degrees C, the tissue was extracted with MeOH and the partially purified extracts were analyzed by reversed phase HPLC-RC. Six major metabolite peaks were detected and subsequently analyzed by combined HPLC-frit-FAB MS. The metabolite peak 6 contained oxindole-3-acetic acid (OxIAA), indole-3-acetyl-N-aspartic acid (IAAsp) and also indole-3-acetyl-N-glutamic acid (IAGlu). The nature of metabolite 5 remains unknown. Metabolites 3 and 4 were diastereomers of oxindole-3-acetyl-N-aspartic acid (OxIAAsp). Metabolite 2 was identified as dioxindole-3-acetic acid and metabolite 1 as a DiOx-IAA linked in position three to a hexose, which is suggested to be 3-(-O-beta-glucosyl) dioxindole-3-acetic acid (DiOxIAGlc). Identification work as well as feeding experiments with the [5-3H]IAA labeled metabolites suggest that IAA is metabolized in flavedo tissue mainly through two pathways, namely IAA-OxIAA-DiOxIAA-DiOxIAGlc and IAA-IAAsp-OxIAAsp. The flavedo of citrus fruit has a high capacity for IAA catabolism until the beginning of fruit senescence, with the major route having DiOxIAGlc as end product. This capacity is operative even at high IAA concentrations and is accelerated by pretreatment with the synthetic auxins 2,4-D, NAA and the gibberellin GA3.

  8. Use of acetic and citric acids to inhibit Escherichia coli O157:H7, Salmonella Typhimurium and Staphylococcus aureus in tabbouleh salad.

    PubMed

    Al-Rousan, Walid M; Olaimat, Amin N; Osaili, Tareq M; Al-Nabulsi, Anas A; Ajo, Radwan Y; Holley, Richard A

    2018-08-01

    The objective of the current study was to evaluate the antimicrobial action of different concentrations of acetic (0.3% and 0.4%) or citric (1% and 1.4%) acids and their combinations (1% citric acid plus 0.4% acetic acid and 1.4% citric acid plus 0.3% acetic acid) against Salmonella Typhimurium, Escherichia coli O157:H7 and Staphylococcus aureus in tabbouleh salad stored at 21, 10 and 4 °C. Acetic acid was more inhibitory toward S. Typhimurium and E. coli O157:H7 than citric acid at 21 °C; S. Typhimurium and E. coli O157:H7 cells were not detected in tabbouleh treated with 0.4% acetic acid after 5 and 7 days, respectively. The combined effect of acetic and citric acid was synergistic against S. Typhimurium, and E. coli O157:H7, but not against S. aureus. The combinations of acetic and citric acids reduced S. Typhimurium, and E. coli O157:H7 to below the detection levels after 2 and 3 days at 21 °C, respectively. However, these treatments significantly reduced S. aureus numbers compared to the control at tested temperatures by the end of storage. Acetic and citric acids have the potential to be used in tabbouleh salad to reduce the risk from S. Typhimurium, E. coli O157:H7 and S. aureus. Copyright © 2018. Published by Elsevier Ltd.

  9. Quantifying Effect of Lactic, Acetic, and Propionic Acids on Growth of Molds Isolated from Spoiled Bakery Products.

    PubMed

    Dagnas, Stéphane; Gauvry, Emilie; Onno, Bernard; Membré, Jeanne-Marie

    2015-09-01

    The combined effect of undissociated lactic acid (0 to 180 mmol/liter), acetic acid (0 to 60 mmol/liter), and propionic acid (0 to 12 mmol/liter) on growth of the molds Aspergillus niger, Penicillium corylophilum, and Eurotium repens was quantified at pH 3.8 and 25°C on malt extract agar acid medium. The impact of these acids on lag time for growth (λ) was quantified through a gamma model based on the MIC. The impact of these acids on radial growth rate (μ) was analyzed statistically through polynomial regression. Concerning λ, propionic acid exhibited a stronger inhibitory effect (MIC of 8 to 20 mmol/liter depending on the mold species) than did acetic acid (MIC of 23 to 72 mmol/liter). The lactic acid effect was null on E. repens and inhibitory on A. niger and P. corylophilum. These results were validated using independent sets of data for the three acids at pH 3.8 but for only acetic and propionic acids at pH 4.5. Concerning μ, the effect of acetic and propionic acids was slightly inhibitory for A. niger and P. corylophilum but was not significant for E. repens. In contrast, lactic acid promoted radial growth of all three molds. The gamma terms developed here for these acids will be incorporated in a predictive model for temperature, water activity, and acid. More generally, results for μ and λ will be used to identify and evaluate solutions for controlling bakery product spoilage.

  10. Different response to acetic acid stress in Saccharomyces cerevisiae wild-type and l-ascorbic acid-producing strains.

    PubMed

    Martani, Francesca; Fossati, Tiziana; Posteri, Riccardo; Signori, Lorenzo; Porro, Danilo; Branduardi, Paola

    2013-09-01

    Biotechnological processes are of increasing significance for industrial production of fine and bulk chemicals, including biofuels. Unfortunately, under operative conditions microorganisms meet multiple stresses, such as non-optimal pH, temperature, oxygenation and osmotic stress. Moreover, they have to face inhibitory compounds released during the pretreatment of lignocellulosic biomasses, which constitute the preferential substrate for second-generation processes. Inhibitors include furan derivatives, phenolic compounds and weak organic acids, among which acetic acid is one of the most abundant and detrimental for cells. They impair cellular metabolism and growth, reducing the productivity of the process: therefore, the development of robust cell factories with improved production rates and resistance is of crucial importance. Here we show that a yeast strain engineered to endogenously produce vitamin C exhibits an increased tolerance compared to the parental strain when exposed to acetic acid at moderately toxic concentrations, measured as viability on plates. Starting from this evidence, we investigated more deeply: (a) the nature and levels of reactive oxygen species (ROS); (b) the activation of enzymes that act directly as detoxifiers of reactive oxygen species, such as superoxide dismutase (SOD) and catalase, in parental and engineered strains during acetic acid stress. The data indicate that the engineered strain can better recover from stress by limiting ROS accumulation, independently from SOD activation. The engineered yeast can be proposed as a model for further investigating direct and indirect mechanism(s) by which an antioxidant can rescue cells from organic acid damage; moreover, these studies will possibly provide additional targets for further strain improvements. Copyright © 2013 John Wiley & Sons, Ltd.

  11. Effect of acetic acid on physical properties of pregelatinized wheat and corn starch gels.

    PubMed

    Majzoobi, Mahsa; Kaveh, Zahra; Farahnaky, Asgar

    2016-04-01

    Pregelatinized starches are physically modified starches with ability to absorb water and increase viscosity at ambient temperature. The main purpose of this study was to determine how different concentrations of acetic acid (0, 500, 1000, 10,000 mg/kg) can affect functional properties of pregelatinized wheat and corn starches (PGWS and PGCS, respectively) produced by a twin drum drier. With increasing acetic acid following changes occurred for both samples; cold water solubility (at 25 °C) increased, water absorption and apparent cold water viscosity (at 25 °C) reduced, the smooth surface of the starch particles converted to an uneven surface as confirmed by scanning electron microscopy, cohesiveness, consistency and turbidity of the starch gels reduced while their syneresis increased. It was found that in presence of acetic acid, PGWS resulted in higher water absorption and apparent cold water viscosity and produced more cohesive and turbid gels with less syneresis compared to PGCS. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Efficacy of Lactic Acid, Lactic Acid-Acetic Acid Blends, and Peracetic Acid To Reduce Salmonella on Chicken Parts under Simulated Commercial Processing Conditions.

    PubMed

    Ramirez-Hernandez, Alejandra; Brashears, Mindy M; Sanchez-Plata, Marcos X

    2018-01-01

    The poultry processing industry has been undergoing a series of changes as it modifies processing practices to comply with new performance standards for chicken parts and comminuted poultry products. The regulatory approach encourages the use of intervention strategies to prevent and control foodborne pathogens in poultry products and thus improve food safety and protect human health. The present studies were conducted to evaluate the efficacy of antimicrobial interventions for reducing Salmonella on inoculated chicken parts under simulated commercial processing conditions. Chicken pieces were inoculated by immersion in a five-strain Salmonella cocktail at 6 log CFU/mL and then treated with organic acids and oxidizing agents on a commercial rinsing conveyor belt. The efficacy of spraying with six different treatments (sterile water, lactic acid, acetic acid, buffered lactic acid, acetic acid in combination with lactic acid, and peracetic acid) at two concentrations was evaluated on skin-on and skin-off chicken thighs at three application temperatures. Skinless chicken breasts were used to evaluate the antimicrobial efficacy of lactic acid and peracetic acid. The color stability of treated and untreated chicken parts was assessed after the acid interventions. The lactic acid and buffered lactic acid treatments produced the greatest reductions in Salmonella counts. Significant differences between the control and water treatments were identified for 5.11% lactic acid and 5.85% buffered lactic acid in both skin-on and skin-off chicken thighs. No significant effect of treatment temperature for skin-on chicken thighs was found. Lactic acid and peracetic acid were effective agents for eluting Salmonella cells attached to chicken breasts.

  13. Metabolizable energy values and amino acid availability of vetch (Vicia sativa) and ervil (Vicia ervilia) seeds soaked in water and acetic acid.

    PubMed

    Farran, M T; Barbour, G W; Uwayjan, M G; Ashkarian, V M

    2001-07-01

    In two experiments we evaluated the effect of water and acetic acid soaking on ME, apparent amino acid (AA) availability, and true AA availability of vetch (V) and ervil (E) seeds. In Experiment 1, the feedstuffs were untreated (U) V or coarsely ground V soaked in water (1:10, wt/vol) at 40 C for 72 h with a water change every 12 h (40WV), vetch soaked in 1% acetic acid for 24 h at 40 C (40AAV) or at room temperature (RTAAV), or dehulled soybean meal (SBM). In Experiment 2, E seeds were subjected to the same soaking methods, and the ingredients were UE, 40WE, 40AAE, RTAAE, and SBM. Each feedstuff was precision-fed to five individually caged mature ISA Brown roosters. A group of five roosters was used to correct for metabolic and endogenous energy and amino acid losses. The AME, AMEn, TME, and TMEn of UV and UE (in parentheses) were 2,558 (2,663), 2,840 (3,098), 3,026 (3,154), and 2,934 (3,176) kcal/kg DM, respectively, and were, in general, higher than those of SBM. The TMEn of V increased as a result of soaking in water or acetic acid, whereas that of E decreased in 40WE and RTAAE by 492 and 920 kcal/kg DM, respectively (P < 0.05). The apparent availability of most essential amino acids in UV and UE was lower (P < 0.05) than that of SBM. Acetic acid soaking of V, irrespective of temperature, and E at 40 C resulted in apparent AA availability similar to that of SBM except for Met. The true AA availability of V treated or not, and that of E soaked at 40 C, were similar to that of SBM. Results indicated that UV and UE are energy rich ingredients but detrimental to amino acid availability. Soaking the seeds in acetic acid at room temperature and at 40 C improved the nutritional value of V and E, respectively.

  14. Lewis base activation of Lewis acids: catalytic, enantioselective addition of silyl ketene acetals to aldehydes.

    PubMed

    Denmark, Scott E; Beutner, Gregory L; Wynn, Thomas; Eastgate, Martin D

    2005-03-23

    The concept of Lewis base activation of Lewis acids has been reduced to practice for catalysis of the aldol reaction of silyl ketene acetals and silyl dienol ethers with aldehydes. The weakly acidic species, silicon tetrachloride (SiCl4), can be activated by binding of a strongly Lewis basic chiral phosphoramide, leading to in situ formation of a chiral Lewis acid. This species has proven to be a competent catalyst for the aldol addition of acetate-, propanoate-, and isobutyrate-derived silyl ketene acetals to conjugated and nonconjugated aldehydes. Furthermore, vinylogous aldol reactions of silyl dienol ethers are also demonstrated. The high levels of regio-, anti diastereo-, and enantioselectivity observed in these reactions can be rationalized through consideration of an open transition structure where steric interactions between the silyl cation complex and the approaching nucleophile are dominant.

  15. Co-administration of α-lipoic acid and cyclosporine aggravates colon ulceration of acetic acid-induced ulcerative colitis via facilitation of NO/COX-2/miR-210 cascade.

    PubMed

    El-Gowelli, Hanan M; Saad, Evan I; Abdel-Galil, Abdel-Galil A; Ibrahim, Einas R

    2015-11-01

    In this work, α-lipoic acid and cyclosporine demonstrated significant protection against acetic acid-induced ulcerative colitis in rats. We proposed that α-lipoic acid and cyclosporine co-administration might modulate their individual effects. Induction of ulcerative colitis in rats was performed by intra-rectal acetic acid (5% v/v) administration for 3 consecutive days. Effects of individual or combined used of α-lipoic acid (35 mg/kg ip) or cyclosporine (5mg/kg sc) for 6 days starting 2 days prior to acetic acid were assessed. Acetic acid caused colon ulceration, bloody diarrhea and weight loss. Histologically, there was mucosal atrophy and inflammatory cells infiltration in submucosa, associated with depletion of colon reduced glutathione, superoxide dismutase and catalase activities and elevated colon malondialdehyde, serum C-reactive protein (C-RP) and tumor necrosis factor-α (TNF-α). Colon gene expression of cyclooxygenase-2 and miR-210 was also elevated. These devastating effects of acetic acid were abolished upon concurrent administration of α-lipoic acid. Alternatively, cyclosporine caused partial protection against acetic acid-induced ulcerative colitis. Cyclosporine did not restore colon reduced glutathione, catalase activity, serum C-RP or TNF-α. Unexpectedly, co-administration of α-lipoic acid and cyclosporine aggravated colon ulceration. Concomitant use of α-lipoic acid and cyclosporine significantly increased nitric oxide production, cyclooxygenase-2 and miR-210 gene expression compared to all other studied groups. The current findings suggest that facilitation of nitric oxide/cyclooxygenase-2/miR-210 cascade constitutes, at least partially, the cellular mechanism by which concurrent use of α-lipoic acid and cyclosporine aggravates colon damage. Collectively, the present work highlights the probable risk of using α-lipoic acid/cyclosporine combination in ulcerative colitis patients. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. Ab initio Hartree-Fock investigation of 1- H-pyrrolo[3,2- b]pyridine-3-yl acetic acid

    NASA Astrophysics Data System (ADS)

    Ramek, Michael; Tomić, Sanja

    2001-09-01

    The potential energy surface of 1- H-pyrrolo[3,2- b]pyridine-3-yl acetic acid has been investigated via RIIF/6-31G* calculations. The stationary points and reaction paths for syn orientation of the COOH group were determined and are compared with those of the derivatives of 3-indole acetic acid, which act as plant growth hormones. 1- H-pyrrolo[3,2- b]pyridine-3-yl acetic acid forms a kinetically stable conformer with a strong intramolecular hydrogen bond, in which the COOH group is in anti orientation. The influence of this hydrogen bond on bond lengths and vibration frequencies is described.

  17. Function and phylogeny of bacterial butyryl-CoA:acetate transferases and their diversity in the proximal colon of swine

    USDA-ARS?s Scientific Manuscript database

    Studying the host-associated butyrate-producing bacterial community is important because butyrate is essential for colonic homeostasis and gut health. Previous research has identified the butyryl-coA:acetate transferase (2.3.8.3) as a the main gene for butyrate production in intestinal ecosystems; h...

  18. Influence of Acidic pH on Hydrogen and Acetate Production by an Electrosynthetic Microbiome

    PubMed Central

    LaBelle, Edward V.; Marshall, Christopher W.; Gilbert, Jack A.; May, Harold D.

    2014-01-01

    Production of hydrogen and organic compounds by an electrosynthetic microbiome using electrodes and carbon dioxide as sole electron donor and carbon source, respectively, was examined after exposure to acidic pH (∼5). Hydrogen production by biocathodes poised at −600 mV vs. SHE increased>100-fold and acetate production ceased at acidic pH, but ∼5–15 mM (catholyte volume)/day acetate and>1,000 mM/day hydrogen were attained at pH ∼6.5 following repeated exposure to acidic pH. Cyclic voltammetry revealed a 250 mV decrease in hydrogen overpotential and a maximum current density of 12.2 mA/cm2 at −765 mV (0.065 mA/cm2 sterile control at −800 mV) by the Acetobacterium-dominated community. Supplying −800 mV to the microbiome after repeated exposure to acidic pH resulted in up to 2.6 kg/m3/day hydrogen (≈2.6 gallons gasoline equivalent), 0.7 kg/m3/day formate, and 3.1 kg/m3/day acetate ( = 4.7 kg CO2 captured). PMID:25333313

  19. Influence of acidic pH on hydrogen and acetate production by an electrosynthetic microbiome

    DOE PAGES

    LaBelle, Edward V.; Marshall, Christopher W.; Gilbert, Jack A.; ...

    2014-10-15

    Production of hydrogen and organic compounds by an electrosynthetic microbiome using electrodes and carbon dioxide as sole electron donor and carbon source, respectively, was examined after exposure to acidic pH (~5). Hydrogen production by biocathodes poised at -600 mV vs. SHE increased>100-fold and acetate production ceased at acidic pH, but ~5–15 mM (catholyte volume)/day acetate and>1,000 mM/day hydrogen were attained at pH ~6.5 following repeated exposure to acidic pH. Cyclic voltammetry revealed a 250 mV decrease in hydrogen overpotential and a maximum current density of 12.2 mA/cm 2 at -765 mV (0.065 mA/cm 2 sterile control at -800 mV) bymore » the Acetobacterium-dominated community. Supplying -800 mV to the microbiome after repeated exposure to acidic pH resulted in up to 2.6 kg/m 3/day hydrogen (≈2.6 gallons gasoline equivalent), 0.7 kg/m 3/day formate, and 3.1 kg/m 3/day acetate ( = 4.7 kg CO 2 captured).« less

  20. Co-administration of α-lipoic acid and cyclosporine aggravates colon ulceration of acetic acid-induced ulcerative colitis via facilitation of NO/COX-2/miR-210 cascade

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    El-Gowelli, Hanan M., E-mail: dr_Hanan_el_gowali@hotmail.com; Saad, Evan I.; Abdel-Galil, Abdel-Galil A.

    In this work, α-lipoic acid and cyclosporine demonstrated significant protection against acetic acid-induced ulcerative colitis in rats. We proposed that α-lipoic acid and cyclosporine co-administration might modulate their individual effects. Induction of ulcerative colitis in rats was performed by intra-rectal acetic acid (5% v/v) administration for 3 consecutive days. Effects of individual or combined used of α-lipoic acid (35 mg/kg ip) or cyclosporine (5 mg/kg sc) for 6 days starting 2 days prior to acetic acid were assessed. Acetic acid caused colon ulceration, bloody diarrhea and weight loss. Histologically, there was mucosal atrophy and inflammatory cells infiltration in submucosa, associatedmore » with depletion of colon reduced glutathione, superoxide dismutase and catalase activities and elevated colon malondialdehyde, serum C-reactive protein (C-RP) and tumor necrosis factor-α (TNF-α). Colon gene expression of cyclooxygenase-2 and miR-210 was also elevated. These devastating effects of acetic acid were abolished upon concurrent administration of α-lipoic acid. Alternatively, cyclosporine caused partial protection against acetic acid-induced ulcerative colitis. Cyclosporine did not restore colon reduced glutathione, catalase activity, serum C-RP or TNF-α. Unexpectedly, co-administration of α-lipoic acid and cyclosporine aggravated colon ulceration. Concomitant use of α-lipoic acid and cyclosporine significantly increased nitric oxide production, cyclooxygenase-2 and miR-210 gene expression compared to all other studied groups. The current findings suggest that facilitation of nitric oxide/cyclooxygenase-2/miR-210 cascade constitutes, at least partially, the cellular mechanism by which concurrent use of α-lipoic acid and cyclosporine aggravates colon damage. Collectively, the present work highlights the probable risk of using α-lipoic acid/cyclosporine combination in ulcerative colitis patients. - Highlights: • Lipoic acid is more effective

  1. Isolation and Characterization of Esters of Indole-3-Acetic Acid from the Liquid Endosperm of the Horse Chestnut (Aesculus species) 1

    PubMed Central

    Domagalski, Wojciech; Schulze, Aga; Bandurski, Robert S.

    1987-01-01

    Esters of indole-3-acetic acid were extracted and purified from the liquid endosperm of immature fruits of various species of the horse chestnut (Aesculus parviflora, A. baumanni, A.pavia rubra, and A. pavia humulis). The liquid endosperm contained, at least 12 chromatographically distinct esters. One of these compounds was purified and characterized as an ester of indole-3-acetic acid and myo-inositol. A second compound was found to be an ester of indole-3-acetic acid and the disaccharide rutinose (glucosyl-rhamnose). A third compound was partially characterized as an ester of indole-3-acetic acid and a desoxyaminohexose. PMID:11539676

  2. Condensation of acetol and acetic acid vapor with sprayed liquid

    USDA-ARS?s Scientific Manuscript database

    A cellulose-derived fraction of biomass pyrolysis vapor was simulated by evaporating acetol and acetic acid (AA) from flasks on a hot plate. The liquid in the flasks was infused with heated nitrogen. The vapor/nitrogen stream was superheated in a tube oven and condensed by contact with a cloud of ...

  3. Evaluation of sanitizing efficacy of acetic acid on Piper betle leaves and its effect on antioxidant properties.

    PubMed

    Singla, Richu; Ganguli, Abhijit; Ghosh, Moushumi; Sohal, Sapna

    2009-01-01

    The sanitizing efficacy of acetic acid and its effect on health beneficial properties of Piper betle leaves were determined. Betel leaves artificially inoculated with Aeromonas, Salmonella and Yersinia were subjected to organic acid (citric acid, acetic acid and lactic acid) treatment. Pathogen populations reduced by 4 log upon individual inoculation and up to 2 log in a mixed cocktail following treatment with 2% acetic acid during storage up to 20 h at 28 degrees C, indicating a residual antimicrobial effect on pathogen during storage. Antioxidant potential ethanolic extracts of both raw and treated P. betle leaves were assayed for free radical scavenging activities against 2,2-diphenyl-1-picryhydrazyl. Polyphenols, flavonoids and the reducing power of treated and untreated P. betle were also compared. No significant (P>0.05) changes were observed in antioxidant status; flavonoids, polyphenols and reducing power of treated betel leaves. Results indicate the feasibility of a simple intervention strategy for inactivating pathogens in edible leaves of P. betle.

  4. Lead acetate trihydrate precursor route to synthesize novel ultrafine lead oxide from spent lead acid battery pastes

    NASA Astrophysics Data System (ADS)

    Sun, Xiaojuan; Yang, Jiakuan; Zhang, Wei; Zhu, Xinfeng; Hu, Yuchen; Yang, Danni; Yuan, Xiqing; Yu, Wenhao; Dong, Jinxin; Wang, Haifeng; Li, Lei; Vasant Kumar, R.; Liang, Sha

    2014-12-01

    A novel green recycling process is investigated to prepare lead acetate trihydrate precursors and novel ultrafine lead oxide from spent lead acid battery pastes. The route contains the following four processes. (1) The spent lead pastes are desulphurized by (NH4)2CO3. (2) The desulphurized pastes are converted into lead acetate solution by leaching with acetic acid solution and H2O2; (3) The Pb(CH3COO)2·3H2O precursor is crystallized and purified from the lead acetate solution with the addition of glacial acetic acid; (4) The novel ultrafine lead oxide is prepared by the calcination of lead acetate trihydrate precursor in N2 or air at 320-400 °C. Both the lead acetate trihydrate and lead oxide products are characterized by TG-DTA, XRD, and SEM techniques. The calcination products are mainly α-PbO, β-PbO, and a small amount of metallic Pb. The particle size of the calcination products in air is significantly larger than that in N2. Cyclic voltammetry measurements of the novel ultrafine lead oxide products show good reversibility and cycle stability. The assembled batteries using the lead oxide products as cathode active materials show a good cyclic stability in 80 charge/discharge cycles with the depth of discharge (DOD) of 100%.

  5. Validation of a multi-analyte HPLC-DAD method for determination of uric acid, creatinine, homovanillic acid, niacinamide, hippuric acid, indole-3-acetic acid and 2-methylhippuric acid in human urine.

    PubMed

    Remane, Daniela; Grunwald, Soeren; Hoeke, Henrike; Mueller, Andrea; Roeder, Stefan; von Bergen, Martin; Wissenbach, Dirk K

    2015-08-15

    During the last decades exposure sciences and epidemiological studies attracts more attention to unravel the mechanisms for the development of chronic diseases. According to this an existing HPLC-DAD method for determination of creatinine in urine samples was expended for seven analytes and validated. Creatinine, uric acid, homovanillic acid, niacinamide, hippuric acid, indole-3-acetic acid, and 2-methylhippuric acid were separated by gradient elution (formate buffer/methanol) using an Eclipse Plus C18 Rapid Resolution column (4.6mm×100mm). No interfering signals were detected in mobile phase. After injection of blank urine samples signals for the endogenous compounds but no interferences were detected. All analytes were linear in the selected calibration range and a non weighted calibration model was chosen. Bias, intra-day and inter-day precision for all analytes were below 20% for quality control (QC) low and below 10% for QC medium and high. The limits of quantification in mobile phase were in line with reported reference values but had to be adjusted in urine for homovanillic acid (45mg/L), niacinamide 58.5(mg/L), and indole-3-acetic acid (63mg/L). Comparison of creatinine data obtained by the existing method with those of the developed method showing differences from -120mg/L to +110mg/L with a mean of differences of 29.0mg/L for 50 authentic urine samples. Analyzing 50 authentic urine samples, uric acid, creatinine, hippuric acid, and 2-methylhippuric acid were detected in (nearly) all samples. However, homovanillic acid was detected in 40%, niacinamide in 4% and indole-3-acetic acid was never detected within the selected samples. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Identification and characterization of thermotolerant acetic acid bacteria strains isolated from coconut water vinegar in Sri Lanka.

    PubMed

    Perumpuli, P A B N; Watanabe, Taisuke; Toyama, Hirohide

    2014-01-01

    From the pellicle formed on top of brewing coconut water vinegar in Sri Lanka, three Acetobacter strains (SL13E-2, SL13E-3, and SL13E-4) that grow at 42 °C and four Gluconobacter strains (SL13-5, SL13-6, SL13-7, and SL13-8) grow at 37 °C were identified as Acetobacter pasteurianus and Gluconobacter frateurii, respectively. Acetic acid production by the isolated Acetobacter strains was examined. All three strains gave 4% acetic acid from 6% initial ethanol at 37 °C, and 2.5% acetic acid from 4% initial ethanol at 40 °C. Compared with the two other strains, SL13E-4 showed both slower growth and slower acetic acid production. As well as the thermotolerant SKU1108 strain, the activities of the alcohol dehydrogenase and the aldehyde dehydrogenase of SL13E-2 and SL13E-4 were more stable than those of the mesophilic strain. The isolated strains were used to produce coconut water vinegar at higher temperatures than typically used for vinegar production.

  7. 40 CFR 721.2076 - D-Glucuronic acid, polymer with 6-deoxy-L-mannose and D-glucose, acetate, calcium magnesium...

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false D-Glucuronic acid, polymer with 6...-Glucuronic acid, polymer with 6-deoxy-L-mannose and D-glucose, acetate, calcium magnesium potassium sodium... identified as D-Glucuronic acid, polymer with 6-deoxy-L-mannose and D-glucose, acetate, calcium magnesium...

  8. Microwave Spectroscopy and Proton Transfer Dynamics in the Formic Acid-Acetic Acid Dimer

    NASA Astrophysics Data System (ADS)

    Howard, B. J.; Steer, E.; Page, F.; Tayler, M.; Ouyang, B.; Leung, H. O.; Marshall, M. D.; Muenter, J. S.

    2012-06-01

    The rotational spectrum of the doubly hydrogen-bonded {hetero} dimer formed between formic acid and acetic acid has been recorded between 4 and 18 GHz using a pulsed-nozzle Fourier transform microwave spectrometer. Each rigid-molecule rotational transition is split into four as a result of two concurrent tunnelling motions, one being proton transfer between the two acid molecules, and the other the torsion/rotation of the methyl group within the acetic acid. We present a full assignment of the spectrum for {J} = 1 to {J} = 7 for these four torsion/tunnelling states. Spectra have been observed for the main isotopic species, with deuterium substitution at the C of the formic acid and all 13C species in natural abundance, The observed transitions are fitted to within a few kilohertz using a molecule-fixed effective rotational Hamiltonian for the separate {A} and {E} vibrational species of the G12 permutation-inversion group which is applicable to this complex. To reduce the effects of internal angular momentum, a non-principal axis system is used throughout. Interpretation of the internal motion uses an internal-vibration and overall rotation scheme, and full sets of rotational and centrifugal distortion constants are determined. The proton tunnelling rates and the internal angular momentum of the methyl group in the {E} states is interpreted in terms of a dynamical model which involves coupled proton transfer and internal rotation. The resulting potential energy surface not only describes these internal motions, but can also explain the observed shifts in rotational constants between {A} and {E} species, and the deviations of the tunnelling frequencies from the expected 2:1 ratio. It also permits the determination of spectral constants free from the contamination effects of the internal dynamics. M.C.D. Tayler, B. Ouyang and B.J. Howard, J. Chem. Phys., {134}, 054316 (2011).

  9. Dynamic metabolic exchange governs a marine algal-bacterial interaction.

    PubMed

    Segev, Einat; Wyche, Thomas P; Kim, Ki Hyun; Petersen, Jörn; Ellebrandt, Claire; Vlamakis, Hera; Barteneva, Natasha; Paulson, Joseph N; Chai, Liraz; Clardy, Jon; Kolter, Roberto

    2016-11-18

    Emiliania huxleyi is a model coccolithophore micro-alga that generates vast blooms in the ocean. Bacteria are not considered among the major factors influencing coccolithophore physiology. Here we show through a laboratory model system that the bacterium Phaeobacter inhibens , a well-studied member of the Roseobacter group, intimately interacts with E. huxleyi. While attached to the algal cell, bacteria initially promote algal growth but ultimately kill their algal host. Both algal growth enhancement and algal death are driven by the bacterially-produced phytohormone indole-3-acetic acid. Bacterial production of indole-3-acetic acid and attachment to algae are significantly increased by tryptophan, which is exuded from the algal cell. Algal death triggered by bacteria involves activation of pathways unique to oxidative stress response and programmed cell death. Our observations suggest that bacteria greatly influence the physiology and metabolism of E. huxleyi. Coccolithophore-bacteria interactions should be further studied in the environment to determine whether they impact micro-algal population dynamics on a global scale.

  10. Temperature-programmed deoxygenation of acetic acid on molybdenum carbide catalysts

    DOE PAGES

    Nash, Connor P.; Farberow, Carrie A.; Hensley, Jesse E.

    2017-02-07

    Temperature programmed reaction (TPRxn) is a simple yet powerful tool for screening solid catalyst performance at a variety of conditions. A TPRxn system includes a reactor, furnace, gas and vapor sources, flow control, instrumentation to quantify reaction products (e.g., gas chromatograph), and instrumentation to monitor the reaction in real time (e.g., mass spectrometer). Here, we apply the TPRxn methodology to study molybdenum carbide catalysts for the deoxygenation of acetic acid, an important reaction among many in the upgrading/stabilization of biomass pyrolysis vapors. TPRxn is used to evaluate catalyst activity and selectivity and to test hypothetical reaction pathways (e.g., decarbonylation, ketonization,more » and hydrogenation). Furthermore, the results of the TPRxn study of acetic acid deoxygenation show that molybdenum carbide is an active catalyst for this reaction at temperatures above ca. 300 °C and that the reaction favors deoxygenation (i.e., C-O bond-breaking) products at temperatures below ca. 400 °C and decarbonylation (i.e., C-C bond-breaking) products at temperatures above ca. 400 °C.« less

  11. Antimicrobial and immune modulatory effects of lactic acid and short chain fatty acids produced by vaginal microbiota associated with eubiosis and bacterial vaginosis

    PubMed Central

    Aldunate, Muriel; Srbinovski, Daniela; Hearps, Anna C.; Latham, Catherine F.; Ramsland, Paul A.; Gugasyan, Raffi; Cone, Richard A.; Tachedjian, Gilda

    2015-01-01

    Lactic acid and short chain fatty acids (SCFAs) produced by vaginal microbiota have reported antimicrobial and immune modulatory activities indicating their potential as biomarkers of disease and/or disease susceptibility. In asymptomatic women of reproductive-age the vaginal microbiota is comprised of lactic acid-producing bacteria that are primarily responsible for the production of lactic acid present at ~110 mM and acidifying the vaginal milieu to pH ~3.5. In contrast, bacterial vaginosis (BV), a dysbiosis of the vaginal microbiota, is characterized by decreased lactic acid-producing microbiota and increased diverse anaerobic bacteria accompanied by an elevated pH>4.5. BV is also characterized by a dramatic loss of lactic acid and greater concentrations of mixed SCFAs including acetate, propionate, butyrate, and succinate. Notably women with lactic acid-producing microbiota have more favorable reproductive and sexual health outcomes compared to women with BV. Regarding the latter, BV is associated with increased susceptibility to sexually transmitted infections (STIs) including HIV. In vitro studies demonstrate that lactic acid produced by vaginal microbiota has microbicidal and virucidal activities that may protect against STIs and endogenous opportunistic bacteria as well as immune modulatory properties that require further characterization with regard to their effects on the vaginal mucosa. In contrast, BV-associated SCFAs have far less antimicrobial activity with the potential to contribute to a pro-inflammatory vaginal environment. Here we review the composition of lactic acid and SCFAs in respective states of eubiosis (non-BV) or dysbiosis (BV), their effects on susceptibility to bacterial/viral STIs and whether they have inherent microbicidal/virucidal and immune modulatory properties. We also explore their potential as biomarkers for the presence and/or increased susceptibility to STIs. PMID:26082720

  12. Acetic acid as a decontamination method for sink drains in a nosocomial outbreak of metallo-β-lactamase-producing Pseudomonas aeruginosa.

    PubMed

    Stjärne Aspelund, A; Sjöström, K; Olsson Liljequist, B; Mörgelin, M; Melander, E; Påhlman, L I

    2016-09-01

    Pseudomonas aeruginosa may colonize water systems via biofilm formation. In hospital environments, contaminated sinks have been associated with nosocomial transmission. Here we describe a prolonged outbreak of a metallo-β-lactamase-producing P. aeruginosa (Pae-MBL) associated with sink drains, and propose a previously unreported decontamination method with acetic acid. To describe a nosocomial outbreak of Pae-MBL associated with hospital sink drains and to evaluate acetic acid as a decontamination method. The outbreak was investigated by searching the microbiology database, microbiological sampling and strain typing. Antibacterial and antibiofilm properties of acetic acid were evaluated in vitro. Pae-MBL-positive sinks were treated with 24% acetic acid once weekly and monitored with repeated cultures. Fourteen patients with positive cultures for Pae-MBL were identified from 2008 to 2014. The patients had been admitted to three wards, where screening discovered Pae-MBL in 12 sink drains located in the patient bathrooms. Typing of clinical and sink drain isolates revealed identical or closely related strains. Pae-MBL biofilm was highly sensitive to acetic acid with a minimum biofilm eradication concentration of 0.75% (range: 0.19-1.5). Weekly treatment of colonized sink drains with acetic acid resulted in negative cultures and terminated transmission. Acetic acid is highly effective against Pae-MBL biofilms, and may be used as a simple method to decontaminate sink drains and to prevent nosocomial transmission. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  13. The integration of acetic acid iontophoresis, orthotic therapy and physical rehabilitation for chronic plantar fasciitis: a case study

    PubMed Central

    Costa, Ivano A; Dyson, Anita

    2007-01-01

    A 15-year-old female soccer player presented with chronic plantar fasciitis. She was treated with acetic acid iontophoresis and a combination of rehabilitation protocols, ultrasound, athletic taping, custom orthotics and soft tissue therapies with symptom resolution and return to full activities within a period of 6 weeks. She reported no significant return of symptoms post follow-up at 2 months. Acetic acid iontophoresis has shown promising results and further studies should be considered to determine clinical effectiveness. The combination of acetic acid iontophoresis with conservative treatments may promote recovery within a shorter duration compared to the use of one-method treatment approaches. PMID:17885679

  14. Molecular dynamics simulations of the auxin-binding protein 1 in complex with indole-3-acetic acid and naphthalen-1-acetic acid.

    PubMed

    Grandits, Melanie; Oostenbrink, Chris

    2014-10-01

    Auxin-binding protein 1 (ABP1) is suggested to be an auxin receptor which plays an important role in several processes in green plants. Maize ABP1 was simulated with the natural auxin indole-3-acetic acid (IAA) and the synthetic analog naphthalen-1-acetic acid (NAA), to elucidate the role of the KDEL sequence and the helix at the C-terminus. The KDEL sequence weakens the intermolecular interactions between the monomers but stabilizes the C-terminal helix. Conformational changes at the C-terminus occur within the KDEL sequence and are influenced by the binding of the simulated ligands. This observation helps to explain experimental findings on ABP1 interactions with antibodies that are modulated by the presence of auxin, and supports the hypothesis that ABP1 acts as an auxin receptor. Stable hydrogen bonds between the monomers are formed between Glu40 and Glu62, Arg10 and Thr97, Lys39, and Glu62 in all simulations. The amino acids Ile22, Leu25, Trp44, Pro55, Ile130, and Phe149 are located in the binding pocket and are involved in hydrophobic interactions with the ring system of the ligand. Trp151 is stably involved in a face to end interaction with the ligand. The calculated free energy of binding using the linear interaction energy approach showed a higher binding affinity for NAA as compared to IAA. Our simulations confirm the asymmetric behavior of the two monomers, the stronger interaction of NAA than IAA and offers insight into the possible mechanism of ABP1 as an auxin receptor. © 2014 Wiley Periodicals, Inc.

  15. Effect of acetic acid and pH on the cofermentation of glucose and xylose to ethanol by a genetically engineered strain of Saccharomyces cerevisiae.

    PubMed

    Casey, Elizabeth; Sedlak, Miroslav; Ho, Nancy W Y; Mosier, Nathan S

    2010-06-01

    A current challenge of the cellulosic ethanol industry is the effect of inhibitors present in biomass hydrolysates. Acetic acid is an example of one such inhibitor that is released during the pretreatment of hemicellulose. This study examined the effect of acetic acid on the cofermentation of glucose and xylose under controlled pH conditions by Saccharomyces cerevisiae 424A(LNH-ST), a genetically engineered industrial yeast strain. Acetic acid concentrations of 7.5 and 15 g L(-1), representing the range of concentrations expected in actual biomass hydrolysates, were tested under controlled pH conditions of 5, 5.5, and 6. The presence of acetic acid in the fermentation media led to a significant decrease in the observed maximum cell biomass concentration. Glucose- and xylose-specific consumption rates decreased as the acetic acid concentration increased, with the inhibitory effect being more severe for xylose consumption. The ethanol production rates also decreased when acetic acid was present, but ethanol metabolic yields increased under the same conditions. The results also revealed that the inhibitory effect of acetic acid could be reduced by increasing media pH, thus confirming that the undissociated form of acetic acid is the inhibitory form of the molecule.

  16. Ulcer healing activity of Mumijo aqueous extract against acetic acid induced gastric ulcer in rats

    PubMed Central

    Shahrokhi, Nader; Keshavarzi, Zakieh; Khaksari, Mohammad

    2015-01-01

    Objective: Gastric ulcer is an important clinical problem, chiefly due to extensive use of some drugs. The aim was to assess the activity of Mumijo extract (which is used in traditional medicine) against acetic acid induced gastric ulcer in rats. Materials and Methods: The aqueous extract of Mumijo was prepared. Animals were randomly (n = 10) divided into four groups: Control, sham-operated group (received 0.2 ml of acetic acid to induce gastric ulcer), Mumijo (100 mg/kg/daily) were given for 4 days postacetic acid administration, and ranitidine group (20 mg/kg). The assessed parameters were pH and pepsin levels (by Anson method) of gastric contents and gastric histopathology. Ranitidine was used as reference anti-ulcer drug. Results: The extract (100 mg/kg/daily, p.o.) inhibited acid acetic-induced gastric ulceration by elevating its pH versus sham group (P < 0.01) and decreasing the pepsin levels compared to standard drug, ranitidine (P < 0.05). The histopathology data showed that the treatment with Mumijo extract had a significant protection against all mucosal damages. Conclusion: Mumijo extract has potent antiulcer activity. Its anti-ulcer property probably acts via a reduction in gastric acid secretion and pepsin levels. The obtained results support the use of this herbal material in folk medicine. PMID:25709338

  17. Screening and characterization of ethanol-tolerant and thermotolerant acetic acid bacteria from Chinese vinegar Pei.

    PubMed

    Chen, Yang; Bai, Ye; Li, Dongsheng; Wang, Chao; Xu, Ning; Hu, Yong

    2016-01-01

    Acetic acid bacteria (AAB) are important microorganisms in the vinegar industry. However, AAB have to tolerate the presence of ethanol and high temperatures, especially in submerged fermentation (SF), which inhibits AAB growth and acid yield. In this study, seven AAB that are tolerant to temperatures above 40 °C and ethanol concentrations above 10% (v/v) were isolated from Chinese vinegar Pei. All the isolated AAB belong to Acetobacter pasteurianus according to 16S rDNA analysis. Among all AAB, AAB4 produced the highest acid yield under high temperature and ethanol test conditions. At 4% ethanol and 30-40 °C temperatures, AAB4 maintained an alcohol-acid transform ratio of more than 90.5 %. High alcohol-acid transform ratio was still maintained even at higher temperatures, namely, 87.2, 77.1, 14.5 and 2.9% at 41, 42, 43 and 44 °C, respectively. At 30 °C and different initial ethanol concentrations (4-10%), the acid yield by AAB4 increased gradually, although the alcohol-acid transform ratio decreased to some extent. However, 46.5, 8.7 and 0.9% ratios were retained at ethanol concentrations of 11, 12 and 13%, respectively. When compared with AS1.41 (an AAB widely used in China) using a 10 L fermentor, AAB4 produced 42.0 g/L acetic acid at 37 °C with 10% ethanol, whereas AS1.41 almost stopped producing acetic acid. In conclusion, these traits suggest that AAB4 is a valuable strain for vinegar production in SF.

  18. Unusal pattern of product inhibition: batch acetic acid fermentation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bar, R.; Gainer, J.L.; Kirwan, D.J.

    1987-04-20

    The limited tolerance of microorganisms to their metabolic products results in inhibited growth and product formation. The relationship between the specific growth rate, micro, and the concentration of an inhibitory product has been described by a number of mathematical models. In most cases, micro was found to be inversely proportional to the product concentration and invariably the rate of substrate utilization followed the same pattern. In this communication, the authors report a rather unusual case in which the formation rate of a product, acetic acid, increased with a decreasing growth rate of the microorganism, Acetobacter aceti. Apparently, a similar behaviormore » was mentioned in a review report with respect to Clostridium thermocellum in a batch culture but was not published in the freely circulating literature. The fermentation of ethanol to acetic acid, C/sub 2/H/sub 5/OH + O/sub 2/ = CH/sub 3/COOH + H/sub 2/O is clearly one of the oldest known fermentations. Because of its association with the commercial production of vinegar it has been a subject of extensive but rather technically oriented studies. Suprisingly, the uncommon uncoupling between the inhibited microbial growth and the product formation appears to have been unnoticed. 13 references.« less

  19. Characterization of a bioflocculant produced by Citrobacter sp. TKF04 from acetic and propionic acids.

    PubMed

    Fujita, M; Ike, M; Tachibana, S; Kitada, G; Kim, S M; Inoue, Z

    2000-01-01

    A bacterial strain, TKF04, capable of producing a bioflocculant from acetic and/or propionic acids was isolated from a biofilm formed in inside a kitchen drain. It was identified as a Citrobacter based on its morphological and physiological characteristics and the partial sequences of its 16S rRNA. TKF04 produced the bioflocculant during the logarithmic phase of growth, and the optimum temperature and pH for the bioflocculant production were 30 degrees C and 7.2-10.0, respectively. It could utilize some organic acids and sugars for its growth as the sole carbon sources when yeast extract was supplemented; however, only acetate and propionate were found to be good substrates for the bioflocculant production. The crude bioflocculant could be recovered from the supernatant of the culture broth by ethanol precipitation and dialysis against deionized water. It was found to be effective for flocculation of a kaolin suspension, when added at a final concentration of 1-10 mg/l, over a wide range of pHs (2-8) and temperatures (approximately 3-95 degrees C), while the co-presence of cations (Na+, K+, Ca2+, Mg2+, Fe2+, Al3+ or Fe3+) did not enhance the flocculating activity. It could efficiently flocculate a variety of inorganic and organic suspended particles, including kaolin, diatomite, bentonite, activated carbon, soil and activated sludge. It contained glucosamine as the major component, and the molecular weight was estimated to be between 232 and 440 kDa by gel filtration. The observation that the flocculating activity was completely lost following chitinase treatment and its analysis with a Fourier transform infrared spectrometer suggested that the bioflocculant is a biopolymer structurally-similar to chitin or chitosan.

  20. Free acetic acid as the key factor for the inhibition of hydrogenotrophic methanogenesis in mesophilic mixed culture fermentation.

    PubMed

    Zhang, Wei; Dai, Kun; Xia, Xiu-Yang; Wang, Hua-Jie; Chen, Yun; Lu, Yong-Ze; Zhang, Fang; Zeng, Raymond Jianxiong

    2018-05-18

    The inhibition of acetate under acidic pH is an ideal way to reduce methanogenesis in mesophilic mixed culture fermentation (MCF). However, the effects of acetate concentration and acidic pH on methanogenesis remain unclear. Besides, although hydrogenotrophic methanogens can be suitable targets in MCF, they are generally ignored. Therefore, we intentionally enriched hydrogenotrophic methanogens and found that free acetic acid (FAA, x) concentration and specific methanogenic activity (SMA, y) were correlated according to the equation: y = 0.86 × 0.31/(0.31 + x) (R 2  = 0.909). The SMA was decreased by 50% and 90% at the FAA concentrations of 0.31 and 2.36 g/L, respectively. The coenzyme M concentration and relative electron transport activity agreed well with the FAA concentration. Moreover, the methanogenic activity could not be recovered when the FAA concentration exceeded 0.81 g/L. These findings indicated that neither acetate nor acidic pH, but FAA was the key factor to inhibit methanogenesis in MCF. Copyright © 2018 Elsevier Ltd. All rights reserved.

  1. Effect of Concentrated Apple Extract on Experimental Colitis Induced by Acetic Acid.

    PubMed

    Pastrelo, Maurício Mercaldi; Dias Ribeiro, Carla Caroline; Duarte, Joselmo Willamys; Bioago Gollücke, Andréa Pitelli; Artigiani-Neto, Ricardo; Ribeiro, Daniel Araki; Miszputen, Sender Jankiel; Fujiyama Oshima, Celina Tizuko; Ribeiro Paiotti, Ana Paula

    2017-01-01

    Reactive oxygen and nitrogen species (ROS/RNS) play a crucial role in inflammatory bowel disease (IBD) exacerbating the chronic inflammatory process. Endogenous and diet antioxidants can neutralize these compounds. The apple is widely consumed, with several antioxidant activity compounds. The present study evaluated the effects of concentrated apple extract (CAE) in acetic acid induced colitis. 29 Wistar male rats were randomized into 5 groups. G1-Sham/saline solution, G2-CAE/control, G3-acetic acid/control, G4-curative- CAE treatment and G5-preventive-CAE treatment. Eight days later, the animals were euthanized and the colonic segment resected for macroscopic and histological analysis. Gene expression was evaluated for inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2), catalase and copper and zinc superoxide dismutase (CuZnSOD) by quantitative real time PCR, while protein expression was assessed for iNOS, COX-2 and 8-hydroxy-20-deoxyguanosine (8-OHdG) via immunohistochemistry. The groups G3, G4 and G5 had weight loss, while G5 had weight increase at the end of the experiment. The treatment with CAE reduced the macroscopic and microscopic injury, decreased iNOS mRNA expression and increased CuZnSOD mRNA expression in animals with induced acetic acid-colitis. The findings of the present study suggest that CAE treatment exerts an antioxidant role by downregulating iNOS and upregulating CuZnSOD.

  2. Regulation of Auxin Homeostasis and Gradients in Arabidopsis Roots through the Formation of the Indole-3-Acetic Acid Catabolite 2-Oxindole-3-Acetic Acid[C][W][OPEN

    PubMed Central

    Pěnčík, Aleš; Simonovik, Biljana; Petersson, Sara V.; Henyková, Eva; Simon, Sibu; Greenham, Kathleen; Zhang, Yi; Kowalczyk, Mariusz; Estelle, Mark; Zažímalová, Eva; Novák, Ondřej; Sandberg, Göran; Ljung, Karin

    2013-01-01

    The native auxin, indole-3-acetic acid (IAA), is a major regulator of plant growth and development. Its nonuniform distribution between cells and tissues underlies the spatiotemporal coordination of many developmental events and responses to environmental stimuli. The regulation of auxin gradients and the formation of auxin maxima/minima most likely involve the regulation of both metabolic and transport processes. In this article, we have demonstrated that 2-oxindole-3-acetic acid (oxIAA) is a major primary IAA catabolite formed in Arabidopsis thaliana root tissues. OxIAA had little biological activity and was formed rapidly and irreversibly in response to increases in auxin levels. We further showed that there is cell type–specific regulation of oxIAA levels in the Arabidopsis root apex. We propose that oxIAA is an important element in the regulation of output from auxin gradients and, therefore, in the regulation of auxin homeostasis and response mechanisms. PMID:24163311

  3. (GTG)5-PCR reference framework for acetic acid bacteria.

    PubMed

    Papalexandratou, Zoi; Cleenwerck, Ilse; De Vos, Paul; De Vuyst, Luc

    2009-11-01

    One hundred and fifty-eight strains of acetic acid bacteria (AAB) were subjected to (GTG)(5)-PCR fingerprinting to construct a reference framework for their rapid classification and identification. Most of them clustered according to their respective taxonomic designation; others had to be reclassified based on polyphasic data. This study shows the usefulness of the method to determine the taxonomic and phylogenetic relationships among AAB and to study the AAB diversity of complex ecosystems.

  4. 21 CFR 862.1390 - 5-Hydroxyindole acetic acid/serotonin test system.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false 5-Hydroxyindole acetic acid/serotonin test system. 862.1390 Section 862.1390 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry...

  5. Metal adsorption onto bacterial surfaces: development of a predictive approach

    NASA Astrophysics Data System (ADS)

    Fein, Jeremy B.; Martin, Aaron M.; Wightman, Peter G.

    2001-12-01

    Aqueous metal cation adsorption onto bacterial surfaces can be successfully modeled by means of a surface complexation approach. However, relatively few stability constants for metal-bacterial surface complexes have been measured. In order to determine the bacterial adsorption behavior of cations that have not been studied in the laboratory, predictive techniques are required that enable estimation of the stability constants of bacterial surface complexes. In this study, we use a linear free-energy approach to compare previously measured stability constants for Bacillus subtilis metal-carboxyl surface complexes with aqueous metal-organic acid anion stability constants. The organic acids that we consider are acetic, oxalic, citric, and tiron. We add to this limited data set by conducting metal adsorption experiments onto Bacillus subtilis, determining bacterial surface stability constants for Co, Nd, Ni, Sr, and Zn. The adsorption behavior of each of the metals studied here was described well by considering metal-carboxyl bacterial surface complexation only, except for the Zn adsorption behavior, which required carboxyl and phosphoryl complexation to obtain a suitable fit to the data. The best correlation between bacterial carboxyl surface complexes and aqueous organic acid anion stability constants was obtained by means of metal-acetate aqueous complexes, with a linear correlation coefficient of 0.97. This correlation applies only to unhydrolyzed aqueous cations and only to carboxyl binding of those cations, and it does not predict the binding behavior under conditions where metal binding to other bacterial surface site types occurs. However, the relationship derived in this study permits estimation of the carboxyl site adsorption behavior of a wide range of aqueous metal cations for which there is an absence of experimental data. This technique, coupled with the observation of similar adsorption behaviors across bacterial species (Yee and Fein, 2001), enables

  6. Rapid degradation of 2,4-dichlorophenoxyacetic acid facilitated by acetate under methanogenic condition.

    PubMed

    Yang, Zhiman; Xu, Xiaohui; Dai, Meng; Wang, Lin; Shi, Xiaoshuang; Guo, Rongbo

    2017-05-01

    Acetate can be used as an electron donor to stimulate 2,4-dichlorophenoxyacetic acid (2,4-D), which has not been determined under methanogenic condition. This study applied high-throughput sequencing and methanogenic inhibition approaches to investigate the 2,4-D degradation process using the enrichments obtained from paddy soil. Acetate addition significantly promoted 2,4-D degradation, which was 5-fold higher than in the acetate-unsupplemented enrichments in terms of the 2,4-D degradation rate constant. Dechloromonas and Pseudomonas were the dominant 2,4-D degraders. Methanogenic inhibition experiments indicated that the 2,4-D degradation was independent of methanogenesis. It was proposed that the accelerated 2,4-D degradation in the acetate-supplemented enrichment involved an unusual interaction, where members of the acetate oxidizers primarily oxidized acetate and produced H 2 . H 2 was utilized by the 2,4-D degraders to degrade 2,4-D, but also partially consumed by the hydrogenotrophic methanogens to produce methane. The findings presented here provide a new strategy for the remediation of 2,4-D-polluted soils. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Direct carbon-carbon coupling of furanics with acetic acid over Bronsted zeolites

    DOE PAGES

    Gumidyala, Abhishek; Wang, Bin; Crossley, Steven

    2016-09-16

    Effective carbon-carbon coupling of acetic acid to form larger products while minimizing CO 2 emissions is critical to achieving a step change in efficiency for the production of transportation fuels from sustainable biomass. Here, we report the direct acylation of methylfuran with acetic acid in the presence ofwater, all ofwhich can be readily produced from biomass. This direct coupling limits unwanted polymerization of furanics while producing acetyl methylfuran. Reaction kinetics and density functional theory calculations illustrate that the calculated apparent barrier for the dehydration of the acid to form surface acyl species is similar to the experimentally measured barrier, implyingmore » that this step plays a significant role in determining the net reaction rate. Water inhibits the overall rate, but selectivity to acylated products is not affected.We show that furanic species effectively stabilize the charge of the transition state, therefore lowering the overall activation barrier. These results demonstrate a promising new route to C–C bond–forming reactions for the production of higher-value products from biomass.« less

  8. Calcium Supplementation Abates the Inhibition Effects of Acetic Acid on Saccharomyces cerevisiae.

    PubMed

    Zhao, Hongwei; Li, Jingyuan; Wang, Jiming; Xu, Xin; Xian, Mo; Liu, Huizhou; Zhang, Haibo

    2017-04-01

    The toxic level of acetic acid could be released during the pretreatment of lignocellulosic biomass, and an economical method was reported to minimize the acidic stress on the fermentation of Saccharomyces cerevisiae by cation supplementation. A dose-dependent protection of Ca 2+ was monitored, and the optimal concentration of Ca 2+ was 8 mM under 4.5 g/L acetic acid stress. The activities of catalase and superoxide dismutase of yeast cells supplemented with optimal Ca 2+ increased by 18.6 and 27.3 %, respectively, coupling with an obvious decrease of reactive oxygen species content. Cell viability also performed a significant increase from 52.4 % (without Ca 2+ addition) to 73.56 % (with 8 mM Ca 2+ addition). No significant improvements were found in the bioethanol yields by Ca 2+ supplementation; however, the fermentation time was shortened by about 8 h obviously. Our results illustrated that the Ca 2+ supplementation could be an economical method to make the bioethanol production more efficient and cost-effective.

  9. Modeling of acetate-type fermentation of sugar-containing wastewater under acidic pH conditions.

    PubMed

    Huang, Liang; Pan, Xin-Rong; Wang, Ya-Zhou; Li, Chen-Xuan; Chen, Chang-Bin; Zhao, Quan-Bao; Mu, Yang; Yu, Han-Qing; Li, Wen-Wei

    2018-01-01

    In this study, a kinetic model was developed based on Anaerobic Digestion Model No. 1 to provide insights into the directed production of acetate and methane from sugar-containing wastewater under low pH conditions. The model sufficiently described the dynamics of liquid-phase and gaseous products in an anaerobic membrane bioreactor by comprehensively considering the syntrophic bioconversion steps of sucrose hydrolysis, acidogenesis, acetogenesis and methanogenesis under acidic pH conditions. The modeling results revealed a significant pH-dependency of hydrogenotrophic methanogenesis and ethanol-producing processes that govern the sucrose fermentative pathway through changing the hydrogen yield. The reaction thermodynamics of such acetate-type fermentation were evaluated, and the implications for process optimization by adjusting the hydraulic retention time were discussed. This work sheds light on the acid-stimulated acetate-type fermentation process and may lay a foundation for optimization of resource-oriented processes for treatment of food wastewater. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Co-production of furfural and acetic acid from corncob using ZnCl2 through fast pyrolysis in a fluidized bed reactor.

    PubMed

    Oh, Seung-Jin; Jung, Su-Hwa; Kim, Joo-Sik

    2013-09-01

    Corncob was pyrolyzed using ZnCl2 in a pyrolysis plant equipped with a fluidized bed reactor to co-produce furfural and acetic acid. The effects of reaction conditions, the ZnCl2 content and contacting method of ZnCl2 with corncob on the yields of furfural and acetic acid were investigated. The pyrolysis was performed within the temperature range between 310 and 410°C, and the bio-oil yield were 30-60 wt% of the product. The furfural yield increased up to 8.2 wt%. The acetic acid yield was maximized with a value of 13.1 wt%. A lower feed rate in the presence of ZnCl2 was advantageous for the production of acetic acid. The fast pyrolysis of a smaller corncob sample mechanically mixed with 20 wt% of ZnCl2 gave rise to a distinct increase in furfural. A high selectivity for furfural and acetic acid in bio-oil would make the pyrolysis of corncob with ZnCl2 very economically attractive. Copyright © 2013 Elsevier Ltd. All rights reserved.

  11. Genomic and Transcriptomic Analyses of Indole-3-Acetic Acid Biosynthesis in Diatoms

    NASA Astrophysics Data System (ADS)

    Lim, R.; Armbrust, V.

    2016-02-01

    Indole-3-acetic acid (IAA) is a major plant growth hormone and a common mediator of plant-bacterial interactions. Recently, IAA has also been found to play a role in interactions between diatoms and bacteria, with IAA production by an associated Sulfitobacter leading to increased growth rates in the marine diatom Pseudo-nitzschia multiseries. It is unclear, however, if diatoms themselves are able to synthesize IAA and whether this capability is widespread throughout Bacillariophyta. Four major tryptophan-dependent IAA biosynthesis pathways have been identified in plants and bacteria, each denoted by the first intermediate downstream of tryptophan: the indole-3-pyruvate (IPyA), tryptamine (TAM), indole-3-acetaldoxime (IAOx) and indole-3-acetamide (IAM) pathways. To investigate the possibility of IAA biosynthesis in diatoms, we first analyzed publicly available genomes of raphid pennates P. multiseries, Phaeodactylum tricornutum, Fragilariopsis cylindrus and centric Thalassiosira pseudonana for potential homologs to plant and bacterial IAA biosynthesis genes. The P. multiseries, F. cylindrus and P. tricornutum genomes encode downstream enzymes for bacterial TAM and IAM and plant IPyA pathways. The more evolutionarily ancient T. pseudonana encodes one TAM enzyme in its genome. To investigate the potential distribution of these pathways more broadly, we surveyed the transcriptomes of 11 diatom species that include representatives from all four Bacillariophyta classes. Datasets used were sequenced as part of the Marine Microbial Eukaryote Transcriptome Sequencing Project (MMETSP) and obtained from cultures maintained axenically. Transcripts associated with the TAM pathway were most frequently detected, with potential homologs to required enzymes identified in 10 of the 11 species examined. Transcripts homologous to rate-limiting IPyA enzymes were detected in six species. Only two centric and araphid pennate species expressed transcripts associated with enzymes in the

  12. Methane Upgrading of Acetic Acid as a Model Compound for a Biomass-Derived Liquid over a Modified Zeolite Catalyst

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Aiguo; Austin, Danielle; Karmakar, Abhoy

    The technical feasibility of coaromatization of acetic acid derived from biomass and methane was investigated under mild reaction conditions (400 °C and 30 bar) over silver-, zinc-, and/or gallium-modified zeolite catalysts. On the basis of GC-MS, Micro-GC, and TGA analysis, more light aromatic hydrocarbons, less phenol formation, lower coke production, and higher methane conversion are observed over 5%Zn-1%Ga/ZSM-5 catalyst in comparison with catalytic performance over the other catalysts. Direct evidence of methane incorporation into aromatics over 5%Zn-1%Ga/ZSM-5 catalyst is witnessed in 1H, 2H, and 13C NMR spectra, revealing that the carbon from methane prefers to occupy the phenyl carbon sitesmore » and the benzylic carbon sites, and the hydrogen of methane favors the aromatic and benzylic substitutions of product molecules. In combination with the 13C NMR results for isotopically labeled acetic acid ( 13CH 3COOH and CH 3 13COOH), it can be seen that the methyl and carbonyl carbons of acetic acid are equally involved in the formation of ortho, meta and para carbons of the aromatics, whereas the phenyl carbons directly bonded with alkyl substituent groups and benzylic carbons are derived mainly from the carboxyl carbon of acetic acid. After various catalyst characterizations by using TEM, XRD, DRIFT, NH 3-TPD, and XPS, the excellent catalytic performance might be closely related to the highly dispersed zinc and gallium species on the zeolite support, moderate surface acidity, and an appropriate ratio of weak acidic sites to strong acidic sites as well as the fairly stable oxidation state during acetic acid conversion under a methane environment. Two mechanisms of the coaromatization of acetic acid and methane have also been proposed after consulting all the collected data in this study. In conclusion, the results reported in this paper could potentially lead to more cost-effective utilization of abundant natural gas and biomass.« less

  13. Methane Upgrading of Acetic Acid as a Model Compound for a Biomass-Derived Liquid over a Modified Zeolite Catalyst

    DOE PAGES

    Wang, Aiguo; Austin, Danielle; Karmakar, Abhoy; ...

    2017-04-19

    The technical feasibility of coaromatization of acetic acid derived from biomass and methane was investigated under mild reaction conditions (400 °C and 30 bar) over silver-, zinc-, and/or gallium-modified zeolite catalysts. On the basis of GC-MS, Micro-GC, and TGA analysis, more light aromatic hydrocarbons, less phenol formation, lower coke production, and higher methane conversion are observed over 5%Zn-1%Ga/ZSM-5 catalyst in comparison with catalytic performance over the other catalysts. Direct evidence of methane incorporation into aromatics over 5%Zn-1%Ga/ZSM-5 catalyst is witnessed in 1H, 2H, and 13C NMR spectra, revealing that the carbon from methane prefers to occupy the phenyl carbon sitesmore » and the benzylic carbon sites, and the hydrogen of methane favors the aromatic and benzylic substitutions of product molecules. In combination with the 13C NMR results for isotopically labeled acetic acid ( 13CH 3COOH and CH 3 13COOH), it can be seen that the methyl and carbonyl carbons of acetic acid are equally involved in the formation of ortho, meta and para carbons of the aromatics, whereas the phenyl carbons directly bonded with alkyl substituent groups and benzylic carbons are derived mainly from the carboxyl carbon of acetic acid. After various catalyst characterizations by using TEM, XRD, DRIFT, NH 3-TPD, and XPS, the excellent catalytic performance might be closely related to the highly dispersed zinc and gallium species on the zeolite support, moderate surface acidity, and an appropriate ratio of weak acidic sites to strong acidic sites as well as the fairly stable oxidation state during acetic acid conversion under a methane environment. Two mechanisms of the coaromatization of acetic acid and methane have also been proposed after consulting all the collected data in this study. In conclusion, the results reported in this paper could potentially lead to more cost-effective utilization of abundant natural gas and biomass.« less

  14. High-level expression of recombinant thermostable β-glucosidase in Escherichia coli by regulating acetic acid.

    PubMed

    Shi, Xuejia; Xie, Jingcong; Liao, Shiyong; Wu, Tao; Zhao, Lin-Guo; Ding, Gang; Wang, Zhenzhong; Xiao, Wei

    2017-10-01

    In the fermentation progress, fermentation parameters including the feed rate, induction temperature, and induction pH evidently regulate the accumulation of acetic acid generated by recombinant E. coli in the medium. The production of thermostable β-glucosidase (Tpebgl3) was increased by optimizing the parameters mentioned step by step. The optimal conditions were obtained with the highest enzyme expression (560.4U/mL) and the maximum DCW (65g/L) at the pre-induction specific growth rate of 0.2h -1 followed by a post-induction specific growth rate (0.18h -1 ); induction temperature is 39°C; the pH is 7.2; the concentration of acetic acid was maintained all along below 0.9g/L. Results show it is necessary for the synthesis of Tpebgl3 to regulate the accumulation of acetic acid at the premise of feeding to meet the normal growth of E. coli. The production of Tpebgl3 by recombinant E. coli is the highest reported to date. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Role of the glyoxylate pathway in acetic acid production by Acetobacter aceti.

    PubMed

    Sakurai, Kenta; Yamazaki, Shoko; Ishii, Masaharu; Igarashi, Yasuo; Arai, Hiroyuki

    2013-01-01

    Wild-type Acetobacter aceti NBRC 14818 possesses genes encoding isocitrate lyase (aceA) and malate synthase (glcB), which constitute the glyoxylate pathway. In contrast, several acetic acid bacteria that are utilized for vinegar production lack these genes. Here, an aceA-glcB knockout mutant of NBRC 14818 was constructed and used for investigating the role of the glyoxylate pathway in acetate productivity. In medium containing ethanol as a carbon source, the mutant grew normally during ethanol oxidation to acetate, but exhibited slower growth than that of the wild-type strain as the accumulated acetate was oxidized. The mutant grew similarly to that of the wild-type strain in medium containing glucose as a carbon source, indicating that the glyoxylate pathway was not necessary for glucose utilization. However, in medium containing both ethanol and glucose, the mutant exhibited significantly poorer growth and lower glucose consumption compared to the wild-type strain. Notably, the mutant oxidized ethanol nearly stoichiometrically to acetate, which was retained in the medium for a longer period of time than the acetate produced by wild-type strain. The features of the aceA-glcB knockout mutant revealed here indicate that the lack of the glyoxylate pathway is advantageous for industrial vinegar production by A. aceti. Copyright © 2012 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  16. Efficacy of Trichloro-Acetic Acid Peel Alone Versus Combined Topical Magnesium Ascorbyl Phosphate for Epidermal Melasma.

    PubMed

    Murtaza, Fatima; Bangash, Abdur Rahim; Khushdil, Arshad; Noor, Sahibzada Mahmood

    2016-07-01

    To compare the efficacy in terms of reduction in melasma area and severity index (MASI) score by more than 10 of a combination of 20% trichloro-acetic acid peel plus 5% topical magnesium ascorbyl phosphate versus 20% trichloroacetic acid peel alone in the treatment of epidermal melasma. Randomized controlled trial. Department of Dermatology, Lady Reading Hospital (LRH), Peshawar, from May 2012 to May 2013. Patients aged 18 - 65 years, with Fitzpatrick skin type III-V were divided into two equal groups having 74 patients each. Detailed history was taken and Wood's lamp examination done to rule out mixed and dermal melasma. Melasma area and severity index (MASI) score was calculated for every patient. Priming was done for all patients with tretinoin cream applied once daily at night for 2 weeks, and to use a broad spectrum sun block cream before sun exposure. Patients in group Awere subjected to combined treatment, i.e. trichloro-acetic acid peel 20% (weekly) plus magnesium ascorbyl phosphate cream (applied once daily), while patients in group B were subjected to trichloro-acetic acid peel 20% (weekly) alone. Treatment was continued for 6 weeks. After completion of treatment, MASI score was recalculated. Proportion of patients with significant MASI score reduction was compared using chi-square test with significance at p < 0.05. Male and female patients were 11 (14.9%) and 63 (85.1%), respectively in group A, whereas 13 (17.6%) and 61 (82.4%) in group B. The mean age in group Awas 30.28 ±8.08 years, and 29.36 ±6.84 years in group B. Significant MASI score reduction in group Awas seen in 60 (81.1%) patients and in group B 49 (66.2%, p= 0.040). Combination of trichloro-acetic acid peel and topical magnesium ascorbyl phosphate cream was significantly more effective than trichloro-acetic acid peel alone in treatment of melasma.

  17. Acetobacter fabarum sp. nov., an acetic acid bacterium from a Ghanaian cocoa bean heap fermentation.

    PubMed

    Cleenwerck, Ilse; Gonzalez, Angel; Camu, Nicholas; Engelbeen, Katrien; De Vos, Paul; De Vuyst, Luc

    2008-09-01

    Six acetic acid bacterial isolates, obtained during a study of the microbial diversity of spontaneous fermentations of Ghanaian cocoa beans, were subjected to a polyphasic taxonomic study. (GTG)(5)-PCR fingerprinting grouped the isolates together, but they could not be identified using this method. Phylogenetic analysis based on 16S rRNA gene sequences allocated the isolates to the genus Acetobacter and revealed Acetobacter lovaniensis, Acetobacter ghanensis and Acetobacter syzygii to be nearest neighbours. DNA-DNA hybridizations demonstrated that the isolates belonged to a single novel genospecies that could be differentiated from its phylogenetically nearest neighbours by the following phenotypic characteristics: no production of 2-keto-D-gluconic acid from D-glucose; growth on methanol and D-xylose, but not on maltose, as sole carbon sources; no growth on yeast extract with 30% D-glucose; and weak growth at 37 degrees C. The DNA G+C contents of four selected strains were 56.8-58.0 mol%. The results obtained prove that the isolates should be classified as representatives of a novel Acetobacter species, for which the name Acetobacter fabarum sp. nov. is proposed. The type strain is strain 985(T) (=R-36330(T) =LMG 24244(T) =DSM 19596(T)).

  18. D-amino acids inhibit initial bacterial adhesion: thermodynamic evidence.

    PubMed

    Xing, Su-Fang; Sun, Xue-Fei; Taylor, Alicia A; Walker, Sharon L; Wang, Yi-Fu; Wang, Shu-Guang

    2015-04-01

    Bacterial biofilms are structured communities of cells enclosed in a self-produced hydrated polymeric matrix that can adhere to inert or living surfaces. D-Amino acids were previously identified as self-produced compounds that mediate biofilm disassembly by causing the release of the protein component of the polymeric matrix. However, whether exogenous D-amino acids could inhibit initial bacterial adhesion is still unknown. Here, the effect of the exogenous amino acid D-tyrosine on initial bacterial adhesion was determined by combined use of chemical analysis, force spectroscopic measurement, and theoretical predictions. The surface thermodynamic theory demonstrated that the total interaction energy increased with more D-tyrosine, and the contribution of Lewis acid-base interactions relative to the change in the total interaction energy was much greater than the overall nonspecific interactions. Finally, atomic force microscopy analysis implied that the hydrogen bond numbers and adhesion forces decreased with the increase in D-tyrosine concentrations. D-Tyrosine contributed to the repulsive nature of the cell and ultimately led to the inhibition of bacterial adhesion. This study provides a new way to regulate biofilm formation by manipulating the contents of D-amino acids in natural or engineered systems. © 2014 Wiley Periodicals, Inc.

  19. Enhanced acetic acid production from manalagi apple (Malus sylvestris mill) by mixed cultures of Saccharomyces cerevisiae and Acetobacter aceti in submerged fermentation

    NASA Astrophysics Data System (ADS)

    Rosada, K. K.

    2018-05-01

    The production of acetic acid from Manalagi apple was studied using a mixed culture of S. cerevisiae and A. aceti by submerged fermentation technique. Determination of the best conditions for producing acetic acid was performed by stratified optimization with variations that were made on the concentration of the initial sugar addition to the medium (0%, 10%, 20% w/v), the ratio of the number of inocula S. cerevisiae and A. aceti (7:3, 1:1, 3:7), and agitation rate (80 and 160 rpm). All experiments were done by using the initial pH medium of 4.5 and incubated at room temperature (28±2oC) for 14 days. The concentration of reducing sugar, alcohol, acetic acid, and the pH were measured every 48 hours. The efficiency of sugar conversion to acetic acid with the addition of initial sugar 0%, 10%, and20%were 233%, 46.6%, and 6.4% respectively after ten days of incubation. Overall, the result showed that the highest acetic acid was produced from Manalagi apple juice when no sugar was added, using seven parts of S. cerevisiae to three parts of A. aceti and agitation rate of 160 rpm on the tenth day of fermentation. Under these conditions, glucose conversion efficiency to acetic acid increased to 362%.

  20. D-lactic acid measurements in the diagnosis of bacterial infections.

    PubMed Central

    Smith, S M; Eng, R H; Campos, J M; Chmel, H

    1989-01-01

    Body fluids suspected of bacterial infection were cultured and examined for the presence of D-lactic acid, a specific bacterial metabolite. We examined 206 patients and 264 specimens. D-Lactic acid was found in concentrations of greater than or equal to 0.15 mM in 11 of 11 infected and 6 of 40 noninfected ascitic fluids, 6 of 6 infected and 4 of 33 noninfected pleural fluids, 4 of 4 infected and 0 of 13 noninfected synovial fluids, and 26 of 27 infected and 2 of 130 noninfected cerebrospinal fluids. The overall sensitivity was 79.7%, and the specificity was 99.5% when the D-lactic acid concentration was at least 0.15 mM. The most important clinical utility of the D-lactic acid measurement appears to be for patients with bacterial infection in various body compartments and in patients who have already received antimicrobial therapy. An elevation in D-lactic acid may indicate the presence of bacterial infection even when cultures are negative. PMID:2715313

  1. [Comparison of the diagnostic utility from visual inspection with acetic acid and cervical cytology].

    PubMed

    Velázquez-Hernández, Nadia; Sánchez-Anguiano, Luis Francisco; Lares-Bayona, Edgar Felipe; Cisneros-Pérez, Vicente; Milla-Villeda, Reinaldo Humberto; Arreola-Herrera, Francisco de Asís; Navarrete-Flores, José Antonio; Aguilar-Durán, Maricela; Núñez-Márquez, Teresita; Rueda-Cisneros, Dora Alicia

    2010-05-01

    In Mexico, cervical cancer is the second leading cause of death in women after breast cancer. The human papillomavirus is associated with intraepithelial lesions, detected up to 99.7% of cervical carcinomas. Despite being easy to detect is a condition that many women suffer. To determine the diagnostic utility of the visual inspection with acetic acid of the uterine cervix compared with the cervical cytology. Study of diagnostic tests. The study was realized in the Centro de Atención Materno Infantil y Planificación Familiar of the Instituto de Investigación Científica, Durango, Mexico, research of the Juárez University of the State of Durango, from August 23, 2005 to November 13, 2006. 1,521 participants were examined who went consecutively to opportune detection of cervical cancer. One doctor practiced the test of acetic acid and cervical cytology to them, and one digital photograph, which was evaluated by three inter-observers triple blind. Those that was positive to anyone of these tests, were remitted to colposcopy and/or biopsy; also to 10% of selected negative population randomly was realized this procedure. Sensitivity, specificity, positive and negative predictive values and exactitude were determined. For the agreement inter-observer index of Kappa was used. Sensitivity, specificity, values predictive positive, negative and exactitude for the visual inspection with acetic acid were 20, 97, 5 and 99%, respectively. For the cervical cytology were of 80, 99, 57 and 99%, respectively. The force of agreement between the interobservant was poor. In this study cervical cytology was more useful than visual inspection with acetic acid to detect dysplasias or cervical cancer opportunely, due to detect all the positive true cases confirmed by biopsy.

  2. Study on the extraction, purification and quantification of jasmonic acid, abscisic acid and indole-3-acetic acid in plants.

    PubMed

    Zhang, Feng Juan; Jin, You Ju; Xu, Xing You; Lu, Rong Chun; Chen, Hua Jun

    2008-01-01

    Jasmonic acid (JA), abscisic acid (ABA) and indole-3-acetic acid (IAA) are important plant hormones. Plant hormones are difficult to analyse because they occur in small concentrations and other substances in the plant interfere with their detection. To develop a new, inexpensive procedure for the rapid extraction and purification of IAA, ABA and JA from various plant species. Samples were prepared by extraction of plant tissues with methanol and ethyl acetate. Then the extracts were further purified and enriched with C(18) cartridges. The final extracts were derivatised with diazomethane and then measured by GC-MS. The results of the new methodology were compared with those of the Creelman and Mullet procedure. Sequential elution of the assimilates from the C(18 )cartridges revealed that IAA and ABA eluted in 40% methanol, while JA subsequently eluted in 60% methanol. The new plant hormone extraction and purification procedure produced results that were comparable to those obtained with the Creelman and Mullet's procedure. This new procedure requires only 0.5 g leaf samples to quantify these compounds with high reliability and can simultaneously determine the concentrations of the three plant hormones. A simple, inexpensive method was developed for determining endogenous IAA, ABA and JA concentrations in plant tissue.

  3. Estimation of lactic acid bacterial cell number by DNA quantification.

    PubMed

    Ishii, Masaki; Matsumoto, Yasuhiko; Sekimizu, Kazuhisa

    2018-01-01

    Lactic acid bacteria are provided by fermented foods, beverages, medicines, and supplements. Because the beneficial effects of medicines and supplements containing functional lactic acid bacteria are related to the bacterial cell number, it is important to establish a simple method for estimating the total number of lactic acid bacterial cells in the products for quality control. Almost all of the lactic acid bacteria in the products are dead, however, making it difficult to estimate the total number of lactic acid bacterial cells in the products using a standard colony-counting method. Here we estimated the total lactic acid bacterial cell number in samples containing dead bacteria by quantifying the DNA. The number of viable Enterococcus faecalis 0831-07 cells decreased to less than 1 × 10 -8 by 15 min of heat treatment at 80°C. The amount of extracted DNA from heat-treated cells was 78% that of non-heated cells. The number of viable Lactobacillus paraplantarum 11-1 cells decreased to 1 × 10 -4 after 4 days culture. The amount of extracted DNA of the long-cultured cells, however, was maintained at 97%. These results suggest that cell number of lactic acid bacteria killed by heat-treatment or long-term culture can be estimated by DNA quantification.

  4. High temperature stimulates acetic acid accumulation and enhances the growth inhibition and ethanol production by Saccharomyces cerevisiae under fermenting conditions.

    PubMed

    Woo, Ji-Min; Yang, Kyung-Mi; Kim, Sae-Um; Blank, Lars M; Park, Jin-Byung

    2014-07-01

    Cellular responses of Saccharomyces cerevisiae to high temperatures of up to 42 °C during ethanol fermentation at a high glucose concentration (i.e., 100 g/L) were investigated. Increased temperature correlated with stimulated glucose uptake to produce not only the thermal protectant glycerol but also ethanol and acetic acid. Carbon flux into the tricarboxylic acid (TCA) cycle correlated positively with cultivation temperature. These results indicate that the increased demand for energy (in the form of ATP), most likely caused by multiple stressors, including heat, acetic acid, and ethanol, was matched by both the fermentation and respiration pathways. Notably, acetic acid production was substantially stimulated compared to that of other metabolites during growth at increased temperature. The acetic acid produced in addition to ethanol seemed to subsequently result in adverse effects, leading to increased production of reactive oxygen species. This, in turn, appeared to cause the specific growth rate, and glucose uptake rate reduced leading to a decrease of the specific ethanol production rate far before glucose depletion. These results suggest that adverse effects from heat, acetic acid, ethanol, and oxidative stressors are synergistic, resulting in a decrease of the specific growth rate and ethanol production rate and, hence, are major determinants of cell stability and ethanol fermentation performance of S. cerevisiae at high temperatures. The results are discussed in the context of possible applications.

  5. [Effect of Ce3+ on volatile fatty acid concentrations during anaerobic granular sludge digestion].

    PubMed

    Liang, Rui; Xia, Qing; Ding, Li-Li; Shi, Xiao-Lei; Zhao, Ming-Yu; Ren, Hong-Qiang

    2009-04-15

    Batch experiments were conducted to investigate the effect of Ce3+ on volatile fatty acid(VFA) concentrations by anaerobic granular sludge digestion using D-Glucose and acetic sodium as substrate in the state of stabilization and restart-up. Results show that when the concentration of Ce3+ is lower than 1 mg/L, VFA concentration decreases, which suggests the transformation of butyric acid to acetic acid and acetic acid to methane is promoted. When the concentration of Ce3+ is 1-10 mg/L, the bacterial activity decreases and decomposition of the acetic acid and butyric acid becomes more difficult compared with the control. Adding Ce3+ brings little change in the constitution of VFA: 96% of VFA is acetic acid and butyric acid, while the propionic acid accounts for less than 3%. With the acetic sodium as the sole carbon and energy source, adding 0.05 mg/L Ce3+ could accelerate acetate degradation. After being conserved for 4 months, the activity of the Ce-containing anaerobic granular sludge is higher than that of the Ce-free sludge. The present of Ce contributes to the restart-up of anaerobic reactors.

  6. Characterization of a recombinant flocculent Saccharomyces cerevisiae strain that co-ferments glucose and xylose: II. influence of pH and acetic acid on ethanol production.

    PubMed

    Matsushika, Akinori; Sawayama, Shigeki

    2012-12-01

    The inhibitory effects of pH and acetic acid on the co-fermentation of glucose and xylose in complex medium by recombinant flocculent Saccharomyces cerevisiae MA-R4 were evaluated. In the absence of acetic acid, the fermentation performance of strain MA-R4 was similar between pH 4.0-6.0, but was negatively affected at pH 2.5. The addition of acetic acid to batch cultures resulted in negligible inhibition of several fermentation parameters at pH 6.0, whereas the interactive inhibition of pH and acetic acid on the maximum cell and ethanol concentrations, and rates of sugar consumption and ethanol production were observed at pH levels below 5.4. The inhibitory effect of acetic acid was particularly marked for the consumption rate of xylose, as compared with that of glucose. With increasing initial acetic acid concentration, the ethanol yield slightly increased at pH 5.4 and 6.0, but decreased at pH values lower than 4.7. Notably, ethanol production was nearly completely inhibited under low pH (4.0) and high acetic acid (150-200 mM) conditions. Together, these results indicate that the inhibitory effects of acetic acid and pH on ethanol fermentation by MA-R4 are highly synergistic, although the inhibition can be reduced by increasing the medium pH.

  7. Experimental and Theoretical Investigation of Effects of Ethanol and Acetic Acid on Carcinogenic NDMA Formation in Simulated Gastric Fluid.

    PubMed

    Zhang, Ou; Zou, Xuan; Li, Qi-Hong; Sun, Zhi; Liu, Yong Dong; Zhong, Ru Gang

    2016-07-07

    N-nitrosodimethylamine (NDMA), as a representative of endogenously formed N-nitroso compounds (NOCs), has become the focus of considerable research interest due to its unusually high carcinogenicity. In this study, effects of ethanol and acetic acid on the formation of NDMA from dimethylamine (DMA) and nitrite in simulated gastric fluid (SGF) were investigated. Experimental results showed that ethanol in the concentrations of 1-8% (v/v) and acetic acid in the concentrations of 0.01-8% (v/v) exhibit inhibitory and promotion effects on the formation of NDMA, respectively. Moreover, they are both in a dose-dependent manner with the largest inhibition/promotion rate reaching ∼70%. Further experimental investigations indicate that ethanol and acetic acid are both able to scavenge nitrite in SGF. It implies that there are interactions of ethanol and acetic acid with nitrite or nitrite-related nitrosating agents rather than DMA. Theoretical calculations confirm the above experimental results and demonstrate that ethanol and acetic acid can both react with nitrite-related nitrosating agents to produce ethyl nitrite (EtONO) and acetyl nitrite (AcONO), respectively. Furthermore, the reactivities of ethyl nitrite, acetyl nitrite, and dinitrogen trioxide reacting with DMA were found in the order of AcONO > N2O3 ≫ EtONO. This is probably the main reason why there are completely different effects of ethanol and acetic acid on NDMA formation. On the basis of the above results, two requirements for a potential inhibitor of NOCs formation in SGF were provided. The results obtained in this study will be helpful in better understanding the inhibition/promotion mechanisms of compounds on NDMA formation in SGF and searching for protective substances to prevent carcinogenic NOCs formation.

  8. Dynamic metabolic exchange governs a marine algal-bacterial interaction

    PubMed Central

    Segev, Einat; Wyche, Thomas P; Kim, Ki Hyun; Petersen, Jörn; Ellebrandt, Claire; Vlamakis, Hera; Barteneva, Natasha; Paulson, Joseph N; Chai, Liraz; Clardy, Jon; Kolter, Roberto

    2016-01-01

    Emiliania huxleyi is a model coccolithophore micro-alga that generates vast blooms in the ocean. Bacteria are not considered among the major factors influencing coccolithophore physiology. Here we show through a laboratory model system that the bacterium Phaeobacter inhibens, a well-studied member of the Roseobacter group, intimately interacts with E. huxleyi. While attached to the algal cell, bacteria initially promote algal growth but ultimately kill their algal host. Both algal growth enhancement and algal death are driven by the bacterially-produced phytohormone indole-3-acetic acid. Bacterial production of indole-3-acetic acid and attachment to algae are significantly increased by tryptophan, which is exuded from the algal cell. Algal death triggered by bacteria involves activation of pathways unique to oxidative stress response and programmed cell death. Our observations suggest that bacteria greatly influence the physiology and metabolism of E. huxleyi. Coccolithophore-bacteria interactions should be further studied in the environment to determine whether they impact micro-algal population dynamics on a global scale. DOI: http://dx.doi.org/10.7554/eLife.17473.001 PMID:27855786

  9. Visualization of early events in acetic acid denaturation of HIV-1 protease: a molecular dynamics study.

    PubMed

    Borkar, Aditi Narendra; Rout, Manoj Kumar; Hosur, Ramakrishna V

    2011-01-01

    Protein denaturation plays a crucial role in cellular processes. In this study, denaturation of HIV-1 Protease (PR) was investigated by all-atom MD simulations in explicit solvent. The PR dimer and monomer were simulated separately in 9 M acetic acid (9 M AcOH) solution and water to study the denaturation process of PR in acetic acid environment. Direct visualization of the denaturation dynamics that is readily available from such simulations has been presented. Our simulations in 9 M AcOH reveal that the PR denaturation begins by separation of dimer into intact monomers and it is only after this separation that the monomer units start denaturing. The denaturation of the monomers is flagged off by the loss of crucial interactions between the α-helix at C-terminal and surrounding β-strands. This causes the structure to transit from the equilibrium dynamics to random non-equilibrating dynamics. Residence time calculations indicate that denaturation occurs via direct interaction of the acetic acid molecules with certain regions of the protein in 9 M AcOH. All these observations have helped to decipher a picture of the early events in acetic acid denaturation of PR and have illustrated that the α-helix and the β-sheet at the C-terminus of a native and functional PR dimer should maintain both the stability and the function of the enzyme and thus present newer targets for blocking PR function.

  10. Investigation of gel formation and volatilization of acetate acid in magnesium acetate droplets by the optical tweezers

    NASA Astrophysics Data System (ADS)

    Lv, Xi-Juan; Wang, Yang; Cai, Chen; Pang, Shu-Feng; Ma, Jia-Bi; Zhang, Yun-Hong

    2018-07-01

    Hygroscopicity and volatility of single magnesium acetate (MgAc2) aerosol particles at various relative humidities (RHs) are studied by a single-beam optical tweezers, and refractive indices (RIs) and morphology are characterized by cavity enhanced Raman spectroscopy. Gel formation and volatilization of acetate acid (HAc) in MgAc2 droplets are observed. Due to the formation of amorphous gel structure, water transposition in droplets at RH < 50% is significantly impeded on a time scale of 140,000 s. Different phase transition at RH < 10% is proposed to explain the distinct water loss after the gel formation. To compare volatilization of HAc in different systems, MgAc2 and sodium acetate (NaAc) droplets are maintained at several different stable RHs during up to 86,000 s. At RH ≈ 74%, magnesium hydroxide (Mg(OH)2) inclusions are formed in MgAc2 droplets due to the volatilization of HAc, and whispering gallery modes (WGMs) of MgAc2 droplets in the Raman spectrum quench after 50,000 s. In sharp contrast, after 86,000 s at RH ≈ 70%, NaAc droplets are in well-mixed liquid states, containing soluble sodium hydroxide (NaOH). At this state, the RI of NaAc droplet is increased, and the quenching of WGMs is not observable.

  11. Endogenous level of acetic acid in yellowfin tuna (Thunnus albacares): a pilot study about a possible controversy on its residue nature.

    PubMed

    Chiesa, Luca Maria; Pasquale, Elisa; Panseri, Sara; Britti, Domenico; Malandra, Renato; Villa, Roberto; Arioli, Francesco

    2017-03-01

    A method based on headspace solid-phase microextraction (HS-SPME) followed by GC-MS analysis was developed for the determination of underivatised acetic acid in fresh tuna fish muscle. Parameters such as the fibre selected and the extraction time and temperature were optimised and the linearity, detection limits and precision of the whole analytical procedure were assessed. The method was then applied to determine the acetic acid concentration in fresh yellowfin tuna muscles (Thunnus albacares) in order to evaluate the endogenous level and its variations during the shelf life under different storage conditions. A qualitative comparison was also made with variations in histamine levels to evaluate the possibility of the joint monitoring of acetic acid and histamine to identify fish stored in poor conditions. The caudal area always had a lower content of acetic acid than the ventral area, independent of the storage time and temperature. A difference was found between the 6- and 3-day time points and day 0 at a storage temperature of 8°C and between the 6-day time point and day 0 at a storage temperature of 0°C, independent of the anatomical area of the sampled tissue. The evaluation of acetic acid could represent an important approach in the field of food safety to detect the illicit use of acetic acid as an antibacterial preservative treatment or to eliminate the unpleasant smell of trimethylamine.

  12. Efficacy of acetate-amended biostimulation for uranium sequestration: Combined analysis of sediment/groundwater geochemistry and bacterial community structure

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xu, Jie; Veeramani, Harish; Qafoku, Nikolla P.

    Systematic flow-through column experiments were conducted using sediments and ground water collected from different subsurface localities at the U.S. Department of Energy's Integrated Field Research Challenge site in Rifle, Colorado. The principal purpose of this study is to gain a better understanding of the interactive effects of groundwater geochemistry, sediment mineralogy, and indigenous bacterial community structures on the efficacy of uranium removal from the groundwater with/without acetate amendment. Overall, we find that the subtle variations in the sediments' mineralogy, particle size, redox conditions, as well as contents of metal(loid) co-contaminants showed a pronounced effect on the associated bacterial population andmore » composition, which mainly determines the system's performance with respect to uranium removal. Positive relationship was identified between the abundance of dissimilatory sulfate-reduction genes (i.e., drsA), markers of sulfatereducing bacteria, and the sediments' propensity to sequester aqueous uranium. In contrast, no obvious connections were observed between the abundance of common iron-reducing bacteria, e.g., Geobacter spp., and the sediments' ability to sequester uranium. In the sediments with low bacterial biomass and the absence of sulfate-reducing conditions, abiotic adsorption onto mineral surfaces such as phyllosilicates likely played a relatively major role in the attenuation of aqueous uranium; however, in these scenarios, acetate amendment induced detectable rebounds in the effluent uranium concentrations. The results of this study suggest that reductive immobilization of uranium can be achieved under predominantly sulfate-reducing conditions, and provide insight into the integrated roles of various biogeochemical components in long-term uranium sequestration.« less

  13. Efficacy of acetate-amended biostimulation for uranium sequestration: Combined analysis of sediment/groundwater geochemistry and bacterial community structure

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xu, Jie; Veeramani, Harish; Qafoku, Nikolla P.

    Systematic flow-through column experiments were conducted using sediments and ground water collected from different subsurface localities at the U.S. Department of Energy’s Integrated Field Research Challenge site in Rifle, Colorado. The principal purpose of this study is to gain a better understanding of the interactive effects of groundwater geochemistry, sediment mineralogy, and indigenous bacterial community structures on the efficacy of uranium removal from the groundwater with/without acetate amendment. Overall, we find that the subtle variations in the sediments’ mineralogy, particle size, redox conditions, as well as contents of metal(loid) co-contaminants showed a pronounced effect on the associated bacterial population andmore » composition, which mainly determines the system’s performance with respect to uranium removal. Positive relationship was identified between the abundance of dissimilatory sulfate-reduction genes (i.e., drsA), markers of sulfate-reducing bacteria, and the sediments’ propensity to sequester aqueous uranium. In contrast, no obvious connections were observed between the abundance of common iron-reducing bacteria, e.g., Geobacter spp., and the sediments’ ability to sequester uranium. In the sediments with low bacterial biomass and the absence of sulfate-reducing conditions, abiotic adsorption onto mineral surfaces such as phyllosilicates likely played a relatively major role in the attenuation of aqueous uranium; however, in these scenarios, acetate amendment induced detectable rebounds in the effluent uranium concentrations. The results of this study suggest that reductive immobilization of uranium can be achieved under predominantly sulfate-reducing conditions, and provide insight into the integrated roles of various biogeochemical components in long-term uranium sequestration.« less

  14. Efficacy of acetate-amended biostimulation for uranium sequestration: Combined analysis of sediment/groundwater geochemistry and bacterial community structure

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xu, Jie; Veeramani, Harish; Qafoku, Nikolla P.

    Systematic flow-through column experiments were conducted using sediments and ground water collected from different subsurface localities at the U.S. Department of Energy's Integrated Field Research Challenge site in Rifle, Colorado. The principal purpose of this study is to gain a better understanding of the interactive effects of groundwater geochemistry, sediment mineralogy, and indigenous bacterial community structures on the efficacy of uranium removal from the groundwater with/without acetate amendment. Overall, we find that the subtle variations in the sediments' mineralogy, redox conditions, as well as contents of metal(loid) co-contaminants showed a pronounced effect on the associated bacterial population and composition, whichmore » mainly determines the system's performance with respect to uranium removal. Positive relationship was identified between the abundance of dissimilatory sulfate-reduction genes (i.e., drsA), markers of sulfate-reducing bacteria, and the sediments' propensity to sequester aqueous uranium. In contrast, no obvious connections were observed between the abundance of common iron-reducing bacteria, e.g., Geobacter spp., and the sediments' ability to sequester uranium. In the sediments with low bacterial biomass and the absence of sulfate-reducing conditions, abiotic adsorption onto mineral surfaces such as phyllosilicates likely played a relatively major role in the attenuation of aqueous uranium; however, in these scenarios, acetate amendment induced detectable rebounds in the effluent uranium concentrations. Lastly, the results of this study suggest that immobilization of uranium can be achieved under predominantly sulfate-reducing conditions, and provide insight into the integrated roles of various biogeochemical components in long-term uranium sequestration.« less

  15. Efficacy of acetate-amended biostimulation for uranium sequestration: Combined analysis of sediment/groundwater geochemistry and bacterial community structure

    DOE PAGES

    Xu, Jie; Veeramani, Harish; Qafoku, Nikolla P.; ...

    2016-12-29

    Systematic flow-through column experiments were conducted using sediments and ground water collected from different subsurface localities at the U.S. Department of Energy's Integrated Field Research Challenge site in Rifle, Colorado. The principal purpose of this study is to gain a better understanding of the interactive effects of groundwater geochemistry, sediment mineralogy, and indigenous bacterial community structures on the efficacy of uranium removal from the groundwater with/without acetate amendment. Overall, we find that the subtle variations in the sediments' mineralogy, redox conditions, as well as contents of metal(loid) co-contaminants showed a pronounced effect on the associated bacterial population and composition, whichmore » mainly determines the system's performance with respect to uranium removal. Positive relationship was identified between the abundance of dissimilatory sulfate-reduction genes (i.e., drsA), markers of sulfate-reducing bacteria, and the sediments' propensity to sequester aqueous uranium. In contrast, no obvious connections were observed between the abundance of common iron-reducing bacteria, e.g., Geobacter spp., and the sediments' ability to sequester uranium. In the sediments with low bacterial biomass and the absence of sulfate-reducing conditions, abiotic adsorption onto mineral surfaces such as phyllosilicates likely played a relatively major role in the attenuation of aqueous uranium; however, in these scenarios, acetate amendment induced detectable rebounds in the effluent uranium concentrations. Lastly, the results of this study suggest that immobilization of uranium can be achieved under predominantly sulfate-reducing conditions, and provide insight into the integrated roles of various biogeochemical components in long-term uranium sequestration.« less

  16. Metabolic pathway engineering based on metabolomics confers acetic and formic acid tolerance to a recombinant xylose-fermenting strain of Saccharomyces cerevisiae

    PubMed Central

    2011-01-01

    Background The development of novel yeast strains with increased tolerance toward inhibitors in lignocellulosic hydrolysates is highly desirable for the production of bio-ethanol. Weak organic acids such as acetic and formic acids are necessarily released during the pretreatment (i.e. solubilization and hydrolysis) of lignocelluloses, which negatively affect microbial growth and ethanol production. However, since the mode of toxicity is complicated, genetic engineering strategies addressing yeast tolerance to weak organic acids have been rare. Thus, enhanced basic research is expected to identify target genes for improved weak acid tolerance. Results In this study, the effect of acetic acid on xylose fermentation was analyzed by examining metabolite profiles in a recombinant xylose-fermenting strain of Saccharomyces cerevisiae. Metabolome analysis revealed that metabolites involved in the non-oxidative pentose phosphate pathway (PPP) [e.g. sedoheptulose-7-phosphate, ribulose-5-phosphate, ribose-5-phosphate and erythrose-4-phosphate] were significantly accumulated by the addition of acetate, indicating the possibility that acetic acid slows down the flux of the pathway. Accordingly, a gene encoding a PPP-related enzyme, transaldolase or transketolase, was overexpressed in the xylose-fermenting yeast, which successfully conferred increased ethanol productivity in the presence of acetic and formic acid. Conclusions Our metabolomic approach revealed one of the molecular events underlying the response to acetic acid and focuses attention on the non-oxidative PPP as a target for metabolic engineering. An important challenge for metabolic engineering is identification of gene targets that have material importance. This study has demonstrated that metabolomics is a powerful tool to develop rational strategies to confer tolerance to stress through genetic engineering. PMID:21219616

  17. Modeling the effects of sodium chloride, acetic acid, and intracellular pH on survival of Escherichia coli O157:H7.

    PubMed

    Hosein, Althea M; Breidt, Frederick; Smith, Charles E

    2011-02-01

    Microbiological safety has been a critical issue for acid and acidified foods since it became clear that acid-tolerant pathogens such as Escherichia coli O157:H7 can survive (even though they are unable to grow) in a pH range of 3 to 4, which is typical for these classes of food products. The primary antimicrobial compounds in these products are acetic acid and NaCl, which can alter the intracellular physiology of E. coli O157:H7, leading to cell death. For combinations of acetic acid and NaCl at pH 3.2 (a pH value typical for non-heat-processed acidified vegetables), survival curves were described by using a Weibull model. The data revealed a protective effect of NaCl concentration on cell survival for selected acetic acid concentrations. The intracellular pH of an E. coli O157:H7 strain exposed to acetic acid concentrations of up to 40 mM and NaCl concentrations between 2 and 4% was determined. A reduction in the intracellular pH was observed for increasing acetic acid concentrations with an external pH of 3.2. Comparing intracellular pH with Weibull model predictions showed that decreases in intracellular pH were significantly correlated with the corresponding times required to achieve a 5-log reduction in the number of bacteria.

  18. Antibacterial Activity of the Isolation Ethyl Acetate-Soluble Extract Noni Fruit (Morindra citrifolia L.) against Meat Bacterial Decay

    NASA Astrophysics Data System (ADS)

    Nugraheni, E. R.; Nurrakhman, M. B. E.; Munawaroh, H.; Saputri, L.

    2017-02-01

    Noni (Morindra citrifolia L.) is native to Indonesia which have medicinal properties. One of them as an antibacterial. This study aims to determine the antibacterial activity of isolates from the ethanol extract noni fruit to bacterial decay meat is Bacillus licheniformis, Klebsiella pneumonia, Bacillus alvei, Acinetobacter calcoaceticus, and Staphylococcus saprophyticus. The extraction process using the maceration method, and then made a partition by centrifugation ethyl acetate. Soluble part partition showed bacterial growth inhibition activity of the strong to very strong. Furthermore, the ethyl acetate soluble partition on preparative thin layer chromatography produced 5 isolates. Isolates obtained antibacterial activity test performed with a concentration of 20% and 30%. The results of antibacterial test against bacteria test isolates, showing isolates A can not inhibit the growth of bacteria, isolates B and C have medium activity and strong, isolates D and E isolates have activity against bacteria that were tested. MIC and MBC test results showed that the isolates B gives an inhibitory effect (bacteriostatic) against all bacteria. Content analysis of compounds by TLC using the reagents cerium (IV) sulfate indicates a phenol group. Isolates B contains a major compound which can be used as an antibacterial candidate in food preservation replace chemical preservatives.

  19. Spectrophotometric determination of [2-(2,6-dichloro-phenylamino)-phenyl]-acetic acid in pure form and in pharmaceuticals

    NASA Astrophysics Data System (ADS)

    Bazel, Yaroslav; Hunka, Iryna; Kormosh, Zholt; Andruch, Vasil

    2009-12-01

    A new sensitive and selective spectrophotometric method has been developed for the determination of [2-(2,6-dichloro-phenylamino)-phenyl]-acetic acid in pharmaceuticals in the presence of nicotinic acid. The method is based on the reaction of [2-(2,6-dichloro-phenylamino)-phenyl]-acetic acid with 1,3,3-trimethyl-5-phenyl-2-[3-(1,3,3-trimethyl-1,3-dihydro-indol-2-ylidene)-propenyl]-3 H-indolium chloride (PIC) followed by the extraction of the formed ion associate into toluene and spectrophotometric detection at 581 nm. Appropriate experimental conditions were found to be pH 7.8-9.8 and 3.6 × 10 -4 mol L -1 of PIC. The molar absorptivity is 5.0 × 10 -4 L mol -1 cm -1. The absorbance obeys Beer's law in the range 0.61-12.60 μg mL -1 of [2-(2,6-dichloro-phenylamino)-phenyl]-acetic acid, and the detection limit calculated from a blank test was 0.20 μg mL -1.

  20. Adaptive laboratory evolution of ethanologenic Zymomonas mobilis strain tolerant to furfural and acetic acid inhibitors.

    PubMed

    Shui, Zong-Xia; Qin, Han; Wu, Bo; Ruan, Zhi-yong; Wang, Lu-shang; Tan, Fu-Rong; Wang, Jing-Li; Tang, Xiao-Yu; Dai, Li-Chun; Hu, Guo-Quan; He, Ming-Xiong

    2015-07-01

    Furfural and acetic acid from lignocellulosic hydrolysates are the prevalent inhibitors to Zymomonas mobilis during cellulosic ethanol production. Developing a strain tolerant to furfural or acetic acid inhibitors is difficul by using rational engineering strategies due to poor understanding of their underlying molecular mechanisms. In this study, strategy of adaptive laboratory evolution (ALE) was used for development of a furfural and acetic acid-tolerant strain. After three round evolution, four evolved mutants (ZMA7-2, ZMA7-3, ZMF3-2, and ZMF3-3) that showed higher growth capacity were successfully obtained via ALE method. Based on the results of profiling of cell growth, glucose utilization, ethanol yield, and activity of key enzymes, two desired strains, ZMA7-2 and ZMF3-3, were achieved, which showed higher tolerance under 7 g/l acetic acid and 3 g/l furfural stress condition. Especially, it is the first report of Z. mobilis strain that could tolerate higher furfural. The best strain, Z. mobilis ZMF3-3, has showed 94.84% theoretical ethanol yield under 3-g/l furfural stress condition, and the theoretical ethanol yield of ZM4 is only 9.89%. Our study also demonstrated that ALE method might also be used as a powerful metabolic engineering tool for metabolic engineering in Z. mobilis. Furthermore, the two best strains could be used as novel host for further metabolic engineering in cellulosic ethanol or future biorefinery. Importantly, the two strains may also be used as novel-tolerant model organisms for the genetic mechanism on the "omics" level, which will provide some useful information for inverse metabolic engineering.

  1. Absence of Rtt109p, a fungal-specific histone acetyltransferase, results in improved acetic acid tolerance of Saccharomyces cerevisiae.

    PubMed

    Cheng, Cheng; Zhao, Xinqing; Zhang, Mingming; Bai, Fengwu

    2016-03-01

    RTT109 is a histone acetyltransferase for the acetylation of histone H3. It is still not clear whether RTT109 plays a role in regulation of gene expression under environmental stresses. In this study, the involvement of RTT109 in acetic acid stress tolerance of Saccharomyces cerevisiae was investigated. It was revealed that the absence of RTT109 enhanced resistance to 5.5 g L(-1) acetic acid, which was indicated by improved growth of RTT109Δ mutant compared with that of the wild-type BY4741 strain. Meanwhile, the lag phase was shortened for 48 h and glucose consumption completed 36 h in advance for RTT109Δ mutant compared to the wild-type strain, with ethanol production rate increased from 0.39 to 0.60 g L(-1) h(-1). Significantly, elevated transcription levels of HSP12, CTT1 and GSH1, as well as increased activities of antioxidant enzymes were observed in RTT109Δ under acetic acid stress. Improved flocculation of RTT109Δ compared to that of the control strain BY4741 under the acetic acid stress was also observed. These results suggest that the absence of RTT109 not only activates transcription of stress responsive genes, but also improves resistance to oxidative stress, which ultimately contributes to improved acetic acid tolerance in S. cerevisiae. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  2. Effect of surface oxygen vacancy sites on ethanol synthesis from acetic acid hydrogenation on a defective In2O3(110) surface.

    PubMed

    Lyu, Huisheng; Liu, Jiatao; Chen, Yifei; Li, Guiming; Jiang, Haoxi; Zhang, Minhua

    2018-03-07

    Developing a new type of low-cost and high-efficiency non-noble metal catalyst is beneficial for industrially massive synthesis of alcohols from carboxylic acids which can be obtained from renewable biomass. In this work, the effect of active oxygen vacancies on ethanol synthesis from acetic acid hydrogenation over defective In 2 O 3 (110) surfaces has been studied using periodic density functional theory (DFT) calculations. The relative stabilities of six surface oxygen vacancies from O v1 to O v6 on the In 2 O 3 (110) surface were compared. D1 and D4 surfaces with respective O v1 and O v4 oxygen vacancies were chosen to map out the reaction paths from acetic acid to ethanol. A reaction cycle mechanism between the perfect and defective states of the In 2 O 3 surface was found to catalyze the formation of ethanol from acetic acid hydrogenation. By H 2 reduction the oxygen vacancies on the In 2 O 3 surface play key roles in promoting CH 3 COO* hydrogenation and C-O bond breaking in acetic acid hydrogenation. The acetic acid, in turn, benefits the creation of oxygen vacancies, while the C-O bond breaking of acetic acid refills the oxygen vacancy and, thereby, sustains the catalytic cycle. The In 2 O 3 based catalysts were shown to be advantageous over traditional noble metal catalysts in this paper by theoretical analysis.

  3. Improving the environmental profile of wood panels via co-production of ethanol and acetic acid.

    PubMed

    Earles, J Mason; Halog, Anthony; Shaler, Stephen

    2011-11-15

    The oriented strand board (OSB) biorefinery is an emerging technology that could improve the building, transportation, and chemical sectors' environmental profiles. By adding a hot water extraction stage to conventional OSB panel manufacturing, hemicellulose polysaccharides can be extracted from wood strands and converted to renewably sourced ethanol and acetic acid. Replacing fossil-based gasoline and acetic acid has the potential to reduce greenhouse gas (GHG) emissions, among other possible impacts. At the same time, hemicellulose extraction could improve the environmental profile of OSB panels by reducing the level of volatile organic compounds (VOCs) emitted during manufacturing. In this study, the life cycle significance of such GHG, VOC, and other emission reductions was investigated. A process model was developed based on a mix of laboratory and industrial-level mass and energy flow data. Using these data a life cycle assessment (LCA) model was built. Sensitive process parameters were identified and used to develop a target production scenario for the OSB biorefinery. The findings suggest that the OSB biorefinery's deployment could substantially improve human and ecosystem health via reduction of select VOCs compared to conventionally produced OSB, gasoline, and acetic acid. Technological advancements are needed, however, to achieve desirable GHG reductions.

  4. [Improvement of acetic acid tolerance and fermentation performance of industrial Saccharomyces cerevisiae by overexpression of flocculent gene FLO1 and FLO1c].

    PubMed

    Du, Zhaoli; Cheng, Yanfei; Zhu, Hui; He, Xiuping; Zhang, Borun

    2015-02-01

    Flocculent gene FLO1 and its truncated form FLO1c with complete deletion of repeat unit C were expressed in a non-flocculent industrial strain Saccharomyces cerevisiae CE6 to generate recombinant flocculent strains 6-AF1 and 6-AF1c respectively. Both strains of 6-AF1 and 6-AF1c displayed strong flocculation and better cell growth than the control strain CE6-V carrying the empty vector under acetic acid stress. Moreover, the flocculent strains converted glucose to ethanol at much higher rates than the control strain CE6-V under acetic acid stress. In the presence of 0.6% (V/V) acetic acid, the average ethanol production rates of 6-AF1 and 6-AF1c were 1.56 and 1.62 times of that of strain CE6-V, while the ethanol production rates of 6-AF1 and 6-AF1c were 1.21 and 1.78 times of that of strain CE6-V under 1.0% acetic acid stress. Results in this study indicate that acetic acid tolerance and fermentation performance of industrial S. cerevisiae under acetic acid stress can be improved largely by flocculation endowed by expression of flocculent genes, especially FLO1c.

  5. Strain typing of acetic acid bacteria responsible for vinegar production by the submerged elaboration method.

    PubMed

    Fernández-Pérez, Rocío; Torres, Carmen; Sanz, Susana; Ruiz-Larrea, Fernanda

    2010-12-01

    Strain typing of 103 acetic acid bacteria isolates from vinegars elaborated by the submerged method from ciders, wines and spirit ethanol, was carried on in this study. Two different molecular methods were utilised: pulsed field gel electrophoresis (PFGE) of total DNA digests with a number of restriction enzymes, and enterobacterial repetitive intergenic consensus (ERIC) - PCR analysis. The comparative study of both methods showed that restriction fragment PFGE of SpeI digests of total DNA was a suitable method for strain typing and for determining which strains were present in vinegar fermentations. Results showed that strains of the species Gluconacetobacter europaeus were the most frequent leader strains of fermentations by the submerged method in the studied vinegars, and among them strain R1 was the predominant one. Results showed as well that mixed populations (at least two different strains) occurred in vinegars from cider and wine, whereas unique strains were found in spirit vinegars, which offered the most stressing conditions for bacterial growth. Copyright © 2010 Elsevier Ltd. All rights reserved.

  6. Development of a new lactic acid bacterial inoculant for fresh rice straw silage.

    PubMed

    Kim, Jong Geun; Ham, Jun Sang; Li, Yu Wei; Park, Hyung Soo; Huh, Chul-Sung; Park, Byung-Chul

    2017-07-01

    Effects of newly isolated Lactobacillus plantarum on the fermentation and chemical composition of fresh rice straw silage was evaluated in this study. Lactic acid bacteria (LAB) from good crop silage were screened by growing them in MRS broth and a minimal medium with low carbohydrate content. Selected LAB (LAB 1821) were Gram-positive, rods, catalase negative, and were identified to be Lactobacillus plantarum based on their biochemical characteristics and a 16S rRNA analysis. Fresh rice straw was ensiled with two isolated LAB (1821 and 1841), two commercial inoculants (HM/F and P1132) and no additive as a control. After 2 months of storage at ambient temperature, rice straw silages treated with additives were well-preserved, the pH values and butyric and acetic acid contents were lower, and the lactic acid content and lactic/acetic acid ratio were higher than those in the control (p<0.05). Acidity (pH) was lowest, and lactic acid highest, in 1821-treated silage (p<0.05). The NH 3 -N content decreased significantly in inoculant-treated silage (p<0.05) and the NH 3 -N content in 1821-treated silage was lowest among the treatments. The dry matter (DM) content of the control silage was lower than that of fresh rice straw (p<0.05), while that of the 1841- and p1174-inoculant-treated silages was significantly higher than that of HM/F-treated silage. Microbial additives did not have any significant (p>0.05) effect on acid detergent fiber or neutral detergent fiber contents. Crude protein (CP) content and in vitro DM digestibility (IVDMD) increased after inoculation of LAB 1821 (p<0.05). LAB 1821 increased the CP, IVDMD, lactic acid content and ratio of lactic acid to acetic acid in rice straw silage and decreased the pH, acetic acid, NH 3 -N, and butyric acid contents. Therefore, adding LAB 1821 improved the fermentation quality and feed value of rice straw silage.

  7. Inhibition effect of Arabic gum and cellulose acetate coatings on aluminium in acid/base media

    NASA Astrophysics Data System (ADS)

    Alva, S.; Sundari, R.; Rahmatullah, A.; Wahyudi, H.

    2018-03-01

    Nowadays aluminium is broadly used for battery purpose due to its conductivity, non toxic and economic reasons. Arabic gum and cellulose acetate are used as potential inhibitors to hinder corrosion effect on aluminium plate immersed in a solution of hydrochloric acid or sodium hydroxide. This investigation has studied the corrosion rate in terms of different concentrations of acid or base media. The average inhibition efficiency in the interested concentration range of both HCl and NaOH (0.1 M – 3.0 M) for 1 × 1 cm2 aluminium (Al) plate coated by 20% Arabic gum (AG) and 5% cellulose acetate (CA) with each thickness of 0.5 mm is found to be higher than 90%. The electrochemical behavior of corrosion effect is examined by cyclic voltammetric performance with respect to HCl or NaOH media. This investigation is useful especially for the study of Arabic gum and cellulose acetate utilized as polymer inhibitor in strong corrosive media.

  8. High Acetic Acid Production Rate Obtained by Microbial Electrosynthesis from Carbon Dioxide.

    PubMed

    Jourdin, Ludovic; Grieger, Timothy; Monetti, Juliette; Flexer, Victoria; Freguia, Stefano; Lu, Yang; Chen, Jun; Romano, Mark; Wallace, Gordon G; Keller, Jurg

    2015-11-17

    High product specificity and production rate are regarded as key success parameters for large-scale applicability of a (bio)chemical reaction technology. Here, we report a significant performance enhancement in acetate formation from CO2, reaching comparable productivity levels as in industrial fermentation processes (volumetric production rate and product yield). A biocathode current density of -102 ± 1 A m(-2) and an acetic acid production rate of 685 ± 30 (g m(-2) day(-1)) have been achieved in this study. High recoveries of 94 ± 2% of the CO2 supplied as the sole carbon source and 100 ± 4% of electrons into the final product (acetic acid) were achieved after development of a mature biofilm, reaching an elevated product titer of up to 11 g L(-1). This high product specificity is remarkable for mixed microbial cultures, which would make the product downstream processing easier and the technology more attractive. This performance enhancement was enabled through the combination of a well-acclimatized and enriched microbial culture (very fast start-up after culture transfer), coupled with the use of a newly synthesized electrode material, EPD-3D. The throwing power of the electrophoretic deposition technique, a method suitable for large-scale production, was harnessed to form multiwalled carbon nanotube coatings onto reticulated vitreous carbon to generate a hierarchical porous structure.

  9. Novel wine yeast with mutations in YAP1 that produce less acetic acid during fermentation.

    PubMed

    Cordente, Antonio G; Cordero-Bueso, Gustavo; Pretorius, Isak S; Curtin, Christopher D

    2013-02-01

    Acetic acid, a byproduct formed during yeast alcoholic fermentation, is the main component of volatile acidity (VA). When present in high concentrations in wine, acetic acid imparts an undesirable 'vinegary' character that results in a significant reduction in quality and sales. Previously, it has been shown that saké yeast strains resistant to the antifungal cerulenin produce significantly lower levels of VA. In this study, we used a classical mutagenesis method to isolate a series of cerulenin-resistant strains, derived from a commercial diploid wine yeast. Four of the selected strains showed a consistent low-VA production phenotype after small-scale fermentation of different white and red grape musts. Specific mutations in YAP1, a gene encoding a transcription factor required for oxidative stress tolerance, were found in three of the four low-VA strains. When integrated into the genome of a haploid wine strain, the mutated YAP1 alleles partially reproduced the low-VA production phenotype of the diploid cerulenin-resistant strains, suggesting that YAP1 might play a role in (regulating) acetic acid production during fermentation. This study offers prospects for the development of low-VA wine yeast starter strains that could assist winemakers in their effort to consistently produce wine to definable quality specifications. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  10. Effects of alternative energy sources on bacterial cellulose characteristics produced by Komagataeibacter medellinensis.

    PubMed

    Molina-Ramírez, Carlos; Enciso, Carla; Torres-Taborda, Mabel; Zuluaga, Robin; Gañán, Piedad; Rojas, Orlando J; Castro, Cristina

    2018-05-27

    Bacterial cellulose (BC) was produced by Komagataeibacter medellinensis using Hestrin and Schramm modified medium in the presence of alternative energy sources (AES), such as ethanol and acetic acid, to explore the effect of AES on the characteristics and properties of the resulting BC. In this study, the physicochemical and structural characteristics of the obtained BC were determined using Fourier-transform infrared spectroscopy, X-ray diffraction spectrometry, thermogravimetric analysis, and mechanical testing analysis. Ethanol and acetic acid (at 0.1 wt%) were proven to improve the BC yield by K. medellinensis by 279% and 222%, respectively. However, the crystallinity index (%), the degree of polymerization, and maximum rate of degradation temperatures decreased by 9.2%, 36%, and 4.96%, respectively, by the addition of ethanol and by 7.2%, 27%, and 4.21%, respectively, by the addition of acetic acid. The significance of this work, lies on the fact that there is not any report about how BC properties change when substances like ethanol or acetic acid are added to culture medium, and which is the mechanism that provokes those changes, that in our case we could demonstrate the relationship of a higher BC production rate (provoked by ethanol and acetic acid adding) and changes in BC properties. Copyright © 2018 Elsevier B.V. All rights reserved.

  11. Improved Butanol-Methanol (BUME) Method by Replacing Acetic Acid for Lipid Extraction of Biological Samples.

    PubMed

    Cruz, Mutya; Wang, Miao; Frisch-Daiello, Jessica; Han, Xianlin

    2016-07-01

    Extraction of lipids from biological samples is a critical step in lipidomics, especially for shotgun lipidomics where lipid extracts are directly infused into a mass spectrometer. The butanol-methanol (BUME) extraction method was originally developed to extract lipids from plasma samples with 1 % acetic acid. Considering some lipids are sensitive to acidic environments, we modified this protocol by replacing acetic acid with lithium chloride solution and extended the modified extraction to tissue samples. Although no significant reduction of plasmalogen levels in the acidic BUME extracts of rat heart samples was found, the modified method was established to extract various tissue samples, including rat liver, heart, and plasma. Essentially identical profiles of the majority of lipid classes were obtained from the extracts of the modified BUME and traditional Bligh-Dyer methods. However, it was found that neither the original, nor the modified BUME method was suitable for 4-hydroxyalkenal species measurement in biological samples.

  12. Improved Butanol-Methanol (BUME) Method by Replacing Acetic Acid for Lipid Extraction of Biological Samples

    PubMed Central

    Cruz, Mutya; Wang, Miao; Frisch-Daiello, Jessica; Han, Xianlin

    2016-01-01

    Extraction of lipids from biological samples is a critical step in lipidomics, especially for shotgun lipidomics where lipid extracts are directly infused into a mass spectrometer. The butanol-methanol (BUME) extraction method was originally developed to extract lipids from plasma samples with 1% acetic acid. Considering some lipids are sensitive to acidic environments, we modified this protocol by replacing acetic acid with lithium chloride solution and extended the modified extraction to tissue samples. Although no significant reduction of plasmalogen levels in the acidic BUME extracts of rat heart samples was found, the modified method was established to extract various tissue samples, including rat liver, heart, and plasma. Essentially identical profiles of the majority of lipid classes were obtained from the extracts of the modified BUME and traditional Bligh-Dyer methods. However, it was found that neither the original, nor the modified BUME method was suitable for 4-hydroxyalkenal species measurement in biological samples. PMID:27245345

  13. Effect of royal jelly on experimental colitis induced by acetic acid and alteration of mast cell distribution in the colon of rats

    PubMed Central

    Karaca, T.; Bayiroglu, F.; Yoruk, M.; Kaya, M.S.; Uslu, S.; Comba, B.; Mis, L.

    2010-01-01

    This study investigated the effects of royal jelly (RJ) on acetic acid-induced colitis in rats. Twenty adult female Wistar albino rats were divided into four treatment groups of 5 animals each, including a control group (Group I); Group II was treated orally with RJ (150 mg kg−1 body weight); Group III had acetic acid-induced colitis; and Group IV had acetic acid-induced colitis treated orally with RJ (150 mg kg−1 body weight) for 4 weeks. Colitis was induced by intracolonic instillation of 4% acetic acid; the control group received physiological saline (10 mL kg−1). Colon samples were obtained under deep anaesthesia from animals in all groups. Tissues were fixed in 10% formalin neutral buffer solution for 24 h and embedded in paraffin. Six-micrometre-thick sections were stained with Mallory’s triple stain and toluidine blue in 1% aqueous solution at pH 1.0 for 5 min (for Mast Cells). RJ was shown to protect the colonic mucosa against the injurious effect of acetic acid. Colitis (colonic damage) was confirmed histomorphometrically as significant increases in the number of mast cells (MC) and colonic erosions in rats with acetic acid-induced colitis. The RJ treatment significantly decreased the number of MC and reduced the area of colonic erosion in the colon of RJ-treated rats compared with rats with untreated colitis. The results suggest that oral treatment with RJ could be used to treat colitis. PMID:21263740

  14. An on-line potentiometric sequential injection titration process analyser for the determination of acetic acid.

    PubMed

    van Staden, J F; Mashamba, Mulalo G; Stefan, Raluca I

    2002-09-01

    An on-line potentiometric sequential injection titration process analyser for the determination of acetic acid is proposed. A solution of 0.1 mol L(-1) sodium chloride is used as carrier. Titration is achieved by aspirating acetic acid samples between two strong base-zone volumes into a holding coil and by channelling the stack of well-defined zones with flow reversal through a reaction coil to a potentiometric sensor where the peak widths were measured. A linear relationship between peak width and logarithm of the acid concentration was obtained in the range 1-9 g/100 mL. Vinegar samples were analysed without any sample pre-treatment. The method has a relative standard deviation of 0.4% with a sample frequency of 28 samples per hour. The results revealed good agreement between the proposed sequential injection and an automated batch titration method.

  15. Investigation of gel formation and volatilization of acetate acid in magnesium acetate droplets by the optical tweezers.

    PubMed

    Lv, Xi-Juan; Wang, Yang; Cai, Chen; Pang, Shu-Feng; Ma, Jia-Bi; Zhang, Yun-Hong

    2018-07-05

    Hygroscopicity and volatility of single magnesium acetate (MgAc 2 ) aerosol particles at various relative humidities (RHs) are studied by a single-beam optical tweezers, and refractive indices (RIs) and morphology are characterized by cavity enhanced Raman spectroscopy. Gel formation and volatilization of acetate acid (HAc) in MgAc 2 droplets are observed. Due to the formation of amorphous gel structure, water transposition in droplets at RH < 50% is significantly impeded on a time scale of 140,000 s. Different phase transition at RH < 10% is proposed to explain the distinct water loss after the gel formation. To compare volatilization of HAc in different systems, MgAc 2 and sodium acetate (NaAc) droplets are maintained at several different stable RHs during up to 86,000 s. At RH ≈ 74%, magnesium hydroxide (Mg(OH) 2 ) inclusions are formed in MgAc 2 droplets due to the volatilization of HAc, and whispering gallery modes (WGMs) of MgAc 2 droplets in the Raman spectrum quench after 50,000 s. In sharp contrast, after 86,000 s at RH ≈ 70%, NaAc droplets are in well-mixed liquid states, containing soluble sodium hydroxide (NaOH). At this state, the RI of NaAc droplet is increased, and the quenching of WGMs is not observable. Copyright © 2018 Elsevier B.V. All rights reserved.

  16. Short-term adaptation improves the fermentation performance of Saccharomyces cerevisiae in the presence of acetic acid at low pH.

    PubMed

    Sànchez i Nogué, Violeta; Narayanan, Venkatachalam; Gorwa-Grauslund, Marie F

    2013-08-01

    The release of acetic acid due to deacetylation of the hemicellulose fraction during the treatment of lignocellulosic biomass contributes to the inhibitory character of the generated hydrolysates. In the present study, we identified a strain-independent adaptation protocol consisting of pre-cultivating the strain at pH 5.0 in the presence of at least 4 g L⁻¹ acetic acid that enabled aerobic growth and improved fermentation performance of Saccharomyces cerevisiae cells at low pH (3.7) and in the presence of inhibitory levels of acetic acid (6 g L⁻¹). During anaerobic cultivation with adapted cells of strain TMB3500, the specific ethanol production rate was increased, reducing the fermentation time to 48 %.

  17. The Urine Preservative Acetic Acid Degrades Urine Protein: Implications for Urine Biorepositories and the AASK Cohort Study.

    PubMed

    Almaani, Salem; Hebert, Lee A; Rovin, Brad H; Birmingham, Daniel J

    2017-05-01

    Patients enrolled in the African American Study of Kidney Disease and Hypertension (AASK) Cohort Study who exhibited overt proteinuria have been reported to show high nonalbumin proteinuria (NAP), which is characteristic of a tubulopathy. To determine whether African American Study of Kidney Disease and Hypertension nephropathy (AASK-N) is a tubulopathy, we obtained urine samples of 37 patients with AASK-N, with 24-hour protein-to-creatinine ratios (milligrams per milligram) ranging from 0.2 to 1.0, from the National Institute of Diabetes and Digestive Kidney Diseases repository and tested for seven markers of tubular proteinuria. By protocol, each sample had been collected in acetic acid (0.5%; mean final concentration). Compared with samples from patients with lupus nephritis or healthy black controls, AASK-N samples had lower amounts of six markers. Four markers (albumin, β -2-microglobulin, cystatin C, and osteopontin) were undetectable in most AASK-N samples. Examination by SDS-PAGE followed by protein staining revealed protein profiles indicative of severe protein degradation in 34 of 37 AASK-N urine samples. Treatment of lupus nephritis urine samples with 0.5% acetic acid produced the same protein degradation profile as that of AASK-N urine. We conclude that the increased NAP in AASK-N is an artifact of acetic acid-mediated degradation of albumin. The AASK-N repository urine samples have been compromised by the acetic acid preservative. Copyright © 2017 by the American Society of Nephrology.

  18. Immunolocalization of endogenous indole-3-acetic acid and abscisic acid in the shoot internodes of Fargesia yunnanensis bamboo during development

    Treesearch

    Shuguang Wang; Yongpeng Ma; Chengbin Wan; Chungyun Hse; Todd F. Shupe; Yujun Wang; Changming Wang

    2016-01-01

    The Bambusoideae subfamily includes the fastest-growing plants worldwide, as a consequence of fast internode elongation. However, few studies have evaluated the temporal and spatial distribution of endogenous hormones during internode elongation. In this paper, endogenous indole-3-acetic acid (IAA) and abscisic acid (ABA) were detected in different developmental...

  19. Membrane lipid physiology and toxin catabolism underlie ethanol and acetic acid tolerance in Drosophila melanogaster.

    PubMed

    Montooth, Kristi L; Siebenthall, Kyle T; Clark, Andrew G

    2006-10-01

    Drosophila melanogaster has evolved the ability to tolerate and utilize high levels of ethanol and acetic acid encountered in its rotting-fruit niche. Investigation of this phenomenon has focused on ethanol catabolism, particularly by the enzyme alcohol dehydrogenase. Here we report that survival under ethanol and acetic acid stress in D. melanogaster from high- and low-latitude populations is an integrated consequence of toxin catabolism and alteration of physical properties of cellular membranes by ethanol. Metabolic detoxification contributed to differences in ethanol tolerance between populations and acclimation temperatures via changes in both alcohol dehydrogenase and acetyl-CoA synthetase mRNA expression and enzyme activity. Independent of changes in ethanol catabolism, rapid thermal shifts that change membrane fluidity had dramatic effects on ethanol tolerance. Cold temperature treatments upregulated phospholipid metabolism genes and enhanced acetic acid tolerance, consistent with the predicted effects of restoring membrane fluidity. Phospholipase D was expressed at high levels in all treatments that conferred enhanced ethanol tolerance, suggesting that this lipid-mediated signaling enzyme may enhance tolerance by sequestering ethanol in membranes as phophatidylethanol. These results reveal new candidate genes underlying toxin tolerance and membrane adaptation to temperature in Drosophila and provide insight into how interactions between these phenotypes may underlie the maintenance of latitudinal clines in ethanol tolerance.

  20. Anaerobic microbial dissolution of lead and production of organic acids

    DOEpatents

    Francis, A.J.; Dodge, C.; Chendrayan, K.; Quinby, H.L.

    1987-04-16

    The present invention related to an anaerobic bacterial culture of Clostridium sp. ATCC No. 53464 which solubilizes lead oxide under anaerobic conditions in coal and industrial wastes and therefore presents a method of removing lead from such wastes before they are dumped into the environment. The rat of lead dissolution during logarithmic growth of the bacteria in 40 ml medium containing 3.32 ..mu..moles of lead as lead oxide was 0.042 ..mu..moles m1/sup /-/1/ hr/sup /-/1/. Dissolution of lead oxide by the bacterial isolate is due to the production of metabolites and acidity in the culture medium. The major metabolites are acetic, butyric and lactic acid. The major metabolites are acetic, butyric and lactic acid. Clostridium sp. ATCC No. 53464 can be used in the recovery of the strategic metals from ores and wastes and also for the production of lactic acid for commercial purposes. The process yields large quantities of lactic acid as well as lead complexed in a stable form with said acids. 4 figs., 3 tabs.

  1. Study on Esterification Reaction of Starch Isolated from Cassava (Manihot esculeta) with Acetic Acid and Isopropyl Myrtistate Using Ultrasonicator

    NASA Astrophysics Data System (ADS)

    Wika Amini, Helda; Masruri; Mariyah Ulfa, Siti

    2018-01-01

    Cassava starch is a polysaccharide consists of amylose and amylopectin. This research was purposed to modify the starch isolated from local cassava (Manihot esculenta). Modification was undertaken to study the esterification reaction of cassava starch with acetic acid and with isopropyl myristate. Moreover, morphology observation was also conducted both for original starch and its modification yields. It was found that cassava’s starch was isolated in 16.4% yield as a white powder. Esterification on the starch provided DS value 0.549 for ratio 1:2 of starch-acetic acid. It gave DS value 0.356 for ratio 1:3 of starch-isopropyl myristate. Treatment by ultrasonication from 0 to 60 minutes was significantly improved the DS value to 0.549 for starch-acetic acid. But it gave DS value to 0.413 for 30 minute ultrasonication of starch-isopropyl myristate. In addition, morphology of the starch observed by microscope gave different features with starch ester acetate and starch ester myristate. The original starch consists of granules, but starch ester acetate indicates a non-granules shape (amorf solid). Moreover for starch ester myristate shows a rather bigger size of granules, and all of the granules afforded were round and oval.

  2. Visual inspection of cervix with acetic acid: a good alternative to pap smear for cervical cancer screening in resource-limited setting.

    PubMed

    Khan, Momna; Sultana, Syeda Seema; Jabeen, Nigar; Arain, Uzma; Khans, Salma

    2015-02-01

    To determine the diagnostic accuracy of visual inspection of cervix using 3% acetic acid as a screening test for early detection of cervical cancer taking histopathology as the gold standard. The cross-sectional study was conducted at Civil Hospital Karachi from July 1 to December 31, 2012 and comprised all sexually active women aged 19-60 years. During speculum examination 3% acetic acid was applied over the cervix with the help of cotton swab. The observations were noted as positive or negative on visual inspection of the cervix after acetic acid application according to acetowhite changes. Colposcopy-guided cervical biopsy was done in patients with positive or abnormal looking cervix. Colposcopic-directed biopsy was taken as the gold standard to assess visual inspection readings. SPSS 17 was used for statistical analysis. There were 500 subjects with a mean age of 35.74 ± 9.64 years. Sensitivity, specifically, positive predicted value, negative predicted value of visual inspection of the cervix after acetic acid application was 93.5%, 95.8%, 76.3%, 99%, and the diagnostic accuracy was 95.6%. Visual inspection of the cervix after acetic acid application is an effective method of detecting pre-invasive phase of cervical cancer and a good alternative to cytological screening for cervical cancer in resource-poor setting like Pakistan and can reduce maternal morbidity and mortality.

  3. Polycyclic Aromatic Hydrocarbon Affects Acetic Acid Production during Anaerobic Fermentation of Waste Activated Sludge by Altering Activity and Viability of Acetogen.

    PubMed

    Luo, Jingyang; Chen, Yinguang; Feng, Leiyu

    2016-07-05

    Till now, almost all the studies on anaerobic fermentation of waste activated sludge (WAS) for bioproducts generation focused on the influences of operating conditions, pretreatment methods and sludge characteristics, and few considered those of widespread persistent organic pollutants (POPs) in sludge, for example, polycyclic aromatic hydrocarbons (PAHs). Herein, phenanthrene, which was a typical PAH and widespread in WAS, was selected as a model compound to investigate its effect on WAS anaerobic fermentation for short-chain fatty acids (SCFAs) accumulation. Experimental results showed that the concentration of SCFAs derived from WAS was increased in the presence of phenanthrene during anaerobic fermentation. The yield of acetic acid which was the predominant SCFA in the fermentation reactor with the concentration of 100 mg/kg dry sludge was 1.8 fold of that in the control. Mechanism exploration revealed that the present phenanthrene mainly affected the acidification process of anaerobic fermentation and caused the shift of the microbial community to benefit the accumulation of acetic acid. Further investigation showed that both the activities of key enzymes (phosphotransacetylase and acetate kinase) involved in acetic acid production and the quantities of their corresponding encoding genes were enhanced in the presence of phenanthrene. Viability tests by determining the adenosine 5'-triphosphate content and membrane potential confirmed that the acetogens were more viable in anaerobic fermentation systems with phenanthrene, which resulted in the increased production of acetic acid.

  4. Lewis base activation of Lewis acids: catalytic, enantioselective addition of glycolate-derived silyl ketene acetals to aldehydes.

    PubMed

    Denmark, Scott E; Chung, Won-Jin

    2008-06-20

    A catalytic system involving silicon tetrachloride and a chiral, Lewis basic bisphosphoramide catalyst is effective for the addition of glycolate-derived silyl ketene acetals to aldehydes. It was found that the sense of diastereoselectivity could be modulated by changing the size of the substituents on the silyl ketene acetals. In general, the trimethylsilyl ketene acetals derived from methyl glycolates with a large protecting group on the alpha-oxygen provide enantiomerically enriched alpha,beta-dihydroxy esters with high syn-diastereoselectivity, whereas the tert-butyldimethylsilyl ketene acetals derived from bulky esters of alpha-methoxyacetic acid provide enantiomerically enriched alpha,beta-dihydroxy esters with high anti-diastereoselecitvity.

  5. The low photo-inactivation rate of bacteria in human plasma II. Inhibition of methylene blue bleaching in plasma and effective bacterial destruction by the addition of dilute acetic acid to human plasma.

    PubMed

    Chen, Jie; Cesario, Thomas C; Li, Runze; Er, Ali O; Rentzepis, Peter M

    2015-10-01

    Methylene blue (MB) and other photo-sensitizer molecules have been recognized as effective means for the inactivation of bacteria and other pathogens owing to their ability to photo-generate reactive oxygen species (ROS) including singlet oxygen. These reactive species react with the membrane of the bacteria causing their destruction. However, the efficiency of MB to destroy bacteria in plasma is very low because the MB 660 nm absorption band, that is responsible for the ROS generation, is bleached. The bleaching of MB, in plasma, is caused by the attachment of a hydrogen atom to the central ring nitrogen of MB, which destroys the ring conjugation and forms Leuco-MB which does not absorb in the 600 nm region. In this paper we show that addition of dilute acetic acid, ∼10(-4) M, to human plasma, prevents H-atom attachment to MB, allowing MB to absorb at 660 nm, generates singlet oxygen and thus inactivates bacteria. The mechanism proposed, for preventing MB bleaching in plasma, is based on the oxidation of cysteine to cystine, by reaction with added dilute acetic acid, thus eliminating the availability of the thiol hydrogen atom which attaches to the MB nitrogen. It is expected that the addition of acetic acid to plasma will be effective in the sterilization of plasma and killing of bacteria in wounds and burns.

  6. Improvement of inverted organic solar cells using acetic acid as an additive for ZnO layer processing

    NASA Astrophysics Data System (ADS)

    Li, Yang; Liu, Yawen; Liu, Zhihai; Xie, Xiaoyin; Lee, Eun-Cheol

    2018-02-01

    In this work, we used acetic acid as an additive for the preparation of ZnO layers and improved the performance of poly{4,8-bis[(2-ethylhexyl)-oxy]benzo[1,2-b:4,5-b'] dithiophene-2,6-diyl-alt-3-fluoro-2-[(2-ethylhexyl)carbonyl]thieno[3,4-b]thiophene- 4,6-diyl} (PTB7)-based inverted organic solar cells. The addition of acetic acid to the ZnO precursor solution improved the transparency and conductivity of the sol-gel-synthesized ZnO film, by increasing the grain size of the film. Accordingly, the power conversion efficiency (PCE) of the organic solar cells was improved from 6.42% to 7.55%, which was mainly caused by the enhanced current density and fill factor. The best sample demonstrated a high PCE of 7.85% with negligible hysteresis and good stability. Our results indicate that using acetic acid as an additive for the preparation of ZnO is a simple and effective way of fabricating high-performance inverted organic solar cells.

  7. Carbon monoxide fermentation to ethanol by Clostridium autoethanogenum in a bioreactor with no accumulation of acetic acid.

    PubMed

    Abubackar, Haris Nalakath; Veiga, María C; Kennes, Christian

    2015-06-01

    Fermentation of CO or syngas offers an attractive route to produce bioethanol. However, during the bioconversion, one of the challenges to overcome is to reduce the production of acetic acid in order to minimize recovery costs. Different experiments were done with Clostridium autoethanogenum. With the addition of 0.75 μM tungsten, ethanol production from carbon monoxide increased by about 128% compared to the control, without such addition, in batch mode. In bioreactors with continuous carbon monoxide supply, the maximum biomass concentration reached at pH 6.0 was 109% higher than the maximum achieved at pH 4.75 but, interestingly, at pH 4.75, no acetic acid was produced and the ethanol titer reached a maximum of 867 mg/L with minor amounts of 2,3-butanediol (46 mg/L). At the higher pH studied (pH 6.0) in the continuous gas-fed bioreactor, almost equal amounts of ethanol and acetic acid were formed, reaching 907.72 mg/L and 910.69 mg/L respectively. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. Indole-3-acetic acid biosynthetic pathway and aromatic amino acid aminotransferase activities in Pantoea dispersa strain GPK.

    PubMed

    Kulkarni, G B; Nayak, A S; Sajjan, S S; Oblesha, A; Karegoudar, T B

    2013-05-01

    This investigation deals with the production of IAA by a bacterial isolate Pantoea dispersa strain GPK (PDG) identified by 16S rRNA gene sequence analysis. HPLC and Mass spectral analysis of metabolites from bacterial spent medium revealed that, IAA production by PDG is Trp-dependent and follows indole-3-pyruvic acid (IPyA) pathway. Substrate specificity study of aromatic amino acid aminotransferase (AAT) showed high activities, only when tryptophan (Trp) and α-ketoglutarate (α-kg) were used as substrates. AAT is highly specific for Trp and α-kg as amino group donor and acceptor, respectively. The effect of exogenous IAA on bacterial growth was established. Low concentration of exogenous IAA induced the growth, whereas high concentration decreased the growth of bacterium. PDG treatment significantly increased the root length, shoot length and dry mass of the chickpea and pigeon pea plants. © 2013 The Society for Applied Microbiology.

  9. Efficient sugar release by acetic acid ethanol-based organosolv pretreatment and enzymatic saccharification.

    PubMed

    Zhang, Hongdan; Wu, Shubin

    2014-12-03

    Acetic acid ethanol-based organosolv pretreatment of sugar cane bagasse was performed to enhance enzymatic hydrolysis. The effect of different parameters (including temperature, reaction time, solvent concentration, and acid catalyst dose) on pretreatment prehydrolyzate and subsequent enzymatic digestibility was determined. During the pretreatment process, 11.83 g of xylose based on 100 g of raw material could be obtained. After the ethanol-based pretreatment, the enzymatic hydrolysis was enhanced and the highest glucose yield of 40.99 g based on 100 g of raw material could be obtained, representing 93.8% of glucose in sugar cane bagasse. The maximum total sugar yields occurred at 190 °C, 45 min, 60:40 ethanol/water, and 5% dosage of acetic acid, reaching 58.36 g (including 17.69 g of xylose and 40.67 g of glucose) based on 100 g of raw material, representing 85.4% of total sugars in raw material. Furthermore, characterization of the pretreated sugar cane bagasse using X-ray diffraction and scanning electron microscopy analyses were also developed. The results suggested that ethanol-based organosolv pretreatment could enhance enzymatic digestibilities because of the delignification and removal of xylan.

  10. Acetic acid bacteria in fermented foods and beverages.

    PubMed

    De Roos, Jonas; De Vuyst, Luc

    2018-02-01

    Although acetic acid bacteria (AAB) are commonly found in spontaneous or backslopped fermented foods and beverages, rather limited knowledge about their occurrence and functional role in natural food fermentation ecosystems is available. Not only is their cultivation, isolation, and identification difficult, their cells are often present in a viable but not culturable state. Yet, they are promising starter cultures either to better control known food fermentation processes or to produce novel fermented foods and beverages. This review summarizes the most recent findings on the occurrence and functional role of AAB in natural food fermentation processes such as lambic beer, water kefir, kombucha, and cocoa. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Metaproteomics and ultrastructure characterization of Komagataeibacter spp. involved in high-acid spirit vinegar production.

    PubMed

    Andrés-Barrao, Cristina; Saad, Maged M; Cabello Ferrete, Elena; Bravo, Daniel; Chappuis, Marie-Luise; Ortega Pérez, Ruben; Junier, Pilar; Perret, Xavier; Barja, François

    2016-05-01

    Acetic acid bacteria (AAB) are widespread microorganisms in nature, extensively used in food industry to transform alcohols and sugar alcohols into their corresponding organic acids. Specialized strains are used in the production of vinegar through the oxidative transformation of ethanol into acetic acid. The main AAB involved in the production of high-acid vinegars using the submerged fermentation method belong to the genus Komagataeibacter, characterized by their higher ADH stability and activity, and higher acetic acid resistance (15-20%), compared to other AAB. In this work, the bacteria involved in the production of high-acid spirit vinegar through a spontaneous acetic acid fermentation process was studied. The analysis using a culture-independent approach revealed a homogeneous bacterial population involved in the process, identified as Komagataeibacter spp. Differentially expressed proteins during acetic acid fermentation were investigated by using 2D-DIGE and mass spectrometry. Most of these proteins were functionally related to stress response, the TCA cycle and different metabolic processes. In addition, scanning and transmission electron microscopy and specific staining of polysaccharide SDS-PAGE gels confirmed that Komagataeibacter spp. lacked the characteristic polysaccharide layer surrounding the outer membrane that has been previously reported to have an important role in acetic acid resistance in the genus Acetobacter. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Carbon isotope fractionation by sulfate-reducing bacteria using different pathways for the oxidation of acetate.

    PubMed

    Goevert, Dennis; Conrad, Ralf

    2008-11-01

    Acetate is a key intermediate in the anaerobic degradation of organic matter. In anoxic environments, available acetate is a competitive substrate for sulfate-reducing bacteria (SRB) and methane-producing archaea. Little is known about the fractionation of carbon isotopes by sulfate reducers. Therefore, we determined carbon isotope compositions in cultures of three acetate-utilizing SRB, Desulfobacter postgatei, Desulfobacter hydrogenophilus, and Desulfobacca acetoxidans. We found that these species showed strong differences in their isotope enrichment factors (epsilon) of acetate. During the consumption of acetate and sulfate, acetate was enriched in 13C by 19.3% per hundred in Desulfobacca acetoxidans. By contrast, both D. postgatei and D. hydrogenophilus showed a slight depletion of 13C resulting in epsilon(ac)-values of 1.8 and 1.5% per hundred, respectively. We suggest that the different isotope fractionation is due to the different metabolic pathways for acetate oxidation. The strongly fractionating Desulfobacca acetoxidans uses the acetyl-CoA/carbon monoxide dehydrogenase pathway, which is also used by acetoclastic methanogens that show a similar fractionation of acetate (epsilon(ac) = -21 to -27% per hundred). In contrast, Desulfobacter spp. oxidize acetate to CO2 via the tricarboxylic acid (TCA) cycle and apparently did not discriminate against 13C. Our results suggestthat carbon isotope fractionation in environments with sulfate reduction will strongly depend on the composition of the sulfate-reducing bacterial community oxidizing acetate.

  13. An OmpA family protein, a target of the GinI/GinR quorum-sensing system in Gluconacetobacter intermedius, controls acetic acid fermentation.

    PubMed

    Iida, Aya; Ohnishi, Yasuo; Horinouchi, Sueharu

    2008-07-01

    Via N-acylhomoserine lactones, the GinI/GinR quorum-sensing system in Gluconacetobacter intermedius NCI1051, a gram-negative acetic acid bacterium, represses acetic acid and gluconic acid fermentation. Two-dimensional polyacrylamide gel electrophoretic analysis of protein profiles of strain NCI1051 and ginI and ginR mutants identified a protein that was produced in response to the GinI/GinR regulatory system. Cloning and nucleotide sequencing of the gene encoding this protein revealed that it encoded an OmpA family protein, named GmpA. gmpA was a member of the gene cluster containing three adjacent homologous genes, gmpA to gmpC, the organization of which appeared to be unique to vinegar producers, including "Gluconacetobacter polyoxogenes." In addition, GmpA was unique among the OmpA family proteins in that its N-terminal membrane domain forming eight antiparallel transmembrane beta-strands contained an extra sequence in one of the surface-exposed loops. Transcriptional analysis showed that only gmpA of the three adjacent gmp genes was activated by the GinI/GinR quorum-sensing system. However, gmpA was not controlled directly by GinR but was controlled by an 89-amino-acid protein, GinA, a target of this quorum-sensing system. A gmpA mutant grew more rapidly in the presence of 2% (vol/vol) ethanol and accumulated acetic acid and gluconic acid in greater final yields than strain NCI1051. Thus, GmpA plays a role in repressing oxidative fermentation, including acetic acid fermentation, which is unique to acetic acid bacteria and allows ATP synthesis via ethanol oxidation. Consistent with the involvement of gmpA in oxidative fermentation, its transcription was also enhanced by ethanol and acetic acid.

  14. Obeticholic acid reduces bacterial translocation and inhibits intestinal inflammation in cirrhotic rats.

    PubMed

    Úbeda, María; Lario, Margaret; Muñoz, Leticia; Borrero, María-José; Rodríguez-Serrano, Macarena; Sánchez-Díaz, Ana-María; Del Campo, Rosa; Lledó, Lourdes; Pastor, Óscar; García-Bermejo, Laura; Díaz, David; Álvarez-Mon, Melchor; Albillos, Agustín

    2016-05-01

    In advanced cirrhosis, gut bacterial translocation is the consequence of intestinal barrier disruption and leads to bacterial infection. Bile acid abnormalities in cirrhosis could play a role in the integrity of the intestinal barrier and the control of microbiota, mainly through the farnesoid X receptor. We investigated the long-term effects of the farnesoid X receptor agonist, obeticholic acid, on gut bacterial translocation, intestinal microbiota composition, barrier integrity and inflammation in rats with CCl4-induced cirrhosis with ascites. Cirrhotic rats received a 2-week course of obeticholic acid or vehicle starting once ascites developed. We then determined: bacterial translocation by mesenteric lymph node culture, ileum expression of antimicrobial peptides and tight junction proteins by qPCR, fecal albumin loss, enteric bacterial load and microbiota composition by qPCR and pyrosequencing of ileum mucosa-attached contents, and intestinal inflammation by cytometry of the inflammatory infiltrate. Obeticholic acid reduced bacterial translocation from 78.3% to 33.3% (p<0.01) and upregulated the expression of the farnesoid X receptor-associated gene small heterodimer partner. Treatment improved ileum expression of antimicrobial peptides, angiogenin-1 and alpha-5-defensin, tight junction proteins zonulin-1 and occludin, and reduced fecal albumin loss and liver fibrosis. Enteric bacterial load normalized, and the distinctive mucosal microbiota of cirrhosis was reduced. Gut immune cell infiltration was reduced and inflammatory cytokine and Toll-like receptor 4 expression normalized. In ascitic cirrhotic rats, obeticholic acid reduces gut bacterial translocation via several complementary mechanisms at the intestinal level. This agent could be used as an alternative to antibiotics to prevent bacterial infection in cirrhosis. Copyright © 2016 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

  15. Microarray-based transcriptome of Listeria monocytogenes adapted to sublethal concentrations of acetic acid, lactic acid, and hydrochloric acid.

    PubMed

    Tessema, Girum Tadesse; Møretrø, Trond; Snipen, Lars; Heir, Even; Holck, Askild; Naterstad, Kristine; Axelsson, Lars

    2012-09-01

    Listeria monocytogenes , an important foodborne pathogen, commonly encounters organic acids in food-related environments. The transcriptome of L. monocytogenes L502 was analyzed after adaptation to pH 5 in the presence of acetic acid, lactic acid, or hydrochloric acid (HCl) at 25 °C, representing a condition encountered in mildly acidic ready-to-eat food kept at room temperature. The acid-treated cells were compared with a reference culture with a pH of 6.7 at the time of RNA harvesting. The number of genes and magnitude of transcriptional responses were higher for the organic acids than for HCl. Protein coding genes described for low pH stress, energy transport and metabolism, virulence determinates, and acid tolerance response were commonly regulated in the 3 acid-stressed cultures. Interestingly, the transcriptional levels of histidine and cell wall biosynthetic operons were upregulated, indicating possible universal response against low pH stress in L. monocytogenes. The opuCABCD operon, coding proteins for compatible solutes transport, and the transcriptional regulator sigL were significantly induced in the organic acids, strongly suggesting key roles during organic acid stress. The present study revealed the complex transcriptional responses of L. monocytogenes towards food-related acidulants and opens the roadmap for more specific and in-depth future studies.

  16. Direct carbon-carbon coupling of furanics with acetic acid over Brønsted zeolites

    PubMed Central

    Gumidyala, Abhishek; Wang, Bin; Crossley, Steven

    2016-01-01

    Effective carbon-carbon coupling of acetic acid to form larger products while minimizing CO2 emissions is critical to achieving a step change in efficiency for the production of transportation fuels from sustainable biomass. We report the direct acylation of methylfuran with acetic acid in the presence of water, all of which can be readily produced from biomass. This direct coupling limits unwanted polymerization of furanics while producing acetyl methylfuran. Reaction kinetics and density functional theory calculations illustrate that the calculated apparent barrier for the dehydration of the acid to form surface acyl species is similar to the experimentally measured barrier, implying that this step plays a significant role in determining the net reaction rate. Water inhibits the overall rate, but selectivity to acylated products is not affected. We show that furanic species effectively stabilize the charge of the transition state, therefore lowering the overall activation barrier. These results demonstrate a promising new route to C–C bond–forming reactions for the production of higher-value products from biomass. PMID:27652345

  17. Regulation of Acetate Kinase Isozymes and Its Importance for Mixed-Acid Fermentation in Lactococcus lactis

    PubMed Central

    Puri, Pranav; Goel, Anisha; Bochynska, Agnieszka

    2014-01-01

    Acetate kinase (ACK) converts acetyl phosphate to acetate along with the generation of ATP in the pathway for mixed-acid fermentation in Lactococcus lactis. The reverse reaction yields acetyl phosphate for assimilation purposes. Remarkably, L. lactis has two ACK isozymes, and the corresponding genes are present in an operon. We purified both enzymes (AckA1 and AckA2) from L. lactis MG1363 and determined their oligomeric state, specific activities, and allosteric regulation. Both proteins form homodimeric complexes, as shown by size exclusion chromatography and static light-scattering measurements. The turnover number of AckA1 is about an order of magnitude higher than that of AckA2 for the reaction in either direction. The Km values for acetyl phosphate, ATP, and ADP are similar for both enzymes. However, AckA2 has a higher affinity for acetate than does AckA1, suggesting an important role under acetate-limiting conditions despite the lower activity. Fructose-1,6-bisphosphate, glyceraldehyde-3-phosphate, and phospho-enol-pyruvate inhibit the activities of AckA1 and AckA2 to different extents. The allosteric regulation of AckA1 and AckA2 and the pool sizes of the glycolytic intermediates are consistent with a switch from homolactic to mixed-acid fermentation upon slowing of the growth rate. PMID:24464460

  18. Design and synthesis of alkoxyindolyl-3-acetic acid analogs as peroxisome proliferator-activated receptor-γ/δ agonists.

    PubMed

    Gim, Hyo Jin; Li, Hua; Lee, Eun; Ryu, Jae-Ha; Jeon, Raok

    2013-01-15

    A series of carbazole or phenoxazine containing alkoxyindole-3-acetic acid analogs were prepared as PPARγ/δ agonists and their transactivation activities for PPAR receptor subtypes (α, γ and δ) were investigated. Structure-activity relationship studies disclosed the effect of the lipophilic tail, attaching position of the alkoxy group and N-benzyl substitution at indole. Compound 1b was the most potent for PPARδ and 3b for PPARγ. Molecular modeling suggested two different binding modes of our alkoxyindole-3-acetic acid analogs providing the insight into their PPAR activity. Copyright © 2012 Elsevier Ltd. All rights reserved.

  19. Simultaneous extraction and HPLC determination of 3-indole butyric acid and 3-indole acetic acid in pea plant by using ionic liquid-modified silica as sorbent.

    PubMed

    Sheikhian, Leila; Bina, Sedigheh

    2016-01-15

    In this study, ionic liquid-modified silica was used as sorbent for simultaneous extraction and preconcentration of 3-indole butyric acid and 3-indole acetic acid in pea plants. The effect of some parameters such as pH and ionic strength of sample solution, amount of sorbent, flow rate of aqueous sample solution and eluent solution, concentration of eluent solution, and temperature were studied for each hormone solution. Percent extraction of 3-indole butyric acid and 3-indole acetic acid was strongly affected by pH of aqueous sample solution. Ionic strength of aqueous phase and temperature showed no serious effects on extraction efficiency of studied plant hormones. Obtained breakthrough volume was 200mL for each of studied hormones. Preconcentration factor for spectroscopic and chromatographic determination of studied hormones was 100 and 4.0×10(3) respectively. Each solid sorbent phase was reusable for almost 10 times of extraction/stripping procedure. Relative standard deviations of extraction/stripping processes of 3-indole butyric acid and 3-indole acetic acid were 2.79% and 3.66% respectively. The calculated limit of detections for IBA and IAA were 9.1×10(-2)mgL(-1) and 1.6×10(-1)mgL(-1) respectively. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. STABILITY OF MFI ZEOLITE-FILLED PDMS MEMBRANES DURING PERVAPORATIVE ETHANOL RECOVERY FROM AQUEOUS MIXTURES CONTAINING ACETIC ACID

    EPA Science Inventory

    Pervaporation is a potential process for recovering bioethanol produced from biomass fermentation. Fermentation broths contain ethanol, water, and a variety of other compounds, often including carboxylic acids. The effects of acetic acid on long-term pervaporation of aqueous et...

  1. Recycling acetic acid from polarizing film of waste liquid crystal display panels by sub/supercritical water treatments.

    PubMed

    Wang, Ruixue; Chen, Ya; Xu, Zhenming

    2015-05-19

    Waste liquid crystal display (LCD) panels mainly contain inorganic materials (glass substrate) and organic materials (polarizing film and liquid crystal). The organic materials should be removed first since containing polarizing film and liquid crystal is to the disadvantage of the indium recycling process. In the present study, an efficient and environmentally friendly process to obtain acetic acid from waste LCD panels by sub/supercritical water treatments is investigated. Furthermore, a well-founded reaction mechanism is proposed. Several highlights of this study are summarized as follows: (i) 99.77% of organic matters are removed, which means the present technology is quite efficient to recycle the organic matters; (ii) a yield of 78.23% acetic acid, a quite important fossil energy based chemical product is obtained, which can reduce the consumption of fossil energy for producing acetic acid; (iii) supercritical water acts as an ideal solvent, a requisite reactant as well as an efficient acid-base catalyst, and this is quite significant in accordance with the "Principles of Green Chemistry". In a word, the organic matters of waste LCD panels are recycled without environmental pollution. Meanwhile, this study provides new opportunities for alternating fossil-based chemical products for sustainable development, converting "waste" into "fossil-based chemicals".

  2. Competitive fragmentation pathways of acetic acid dimer explored by synchrotron VUV photoionization mass spectrometry and electronic structure calculations.

    PubMed

    Guan, Jiwen; Hu, Yongjun; Zou, Hao; Cao, Lanlan; Liu, Fuyi; Shan, Xiaobin; Sheng, Liusi

    2012-09-28

    In present study, photoionization and dissociation of acetic acid dimers have been studied with the synchrotron vacuum ultraviolet photoionization mass spectrometry and theoretical calculations. Besides the intense signal corresponding to protonated cluster ions (CH(3)COOH)(n)·H(+), the feature related to the fragment ions (CH(3)COOH)H(+)·COO (105 amu) via β-carbon-carbon bond cleavage is observed. By scanning photoionization efficiency spectra, appearance energies of the fragments (CH(3)COOH)·H(+) and (CH(3)COOH)H(+)·COO are obtained. With the aid of theoretical calculations, seven fragmentation channels of acetic acid dimer cations were discussed, where five cation isomers of acetic acid dimer are involved. While four of them are found to generate the protonated species, only one of them can dissociate into a C-C bond cleavage product (CH(3)COOH)H(+)·COO. After surmounting the methyl hydrogen-transfer barrier 10.84 ± 0.05 eV, the opening of dissociative channel to produce ions (CH(3)COOH)(+) becomes the most competitive path. When photon energy increases to 12.4 eV, we also found dimer cations can be fragmented and generate new cations (CH(3)COOH)·CH(3)CO(+). Kinetics, thermodynamics, and entropy factors for these competitive dissociation pathways are discussed. The present report provides a clear picture of the photoionization and dissociation processes of the acetic acid dimer in the range of the photon energy 9-15 eV.

  3. Role of a membrane-bound aldehyde dehydrogenase complex AldFGH in acetic acid fermentation with Acetobacter pasteurianus SKU1108.

    PubMed

    Yakushi, Toshiharu; Fukunari, Seiya; Kodama, Tomohiro; Matsutani, Minenosuke; Nina, Shun; Kataoka, Naoya; Theeragool, Gunjana; Matsushita, Kazunobu

    2018-05-01

    Acetic acid fermentation is widely considered a consequence of ethanol oxidation by two membrane-bound enzymes-alcohol dehydrogenase and aldehyde dehydrogenase (ALDH)-of acetic acid bacteria. Here, we used a markerless gene disruption method to construct a mutant of the Acetobacter pasteurianus strain SKU1108 with a deletion in the aldH gene, which encodes the large catalytic subunit of a heterotrimeric ALDH complex (AldFGH), to examine the role of AldFGH in acetic acid fermentation. The ΔaldH strain grew less on ethanol-containing medium, i.e., acetic acid fermentation conditions, than the wild-type strain and significantly accumulated acetaldehyde in the culture medium. Unexpectedly, acetaldehyde oxidase activity levels of the intact ΔaldH cells and the ΔaldH cell membranes were similar to those of the wild-type strain, which might be attributed to an additional ALDH isozyme (AldSLC). The apparent K M values of the wild-type and ΔaldH membranes for acetaldehyde were similar to each other, when the cells were cultured in nonfermentation conditions, where ΔaldH cells grow as well as the wild-type cells. However, the membranes of the wild-type cells grown under fermentation conditions showed a 10-fold lower apparent K M value than those of the cells grown under nonfermentation conditions. Under fermentation conditions, transcriptional levels of a gene for AldSLC were 10-fold lower than those under nonfermentation conditions, whereas aldH transcript levels were not dramatically changed under the two conditions. We suggest that A. pasteurianus SKU1108 has two ALDHs, and the AldFGH complex is indispensable for acetic acid fermentation and is the major enzyme under fermentation conditions.

  4. 21 CFR 184.1185 - Calcium acetate.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Calcium acetate. 184.1185 Section 184.1185 Food... Specific Substances Affirmed as GRAS § 184.1185 Calcium acetate. (a) Calcium acetate (Ca (C2H3O2)2, CAS Reg. No. 62-54-4), also known as acetate of lime or vinegar salts, is the calcium salt of acetic acid. It...

  5. 21 CFR 184.1185 - Calcium acetate.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Calcium acetate. 184.1185 Section 184.1185 Food... GRAS § 184.1185 Calcium acetate. (a) Calcium acetate (Ca (C2H3O2)2, CAS Reg. No. 62-54-4), also known as acetate of lime or vinegar salts, is the calcium salt of acetic acid. It may be produced by the...

  6. 21 CFR 184.1185 - Calcium acetate.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Calcium acetate. 184.1185 Section 184.1185 Food... Specific Substances Affirmed as GRAS § 184.1185 Calcium acetate. (a) Calcium acetate (Ca (C2H3O2)2, CAS Reg. No. 62-54-4), also known as acetate of lime or vinegar salts, is the calcium salt of acetic acid. It...

  7. Improved robustness of an ethanologenic yeast strain through adaptive evolution in acetic acid is associated with its enzymatic antioxidant ability.

    PubMed

    Gurdo, N; Novelli Poisson, G F; Juárez, Á B; Ríos de Molina, M C; Galvagno, M A

    2018-05-16

    To investigate multiple tolerance of Saccharomyces cerevisiae obtained through a laboratory strategy of adaptive evolution in acetic acid, its relation with enzymatic ROS detoxification and bioethanol 2G production. After adaptive evolution in acetic acid, a clone (Y8A) was selected for its tolerance to high acetic acid concentrations (13 g l -1 ) in batch cultures. Y8A was resistant to multiple stresses: osmotic, thermic, oxidative, saline, ethanol, organic acid, phenolic compounds and slow freeze-thawing cycles. Also, Y8A was able to maintain redox homeostasis under oxidative stress, whereas the isogenic parental strain (Y8) could not, indicating higher basal activity levels of antioxidative enzyme Catalase (CAT) and Gluthatione-S-Transferase (GST) in Y8A. Y8A reached higher bioethanol levels in a fermentation medium containing up to 8 g l -1 of acetic acid when compared to parental strain Y8. A multiple-stress-tolerant clone was obtained using adaptive evolution in acetic acid. Stress cross-tolerance could be explained by its enzymatic antioxidative capacity, namely CAT and GST. We demonstrate that adaptive evolution used in S. cerevisiae was a useful strategy to obtain a yeast clone tolerant to multiple stresses. At the same time, our findings support the idea that tolerance to oxidative stress is the common basis for stress co-tolerance, which is related to an increase in the specific enzymes CAT and GST but not in Superoxide dismutase (SOD), emphasizing the fact that detoxification of H 2 O 2 and not O 2 . is a key condition for multiple stress tolerance in S. cerevisiae. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  8. Study of acetic acid production by immobilized acetobacter cells: oxygen transfer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ghommidh, C.; Navarro, J.M.; Durand, G.

    1982-03-01

    The immobilization of living Acetobacter cells by adsorption onto a large-surface-area ceramic support was studied in a pulsed flow reactor. The high oxygen transfer capability of the reactor enabled acetic acid production rates up to 10.4 g/L/h to be achieved. Using a simple mathematical model incorporating both internal and external mass transfer coefficients, it was shown that oxygen transfer in the microbial film controls the reactor productivity. (Refs. 10).

  9. Preparation of vinyl acetate

    DOEpatents

    Tustin, Gerald Charles; Zoeller, Joseph Robert; Depew, Leslie Sharon

    1998-01-01

    This invention pertains to the preparation of vinyl acetate by contacting a mixture of hydrogen and ketene with a heterogeneous catalyst containing a transition metal to produce acetaldehyde, which is then reacted with ketene in the presence of an acid catalyst to produce vinyl acetate.

  10. Preparation of vinyl acetate

    DOEpatents

    Tustin, G.C.; Zoeller, J.R.; Depew, L.S.

    1998-03-24

    This invention pertains to the preparation of vinyl acetate by contacting a mixture of hydrogen and ketene with a heterogeneous catalyst containing a transition metal to produce acetaldehyde, which is then reacted with ketene in the presence of an acid catalyst to produce vinyl acetate.

  11. Synergic Interaction of Rifaximin and Mutaflor (Escherichia coli Nissle 1917) in the Treatment of Acetic Acid-Induced Colitis in Rats.

    PubMed

    Dembiński, Artur; Warzecha, Zygmunt; Ceranowicz, Piotr; Dembiński, Marcin; Cieszkowski, Jakub; Gosiewski, Tomasz; Bulanda, Małgorzata; Kuśnierz-Cabala, Beata; Gałązka, Krystyna; Konturek, Peter Christopher

    2016-01-01

    Background. Inflammatory bowel disease results from the dysregulation of immune response to environmental and microbial agents in genetically susceptible individuals. The aim of the present study was to examine the effect of rifaximin and/or Mutaflor (Escherichia coli Nissle 1917, EcN) administration on the healing of acetic acid-induced colitis. Methods. Colitis was induced in male Wistar rats by rectal enema with 3.5% acetic acid solution. Rifaximin (50 mg/kg/dose) and/or Mutaflor (10(9) CFU/dose) were given intragastrically once a day. The severity of colitis was assessed at the 8th day after induction of inflammation. Results. Treatment with rifaximin significantly accelerated the healing of colonic damage. This effect was associated with significant reversion of the acetic acid-evoked decrease in mucosal blood flow and DNA synthesis. Moreover, administration of rifaximin significantly reduced concentration of proinflammatory TNF-α and activity of myeloperoxidase in colonic mucosa. Mutaflor given alone was without significant effect on activity of colitis. In contrast, Mutaflor given in combination with rifaximin significantly enhanced therapeutic effect of rifaximin. Moreover, Mutaflor led to settle of the colon by EcN and this effect was augmented by pretreatment with rifaximin. Conclusion. Rifaximin and Mutaflor exhibit synergic anti-inflammatory and therapeutic effect in acetic acid-induced colitis in rats.

  12. Oxidation of fatty acid may be enhanced by a combination of pomegranate fruit phytochemicals and acetic acid in HepG2 cells.

    PubMed

    Kim, Ji Yeon; Ok, Elly; Kim, You Jin; Choi, Kyoung-Sook; Kwon, Oran

    2013-06-01

    We investigated whether the combination of phytochemicals and acetic acid in the form of fruit vinegar provides an additive effect on changes of mRNA levels related to fatty acid oxidation in human hepatocyte (HepG2). Among the seven fruit vinegars (Rubuscoreanus, Opuntia, blueberry, cherry, red ginseng, mulberry, and pomegranate) studied, treatment of HepG2 with pomegranate vinegar (PV) at concentrations containing 1 mM acetic acid showed the highest in vitro potentiating effect on the mRNA expression levels of peroxisome proliferator-activated receptor α, carnitinepalmitoyl transferase-1, and acyl-CoA oxidase compared to the control group (P < 0.05). Reversed-phase liquid chromatography in combination with quadrupole time-of-flight mass spectrometry analysis revealed four potential compounds (punicalagin B, ellagic acid, and two unidentified compounds) responsible for altered gene expression in HepG2 cells treated with PV as compared with the others. Further investigations are warranted to determine if drinking PV beverages may help to maintain a healthy body weight in overweight subjects.

  13. The Urine Preservative Acetic Acid Degrades Urine Protein: Implications for Urine Biorepositories and the AASK Cohort Study

    PubMed Central

    Almaani, Salem; Hebert, Lee A.; Rovin, Brad H.

    2017-01-01

    Patients enrolled in the African American Study of Kidney Disease and Hypertension (AASK) Cohort Study who exhibited overt proteinuria have been reported to show high nonalbumin proteinuria (NAP), which is characteristic of a tubulopathy. To determine whether African American Study of Kidney Disease and Hypertension nephropathy (AASK-N) is a tubulopathy, we obtained urine samples of 37 patients with AASK-N, with 24-hour protein-to-creatinine ratios (milligrams per milligram) ranging from 0.2 to 1.0, from the National Institute of Diabetes and Digestive Kidney Diseases repository and tested for seven markers of tubular proteinuria. By protocol, each sample had been collected in acetic acid (0.5%; mean final concentration). Compared with samples from patients with lupus nephritis or healthy black controls, AASK-N samples had lower amounts of six markers. Four markers (albumin, β-2-microglobulin, cystatin C, and osteopontin) were undetectable in most AASK-N samples. Examination by SDS-PAGE followed by protein staining revealed protein profiles indicative of severe protein degradation in 34 of 37 AASK-N urine samples. Treatment of lupus nephritis urine samples with 0.5% acetic acid produced the same protein degradation profile as that of AASK-N urine. We conclude that the increased NAP in AASK-N is an artifact of acetic acid–mediated degradation of albumin. The AASK-N repository urine samples have been compromised by the acetic acid preservative. PMID:28104821

  14. An OmpA Family Protein, a Target of the GinI/GinR Quorum-Sensing System in Gluconacetobacter intermedius, Controls Acetic Acid Fermentation▿ †

    PubMed Central

    Iida, Aya; Ohnishi, Yasuo; Horinouchi, Sueharu

    2008-01-01

    Via N-acylhomoserine lactones, the GinI/GinR quorum-sensing system in Gluconacetobacter intermedius NCI1051, a gram-negative acetic acid bacterium, represses acetic acid and gluconic acid fermentation. Two-dimensional polyacrylamide gel electrophoretic analysis of protein profiles of strain NCI1051 and ginI and ginR mutants identified a protein that was produced in response to the GinI/GinR regulatory system. Cloning and nucleotide sequencing of the gene encoding this protein revealed that it encoded an OmpA family protein, named GmpA. gmpA was a member of the gene cluster containing three adjacent homologous genes, gmpA to gmpC, the organization of which appeared to be unique to vinegar producers, including “Gluconacetobacter polyoxogenes.” In addition, GmpA was unique among the OmpA family proteins in that its N-terminal membrane domain forming eight antiparallel transmembrane β-strands contained an extra sequence in one of the surface-exposed loops. Transcriptional analysis showed that only gmpA of the three adjacent gmp genes was activated by the GinI/GinR quorum-sensing system. However, gmpA was not controlled directly by GinR but was controlled by an 89-amino-acid protein, GinA, a target of this quorum-sensing system. A gmpA mutant grew more rapidly in the presence of 2% (vol/vol) ethanol and accumulated acetic acid and gluconic acid in greater final yields than strain NCI1051. Thus, GmpA plays a role in repressing oxidative fermentation, including acetic acid fermentation, which is unique to acetic acid bacteria and allows ATP synthesis via ethanol oxidation. Consistent with the involvement of gmpA in oxidative fermentation, its transcription was also enhanced by ethanol and acetic acid. PMID:18487322

  15. Recovering/concentrating of hemicellulosic sugars and acetic acid by nanofiltration and reverse osmosis from prehydrolysis liquor of kraft based hardwood dissolving pulp process.

    PubMed

    Ahsan, Laboni; Jahan, M Sarwar; Ni, Yonghao

    2014-03-01

    This work investigated the feasibility of recovering and concentrating sugars and acetic acid (HAc) from prehydrolysis liquor (PHL) of the kraft-based dissolving pulp process prior to fermentation of hemicellulosic sugars, by the combination of activated carbon adsorption, nanofiltration (NF) and reverse osmosis (RO) processes. To reduce the fouling PHL was subjected to adsorption on activated carbon, then the treated PHL (TPHL) passed through a nanofiltration (NF DK) membrane to retain the sugars, and the permeate of acetic acid rich solution was passed through a reverse osmosis membrane (RO SG). It was found that for NF process sugars were concentrated from 48 to 227g/L at a volume reduction factor (VRF) of 5 while 80 to 90% of acetic acid was permeated. For the reverse osmosis process, 68% of acetic acid retention was achieved at pH 4.3 and 500 psi pressure and the HAc concentration increased from 10 to 50g/L. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

  16. Utilization of acetic acid-rich pyrolytic bio-oil by microalga Chlamydomonas reinhardtii: reducing bio-oil toxicity and enhancing algal toxicity tolerance.

    PubMed

    Liang, Yi; Zhao, Xuefei; Chi, Zhanyou; Rover, Marjorie; Johnston, Patrick; Brown, Robert; Jarboe, Laura; Wen, Zhiyou

    2013-04-01

    This work was to utilize acetic acid contained in bio-oil for growth and lipid production of the microalga Chlamydomonas reinhardtii. The acetic acid-rich bio-oil fraction derived from fast pyrolysis of softwood contained 26% (w/w) acetic acid, formic acid, methanol, furfural, acetol, and phenolics as identified compounds, and 13% (w/w) unidentified compounds. Among those identified compounds, phenolics were most inhibitory to algal growth, followed by furfural and acetol. To enhance the fermentability of the bio-oil fraction, activated carbon was used to reduce the toxicity of the bio-oil, while metabolic evolution was used to enhance the toxicity tolerance of the microalgae. Combining activated carbon treatment and using evolved algal strain resulted in significant algal growth improvement. The results collectively showed that fast pyrolysis-fermentation process was a viable approach for converting biomass into fuels and chemicals. Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. Isolation and identification of biocellulose-producing bacterial strains from Malaysian acidic fruits.

    PubMed

    Voon, W W Y; Rukayadi, Y; Meor Hussin, A S

    2016-05-01

    Biocellulose (BC) is pure extracellular cellulose produced by several species of micro-organisms that has numerous applications in the food, biomedical and paper industries. However, the existing biocellulose-producing bacterial strain with high yield was limited. The aim of this study was to isolate and identify the potential biocellulose-producing bacterial isolates from Malaysian acidic fruits. One hundred and ninety-three bacterial isolates were obtained from 19 local acidic fruits collected in Malaysia and screened for their ability to produce BC. A total of 15 potential bacterial isolates were then cultured in standard Hestrin-Schramm (HS) medium statically at 30°C for 2 weeks to determine the BC production. The most potent bacterial isolates were identified using 16S rRNA gene sequence analysis, morphological and biochemical characteristics. Three new and potent biocellulose-producing bacterial strains were isolated from soursop fruit and identified as Stenotrophomonas maltophilia WAUPM42, Pantoea vagans WAUPM45 and Beijerinckia fluminensis WAUPM53. Stenotrophomonas maltophilia WAUPM42 was the most potent biocellulose-producing bacterial strain that produced the highest amount of BC 0·58 g l(-1) in standard HS medium. Whereas, the isolates P. vagans WAUPM45 and B. fluminensis WAUPM53 showed 0·50 and 0·52 g l(-1) of BC production, respectively. Biocellulose (BC) is pure extracellular cellulose that is formed by many micro-organisms in the presence of carbon source and acidic condition. It can replace plant-based cellulose in multifarious applications due to its unique characteristics. In this study, three potential biocellulose-producing bacterial strains were obtained from Malaysian acidic fruits and identified as Stenotrophomonas maltophilia WAUPM42, Pantoea vagans WAUPM45 and Beijerinckia fluminensis WAUPM53. This study reports for the first time the new biocellulose-producing bacterial strains isolated from Malaysian acidic fruits. © 2016 The

  18. Environmentally triggered genomic plasticity and capsular polysaccharide formation are involved in increased ethanol and acetic acid tolerance in Kozakia baliensis NBRC 16680.

    PubMed

    Brandt, Julia U; Born, Friederike-Leonie; Jakob, Frank; Vogel, Rudi F

    2017-08-10

    Kozakia baliensis NBRC 16680 secretes a gum-cluster derived heteropolysaccharide and forms a surface pellicle composed of polysaccharides during static cultivation. Furthermore, this strain exhibits two colony types on agar plates; smooth wild-type (S) and rough mutant colonies (R). This switch is caused by a spontaneous transposon insertion into the gumD gene of the gum-cluster, resulting in a heteropolysaccharide secretion deficient, rough phenotype. To elucidate, whether this is a directed switch triggered by environmental factors, we checked the number of R and S colonies under different growth conditions including ethanol and acetic acid supplementation. Furthermore, we investigated the tolerance of R and S strains against ethanol and acetic acid in shaking and static growth experiments. To get new insights into the composition and function of the pellicle polysaccharide, the polE gene of the R strain was additionally deleted, as it was reported to be involved in pellicle formation in other acetic acid bacteria. The number of R colonies was significantly increased upon growth on acetic acid and especially ethanol. The morphological change from K. baliensis NBRC 16680 S to R strain was accompanied by changes in the sugar contents of the produced pellicle EPS. The R:ΔpolE mutant strain was not able to form a regular pellicle anymore, but secreted an EPS into the medium, which exhibited a similar sugar monomer composition as the pellicle polysaccharide isolated from the R strain. The R strain had a markedly increased tolerance towards acetic acid and ethanol compared to the other NBRC 16680 strains (S, R:ΔpolE). A relatively high intrinsic acetic acid tolerance was also observable for K. baliensis DSM 14400 T , which might indicate diverse adaptation mechanisms of different K. baliensis strains in altering natural habitats. The results suggest that the genetically triggered R phenotype formation is directly related to increased acetic acid and ethanol

  19. Improvement of sensitivity of electrolyte cathode discharge atomic emission spectrometry (ELCAD-AES) for mercury using acetic acid medium.

    PubMed

    Shekhar, R

    2012-05-15

    A method has been developed to improve the sensitivity of the electrolyte cathode discharge atomic emission spectrometry (ELCAD-AES) for mercury determination. Effects of various low molecular weight organic solvents at different volume percentages as well as at different acid molarities on the mercury signal were investigated using ELCAD-AES. The addition of few percent of organic solvent, acetic acid produced significant enhancement in mercury signal. Acetic acid of 5% (v/v) with the 0.2M acidity has been found to give 500% enhancement for mercury signal in flow injection mode. Under the optimized parameters the repeatability, expressed as the percentage relative standard deviation of spectral peak area for mercury with 5% acetic acid was found to be 10% for acid blank solution and 5% for 20 ng/mL mercury standard based on multiple measurements with a multiple sample loading in flow injection mode. Limit of detection of this method was determined to be 2 ng/mL for inorganic mercury. The proposed method has been validated by determining mercury in certified reference materials, Tuna fish (IAEA-350) and Aquatic plant (BCR-060). Accuracy of the method for the mercury determination in the reference materials has been found to be between 3.5% and 5.9%. This study enhances the utility of ELCAD-AES for various types of biological and environmental materials to quantify total mercury at very low levels. Copyright © 2012 Elsevier B.V. All rights reserved.

  20. A 2,4-dichlorophenoxyacetic acid analog screened using a maize coleoptile system potentially inhibits indole-3-acetic acid influx in Arabidopsis thaliana

    PubMed Central

    Suzuki, Hiromi; Matano, Naoyuki; Nishimura, Takeshi; Koshiba, Tomokazu

    2014-01-01

    Studies using inhibitors of indole-3-acetic acid (IAA) transport, not only for efflux but influx carriers, provide many aspects of auxin physiology in plants. 1-Naphtoxyacetic acid (1-NOA), an analog of the synthetic auxin 1-N-naphtalene acetic acid (NAA), inhibits the IAA influx carrier AUX1. However, 1-NOA also shows auxin activity because of its structural similarity to NAA. In this study, we have identified another candidate inhibitor of the IAA influx carrier. The compound, “7-B3; ethyl 2-[(2-chloro-4-nitrophenyl)thio]acetate,” is a 2,4-dichlorophenoxyacetic acid (2,4-D) analog. At high concentrations (> 300 µM), 7-B3 slightly reduced IAA transport and tropic curvature of maize coleoptiles, whereas lower concentrations had almost no effect. We have analyzed the effects of 7-B3 on Arabidopsis thaliana seedlings. 7-B3 rescued the 2,4-D-inhibited root elongation, but not the NAA-inhibited root elongation. The effect of 7-B3 was weaker than that of 1-NOA. Both 1-NOA and 7-B3 inhibited DR5::GUS expression induced by IAA and 2,4-D, but not that induced by NAA. At high concentrations, 1-NOA exhibited auxin activity, but 7-B3 did not. Furthermore, 7-B3 inhibited apical hook formation in etiolated seedlings more effectively than 1-NOA did. These results indicate that 7-B3 is a potential inhibitor of IAA influx that has almost no effect on IAA efflux or auxin signaling. PMID:24800738

  1. Bio-conversion of apple pomace into ethanol and acetic acid: Enzymatic hydrolysis and fermentation.

    PubMed

    Parmar, Indu; Rupasinghe, H P Vasantha

    2013-02-01

    Enzymatic hydrolysis of cellulose present in apple pomace was investigated using process variables such as enzyme activity of commercial cellulase, pectinase and β-glucosidase, temperature, pH, time, pre-treatments and end product separation. The interaction of enzyme activity, temperature, pH and time had a significant effect (P<0.05) on release of glucose. Optimal conditions of enzymatic saccharification were: enzyme activity of cellulase, 43units; pectinase, 183units; β-glucosidase, 41units/g dry matter (DM); temperature, 40°C; pH 4.0 and time, 24h. The sugars were fermented using Saccharomyces cerevisae yielding 19.0g ethanol/100g DM. Further bio-conversion using Acetobacter aceti resulted in the production of acetic acid at a concentration of 61.4g/100g DM. The present study demonstrates an improved process of enzymatic hydrolysis of apple pomace to yield sugars and concomitant bioconversion to produce ethanol and acetic acid. Copyright © 2012 Elsevier Ltd. All rights reserved.

  2. Protective Effect of Ocimum basilicum Essential Oil Against Acetic Acid-Induced Colitis in Rats.

    PubMed

    Rashidian, Amir; Roohi, Parnia; Mehrzadi, Saeed; Ghannadi, Ali Reza; Minaiyan, Mohsen

    2016-10-01

    Ocimum basilicum L has been traditionally used for the treatment of inflammatory bowel disease in Iran. This study investigates the ameliorative effect of Ocimum basilicum essential oil on an acetic acid-induced colitis model in rats. Ocimum basilicum essential oil with 2 doses (200 and 400 μL/kg) significantly ameliorated wet weight/length ratio of colonic tissue compared to the control group. Higher doses of essential oil (200 and 400 μL/kg) significantly reduced ulcer severity, ulcer area, and ulcer index. On the other hand, histological examination revealed the diminution of total colitis index as a marker for inflammatory cell infiltration in the colonic segments of rats treated with Ocimum basilicum essential oil (200 and 400 μL/kg). The increased level of myeloperoxidase was significantly decreased after the treatment with the essential oil (200 and 400 μL/kg). These results suggest that Ocimum basilicum exhibits protective effect against acetic acid-induced colitis. © The Author(s) 2015.

  3. Design and Evaluation of PCR Primers for Analysis of Bacterial Populations in Wine by Denaturing Gradient Gel Electrophoresis

    PubMed Central

    Lopez, Isabel; Ruiz-Larrea, Fernanda; Cocolin, Luca; Orr, Erica; Phister, Trevor; Marshall, Megan; VanderGheynst, Jean; Mills, David A.

    2003-01-01

    Denaturing gradient gel electrophoresis (DGGE) of PCR-amplified ribosomal DNA (rDNA) is routinely used to compare levels of diversity of microbial communities and to monitor population dynamics. While using PCR-DGGE to examine the bacteria in wine fermentations, we noted that several commonly used PCR primers for amplifying bacterial 16S rDNA also coamplified yeast, fungal, or plant DNA present in samples. Unfortunately, amplification of nonbacterial DNA can result in a masking of bacterial populations in DGGE profiles. To surmount this problem, we developed two new primer sets for specific amplification of bacterial 16S rDNA in wine fermentation samples without amplification of eukaryotic DNA. One primer set, termed WLAB1 and WLAB2, amplified lactic acid bacteria, while another, termed WBAC1 and WBAC2, amplified both lactic acid bacterial and acetic acid bacterial populations found in wine. Primer specificity and efficacy were examined with DNA isolated from numerous bacterial, yeast, and fungal species commonly found in wine and must samples. Importantly, both primer sets effectively distinguished bacterial species in wine containing mixtures of yeast and bacteria. PMID:14602643

  4. Combined effects of mustard flour, acetic acid, and salt against Esherichia coil O157:H7 stored at 5 and 22 degrees C.

    PubMed

    Rhee, Min-Suk; Dougherty, Richard H; Kang, Dong-Hyun

    2002-10-01

    The combined effects of acetic acid and mustard flour were investigated to ascertain their impact on Escherichia coli O157:H7 stored at 5 and 22 degrees C. Samples were prepared with various concentrations of acetic acid (0, 0.25, 0.5, 0.75, and 1% [vol/vol]) combined with 10% (wt/vol) Baltimore or Coleman mustard flour and 2% (fixed; wt/vol) sodium chloride. An acid-adapted mixture of three E. coli O157:H7 strains (10(6) to 10(7) CFU/ml) was inoculated into prepared mustard samples that were stored at 5 and 22 degrees C, and samples were assayed periodically for the survival of E. coli O157:H7. The numbers of E. coli O157:H7 were reduced much more rapidly at 22 degrees C than at 5 degrees C. E. coli O157:H7 was rapidly reduced to below the detection limit (<0.3 log10, CFU/ml) after 1 day at 22 degrees C, whereas it survived for up to 5 days at 5 degrees C. There was no synergistic or additive effect with regard to the killing of E. coli O157:H7 with the addition of small amounts of acetic acid to the mustard flour. When stored at 5 degrees C, mustard in combination with 0.25 (M-0.25), 0.5 (M-0.5), and 0.75% (M-0.75) acetic acid exerted less antimicrobial activity than the control (M-0). The order of lethality at 5 degrees C was generally M-0.25 = M-0.5 < M-0.75 = M-0 < M-1. The addition of small amounts of acetic acid (<0.75%) to mustard retards the reduction of E coli O157:H7. Statistical reduction in populations of E. coli O157:H7 (P < 0.05) was enhanced relative to that of the control (mustard alone) only with the addition of 1% acetic acid. This information may help mustard manufacturers to understand the antimicrobial activity associated with use of mustard flour in combination with acetic acid.

  5. Acetic acid and aromatics units planned in China

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Alperowicz, N.

    1993-01-27

    The Shanghai Wujing Chemical Complex (SWCC; Shanghai) is proceeding with construction of an acetic acid plant. The 100,000-m.t./year until will use BP Chemicals carbonylation technology, originally developed by Monsanto. John Brown has been selected by China National Technical Import Corp. (CNTIC) to supply the plant, Chinese sources say. The UK contractor, which competed against Mitsui Engineering Shipbuilding (Tokyo) and Lurgi (Frankfurt), has built a similar plant for BP in the UK, although using different technology. The new plant will require 54,000 m.t./year of methanol, which is available onsite. Carbon monoxide will be delivered from a new plant. The acetic acidmore » unit will joint two other acetic plants in China supplied some time ago by Uhde (Dortmund). SWCC is due to be integrated with two adjacent complexes to form Shanghai Pacific Chemical. Meanwhile, four groups are competing to supply a UOP-process aromatics complex for Jilin Chemical Industrial Corp. They are Toyo Engineering, Lurgi, Lucky/Foster Wheeler, and Eurotechnica. The complex will include plants with annual capacities for 115,000 m.t. of benzene, 90,000 m.t. of ortho-xylene, 93,000 m.t. of mixed xylenes, and 20,000 m.t. of toluene. The plants will form part of a $2-billion petrochemical complex based on a 300,000-m.t./year ethylene plant awarded last year to a consortium of Samsung Engineering and Linde. Downstream plants will have annual capacities for 120,000 m.t. of linear low-density polyethylene, 80,000 m.t. of ethylene oxide, 100,000 m.t. of ethylene glycol, 80,000 m.t. of phenol, 100,000 m.t. of acrylonitrile, 20,000 m.t. of sodium cyanide, 40,000 m.t. of phthalic anhydride, 40,000 m.t. of ethylene propylene rubber, 20,000 m.t. of styrene butadiene styrene, and 30,000 m.t. of acrylic fiber.« less

  6. Cartilage and bone malformations in the head of zebrafish (Danio rerio) embryos following exposure to disulfiram and acetic acid hydrazide

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Strecker, Ruben, E-mail: Ruben.Strecker@cos.uni-heidelberg.de; Weigt, Stefan, E-mail: stefan.weigt@merckgroup.com; Braunbeck, Thomas, E-mail: braunbeck@uni-hd.de

    In order to investigate teratogenic effects, especially on cartilage and bone formation, zebrafish embryos were exposed for 144 h to the dithiocarbamate pesticide disulfiram (20–320 μg/L) and acetic acid hydrazide (0.375–12 g/L), a degradation product of isoniazid. After fixation and full-mount staining, disulfiram could be shown to induce strong cartilage malformations after exposure to ≥ 80 μg/L, whereas acetic acid hydrazide caused cartilage alterations only from 1.5 g/L. Undulating notochords occurred after exposure to disulfiram even at the lowest test concentration of 20 μg/L, whereas at the two lowest concentrations of acetic acid hydrazide (0.375 and 0.75 g/L) mainly fracturesmore » of the notochord were observed. Concentrations of acetic acid hydrazide ≥ 1.5 g/L resulted in undulated notochords similar to disulfiram. Cartilages and ossifications of the cranium, including the cleithrum, were individually analyzed assessing the severity of malformation and the degree of ossification in a semi-quantitative approach. Cartilages of the neurocranium such as the ethmoid plate proved to be more stable than cartilages of the pharyngeal skeleton such as Meckel's cartilage. Hence, ossification proved significantly more susceptible than cartilage. The alterations induced in the notochord as well as in the cranium might well be of ecological relevance, since notochord malformation is likely to result in impaired swimming and cranial malformation might compromise regular food uptake. - Highlights: ► Disulfiram and acetic acid hydrazide as notochord, cartilage and bone teratogens ► Zebrafish embryos to model effects on single cartilages and bones in the head ► LC50 calculation and head length measurements after six days post-fertilization ► Lethality, head length and teratogenic effects are dose-dependent. ► Cartilages of the neurocranium are the most stable elements in the head.« less

  7. Cross ketonization of Cuphea sp. oil with acetic acid over a composite oxide of Fe, Ce, and Al

    USDA-ARS?s Scientific Manuscript database

    The objective of this work was to demonstrate the viability of the cross ketonization reaction with the triacylglycerol from Cuphea sp. and acetic acid in a fixed-bed plug-flow reactor. The seed oil from Cuphea sp. contains up to 71% decanoic acid and the reaction of this fatty acid residue with ac...

  8. Acetic Acid Ketonization over Fe3O4/SiO2 for Pyrolysis Bio-Oil Upgrading.

    PubMed

    Bennett, James A; Parlett, Christopher M A; Isaacs, Mark A; Durndell, Lee J; Olivi, Luca; Lee, Adam F; Wilson, Karen

    2017-05-10

    A family of silica-supported, magnetite nanoparticle catalysts was synthesised and investigated for continuous-flow acetic acid ketonisation as a model pyrolysis bio-oil upgrading reaction. The physico-chemical properties of Fe 3 O 4 /SiO 2 catalysts were characterised by using high-resolution transmission electron microscopy, X-ray absorption spectroscopy, X-ray photo-electron spectroscopy, diffuse reflectance infrared Fourier transform spectroscopy, thermogravimetric analysis and porosimetry. The acid site densities were inversely proportional to the Fe 3 O 4 particle size, although the acid strength and Lewis character were size-invariant, and correlated with the specific activity for the vapour-phase acetic ketonisation to acetone. A constant activation energy (∼110 kJ mol -1 ), turnover frequency (∼13 h -1 ) and selectivity to acetone of 60 % were observed for ketonisation across the catalyst series, which implies that Fe 3 O 4 is the principal active component of Red Mud waste.

  9. Combined application of origanum vulgare l. essential oil and acetic acid for controlling the growth of staphylococcus aureus in foods

    PubMed Central

    de Souza, Evandro Leite; de Barros, Jefferson Carneiro; da Conceição, Maria Lúcia; Neto, Nelson Justino Gomes; da Costa, Ana Caroliny Vieira

    2009-01-01

    This study evaluated the occurrence of an enhancing inhibitory effect of the combined application of Origanum vulgare L. essential oil and acetic acid against Staphylococcus aureus by the determination of Fractional Inhibitory Concentration (FIC) index and kill-time assay in nutrient broth, meat broth and in a food model (meat pieces). Acetic acid showed MIC and MFC of 0.6 and 1.25 μL.mL-1, respectively. For O. vulgare essential oil MIC and MBC were 1.25 and 2.5 μL.mL-1, respectively. FIC indexes of the mixture of essential oil and acetic acid at MIC x ½ were ≤ 1.0, showing an additive effect. No synergy was found at kill-time study. Anti-staphylococcal effect of the antimicrobials alone or in mixture (MIC x ½) was lower in meat than in nutrient and meat broths. The effective combination of essential oils and organic acids could appear as an attractive alternative for the food industry, as the doses to inhibit the microbial growth in foods can be lowered. PMID:24031377

  10. GAS-PHASE SYNTHESIS OF PRECURSORS OF INTERSTELLAR GLYCINE: A COMPUTATIONAL STUDY OF THE REACTIONS OF ACETIC ACID WITH HYDROXYLAMINE AND ITS IONIZED AND PROTONATED DERIVATIVES

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Barrientos, Carmen; Redondo, Pilar; Largo, Laura

    2012-04-01

    A computational study of the reactions of hydroxylamine and its ionized and protonated derivatives with acetic acid is provided. The reaction of neutral hydroxylamine with acetic acid, despite being clearly exothermic, involves a very large energy barrier. The reaction of ionized hydroxylamine with acetic acid is also clearly exothermic, but again a significant energy barrier is found (around 24 kcal mol{sup -1} at the CCSD(T) level). The reaction of the most stable protonated isomer of hydroxylamine, NH{sub 3}OH{sup +}, with acetic acid also involves a high barrier (more than 27 kcal mol{sup -1} at the CCSD(T) level). Only the highermore » energy isomer, NH{sub 2}OH{sup +}{sub 2}, leads to a sensibly lower energy barrier (about 2.3 kcal mol{sup -1} at the CCSD(T) level). Nevertheless, an estimate of the reaction coefficient at low temperatures such as those reigning in the interstellar medium gives very low values. Therefore, it seems that precursors of interstellar glycine could not be efficiently produced from the reactions of hydroxylamine-derived ions with acetic acid.« less

  11. THE INCORPORATION OF ACETATE-1-C14 INTO CHOLESTEROL AND FATTY ACIDS BY SURVIVING TISSUES OF NORMAL AND SCORBUTIC GUINEA PIGS

    PubMed Central

    Bolker, H. I.; Fishman, S.; Heard, R. D. H.; O'Donnell, V. J.; Webb, J. L.; Willis, G. C.

    1956-01-01

    The synthesis of cholesterol and fatty acids from acetate-l-C14 by the isolated liver, adrenal, and aorta of scorbutic and pair-fed control guinea pigs has been studied. It was found that ascorbic acid deficiency does not affect the rate of incorporation of C14-acetate into cholesterol and fatty acids by the tissues investigated, under our experimental conditions. The relatively high metabolic activity of the artery with regard to cholesterogenesis and lipogenesis was noted. The elevation of serum cholesterol and hexosamine in scurvy has been confirmed. PMID:13286427

  12. Isotopic composition of Murchison organic compounds: Intramolecular carbon isotope fractionation of acetic acid. Simulation studies of cosmochemical organic syntheses

    NASA Technical Reports Server (NTRS)

    Yuen, G. U.; Cronin, J. R.; Blair, N. E.; Desmarais, D. J.; Chang, S.

    1991-01-01

    Recently, in our laboratories, samples of Murchison acetic acid were decarboxylated successfully and the carbon isotopic composition was measured for the methane released by this procedure. These analyses showed significant differences in C-13/C-12 ratios for the methyl and carboxyl carbons of the acetic acid molecule, strongly suggesting that more than one carbon source may be involved in the synthesis of the Murchison organic compounds. On the basis of this finding, laboratory model systems simulating cosmochemical synthesis are being studied, especially those processes capable of involving two or more starting carbon sources.

  13. ["Candidatus contubernalis alkalaceticum," an obligately syntrophic alkaliphilic bacterium capable of anaerobic acetate oxidation in a coculture with Desulfonatronum cooperativum].

    PubMed

    Zhilina, T N; Zavarzina, D G; Kolganova, T V; Turova, T P; Zavarzin, G A

    2005-01-01

    From the silty sediments of the Khadyn soda lake (Tuva), a binary sulfidogenic bacterial association capable of syntrophic acetate oxidation at pH 10.0 was isolated. An obligately syntrophic, gram-positive, spore-forming alkaliphilic rod-shaped bacterium performs acetate oxidation in a syntrophic association with a hydrogenotrophic, alkaliphilic sulfate-reducing bacterium; the latter organism was previously isolated and characterized as the new species Desulfonatronum cooperativum. Other sulfate-reducing bacteria of the genera Desulfonatronum and Desulfonatronovibrio can also act as the hydrogenotrophic partner. Apart from acetate, the syntrophic culture can oxidize ethanol, propanol, isopropanol, serine, fructose, and isobutyric acid. Selective amplification of 16S rRNA gene fragments of the acetate-utilizing syntrophic component of the binary culture was performed; it was found to cluster with clones of uncultured gram-positive bacteria within the family Syntrophomonadaceae. The acetate-oxidizing bacterium is thus the first representative of this cluster obtained in a laboratory culture. Based on its phylogenetic position, the new acetate-oxidizing syntrophic bacterium is proposed to be assigned, in a Candidate status, to a new genus and species: "Candidatus Contubernalis alkalaceticum."

  14. The Cytosolic pH of Individual Saccharomyces cerevisiae Cells Is a Key Factor in Acetic Acid Tolerance

    PubMed Central

    Fernández-Niño, Miguel; Marquina, Maribel; Swinnen, Steve; Rodríguez-Porrata, Boris

    2015-01-01

    It was shown recently that individual cells of an isogenic Saccharomyces cerevisiae population show variability in acetic acid tolerance, and this variability affects the quantitative manifestation of the trait at the population level. In the current study, we investigated whether cell-to-cell variability in acetic acid tolerance could be explained by the observed differences in the cytosolic pHs of individual cells immediately before exposure to the acid. Results obtained with cells of the strain CEN.PK113-7D in synthetic medium containing 96 mM acetic acid (pH 4.5) showed a direct correlation between the initial cytosolic pH and the cytosolic pH drop after exposure to the acid. Moreover, only cells with a low initial cytosolic pH, which experienced a less severe drop in cytosolic pH, were able to proliferate. A similar correlation between initial cytosolic pH and cytosolic pH drop was also observed in the more acid-tolerant strain MUCL 11987-9. Interestingly, a fraction of cells in the MUCL 11987-9 population showed initial cytosolic pH values below the minimal cytosolic pH detected in cells of the strain CEN.PK113-7D; consequently, these cells experienced less severe drops in cytosolic pH. Although this might explain in part the difference between the two strains with regard to the number of cells that resumed proliferation, it was observed that all cells from strain MUCL 11987-9 were able to proliferate, independently of their initial cytosolic pH. Therefore, other factors must also be involved in the greater ability of MUCL 11987-9 cells to endure strong drops in cytosolic pH. PMID:26341199

  15. 40 CFR 721.2076 - D-Glucuronic acid, polymer with 6-deoxy-L-mannose and D-glucose, acetate, calcium magnesium...

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ...-deoxy-L-mannose and D-glucose, acetate, calcium magnesium potassium sodium salt. 721.2076 Section 721...-Glucuronic acid, polymer with 6-deoxy-L-mannose and D-glucose, acetate, calcium magnesium potassium sodium... potassium sodium salt (PMN P-00-7; CAS No.125005-87-0) is subject to reporting under this section for the...

  16. 40 CFR 721.2076 - D-Glucuronic acid, polymer with 6-deoxy-L-mannose and D-glucose, acetate, calcium magnesium...

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ...-deoxy-L-mannose and D-glucose, acetate, calcium magnesium potassium sodium salt. 721.2076 Section 721...-Glucuronic acid, polymer with 6-deoxy-L-mannose and D-glucose, acetate, calcium magnesium potassium sodium... potassium sodium salt (PMN P-00-7; CAS No.125005-87-0) is subject to reporting under this section for the...

  17. 40 CFR 721.2076 - D-Glucuronic acid, polymer with 6-deoxy-L-mannose and D-glucose, acetate, calcium magnesium...

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ...-deoxy-L-mannose and D-glucose, acetate, calcium magnesium potassium sodium salt. 721.2076 Section 721...-Glucuronic acid, polymer with 6-deoxy-L-mannose and D-glucose, acetate, calcium magnesium potassium sodium... potassium sodium salt (PMN P-00-7; CAS No.125005-87-0) is subject to reporting under this section for the...

  18. 40 CFR 721.2076 - D-Glucuronic acid, polymer with 6-deoxy-L-mannose and D-glucose, acetate, calcium magnesium...

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ...-deoxy-L-mannose and D-glucose, acetate, calcium magnesium potassium sodium salt. 721.2076 Section 721...-Glucuronic acid, polymer with 6-deoxy-L-mannose and D-glucose, acetate, calcium magnesium potassium sodium... potassium sodium salt (PMN P-00-7; CAS No.125005-87-0) is subject to reporting under this section for the...

  19. Improved ethanol production from xylose in the presence of acetic acid by the overexpression of the HAA1 gene in Saccharomyces cerevisiae.

    PubMed

    Sakihama, Yuri; Hasunuma, Tomohisa; Kondo, Akihiko

    2015-03-01

    The hydrolysis of lignocellulosic biomass liberates sugars, primarily glucose and xylose, which are subsequently converted to ethanol by microbial fermentation. The rapid and efficient fermentation of xylose by recombinant Saccharomyces cerevisiae strains is limited by weak acids generated during biomass pretreatment processes. In particular, acetic acid negatively affects cell growth, xylose fermentation rate, and ethanol production. The ability of S. cerevisiae to efficiently utilize xylose in the presence of acetic acid is an essential requirement for the cost-effective production of ethanol from lignocellulosic hydrolysates. Here, an acetic acid-responsive transcriptional activator, HAA1, was overexpressed in a recombinant xylose-fermenting S. cerevisiae strain to yield BY4741X/HAA1. This strain exhibited improved cell growth and ethanol production from xylose under aerobic and oxygen limited conditions, respectively, in the presence of acetic acid. The HAA1p regulon enhanced transcript levels in BY4741X/HAA1. The disruption of PHO13, a p-nitrophenylphosphatase gene, in BY4741X/HAA1 led to further improvement in both yeast growth and the ability to ferment xylose, indicating that HAA1 overexpression and PHO13 deletion act by different mechanisms to enhance ethanol production. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  20. Hydration of AN Acid Anhydride: the Water Complex of Acetic Sulfuric Anhydride

    NASA Astrophysics Data System (ADS)

    Smith, CJ; Huff, Anna; Mackenzie, Becca; Leopold, Ken

    2017-06-01

    The water complex of acetic sulfuric anhydride (ASA, CH_{3}COOSO_{2}OH) has been observed by pulsed nozzle Fourier transform microwave spectroscopy. ASA is formed in situ in the supersonic jet via the reaction of SO_{3} and acetic acid and subsequently forms a complex with water during the expansion. Spectra of the parent and fully deuterated form, as well as those of the species derived from CH_{3}^{13}COOH, have been observed. The fitted internal rotation barrier of the methyl group is 219.599(21), \\wn indicating the complexation with water lowers the internal rotation barrier of the methyl group by 9% relative to that of free ASA. The observed species is one of several isomers identified theoretically in which the water inserts into the intramolecular hydrogen bond of the ASA. Aspects of the intermolecular potential energy surface are discussed.

  1. Impact of gluconic fermentation of strawberry using acetic acid bacteria on amino acids and biogenic amines profile.

    PubMed

    Ordóñez, J L; Sainz, F; Callejón, R M; Troncoso, A M; Torija, M J; García-Parrilla, M C

    2015-07-01

    This paper studies the amino acid profile of beverages obtained through the fermentation of strawberry purée by a surface culture using three strains belonging to different acetic acid bacteria species (one of Gluconobacter japonicus, one of Gluconobacter oxydans and one of Acetobacter malorum). An HPLC-UV method involving diethyl ethoxymethylenemalonate (DEEMM) was adapted and validated. From the entire set of 21 amino acids, multiple linear regressions showed that glutamine, alanine, arginine, tryptophan, GABA and proline were significantly related to the fermentation process. Furthermore, linear discriminant analysis classified 100% of the samples correctly in accordance with the microorganism involved. G. japonicus consumed glucose most quickly and achieved the greatest decrease in amino acid concentration. None of the 8 biogenic amines were detected in the final products, which could serve as a safety guarantee for these strawberry gluconic fermentation beverages, in this regard. Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. Sensitivity to acetic acid, ability to colonize abiotic surfaces and virulence potential of Listeria monocytogenes EGD-e after incubation on parsley leaves.

    PubMed

    Rieu, A; Guzzo, J; Piveteau, P

    2010-02-01

    To investigate how the survival of Listeria monocytogenes on parsley leaves may affect its ability to sustain process-related harsh conditions and its virulence. Parsley seedlings were spot inoculated with stationary phase cells of L. monocytogenes EGD-e and incubated for 15 days. Each day, bacterial cells were harvested and enumerated, and their ability to survive acetic acid challenge (90 min, pH 4.0), to colonize abiotic surfaces and to grow as biofilms was assessed. After a 3-log decrease over the first 48 h, the population stabilized to about 10(6) CFU g(-1) until the sixth day. After the sixth day, L. monocytogenes was no longer detected, even after specific enrichment. Incubation on parsley leaves affected the ability of L. monocytogenes to survive acetic acid challenge (90 min, pH 4.0) and to adhere to stainless steel although the ability to grow as biofilm was preserved. To further investigate these physiological alterations, the mRNA levels of six target genes (bsh, clpC, groEL, inlA, opuC, prfA) was quantified using reverse transcription qPCR after 5 h of incubation on parsley leaves. A decrease was observed in all but one (bsh) target, including groEL and clpC which are involved in resistance to salt and acid. Moreover, the decrease in the levels of inlA, prfA and opuC transcripts after incubation on parsley suggested a repression of some genes involved in pathogenicity. In vitro assessment of mammalian cell adherence and invasion using Caco-2 cells confirmed the repression of the virulence factor InlA; however, the virulence potential in vivo in the chick embryo model was not affected. Listeria monocytogenes did undergo rapid changes to adapt its physiology to the phyllosphere. This study highlights the physiological changes undergone by L. monocytogenes during/after survival on parsley leaves.

  3. Microbial Electrosynthesis and Anaerobic Fermentation: An Economic Evaluation for Acetic Acid Production from CO2 and CO.

    PubMed

    Christodoulou, Xenia; Velasquez-Orta, Sharon B

    2016-10-18

    Microbial electrosynthesis (MES) and anaerobic fermentation (AF) are two biological processes capable of reducing CO 2 , CO, and water into acetic acid, an essential industrial reagent. In this study, we evaluated investment and production costs of acetic acid via MES and AF, and compared them to industrial chemical processes: methanol carbonylation and ethane direct oxidation. Production and investment costs were found high-priced for MES (1.44 £/kg, 1770 £/t) and AF (4.14 £/kg, 1598 £/t) because of variable and fixed costs and low production yields (100 t/y) compared to methanol carbonylation (0.26 £/kg, 261 £/t) and ethane direct oxidation (0.11 £/kg, 258 £/t). However, integrating AF with MES would reduce the release of CO 2 , double production rates (200 t/y), and decrease investment costs by 9% (1366 £/t). This resulted into setting the production costs at 0.24 £/kg which is currently market competitive (0.48 £/kg). This economically feasible bioprocess produced molar flow rates of 4550 mol per day from MES and AF independently. Our findings offer a bright opportunity toward the use and scale-up of MES and AF for an economically viable acetic acid production process.

  4. The microbiology of Bandji, palm wine of Borassus akeassii from Burkina Faso: identification and genotypic diversity of yeasts, lactic acid and acetic acid bacteria.

    PubMed

    Ouoba, L I I; Kando, C; Parkouda, C; Sawadogo-Lingani, H; Diawara, B; Sutherland, J P

    2012-12-01

    To investigate physicochemical characteristics and especially genotypic diversity of the main culturable micro-organisms involved in fermentation of sap from Borassus akeassii, a newly identified palm tree from West Africa. Physicochemical characterization was performed using conventional methods. Identification of micro-organisms included phenotyping and sequencing of: 26S rRNA gene for yeasts, 16S rRNA and gyrB genes for lactic acid bacteria (LAB) and acetic acid bacteria (AAB). Interspecies and intraspecies genotypic diversities of the micro-organisms were screened respectively by amplification of the ITS1-5.8S rDNA-ITS2/16S-23S rDNA ITS regions and repetitive sequence-based PCR (rep-PCR). The physicochemical characteristics of samples were: pH: 3.48-4.12, titratable acidity: 1.67-3.50 mg KOH g(-1), acetic acid: 0.16-0.37%, alcohol content: 0.30-2.73%, sugars (degrees Brix): 2.70-8.50. Yeast included mainly Saccharomyces cerevisiae and species of the genera Arthroascus, Issatchenkia, Candida, Trichosporon, Hanseniaspora, Kodamaea, Schizosaccharomyces, Trigonopsis and Galactomyces. Lactobacillus plantarum was the predominant LAB species. Three other species of Lactobacillus were also identified as well as isolates of Leuconostoc mesenteroides, Fructobacillus durionis and Streptococcus mitis. Acetic acid bacteria included nine species of the genus Acetobacter with Acetobacter indonesiensis as predominant species. In addition, isolates of Gluconobacter oxydans and Gluconacetobacter saccharivorans were also identified. Intraspecies diversity was observed for some species of micro-organisms including four genotypes for Acet. indonesiensis, three for Candida tropicalis and Lactobacillus fermentum and two each for S. cerevisiae, Trichosporon asahii, Candida pararugosa and Acetobacter tropicalis. fermentation of palm sap from B. akeassii involved multi-yeast-LAB-AAB cultures at genus, species and intraspecies level. First study describing microbiological and

  5. Molecular identification and physiological characterization of yeasts, lactic acid bacteria and acetic acid bacteria isolated from heap and box cocoa bean fermentations in West Africa.

    PubMed

    Visintin, Simonetta; Alessandria, Valentina; Valente, Antonio; Dolci, Paola; Cocolin, Luca

    2016-01-04

    Yeast, lactic acid bacteria (LAB) and acetic acid bacteria (AAB) populations, isolated from cocoa bean heap and box fermentations in West Africa, have been investigated. The fermentation dynamicswere determined by viable counts, and 106 yeasts, 105 LAB and 82 AAB isolateswere identified by means of rep-PCR grouping and sequencing of the rRNA genes. During the box fermentations, the most abundant species were Saccharomyces cerevisiae, Candida ethanolica, Lactobacillus fermentum, Lactobacillus plantarum, Acetobacter pasteurianus and Acetobacter syzygii, while S. cerevisiae, Schizosaccharomyces pombe, Hanseniaspora guilliermondii, Pichia manshurica, C. ethanolica, Hanseniaspora uvarum, Lb. fermentum, Lb. plantarum, A. pasteurianus and Acetobacter lovaniensis were identified in the heap fermentations. Furthermore, the most abundant species were molecularly characterized by analyzing the rep-PCR profiles. Strains grouped according to the type of fermentations and their progression during the transformation process were also highlighted. The yeast, LAB and AAB isolates were physiologically characterized to determine their ability to grow at different temperatures, as well as at different pH, and ethanol concentrations, tolerance to osmotic stress, and lactic acid and acetic acid inhibition. Temperatures of 45 °C, a pH of 2.5 to 3.5, 12% (v/v) ethanol and high concentrations of lactic and acetic acid have a significant influence on the growth of yeasts, LAB and AAB. Finally, the yeastswere screened for enzymatic activity, and the S. cerevisiae, H. guilliermondii, H. uvarumand C. ethanolica species were shown to possess several enzymes that may impact the quality of the final product.

  6. Fermentation of alfalfa wet-fractionation liquids to volatile fatty acids by Streptococcus bovis and Megasphaera elsdenii

    USDA-ARS?s Scientific Manuscript database

    A “green juice”, obtained by squeezing freshly harvested alfalfa leaves amended with a commercial lactic acid bacterial inoculant, was readily fermented by 7- to 21-d incubation at room temperature to obtain lactic acid at concentrations of 12-46 g l-1, along with additional acetic and succinic acid...

  7. Competitive fragmentation pathways of acetic acid dimer explored by synchrotron VUV photoionization mass spectrometry and electronic structure calculations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Guan Jiwen; Hu Yongjun; Zou Hao

    2012-09-28

    In present study, photoionization and dissociation of acetic acid dimers have been studied with the synchrotron vacuum ultraviolet photoionization mass spectrometry and theoretical calculations. Besides the intense signal corresponding to protonated cluster ions (CH{sub 3}COOH){sub n}{center_dot}H{sup +}, the feature related to the fragment ions (CH{sub 3}COOH)H{sup +}{center_dot}COO (105 amu) via {beta}-carbon-carbon bond cleavage is observed. By scanning photoionization efficiency spectra, appearance energies of the fragments (CH{sub 3}COOH){center_dot}H{sup +} and (CH{sub 3}COOH)H{sup +}{center_dot}COO are obtained. With the aid of theoretical calculations, seven fragmentation channels of acetic acid dimer cations were discussed, where five cation isomers of acetic acid dimer are involved.more » While four of them are found to generate the protonated species, only one of them can dissociate into a C-C bond cleavage product (CH{sub 3}COOH)H{sup +}{center_dot}COO. After surmounting the methyl hydrogen-transfer barrier 10.84 {+-} 0.05 eV, the opening of dissociative channel to produce ions (CH{sub 3}COOH){sup +} becomes the most competitive path. When photon energy increases to 12.4 eV, we also found dimer cations can be fragmented and generate new cations (CH{sub 3}COOH){center_dot}CH{sub 3}CO{sup +}. Kinetics, thermodynamics, and entropy factors for these competitive dissociation pathways are discussed. The present report provides a clear picture of the photoionization and dissociation processes of the acetic acid dimer in the range of the photon energy 9-15 eV.« less

  8. Antibacterial effect of roselle extracts (Hibiscus sabadariffa), sodium hypochlorite and acetic acid against multidrug-resistant Salmonella strains isolated from tomatoes.

    PubMed

    Gutiérrez-Alcántara, E J; Rangel-Vargas, E; Gómez-Aldapa, C A; Falfan-Cortes, R N; Rodríguez-Marín, M L; Godínez-Oviedo, A; Cortes-López, H; Castro-Rosas, J

    2016-02-01

    Antibiotic-resistant Salmonella strains were isolated from saladette and red round type tomatoes, and an analysis done of the antibacterial activity of roselle calyx extracts against any of the identified strains. One hundred saladette tomato samples and 100 red round tomato samples were collected from public markets. Each sample consisted of four whole tomatoes. Salmonella was isolated from the samples by conventional culture procedure. Susceptibility to 16 antibiotics was tested for the isolated Salmonella strains by standard test. The antibacterial effect of four roselle calyx extracts (water, methanol, acetone and ethyl acetate), sodium hypochlorite and acetic acid against antibiotic-resistant Salmonella isolates was evaluated on contaminated tomatoes. Twenty-four Salmonella strains were isolated from 12% of each tomato type. Identified Salmonella serotypes were Typhimurium and Typhi. All isolated strains exhibited resistance to at least three antibiotics and some to as many as 12. Over contaminated tomatoes, the roselle calyx extracts produced a greater reduction (2-2·6 log) in antibiotic-resistant Salmonella strain concentration than sodium hypochlorite and acetic acid. The presence of multidrug-resistant Salmonella in vegetables is a significant public health concern. Multidrug-resistant Salmonella strains were isolated from raw tomatoes purchased in public markets in Mexico and challenged with roselle Hibiscus sabdariffa calyx extracts, sodium hypochlorite and acetic acid. On tomatoes, the extracts caused a greater reduction in the concentration of antibiotic-resistant Salmonella strains than sodium hypochlorite and acetic acid. Roselle calyx extracts are a potentially useful addition to disinfection procedures of raw tomatoes in the field, processing plants, restaurants and homes. © 2015 The Society for Applied Microbiology.

  9. Elimination of glycerol production in anaerobic cultures of a Saccharomyces cerevisiae strain engineered to use acetic acid as an electron acceptor.

    PubMed

    Guadalupe Medina, Víctor; Almering, Marinka J H; van Maris, Antonius J A; Pronk, Jack T

    2010-01-01

    In anaerobic cultures of wild-type Saccharomyces cerevisiae, glycerol production is essential to reoxidize NADH produced in biosynthetic processes. Consequently, glycerol is a major by-product during anaerobic production of ethanol by S. cerevisiae, the single largest fermentation process in industrial biotechnology. The present study investigates the possibility of completely eliminating glycerol production by engineering S. cerevisiae such that it can reoxidize NADH by the reduction of acetic acid to ethanol via NADH-dependent reactions. Acetic acid is available at significant amounts in lignocellulosic hydrolysates of agricultural residues. Consistent with earlier studies, deletion of the two genes encoding NAD-dependent glycerol-3-phosphate dehydrogenase (GPD1 and GPD2) led to elimination of glycerol production and an inability to grow anaerobically. However, when the E. coli mhpF gene, encoding the acetylating NAD-dependent acetaldehyde dehydrogenase (EC 1.2.1.10; acetaldehyde+NAD++coenzyme A<-->acetyl coenzyme A+NADH+H+), was expressed in the gpd1Delta gpd2Delta strain, anaerobic growth was restored by supplementation with 2.0 g liter(-1) acetic acid. The stoichiometry of acetate consumption and growth was consistent with the complete replacement of glycerol formation by acetate reduction to ethanol as the mechanism for NADH reoxidation. This study provides a proof of principle for the potential of this metabolic engineering strategy to improve ethanol yields, eliminate glycerol production, and partially convert acetate, which is a well-known inhibitor of yeast performance in lignocellulosic hydrolysates, to ethanol. Further research should address the kinetic aspects of acetate reduction and the effect of the elimination of glycerol production on cellular robustness (e.g., osmotolerance).

  10. Isolation of a high malic and low acetic acid-producing sake yeast Saccharomyces cerevisiae strain screened from respiratory inhibitor 2,4-dinitrophenol (DNP)-resistant strains.

    PubMed

    Kosugi, Shingo; Kiyoshi, Keiji; Oba, Takahiro; Kusumoto, Kenichi; Kadokura, Toshimori; Nakazato, Atsumi; Nakayama, Shunichi

    2014-01-01

    We isolated 2,4-dinitrophenol (DNP)-resistant sake yeast strains by UV mutagenesis. Among the DNP-resistant mutants, we focused on strains exhibiting high malic acid and low acetic acid production. The improved organic acid composition is unlikely to be under the control of enzyme activities related to malic and acetic acid synthesis pathways. Instead, low mitochondrial activity was observed in DNP-resistant mutants, indicating that the excess pyruvic acid generated during glycolysis is not metabolized in the mitochondria but converted to malic acid in the cytosol. In addition, the NADH/NAD(+) ratio of the DNP-resistant strains was higher than that of the parental strain K901. These results suggest that the increased NADH/NAD(+) ratio together with the low mitochondrial activity alter the organic acid composition because malic acid synthesis requires NADH, while acetic acid uses NAD(+). Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  11. Reducing bacterial contamination in fuel ethanol fermentations by ozone treatment of uncooked corn mash.

    PubMed

    Rasmussen, Mary L; Koziel, Jacek A; Jane, Jay-lin; Pometto, Anthony L

    2015-06-03

    Ozonation of uncooked corn mash from the POET BPX process was investigated as a potential disinfection method for reducing bacterial contamination prior to ethanol fermentation. Corn mash (200 g) was prepared from POET ground corn and POET corn slurry and was ozonated in 250 mL polypropylene bottles. Lactic and acetic acid levels were monitored daily during the fermentation of ozonated, aerated, and nontreated corn mash samples to evaluate bacterial activity. Glycerol and ethanol contents of fermentation samples were checked daily to assess yeast activity. No yeast supplementation, no addition of other antimicrobial agents (such as antibiotics), and spiking with a common lactic acid bacterium found in corn ethanol plants, Lactobacillus plantarum, amplified the treatment effects. The laboratory-scale ozone dosages ranged from 26-188 mg/L, with very low estimated costs of $0.0008-0.006/gal ($0.21-1.6/m(3)) of ethanol. Ozonation was found to decrease the initial pH of ground corn mash samples, which could reduce the sulfuric acid required to adjust the pH prior to ethanol fermentation. Lactic and acetic acid levels tended to be lower for samples subjected to increasing ozone dosages, indicating less bacterial activity. The lower ozone dosages in the range applied achieved higher ethanol yields. Preliminary experiments on ozonating POET corn slurry at low ozone dosages were not as effective as using POET ground corn, possibly because corn slurry samples contained recycled antimicrobials from the backset. The data suggest additional dissolved and suspended organic materials from the backset consumed the ozone or shielded the bacteria.

  12. The complexity of Orion: an ALMA view. II. gGg'-ethylene glycol and acetic acid

    NASA Astrophysics Data System (ADS)

    Favre, C.; Pagani, L.; Goldsmith, P. F.; Bergin, E. A.; Carvajal, M.; Kleiner, I.; Melnick, G.; Snell, R.

    2017-07-01

    We report the first detection and high angular resolution (1.8″× 1.1″) imaging of acetic acid (CH3COOH) and gGg'-ethylene glycol (gGg'(CH2OH)2) toward the Orion Kleinmann-Low (Orion-KL) nebula. The observations were carried out at 1.3 mm with ALMA during Cycle 2. A notable result is that the spatial distribution of the acetic acid and ethylene glycol emission differs from that of the other O-bearing molecules within Orion-KL. While the typical emission of O-bearing species harbors a morphology associated with a V-shape linking the hot core region to the compact ridge (with an extension toward the BN object), the emission of acetic acid and ethylene glycol mainly peaks at about 2'' southwest from the hot core region (near sources I and n). We find that the measured CH3COOH:aGg'(CH2OH)2 and CH3COOH:gGg'(CH2OH)2 ratios differ from those measured toward the low-mass protostar IRAS 16293-2422 by more than one order of magnitude. Our best hypothesis to explain these findings is that CH3COOH, aGg'(CH2OH)2, and gGg'(CH2OH)2 are formed on the icy surface of grains and are then released into the gas-phase via co-desorption with water, by way of a bullet of matter ejected during the explosive event that occurred in the heart of the nebula about 500-700 yr ago.

  13. GENE EXPRESSION PATTERNS OF CD-1 DAY-8 EMBRYO CULTURES EXPOSED TO BROMOCHLORO ACETIC ACID

    EPA Science Inventory

    Gene expression patterns of CD-1 day-8 embryo cultures exposed to bromochloro acetic acid

    Edward D. Karoly?*, Judith E. Schmid* and E. Sidney Hunter III*
    ?Curriculum in Toxicology, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina and *Reproductiv...

  14. 21 CFR 184.1721 - Sodium acetate.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Sodium acetate. 184.1721 Section 184.1721 Food and....1721 Sodium acetate. (a) Sodium acetate (C2H3O2Na, CAS Reg. No. 127-09-3 or C2H3O2Na·3H2O, CAS Reg. No. 6131-90-4) is the sodium salt of acetic acid and occurs naturally in plant and animal tissues. Sodium...

  15. The Cytosolic pH of Individual Saccharomyces cerevisiae Cells Is a Key Factor in Acetic Acid Tolerance.

    PubMed

    Fernández-Niño, Miguel; Marquina, Maribel; Swinnen, Steve; Rodríguez-Porrata, Boris; Nevoigt, Elke; Ariño, Joaquín

    2015-11-01

    It was shown recently that individual cells of an isogenic Saccharomyces cerevisiae population show variability in acetic acid tolerance, and this variability affects the quantitative manifestation of the trait at the population level. In the current study, we investigated whether cell-to-cell variability in acetic acid tolerance could be explained by the observed differences in the cytosolic pHs of individual cells immediately before exposure to the acid. Results obtained with cells of the strain CEN.PK113-7D in synthetic medium containing 96 mM acetic acid (pH 4.5) showed a direct correlation between the initial cytosolic pH and the cytosolic pH drop after exposure to the acid. Moreover, only cells with a low initial cytosolic pH, which experienced a less severe drop in cytosolic pH, were able to proliferate. A similar correlation between initial cytosolic pH and cytosolic pH drop was also observed in the more acid-tolerant strain MUCL 11987-9. Interestingly, a fraction of cells in the MUCL 11987-9 population showed initial cytosolic pH values below the minimal cytosolic pH detected in cells of the strain CEN.PK113-7D; consequently, these cells experienced less severe drops in cytosolic pH. Although this might explain in part the difference between the two strains with regard to the number of cells that resumed proliferation, it was observed that all cells from strain MUCL 11987-9 were able to proliferate, independently of their initial cytosolic pH. Therefore, other factors must also be involved in the greater ability of MUCL 11987-9 cells to endure strong drops in cytosolic pH. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  16. Pipecolic acid enhances resistance to bacterial infection and primes salicylic acid and nicotine accumulation in tobacco

    PubMed Central

    Vogel-Adghough, Drissia; Stahl, Elia; Návarová, Hana; Zeier, Jürgen

    2013-01-01

    Distinct amino acid metabolic pathways constitute integral parts of the plant immune system. We have recently identified pipecolic acid (Pip), a lysine-derived non-protein amino acid, as a critical regulator of systemic acquired resistance (SAR) and basal immunity to bacterial infection in Arabidopsis thaliana. In Arabidopsis, Pip acts as an endogenous mediator of defense amplification and priming. For instance, Pip conditions plants for effective biosynthesis of the phenolic defense signal salicylic acid (SA), accumulation of the phytoalexin camalexin, and expression of defense-related genes. Here, we show that tobacco plants respond to leaf infection by the compatible bacterial pathogen Pseudomonas syringae pv tabaci (Pstb) with a significant accumulation of several amino acids, including Lys, branched-chain, aromatic, and amide group amino acids. Moreover, Pstb strongly triggers, alongside the biosynthesis of SA and increases in the defensive alkaloid nicotine, the production of the Lys catabolites Pip and α-aminoadipic acid. Exogenous application of Pip to tobacco plants provides significant protection to infection by adapted Pstb or by non-adapted, hypersensitive cell death-inducing P. syringae pv maculicola. Pip thereby primes tobacco for rapid and strong accumulation of SA and nicotine following bacterial infection. Thus, our study indicates that the role of Pip as an amplifier of immune responses is conserved between members of the rosid and asterid groups of eudicot plants and suggests a broad practical applicability for Pip as a natural enhancer of plant disease resistance. PMID:24025239

  17. Performance, kinetics, and equilibrium of methylene blue adsorption on biochar derived from eucalyptus saw dust modified with citric, tartaric, and acetic acids.

    PubMed

    Sun, Lei; Chen, Dongmei; Wan, Shungang; Yu, Zebin

    2015-12-01

    Biochar derived from eucalyptus saw dust modified with citric, tartaric, and acetic acids at low temperatures was utilized as adsorbent to remove methylene blue (MB) from aqueous solutions. Fourier transform infrared spectroscopy analysis showed that the carboxyl group was introduced on the biochar surface. Adsorption experiment data indicated that eucalyptus saw dust modified with citric acid showed higher MB adsorption efficiency than that modified with tartaric and acetic acids. Pseudo-second-order kinetics was the most suitable model for describing MB adsorption on biochar compared with pseudo-first-order, Elovich, and intraparticle diffusion models. The calculated values of ΔG(0) and ΔH(0) indicated the spontaneous and endothermic nature of the adsorption process. MB adsorption on biochar followed the Langmuir isotherm. The maximum adsorption capacities for eucalyptus saw dust modified with citric, tartaric, and acetic acids were 178.57, 99.01, and 29.94 mg g(-1), respectively, at 35°C. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Application of activated carbon modified by acetic acid in adsorption and separation of CO2 and CH4

    NASA Astrophysics Data System (ADS)

    Song, Xue; Wang, Li'ao; Zeng, Yunmin; Zhan, Xinyuan; Gong, Jian; Li, Tong

    2018-03-01

    Compared with the methods to modify the activated carbons by alkalis for gas adsorption, fewer studies of that by organic acids have been reported. The acid modified activated carbons are usually utilized to treat wastewater, whereas the application in the separation of CO2/CH4 has less been studied. In this study, acetic acid was used to modify activated carbon. N2 adsorption/desorption isotherms and FT-IR were adopted to describe the properties of the samples. According to the adsorption data of pure gas component at 298 K, the gas adsorbed amount and the selectivity on the modified samples were larger than that on the raw sample. Besides, the adsorbed amount of CO2 and the selectivity on 15H-AC in the adsorption breakthrough experiments showed better performance. The results confirm that the method to modify the activated carbons with acetic acid is feasible to improve the adsorption capacity and the separation effect of CO2/CH4.

  19. Conductive iron oxides accelerate thermophilic methanogenesis from acetate and propionate.

    PubMed

    Yamada, Chihaya; Kato, Souichiro; Ueno, Yoshiyuki; Ishii, Masaharu; Igarashi, Yasuo

    2015-06-01

    Anaerobic digester is one of the attractive technologies for treatment of organic wastes and wastewater, while continuous development and improvements on their stable operation with efficient organic removal are required. Particles of conductive iron oxides (e.g., magnetite) are known to facilitate microbial interspecies electron transfer (termed as electric syntrophy). Electric syntrophy has been reported to enhance methanogenic degradation of organic acids by mesophilic communities in soil and anaerobic digester. Here we investigated the effects of supplementation of conductive iron oxides (magnetite) on thermophilic methanogenic microbial communities derived from a thermophilic anaerobic digester. Supplementation of magnetite accelerated methanogenesis from acetate and propionate under thermophilic conditions, while supplementation of ferrihydrite also accelerated methanogenesis from propionate. Microbial community analysis revealed that supplementation of magnetite drastically changed bacterial populations in the methanogenic acetate-degrading cultures, in which Tepidoanaerobacter sp. and Coprothermobacter sp. dominated. These results suggest that supplementation of magnetite induce electric syntrophy between organic acid-oxidizing bacteria and methanogenic archaea and accelerate methanogenesis even under thermophilic conditions. Findings from this study would provide a possibility for the achievement of stably operating thermophilic anaerobic digestion systems with high efficiency for removal of organics and generation of CH4. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  20. Brettanomyces acidodurans sp. nov., a new acetic acid producing yeast species from olive oil.

    PubMed

    Péter, Gábor; Dlauchy, Dénes; Tóbiás, Andrea; Fülöp, László; Podgoršek, Martina; Čadež, Neža

    2017-05-01

    Two yeast strains representing a hitherto undescribed yeast species were isolated from olive oil and spoiled olive oil originating from Spain and Israel, respectively. Both strains are strong acetic acid producers, equipped with considerable tolerance to acetic acid. The cultures are not short-lived. Cellobiose is fermented as well as several other sugars. The sequences of their large subunit (LSU) rRNA gene D1/D2 domain are very divergent from the sequences available in the GenBank. They differ from the closest hit, Brettanomyces naardenensis by about 27%, mainly substitutions. Sequence analyses of the concatenated dataset from genes of the small subunit (SSU) rRNA, LSU rRNA and translation elongation factor-1α (EF-1α) placed the two strains as an early diverging member of the Brettanomyces/Dekkera clade with high bootstrap support. Sexual reproduction was not observed. The name Brettanomyces acidodurans sp. nov. (holotype: NCAIM Y.02178 T ; isotypes: CBS 14519 T  = NRRL Y-63865 T  = ZIM 2626 T , MycoBank no.: MB 819608) is proposed for this highly divergent new yeast species.

  1. Papanicolaou stain: Is it economical to switch to rapid, economical, acetic acid, papanicolaou stain?

    PubMed

    Dighe, Swati B; Ajit, Dulhan; Pathuthara, Saleem; Chinoy, Roshni

    2006-01-01

    To standardize an inexpensive and rapid Papanicolaou staining technique with limited ethanol usage. Smears from 200 patients were collected (2 per patient) and fixed in methanol. Half were subjected to conventional Papanicolaou and half to stain ing with rapid, economical, acetic acid Papanicolaou (REAP) stain. In REAP, pre-OG6 and post-OG6 and post-EA36 ethanol baths were replaced by 1% acetic acid and Scott's tap water with tap water. Hematoxylin was preheated to 60 degrees C. Final dehydration was with methanol. REAP smears were compared with Papanicolaou smears for optimal cytoplasmic and nuclear staining, stain preservation, cost and turnaround time. With the REAP method, cytoplasmic and nuclear staining was optimal in 181 and 192 cases, respectively. The staining time was considerably reduced, to 3 minutes, and the cost per smear was reduced to one fourth. The staining quality remained good in all the smears for > 2 years. REAP is a rapid, cost-effective alternative to Papanicolaou stain. Though low stain penetration in large cell clusters is a limitation, final interpretation was not compromised.

  2. Production of bio-oil rich in acetic acid and phenol from fast pyrolysis of palm residues using a fluidized bed reactor: Influence of activated carbons.

    PubMed

    Jeong, Jae-Yong; Lee, Uen-Do; Chang, Won-Seok; Jeong, Soo-Hwa

    2016-11-01

    In this study, palm residues were pyrolyzed in a bench-scale (3kg/h) fast pyrolysis plant equipped with a fluidized bed reactor and bio-oil separation system for the production of bio-oil rich in acetic acid and phenol. Pyrolysis experiments were performed to investigate the effects of reaction temperature and the types and amounts of activated carbon on the bio-oil composition. The maximum bio-oil yield obtained was approximately 47wt% at a reaction temperature of 515°C. The main compounds produced from the bio-oils were acetic acid, hydroxyacetone, phenol, and phenolic compounds such as cresol, xylenol, and pyrocatechol. When coal-derived activated carbon was applied, the acetic acid and phenol yields in the bio-oils reached 21 and 19wt%, respectively. Finally, bio-oils rich in acetic acid and phenol could be produced separately by using an in situ bio-oil separation system and activated carbon as an additive. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. 40 CFR 721.304 - Acetic acid, [(5-chloro-8-quinolinyl)oxy-], 1-methyl hexyl ester.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... PROTECTION AGENCY (CONTINUED) TOXIC SUBSTANCES CONTROL ACT SIGNIFICANT NEW USES OF CHEMICAL SUBSTANCES Significant New Uses for Specific Chemical Substances § 721.304 Acetic acid, [(5-chloro-8-quinolinyl)oxy-], 1-methyl hexyl ester. (a) Chemical substance and significant new uses subject to reporting. (1) The...

  4. Dynamics and Biodiversity of Populations of Lactic Acid Bacteria and Acetic Acid Bacteria Involved in Spontaneous Heap Fermentation of Cocoa Beans in Ghana▿

    PubMed Central

    Camu, Nicholas; De Winter, Tom; Verbrugghe, Kristof; Cleenwerck, Ilse; Vandamme, Peter; Takrama, Jemmy S.; Vancanneyt, Marc; De Vuyst, Luc

    2007-01-01

    The Ghanaian cocoa bean heap fermentation process was studied through a multiphasic approach, encompassing both microbiological and metabolite target analyses. A culture-dependent (plating and incubation, followed by repetitive-sequence-based PCR analyses of picked-up colonies) and culture-independent (denaturing gradient gel electrophoresis [DGGE] of 16S rRNA gene amplicons, PCR-DGGE) approach revealed a limited biodiversity and targeted population dynamics of both lactic acid bacteria (LAB) and acetic acid bacteria (AAB) during fermentation. Four main clusters were identified among the LAB isolated: Lactobacillus plantarum, Lactobacillus fermentum, Leuconostoc pseudomesenteroides, and Enterococcus casseliflavus. Other taxa encompassed, for instance, Weissella. Only four clusters were found among the AAB identified: Acetobacter pasteurianus, Acetobacter syzygii-like bacteria, and two small clusters of Acetobacter tropicalis-like bacteria. Particular strains of L. plantarum, L. fermentum, and A. pasteurianus, originating from the environment, were well adapted to the environmental conditions prevailing during Ghanaian cocoa bean heap fermentation and apparently played a significant role in the cocoa bean fermentation process. Yeasts produced ethanol from sugars, and LAB produced lactic acid, acetic acid, ethanol, and mannitol from sugars and/or citrate. Whereas L. plantarum strains were abundant in the beginning of the fermentation, L. fermentum strains converted fructose into mannitol upon prolonged fermentation. A. pasteurianus grew on ethanol, mannitol, and lactate and converted ethanol into acetic acid. A newly proposed Weissella sp., referred to as “Weissella ghanaensis,” was detected through PCR-DGGE analysis in some of the fermentations and was only occasionally picked up through culture-based isolation. Two new species of Acetobacter were found as well, namely, the species tentatively named “Acetobacter senegalensis” (A. tropicalis-like) and

  5. Preparation and Adsorption Property of Imido-acetic Acid Type Chelating Nano-fibers by Electro-spinning Technique

    NASA Astrophysics Data System (ADS)

    Yang, Jiali; Lu, Lansi; Zhang, Zhu; Liao, Minhui; He, Huirong; Li, Lingxing; Chen, Jida; Chen, Shijin

    2017-12-01

    A novel nano-fibrous adsorbent from imino-acetic acid (IDA) and polyvinyl alcohol (PVA) mixture solution was prepared by electro-spinning technique. The nano-fibrous adsorbents with imino-acetic acid functional groups were characterized and demonstrated by fourier transform infrared spectrometry (FT-IR) and the scanning electron microscopy (SEM). The effect of the adsorbents to remove heavy metals such as lead (Pb) and copper (Cu) ions from the aqueous solution was studied. The maximum adsorption percentage (SP) of the metal ions can reach 93.08% for Cu (II) and 96.69% for Pb(II), respectively. Furthermore, it shows that the adsorption procedure of the adsorbents is spontaneous and endothermic, and adsorption rate fits well with pseudo-second-order kinetic model. Most importantly, the reusability of the nanofibers for removal of metal ions was also demonstrated to be used at least five times.

  6. Relative Reactivity Measurements of Stabilized CH2OO, Produced by Ethene Ozonolysis, Toward Acetic Acid and Water Vapor Using Chemical Ionization Mass Spectrometry.

    PubMed

    Yajima, Ryoji; Sakamoto, Yosuke; Inomata, Satoshi; Hirokawa, Jun

    2017-08-31

    We investigated the relative reactivity of stabilized CH 2 OO, produced by ethene ozonolysis, toward acetic acid and water vapor at a temperature of 298 ± 2 K and atmospheric pressure. Hydroperoxymethyl acetate produced through the reaction between stabilized CH 2 OO and acetic acid was monitored using a chemical ionization mass spectrometer as a function of the acetic acid concentration at different relative humidities. The rate of the reaction between CH 2 OO and water vapor depended quadratically on the water vapor concentration, suggesting that CH 2 OO reacted with water dimers in preference to water monomers. We obtained the bimolecular rate constant for the reaction between CH 2 OO and water dimer relative to the rate constant for the reaction between CH 2 OO and acetic acid, k 3 /k 1 , of (6.3 ± 0.4) × 10 -2 . The k 3 value of (8.2 ± 0.8) × 10 -12 cm 3 molecule -1 s -1 was derived by combining with a k 1 value of (1.3 ± 0.1) × 10 -10 cm 3 molecule -1 s -1 , which has been previously reported by direct kinetic studies. The k 3 value thus obtained is consistent with the absolute rate constants measured directly, suggesting that the reactivity of CH 2 OO is irrespective of the CH 2 OO generation method, namely, ethene ozonolysis or diiodomethane photolysis. We indirectly determined the yield of stabilized CH 2 OO from the ozonolysis of ethene of 0.59 ± 0.17 and 0.55 ± 0.16 under dry and humid (relative humidity 23-24%) conditions, respectively, suggesting that the yield is independent of the water vapor concentration. Our results suggest that hydroperoxymethyl acetate is the sole product of the reaction between stabilized CH 2 OO and acetic acid. The approach presented here can likely be extended to studies of the reactivities of more complicated and atmospherically relevant stabilized Criegee intermediates.

  7. Needle trap extraction for GC analysis of formic and acetic acids in aqueous solution.

    PubMed

    Lee, Xinqing; Huang, Daikuan; Lou, Dawei; Pawliszyn, Janusz

    2012-07-01

    Formic and acetic acids are ubiquitous in the environment, food, and most of the natural products. Extraction of the acids from aqueous solution is required for their isotope analysis by the gas chromatography-isotope ratio mass spectrometry. To this objective, we have previously developed a purge-and-trap technique using the dynamic solid-phase microextraction technology, the NeedlEX. The extraction efficiency, however, remains unexamined. Here, we address this question using the flame ionization detector and isotope ratio mass spectrometer while comparing it with that of the CAR/PDMS fiber. The results show that the NeedlEX is applicable at a wide range of concentration through coordination of purge volume given the minimum amount 3.7 ng and 1.8 ng of formic and acetic, respectively, is extracted. The efficiency of NeedlEX was 6-7 times lower than the fiber at 1000 μg/mL depending on the analyte. It is, however, superior to the latter at 10 μg/mL or less owing to its lower detection limit. The extraction efficiency of both acids is equivalent in molar amount. This is, however, disguised by the different response of the flame ionization detector. The isotope ratio mass spectrometor overcomes this problem but is compromised by relatively large errors. These results are particularly useful for isotopic analysis of carboxylic acids. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Improved growth and ethanol fermentation of Saccharomyces cerevisiae in the presence of acetic acid by overexpression of SET5 and PPR1.

    PubMed

    Zhang, Ming-Ming; Zhao, Xin-Qing; Cheng, Cheng; Bai, Feng-Wu

    2015-12-01

    To better understand the contribution of zinc-finger proteins to environmental stress tolerance, particularly inhibition from acetic acid, which is a potent inhibitor for cellulosic ethanol production by microbial fermentations, SET5 and PPR1 were overexpressed in Saccharomyces cerevisiae BY4741. With 5 g/L acetic acid addition, engineered strains BY4741/SET5 and BY4741/PPR1 showed improved growth and enhanced ethanol fermentation performance compared to that with the control strain. Similar results were also observed in ethanol production using corn stover hydrolysate. Further studies indicated that SET5 and PPR1 overexpression in S. cerevisiae significantly improved activities of antioxidant enzymes and ATP generation in the presence of acetic acid, and consequently decreased intracellular accumulation of reactive oxygen species (50.9 and 45.7%, respectively). These results revealed the novel functions of SET5 and PPR1 for the improvement of yeast acetic acid tolerance, and also implicated the involvement of these proteins in oxidative stress defense and energy metabolism in S. cerevisiae. This work also demonstrated that overexpression of SET5 and PPR1 would be a feasible strategy to increase cellulosic ethanol production efficiency. Copyright © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. 21 CFR 184.1721 - Sodium acetate.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Sodium acetate. 184.1721 Section 184.1721 Food and... Substances Affirmed as GRAS § 184.1721 Sodium acetate. (a) Sodium acetate (C2H3O2Na, CAS Reg. No. 127-09-3 or C2H3O2Na·3H2O, CAS Reg. No. 6131-90-4) is the sodium salt of acetic acid and occurs naturally in plant and...

  10. 21 CFR 184.1721 - Sodium acetate.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Sodium acetate. 184.1721 Section 184.1721 Food and... Substances Affirmed as GRAS § 184.1721 Sodium acetate. (a) Sodium acetate (C2H3O2Na, CAS Reg. No. 127-09-3 or C2H3O2Na·3H2O, CAS Reg. No. 6131-90-4) is the sodium salt of acetic acid and occurs naturally in plant and...

  11. 21 CFR 184.1721 - Sodium acetate.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Sodium acetate. 184.1721 Section 184.1721 Food and... Substances Affirmed as GRAS § 184.1721 Sodium acetate. (a) Sodium acetate (C2H3O2Na, CAS Reg. No. 127-09-3 or C2H3O2Na·3H2O, CAS Reg. No. 6131-90-4) is the sodium salt of acetic acid and occurs naturally in plant and...

  12. 21 CFR 184.1721 - Sodium acetate.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 3 2011-04-01 2011-04-01 false Sodium acetate. 184.1721 Section 184.1721 Food and... Substances Affirmed as GRAS § 184.1721 Sodium acetate. (a) Sodium acetate (C2H3O2Na, CAS Reg. No. 127-09-3 or C2H3O2Na·3H2O, CAS Reg. No. 6131-90-4) is the sodium salt of acetic acid and occurs naturally in plant and...

  13. Identification of human-selective analogues of the vascular-disrupting agent 5,6-dimethylxanthenone-4-acetic acid (DMXAA)

    PubMed Central

    Tijono, S M; Guo, K; Henare, K; Palmer, B D; Wang, L-C S; Albelda, S M; Ching, L-M

    2013-01-01

    Background: Species selectivity of DMXAA (5,6-dimethylxanthenone-4-acetic acid, Vadimezan) for murine cells over human cells could explain in part the recent disappointing phase III trials clinical results when preclinical studies were so promising. To identify analogues with greater human clinical potential, we compared the activity of xanthenone-4-acetic acid (XAA) analogues in murine or human cellular models. Methods: Analogues with a methyl group systematically substituted at different positions of the XAA backbone were evaluated for cytokine induction in cultured murine or human leukocytes; and for anti-vascular effects on endothelial cells on matrigel. In vivo antitumour activity and cytokine production by stromal or cancer cells was measured in human A375 and HCT116 xenografts. Results: Mono-methyl XAA analogues with substitutions at the seventh and eighth positions were the most active in stimulating human leukocytes to produce IL-6 and IL-8; and for inhibition of tube formation by ECV304 human endothelial-like cells, while 5- and 6-substituted analogues were the most active in murine cell systems. Conclusion: Xanthenone-4-acetic acid analogues exhibit extreme species selectivity. Analogues that are the most active in human systems are inactive in murine models, highlighting the need for the use of appropriate in vivo animal models in selecting clinical candidates for this class of compounds. PMID:23481185

  14. Developmental toxicity of mixtures: the water disinfection by-products dichloro-, dibromo- and bromochloro acetic acid in rat embryo culture

    EPA Science Inventory

    The chlorination of drinking water results in production of numerous disinfection by-products (DBPs). One of the important classes of DBPs is the haloacetic acids. We have previously shown that the haloacetic acids (HAs), dichloro (DCA), dibromo (DBA) and bromochloro (BCA) acetic...

  15. Anti-inflammatory effects of nesfatin-1 in rats with acetic acid - induced colitis and underlying mechanisms.

    PubMed

    Ozturk, C C; Oktay, S; Yuksel, M; Akakin, D; Yarat, A; Kasimay Cakir, O

    2015-10-01

    Mucosal balance impairment, bacterial over-proliferation, cytokines, inflammatory mediators are known as responsible for inflammatory bowel disease. Besides known anorexigenic, neuroprotective, and anti-apoptotic effects, the major effect of nesfatin-1 on colitis is unknown. Our aim was to investigate the possible anti-inflammatory effects of nesfatin-1 in acetic acid induced colitis model and potential underlying mechanisms. Male Spraque-Dawley rats were anesthetized by intraperitoneal ketamine (100 mg/kg) and chlorpromazine (0.75 mg/kg). For nesfatin-1 and antagonist applications some of the rats were intracerebroventricularly (i.c.v.) cannulated. In colitis group, intrarectally (i.r.) 4% acetic acid solution (1 ml) and 10 minutes later i.c.v. nesfatin-1 (0.05 μg/5 μl) or vehicle (5 μl) were administered. Treatments continued for 3 days. In control group, physiological saline solution was used intrarectally. To identify the underlying effective mechanism of nesfatin-1, rats were divided into 3 subgroups, 5 minutes following colitis induction; i.c.v. atosiban (oxytocin receptor antagonist), SHU9119 (melanocortin receptor antagonist) or GHSR-1a antagonist (ghrelin receptor antagonist) were administered, 5 minutes later nesfatin-1 was administered for 3 days. On the fourth day, rats were decapitated, and colon tissues were sampled. Macroscopic and microscopic damage scores of distal colon, and colonic tissue malondialdehyde, glutathione, myeloperoxidase, superoxide dismutase, catalase, luminol and lucigenin chemiluminescence measurements were analysed. The increased myeloperoxidase activity, malondialdehyde levels, luminol and lucigenin chemiluminescence measurements, macroscopic and microscopic damage scores with colitis induction (P < 0.05 - 0.001) were decreased with nesfatin-1 treatment (P < 0.05 - 0.001). Nesfatin-1 may show this effect by inhibiting neutrophil infiltration through tissues and by decreasing formation of free oxygen radicals. Atosiban and

  16. Amylolytic bacterial lactic acid fermentation - a review.

    PubMed

    Reddy, Gopal; Altaf, Md; Naveena, B J; Venkateshwar, M; Kumar, E Vijay

    2008-01-01

    Lactic acid, an enigmatic chemical has wide applications in food, pharmaceutical, leather, textile industries and as chemical feed stock. Novel applications in synthesis of biodegradable plastics have increased the demand for lactic acid. Microbial fermentations are preferred over chemical synthesis of lactic acid due to various factors. Refined sugars, though costly, are the choice substrates for lactic acid production using Lactobacillus sps. Complex natural starchy raw materials used for production of lactic acid involve pretreatment by gelatinization and liquefaction followed by enzymatic saccharification to glucose and subsequent conversion of glucose to lactic acid by Lactobacillus fermentation. Direct conversion of starchy biomass to lactic acid by bacteria possessing both amylolytic and lactic acid producing character will eliminate the two step process to make it economical. Very few amylolytic lactic acid bacteria with high potential to produce lactic acid at high substrate concentrations are reported till date. In this view, a search has been made for various amylolytic LAB involved in production of lactic acid and utilization of cheaply available renewable agricultural starchy biomass. Lactobacillus amylophilus GV6 is an efficient and widely studied amylolytic lactic acid producing bacteria capable of utilizing inexpensive carbon and nitrogen substrates with high lactic acid production efficiency. This is the first review on amylolytic bacterial lactic acid fermentations till date.

  17. Gluconacetobacter kakiaceti sp. nov., an acetic acid bacterium isolated from a traditional Japanese fruit vinegar.

    PubMed

    Iino, Takao; Suzuki, Rei; Tanaka, Naoto; Kosako, Yoshimasa; Ohkuma, Moriya; Komagata, Kazuo; Uchimura, Tai

    2012-07-01

    Two novel acetic acid bacteria, strains G5-1(T) and I5-1, were isolated from traditional kaki vinegar (produced from fruits of kaki, Diospyros kaki Thunb.), collected in Kumamoto Prefecture, Japan. Phylogenetic analysis based on 16S rRNA gene sequences revealed that strains G5-1(T) and I5-1 formed a distinct subline in the genus Gluconacetobacter and were closely related to Gluconacetobacter swingsii DST GL01(T) (99.3% 16S rRNA gene sequence similarity). The isolates showed 96-100% DNA-DNA relatedness with each other, but <53% DNA-DNA relatedness with closely related members of the genus Gluconacetobacter. The isolates could be distinguished from closely related members of the genus Gluconacetobacter by not producing 2- and 5-ketogluconic acids from glucose, producing cellulose, growing without acetic acid and with 30% (w/v) d-glucose, and producing acid from sugars and alcohols. Furthermore, the genomic DNA G+C contents of strains G5-1(T) and I5-1 were a little higher than those of their closest phylogenetic neighbours. On the basis of the phenotypic characteristics and phylogenetic position, strains G5-1(T) and I5-1 are assigned to a novel species, for which the name Gluconacetobacter kakiaceti sp. nov. is proposed; the type strain is G5-1(T) (=JCM 25156(T)=NRIC 0798(T)=LMG 26206(T)).

  18. Disorder effects in Mn(12)-acetate at 83 K.

    PubMed

    Cornia, Andrea; Fabretti, Antonio Costantino; Sessoli, Roberta; Sorace, Lorenzo; Gatteschi, Dante; Barra, Anne-Laure; Daiguebonne, Carole; Roisnel, Thierry

    2002-07-01

    The structure of hexadeca-mu-acetato-tetraaquadodeca-mu(3)-oxo-dodecamanganese bis(acetic acid) tetrahydrate, [Mn(12)O(12)(CH(3)COO)(16)(H(2)O)(4)] x 2CH(3)COOH x 4H(2)O, known as Mn(12)-acetate, has been determined at 83 (2) K by X-ray diffraction methods. The fourfold (S(4)) molecular symmetry is disrupted by a strong hydrogen-bonding interaction with the disordered acetic acid molecule of solvation, which displaces one of the acetate ligands in the cluster. Up to six Mn(12) isomers are potentially present in the crystal lattice, which differ in the number and arrangement of hydrogen-bonded acetic acid molecules. These results considerably improve the structural information available on this molecular nanomagnet, which was first synthesized and characterized by Lis [Acta Cryst. (1980), B36, 2042-2046].

  19. PEP3 overexpression shortens lag phase but does not alter growth rate in Saccharomyces cerevisiae exposed to acetic acid stress

    PubMed Central

    Ding, Jun; Holzwarth, Garrett; Bradford, C. Samuel; Cooley, Ben; Yoshinaga, Allen S.; Patton-Vogt, Jana; Abeliovich, Hagai; Penner, Michael H.; Bakalinsky, Alan T.

    2017-01-01

    In fungi, two recognized mechanisms contribute to pH homeostasis: the plasma membrane proton-pumping ATPase that exports excess protons and the vacuolar proton-pumping ATPase (V-ATPase) that mediates vacuolar proton uptake. Here, we report that overexpression of PEP3 which encodes a component of the HOPS and CORVET complexes involved in vacuolar biogenesis, shortened lag phase in Saccharomyces cerevisiae exposed to acetic acid stress. By confocal microscopy, PEP3-overexpressing cells stained with the vacuolar membrane-specific dye, FM4-64 had more fragmented vacuoles than the wild-type control. The stained overexpression mutant was also found to exhibit about 3.6-fold more FM4-64 fluorescence than the wild-type control as determined by flow cytometry. While the vacuolar pH of the wild-type strain grown in the presence of 80 mM acetic acid was significantly higher than in the absence of added acid, no significant difference was observed in vacuolar pH of the overexpression strain grown either in the presence or absence of 80 mM acetic acid. Based on an indirect growth assay, the PEP3-overexpression strain exhibited higher V-ATPase activity. We hypothesize that PEP3 overexpression provides protection from acid stress by increasing vacuolar surface area and V-ATPase activity and, hence, proton-sequestering capacity. PMID:26051671

  20. Esterification of phenyl acetic acid with p-cresol using metal cation exchanged montmorillonite nanoclay catalysts

    PubMed Central

    Bhaskar, M.; Surekha, M.; Suma, N.

    2018-01-01

    The liquid phase esterification of phenyl acetic acid with p-cresol over different metal cation exchanged montmorillonite nanoclays yields p-cresyl phenyl acetate. Different metal cation exchanged montmorillonite nanoclays (Mn+ = Al3+, Zn2+, Mn2+, Fe3+, Cu2+) were prepared and the catalytic activity was studied. The esterification reaction was conducted by varying molar ratio of the reactants, reaction time and catalyst amount on the yield of the ester. Among the different metal cation exchanged catalysts used, Al3+-montmorillonite nanoclay was found to be more active. The characterization of the material used was studied under different techniques, namely X-ray diffraction, scanning electron microscopy and thermogravimetric analysis. The product obtained, p-cresyl phenyl acetate, was identified by thin-layer chromotography and confirmed by Fourier transform infrared, 1H NMR and 13C NMR. The regeneration activity of used catalyst was also investigated up to fourth generation. PMID:29515855

  1. Esterification of phenyl acetic acid with p-cresol using metal cation exchanged montmorillonite nanoclay catalysts.

    PubMed

    Bhaskar, M; Surekha, M; Suma, N

    2018-02-01

    The liquid phase esterification of phenyl acetic acid with p -cresol over different metal cation exchanged montmorillonite nanoclays yields p -cresyl phenyl acetate. Different metal cation exchanged montmorillonite nanoclays (M n +  = Al 3+ , Zn 2+ , Mn 2+ , Fe 3+ , Cu 2+ ) were prepared and the catalytic activity was studied. The esterification reaction was conducted by varying molar ratio of the reactants, reaction time and catalyst amount on the yield of the ester. Among the different metal cation exchanged catalysts used, Al 3+ -montmorillonite nanoclay was found to be more active. The characterization of the material used was studied under different techniques, namely X-ray diffraction, scanning electron microscopy and thermogravimetric analysis. The product obtained, p -cresyl phenyl acetate, was identified by thin-layer chromotography and confirmed by Fourier transform infrared, 1 H NMR and 13 C NMR. The regeneration activity of used catalyst was also investigated up to fourth generation.

  2. Effect of acetic acid on Saccharomyces carlsbergensis ATCC 6269 batch ethanol production monitored by flow cytometry.

    PubMed

    Freitas, Cláudia; Neves, Elisabete; Reis, Alberto; Passarinho, Paula C; da Silva, Teresa Lopes

    2012-11-01

    Bioethanol produced from lignocellulosic materials has been considered a sustainable alternative fuel. Such type of raw materials have a huge potential, but their hydrolysis into mono-sugars releases toxic compounds such as weak acids, which affect the microorganisms' physiology, inhibiting the growth and ethanol production. Acetic acid (HAc) is the most abundant weak acid in the lignocellulosic materials hydrolysates. In order to understand the physiological changes of Saccharomyces carlsbergensis when fermenting in the presence of different acetic acid (HAc) concentrations, the yeast growth was monitored by multi-parameter flow cytometry at same time that the ethanol production was assessed. The membrane potential stain DiOC(6)(3) fluorescence intensity decreased as the HAc concentration increased, which was attributed to the plasmic membrane potential reduction as a result of the toxic effect of the HAc undissociated form. Nevertheless, the proportion of cells with permeabilized membrane did not increase with the HAc concentration increase. Fermentations ending at lower external pH and higher ethanol concentrations depicted the highest proportions of permeabilized cells and cells with increased reactive oxygen species levels. Flow cytometry allowed monitoring, near real time (at-line), the physiological states of the yeast during the fermentations. The information obtained can be used to optimize culture conditions to improve bioethanol production.

  3. ETHANOL, ACETIC ACID, AND WATER ADSORPTION FROM BINARY AND TERNARY LIQUID MIXTURES ON HIGH-SILICA ZEOLITES

    EPA Science Inventory

    Adsorption isotherms were measured for ethanol, acetic acid, and water adsorbed on high-silica ZSM-5 zeolite powder from binary and ternary liquid mixtures at room temperature. Ethanol and water adsorption on two high-silica ZSM-5 zeolites with different aluminum contents and a h...

  4. Rapid determination of acetic acid, furfural and 5-hydroxymethylfurfural in biomass hydrolysate using near-infrared spectroscopy

    USDA-ARS?s Scientific Manuscript database

    Near infrared spectroscopy (NIR) is a rapid detection technique that has been used to characterize biomass. The objective of this study was to develop suitable NIR models to predict the acetic acid, furfural, and 5-hydroxymethylfurfural (HMF) contents in biomass hydrolysates. Using a uniform distrib...

  5. Synergistic Trap Response of the False Stable Fly and Little House Fly (Diptera: Muscidae) to Acetic Acid and Ethanol, Two Principal Sugar Fermentation Volatiles.

    PubMed

    Landolt, Peter J; Cha, Dong H; Zack, Richard S

    2015-10-01

    In an initial observation, large numbers of muscoid flies (Diptera) were captured as nontarget insects in traps baited with solutions of acetic acid plus ethanol. In subsequent field experiments, numbers of false stable fly Muscina stabulans (Fallén) and little house fly Fannia canicularis (L.) trapped with the combination of acetic acid plus ethanol were significantly higher than those trapped with either chemical alone, or in unbaited traps. Flies were trapped with acetic acid and ethanol that had been formulated in the water of the drowning solution of the trap, or dispensed from polypropylene vials with holes in the vial lids for diffusion of evaporated chemical. Numbers of both species of fly captured were greater with acetic acid and ethanol in glass McPhail traps, compared to four other similar wet trap designs. This combination of chemicals may be useful as an inexpensive and not unpleasant lure for monitoring or removing these two pest fly species. Published by Oxford University Press on behalf of Entomological Society of America 2015. This work is written by US Government employees and is in the public domain in the US.

  6. [Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].

    PubMed

    Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua

    2016-03-01

    Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis.

  7. Measurement of the incorporation rates of four amino acids into proteins for estimating bacterial production.

    PubMed

    Servais, P

    1995-03-01

    In aquatic ecosystems, [(3)H]thymidine incorporation into bacterial DNA and [(3)H]leucine incorporation into proteins are usually used to estimate bacterial production. The incorporation rates of four amino acids (leucine, tyrosine, lysine, alanine) into proteins of bacteria were measured in parallel on natural freshwater samples from the basin of the river Meuse (Belgium). Comparison of the incorporation into proteins and into the total macromolecular fraction showed that these different amino acids were incorporated at more than 90% into proteins. From incorporation measurements at four subsaturated concentrations (range, 2-77 nm), the maximum incorporation rates were determined. Strong correlations (r > 0.91 for all the calculated correlations) were found between the maximum incorporation rates of the different tested amino acids over a range of two orders of magnitude of bacterial activity. Bacterial production estimates were calculated using theoretical and experimental conversion factors. The productions calculated from the incorporation rates of the four amino acids were in good concordance, especially when the experimental conversion factors were used (slope range, 0.91-1.11, and r > 0.91). This study suggests that the incorporation of various amino acids into proteins can be used to estimate bacterial production.

  8. Alcohol dehydrogenase of acetic acid bacteria: structure, mode of action, and applications in biotechnology.

    PubMed

    Yakushi, Toshiharu; Matsushita, Kazunobu

    2010-05-01

    Pyrroquinoline quinone-dependent alcohol dehydrogenase (PQQ-ADH) of acetic acid bacteria is a membrane-bound enzyme involved in the acetic acid fermentation by oxidizing ethanol to acetaldehyde coupling with reduction of membranous ubiquinone (Q), which is, in turn, re-oxidized by ubiquinol oxidase, reducing oxygen to water. PQQ-ADHs seem to have co-evolved with the organisms fitting to their own habitats. The enzyme consists of three subunits and has a pyrroloquinoline quinone, 4 heme c moieties, and a tightly bound Q as the electron transfer mediators. Biochemical, genetic, and electrochemical studies have revealed the unique properties of PQQ-ADH since it was purified in 1978. The enzyme is unique to have ubiquinol oxidation activity in addition to Q reduction. This mini-review focuses on the molecular properties of PQQ-ADH, such as the roles of the subunits and the cofactors, particularly in intramolecular electron transport of the enzyme from ethanol to Q. Also, we summarize biotechnological applications of PQQ-ADH as to enantiospecific oxidations for production of the valuable chemicals and bioelectrocatalysis for sensors and fuel cells using indirect and direct electron transfer technologies and discuss unsolved issues and future prospects related to this elaborate enzyme.

  9. Effect of kaolin silver complex on the control of populations of Brettanomyces and acetic acid bacteria in wine.

    PubMed

    Izquierdo-Cañas, P M; López-Martín, R; García-Romero, E; González-Arenzana, L; Mínguez-Sanz, S; Chatonnet, P; Palacios-García, A; Puig-Pujol, A

    2018-05-01

    In this work, the effects of kaolin silver complex (KAgC) have been evaluated to replace the use of SO 2 for the control of spoilage microorganisms in the winemaking process. The results showed that KAgC at a dose of 1 g/L provided effective control against the development of B. bruxellensis and acetic acid bacteria. In wines artificially contaminated with an initial population of B. bruxellensis at 10 4 CFU/mL, a concentration proven to produce off flavors in wine, only residual populations of the contaminating yeast remained after 24 days of contact with the additive. Populations of acetic bacteria inoculated into wine at concentrations of 10 2 and 10 4  CFU/mL were reduced to negligible levels after 72 h of treatment with KAgC. The antimicrobial effect of KAgC against B. bruxellensis and acetic bacteria was also demonstrated in a wine naturally contaminated by these microorganisms, decreasing their population in a similar way to a chitosan treatment. Related to this effect, wines with KAgC showed lower concentrations of acetic acid and 4-ethyl phenol than wines without KAgC. The silver concentration from KAgC that remained in the finished wines was below the legal limits. These results demonstrated the effectiveness of KAgC to reduce spoilage microorganisms in winemaking.

  10. Effect of Cooling Rates on Shape and Crystal Size Distributions of Mefenamic Acid Polymorph in Ethyl Acetate

    NASA Astrophysics Data System (ADS)

    Mudalip, S. K. Abdul; Adam, F.; Parveen, J.; Abu Bakar, M. R.; Amran, N.; Sulaiman, S. Z.; Che Man, R.; Arshad, Z. I. Mohd; Shaarani, S. Md.

    2017-06-01

    This study investigate the effect of cooling rates on mefenamic acid crystallisation in ethyl acetate. The cooling rate was varied from 0.2 to 5 °C/min. The in-line conductivity system and turbidity system were employed to detect the onset of the crystallization process. The crystals produced were analysed using optical microscopy and Fourier transform infrared spectroscopy (FTIR). It was found that the crystals produced at different cooling rates were needle-like and exhibit polymorphic form type I. However, the aspect ratio and crystal size distributions were varied with the increased of cooling rate. A high crystals aspect ratio and narrower CSD (100-900 μm) was obtained at cooling rate of 0.5 °C/min. Thus, can be suggested as the most suitable cooling rate for crystallization of mefenamic acid in ethyl acetate.

  11. Understanding the dissolution of α-zein in aqueous ethanol and acetic acid solutions.

    PubMed

    Li, Yunqi; Li, Ji; Xia, Qiuyang; Zhang, Boce; Wang, Qin; Huang, Qingrong

    2012-10-04

    Zein is a corn prolamin that has broad industrial applications because of its unique physical properties. Currently, the high cost of extraction and purification, which is directly related to the dispersion of zein in different solvents, is the major bottleneck of the zein industry. Solution behaviors of zein have been studied for a long time. However, the physical nature of zein in different solvents remains unclear. In this study, small-angle X-ray scattering (SAXS), static light scattering (SLS), and rheology were combined to study the structure and protein-solvent interaction of α-zein in both acetic acid and aqueous ethanol solutions. We found that the like-dissolve-like rule, the partial unfolding, and the protonation of zein are all critical to understanding the solution behaviors. Zein holds an elongated conformation (i.e., prolate ellipsoid) in all solutions, as revealed from SAXS data. There is an "aging effect" for zein in aqueous ethanol solutions, as evidenced by the transition of Newtonian rheological profiles for fresh zein solutions to the non-Newtonian shear thinning behavior for zein solutions after storage at room temperature for 24 h. Such shear thinning behavior becomes more pronounced for zein solutions at higher concentrations. The SLS results clearly show that acetic acid is a better solvent to dissolve zein than aqueous ethanol solution, as supported by a more negative second virial coefficient. This is majorly caused by the protonation of the protein, which was further verified by the dissolution of zein in water (a nonsolvent for zein) with the addition of acids.

  12. Intermediates in the reaction of substrate-free cytochrome P450cam with peroxy acetic acid.

    PubMed

    Schünemann, V; Jung, C; Trautwein, A X; Mandon, D; Weiss, R

    2000-08-18

    Freeze-quenched intermediates of substrate-free cytochrome 57Fe-P450(cam) in reaction with peroxy acetic acid as oxidizing agent have been characterized by EPR and Mossbauer spectroscopy. After 8 ms of reaction time the reaction mixture consists of approximately 90% of ferric low-spin iron with g-factors and hyperfine parameters of the starting material; the remaining approximately 10% are identified as a free radical (S' = 1/2) by its EPR and as an iron(IV) (S= 1) species by its Mossbauer signature. After 5 min of reaction time the intermediates have disappeared and the Mossbauer and EPR-spectra exhibit 100% of the starting material. We note that the spin-Hamiltonian analysis of the spectra of the 8 ms reactant clearly reveals that the two paramagnetic species, e.g. the ferryl (iron(IV)) species and the radical, are not exchanged coupled. This led to the conclusion that under the conditions used, peroxy acetic acid oxidized a tyrosine residue (probably Tyr-96) into a tyrosine radical (Tyr*-96), and the iron(III) center of substrate-free P450(cam) to iron(IV).

  13. Enterococcus faecium LKE12 Cell-Free Extract Accelerates Host Plant Growth via Gibberellin and Indole-3-Acetic Acid Secretion.

    PubMed

    Lee, Ko-Eun; Radhakrishnan, Ramalingam; Kang, Sang-Mo; You, Young-Hyun; Joo, Gil-Jae; Lee, In-Jung; Ko, Jae-Hwan; Kim, Jin-Ho

    2015-09-01

    The use of microbial extracts containing plant hormones is a promising technique to improve crop growth. Little is known about the effect of bacterial cell-free extracts on plant growth promotion. This study, based on phytohormonal analyses, aimed at exploring the potential mechanisms by which Enterococcus faecium LKE12 enhances plant growth in oriental melon. A bacterial strain, LKE12, was isolated from soil, and further identified as E. faecium by 16S rDNA sequencing and phylogenetic analysis. The plant growth-promoting ability of an LKE12 bacterial culture was tested in a gibberellin (GA)-deficient rice dwarf mutant (waito-C) and a normal GA biosynthesis rice cultivar (Hwayongbyeo). E. faecium LKE12 significantly improved the length and biomass of rice shoots in both normal and dwarf cultivars through the secretion of an array of gibberellins (GA1, GA3, GA7, GA8, GA9, GA12, GA19, GA20, GA24, and GA53), as well as indole-3-acetic acid (IAA). To the best of our knowledge, this is the first study indicating that E. faecium can produce GAs. Increases in shoot and root lengths, plant fresh weight, and chlorophyll content promoted by E. faecium LKE12 and its cell-free extract inoculated in oriental melon plants revealed a favorable interaction of E. faecium LKE12 with plants. Higher plant growth rates and nutrient contents of magnesium, calcium, sodium, iron, manganese, silicon, zinc, and nitrogen were found in cell-free extract-treated plants than in control plants. The results of the current study suggest that E. faecium LKE12 promotes plant growth by producing GAs and IAA; interestingly, the exogenous application of its cell-free culture extract can be a potential strategy to accelerate plant growth.

  14. Camellia Oil ( Camellia oleifera Abel.) Modifies the Composition of the Gut Microbiota and Alleviates Acetic Acid-induced Colitis in Rats.

    PubMed

    Lee, Wei-Ting; Tung, Yu-Tang; Wu, Chun-Ching; Tu, Pang-Shuo; Yen, Gow-Chin

    2018-06-13

    Ulcerative colitis (UC), one type of chronic inflammatory bowel disease (IBD), is a chronic and recurrent disorder of the gastrointestinal (GI) tract. As camellia oil (CO) is traditionally used to treat GI disorders, this study investigated the role of CO on acetic acid-induced colitis in the rat. The composition of the gut microbial community is related to many diseases, thus, this study also investigated the effects of CO on the composition of the gut microbiota. The rats were fed a dose of 2 mL/kg body weight CO, olive oil (OO), or soybean oil (SO) once a day for 20 days, and the gut microbiota was analyzed using 16S rRNA gene sequencing. Results of the gut microbiota examination showed significant clustering of feces after treatment with CO and OO; however, individual differences with OO varied considerably. Compared to SO and OO, the intake of CO increased the ratio of Firmicutes/Bacteroidetes, the α-diversity, relative abundance of the Bifidobacterium, and reduced Prevotella of the gut microbiota. On day 21, colitis was induced by a single transrectal administration of 2 mL of 4% acetic acid. However, pretreatment of rats with CO or OO for 24 days slightly enhanced antioxidant and antioxidant enzyme activities, and significantly reduced inflammatory damage and lipid peroxidation, thus ameliorating acetic acid-induced colitis. These results indicated that CO was better able to ameliorate impairment of the antioxidant system induced by acetic acid compared to OO and SO, which may have been due to CO modifying the composition of the gut microbiota or CO being a rich source of phytochemicals.

  15. Density Functional Investigation of the Adsorption of Isooctane, Ethanol, and Acetic Acid on a Water-Covered Fe(100) Surface

    PubMed Central

    2014-01-01

    The presence of water in biofuels poses the question of how it affects the frictional performance of additives in fuels containing organic substances. To investigate the effect of water on the adsorption of molecules present in fuel and its additives we simulated within the framework of density functional theory the adsorption of ethanol, isooctane (2,2,4-trimethylpentane), and acetic acid on a bare and a water-covered Fe(100) surface. Van der Waals interactions are taken into account in our computations. In those molecules, where dispersion forces contribute significantly to the binding mechanism, the water layer has a stronger screening effect. Additionally, this effect can be enhanced by the presence of polar functional groups in the molecule. Thus, with the introduction of a water layer, the adsorption energy of isooctane and ethanol is reduced but it is increased in the case of the acetic acid. The adsorption configuration of ethanol is changed, while the one of acetic acid is moderately, and for isooctane only very slightly altered. Therefore, the effect of a water layer in the adsorption of organic molecules on an Fe(100) surface strongly depends on the type of bond and consequently, so do the tribological properties. PMID:25243045

  16. Development of 2-phenlethanol and acetic acid lures to monitor Obliquebanded leafroller (Lepidoptera: Tortricidae) under mating disruption

    USDA-ARS?s Scientific Manuscript database

    Studies were conducted to compare the relative attraction of the benzenoid plant volatiles 2-phenylethanol, phenylacetaldehyde, and phenylacetonitrile in combination with acetic acid as lures for male and female adults of the obliquebanded leafroller, Choristoneura rosaceana (Harris), in apple, Mal...

  17. INHIBITION OF NEURAL CREST CELL MIGRATION BY THE WATER DISINFECTION BYPRODUCTS DICHLORO-, DIBROMO-, AND BROMOCHLORO-ACETIC ACID.

    EPA Science Inventory

    INHIBITION OF NEURAL CREST CELL MIGRATION BY THE WATER DISINFECTION BYPRODUCTS DICHLORO-, DIBROMO- AND BROMOCHLORO-ACETIC ACID. JE Andrews, H Nichols, J Schmid 1, and ES Hunter. Reproductive Toxicology Division, 1Research Support Division, NHEERL, USEPA, RTP, NC, USA.

    ...

  18. Sources and sinks of formic, acetic, and pyruvic acids over central Amazonia. II - Wet season

    NASA Technical Reports Server (NTRS)

    Talbot, R. W.; Andreae, M. O.; Berresheim, H.; Jacob, D. J.; Beecher, K. M.

    1990-01-01

    Potential sources and sinks of formic, acetic, and pyruvic acids over the Amazon forest were investigated using a photochemical model and data collected on gas phase concentrations of these acids in the forest canopy, boundary layer, and free troposphere over the central Amazon Basin during the 1987 wet season. It was found that the atmospheric reactions previously suggested in the literature as sources of carboxylic acids (i.e., the gas phase decomposition of isoprene, the reaction between CH3CO3 and a peroxide, and aqueous phase oxidation of CH2O) appear to be too slow to explain the observed concentrations, suggesting that other atmospheric reactions, so far unidentified, could make a major contribution to the carboxylic acid budgets.

  19. The implementation of high fermentative 2,3-butanediol production from xylose by simultaneous additions of yeast extract, Na2EDTA, and acetic acid.

    PubMed

    Wang, Xiao-Xiong; Hu, Hong-Ying; Liu, De-Hua; Song, Yuan-Quan

    2016-01-25

    The effective use of xylose may significantly enhance the feasibility of using lignocellulosic hydrolysate to produce 2,3-butanediol (2,3-BD). Previous difficulties in 2,3-BD production include that the high-concentration xylose cannot be converted completely and the fermentation rate is slow. This study investigated the effects of yeast extract, ethylenediaminetetraacetic acid disodium salt (Na2EDTA), and acetic acid on 2,3-BD production from xylose. The central composite design approach was used to optimize the concentrations of these components. It was found that simultaneous addition of yeast extract, Na2EDTA, and acetic acid could significantly improve 2,3-BD production. The optimal concentrations of yeast extract, Na2EDTA, and acetic acid were 35.2, 1.2, and 4.5 g/L, respectively. The 2,3-BD concentration in the optimized medium reached 39.7 g/L after 48 hours of shake flask fermentation, the highest value ever reported in such a short period. The xylose utilization ratio and the 2,3-BD concentration increased to 99.0% and 42.7 g/L, respectively, after 48 hours of stirred batch fermentation. Furthermore, the 2,3-BD yield was 0.475 g/g, 95.0% of the theoretical maximum value. As the major components of lignocellulosic hydrolysate are glucose, xylose, and acetic acid, the results of this study indicate the possibility of directly using the hydrolysate to effectively produce 2,3-BD. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Interaction of acetic acid and phenylacetaldehyde as attractants for trapping pest species of moths (Lepidoptera: Noctuidae)

    USDA-ARS?s Scientific Manuscript database

    Phenylacetaldehyde is a flower volatile and attractant for many nectar-seeking moths. Acetic acid is a microbial fermentation product that is present in insect sweet baits. It is weakly attractive to some moths and other insects, but can be additive or synergistic with other compounds to make more p...

  1. Acetate Dissimilation and Assimilation in Mycobacterium tuberculosis Depend on Carbon Availability

    PubMed Central

    Rücker, Nadine; Billig, Sandra; Bücker, René; Jahn, Dieter

    2015-01-01

    ABSTRACT Mycobacterium tuberculosis persists inside granulomas in the human lung. Analysis of the metabolic composition of granulomas from guinea pigs revealed that one of the organic acids accumulating in the course of infection is acetate (B. S. Somashekar, A. G. Amin, C. D. Rithner, J. Troudt, R. Basaraba, A. Izzo, D. C. Crick, and D. Chatterjee, J Proteome Res 10:4186–4195, 2011, doi:http://dx.doi.org/10.1021/pr2003352), which might result either from metabolism of the pathogen or might be provided by the host itself. Our studies characterize a metabolic pathway by which M. tuberculosis generates acetate in the cause of fatty acid catabolism. The acetate formation depends on the enzymatic activities of Pta and AckA. Using actyl coenzyme A (acetyl-CoA) as a substrate, acetyl-phosphate is generated and finally dephosphorylated to acetate, which is secreted into the medium. Knockout mutants lacking either the pta or ackA gene showed significantly reduced acetate production when grown on fatty acids. This effect is even more pronounced when the glyoxylate shunt is blocked, resulting in higher acetate levels released to the medium. The secretion of acetate was followed by an assimilation of the metabolite when other carbon substrates became limiting. Our data indicate that during acetate assimilation, the Pta-AckA pathway acts in concert with another enzymatic reaction, namely, the acetyl-CoA synthetase (Acs) reaction. Thus, acetate metabolism might possess a dual function, mediating an overflow reaction to release excess carbon units and resumption of acetate as a carbon substrate. IMPORTANCE During infection, host-derived lipid components present the major carbon source at the infection site. β-Oxidation of fatty acids results in the formation of acetyl-CoA. In this study, we demonstrate that consumption of fatty acids by Mycobacterium tuberculosis activates an overflow mechanism, causing the pathogen to release excess carbon intermediates as acetate. The Pta

  2. The Aerobic Oxidation of Bromide to Dibromine Catalyzed by Homogeneous Oxidation Catalysts and Initiated by Nitrate in Acetic Acid

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Partenheimer, Walt; Fulton, John L.; Sorensen, Christina M.

    A small amount of nitrate, ~0.002 molal, initiates the Co/Mn catalyzed aerobic oxidation of bromide compounds (HBr,NaBr,LiBr) to dibromine in acetic acid at room temperature. At temperatures 40oC or less , the reaction is autocatalytic. Co(II) and Mn(II) themselves and mixed with ionic bromide are known homogeneous oxidation catalysts. The reaction was discovered serendipitously when a Co/Br and Co/Mn/Br catalyst solution was prepared for the aerobic oxidation of methyaromatic compounds and the Co acetate contained a small amount of impurity i.e. nitrate. The reaction was characterized by IR, UV-VIS, MALDI and EXAFS spectroscopies and the coordination chemistry is described. Themore » reaction is inhibited by water and its rate changed by pH. The change in these variables, as well as others, are identical to those observed during homogeneous, aerobic oxidation of akylaromatics. A mechanism is proposed. Accidental addition of a small amount of nitrate compound into a Co/Mn/Br/acetic acid mixture in a large, commercial feedtank is potentially dangerous.« less

  3. Identification of a novel acetate-utilizing bacterium belonging to Synergistes group 4 in anaerobic digester sludge.

    PubMed

    Ito, Tsukasa; Yoshiguchi, Kazumi; Ariesyady, Herto Dwi; Okabe, Satoshi

    2011-12-01

    Major acetate-utilizing bacterial and archaeal populations in methanogenic anaerobic digester sludge were identified and quantified by radioisotope- and stable-isotope-based functional analyses, microautoradiography-fluorescence in situ hybridization (MAR-FISH) and stable-isotope probing of 16S rRNA (RNA-SIP) that can directly link 16S rRNA phylogeny with in situ metabolic function. First, MAR-FISH with (14)C-acetate indicated the significant utilization of acetate by only two major groups, unidentified bacterial cells and Methanosaeta-like filamentous archaeal cells, in the digester sludge. To identify the acetate-utilizing unidentified bacteria, RNA-SIP was conducted with (13)C(6)-glucose and (13)C(3)-propionate as sole carbon source, which were followed by phylogenetic analysis of 16S rRNA. We found that bacteria belonging to Synergistes group 4 were commonly detected in both 16S rRNA clone libraries derived from the sludge incubated with (13)C-glucose and (13)C-propionate. To confirm that this bacterial group can utilize acetate, specific FISH probe targeting for Synergistes group 4 was newly designed and applied to the sludge incubated with (14)C-acetate for MAR-FISH. The MAR-FISH result showed that bacteria belonging to Synergistes group 4 significantly took up acetate and their active population size was comparable to that of Methanosaeta in this sludge. In addition, as bacteria belonging to Synergistes group 4 had high K(m) for acetate and maximum utilization rate, they are more competitive for acetate over Methanosaeta at high acetate concentrations (2.5-10  mM). To our knowledge, it is the first time to report the acetate-utilizing activity of uncultured bacteria belonging to Synergistes group 4 and its competitive significance to acetoclastic methanogen, Methanosaeta.

  4. Identification of a novel acetate-utilizing bacterium belonging to Synergistes group 4 in anaerobic digester sludge

    PubMed Central

    Ito, Tsukasa; Yoshiguchi, Kazumi; Ariesyady, Herto Dwi; Okabe, Satoshi

    2011-01-01

    Major acetate-utilizing bacterial and archaeal populations in methanogenic anaerobic digester sludge were identified and quantified by radioisotope- and stable-isotope-based functional analyses, microautoradiography-fluorescence in situ hybridization (MAR-FISH) and stable-isotope probing of 16S rRNA (RNA-SIP) that can directly link 16S rRNA phylogeny with in situ metabolic function. First, MAR-FISH with 14C-acetate indicated the significant utilization of acetate by only two major groups, unidentified bacterial cells and Methanosaeta-like filamentous archaeal cells, in the digester sludge. To identify the acetate-utilizing unidentified bacteria, RNA-SIP was conducted with 13C6-glucose and 13C3-propionate as sole carbon source, which were followed by phylogenetic analysis of 16S rRNA. We found that bacteria belonging to Synergistes group 4 were commonly detected in both 16S rRNA clone libraries derived from the sludge incubated with 13C-glucose and 13C-propionate. To confirm that this bacterial group can utilize acetate, specific FISH probe targeting for Synergistes group 4 was newly designed and applied to the sludge incubated with 14C-acetate for MAR-FISH. The MAR-FISH result showed that bacteria belonging to Synergistes group 4 significantly took up acetate and their active population size was comparable to that of Methanosaeta in this sludge. In addition, as bacteria belonging to Synergistes group 4 had high Km for acetate and maximum utilization rate, they are more competitive for acetate over Methanosaeta at high acetate concentrations (2.5–10 m). To our knowledge, it is the first time to report the acetate-utilizing activity of uncultured bacteria belonging to Synergistes group 4 and its competitive significance to acetoclastic methanogen, Methanosaeta. PMID:21562600

  5. Engineering Escherichia coli for Biodiesel Production Utilizing a Bacterial Fatty Acid Methyltransferase▿†

    PubMed Central

    Nawabi, Parwez; Bauer, Stefan; Kyrpides, Nikos; Lykidis, Athanasios

    2011-01-01

    The production of low-cost biofuels in engineered microorganisms is of great interest due to the continual increase in the world's energy demands. Biodiesel is a renewable fuel that can potentially be produced in microbes cost-effectively. Fatty acid methyl esters (FAMEs) are a common component of biodiesel and can be synthesized from either triacylglycerol or free fatty acids (FFAs). Here we report the identification of a novel bacterial fatty acid methyltransferase (FAMT) that catalyzes the formation of FAMEs and 3-hydroxyl fatty acid methyl esters (3-OH-FAMEs) from the respective free acids and S-adenosylmethionine (AdoMet). FAMT exhibits a higher specificity toward 3-hydroxy free fatty acids (3-OH-FFAs) than FFAs, synthesizing 3-hydroxy fatty acid methyl esters (3-OH-FAMEs) in vivo. We have also identified bacterial members of the fatty acyl-acyl carrier protein (ACP) thioesterase (FAT) enzyme family with distinct acyl chain specificities. These bacterial FATs exhibit increased specificity toward 3-hydroxyacyl-ACP, generating 3-OH-FFAs, which can subsequently be utilized by FAMTs to produce 3-OH-FAMEs. PhaG (3-hydroxyacyl ACP:coenzyme A [CoA] transacylase) constitutes an alternative route to 3-OH-FFA synthesis; the coexpression of PhaG with FAMT led to the highest level of accumulation of 3-OH-FAMEs and FAMEs. The availability of AdoMet, the second substrate for FAMT, is an important factor regulating the amount of methyl esters produced by bacterial cells. Our results indicate that the deletion of the global methionine regulator metJ and the overexpression of methionine adenosyltransferase result in increased methyl ester synthesis. PMID:21926202

  6. Mechanistic Insights on C-O and C-C Bond Activation and Hydrogen Insertion during Acetic Acid Hydrogenation Catalyzed by Ruthenium Clusters in Aqueous Medium

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shangguan, Junnan; Olarte, Mariefel V.; Chin, Ya-Huei

    Catalytic pathways for acetic acid (CH3COOH) and hydrogen (H2) reactions on dispersed Ru clusters in the aqueous medium and the associated kinetic requirements for C-O and C-C bond cleavages and hydrogen insertion are established from rate and isotopic assessments. CH3COOH reacts with H2 in steps that either retain its carbon backbone and lead to ethanol, ethyl acetate, and ethane (47-95 %, 1-23 %, and 2-17 % carbon selectivities, respectively) or break its C-C bond and form methane (1-43 % carbon selectivities) at moderate temperatures (413-523 K) and H2 pressures (10-60 bar, 298 K). Initial CH3COOH activation is the kinetically relevantmore » step, during which CH3C(O)-OH bond cleaves on a metal site pair at Ru cluster surfaces nearly saturated with adsorbed hydroxyl (OH*) and acetate (CH3COO*) intermediates, forming an adsorbed acetyl (CH3CO*) and hydroxyl (OH*) species. Acetic acid turnover rates increase proportionally with both H2 (10-60 bar) and CH3COOH concentrations at low CH3COOH concentrations (<0.83 M), but decrease from first to zero order as the CH3COOH concentration and the CH3COO* coverages increase and the vacant Ru sites concomitantly decrease. Beyond the initial CH3C(O)-OH bond activation, sequential H-insertions on the surface acetyl species (CH3CO*) lead to C2 products and their derivative (ethanol, ethane, and ethyl acetate) and the competitive C-C bond cleavage of CH3CO* causes the eventual methane formation. The instantaneous carbon selectivities towards C2 species (ethanol, ethane, and ethyl acetate) increase linearly with the concentration of proton-type Hδ+ (derived from carboxylic acid dissociation) and chemisorbed H*. The selectivities towards C2 products decrease with increasing temperature, because of higher observed barriers for C-C bond cleavage than H-insertion. This study offers an interpretation of mechanism and energetics and provides kinetic evidence of carboxylic acid assisted proton-type hydrogen (Hδ+) shuffling during H

  7. Isolation of bacterial cellulose nanocrystalline from pineapple peel waste: Optimization of acid concentration in the hydrolysis method

    NASA Astrophysics Data System (ADS)

    Anwar, Budiman; Rosyid, Nurul Huda; Effendi, Devi Bentia; Nandiyanto, Asep Bayu Dani; Mudzakir, Ahmad; Hidayat, Topik

    2016-02-01

    Isolation of needle-shaped bacterial cellulose nanocrystalline with a diameter of 16-64 nm, a fiber length of 258-806 nm, and a degree of crystallinity of 64% from pineapple peel waste using an acid hydrolysis process was investigated. Experimental showed that selective concentration of acid played important roles in isolating the bacterial cellulose nanocrystalline from the cellulose source. To achieve the successful isolation of bacterial cellulose nanocrystalline, various acid concentrations were tested. To confirm the effect of acid concentration on the successful isolation process, the reaction conditions were fixed at a temperature of 50°C, a hydrolysis time of 30 minutes, and a bacterial cellulose-to-acid ratio of 1:50. Pineapple peel waste was used as a model for a cellulose source because to the best of our knowledge, there is no report on the use of this raw material for producing bacterial cellulose nanocrystalline. In fact, this material can be used as an alternative for ecofriendly and cost-free cellulose sources. Therefore, understanding in how to isolate bacterial cellulose nanocrystalline from pineapple peel waste has the potential for large-scale production of inexpensive cellulose nanocrystalline.

  8. A gaseous acetic acid treatment to disinfect fenugreek seeds and black pepper inoculated with pathogenic and spoilage bacteria.

    PubMed

    Nei, Daisuke; Enomoto, Katsuyoshi; Nakamura, Nobutaka

    2015-08-01

    Contamination of spices by pathogenic and/or spoilage bacteria can be deleterious to consumer's health and cause deterioration of foods, and inactivation of such bacteria is necessary for the food industry. The present study examined the effect of gaseous acetic acid treatment in reducing Escherichia coli O157:H7, Salmonella Enteritidis and Bacillus subtilis populations inoculated on fenugreek seeds and black pepper. Treatment with gaseous acetic acid at 0.3 mmol/L, 0.6 mmol/L and 4.7 mmol/L for 1-3 h significantly reduced the populations of E. coli O157:H7 and Salmonella Enteritidis on black pepper and fenugreek seeds at 55 °C (p < 0.05). The gas treatments at 4.7 mmol/L were more effective in inactivating the pathogens than the treatment at 0.3 mmol/L. An approximately 5.0 log reduction was obtained after 3 h of treatment with 4.7 mmol/L acetic acid. No significant reductions in the population of B. subtilis spores inoculated on fenugreek seeds and black pepper were obtained after the gas treatments at 0.3 mmol/L or 0.6 mmol/L (p > 0.05). However, the gas treatment at 4.7 mmol/L significantly reduced B. subtilis spores (p < 0.05), and 4.0 log CFU/g and 3.5 log CFU/g reductions on fenugreek seeds and black pepper, respectively, were obtained after 3 h of treatment. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Selective liquid chromatographic separation of yttrium from heavier rare earth elements using acetic acid as a novel eluent.

    PubMed

    Kifle, Dejene; Wibetoe, Grethe

    2013-09-13

    One of the major difficulties in the rare earth elements separation is purification of yttrium from heavy rare earth elements. Thus, an HPLC method using acetic acid as novel eluent was explored for selective separation of yttrium form the heavy rare earth elements. When acetic acid is used as a mobile phase yttrium eluted with the lighter lanthanides. This is contrary to its relative position amongst heavier lanthanides when eluents commonly used for separation of rare earth elements were employed. The shift in elution position of yttrium with acetic acid as eluent may reflect a relatively lower stability constant of the yttrium-AcOH complex (in the same order as for the lighter lanthanides) compared to the corresponding AcOH complexes with heavy lanthanides, enabling selective separation of yttrium from the latter. The method was successfully used for selective separation of yttrium in mixed rare earth sample containing about 80% of yttrium and about 20% of heavy rare earth oxides. Thus, the use of AcOH as eluent is an effective approach for separating and determining the trace amounts of heavy rare earth elements in large amounts of yttrium matrix. Separation was performed on C18 column by running appropriate elution programs. The effluent from the column was monitored with diode array detector at absorbance wavelength of 658nm after post column derivatization with Arsenazo III. Copyright © 2013 Elsevier B.V. All rights reserved.

  10. In vitro effects of hydrochloric acid and various concentrations of acetic, propionic, butyric, or valeric acids on bioelectric properties of equine gastric squamous mucosa.

    PubMed

    Andrews, Frank M; Buchanan, Benjamin R; Smith, Sionagh H; Elliott, Sarah B; Saxton, Arnold M

    2006-11-01

    To compare the effects of hydrochloric acid (HCl) and various concentrations of volatile fatty acids (VFAs) on tissue bioelectric properties of equine stomach nonglandular (NG) mucosa. Gastric tissues obtained from 48 adult horses. NG gastric mucosa was studied by use of Ussing chambers. Short-circuit current (Isc) and potential difference (PD) were measured and electrical resistance (R) and conductance calculated for tissues after addition of HCl and VFAs (5, 10, 20, and 40 mM) in normal Ringer's solution (NRS). Mucosa exposed to HCl in NRS (pH of 1.5 and, to a lesser extent, 4.0) had a significant decrease in Isc, PD, and R, whereas tissues exposed to acetic acid at a pH of < 4.0, propionic and butyric acids at a pH of acid at a pH of acid at a pH of acetic acid, in the presence of HCl at a pH of

  11. Flash photolysis and pulse radiolysis studies on collagen Type I in acetic acid solution.

    PubMed

    Sionkowska, Alina

    2006-07-03

    An investigation of the photochemical properties of collagen Type I in acetic acid solution was carried out using nanosecond laser irradiation. The transient spectra of collagen solution excited at 266 nm show two bands. One of them with maximum at 295 nm and the second one with maximum at 400 nm. The peak at 400 nm is assigned to tyrosyl radicals. The first peak of the transient absorption spectra at 295 nm is probably due to photoionisation producing collagen radical cation. The transient for collagen solution in acetic acid at 640 nm was not observed. It is evidence that there is no hydrated electron in the irradiated collagen solution. The reactions of hydrated electrons and (*)OH radicals with collagen have been studied by pulse radiolysis. In the absorption spectra of products resulting from the reaction of collagen with e(aq)(-) no characteristic maximum absorption in UV and visible light region has been observed. In the absorption spectra of products resulting from the reaction of the hydroxyl radicals with collagen two bands have been observed. The first one at 320 nm and the second one at 405 nm. Reaction of (*)OH radicals with tyrosine residues in collagen chains gives rise to Tyr phenoxyl radicals (absorption at 400 nm).

  12. 21 CFR 73.2396 - Lead acetate.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... acetate is the trihydrate of lead (2+) salt of acetic acid. The color additive has the chemical formula Pb... cosmetics intended for coloring hair on the scalp only, subject to the following restrictions: (1) The... mustaches, eyelashes, eyebrows, or hair on parts of the body other than the scalp. (d) Labeling requirements...

  13. 21 CFR 73.2396 - Lead acetate.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... acetate is the trihydrate of lead (2+) salt of acetic acid. The color additive has the chemical formula Pb... cosmetics intended for coloring hair on the scalp only, subject to the following restrictions: (1) The... mustaches, eyelashes, eyebrows, or hair on parts of the body other than the scalp. (d) Labeling requirements...

  14. 21 CFR 73.2396 - Lead acetate.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... acetate is the trihydrate of lead (2+) salt of acetic acid. The color additive has the chemical formula Pb... cosmetics intended for coloring hair on the scalp only, subject to the following restrictions: (1) The... mustaches, eyelashes, eyebrows, or hair on parts of the body other than the scalp. (d) Labeling requirements...

  15. 21 CFR 73.2396 - Lead acetate.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... acetate is the trihydrate of lead (2+) salt of acetic acid. The color additive has the chemical formula Pb... cosmetics intended for coloring hair on the scalp only, subject to the following restrictions: (1) The... mustaches, eyelashes, eyebrows, or hair on parts of the body other than the scalp. (d) Labeling requirements...

  16. 21 CFR 73.2396 - Lead acetate.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... acetate is the trihydrate of lead (2+) salt of acetic acid. The color additive has the chemical formula Pb... cosmetics intended for coloring hair on the scalp only, subject to the following restrictions: (1) The... mustaches, eyelashes, eyebrows, or hair on parts of the body other than the scalp. (d) Labeling requirements...

  17. Goat whey ameliorates intestinal inflammation on acetic acid-induced colitis in rats.

    PubMed

    Araújo, Daline Fernandes de Souza; Guerra, Gerlane Coelho Bernardo; Júnior, Raimundo Fernandes de Araújo; Antunes de Araújo, Aurigena; Antonino de Assis, Paloma Oliveira; Nunes de Medeiros, Ariosvaldo; Formiga de Sousa, Yasmim Regis; Pintado, Maria Manuela Estevez; Gálvez, Julio; Queiroga, Rita de Cássia Ramos do Egypto

    2016-12-01

    Complementary or alternative medicine is of great interest for the treatment of inflammatory bowel disease, with the aim of ameliorating the side effects of the drugs commonly used or improving their efficacy. In this study, we evaluated the ability of goat whey to prevent intestinal inflammation in the experimental model of acetic acid-induced rats and compared it to sulfasalazine. Pretreatment with goat whey (1, 2, and 4g/kg) and sulfasalazine (250mg/kg) on colitic rats improved colonic inflammatory markers, including myeloperoxidase activity, leukotriene B 4 levels, as well as the production of proinflammatory cytokines IL-1β and tumor necrosis factor-α. Furthermore, the administration of goat whey significantly reduced the colonic oxidative stress by reducing malondialdehyde levels and increased total glutathione content, a potent antioxidant peptide. The histological evaluation of the colonic specimens from colitic rats confirmed these beneficial effects, as goat whey preserved the colonic tissue, especially in those rats treated with the highest dose of goat whey or with sulfasalazine. The immunohistochemistry analysis of the colonic tissue evaluation also revealed a reduction in the expression of cyclooxygenase-2, inducible nitric oxide synthase, and matrix metalloproteinase-9, together with an increased expression of suppressor of cytokine signaling-1. These results suggest that goat whey exerted a preventive effect against the intestinal damage induced by acetic acid, showing a similar efficacy to that shown by sulfasalazine, therefore making it a potential treatment for human inflammatory bowel disease. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  18. Estrogen treatment of acetic acid burns to the vagina, cervix, and perineum: a case report and review of the literature.

    PubMed

    Ching, Jessica A; Kuykendall, Lauren V; Troy, Jared S; Smith, David J

    2014-01-01

    In colposcopic evaluation of the cervix, acetic acid of 3 to 5% is commonly used for identification of preneoplastic and neoplastic cells. Acetic acid is a known caustic substance and has the potential to cause irritation and chemical burns when there is sufficient concentration or duration of contact. The authors present a unique case of a woman who inadvertently received undiluted acetic acid during a routine colposcopy, resulting in significant chemical burns of the vagina, cervix, and perineum. Her burns were treated with topical estrogen cream of 1 g twice daily applied directly to the wounds. The burn wounds were fully healed within 8 weeks without complication or additional treatment. At 6 months after the injury, the patient was allowed to engage in sexual activity, and vaginal dilation and pelvic floor therapy were initiated. At 12 months postinjury, her only symptomatic scarring at the left vaginal wall continues to improve. Thus, topical estrogen treatment of 1 g applied twice daily should be continued until burn scar maturation is complete and treatment improvement plateaus in cases of burns to the vagina, cervix, and perineum. This case is further clinical evidence of estrogen's positive effect on wound healing and its potential role in burn treatment.

  19. Simultaneous determination of triacetin, acetic ether, butyl acetate and amorolfine hydrochloride in amorolfine liniment by HPLC.

    PubMed

    Gao, Yuan; Li, Li; Zhang, Jianjun; Shu, Wenjuan; Gao, Liqiong

    2012-04-01

    A simple, rapid, specific and precise reversed-phase high-performance liquid chromatographic method was developed for simultaneous estimation of triacetin, acetic ether, butyl acetate and amorolfine in marketed pharmaceutical liniment. Chromatographic separation was performed on a Shimadzu VP-ODS C(18) column using the mixture of citric acid-hydrochloric acid-sodium hydrate buffer (pH 3.0), acetonitrile and methanol (32:30:38) as the mobile phase at a flow rate of 1.0 mL/min with UV-detection at 215 nm. The method separated the four components simultaneously in less than 10 min. The validation of the method was performed with respect to specificity, linearity, accuracy, and precision. The calibration curves were linear in the range of 35.1-81.9 μ/mL for triacetin, 431.1-1005.9 μ/mL for acetic ether, 167.0-389.7 μ/mL for butyl acetate and 151.0-352.3 μ/mL for amorolfine. The mean 100% spiked recovery for triacetin, acetic ether, butyl acetate and amorolfine is 99.43 ± 0.42, 101.5 ± 1.09, 101.4 ± 1.02 and 100.8 ± 0.69, respectively. The intra-day and inter-day relative standard deviation values were <2.0%. The limits of detection of these compounds ranged from 0.08 to 5.88 ng. The utility of the procedure was verified by its application to the commercial liniment.

  20. Mechanosensitive neurons on the internal reproductive tract contribute to egg-laying-induced acetic acid attraction in Drosophila

    PubMed Central

    Gou, Bin; Liu, Ying; Guntur, Ananya R.; Stern, Ulrich; Yang, Chung-Hui

    2014-01-01

    Selecting a suitable site to deposit their eggs is an important reproductive need of Drosophila females. While their choosiness towards egg-laying sites is well documented, the specific neural mechanism that activates females’ search for attractive egg-laying sites is not known. Here we show that distention/contraction of females’ internal reproductive tract triggered by egg-delivery through the tract plays a critical role in activating such search. We found that females start to exhibit acetic acid attraction prior to depositing each egg but no attraction when they are not laying eggs. Artificially distending the reproductive tract triggers acetic acid attraction in non-egg-laying females whereas silencing the mechanosensitive neurons we identified that can sense the contractile status of the tract eliminates such attraction. Our work uncovers the circuit basis of an important reproductive need of Drosophila females and provides a simple model to dissect the neural mechanism that underlies a reproductive need-induced behavioral modification. PMID:25373900

  1. Myo-inositol esters of indole-3-acetic acid are endogenous components of Zea mays L. shoot tissue

    NASA Technical Reports Server (NTRS)

    Chisnell, J. R.

    1984-01-01

    Indole-3-acetyl-myo-inositol esters have been demonstrated to be endogenous components of etiolated Zea mays shoots tissue. This was accomplished by comparison of the putative compounds with authentic, synthetic esters. The properties compared were liquid and gas-liquid chromatographic retention times and the 70-ev mass spectral fragmentation pattern of the pentaacetyl derivative. The amount of indole-3-acetyl-myo-inositol esters in the shoots was determined to be 74 nanomoles per kilogram fresh weight as measured by isotope dilution, accounting for 19% of the ester indole-3-acetic acid of the shoot. This work is the first characterization of an ester conjugate of indole-3-acetate acid from vegetative shoot tissue using multiple chromatographic properties and mass spectral identification. The kernel and the seedling shoot both contain indole-3-acetyl-myo-inositol esters, and these esters comprise approximately the same percentage of the total ester content of the kernel and of the shoot.

  2. Acetic acid effects on enhancement of growth rate and reduction of amorphous carbon deposition on CNT arrays along a growth window in a floating catalyst reactor

    NASA Astrophysics Data System (ADS)

    Maghrebi, Morteza; Khodadadi, Abbas Ali; Mortazavi, Yadollah; Sane, Ali; Rahimi, Mohsen; Shirazi, Yaser; Tsakadze, Zviad; Mhaisalkar, Subodh

    2009-11-01

    The mm-long carbon nanotube (CNT) arrays were grown in a floating catalyst reactor, using xylene-ferrocene and a small amount of acetic acid as the feed. The CNT arrays deposited on a quartz substrate at several positions along the reactor were extensively characterized using Raman spectroscopy, scanning electron microscopy, X-ray diffraction, high-resolution transmission electron microscopy, and optical microscopy. Various characterization methods consistently reveal that the acetic acid additive to the feed alleviates deposition of amorphous carbon layer, which gradually thickens CNTs along the reactor. The acetic acid also resulted in a higher growth rate along the so-called growth window, where CNT arrays are deposited on the quartz substrate. High-performance liquid chromatography of extracted byproducts (PAHs) confirmed the presence of some polycyclic aromatic hydrocarbons. The solid weight of PAHs decreased upon addition of ferrocene as the catalyst precursor, as well as of acetic acid to xylene feed. The results suggest that primary light products of xylene pyrolysis can be competitive reactants for both catalytic and subsequent pyrolytic reactions. They may also be more efficient feeds for CNT growth than xylene itself.

  3. Synthesis and biological evaluation of N-difluoromethyl-1,2-dihydropyrid-2-one acetic acid regioisomers: dual inhibitors of cyclooxygenases and 5-lipoxygenase.

    PubMed

    Yu, Gang; Praveen Rao, P N; Chowdhury, Morshed A; Abdellatif, Khaled R A; Dong, Ying; Das, Dipankar; Velázquez, Carlos A; Suresh, Mavanur R; Knaus, Edward E

    2010-04-01

    A new group of acetic acid (7a-c, R(1) = H), and propionic acid (7d-f, R(1) = Me), regioisomers wherein a N-difluoromethyl-1,2-dihydropyrid-2-one moiety is attached via its C-3, C-4, and C-5 position was synthesized. This group of compounds exhibited a more potent inhibition, and hence selectivity, for the cyclooxygenase-2 (COX-2) relative to the COX-1 isozyme. Attachment of the N-difluoromethyl-1,2-dihydropyrid-2-one ring system to an acetic acid, or propionic acid, moiety confers potent 5-LOX inhibitory activity, that is, absent in traditional arylacetic acid NSAIDs. 2-(1-Difluoromethyl-2-oxo-1,2-dihydropyridin-5-yl)acetic acid (7c) exhibited the best combination of dual COX-2 and 5-LOX inhibitory activities. Molecular modeling (docking) studies showed that the highly electronegative CHF(2) substituent present in 7c, that showed a modest selectivity for the COX-2 isozyme, is oriented within the secondary pocket (Val523) present in COX-2 similar to the sulfonamide (SO(2)NH(2)) COX-2 pharmacophore present in celecoxib, and that the N-difluoromethyl-1,2-dihydropyrid-2-one pharmacophore is oriented close to the region containing the LOX enzyme catalytic iron (His361, His366, and His545). Accordingly, the N-difluoromethyl-1,2-dihyrdopyrid-2-one moiety possesses properties suitable for the design of dual COX-2/5-LOX inhibitory drugs. 2010 Elsevier Ltd. All rights reserved.

  4. Cellulose-ethylenediaminetetraacetic acid conjugates protect mammalian cells from bacterial cells.

    PubMed

    Luo, Jie; Lv, Wei; Deng, Ying; Sun, Yuyu

    2013-04-08

    Cellulose-ethylenediaminetetraacetic acid (EDTA) conjugates were synthesized by the esterification of cellulose with ethylenediaminetetraacetic dianhydride (EDTAD). The new materials provided potent antimicrobial activities against Staphylococcus aureus (S. aureus, Gram-positive bacteria) and Pseudomonas aeruginosa (P. aeruginosa, Gram-negative bacteria), and inhibited the formation of bacterial biofilms. The biocompatibility of the new cellulose-EDTA conjugates was evaluated with mouse skin fibroblasts for up to 14 days. SEM observation and DNA content analysis suggested that the new materials sustained the viability of fibroblast cells. Moreover, in mouse skin fibroblast-bacteria co-culture systems, the new cellulose-EDTA conjugates prevented bacterial biofilm formation and protected the mammalian cells from the bacterial cells for at least one day.

  5. Manufacturing Ethyl Acetate From Fermentation Ethanol

    NASA Technical Reports Server (NTRS)

    Rohatgi, Naresh K.; Ingham, John D.

    1991-01-01

    Conceptual process uses dilute product of fermentation instead of concentrated ethanol. Low-concentration ethanol, extracted by vacuum from fermentation tank, and acetic acid constitutes feedstock for catalytic reaction. Product of reaction goes through steps that increases ethyl acetate content to 93 percent by weight. To conserve energy, heat exchangers recycle waste heat to preheat process streams at various points.

  6. Acetate but not propionate induces oxidative stress in bakers' yeast Saccharomyces cerevisiae.

    PubMed

    Semchyshyn, Halyna M; Abrat, Oleksandra B; Miedzobrodzki, Jacek; Inoue, Yoshiharu; Lushchak, Volodymyr I

    2011-01-01

    The influence of acetic and propionic acids on baker's yeast was investigated in order to expand our understanding of the effect of weak organic acid food preservatives on eukaryotic cells. Both acids decreased yeast survival in a concentration-dependent manner, but with different efficiencies. The acids inhibited the fluorescein efflux from yeast cells. The inhibition constant of fluorescein extrusion from cells treated with acetate was significantly lower in parental strain than in either PDR12 (ABC-transporter Pdr12p) or WAR1 (transcriptional factor of Pdr12p) defective mutants. The constants of inhibition by propionate were virtually the same in all strains used. Yeast exposure to acetate increased the level of oxidized proteins and the activity of antioxidant enzymes, while propionate did not change these parameters. This suggests that various mechanisms underlie the yeast toxicity by acetic and propionic acids. Our studies with mutant cells clearly indicated the involvement of Yap1p transcriptional regulator and de novo protein synthesis in superoxide dismutase up-regulation by acetate. The up-regulation of catalase was Yap1p independent. Yeast pre-incubation with low concentrations of H₂O₂ caused cellular cross-protection against high concentrations of acetate. The results are discussed from the point of view that acetate induces a prooxidant effect in vivo, whereas propionate does not.

  7. Consolidated bioprocessing of lignocellulosic biomass to lactic acid by a synthetic fungal-bacterial consortium.

    PubMed

    Shahab, Robert L; Luterbacher, Jeremy S; Brethauer, Simone; Studer, Michael H

    2018-05-01

    Consolidated bioprocessing (CBP) of lignocellulosic feedstocks to platform chemicals requires complex metabolic processes, which are commonly executed by single genetically engineered microorganisms. Alternatively, synthetic consortia can be employed to compartmentalize the required metabolic functions among different specialized microorganisms as demonstrated in this work for the direct production of lactic acid from lignocellulosic biomass. We composed an artificial cross-kingdom consortium and co-cultivated the aerobic fungus Trichoderma reesei for the secretion of cellulolytic enzymes with facultative anaerobic lactic acid bacteria. We engineered ecological niches to enable the formation of a spatially structured biofilm. Up to 34.7 gL -1 lactic acid could be produced from 5% (w/w) microcrystalline cellulose. Challenges in converting pretreated lignocellulosic biomass include the presence of inhibitors, the formation of acetic acid and carbon catabolite repression. In the CBP consortium hexoses and pentoses were simultaneously consumed and metabolic cross-feeding enabled the in situ degradation of acetic acid. As a result, superior product purities were achieved and 19.8 gL -1 (85.2% of the theoretical maximum) of lactic acid could be produced from non-detoxified steam-pretreated beech wood. These results demonstrate the potential of consortium-based CBP technologies for the production of high value chemicals from pretreated lignocellulosic biomass in a single step. © 2018 Wiley Periodicals, Inc.

  8. Saccharomyces kudriavzevii and Saccharomyces uvarum differ from Saccharomyces cerevisiae during the production of aroma-active higher alcohols and acetate esters using their amino acidic precursors.

    PubMed

    Stribny, Jiri; Gamero, Amparo; Pérez-Torrado, Roberto; Querol, Amparo

    2015-07-16

    Higher alcohols and acetate esters are important flavour and aroma components in the food industry. In alcoholic beverages these compounds are produced by yeast during fermentation. Although Saccharomyces cerevisiae is one of the most extensively used species, other species of the Saccharomyces genus have become common in fermentation processes. This study analyses and compares the production of higher alcohols and acetate esters from their amino acidic precursors in three Saccharomyces species: Saccharomyces kudriavzevii, Saccharomyces uvarum and S. cerevisiae. The global volatile compound analysis revealed that S. kudriavzevii produced large amounts of higher alcohols, whereas S. uvarum excelled in the production of acetate esters. Particularly from phenylalanine, S. uvarum produced the largest amounts of 2-phenylethyl acetate, while S. kudriavzevii obtained the greatest 2-phenylethanol formation from this precursor. The present data indicate differences in the amino acid metabolism and subsequent production of flavour-active higher alcohols and acetate esters among the closely related Saccharomyces species. This knowledge will prove useful for developing new enhanced processes in fragrance, flavour, and food industries. Copyright © 2015. Published by Elsevier B.V.

  9. Efficient aquatic bacterial metabolism of dissolved low-molecular-weight compounds from terrestrial sources.

    PubMed

    Berggren, Martin; Laudon, Hjalmar; Haei, Mahsa; Ström, Lena; Jansson, Mats

    2010-03-01

    Carboxylic acids (CAs), amino acids (AAs) and carbohydrates (CHs) in dissolved free forms can be readily assimilated by aquatic bacteria and metabolized at high growth efficiencies. Previous studies have shown that these low-molecular-weight (LMW) substrates are released by phytoplankton but also that unidentified LMW compounds of terrestrial origin is a subsidy for bacterial metabolism in unproductive freshwater systems. We tested the hypothesis that different terrestrially derived CA, AA and CH compounds can offer substantial support for aquatic bacterial metabolism in fresh waters that are dominated by allochthonous dissolved organic matter (DOM). Drainage water from three catchments of different characters in the Krycklan experimental area in Northern Sweden were studied at the rising and falling limb of the spring flood, using a 2-week bioassay approach. A variety of CA, AA and CH compounds were significantly assimilated by bacteria, meeting 15-100% of the bacterial carbon demand and explaining most of the observed variation in bacterial growth efficiency (BGE; R(2)=0.66). Of the 29 chemical species that was detected, acetate was the most important, representing 45% of the total bacterial consumption of all LMW compounds. We suggest that LMW organic compounds in boreal spring flood drainage could potentially support all in situ bacterial production in receiving lake waters during periods of weeks to months after the spring flood.

  10. Epigenetic Metabolite Acetate Inhibits Class I/II Histone Deacetylases, Promotes Histone Acetylation, and Increases HIV-1 Integration in CD4+ T Cells.

    PubMed

    Bolduc, Jean-François; Hany, Laurent; Barat, Corinne; Ouellet, Michel; Tremblay, Michel J

    2017-08-15

    In this study, we investigated the effect of acetate, the most concentrated short-chain fatty acid (SCFA) in the gut and bloodstream, on the susceptibility of primary human CD4 + T cells to HIV-1 infection. We report that HIV-1 replication is increased in CD3/CD28-costimulated CD4 + T cells upon acetate treatment. This enhancing effect correlates with increased expression of the early activation marker CD69 and impaired class I/II histone deacetylase (HDAC) activity. In addition, acetate enhances acetylation of histones H3 and H4 and augments HIV-1 integration into the genome of CD4 + T cells. Thus, we propose that upon antigen presentation, acetate influences class I/II HDAC activity that transforms condensed chromatin into a more relaxed structure. This event leads to a higher level of viral integration and enhanced HIV-1 production. In line with previous studies showing reactivation of latent HIV-1 by SCFAs, we provide evidence that acetate can also increase the susceptibility of primary human CD4 + T cells to productive HIV-1 infection. IMPORTANCE Alterations in the fecal microbiota and intestinal epithelial damage involved in the gastrointestinal disorder associated with HIV-1 infection result in microbial translocation that leads to disease progression and virus-related comorbidities. Indeed, notably via production of short-chain fatty acids, bacteria migrating from the lumen to the intestinal mucosa could influence HIV-1 replication by epigenetic regulatory mechanisms, such as histone acetylation. We demonstrate that acetate enhances virus production in primary human CD4 + T cells. Moreover, we report that acetate impairs class I/II histone deacetylase activity and increases integration of HIV-1 DNA into the host genome. Therefore, it can be postulated that bacterial metabolites such as acetate modulate HIV-1-mediated disease progression. Copyright © 2017 American Society for Microbiology.

  11. Nematocyst discharge in Pelagia noctiluca (Cnidaria, Scyphozoa) oral arms can be affected by lidocaine, ethanol, ammonia and acetic acid.

    PubMed

    Morabito, Rossana; Marino, Angela; Dossena, Silvia; La Spada, Giuseppa

    2014-06-01

    Nematocyst discharge and concomitant delivery of toxins is triggered to perform both defence and predation strategies in Cnidarians, and may lead to serious local and systemic reactions in humans. Pelagia noctiluca (Cnidaria, Scyphozoa) is a jellyfish particularly abundant in the Strait of Messina (Italy). After accidental contact with this jellyfish, not discharged nematocysts or even fragments of tentacles or oral arms may tightly adhere to the human skin and, following discharge, severely increase pain and the other adverse consequences of the sting. The aim of the present study is to verify if the local anesthetic lidocaine and other compounds, like alcohols, acetic acid and ammonia, known to provide pain relief after jellyfish stings, may also affect in situ discharge of nematocysts. Discharge was induced by a combined physico-chemical stimulation of oral arms by chemosensitizers (such as N-acetylated sugars, aminoacids, proteins and nucleotides), in the presence or absence of 1% lidocaine, 70% ethanol, 5% acetic acid or 20% ammonia, followed by mechanical stimulation by a non-vibrating test probe. The above mentioned compounds failed to induce discharge per se, and dramatically impaired the chemosensitizer-induced discharge response. We therefore suggest that prompt local treatment of the stung epidermis with lidocaine, acetic acid, ethanol and ammonia may provide substantial pain relief and help in reducing possible harmful local and systemic adverse reaction following accidental contact with P. noctiluca specimens. Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. Evaluation of Prevalent Phytocannabinoids in the Acetic Acid Model of Visceral Nociception

    PubMed Central

    Booker, Lamont; Naidu, Pattipati S.; Razdan, Raj K.; Mahadevan, Anu; Lichtman, Aron H.

    2009-01-01

    Considerable preclinical research has demonstrated the efficacy of Δ9-tetrahydrocannabinol (Δ9-THC), the primary psychoactive constituent of Cannabis sativa, in a wide variety of animal models of pain, but few studies have examined other phytocannabinoids. Indeed, other plant-derived cannabinoids, including cannabidiol (CBD), cannabinol (CBN), and cannabichromene (CBC) elicit antinociceptive effects in some assays. In contrast, tetrahydrocannabivarin (THCV), another component of cannabis, antagonizes the pharmacological effects of Δ9-THC. These results suggest that various constituents of this plant may interact in a complex manner to modulate pain. The primary purpose of the present study was to assess the antinociceptive effects of these other prevalent phytocannabinoids in the acetic acid stretching test, a rodent visceral pain model. Of the cannabinoid compounds tested, Δ9-THC and CBN bound to the CB1 receptor and produced antinociceptive effects. The CB1 receptor antagonist, rimonabant, but not the CB2 receptor antagonist, SR144528, blocked the antinociceptive effects of both compounds. Although THCV bound to the CB1 receptor with similar affinity as Δ9-THC, it had no effects when administered alone, but antagonized the antinociceptive effects of Δ9-THC when both drugs were given in combination. Importantly, the antinociceptive effects of Δ9-THC and CBN occurred at lower doses than those necessary to produce locomotor suppression, suggesting motor dysfunction did not account for the decreases in acetic acid-induced abdominal stretching. These data raise the intriguing possibility that other constituents of cannabis can be used to modify the pharmacological effects of Δ9-THC by either eliciting antinociceptive effects (i.e., CBN) or antagonizing (i.e., THCV) the actions of Δ9-THC. PMID:19679411

  13. Toward understanding the chloroquine action at the molecular level in antimalarial therapy--X-ray absorption studies in acetic acid solution.

    PubMed

    Walczak, Monika S; Lawniczak-Jablonska, Krystyna; Wolska, Anna; Sikora, Marcin; Sienkiewicz, Andrzej; Suárez, Liliana; Kosar, Aaron J; Bellemare, Marie-Josee; Bohle, D Scott

    2011-04-21

    The local atomic structure around the central iron of the synthetic soluble analog of malarial pigment in acetic acid solution and with addition of chloroquine as found by X-ray absorption spectroscopy is reported. The special interest was drawn to the axial linkage between the central iron atom of the ferriprotoporphyrin IX (FePPIX) coordinated axially to the propionate group of the adjacent FePPIX. This kind of bonding is typical for hematin anhydride. Detailed analysis revealed differences in oxygen coordination sphere (part of dimer linkage bond) between synthetic equivalent of hemozoin in the powder state and dissolved in acetic acid and water at different concentrations mimicking the physiological condition of the parasite's food vacuole. The results of performed studies suggest that the molecular structure of synthetic analogue of hemozoin is no longer dimer-like in acidic solution. Further changes in atomic order around Fe are seen after addition of the antimalarial drug chloroquine.

  14. Is Bacterial Fatty Acid Synthesis a Valid Target for Antibacterial Drug Discovery?

    PubMed Central

    Parsons, Joshua B.; Rock, Charles O.

    2011-01-01

    The emergence of resistance against most current drugs emphasizes the need to develop new approaches to control bacterial pathogens, particularly Staphylococcus aureus. Bacterial fatty acid synthesis is one such target that is being actively pursued by several research groups to develop anti-Staphylococcal agents. Recently, the wisdom of this approach has been challenged based on the ability of a Gram-positive bacterium to incorporate extracellular fatty acids and thus circumvent the inhibition of de novo fatty acid synthesis. The generality of this conclusion has been challenged, and there is enough diversity in the enzymes and regulation of fatty acid synthesis in bacteria to conclude that there isn’t a single organism that can be considered typical and representative of bacteria as a whole. We are left without a clear resolution to this ongoing debate and await new basic research to define the pathways for fatty acid uptake and that determine the biochemical and genetic mechanisms for the regulation of fatty acid synthesis in Gram-positive bacteria. These crucial experiments will determine whether diversity in the control of this important pathway accounts for the apparently different responses of Gram-positive bacteria to the inhibition of de novo fatty acid synthesis in presence of extracellular fatty acid supplements. PMID:21862391

  15. Pdr18 is involved in yeast response to acetic acid stress counteracting the decrease of plasma membrane ergosterol content and order.

    PubMed

    Godinho, Cláudia P; Prata, Catarina S; Pinto, Sandra N; Cardoso, Carlos; Bandarra, Narcisa M; Fernandes, Fábio; Sá-Correia, Isabel

    2018-05-18

    Saccharomyces cerevisiae has the ability to become less sensitive to a broad range of chemically and functionally unrelated cytotoxic compounds. Among multistress resistance mechanisms is the one mediated by plasma membrane efflux pump proteins belonging to the ABC superfamily, questionably proposed to enhance the kinetics of extrusion of all these compounds. This study provides new insights into the biological role and impact in yeast response to acetic acid stress of the multistress resistance determinant Pdr18 proposed to mediate ergosterol incorporation in plasma membrane. The described coordinated activation of the transcription of PDR18 and of several ergosterol biosynthetic genes (ERG2-4, ERG6, ERG24) during the period of adaptation to acetic acid inhibited growth provides further support to the involvement of Pdr18 in yeast response to maintain plasma membrane ergosterol content in stressed cells. Pdr18 role in ergosterol homeostasis helps the cell to counteract acetic acid-induced decrease of plasma membrane lipid order, increase of the non-specific membrane permeability and decrease of transmembrane electrochemical potential. Collectively, our results support the notion that Pdr18-mediated multistress resistance is closely linked to the status of plasma membrane lipid environment related with ergosterol content and the associated plasma membrane properties.

  16. Aerobic Oxidation of 5-(Hydroxymethyl)furfural Cyclic Acetal Enables Selective Furan-2,5-dicarboxylic Acid Formation with CeO2 -Supported Gold Catalyst.

    PubMed

    Kim, Minjune; Su, Yaqiong; Fukuoka, Atsushi; Hensen, Emiel J M; Nakajima, Kiyotaka

    2018-05-14

    The utilization of 5-(hydroxymethyl)furfural (HMF) for the large-scale production of essential chemicals has been largely limited by the formation of solid humin as a byproduct, which prevents the operation of stepwise batch-type and continuous flow-type processes. The reaction of HMF with 1,3-propanediol produces an HMF acetal derivative that exhibits excellent thermal stability. Aerobic oxidation of the HMF acetal with a CeO 2 -supported Au catalyst and Na 2 CO 3 in water gives a 90-95 % yield of furan 2,5-dicarboxylic acid, an increasingly important commodity chemical for the biorenewables industry, from concentrated solutions (10-20 wt %) without humin formation. The six-membered acetal ring suppresses thermal decomposition and self-polymerization of HMF in concentrated solutions. Kinetic studies supported by DFT calculations identify two crucial steps in the reaction mechanism, that is, the partial hydrolysis of the acetal into 5-formyl-2-furan carboxylic acid involving OH - and Lewis acid sites on CeO 2 , and subsequent oxidative dehydrogenation of the in situ generated hemiacetal involving Au nanoparticles. These results represent a significant advance over the current state of the art, overcoming an inherent limitation of the oxidation of HMF to an important monomer for biopolymer production. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Optimisation of continuous gas fermentation by immobilisation of acetate-producing Acetobacterium woodii.

    PubMed

    Steger, Franziska; Rachbauer, Lydia; Windhagauer, Matthias; Montgomery, Lucy F R; Bochmann, Günther

    2017-08-01

    Hydrogen from water electrolysis is often suggested as a way of storing the excess energy from wind and solar power plants. However, unlike natural gas, hydrogen is difficult to store and distribute. One solution is to convert the hydrogen into other fuels or bulk chemicals. In this study we investigated fermentation in which homoacetogenic clostridia apply the Wood-Ljungdahl pathway to generate acetate from H 2 and CO 2 . Acetate can be used as a bulk chemical or further transformed into biofuels. Autotrophic growth with CO 2 as the sole carbon source is slow compared to heterotrophic growth, so the aim of this work was to improve continuous gas fermentation by immobilising the acetate-producing clostridia, thus preventing their wash out from the bioreactor. Two homoacetogenic bacterial strains (Acetobacterium woodii and Moorella thermoacetica) were tested for their acetate production potential, with A. woodii proving to be the better strain with maximum acetate concentration of 29.57 g l -1 . Due to its stability during fermentation and good bacterial immobilisation, linen was chosen as immobilisation material for continuous fermentation. This study demonstrates the successful continuous fermentation of acetate from H 2 and CO 2 using A. woodii immobilised on a low-cost surface at high volumetric productivity of 1.21 ± 0.05 g acetate l -1 d -1 . This has great industrial potential and future studies should focus on the scale-up of this process. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Azithromycin and erythromycin ameliorate the extent of colonic damage induced by acetic acid in rats

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mahgoub, Afaf; El-Medany, Azza; Mustafa, Ali

    2005-05-15

    Ulcerative colitis is a common inflammatory bowel disease (IBD) of unknown etiology. Recent studies have revealed the role of some microorganisms in the initiation and perpetuation of IBD. The role of antibiotics in the possible modulation of colon inflammation is still uncertain. In this study, we evaluated the effects of two macrolides, namely azithromycin and erythromycin, at different doses on the extent and severity of ulcerative colitis caused by intracolonic administration of 3% acetic acid in rats. The lesions and the inflammatory response were assessed by histology and measurement of myeloperoxidase (MPO) activity, nitric oxide synthetase (NOS) and tumor necrosismore » factor alpha (TNF{alpha}) in colonic tissues. Inflammation following acetic acid instillation was characterized by oedema, diffuse inflammatory cell infiltration and necrosis. Increase in MPO, NOS and TNF{alpha} was detected in the colonic tissues. Administration of either azithromycin or erythromycin at different dosage (10, 20 and 40 mg/kg orally, daily for 5 consecutive days) significantly (P < 0.05) reduced the colonic damage, MPO and NOS activities as well as TNF{alpha} level. This reduction was highly significant with azithromycin when given at a dose of 40 mg/kg. It is concluded that azithromycin and erythromycin may have a beneficial therapeutic role in ulcerative colitis.« less

  19. Ethylene-enhanced catabolism of ( sup 14 C)indole-3-acetic acid to indole-3-carboxylic acid in citrus leaf tissues. [Citrus sinensis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sagee, O.; Riov, J.; Goren, J.

    Exogenous ({sup 14}C)indole-3-acetic acid (IAA) is conjugated in citrus (Citrus sinensis) leaf tissues to one major substance which has been identified as indole-3-acetylaspartic acid (IAAsp). Ethylene pretreatment enhanced the catabolism of ({sup 14}C)IAA to indole-3-carboxylic acid (ICA), which accumulated as glucose esters (ICGlu). Increased formation of ICGlu by ethylene was accompanied by a concomitant decrease in IAAsp formation. IAAsp and ICGlu were identified by combined gas chromatography-mass spectrometry. Formation of ICGlu was dependent on the concentration of ethylene and the duration of the ethylene pretreatment. It is suggested that the catabolism of IAA to ICA may be one of themore » mechanisms by which ethylene endogenous IAA levels.« less

  20. Rapid identification of acetic acid bacteria using MALDI-TOF mass spectrometry fingerprinting.

    PubMed

    Andrés-Barrao, Cristina; Benagli, Cinzia; Chappuis, Malou; Ortega Pérez, Ruben; Tonolla, Mauro; Barja, François

    2013-03-01

    Acetic acid bacteria (AAB) are widespread microorganisms characterized by their ability to transform alcohols and sugar-alcohols into their corresponding organic acids. The suitability of matrix-assisted laser desorption-time of flight mass spectrometry (MALDI-TOF MS) for the identification of cultured AAB involved in the industrial production of vinegar was evaluated on 64 reference strains from the genera Acetobacter, Gluconacetobacter and Gluconobacter. Analysis of MS spectra obtained from single colonies of these strains confirmed their basic classification based on comparative 16S rRNA gene sequence analysis. MALDI-TOF analyses of isolates from vinegar cross-checked by comparative sequence analysis of 16S rRNA gene fragments allowed AAB to be identified, and it was possible to differentiate them from mixed cultures and non-AAB. The results showed that MALDI-TOF MS analysis was a rapid and reliable method for the clustering and identification of AAB species. Copyright © 2012 Elsevier GmbH. All rights reserved.

  1. Reinforcement of bacterial cellulose aerogels with biocompatible polymers

    PubMed Central

    Pircher, N.; Veigel, S.; Aigner, N.; Nedelec, J.M.; Rosenau, T.; Liebner, F.

    2014-01-01

    Bacterial cellulose (BC) aerogels, which are fragile, ultra-lightweight, open-porous and transversally isotropic materials, have been reinforced with the biocompatible polymers polylactic acid (PLA), polycaprolactone (PCL), cellulose acetate (CA), and poly(methyl methacrylate) (PMMA), respectively, at varying BC/polymer ratios. Supercritical carbon dioxide anti-solvent precipitation and simultaneous extraction of the anti-solvent using scCO2 have been used as core techniques for incorporating the secondary polymer into the BC matrix and to convert the formed composite organogels into aerogels. Uniaxial compression tests revealed a considerable enhancement of the mechanical properties as compared to BC aerogels. Nitrogen sorption experiments at 77 K and scanning electron micrographs confirmed the preservation (or even enhancement) of the surface-area-to-volume ratio for most of the samples. The formation of an open-porous, interpenetrating network of the second polymer has been demonstrated by treatment of BC/PMMA hybrid aerogels with EMIM acetate, which exclusively extracted cellulose, leaving behind self-supporting organogels. PMID:25037381

  2. Bacterial endophytes enhance competition by invasive plants.

    PubMed

    Rout, Marnie E; Chrzanowski, Thomas H; Westlie, Tara K; DeLuca, Thomas H; Callaway, Ragan M; Holben, William E

    2013-09-01

    Invasive plants can alter soil microbial communities and profoundly alter ecosystem processes. In the invasive grass Sorghum halepense, these disruptions are consequences of rhizome-associated bacterial endophytes. We describe the effects of N2-fixing bacterial strains from S. halepense (Rout and Chrzanowski, 2009) on plant growth and show that bacteria interact with the plant to alter soil nutrient cycles, enabling persistence of the invasive. • We assessed fluxes in soil nutrients for ∼4 yr across a site invaded by S. halepense. We assayed the N2-fixing bacteria in vitro for phosphate solubilization, iron chelation, and production of the plant-growth hormone indole-3-acetic acid (IAA). We assessed the plant's ability to recruit bacterial partners from substrates and vertically transmit endophytes to seeds and used an antibiotic approach to inhibit bacterial activity in planta and assess microbial contributions to plant growth. • We found persistent alterations to eight biogeochemical cycles (including nitrogen, phosphorus, and iron) in soils invaded by S. halepense. In this context, three bacterial isolates solubilized phosphate, and all produced iron siderophores and IAA in vitro. In growth chamber experiments, bacteria were transmitted vertically, and molecular analysis of bacterial community fingerprints from rhizomes indicated that endophytes are also horizontally recruited. Inhibiting bacterial activity with antibiotics resulted in significant declines in plant growth rate and biomass, with pronounced rhizome reductions. • This work suggests a major role of endophytes on growth and resource allocation of an invasive plant. Indeed, bacterial isolate physiology is correlated with invader effects on biogeochemical cycles of nitrogen, phosphate, and iron.

  3. Anaerobic microbial dissolution of lead and production of organic acids

    DOEpatents

    Francis, Arokiasamy J.; Dodge, Cleveland; Chendrayan, Krishnachetty; Quinby, Helen L.

    1988-01-01

    The present invention relates to an anaerobic bacterial culture of Clostridium sp. ATCC No. 53464 which solubilizes lead oxide under anaerobic conditions in coal and industrial wastes and therefore presents a method of removing lead from such wastes before they are dumped into the environment. The rate of lead dissolution during logarithmic growth of the bacteria in 40 ml medium containing 3.32 .mu.moles of lead as lead oxide was 0.042 .mu.moles ml.sup.-1 hr.sup.-1. Dissolution of lead oxide by the bacterial isolate is due to the production of metabolites and acidity in the culture medium. The major metabolites are acetic, butyric and lactic acid. Clostridium sp. ATCC No. 53464 can be used in the recovery of strategic metals from ores and wastes and also for the production of lactic acid for commercial purposes. The process yields large quantities of lactic acid as well as lead complexed in a stable form with said acids.

  4. The effect of particle immersing in acetic acid solution on dimensional stability and strength properties of particleboard

    NASA Astrophysics Data System (ADS)

    Heri Iswanto, Apri; Hermanto, Samuel; Sucipto, Tito

    2018-03-01

    The objective of the research was to evaluate the effect of particle immersing treatments in acetic acid (AA) solution on dimensional stability and strength properties of particleboard. Particle was immersed in various level AA solution namely 0 (untreated), 1, 2, 3, 4% for 24 hours. Afterward, the particle was oven dried up to 5% moisture content. The amount of 12% UF resin level used for binding in manufacturing particleboard. Board size, thickness and density target in this experiment was 25 by 25 cm2, 1 cm, and 0.75 g/cm3 respectively. After mat forming, board pressed using 130°C temperature, 30 kg/cm2, and pressure for 10 minutes. The results showed that particles immersing in AA solution provide enhancement of thickness swelling (TS) parameters. Overall, 1% AA solution is the best treatment to improve dimensional stability. The similar results also showed by internal bond value. In general, the excess of 1% acetic acid level resulted in decreasing of IB value. A similar trend also occurs in modulus of rupture (MoR) and modulus of elasticity (MoE) parameters.

  5. Kinetic analysis of strains of lactic acid bacteria and acetic acid bacteria in cocoa pulp simulation media toward development of a starter culture for cocoa bean fermentation.

    PubMed

    Lefeber, Timothy; Janssens, Maarten; Camu, Nicholas; De Vuyst, Luc

    2010-12-01

    The composition of cocoa pulp simulation media (PSM) was optimized with species-specific strains of lactic acid bacteria (PSM-LAB) and acetic acid bacteria (PSM-AAB). Also, laboratory fermentations were carried out in PSM to investigate growth and metabolite production of strains of Lactobacillus plantarum and Lactobacillus fermentum and of Acetobacter pasteurianus isolated from Ghanaian cocoa bean heap fermentations, in view of the development of a defined starter culture. In a first step, a selection of strains was made out of a pool of strains of these LAB and AAB species, obtained from previous studies, based on their fermentation kinetics in PSM. Also, various concentrations of citric acid in the presence of glucose and/or fructose (PSM-LAB) and of lactic acid in the presence of ethanol (PSM-AAB) were tested. These data could explain the competitiveness of particular cocoa-specific strains, namely, L. plantarum 80 (homolactic and acid tolerant), L. fermentum 222 (heterolactic, citric acid fermenting, mannitol producing, and less acid tolerant), and A. pasteurianus 386B (ethanol and lactic acid oxidizing, acetic acid overoxidizing, acid tolerant, and moderately heat tolerant), during the natural cocoa bean fermentation process. For instance, it turned out that the capacity to use citric acid, which was exhibited by L. fermentum 222, is of the utmost importance. Also, the formation of mannitol was dependent not only on the LAB strain but also on environmental conditions. A mixture of L. plantarum 80, L. fermentum 222, and A. pasteurianus 386B can now be considered a mixed-strain starter culture for better controlled and more reliable cocoa bean fermentation processes.

  6. Cost-effective production of bacterial cellulose using acidic food industry by-products.

    PubMed

    Revin, Victor; Liyaskina, Elena; Nazarkina, Maria; Bogatyreva, Alena; Shchankin, Mikhail

    2018-03-13

    To reduce the cost of obtaining bacterial cellulose, acidic by-products of the alcohol and dairy industries were used without any pretreatment or addition of other nitrogen sources. Studies have shown that the greatest accumulation of bacterial cellulose (6.19g/L) occurs on wheat thin stillage for 3 days of cultivation under dynamic conditions, which is almost 3 times higher than on standard Hestrin and Schramm medium (2.14g/L). The use of whey as a nutrient medium makes it possible to obtain 5.45g/L bacterial cellulose under similar conditions of cultivation. It is established that the pH of the medium during the growth of Gluconacetobacter sucrofermentans B-11267 depends on the feedstock used and its initial value. By culturing the bacterium on thin stillage and whey, there is a decrease in the acidity of the waste. It is shown that the infrared spectra of bacterial cellulose obtained in a variety of environments have a similar character, but we found differences in the micromorphology and crystallinity of the resulting biopolymer. Copyright © 2018 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  7. RIG-I detects infection with live Listeria by sensing secreted bacterial nucleic acids

    PubMed Central

    Abdullah, Zeinab; Schlee, Martin; Roth, Susanne; Mraheil, Mobarak Abu; Barchet, Winfried; Böttcher, Jan; Hain, Torsten; Geiger, Sergej; Hayakawa, Yoshihiro; Fritz, Jörg H; Civril, Filiz; Hopfner, Karl-Peter; Kurts, Christian; Ruland, Jürgen; Hartmann, Gunther; Chakraborty, Trinad; Knolle, Percy A

    2012-01-01

    Immunity against infection with Listeria monocytogenes is not achieved from innate immune stimulation by contact with killed but requires viable Listeria gaining access to the cytosol of infected cells. It has remained ill-defined how such immune sensing of live Listeria occurs. Here, we report that efficient cytosolic immune sensing requires access of nucleic acids derived from live Listeria to the cytoplasm of infected cells. We found that Listeria released nucleic acids and that such secreted bacterial RNA/DNA was recognized by the cytosolic sensors RIG-I, MDA5 and STING thereby triggering interferon β production. Secreted Listeria nucleic acids also caused RIG-I-dependent IL-1β-production and inflammasome activation. The signalling molecule CARD9 contributed to IL-1β production in response to secreted nucleic acids. In conclusion, cytosolic recognition of secreted bacterial nucleic acids by RIG-I provides a mechanistic explanation for efficient induction of immunity by live bacteria. PMID:23064150

  8. Protective Effect of Cod (Gadus macrocephalus) Skin Collagen Peptides on Acetic Acid-Induced Gastric Ulcer in Rats.

    PubMed

    Niu, Huina; Wang, Zhicong; Hou, Hu; Zhang, Zhaohui; Li, Bafang

    2016-07-01

    This research was performed to explore the protective effect of cod skin collagen peptides (CCP) on gastric ulcer induced by acetic acid. The CCP were fractionated into low molecular CCP (LMCCP, Mw < 3 kDa) and high molecular CCP (HMCCP, Mw > 3 kDa). In HMCCP and LMCCP, glycine of accounted for about one-third of the total amino acids without cysteine and tryptophan, and hydrophobic amino acids accounted for about 50%. After 21 d CCP treatment (60 or 300 mg/kg, p.o./daily), the healing effects on acetic acid-induced gastric ulcers were evaluated by macroscopic measure, microscopic measure, and immune histochemistry. Moreover, the expression levels of the growth factors, such as vascular endothelial growth factor, epidermal growth factor, transforming growth factor β1 (TGFβ1), and the heat shock protein 70 (HSP70) was detected. The results showed that both LMCCP and HMCCP could significantly decrease the ulcer areas and promote the healing of the lesions. They also could improve the levels of hexosamine, glutathione, superoxide dismutase, and glutathione peroxidase, and reduce the content of malondialdehyde and inducible nitric oxide synthase. In addition, the expression level of TGFβ1 gene and HSP70 mRNA was significantly improved by the treatment. It suggested that CCP could be able to improve symptoms of gastric ulcer and probably be used in the treatment of gastric ulcer. © 2016 Institute of Food Technologists®

  9. Performance of visual inspection with acetic acid for cervical cancer screening: a qualitative summary of evidence to date.

    PubMed

    Gaffikin, Lynne; Lauterbach, Margo; Blumenthal, Paul D

    2003-08-01

    Developing countries often lack the necessary resources to use the Papanicolaou (Pap) smear as a screening tool for cervical abnormalities. Because the burden of cervical cancer is highest in such low-resource settings, alternative techniques have been sought. Recently, interest in visual inspection with acetic acid (VIA) has increased. Numerous studies have been conducted on its accuracy and its ability to detect cervical lesions when compared with other techniques, both conventional and nonconventional. This review summarizes key findings from the literature to provide researchers and policymakers with an up-to-date summary on VIA. PubMed was used to identify relevant journal articles published between 1982 and 2002. Key words were cervical cancer screening, visual inspection, VIA (visual inspection with acetic acid), DVI (direct visual inspection), AAT (acetic acid test), and cervicoscopy. Studies were eligible for review only if they involved analysis of primary VIA data (ie, not review articles); studies involving magnification devices were excluded. Fifteen studies were reviewed in total; key results were extracted and a summary analysis was performed for sensitivity and specificity parameters. When reported, sensitivity ranged between 66% and 96% and specificity between 64% and 98%. Authors comparing VIA with cytology noted that the overall usefulness of VIA compares favorably with that of the Pap test. The reported findings reviewed here suggest that VIA has the potential to be a cervical cancer screening tool, especially in low resource settings. Obstetricians & Gynecologists, Family Physicians. After completion of this article, the reader will be able to describe how visual inspection of the cervix for cervical cancer screening (VIA) is performed, to summarize the current literature on VIA, and to list potential advantages of VIA.

  10. Trapping female Pandemis limitata (Lepidoptera: Tortricidae) moths with mixtures of acetic acid, benzenoid apple leaf volatiles, and sex pheromones

    USDA-ARS?s Scientific Manuscript database

    Pandemis limitata (Robinson) is one of several leaf-feeding caterpillar pests of commercial tree-fruit crops in British Columbia. Recent discovery that European Pandemis spp. are attracted to lures containing acetic acid (AA) and caterpillar-induced benzenoid apple leaf volatiles, 2-phenylethanol a...

  11. Acetobacter ghanensis sp. nov., a novel acetic acid bacterium isolated from traditional heap fermentations of Ghanaian cocoa beans.

    PubMed

    Cleenwerck, Ilse; Camu, Nicholas; Engelbeen, Katrien; De Winter, Tom; Vandemeulebroecke, Katrien; De Vos, Paul; De Vuyst, Luc

    2007-07-01

    Twenty-three acetic acid bacteria, isolated from traditional heap fermentations of Ghanaian cocoa beans, were subjected to a polyphasic taxonomic study. The isolates were catalase-positive, oxidase-negative, Gram-negative rods. They oxidized ethanol to acetic acid and were unable to produce 2-ketogluconic acid, 5-ketogluconic acid and 2,5-diketogluconic acid from glucose; therefore, they were tentatively identified as Acetobacter species. 16S rRNA gene sequencing and phylogenetic analysis confirmed their position in the genus Acetobacter, with Acetobacter syzygii and Acetobacter lovaniensis as their closest phylogenetic neighbours. (GTG)(5)-PCR fingerprinting grouped the strains in a cluster that did not contain any type strains of members of the genus Acetobacter. DNA-DNA hybridization with the type strains of all recognized Acetobacter species revealed DNA-DNA relatedness values below the species level. The DNA G+C contents of three selected strains were 56.9-57.3 mol%. The novel strains had phenotypic characteristics that enabled them to be differentiated from phylogenetically related Acetobacter species, i.e. they were motile, did not produce 2-ketogluconic acid or 5-ketogluconic acid from glucose, were catalase-positive and oxidase-negative, grew on yeast extract with 30 % glucose, grew on glycerol (although weakly) but not on maltose or methanol as carbon sources, and did not grow with ammonium as sole nitrogen source and ethanol as carbon source. Based on the genotypic and phenotypic data, the isolates represent a novel species of the genus Acetobacter for which the name Acetobacter ghanensis sp. nov. is proposed. The type strain is R-29337(T) (=430A(T)=LMG 23848(T)=DSM 18895(T)).

  12. Simultaneous utilization of cellobiose, xylose, and acetic acid from lignocellulosic biomass for biofuel production by an engineered yeast platform.

    PubMed

    Wei, Na; Oh, Eun Joong; Million, Gyver; Cate, Jamie H D; Jin, Yong-Su

    2015-06-19

    The inability of fermenting microorganisms to use mixed carbon components derived from lignocellulosic biomass is a major technical barrier that hinders the development of economically viable cellulosic biofuel production. In this study, we integrated the fermentation pathways of both hexose and pentose sugars and an acetic acid reduction pathway into one Saccharomyces cerevisiae strain for the first time using synthetic biology and metabolic engineering approaches. The engineered strain coutilized cellobiose, xylose, and acetic acid to produce ethanol with a substantially higher yield and productivity than the control strains, and the results showed the unique synergistic effects of pathway coexpression. The mixed substrate coutilization strategy is important for making complete and efficient use of cellulosic carbon and will contribute to the development of consolidated bioprocessing for cellulosic biofuel. The study also presents an innovative metabolic engineering approach whereby multiple substrate consumption pathways can be integrated in a synergistic way for enhanced bioconversion.

  13. Rifaximin Modulates the Vaginal Microbiome and Metabolome in Women Affected by Bacterial Vaginosis

    PubMed Central

    Picone, Gianfranco; Cruciani, Federica; Brigidi, Patrizia; Calanni, Fiorella; Donders, Gilbert; Capozzi, Francesco; Vitali, Beatrice

    2014-01-01

    Bacterial vaginosis (BV) is a common vaginal disorder characterized by the decrease of lactobacilli and overgrowth of Gardnerella vaginalis and resident anaerobic vaginal bacteria. In the present work, the effects of rifaximin vaginal tablets on vaginal microbiota and metabolome of women affected by BV were investigated by combining quantitative PCR and a metabolomic approach based on 1H nuclear magnetic resonance. To highlight the general trends of the bacterial communities and metabolomic profiles in response to the antibiotic/placebo therapy, a multivariate statistical strategy was set up based on the trajectories traced by vaginal samples in a principal component analysis space. Our data demonstrated the efficacy of rifaximin in restoring a health-like condition in terms of both bacterial communities and metabolomic features. In particular, rifaximin treatment was significantly associated with an increase in the lactobacillus/BV-related bacteria ratio, as well as with an increase in lactic acid concentration and a decrease of a pool of metabolites typically produced by BV-related bacteria (acetic acid, succinate, short-chain fatty acids, and biogenic amines). Among the tested dosages of rifaximin (100 and 25 mg for 5 days and 100 mg for 2 days), 25 mg for 5 days was found to be the most effective. PMID:24709255

  14. Contribution of bacterial cells to lacustrine organic matter based on amino sugars and D-amino acids

    NASA Astrophysics Data System (ADS)

    Carstens, Dörte; Köllner, Krista E.; Bürgmann, Helmut; Wehrli, Bernhard; Schubert, Carsten J.

    2012-07-01

    Amino sugars (ASs), D-amino acids (D-AAs), and bacterial cell counts were measured in two Swiss lakes to study the contribution of bacterial cells to organic matter (OM) and the fate of ASs and bacterial amino biomarkers during OM degradation. Concentrations of individual ASs (glucosamine, galactosamine, muramic acid, and mannosamine) in the particulate and total OM pools were analyzed in water-column profiles of Lake Brienz (oligotrophic and oxic throughout the entire water column) and Lake Zug (eutrophic, stratified, and permanently anoxic below 170 m) in spring and in fall. Generally, carbon-normalized AS concentrations decreased with water depth, indicating the preferential decomposition of ASs. For Lake Brienz the relative loss of particulate ASs was higher than in Lake Zug, suggesting enhanced AS turnover in an oligotrophic environment. AS ratio changes in the water column revealed a replacement of plankton biomass with OM from heterotrophic microorganisms with increasing water depth. Similar to the ASs, highest carbon normalized D-AA concentrations were found in the upper water column with decreasing concentrations with depth and an increase close to the sediments. In Lake Zug, an increase in the percentage of D-AAs also showed the involvement of bacteria in OM degradation. Estimations of OM derived from bacterial cells using cell counts and the bacterial biomarkers muramic acid and D-AAs gave similar results. For Lake Brienz 0.2-14% of the organic carbon pool originated from bacterial cells, compared to only 0.1-5% in Lake Zug. Based on our estimates, muramic acid appeared primarily associated with bacterial biomass and not with refractory bacterial necromass. Our study underscores that bacteria are not only important drivers of OM degradation in lacustrine systems, they also represent a significant source of OM themselves, especially in oligotrophic lakes.

  15. Ethanol and Acetic Acid Production from Carbon Monoxide in a Clostridium Strain in Batch and Continuous Gas-Fed Bioreactors

    PubMed Central

    Nalakath Abubackar, Haris; Veiga, María C.; Kennes, Christian

    2015-01-01

    The effect of different sources of nitrogen as well as their concentrations on the bioconversion of carbon monoxide to metabolic products such as acetic acid and ethanol by Clostridium autoethanogenum was studied. In a first set of assays, under batch conditions, either NH4Cl, trypticase soy broth or yeast extract (YE) were used as sources of nitrogen. The use of YE was found statistically significant (p < 0.05) on the product spectrum in such batch assays. In another set of experiments, three bioreactors were operated with continuous CO supply, in order to estimate the effect of running conditions on products and biomass formation. The bioreactors were operated under different conditions, i.e., EXP1 (pH = 5.75, YE 1g/L), EXP2 (pH = 4.75, YE 1 g/L) and EXP3 (pH = 5.75, YE 0.2 g/L). When compared to EXP2 and EXP3, it was found that EXP1 yielded the maximum biomass accumulation (302.4 mg/L) and products concentrations, i.e., acetic acid (2147.1 mg/L) and ethanol (352.6 mg/L). This can be attributed to the fact that the higher pH and higher YE concentration used in EXP1 stimulated cell growth and did, consequently, also enhance metabolite production. However, when ethanol is the desired end-product, as a biofuel, the lower pH used in EXP2 was more favourable for solventogenesis and yielded the highest ethanol/acetic acid ratio, reaching a value of 0.54. PMID:25608591

  16. Ethanol and acetic acid production from carbon monoxide in a Clostridium strain in batch and continuous gas-fed bioreactors.

    PubMed

    Abubackar, Haris Nalakath; Veiga, María C; Kennes, Christian

    2015-01-20

    The effect of different sources of nitrogen as well as their concentrations on the bioconversion of carbon monoxide to metabolic products such as acetic acid and ethanol by Clostridium autoethanogenum was studied. In a first set of assays, under batch conditions, either NH4Cl, trypticase soy broth or yeast extract (YE) were used as sources of nitrogen. The use of YE was found statistically significant (p < 0.05) on the product spectrum in such batch assays. In another set of experiments, three bioreactors were operated with continuous CO supply, in order to estimate the effect of running conditions on products and biomass formation. The bioreactors were operated under different conditions, i.e., EXP1 (pH = 5.75, YE 1g/L), EXP2 (pH = 4.75, YE 1 g/L) and EXP3 (pH = 5.75, YE 0.2 g/L). When compared to EXP2 and EXP3, it was found that EXP1 yielded the maximum biomass accumulation (302.4 mg/L) and products concentrations, i.e., acetic acid (2147.1 mg/L) and ethanol (352.6 mg/L). This can be attributed to the fact that the higher pH and higher YE concentration used in EXP1 stimulated cell growth and did, consequently, also enhance metabolite production. However, when ethanol is the desired end-product, as a biofuel, the lower pH used in EXP2 was more favourable for solventogenesis and yielded the highest ethanol/acetic acid ratio, reaching a value of 0.54.

  17. Reduction in bacterial load using hypochlorous acid hygiene solution on ocular skin

    PubMed Central

    Stroman, David W; Mintun, Keri; Epstein, Arthur B; Brimer, Crystal M; Patel, Chirag R; Branch, James D; Najafi-Tagol, Kathryn

    2017-01-01

    Purpose To examine the magnitude of bacterial load reduction on the surface of the periocular skin 20 minutes after application of a saline hygiene solution containing 0.01% pure hypochlorous acid (HOCl). Methods Microbiological specimens were collected immediately prior to applying the hygiene solution and again 20 minutes later. Total microbial colonies were counted and each unique colony morphology was processed to identify the bacterial species and to determine the susceptibility profile to 15 selected antibiotics. Results Specimens were analyzed from the skin samples of 71 eyes from 36 patients. Prior to treatment, 194 unique bacterial isolates belonging to 33 different species were recovered. Twenty minutes after treatment, 138 unique bacterial isolates belonging to 26 different species were identified. Staphylococci accounted for 61% of all strains recovered and Staphylococcus epidermidis strains comprised 60% of the staphylococcal strains. No substantial differences in the distribution of Gram-positive, Gram-negative, or anaerobic species were noted before and after treatment. The quantitative data demonstrated a >99% reduction in the staphylococcal load on the surface of the skin 20 minutes following application of the hygiene solution. The total S. epidermidis colony-forming units were reduced by 99.5%. The HOCl hygiene solution removed staphylococcal isolates that were resistant to multiple antibiotics equally well as those isolates that were susceptible to antibiotics. Conclusion The application of a saline hygiene solution preserved with pure HOCl acid reduced the bacterial load significantly without altering the diversity of bacterial species remaining on the skin under the lower eyelid. PMID:28458509

  18. The impact of zinc sulfate addition on the dynamic metabolic profiling of Saccharomyces cerevisiae subjected to long term acetic acid stress treatment and identification of key metabolites involved in the antioxidant effect of zinc.

    PubMed

    Wan, Chun; Zhang, Mingming; Fang, Qing; Xiong, Liang; Zhao, Xinqing; Hasunuma, Tomohisa; Bai, Fengwu; Kondo, Akihiko

    2015-02-01

    The mechanisms of how zinc protects the cells against acetic acid toxicity and acts as an antioxidant are still not clear. Here we present results of the metabolic profiling of the eukaryotic model yeast species Saccharomyces cerevisiae subjected to long term high concentration acetic acid stress treatment in the presence and absence of zinc supplementation. Zinc addition decreased the release of reactive oxygen species (ROS) in the presence of chronic acetic acid stress. The dynamic changes in the accumulation of intermediates in central carbon metabolism were observed, and higher contents of intracellular alanine, valine and serine were observed by zinc supplementation. The most significant change was observed in alanine content, which is 3.51-fold of that of the control culture in cells in the stationary phase. Subsequently, it was found that 0.5 g L(-1) alanine addition resulted in faster glucose consumption in the presence of 5 g L(-1) acetic acid, and apparently decreased ROS accumulation in zinc-supplemented cells. This indicates that alanine exerted its antioxidant effect at least partially through the detoxification of acetic acid. In addition, intracellular glutathione (GSH) accumulation was enhanced by zinc addition, which is related to the protection of yeast cells from the oxidative injury caused by acetic acid. Our studies revealed for the first time that zinc modulates cellular amino acid metabolism and redox balance, especially biosynthesis of alanine and glutathione to exert its antioxidant effect.

  19. Final report on the safety assessment of ethoxyethanol and ethoxyethanol acetate.

    PubMed

    Johnson, Wilbur

    2002-01-01

    Ethoxyethanol is an ether alcohol described as a solvent and viscosity-decreasing agent for use in cosmetics. Ethoxyethanol Acetate is the ester of Ethoxyethanol and acetic acid described as a solvent for use in cosmetics. Although these ingredients have been used in the past, neither ingredient is in current use. Ethoxyethanol is produced by reacting ethylene oxide with ethyl alcohol. Ethoxyethanol Acetate is produced via an esterification of Ethoxyethanol and acetic acid, acetic acid anhydride, or acetic chloride. Ethoxyethanol is metabolized to ethoxyacetaldehyde, which is further metabolized to ethoxyacetic acid, which is also a metabolite of Ethoxyethanol Acetate. Low to moderate acute inhalation toxicity is seen in animals studies. Acute oral toxicity studies in several species reported kidney damage, including extreme tubular degeneration. Kidney damage was also seen in acute dermal toxicity studies in rats and rabbits. Minor liver and kidney damage was also seen in short-term studies of rats injected subcutaneously with Ethoxyethanol, but was absent in dogs dosed intravenously. Mixed toxicity results were also seen in subchronic tests in mice and rats. Ethoxyethanol and Ethoxyethanol Acetate were mild to moderate eye irritants in rabbits; mild skin irritants in rabbits, and nonsensitizing in guinea pigs. Most genotoxicity tests were negative, but chromosome aberrations and sister-chromatid exchanges were among the positive results seen. Numerous reproductive and developmental toxicity studies, across several species, involving various routes of administration, indicate that Ethoxyethanol and Ethoxyethanol Acetate are reproductive toxicants and teratogens. Mild anemia was reported in individuals exposed occupationally to Ethoxyethanol, which resolved when the chemical was not used. Reproductive effects have been noted in males exposed occupationally to Ethoxyethanol. Although there are insufficient data to determine the potential carcinogenic effects of

  20. Vinpocetine Ameliorates Acetic Acid-Induced Colitis by Inhibiting NF-κB Activation in Mice.

    PubMed

    Colombo, Bárbara B; Fattori, Victor; Guazelli, Carla F S; Zaninelli, Tiago H; Carvalho, Thacyana T; Ferraz, Camila R; Bussmann, Allan J C; Ruiz-Miyazawa, Kenji W; Baracat, Marcela M; Casagrande, Rúbia; Verri, Waldiceu A

    2018-04-10

    The idiopathic inflammatory bowel diseases (IBD) comprise two types of chronic intestinal disorders: Crohn's disease and ulcerative colitis. Recruited neutrophils and macrophages contribute to intestinal tissue damage via production of ROS and NF-κB-dependent pro-inflammatory cytokines. The introduction of anti-TNF-α therapies in the treatment of IBD patients was a seminal advance. This therapy is often limited by a loss of efficacy due to the development of adaptive immune response, underscoring the need for novel therapies targeting similar pathways. Vinpocetine is a nootropic drug and in addition to its antioxidant effect, it is known to have anti-inflammatory and analgesic properties, partly by inhibition of NF-κB and downstream cytokines. Therefore, the present study evaluated the effect of the vinpocetine in a model of acid acetic-induced colitis in mice. Treatment with vinpocetine reduced edema, MPO activity, microscopic score and macroscopic damage, and visceral mechanical hyperalgesia. Vinpocetine prevented the reduction of colonic levels of GSH, ABTS radical scavenging ability, and normalized levels of anti-inflammatory cytokine IL-10. Moreover, vinpocetine reduced NF-κB activation and thereby NF-κB-dependent pro-inflammatory cytokines IL-1β, TNF-α, and IL-33 in the colon. Thus, we demonstrate for the first time that vinpocetine has anti-inflammatory, antioxidant, and analgesic effects in a model of acid acetic-induced colitis in mice and deserves further screening to address its suitability as an approach for the treatment of IBD.

  1. [Identification of new conserved and variable regions in the 16S rRNA gene of acetic acid bacteria and acetobacteraceae family].

    PubMed

    Chakravorty, S; Sarkar, S; Gachhui, R

    2015-01-01

    The Acetobacteraceae family of the class Alpha Proteobacteria is comprised of high sugar and acid tolerant bacteria. The Acetic Acid Bacteria are the economically most significant group of this family because of its association with food products like vinegar, wine etc. Acetobacteraceae are often hard to culture in laboratory conditions and they also maintain very low abundances in their natural habitats. Thus identification of the organisms in such environments is greatly dependent on modern tools of molecular biology which require a thorough knowledge of specific conserved gene sequences that may act as primers and or probes. Moreover unconserved domains in genes also become markers for differentiating closely related genera. In bacteria, the 16S rRNA gene is an ideal candidate for such conserved and variable domains. In order to study the conserved and variable domains of the 16S rRNA gene of Acetic Acid Bacteria and the Acetobacteraceae family, sequences from publicly available databases were aligned and compared. Near complete sequences of the gene were also obtained from Kombucha tea biofilm, a known Acetobacteraceae family habitat, in order to corroborate the domains obtained from the alignment studies. The study indicated that the degree of conservation in the gene is significantly higher among the Acetic Acid Bacteria than the whole Acetobacteraceae family. Moreover it was also observed that the previously described hypervariable regions V1, V3, V5, V6 and V7 were more or less conserved in the family and the spans of the variable regions are quite distinct as well.

  2. Mass spectrometry-compatible silver staining of histones resolved on acetic acid-urea-Triton PAGE.

    PubMed

    Pramod, Khare Satyajeet; Bharat, Khade; Sanjay, Gupta

    2009-05-01

    Acetic acid-Urea-Triton (AUT) PAGE is commonly used method to separate histone variants and their post-translationally modified forms. Coomassie staining is the preferred method for protein visualization; however, its sensitivity is less than that of silver staining. Though silver staining of histones in AUT-PAGE has been reported, the method is time-consuming, dependent on prior staining by Amido black and has not been reported suitable for mass spectrometry. Here, we propose 'SDS-Silver' method for rapid, sensitive and mass spectrometry-compatible staining of histones resolved on AUT-PAGE.

  3. Kinetic Analysis of Strains of Lactic Acid Bacteria and Acetic Acid Bacteria in Cocoa Pulp Simulation Media toward Development of a Starter Culture for Cocoa Bean Fermentation ▿

    PubMed Central

    Lefeber, Timothy; Janssens, Maarten; Camu, Nicholas; De Vuyst, Luc

    2010-01-01

    The composition of cocoa pulp simulation media (PSM) was optimized with species-specific strains of lactic acid bacteria (PSM-LAB) and acetic acid bacteria (PSM-AAB). Also, laboratory fermentations were carried out in PSM to investigate growth and metabolite production of strains of Lactobacillus plantarum and Lactobacillus fermentum and of Acetobacter pasteurianus isolated from Ghanaian cocoa bean heap fermentations, in view of the development of a defined starter culture. In a first step, a selection of strains was made out of a pool of strains of these LAB and AAB species, obtained from previous studies, based on their fermentation kinetics in PSM. Also, various concentrations of citric acid in the presence of glucose and/or fructose (PSM-LAB) and of lactic acid in the presence of ethanol (PSM-AAB) were tested. These data could explain the competitiveness of particular cocoa-specific strains, namely, L. plantarum 80 (homolactic and acid tolerant), L. fermentum 222 (heterolactic, citric acid fermenting, mannitol producing, and less acid tolerant), and A. pasteurianus 386B (ethanol and lactic acid oxidizing, acetic acid overoxidizing, acid tolerant, and moderately heat tolerant), during the natural cocoa bean fermentation process. For instance, it turned out that the capacity to use citric acid, which was exhibited by L. fermentum 222, is of the utmost importance. Also, the formation of mannitol was dependent not only on the LAB strain but also on environmental conditions. A mixture of L. plantarum 80, L. fermentum 222, and A. pasteurianus 386B can now be considered a mixed-strain starter culture for better controlled and more reliable cocoa bean fermentation processes. PMID:20889778

  4. Lipid oxidation of stored eggs enriched with very long chain n-3 fatty acids, as affected by dietary olive leaves (Olea europea L.) or α-tocopheryl acetate supplementation.

    PubMed

    Botsoglou, E; Govaris, A; Fletouris, D; Botsoglou, N

    2012-09-15

    The antioxidant potential of dietary olive leaves or α-tocopheryl acetate supplementation on lipid oxidation of refrigerated stored hen eggs enriched with very long-chain n-3 fatty acids, was investigated. Ninety-six brown Lohmann laying hens, were equally assigned into three groups. Hens within the control group were given a typical diet containing 3% fish oil, whereas other groups were given the same diet further supplemented with 10 g ground olive leaves/kg feed or 200mg α-tocopheryl acetate/kg feed. Results showed that α-tocopheryl acetate or olive leaves supplementation had no significant effect on the fatty acid composition and malondialdehyde (MDA) levels of fresh eggs but reduced their lipid hydroperoxide levels compared to controls. Storage for 60 d decreased the proportions of polyunsaturated fatty acids (PUFAs) but increased those of monounsaturated fatty acids (MUFAs) in eggs from the control group, while had no effect on the fatty acid composition of the eggs from the other two groups, which showed decreased levels of lipid hydroperoxides and MDA. Therefore, the very long chain n-3 PUFAs in eggs were protected from undergoing deterioration partly by olive leaves supplementation and totally by α-tocopheryl acetate supplementation. In addition, incorporating tocopherols into eggs might also provide a source of tocopherols for the human diet. Copyright © 2012 Elsevier Ltd. All rights reserved.

  5. Succession of bacterial and fungal communities during a traditional pot fermentation of rice vinegar assessed by PCR-mediated denaturing gradient gel electrophoresis.

    PubMed

    Haruta, Shin; Ueno, Shintaro; Egawa, Isao; Hashiguchi, Kazunori; Fujii, Akira; Nagano, Masanobu; Ishii, Masaharu; Igarashi, Yasuo

    2006-05-25

    Denaturing gradient gel electrophoresis (DGGE) based on small subunit rRNA gene was applied to a traditional rice vinegar fermentation process in which the conversion of rice starch into acetic acid proceeded in a pot. The fungal DGGE profile indicated that the transition from Aspergillus oryzae to Saccharomyces sp. took place at the initial stage at which alcohol production was observed. The early stage was characterized by the coexistence of Saccharomyces sp. and lactic acid bacteria. Almost all of the bacterial DGGE bands related to lactic acid bacteria were replaced by bands derived from Lactobacillus acetotolerance and Acetobacter pasteurianus at the stage at which acetic acid started to accumulate. The microbial succession, tested in three different pots, was found to be essentially identical. Among the bacteria isolated at the early stage, some species differed from those detected by DGGE. This is the first report to reveal the microbial community succession that occurs during a unique vinegar fermentation process, as determined by a culture-independent method.

  6. Integrated phospholipidomics and transcriptomics analysis of Saccharomyces cerevisiae with enhanced tolerance to a mixture of acetic acid, furfural, and phenol

    USDA-ARS?s Scientific Manuscript database

    A mixture of acetic acid, furfural and phenol (AFP), three representative lignocellulose derived inhibitors, significantly inhibited the growth and bioethanol production of Saccharomyces cerevisiae. In order to uncover mechanisms behind the enhanced tolerance of an inhibitor-tolerant S.cerevisiae s...

  7. Silver nanoparticles in combination with acetic acid and zinc oxide quantum dots for antibacterial activities improvement-A comparative study

    NASA Astrophysics Data System (ADS)

    Sedira, Sofiane; Ayachi, Ahmed Abdelhakim; Lakehal, Sihem; Fateh, Merouane; Achour, Slimane

    2014-08-01

    Due to their remarkable antibacterial/antivirus properties, silver nanoparticles (Ag NPs) and zinc oxide quantum dots (ZnO Qds) have been widely used in the antimicrobial field. The mechanism of action of Ag NPs on bacteria was recently studied and it has been proven that Ag NPs exerts their antibacterial activities mainly by the released Ag+. In this work, Ag NPs and ZnO Qds were synthesized using polyol and hydrothermal method, respectively. It was demonstrated that Ag NPs can be oxidized easily in aqueous solution and the addition of acetic acid can increase the Ag+ release which improves the antibacterial activity of Ag NPs. A comparative study between bactericidal effect of Ag NPs/acetic acid and Ag NPs/ZnO Qds on Pseudomonas aeruginosa, Escherichia coli, Klebsiella pneumonia and Staphylococcus aureus was undertaken using agar diffusion method. The obtained colloids were characterized using UV-vis spectroscopy, Raman spectrometry, X-ray diffraction (XRD), transmission electron microscopy (TEM) and atomic force microscopy (AFM).

  8. Acetate supplementation attenuates lipopolysaccharide-induced neuroinflammation.

    PubMed

    Reisenauer, Chris J; Bhatt, Dhaval P; Mitteness, Dane J; Slanczka, Evan R; Gienger, Heidi M; Watt, John A; Rosenberger, Thad A

    2011-04-01

    Glyceryl triacetate (GTA), a compound effective at increasing circulating and tissue levels of acetate was used to treat rats subjected to a continual 28 day intra-ventricular infusion of bacterial lipopolysaccharide (LPS). This model produces a neuroinflammatory injury characterized by global neuroglial activation and a decrease in choline acetyltransferase immunoreactivity in the basal forebrain. During the LPS infusion, rats were given a daily treatment of either water or GTA at a dose of 6 g/kg by oral gavage. In parallel experiments, free-CoA and acetyl-CoA levels were measured in microwave fixed brains and flash frozen heart, liver, kidney and muscle following a single oral dose of GTA. We found that a single oral dose of GTA significantly increased plasma acetate levels by 15 min and remained elevated for up to 4 h. At 30 min the acetyl-CoA levels in microwave-fixed brain and flash frozen heart and liver were increased at least 2.2-fold. The concentrations of brain acetyl-CoA was significantly increased between 30 and 45 min following treatment and remained elevated for up to 4 h. The concentration of free-CoA in brain was significantly decreased compared to controls at 240 min. Immunohistochemical and morphological analysis demonstrated that a daily treatment with GTA significantly reduced the percentage of reactive glial fibrillary acidic protein-positive astrocytes and activated CD11b-positive microglia by 40-50% in rats subjected to LPS-induced neuroinflammation. Further, in rats subjected to neuroinflammation, GTA significantly increased the number of choline acetyltransferase (ChAT)-positive cells by 40% in the basal forebrain compared to untreated controls. These data suggest that acetate supplementation increases intermediary short chain acetyl-CoA metabolism and that treatment is potentially anti-inflammatory and neuroprotective with regards to attenuating neuroglial activation and increasing ChAT immunoreactivity in this model. © 2011 The Authors

  9. As, Cd, Cr, Ni and Pb pressurized liquid extraction with acetic acid from marine sediment and soil samples

    NASA Astrophysics Data System (ADS)

    Moreda-Piñeiro, Jorge; Alonso-Rodríguez, Elia; López-Mahía, Purificación; Muniategui-Lorenzo, Soledad; Prada-Rodríguez, Darío; Moreda-Piñeiro, Antonio; Bermejo-Barrera, Adela; Bermejo-Barrera, Pilar

    2006-12-01

    Rapid leaching procedures by Pressurized Liquid Extraction (PLE) have been developed for As, Cd, Cr, Ni and Pb leaching from environmental matrices (marine sediment and soil samples). The Pressurized Liquid Extraction is completed after 16 min. The released elements by acetic acid Pressurized Liquid Extraction have been evaluated by inductively coupled plasma-optical emission spectrometry. The optimum multi-element leaching conditions when using 5.0 ml stainless steel extraction cells, were: acetic acid concentration 8.0 M, extraction temperature 100 °C, pressure 1500 psi, static time 5 min, flush solvent 60%, two extraction steps and 0.50 g of diatomaceous earth as dispersing agent (diatomaceous earth mass/sample mass ratio of 2). Results have showed that high acetic acid concentrations and high extraction temperatures increase the metal leaching efficiency. Limits of detection (between 0.12 and 0.5 μg g - 1 ) and repeatability of the over-all procedure (around 6.0%) were assessed. Finally, accuracy was studied by analyzing PACS-2 (marine sediment), GBW-07409 (soil), IRANT-12-1-07 (cambisol soil) and IRANT-12-1-08 (luvisol soil) certified reference materials (CRMs). These certified reference materials offer certified concentrations ranges between 2.9 and 26.2 μg g - 1 for As, from 0.068 to 2.85 μg g - 1 for Cd, between 26.4 and 90.7 μg g - 1 for Cr, from 9.3 to 40.0 μg g - 1 for Ni and between 16.3 and 183.0 μg g - 1 for Pb. Recoveries after analysis were between 95.7 and 105.1% for As, 96.2% for Cd, 95.2 and 100.6% for Cr, 95.7 and 103% for Ni and 94.2 and 105.5% for Pb.

  10. Metabolism of triacetin-derived acetate in dogs.

    PubMed

    Bleiberg, B; Beers, T R; Persson, M; Miles, J M

    1993-12-01

    Triacetin is a water-soluble triglyceride that may have a role as a parenteral nutrient. In the present study triacetin was administered intravenously to mongrel dogs (n = 10) 2 wk after surgical placement of blood-sampling catheters in the aorta and in the portal, hepatic, renal, and femoral veins. [1-14C]Acetate was infused to allow quantification of organ uptake of acetate as well as systemic turnover and oxidation. Systemic acetate turnover accounted for approximately 70% of triacetin-derived acetate, assuming complete hydrolysis of the triglyceride. Approximately 80% of systemic acetate uptake was rapidly oxidized. Significant acetate uptake was demonstrated in all tissues (liver, 559 +/- 68; intestine, 342 +/- 23; hindlimb, 89 +/- 7; and kidney, 330 +/- 37 mumol/min). In conclusion, during intravenous administration in dogs, the majority of infused triacetin undergoes intravascular hydrolysis, and the majority of the resulting acetate is oxidized. Thus, energy in the form of short-chain fatty acids can be delivered to a resting gut via intravenous infusion of a short-chain triglyceride.

  11. Bacterial community composition and fermentation patterns in the rumen of sika deer (Cervus nippon) fed three different diets.

    PubMed

    Li, Zhipeng; Wright, André-Denis G; Liu, Hanlu; Bao, Kun; Zhang, Tietao; Wang, Kaiying; Cui, Xuezhe; Yang, Fuhe; Zhang, Zhigang; Li, Guangyu

    2015-02-01

    Sika deer (Cervus nippon) rely on microorganisms living in the rumen to convert plant materials into chemical compounds, such as volatile fatty acids (VFAs), but how the rumen bacterial community is affected by different forages and adapt to altered diets remains poorly understood. The present study used 454-pyrosequencing of bacterial 16S ribosomal RNA (rRNA) genes to examine the relationship between rumen bacterial diversity and metabolic phenotypes using three sika deer in a 3 × 3 latin square design. Three sika deer were fed oak leaves (OL), corn stover (CS), or corn silage (CI), respectively. After a 7-day feeding period, when compared to the CS and CI groups, the OL group had a lower proportion of Prevotella spp. and a higher proportion of unclassified bacteria belonging to the families Succinivibrionaceae and Paraprevotellaceae (P<0.05). Meanwhile, the concentration of isobutyrate was significantly lower (P<0.05) in the OL group than in the CS and CI groups. There was no significant change of dominant bacterial genera in the OL group after 28 days of feeding. Conversely, total volatile fatty acids (TVFAs) showed an increase after 28 days of feeding, mainly due to the increasing of acetate, propionate, and valerate (P<0.05). The interplay between bacteria and metabolism in the OL group differed from that in the CS and CI groups, especially for the interaction of TVFAs and acetate/propionate. Overall, the current study suggested that Prevotella spp. played critical roles in the fermentation of feed in the rumen of sika deer. However, the differences in interplay patterns between rumen bacterial community composition and metabolic phenotypes were altered in the native and domesticated diets indicating the changed fermentation patterns in the rumen of sika deer.

  12. Acetate Utilization and Butyryl Coenzyme A (CoA):Acetate-CoA Transferase in Butyrate-Producing Bacteria from the Human Large Intestine

    PubMed Central

    Duncan, Sylvia H.; Barcenilla, Adela; Stewart, Colin S.; Pryde, Susan E.; Flint, Harry J.

    2002-01-01

    Seven strains of Roseburia sp., Faecalibacterium prausnitzii, and Coprococcus sp. from the human gut that produce high levels of butyric acid in vitro were studied with respect to key butyrate pathway enzymes and fermentation patterns. Strains of Roseburia sp. and F. prausnitzii possessed butyryl coenzyme A (CoA):acetate-CoA transferase and acetate kinase activities, but butyrate kinase activity was not detectable either in growing or in stationary-phase cultures. Although unable to use acetate as a sole source of energy, these strains showed net utilization of acetate during growth on glucose. In contrast, Coprococcus sp. strain L2-50 is a net producer of acetate and possessed detectable butyrate kinase, acetate kinase, and butyryl-CoA:acetate-CoA transferase activities. These results demonstrate that different functionally distinct groups of butyrate-producing bacteria are present in the human large intestine. PMID:12324374

  13. Protozoan, Bacterial, and Volatile Fatty Acid Changes Associated with Feeding Tylosin

    PubMed Central

    Satapathy, N.; Purser, D. B.

    1967-01-01

    Tylosin was fed to two of six wethers for 79 days, to a second two for only 28 days, and not at all to a third pair (controls). The addition of tylosin to the daily feed resulted in a rapid twofold increase in protozoal concentration and a change in the composition or characteristics, or both, of the bacterial population. The results indicate that the bacterial population was modified to the extent of about 80%. Total acid concentrations were initially depressed but appeared to be greater than those in control animals at the termination of the experiment. Deletion of tylosin from the ration resulted in a rapid decrease in protozoal concentrations, whereas changes in the bacterial population did not occur for a further 30 days. PMID:16349756

  14. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  15. A new regulatory mechanism for bacterial lipoic acid synthesis.

    PubMed

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-22

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015

  16. Effects of carbon dioxide on metabolite production and bacterial communities during kimchi fermentation.

    PubMed

    Park, Doo Hyun

    2018-04-24

    Bacterial communities and metabolites in kimchi fermented under conventional conditions (CC) compared to CO 2 -rich environments (CO 2 ) were analyzed. After a 20-day fermentation, lactic and acetic acid productions were 54 and 69 mM under CC, and 19 and 12 mM under CO 2 , respectively. The final pH of kimchi fermented under CC (CC-fermenting) and CO 2 (CO 2 -fermenting) were 4.1 and 4.7, respectively. For bacterial communities, OTU and Chao1 indices were both 35 in fresh kimchi, 10 and 15 in CC-fermenting kimchi, and 8 and 24 in CO 2 -fermenting kimchi, respectively. Shannon and Simpson indices were 3.47 and 0.93 in fresh kimchi, 1.87-0.06 and 0.46-0.01 in CC-fermenting kimchi, and 1.65-0.44 and 0.63-0.12 in CO 2 -fermenting kimchi, respectively. Non-lactic acid bacteria were eliminated in fermenting kimchi after 12 days under CC and 6 days under CO 2 . I conclude that carbon dioxide can alter bacterial communities, reduce metabolite production, and improve fermented kimchi quality.

  17. Hydroxylamine hydrochloride-acetic acid-soluble and -insoluble fractions of pelagic sediment: Readsorption revisited

    USGS Publications Warehouse

    Piper, D.Z.; Wandless, G.A.

    1992-01-01

    The extraction of the rare earth elements (REE) from deep-ocean pelagic sediment, using hydroxylamine hydrochloride-acetic acid, leads to the separation of approximately 70% of the bulk REE content into the soluble fraction and 30% into the insoluble fraction. The REE pattern of the soluble fraction, i.e., the content of REE normalized to average shale on an element-by-element basis and plotted against atomic number, resembles the pattern for seawater, whereas the pattern, as well as the absolute concentrations, in the insoluble fraction resembles the North American shale composite. These results preclude significant readsorption of the REE by the insoluble phases during the leaching procedure.

  18. Influence of Turning and Environmental Contamination on the Dynamics of Populations of Lactic Acid and Acetic Acid Bacteria Involved in Spontaneous Cocoa Bean Heap Fermentation in Ghana▿

    PubMed Central

    Camu, Nicholas; González, Ángel; De Winter, Tom; Van Schoor, Ann; De Bruyne, Katrien; Vandamme, Peter; Takrama, Jemmy S.; Addo, Solomon K.; De Vuyst, Luc

    2008-01-01

    The influence of turning and environmental contamination on six spontaneous cocoa bean heap fermentations performed in Ghana was studied through a multiphasic approach, encompassing both microbiological (culture-dependent and culture-independent techniques) and metabolite target analyses. A sensory analysis of chocolate made from the fermented, dried beans was performed as well. Only four clusters were found among the isolates of acetic acid bacteria (AAB) identified: Acetobacter pasteurianus, Acetobacter ghanensis, Acetobacter senegalensis, and a potential new Acetobacter lovaniensis-like species. Two main clusters were identified among the lactic acid bacteria (LAB) isolated, namely, Lactobacillus plantarum and Lactobacillus fermentum. No differences in biodiversity of LAB and AAB were seen for fermentations carried out at the farm and factory sites, indicating the cocoa pod surfaces and not the general environment as the main inoculum for spontaneous cocoa bean heap fermentation. Turning of the heaps enhanced aeration and increased the relative population size of AAB and the production of acetic acid. This in turn gave a more sour taste to chocolate made from these beans. Bitterness was reduced through losses of polyphenols and alkaloids upon fermentation and cocoa bean processing. PMID:17993565

  19. Effectiveness of acidic oxidative potential water in preventing bacterial infection in islet transplantation.

    PubMed

    Miyamoto, M; Inoue, K; Gu, Y; Hoki, M; Haji, S; Ohyanagi, H

    1999-01-01

    At a number of points in the current procedures of islet isolation and islet culture after the harvesting of donor pancreata, microorganisms could potentially infect the islet preparation. Furthermore, the use of islets from multiple donors can compound the risks of contamination of individual recipients. Acidic oxidative potential water (also termed electrolyzed strong acid solution, function water, or acqua oxidation water), which was developed in Japan, is a strong acid formed on the anode in the electrolysis of water containing a small amount of sodium chloride. It has these physical properties: pH, from 2.3 to 2.7; oxidative-reduction potential, from 1,000 to 1,100 mV; dissolved chlorine, from 30 to 40 ppm; and dissolved oxygen, from 10 to 30 ppm. Because of these properties, acidic oxidative potential water has strong bactericidal effects on all bacteria including methicillin-resistant Staphylococcus aureus (MRSA), viruses including HIV, HBV, HCV, CMV, and fungi as a result of the action of the active oxygen and active chlorine that it contains. We conducted this study to evaluate the effect of acidic oxidative potential water irrigation on bacterial contamination on the harvesting of porcine pancreata from slaughterhouses for islet xenotransplantation by counting the number of pancreatic surface bacteria using the Dip-slide method, and on the results of islet culture; and to evaluate the direct effect on isolated islets when it is used to prevent bacterial contamination by the static incubation test and by morphological examination. Direct irrigation of the pancreas by acidic oxidative potential water was found to be very effective in preventing bacterial contamination, but direct irrigation of isolated islets slightly decreased their viability and function.

  20. Impact of high initial concentrations of acetic acid and ethanol on acetification rate in an internal Venturi injector bioreactor.

    PubMed

    Krusong, W; Yaiyen, S; Pornpukdeewatana, S

    2015-03-01

    To evaluate the comparative impact of high initial concentrations of acetic acid (AAi ) and of ethanol (ETi ) on acetification rate (ETA). Acetic acid bacteria (AAB) were cultivated in a 100-l internal Venturi injector bioreactor. To quantify the oxygen availability, the 1.0 l min(-1) air inflow rate for the start-up phase (25 l) while 3·0 l min(-1) for the operational phase (75 l) achieved a high oxygen transfer coefficient (kL a). Changes in cell wall by TEM images and the remained ADH and ALDH activities confirmed the high acid tolerance ability of AAB. While ETAs using high AAi at 65 g l(-1) could be processed of 9.57 ± 0.19 g l(-1) day(-1) , which is just higher than 9.12 ± 0.12 g l(-1) day(-1) using high ETi at 55 g l(-1) . The average biotransformation yields were at 96.3 ± 0.1% and 94.4 ± 0.1% for high AAi and ETi , respectively. Results confirm that high oxygenation was generated in the bioreactor. Both high AAi and ETi were important in increasing ETA under stress 100 g l(-1) total concentration. High acid-tolerant AAB contains the high ADH and ALDH activities causing higher ETAs in HIA process. It is a competitive commercialized acetification process. © 2014 The Society for Applied Microbiology.