Wang, Yanhan; Zhang, Lingjuan; Yu, Jinghua; Huang, Stephen; Wang, Zhenping; Chun, Kimberly Ann; Lee, Tammy Ling; Chen, Ying-Tung; Gallo, Richard L; Huang, Chun-Ming
2017-01-01
We show that Staphylococcus epidermidis, a commensal bacterium in the human skin microbiome, produces short-chain fatty acids by glycerol fermentation that can induce adipogenesis. Although the antimicrobial and anti-inflammatory activities of short-chain fatty acids have been previously well characterized, little is known about the contribution of short-chain fatty acids to the adipogenic differentiation of adipose-derived stem cells (ADSCs). We show that ADSCs differentiated into adipocytes and accumulated lipids in the cytoplasm when cultured with butyric acid, a principal short-chain fatty acid in the fermentation metabolites of S. epidermidis. Additionally, a co-drug, butyric acid 2-(2-butyryloxyethoxy) ethyl ester (BA-DEG-BA), released active butyric acid when it was intradermally injected into mouse ears and induced ADSC differentiation, characterized by an increased expression of cytoplasmic lipids and perilipin A. The BA-DEG-BA-induced adipogenic differentiation was mediated via peroxisome proliferator-activated receptor gamma. Furthermore, intradermal injection of ADSCs along with BA-DEG-BA into mouse ears markedly enhanced the adipogenic differentiation of ADSCs, leading to dermal augmentation. Our study introduces BA-DEG-BA as an enhancer of ADSC adipogenesis and suggests an integral interaction between the human skin microbiome and ADSCs. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Bache, Matthias; Bernhardt, Stephan; Passin, Sarina; Wichmann, Henri; Hein, Anja; Zschornak, Martin; Kappler, Matthias; Taubert, Helge; Paschke, Reinhard; Vordermark, Dirk
2014-10-30
Betulinic acid (BA), a pentacyclic triterpene, represents a new therapeutic substance that has potential benefits for treating glioblastoma. Recently, new strategies for producing BA derivatives with improved properties have evolved. However, few studies have examined the combination of BA or BA derivatives using radiotherapy. The effects of two BA derivatives, NVX-207 and B10, on cellular and radiobiological behavior were analyzed using glioblastoma cell lines (U251MG, U343MG and LN229). Based on IC50 values under normoxic conditions, we detected a 1.3-2.9-fold higher cytotoxicity of the BA derivatives B10 and NVX-207, respectively, compared to BA. Incubation using both BA derivatives led to decreased cell migration, cleavage of PARP and decreased protein expression levels of Survivin. Weak radiation sensitivity enhancement was observed in U251MG cells after treatment with both BA derivatives. The enhancement factors at an irradiation dose of 6 Gy after treatment with 5 µM NVX-207 and 5 µM B10 were 1.32 (p=0.029) and 1.55 (p=0.002), respectively. In contrast to BA, neither NVX-207 nor B10 had additional effects under hypoxic conditions. Our results suggest that the BA derivatives NVX-207 and B10 improve the effects of radiotherapy on human malignant glioma cells, particularly under normoxic conditions.
Bache, Matthias; Bernhardt, Stephan; Passin, Sarina; Wichmann, Henri; Hein, Anja; Zschornak, Martin; Kappler, Matthias; Taubert, Helge; Paschke, Reinhard; Vordermark, Dirk
2014-01-01
Betulinic acid (BA), a pentacyclic triterpene, represents a new therapeutic substance that has potential benefits for treating glioblastoma. Recently, new strategies for producing BA derivatives with improved properties have evolved. However, few studies have examined the combination of BA or BA derivatives using radiotherapy. The effects of two BA derivatives, NVX-207 and B10, on cellular and radiobiological behavior were analyzed using glioblastoma cell lines (U251MG, U343MG and LN229). Based on IC50 values under normoxic conditions, we detected a 1.3–2.9-fold higher cytotoxicity of the BA derivatives B10 and NVX-207, respectively, compared to BA. Incubation using both BA derivatives led to decreased cell migration, cleavage of PARP and decreased protein expression levels of Survivin. Weak radiation sensitivity enhancement was observed in U251MG cells after treatment with both BA derivatives. The enhancement factors at an irradiation dose of 6 Gy after treatment with 5 µM NVX-207 and 5 µM B10 were 1.32 (p = 0.029) and 1.55 (p = 0.002), respectively. In contrast to BA, neither NVX-207 nor B10 had additional effects under hypoxic conditions. Our results suggest that the BA derivatives NVX-207 and B10 improve the effects of radiotherapy on human malignant glioma cells, particularly under normoxic conditions. PMID:25361208
CR@BaSO4: an acid rain-indicating material.
Gao, Hong-Wen; Xu, Xin-Hui
2011-12-28
The CR@BaSO(4) hybrid was synthesized, characterized and used as an acid rain-indicating (ARI) material. A painted ARI umbrella was discolored after exposure to simulated acid rain of pH 5 or less and returned to the initial color after the rain stopped. Such a functionalized material may make acid rain visual to remind people in real-time. This journal is © The Royal Society of Chemistry 2011
Qian, Keduo; Kuo, Reen-Yun; Chen, Chin-Ho; Huang, Li; Morris-Natschke, Susan L; Lee, Kuo-Hsiung
2010-04-22
In our continuing study of triterpene derivatives as potent anti-HIV agents, different C-3 conformationally restricted betulinic acid (BA, 1) derivatives were designed and synthesized in order to explore the conformational space of the C-3 pharmacophore. 3-O-Monomethylsuccinyl-betulinic acid (MSB) analogues were also designed to better understand the contribution of the C-3' dimethyl group of bevirimat (2), the first-in-class HIV maturation inhibitor, which is currently in phase IIb clinical trials. In addition, another triterpene skeleton, moronic acid (MA, 3), was also employed to study the influence of the backbone and the C-3 modification toward the anti-HIV activity of this compound class. This study enabled us to better understand the structure-activity relationships (SAR) of triterpene-derived anti-HIV agents and led to the design and synthesis of compound 12 (EC(50): 0.0006 microM), which displayed slightly better activity than 2 as a HIV-1 maturation inhibitor.
NASA Astrophysics Data System (ADS)
Fatra, F.; Ivanto, G.; Dera, N. S.; Muryanto, S.; Bayuseno, A. P.
2017-05-01
The barite (BaSO4) scale is a mineral deposit that can be precipitated during the process of drilling oil and gas in the offshore. Deposite scale in pipes can cause a narrowing of the diameter of pipes, and can reduce water flowing in the pipe. The aim of this study is to investigation the effect of the tartaric acid additive and Ba2+ concentration on the growth o the scale formation of barite in the laminar flow of the piping system. Solution forming barite crystal was prepared by mixing equimolar solutions of barium chloride (BaCl2) and sodium sulfate (Na2SO4) with concentration variations of Ba2+ of 3000, 3500, 4000, 4500, and 5000 ppm. The flow rate of solution is 40 ml/min at temperature of 50 °C. Various concentrations of tartaric acid (C4H6O6) of 0 ppm, 5 ppm and 10 ppm were added to the solutions. The formation of barite from the solution was observed by ion conductivity measurement. The obtained barite crystals before and after adding tartaric acid were dried and characterized by using SEM/EDX for morphology and elemental analysis, and XRD for phase identification. The SEM results show that the morphology of the crystals are star-like particles, while XRD analysis confirmed that the barite crystals were produced during the experiments are high purity. Moreover, the tartaric acid can inhibit the crystal growth of barite.
Santra, Dines Chandra; Bera, Manas Kumar; Sukul, Pradip Kumar; Malik, Sudip
2016-02-01
2,6-Divinylpyridine-appended anthracene derivatives flanked by two alkyl chains at the 9,10-position of the core have been designed, synthesized, and characterized by NMR, MALDI-TOF, FTIR, and single-crystal XRD. These anthracene derivatives are able to recognize picric acid (2,4,6-trinitrophenol, PA) selectively down to parts per billion (ppb) level in aqueous as well as nonaqueous medium. Fluorescence emission of these derivatives in solution is significantly quenched by adding trace amounts of PA, even in the presence of other competing analogues, such as 2,4-dinitrophenol (2,4-DNP), 4-nitrophenol (NP), nitrobenzene (NB), benzoic acid (BA), and phenol (PH). The high sensitivity of these derivatives toward PA is considered as a combined effect of the proton-induced intramolecular charge transfer (ICT) as well as electron transfer from the electron-rich anthracene to the electron-deficient PA. Moreover, visual detection of PA has been successfully demonstrated in the solid state by using different substrates. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Ding, Weimin; Sun, Miao; Luo, Shaman; Xu, Tao; Cao, Yibo; Yan, Xiufeng; Wang, Yang
2013-08-22
Betulinic acid (BA) is a natural product that exerts its cytotoxicity against various malignant carcinomas without side effects by triggering the mitochondrial pathway to apoptosis. Betulin (BE), the 28-hydroxyl analog of BA, is present in large amounts (up to 30% dry weight) in the outer bark of birch trees, and shares the same pentacyclic triterpenoid core as BA, yet exhibits no significant cytotoxicity. Topomer CoMFA studies were performed on 37 BA and BE derivatives and their in vitro anti-cancer activity results (reported as IC₅₀ values) against HT29 human colon cancer cells in the present study. All derivatives share a common pentacyclic triterpenoid core and the molecules were split into three pieces by cutting at the C-3 and C-28 sites with a consideration toward structural diversity. The analysis gave a leave-one-out cross-validation q² value of 0.722 and a non-cross-validation r² value of 0.974, which suggested that the model has good predictive ability (q² > 0.2). The contour maps illustrated that bulky and electron-donating groups would be favorable for activity at the C-28 site, and a moderately bulky and electron-withdrawing group near the C-3 site would improve this activity. BE derivatives were designed and synthesized according to the modeling result, whereby bulky electronegative groups (maleyl, phthalyl, and hexahydrophthalyl groups) were directly introduced at the C-28 position of BE. The in vitro cytotoxicity values of the given analogs against HT29 cells were consistent with the predicted values, proving that the present topomer CoMFA model is successful and that it could potentially guide the synthesis of new betulinic acid derivatives with high anti-cancer activity. The IC₅₀ values of these three new compounds were also assayed in five other tumor cell lines. 28-O-hexahydrophthalyl BE exhibited the greatest anti-cancer activities and its IC₅₀ values were lower than those of BA in all cell lines, excluding DU145 cells.
Oxidative cleavage of erucic acid for the synthesis of brassylic acid
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mohammed J. Nasrullah; Pooja Thapliyal; Erica N. Pfarr
2010-10-29
The main focus of this work is to synthesize Brassylic Acid (BA) using oxidative cleavage of Erucic Acid (EA). Crambe (Crambe abyssinica) is an industrial oilseed grown in North Dakota. Crambe has potential as an industrial fatty acid feedstock as a source of Erucic acid (EA). It has approximately 50-60 % of EA, a C{sub 22} monounsaturated fatty acid. Oxidative cleavage of unsaturated fatty acids derived from oilseeds produces long chain (9, 11, and 13 carbon atoms) dibasic and monobasic acids. These acids are known commercial feedstocks for the preparation of nylons, polyesters, waxes, surfactants, and perfumes. Other sources ofmore » EA are Rapeseed seed oil which 50-60 % of EA. Rapeseed is grown outside USA. The oxidative cleavage of EA was done using a high throughput parallel pressure reactor system. Kinetics of the reaction shows that BA yields reach a saturation at 12 hours. H{sub 2}WO{sub 4} was found to be the best catalyst for the oxidative cleavage of EA. High yields of BA were obtained at 80 C with bubbling of O{sub 2} or 10 bar of O{sub 2} for 12 hours.« less
21 CFR 172.862 - Oleic acid derived from tall oil fatty acids.
Code of Federal Regulations, 2010 CFR
2010-04-01
... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Oleic acid derived from tall oil fatty acids. 172... FOOD FOR HUMAN CONSUMPTION Multipurpose Additives § 172.862 Oleic acid derived from tall oil fatty acids. The food additive oleic acid derived from tall oil fatty acids may be safely used in food and as...
21 CFR 172.862 - Oleic acid derived from tall oil fatty acids.
Code of Federal Regulations, 2011 CFR
2011-04-01
... 21 Food and Drugs 3 2011-04-01 2011-04-01 false Oleic acid derived from tall oil fatty acids. 172... FOOD FOR HUMAN CONSUMPTION Multipurpose Additives § 172.862 Oleic acid derived from tall oil fatty acids. The food additive oleic acid derived from tall oil fatty acids may be safely used in food and as...
Multifunctional Cinnamic Acid Derivatives.
Peperidou, Aikaterini; Pontiki, Eleni; Hadjipavlou-Litina, Dimitra; Voulgari, Efstathia; Avgoustakis, Konstantinos
2017-07-25
Our research to discover potential new multitarget agents led to the synthesis of 10 novel derivatives of cinnamic acids and propranolol, atenolol, 1-adamantanol, naphth-1-ol, and (benzylamino) ethan-1-ol. The synthesized molecules were evaluated as trypsin, lipoxygenase and lipid peroxidation inhibitors and for their cytotoxicity. Compound 2b derived from phenoxyphenyl cinnamic acid and propranolol showed the highest lipoxygenase (LOX) inhibition (IC 50 = 6 μΜ) and antiproteolytic activity (IC 50 = 0.425 μΜ). The conjugate 1a of simple cinnamic acid with propranolol showed the higher antiproteolytic activity (IC 50 = 0.315 μΜ) and good LOX inhibitory activity (IC 50 = 66 μΜ). Compounds 3a and 3b , derived from methoxylated caffeic acid present a promising combination of in vitro inhibitory and antioxidative activities. The S isomer of 2b also presented an interesting multitarget biological profile in vitro . Molecular docking studies point to the fact that the theoretical results for LOX-inhibitor binding are identical to those from preliminary in vitro study.
Code of Federal Regulations, 2011 CFR
2011-07-01
... 40 Protection of Environment 31 2011-07-01 2011-07-01 false Diethoxybenzenamine derivative, diazotized, coupled with aminonaphthalenesulfonic acid derivative, ammonium salt (generic). 721.10039 Section... Substances § 721.10039 Diethoxybenzenamine derivative, diazotized, coupled with aminonaphthalenesulfonic acid...
Code of Federal Regulations, 2010 CFR
2010-07-01
... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Diethoxybenzenamine derivative, diazotized, coupled with aminonaphthalenesulfonic acid derivative, ammonium salt (generic). 721.10039 Section... Substances § 721.10039 Diethoxybenzenamine derivative, diazotized, coupled with aminonaphthalenesulfonic acid...
Antioxidant and antimicrobial activities of cinnamic acid derivatives.
Sova, M
2012-07-01
Cinnamic acid is an organic acid occurring naturally in plants that has low toxicity and a broad spectrum of biological activities. In the search for novel pharmacologically active compounds, cinnamic acid derivatives are important and promising compounds with high potential for development into drugs. Many cinnamic acid derivatives, especially those with the phenolic hydroxyl group, are well-known antioxidants and are supposed to have several health benefits due to their strong free radical scavenging properties. It is also well known that cinnamic acid has antimicrobial activity. Cinnamic acid derivatives, both isolated from plant material and synthesized, have been reported to have antibacterial, antiviral and antifungal properties. Acids, esters, amides, hydrazides and related derivatives of cinnamic acid with such activities are here reviewed.
Adhikari, Birendra Babu; To, Cuong-Alexander; Iwasawa, Tetsuo; Schramm, Michael P.
2015-01-01
Calix[6]arene hexacarboxylic acid binds instantly and with low symmetry to Pb, Sr and Ba. Later a highly symmetric up-down alternating conformation emerges. The solution structures are identical to their p-tert-butylcalix[6]arene hexacarboxylic acid counterparts. With either receptor an octahedral cage is formed around the metal. The transformation from low to high symmetry however proceeds at significantly faster rates for the de-t-butylated host. PMID:26752941
Anticancer agents derived from natural cinnamic acids.
Su, Ping; Shi, Yaling; Wang, Jinfeng; Shen, Xiuxiu; Zhang, Jie
2015-01-01
Cancer is the most dangerous disease that causes deaths all over the world. Natural products have afforded a rich source of drugs in a number of therapeutic fields including anticancer agents. Many significant drugs have been derived from natural sources by structural optimization of natural products. Cinnamic acid has gained great interest due to its antiproliferative, antioxidant, antiangiogenic and antitumorigenic potency. Currently it has been observed that cinnamic acid and its analogs such as caffeic acid, sinapic acid, ferulic acid, and isoferulic acid display various pharmacological activities, such as immunomodulation, anti-inflammation, anticancer and antioxidant. They have served to be the major sources of potential leading anticancer compounds. In this review, we focus on the anticancer potency of cinnamic acid derivatives and novel strategies to design these derivatives. We hope this review will be useful for researchers who are interested in developing anticancer agents.
3-Nitroasterric Acid Derivatives from an Antarctic Sponge-Derived Pseudogymnoascus sp. Fungus.
Figueroa, Luis; Jiménez, Carlos; Rodríguez, Jaime; Areche, Carlos; Chávez, Renato; Henríquez, Marlene; de la Cruz, Mercedes; Díaz, Caridad; Segade, Yuri; Vaca, Inmaculada
2015-04-24
Four new nitroasterric acid derivatives, pseudogymnoascins A-C (1-3) and 3-nitroasterric acid (4), along with the two known compounds questin and pyriculamide, were obtained from the cultures of a Pseudogymnoascus sp. fungus isolated from an Antarctic marine sponge belonging to the genus Hymeniacidon. The structures of the new compounds were determined by extensive NMR and MS analyses. These compounds are the first nitro derivatives of the known fungal metabolite asterric acid. Several asterric acid derivatives isolated from other fungal strains have shown antibacterial and antifungal activities. However, the new compounds described in this work were inactive against a panel of bacteria and fungi (MIC > 64 μg/mL).
Acetylcholinesterase inhibitory properties of some benzoic acid derivatives
NASA Astrophysics Data System (ADS)
Yildiz, Melike; Kiliç, Deryanur; Ünver, Yaǧmur; Şentürk, Murat; Askin, Hakan; Küfrevioǧlu, Ömer Irfan
2016-04-01
Acetylcholinesterase (AChE) hydrolyses the neurotransmitter acetylcholine to acetic acid and choline. AChE inhibitors are used in treatment of several neurodegeneartive disorder and Alzheimer's disease. In the present study, inhibition of AChE with some benzoic acid derivatives were investigated. 3-Chloro-benzoic acid (1), 2-hydroxy-5-sulfobenzoic acid (2), 2-(sulfooxy) benzoic acid (3), 2-hydroxybenzoic acid (4), 2,3-dimethoxybenzoic (5), and 3,4,5-trimethoxybenzoic (6) were calculated IC50 values AChE enzyme. Kinetic investigations showed that similarly to AChE inhibitors. Benzoic acid derivatives (1-6) investigated are encouraging agents which may be used as lead molecules in order to derivative novel AChE inhibitors that might be useful in medical applications.
Ahmad, I; Ali Sheraz, M; Ahmed, S; Shad, Z; Vaid, F H M
2012-06-01
This study involves the evaluation of the effect of certain stabilizers, that is, citric acid (CT), tartaric acid (TA) and boric acid (BA) on the degradation of ascorbic acid (AH(2) ) in oil-in-water cream formulations exposed to the UV light and stored in the dark. The apparent first-order rate constants (0.34-0.95 × 10(-3) min(-1) in light, 0.38-1.24 × 10(-2) day(-1) in dark) for the degradation reactions in the presence of the stabilizers have been determined. These rate constants have been used to derive the second-order rate constants (0.26-1.45 × 10(-2) M(-1) min(-1) in light, 3.75-8.50 × 10(-3) M(-1) day(-1) in dark) for the interaction of AH(2) and the individual stabilizers. These stabilizers are effective in causing the inhibition of the rate of degradation of AH(2) both in the light and in the dark. The inhibitory effect of the stabilizers is in the order of CT > TA > BA. The rate of degradation of AH(2) in the presence of these stabilizers in the light is about 120 times higher than that in the dark. This could be explained on the basis of the deactivation of AH(2) -excited triplet state by CT and TA and by the inhibition of AH(2) degradation through complex formation with BA. AH(2) leads to the formation of dehydroascorbic acid (A) by chemical and photooxidation in cream formulations. © 2012 The Authors. ICS © 2012 Society of Cosmetic Scientists and the Société Française de Cosmétologie.
Bile Acids in the Treatment of Cardiometabolic Diseases.
Vítek, Libor
2017-11-01
Bile acids (BA), for decades considered only to have fat-emulsifying functions in the gut lumen, have recently emerged as novel cardio-metabolic modulators. They have real endocrine effects, acting via multiple intracellular receptors in various organs and tissues. BA affect energy homeostasis through the modulation of glucose and lipid metabolism, predominantly by activating the nuclear farnesoid X receptor (FXR), as well as the cytoplasmic membrane G protein-coupled BA receptor TGR5 in a variety of tissues; although numerous other intracellular targets of BA are also in play.The roles of BA in the pathogenesis of diabetes, obesity, metabolic syndrome, and cardiovascular diseases are seriously being considered, and BA and their derivatives seem to represent novel potential therapeutics to treat these diseases of civilization.
Cinnamic acid and its derivatives inhibit fructose-mediated protein glycation.
Adisakwattana, Sirichai; Sompong, Weerachat; Meeprom, Aramsri; Ngamukote, Sathaporn; Yibchok-Anun, Sirintorn
2012-01-01
Cinnamic acid and its derivatives have shown a variety of pharmacologic properties. However, little is known about the antiglycation properties of cinnamic acid and its derivatives. The present study sought to characterize the protein glycation inhibitory activity of cinnamic acid and its derivatives in a bovine serum albumin (BSA)/fructose system. The results demonstrated that cinnamic acid and its derivatives significantly inhibited the formation of advanced glycation end products (AGEs) by approximately 11.96-63.36% at a concentration of 1 mM. The strongest inhibitory activity against the formation of AGEs was shown by cinnamic acid. Furthermore, cinnamic acid and its derivatives reduced the level of fructosamine, the formation of N(ɛ)-(carboxymethyl) lysine (CML), and the level of amyloid cross β-structure. Cinnamic acid and its derivatives also prevented oxidative protein damages, including effects on protein carbonyl formation and thiol oxidation of BSA. Our findings may lead to the possibility of using cinnamic acid and its derivatives for preventing AGE-mediated diabetic complications.
Cinnamic Acid and Its Derivatives Inhibit Fructose-Mediated Protein Glycation
Adisakwattana, Sirichai; Sompong, Weerachat; Meeprom, Aramsri; Ngamukote, Sathaporn; Yibchok-anun, Sirintorn
2012-01-01
Cinnamic acid and its derivatives have shown a variety of pharmacologic properties. However, little is known about the antiglycation properties of cinnamic acid and its derivatives. The present study sought to characterize the protein glycation inhibitory activity of cinnamic acid and its derivatives in a bovine serum albumin (BSA)/fructose system. The results demonstrated that cinnamic acid and its derivatives significantly inhibited the formation of advanced glycation end products (AGEs) by approximately 11.96–63.36% at a concentration of 1 mM. The strongest inhibitory activity against the formation of AGEs was shown by cinnamic acid. Furthermore, cinnamic acid and its derivatives reduced the level of fructosamine, the formation of Nɛ-(carboxymethyl) lysine (CML), and the level of amyloid cross β-structure. Cinnamic acid and its derivatives also prevented oxidative protein damages, including effects on protein carbonyl formation and thiol oxidation of BSA. Our findings may lead to the possibility of using cinnamic acid and its derivatives for preventing AGE-mediated diabetic complications. PMID:22408423
An efficient synthesis of tetramic acid derivatives with extended conjugation from L-Ascorbic Acid
Singh, Biswajit K; Bisht, Surendra S; Tripathi, Rama P
2006-01-01
Background Tetramic acids with polyenyl substituents are an important class of compounds in medicinal chemistry. Both solid and solution phase syntheses of such molecules have been reported recently. Thiolactomycin, a clinical candidate for treatment of tuberculosis has led to further explorations in this class. We have recently developed an efficient synthesis of tetramic acids derivatives from L- ascorbic acid. In continuation of this work, we have synthesised dienyl tetramic acid derivatives. Results 5,6-O-Isopropylidene-ascorbic acid on reaction with DBU led to the formation of tetronolactonyl allyl alcohol, which on oxidation with pyridinium chlorochromate gave the respective tetranolactonyl allylic aldehydes. Wittig olefination followed by reaction of the resulting tetranolactonyl dienyl esters with different amines resulted in the respective 5-hydroxy lactams. Subsequent dehydration of the hydroxy lactams with p-toluene sulphonic acid afforded the dienyl tetramic acid derivatives. All reactions were performed at ambient temperature and the yields are good. Conclusion An efficient and practical method for the synthesis of dienyl tetramic acid derivatives from inexpensive and easily accessible ascorbic acid has been developed. The compounds bear structural similarities to the tetramic acid based polyenic antibiotics and thus this method offers a new and short route for the synthesis of tetramic acid derivatives of biological significance. PMID:17147830
An efficient synthesis of tetramic acid derivatives with extended conjugation from L-ascorbic acid.
Singh, Biswajit K; Bisht, Surendra S; Tripathi, Rama P
2006-12-06
Tetramic acids with polyenyl substituents are an important class of compounds in medicinal chemistry. Both solid and solution phase syntheses of such molecules have been reported recently. Thiolactomycin, a clinical candidate for treatment of tuberculosis has led to further explorations in this class. We have recently developed an efficient synthesis of tetramic acids derivatives from L-ascorbic acid. In continuation of this work, we have synthesised dienyl tetramic acid derivatives. 5,6-O-isopropylidene-ascorbic acid on reaction with DBU led to the formation of tetronolactonyl allyl alcohol, which on oxidation with pyridinium chlorochromate gave the respective tetranolactonyl allylic aldehydes. Wittig olefination followed by reaction of the resulting tetranolactonyl dienyl esters with different amines resulted in the respective 5-hydroxy lactams. Subsequent dehydration of the hydroxy lactams with p-toluene sulphonic acid afforded the dienyl tetramic acid derivatives. All reactions were performed at ambient temperature and the yields are good. An efficient and practical method for the synthesis of dienyl tetramic acid derivatives from inexpensive and easily accessible ascorbic acid has been developed. The compounds bear structural similarities to the tetramic acid based polyenic antibiotics and thus this method offers a new and short route for the synthesis of tetramic acid derivatives of biological significance.
40 CFR 721.6097 - Phosphoric acid derivative (generic name).
Code of Federal Regulations, 2010 CFR
2010-07-01
... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Phosphoric acid derivative (generic... Specific Chemical Substances § 721.6097 Phosphoric acid derivative (generic name). (a) Chemical substance... phosphoric acid derivative (PMN P-95-284) is subject to reporting under this section for the significant new...
40 CFR 721.6097 - Phosphoric acid derivative (generic name).
Code of Federal Regulations, 2011 CFR
2011-07-01
... 40 Protection of Environment 31 2011-07-01 2011-07-01 false Phosphoric acid derivative (generic... Specific Chemical Substances § 721.6097 Phosphoric acid derivative (generic name). (a) Chemical substance... phosphoric acid derivative (PMN P-95-284) is subject to reporting under this section for the significant new...
Synthesis of 5'-deoxy-5'-nucleosideacetic acid derivatives
NASA Technical Reports Server (NTRS)
Harada, Kazuo; Orgel, Leslie E.
1990-01-01
Several new 5'-deoxy-5'-nucleosideacetic acid derivatives have been synthesized by the reactions of alkoxycarbonylmethylene triphenylphosphoranes with nucleoside 5'-aldehydes. The oligomerization of adenine derivatives IIa, IIIa, IV, V and guanine derivatives IIc and IIIc in aqueous solution was studied using a water-soluble carbodiimide as a condensing agent. It is found that the saturated acid (IV) tends to cyclize to the lactone, while IIa and unsaturated acids (IIIa and V) oligomerized efficiently, especially in the presence of poly (U) as a template.
Wang, Ruiqi; Zhang, Xian; He, Jianqiao; Bu, Kejun; Zheng, Chong; Lin, Jianhua; Huang, Fuqiang
2018-02-05
Six isostructural antiperovskite-derived chalcohalides, Ba 2 MQ 3 X (M = As, Sb; Q = S, Se; X = Cl, Br, I), crystallizing in the space group Pnma, have been synthesized by solid-state reactions. The crystal structure features a 3D framework with the [XBa 5 ] 9+ disordered square pyramids as building blocks and [MQ 3 ] 3- units filling the interspace. [XBa 5 ] 9+ disordered square pyramids are edge-sharing along [010], derived from the fusing of the two pyramids in octahedral [XBa 6 ] 11+ . Surprisingly, Ba 2 AsS 3 X (X = Cl, Br, I) show almost the same optical band gap of 2.80 eV, and Ba 2 AsSe 3 X (X = Br, I) also have a similar band gap of 2.28 eV. The optical band gap of Ba 2 SbS 3 I is 2.64 eV. First-principles calculations reveal that the optical absorption is attributed to the transitions between Q np at the valence band maximum (VBM) and M np-Q np at the conduction band minimum (CBM). These compounds also possess interesting photoluminescence properties with splitting emission peaks on excitation at 200 nm.
Synthesis of new kojic acid based unnatural α-amino acid derivatives.
Balakrishna, C; Payili, Nagaraju; Yennam, Satyanarayana; Uma Devi, P; Behera, Manoranjan
2015-11-01
An efficient method for the preparation of kojic acid based α-amino acid derivatives by alkylation of glycinate schiff base with bromokojic acids have been described. Using this method, mono as well as di alkylated kojic acid-amino acid conjugates have been prepared. This is the first synthesis of C-linked kojic acid-amino acid conjugate where kojic acid is directly linked to amino acid through a C-C bond. Copyright © 2015 Elsevier Ltd. All rights reserved.
Synthesis and characterization of bis-thiourea having amino acid derivatives
NASA Astrophysics Data System (ADS)
Fakhar, Imran; Yamin, Bohari M.; Hasbullah, Siti Aishah
2016-11-01
In this article four new symmetric bis-thiourea derivatives having amino acid linkers were reported with good yield. Isophthaloyl dichloride was used as spacer and L-alanine, L-aspartic acid, L-phenylalanine and L-glutamic acid were used as linkers. Bis-thiourea derivatives were prepared from relatively stable isophthaloyl isothiocyanate intermediate. Newly synthesized bis-thiourea derivatives were characterized by FTIR, H-NMR, 13C-NMR and CHNS-O elemental analysis techniques. Characterization data was in good agreement with the expected derivatives, hence confirmed the synthesis of four new derivatives of bis-thiourea having amino acids.
p-tert-Butylcalix[6]arene hexacarboxylic acid as host for Pb(ii), Sr(ii) and Ba(ii)†
Adhikari, Birendra Babu; Zhao, Xiang; Derakhshan, Shahab
2015-01-01
p-tert-Butylcalixarene hexacarboxylic acid initially binds with low symmetry, to later adopt a highly symmetric up-down alternating conformation in the presence of Pb, Sr or Ba. The conformational dynamics for the three ions are distinct, from 15 hours, to 20 days, to 38 days, respectively. PMID:25198172
NASA Astrophysics Data System (ADS)
Anbalagan, Kousika; Thomas, Tiju
2018-05-01
Interatomic potentials for complex materials (like ceramic systems) are important for realistic molecular dynamics (MD) simulations. Such simulations are relevant for understanding equilibrium, transport and dynamical properties of materials, especially in the nanoregime. Here we derive a hybrid interatomic potential (based on bond valence (BV) derived Morse and Coulomb terms), for modeling a complex ceramic, barium tantalum oxynitride (BaTaO2N). This material has been chosen due to its relevance for capacitive and photoactive applications. However, the material presents processing challenges such as the emergence of non-stoichiometric phases during processing, demonstrating complex processing-property correlations. This makes MD investigations of this material both scientifically and technologically relevant. The BV based hybrid potential presented here has been used for simulating sintering of BaTaO2N nanoparticles ( 2-20 nm) under different conditions (using the relevant canonical ensemble). Notably, we show that sintering of particles of diameter < 10 nm requires no external sintering aids such as the addition of barium sources (since stoichiometry is preserved during heat treatment in this size regime). Also, we observe that sintering of particles > 10 nm in size results in the formation of a cluster of tantalum and oxygen atoms at the interface of the BaTaO2N particles. This is in agreement with the experimental reports. The results presented here suggest that the potential proposed can be used to explore dynamical properties of BaTaO2N and related systems. This work will also open avenues for development of nanoscience-enabled aid-free sintering approaches to this and related materials.
Xu, Hongwu; Chavez, Manuel E.; Mitchell, Jeremy N.; ...
2015-04-23
An analogue of the mineral pollucite (CsAlSi 2O 6), CsTiSi 2O 6.5 has a potential host phase for radioactive Cs. However, as 137Cs and 135Cs transmute to 137Ba and 135Ba, respectively, through the beta decay, it is essential to study the structure and stability of this phase upon Cs → Ba substitution. In this work, two series of Ba/Ti-substituted samples, Cs xBa (1-x)/2TiSi 2O 6.5 and Cs xBa 1-xTiSi 2O 7-0.5x, (x = 0.9 and 0.7), were synthesized by high-temperature crystallization from their respective precursors. Synchrotron X-ray diffraction and Rietveld analysis reveal that while Cs xBa (1-x)/2TiSi 2O 6.5 samplesmore » are phase-pure, Cs xBa 1-xTiSi 2O 7-0.5x samples contain Cs3x/(2+x)Ba (1-x)/(2+x)TiSi 2O 6.5 pollucites (i.e., also two-Cs-to-one-Ba substitution) and a secondary phase, fresnoite (Ba2TiSi2O8). Thus, the Cs xBa 1-xTiSi 2O 7-0.5x series is energetically less favorable than Cs xBa (1-x)/2TiSi 2O 6.5. To study the stability systematics of Cs xBa (1-x)/2TiSi 2O 6.5 pollucites, high-temperature calorimetric experiments were performed at 973 K with or without the lead borate solvent. Enthalpies of formation from the constituent oxides (and elements) have thus been derived. Our results show that with increasing Ba/(Cs + Ba) ratio, the thermodynamic stability of these phases decreases with respect to their component oxides. Hence, from the energetic viewpoint, continued Cs → Ba transmutation tends to destabilize the parent silicotitanate pollucite structure. However, the Ba-substituted pollucite co-forms with fresnoite (which incorporates the excess Ba), thereby providing viable ceramic waste forms for all the Ba decay products.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Adhikari, Shiba P.; Hood, Zachary D.; Gallego, Nidia C.
Here, the production of biodiesel by the esterification of oleic acid, as an example of free fatty acid (FFA), was explored by using a new solid acid catalyst derived from lignin, a highly abundant low-cost biomass material. The catalyst was synthesized from lignin-derived carbon fiber by straightforward sulfonation and contains 1.86 mmol/g of sulfonic acid (-SO 3H) groups. The catalyst was characterized by a variety of techniques including PXRD, TGA, TPD-MS, SEM, and XPS to understand the surface chemistry and the result of sulfonation. It was found that the sulfonated lignin-derived carbon fiber (CF-SO 3H) catalyst was very efficient atmore » esterifying oleic acid at 80 oC in 4 hours, with 10 wt. % catalyst (in terms of oleic acid content) and at a 10:1 molar ratio of methanol: oleic acid with a yield of 92%. Furthermore, the catalyst can be reused with no significant loss in activity after 4 cycles. Hence, synthesizing solid acid catalysts from lignin-derived carbon fiber affords a novel strategy for producing biodiesel via ‘green chemistry’.« less
Adhikari, Shiba P.; Hood, Zachary D.; Gallego, Nidia C.; ...
2018-06-04
Here, the production of biodiesel by the esterification of oleic acid, as an example of free fatty acid (FFA), was explored by using a new solid acid catalyst derived from lignin, a highly abundant low-cost biomass material. The catalyst was synthesized from lignin-derived carbon fiber by straightforward sulfonation and contains 1.86 mmol/g of sulfonic acid (-SO 3H) groups. The catalyst was characterized by a variety of techniques including PXRD, TGA, TPD-MS, SEM, and XPS to understand the surface chemistry and the result of sulfonation. It was found that the sulfonated lignin-derived carbon fiber (CF-SO 3H) catalyst was very efficient atmore » esterifying oleic acid at 80 oC in 4 hours, with 10 wt. % catalyst (in terms of oleic acid content) and at a 10:1 molar ratio of methanol: oleic acid with a yield of 92%. Furthermore, the catalyst can be reused with no significant loss in activity after 4 cycles. Hence, synthesizing solid acid catalysts from lignin-derived carbon fiber affords a novel strategy for producing biodiesel via ‘green chemistry’.« less
Shin, Hee Jae; Pil, Gam Bang; Heo, Soo-Jin; Lee, Hyi-Seung; Lee, Jong Seok; Lee, Yeon-Ju; Lee, Jihoon; Won, Ho Shik
2016-01-01
Chemical investigation of a marine-derived fungus, Penicillium steckii 108YD142, resulted in the discovery of a new tanzawaic acid derivative, tanzawaic acid Q (1), together with four known analogues, tanzawaic acids A (2), C (3), D (4), and K (5). The structures of tanzawaic acid derivatives 1–5 were determined by the detailed analysis of 1D, 2D NMR and LC-MS data, along with chemical methods and literature data analysis. These compounds significantly inhibited nitric oxide (NO) production and the new tanzawaic acid Q (1) inhibited the lipopolysaccharide (LPS)-induced inducible nitric oxide synthase (iNOS) and cyclooxygenase-2 (COX-2) proteins and mRNA expressions in RAW 264.7 macrophages. Additionally, compound 1 reduced the mRNA levels of inflammatory cytokines. Taken together, the results of this study demonstrated that the new tanzawaic acid derivative inhibits LPS-induced inflammation. This is the first report on the anti-inflammatory activity of tanzawaic acid Q (1). PMID:26761016
Oleic acid-derived oleoylethanolamide: A nutritional science perspective.
Bowen, Kate J; Kris-Etherton, Penny M; Shearer, Gregory C; West, Sheila G; Reddivari, Lavanya; Jones, Peter J H
2017-07-01
The fatty acid ethanolamide oleoylethanolamide (OEA) is an endogenous lipid mediator derived from the monounsaturated fatty acid, oleic acid. OEA is synthesized from membrane glycerophospholipids and is a high-affinity agonist of the nuclear transcription factor peroxisome proliferator-activated receptor α (PPAR-α). Dietary intake of oleic acid elevates circulating levels of OEA in humans by increasing substrate availability for OEA biosynthesis. Numerous clinical studies demonstrate a beneficial relationship between high-oleic acid diets and body composition, with emerging evidence to suggest OEA may mediate this response through modulation of lipid metabolism and energy intake. OEA exposure has been shown to stimulate fatty acid uptake, lipolysis, and β-oxidation, and also promote food intake control. Future research on high-oleic acid diets and body composition is warranted to confirm these outcomes and elucidate the underlying mechanisms by which oleic acid exerts its biological effects. These findings have significant practical implications, as the oleic acid-derived OEA molecule may be a promising therapeutic agent for weight management and obesity treatment. Copyright © 2017 Elsevier Ltd. All rights reserved.
Killinger, Bryan; Shah, Mrudang; Moszczynska, Anna
2013-01-01
Psychostimulant methamphetamine (METH) is toxic to dopaminergic and serotonergic striatal nerve terminals in adult, but not in adolescent, brain. Betulinic acid (BA) and its derivatives are promising anti-HIV agents with some toxic properties. Many METH users, particularly young men, are HIV-positive; therefore, they might be treated with BA or its derivative for HIV infection. It is not known whether BA, or any of its derivatives, is neurotoxic in combination with METH in adolescent brain. The present study investigated the effects of BA and binge METH in the striatum in late adolescent rats. BA or METH alone did not decrease the levels of dopaminergic or serotonergic markers in the striatum whereas BA and METH together decreased these markers in a BA dose-dependent manner. BA and METH combination also caused decreases in the levels of mitochondrial complex I in the same manner; BA alone only slightly decreased the levels of the enzyme in striatal synaptosomes. BA or METH alone increased cytochrome c. METH alone decreased parkin, increased complex II and striatal BA levels. These results suggest that METH in combination with BA can be neurotoxic to dopaminergic and serotonergic striatal nerve terminals in late adolescent brain via mitochondrial dysfunction and parkin deficit. PMID:24151877
Goldman, Aaron; Shahidullah, Mohammad; Goldman, David; Khailova, Ludmila; Watts, George; Delamere, Nicholas; Dvorak, Katerina
2010-12-01
Barrett's oesophagus is a premalignant disease associated with oesophageal adenocarcinoma. The major goal of this study was to determine the mechanism responsible for bile acid-induced alteration in intracellular pH (pH(i)) and its effect on DNA damage in cells derived from normal oesophagus (HET1A) or Barrett's oesophagus (CP-A). Cells were exposed to bile acid cocktail (BA) and/or acid in the presence/absence of inhibitors of nitric oxide synthase (NOS) or sodium-hydrogen exchanger (NHE). Nitric oxide (NO), pH(i) and DNA damage were measured by fluorescent imaging and comet assay. Expression of NHE1 and NOS in cultured cells and biopsies from Barrett's oesophagus or normal squamous epithelium was determined by RT-PCR, immunoblotting or immunohistochemistry. A dose dependent decrease in pH(i) was observed in CP-A cells exposed to BA. This effect of BA is the consequence of NOS activation and increased NO production, which leads to NHE inhibition. Exposure of oesophageal cells to acid in combination with BA synergistically decreased pH(i). The decrease was more pronounced in CP-A cells and resulted in >2-fold increase in DNA damage compared to acid treatment alone. Examination of biopsies and cell lines revealed robust expression of NHE1 in Barrett's oesophagus but an absence of NHE1 in normal epithelium. The results of this study identify a new mechanism of bile acid-induced DNA damage. We found that bile acids present in the refluxate activate immediately all three isoforms of NOS, which leads to an increased NO production and NHE inhibition. This consequently results in increased intracellular acidification and DNA damage, which may lead to mutations and cancer progression. Therefore, we propose that in addition to gastric reflux, bile reflux should be controlled in patients with Barrett's oesophagus.
Naturally Occurring Cinnamic Acid Sugar Ester Derivatives.
Tian, Yuxin; Liu, Weirui; Lu, Yi; Wang, Yan; Chen, Xiaoyi; Bai, Shaojuan; Zhao, Yicheng; He, Ting; Lao, Fengxue; Shang, Yinghui; Guo, Yu; She, Gaimei
2016-10-24
Cinnamic acid sugar ester derivatives (CASEDs) are a class of natural product with one or several phenylacrylic moieties linked with the non-anomeric carbon of a glycosyl skeleton part through ester bonds. Their notable anti-depressant and brains protective activities have made them a topic of great interest over the past several decades. In particular the compound 3',6-disinapoylsucrose, the index component of Yuanzhi (a well-known Traditional Chinese Medicine or TCM), presents antidepressant effects at a molecular level, and has become a hotspot of research on new lead drug compounds. Several other similar cinnamic acid sugar ester derivatives are reported in traditional medicine as compounds to calm the nerves and display anti-depression and neuroprotective activity. Interestingly, more than one third of CASEDs are distributed in the family Polygalaceae . This overview discusses the isolation of cinnamic acid sugar ester derivatives from plants, together with a systematic discussion of their distribution, chemical structures and properties and pharmacological activities, with the hope of providing references for natural product researchers and draw attention to these interesting compounds.
Natural cinnamic acids, synthetic derivatives and hybrids with antimicrobial activity.
Guzman, Juan David
2014-11-25
Antimicrobial natural preparations involving cinnamon, storax and propolis have been long used topically for treating infections. Cinnamic acids and related molecules are partly responsible for the therapeutic effects observed in these preparations. Most of the cinnamic acids, their esters, amides, aldehydes and alcohols, show significant growth inhibition against one or several bacterial and fungal species. Of particular interest is the potent antitubercular activity observed for some of these cinnamic derivatives, which may be amenable as future drugs for treating tuberculosis. This review intends to summarize the literature data on the antimicrobial activity of the natural cinnamic acids and related derivatives. In addition, selected hybrids between cinnamic acids and biologically active scaffolds with antimicrobial activity were also included. A comprehensive literature search was performed collating the minimum inhibitory concentration (MIC) of each cinnamic acid or derivative against the reported microorganisms. The MIC data allows the relative comparison between series of molecules and the derivation of structure-activity relationships.
Iron Release from Soybean Seed Ferritin Induced by Cinnamic Acid Derivatives.
Sha, Xuejiao; Chen, Hai; Zhang, Jingsheng; Zhao, Guanghua
2018-05-04
Plant ferritin represents a novel class of iron supplement, which widely co-exists with phenolic acids in a plant diet. However, there are few reports on the effect of these phenolic acids on function of ferritin. In this study, we demonstrated that cinnamic acid derivatives, as widely occurring phenolic acids, can induce iron release from holo soybean seed ferritin (SSF) in a structure-dependent manner. The ability of the iron release from SSF by five cinnamic acids follows the sequence of Cinnamic acid > Chlorogenic acid > Ferulic acid > p -Coumaric acid > Trans -Cinnamic acid. Fluorescence titration in conjunction with dialysis results showed that all of these five compounds have a similar, weak ability to bind with protein, suggesting that their protein-binding ability is not related to their iron release activity. In contrast, both Fe 2+ -chelating activity and reducibility of these cinnamic acid derivatives are in good agreement with their ability to induce iron release from ferritin. These studies indicate that cinnamic acid and its derivatives could have a negative effect on iron stability of holo soybean seed ferritin in diet, and the Fe 2+ -chelating activity and reducibility of cinnamic acid and its derivatives have strong relations to the iron release of soybean seed ferritin.
Taira, Norihisa; Katsuyama, Yushi; Yoshioka, Masato; Muraoka, Osamu; Morikawa, Toshio
2018-04-10
l-Ascorbic acid has multifunctional benefits on skin aesthetics, including inhibition of melanin production, and is widely used in cosmetics. It, however, has low stability and poor skin penetration. We hypothesize that alkylglyceryl-l-ascorbic acid derivatives, highly stable vitamin C-alkylglycerol conjugates, would have similar anti-melanogenic activity with better stability and penetration. We test 28 alkylglyceryl-l-ascorbic acid derivatives ( 1 - 28 ) on theophylline-stimulated B16 melanoma 4A5 cells to determine if they inhibit melanogenesis and establish any structure-function relationships. Although not the most potent inhibitors, 3- O -(2,3-dihydroxypropyl)-2- O -hexyl-l-ascorbic acid ( 6 , IC 50 = 81.4 µM) and 2- O -(2,3-dihydroxypropyl)-3- O -hexyl-l-ascorbic acid ( 20 , IC 50 = 117 µM) are deemed the best candidate derivatives based on their inhibitory activities and low toxicities. These derivatives are also found to be more stable than l-ascorbic acid and to have favorable characteristics for skin penetration. The following structural requirements for inhibitory activity of alkylglyceryl-l-ascorbic acid derivatives are also determined: (i) alkylation of glyceryl-l-ascorbic acid is essential for inhibitory activity; (ii) the 3- O -alkyl-derivatives ( 2 - 14 ) exhibit stronger inhibitory activity than the corresponding 2- O -alkyl-derivatives ( 16 - 28 ); and (iii) derivatives with longer alkyl chains have stronger inhibitory activities. Mechanistically, our studies suggest that l-ascorbic acid derivatives exert their effects by suppressing the mRNA expression of tyrosinase and tyrosine-related protein-1.
Code of Federal Regulations, 2014 CFR
2014-07-01
...) derivative, phosphoric acid esters, potassium salts. 721.6110 Section 721.6110 Protection of Environment...) derivative, phosphoric acid esters, potassium salts. (a) Chemical substance and significant new uses subject...) derivative, phosphoric acid esters, potassium salts (PMN P-91-818) is subject to reporting under this section...
Code of Federal Regulations, 2013 CFR
2013-07-01
...) derivative, phosphoric acid esters, potassium salts. 721.6110 Section 721.6110 Protection of Environment...) derivative, phosphoric acid esters, potassium salts. (a) Chemical substance and significant new uses subject...) derivative, phosphoric acid esters, potassium salts (PMN P-91-818) is subject to reporting under this section...
Code of Federal Regulations, 2010 CFR
2010-07-01
...) derivative, phosphoric acid esters, potassium salts. 721.6110 Section 721.6110 Protection of Environment...) derivative, phosphoric acid esters, potassium salts. (a) Chemical substance and significant new uses subject...) derivative, phosphoric acid esters, potassium salts (PMN P-91-818) is subject to reporting under this section...
Code of Federal Regulations, 2012 CFR
2012-07-01
...) derivative, phosphoric acid esters, potassium salts. 721.6110 Section 721.6110 Protection of Environment...) derivative, phosphoric acid esters, potassium salts. (a) Chemical substance and significant new uses subject...) derivative, phosphoric acid esters, potassium salts (PMN P-91-818) is subject to reporting under this section...
Code of Federal Regulations, 2011 CFR
2011-07-01
...) derivative, phosphoric acid esters, potassium salts. 721.6110 Section 721.6110 Protection of Environment...) derivative, phosphoric acid esters, potassium salts. (a) Chemical substance and significant new uses subject...) derivative, phosphoric acid esters, potassium salts (PMN P-91-818) is subject to reporting under this section...
Mitamura, Kuniko; Sakai, Toshihiro; Nakai, Risa; Wakamiya, Tateaki; Iida, Takashi; Hofmann, Alan F; Ikegawa, Shigeo
2011-06-01
Previous work from this laboratory has reported the chemical synthesis of N-acetylcysteine (NAC) conjugates of natural bile acids (BAs) and shown that such novel conjugates can be formed in vivo in rats to which NAC has been administered. The subsequent fate of such novel conjugates is not known. One possible biotransformation is sulfation, a major pathway for BAs N-acylamidates in patients with cholestatic liver disease. Here, we report the chemical synthesis of the 3-sulfates of the S-acyl NAC conjugates of five natural BAs (cholic, chenodeoxycholic, deoxycholic, ursodeoxycholic, and lithocholic). We also measured the sulfation of N-acetylcysteine-natural bile acid (BA-NAC) conjugates when they were incubated with a rat liver cytosolic fraction. The chemical structures of the BA-NAC 3-sulfates were confirmed by proton nuclear magnetic resonance, as well as by means of electrospray ionization-linear ion trap mass spectrometry with negative-ion detection. Upon collision-induced dissociation of singly and doubly charged deprotonated molecules, structurally informative product ions were observed. Using a triple-stage quadrupole instrument, selected reaction monitoring analyses by monitoring characteristic transition ions allowed the achievement of a highly sensitive and specific assay. When BA-NACs were incubated with a rat liver cytosolic fraction to which 3'-phosphoadenosine 5'-phosphosulfate was added, sulfation occurred, but the dominant reaction was hydrolysis of the S-acyl linkage to form the unconjugated BAs. Subsequent sulfation occurred at C-3 on the unconjugated BAs that had been formed from the BA-NACs. Such sulfation was proportional to the hydrophobicity of the unconjugated bile acid. Thus, NAC conjugates of BAs as well as their C-3 sulfates if formed in vivo are rapidly hydrolyzed by cytosolic enzymes.
Kuda, Ondrej; Brezinova, Marie; Rombaldova, Martina; Slavikova, Barbora; Posta, Martin; Beier, Petr; Janovska, Petra; Veleba, Jiri; Kopecky, Jan; Kudova, Eva; Pelikanova, Terezie; Kopecky, Jan
2016-09-01
White adipose tissue (WAT) is a complex organ with both metabolic and endocrine functions. Dysregulation of all of these functions of WAT, together with low-grade inflammation of the tissue in obese individuals, contributes to the development of insulin resistance and type 2 diabetes. n-3 polyunsaturated fatty acids (PUFAs) of marine origin play an important role in the resolution of inflammation and exert beneficial metabolic effects. Using experiments in mice and overweight/obese patients with type 2 diabetes, we elucidated the structures of novel members of fatty acid esters of hydroxy fatty acids-lipokines derived from docosahexaenoic acid (DHA) and linoleic acid, which were present in serum and WAT after n-3 PUFA supplementation. These compounds contained DHA esterified to 9- and 13-hydroxyoctadecadienoic acid (HLA) or 14-hydroxydocosahexaenoic acid (HDHA), termed 9-DHAHLA, 13-DHAHLA, and 14-DHAHDHA, and were synthesized by adipocytes at concentrations comparable to those of protectins and resolvins derived from DHA in WAT. 13-DHAHLA exerted anti-inflammatory and proresolving properties while reducing macrophage activation by lipopolysaccharides and enhancing the phagocytosis of zymosan particles. Our results document the existence of novel lipid mediators, which are involved in the beneficial anti-inflammatory effects attributed to n-3 PUFAs, in both mice and humans. © 2016 by the American Diabetes Association.
Synthesis and Proteasome Inhibition of Glycyrrhetinic Acid Derivatives
Huang, Li; Yu, Donglei; Ho, Phong; Qian, Keduo; Lee, Kuo-Hsiung; Chen, Chin-Ho
2008-01-01
This study discovered that glycyrrhetinic acid inhibited the human 20S proteasome at 22.3 µM. Esterification of the C-3 hydroxyl group on glycyrrhetinic acid with various carboxylic acid reagents yielded a series of analogs with marked improved potency. Among the derivatives, glycyrrhetinic acid 3-O-isophthalate (17) was the most potent compound with IC50 of 0.22 µM, which was approximately 100-fold more potent than glycyrrhetinic acid. PMID:18562200
Katakura, Masanori; Hashimoto, Michio; Inoue, Takayuki; Mamun, Abdullah Al; Tanabe, Yoko; Arita, Makoto; Shido, Osamu
2015-01-01
Arachidonic acid (ARA) metabolites produced by cyclo-oxygenase and lipoxygenase are important mediators maintaining physiological renal function. However, the effects of exogenous ARA on kidney function in vivo remain unknown. This study examined the effects of long-term oral ARA administration on normal renal function as well as inflammation and oxidative stress in aged rats. In addition, we measured levels of renal eicosanoids and docosanoids using liquid chromatography-tandem mass spectrometry. Control or ARA oil (240 mg/kg body weight/day) was orally administered to 21-month-old Wistar rats for 13 weeks. Levels of plasma creatinine, blood urea nitrogen, inflammatory and anti-inflammatory cytokines, reactive oxygen species, and lipid peroxidation were not significantly different between the two groups. The ARA concentration in the plasma, kidney, and liver increased in the ARA-administered group. In addition, levels of free-form ARA, prostaglandin E2, and 12- and 15-hydroxyeicosatetraenoic acid increased in the ARA-administered group, whereas renal concentration of docosahexaenoic acid and eicosapentaenoic acid decreased in the ARA-administered group. Levels of docosahexaenoic acid-derived protectin D1, eicosapentaenoic acid-derived 5-, and 18-hydroxyeicosapentaenoic acids, and resolvin E2 and E3 decreased in the ARA-administered group. Our results indicate that long-term ARA administration led to no serious adverse reactions under normal conditions and to a decrease in anti-inflammatory docosahexaenoic acid- and eicosapentaenoic acid-derived metabolites in the kidneys of aged rats. These results indicate that there is a possibility of ARA administration having a reducing anti-inflammatory effect on the kidney.
Katakura, Masanori; Hashimoto, Michio; Inoue, Takayuki; Mamun, Abdullah Al; Tanabe, Yoko; Arita, Makoto; Shido, Osamu
2015-01-01
Arachidonic acid (ARA) metabolites produced by cyclo-oxygenase and lipoxygenase are important mediators maintaining physiological renal function. However, the effects of exogenous ARA on kidney function in vivo remain unknown. This study examined the effects of long-term oral ARA administration on normal renal function as well as inflammation and oxidative stress in aged rats. In addition, we measured levels of renal eicosanoids and docosanoids using liquid chromatography–tandem mass spectrometry. Control or ARA oil (240 mg/kg body weight/day) was orally administered to 21-month-old Wistar rats for 13 weeks. Levels of plasma creatinine, blood urea nitrogen, inflammatory and anti-inflammatory cytokines, reactive oxygen species, and lipid peroxidation were not significantly different between the two groups. The ARA concentration in the plasma, kidney, and liver increased in the ARA-administered group. In addition, levels of free-form ARA, prostaglandin E2, and 12- and 15-hydroxyeicosatetraenoic acid increased in the ARA-administered group, whereas renal concentration of docosahexaenoic acid and eicosapentaenoic acid decreased in the ARA-administered group. Levels of docosahexaenoic acid-derived protectin D1, eicosapentaenoic acid-derived 5-, and 18-hydroxyeicosapentaenoic acids, and resolvin E2 and E3 decreased in the ARA-administered group. Our results indicate that long-term ARA administration led to no serious adverse reactions under normal conditions and to a decrease in anti-inflammatory docosahexaenoic acid- and eicosapentaenoic acid-derived metabolites in the kidneys of aged rats. These results indicate that there is a possibility of ARA administration having a reducing anti-inflammatory effect on the kidney. PMID:26485038
Synthesis and preliminary biological evaluations of (+)-isocampholenic acid-derived amides.
Grošelj, Uroš; Golobič, Amalija; Knez, Damijan; Hrast, Martina; Gobec, Stanislav; Ričko, Sebastijan; Svete, Jurij
2016-08-01
The synthesis of two novel (+)-isocampholenic acid-derived amines has been realized starting from commercially available (1S)-(+)-10-camphorsulfonic acid. The novel amines as well as (+)-isocampholenic acid have been used as building blocks in the construction of a library of amides using various aliphatic, aromatic, and amino acid-derived coupling partners using BPC and CDI as activating agents. Amide derivatives have been assayed against several enzymes that hold potential for the development of new drugs to battle bacterial infections and Alzheimer's disease. Compounds 20c and 20e showed promising selective sub-micromolar inhibition of human butyrylcholinesterase [Formula: see text] ([Formula: see text] values [Formula: see text] and [Formula: see text], respectively).
Novel cajaninstilbene acid derivatives as antibacterial agents.
Geng, Zhi-Zhong; Zhang, Jian-Jun; Lin, Jing; Huang, Mei-Yan; An, Lin-Kun; Zhang, Hong-Bin; Sun, Ping-Hua; Ye, Wen-Cai; Chen, Wei-Min
2015-07-15
Discovery of novel antibacterial agents with new structural scaffolds that combat drug-resistant pathogens is an urgent task. Cajaninstilbene acid, which is isolated from pigeonpea leaves, has shown antibacterial activity. In this study, a series of cajaninstilbene acid derivatives were designed and synthesized. The antibacterial activities of these compounds against gram-negative and gram-positive bacteria, as well as nine strains of methicillin-resistant staphylococcus aureus (MRSA) bacteria are evaluated,and the related structure-activity relationships are discussed. Assays suggest that some of the synthetic cajaninstilbene acid derivatives exhibit potent antibacterial activity against gram-positive bacterial strains and MRSA. Among these compounds, 5b, 5c, 5j and 5k show better antibacterial activity than the positive control compounds. The results of MTT assays illustrate the low cytotoxicity of the active compounds. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Spirocyclic systems derived from pyroglutamic acid.
Cowley, Andrew R; Hill, Thomas J; Kocis, Petr; Moloney, Mark G; Stevenson, Robert D; Thompson, Amber L
2011-10-21
The synthesis and likely conformational structure of rigid spirocyclic bislactams and lactam-lactones derived from pyroglutamic acid, and their suitability as lead structures for applications in drug development programmes using cheminformatic analysis, has been investgated.
When one becomes two: Ba12In4Se20, not quite isostructural to Ba12In4S19
NASA Astrophysics Data System (ADS)
Yin, Wenlong; Iyer, Abishek K.; Li, Chao; Yao, Jiyong; Mar, Arthur
2017-09-01
The ternary selenide Ba12In4Se20 was synthesized by reaction of BaSe, In2Se3, and Se at 1023 K. Single-crystal X-ray diffraction revealed a trigonal structure (space group R 3 bar, Z = 6, a = 10.0360(6) Å, c = 78.286(4) Å at room temperature) consisting of one-dimensional stacks of InSe4 tetrahedra, In2Se7 double tetrahedra, selenide Se2- anions, and diselenide Se22- anions, with Ba2+ cations in the intervening spaces. The selenide Ba12In4Se20 can be derived from the corresponding sulfide Ba12In4S19 by replacing one monoatomic Ch2- anion with a diatomic Ch22- anion. An optical band gap of 1.70(2) eV, consistent with the dark red colour of the crystals, was deduced from the UV-vis-NIR diffuse reflectance spectrum.
Synthesis and Anti-microbial Activity of Novel Phosphatidylethanolamine-N-amino Acid Derivatives.
Vijeetha, Tadla; Balakrishna, Marrapu; Karuna, Mallampalli Sri Lakshmi; Surya Koppeswara Rao, Bhamidipati Venkata; Prasad, Rachapudi Badari Narayana; Kumar, Koochana Pranay; Surya Narayana Murthy, Upadyaula
2015-01-01
The study involved synthesis of five novel amino acid derivatives of phosphatidylethanolamine isolated from egg yolk lecithin employing a three step procedure i) N-protection of L-amino acids with BOC anhydride in alkaline medium ii) condensation of - CO2H group of N-protected amino acid with free -NH2 of PE by a peptide linkage and iii) deprotection of N-protected group of amino acids to obtain phosphatidylethanolamine-N-amino acid derivatives in 60-75% yield. The five L-amino acids used were L glycine, L-valine, L-leucine, L-isoleucine and L-phenylalanine. The amino acid derivatives were screened for anti-baterial activity against B. subtilis, S. aureus, P. aeroginosa and E. coli taking Streptomycin as reference compound and anti-fungal activity against C. albicans, S. cervisiae, A. niger taking AmphotericinB as reference compound. All the amino acid derivatives exhibited extraordinary anti-bacterial activities about 3 folds or comparable to Streptomycin and moderate or no anti-fungal activity against Amphotericin-B.
40 CFR 721.430 - Oxo-substituted amino-al-kanoic acid derivative.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Oxo-substituted amino-al-kanoic acid... Specific Chemical Substances § 721.430 Oxo-substituted amino-al-kanoic acid derivative. (a) Chemical... as oxo-substituted amino al-kan-oic acid derivative (PMN No. P-92-692) is subject to reporting under...
40 CFR 721.430 - Oxo-substituted amino-al-kanoic acid derivative.
Code of Federal Regulations, 2011 CFR
2011-07-01
... 40 Protection of Environment 31 2011-07-01 2011-07-01 false Oxo-substituted amino-al-kanoic acid... Specific Chemical Substances § 721.430 Oxo-substituted amino-al-kanoic acid derivative. (a) Chemical... as oxo-substituted amino al-kan-oic acid derivative (PMN No. P-92-692) is subject to reporting under...
40 CFR 721.430 - Oxo-substituted amino-al-kanoic acid derivative.
Code of Federal Regulations, 2013 CFR
2013-07-01
... 40 Protection of Environment 32 2013-07-01 2013-07-01 false Oxo-substituted amino-al-kanoic acid... Specific Chemical Substances § 721.430 Oxo-substituted amino-al-kanoic acid derivative. (a) Chemical... as oxo-substituted amino al-kan-oic acid derivative (PMN No. P-92-692) is subject to reporting under...
40 CFR 721.430 - Oxo-substituted amino-al-kanoic acid derivative.
Code of Federal Regulations, 2014 CFR
2014-07-01
... 40 Protection of Environment 31 2014-07-01 2014-07-01 false Oxo-substituted amino-al-kanoic acid... Specific Chemical Substances § 721.430 Oxo-substituted amino-al-kanoic acid derivative. (a) Chemical... as oxo-substituted amino al-kan-oic acid derivative (PMN No. P-92-692) is subject to reporting under...
40 CFR 721.430 - Oxo-substituted amino-al-kanoic acid derivative.
Code of Federal Regulations, 2012 CFR
2012-07-01
... 40 Protection of Environment 32 2012-07-01 2012-07-01 false Oxo-substituted amino-al-kanoic acid... Specific Chemical Substances § 721.430 Oxo-substituted amino-al-kanoic acid derivative. (a) Chemical... as oxo-substituted amino al-kan-oic acid derivative (PMN No. P-92-692) is subject to reporting under...
2014-01-01
Background Co-crystal is a structurally homogeneous crystalline material that contains two or more neutral building blocks that are present in definite stoichiometric amounts. The main advantage of co-crystals is their ability to generate a variety of solid forms of a drug that have distinct physicochemical properties from the solid co-crystal components. In the present investigation, five co-crystals containing 2-amino-6-chloropyridine (AMPY) moiety were synthesized and characterized. Results The crystal structure of 2-amino-6-chloropyridine (AMPY) (I), and the robustness of pyridine-acid supramolecular synthon were discussed in four stoichiometry co-crystals of AMPY…BA (II), AMPY…2ABA (III), AMPY…3CLBA (IV) and AMPY…4NBA (V). The abbreviated designations used are benzoic acid (BA), 2-aminobenzoic acid (2ABA), 3-chlorobenzoic acid (3CLBA) and 4-nitrobenzoic acid (4NBA). All the crystalline materials have been characterized by 1HNMR, 13CNMR, IR, photoluminescence, TEM analysis and X-ray diffraction. The supramolecular assembly of each co-crystal is analyzed and discussed. Conclusions Extensive N---H · · · N/N---H · · · O/O---H · · · N hydrogen bonds are found in (I-V), featuring different supramolecular synthons. In the crystal structure, for compound (I), the 2-amino-6-chloropyridine molecules are linked together into centrosymmetric dimers by hydrogen bonds to form homosynthon, whereas for compounds (II-V), the carboxylic group of the respective acids (benzoic acid, 2-aminobenzoic acid, 3-chlorobenzoic acid and 4-nitrobenzoic acid) interacts with pyridine molecule in a linear fashion through a pair of N---H · · · O and O---H · · · N hydrogen bonds, generating cyclic hydrogen-bonded motifs with the graph-set notation R 2 2 8 , to form heterosynthon. In compound (II), another intermolecular N---H · · · O hydrogen bonds further link these heterosynthons into zig-zag chains. Whereas in
Hemamalini, Madhukar; Loh, Wan-Sin; Quah, Ching Kheng; Fun, Hoong-Kun
2014-01-01
Co-crystal is a structurally homogeneous crystalline material that contains two or more neutral building blocks that are present in definite stoichiometric amounts. The main advantage of co-crystals is their ability to generate a variety of solid forms of a drug that have distinct physicochemical properties from the solid co-crystal components. In the present investigation, five co-crystals containing 2-amino-6-chloropyridine (AMPY) moiety were synthesized and characterized. The crystal structure of 2-amino-6-chloropyridine (AMPY) (I), and the robustness of pyridine-acid supramolecular synthon were discussed in four stoichiometry co-crystals of AMPY…BA (II), AMPY…2ABA (III), AMPY…3CLBA (IV) and AMPY…4NBA (V). The abbreviated designations used are benzoic acid (BA), 2-aminobenzoic acid (2ABA), 3-chlorobenzoic acid (3CLBA) and 4-nitrobenzoic acid (4NBA). All the crystalline materials have been characterized by (1)HNMR, (13)CNMR, IR, photoluminescence, TEM analysis and X-ray diffraction. The supramolecular assembly of each co-crystal is analyzed and discussed. Extensive N---H · · · N/N---H · · · O/O---H · · · N hydrogen bonds are found in (I-V), featuring different supramolecular synthons. In the crystal structure, for compound (I), the 2-amino-6-chloropyridine molecules are linked together into centrosymmetric dimers by hydrogen bonds to form homosynthon, whereas for compounds (II-V), the carboxylic group of the respective acids (benzoic acid, 2-aminobenzoic acid, 3-chlorobenzoic acid and 4-nitrobenzoic acid) interacts with pyridine molecule in a linear fashion through a pair of N---H · · · O and O---H · · · N hydrogen bonds, generating cyclic hydrogen-bonded motifs with the graph-set notation [Formula: see text] , to form heterosynthon. In compound (II), another intermolecular N---H · · · O hydrogen bonds further link these heterosynthons into zig-zag chains. Whereas in compounds (IV) and (V
Reactions of glycidyl derivatives with ambident nucleophiles; part 2: amino acid derivatives
Dyker, Gerald; Thöne, Andreas; Henkel, Gerald
2007-01-01
A three-step procedure for the synthesis of multifunctionalized heterocycles from a pyroglutamic acid derivative, glycidyl components and anilines by nucleophilic substitution and cobalt catalysis is presented. PMID:17900352
21 CFR 172.862 - Oleic acid derived from tall oil fatty acids.
Code of Federal Regulations, 2013 CFR
2013-04-01
... a component in the manufacture of food-grade additives in accordance with the following prescribed... component in the manufacture of other food-grade additives. (d) To assure safe use of the additive, the... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Oleic acid derived from tall oil fatty acids. 172...
Acyl Meldrum's acid derivatives: application in organic synthesis
NASA Astrophysics Data System (ADS)
Janikowska, K.; Rachoń, J.; Makowiec, S.
2014-07-01
This review is focused on an important class of Meldrum's acid derivatives commonly known as acyl Meldrum's acids. The preparation methods of these compounds are considered including the recently proposed and rather rarely used ones. The chemical properties of acyl Meldrum's acids are described in detail, including thermal stability and reactions with various nucleophiles. The possible mechanisms of these transformations are analyzed. The bibliography includes 134 references.
Cinnamic acid derivatives in cosmetics - current use and future prospects.
Gunia-Krzyżak, Agnieszka; Słoczyńska, Karolina; Popiół, Justyna; Koczurkiewicz, Paulina; Marona, Henryk; Pękala, Elżbieta
2018-06-05
Cinnamic acid derivatives are widely used in cosmetics and possess various functions. This group of compounds includes both naturally occurring as well as synthetic substances. On the basis of the Cosmetic Ingredient Database (CosIng) and available literature, this review summarizes their functions in cosmetics, including their physicochemical and biological properties as well as reported adverse effects. A perfuming function is typical of many derivatives of cinnamaldehyde, cinnamyl alcohol, dihydrocinnamyl alcohol, and cinnamic acid itself; these substances are commonly used in cosmetics all over the world. Some of them show allergic and photoallergic potential, resulting in restrictions in maximum concentrations and/or a requirement to indicate the presence of some substances in the list of ingredients when their concentrations exceed certain fixed values in a cosmetic product. Another important function of cinnamic acid derivatives in cosmetics is UV protection. Ester derivatives such as ethylhexyl methoxycinnamate (octinoxate), isoamyl p-methoxycinnamte (amiloxiate), octocrylene, and cinoxate are used in cosmetics all over the world as UV filters. However, their maximum concentrations in cosmetic products are restricted due to their adverse effects, which include contact and a photocontact allergies, phototoxic contact dermatitis, contact dermatitis, estrogenic modulation, and generation of reactive oxygen species. Other rarely utilized functions of cinnamic acid derivatives are as an antioxidant, in skin conditioning, hair conditioning, as a tonic, and in antimicrobial activities. Moreover, some currently investigated natural and synthetic derivatives of cinnamic acid have shown skin lightening and anti-aging properties. Some of them may become new cosmetic ingredients in the future. In particular, 4-hydroxycinnamic acid, which is currently indexed as a skin-conditioning cosmetics ingredient, has been widely tested in vitro and in vivo as a new drug candidate
Actions of derivatives of lysergic acid on the heart of venus mercenaria
Wright, Anne McCoy; Moorhead, Merilyn; Welsh, J. H.
1962-01-01
5-Hydroxytryptamine and a number of (+)-lysergic acid derivatives have been tested on the heart of Venus mercenaria. One group of derivatives was found to increase the amplitude and frequency of heart beat in a manner much like 5-hydroxytryptamine. It included the monoethylamide, diethylamide, propanolamide (ergometrine), butanolamide (methylergometrine) and certain peptide derivatives of lysergic acid without substituents in positions 1 or 2. Of these, lysergic acid diethylamide was the most active. Given sufficient time (up to 4 hr), as little as 10 ml. of 10-16 M lysergic acid diethylamide produced a maximum increase in amplitude and frequency in about one-half of the 80 hearts on which it was tested. Its action was very slowly reversed by washing, as was true of all lysergic acid derivatives. A second group of lysergic acid derivatives, substituted in positions 1 or 2, had weak excitor action, if any, and specific 5-hydroxytryptamine blocking action. This group consisted of 1-methyl-, 1-acetyl-, and 2-bromo-lysergic acid diethylamide and 1-methyllysergic acid butanolamide (methysergide). Of these, the last showed least signs of excitor action, usually none up to 10-4 M, and it blocked 5-hydroxytryptamine in a molar ratio of about one to one. PMID:14008412
Metabolic engineering of Saccharomyces cerevisiae for production of fatty acid-derived hydrocarbons.
Zhang, Yiming; Nielsen, Jens; Liu, Zihe
2018-06-05
Fatty acid-derived hydrocarbons attract increasing attention as biofuels due to their immiscibility with water, high-energy content, low freezing point, and high compatibility with existing refineries and end-user infrastructures. Yeast Saccharomyces cerevisiae has advantages for production of fatty acid-derived hydrocarbons as its native routes toward fatty acid synthesis involve only a few reactions that allow more efficient conversion of carbon substrates. Here we describe major biosynthetic pathways of fatty acid-derived hydrocarbons in yeast, and summarize key metabolic engineering strategies, including enhancing precursor supply, eliminating competing pathways, and expressing heterologous pathways. With recent advances in yeast production of fatty acid-derived hydrocarbons, our review identifies key research challenges and opportunities for future optimization, and concludes with perspectives and outlooks for further research directions. © 2018 Wiley Periodicals, Inc.
Luna-Palencia, Gabriela R; Martinez-Ramos, Federico; Vasquez-Moctezuma, Ismael; Fragoso-Vazquez, Manuel Jonathan; Mendieta-Wejebe, Jessica Elena; Padilla-Martínez, Itzia I; Sixto-Lopez, Yudibeth; Mendez-Luna, David; Trujillo-Ferrara, Jose; Meraz-Rios, Marco A; Fonseca-Sabater, Yadira; Correa-Basurto, Jose
2014-01-01
Valproic acid (VPA) is extensively used as an anticonvulsive agent and as a treatment for other neurological disorders. It has been shown that VPA exerts an anti-proliferative effect on several types of cancer cells by inhibiting the activity of histone deacetylases (HDACs), which are involved in replication and differentiation processes. However, VPA has some disadvantages, among which are poor water solubility and hepatotoxicity. Therefore, the aim of the present study was to design and synthesize three derivatives of VPA to improve its physicochemical properties and anti-proliferative effects. For this purpose, the amino acids aspartic acid, glutamic acid and proline were added to the molecular structure of VPA. Docking and molecular dynamics simulations were used to determine the mode of recognition of these three derivatives by different conformations of HDAC8. This receptor was used as the specific target because of its high affinity for this type of substrate. The results demonstrate that, compared to VPA, the test compounds bind to different sites on the enzyme and that hydrogen bonds and hydrophobic interactions play key roles in this difference. The IC50 values of the VPA derivatives, experimentally determined using HeLa cells, were in the mM range. This result indicates that the derivatives have greater antiproliferative effects than the parent compound. Hence, these results suggest that these amino acid derivatives may represent a good alternative for anticancer treatment.
Adipose‑derived stem cells and hyaluronic acid based gel compatibility, studied in vitro.
Guo, Jiayan; Guo, Shu; Wang, Yuxin; Yu, Yanqiu
2017-10-01
Minimally invasive aesthetic and cosmetic procedures have increased in popularity. Injectable dermal fillers provide soft tissue augmentation, improve facial rejuvenation and wrinkles, and correct tissue defects. To investigate the use of adipose‑derived stem cells integrated with a hyaluronic acid based gel as a dermal filler, the present study used cytotoxicity studies, proliferation studies, adipogenic and osteogenic differentiation, apoptosis assays and scanning electron microscopy. Although hyaluronic acid induced low levels of apoptosis in adipose‑derived stem cells, its significantly promoted proliferation of adipose‑derived stem cells. Hyaluronic acid demonstrates little toxicity against adipose‑derived stem cells. Adipose‑derived stem cells were able to differentiate into adipocytes and osteoblasts. Furthermore, scanning electron microscopy revealed that adipose‑derived stem cells maintained intact structures on the surface of hyaluronic acid as well as in it, and demonstrated abundant cell attachments. The present study demonstrated the compatibility of adipose‑derived stem cells and hyaluronic acid based gels in vitro.
Mei, Xuefeng; August, Adam T.; Wolf, Christian
2008-01-01
A chemo- and regioselective copper-catalyzed cross-coupling reaction for effective amination of 2-chlorobenzoic acids with aniline derivatives has been developed. The method eliminates the need for acid protection and produces a wide range of N-aryl anthranilic acid derivatives in up to 99%. The amination was found to proceed with both electron-rich and electron-deficient aryl chlorides and anilines and also utilizes sterically hindered anilines such as 2,6-dimethylaniline and 2-tert-butylaniline. The conformational isomerism of appropriately substituted N-aryl anthranilic acids has been investigated in the solid state. Crystallographic analysis of seven anthranilic acid derivatives showed formation of two distinct supramolecular architectures exhibiting trans-anti- and unprecedented trans-syn-dimeric structures. PMID:16388629
Cinnamic acid derivatives induce cell cycle arrest in carcinoma cell lines.
Sova, Matej; Žižak, Željko; Stanković, Jelena A Antic; Prijatelj, Matevž; Turk, Samo; Juranić, Zorica D; Mlinarič-Raščan, Irena; Gobec, Stanislav
2013-08-01
Cinnamic acid derivatives can be found in plant material, and they possess a remarkable variety of biological effects. In the present study, we have investigated the cytotoxic effects of representative cinnamic acid esters and amides. The cytotoxicity was determined by MTT test on human cervix adenocarcinoma (HeLa), myelogenous leukemia (K562), malignant melanoma (Fem-x), and estrogen-receptor-positive breast cancer (MCF-7) cells, versus peripheral blood mononuclear cells (PBMCs) without or with the addition of the plant lectin phytohemaglutinin (PHA). The compounds tested showed significant cytotoxicity (IC50s between 42 and 166 µM) and furthermore selectivity of these cytotoxic effects on the malignant cell lines versus the PBMCs was also seen, especially when electron-withdrawing groups, such as a cyano group (compound 5), were present on the aromatic rings of the alcohol or amine parts of the cinnamic acid derivatives. The additional study on cell cycle phase distribution indicated that novel cinnamic acid derivatives inhibit cell growth by induction of cell death. Thus, cinnamic acids derivatives represent important lead compounds for further development of antineoplastic agents.
Production of Fatty Acid-Derived Valuable Chemicals in Synthetic Microbes
Yu, Ai-Qun; Pratomo Juwono, Nina Kurniasih; Leong, Susanna Su Jan; Chang, Matthew Wook
2014-01-01
Fatty acid derivatives, such as hydroxy fatty acids, fatty alcohols, fatty acid methyl/ethyl esters, and fatty alka(e)nes, have a wide range of industrial applications including plastics, lubricants, and fuels. Currently, these chemicals are obtained mainly through chemical synthesis, which is complex and costly, and their availability from natural biological sources is extremely limited. Metabolic engineering of microorganisms has provided a platform for effective production of these valuable biochemicals. Notably, synthetic biology-based metabolic engineering strategies have been extensively applied to refactor microorganisms for improved biochemical production. Here, we reviewed: (i) the current status of metabolic engineering of microbes that produce fatty acid-derived valuable chemicals, and (ii) the recent progress of synthetic biology approaches that assist metabolic engineering, such as mRNA secondary structure engineering, sensor-regulator system, regulatable expression system, ultrasensitive input/output control system, and computer science-based design of complex gene circuits. Furthermore, key challenges and strategies were discussed. Finally, we concluded that synthetic biology provides useful metabolic engineering strategies for economically viable production of fatty acid-derived valuable chemicals in engineered microbes. PMID:25566540
Antibacterial activity of triterpene acids and semi-synthetic derivatives against oral pathogens
Scalon Cunha, Luis C; Andrade e Silva, Márcio L; Cardoso Furtado, Niege A J; Vinhólis, Adriana H C; Martins, Carlos H; da Silva Filho, Ademar A; Cunha, Wilson R
2007-01-01
Triterpene acids (ursolic, oleanoic, gypsogenic, and sumaresinolic acids) isolated from Miconia species, along with a mixture of ursolic and oleanolic acids and a mixture of maslinic and 2-a-hydroxyursolic acids, as well as ursolic acid derivatives were evaluated against the following microorganisms: Streptococcus mutans, Streptococcus mitis, Streptococcus sanguinis, Streptococcus salivarius, Streptococcus sobrinus, and Enterococcus faecalis, which are potentially responsible for the formation of dental caries in humans. The microdilution method was used for the determination of the minimum inhibitory concentration (MIC) during the evaluation of the antibacterial activity. All the isolated compounds, mixtures, and semi-synthetic derivatives displayed activity against all the tested bacteria, showing that they are promising antiplaque and anticaries agents. Ursolic and oleanolic acids displayed the most intense antibacterial effect, with MIC values ranging from 30 microg/mL to 80 microg/mL. The MIC values of ursolic acid derivatives, as well as those obtained for the mixture of ursolic and oleanolic acids showed that these compounds do not have higher antibacterial activity when compared with the activity observed with either ursolic acid or oleanolic acid alone. With regard to the structure-activity relationship of triterpene acids and derivatives, it is suggested that both hydroxy and carboxy groups present in the triterpenes are important for their antibacterial activity against oral pathogens.
Antioxidant and prooxidant nature of hydroxycinnamic acid derivatives ferulic and caffeic acids.
Maurya, Dharmendra Kumar; Devasagayam, Thomas Paul Asir
2010-12-01
Dietary polyphenols are beneficial to human health by exerting various biological effects. Ferulic and caffeic acids are hydroxycinnamic acid derivatives widely distributed in plant-derived food products. Studies indicate that some dietary compounds may have concentration-dependent antioxidant or prooxidant activities. The present study concerns such activities of ferulic and caffeic acids. They have concentration-dependent antioxidant effects in terms of inhibition of lipid peroxidation and reactive oxygen species-scavenging after 2,2'-azobis-amidinopropane dihydrochloride-induced damage in mouse liver microsomes and splenic lymphocytes respectively. They also show differential scavenging of nitric oxide, superoxide and 2,2'-azino-bis-3-ethylbenzthiazoline-6-sulfonic acid radical (ABTS*(+)). In DPPH (1,1-diphenyl picrylhydrazyl) assay above 20 μM the absorbance start increasing due to the formation of an unknown adduct which has a shoulder at 517 nm. However, in Fenton reaction, above 5 μM, they behave as prooxidants and the possible mechanisms responsible for their prooxidant property may be related to their ferric reducing ability. These findings may have significant health implications where these natural compounds are being used/consumed. Copyright © 2010 Elsevier Ltd. All rights reserved.
Citric-Acid-Derived Photo-cross-Linked Biodegradable Elastomers
Gyawali, Dipendra; Tran, Richard T.; Guleserian, Kristine J.; Tang, Liping; Yang, Jian
2010-01-01
Citric-acid-derived thermally cross-linked biodegradable elastomers (CABEs) have recently received significant attention in various biomedical applications, including tissue-engineering orthopedic devices, bioimaging and implant coatings. However, citric-acid-derived photo-cross-linked biodegradable elastomers are rarely reported. Herein, we report a novel photo-cross-linked biodegradable elastomer, referred to as poly(octamethylene maleate citrate) (POMC), which preserves pendant hydroxyl and carboxylic functionalities after cross-linking for the potential conjugation of biologically active molecules. POMC is a low-molecular-mass pre-polymer with a molecular mass average between 701 and 1291 Da. POMC networks are soft and elastic with an initial modulus of 0.07 to 1.3 MPa and an elongation at break between 38 and 382%. FT-IR–ATR results confirmed the successful surface immobilization of type-I collagen onto POMC films, which enhanced in vitro cellular attachment and proliferation. Photo-polymerized POMC films implanted subcutaneously into Sprague–Dawley rats demonstrated minimal in vivo inflammatory responses. The development of POMC enriches the family of citric-acid-derived biodegradable elastomers and expands the available biodegradable polymers for versatile needs in biomedical applications. PMID:20557687
Effect of molecular parameters on the binding of phenoxyacetic acid derivatives to albumins.
Cserháti, T; Forgács, E; Deyl, Z; Miksík, I
2001-03-25
The interaction of 12 phenoxyacetic acid derivatives with human and serum albumin as well as with egg albumin was studied by charge-transfer reversed-phase (RP) thin-layer chromatography (TLC) and the relative strength of interaction was calculated. Each phenoxyacetic acid derivative interacted with human and bovine serum albumins whereas no interaction was observed with egg albumin. Stepwise regression analysis proved that the lipophilicity of the derivatives exert a significant impact on their capacity to bind to serum albumins. This result supports the hypothesis that the binding of phenoxyacetic acid derivatives to albumins may involve hydrophobic forces occurring between the corresponding apolar substructures of these derivatives and the amino acid side chains.
REPRODUCTION IN VITRO OF ENTAMŒBA TETRAGENA AND ENTAMŒBA COLI FROM THEIR CYSTS
Yoshida, Kazuyoshi
1920-01-01
1. The vegetative forms of amebæ may be developed in vitro from the cysts. 2. The cysts of Entamœba tetragena and Entamœba coli each produce only a single vegetative individual. It has not been observed in vitro that a number of daughter amebæ, corresponding to the number of nuclei present in the cyst, emerge from the mother cyst, as claimed by Casagrandi and Barbagallo, Schaudinn, and a number of other investigators. 3. The daughter nuclei in the cystic stage correspond to the gamete nuclei of other protozoa. The syngamic nuclear union in the case of these two amebæ does not take place in the tetranuclear stage of the cyst, as claimed by Schaudinn and Wenyon, but during reproduction. 4. The process of autogamy of both amebæ is not restricted to two nuclei; it may involve more than two, which unite to form a syncaryon. In the case of all other protozoa, autogamy is restricted to two nuclei. 5. In order to distinguish the two types of autogamy, one has been termed simple autogamy and the other polynuclear autogamy. The latter may again be classified according to the number of nuclei involved, as trinuclear and tetranuclear autogamy. 6. The majority of cysts treated for 5 minutes in a 2 per cent solution of hydrochloric acid survives. 7. It was possible to demonstrate in vitro the developmental cycle of Entamœba tetragena. 8. No evidence of heterogamy has been observed in vitro in Entamœba tetragena or Entamœba coli. 9. The vegetative form of Entamœba tetragena, at a certain stage of its life cycle in vitro, shortly after its formation, has not only one or two, but may have as many as three or four nuclei. PMID:19868451
Amino acids derived from Titan tholins
NASA Technical Reports Server (NTRS)
Khare, B. N.; Sagan, C.; Ogino, H.; Nagy, B.; Er, C.; Schram, K. H.; Arakawa, E. T.
1986-01-01
An organic heteropolymer (Titan tholin) was produced by continuous dc discharge through a 0.9 N2/0.1 CH4 gas mixture at 0.2 mbar pressure, roughly simulating the cloudtop atmosphere of Titan. Treatment of this tholin with 6N HCl yielded 16 amino acids by gas chromatography after derivatization of N-trifluroacetyl isopropyl esters on two different capillary columns. Identifications were confirmed by GC/MS. Glycine, aspartic acid, and alpha- and beta-alanine were produced in greatest abundance; the total yield of amino acids was approximately 10(-2), approximately equal to the yield of urea. The presence of "nonbiological" amino acids, the absence of serine, and the fact that the amino acids are racemic within experimental error together indicate that these molecules are not due to microbial or other contamination, but are derived from the tholin. In addition to the HCN, HC2CN, and (CN)2 found by Voyager, nitriles and aminonitriles should be sought in the Titanian atmosphere and, eventually, amino acids on the surface. These results suggest that episodes of liquid water in the past or future of Titan might lead to major further steps in prebiological organic chemistry on that body.
A Tc-99m-labeled long chain fatty acid derivative for myocardial imaging.
Magata, Yasuhiro; Kawaguchi, Takayoshi; Ukon, Misa; Yamamura, Norio; Uehara, Tomoya; Ogawa, Kazuma; Arano, Yasushi; Temma, Takashi; Mukai, Takahiro; Tadamura, Eiji; Saji, Hideo
2004-01-01
C-11- and I-123-labeled long chain fatty acid derivatives have been reported as useful radiopharmaceuticals for the estimation of myocardial fatty acid metabolism. We have reported that Tc-99m-labeled N-[[[(2-mercaptoethyl)amino]carbonyl]methyl]-N-(2-mercaptoethyl)-6-aminohexanoic acid ([(99m)Tc]MAMA-HA), a medium chain fatty acid derivative, is metabolized by beta-oxidation in the liver and that the MAMA ligand is useful for attaching to the omega-position of fatty acid derivatives as a chelating group for Tc-99m. On the basis of these findings, we focused on developing a Tc-99m-labeled long chain fatty acid derivative that reflected fatty acid metabolism in the myocardium. In this study, we synthesized a dodecanoic acid derivative, MAMA-DA, and a hexadecanoic acid derivative, MAMA-HDA, and performed radiolabeling and biodistribution studies. [(99m)Tc]MAMA-DA and [(99m)Tc]MAMA-HDA were prepared using a ligand-exchange reaction. Biodistribution studies were carried out in normal mice and rats. Then, a high initial uptake of Tc-99m was observed, followed by a rapid clearance from the heart. The maximum heart/blood ratio was 3.6 at 2 min postinjection of [(99m)Tc]MAMA-HDA. These kinetics were similar to those with postinjection of p-[(125)I]iodophenylpentadecanoic acid. Metabolite analysis showed [(99m)Tc]MAMA-HDA was metabolized by beta-oxidation in the body. In conclusion, [(99m)Tc]MAMA-HDA is a promising compound as a long chain fatty acid analogue for estimating beta-oxidation of fatty acid in the heart.
Membrane extraction with thermodynamically unstable diphosphonic acid derivatives
Horwitz, Earl Philip; Gatrone, Ralph Carl; Nash, Kenneth LaVerne
1997-01-01
Thermodynamically-unstable complexing agents which are diphosphonic acids and diphosphonic acid derivatives (or sulphur containing analogs), like carboxyhydroxymethanediphosphonic acid and vinylidene-1,1-diphosphonic acid, are capable of complexing with metal ions, and especially metal ions in the II, III, IV, V and VI oxidation states, to form stable, water-soluble metal ion complexes in moderately alkaline to highly-acidic media. However, the complexing agents can be decomposed, under mild conditions, into non-organic compounds which, for many purposes are environmentally-nondamaging compounds thereby degrading the complex and releasing the metal ion for disposal or recovery. Uses for such complexing agents as well as methods for their manufacture are also described.
Individual bile acids have differential effects on bile acid signaling in mice
DOE Office of Scientific and Technical Information (OSTI.GOV)
Song, Peizhen, E-mail: songacad@gmail.com; Rockwell, Cheryl E., E-mail: rockwelc@msu.edu; Cui, Julia Yue, E-mail: juliacui@uw.edu
2015-02-15
Bile acids (BAs) are known to regulate BA synthesis and transport by the farnesoid X receptor in the liver (FXR-SHP) and intestine (FXR-Fgf15). However, the relative importance of individual BAs in regulating these processes is not known. Therefore, mice were fed various doses of five individual BAs, including cholic acid (CA), chenodeoxycholic acid (CDCA), deoxoycholic acid (DCA), lithocholic acid (LCA), and ursodeoxycholic acid (UDCA) in their diets at various concentrations for one week to increase the concentration of one BA in the enterohepatic circulation. The mRNA of BA synthesis and transporting genes in liver and ileum were quantified. In themore » liver, the mRNA of SHP, which is the prototypical target gene of FXR, increased in mice fed all concentrations of BAs. In the ileum, the mRNA of the intestinal FXR target gene Fgf15 was increased at lower doses and to a higher extent by CA and DCA than by CDCA and LCA. Cyp7a1, the rate-limiting enzyme in BA synthesis, was decreased more by CA and DCA than CDCA and LCA. Cyp8b1, the enzyme that 12-hydroxylates BAs and is thus responsible for the synthesis of CA, was decreased much more by CA and DCA than CDCA and LCA. Surprisingly, neither a decrease in the conjugated BA uptake transporter (Ntcp) nor increase in BA efflux transporter (Bsep) was observed by FXR activation, but an increase in the cholesterol efflux transporter (Abcg5/Abcg8) was observed with FXR activation. Thus in conclusion, CA and DCA are more potent FXR activators than CDCA and LCA when fed to mice, and thus they are more effective in decreasing the expression of the rate limiting gene in BA synthesis Cyp7a1 and the 12-hydroxylation of BAs Cyp8b1, and are also more effective in increasing the expression of Abcg5/Abcg8, which is responsible for biliary cholesterol excretion. However, feeding BAs do not alter the mRNA or protein levels of Ntcp or Bsep, suggesting that the uptake or efflux of BAs is not regulated by FXR at physiological and
Pseudoephedrine-Directed Asymmetric α-Arylation of α-Amino Acid Derivatives.
Atkinson, Rachel C; Fernández-Nieto, Fernando; Mas Roselló, Josep; Clayden, Jonathan
2015-07-27
Available α-amino acids undergo arylation at their α position in an enantioselective manner on treatment with base of N'-aryl urea derivatives ligated to pseudoephedrine as a chiral auxiliary. In situ silylation and enolization induces diastereoselective migration of the N'-aryl group to the α position of the amino acid, followed by ring closure to a hydantoin with concomitant explulsion of the recyclable auxiliary. The hydrolysis of the hydantoin products provides derivatives of quaternary amino acids. The arylation avoids the use of heavy-metal additives, and is successful with a range of amino acids and with aryl rings of varying electronic character. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Salicylic acid derivatives: synthesis, features and usage as therapeutic tools.
Ekinci, Deniz; Sentürk, Murat; Küfrevioğlu, Ömer İrfan
2011-12-01
In the field of medicinal chemistry, there is a growing interest in the use of small molecules. Although acetyl salicylic acid is well known for medical applications, little is known about other salicylic acid derivatives, and there is serious lack of data and information on the effects and biological evaluation that connect them. This review covers the synthesis and drug potencies of salicylic acid derivatives. After a brief overview of the information on salicylic acid and its features, a detailed review of salicylic acids as drugs and prodrugs, usage as cyclooxygenase inhibitors, properties in plants, synthesis and recent patents, is developed. Salicylic acid research is still an important area and innovations continue to arise, which offer hope for new therapeutics in related fields. It is anticipated that this review will guide the direction of long-term drug/nutraceutical safety trials and stimulate ideas for future research.
Wu, Xin-Jiang; Lu, Wen-qing; Roos, Peter H; Mersch-Sundermann, Volker
2005-10-15
Vinclozolin, a widely used fungicide, can be identified as a residue in numerous vegetable and fruit samples. To get insight in its genetic toxicity, we investigated the genotoxic effect of vinclozolin in the human derived hepatoma cell line HepG2 using the micronucleus (MN) assay. Additionally, to evaluate the co- or anti-mutagenic potency of vinclozolin, we treated HepG2 cells with different concentrations of vinclozolin for 24 h. Subsequently, the cells were exposed to benzo[a]pyrene (BaP) for 1h. Exposure of HepG2 cells to 50-400 microM vinclozolin alone did not cause any induction of micronuclei. However, a pronounced co-mutagenic effect was observed. MN frequencies caused by BaP increased by 30.6%, 52.8% and 65.3% after pretreatment of the cell cultures with 50, 100 and 200 microM vinclozolin, respectively. The highest concentration (400 microM) of vinclozolin tested caused cytotoxicity. Therefore, micronuclei were not considered for that concentration. To clarify the mechanism of cogenotoxicity, we assayed cytochrome P450 1A1 (CYP1A1), which plays a pivotal role in activation of BaP. Cells exposed to vinclozolin led to significant increase of CYP1A1 expression in Western blot. The result suggested that induction of CYP1A1 by vinclozolin account for its enhancing effect on genotoxicity caused by BaP.
Membrane extraction with thermodynamically unstable diphosphonic acid derivatives
Horwitz, E.P.; Gatrone, R.C.; Nash, K.L.
1997-10-14
Thermodynamically-unstable complexing agents which are diphosphonic acids and diphosphonic acid derivatives (or sulphur containing analogs), like carboxyhydroxymethanediphosphonic acid and vinylidene-1,1-diphosphonic acid, are capable of complexing with metal ions, and especially metal ions in the II, III, IV, V and VI oxidation states, to form stable, water-soluble metal ion complexes in moderately alkaline to highly-acidic media. However, the complexing agents can be decomposed, under mild conditions, into non-organic compounds which, for many purposes are environmentally-nondamaging compounds thereby degrading the complex and releasing the metal ion for disposal or recovery. Uses for such complexing agents as well as methods for their manufacture are also described. 1 fig.
Quest for steroidomimetics: Amino acids derived steroidal and nonsteroidal architectures.
Shagufta; Ahmad, Irshad; Panda, Gautam
2017-06-16
The chiral pool amino acids have been utilized for the construction of steroidal and non-steroidal architectures in the quest for steroidomimetics. Chirality derived from amino acid-based architectures provides new and easy to incorporate chiral chemical space, which is otherwise very difficult to introduce and comprised of several synthetic steps for asymmetric steroids. The different and exciting ligand-receptor interactions may arise from the use of each amino acid enantiomer that was introduced into the chiral steroidal backbone. The A and D rings of steroidal architectures can be mimicked by the phenyl group of the amino acid tyrosine. The Mitsunobu reaction, nucleophilic substitution and elimination, etc. were utilized for constructing diverse tri- and tetracyclic steroidal skeletons as well as benzofused seco-steroids from amino acids. These benzofused, amino acid-derived steroidal and nonsteroidal molecules had promising biological activity in hormonal related disorders. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Pyrrolidinones derived from (S)-pyroglutamic acid: penmacric acid and analogues.
Anwar, Muhammed; Bailey, Jonathan H; Dickinson, Laura C; Edwards, Hermia J; Goswami, Rajesh; Moloney, Mark G
2003-07-07
Alkylation reactions using alpha-halolactams or lactam enolates derived from bicyclic lactam templates can proceed with high endo- or exo- diastereoselectivity respectively. In the latter case, stereochemical correction by means of enolate generation and hindered phenol quench is possible with moderate efficiency. This protocol has been applied to the synthesis of protected penmacric acid and its analogues.
Acid-catalyzed rearrangements of flavans to novelbenzofuran derivatives
Richard W. Hemingway; Weiling Peng; Anthony H. Conner; Petrus J. Steynberg; Jan P. Steynberg
1998-01-01
The objective of this work was to define reactions that occur when proanthocyanidins and their derivatives are reacted in the presence of acid catalysts. Pure compounds (either as the free phenols, the methyl ether, or the methyl ether-acetate derivatives) were isolated by a variety of chromatographic methods. Proof of their structure was based mainly on 2D-NMR, as...
Quality improvement of acidic soils by biochar derived from renewable materials.
Moon, Deok Hyun; Hwang, Inseong; Chang, Yoon-Young; Koutsospyros, Agamemnon; Cheong, Kyung Hoon; Ji, Won Hyun; Park, Jeong-Hun
2017-02-01
Biochar derived from waste plant materials and agricultural residues was used to improve the quality of an acidic soil. The acidic soil was treated for 1 month with both soy bean stover-derived biochar and oak-derived biochar in the range of 1 to 5 wt% for pH improvement and exchangeable cation enhancement. Following 1 month of treatment, the soil pH was monitored and exchangeable cations were measured. Moreover, a maize growth experiment was performed for 14 days with selected treated soil samples to confirm the effectiveness of the treatment. The results showed that the pH of the treated acidic soil increased by more than 2 units, and the exchangeable cation values were greatly enhanced upon treatment with 5 wt% of both biochars, after 1 month of curing. Maize growth was superior in the 3 wt% biochar-treated samples compared to the control sample. The presented results demonstrate the effective use of biochar derived from renewable materials such as waste plant materials and agricultural residues for quality improvement of acidic soils.
Insecticidal peptides from the theraposid spider Brachypelma albiceps: an NMR-based model of Ba2.
Corzo, Gerardo; Bernard, Cedric; Clement, Herlinda; Villegas, Elba; Bosmans, Frank; Tytgat, Jan; Possani, Lourival D; Darbon, Herve; Alagón, Alejandro
2009-08-01
Soluble venom and purified fractions of the theraposid spider Brachypelma albiceps were screened for insecticidal peptides based on toxicity to crickets. Two insecticidal peptides, named Ba1 and Ba2, were obtained after the soluble venom was separated by high performance liquid chromatography and cation exchange chromatography. The two insecticidal peptides contain 39 amino acid residues and three disulfide bonds, and based on their amino acid sequence, they are highly identical to the insecticidal peptides from the theraposid spiders Aphonopelma sp. from the USA and Haplopelma huwenum from China indicating a relationship among these genera. Although Ba1 and Ba2 were not able to modify currents in insect and vertebrate cloned voltage-gated sodium ion channels, they have noteworthy insecticidal activities compared to classical arachnid insecticidal toxins indicating that they might target unknown receptors in insect species. The most abundant insecticidal peptide Ba2 was submitted to NMR spectroscopy to determine its 3-D structure; a remarkable characteristic of Ba2 is a cluster of basic residues, which might be important for receptor recognition.
Gao, Xiaohui; Tang, Jingjing; Liu, Haoran; Liu, Linbo; Kang, Lu; Chen, Wen
2018-12-01
In the present investigation, 48 new tertiary amine derivatives of cinnamic acid, phenylpropionic acid, sorbic acid and hexanoic acid (4d-6g, 10d-12g, 16d-18g and 22d-24g) were designed, synthesized and evaluated for the effect on AChE and BChE in vitro. The results revealed that the alteration of aminoalkyl types and substituted positions markedly influences the effects in inhibiting AChE. Almost of all cinnamic acid derivatives had the most potent inhibitory activity than that of other acid derivatives with the same aminoalkyl side chain. Unsaturated bond and benzene ring in cinnamic acid scaffold seems important for the inhibitory activity against AChE. Among them, compound 6g revealed the most potent AChE inhibitory activity (IC 50 value: 3.64 µmol/L) and highest selectivity over BChE (ratio: 28.6). Enzyme kinetic study showed that it present a mixed-type inhibition against AChE. The molecular docking study suggested that it can bind with the catalytic site and peripheral site of AChE.
Zhao, Cindy J; Schieber, Andreas; Gänzle, Michael G
2016-11-01
Fermented foods are valued for their rich and complex odour and taste. The metabolic activity of food-fermenting microorganisms determines food quality and generates odour and taste compounds. This communication reviews the formation of taste-active amino acids, amino acid derivatives and peptides in food fermentations. Pathways of the generation of taste compounds are presented for soy sauce, cheese, fermented meats, and bread. Proteolysis or autolysis during food fermentations generates taste-active amino acids and peptides; peptides derived from proteolysis particularly impart umami taste (e.g. α-glutamyl peptides) or bitter taste (e.g. hydrophobic peptides containing proline). Taste active peptide derivatives include pyroglutamyl peptides, γ-glutamyl peptides, and succinyl- or lactoyl amino acids. The influence of fermentation microbiota on proteolysis, and peptide hydrolysis, and the metabolism of glutamate and arginine is well understood, however, the understanding of microbial metabolic activities related to the formation of taste-active peptide derivatives is incomplete. Improved knowledge of the interactions between taste-active compounds will enable the development of novel fermentation strategies to develop tastier, less bitter, and low-salt food products, and may provide novel and "clean label" ingredients to improve the taste of other food products. Copyright © 2016 Elsevier Ltd. All rights reserved.
A Novel Ellagic Acid Derivative from Desbordesia glaucescens.
DongmoMafodong, Faustine L; Tsopmo, Apollinaire; Awouafack, Maurice D; Roland, Tchuenguem T; Dzoyem, Jean P; Tane, Pierre
2015-10-01
One novel ellagic acid derivative, desglauside (1), was isolated from the leaves of Desbordesia glaucescens together with three known compounds [3',4'-di-O-methylellagic acid (2), oleanolic acid (3) and β-sitosterol-3-O-β-D-glucopyranoside (4)]. Their structures were elucidated on the basis of NMR spectroscopic and MS analysis, and by comparison with related published data. The crude extract, fractions and isolated compounds showed no activity against four yeast strains [Candida albicans (ATCC 9002), C. parapsilopsis (ATCC22019), C. tropicalis (ATCC750), Cryptococcus neoformans (IP95026) and one isolate of Candida guilliermondii].
Modulation by glycyrrhetinic acid derivatives of TPA-induced mouse ear oedema.
Inoue, H.; Mori, T.; Shibata, S.; Koshihara, Y.
1989-01-01
1. The anti-inflammatory effects of glycyrrhetinic acid and its derivatives on TPA (12-O-tetradecanoylphorbol-13-acetate)-induced mouse ear oedema were studied. The mechanisms of TPA-induced ear oedema were first investigated with respect to the chemical mediators. 2. The formation of ear oedema reached a maximum 5 h after TPA application (2 micrograms per ear) and the prostaglandin E2 (PGE2) production of mouse ear increased with the oedema formation. 3. TPA-induced ear oedema was prevented by actinomycin D and cycloheximide (0.1 mg per ear, respectively) when applied during 60 min after TPA treatment. 4. Of glycyrrhetinic acid derivatives examined, dihemiphthalate derivatives (IIe, IIe', IIIa, IIIa', IVa, IVa') most strongly inhibited ear oedema on both topical (ID50, 1.6 mg per ear for IIe, 2.0 mg per ear for IIIa and 1.6 mg per ear for IVa) and oral (ID50, 88 mg kg-1 for IIe', 130 mg kg-1 for IIIa' and 92 mg kg-1 for IVa') administration. 5. Glycyrrhetinic acid (Ia) and its derivatives applied 30 min before TPA treatment were much more effective in inhibiting oedema than when applied 30 min after TPA. A dihemiphthalate of triterpenoid compound IVa completely inhibited oedema, even when applied 3 h before TPA treatment. 6. Glycyrrhetinic acid (Ia) and deoxoglycyrrhetol (IIa), the parent compounds, produced little inhibition by oral administration at less than 200 mg kg-1. 7. These results suggest that the dihemiphthalate derivatives of triterpenes derived from glycyrrhetinic acid by chemical modification are useful for the treatment of skin inflammation by both topical and oral application. PMID:2924072
NASA Astrophysics Data System (ADS)
Özdemir (nee Güngör), Özlem; Gürkan, Perihan; Özçelik, Berrin; Oyardı, Özlem
2016-02-01
Novel β-lactam derivatives (1c-3c) (1d-3d) were produced by using 6-aminopenicillanic acid (6-APA), 7-aminocephalosporanic acid (7-ACA) and the higher amino acid Schiff bases. The synthesized compounds were characterized by elemental analysis, IR, 1H/13C NMR and UV-vis spectra. Antibacterial activities of all the higher amino acid Schiff bases (1a-3a) (1b-3b) and β-lactam derivatives were screened against three gram negative bacteria (Escherichia coli ATCC 25922, Pseudomonas aeruginosa ATCC 27853, Acinetobacter baumannii RSKK 02026), three gram positive bacteria (Staphylococcus aureus ATCC 25923, Enterococcus faecalis ATCC 07005, Bacillus subtilis ATCC 6633) and their drug-resistant isolates by using broth microdilution method. Two fungi (Candida albicans and Candida krusei) were used for antifungal activity.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Halake, Shobha; Ok, Kang Min, E-mail: kmok@cau.ac.kr
2015-11-15
Single crystals of two barium-organic framework materials, Ba(SBA)(DMF){sub 4} (CAUMOF-15) and Ba{sub 2}(BTEC)(H{sub 2}O) (CAUMOF-16), have been grown through solvothermal reactions (H{sub 2}SBA=4,4′-sulfonyldibenzoic acid and H{sub 4}BTEC=1,2,4,5-benzenetetracarboxylic acid). The crystal structures of the reported frameworks have been determined by single-crystal X-ray diffraction. The materials have been fully characterized by powder X-ray diffraction (PXRD), elemental analyses, Infrared (IR) spectroscopy, and thermogravimetric analyses (TGA). CAUMOF-15 reveals a three-dimensional open-framework that comprises of an inorganic motif with one-dimensional chains and the SBA linkers. CAUMOF-16 shows another three-dimensional backbone consisting of layers of edge-shared BaO{sub 9} and BaO{sub 10} polyhedra, and BTEC pillars. Bothmore » of the 3D frameworks exhibit relatively high thermal stabilities. The PXRD and IR spectral data confirm that CAUMOF-15 and CAUMOF-16 reveal reversible coordinations of the respective solvent molecules, DMF and H{sub 2}O. Gas adsorption properties towards nitrogen, hydrogen, and carbon dioxide have been also investigated. - Graphical abstract: Crystals of two new barium-organic frameworks, Ba(SBA)(DMF){sub 4} and Ba{sub 2}(BTEC)(H{sub 2}O), exhibiting a differential gas adsorption, a high thermal stability, and a reversible coordination of solvent molecules have been grown. - Highlights: • Crystals of two new 3D Ba-MOFs are grown. • The two Ba-MOFs reveal very high thermal stabilities up to ca. 400 °C. • Ba(SBA)(DMF){sub 4} exhibits differential gas adsorption properties. • The two Ba-MOFs show reversible coordination of the solvent molecules.« less
HYPERSENSITIVITY TO PENICILLENIC ACID DERIVATIVES IN HUMAN BEINGS WITH PENICILLIN ALLERGY
Parker, Charles W.; Shapiro, Jack; Kern, Milton; Eisen, Herman N.
1962-01-01
Multifunctional derivatives of penicillenic acid are effective elicitors of wheal-and-erythema skin responses in humans allergic to penicillin. Of the effective derivatives, penicilloyl-polylysines are particularly attractive as skin test reagents because they appear to be incapable of inducing antibody formation. The skin responses are specifically inhibitable in most instances by homologous unifunctional haptens. The penicillenic acid derivatives which appear to be determinants of human allergic reactions to penicillin are: penicilloyl, penicillenate, and groups of the penamaldate-penilloaldehyde type. Of these, the most significant appears to be the penicilloyl-lysyl determinant. PMID:14483916
Decay resistance of wood treated with boric acid and tall oil derivates.
Temiz, Ali; Alfredsen, Gry; Eikenes, Morten; Terziev, Nasko
2008-05-01
In this study, the effect of two boric acid concentrations (1% and 2%) and four derivates of tall oil with varying chemical composition were tested separately and in combination. The tall oil derivates were chosen in a way that they consist of different amounts of free fatty, resin acids and neutral compounds. Decay tests using two brown rot fungi (Postia placenta and Coniophora puteana) were performed on both unleached and leached test samples. Boric acid showed a low weight loss in test samples when exposed to fungal decay before leaching, but no effect after leaching. The tall oil derivates gave better efficacy against decay fungi compared to control, but are not within the range of the efficacy needed for a wood preservative. Double impregnation with boric acid and tall oil derivates gave synergistic effects for several of the double treatments both in unleached and leached samples. In the unleached samples the double treatment gave a better efficacy against decay fungi than tall oil alone. In leached samples a better efficacy against brown rot fungi were achieved than in samples with boron alone and a nearly similar or better efficacy than for tall oil alone. Boric acid at 2% concentration combined with the tall oil derivate consisting of 90% free resin acids (TO-III) showed the best performance against the two decay fungi with a weight loss less than 3% after a modified pure culture test.
Takebayashi, Jun; Kaji, Hiroaki; Ichiyama, Kenji; Makino, Kazutaka; Gohda, Eiichi; Yamamoto, Itaru; Tai, Akihiro
2007-10-15
Inhibitory effects of 2-O-substituted ascorbic acid derivatives, ascorbic acid 2-glucoside (AA-2G), ascorbic acid 2-phosphate (AA-2P), and ascorbic acid 2-sulfate (AA-2S), on 2,2'-azobis(2-amidinopropane) dihydrochloride (AAPH)-induced oxidative hemolysis of sheep erythrocytes were studied and were compared with those of ascorbic acid (AA) and other antioxidants. The order of the inhibition efficiency was AA-2S> or =Trolox=uric acid> or =AA-2P> or =AA-2G=AA>glutathione. Although the reactivity of the AA derivatives against AAPH-derived peroxyl radical (ROO(*)) was much lower than that of AA, the derivatives exerted equal or more potent protective effects on AAPH-induced hemolysis and membrane protein oxidation. In addition, the AA derivatives were found to react per se with ROO(*), not via AA as an intermediate. These findings suggest that secondary reactions between the AA derivative radical and ROO(*) play a part in hemolysis inhibition. Delayed addition of the AA derivatives after AAPH-induced oxidation of erythrocytes had already proceeded showed weaker inhibition of hemolysis compared to that of AA. These results suggest that the AA derivatives per se act as biologically effective antioxidants under moderate oxidative stress and that AA-2G and AA-2P may be able to act under severe oxidative stress after enzymatic conversion to AA in vivo.
Extracting metal ions with diphosphonic acid, or derivative thereof
Horwitz, Earl P.; Gatrone, Ralph C.; Nash, Kenneth L.
1994-01-01
Thermodynamically-unstable complexing agents which are diphosphonic acids and diphosphonic acid derivatives (or sulphur containing analogs), like carboxyhydroxymethanediphosphonic acid and vinylidene-1,1-diphosphonic acid, are capable of complexing with metal ions, and especially metal ions in the II, III, IV, V and VI oxidation states, to form stable, water-soluble metal ion complexes in moderately alkaline to highly-acidic media. However, the complexing agents can be decomposed, under mild conditions, into non-organic compounds which, for many purposes are environmentally-nondamaging compounds thereby degrading the complex and releasing the metal ion for disposal or recovery. Uses for such complexing agents as well as methods for their manufacture are also described.
Code of Federal Regulations, 2014 CFR
2014-07-01
... coupled with naphthalene sulfonic acid derivative, nickel complex, alkaline salt (generic). 721.10045... derivative, nickel complex, alkaline salt (generic). (a) Chemical substance and significant new uses subject... heteromonocycle coupled with naphthalene sulfonic acid derivative, nickel complex, alkaline salt (PMN P-02-737) is...
Code of Federal Regulations, 2011 CFR
2011-07-01
... coupled with naphthalene sulfonic acid derivative, nickel complex, alkaline salt (generic). 721.10045... derivative, nickel complex, alkaline salt (generic). (a) Chemical substance and significant new uses subject... heteromonocycle coupled with naphthalene sulfonic acid derivative, nickel complex, alkaline salt (PMN P-02-737) is...
Code of Federal Regulations, 2013 CFR
2013-07-01
... coupled with naphthalene sulfonic acid derivative, nickel complex, alkaline salt (generic). 721.10045... derivative, nickel complex, alkaline salt (generic). (a) Chemical substance and significant new uses subject... heteromonocycle coupled with naphthalene sulfonic acid derivative, nickel complex, alkaline salt (PMN P-02-737) is...
Code of Federal Regulations, 2010 CFR
2010-07-01
... coupled with naphthalene sulfonic acid derivative, nickel complex, alkaline salt (generic). 721.10045... derivative, nickel complex, alkaline salt (generic). (a) Chemical substance and significant new uses subject... heteromonocycle coupled with naphthalene sulfonic acid derivative, nickel complex, alkaline salt (PMN P-02-737) is...
Code of Federal Regulations, 2012 CFR
2012-07-01
... coupled with naphthalene sulfonic acid derivative, nickel complex, alkaline salt (generic). 721.10045... derivative, nickel complex, alkaline salt (generic). (a) Chemical substance and significant new uses subject... heteromonocycle coupled with naphthalene sulfonic acid derivative, nickel complex, alkaline salt (PMN P-02-737) is...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gilkey, Matthew J.; Balakumar, Rachana; Vlachos, Dionisios G.
We recently reported biomass-derived tetrahydrofuran-2,5-dicarboxylic acid (THFDCA) as a potential renewable feedstock for adipic acid (AA) production by combining HI and molecular H 2 in organic acid solvents.
Gilkey, Matthew J.; Balakumar, Rachana; Vlachos, Dionisios G.; ...
2018-01-01
We recently reported biomass-derived tetrahydrofuran-2,5-dicarboxylic acid (THFDCA) as a potential renewable feedstock for adipic acid (AA) production by combining HI and molecular H 2 in organic acid solvents.
USDA-ARS?s Scientific Manuscript database
6-Nonadecynoic acid (6-NDA), a plant-derived acetylenic acid, exhibits strong inhibitory activity against the human fungal pathogens Candida albicans, Aspergillus fumigatus, and Trichophyton mentagrophytes. In the present study, transcriptional profiling coupled with mutant and biochemical analyses...
Caffeic Acid Derivatives in Dried Lamiaceae and Echinacea purpurea Products
USDA-ARS?s Scientific Manuscript database
The concentrations of caffeic acid derivatives within Lamiaceae and Echinacea (herb, spice, tea, and dietary supplement forms) readily available in the U.S. marketplace (n=72) were determined. After the first identification of chicoric acid in Ocimum basilicum (basil), the extent to which chicoric a...
Extracting metal ions with diphosphonic acid, or derivative thereof
Horwitz, E.P.; Gatrone, R.C.; Nash, K.L.
1994-07-26
Thermodynamically-unstable complexing agents which are diphosphonic acids and diphosphonic acid derivatives (or sulfur containing analogs), like carboxyhydroxymethanediphosphonic acid and vinylidene-1,1-diphosphonic acid, are capable of complexing with metal ions, and especially metal ions in the II, III, IV, V and VI oxidation states, to form stable, water-soluble metal ion complexes in moderately alkaline to highly-acidic media. However, the complexing agents can be decomposed, under mild conditions, into non-organic compounds which, for many purposes are environmentally-nondamaging compounds thereby degrading the complex and releasing the metal ion for disposal or recovery. Uses for such complexing agents as well as methods for their manufacture are also described. 1 fig.
[Stereoselective synthesis of polyhydroxylated amines using (S)-pyroglutamic acid derivatives].
Ikota, Nobuo
2014-01-01
Naturally occurring polyhydroxylated amines such as (+)-1-deoxynojirimycin, polyoxamic acid, anisomycin, (-)swainsonine, and alexine stereoisomers, which have interesting biological activities including glucosidase- and mannosidase-inhibitory activity, immunoregulatory activity, and antibacterial effects, were synthesized stereoselectively starting from (S)-pyroglutamic acid derivatives. α,β-Unsaturated lactams ((S)-5-hydroxymethyl-2-oxo-3-pyrroline derivatives), α,β-unsaturated δ-lactone ((S)-4-amino-2-penten-5-olide derivative), and E-olefin ((S,E)-methyl-4-amino-5-hydroxypent-2-enoate derivative) from (S)-pyroglutamic acid derivatives were dihydroxylated using OsO4 in the presence of N-methyl morpholine N-oxide (NMO) to afford various chiral building blocks with different configurations. The stereoselectivity of cis-dihydroxylation for α,β-unsaturated lactams and α,β-unsaturated δ-lactone was very high, while the stereoselectivity was low for E-olefin. Therefore, the double asymmetric induction of E-olefin using K2OsO4 with chiral ligands was successively applied to yield high stereoselectivity. (2R,3S)-2-Hydroxymethyl-3-hydroxypyrrolidine and Gaissman-Weiss lactone, important intermediates for the preparation of pyrrolizidine alkaloids, were synthesized from a (3R,4R,5R)-3,4-dihydroxy-5-hydroxymethyl-2-pyrrolidinone derivative derived from α,β-unsatulated lactam. (+)-1-Deoxynojirimycin was synthesized from a (2S,3R,4R)-methyl 4-amino-2,3,5-trihydroxypentanoate derivative of E-olefin. (-)-Swainsonine and its stereoisomers were synthesized from (2R,3S,4R)- or (2R,3R,4R)-2-hydroxymethyl-3,4-dihydroxypyrrolidine derivatives of α,β-unsaturated δ-lactone or α,β-unsaturated lactam. The key reaction was diastereoselective allylation of the aldehyde derived from the corresponding 2-hydroxymethylpyrrolidine derivatives with various allylation reagents. The high diastereoselectivity could be explained by cyclic chelate formation between metals and the
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nasir, Navida; Grytsiv, Andriy; Melnychenko-Koblyuk, Nataliya
2010-10-15
Three series of vacancy-free quaternary clathrates of type I, Ba{sub 8}Zn{sub x}Ge{sub 46-x-y}Si{sub y}, Ba{sub 8}(Zn,Cu){sub x}Ge{sub 46-x}, and Ba{sub 8}(Zn,Pd){sub x}Ge{sub 46-x}, have been prepared by reactions of elemental ingots in vacuum sealed quartz at 800 {sup o}C. In all cases cubic primitive symmetry (space group Pm3n, a{approx}1.1 nm) was confirmed for the clathrate phase by X-ray powder diffraction and X-ray single crystal analyses. The lattice parameters show a linear increase with increase in Ge for Ba{sub 8}Zn{sub x}Ge{sub 46-x-y}Si{sub y}. M atoms (Zn, Pd, Cu) preferably occupy the 6d site in random mixtures. No defects were observed formore » the 6d site. Site preference of Ge and Si in Ba{sub 8}Zn{sub x}Ge{sub 46-x-y}Si{sub y} has been elucidated from X-ray refinement: Ge atoms linearly substitute Si in the 24k site whilst a significant deviation from linearity is observed for occupation of the 16i site. A connectivity scheme for the phase equilibria in the 'Ba{sub 8}Ge{sub 46}' corner at 800 {sup o}C has been derived and a three-dimensional isothermal section at 800 {sup o}C is presented for the Ba-Pd-Zn-Ge system. Studies of transport properties carried out for Ba{sub 8{l_brace}}Cu,Pd,Zn{r_brace}{sub x}Ge{sub 46-x} and Ba{sub 8}Zn{sub x}Si{sub y}Ge{sub 46-x-y} evidenced predominantly electrons as charge carriers and the closeness of the systems to a metal-to-insulator transition, fine-tuned by substitution and mechanical processing of starting material Ba{sub 8}Ge{sub 43}. A promising figure of merit, ZT {approx}0.45 at 750 K, has been derived for Ba{sub 8}Zn{sub 7.4}Ge{sub 19.8}Si{sub 18.8}, where pricey germanium is exchanged by reasonably cheap silicon. - Graphical abstract: Quaternary phase diagram of Ba-Pd-Zn-Ge system at 800 {sup o}C.« less
Gamaleldin Elsadig Karar, Mohamed; Matei, Marius-Febi; Jaiswal, Rakesh; Illenberger, Susanne; Kuhnert, Nikolai
2016-04-01
Plants rich in chlorogenic acids (CGAs), caffeic acids and their derivatives have been found to exert antiviral effects against influenza virus neuroaminidase. In this study several dietary naturally occurring chlorogenic acids, phenolic acids and derivatives were screened for their inhibitory activity against neuroaminidases (NAs) from C. perfringens, H5N1 and recombinant H5N1 (N-His)-Tag using a fluorometric assay. There was no significant difference in inhibition between the different NA enzymes. The enzyme inhibition results indicated that chlorogenic acids and selected derivatives, exhibited high activities against NAs. It seems that the catechol group from caffeic acid was important for the activity. Dietary CGA therefore show promise as potential antiviral agents. However, caffeoyl quinic acids show low bioavailibility and are intensly metabolized by the gut micro flora, only low nM concentrations are observed in plasma and urine, therefore a systemic antiviral effect of these compounds is unlikely. Nevertheless, gut floral metabolites with a catechol moiety or structurally related dietary phenolics with a catechol moiety might serve as interesting compounds for future investigations.
Lorenzo, Daniel A; Forrest, Sebastian J K; Sparkes, Hazel A
2016-02-01
A number of hydrogen-bonded co-crystals, consisting of a cinnamic acid derivative and a pyridyl co-crystallizer, have been synthesized and their properties investigated by X-ray diffraction. Samples were prepared by recrystallization or solvent drop grinding of trans-cinnamic acid (1), 4-methylcinnamic acid (2), 4-methoxy cinnamic acid (3) or 3,4-methoxy cinnamic acid (4), with 4,4-dipyridyl (A), iso-nicotinamide (B) or nicotinamide (C). The X-ray single-crystal structures of seven novel co-crystals, obtained through recrystallization, are examined and the hydrogen-bonding interactions discussed. Consistent hydrogen-bonding motifs were observed for samples prepared when using 4,4-dipyridyl (A) or iso-nicotinamide (B) as the co-crystallizing agent. Powder X-ray diffraction analysis of the samples prepared by solvent drop grinding suggests the formation of ten co-crystals.
Aristolic Acid Derivatives from the Bark of Antidesma ghaesembilla.
Schäfer, Sibylle; Schwaiger, Stefan; Stuppner, Hermann
2017-08-01
Antidesma ghaesembilla is an important medicinal and food plant in many Asian countries. Ten substances could be isolated from the dichloromethane and methanol extract: sitostenone ( 3 ), daucosterol ( 4 ), chavibetol ( 5 ), asperphenamate ( 6 ), protocatechuic acid ( 7 ), vanillic acid-4- O - β -D-glucoside ( 8 ), 1- O - β -D-glucopyranosyl-3- O -methyl-phloroglucinol ( 9 ), and aristolic acid II-8- O - β -D-glucoside ( 10 ), and two new aristolic acid derivatives, 10-amino-5,7-dimethoxy-aristolic acid II (= 6-amino-9,11-dimethoxyphenanthro[3,4- d ]-1,3-dioxole-5-carboxylic acid; 1 ) and 5,7-dimethoxy-aristolochic acid II (= 9,11-dimethoxy-6-nitrophenantro[3,4- d ]-1,3-dioxole-5-carboxylic acid; 2 ). Exposure to humans of some of these compounds is associated with a severe disease today known as aristolochic acid nephropathy. Therefore, the traditional usage of this plant has to be reconsidered carefully. Georg Thieme Verlag KG Stuttgart · New York.
Towards Tartaric-Acid-Derived Asymmetric Organocatalysts
Gratzer, Katharina; Gururaja, Guddeangadi N; Waser, Mario
2013-01-01
Tartaric acid is one of the most prominent naturally occurring chiral compounds. Whereas its application in the production of chiral ligands for metal-catalysed reactions has been exhaustively investigated, its potential to provide new organocatalysts has been less extensively explored. Nevertheless, some impressive results, such as the use of TADDOLs as chiral H-bonding catalysts or of tartrate-derived asymmetric quaternary ammonium salt catalysts, have been reported over the last decade. The goal of this article is to provide a representative overview of the potential and the limitations of tartaric acid or TADDOLs in the creation of new organocatalysts and to highlight some of the most spectacular applications of these catalysts, as well as to summarize case studies in which other classes of chiral backbones were better suited. PMID:24194674
Chen, Hongxia; Lee, Minsu; Lee, Jaebeom; Kim, Jae-Ho; Gal, Yeong-Soon; Hwang, Yoon-Hwae; An, Won Gun; Koh, Kwangnak
2007-01-01
We designed and synthesized phenylboronic acid as a molecular recognition model system for saccharide detection. The phenylboronic acid derivatives that have boronic acid moiety are well known to interact with saccharides in aqueous solution; thus, they can be applied to a functional interface of saccharide sensing through the formation of self-assembled monolayer (SAM). In this study, self-assembled phenylboronic acid derivative monolayers were formed on Au surface and carefully characterized by atomic force microscopy (AFM), Fourier transform infrared reflection absorption spectroscopy (FTIR-RAS), surface enhanced Raman spectroscopy (SERS), and surface electrochemical measurements. The saccharide sensing application was investigated using surface plasmon resonance (SPR) spectroscopy. The phenylboronic acid monolayers showed good sensitivity of monosaccharide sensing even at the low concentration range (1.0 × 10−12 M). The SPR angle shift derived from interaction between phenylboronic acid and monosaccharide was increased with increasing the alkyl spacer length of synthesized phenylboronic acid derivatives.
RNA:DNA Ratio and Other Nucleic Acid Derived Indices in Marine Ecology
Chícharo, Maria Alexandra; Chícharo, Luis
2008-01-01
Some of most used indicators in marine ecology are nucleic acid-derived indices. They can be divided by target levels in three groups: 1) at the organism level as ecophysiologic indicators, indicators such as RNA:DNA ratios, DNA:dry weight and RNA:protein, 2) at the population level, indicators such as growth rate, starvation incidence or fisheries impact indicators, and 3) at the community level, indicators such as trophic interactions, exergy indices and prey identification. The nucleic acids derived indices, especially RNA:DNA ratio, have been applied with success as indicators of nutritional condition, well been and growth in marine organisms. They are also useful as indicators of natural or anthropogenic impacts in marine population and communities, such as upwelling or dredge fisheries, respectively. They can help in understanding important issues of marine ecology such as trophic interactions in marine environment, fish and invertebrate recruitment failure and biodiversity changes, without laborious work of counting, measuring and identification of small marine organisms. Besides the objective of integrate nucleic acid derived indices across levels of organization, the paper will also include a general characterization of most used nucleic acid derived indices in marine ecology and also advantages and limitations of them. We can conclude that using indicators, such RNA:DNA ratios and other nucleic acids derived indices concomitantly with organism and ecosystems measures of responses to climate change (distribution, abundance, activity, metabolic rate, survival) will allow for the development of more rigorous and realistic predictions of the effects of anthropogenic climate change on marine systems. PMID:19325815
Synthesis and Hydrolytic Degradation of Substituted Poly(DL-Lactic Acid)s
Tsuji, Hideto; Eto, Takehiko; Sakamoto, Yuzuru
2011-01-01
Non-substituted racemic poly(DL-lactic acid) (PLA) and substituted racemic poly(DL-lactic acid)s or poly(DL-2-hydroxyalkanoic acid)s with different side-chain lengths, i.e., poly(DL-2-hydroxybutanoic acid) (PBA), poly(DL-2-hydroxyhexanoic acid) (PHA), and poly(DL-2-hydroxydecanoic acid) (PDA) were synthesized by acid-catalyzed polycondensation of DL-lactic acid (LA), DL-2-hydroxybutanoic acid (BA), DL-2-hydroxyhexanoic acid (HA), and DL-2-hydroxydecanoic acid (DA), respectively. The hydrolytic degradation behavior was investigated in phosphate-buffered solution at 80 and 37 °C by gravimetry and gel permeation chromatography. It was found that the reactivity of monomers during polycondensation as monitored by the degree of polymerization (DP) decreased in the following order: LA > DA > BA > HA. The hydrolytic degradation rate traced by DP and weight loss at 80 °C decreased in the following order: PLA > PDA > PHA > PBA and that monitored by DP at 37 °C decreased in the following order: PLA > PDA > PBA > PHA. LA and PLA had the highest reactivity during polymerization and hydrolytic degradation rate, respectively, and were followed by DA and PDA. BA, HA, PBA, and PHA had the lowest reactivity during polymerization and hydrolytic degradation rate. The findings of the present study strongly suggest that inter-chain interactions play a major role in the reactivity of non-substituted and substituted LA monomers and degradation rate of the non-substituted and substituted PLA, along with steric hindrance of the side chains as can be expected. PMID:28824149
Salih, Nabaz; Adams, Harry; Jackson, Richard F W
2016-09-16
A range of 7-oxo, 8-oxo, and 9-oxo amino acids, analogues of 8-oxo-2-aminodecanoic acid, one of the key components of the cyclic tetrapeptide apicidin, have been prepared by a three-step process involving copper-catalyzed allylation of serine-, aspartic acid-, and glutamic acid-derived organozinc reagents, followed by cross-metathesis of the resulting terminal alkenes with unsaturated ketones and hydrogenation. The intermediate 7-oxo-5-enones underwent a highly diastereoselective (dr ≥96:4) acid-catalyzed aza-Michael reaction to give trans-2,5-disubstituted pyrrolidines, 5-substituted proline derivatives. The aza-Michael reaction was first observed when the starting enones were allowed to stand in solution in deuterochloroform but can be efficiently promoted by catalytic amounts of dry HCl.
Baba, M; Schols, D; Nakashima, H; Pauwels, R; Parmentier, G; Meijer, D K; De Clercq, E
1989-01-01
Several cholic acid derivatives such as taurolithocholic acid, lithocholic acid 3-sulfate, taurolithocholic acid 3-sulfate, and glycolithocholic acid 3-sulfate were shown to inhibit selectively the replication of human immunodeficiency virus type 1 (HIV-1) in vitro. These compounds completely protected MT-4 cells against HIV-1-induced cytopathogenicity at a concentration of 100 micrograms/ml, whereas no toxicity for the host cells was observed at 200 micrograms/ml. They also inhibited HIV-1 antigen expression in HIV-1-infected CEM cells. The bile acids (cholic acid, deoxycholic acid, chenodeoxycholic acid, and lithocholic acid) did not show any inhibitory effect on HIV-1 replication at concentrations that were not toxic to the host (MT-4) cells. From a structure-function analysis of a number of cholic acid derivatives, the presence of either a sulfonate (as in the tauro conjugates) or a sulfate group as well as the "litho" configuration appeared to be necessary for the expression of anti-HIV-1 activity. The active cholic acid derivatives did not directly inactivate the virus particles at the concentrations that were not toxic to the host cells. Lithocholic acid 3-sulfate, taurolithocholic acid 3-sulfate, and glycolithocholic acid 3-sulfate, but not taurolithocholic acid, partially inhibited virus adsorption to MT-4 cells. These three compounds were also inhibitory to the reverse transcriptase activity associated with HIV-1.
Microwave-induced facile synthesis of water-soluble fluorogenic alginic acid derivatives.
Chhatbar, Mahesh U; Meena, Ramavatar; Prasad, Kamalesh; Chejara, Dharmesh R; Siddhanta, A K
2011-04-01
A facile microwave-induced method was developed for synthesizing water-soluble fluorescent derivatives of alginic acid (ALG) with four different diamines, hydrazine (HY), ethylenediamine (EDA), 1,6-hexanediamine (HDA), and 1,4-cyclohexanediamine (CHDA), followed by a cross-linking reaction with a natural cross linker genipin. The ethylenediamine derivative of alginic acid (ALG-EDA) exhibited good fluorescent activity, which upon cross linking was enhanced threefold. The other amide derivatives, for example, ALG-HY, ALG-HDA, and ALG-CHDA, were not fluorescent, but their respective crosslinked products exhibited excellent fluorescent activity. The fluorescence intensity had an inverse correlation with the number of carbon atoms present in the amine, which in turn was a function of degree of substitution (DS). These fluorescent polysaccharide derivatives are of potential utility in the domain of sensor applications. Copyright © 2011 Elsevier Ltd. All rights reserved.
Lee, Yeonmi; Yoshitsugu, Reika; Kikuchi, Keidai; Joe, Ga-Hyun; Tsuji, Misaki; Nose, Takuma; Shimizu, Hidehisa; Hara, Hiroshi; Minamida, Kimiko; Miwa, Kazunori; Ishizuka, Satoshi
2016-08-01
Intestinal bacteria are involved in bile acid (BA) deconjugation and/or dehydroxylation and are responsible for the production of secondary BA. However, an increase in the production of secondary BA modulates the intestinal microbiota due to the bactericidal effects and promotes cancer risk in the liver and colon. The ingestion of Bacillus coagulans improves constipation via the activation of bowel movement to promote defaecation in humans, which may alter BA metabolism in the intestinal contents. BA secretion is promoted with high-fat diet consumption, and the ratio of cholic acid (CA):chenodeoxycholic acid in primary BA increases with ageing. The dietary supplementation of CA mimics the BA environment in diet-induced obesity and ageing. We investigated whether B. coagulans lilac-01 and soya pulp influence both BA metabolism and the maintenance of host health in CA-supplemented diet-fed rats. In CA-fed rats, soya pulp significantly increased the production of secondary BA such as deoxycholic acid and ω-muricholic acids, and soya pulp ingestion alleviated problems related to plasma adiponectin and gut permeability in rats fed the CA diet. The combination of B. coagulans and soya pulp successfully suppressed the increased production of secondary BA in CA-fed rats compared with soya pulp itself, without impairing the beneficial effects of soya pulp ingestion. In conclusion, it is possible that a combination of prebiotics and probiotics can be used to avoid an unnecessary increase in the production of secondary BA in the large intestine without impairing the beneficial functions of prebiotics.
NASA Astrophysics Data System (ADS)
Yin, Yongkui; Li, Ying; Zhang, Haifeng; Ren, Fengyun; Zhang, Dawei; Feng, Wenxu; Shao, Lili; Li, Kaijun; Liu, Yang; Sun, Zhanpeng; Li, Miaojing; Song, Gaochen; Wang, Guan
2013-03-01
A facile strategy has been developed to synthesize BaMoO4 microcrystals with different morphologies, such as octopus-like, flower-like, and Chinese-cabbage-like, by using ethylenediaminetetraacetic acid as chelating and capping reagent at room temperature. X-ray diffraction, field emission scanning electron microscopy, and Fourier transformer infrared spectroscopy were introduced to characterize the composition, morphology, and chemical information of the as-obtained products. The effects of a series of experimental parameters, such as ethylenediaminetetraacetic acid quantity and the reagent concentrations, on the morphology and photoluminescence properties of the consequential BaMoO4 microcrystals were investigated in detail. The photoluminescence spectra of the obtained BaMoO4 microstructures exhibited different emission intensities. This method could be readily extended to synthesize BaWO4 microstructures with various morphologies.
Wang, Lei; Murai, Yuta; Yoshida, Takuma; Okamoto, Masashi; Tachrim, Zetryana Puteri; Hashidoko, Yasuyuki; Hashimoto, Makoto
2014-05-16
Aryl-keto-containing α-amino acids are of great importance in organic chemistry and biochemistry. They are valuable intermediates for the construction of hydroxyl α-amino acids, nonproteinogenic α-amino acids, as well as other biofunctional components. Friedel-Crafts acylation is an effective method to prepare aryl-keto derivatives. In this review, we summarize the preparation of aryl-keto containing α-amino acids by Friedel-Crafts acylation using acidic α-amino acids as acyl-donors and Lewis acids or Brönsted acids as catalysts.
Walters, Julian R F; Pattni, Sanjeev S
2010-11-01
Bowel symptoms including diarrhoea can be produced when excess bile acids (BA) are present in the colon. This condition, known as bile acid or bile salt malabsorption, has been under recognized, as the best diagnostic method, the (75)Se-homocholic acid taurine (SeHCAT) test, is not available in many countries and is not fully utilized in others. Reduced SeHCAT retention establishes that this is a complication of many other gastrointestinal diseases. Repeated studies show SeHCAT tests are abnormal in about 30% of patients otherwise diagnosed as diarrhoea-predominant irritable bowel syndrome or functional diarrhoea, with an estimated population prevalence of around 1%. Recent work suggests that the condition previously called idiopathic bile acid malabsorption (BAM) is not in fact due to a defect in absorption, but results from an overproduction of BA because of defective feedback inhibition of hepatic bile acid synthesis, a function of the ileal hormone fibroblast growth factor 19 (FGF19). The approach to treatment currently depends on binding excess BA, to reduce their secretory actions, using colestyramine, colestipol and, most recently, colesevelam. Colesevelam has a number of potential advantages that merit further investigation in trials directed at patients with bile acid diarrhoea.
Westfall, Corey S.; Sherp, Ashley M.; Zubieta, Chloe; Alvarez, Sophie; Schraft, Evelyn; Marcellin, Romain; Ramirez, Loren; Jez, Joseph M.
2016-01-01
In Arabidopsis thaliana, the acyl acid amido synthetase Gretchen Hagen 3.5 (AtGH3.5) conjugates both indole-3-acetic acid (IAA) and salicylic acid (SA) to modulate auxin and pathogen response pathways. To understand the molecular basis for the activity of AtGH3.5, we determined the X-ray crystal structure of the enzyme in complex with IAA and AMP. Biochemical analysis demonstrates that the substrate preference of AtGH3.5 is wider than originally described and includes the natural auxin phenylacetic acid (PAA) and the potential SA precursor benzoic acid (BA). Residues that determine IAA versus BA substrate preference were identified. The dual functionality of AtGH3.5 is unique to this enzyme although multiple IAA-conjugating GH3 proteins share nearly identical acyl acid binding sites. In planta analysis of IAA, PAA, SA, and BA and their respective aspartyl conjugates were determined in wild-type and overexpressing lines of A. thaliana. This study suggests that AtGH3.5 conjugates auxins (i.e., IAA and PAA) and benzoates (i.e., SA and BA) to mediate crosstalk between different metabolic pathways, broadening the potential roles for GH3 acyl acid amido synthetases in plants. PMID:27849615
Chen, Xingxuan; Wang, Xiahui; Xue, Yiyun; Zhang, Tian-Ao; Li, Yuhao; Hu, Jiajun; Tsang, Yiu Fai; Zhang, Hongsheng; Gao, Min-Tian
2018-06-01
Rice straw can be used as carbon sources for lactic acid fermentation. However, only a small amount of lactic acid is produced even though Rhizopus oryzae can consume glucose in rice straw-derived hydrolysates. This study correlated the inhibitory effect of rice straw with rice straw-derived dissolved organic matter (DOM). Lactic acid fermentations with and without DOM were conducted to investigate the effect of DOM on lactic acid fermentation by R. oryzae. Fermentation using control medium with DOM showed a similar trend to fermentation with rice straw-derived hydrolysates, showing that DOM contained the major inhibitor of rice straw. DOM assay indicated that it mainly consisted of polyphenols and polysaccharides. The addition of polyphenols and polysaccharides derived from rice straw confirmed that lactic acid fermentation was promoted by polysaccharides and significantly inhibited by polyphenols. The removal of polyphenols also improved lactic acid production. However, the loss of polysaccharides during the removal of polyphenols resulted in low glucose consumption. This study is the first to investigate the effects of rice straw-derived DOM on lactic acid fermentation by R. oryzae. The results may provide a theoretical basis for identifying inhibitors and promoters associated with lactic acid fermentation and for establishing suitable pretreatment methods. Copyright © 2018 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mesbah, Adel; ICSM, UMR 5257 CEA / CNRS / UM / ENSCM, Site de Marcoule-Bâtiment 426, BP 17171, 30207 Bagnols-sur-Cèze Cedex; Prakash, Jai
Five new compounds belonging to the ABaMQ{sub 4} family were synthesized by solid-state chemistry at 1123 K. The compounds RbBaPS{sub 4}, CsBaPS{sub 4}, CsBaVS{sub 4}, RbBaVSe{sub 4}, and CsBaVSe{sub 4} are isostructural and have the TlEuPS{sub 4} structure type. They crystallize in space group D{sup 16}{sub 2h} – Pnma of the orthorhombic system. Their structure consists isolated MQ{sub 4} tetrahedra separated by A and Ba atoms to form a salt-like structure. Density Functional Theory (DFT) calculations of the electronic structures with the use of the HSE functional suggest that the compounds are semiconductors with calculated band gaps of 3.3 eVmore » (RbBaPS{sub 4}), 3.4 eV (CsBaPS{sub 4}), 2.3 eV (CsBaVS{sub 4}), and 1.6 eV (RbBaVSe{sub 4}). - Graphical abstract: General view of the ABaMQ{sub 4} structure down the a axis. - Highlights: • Five new ABaMQ{sub 4} compounds were synthesized by solid-state chemistry at 1123 K. • RbBaPS{sub 4}, CsBaPS{sub 4}, CsBaVS{sub 4}, RbBaVSe{sub 4}, and CsBaVSe{sub 4} have the TlEuPS{sub 4} structure type. • The compounds are semiconductors with calculated band gaps ranging from 1.6 to 3.4 eV.« less
Synthesis and antimycobacterial activity of isoniazid derivatives from renewable fatty acids.
Rodrigues, Marieli O; Cantos, Jéssica B; D'Oca, Caroline R Montes; Soares, Karina L; Coelho, Tatiane S; Piovesan, Luciana A; Russowsky, Dennis; da Silva, Pedro A; D'Oca, Marcelo G Montes
2013-11-15
This work describes the synthesis of a series of fatty acid hydrazide derivatives of isoniazid (INH). The compounds were tested against Mycobacterium tuberculosis H37Rv (ATCC 27294) as well as INH-resistant (ATCC 35822 and 1896 HF) and rifampicin-resistant (ATCC 35338) M. tuberculosis strains. The fatty acid derivatives of INH showed high antimycobacterial potency against the studied strains, which is desirable for a pharmaceutical compound, suggesting that the increased lipophilicity of isoniazid plays an important role in its antimycobacterial activity. Copyright © 2013 Elsevier Ltd. All rights reserved.
2010-06-11
the cinnamic acid phenyl ring. Although compound 4c proved to be very cytotoxic in HUVEC over a 24 h period, the toxicity is less apparent over a 5 h...drug development process, as it determines how much of the initial dose actually reaches the target site. Cinnamic acid -derived amides are known to...Synthesis of a series of caffeic acid phenethyl amide (CAPA) fluorinated derivatives: Comparison of cytoprotective effects to caffeic acid phenethyl
Catalytic conversion of lactic acid and its derivatives
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kokitkar, P.B.; Langford, R.; Miller, D.J.
1993-12-31
The catalytic upgrading of lactic acid and methyl lactate is being investigated. With the commercialization of inexpensive starch fermentation technologies, US production of lactic acid is undergoing a surge. Dropping cost and increased availability offer a major opportunity to develop lactic acid as a renewable feedstock for chemicals production. IT can be catalytically converted into several important chemical intermediates currently derived from petroleum including acrylic acid, propanoic acid, and 2,3-pentanedione. The process can expand the potential of biomass as a substitute feedstock for petroleum and can benefit both the US chemical process industry and US agriculture via increased production ofmore » high-value, non-food products from crops and crop byproducts. Reaction studies of lactic acid and its ester are conducted in fixed bed reactors at 250-380{degrees}C and 0.1-0.5 MPa (1-5 atm) using salt catalysts on low surface area supports. Highest selectivities achieved are 42% to acrylic acid and 55% to 2,3-pentanedione from lactic acid over NaNO{sub 3} catalyst on low surface area silica support. High surface area (microporous) or highly acidic supports promote fragmentation to acetaldehyde and thus reduce yields of desirable products. The support acidity gives rice to lactic acid from neat methyl lactate feed but the lactic acid yield goes down after the nitrate salt is impregnated on the support. Both lactic acid and methyl lactate form 2,3-pentanedione. Methyl lactate reactions are more complex since it forms all the products obtained from lactic acid as well as many corresponding esters of the acids obtained from lactic acid (mainly methyl acrylate, methyl propionate, methyl acetate). At high temperatures, methyl acetate and acetic acid yields become significant from methyl lactate whereas lactic acid gives significant amount of acetol at high temperatures.« less
Derivatives of diphosphonic acids: synthesis and biological activity
NASA Astrophysics Data System (ADS)
Zolotukhina, M. M.; Krutikov, V. I.; Lavrent'ev, A. N.
1993-07-01
The scientific-technical and patent literature on the synthesis of derivatives of diphosphonic acids is surveyed. Various methods of synthesis of diphosphonate, phosphonylphosphinyl, and phosphonophosphate compounds are described. The principal aspects of the use of the above compounds in medicine, biochemistry, and agriculture are examined. The bibliography includes 174 references.
Effect of Roux-en-Y Gastric Bypass Surgery on Bile Acid Metabolism in Normal and Obese Diabetic Rats
Bhutta, Hina Y; Rajpal, Neetu; White, Wendy; Freudenberg, Johannes M.; Liu, Yaping; Way, James; Rajpal, Deepak; Cooper, David C.; Young, Andrew; Tavakkoli, Ali; Chen, Lihong
2015-01-01
In addition to classic functions of facilitating hepatobiliary secretion and intestinal absorption of lipophilic nutrients, bile acids (BA) are also endocrine factors and regulate glucose and lipid metabolism. Recent data indicate that antiobesity bariatric procedures e.g. Roux-en-Y gastric bypass surgery (RYGB), which also remit diabetes, increase plasma BAs in humans, leading to the hypothesis that BAs may play a role in diabetes resolution following surgery. To investigate the effect of RYGB on BA physiology and its relationship with glucose homeostasis, we undertook RYGB and SHAM surgery in Zucker diabetic fatty (ZDF) and normoglycemic Sprague Dawley (SD) rats and measured plasma and fecal BA levels, as well as plasma glucose, insulin, Glucagon like peptide 1 (GLP-1) and Peptide YY (PYY), 2 days before and 3, 7, 14 and 28 days after surgery. RYGB decreased body weight and increased plasma GLP-1 in both SD and ZDF rats while decreasing plasma insulin and glucose in ZDF rats starting from the first week. Compared to SHAM groups, both SD-RYGB and ZDF-RYGB groups started to have increases in plasma total BAs in the second week, which might not contribute to early post-surgery metabolic changes. While there was no significant difference in fecal BA excretion between SD-RYGB and SD-SHAM groups, the ZDF-RYGB group had a transient 4.2-fold increase (P<0.001) in 24-hour fecal BA excretion on post-operative day 3 compared to ZDF-SHAM, which paralleled a significant increase in plasma PYY. Ratios of plasma and fecal cholic acid/chenodeoxycholic acid derived BAs were decreased in RYGB groups. In addition, tissue mRNA expression analysis suggested early intestinal BA reabsorption and potentially reduced hepatic cholic acid production in RYGB groups. In summary, we present novel data on RYGB-mediated changes in BA metabolism to further understand the role of BAs in RYGB-induced metabolic effects in humans. PMID:25798945
DOE Office of Scientific and Technical Information (OSTI.GOV)
Di Renzo, Francesca; Cappelletti, Graziella; Broccia, Maria L.
2007-04-15
Histone deacetylases (HDAC) control gene expression by changing histonic as well as non histonic protein conformation. HDAC inhibitors (HDACi) are considered to be among the most promising drugs for epigenetic treatment for cancer. Recently a strict relationship between histone hyperacetylation in specific tissues of mouse embryos exposed to two HDACi (valproic acid and trichostatin A) and specific axial skeleton malformations has been demonstrated. The aim of this study is to verify if boric acid (BA), that induces in rodents malformations similar to those valproic acid and trichostatin A-related, acts through similar mechanisms: HDAC inhibition and histone hyperacetylation. Pregnant mice weremore » treated intraperitoneally with a teratogenic dose of BA (1000 mg/kg, day 8 of gestation). Western blot analysis and immunostaining were performed with anti hyperacetylated histone 4 (H4) antibody on embryos explanted 1, 3 or 4 h after treatment and revealed H4 hyperacetylation at the level of somites. HDAC enzyme assay was performed on embryonic nuclear extracts. A significant HDAC inhibition activity (compatible with a mixed type partial inhibition mechanism) was evident with BA. Kinetic analyses indicate that BA modifies substrate affinity by a factor {alpha} = 0.51 and maximum velocity by a factor {beta} = 0.70. This work provides the first evidence for HDAC inhibition by BA and suggests such a molecular mechanism for the induction of BA-related malformations.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kumar, Rohitash, E-mail: dootrohit1976@gmail.com; Department of Physics & Center for Solar Energy, Indian Institute of Technology Jodhpur, Rajasthan, India 342011, +91-291-2449045; Kumar, Ravindra
2016-05-06
Thermal properties of Acetamide (AM) – Benzoic acid (BA) and Benzoic acid (BA) – Phthalimide (PM) binary eutectic systems are theoretically calculated using thermodynamic principles. We found that the binary systems of AM-BA at 67.6 : 32.4 molar ratio, BA-PM at 89.7 : 10.3 molar ratio form eutectic mixtures with melting temperatures ~ 54.5 °C and 114.3 °C respectively. Calculated latent heat of fusion for these eutectic mixtures are 191 kJ/kg and 146.5 kJ/kg respectively. These melting temperatures and heat of fusions of these eutectic mixtures make them suitable for thermal energy storage applications in solar water heating and solarmore » cooking systems.« less
NASA Astrophysics Data System (ADS)
de Marino, Simona; Carino, Adriana; Masullo, Dario; Finamore, Claudia; Marchianò, Silvia; Cipriani, Sabrina; di Leva, Francesco Saverio; Catalanotti, Bruno; Novellino, Ettore; Limongelli, Vittorio; Fiorucci, Stefano; Zampella, Angela
2017-02-01
Bile acids are extensively investigated for their potential in the treatment of human disorders. The liver X receptors (LXRs), activated by oxysterols and by a secondary bile acid named hyodeoxycholic acid (HDCA), have been found essential in the regulation of lipid homeostasis in mammals. Unfortunately, LXRα activates lipogenic enzymes causing accumulation of lipid in the liver. In addition to LXRs, HDCA has been also shown to function as ligand for GPBAR1, a G protein coupled receptor for secondary bile acids whose activation represents a promising approach to liver steatosis. In the present study, we report a library of HDCA derivatives endowed with modulatory activity on the two receptors. The lead optimization of HDCA moiety was rationally driven by the structural information on the binding site of the two targets and results from pharmacological characterization allowed the identification of hyodeoxycholane derivatives with selective agonistic activity toward LXRα and GPBAR1 and notably to the identification of the first example of potent dual LXRα/GPBAR1 agonists. The new chemical entities might hold utility in the treatment of dyslipidemic disorders.
An Overview of Structurally Modified Glycyrrhetinic Acid Derivatives as Antitumor Agents.
Xu, Bing; Wu, Gao-Rong; Zhang, Xin-Yu; Yan, Meng-Meng; Zhao, Rui; Xue, Nan-Nan; Fang, Kang; Wang, Hui; Chen, Meng; Guo, Wen-Bo; Wang, Peng-Long; Lei, Hai-Min
2017-06-02
Glycyrrhetinic Acid ( GA ), a triterpenoid aglycone component of the natural product glycyrrhizinic acid, was found to possess remarkable anti-proliferative and apoptosis-inducing activity in various cancer cell lines. Though GA was not as active as other triterpenes, such as betulinic acid and oleanolic acid, it could trigger apoptosis in tumor cells and it can be obtained easily and cheaply, which has stimulated scientific interest in using GA as a scaffold to synthesize new antitumor agents. The structural modifications of GA reported in recent decades can be divided into four groups, which include structural modifications on ring-A, ring-C, ring-E and multiple ring modifications. The lack of a comprehensive and recent review on this topic prompted us to gather more new information. This overview is dedicated to summarizing and updating the structural modification of GA to improve its antitumor activity published between 2005 and 2016. We reviewed a total of 210 GA derivatives that we encountered and compiled the most active GA derivatives along with their activity profile in different series. Furthermore, the structure activity relationships of these derivatives are briefly discussed. The included information is expected to be of benefit to further studies of structural modifications of GA to enhance its antitumor activity.
Analysis of Jupiter's Oval BA: A Streamlined Approach
NASA Technical Reports Server (NTRS)
Sussman, Michael G.; Chanover, Nancy J.; Simon-Miller, Amy A.; Vasavada, Ashwin R.; Beebe, Reta F.
2010-01-01
We present a novel method of constructing streamlines to derive wind speeds within jovian vortices and demonstrate its application to Oval BA for 2001 pre-reddened Cassini flyby data, 2007 post-reddened New Horizons flyby data, and 1998 Galileo data of precursor Oval DE. Our method, while automated, attempts to combine the advantages of both automated and manual cloud tracking methods. The southern maximum wind speed of Oval BA does not show significant changes between these data sets to within our measurement uncertainty. The northern maximum dries appear to have increased in strength during this time interval, tvhich likely correlates with the oval's return to a symmetric shape. We demonstrate how the use of closed streamlines can provide measurements of vorticity averaged over the encircled area with no a priori assumptions concerning oval shape. We find increased averaged interior vorticity between pre- and post-reddened Oval BA, with the precursor Oval DE occupying a middle value of vorticity between these two.
Quantification of acidic compounds in complex biomass-derived streams
Karp, Eric M.; Nimlos, Claire T.; Deutch, Steve; ...
2016-05-10
Biomass-derived streams that contain acidic compounds from the degradation of lignin and polysaccharides (e.g. black liquor, pyrolysis oil, pyrolytic lignin, etc.) are chemically complex solutions prone to instability and degradation during analysis, making quantification of compounds within them challenging. Here we present a robust analytical method to quantify acidic compounds in complex biomass-derived mixtures using ion exchange, sample reconstitution in pyridine and derivatization with BSTFA. The procedure is based on an earlier method originally reported for kraft black liquors and, in this work, is applied to identify and quantify a large slate of acidic compounds in corn stover derived alkalinemore » pretreatment liquor (APL) as a function of pretreatment severity. Analysis of the samples is conducted with GCxGC-TOFMS to achieve good resolution of the components within the complex mixture. The results reveal the dominant low molecular weight components and their concentrations as a function of pretreatment severity. Application of this method is also demonstrated in the context of lignin conversion technologies by applying it to track the microbial conversion of an APL substrate. Here as well excellent results are achieved, and the appearance and disappearance of compounds is observed in agreement with the known metabolic pathways of two bacteria, indicating the sample integrity was maintained throughout analysis. Finally, it is shown that this method applies more generally to lignin-rich materials by demonstrating its usefulness in analysis of pyrolysis oil and pyrolytic lignin.« less
Stereoselective Synthesis of α-Amino-C-phosphinic Acids and Derivatives.
Viveros-Ceballos, José Luis; Ordóñez, Mario; Sayago, Francisco J; Cativiela, Carlos
2016-08-29
α-Amino-C-phosphinic acids and derivatives are an important group of compounds of synthetic and medicinal interest and particular attention has been dedicated to their stereoselective synthesis in recent years. Among these, phosphinic pseudopeptides have acquired pharmacological importance in influencing physiologic and pathologic processes, primarily acting as inhibitors for proteolytic enzymes where molecular stereochemistry has proven to be critical. This review summarizes the latest developments in the asymmetric synthesis of acyclic and phosphacyclic α-amino-C-phosphinic acids and derivatives, following in the first case an order according to the strategy used, whereas for cyclic compounds the nitrogen embedding in the heterocyclic core is considered. In addition selected examples of pharmacological implications of title compounds are also disclosed.
Liu, Jia; Liu, Jia-Nan; Yuan, Ming; Shen, Zi-Heng; Peng, Kai-Ming; Lu, Li-Jun; Huang, Xiang-Feng
2016-07-01
Pure volatile fatty acid (VFA) solution derived from waste activated sludge (WAS) was used to produce microbial lipids as culture medium in this study, which aimed to realize the resource recovery of WAS and provide low-cost feedstock for biodiesel production simultaneously. Cryptococcus curvatus was selected among three oleaginous yeast to produce lipids with VFAs derived from WAS. In batch cultivation, lipid contents increased from 10.2% to 16.8% when carbon to nitrogen ratio increased from about 3.5 to 165 after removal of ammonia nitrogen by struvite precipitation. The lipid content further increased to 39.6% and the biomass increased from 1.56g/L to 4.53g/L after cultivation for five cycles using sequencing batch culture (SBC) strategy. The lipids produced from WAS-derived VFA solution contained nearly 50% of monounsaturated fatty acids, including palmitic acid, heptadecanoic acid, ginkgolic acid, stearic acid, oleic acid, and linoleic acid, which showed the adequacy of biodiesel production. Copyright © 2016 Elsevier Ltd. All rights reserved.
Oleanolic acid alters bile acid metabolism and produces cholestatic liver injury in mice
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu, Jie, E-mail: JLiu@kumc.edu; Zunyi Medical College, Zunyi 563003; Lu, Yuan-Fu
2013-11-01
Oleanolic acid (OA) is a triterpenoids that exists widely in plants. OA is effective in protecting against hepatotoxicants. Whereas a low dose of OA is hepatoprotective, higher doses and longer-term use of OA produce liver injury. This study characterized OA-induced liver injury in mice. Adult C57BL/6 mice were given OA at doses of 0, 22.5, 45, 90, and 135 mg/kg, s.c., daily for 5 days, and liver injury was observed at doses of 90 mg/kg and above, as evidenced by increases in serum activities of alanine aminotransferase and alkaline phosphatase, increases in serum total bilirubin, as well as by livermore » histopathology. OA-induced cholestatic liver injury was further evidenced by marked increases of both unconjugated and conjugated bile acids (BAs) in serum. Gene and protein expression analysis suggested that livers of OA-treated mice had adaptive responses to prevent BA accumulation by suppressing BA biosynthetic enzyme genes (Cyp7a1, 8b1, 27a1, and 7b1); lowering BA uptake transporters (Ntcp and Oatp1b2); and increasing a BA efflux transporter (Ostβ). OA increased the expression of Nrf2 and its target gene, Nqo1, but decreased the expression of AhR, CAR and PPARα along with their target genes, Cyp1a2, Cyp2b10 and Cyp4a10. OA had minimal effects on PXR and Cyp3a11. Taken together, the present study characterized OA-induced liver injury, which is associated with altered BA homeostasis, and alerts its toxicity potential. - Highlights: • Oleanolic acid at higher doses and long-term use may produce liver injury. • Oleanolic acid increased serum ALT, ALP, bilirubin and bile acid concentrations. • OA produced feathery degeneration, inflammation and cell death in the liver. • OA altered bile acid homeostasis, affecting bile acid synthesis and transport.« less
Photoelectron spectra and biological activity of cinnamic acid derivatives revisited
NASA Astrophysics Data System (ADS)
Novak, Igor; Klasinc, Leo; McGlynn, Sean P.
2018-01-01
The electronic structures of several derivatives of cinnamic acid have been studied by UV photoelectron spectroscopy (UPS) and Green's function quantum chemical calculations. The spectra reveal the presence of dimers in the gas phase for p-coumaric and ferulic acids. The electronic structure analysis has been related to the biological properties of these compounds through the analysis of some structure-activity relationships (SAR).
Cui, Yi; Hu, Yong-Hua; Yu, Feng; Zheng, Jing; Chen, Lin-Shan; Chen, Qing-Xi; Wang, Qin
2017-02-01
This study was to investigate the inhibition effects of para-substituted cinnamic acid derivatives (4-chlorocinnamic acid, 4-ethoxycinnamic acid and 4-nitrocinnamic acid) on tyrosinase catalyzing the substrates, with the purpose of elucidating the inhibition mechanism of the tested derivatives on tyrosinase by the UV-vis spectrum, fluorescence spectroscopy, copper interacting and molecular docking, respectively. The native-PAGE results showed that 4-chlorocinnamic acid (4-CCA), 4-ethoxycinnamic acid (4-ECA) and 4-nitrocinnamic acid (4-NCA) had inhibitory effects on tyrosinase. Spectrophotometric analysis used to determine the inhibition capabilities of these compounds on tyrosinase catalyzing L-tyrosine (L-Tyr) and L-3,4-Dihydroxyphenylalanine (L-DOPA) as well. The IC 50 values and inhibition constants were further determined. Moreover, quenching mechanisms of tested compounds to tyrosinase belonged to static type and a red shift on fluorescence emission peak occurred when 4-NCA added. Copper interacting and molecular docking demonstrated that 4-CCA could not bind directly to the copper, but it could interact with residues in the active center of tyrosinase. Meanwhile, 4-ECA and 4-NCA could chelate a copper ion of tyrosinase. Anti-tyrosinase activities of para-substituted cinnamic acid derivatives would lay scientific foundation for their utilization in designing of novel tyrosinase inhibitors. Copyright © 2016 Elsevier B.V. All rights reserved.
A new coruleoellagic acid derivative from stems of Rhodamnia dumetorum.
Lakornwong, Waranya; Kanokmedhakul, Kwanjai; Kanokmedhakul, Somdej
2018-07-01
A new coruleoellagic acid derivative, 3,3',4,4',5'-pentamethylcoruleoellagic acid (1) together with nine known compounds, hexamethylcoruleoellagic acid (2), 3,4,3'-tri-O-methylellagic acid (3), heptaphylline (4), 7-methoxymukonal (5), dentatin (6), sinapaldehyde (7), gallic acid (8), 2,6-dimethoxy-4H-pyran-4-one (9) and β-sitosterol (10) were isolated from the stems of Rhodamnia dumetorum. Their structures were identified by physical and spectroscopic data (IR, 1D and 2D NMR, and MS). Compounds 1, 2 and 7-10 were tested for antibacterial activity against six pathogenic bacterial strains (Bacillus cereus, Escherichia coli, Pseudomonas aeruginosa, Salmonella enterica serovar Typhimurium, Staphylococcus aureus, and Methicillin resistant S. aureus (MRSA)).
Analysis of oxygen binding-energy variations for BaO on W
NASA Astrophysics Data System (ADS)
Haas, G. A.; Shih, A.; Mueller, D.; Thomas, R. E.
Interatomic Auger analyses have been made of different forms of BaO layers on W substrates. Variations in Auger spectroscopy energies of the Ba4dBa5pO2p interatomic Auger transition were found to be largely governed by the O2p binding energy of the BaO adsorbate. This was illustrated by comparing results of the Auger data values with values derived from O2p binding energies using ultraviolet photoelectron spectroscopy. Very good agreement was observed not only for the W<100> substrate but also for the W<110> substrate which showed two oxygen-induced electronics state. Variations in binding energy were noted for different states of BaO lattice formation and for different amounts of oxidation, ranging from the transition of Ba to BaO and continuing to the BaO 2 stoichiometry and beyond. Effects were also reported for adsorbate alignment and thermal activation (i.e., reduction) of the oxidized state. An empirical relationship was found suggesting that the more tightly bound the O2p states of the BaO adsorbate were, the lower its work function would be. This link between binding energy and work function was observed to be valid not only for cases of poisoning by oxidation, but held as well during reactivation by the subsequent reduction of the oxide. In addition, this relationship also appeared to predict the low work function obtained through the introduction of substances such as Sc to the BaO-W system. Possible qualitative reasons which might contribute to this are discussed in terms of enhanced dipole effects and shifts in band structure.
Reactive Derivatives of Nucleic Acids and Their Components as Affinity Reagents
NASA Astrophysics Data System (ADS)
Knorre, Dmitrii G.; Vlasov, Valentin V.
1985-09-01
The review is devoted to derivatives of nucleic acids and their components — nucleotides, nucleoside triphosphates, and oligonucleotides carrying reactive groups. Such derivatives are important tools for the investigation of protein-nucleic acid interactions and the functional topography of complex protein and nucleoprotein structures and can give rise to the prospect of being able to influence in a highly selective manner living organisms, including the nucleic acids and the nucleoproteins of the genetic apparatus. The review considers the principal groups of such reagents, the methods of their synthesis, and their properties which determine the possibility of their use for the selective (affinity) modification of biopolymers. The general principles of the construction of affinity reagents and their applications are analysed in relation to nucleotide affinity reagents. The bibliography includes 121 references.
Anti-Trichomonas vaginalis activity of ursolic acid derivative: a promising alternative.
Bitencourt, Fernanda Gobbi; de Brum Vieira, Patrícia; Meirelles, Lucia Collares; Rigo, Graziela Vargas; da Silva, Elenilson Figueiredo; Gnoatto, Simone Cristina Baggio; Tasca, Tiana
2018-05-01
Trichomonas vaginalis is an extracellular parasite that binds to the epithelium of the human urogenital tract and causes the sexually transmitted infection, trichomoniasis. In view of increased resistance to drugs belonging to the 5-nitroimidazole class, new treatment alternatives are urgently needed. In this study, eight semisynthetized triterpene derivatives were evaluated for in vitro anti-T. vaginalis activity. Ursolic acid and its derivative, 3-oxime-urs-12-en-28-oic-ursolic acid (9), presented the best anti-T. vaginalis activity when compared to other derivatives, with minimum inhibitory concentration (MIC) at 25 μM. Moreover, 9 was active against several T. vaginalis fresh clinical isolates. Hemolysis assay demonstrated that 9 presented a low hemolytic effect. Importantly, 25 μM 9 was not cytotoxic against the Vero cell lineage. Finally, we demonstrated that compound 9 acts synergistically with metronidazole against a T. vaginalis metronidazole-resistant isolate. This report reveals the high potential of the triterpenoid derivative 9 as trichomonicidal agent.
Sheng, Lili; Jena, Prasant Kumar; Hu, Ying; Liu, Hui-Xin; Nagar, Nidhi; Kalanetra, Karen M; French, Samuel William; French, Samuel Wheeler; Mills, David A; Wan, Yu-Jui Yvonne
2017-12-01
Dysregulated bile acid (BA) synthesis or reduced farnesoid X receptor (FXR) levels are found in patients having metabolic diseases, autoimmune hepatitis, and liver cirrhosis or cancer. The objective of this study was to establish the relationship between butyrate and dysregulated BA synthesis-induced hepatitis as well as the effect of butyrate in reversing the liver pathology. Wild-type (WT) and FXR knockout (KO) male mice were placed on a control (CD) or western diet (WD) for 15 months. In the presence or absence of butyrate supplementation, feces obtained from 15-month-old WD-fed FXR KO mice, which had severe hepatitis and liver tumors, were transplanted to 7-month-old WD-fed FXR KO for 3 months. Hepatic phenotypes, microbiota profile, and BA composition were analyzed. Butyrate-generating bacteria and colonic butyrate concentration were reduced due to FXR inactivation and further reduced by WD intake. In addition, WD-fed FXR KO male mice had the highest concentration of hepatic β-muricholic acid (β-MCA) and bacteria-generated deoxycholic acid (DCA) accompanied by serious hepatitis. Moreover, dysregulated BA and reduced SCFA signaling co-existed in both human liver cancers and WD-fed FXR KO mice. Microbiota transplantation using butyrate-deficient feces derived from 15-month-old WD-fed FXR KO mice increased hepatic lymphocyte numbers as well as hepatic β-MCA and DCA concentrations. Furthermore, butyrate supplementation reduced hepatic β-MCA as well as DCA and eliminated hepatic lymphocyte infiltration. In conclusion, reduced butyrate contributes to the development of hepatitis in the FXR KO mouse model. In addition, butyrate reverses dysregulated BA synthesis and its associated hepatitis. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.
van Dijk, K; Voets, G M; Scharringa, J; Voskuil, S; Fluit, A C; Rottier, W C; Leverstein-Van Hall, M A; Cohen Stuart, J W T
2014-04-01
Class A and B carbapenemases in Enterobacteriaceae may be detected using carbapenemase inhibition tests with boronic acid derivatives (BA) and dipicolinic acid (DPA)/EDTA, respectively. However, for OXA-48 (like) carbapenemases, no specific inhibitor is available. Because OXA-48 confers high-level temocillin resistance, a disc diffusion assay using temocillin as well as BA and DPA inhibition tests was evaluated for detection of class A, B and OXA-48 carbapenemases. The test collection included 128 well-characterized non-repeat Enterobacteriaceae isolates suspected of carbapenemase production; that is, with meropenem MICs ≥ 0.5 mg/L, including 99 carbapenemase producers (36 KPC, one GES, 31 MBL, four KPC plus VIM, 25 OXA-48, two OXA-162), and 29 ESBL and/or AmpC-producing isolates. PCR and sequencing of beta-lactamase genes was used as a reference test. Phenotypic carbapenemase detection was performed with discs (Rosco) containing meropenem (10 μg), temocillin (30 μg), meropenem + phenyl boronic acid (PBA), meropenem + DPA, meropenem + BA + DPA, and meropenem + cloxacillin (CL). Absence of synergy between meropenem and BA and/or DPA and a temocillin zone ≤10 mm was used to identify OXA-48. The sensitivity for identification of class A, B and OXA-48 carbapenemases was 95%, 90% and 100%, with 96-100% specificity. In non-Proteus species, the sensitivity for class B carbapenemase detection was 97%. All isolates without PBA or DPA synergy and a temocillin disc zone ≤10 mm were OXA-48 (like) positive. In conclusion, carbapenemase inhibition tests with PBA and DPA combined with a temocillin disc provide a reliable phenotypic confirmation method for class A, B and OXA-48 carbapenemases in Enterobacteriaceae. © 2013 The Authors Clinical Microbiology and Infection © 2013 European Society of Clinical Microbiology and Infectious Diseases.
NASA Astrophysics Data System (ADS)
Afanasiev, Pavel
2018-02-01
A novel inorganic-organic hybrid barium tungstate - ethylene glycol Ba(C2H6O2)W2O7 phase has been prepared by non-aqueous precipitation and characterized. According to powder X-ray diffraction, the solid has an orthorhombic lattice (a = b = 6.415 Å, c = 13.05 Å) and represents a derivative of the H2W2O7 lamellar acid. The Ba(C2H6O2)W2O7 hybrid material is a layered solid and crystallizes as thin plates, which can be further topotacticaly transformed to few-layer WS2 nanoplates. Tungsten sulfide as obtained possesses high specific surface area and increased defectness of layers. Thin-layer WS2 materials as prepared show advantageous properties as hydrogen evolution electrocatalysts, or in combination with TiO2 as co-catalysts for photo catalytic hydrogen production from methanol.
[Lactic acid inhibits the formation of semen-derived amyloid fibrils].
Li, Jin-Qing; Song, Ya-Li; Xun, Tian-Rong; Tan, Sui-Yi; Liu, Shu-Wen
2017-07-20
To investigate the inhibitory effect of lactic acid on semen-derived amyloid (SEVI) fibril formation. PAP248-286 (2 mg/mL) was incubated with 4.0, 2.0, 1.0, 0.5, 0.25, and 0.125 mg/mL of lactic acid. After incubation for different times, aliquots were drawn from each sample for Thioflavin T (ThT) and Congo red staining to monitor semen-derived amyloid fibril formation. The β sheet structure formation of PAP248-286 was measured by circular dichroism spectrum, and the morphology of amyloid fibrils incubated with or without lactic acid was observed with transmission electron microscopy (TEM). The enhancing effect of amyloid fibril incubated with lactic acid at different time points was determined using virus infection assay. PAP248-286 (2 mg/mL) was incubated with dilutions of vaginal secretion from healthy women, and amyloid fibril formation was detected with ThT and Congo red staining. Lactic acid inhibited SEVI fibril formation in a dose-dependent manner in vitro. Lactic acid at 0.5 mg/mL completely inhibited 2 mg/mL SEVI fibril formation within 48 h. After incubation for 48 h, lactic acid at 1 mg/mL inhibited the formation of β-sheet structure of SEVI (2 mg/mL) and completely inhibited 2 mg/mL PAP248-286 aggregation as observed with TEM. In the presence of lactic acid, PAP248-286 lost the ability to enhance virus infection. Vaginal secretion inhibited SEVI fibril formation in a dose-dependent manner, and virtually no SEVI fibril occurred after incubation of 2 mg/mL PAP248-286 with 67% vaginal secretion. Lactic acid inhibits SEVI fibril formation in vitro.
Nagy, R A; van Montfoort, A P A; Dikkers, A; van Echten-Arends, J; Homminga, I; Land, J A; Hoek, A; Tietge, U J F
2015-05-01
Are bile acids (BA) and their respective subspecies present in human follicular fluid (FF) and do they relate to embryo quality in modified natural cycle IVF (MNC-IVF)? BA concentrations are 2-fold higher in follicular fluid than in serum and ursodeoxycholic acid (UDCA) derivatives were associated with development of top quality embryos on Day 3 after fertilization. Granulosa cells are capable of synthesizing BA, but a potential correlation with oocyte and embryo quality as well as information on the presence and role of BA subspecies in follicular fluid have yet to be investigated. Between January 2001 and June 2004, follicular fluid and serum samples were collected from 303 patients treated in a single academic centre that was involved in a multicentre cohort study on the effectiveness of MNC-IVF. Material from patients who underwent a first cycle of MNC-IVF was used. Serum was not stored from all patients, and the available material comprised 156 follicular fluid and 116 matching serum samples. Total BA and BA subspecies were measured in follicular fluid and in matching serum by enzymatic fluorimetric assay and liquid chromatography-mass spectrometry, respectively. The association of BA in follicular fluid with oocyte and embryo quality parameters, such as fertilization rate and cell number, presence of multinucleated blastomeres and percentage of fragmentation on Day 3, was analysed. Embryos with eight cells on Day 3 after oocyte retrieval were more likely to originate from follicles with a higher level of UDCA derivatives than those with fewer than eight cells (P < 0.05). Furthermore, follicular fluid levels of chenodeoxycholic derivatives were higher and deoxycholic derivatives were lower in the group of embryos with fragmentation compared with those without (each P < 0.05). Levels of total BA were 2-fold higher in follicular fluid compared with serum (P < 0.001), but had no predictive value for oocyte and embryo quality. Only samples originating from first
Adisakwattana, Sirichai
2017-02-21
With recent insight into the development of dietary supplements and functional foods, search of effective phytochemical compounds and their mechanisms involved in prevention and management of diabetes and its complications are now being assessed. Cinnamic acid and its derivatives occur naturally in high levels of plant-based foods. Among various biological activities, cinnamic acid and its derivatives are associated with a beneficial influence on diabetes and its complications. The aim of the review is to summarize the potential mechanisms of these compounds for prevention and management of diabetes and its complications. Based on several in vitro studies and animal models, cinnamic acid and its derivatives act on different mechanism of actions, including stimulation of insulin secretion, improvement of pancreatic β-cell functionality, inhibition of hepatic gluconeogenesis, enhanced glucose uptake, increased insulin signaling pathway, delay of carbohydrate digestion and glucose absorption, and inhibition of protein glycation and insulin fibrillation. However, due to the limited intestinal absorption being a result of low bioavailability of cinnamic acid and its derivatives, current improvement efforts with entrapping into solid and liquid particles are highlighted. Further human clinical studies are needed to clarify the effects of cinnamic acid and its derivatives in diabetic patients.
Walters, Julian R. F.; Pattni, Sanjeev S.
2010-01-01
Bowel symptoms including diarrhoea can be produced when excess bile acids (BA) are present in the colon. This condition, known as bile acid or bile salt malabsorption, has been under recognized, as the best diagnostic method, the 75Se-homocholic acid taurine (SeHCAT) test, is not available in many countries and is not fully utilized in others. Reduced SeHCAT retention establishes that this is a complication of many other gastrointestinal diseases. Repeated studies show SeHCAT tests are abnormal in about 30% of patients otherwise diagnosed as diarrhoea-predominant irritable bowel syndrome or functional diarrhoea, with an estimated population prevalence of around 1%. Recent work suggests that the condition previously called idiopathic bile acid malabsorption (BAM) is not in fact due to a defect in absorption, but results from an overproduction of BA because of defective feedback inhibition of hepatic bile acid synthesis, a function of the ileal hormone fibroblast growth factor 19 (FGF19). The approach to treatment currently depends on binding excess BA, to reduce their secretory actions, using colestyramine, colestipol and, most recently, colesevelam. Colesevelam has a number of potential advantages that merit further investigation in trials directed at patients with bile acid diarrhoea. PMID:21180614
Khan, Mohammad Firoz; Nahar, Nusrat; Rashid, Ridwan Bin; Chowdhury, Akhtaruzzaman; Rashid, Mohammad A
2018-02-02
Betulinic acid (BA) is a natural triterpenoid compound and exhibits a wide range of biological and medicinal properties including anti-inflammatory activity. Therefore, this theoretical investigation is performed to evaluate (a) physicochemical properties such as acid dissociation constant (pKa), distribution coefficient (logD), partition coefficient (logP), aqueous solubility (logS), solvation free energy, dipole moment, polarizability, hyperpolarizability and different reactivity descriptors, (b) pharmacokinetic properties like human intestinal absorption (HIA), cellular permeability, skin permeability (P Skin ), plasma protein binding (PPB), penetration of the blood brain barrier (BBB), (c) toxicological properties including mutagenicity, carcinogenicity, risk of inhibition of hERG gene and (d) molecular mechanism of anti-inflammatory action which will aid the development of analytical method and the synthesis of BA derivatives. The physicochemical properties were calculated using MarvinSketch 15.6.29 and Gaussian 09 software package. The pharmacokinetic and toxicological properties were calculated on online server PreADMET. Further, the molecular docking study was conducted on AutoDock vina in PyRx 0.8. The aqueous solubility increased with increasing pH due to the ionization of BA leading to decrease in distribution coefficient. The solvation energies in water, dimethyl sulfoxide (DMSO), acetonitrile, n-octanol, chloroform and carbon tetrachloride were - 41.74 kJ/mol, - 53.80 kJ/mol, - 66.27 kJ/mol, - 69.64 kJ/mol, - 65.96 kJ/mol and - 60.13 kJ/mol, respectively. From the results of polarizability and softness, it was clear that BA is less stable and hence, kinetically more reactive in water. BA demonstrated good human intestinal absorption (HIA) and moderate cellular permeability. Further, BA also exhibited positive CNS activity due to high permeability through BBB. The toxicological study revealed that BA was a mutagenic compound but
Synthesis and Pro-Apoptotic Activity of Novel Glycyrrhetinic Acid Derivatives
Logashenko, Evgeniya B; Salomatina, Oksana V; Markov, A V; Korchagina, Dina V; Salakhutdinov, Nariman F; Tolstikov, Genrikh A; Vlassov, Valentin V; Zenkova, Marina A
2011-01-01
Triterpenoids are used for medicinal purposes in many countries. Some, such as oleanolic and glycyrrhetinic acids, are known to be anti-inflammatory and anticarcinogenic. However, the biological activities of these naturally occurring molecules against their particular targets are weak, so the synthesis of new synthetic analogues with enhanced potency is needed. By combining modifications to both the A and C rings of 18βH-glycyrrhetinic acid, the novel synthetic derivative methyl 2-cyano-3,12-dioxo-18βH-olean-9(11),1(2)-dien-30-oate was obtained. This derivative displays high antiproliferative activity in cancer cells, including a cell line with a multidrug-resistance phenotype. It causes cell death by inducing the intrinsic caspase-dependent apoptotic pathway. PMID:21328513
Cunha, Wilson R; de Matos, Geilton X; Souza, Maria Goreti M; Tozatti, Marcos G; Andrade e Silva, Márcio L; Martins, Carlos H G; da Silva, Rosangela; Da Silva Filho, Ademar A
2010-02-01
The methylene chloride extract of Miconia ligustroides (DC.) Naudin (Melastomataceae), the isolated compounds ursolic and oleanolic acids and a mixture of these acids, and ursolic acid derivatives were evaluated against the following microorganisms: Bacillus cereus (ATCC 14579), Vibrio cholerae (ATCC 9458), Salmonella choleraesuis (ATCC 10708), Klebsiella pneumoniae (ATCC 10031), and Streptococcus pneumoniae (ATCC 6305). The microdilution method was used for determination of the minimum inhibitory concentration (MIC) during evaluation of the antibacterial activity. The methylene chloride extract showed no activity against the selected microorganisms. Ursolic acid was active against B. cereus, showing a MIC value of 20 microg/mL. Oleanolic acid was effective against B. cereus and S. pneumoniae with a MIC of 80 microg/mL in both cases. The mixture of triterpenes, ursolic and oleanolic acids, did not enhance the antimicrobial activity. However, the acetyl and methyl ester derivatives, prepared from ursolic acid, increased the inhibitory activity for S. pneumoniae.
Shoot-derived abscisic acid promotes root growth.
McAdam, Scott A M; Brodribb, Timothy J; Ross, John J
2016-03-01
The phytohormone abscisic acid (ABA) plays a major role in regulating root growth. Most work to date has investigated the influence of root-sourced ABA on root growth during water stress. Here, we tested whether foliage-derived ABA could be transported to the roots, and whether this foliage-derived ABA had an influence on root growth under well-watered conditions. Using both application studies of deuterium-labelled ABA and reciprocal grafting between wild-type and ABA-biosynthetic mutant plants, we show that both ABA levels in the roots and root growth in representative angiosperms are controlled by ABA synthesized in the leaves rather than sourced from the roots. Foliage-derived ABA was found to promote root growth relative to shoot growth but to inhibit the development of lateral roots. Increased root auxin (IAA) levels in plants with ABA-deficient scions suggest that foliage-derived ABA inhibits root growth through the root growth-inhibitor IAA. These results highlight the physiological and morphological importance, beyond the control of stomata, of foliage-derived ABA. The use of foliar ABA as a signal for root growth has important implications for regulating root to shoot growth under normal conditions and suggests that leaf rather than root hydration is the main signal for regulating plant responses to moisture. © 2015 John Wiley & Sons Ltd.
Posa, Mihalj; Pilipović, Ana; Lalić, Mladena
2010-11-01
Many of bile acids' (BA) physiological properties, as receptor binding, activation of ionic channels, binding to blood proteins, etc. are due to their hydrophobicity. On the other hand, hydrophobicity determines BAs' physico-chemical characteristics as micelle forming and adsorption (surface activity). However, BA hydrophobicity is not determined solely by their structure. Medium composition, especially the concentration of electrolytes has influence on BA hydrophobicity. Thus, the objective of this work was to examine the effect of NaCl on hydrophobicity of selected bile acids. This influence is specified with the retention factor k (reversed phase high pressure liquid chromatography (RPHPLC)) and critical micellar concentration (CMC) determined by non-invasive NMR method. The value of lnk elevates with the increase in mobile phase NaCl concentration i.e. Deltalnk/Deltac(NaCl) depends on the number of water molecules not stabilised by hydrogen bonds in bile acid hydration sheath. For bile acids that contain hydroxyl groups (except those with beta equatorial hydroxyl groups) the value of |DeltalnCMC/Deltac(NaCl)| rises with the increase in the number of non-stabilized water molecules in their hydration sheath. Even though oxo derivatives of cholic acid have similar chromatographic parameters they behave differently when it comes to CMC. In fact with the introduction of oxo groups the value of its |DeltalnCMC/Deltac(NaCl)| elevates but it results in a decrease in the number of non-stabilized water molecules i.e. hydrophobicity falls. Different behaviour of oxo derivatives implicate that, besides "hydrophobic interactions" in their micelles, there are also hydrogen bonds i.e. fiord effect exists. Copyright (c) 2010 Elsevier B.V. All rights reserved.
Electrooxidation of pyrrole-terminated self-assembled lipoic acid derivatives
NASA Astrophysics Data System (ADS)
Cabrita, Joana F.; Viana, Ana S.; Eberle, Christoph; Montforts, Franz-Peter; Mourato, Ana; Abrantes, Luisa M.
2009-08-01
New pyrrole derivatives, pyrrolyl lipoic acid (Py-LA 3) and dipyrrolyl lipoic acid (Py 2-LA 2) have been used for surface attachment and immobilisation on gold surfaces, by self-assembly. The electrooxidation of the surface-confined pyrroles was analysed by cyclic voltammetry and the modified electrodes morphological and thickness changes addressed by scanning probe microscopy and ellipsometry. The data support the formation of oligomers as a result of the pendant-pyrrolyl units ease oxidation but provide no evidence of an effective subsequent polymerisation.
Catalytic amino acid production from biomass-derived intermediates
DOE Office of Scientific and Technical Information (OSTI.GOV)
Deng, Weiping; Wang, Yunzhu; Zhang, Sui
Amino acids are the building blocks for protein biosynthesis and find use in myriad industrial applications including in food for humans, in animal feed, and as precursors for bio-based plastics, among others. However, the development of efficient chemical methods to convert abundant and renewable feedstocks into amino acids has been largely unsuccessful to date. To that end, here we report a heterogeneous catalyst that directly transforms lignocellulosic biomass-derived a-hydroxyl acids into a-amino acids, including alanine, leucine, valine, aspartic acid, and phenylalanine in high yields. The reaction follows a dehydrogenation-reductive amination pathway, with dehydrogenation as the rate-determining step. Ruthenium nanoparticles supportedmore » on carbon nanotubes (Ru/CNT) exhibit exceptional efficiency compared with catalysts based on other metals, due to the unique, reversible enhancement effect of NH 3 on Ru in dehydrogenation. Based on the catalytic system, a two-step chemical process was designed to convert glucose into alanine in 43% yield, comparable with the well-established microbial cultivation process, and therefore, the present strategy enables a route for the production of amino acids from renewable feedstocks. Moreover, a conceptual process design employing membrane distillation to facilitate product purification is proposed and validated. Overall, this study offers a rapid and potentially more efficient chemical method to produce amino acids from woody biomass components.« less
Catalytic amino acid production from biomass-derived intermediates
Deng, Weiping; Zhang, Sui; Gupta, Krishna M.; Hülsey, Max J.; Asakura, Hiroyuki; Liu, Lingmei; Han, Yu; Karp, Eric M.; Jiang, Jianwen; Tanaka, Tsunehiro; Wang, Ye
2018-01-01
Amino acids are the building blocks for protein biosynthesis and find use in myriad industrial applications including in food for humans, in animal feed, and as precursors for bio-based plastics, among others. However, the development of efficient chemical methods to convert abundant and renewable feedstocks into amino acids has been largely unsuccessful to date. To that end, here we report a heterogeneous catalyst that directly transforms lignocellulosic biomass-derived α-hydroxyl acids into α-amino acids, including alanine, leucine, valine, aspartic acid, and phenylalanine in high yields. The reaction follows a dehydrogenation-reductive amination pathway, with dehydrogenation as the rate-determining step. Ruthenium nanoparticles supported on carbon nanotubes (Ru/CNT) exhibit exceptional efficiency compared with catalysts based on other metals, due to the unique, reversible enhancement effect of NH3 on Ru in dehydrogenation. Based on the catalytic system, a two-step chemical process was designed to convert glucose into alanine in 43% yield, comparable with the well-established microbial cultivation process, and therefore, the present strategy enables a route for the production of amino acids from renewable feedstocks. Moreover, a conceptual process design employing membrane distillation to facilitate product purification is proposed and validated. Overall, this study offers a rapid and potentially more efficient chemical method to produce amino acids from woody biomass components. PMID:29712826
Catalytic amino acid production from biomass-derived intermediates.
Deng, Weiping; Wang, Yunzhu; Zhang, Sui; Gupta, Krishna M; Hülsey, Max J; Asakura, Hiroyuki; Liu, Lingmei; Han, Yu; Karp, Eric M; Beckham, Gregg T; Dyson, Paul J; Jiang, Jianwen; Tanaka, Tsunehiro; Wang, Ye; Yan, Ning
2018-05-15
Amino acids are the building blocks for protein biosynthesis and find use in myriad industrial applications including in food for humans, in animal feed, and as precursors for bio-based plastics, among others. However, the development of efficient chemical methods to convert abundant and renewable feedstocks into amino acids has been largely unsuccessful to date. To that end, here we report a heterogeneous catalyst that directly transforms lignocellulosic biomass-derived α-hydroxyl acids into α-amino acids, including alanine, leucine, valine, aspartic acid, and phenylalanine in high yields. The reaction follows a dehydrogenation-reductive amination pathway, with dehydrogenation as the rate-determining step. Ruthenium nanoparticles supported on carbon nanotubes (Ru/CNT) exhibit exceptional efficiency compared with catalysts based on other metals, due to the unique, reversible enhancement effect of NH 3 on Ru in dehydrogenation. Based on the catalytic system, a two-step chemical process was designed to convert glucose into alanine in 43% yield, comparable with the well-established microbial cultivation process, and therefore, the present strategy enables a route for the production of amino acids from renewable feedstocks. Moreover, a conceptual process design employing membrane distillation to facilitate product purification is proposed and validated. Overall, this study offers a rapid and potentially more efficient chemical method to produce amino acids from woody biomass components. Copyright © 2018 the Author(s). Published by PNAS.
Catalytic amino acid production from biomass-derived intermediates
Deng, Weiping; Wang, Yunzhu; Zhang, Sui; ...
2018-04-30
Amino acids are the building blocks for protein biosynthesis and find use in myriad industrial applications including in food for humans, in animal feed, and as precursors for bio-based plastics, among others. However, the development of efficient chemical methods to convert abundant and renewable feedstocks into amino acids has been largely unsuccessful to date. To that end, here we report a heterogeneous catalyst that directly transforms lignocellulosic biomass-derived a-hydroxyl acids into a-amino acids, including alanine, leucine, valine, aspartic acid, and phenylalanine in high yields. The reaction follows a dehydrogenation-reductive amination pathway, with dehydrogenation as the rate-determining step. Ruthenium nanoparticles supportedmore » on carbon nanotubes (Ru/CNT) exhibit exceptional efficiency compared with catalysts based on other metals, due to the unique, reversible enhancement effect of NH 3 on Ru in dehydrogenation. Based on the catalytic system, a two-step chemical process was designed to convert glucose into alanine in 43% yield, comparable with the well-established microbial cultivation process, and therefore, the present strategy enables a route for the production of amino acids from renewable feedstocks. Moreover, a conceptual process design employing membrane distillation to facilitate product purification is proposed and validated. Overall, this study offers a rapid and potentially more efficient chemical method to produce amino acids from woody biomass components.« less
NASA Astrophysics Data System (ADS)
Du, Yong; Xue, Jiadan; Cai, Qiang; Zhang, Qi
2018-02-01
Vibrational spectroscopic methods, including terahertz absorption and Raman scattering spectroscopy, were utilized for the characterization and analysis of gamma-aminobutyric acid (GABA), benzoic acid (BA), and the corresponding GABA-BA cocrystal formation under various pH values of aqueous solution. Vibrational spectroscopic results demonstrated that the solvent GABA-BA cocrystal, similar as grinding counterpart, possessed unique characteristic features compared with that of starting parent compounds. The change of vibrational modes for GABA-BA cocrystal comparing with starting components indicates there is strong inter-molecular interaction between GABA and BA molecules during its cocrystallization process. Formation of GABA-BA cocrystal under slow solvent evaporation is impacted by the pH value of aqueous solution. Vibrational spectra indicate that the GABA-BA cocrystal could be stably formed with the solvent condition of 2.00 ≤ pH ≤ 7.00. In contrast, such cocrystallization did not occur and the cocrystal would dissociate into its parent components when the pH value of solvent is lower than 2.00. This study provides experimental benchmark to discriminate and identify the structure of cocrystal and also pH-dependent cocrystallization effect with vibrational spectroscopic techniques in solid-state pharmaceutical fields.
Mogaki, Rina
2015-01-01
Water-soluble bioadhesive polymers bearing multiple guanidinium ion (Gu+) pendants at their side-chain termini (Gluen–BA, n = 10 and 29) that were conjugated with benzamidine (BA) as a trypsin inhibitor were developed. The Gluen–BA molecules are supposed to adhere to oxyanionic regions of the trypsin surface, even in buffer, via a multivalent Gu+/oxyanion salt-bridge interaction, such that their BA group properly blocks the substrate-binding site. In fact, Glue10–BA and Glue29–BA exhibited 35- and 200-fold higher affinities for trypsin, respectively, than a BA derivative without the glue moiety (TEG–BA). Most importantly, Glue10–BA inhibited the protease activity of trypsin 13-fold more than TEG–BA. In sharp contrast, mGlue27–BA, which bears 27 Gu+ units along the main chain and has a 5-fold higher affinity than TEG–BA for trypsin, was inferior even to TEG–BA for trypsin inhibition. PMID:28706668
Norimatsu, Yuka; Kawashima, Junko; Takano-Yamamoto, Teruko; Takahashi, Nobuhiro
2015-09-01
Both Streptococcus and Actinomyces can produce acids from dietary sugars and are frequently found in caries lesions. In the oral cavity, nitrogenous compounds, such as peptides and amino acids, are provided continuously by saliva and crevicular gingival fluid. Given that these bacteria can also utilize nitrogen compounds for their growth, it was hypothesized that nitrogenous compounds may influence their acid production; however, no previous studies have examined this topic. Therefore, the present study aimed to assess the effects of nitrogenous compounds (tryptone and glutamate) on glucose-derived acid production by Streptococcus and Actinomyces. Acid production was evaluated using a pH-stat method under anaerobic conditions, whereas the amounts of metabolic end-products were quantified using high performance liquid chromatography. Tryptone enhanced glucose-derived acid production by up to 2.68-fold, whereas glutamate enhanced Streptococcus species only. However, neither tryptone nor glutamate altered the end-product profiles, indicating that the nitrogenous compounds stimulate the whole metabolic pathways involving in acid production from glucose, but are not actively metabolized, nor do they alter metabolic pathways. These results suggest that nitrogenous compounds in the oral cavity promote acid production by Streptococcus and Actinomyces in vivo. © 2015 The Societies and Wiley Publishing Asia Pty Ltd.
NASA Astrophysics Data System (ADS)
Liu, Shuanglong; Vorobyova, Ivetta; Park, Ryan; Conti, Peter S.
2017-10-01
comparable to other reported RGD-derived radiopharmaceuticals labeled with 64Cu and 18F. Therefore, 64Cu-BaBaSar-RGD2 can be safely injected into humans for studying integrin αvβ3 expression non-invasively.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lake, April D.; Novak, Petr; Shipkova, Petia
2013-04-15
Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the ‘classical’ (neutral) and ‘alternative’ (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BAmore » profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. - Highlights: ► Altered hepatic bile acid composition is observed in progressive NAFLD. ► Bile acid synthesis enzymes are transcriptionally altered in NASH livers. ► Increased levels of taurine and conjugated bile
Chong, Julie; Pierrel, Marie-Agnès; Atanassova, Rossitza; Werck-Reichhart, Danièle; Fritig, Bernard; Saindrenan, Patrick
2001-01-01
Salicylic acid (SA) is a key endogenous component of local and systemic disease resistance in plants. In this study, we investigated the role of benzoic acid (BA) as precursor of SA biosynthesis in tobacco (Nicotiana tabacum cv Samsun NN) plants undergoing a hypersensitive response following infection with tobacco mosaic virus or in tobacco cell suspensions elicited with β-megaspermin, an elicitor from Phytophthora megasperma. We found a small pool of conjugated BA in healthy leaves and untreated cell suspensions of tobacco, whereas free BA levels were barely detectable. Infection of plants with tobacco mosaic virus or elicitation of cells led to a rapid de novo synthesis and accumulation of conjugated BA, whereas free BA was weakly induced. In presence of diphenylene iodonium, an inhibitor of superoxide anion formation, SA accumulation was abolished in elicited cells and much higher BA levels were concomitantly induced, mainly as a conjugated form. Furthermore, piperonylic acid, an inhibitor of cinnamate-4-hydroxylase was used as a powerful tool to redirect the metabolic flow from the main phenylpropanoid pathway into the SA biosynthetic branch. Under these conditions, in vivo labeling and radioisotope dilution experiments with [14C]trans-cinnamic acid as precursor clearly indicated that the free form of BA produced in elicited tobacco cells is not the major precursor of SA biosynthesis. The main conjugated form of BA accumulating after elicitation of tobacco cells was identified for the first time as benzoyl-glucose. Our data point to the likely role of conjugated forms of BA in SA biosynthesis. PMID:11154339
DOE Office of Scientific and Technical Information (OSTI.GOV)
Au, Kinfai; Ren, Jingshan; Division of Structural Biology, The Henry Wellcome Building for Genomic Medicine, Oxford University, Roosevelt Drive, Oxford OX3 7BN
2008-05-01
Structures of BA0252, an alanine racemase from B. anthracis, in the presence and absence of the inhibitor (R)-1-aminoethylphosphonic acid (l-Ala-P) and determined by X-ray crystallography to resolutions of 2.1 and 1.47 Å, respectively, are described. Bacillus anthracis, the causative agent of anthrax, has been targeted by the Oxford Protein Production Facility to validate high-throughput protocols within the Structural Proteomics in Europe project. As part of this work, the structures of an alanine racemase (BA0252) in the presence and absence of the inhibitor (R)-1-aminoethylphosphonic acid (l-Ala-P) have determined by X-ray crystallo@@graphy to resolutions of 2.1 and 1.47 Å, respectively. Difficulties inmore » crystallizing this protein were overcome by the use of reductive methylation. Alanine racemase has attracted much interest as a possible target for anti-anthrax drugs: not only is d-alanine a vital component of the bacterial cell wall, but recent studies also indicate that alanine racemase, which is accessible in the exosporium, plays a key role in inhibition of germination in B. anthracis. These structures confirm the binding mode of l-Ala-P but suggest an unexpected mechanism of inhibition of alanine racemase by this compound and could provide a basis for the design of improved alanine racemase inhibitors with potential as anti-anthrax therapies.« less
Liquidus Diagram of the Ba-Y-Cu-O System in the Vicinity of the Ba2YCu3O6+x Phase Field
Wong-Ng, Winnie; Cook, Lawrence P.
1998-01-01
This paper describes the melting equilibria in the vicinity of the high Tc phase Ba2YCu3O6+x, including evidence for two Ba-Y-Cu-O immiscible liquids. Melting equilibria have been investigated in purified air using a combination of differential thermal analysis (DTA), thermogravimetric analysis (TGA), powder x-ray diffraction (XRD), MgO wick entrapment of liquid for analysis, scanning electron microscopy (SEM) coupled with energy dispersive x-ray analysis (EDS), and hydrogen reduction for determination of copper oxidation state. For relatively barium-rich compositions, it was necessary to prepare the starting materials under controlled atmosphere conditions using BaO. A liquidus diagram was derived from quantitative data for the melts involved in various melting reactions. In general the 1/2(Y2O3) contents of the melts participating in these equilibria were low (mole fraction <4 %). The primary phase field of Ba2YCu3O6+x occurs at a mole fraction of <2.0 % 1/2Y2O3 and lies very close along the BaO-CuOx edge, extending from a mole fraction of ≈43 % CuO to a mole fraction of ≈76 % CuO. It is divided by a liquid miscibility gap and extends on either side about this gap. The topological sequence of melting reactions associated with the liquidus is presented as a function of temperature. Implications for the growth of Ba2YCu3O6+x crystals are discussed. PMID:28009382
Adisakwattana, Sirichai
2017-01-01
With recent insight into the development of dietary supplements and functional foods, search of effective phytochemical compounds and their mechanisms involved in prevention and management of diabetes and its complications are now being assessed. Cinnamic acid and its derivatives occur naturally in high levels of plant-based foods. Among various biological activities, cinnamic acid and its derivatives are associated with a beneficial influence on diabetes and its complications. The aim of the review is to summarize the potential mechanisms of these compounds for prevention and management of diabetes and its complications. Based on several in vitro studies and animal models, cinnamic acid and its derivatives act on different mechanism of actions, including stimulation of insulin secretion, improvement of pancreatic β-cell functionality, inhibition of hepatic gluconeogenesis, enhanced glucose uptake, increased insulin signaling pathway, delay of carbohydrate digestion and glucose absorption, and inhibition of protein glycation and insulin fibrillation. However, due to the limited intestinal absorption being a result of low bioavailability of cinnamic acid and its derivatives, current improvement efforts with entrapping into solid and liquid particles are highlighted. Further human clinical studies are needed to clarify the effects of cinnamic acid and its derivatives in diabetic patients. PMID:28230764
Benzoylsalicylic acid derivatives as defense activators in tobacco and Arabidopsis.
Kamatham, Samuel; Pallu, Reddanna; Pasupulati, Anil Kumar; Singh, Surya Satyanarayana; Gudipalli, Padmaja
2017-11-01
Systemic acquired resistance (SAR) is a long lasting inducible whole plant immunity often induced by either pathogens or chemical elicitors. Salicylic acid (SA) is a known SAR signal against a broad spectrum of pathogens in plants. In a recent study, we have reported that benzoylsalicylic acid (BzSA) is a SAR inducer in tobacco and Arabidopsis plants. Here, we have synthesized BzSA derivatives using SA and benzoyl chlorides of various moieties as substrates. The chemical structures of BzSA derivatives were elucidated using Infrared spectroscopy (IR), Nuclear magnetic spectroscopy (NMR) and High-resolution mass spectrometer (HRMS) analysis. The bioefficacy of BzSA derivatives in inducing defense response against tobacco mosaic virus (TMV) was investigated in tobacco and SA abolished transgenic NahG Arabidopsis plants. Interestingly, pre-treatment of local leaves of tobacco with BzSA derivatives enhanced the expression of SAR genes such as NPR1 [Non-expressor of pathogenesis-related (PR) genes 1], PR and other defense marker genes (HSR203, SIPK, WIPK) in systemic leaves. Pre-treatment of BzSA derivatives reduced the spread of TMV infection to uninfected areas by restricting lesion number and diameter both in local and systemic leaves of tobacco in a dose-dependent manner. Furthermore, pre-treatment of BzSA derivatives in local leaves of SA deficient Arabidopsis NahG plants induced SAR through AtPR1 and AtPR5 gene expression and reduced leaf necrosis and curling symptoms in systemic leaves as compared to BzSA. These results suggest that BzSA derivatives are potent SAR inducers against TMV in tobacco and Arabidopsis. Copyright © 2017 Elsevier Ltd. All rights reserved.
Photoelectron spectra and biological activity of cinnamic acid derivatives revisited.
Novak, Igor; Klasinc, Leo; McGlynn, Sean P
2018-01-15
The electronic structures of several derivatives of cinnamic acid have been studied by UV photoelectron spectroscopy (UPS) and Green's function quantum chemical calculations. The spectra reveal the presence of dimers in the gas phase for p-coumaric and ferulic acids. The electronic structure analysis has been related to the biological properties of these compounds through the analysis of some structure-activity relationships (SAR). Copyright © 2017 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Pizzarello, Sandra; Cooper, George W.
2001-07-01
The varied organic suite extracted from the Murchison meteorite contains several amino acids that are common to the biosphere. Some of these have been found to be non-racemic, but the indigenous nature of their L-enantiomeric excesses has been subject to debate in view of possible terrestrial contamination. We have investigated two amino acids of common terrestrial and meteoritic occurrence, alanine and glutamic acid, and assessed their indigenous enantiomeric ratios in the Murchison and Murray meteorites through the ratios of some of their derivatives. Analyzed were: N-acetyl alanine, ??imino propioacetic acid, N-acetyl glutamic acid and pyroglutamic acid. Both alanine derivatives were found to be racemic, while those of glutamic acid showed L-enantiomeric excesses varying from 16% to 47.2% for pyroglutamic acid, and from 8.6% to 41% for N-acetyl glutamic acid. The ?13C was determined for the two enantiomers of Murchison pyroglutamic acid both before and after acid hydrolysis of the lactam to glutamic acid. The values of +27.7 (D-pyro), +10.0 (L-pyro), +32.2 (D-glu) and +14.6 (L-glu) were obtained. The racemic nature of alanine derivatives strongly suggests that alanine itself, as indigenous to the meteorite, is racemic. The explanation of the L-enantiomeric excesses found for glutamic acid derivatives is less direct; however, the variability of the enantiomeric ratios for these compounds and the distinctly lower ?13C values determined for pyroglutamic L-enantiomer point to a terrestrial contamination, possibly dating to the time of fall.
Pereira, G; Vilaça, H; Ferreira, P M T
2013-02-01
Several β-amidodehydroaminobutyric acid derivatives were prepared from N,C-diprotected β-bromodehydroaminobutyric acids and amides by a copper catalyzed C-N coupling reaction. The best reaction conditions include the use of a catalytic amount of CuI, N,N'-dimethylethylenediamine as ligand and K(2)CO(3) as base in toluene at 110 °C. The stereochemistry of the products was determined using NOE difference experiments and the results obtained are in agreement with an E-stereochemistry. Thus, the stereochemistry is maintained in the case of the E-isomers of β-bromodehydroaminobutyric acid derivatives, but when the Z-isomers were used as substrates the reaction proceeds with inversion of configuration. The use of β-bromodehydrodipeptides as substrates was also tested. It was found that the reaction outcome depend on the stereochemistry of the β-bromodehydrodipeptide and on the nature of the first amino acid residue. The products isolated were the β-amidodehydrodipeptide derivatives and/or the corresponding dihydropyrazines. The same catalytic system (CuI/N,N'-dimethylethylene diamine) was used in the C-O coupling reactions between a tyrosine derivative and aryl bromides. The new O-aryltyrosine derivatives were isolated in moderate to good yields. The photophysical properties of two of these compounds were studied in four solvents of different polarity. The results show that these compounds after deprotection can be used as fluorescence markers.
Kim, Sung Won; Hooker, Jacob M.; Otto, Nicola; Win, Khaing; Muench, Lisa; Shea, Colleen; Carter, Pauline; King, Payton; Reid, Alicia E.; Volkow, Nora D.; Fowler, Joanna S.
2013-01-01
The fatty acids, n-butyric acid (BA), 4-phenylbutyric acid (PBA) and valproic acid (VPA, 2-propylpentanoic acid) have been used for many years in the treatment of a variety of CNS and peripheral organ diseases including cancer. New information that these drugs alter epigenetic processes through their inhibition of histone deacetylases (HDACs) has renewed interest in their biodistribution and pharmacokinetics and the relationship of these properties to their therapeutic and side effect profile. In order to determine the pharmacokinetics and biodistribution of these drugs in primates, we synthesized their carbon-11 labeled analogues and performed dynamic positron emission tomography (PET) in six female baboons over 90 min. The carbon-11 labeled carboxylic acids were prepared by using 11CO2 and the appropriate Grignard reagents. [11C]BA was metabolized rapidly (only 20% of the total carbon-11 in plasma was parent compound at 5 min post injection) whereas for VPA and PBA 98% and 85% of the radioactivity was the unmetabolized compound at 30 min after their administration respectively. The brain uptake of all three carboxylic acids was very low (<0.006%ID/cc, BA>VPA>PBA), which is consistent with the need for very high doses for therapeutic efficacy. Most of the radioactivity was excreted through the kidneys and accumulated in the bladder. However, the organ biodistribution between the drugs differed. [11C]BA showed relatively high uptake in spleen and pancreas whereas [11C]PBA showed high uptake in liver and heart. Notably, [11C]VPA showed exceptionally high heart uptake possibly due to its involvement in lipid metabolism. The unique biodistribution of each of these drugs may be of relevance in understanding their therapeutic and side effect profile including their teratogenic effects. PMID:23906667
Kim, Sung Won; Hooker, Jacob M; Otto, Nicola; Win, Khaing; Muench, Lisa; Shea, Colleen; Carter, Pauline; King, Payton; Reid, Alicia E; Volkow, Nora D; Fowler, Joanna S
2013-10-01
The fatty acids, n-butyric acid (BA), 4-phenylbutyric acid (PBA) and valproic acid (VPA, 2-propylpentanoic acid) have been used for many years in the treatment of a variety of CNS and peripheral organ diseases including cancer. New information that these drugs alter epigenetic processes through their inhibition of histone deacetylases (HDACs) has renewed interest in their biodistribution and pharmacokinetics and the relationship of these properties to their therapeutic and side effect profiles. In order to determine the pharmacokinetics and biodistribution of these drugs in primates, we synthesized their carbon-11 labeled analogues and performed dynamic positron emission tomography (PET) in six female baboons over 90 min. The carbon-11 labeled carboxylic acids were prepared by using (11)CO2 and the appropriate Grignard reagents. [(11)C]BA was metabolized rapidly (only 20% of the total carbon-11 in plasma was parent compound at 5 min post injection) whereas for VPA and PBA 98% and 85% of the radioactivity were the unmetabolized compound at 30 min after their administration respectively. The brain uptake of all three carboxylic acids was very low (<0.006%ID/cc, BA>VPA>PBA), which is consistent with the need for very high doses for therapeutic efficacy. Most of the radioactivity was excreted through the kidneys and accumulated in the bladder. However, the organ biodistribution between the drugs differed. [(11)C]BA showed relatively high uptake in spleen and pancreas whereas [(11)C]PBA showed high uptake in liver and heart. Notably, [(11)C]VPA showed exceptionally high heart uptake possibly due to its involvement in lipid metabolism. The unique biodistribution of each of these drugs may be of relevance in understanding their therapeutic and side effect profile including their teratogenic effects. © 2013.
NASA Astrophysics Data System (ADS)
Min, Jiang; Meng-Xia, Xie; Dong, Zheng; Yuan, Liu; Xiao-Yu, Li; Xing, Chen
2004-04-01
Cinnamic acid and its derivatives possess various biological effects in remedy of many diseases. Interaction of cinnamic acid and its hydroxyl derivatives, p-coumaric acid and caffeic acid, with human serum albumin (HSA), and concomitant changes in its conformation were studied using fluorescence and Fourier transform infrared spectroscopic methods. Fluorescence data revealed the presence of one binding site on HSA for cinnamic acid and its hydroxyl derivatives, and their binding constants ( KA) are caffeic acid> p-coumaric acid> cinnamic acid when Cdrug/ CHSA ranging from 1 to 10. The changes of the secondary structure of HSA after interacting with the three drugs are estimated, respectively by combining the curve-fitting results of amid I and amid III bands. The α-helix structure has a decrease of ≈9, 5 and 3% after HSA interacted with caffeic acid, p-coumaric acid and cinnamic acid, respectively. It was found that the hydroxyls substituted on aromatic ring of the drugs play an important role in the changes of protein's secondary structure. Combining the result of fluorescence quenching and the changes of secondary structure of HSA after interaction with the three drugs, the drug-HSA interaction mode was discussed.
High rate capability of a BaTiO3-decorated LiCoO2 cathode prepared via metal organic decomposition
NASA Astrophysics Data System (ADS)
Teranishi, Takashi; Katsuji, Naoto; Yoshikawa, Yumi; Yoneda, Mika; Hayashi, Hidetaka; Kishimoto, Akira; Yoda, Koji; Motobayashi, Hidefumi; Tasaki, Yuzo
2016-10-01
Metal organic decomposition (MOD) using octylic acid salts was applied to synthesize a BaTiO3-LiCoO2 (BT-LC) composite powder. The Ba and Ti octylates were utilized as metal precursors, in an attempt to synthesize homogeneous BT nanoparticles on the LC matrix. The BT-LC composite, having a phase-separated composite structure without any impurity phase, was successfully obtained by optimizing the MOD procedure. The composite prepared using octylate precursors exhibited a sharper distribution and better dispersibility of decorated BT particles. Additionally, the average particle size of the decorated BTs using metal octylate was reduced to 23.3 nm, compared to 44.4 nm from conventional processes using Ba acetate as well as Ti alkoxide as precursors. The composite cathode displayed better cell performance than its conventional counterpart; the discharge capacity of the metal octylate-derived specimen was 55.6 mAh/g at a 50C rate, corresponding to 173% of the capacity of the conventional specimen (32.2 mAh/g). The notable improvement in high rate capability obtained in this study, compared with the conventional route, was attributed to the higher density of the triple junction formed by the BT-LC-electrolyte interface.
Gao, Yazhi; Liu, Wei; Wang, Xiaoxiong; Yang, Lihua; Han, Su; Chen, Shiguo; Strasser, Reto Jörg; Valverde, Bernal E; Qiang, Sheng
2018-07-01
The effects of four phytotoxins usnic acid (UA), salicylic acid (SA), cinnamic acid (CA) and benzoic acid (BA) on photosynthesis of Chlamydomonas reinhardtii were studied in vivo to identify and localise their initial action sites on two photosystems. Our experimental evidence shows that the four phytotoxins have multiple targets in chloroplasts, which mainly lie in photosystem II (PSII), not photosystem I (PSI). They share an original action site by blocking electron transport beyond Q A (primary plastoquinone acceptor) at PSII acceptor side since a fast increase of the J-step level is the greatest change in chlorophyll a fluorescence induction kinetics OJIP in C. reinhardtii cells treated with the phytotoxins. UA decreases photosynthetic activity by reducing O 2 evolution rate, interrupting PSII electron transport at both the donor and acceptor sides, inactivating the PSII reaction centers (RCs), reducing the content of chlorophylls and carotenoids, destroying the conformation of antenna pigment assemblies, and casuing the degradation of D1/D2 proteins. SA damage to photosynthetic machinery is mainly attributed to inhibition of PSII electron transport beyond Q A at the acceptor side, inactivation of the PSII RCs, reduction of chlorophyll content, digestion of thylakoid ploypeptides and destabilization of thylakoid membranes. Both CA and BA affect the photosynthetic process by decreasing PSII electron transport efficiency at the acceptor side and the amount of active PSII RCs. Besides, the initial cause of BA-inhibiting photosynthesis is also assocaited with the O 2 evolution rate and the disconnection of some antenna molecules from PSII RCs. Copyright © 2018 Elsevier Masson SAS. All rights reserved.
The Ba 4d-4f giant dipole resonance in complex Ba/Si compounds
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sahle, Ch. J.; Sternemann, C.; Sternemann, H.
2014-08-06
The shape of the Ba 4d–4f giant dipole resonance is studied for Ba atoms embedded inside complex Si networks covering structures consisting of Si nanocages and nanotubes, i.e. the clathrate Ba 8Si 46, the complex compound BaSi 6, and the semiconducting BaSi 2. Here, non-resonant x-ray Raman scattering is used to investigate confinement effects on the shape of the giant resonance in the vicinity of the Ba NIV, V-edge. The distinct momentum transfer dependence of the spectra is analyzed and discussed. The measurements are compared to calculations of the giant resonance within time-dependent local density approximation in the dipole limit.more » No modulation of the giant resonance's shape for Ba atoms confined in different local environments was observed, in contrast to the calculations. The absence of such shape modulation for complex Ba/Si compounds is discussed providing important implications for further studies of giant resonance phenomena utilizing both theory and experiment.« less
The Ba 4d-4f giant dipole resonance in complex Ba/Si compounds
NASA Astrophysics Data System (ADS)
Sahle, Ch J.; Sternemann, C.; Sternemann, H.; Tse, J. S.; Gordon, R. A.; Desgreniers, S.; Maekawa, S.; Yamanaka, S.; Lehmkühler, F.; Wieland, D. C. F.; Mende, K.; Huotari, S.; Tolan, M.
2014-02-01
The shape of the Ba 4d-4f giant dipole resonance is studied for Ba atoms embedded inside complex Si networks covering structures consisting of Si nanocages and nanotubes, i.e. the clathrate Ba8Si46, the complex compound BaSi6, and the semiconducting BaSi2. Here, non-resonant x-ray Raman scattering is used to investigate confinement effects on the shape of the giant resonance in the vicinity of the Ba NIV, V-edge. The distinct momentum transfer dependence of the spectra is analyzed and discussed. The measurements are compared to calculations of the giant resonance within time-dependent local density approximation in the dipole limit. No modulation of the giant resonance’s shape for Ba atoms confined in different local environments was observed, in contrast to the calculations. The absence of such shape modulation for complex Ba/Si compounds is discussed providing important implications for further studies of giant resonance phenomena utilizing both theory and experiment.
Spin labeled amino acid nitrosourea derivatives--synthesis and antitumour activity.
Zheleva, A; Raikov, Z; Ilarionova, M; Todorov, D
1995-01-01
The synthesis of three spin labeled derivatives of N-[N'-(chloroethyl)-N'-nitrosocarbamoyl] amino acids is reported. The new nitrosoureas are obtained by condensation of the corresponding N-[N'-(2-chloroethyl)-N'-nitrosocarbamoyl] amino acid with 2,2,6,6-tetramethyl-1-oxyl-4-aminopiperidine using dicyclohexylcarbodiimide. Their chemical structures are confirmed by elemental analysis, IR, MS, and EPR spectroscopy. All newly synthesized compounds showed high antitumour activity against the lymphoid leukemia L1210 in BDF1 mice.
Du, Yong; Xue, Jiadan; Cai, Qiang; Zhang, Qi
2018-02-15
Vibrational spectroscopic methods, including terahertz absorption and Raman scattering spectroscopy, were utilized for the characterization and analysis of gamma-aminobutyric acid (GABA), benzoic acid (BA), and the corresponding GABA-BA cocrystal formation under various pH values of aqueous solution. Vibrational spectroscopic results demonstrated that the solvent GABA-BA cocrystal, similar as grinding counterpart, possessed unique characteristic features compared with that of starting parent compounds. The change of vibrational modes for GABA-BA cocrystal comparing with starting components indicates there is strong inter-molecular interaction between GABA and BA molecules during its cocrystallization process. Formation of GABA-BA cocrystal under slow solvent evaporation is impacted by the pH value of aqueous solution. Vibrational spectra indicate that the GABA-BA cocrystal could be stably formed with the solvent condition of 2.00≤pH≤7.00. In contrast, such cocrystallization did not occur and the cocrystal would dissociate into its parent components when the pH value of solvent is lower than 2.00. This study provides experimental benchmark to discriminate and identify the structure of cocrystal and also pH-dependent cocrystallization effect with vibrational spectroscopic techniques in solid-state pharmaceutical fields. Copyright © 2017 Elsevier B.V. All rights reserved.
Lu, Li Ping; Wan, Yan Ping; Xun, Peng Cheng; Zhou, Ke Jun; Chen, Cheng; Cheng, Si Yang; Zhang, Min Zhong; Wu, Chun Hua; Lin, Wei Wei; Jiang, Ying; Feng, Hai Xia; Wang, Jia Lu; He, Ka; Cai, Wei
2017-08-01
To determine serum bile acid (BA) and fatty acid (FA) profiles in Chinese children with non-alcoholic fatty liver disease (NAFLD). A total 76 children aged 4-17 years were categorized into three groups according to the presence and absence of as well as the severity of NAFLD, that is, non-NAFLD (control), mild and moderate to severe NAFLD groups, respectively, based on their liver ultrasonography findings. Serum BA and FA profiles were quantified separately by mass spectrometry and gas chromatography. General linear models were performed to assess the differences among the groups. After adjusted for potential confounders, children with NAFLD had higher levels of chenodeoxycholic acid (CDCA), unconjugated primary BAs (CDCA + cholic acid) but lower levels of deoxycholic acid (DCA), taurodeoxycholic acid (TDCA), glycodeoxycholic acid (GDCA), total DCA (DCA + TDCA + GDCA), glycolithocholic acid (GLCA) and total lithocholic acid (GLCA + taurolithocholic acid) than children without NAFLD. As for FAs, children with mild and moderate to severe NAFLD had higher levels of n-7 monounsaturated FA. Circulating BA and FA profiles may change in children with NAFLD. Further studies are needed to determine their associations and to understand the underlying mechanism of action. © 2017 Chinese Medical Association Shanghai Branch, Chinese Society of Gastroenterology, Renji Hospital Affiliated to Shanghai Jiaotong University School of Medicine and John Wiley & Sons Australia, Ltd.
Self-assembled pentacenequinone derivative for trace detection of picric acid.
Bhalla, Vandana; Gupta, Ankush; Kumar, Manoj; Rao, D S Shankar; Prasad, S Krishna
2013-02-01
Pentacenequinone derivative 3 forms luminescent supramolecular aggregates both in bulk as well as in solution phase. In bulk phase at high temperature, long-range stacking of columns leads to formation of stable and ordered columnar mesophase. Further, derivative 3 works as sensitive chemosensor for picric acid (PA) and gel-coated paper strips detect PA at nanomolar level and provide a simple, portable, and low-cost method for detection of PA in aqueous solution, vapor phase, and in contact mode.
Mueller, Michaela; Thorell, Anders; Claudel, Thierry; Jha, Pooja; Koefeler, Harald; Lackner, Carolin; Hoesel, Bastian; Fauler, Guenter; Stojakovic, Tatjana; Einarsson, Curt; Marschall, Hanns-Ulrich; Trauner, Michael
2015-06-01
Bile acids (BAs) are major regulators of hepatic BA and lipid metabolism but their mechanisms of action in non-alcoholic fatty liver disease (NAFLD) are still poorly understood. Here we aimed to explore the molecular and biochemical mechanisms of ursodeoxycholic acid (UDCA) in modulating the cross-talk between liver and visceral white adipose tissue (vWAT) regarding BA and cholesterol metabolism and fatty acid/lipid partitioning in morbidly obese NAFLD patients. In this randomized controlled pharmacodynamic study, we analyzed serum, liver and vWAT samples from 40 well-matched morbidly obese patients receiving UDCA (20 mg/kg/day) or no treatment three weeks prior to bariatric surgery. Short term UDCA administration stimulated BA synthesis by reducing circulating fibroblast growth factor 19 and farnesoid X receptor (FXR) activation, resulting in cholesterol 7α-hydroxylase induction mirrored by elevated C4 and 7α-hydroxycholesterol. Enhanced BA formation depleted hepatic and LDL-cholesterol with subsequent activation of the key enzyme of cholesterol synthesis 3-hydroxy-3-methylglutaryl-CoA reductase. Blunted FXR anti-lipogenic effects induced lipogenic stearoyl-CoA desaturase (SCD) in the liver, thereby increasing hepatic triglyceride content. In addition, induced SCD activity in vWAT shifted vWAT lipid metabolism towards generation of less toxic and more lipogenic monounsaturated fatty acids such as oleic acid. These data demonstrate that by exerting FXR-antagonistic effects, UDCA treatment in NAFLD patients strongly impacts on cholesterol and BA synthesis and induces neutral lipid accumulation in both liver and vWAT. Copyright © 2015 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.
Synthesis of transparent BaTiO3 nanoparticle/polymer composite film using DC field
NASA Astrophysics Data System (ADS)
Kondo, Yusuke; Okumura, Yasuko; Oi, Chifumi; Sakamoto, Wataru; Yogo, Toshinobu
2008-10-01
Transparent BaTiO3 nanoparticle/polymer composite films were synthesized from titanium-organic film and barium ion in aqueous solution under direct current (DC) field. Titanium-organic precursor was synthesized from titanium isopropoxide, acetylacetone and methacrylate derivative. The UV treatment was effective to increase the anti-solubility of the titanium-organic film during DC processing. BaTiO3 nanoparticles were crystallized in the precursor films on stainless substrates without high temperature process, as low as 40°C. The crystallite size of BaTiO3 increased with increasing reaction temperature from 40 to 50 °C at 3.0 V/cm. BaTiO3 nanoparticles also grew in size with increasing reaction time from 15 min to 45 min at 3.0 V/cm and 50 °C. Transparent BaTiO3 nanoparticle/polymer films were synthesized on stainless substrates at 3.0 V/cm and 50°C for 45 min.
Anti-Gastric Ulcer Effect of Betulinic Acid in Male Albino Rats.
Onwuchekwa, C; Oluwole, F S
2015-12-20
Betulinic acid (BA) is a lupane-type triterpene that has been identified and isolated from various plant species used in ethnomedicine in various cultures across the world. This study was undertaken to elucidate the mechanisms underlying the anti-ulcer effect of Betulinic acid. The effect of BA on indomethacin-induced ulcer, gastric mucus secretion, gastric mucus cells count, basal and histamine-induced gastric acid secretion and levels of malondialdehyde formation were studied using dose of 0.5, 1.5, and 3.0 mg/kg. The results showed that BA reduced indomethacin-induced ulceration significantly and significantly increased gastric mucus secretion in the 1.5 mg/kg and 3.0 mg/kg BA treated rats compared to the control rats. There was a significant increase in the mucus cells count in all the treated groups which is in a dose- dependent manner compared to the control group. There was significant decrease in gastric acid secretion in each of the BA treated groups compared to the control. Malondialdehyde concentration significantly decrease in all the treated groups compared to the control. The anti-gastric ulcer effect of BA may be mediated via decreasing gastric acid secretion, increasing gastric mucus secretions, increasing the number of gastric mucus cells and also by reducing the level of MDA concentration.
Performance Characteristics of Borate Fatty Acid Formulations as Mold Inhibitors
Robert D. Coleman; Vina Yang; Carol A. Clausen
2013-01-01
The combination of boric acid (BA) or disodium octaborate tetrahydrate (DOT) and a fatty acid (FA) such as heptanoic, octanoic, and nonanoic acids (C7âC9) is an effective treatment solution for protecting wood structures against mold. BA or DOT alone have substantial potency against insects and decay fungi, but have negligible or no mold inhibitor activity. However,...
NASA Astrophysics Data System (ADS)
Murray, R. W.; Kryc, K. A.; Murray, D. W.
2003-12-01
The use of barite has long been recognized as a promising proxy for export production due to the relationship between its formation and settling biogenic matter. Accordingly, excess Ba (total Ba minus Ba associated with terrigenous material) calculations have been applied as a proxy of barite to assess export production, although this approach may be problematic. For example, because there are additional carrying phases of Ba in sediment other than terrigenous Ba and barite (e.g., oxides, organic matter), excess Ba may not be related in a predictable manner to export production. Indeed, previous workers have also identified the importance of non-barite reservoirs of Ba in sediment traps (e.g., Dymond et al., 1992; Francois et al., 1995) and sediment (e.g., Schroeder et al., 1997; Eagle et al., 2003). Despite these multiple reservoirs, the use of elemental Ba in biogenic sediment as a proxy of export production has a proven and resilient track record. To further understand the partitioning of Ba in biogenic sediment, we sequentially extracted seven, operationally-defined fractions (loosely-bound, exchangeable, carbonate, oxide, organic, opal, and residual) of sediment from surface and downcore samples from a cross-equatorial meridional transect in the equatorial Pacific. We find that Ba is evenly distributed between the sedimentary components with approximately 25-40 percent of the total extracted Ba in each of the exchangeable, carbonate, and oxide fractions for both surface and downcore sediment samples. In the surface sediment transect across the equator, there is no Ba in the residual fraction, and between 10 and 50 percent of the total extracted Ba is in the organic fraction. Also, downcore samples that were extracted from sediments with low relative bulk Ba/Ti tend to have Ba in both the residual and organic fractions as opposed to samples with high relative bulk Ba/Ti where there is a lack of Ba in both the residual and organic fractions. These observations
Severe Acute Local Reactions to a Hyaluronic Acid-derived Dermal Filler
Hays, Geoffrey P.; Caglia, Anthony E.; Caglia, Michael
2010-01-01
Injectable fillers are normally well tolerated by patients with little or no adverse effects. The most common side effects include swelling, redness, bruising, and pain at the injection site. This report describes three cases in which patients injected with a hyaluronic acid-derived injectable filler that is premixed with lidocaine developed adverse reactions including persistent swelling, pain, and nodule formation. Two of the three patients' abscesses were cultured for aerobic and anaerobic bacteria and mycobacterium. All three cultures were negative. Abscess persistence in all cases necessitated physical removal and/or enzymatic degradation with hyaluronidase. The effects subsided only after the product had been removed. Two of these patients were subsequently treated with other hyaluronic acid-derived dermal fillers without adverse events. PMID:20725567
USDA-ARS?s Scientific Manuscript database
Unsaturated and epoxy fatty acid estolides were synthesized from the omega and omega-1 hydroxy fatty acids derived from sophorolipids (SLs) prepared by fermentation from glucose:soybean oil and glucose:oleic acid, respectively. These estolides were utilized as additives in solution-cast poly(3-hydro...
NASA Astrophysics Data System (ADS)
Nikolić, Miloš V.; Mijajlović, Marina Ž.; Jevtić, Verica V.; Ratković, Zoran R.; Novaković, Slađana B.; Bogdanović, Goran A.; Milovanović, Jelena; Arsenijević, Aleksandar; Stojanović, Bojana; Trifunović, Srećko R.; Radić, Gordana P.
2016-07-01
The spectroscopically predicted structure of the obtained copper(II)-complex with S-ethyl derivative of thiosalicylic acid was confirmed by X-ray structural study and compared to previously reported crystal structure of the Cu complex with S-methyl derivative. Single crystals suitable for X-ray measurements were obtained by slow crystallization from a water solution. Cytotoxic effects of S-alkyl (R = benzyl (L1), methyl (L2), ethyl (L3), propyl (L4) and butyl (L5)) derivatives of thiosalicylic acid and the corresponding binuclear copper(II)-complexes on murine colon carcinoma cell lines, CT26 and CT26.CL25 and human colon carcinoma cell line HCT-116 were reported here. The analysis of cancer cell viability showed that all the tested complexes had low cytotoxic effect on murine colon carcinoma cell lines, but several times higher cytotoxicity on normal human colon carcinoma cells.
A new regulatory mechanism for bacterial lipoic acid synthesis
Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun
2015-01-01
Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID
A new regulatory mechanism for bacterial lipoic acid synthesis.
Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun
2015-01-22
Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015
Dwivedi, Gaurav Raj; Tiwari, Nimisha; Singh, Aastha; Kumar, Akhil; Roy, Sudeep; Negi, Arvind Singh; Pal, Anirban; Chanda, Debabrata; Sharma, Ashok; Darokar, Mahendra P
2016-03-01
The purpose of the present study was to study the synergy potential of gallic acid-based derivatives in combination with conventional antibiotics using multidrug resistant cultures of Escherichia coli. Gallic acid-based derivatives significantly reduced the MIC of tetracycline against multidrug resistant clinical isolate of E. coli. The best representative, 3-(3',4,'5'-trimethoxyphenyl)-4,5,6-trimethoxyindanone-1, an indanone derivative of gallic acid, was observed to inhibit ethidium bromide efflux and ATPase which was also supported by in silico docking. This derivative extended the post-antibiotic effect and decreased the mutation prevention concentration of tetracycline. This derivative in combination with TET was able to reduce the concentration of TNFα up to 18-fold in Swiss albino mice. This derivative was nontoxic and well tolerated up to 300 mg/kg dose in subacute oral toxicity study in mice. This is the first report of gallic acid-based indanone derivative as drug resistance reversal agent acting through ATP-dependent efflux pump inhibition.
Docking of oxalyl aryl amino benzoic acid derivatives into PTP1B
Verma, Neelam; Mittal, Minakshi; Verma, Raman kumar
2008-01-01
Protein Tyrosine Phosphatases (PTPs) that function as negative regulators of the insulin signaling cascade have been identified as novel targets for the therapeutic enhancement of insulin action in insulin resistant disease states. Reducing Protein Tyrosine Phosphatase1B (PTP1B) abundance not only enhances insulin sensitivity and improves glucose metabolism but also protects against obesity induced by high fat feeding. PTP1B inhibitors such as Formylchromone derivatives, 1, 2-Naphthoquinone derivatives and Oxalyl aryl amino benzoic derivatives may eventually find an important clinical role as insulin sensitizers in the management of Type-II Diabetes and metabolic syndrome. We have carried out docking of modified oxalyl aryl amino benzoic acid derivatives into three dimensional structure of PTP1B using BioMed CAChe 6.1. These compounds exhibit good selectivity for PTP1B over most of phosphatases in selectivity panel such as SHP-2, LAR, CD45 and TCPTP found in literature. This series of compounds identified the amino acid residues such as Gly220 and Arg221 are important for achieving specificity via H-bonding interactions. Lipophilic side chain of methionine in modified oxalyl aryl amino benzoic acid derivative [1b (a2, b2, c1, d)] lies in closer vicinity of hydrophobic region of protein consisted of Meth258 and Phe52 in comparison to active ligand. Docking Score in [1b (a2, b2, c1, d)] is -131.740Kcal/mol much better than active ligand score -98.584Kcal/mol. This information can be exploited to design PTP1B specific inhibitors. PMID:19238234
Dachineni, Rakesh; Kumar, D. Ramesh; Callegari, Eduardo; Kesharwani, Siddharth S.; Sankaranarayanan, Ranjini; Seefeldt, Teresa; Tummala, Hemachand; Bhat, G. Jayarama
2017-01-01
Aspirin's potential as a drug continues to be evaluated for the prevention of colorectal cancer (CRC). Although multiple targets for aspirin and its metabolite, salicylic acid, have been identified, no unifying mechanism has been proposed to clearly explain its chemopreventive effects. Our goal here was to investigate the ability of salicylic acid metabolites, known to be generated through cytochrome P450 (CYP450) enzymes, and its derivatives as cyclin dependent kinase (CDK) inhibitors to gain new insights into aspirin's chemopreventive actions. Using in vitro kinase assays, for the first time, we demonstrate that salicylic acid metabolites, 2,3-dihydroxy-benzoic acid (2,3-DHBA) and 2,5-dihydroxybenzoic acid (2,5-DHBA), as well as derivatives 2,4-dihydroxybenzoic acid (2,4-DHBA), 2,6-dihydroxybenzoic acid (2,6-DHBA), inhibited CDK1 enzyme activity. 2,3-DHBA and 2,6-DHBA did not inhibit CDK2 and 4; however, both inhibited CDK-6 activity. Interestingly, another derivative, 2,4,6-trihydroxybenzoic acid (2,4,6-THBA) was highly effective in inhibiting CDK1, 2, 4 and 6 activity. Molecular docking studies showed that these compounds potentially interact with CDK1. Immunoblotting experiments showed that aspirin acetylated CDK1, and pre-incubation with salicylic acid and its derivatives prevented aspirin-mediated CDK1 acetylation, which supported the data obtained from molecular docking studies. We suggest that intracellularly generated salicylic acid metabolites through CYP450 enzymes within the colonic epithelial cells, or the salicylic acid metabolites generated by gut microflora may significantly contribute to the preferential chemopreventive effect of aspirin against CRC through inhibition of CDKs. This novel hypothesis and mechanism of action in aspirin's chemopreventive effects opens a new area for future research. In addition, structural modification to salicylic acid derivatives may prove useful in the development of novel CDK inhibitors in cancer prevention and
Fluorescence studies on binding of pyrene and its derivatives to humic acid
NASA Astrophysics Data System (ADS)
Nakashima, K.; Maki, M.; Ishikawa, F.; Yoshikawa, T.; Gong, Y.-K.; Miyajima, T.
2007-07-01
Binding of pyrene (PyH) and its derivatives to humic acid (HA) has been studied by fluorescence spectroscopy. The nature of the interaction between HA and pyrene derivatives are extensively investigated by employing three derivatives ranging from anionic to cationic compounds: 1-pyrenebutylic acid (PyA), 1-pyrenemethanol (PyM), and 1-pyrenebutyltrimethylammonium bromide (PyB). Binding constants between HA and PyX (X = H, A, M, B) are obtained by steady-state fluorescence quenching techniques, and it is found that PyB has a markedly large binding constant among the pyrene family. This is attributed to a strong electrostatic interaction between cationic PyB and anionic HA. The result suggests that an electrostatic interaction plays a dominant role in binding of pyrenes to humic acid. The importance of electrostatic interaction was also confirmed by a salt effect on the binding constant. Influence of collisional quenching on the binding constant, which causes overestimation of the binding constant, was examined by time-resolved fluorescence spectroscopy as well as temperature effect in steady-state fluorescence measurements. It is elucidated that collisional quenching does not much bring overestimation into the binding constants.
Tan, Sang-Nee; Sim, Sai-Peng
2018-04-12
Chronic rhinosinusitis (CRS) increases the risk of developing nasopharyngeal carcinoma (NPC) while nasopharyngeal reflux is known to be one of the major aetiological factors of CRS. Bile acid (BA), the component of gastric duodenal contents, has been recognised as a carcinogen. BA-induced apoptosis was suggested to be involved in human malignancies. Cells have the potential and tendency to survive apoptosis. However, cells that evade apoptosis upon erroneous DNA repair may carry chromosome rearrangements. Apoptotic nuclease, caspase-activated deoxyribonuclease (CAD) has been implicated in mediating translocation in leukaemia. We hypothesised that BA-induced apoptosis may cause chromosome breaks mediated by CAD leading to chromosome rearrangement in NPC. This study targeted the AF9 gene located at 9p22 because 9p22 is one of the most common deletion sites in NPC. We tested the ability of BA at neutral and acidic pH in inducing phosphatidylserine (PS) externalisation, reactive oxygen species (ROS) production, mitochondrial membrane potential (MMP) disruption, and caspase 3/7 activity in normal nasopharyngeal epithelial (NP69) and NPC (TWO4) cells. Inverse-PCR (IPCR) was employed to detect AF9 gene cleavages. To investigate the role of CAD in mediating these cleavages, caspase inhibition was performed. IPCR bands representing AF9 cleaved fragments were sequenced. BA-treated cells showed higher levels of PS externalisation, ROS production, MMP loss and caspase 3/7 activity than untreated control cells. The effect of BA in the induction of these intracellular events was enhanced by acid. BA at neutral and acidic pH also induced significant cleavage of the AF9 gene. These BA-induced gene cleavages were inhibited by Z-DEVD-FMK, a caspase-3 inhibitor. Intriguingly, a few chromosome breaks were identified within the AF9 region that was previously reported to participate in reciprocal translocation between the mixed lineage leukaemia (MLL) and AF9 genes in an acute
Boryczka, Stanisław; Jastrzebska, Maria; Bębenek, Ewa; Kusz, Joachim; Zubko, Maciej; Kadela, Monika; Michalik, Ewa
2012-12-01
X-ray diffraction and infrared spectroscopy measurements for the N,N-dimethylformamide (DMF) and dimethyl sulfoxide (DMSO) solvatomorphs of betulonic acid (BA) were investigated. BA [3-oxolup-20(29)-en-28-oic acid, C(30)H(46)O(3)] exhibits a wide spectrum of biological activities and is considered to be a promising natural agent for the treatment of various cancer diseases. BA as a noncrystalline substance was obtained by oxidation of betulin. Crystal structures and the spectral data allowed analysis of hydrogen bonding (H-bonding), molecular conformation, and crystal packing differences in the solvatomorphs. Crystals of BA solvates were grown from the DMF-acetone (1:10, v/v) and DMSO-water (9:1, v/v) solutions. BA-DMF (1:1) solvate crystallizes in the monoclinic P2(1) space group, Z = 2. The unit cell parameters are as follows: cell lengths a = 13.2458(5) Å, b = 6.6501(2) Å, c = 17.9766(7) Å, and β = 110.513(4)°. BA-DMSO (1:1) solvate crystallizes in the orthorhombic P2(1)2(1)2(1) (Z = 4) space group with the following unit cell parameters: a = 6.6484(4) Å, b = 13.3279(8) Å, and c = 32.6821(19) Å. Conformational analysis of the six-membered rings, cyclopentane ring, and isopropenyl group showed differences in comparison with other betulin derivatives examined earlier. For both solvates, the intermolecular packing arrangement was governed mainly by H-bonds. The shortest H-bonds with D···A distances of 2.604 and 2.657 Å, and almost linear DH···A connection occurred between OH of carboxylic group of BA and oxygen atoms from O=C and O=S groups of DMF and DMSO, respectively. Copyright © 2012 Wiley Periodicals, Inc.
NASA Astrophysics Data System (ADS)
El Fallah, Rawa; Rouillon, Régis; Vouvé, Florence
2018-06-01
The fate of benzo(a)pyrene (BaP), a ubiquitous contaminant reported to be persistent in the environment, is largely controlled by its interactions with the soil organic matter. In the present study, the spectral characteristics of fluorophores present in the physical fractions of the soil organic matter were investigated in the presence of pure BaP solution. After extraction of humic substances (HSs), and their fractionation into fluvic acid (FA) and humic acid (HA), two fluorescent compounds (C1 and C2) were identified and characterized in each physical soil fraction, by means of fluorescence excitation-emission matrices (FEEMs) and Parallel Factor Analysis (PARAFAC). Then, to each type of fraction having similar DOC content, was added an increasing volume of pure BaP solution in attempt to assess the behavior of BaP with the fluorophores present in each one. The application of FEEMs-PARAFAC method validated a three-component model that consisted of the two resulted fluorophores from HSs, FA and HA (C1 and C2) and a BaP-like fluorophore (C3). Spectral modifications were noted for components C2HSs (C2 in humic substances fraction) (λex/λem: 420/490-520 nm), C2FA (C2 in fulvic acid fraction) (λex/λem: 400/487(517) nm) and C1HA (C1 in humic acid fraction) (λex/λem: 350/452(520) nm). We explored the impact of increasing the volume of the added pure BaP solution on the scores of the fluorophores present in the soil fractions. It was found that the scores of C2HSs, C2FA, and C1HA increased when the volume of the added pure BaP solution increased. Superposition of the excitation spectra of these fluorophores with the emission spectrum of BaP showed significant overlaps that might explain the observed interactions between BaP and the fluorescent compounds present in SOM physical fractions.
El Fallah, Rawa; Rouillon, Régis; Vouvé, Florence
2018-06-15
The fate of benzo(a)pyrene (BaP), a ubiquitous contaminant reported to be persistent in the environment, is largely controlled by its interactions with the soil organic matter. In the present study, the spectral characteristics of fluorophores present in the physical fractions of the soil organic matter were investigated in the presence of pure BaP solution. After extraction of humic substances (HSs), and their fractionation into fluvic acid (FA) and humic acid (HA), two fluorescent compounds (C 1 and C 2 ) were identified and characterized in each physical soil fraction, by means of fluorescence excitation-emission matrices (FEEMs) and Parallel Factor Analysis (PARAFAC). Then, to each type of fraction having similar DOC content, was added an increasing volume of pure BaP solution in attempt to assess the behavior of BaP with the fluorophores present in each one. The application of FEEMs-PARAFAC method validated a three-component model that consisted of the two resulted fluorophores from HSs, FA and HA (C 1 and C 2 ) and a BaP-like fluorophore (C 3 ). Spectral modifications were noted for components C 2 HSs (C 2 in humic substances fraction) (λex/λem: 420/490-520 nm), C 2 FA (C 2 in fulvic acid fraction) (λex/λem: 400/487(517) nm) and C 1 HA (C 1 in humic acid fraction) (λex/λem: 350/452(520) nm). We explored the impact of increasing the volume of the added pure BaP solution on the scores of the fluorophores present in the soil fractions. It was found that the scores of C 2 HSs, C 2 FA, and C 1 HA increased when the volume of the added pure BaP solution increased. Superposition of the excitation spectra of these fluorophores with the emission spectrum of BaP showed significant overlaps that might explain the observed interactions between BaP and the fluorescent compounds present in SOM physical fractions. Copyright © 2018 Elsevier B.V. All rights reserved.
Wu, Yi-Hang; Zhang, Bing-Yi; Qiu, Li-Peng; Guan, Rong-Fa; Ye, Zi-Hong; Yu, Xiao-Ping
2017-01-01
A great effort has been made to develop efficacious antiviral drugs, but many viral infections are still lack of efficient antiviral therapies so far. The related exploration of natural products to fight viruses has been raised in recent years. Natural compounds with structural diversity and complexity offer a great chance to find new antiviral agents. Particularly, phenolic acids have attracted considerable attention owing to their potent antiviral abilities and unique mechanisms. The aim of this review is to report new discoveries and updates pertaining to antiviral phenolic acids. The relevant references on natural phenolic acids were searched. The antiviral phenolic acids were classified according to their structural properties and antiviral types. Meanwhile, the antiviral characteristics and structure-activity relationships of phenolic acids and their derivatives were summarized. The review finds that natural phenolic acids and their derivatives possessed potent inhibitory effects on multiple virus in humans such as human immunodeficiency virus, hepatitis C virus, hepatitis B virus, herpes simplex virus, influenza virus and respiratory syncytial virus. In particular, caffeic acid/gallic acid and their derivatives exhibited outstanding antiviral properties by a variety of modes of action. Naturally derived phenolic acids especially caffeic acid/gallic acid and their derivatives may be regarded as novel promising antiviral leads or candidates. Additionally, scarcely any of these compounds has been used as antiviral treatment in clinical practice. Therefore, these phenolic acids with diverse skeletons and mechanisms provide us an excellent resource for finding novel antiviral drugs. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Nakada, Yuji; Jiang, Ying; Nishijyo, Takayuki; Itoh, Yoshifumi; Lu, Chung-Dar
2001-01-01
Pseudomonas aeruginosa PAO1 utilizes agmatine as the sole carbon and nitrogen source via two reactions catalyzed successively by agmatine deiminase (encoded by aguA; also called agmatine iminohydrolase) and N-carbamoylputrescine amidohydrolase (encoded by aguB). The aguBA and adjacent aguR genes were cloned and characterized. The predicted AguB protein (Mr 32,759; 292 amino acids) displayed sequence similarity (≤60% identity) to enzymes of the β-alanine synthase/nitrilase family. While the deduced AguA protein (Mr 41,190; 368 amino acids) showed no significant similarity to any protein of known function, assignment of agmatine deiminase to AguA in this report discovered a new family of carbon-nitrogen hydrolases widely distributed in organisms ranging from bacteria to Arabidopsis. The aguR gene encoded a putative regulatory protein (Mr 24,424; 221 amino acids) of the TetR protein family. Measurements of agmatine deiminase and N-carbamoylputrescine amidohydrolase activities indicated the induction effect of agmatine and N-carbamoylputrescine on expression of the aguBA operon. The presence of an inducible promoter for the aguBA operon in the aguR-aguB intergenic region was demonstrated by lacZ fusion experiments, and the transcription start of this promoter was localized 99 bp upstream from the initiation codon of aguB by S1 nuclease mapping. Experiments with knockout mutants of aguR established that expression of the aguBA operon became constitutive in the aguR background. Interaction of AguR overproduced in Escherichia coli with the aguBA regulatory region was demonstrated by gel retardation assays, supporting the hypothesis that AguR serves as the negative regulator of the aguBA operon, and binding of agmatine and N-carbamoylputrescine to AguR would antagonize its repressor function. PMID:11673419
Synthesis of α,ω-polyfluorinated α-amino acid derivatives and δ,δ-difluoronorvaline.
Ulbrich, Dirk; Daniliuc, Constantin G; Haufe, Günter
2016-03-07
Intending to synthesize ω,ω-difluoroalkyl amino acid derivatives by oxidative desulfurization-fluorination reactions of suitable arylthio-2-phthalimido butanoates and pentanoates, in addition to small amounts of the target products, mainly α,ω-polyfluorinated amino acid derivatives were formed by additional sulfur-assisted α-fluorination. This novel structural motif was verified spectroscopically as well as by X-ray analysis. A plausible mechanism of formation is suggested. Using a different approach, δ,δ-difluoronorvaline hydrochloride was synthesized with at least 36% enantiomeric excess via deoxofluorination of the corresponding aldehyde.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bud'ko, Sergey L.; Chung, Duck Young; Bugaris, Daniel
2014-01-16
We present the evolution of the initial (up to ~ 10 kbar) hydrostatic pressure dependencies of T c and of the ambient pressure, and the jump in the heat capacity associated with the superconducting transition as a function of Na doping in the Ba1-xNaxFe2As2 family of iron-based superconductors. For Na concentrations 0.15 ≤ x ≤ 0.9, the jump in specific heat at T c, ΔC p| Tmore » $$_c$$, follows the ΔC p ∝ to T 3 (the so-called BNC scaling) found for most BaFe 2As 2 based superconductors. This finding suggests that, unlike the related Ba 1-xK xFe 2As 2 series, there is no significant modification of the superconducting state (e. g., change in superconducting gap symmetry) in the Ba 1-xNa xFe 2As 2 series over the whole studied Na concentration range. Pressure dependencies are nonmonotonic for x = 0.2 and 0.24. For other Na concentrations, T c decreases under pressure in an almost linear fashion. The anomalous behavior of the x = 0.2 and 0.24 samples under pressure is possibly due to the crossing of the phase boundaries of the narrow antiferromagnetic tetragonal phase, unique for the Ba 1-xNa xFe 2As 2 series, with the application of pressure. The negative sign of the pressure derivatives of T c across the whole superconducting dome (except for x = 0.2) is a clear indication of the nonequivalence of substitution and pressure for the Ba 1-xNa xFe 2As 2 series.« less
Bioinspired bioadhesive polymers: dopa-modified poly(acrylic acid) derivatives.
Laulicht, Bryan; Mancini, Alexis; Geman, Nathanael; Cho, Daniel; Estrellas, Kenneth; Furtado, Stacia; Hopson, Russell; Tripathi, Anubhav; Mathiowitz, Edith
2012-11-01
The one-step synthesis and characterization of novel bioinspired bioadhesive polymers that contain Dopa, implicated in the extremely adhesive byssal fibers of certain gastropods, is reported. The novel polymers consist of combinations of either of two polyanhydride backbones and one of three amino acids, phenylalanine, tyrosine, or Dopa, grafted as side chains. Dopa-grafted hydrophobic backbone polymers exhibit as much as 2.5 × the fracture strength and 2.8 × the tensile work of bioadhesion of a commercially available poly(acrylic acid) derivative as tested on live, excised, rat intestinal tissue. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Sediment pollution in margins of the Lake Guaíba, Southern Brazil.
de Andrade, Leonardo Capeleto; Tiecher, Tales; de Oliveira, Jessica Souza; Andreazza, Robson; Inda, Alberto Vasconcellos; de Oliveira Camargo, Flávio Anastácio
2017-12-02
Sediments are formed by deposition of organic and inorganic particles on depth of water bodies, being an important role in aquatic ecosystems, including destination and potential source of essential nutrients and heavy metals, which may be toxic for living organisms. The Lake Guaíba supplies water for approximately two million people and it is located in the metropolitan region of Porto Alegre, Rio Grande do Sul State, Brazil. Thus, the aim of this study was to evaluate the sediment pollution in the margins of Lake Guaíba in the vicinity of Porto Alegre city. Surface sediment was sampled in 12 sites to assess the concentration of several elements (C, N, P, Fe, Al, Ca, Mg, Na, K, Mn, Ba, Zn, V, Pb, Cu, Cr, Ni, Cd, Mo, and Se) and the mineralogical composition. Sediment in margins of Lake Guaíba presented predominantly (> 95%) sandy fraction in all samples, but with significant differences between evaluated sites. Sediments in the margins of Lake Guaíba showed indications of punctual water pollution with Pb, Cu, Cr, Ni, TOC, TKN, and P, mainly derived from urban streams that flow into the lake. In order to solve these environmental liabilities, public actions should not focus only on Guaíba, but also in the streams that flow into the lake.
Preparation and Stoichiometry Effects on Microstructure and Properties of High Purity BaTiO3.
1986-03-27
oxalate , citrate) salt solutions, from mixed alkoxide precursors or from hydrothermal solutions. Typical starting materials and reaction sequences...decomposition and calcination reactions to form the BaTiO compound. Both the oxalate and 3 hydrothermal processes show commnercial promise and are briefly...thermal decomposition of oxalates and by hydrothermal synthesis. As-received lots of mixed oxide and oxalate -derived powders had Ba:TI ratios of 0.997 and
Novel Acid Catalysts from Waste-Tire-Derived Carbon: Application in Waste-to-Biofuel Conversion
Hood, Zachary D.; Adhikari, Shiba P.; Li, Yunchao; ...
2017-06-21
Many inexpensive biofuel feedstocks, including those containing free fatty acids (FFAs) in high concentrations, are typically disposed of as waste due to our inability to efficiently convert them into usable biofuels. Here we demonstrate that carbon derived from waste tires could be functionalized with sulfonic acid (-SO 3H) to effectively catalyze the esterification of oleic acid or a mixture of fatty acids to usable biofuels. Waste tires were converted to hard carbon, then functionalized with catalytically active -SO 3H groups on the surface through an environmentally benign process that involved the sequential treatment with L-cysteine, dithiothreitol, and H 2O 2.more » In conclusion, when benchmarked against the same waste-tire derived carbon material treated with concentrated sulfuric acid at 150 °C, similar catalytic activity was observed. Both catalysts could also effectively convert oleic acid or a mixture of fatty acids and soybean oil to usable biofuels at 65 °C and 1 atm without leaching of the catalytic sites.« less
Wu, Linglin; Mascal, Mark; Farmer, Thomas J; Arnaud, Sacha Pérocheau; Wong Chang, Maria-Angelica
2017-01-10
Electrolysis of biomass-derived carbonyl compounds is an alternative to condensation chemistry for supplying products with chain length >C 6 for biofuels and renewable materials production. Kolbe coupling of biomass-derived levulinic acid is used to obtain 2,7-octanedione, a new platform molecule only two low process-intensity steps removed from raw biomass. Hydrogenation to 2,7-octanediol provides a chiral secondary diol largely unknown to polymer chemistry, whereas intramolecular aldol condensation followed by hydrogenation yields branched cycloalkanes suitable for use as high-octane, cellulosic gasoline. Analogous electrolysis of an itaconic acid-derived methylsuccinic monoester yields a chiral 2,5-dimethyladipic acid diester, another underutilized monomer owing to lack of availability. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Synthesis and cholinesterase inhibition of cativic acid derivatives.
Alza, Natalia P; Richmond, Victoria; Baier, Carlos J; Freire, Eleonora; Baggio, Ricardo; Murray, Ana Paula
2014-08-01
Alzheimer's disease (AD) is a neurodegenerative disorder associated with memory impairment and cognitive deficit. Most of the drugs currently available for the treatment of AD are acetylcholinesterase (AChE) inhibitors. In a preliminary study, significant AChE inhibition was observed for the ethanolic extract of Grindelia ventanensis (IC₅₀=0.79 mg/mL). This result prompted us to isolate the active constituent, a normal labdane diterpenoid identified as 17-hydroxycativic acid (1), through a bioassay guided fractionation. Taking into account that 1 showed moderate inhibition of AChE (IC₅₀=21.1 μM), selectivity over butyrylcholinesterase (BChE) (IC₅₀=171.1 μM) and that it was easily obtained from the plant extract in a very good yield (0.15% w/w), we decided to prepare semisynthetic derivatives of this natural diterpenoid through simple structural modifications. A set of twenty new cativic acid derivatives (3-6) was prepared from 1 through transformations on the carboxylic group at C-15, introducing a C2-C6 linker and a tertiary amine group. They were tested for their inhibitory activity against AChE and BChE and some structure-activity relationships were outlined. The most active derivative was compound 3c, with an IC₅₀ value of 3.2 μM for AChE. Enzyme kinetic studies and docking modeling revealed that this inhibitor targeted both the catalytic active site and the peripheral anionic site of this enzyme. Furthermore, 3c showed significant inhibition of AChE activity in SH-SY5Y human neuroblastoma cells, and was non-cytotoxic. Copyright © 2014 Elsevier Ltd. All rights reserved.
Ghassempour, Alireza; Nojavan, Saeed; Talebpour, Zahra; Amiri, Ali Asghar; Najafi, Nahid Mashkouri
2004-10-20
In this approach, a derivatization method is described for monitoring of organic acids in fermentation media without any separation step. The aqueous phase of fermentation media was evaporated and heated in a silylation reagent to form trimethylsilyl (TMS) derivatives. The silylated compounds are analyzed by 29Si nuclear magnetic resonance (29Si NMR) and gas chromatography-mass spectrometry (GC-MS). 29Si NMR can qualitatively monitor the components produced in the Krebs cycle. Quantification of these compounds is investigated by using selected ion monitoring mode of mass spectrometry. In this mode, mass to charge (m/z) values of their [M - 15]+ ions, which are 465, 275, 247, 221, 335, 251, and 313 of TMS derivatives of citric, alpha-ketoglutaric, succinic, fumaric, l-malic, oxaloacetic, and palmitic (as an internal standard), acids, respectively, are used. The limit of detection and the linear working range for derivatized citric acid were found to be 0.1 mg L(-1) and 10-3 x 10(4) mg L(-1). The relative standard deviation of the method for five replicates was 2.1%. The average recovery efficiency for citric acid added to culture media was approximately 97.2%. Quantitative results of GC-MS are compared with those obtained by an ultraviolet-visible method. Copyright 2004 American Chemical Society
Oxidation of phenolic acid derivatives by soil and its relevance to allelopathic activity.
Ohno, T
2001-01-01
Previous studies have suggested that phenolic acids from legume green manures may contribute to weed control through allelopathy. The objectives of this study were to investigate the oxidation reactions of phenolic acids in soil and to determine the subsequent effects of oxidation upon phytotoxicity. Soils were reacted for 18 h with 0.25 mmol L(-1) benzoic and cinnamic acid derivative solutions and Mn release from the suspension was used as a marker for phenolic acid oxidation. The extent of oxidation in soil suspensions was in the order of 3,4dihydroxy- > 4-hydroxy-3-methoxy- > 4-hydroxy-approximately 2-hydroxy-substituted benzoic and cinnamic acids. The same ranking was observed for cyclic voltammetry peak currents of the cinnamic acid derivatives. This suggests that the oxidation of phenolic acids is controlled by the electron transfer step from the sorbed phenolic acid to the metal oxide. A bioassay experiment showed that the 4-hydroxy-, 4-hydroxy-3-methoxy-, and 3,4-dihydroxy-substituted cinnamic acids were bioactive at 0.25 mmol L(-1) concentration. Reaction with soil for 18 h resulted in the elimination of bioactivity of these three cinnamic acids at the 5% significance level. The oxidative reactivity of phenolic acids may limit the potential of allelopathy as a component of an integrated weed management system. However, the initial phytotoxicity after soil incorporation may coincide with the early, critical stage of weed emergence and establishment, so that allelopathic phenolic acids may still play a role in weed management despite their reactivity in soil systems.
Sun, Yaming; Bi, Qing; Zhang, Xiaoli; Wang, Litao; Zhang, Xia; Dong, Shuqing; Zhao, Liang
2016-05-01
A facile capillary electrophoresis (CE) method for the separation of cinnamic acid and its derivatives (3,4-dimethoxycinnamic acid, 4-methoxycinnamic acid, isoferulic acid, sinapic acid, cinnamic acid, ferulic acid, and trans-4-hydroxycinnamic acid) using graphene quantum dots (GQDs) as additives with direct ultraviolet (UV) detection is reported. GQDs were synthesized by chemical oxidization and further purified by a macroporous resin column to remove salts (Na2SO4 and NaNO3) and other impurities. Transmission electron microscopy (TEM) indicated that GQDs have a relatively uniform particle size (2.3 nm). Taking into account the structural features of GQDs, cinnamic acid and its derivatives were adopted as model compounds to investigate whether GQDs can be used to improve CE separations. The separation performance of GQDs used as additives in CE was studied through variations of pH, concentration of the background electrolyte (BGE), and contents of GQDs. The results indicated that excellent separation can be achieved in less than 18 min, which is mainly attributed to the interaction between the analytes and GQDs, especially isoferulic acid, sinapic acid, and cinnamic acid. Copyright © 2016 Elsevier Inc. All rights reserved.
Radivojevic, Jelena; Skaro, Sanja; Senerovic, Lidija; Vasiljevic, Branka; Guzik, Maciej; Kenny, Shane T; Maslak, Veselin; Nikodinovic-Runic, Jasmina; O'Connor, Kevin E
2016-01-01
A library of 18 different compounds was synthesized starting from (R)-3-hydroxyoctanoic acid which is derived from the bacterial polymer polyhydroxyalkanoate (PHA). Ten derivatives, including halo and unsaturated methyl and benzyl esters, were synthesized and characterized for the first time. Given that (R)-3-hydroxyalkanoic acids are known to have biological activity, the new compounds were evaluated for antimicrobial activity and in vitro antiproliferative effect with mammalian cell lines. The presence of the carboxylic group was essential for the antimicrobial activity, with minimal inhibitory concentrations against a panel of bacteria (Gram-positive and Gram-negative) and fungi (Candida albicans and Microsporum gypseum) in the range 2.8-7.0 mM and 0.1-6.3 mM, respectively. 3-Halogenated octanoic acids exhibited the ability to inhibit C. albicans hyphae formation. In addition, (R)-3-hydroxyoctanoic and (E)-oct-2-enoic acids inhibited quorum sensing-regulated pyocyanin production in the opportunistic pathogen Pseudomonas aeruginosa PAO1. Generally, derivatives did not inhibit mammalian cell proliferation even at 3-mM concentrations, while only (E)-oct-2-enoic and 3-oxooctanoic acid had IC50 values of 1.7 and 1.6 mM with the human lung fibroblast cell line.
Wang, Shaogui; Yang, Zhiying; Xiong, Fengxiao; Chen, Cheng; Chao, Xiaojuan; Huang, Junying; Huang, Heqing
2016-10-15
Diabetic nephropathy (DN) is the leading cause of end-stage renal failure and is characterized by excessive deposition of extracellular matrix (ECM) proteins such as fibronectin (FN), in the glomerular mesangium and tubulointerstitium. Betulinic acid (BA), a pentacyclic triterpene derived from the bark of the white birch tree, has been demonstrated to have many pharmacological activities. However, the effect of BA on DN has not been fully elucidated. To explore the possible anti-inflammatory effects of BA and their underlying mechanisms, we used streptozotocin-induced diabetic rat kidneys and high glucose-treated glomerular mesangial cells. Our study showed BA could inhibit the degradation of IκBα and the activity of NF-κB in diabetic rat kidneys and high glucose-induced mesangial cells, resulting in reduction of FN expression. In addition, BA suppressed the DNA binding activity and transcriptional activity of NF-κB in high glucose-induced glomerular mesangial cells (GMCs). Furthermore, BA enhanced the interaction between IκBα and β-arrestin2 in mesangial cells. Taken together, our data suggest BA inhibits NF-κB activation through stabilizing NF-κB inhibitory protein IκBα, thereby preventing diabetic renal fibrosis. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Wang, Shi-Fan; Guo, Chao-Lun; Cui, Ke-Ke; Zhu, Yan-Ting; Ding, Jun-Xiong; Zou, Xin-Yue; Li, Yi-Hang
2015-09-01
Lactic acid has been used as a bio-based green solvent to study the ultrasound-assisted scale-up synthesis. We report here, for the first time, on the novel and scalable process for synthesis of pyrrole derivatives in lactic acid solvent under ultrasonic radiation. Eighteen pyrrole derivatives have been synthesized in lactic acid solvent under ultrasonic radiation and characterized by (1)H NMR, IR, ESI MS. The results show, under ultrasonic radiation, lactic acid solvent can overcome the scale-up challenges and exhibited many advantages, such as bio-based origin, shorter reaction time, lower volatility, higher yields, and ease of isolating the products. Copyright © 2015 Elsevier B.V. All rights reserved.
Murthy, Hosakatte Niranjana; Kim, Yun-Soo; Park, So-Young; Paek, Kee-Yoeup
2014-09-01
Caffeic acid derivatives (CADs) are a group of bioactive compounds which are produced in Echinacea species especially Echinacea purpurea, Echinacea angustifolia, and Echinacea pallida. Echinacea is a popular herbal medicine used in the treatment of common cold and it is also a prominent dietary supplement used throughout the world. Caffeic acid, chlorogenic acid (5-O-caffeoylquinic acid), caftaric acid (2-O-caffeoyltartaric acid), cichoric acid (2, 3-O-dicaffeoyltartaric acid), cynarin, and echinacoside are some of the important CADs which have varied pharmacological activities. The concentrations of these bioactive compounds are species specific and also they vary considerably with the cultivated Echinacea species due to geographical location, stage of development, time of harvest, and growth conditions. Due to these reasons, plant cell and organ cultures have become attractive alternative for the production of biomass and caffeic acid derivatives. Adventitious and hairy roots have been induced in E. pupurea and E. angustifolia, and suspension cultures have been established from flask to bioreactor scale for the production of biomass and CADs. Tremendous progress has been made in this area; various bioprocess methods and strategies have been developed for constant high-quality productivity of biomass and secondary products. This review is aimed to discuss biotechnological methods and approaches employed for the sustainable production of CADs.
Humic acid batteries derived from vermicomposts at different C/N ratios
NASA Astrophysics Data System (ADS)
Shamsuddin, R. M.; Borhan, A.; Lim, W. K.
2017-06-01
Humic acid is a known fertilizer derived from decomposed organic matters. Organic wastes are normally landfilled for disposal which had contributed negatively to the environment. From waste-to-wealth perspective, such wastes are potential precursors for compost fertilizers. When worms are added into a composting process, the process is termed as vermicomposting. In this work, humic acid from vermicompost derived from campus green wastes was developed into a battery. This adds value proposition to compost instead of being traditionally used solely as soil improver. This research work aimed to study the correlation between electrical potential generated by humic acid at different Carbon to Nitrogen (C/N) ratios of vermicompost at 20, 25, 30 and 35. The temperature and pH profiles of composting revealed that the compost was ready after 55 days. The humic acid was extracted from compost via alkaline extraction followed by precipitation in a strong acid. The extracted humic acid together with other additives were packed into a compartment and termed as vermibattery. Another set of battery running only on the additives was also prepared as a control. The net voltage produced by a single vermibattery cell with Zn and PbO electrodes was in the range of 0.31 to 0.44 V with compost at C/N ratio of 30 gave the highest voltage. The battery can be connected in series to increase the voltage generation. Quality assessment on the compost revealed that the final carbon content is between 16 to 23 wt%, nitrogen content of 0.4 to 0.5 wt%, humic acid yield of 0.7 to 1.5 wt% and final compost mass reduction of 10 to 35 wt%. Composting campus green wastes carries multi-fold benefits of reducing labour requirement, generating fertilizer for campus greenery and green battery construction.
Mass spectral analysis of C3 and C4 aliphatic amino acid derivatives.
NASA Technical Reports Server (NTRS)
Lawless, J. G.; Chadha, M. S.
1971-01-01
Diagnostic criteria are obtained for the distinction of alpha, beta, gamma, and N-methyl isomers of the C3 and C4 aliphatic amino acids, using mass spectral analysis of the derivatives of these acids. The use of deuterium labeling has helped in the understanding of certain fragmentation pathways.
Steinacher, Daniel; Claudel, Thierry; Trauner, Michael
2017-01-01
Non-alcoholic fatty liver disease is one of the most rapidly rising clinical problems in the 21st century. So far no effective drug treatment has been established to cure this disease. Bile acids (BAs) have a variety of signaling properties, which can be used therapeutically for modulating hepatic metabolism and inflammation. A side-chain shorted derivative of ursodeoxycholic acid (UDCA) is 24 nor-ursodeoxycholic acid (NorUDCA) and it represents a new class of drugs for treatment of liver diseases. NorUDCA has unique biochemical and therapeutic properties, since it is relatively resistant to conjugation with glycine or taurine compared to UDCA. NorUDCA undergoes cholehepatic shunting, resulting in ductular targeting, bicarbonate-rich hypercholeresis, and cholangiocyte protection. Furthermore, it showed anti-fibrotic, anti-inflammatory, and anti-lipotoxic properties in several animal models. As such, NorUDCA is a promising new approach in the treatment of cholestatic and metabolic liver diseases. This review is a summary of current BA-based therapeutic approaches in the treatment of the fatty liver disease. © 2017 S. Karger AG, Basel.
Cao, Jing; Dong, Shuding; Jiang, Delu; Zhu, Peiyu; Zhang, Han; Li, Rui; Li, Zhanyi; Wang, Xuanyu; Tang, Weifang; Du, Ding
2017-04-21
β-Functionalization of indolin-2-one-derived aliphatic acids has been applied in formal [3 + 2] annualtions for catalyst-free and divergent synthesis of two series of structurally interesting 3,3'-spirooxindole γ-butyrolactones that may be attractive for potential drug discovery. These findings also pave the way for further diversity-oriented synthesis of spirooxindoles starting from indolin-2-one-derived aliphatic acids or their derivatives.
NASA Astrophysics Data System (ADS)
Bo, Yan; Bu, Wenhao; Chen, Tao; Lv, Guitao
2017-04-01
In this poster, we report our recently experimental progresses in laser cooling of BaF molecule. Our theoretic calculation shows BaF is a good candidate for laser cooling: quasi-cycling transitions, good wavelengths (around 900nm) for the main transitions. We have built a 4K cryogenic machine, laser ablate the target to make BaF molecules. The precise spectroscopy of BaF is measured and the laser cooling related transitions are identified. The collision between BaF and 4K He is carefully characterized. The quasi-cycling transition is demonstrated. And laser cooling experiment is going on.
Identification and quantitation of new glutamic acid derivatives in soy sauce by UPLC/MS/MS.
Frerot, Eric; Chen, Ting
2013-10-01
Glutamic acid is an abundant amino acid that lends a characteristic umami taste to foods. In fermented foods, glutamic acid can be found as a free amino acid formed by proteolysis or as a non-proteolytic derivative formed by microorganisms. The aim of the present study was to identify different structures of glutamic acid derivatives in a typical fermented protein-based food product, soy sauce. An acidic fraction was prepared with anion-exchange solid-phase extraction (SPE) and analyzed by UPLC/MS/MS and UPLC/TOF-MS. α-Glutamyl, γ-glutamyl, and pyroglutamyl dipeptides, as well as lactoyl amino acids, were identified in the acidic fraction of soy sauce. They were chemically synthesized for confirmation of their occurrence and quantified in the selected reaction monitoring (SRM) mode. Pyroglutamyl dipeptides accounted for 770 mg/kg of soy sauce, followed by lactoyl amino acids (135 mg/kg) and γ-glutamyl dipeptides (70 mg/kg). In addition, N-succinoylglutamic acid was identified for the first time in food as a minor compound in soy sauce (5 mg/kg). Copyright © 2013 Verlag Helvetica Chimica Acta AG, Zürich.
Production and optimisation of rosmarinic acid by Satureja hortensis L. callus cultures.
Tepe, Bektas; Sokmen, Atalay
2007-11-01
In this study, production and optimisation of rosmarinic acid, a phenolic acid and an economically important metabolite, was investigated in the callus cultures established from the mature seeds of Satureja hortensis L. (summer savory) plant. Gamborg's B5 basal medium, supplemented with indol butyric acid (IBA) (1.00 mg L(-1)), N6-benzyl aminopurine (6-BA) (1.00 mg L(-1)) and sucrose (2.5%, w/v), was employed for the establishment and maintenance of the callus cultures. Applications were individually prepared by preparing the media containing different IBA/6-BA combinations and sucrose concentrations. All of the applications were carried out in the continuous dark. In the applications, where the effects of IBA/6-BA combinations on the growth and rosmarinic acid accumulation were assayed (1-15 applications), the highest biomass yield was obtained from the medium supplemented with 1.00 mg L(-1) IBA and 5.00 mg L(-1) 6-BA. In the case of the rosmarinic acid accumulation, an opposite relationship was determined between the growth and rosmarinic acid production. While the highest biomass yield was obtained from the medium containing 1.00 mg L(-1) IBA and 5.00 mg L(-1) 6-BA, the highest rosmarinic acid accumulation was obtained from the medium supported with 1.00 mg L(-1) IBA and 1.00 mg L(-1) 6-BA. In the applications where the effects of sucrose concentrations on the growth and rosmarinic acid accumulation were examined, the highest biomass yield was obtained from the medium which is supplemented with 5.0% (w/v) sucrose. In this category, the highest rosmarinic acid accumulation was obtained from the medium which is supported with 3.0% (w/v) sucrose. According to the experiments carried out with the wild S. hortensis, it is found to have 25.02+/-1.21 mg g(-1) rosmarinic acid. No differentiation was observed in any callus during the course of this study.
Bile acids-mediated overexpression of MUC4 via FAK-dependent c-Jun activation in pancreatic cancer.
Joshi, Suhasini; Cruz, Eric; Rachagani, Satyanarayana; Guha, Sushovan; Brand, Randall E; Ponnusamy, Moorthy P; Kumar, Sushil; Batra, Surinder K
2016-08-01
The majority of pancreatic cancer (PC) patients are clinically presented with obstructive jaundice with elevated levels of circulatory bilirubin and alkaline phosphatases. In the current study, we examined the implications of bile acids (BA), an important component of bile, on the pathophysiology of PC and investigated their mechanistic association in tumor-promoting functions. Integration of results from PC patient samples and autochthonous mouse models showed an elevated levels of BA (p < 0.05) in serum samples compared to healthy controls. Similarly, an elevated BA levels was observed in pancreatic juice derived from PC patients (p < 0.05) than non-pancreatic non-healthy (NPNH) controls, further establishing the clinical association of BA with the pathogenesis of PC. The tumor-promoting functions of BA were established by observed transcriptional upregulation of oncogenic MUC4 expression. Luciferase reporter assay revealed distal MUC4 promoter as the primary responsive site to BA. In silico analysis recognized two c-Jun binding sites at MUC4 distal promoter, which was biochemically established using ChIP assay. Interestingly, BA treatment led to an increased transcription and activation of c-Jun in a FAK-dependent manner. Additionally, BA receptor, namely FXR, which is also upregulated at transcriptional level in PC patient samples, was demonstrated as an upstream molecule in BA-mediated FAK activation, plausibly by regulating Src activation. Altogether, these results demonstrate that elevated levels of BA increase the tumorigenic potential of PC cells by inducing FXR/FAK/c-Jun axis to upregulate MUC4 expression, which is overexpressed in pancreatic tumors and is known to be associated with progression and metastasis of PC. Published by Elsevier B.V.
Synthesis and biological activity of alkynoic acids derivatives against mycobacteria
Vilchèze, Catherine; Leung, Lawrence W.; Bittman, Robert; Jacobs, William R.
2015-01-01
2-alkynoic acids have bactericidal activity against Mycobacterium smegmatis but their activity fall sharply as the length of the carbon chain increased. In this study, derivatives of 2- alkynoic acids were synthesized and tested against fast- and slow-growing mycobacteria. Their activity was first evaluated in M. smegmatis against their parental 2-alkynoic acids, as well as isoniazid, a first-line antituberculosis drug. The introduction of additional unsaturation or heteroatoms into the carbon chain enhanced the antimycobacterial activity of longer chain alkynoic acids (more than 19 carbons long). In contrast, although the modification of the carboxylic group did not improve the antimycobacterial activity, it significantly reduced the toxicity of the compounds against eukaryotic cells. Importantly, 4-(alkylthio)but-2-ynoic acids, had better bactericidal activity than the parental 2-alkynoic acids and on a par with isoniazid against the slow-grower Mycobacterium bovis BCG. These compounds had also low toxicity against eukaryotic cells, suggesting that they could be potential therapeutic agents against other types of topical mycobacterial infections causing skin diseases including Mycobacterium abscessus, Mycobacterium ulcerans, and Mycobacterium leprae. Moreover, they provide a possible scaffold for future drug development. PMID:26256431
Natural derivatives of diphenolic acid as substitutes for bisphenol-A
NASA Astrophysics Data System (ADS)
Ertl, Johanna; Cerri, Elisa; Rizzuto, Matteo; Caretti, Daniele
2014-05-01
Diphenolic acid had been originally used in the first epoxy resins and was later on forgotten as it was substituted by the cheaper bisphenol A. But in the recent years major health concerns have been raised as bisphenol A has a pseudo-hormonal effect on the body, playing the role of estrogen it can cause a severe impact on the organism, especially in males. Moreover it is produced from acetone and phenol, both from fossil, and thus limited resources. On the contrary, diphenolic acid is synthesized from levulinic acid and phenol. Levulinic acid being directly produced by hydrolysis of biomass. By substituting the fossil phenol with natural phenols from lignin or plant extraction we are able to synthesize a fully renewable substitute for bisphenol A. The reactions to yield an epoxy resin have been examined and the reactivity with epichlorohydrin is satisfying. Moreover, some of the derivatives of diphenolic acid have interesting curing properties and preliminary results show excellent properties of the cured resin, including thermal stability and pencil hardness.
Advances in understanding of bile acid diarrhea
Camilleri, Michael
2014-01-01
Bile acids (BA) are actively reabsorbed in the terminal ileum by the apical Na+-dependent bile salt transporter. This review addresses the epidemiology, pathophysiology, diagnosis and treatment of BA diarrhea (BAD). BAD is typically caused by ileal resection or disease; 25–33% of patients with chronic functional diarrhea or irritable bowel syndrome-diarrhea (IBS-D) have BAD, possibly from deficiency in the ileal hormone, FGF-19, which normally provides feedback inhibition of BA synthesis. Diagnosis of BAD is typically based on reduced BA retention of radiolabeled BA (75SeHCAT), increased BA synthesis (serum C4) or increased fecal BA loss. In clinical practice, diagnosis is often based on response to BA sequestrants (e.g., cholestyramine or colesevelam). Diagnostic tests for BA malabsorption (BAM) need to be used more extensively in clinical practice. In the future, farnesoid X receptor agonists that stimulate ileal production of FGF-19 may be alternative treatments of BAD. PMID:24410472
Thermoelectric properties of conducting polyaniline/BaTiO3 nanoparticle composite films
NASA Astrophysics Data System (ADS)
Anno, H.; Yamaguchi, K.; Nakabayashi, T.; Kurokawa, H.; Akagi, F.; Hojo, M.; Toshima, N.
2011-05-01
Conducting polyaniline (PANI)/BaTiO3 nanoparticle composite films with different molar ratio values R=1, 5, 10, and 100 have been prepared on a quartz substrate by casting the m-cresol solution of PANI, (±)-10-camphorsulfonic acid (CSA) and BaTiO3 nanoparticle with an average diameter of about 20 nm. The CSA-doped PANI/BaTiO3 composite films were characterized by x-ray diffraction, Fourier transform infrared spectroscopy, and UV-Vis transmission spectroscopy. The Seebeck coefficient and the electrical conductivity of the films with different R values, together with CSA-doped PANI films, were measured in the temperature range from room temperature to ~400 K. The relation between the Seebeck coefficient and the electrical conductivity in the composite films are discussed from a comparison of them with those of CSA-doped PANI films and other PANI composite films.
Biological Activities of Oleanolic Acid Derivatives from Calendula officinalis Seeds.
Zaki, Ahmed; Ashour, Ahmed; Mira, Amira; Kishikawa, Asuka; Nakagawa, Toshinori; Zhu, Qinchang; Shimizu, Kuniyoshi
2016-05-01
Phytochemical examination of butanol fraction of Calendula officinalis seeds led to the isolation of two compounds identified as 28-O-β-D-glucopyranosyl-oleanolic acid 3-O-β-D-glucopyranosyl (1→3)-β-D-glucopyranosiduronic acid (CS1) and oleanolic acid 3-O-β-D-glucopyranosyl (1→3)-β-D-glucopyranosiduronic acid (CS2). Biological evaluation was carried out for these two compounds such as melanin biosynthesis inhibitory, hyaluronic acid production activities, anti obesity using lipase inhibition and adipocyte differentiation as well as evaluation of the protective effect against hydrogen peroxide induced neurotoxicity in neuro-2A cells. The results showed that, compound CS2 has a melanin biosynthesis stimulatory activity; however, compound CS1 has a potent stimulatory effect for the production of hyaluronic acid on normal human dermal fibroblast from adult (NHDF-Ad). Both compounds did not show any inhibitory effect on both lipase and adipocyte differentiation. Compound CS2 could protect neuro-2A cells and increased cell viability against H2 O2 . These activities (melanin biosynthesis stimulatory and protective effect against H2 O2 of CS2 and hyaluronic acid productive activities of these triterpene derivatives) have been reported for the first time. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.
Highly selective Ba2+ separations with acyclic, lipophilic di-[N-(X)sulfonyl carbamoyl] polyethers.
Elshani, Sadik; Chun, Sangki; Amiri-Eliasi, Bijan; Bartsch, Richard A
2005-01-14
New lipophilic acyclic polyethers with two N-(X)sulfonyl carbamoyl groups of "tunable" acidity exhibit remarkable selectivity for Ba2+ over other alkaline earth metal ions in competitive solvent extraction and transport across polymer inclusion membranes.
Tracking of Drug Release and Material Fate for Naturally Derived Omega-3 Fatty Acid Biomaterials.
Faucher, Keith M; Artzi, Natalie; Beck, Moshe; Beckerman, Rita; Moodie, Geoff; Albergo, Theresa; Conroy, Suzanne; Dale, Alicia; Corbeil, Scott; Martakos, Paul; Edelman, Elazer R
2016-03-01
In vitro and in vivo studies were conducted on omega-3 fatty acid-derived biomaterials to determine their utility as an implantable material for adhesion prevention following soft tissue hernia repair and as a means to allow for the local delivery of antimicrobial or antibiofilm agents. Naturally derived biomaterials offer several advantages over synthetic materials in the field of medical device development. These advantages include enhanced biocompatibility, elimination of risks posed by the presence of toxic catalysts and chemical crosslinking agents, and derivation from renewable resources. Omega-3 fatty acids are readily available from fish and plant sources and can be used to create implantable biomaterials either as a stand-alone device or as a device coating that can be utilized in local drug delivery applications. In-depth characterization of material erosion degradation over time using non-destructive imaging and chemical characterization techniques provided mechanistic insight into material structure: function relationship. This in turn guided rational tailoring of the material based on varying fatty acid composition to control material residence time and hence drug release. These studies demonstrate the utility of omega-3 fatty acid derived biomaterials as an absorbable material for soft tissue hernia repair and drug delivery applications.
VizieR Online Data Catalog: Ba V, Ba VI, and Ba VII oscillator strengths (Rauch+, 2014)
NASA Astrophysics Data System (ADS)
Rauch, T.; Werner, K.; Quinet, P.; Kruk, J. W.
2014-04-01
table1.dat contains calculated HFR oscillator strengths (loggf) and transition probabilities (gA, in 1/s) in Ba V. CF is the cancellation factor as defined by Cowan (1981). In columns 3 and 6, e is written for even and o for odd. table2.dat contains calculated HFR oscillator strengths (loggf) and transition probabilities (gA, in 1/s) in Ba VI. CF is the cancellation factor as defined by Cowan (1981). In columns 3 and 6, e is written for even and o for odd. table3.dat contains calculated HFR oscillator strengths (loggf) and transition probabilities (gA, in 1/s) in Ba VII. CF is the cancellation factor as defined by Cowan (1981). In columns 3 and 6, e is written for even and o for odd. (3 data files).
Hao, Yuwei; Li, Yingying; Zhang, Feilong; Cui, Haijun; Hu, Jinsong; Meng, Jingxin; Wang, Shutao
2018-03-23
Highly efficient cell capture and release with low background are urgently required for early diagnosis of diseases such as cancer. Herein, we report an electrochemical responsive superhydrophilic surface exhibiting specific cell capture and release with high yields and extremely low nonspecific adhesion. Through electrochemical deposition, 3-substituted thiophene derivatives are deposited onto indium tin oxide (ITO) nanowire arrays with 4-n-nonylbenzeneboronic acid (BA) as dopant, fabricating the electrochemical responsive superhydrophilic surfaces. The molecular recognition between sialic acids over-expressed on the cell membrane and doped BAs endows the electrochemical responsive surfaces with the ability to capture and release targeted cancer cells. By adjusting the substituent group of thiophene derivatives, the surface wettability can be readily regulated and further utilized for reducing nonspecific cell adhesion. Significantly, the released cells still maintain a high proliferation ability, which indicates that the applied potential does not significantly harm the cells. Therefore, these results may provide a new strategy to achieve advanced functions of biomedical materials, such as low nonspecific adhesion. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Aung, Hnin-Pwint; Pyell, Ute
2016-06-03
For the rapid simultaneous determination of monosodium glutamate (MSG), benzoic acid (BA), and sorbic acid (SA) in canned food and other processed food samples, we developed a method that combines in-capillary derivatization with separation by capillary electrophoresis. This method employs the rapid derivatization of MSG with o-phthalaldehyde (OPA) in the presence of 3-mercaptopropionic acid (3-MPA) and enables the detection of the resulting OPA-MSG derivative and of non-derivatized BA and SA at 230nm. The composition of the background electrolyte and the parameters of derivatization and separation are as follows: 25mM borax containing 5mM OPA and 6mM 3-MPA, separation voltage 25mV, injection at 30mbar for 20s, and column temperature 25°C. Because of the high reaction rate and suitably adapted effective electrophoretic mobilities, band broadening due to the derivatization reaction at the start of the separation process is kept to a minimum. The optimized method is validated with respect to LOD, LOQ, linearity, recovery, and precision. This method can be applied to real samples such as soy, fish, oyster and sweet and sour chili sauces after application of appropriate clean-up steps. Mechanisms of zone broadening and zone focusing are discussed showing the validity of the employed theoretical approach regarding the dependence of the peak shape for OPA-MSG on the concentration of MSG in the sample. Copyright © 2016 Elsevier B.V. All rights reserved.
Weïwer, Michel; Chen, Chi-Chang; Kemp, Melissa M.; Linhardt, Robert J.
2013-01-01
α-Sialic acid azide 1 has been used as a substrate for the efficient preparation of 1,2,3-triazole derivatives of sialic acid using the copper-catalyzed azide-alkyne Huisgen cycloaddition (“click chemistry”). Our approach is to generate non-natural N-glycosides of sialic acid that are resistant to neuraminidase catalyzed hydrolysis as opposed to the natural O-glycosides. These N-glycosides would act as neuraminidase inhibitors to prevent the release of new virions. As a preliminary study, a small library of 1,2,3-triazole-linked sialic acid derivatives has been synthesized in 71-89% yield. A disaccharide mimic of sialic acid has also been prepared using the α-sialic acid azide 1 and a C-8 propargyl sialic acid acceptor in 68% yield. A model sialic acid coated dendrimer was also synthesized from a per-propargylated pentaerythritol acceptor. These novel sialic acid derivatives were then evaluated as potential neuraminidase inhibitors using a 96-well plate fluorescence assay; micromolar IC50 values were observed, comparable to the known sialidase inhibitor Neu5Ac2en. PMID:24223493
NSAID-derived γ-secretase modulation requires an acidic moiety on the carbazole scaffold.
Zall, Andrea; Kieser, Daniel; Höttecke, Nicole; Naumann, Eva C; Thomaszewski, Binia; Schneider, Katrin; Steinbacher, Dirk T; Schubenel, Robert; Masur, Stefan; Baumann, Karlheinz; Schmidt, Boris
2011-08-15
Modulation of γ-secretase activity holds potential for the treatment of Alzheimer's disease. Most NSAID-derived γ-secretase modulators feature a carboxylic acid, which may impair blood-brain barrier permeation. The structure activity relationship of 33 carbazoles featuring diverse carboxylic acid isosteres or metabolic precursors thereof was established in a cellular amyloid secretion assay. The modulatory activity was observed for acidic moieties and metabolically labile esters only, which supports our hypothesis of an acid-lysine interaction to be relevant for this type of γ-secretase modulators. Copyright © 2011 Elsevier Ltd. All rights reserved.
Trottier, Jocelyn; Perreault, Martin; Rudkowska, Iwona; Levy, Cynthia; Dallaire-Theroux, Amélie; Verreault, Mélanie; Caron, Patrick; Staels, Bart; Vohl, Marie-Claude; Straka, Robert J.; Barbier, Olivier
2014-01-01
Glucuronidation, catalyzed by UDP-glucuronosyltransferase (UGT) enzymes detoxifies cholestatic bile acids (BAs). We aimed at i) characterizing the circulating BA-glucuronide (-G) pool composition in humans, ii) evaluating how sex and UGT polymorphisms influence this composition, and iii) analyzing the effects of lipid-lowering drug fenofibrate on the circulating BA-G profile in 300 volunteers and 5 cholestatic patients. Eleven BA-Gs were determined in pre- and post-fenofibrate samples. Men exhibited higher BA-G concentrations, and various genotype/BA-G associations were discovered in relevant UGT genes. The chenodeoxycholic acid-3G concentration was associated with the UGT2B7 802C>T polymorphism. Glucuronidation assays confirmed the predominant role of UGT2B7 and UGT1A4 in CDCA-3G formation. Fenofibrate exposure increased the serum levels of 5 BA-G species, including CDCA-3G, and up-regulated expression of UGT1A4, but not UGT2B7, in hepatic cells. This study demonstrates that fenofibrate stimulates BA glucuronidation in humans, and thus reduces bile acid toxicity in the liver. PMID:23756370
Butyric acid retention in gingival tissue induces oxidative stress in jugular blood mitochondria.
Cueno, Marni E; Imai, Kenichi; Matsukawa, Noriko; Tsukahara, Takamitsu; Kurita-Ochiai, Tomoko; Ochiai, Kuniyasu
2013-09-01
Butyric acid (BA) is a major extracellular metabolite produced by anaerobic periodontopathic bacteria and is commonly deposited in the gingival tissue. BA induces mitochondrial oxidative stress in vitro; however, its effects in vivo were never elucidated. Here, we determined the effects of butyric acid retention in the gingival tissues on oxidative stress induction in the jugular blood mitochondria. We established that BA injected in the rat gingival tissue has prolonged retention in gingival tissues. Blood taken at 0, 60, and 180 min after BA injection was used for further analysis. We isolated blood mitochondria, verified its purity, and measured hydrogen peroxide (H2O2), heme, superoxide (SOD), and catalase (CAT) to determine BA effects. We found that H2O2, heme, SOD, and CAT levels all increased after BA injection. This would insinuate that mitochondrial oxidative stress was induced ascribable to BA.
Esterification of fermentation-derived acids via pervaporation
Datta, R.; Tsai, S.P.
1998-03-03
A low temperature method for esterifying ammonium- and amine-containing salts is provided whereby the salt is reacted with an alcohol in the presence of heat and a catalyst and then subjected to a dehydration and deamination process using pervaporation. The invention also provides for a method for producing esters of fermentation derived, organic acid salt comprising first cleaving the salt into its cationic part and anionic part, mixing the anionic part with an alcohol to create a mixture; heating the mixture in the presence of a catalyst to create an ester; dehydrating the now heated mixture; and separating the ester from the now-dehydrated mixture. 2 figs.
Esterification of fermentation-derived acids via pervaporation
Datta, Rathin; Tsai, Shih-Perng
1998-01-01
A low temperature method for esterifying ammonium- and amine-containing salts is provided whereby the salt is reacted with an alcohol in the presence of heat and a catalyst and then subjected to a dehydration and deamination process using pervaporation. The invention also provides for a method for producing esters of fermentation derived, organic acid salt comprising first cleaving the salt into its cationic part and anionic part, mixing the anionic part with an alcohol to create a mixture; heating the mixture in the presence of a catalyst to create an ester; dehydrating the now heated mixture; and separating the ester from the now-dehydrated mixture.
Wang, Dong-En; Yan, Jiahang; Jiang, Jingjing; Liu, Xiang; Tian, Chang; Xu, Juan; Yuan, Mao-Sen; Han, Xiang; Wang, Jinyi
2018-03-01
Sialic acid (SA) located at the terminal end of glycans on cell membranes has been shown to play an important yet distinctive role in various biological and pathological processes. Effective methods for the facile, sensitive and in situ analysis of SA on living cell surfaces are of great significance in terms of clinical diagnostics and therapeutics. Here, a new polydiacetylene (PDA) liposome-based sensor system bearing phenylboronic acid (PBA) and 1,8-naphthalimide derived fluorophore moieties was developed as a fluorescence turn-on sensor for the detection of free SA in aqueous solution and the in situ imaging of SA-terminated glycans on living cell surfaces. In the sensor system, three diacetylene monomers, PCDA-pBA, PCDA-Nap and PCDA-EA, were designed and synthesized to construct the composite PDA liposome sensor. The monomer PCDA-pBA modified with PBA molecules was employed as a receptor for SA recognition, while the monomer PCDA-Nap containing a 1,8-naphthalimide derivative fluorophore was used for fluorescence signaling. When the composite PDA liposomes were formed, the energy transfer between the fluorophore and the conjugated backbone could directly quench the fluorescence of the fluorophore. In the presence of additional SA or SA abundant cells, the strong binding of SA with PBA moieties disturbed the pendent side chain conformation, resulting in the fluorescence restoration of the fluorophore. The proposed methods realized the fluorescence turn-on detection of free SA in aqueous solution and the in situ imaging of SA on living MCF-7 cell surfaces. This work provides a new potential tool for simple and selective analysis of SA on living cell membranes.
NASA Astrophysics Data System (ADS)
Suastiyanti, Dwita; Sudarmaji, Arif; Soegijono, Bambang
2012-06-01
Barium hexaferrite BaFe12O19 (BFO) is of great importance as permanent magnets, particularly for magnetic recording as well as in microwave devices. Nano-crystalline BFO powders were prepared by sol gel auto combustion method in citric acid - metal nitrates system. Hence the mole ratios of Ba/Fe were variated at 1:12; 1:11.5 and 1:11. Ratio of cation to fuel was fixed at 1:1. An appropriate amount of amonia solution was added dropwise to this solution with constant stirring until the PH reached 7 in all cases. Heating at 850oC for 10 hours for each sample to get final formation of BFO nanocrystalline. The data from XRD showing the lattice parameters a,c and the unit-cell volume V, confirm that BFO with ratio 1:12 has same crystall parameters with ratio 1:11. Ratio of Ba/Fe 1:12 and 1:11 have diffraction pattern similarly at almost each 2 θ for each samples. Ratio of Ba/Fe 1: 11.5 has the finest crystallite size 22 nm. Almost diffraction pattern peaks of Ba/Fe 1:11.5 move to the left from of Ba/Fe 1:12 then return to diffraction pattern of Ba/Fe 1:12 for Ba/Fe 1:11. SEM observations show the particle size less than 100 nm and the same shape for each sample. Ratio of Ba/Fe 1: 12 gives the highest intrinsic coercive Hc = 427.3 kA/m. The highest remanent magnetization is at ratio 1:11 with Mr = 0.170 T. BFO with mole ratio 1:11.5 has the finest grain 22 nm, good magnetic properties and the highest value of best FoM 89%.
Holm, Olaf; Simon, Franz-Georg
2017-01-01
The industrial sector of bottom ash (BA) treatment from municipal solid waste incineration (MSWI) in Germany is currently changing. In order to increase the recovery rates of metals or to achieve a higher quality of mineral aggregates derived from BA, new procedures have been either implemented to existing plants or completely new treatment plants have been built recently. Three treatment trains, which are designated as entire sequences of selected processing techniques of BA, are introduced and compared. One treatment train is mainly characterized by usage of a high speed rotation accelerator whereas another is operating completely without crushing. In the third treatment train the BA is processed wet directly after incineration. The consequences for recovered metal fractions and the constitution of remaining mineral aggregates are discussed in the context of legislative and economical frameworks. Today the recycling or disposal options of mineral residues still have a high influence on the configuration and the operation mode of the treatment trains of BA despite of the high value of recovered metals. Copyright © 2016 Elsevier Ltd. All rights reserved.
Ba, B, and U element partitioning in magnesian calcite skeletons of Octocorallia corals
NASA Astrophysics Data System (ADS)
Yoshimura, T.; Suzuki, A.; Iwasaki, N.
2015-01-01
Barium, boron and uranium element partitioning and oxygen and carbon isotope fractionation of high-Mg calcite skeletons of Octocorallia corals were investigated. The dissolved Ba concentration in seawater and the coral Ba/Ca ratio showed a clear positive correlation. The empirically derived barium partition coefficient is comparable to previous data for not only calcitic corals but also intermediate- to deep-water-dwelling scleractinian corals whose skeletons are composed of aragonite. Octocorallia corals are geologically important producers of biominerals, and they provide long-term records (up to hundreds of years) of environmental conditions in the deep ocean. Our data suggest that Ba/Ca ratios in Octocorallia corals may be a useful proxy for nutrients in intermediate and deep waters. The Ba/Ca ratio, a possible proxy for pH or carbonate ion concentration in seawater, showed the largest correlation with δ13C among the examined parameters. This result implies that the pH of the extracytoplasmic calcifying fluid (ECF) simultaneously influences δ18O, δ13C, and Ba/Ca by influencing the relative contributions of dissolved carbon sources in the ECF. Positive correlations of Ba/Ca with δ18 and δ13C suggest that δ18 and δ13C are enriched in light isotopes when conditions are less alkaline, suggesting a potential role of biological alkalinity pumping becomes more favorable with decreasing calcifying fluid pH. Substantial inter- and intra-specimen variations in Ba/Ca suggest that physicochemical factors do not exert a dominant systematic control on U incorporation.
Generation and dietary modulation of anti-inflammatory electrophilic omega-3 fatty acid derivatives.
Cipollina, Chiara; Salvatore, Sonia R; Muldoon, Matthew F; Freeman, Bruce A; Schopfer, Francisco J
2014-01-01
Dietary ω-3 polyunsaturated fatty acids (PUFAs) decrease cardiovascular risk via suppression of inflammation. The generation of electrophilic α,β-unsaturated ketone derivatives of the ω-3 PUFAs docosahexaenoic acid (DHA) and docosapentaenoic acid (DPA) in activated human macrophages is catalyzed by cyclooxygenase-2 (Cox-2). These derivatives are potent pleiotropic anti-inflammatory signaling mediators that act via mechanisms including the activation of Nrf2-dependent phase 2 gene expression and suppression of pro-inflammatory NF-κB-driven gene expression. Herein, the endogenous generation of ω-3 PUFAs electrophilic ketone derivatives and their hydroxy precursors was evaluated in human neutrophils. In addition, their dietary modulation was assessed through a randomized clinical trial. Endogenous generation of electrophilic omega-3 PUFAs and their hydroxy precursors was evaluated by mass spectrometry in neutrophils isolated from healthy subjects, both at baseline and upon stimulation with calcium ionophore. For the clinical trial, participants were healthy adults 30-55 years of age with a reported EPA+DHA consumption of ≤300 mg/day randomly assigned to parallel groups receiving daily oil capsule supplements for a period of 4 months containing either 1.4 g of EPA+DHA (active condition, n = 24) or identical appearing soybean oil (control condition, n = 21). Participants and laboratory technicians remained blinded to treatment assignments. 5-lypoxygenase-dependent endogenous generation of 7-oxo-DHA, 7-oxo-DPA and 5-oxo-EPA and their hydroxy precursors is reported in human neutrophils stimulated with calcium ionophore and phorbol 12-myristate 13-acetate (PMA). Dietary EPA+DHA supplementation significantly increased the formation of 7-oxo-DHA and 5-oxo-EPA, with no significant modulation of arachidonic acid (AA) metabolite levels. The endogenous detection of these electrophilic ω-3 fatty acid ketone derivatives supports the precept that the benefit of
Fish-Derived Omega-3 Fatty Acids and Prostate Cancer: A Systematic Review.
Aucoin, Monique; Cooley, Kieran; Knee, Christopher; Fritz, Heidi; Balneaves, Lynda G; Breau, Rodney; Fergusson, Dean; Skidmore, Becky; Wong, Raimond; Seely, Dugald
2017-03-01
The use of natural health products in prostate cancer (PrCa) is high despite a lack of evidence with respect to safety and efficacy. Fish-derived omega-3 fatty acids possess anti-inflammatory effects and preclinical data suggest a protective effect on PrCa incidence and progression; however, human studies have yielded conflicting results. A search of OVID MEDLINE, Pre-MEDLINE, Embase, and the Allied and Complementary Medicine Database (AMED) was completed for human interventional or observational data assessing the safety and efficacy of fish-derived omega-3 fatty acids in the incidence and progression of PrCa. Of 1776 citations screened, 54 publications reporting on 44 studies were included for review and analysis: 4 reports of 3 randomized controlled trials, 1 nonrandomized clinical trial, 20 reports of 14 cohort studies, 26 reports of 23 case-control studies, and 3 case-cohort studies. The interventional studies using fish oil supplements in patients with PrCa showed no impact on prostate-specific antigen levels; however, 2 studies showed a decrease in inflammatory or other cancer markers. A small number of mild adverse events were reported and interactions with other interventions were not assessed. Cohort and case-control studies assessing the relationship between dietary fish intake and the risk of PrCa were equivocal. Cohort studies assessing the risk of PrCa mortality suggested an association between higher intake of fish and decreased risk of prostate cancer-related death. Current evidence is insufficient to suggest a relationship between fish-derived omega-3 fatty acid and risk of PrCa. An association between higher omega-3 intake and decreased PrCa mortality may be present but more research is needed. More intervention trials or observational studies with precisely measured exposure are needed to assess the impact of fish oil supplements and dietary fish-derived omega-3 fatty acid intake on safety, PrCa incidence, treatment, and progression.
Fish-Derived Omega-3 Fatty Acids and Prostate Cancer: A Systematic Review
Aucoin, Monique; Cooley, Kieran; Knee, Christopher; Fritz, Heidi; Balneaves, Lynda G.; Breau, Rodney; Fergusson, Dean; Skidmore, Becky; Wong, Raimond; Seely, Dugald
2016-01-01
Background. The use of natural health products in prostate cancer (PrCa) is high despite a lack of evidence with respect to safety and efficacy. Fish-derived omega-3 fatty acids possess anti-inflammatory effects and preclinical data suggest a protective effect on PrCa incidence and progression; however, human studies have yielded conflicting results. Methods. A search of OVID MEDLINE, Pre-MEDLINE, Embase, and the Allied and Complementary Medicine Database (AMED) was completed for human interventional or observational data assessing the safety and efficacy of fish-derived omega-3 fatty acids in the incidence and progression of PrCa. Results. Of 1776 citations screened, 54 publications reporting on 44 studies were included for review and analysis: 4 reports of 3 randomized controlled trials, 1 nonrandomized clinical trial, 20 reports of 14 cohort studies, 26 reports of 23 case-control studies, and 3 case-cohort studies. The interventional studies using fish oil supplements in patients with PrCa showed no impact on prostate-specific antigen levels; however, 2 studies showed a decrease in inflammatory or other cancer markers. A small number of mild adverse events were reported and interactions with other interventions were not assessed. Cohort and case-control studies assessing the relationship between dietary fish intake and the risk of PrCa were equivocal. Cohort studies assessing the risk of PrCa mortality suggested an association between higher intake of fish and decreased risk of prostate cancer–related death. Conclusions. Current evidence is insufficient to suggest a relationship between fish-derived omega-3 fatty acid and risk of PrCa. An association between higher omega-3 intake and decreased PrCa mortality may be present but more research is needed. More intervention trials or observational studies with precisely measured exposure are needed to assess the impact of fish oil supplements and dietary fish-derived omega-3 fatty acid intake on safety, Pr
Musso, Loana; Cincinelli, Raffaella; Zuco, Valentina; Zunino, Franco; Nurisso, Alessandra; Cuendet, Muriel; Giannini, Giuseppe; Vesci, Loredana; Pisano, Claudio; Dallavalle, Sabrina
2015-10-15
A series of alternative Zn-binding groups were explored in the design of phenyl-4-yl-acrylohydroxamic acid derivatives as histone deacetylase (HDAC) inhibitors. Most of the synthesized compounds were less effective than the parent hydroxamic acid. However, the profile of activity shown by the analog bearing a hydroxyurea head group, makes this derivative promising for further investigation. Copyright © 2015 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Bębenek, Ewa; Chrobak, Elwira; Wietrzyk, Joanna; Kadela, Monika; Chrobak, Artur; Kusz, Joachim; Książek, Maria; Jastrzębska, Maria; Boryczka, Stanisław
2016-02-01
A series of acetylenic derivatives of betulonic and betulinic acids has been synthesized and characterized by 1H and 13C NMR, IR and MS spectroscopy. The structure of propargyl betulonate 4 and propargyl betulinate-DMF solvate 8A was solved by X-ray diffraction. Thermal properties were examined using a DSC technique. The resulting alkynyl derivatives, as well as betulin 1 and betulinic acid 3, were evaluated in vitro for their cytotoxic activity against human T47D breast cancer, CCRF/CEM leukemia, SW707 colorectal, murine P388 leukemia and BALB3T3 normal fibroblasts cell lines. Several of the obtained compounds have a favorable cytotoxic profile than betulin 1. Propargyl betulinate 8 was the most active derivative, being up to 3-fold more potent than betulin 1 against the human leukemia (CCRF/CEM) cell line, with an IC50 value of 3.9 μg/mL.
Synthesis and Anticancer Activities of Glycyrrhetinic Acid Derivatives.
Li, Yang; Feng, Ling; Song, Zhi-Fang; Li, Hai-Bei; Huai, Qi-Yong
2016-02-06
A total of forty novel glycyrrhetinic acid (GA) derivatives were designed and synthesized. The cytotoxic activity of the novel compounds was tested against two human breast cancer cell lines (MCF-7, MDA-MB-231) in vitro by the MTT method. The evaluation results revealed that, in comparison with GA, compound 42 shows the most promising anticancer activity (IC50 1.88 ± 0.20 and 1.37 ± 0.18 µM for MCF-7 and MDA-MB-231, respectively) and merits further exploration as a new anticancer agent.
Munoz-Garrido, Patricia; Marin, José J G; Perugorria, María J; Urribarri, Aura D; Erice, Oihane; Sáez, Elena; Úriz, Miriam; Sarvide, Sarai; Portu, Ainhoa; Concepcion, Axel R; Romero, Marta R; Monte, María J; Santos-Laso, Álvaro; Hijona, Elizabeth; Jimenez-Agüero, Raúl; Marzioni, Marco; Beuers, Ulrich; Masyuk, Tatyana V; LaRusso, Nicholas F; Prieto, Jesús; Bujanda, Luis; Drenth, Joost P H; Banales, Jesús M
2015-10-01
Polycystic liver diseases (PLDs) are genetic disorders characterized by progressive biliary cystogenesis. Current therapies show short-term and/or modest beneficial effects. Cystic cholangiocytes hyperproliferate as a consequence of diminished intracellular calcium levels ([Ca(2+)]i). Here, the therapeutic value of ursodeoxycholic acid (UDCA) was investigated. Effect of UDCA was examined in vitro and in polycystic (PCK) rats. Hepatic cystogenesis and fibrosis, and the bile acid (BA) content were evaluated from the liver, bile, serum, and kidneys by HPLC-MS/MS. Chronic treatment of PCK rats with UDCA inhibits hepatic cystogenesis and fibrosis, and improves their motor behaviour. As compared to wild-type animals, PCK rats show increased BA concentration ([BA]) in liver, similar hepatic Cyp7a1 mRNA levels, and diminished [BA] in bile. Likewise, [BA] is increased in cystic fluid of PLD patients compared to their matched serum levels. In PCK rats, UDCA decreases the intrahepatic accumulation of cytotoxic BA, normalizes their diminished [BA] in bile, increases the BA secretion in bile and diminishes the increased [BA] in kidneys. In vitro, UDCA inhibits the hyperproliferation of polycystic human cholangiocytes via a PI3K/AKT/MEK/ERK1/2-dependent mechanism without affecting apoptosis. Finally, the presence of glycodeoxycholic acid promotes the proliferation of polycystic human cholangiocytes, which is inhibited by both UDCA and tauro-UDCA. UDCA was able to halt the liver disease of a rat model of PLD through inhibiting cystic cholangiocyte hyperproliferation and decreasing the levels of cytotoxic BA species in the liver, which suggests the use of UDCA as a potential therapeutic tool for PLD patients. Copyright © 2015 European Association for the Study of the Liver. All rights reserved.
Kenny, O; Smyth, T J; Hewage, C M; Brunton, N P; McLoughlin, P
2014-02-01
The combination of hyphenated techniques, LC-SPE-NMR and LC-MS, to isolate and identify minor isomeric compounds from an ethyl acetate fraction of Taraxacum officinale root was employed in this study. Two distinct fractions of 4-hydroxyphenylacetic acid derivatives of inositol were isolated and characterised by spectroscopic methods. The (1)H NMR spectra and MS data revealed two groups of compounds, one of which were derivatives of the di-4-hydroxyphenylacetic acid derivative of the inositol compound tetrahydroxy-5-[2-(4-hydroxyphenyl)acetyl] oxycyclohexyl-2-(4-hydroxyphenyl) acetate, while the other group consisted of similar tri-substituted inositol derivatives. For both fractions the derivatives of inositols vary in the number of 4-hydroxyphenylacetic acid groups present and their position and geometry on the inositol ring. In total, three di-substituted and three tri-substituted 4-hydroxyphenylacetic acid inositol derivates were identified for the first time along with a further two previously reported di-substituted inositol derivatives. Copyright © 2013 Elsevier Ltd. All rights reserved.
Dissecting Molecular Mechanisms in Bile Acid Diarrhea.
Camilleri, Michael
2016-03-01
It was previously demonstrated that patients with bile acid (BA) diarrhea have low fasting serum levels of the ileal hormone--fibroblast growth factor-19 (FGF-19). In this paper, the authors demonstrate a positive correlation between ileal transcripts of FGF-19 and (75)SeHCAT retention, providing further evidence of FGF-19 deficiency as an explanation for BA diarrhea. Variants in KLB and FGFR4 genes (that determine the functional re-uptake of BA in the portal circulation by hepatocytes) are also demonstrated to be associated with (75)SeHCAT retention, confirming a second potential mechanism for the development of BA diarrhea.
Diverse bacterial PKS sequences derived from okadaic acid-producing dinoflagellates.
Perez, Roberto; Liu, Li; Lopez, Jose; An, Tianying; Rein, Kathleen S
2008-05-22
Okadaic acid (OA) and the related dinophysistoxins are isolated from dinoflagellates of the genus Prorocentrum and Dinophysis. Bacteria of the Roseobacter group have been associated with okadaic acid producing dinoflagellates and have been previously implicated in OA production. Analysis of 16S rRNA libraries reveals that Roseobacter are the most abundant bacteria associated with OA producing dinoflagellates of the genus Prorocentrum and are not found in association with non-toxic dinoflagellates. While some polyketide synthase (PKS) genes form a highly supported Prorocentrum clade, most appear to be bacterial, but unrelated to Roseobacter or Alpha-Proteobacterial PKSs or those derived from other Alveolates Karenia brevis or Crytosporidium parvum.
Diverse Bacterial PKS Sequences Derived From Okadaic Acid-Producing Dinoflagellates
Perez, Roberto; Liu, Li; Lopez, Jose; An, Tianying; Rein, Kathleen S.
2008-01-01
Okadaic acid (OA) and the related dinophysistoxins are isolated from dinoflagellates of the genus Prorocentrum and Dinophysis. Bacteria of the Roseobacter group have been associated with okadaic acid producing dinoflagellates and have been previously implicated in OA production. Analysis of 16S rRNA libraries reveals that Roseobacter are the most abundant bacteria associated with OA producing dinoflagellates of the genus Prorocentrum and are not found in association with non-toxic dinoflagellates. While some polyketide synthase (PKS) genes form a highly supported Prorocentrum clade, most appear to be bacterial, but unrelated to Roseobacter or Alpha-Proteobacterial PKSs or those derived from other Alveolates Karenia brevis or Crytosporidium parvum. PMID:18728765
Anti-proliferative ambuic acid derivatives from Hawaiian endophytic fungus Pestalotiopsis sp. FT172.
Li, Chun-Shun; Yang, Bao-Jun; Turkson, James; Cao, Shugeng
2017-08-01
Five previously undescribed ambuic acid derivatives, pestallic acids A-E and three known analogs were isolated from the cultured broth of Pestalotiopsis sp. FT172. The structures of the pestallic acids A-E were determined through the analysis of HRMS and NMR spectroscopic data. The absolute configurations (ACs) of pestallic acids B-E were assigned by comparison of the experimental electric circular dichroism (ECD) spectra or the optical rotations with those in the literature. All compounds were tested against A2780 and cisplatin resistant A2780 (A2780CisR) cell lines. Pestallic acid E and (+)-ambuic acid showed potent activities with IC 50 values from 3.3 to 17.0 μM. Copyright © 2017 Elsevier Ltd. All rights reserved.
The High Temperature Resistivity of Ba2YCu3O7-x
NASA Astrophysics Data System (ADS)
Xingkui, Zhang; Shining, Zhu; Hao, Wang; Shiyuan, Zhang; Su, Ye; Ningshen, Zhou; Ziran, Xu
The high temperature resistivity (ρ), thermogravimetry (TG) and derivative thermogravimetry (DTG) have been used to characterize superconductor Ba2YCu3O7-x (BYCO) in O2, air and N2. The resistivity is linear from room temperature to 350°C and then deviate from linearity with oxygen evolution, the derivative of resistivity dρ/dT increases abruptly near orthorhombic to tetragonal phase transition. These phenomena can give good explanations for a two-band Drude model.
Hernandez-Patlan, D; Solis-Cruz, B; Méndez-Albores, A; Latorre, J D; Hernandez-Velasco, X; Tellez, G; López-Arellano, R
2018-02-01
To compare the conventional plating method vs a fluorometric method using PrestoBlue ® as a dye by determining the antimicrobial activity of two organic acids and curcumin (CUR) against Salmonella Enteritidis in an avian in vitro digestion model that simulates the crop, proventriculus and intestine. A concentration of 10 8 CFU per ml of S. Enteritidis was exposed to groups with different rates of ascorbic acid (AA), boric acid (BA) and CUR. Significant differences were observed when the means of the treatments were compared with the controls in the compartments that simulate the crop and intestine (P < 0·05). Ascorbic acid alone and high rates of AA in the mixtures were the most efficient treatments in the crop compartment. However, in the intestinal compartment BA alone and at different rates in the mixture BA-CUR (1 : 1) were the best treatments to decrease the concentration of S. Enteritidis. The results of this study suggest that there could be an antagonistic bactericidal effect between AA and CUR and AA and BA as well as a synergistic bactericidal effect between BA and CUR. These findings may contribute to the development of a formulation with microencapsulated compounds to liberate them in different compartments to combat S. Enteritidis infections in broiler chickens. © 2017 The Society for Applied Microbiology.
Posada Arias, Silvia; Rey-Suárez, Paola; Pereáñez J, Andrés; Acosta, Cristian; Rojas, Mauricio; Delazari Dos Santos, Lucilene; Ferreira, Rui Seabra; Núñez, Vitelbina
2017-10-26
Myotoxic phospholipases A₂ (PLA₂) are responsible for many clinical manifestations in envenomation by Bothrops snakes. A new myotoxic acidic Asp49 PLA₂ (BaCol PLA₂) was isolated from Colombian Bothrops asper venom using reverse-phase high performance liquid chromatography (RP-HPLC). BaCol PLA₂ had a molecular mass of 14,180.69 Da (by mass spectrometry) and an isoelectric point of 4.4. The complete amino acid sequence was obtained by cDNA cloning (GenBank accession No. MF319968) and revealed a mature product of 124 amino acids with Asp at position 49. BaCol PLA₂ showed structural homology with other acidic PLA₂ isolated from Bothrops venoms, including a non-myotoxic PLA₂ from Costa Rican B. asper . In vitro studies showed cell membrane damage without exposure of phosphatidylserine, an early apoptosis hallmark. BaCol PLA₂ had high indirect hemolytic activity and moderate anticoagulant action. In mice, BaCol PLA₂ caused marked edema and myotoxicity, the latter seen as an increase in plasma creatine kinase and histological damage to gastrocnemius muscle fibers that included vacuolization and hyalinization necrosis of the sarcoplasm.
NASA Astrophysics Data System (ADS)
Bukonjić, Andriana M.; Tomović, Dušan Lj.; Nikolić, Miloš V.; Mijajlović, Marina Ž.; Jevtić, Verica V.; Ratković, Zoran R.; Novaković, Slađana B.; Bogdanović, Goran A.; Radojević, Ivana D.; Maksimović, Jovana Z.; Vasić, Sava M.; Čomić, Ljiljana R.; Trifunović, Srećko R.; Radić, Gordana P.
2017-01-01
The spectroscopically predicted structure of the obtained copper(II)-complex with S-propyl derivative of thiosalicylic acid was confirmed by X-ray structural study. The binuclear copper(II)-complex with S-propyl derivative of thiosalicylic acid crystallized in two polymorphic forms with main structural difference in the orientation of phenyl rings relative to corresponding carboxylate groups. The antibacterial activity was tested determining the minimum inhibitory concentration (MIC) and the minimum bactericidal concentration (MBC) by using microdilution method. The influence on bacterial biofilm formation was determined by tissue culture plate method. In general, the copper(II)-complexes manifested a selective and moderate activity. The most sensitive bacteria to the effects of Cu(II)-complexes was a clinical isolate of Pseudomonas aeruginosa. For this bacteria MIC and biofilm inhibitory concentration (BIC) values for all tested complexes were in the range or better than the positive control, doxycycline. Also, for the established biofilm of clinical isolate Staphylococcus aureus, BIC values for the copper(II)-complex with S-ethyl derivative of thiosalicylic acid,[Cu2(S-et-thiosal)4(H2O)2] (C3) and copper(II)-complex with S-butyl derivative of thiosalicylic acid, [Cu2(S-bu-thiosal)4(H2O)2] (C5) were in range or better than the positive control. All the complexes acted better against Gram-positive bacteria (Staphylococcus aureus and Staphylococcus aureus ATCC 25923) than Gram-negative bacteria (Proteus mirabilis ATCC 12453, Pseudomonas aeruginosa, and P. aeruginosa ATCC 27855). The complexes showed weak antioxidative properties tested by two methods (1,1-diphenyl-2-picrylhydrazyl (DPPH) and reducing power assay).
NASA Astrophysics Data System (ADS)
Wang, Shiwei; Xie, Guangbo; Zhang, Jingjing; Zhang, Sen; Li, Tingju
2018-04-01
Novel high luminescence fibers often exhibit potential applications in the fields of color displays and sensor systems. In this study, Eu(BA)3phen and Tb(BA)3phen powders was successfully synthesized by solvothermal reactions, firstly. Then, three kinds of novel flexible Eu(BA)3phen/PAN, Tb(BA)3phen/PAN and Eu/Tb(BA)3phen/PAN (BA = benzoic acid, phen = phenanthroline, PAN = Polyacrylonitrile) fibers had been successfully prepared by electrospinning technology. The characterizations of the final products have been investigated in detail. It was found that the diameter of the as-prepared fibers were almost uniform with the fabricated complexes doping into PAN successfully. Thermogravimetric analysis indicates that the thermal stability of the pure PAN fiber could be improved by the incorporation of the complex, although only 1 wt % was added. Furthermore, in Eu/Tb(BA)3phen complex, the fluorescence intensity of Eu3+ ions was remarkably increased by adding Tb3+ ions. This is primarily due to an energy transfer from the 5D4 level of Tb (III) to the 5D0 level of Eu (III) ions, where Tb3+ acted as sensitizer. The corresponding luminescent fibers displayed the same regularity as the complexes. Moreover, with the increasing of the incorporation of complexes into PAN, the fluorescence intensities were significantly enhanced and reached its maximum value at 2.5 wt % for Eu(BA)3phen/PAN fibers and 2.0 wt% for Tb(BA)3phen/PAN fibers. The further intensity decreased with the increasing content of the complexes because of typical emission concentration quenching.
Preparation of directionally solidified BaTi2O5-Ba6Ti17O40 eutectic by the floating zone method
NASA Astrophysics Data System (ADS)
Shiga, K.; Katsui, H.; Goto, T.
2017-02-01
The BaTi2O5-Ba6Ti17O40 eutectic (BaO-68.7 mol% TiO2) was directionally solidified by the floating zone (FZ) method and crystalline phases, microstructures and orientation were investigated. Ba6Ti17O40 with faceted rod-like shape was dispersed in the BaTi2O5 matrix. The growth directions of BaTi2O5 and Ba6Ti17O40 were parallel to the b and a axis, respectively, and the orientation relations were BaTi2O5 (010)//Ba6Ti17O40(60 2 ̅) and BaTi2O5 (001)//Ba6Ti17O40 (001).
Acid base chemistry of luteolin and its methyl-ether derivatives: A DFT and ab initio investigation
NASA Astrophysics Data System (ADS)
Amat, Anna; De Angelis, Filippo; Sgamellotti, Antonio; Fantacci, Simona
2008-09-01
The acid-base chemistry of luteolin, a flavonoid with important pharmacological and dyeing properties, and of the related methyl ether derivatives have been investigated by DFT and MP2 methods, testing different computational setups. We calculate the pK's of all the possible deprotonation sites, for which no experimental assignment could be achieved. The calculated pK's deliver a different acidity order for the two most acidic deprotonation sites between luteolin and its methyl ether derivatives, due to intramolecular hydrogen bonding in luteolin. A lowest p Ka of 6.19 is computed for luteolin, in good agreement with available experimental data.
Parida, Pravat Kumar; Sau, Abhijit; Ghosh, Tamashree; Jana, Kuladip; Biswas, Kaushik; Raha, Sanghamitra; Misra, Anup Kumar
2014-08-15
A series of glycosyl triazol linked 18β-glycyrrhetinic acid (GA) derivatives have been synthesized using 1,3-dipolar cycloaddition reaction of per-O-acetylated glycosyl azide derivatives (4a-h) with propargyl ester of 18β-glycyrrhetinic acid (GA) (2 and 3) following the concept of 'Click chemistry'. The synthesized triazole derivatives were de-O-acetylated to furnish compounds (7a-h and 8a-c) with free hydroxyl groups in the carbohydrate moieties, which were evaluated for their anticancer potential against human cervical cancer cells (HeLa) and normal kidney epithelial (NKE) cells. GA (1), compound 7d, compound 7g and compound 8c showed promising anticancer activities. Copyright © 2014 Elsevier Ltd. All rights reserved.
Production of fatty acid-derived oleochemicals and biofuels by synthetic yeast cell factories
Zhou, Yongjin J.; Buijs, Nicolaas A.; Zhu, Zhiwei; Qin, Jiufu; Siewers, Verena; Nielsen, Jens
2016-01-01
Sustainable production of oleochemicals requires establishment of cell factory platform strains. The yeast Saccharomyces cerevisiae is an attractive cell factory as new strains can be rapidly implemented into existing infrastructures such as bioethanol production plants. Here we show high-level production of free fatty acids (FFAs) in a yeast cell factory, and the production of alkanes and fatty alcohols from its descendants. The engineered strain produces up to 10.4 g l−1 of FFAs, which is the highest reported titre to date. Furthermore, through screening of specific pathway enzymes, endogenous alcohol dehydrogenases and aldehyde reductases, we reconstruct efficient pathways for conversion of fatty acids to alkanes (0.8 mg l−1) and fatty alcohols (1.5 g l−1), to our knowledge the highest titres reported in S. cerevisiae. This should facilitate the construction of yeast cell factories for production of fatty acids derived products and even aldehyde-derived chemicals of high value. PMID:27222209
Synthesis of pyroglutamic acid derivatives via double michael reactions of alkynones.
Scansetti, Myriam; Hu, Xiangping; McDermott, Benjamin P; Lam, Hon Wai
2007-05-24
In the presence of substoichiometric quantities of potassium tert-butoxide and an additional metal salt, amide-tethered diacids undergo double Michael reactions with alkynones to provide highly functionalized pyroglutamic acid derivatives. The metal salt was found to play an important role in improving the diastereoselectivities of the reactions.
One-pot conversion of biomass-derived xylose and furfural into levulinate esters via acid catalysis.
Hu, Xun; Jiang, Shengjuan; Wu, Liping; Wang, Shuai; Li, Chun-Zhu
2017-03-07
Direct conversion of biomass-derived xylose and furfural into levulinic acid, a platform molecule, via acid-catalysis has been accomplished for the first time in dimethoxymethane/methanol. Dimethoxymethane acted as an electrophile to transform furfural into 5-hydroxymethylfurfural (HMF). Methanol suppressed both the polymerisation of the sugars/furans and the Aldol condensation of levulinic acid/ester.
Konas, D W; Coward, J K
2001-12-28
Electrophilic fluorination of enantiomerically pure 2-pyrrolidinones (4) derived from (L)-glutamic acid has been investigated as a method for the synthesis of single stereoisomers of 4-fluorinated glutamic acids. Reaction of the lactam enolate derived from 9 with NFSi results in a completely diastereoselective monofluorination reaction to yield the monocyclic trans-substituted alpha-fluoro lactam product 21. Unfortunately, a decreased kinetic acidity in 21 and other structurally related monofluorinated products renders them resistant to a second fluorination. In contrast, the bicyclic lactam 12 is readily difluorinated under the standard conditions described to yield the alpha,alpha-difluoro lactam 24. The difference in reactivity between the two types of related lactams is attributed mainly to the presence or lack of a steric interaction between the base used for deprotonation and the protecting group present in the pyrrolidinone substrates. This conclusion was reached based on analysis of the X-ray crystal structure of 21, molecular modeling, and experimental evidence. The key intermediates 21 and 24 are converted to (2S,4R)-4-fluoroglutamic acid and (2S)-4,4-difluoroglutamic acid, respectively.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mudiyanselage, Kumudu; Yi, Cheol-Woo; Szanyi, Janos
2011-05-31
The adsorption and reaction of NO2 on BaO (<1, ~3, and >20 monolayer equivalent (MLE))/Pt(111) model systems were studied with temperature programmed desorption (TPD), X-ray photoelectron spectroscopy (XPS), and infrared reflection absorption spectroscopy (IRAS) under ultra-high vacuum (UHV) as well as elevated pressure conditions. NO2 reacts with sub-monolayer BaO (<1 MLE) to form nitrites only, whereas the reaction of NO2 with BaO (~3 MLE)/Pt(111) produces mainly nitrites and a small amount of nitrates under UHV conditions (PNO2 ~ 1.0 × 10-9 Torr) at 300 K. In contrast, a thick BaO(>20 MLE) layer on Pt(111) reacts with NO2 to form nitrite-nitratemore » ion pairs under the same conditions. At elevated NO2 pressures (≥ 1.0 × 10-5 Torr), however, BaO layers at all these three coverages convert to amorphous barium nitrates at 300 K. Upon annealing to 500 K, these amorphous barium nitrate layers transform into crystalline phases. The thermal decomposition of the thus-formed Ba(NOx)2 species is also influenced by the coverage of BaO on the Pt(111) substrate: at low BaO coverages, these species decompose at significantly lower temperatures in comparison with those formed on thick BaO films due to the presence of Ba(NOx)2/Pt interface where the decomposition can proceed at lower temperatures. However, the thermal decomposition of the thick Ba(NO3)2 films follows that of bulk nitrates. Results obtained from these BaO/Pt(111) model systems under UHV and elevated pressure conditions clearly demonstrate that both the BaO film thickness and the applied NO2 pressure are critical in the Ba(NOx)2 formation and subsequent thermal decomposition processes.« less
Anisotropic Dirac Fermions in BaMnBi2 and BaZnBi2
NASA Astrophysics Data System (ADS)
Ryu, Hyejin; Park, Se Young; Li, Lijun; Ren, Weijun; Petrovic, Cedomir; Hwang, Choonkyu; Mo, Sung-Kwan
We report electronic structures of BaMnBi2 and BaZnBi2 sharing similar structural properties but having different valence configuration of the Mn/Zn-Bi complex. Our angle-resolved photoemission measurements found a strong anisotropic Dirac dispersion in BaMnBi2 and a complete departure from the Dirac dispersion in BaZnBi2. Our findings, substantiated by the first principle calculations, allow us to understand role of Mn/Zn-Bi tetrahedra in the changes of the electronic structures as well as the effect of varying band filling of Bi-square net. Work at BNL was supported by the U.S. Dept of Energy-BES, Division of Materials Science and Engineering, under Contract No. DE-SC0012704 and Chinese Academy of Sciences under Grant No. KJZD-EW-M05.
Aremu, Adeyemi O; Plačková, Lenka; Novák, Ondřej; Stirk, Wendy A; Doležal, Karel; Van Staden, Johannes
2016-01-01
The current evidence of regulatory effect of smoke-water (SW) and karrikinolide (KAR(1)) on the concentrations of endogenous cytokinins in plants partly explain the basis for their growth stimulatory activity. Karrikinolide (KAR1) which is derived from smoke-water (SW) is involved in some physiological aspects in the life-cycle of plants. This suggests a potential influence on the endogenous pool (quantity and quality) of phytohormones such as cytokinins (CKs). In the current study, the effect of SW (1:500; 1:1000; 1:1500 v/v dilutions) and KAR1 (10(-7); 10(-8); 10(-9) M) applied during micropropagation of Eucomis autumnalis subspecies autumnalis on the ex vitro growth and CKs after 4 months post-flask duration was evaluated. The interactions of SW and KAR(1) with benzyladenine (BA), α-naphthaleneacetic acid (NAA) or BA+NAA were also assessed. Plants treated with SW (1:500) and KAR1 (10(-8) M) demonstrated superior growth in terms of the rooting, leaf and bulb sizes and fresh biomass than the control and plants treated with BA and BA+NAA. However, plant growth was generally inhibited with either SW (1:500) or KAR1 (10(-8) M) and BA when compared to BA (alone) treatment. Relative to NAA treatment, the presence of KAR(1) (10(-7) M) with NAA significantly increased the leaf area and fresh biomass. Both SW and KAR1-treated plants accumulated more total CKs, mainly isoprenoid-type than the control and NAA-treated plants. The highest CK content was also accumulated in SW (1:500) with BA+NAA treatments. Similar stimulatory effects were observed with increasing concentrations of KAR(1) and BA. The current findings establish that SW and KAR1 exert significant influence on the endogenous CK pools. However, the better growth of plants treated with SW and KAR1 treatments was not exclusively related to the endogenous CKs.
Methylboronic acid fertilization alleviates boron deficiency symptoms in Arabidopsis thaliana.
Duran, Catherine; Arce-Johnson, Patricio; Aquea, Felipe
2018-07-01
Our results showed that methylboronic acid is capable of alleviating boron deficiency, enhancing plant growth, and is less toxic than boric acid at higher concentrations. Boron is an essential plant micronutrient and its deficiency occurs in several regions globally, resulting in impaired plant growth. Boron fertilization is a common agricultural practice, but the action range of boron is narrow, sharply transitioning from deficiency to toxicity. Boric acid (BA) is the most common chemical form used in agriculture. In this work, we describe that methylboronic acid (MBA) is capable of alleviating boron deficiency in Arabidopsis. MBA is a boronic acid, but does not naturally occur in soils, necessitating synthesis. Other boronic acids have been described as boron competitors in plants, inhibiting auxin biosynthesis and root development. MBA is more water-soluble than BA and delivers the same amount of boron per molecule. We observed that Arabidopsis seedlings grown in the presence of MBA presented higher numbers of lateral roots and greater main root length compared to plants grown in BA. In addition, root hair length and leaf surface area were increased using MBA as a boron fertilizer. Finally, MBA was less toxic than BA at high concentrations, producing a slight reduction in the main root length but no decrease in total chlorophyll. Our results open a new opportunity to explore the use of a synthetic form of boron in agriculture, providing a tool for future research for plant nutrition.
NASA Astrophysics Data System (ADS)
Matsui, Motohide; Nariki, Shinya; Sakai, Naomichi; Iwafuchi, Kengo; Murakami, Masato
2006-07-01
We used Ba-Cu-O substrates to fabricate bulk Nd-Ba-Cu-O superconductors using a top-seeded melt-growth method. There were several advantages for the use of Ba-Cu-O substrate compared to conventional substrate materials such as MgO, ZrO2, Al2O3, RE123 and RE211 (RE = rare earth). The Ba-Cu-O did not react with the precursor and minimized liquid loss. Accordingly, the introduction of large-sized cracks was suppressed. We also found that Tc values were high at the bottom regions, which was ascribed to the beneficial effect of Ba-Cu-O in suppressing Nd/Ba substitution. As a result, we obtained bulk Nd-Ba-Cu-O superconductors that exhibited fairly good field-trapping capabilities, even at the bottom surfaces.
Enhancing the Bioconversion of Azelaic Acid to Its Derivatives by Response Surface Methodology.
Khairudin, Nurshafira; Basri, Mahiran; Fard Masoumi, Hamid Reza; Samson, Shazwani; Ashari, Siti Efliza
2018-02-13
Azelaic acid (AzA) and its derivatives have been known to be effective in the treatment of acne and various cutaneous hyperpigmentary disorders. The esterification of azelaic acid with lauryl alcohol (LA) to produce dilaurylazelate using immobilized lipase B from Candida antarctica (Novozym 435) is reported. Response surface methodology was selected to optimize the reaction conditions. A well-fitting quadratic polynomial regression model for the acid conversion was established with regards to several parameters, including reaction time and temperature, enzyme amount, and substrate molar ratios. The regression equation obtained by the central composite design of RSM predicted that the optimal reaction conditions included a reaction time of 360 min, 0.14 g of enzyme, a reaction temperature of 46 °C, and a molar ratio of substrates of 1:4.1. The results from the model were in good agreement with the experimental data and were within the experimental range (R² of 0.9732).The inhibition zone can be seen at dilaurylazelate ester with diameter 9.0±0.1 mm activities against Staphylococcus epidermidis S273. The normal fibroblasts cell line (3T3) was used to assess the cytotoxicity activity of AzA and AzA derivative, which is dilaurylazelate ester. The comparison of the IC 50 (50% inhibition of cell viability) value for AzA and AzA derivative was demonstrated. The IC 50 value for AzA was 85.28 μg/mL, whereas the IC 50 value for AzA derivative was more than 100 μg/mL. The 3T3 cell was still able to survive without any sign of toxicity from the AzA derivative; thus, it was proven to be non-toxic in this MTT assay when compared with AzA.
Amino acid derivatives of 5-ASA as novel prodrugs for intestinal drug delivery.
Clerici, C; Gentili, G; Boschetti, E; Santucci, C; Aburbeh, A G; Natalini, B; Pellicciari, R; Morelli, A
1994-12-01
In an attempt to obtain site-specific delivery of 5-ASA in the intestinal tract, we have determined the extent of absorption and metabolism of a number of novel 5-ASA derivatives, namely, (N-L-glutamyl)-amino-2-salicylic acid (1), (N-L-aspartyl)-amino-2-salicylic-acid (2), 5-aminosalicyl-L-proline-L-leucine (3), and 5-(N-L-glutamyl)-aminosalicyl-L-proline-L-leucine (4), which are selectively cleaved by intestinal brush border aminopeptidase A and carboxypeptidases. These novel prodrugs, 5-ASA, and sulfasalazine were administered to adult Fisher rats (N = 30) and to animals that had undergone prior colostomy (N = 30). Urine and feces were collected at timed intervals for 48 hr and the metabolites, 5-ASA, and N-acetyl-5-ASA were measured by high-performance liquid chromatography. The absorption and metabolism of all compounds were essentially identical in colostomized and normal animals. 5-ASA exhibited a rapid proximal intestinal absorption as evidenced by the high cumulative urinary excretion (> 65%) and low fecal excretion. Sulfasalazine, as expected, exhibited a lower urinary recovery (< 35%) and higher fecal excretion of 5-ASA and its metabolite. The novel glutamate and aspartate derivatives (1 and 2) behaved similarly to sulfasalazine, while administration of the proline-leucine derivative (3) resulted in urinary and fecal recovery values intermediate with respect to those observed with 5-ASA and sulfasalazine. 5-(N-L-Glutamyl)-aminosalicyl-L-proline-L-leucine yielded the highest fecal recovery of 5-ASA and its N-acetyl derivative, indicating a more efficient delivery to the distal bowel. Amino acid derivatives of 5-ASA appear to be potentially useful prodrugs for the site-specific delivery of 5-ASA to different regions of the intestinal tract.
Recent developments in altering the fatty acid composition of ruminant-derived foods.
Shingfield, K J; Bonnet, M; Scollan, N D
2013-03-01
There is increasing evidence to indicate that nutrition is an important factor involved in the onset and development of several chronic human diseases including cancer, cardiovascular disease (CVD), type II diabetes and obesity. Clinical studies implicate excessive consumption of medium-chain saturated fatty acids (SFA) and trans-fatty acids (TFA) as risk factors for CVD, and in the aetiology of other chronic conditions. Ruminant-derived foods are significant sources of medium-chain SFA and TFA in the human diet, but also provide high-quality protein, essential micronutrients and several bioactive lipids. Altering the fatty acid composition of ruminant-derived foods offers the opportunity to align the consumption of fatty acids in human populations with public health policies without the need for substantial changes in eating habits. Replacing conserved forages with fresh grass or dietary plant oil and oilseed supplements can be used to lower medium-chain and total SFA content and increase cis-9 18:1, total conjugated linoleic acid (CLA), n-3 and n-6 polyunsaturated fatty acids (PUFA) to a variable extent in ruminant milk. However, inclusion of fish oil or marine algae in the ruminant diet results in marginal enrichment of 20- or 22-carbon PUFA in milk. Studies in growing ruminants have confirmed that the same nutritional strategies improve the balance of n-6/n-3 PUFA, and increase CLA and long-chain n-3 PUFA in ruminant meat, but the potential to lower medium-chain and total SFA is limited. Attempts to alter meat and milk fatty acid composition through changes in the diet fed to ruminants are often accompanied by several-fold increases in TFA concentrations. In extreme cases, the distribution of trans 18:1 and 18:2 isomers in ruminant foods may resemble that of partially hydrogenated plant oils. Changes in milk fat or muscle lipid composition in response to diet are now known to be accompanied by tissue-specific alterations in the expression of one or more
Yokosaka, Takuya; Shiga, Naoki; Nemoto, Tetsuhiro; Hamada, Yasumasa
2014-05-02
Two different cascade cyclization processes were developed using aryl group-substituted propargyl alcohol derivatives with a p-hydroxybenzylamine unit as common substrates. Using TFA as an acid promoter, an intramolecular ipso-Friedel-Crafts alkylation of phenol derivatives, formation of an iminium cation via a rearomatization-promoted C-C bond cleavage, an aza-Prins reaction, and a 6-membered ring formation proceeded sequentially, producing a variety of fused-tricyclic dihydroquinoline derivatives in 45-99% yield. In addition, a one-pot sequential silver acetate-catalyzed hydroamination/etherification-acid-promoted skeletal rearrangement was examined using the same series of substrates, affording fused-tricyclic indole/benzofuran derivatives in 66-89% yield.
Scaled-up production of poacic acid, a plant-derived antifungal agent
Yue, Fengxia; Gao, Ruili; Piotrowski, Jeff S.; ...
2017-09-01
Poacic acid, a decarboxylated product from 8–5-diferulic acid that is commonly found in monocot lignocellulosic hydrolysates, has been identified as a natural antifungal agent against economically significant fungi and oomycete plant pathogens. Starting from commercially available or monocot-derivable ferulic acid, a three-step synthetic procedure has been developed for the production of poacic acid needed for field testing in a controlled agricultural setting. First, ferulic acid was esterified to produce ethyl ferulate in 92% yield. Second, peroxidase-catalyzed free radical dehydrodimerization of ethyl ferulate produced crude diferulates, mainly 8–5-diferulate, in 91% yield. Finally, crystalline poacic acid was obtained in 25% yield viamore » alkaline hydrolysis of the crude diferulates after purification by flash-column chromatography. Thus, this new procedure offers two key improvements relevant to large-scale production: 1) bubbling air through the reaction mixture in the second step to remove acetone greatly improves the recovery efficiency of the crude diferulates; and 2) telescoping minor impurities directly into the alkaline hydrolysis step eliminates the need for additional column purifications, thus reducing the overall cost of production and removing a major impediment to process scale-up.« less
Scaled-up production of poacic acid, a plant-derived antifungal agent
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yue, Fengxia; Gao, Ruili; Piotrowski, Jeff S.
Poacic acid, a decarboxylated product from 8–5-diferulic acid that is commonly found in monocot lignocellulosic hydrolysates, has been identified as a natural antifungal agent against economically significant fungi and oomycete plant pathogens. Starting from commercially available or monocot-derivable ferulic acid, a three-step synthetic procedure has been developed for the production of poacic acid needed for field testing in a controlled agricultural setting. First, ferulic acid was esterified to produce ethyl ferulate in 92% yield. Second, peroxidase-catalyzed free radical dehydrodimerization of ethyl ferulate produced crude diferulates, mainly 8–5-diferulate, in 91% yield. Finally, crystalline poacic acid was obtained in 25% yield viamore » alkaline hydrolysis of the crude diferulates after purification by flash-column chromatography. Thus, this new procedure offers two key improvements relevant to large-scale production: 1) bubbling air through the reaction mixture in the second step to remove acetone greatly improves the recovery efficiency of the crude diferulates; and 2) telescoping minor impurities directly into the alkaline hydrolysis step eliminates the need for additional column purifications, thus reducing the overall cost of production and removing a major impediment to process scale-up.« less
2-Thiophenecarboxylic acid hydrazide Derivatives: Synthesis and Anti-Tuberculosis Studies
NASA Astrophysics Data System (ADS)
Fahmi, M. R. G.; Khumaidah, L.; Ilmiah, T. K.; Fadlan, A.; Santoso, M.
2018-04-01
One of the most frequent and widespread infectious diseases especially in developing countries is tuberculosis (TB). The number of TB drug resistant tend to increase, and there has been no new TB drug introduce since the 1960s. Six 2-Thiophenecarboxylic acid hydrazide derivatives were synthesized in 90-97% yields, and 2-thiophenecarbonylhydrazone-5, 7-dibromoisatin showed the highest activity in inhibiting M. tuberculosis H37Rv.
Zhang, Li; Xu, Liang; Zeng, Qiang; Zhang, Shao-Hui; Xie, Hong; Liu, Ai-Lin; Lu, Wen-Qing
2012-01-24
Disinfection of drinking water reduces pathogenic infection, but generates disinfection by-products (DBPs) in drinking water. In this study, the effect of fifteen DBPs on DNA damage in human-derived hepatoma line (HepG2) was investigated by the single cell gel electrophoresis (SCGE) assay. These fifteen DBPs are: four trihalomethanes (THMs), six haloacetic acides (HAAs), three haloacetonitriles (HANs), 3-chloro-4-(dichloromethyl)-5-hydroxy-2(5H)-furanone (MX), and chloral hydrate (CH). Based on the minimal effective concentration (MEC) at which DBPs induced significant increase in olive tail moment (OTM), the rank order of DNA-damaging potency is: bromodichloromethane (BDCM)>dibromochloromethane (DBCM)>tribromomethane (TBM)>trichloromethane (TCM) of the four THMs; iodoacetic acid (IA)>bromoacetic acid (BA)>dibromoacetic acid (DBA)>dichloracetic acid (DCA)>trichloroacetic acid (TCA) of the five HAAs; dibromoacetonitrile (DBN)approximately dichloroacetonitrile (DCN)>trichloroacetonitrile (TCN) of the three HANs. The DNA damaging potency of MX and CH is similar to TCA and DCA, respectively. IA is the most genotoxic DBP in the fifteen DBPs, followed by BA. Chloroacetic acid (CA) is not genotoxic in this assay. Our findings indicated that HepG2/SCGE is a sensitive tool to evaluate the genotoxicity of DBPs and iodinated DBPs are more genotoxic than brominated DBPs, but chlorinated DBPs are less genotoxic than brominated DBPs. © 2011 Elsevier B.V. All rights reserved.
Cytochrome P450-generated metabolites derived from ω-3 fatty acids attenuate neovascularization
Yanai, Ryoji; Mulki, Lama; Hasegawa, Eiichi; Takeuchi, Kimio; Sweigard, Harry; Suzuki, Jun; Gaissert, Philipp; Vavvas, Demetrios G.; Sonoda, Koh-Hei; Rothe, Michael; Schunck, Wolf-Hagen; Miller, Joan W.; Connor, Kip M.
2014-01-01
Ocular neovascularization, including age-related macular degeneration (AMD), is a primary cause of blindness in individuals of industrialized countries. With a projected increase in the prevalence of these blinding neovascular diseases, there is an urgent need for new pharmacological interventions for their treatment or prevention. Increasing evidence has implicated eicosanoid-like metabolites of long-chain polyunsaturated fatty acids (LCPUFAs) in the regulation of neovascular disease. In particular, metabolites generated by the cytochrome P450 (CYP)–epoxygenase pathway have been shown to be potent modulators of angiogenesis, making this pathway a reasonable previously unidentified target for intervention in neovascular ocular disease. Here we show that dietary supplementation with ω-3 LCPUFAs promotes regression of choroidal neovessels in a well-characterized mouse model of neovascular AMD. Leukocyte recruitment and adhesion molecule expression in choroidal neovascular lesions were down-regulated in mice fed ω-3 LCPUFAs. The serum of these mice showed increased levels of anti-inflammatory eicosanoids derived from eicosapentaenoic acid and docosahexaenoic acid. 17,18-epoxyeicosatetraenoic acid and 19,20-epoxydocosapentaenoic acid, the major CYP-generated metabolites of these primary ω-3 LCPUFAs, were identified as key lipid mediators of disease resolution. We conclude that CYP-derived bioactive lipid metabolites from ω-3 LCPUFAs are potent inhibitors of intraocular neovascular disease and show promising therapeutic potential for resolution of neovascular AMD. PMID:24979774
NASA Technical Reports Server (NTRS)
Rauch, T.; Werner, K.; Quinet, P.; Kruk, Jeffrey Walter
2014-01-01
Context. For the spectral analysis of high-resolution and high-signal-to-noise (S/N) spectra of hot stars, state-of-the-art non-local thermodynamic equilibrium (NLTE) model atmospheres are mandatory. These are strongly dependent on the reliability of the atomic data that is used for their calculation. Aims. Reliable Ba 5-7 oscillator strengths are used to identify Ba lines in the spectra of the DA-type white dwarf G191-B2B and the DO-type white dwarf RE 0503-289 and to determine their photospheric Ba abundances. Methods. We newly calculated Ba v-vii oscillator strengths to consider their radiative and collisional bound-bound transitions in detail in our NLTE stellar-atmosphere models for the analysis of Ba lines exhibited in high-resolution and high-S/N UV observations of G191-B2B and RE 0503-289. Results. For the first time, we identified highly ionized Ba in the spectra of hot white dwarfs. We detected Ba vi and Ba vii lines in the Far Ultraviolet Spectroscopic Explorer (FUSE) spectrum of RE 0503-289. The Ba vi/Ba vii ionization equilibrium is well reproduced with the previously determined effective temperature of 70 000 K and surface gravity of log g=7.5. The Ba abundance is 3.5 +/- 0.5 × 10(exp-4) (mass fraction, about 23 000 times the solar value). In the FUSE spectrum of G191-B2B, we identified the strongest Ba vii line (at 993.41 Å) only, and determined a Ba abundance of 4.0 +/- 0.5 × 10(exp-6) (about 265 times solar). Conclusions. Reliable measurements and calculations of atomic data are a pre-requisite for stellar-atmosphere modeling. Observed Ba vi-vii line profiles in two white dwarfs' (G191-B2B and RE 0503-289) far-ultraviolet spectra were well reproduced with our newly calculated oscillator strengths. This allowed to determine the photospheric Ba abundance of these two stars precisely.
NASA Astrophysics Data System (ADS)
Sanders, Christian J.; Santos, Isaac R.; Barcellos, Renato; Silva Filho, Emmanoel V.
2012-07-01
Groundwater underlying a mangrove habitat was studied to determine the geochemical nature of Ba, Fe and Mn as related to dissolved organic carbon (DOC), SO4 and salinity (Sepetiba Bay, Brazil). Wells were placed across geobotanic facies and sampled monthly for a year. We observed non-conservative behavior and elevated concentrations of dissolved metals relative to local end-members (i.e., fresh river water and seawater). Average Ba concentrations were near 2000 nM in an area with low salinity (˜5.3). Dissolved Fe (up to 654 μM) was two orders of magnitude greater in fresh groundwater than in the seaward sampling stations. Manganese concentrations were greatest (112 μM) in the high salinity (˜65) zone, being directly influenced by salinity. Groundwater Ba, Fe and Mn showed differing site specific concentrations, likely related to ion exchange processes and redox-controlled cycling along distinct mangrove facies. The results of this work show that metal concentrations are altered relative to conservative mixing between terrestrial and marine endmembers, illustrating the importance of mangrove subterranean estuaries as biogeochemical reactors. Roughly-estimated submarine groundwater discharge-derived dissolved Ba, Fe and Mn fluxes were at least one order of magnitude greater than river-derived fluxes into Sepetiba Bay.
Alves Monteath, Silvana Amadeu Ferreira; Maciel, Maria Aparecida M.; Vega, Raquel Garcia; de Mello, Heloisa; de Araújo Martins, Carollina; Esteves-Souza, Andressa; Gattass, Cerli Rocha; Echevarria, Aurea
2017-01-01
Background: Ixora coccinea Linn (Rubiaceae) is an evergreen shrub with bright scarlet colored flowers found in several tropical and subtropical countries. It is used as an ornamental and medicinal plant. Phytochemical studies revealed that its major special metabolites are triterpene acids, such as ursolic and oleanolic acid. Objective: To evaluate the isolation of ursolic acid (UA) (1) from methanol extracts of I. coccinea flowers through two methodologies, to prepare four derivatives, and to evaluate the cytotoxic effect against six cancer cell lines. Materials and Methods: The UA was isolated from vegetal material by percolation at room temperature and by ultrasound-assisted extraction. The preparation of derivatives was performed according to literature methods, and the cytotoxic effects were evaluated using the MTT (3,4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide) assay. Results: The most efficient extraction was achieved through ultrasound irradiation with a yield of 35% after KOH-impregnated silica in chromatography column. Furthermore, four derivatives (3, 5, 6, 7) of UA were prepared and evaluated, including 1, against two lung cancer (A549 and H460) and four leukemia (K562, Lucena, HL60, and Jurkat) cell lines. Generally, results showed that 1 and 7 were the most active compounds against the assayed cell lines. Also, the cytotoxic effects observed on terpenes 1 and 7 were higher when compared with cisplatin, used as positive control, with the exception of Jurkat cell line. Conclusion: The efficiency of such an alternative extraction method led to the principal and abundant active component, 1, of I. coccinea, thus representing a considerable contribution for promising triterpenoid in cancer chemotherapy. SUMMARY The ultrasound-assisted extraction of Ixora coccinea flowers improved of the ursolic acid isolationMethanolic extract from flowers of I. coccinea provided, by ultrasound irradiation, after KOH-impregnated silica in chromatography column
Fujiyoshi, Tomoharu; Ikami, Takahito; Kikukawa, Koji; Kobayashi, Masato; Takai, Rina; Kozaki, Daisuke; Yamamoto, Atsushi
2018-02-01
The preservatives benzoic acid and sorbic acid are generally quantified with separation techniques, such as HPLC or GC. Here we describe a new method for determining these compounds in processed food samples based on a narrowness of the UV-visible spectral band width with derivative processing. It permits more selective identification and determination of target analytes in matrices. After a sample is purified by micro dialysis, UV spectra of sample solutions were measured and fourth order derivatives of the spectrum were calculated. The amplitude between the maximum and minimum values in a high-order derivative spectrum was used for the determination of benzoic acid and sorbic acid. Benzoic acid and sorbic acid levels in several commercially available processed foods were measured by HPLC and the proposed spectrometry method. The levels obtained by the two methods were highly correlated (r 2 >0.97) for both preservatives. Copyright © 2017 Elsevier Ltd. All rights reserved.
Ba3CuOs2O9 and Ba3ZnOs2O9, a comparative study
NASA Astrophysics Data System (ADS)
Feng, Hai L.; Jansen, Martin
2018-02-01
Polycrystalline samples of Ba3CuOs2O9 and Ba3ZnOs2O9 were synthesized by solid-state reactions. Ba3CuOs2O9 crystallizes in Cmcm, while Ba3ZnOs2O9 adopts the hexagonal space group P63/mmc. Both the crystal structures consist of face-sharing Os-centered octahedra forming dimer-like Os2O9 units, which are interconnected by corner-sharing CuO6, or ZnO6 octahedra, respectively. In Ba3CuOs2O9, the CuO6 octahedra show a characteristic Jahn-Teller distortion. Both, Ba3CuOs2O9 and Ba3ZnOs2O9, are electrically insulating. Magnetic and specific heat measurements confirm that Ba3CuOs2O9 is antiferromagnetically ordered below 47 K. Analysis of the magnetic data indicated that its magnetic properties are dominated by Cu2+ ions. The magnetic susceptibility of Ba3ZnOs2O9 is weakly temperature-dependent with a broad maximum ≈ 280 K, indicating the presence of strong exchange interactions within the Os2O9 dimer. The residual magnetic susceptibility at low temperatures also suggests the presence of appreciable exchange coupling between the dimers.
Barium bioaccumulation by bacterial biofilms and implications for Ba cycling and use of Ba proxies.
Martinez-Ruiz, Francisca; Jroundi, Fadwa; Paytan, Adina; Guerra-Tschuschke, Isabel; Abad, María Del Mar; González-Muñoz, María Teresa
2018-04-24
Ba proxies have been broadly used to reconstruct past oceanic export production. However, the precise mechanisms underlying barite precipitation in undersaturated seawater are not known. The link between bacterial production and particulate Ba in the ocean suggests that bacteria may play a role. Here we show that under experimental conditions marine bacterial biofilms, particularly extracellular polymeric substances (EPS), are capable of bioaccumulating Ba, providing adequate conditions for barite precipitation. An amorphous P-rich phase is formed at the initial stages of Ba bioaccumulation, which evolves into barite crystals. This supports that in high productivity regions where large amounts of organic matter are subjected to bacterial degradation, the abundant EPS would serve to bind the necessary Ba and form nucleation sites leading to barite precipitation. This also provides new insights into barite precipitation and opens an exciting field to explore the role of EPS in mineral precipitation in the ocean.
Sorbic and benzoic acid in non-preservative-added food products in Turkey.
Cakir, Ruziye; Cagri-Mehmetoglu, Arzu
2013-01-01
Sorbic acid (SA) and benzoic acid (BA) were determined in yoghurt, tomato and pepper paste, fruit juices, chocolates, soups and chips in Turkey by using high-pressure liquid chromatography (HPLC). Levels were compared with Turkish Food Codex limits. SA was detected only in 2 of 21 yoghurt samples, contrary to BA, which was found in all yoghurt samples but one, ranging from 10.5 to 159.9 mg/kg. Both SA and BA were detected also in 3 and 6 of 23 paste samples in a range of 18.1-526.4 and 21.7-1933.5 mg/kg, respectively. Only 1 of 23 fruit juices contained BA. SA was not detected in any chips, fruit juice, soup, or chocolate sample. Although 16.51% of the samples was not compliant with the Turkish Food Codex limits, estimated daily intake of BA or SA was below the acceptable daily intake.
Yoon, Se Rim; Yang, Hee-Man; Park, Chan Woo; Lim, Sujin; Chung, Bong Hyun; Kim, Jong-Duk
2012-08-01
A charge-converting and pH-dependent nanocarrier was achieved by conjugating 2,3-dimethylmaleic anhydride (DMMA) to the amino group of an octadecyl grafted poly (2-hydroxyethyl aspartamide) (PHEA-g-C(18)-NH(2)) backbone, thereby forming a spherical micelle. PHEA, a poly(amino acid)s derivative, was derived from poly(succinimide), which is biocompatible and biodegradable. DMMA, a detachable component at the tumor site, was added, preventing aggregation with negative blood serum and enhancing the nanocarrier's cellular uptake. The polymeric micelle was comprehensively characterized and doxorubicin was encapsulated successively. The cellular uptake and anticancer therapeutic effect were evaluated by flow cytometry, confocal laser scanning microscopy, and a MTT assay. The properties of the nanocarrier can further be exploited to develop an early detection module for cancer. The present work is also expected to advance the study of designing smart carriers for drug and gene delivery. Copyright © 2012 Wiley Periodicals, Inc.
Saludes, Jonel P; Natarajan, Arutselvan; DeNardo, Sally J; Gervay-Hague, Jacquelyn
2010-05-01
Peptides are labile toward proteolytic enzymes, and structural modifications are often required to prolong their metabolic half-life and increase resistance. One modification is the incorporation of non-alpha-amino acids into the peptide to deter recognition by hydrolytic enzymes. We previously reported the synthesis of chimeric alpha/delta-peptides from glutamic acids (Glu) and the sialic acid derivative Neu2en. Conformational analyses revealed these constructs adopt secondary structures in water and may serve as conformational surrogates of polysialic acid. Polysialic acid is a tumor-associated polysaccharide and is correlated with cancer metastasis. Soluble polysialic acid is rapidly cleared from the blood limiting its potential for vaccine development. One motivation in developing structural surrogates of polysialic acid was to create constructs with increased bioavailability. Here, we report plasma stability profiles of Glu/Neu2en alpha/delta-peptides. DOTA was conjugated at the peptide N-termini by solid phase peptide synthesis, radiolabeled with (111)In, incubated in human blood plasma at 37 degrees C, and their degradation patterns monitored by cellulose acetate electrophoresis and radioactivity counting. Results indicate that these peptides exhibit a long half-life that is two- to three-orders of magnitude higher than natural alpha-peptides. These findings provide a viable platform for the synthesis of plasma stable, sialic acid-derived peptides that may find pharmaceutical application.
Spin-Coating and Characterization of Multiferroic MFe2O4 (M=Co, Ni) / BaTiO3 Bilayers
NASA Astrophysics Data System (ADS)
Quandt, Norman; Roth, Robert; Syrowatka, Frank; Steimecke, Matthias; Ebbinghaus, Stefan G.
2016-01-01
Bilayer films of MFe2O4 (M=Co, Ni) and BaTiO3 were prepared by spin coating of N,N-dimethylformamide/acetic acid solutions on platinum coated silicon wafers. Five coating steps were applied to get the desired thickness of 150 nm for both the ferrite and perovskite layer. XRD, IR and Raman spectroscopy revealed the formation of phase-pure ferrite spinels and BaTiO3. Smooth surfaces with roughnesses in the order of 3 to 5 nm were found in AFM investigations. Saturation magnetization of 347 emu cm-3 for the CoFe2O4/BaTiO3 and 188 emu cm-3 for the NiFe2O4/BaTiO3 bilayer, respectively were found. For the CoFe2O4/BaTiO3 bilayer a strong magnetic anisotropy was observed with coercivity fields of 5.1 kOe and 3.3 kOe (applied magnetic field perpendicular and parallel to film surface), while for the NiFe2O4/BaTiO3 bilayer this effect is less pronounced. Saturated polarization hysteresis loops prove the presence of ferroelectricity in both systems.
Effect of the structure of gallic acid and its derivatives on their interaction with plant ferritin.
Wang, Qunqun; Zhou, Kai; Ning, Yong; Zhao, Guanghua
2016-12-15
Gallic acid and its derivatives co-exist with protein components in foodstuffs, but there is few report on their interaction with proteins. On the other hand, plant ferritin represents not only a novel class of iron supplement, but also a new nanocarrier for encapsulation of bioactive nutrients. However, plant ferritin is easy to be degraded by pepsin in the stomach, thereby limiting its application. Herein, we investigated the interaction of gallic acid and its derivatives with recombinant soybean seed H-2 ferritin (rH-2). We found that these phenolic acids interacted with rH-2 in a structure-dependent manner; namely, gallic acid (GA), methyl gallate (MEGA) and propyl gallate (PG) having three HO groups can bind to rH-2, while their analogues with two HO groups cannot. Consequently, such binding largely inhibited ferritin degradation by pepsin. These findings advance our understanding of the relationship between the structure and function of phenolic acids. Copyright © 2016 Elsevier Ltd. All rights reserved.
Zafrilla, P; Ferreres, F; Tomás-Barberán, F A
2001-08-01
From red raspberries, ellagic acid, its 4-arabinoside, its 4' (4' '-acetyl) arabinoside, and its 4' (4' '-acetyl)xyloside, as well as quercetin and kaempferol 3-glucosides, were identified. In addition, two unidentified ellagic acid derivatives were detected. The free radical scavenging activity of the ellagic acid derivatives was evaluated by using the DPPH method and compared to that of Trolox. All of the isolated compounds showed antioxidant activity. The effect of processing to obtain jams on raspberry phenolics was evaluated. The flavonol content decreased slightly with processing and more markedly during storage of the jams. The ellagic acid derivatives, with the exception of ellagic acid itself, remained quite stable with processing and during 6 months of jam storage. The content of free ellagic acid increased 3-fold during the storage period. The initial content (10 mg/kg of fresh weight of raspberries) increased 2-fold with processing, and it continued increasing up to 35 mg/kg after 1 month of storage of the jam. Then a slight decrease was observed until 6 months of storage had elapsed. The increase observed in ellagic acid could be explained by a release of ellagic acid from ellagitannins with the thermal treatment.
Scaleable production and separation of fermentation-derived acetic acid. Final CRADA report.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Snyder, S. W.; Energy Systems
2010-02-08
Half of U.S. acetic acid production is used in manufacturing vinyl acetate monomer (VAM) and is economical only in very large production plants. Nearly 80% of the VAM is produced by methanol carbonylation, which requires high temperatures and exotic construction materials and is energy intensive. Fermentation-derived acetic acid production allows for small-scale production at low temperatures, significantly reducing the energy requirement of the process. The goal of the project is to develop a scaleable production and separation process for fermentation-derived acetic acid. Synthesis gas (syngas) will be fermented to acetic acid, and the fermentation broth will be continuously neutralized withmore » ammonia. The acetic acid product will be recovered from the ammonium acid broth using vapor-based membrane separation technology. The process is summarized in Figure 1. The two technical challenges to success are selecting and developing (1) microbial strains that efficiently ferment syngas to acetic acid in high salt environments and (2) membranes that efficiently separate ammonia from the acetic acid/water mixture and are stable at high enough temperature to facilitate high thermal cracking of the ammonium acetate salt. Fermentation - Microbial strains were procured from a variety of public culture collections (Table 1). Strains were incubated and grown in the presence of the ammonium acetate product and the fastest growing cultures were selected and incubated at higher product concentrations. An example of the performance of a selected culture is shown in Figure 2. Separations - Several membranes were considered. Testing was performed on a new product line produced by Sulzer Chemtech (Germany). These are tubular ceramic membranes with weak acid functionality (see Figure 3). The following results were observed: (1) The membranes were relatively fragile in a laboratory setting; (2) Thermally stable {at} 130 C in hot organic acids; (3) Acetic acid rejection > 99%; and
Taskiran, Derya Topkaya; Urut, Gulsiye Ozturk; Ayata, Sevda; Alp, Serap
2017-03-01
4-(4'-acetyloxy-3'-methoxybenzylidene)-5-oxazolone fluorescent molecules bearing four different aryl groups attached to the 2-position of 5-oxazolone ring have been investigated by spectrophotometric and potentiometric techniques in solution media. The acidity constants (pKa) of the fluorescent molecules were precisely determined in acetone, acetonitrile, dimethylformamide and in 1:1 mixture of toluene-isopropanol. The studied derivatives were titrated with tetrabutylammonium hydroxide and non-aqueous perchloric acid by scanning the basic and acidic region of the pH scale. A computerizable derivative method was used in order to descript precisely the end point and pKa values. The molecules investigated performed well-shaped and stoichiometric potentiometric titration curves.
Abdullah, Mohammed A A; Abuo-Rahma, Gamal El-Din A A; Abdelhafez, El-Shimaa M N; Hassan, Heba A; Abd El-Baky, Rehab M
2017-02-01
New hydroxamic acid, hydrazide and amide derivatives of ciprofloxacin in addition to their analogues of levofloxacin were prepared and identified by different spectroscopic techniques. Some of the prepared compounds revealed good activity against the urease splitting bacteria, Proteus mirabilis. The urease inhibitory activity was investigated using indophenol method. Most of the tested compounds showed better activity than the reference acetohydroxamic acid (AHA). The ciprofloxacin hydrazide derivative 3a and levofloxacin hydroxamic acid 7 experienced the highest activity (IC 50 =1.22μM and 2.20μM, respectively). Molecular docking study revealed high spontaneous binding ability of the tested compounds to the active site of urease. Copyright © 2016 Elsevier Inc. All rights reserved.
Study on reduction and back extraction of Pu(IV) by urea derivatives in nitric acid conditions
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ye, G.A.; Xiao, S.T.; Yan, T.H.
2013-07-01
The reduction kinetics of Pu(IV) by hydroxyl-semicarbazide (HSC), hydroxyurea (HU) and di-hydroxyurea (DHU) in nitric acid solutions were investigated separately with adequate kinetic equations. In addition, counter-current cascade experiments were conducted for Pu split from U in nitric acid media using three kinds of reductant, respectively. The results show that urea derivatives as a kind of novel salt-free reductant can reduce Pu(IV) to Pu(III) rapidly in the nitric acid solutions. The stripping experimental results showed that Pu(IV) in the organic phase can be stripped rapidly to the aqueous phase by the urea derivatives, and the separation factors of plutonium /uraniummore » can reach more than 10{sup 4}. This indicates that urea derivatives is a kind of promising salt-free agent for uranium/plutonium separation. In addition, the complexing effect of HSC with Np(IV) was revealed, and Np(IV) can be back-extracted by HSC with a separation factor of about 20.« less
Innovative methodology for the synthesis of Ba-M hexaferrite BaFe{sub 12}O{sub 19} nanoparticles
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ahmed, M.A., E-mail: moala@47hotmail.com; Helmy, N.; El-Dek, S.I.
2013-09-01
Graphical abstract: Transmission electron microscope images for the BaFe12O19. - Highlights: • BaFe{sub 12}O{sub 19}nanoparticles were prepared in single-phase from organometallic precursors. • BaFe{sub 12}O{sub 19} possesses small size 65 nm, H{sub C} = 3695 Oe and M{sub s} = 58 emu/g. • This method of preparation could be extended in the synthesis of other metal oxide nanoparticles. - Abstract: In this piece of work, high quality and homogeneity, barium hexaferrite (BaM) BaFe{sub 12}O{sub 19} nanoparticles were prepared from organometallic precursors for the 1st time. This method is based on the formation of supramolecular crystal structure of Ba[Fe(H{sub 3}NCH{sub 2}CH{submore » 2}NH{sub 3})]Cl{sub 7}·8H{sub 2}O. The crystal structure, morphology and magnetic properties of BaFe{sub 12}O{sub 19} at two different annealing temperatures namely 1000 °C and 1200 °C were investigated using X-ray diffraction, transmission electron microscope TEM and vibrating sample magnetometry (VSM). The results show that monophasic nanoparticles of hexaferrites were obtained. Nanoparticles of crystallite size 40–50 nm distinguished by narrow distribution and excellent homogeneity were obtained with superior magnetic properties which suggested single-domain particles of Ba-M hexaferrite.« less
Waechter, Fernanda; da Silva, Gloria N S; Willig, Julia B; de Oliveira, Cristiane B; Vieira, Bruna D; Trivella, Daniela B B; Zimmer, Aline R; Buffon, Andreia; Pilger, Diogo A; Gnoatto, Simone C B
2017-01-01
Chronic myeloid leukemia (CML) is currently treated with imatinib, a Bcr-Abl inhibitor. However, resistance to this drug usually develops over time. Triptolide, a diterpenoid triepoxide, has been shown active against CML cells resistant to imatinib, acting mainly on the level of Bcr-Abl transcription inhibition. Here, we used the triterpene betulinic acid, a known proteasome inhibitor with potential antileukemic activity, as a scaffold for the generation of analogues with predicted triptolide biological activity. Betulinic acid derivatives were designed based on the structure-activity relationship of triptolide and evaluated for their cytotoxic effects in CML cells, lymphocytes and human keratinocytes (HaCaT), as well as against the proteasome complex. The main modification performed on betulinic acid was fluorination at C-28 and epoxidation, both of which are responsible for enhancing activity of triptolide. A total of 10 compounds were obtained: 6 previously described and 4 novel compounds. The cytotoxic activity over a CML cell line (K562) was assessed using flow cytometry and compared to lymphocytes and HaCaT. The results show that betulinic acid was the most cytotoxic compound against CML cells, showing a good selectivity index for cancer over normal cells. The most important trend for the activity in betulinic acid derivatives is the presence of a free hydroxyl group at C-3 and a carboxyl group at C-28. Results also indicated that the epoxide is important for enhancing the activity, while modification at C-28 worsens the activity. Proteasome inhibition assays suggest that proteasome is the main target for betulinic acid and its derivatives. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Plasmodium falciparum-Derived Uric Acid Precipitates Induce Maturation of Dendritic Cells
van de Hoef, Diana L.; Coppens, Isabelle; Holowka, Thomas; Ben Mamoun, Choukri; Branch, OraLee; Rodriguez, Ana
2013-01-01
Malaria is characterized by cyclical fevers and high levels of inflammation, and while an early inflammatory response contributes to parasite clearance, excessive and persistent inflammation can lead to severe forms of the disease. Here, we show that Plasmodium falciparum-infected erythrocytes contain uric acid precipitates in the cytoplasm of the parasitophorous vacuole, which are released when erythrocytes rupture. Uric acid precipitates are highly inflammatory molecules that are considered a danger signal for innate immunity and are the causative agent in gout. We determined that P. falciparum-derived uric acid precipitates induce maturation of human dendritic cells, increasing the expression of cell surface co-stimulatory molecules such as CD80 and CD86, while decreasing human leukocyte antigen-DR expression. In accordance with this, uric acid accounts for a significant proportion of the total stimulatory activity induced by parasite-infected erythrocytes. Moreover, the identification of uric acid precipitates in P. falciparum- and P. vivax-infected erythrocytes obtained directly from malaria patients underscores the in vivo and clinical relevance of our findings. Altogether, our data implicate uric acid precipitates as a potentially important contributor to the innate immune response to Plasmodium infection and may provide a novel target for adjunct therapies. PMID:23405174
Lin, Chun-Kuang; Tseng, Chin-Kai; Chen, Kai-Hsun; Wu, Shih-Hsiung; Liaw, Chih-Chuang; Lee, Jin-Ching
2015-06-23
This study was designed to evaluate the effect of betulinic acid (BA), extracted from Avicennia marina, on the replication of hepatitis C virus (HCV) and to investigate the mechanism of this BA-mediated anti-HCV activity. HCV replicon and infectious systems were used to evaluate the anti-HCV activity of BA. Exogenous COX-2 or knock-down of COX-2 expression was used to investigate the role of COX-2 in the anti-HCV activity of BA. The effects of BA on the phosphorylation of NF-κB and on kinases in the MAPK signalling pathway were determined. The anti-HCV activity of BA in combination with other HCV inhibitors was also determined to assess its use as an anti-HCV supplement. BA inhibited HCV replication in both Ava5 replicon cells and in a cell culture-derived infectious HCV particle system. Treatment with a combination of BA and IFN-α, the protease inhibitor telaprevir or the NS5B polymerase inhibitor sofosbuvir resulted in the synergistic suppression of HCV RNA replication. Exogenous overexpression of COX-2 gradually attenuated the inhibitory effect of BA on HCV replication, suggesting that BA reduces HCV replication by suppressing the expression of COX-2. In particular, BA down-regulated HCV-induced COX-2 expression by reducing the phosphorylation of NF-κB and ERK1/2 of the MAPK signalling pathway. BA inhibits HCV replication by suppressing the NF-κB- and ERK1/2-mediated COX-2 pathway and may serve as a promising compound for drug development or as a potential supplement for use in the treatment of HCV-infected patients. © 2015 The British Pharmacological Society.
Dervisevic, Muamer; Şenel, Mehmet; Sagir, Tugba; Isik, Sevim
2017-05-15
A comparative study is reported where folic acid (FA) and boronic acid (BA) based cytosensors and their analytical performances in cancer cell detection were analyzed by using electrochemical impedance spectroscopy (EIS) method. Cytosensors were fabricated using self-assembled monolayer principle by modifying Au electrode with cysteamine (Cys) and immobilization of ferrocene cored polyamidiamine dendrimers second generation (Fc-PAMAM (G2)), after which electrodes were modified with FA and BA. Au/Fc-PAMAM(G2)/FA and Au/Fc-PAMAM(G2)/BA based cytosensors showed extremely good analytical performances in cancer cell detection with linear range of 1×10 2 to 1×10 6 cellsml -1 , detection limit of 20cellsml -1 with incubation time of 20min for FA based electrode, and for BA based electrode detection limit was 28cellsml -1 with incubation time of 10min. Next to excellent analytical performances, cytosensors showed high selectivity towards cancer cells which was demonstrated in selectivity study using human embryonic kidney 293 cells (HEK 293) as normal cells and Au/Fc-PAMAM(G2)/FA electrode showed two times better selectivity than BA modified electrode. These cytosensors are promising for future applications in cancer cell diagnosis. Copyright © 2017 Elsevier B.V. All rights reserved.
Characterization of pH-fractionated humic acids derived from Chinese weathered coal.
Zhang, Shuiqin; Yuan, Liang; Li, Wei; Lin, Zhian; Li, Yanting; Hu, Shuwen; Zhao, Bingqiang
2017-01-01
To reduce the compositional and structural heterogeneity of humic acids (HAs) and achieve better use of HA resources, in this study, we report a new sequential dissolution method for HAs derived from Chinese weathered coal. This method was used to separate HAs into seven fractions by adjusting the pH (3-10) of the extraction solution. The results showed that the HA fractions derived from Chinese weathered coal were concentrated up to 90.31% in the lower pH solutions (3-7). The compositional and structural characteristics of the HA fractions were determined by elemental analysis; ultraviolet-visible (UV-Vis), Fourier transform infrared (FTIR), and solid-state 13 C-nuclear magnetic resonance (NMR) spectroscopies; and other techniques. The results showed significant differences among the HA fractions. The concentrations of the total acidic groups and the carboxyl groups decreased with the increasing pH of the extraction solution. However, the HA fractions derived from extraction solutions with pH 3-4 had relatively lower aromaticity but a higher protonated carbon content. The HA fractions derived from extraction solutions with pH 6-7 had the highest aromaticity and the greatest abundance of COO/N-C=O. This study demonstrated that adjusting the pH of the extraction solution is one way to fractionate HAs from Chinese weathered coal and to obtain HA fractions with compositions and structures that could serve as useful material for study and utilization. Copyright © 2016 Elsevier Ltd. All rights reserved.
In Vitro Anti-Toxoplasma gondii and Antimicrobial Activity of Amides Derived from Cinnamic Acid.
Silveira, Graziela Rangel; Campelo, Karoline Azerêdo; Lima, Gleice Rangel Silveira; Carvalho, Lais Pessanha; Samarão, Solange Silva; Vieira-da-Motta, Olney; Mathias, Leda; Matos, Carlos Roberto Ribeiro; Vieira, Ivo José Curcino; Melo, Edesio José Tenório de; Maria, Edmilson José
2018-03-28
Most cinnamic acids, their esters, amides, aldehydes, and alcohols present several therapeutic actions through anti-inflammatory, antitumor, and inhibitory activity against a great variety of microorganisms. In this work, eight amines derived from cinnamic acid were synthesized and tested against host cells infected with Toxoplasma gondii and the bacteria Escherichia coli, Pseudomonas aeruginosa, Staphylococcus epidermidis, and three strains of Staphylococcus aureus . Compounds 3 and 4 showed the best result against intracellular T. gondii , presenting antiparasitic activity at low concentrations (0.38 and 0.77 mM). The antibacterial activity of these compounds was also evaluated by the agar microdilution method, and amides 2 and 5 had a minimum inhibitory concentration of 250 µg mL -1 against two strains of S. aureus (ATCC 25923 and bovine strain LSA 88). These also showed synergistic action along with a variety of antibiotics, demonstrating that amines derived from cinnamic acid have potential as pharmacological agents.
Fu, Chia-Hsiang; Tsai, Wan-Chun; Lee, Ta-Jen; Huang, Chi-Che; Chang, Po-Hung; Su Pang, Jong-Hwei
2016-01-01
IL-5-induced chemotaxis of eosinophils is an important feature of allergic airway inflammatory diseases. Simvastatin, a lipid lowering agent, has been shown to exhibit anti-inflammatory and anti-allergic effects. Our aim was to investigate the effect of simvastatin on IL-5-induced eosinophil chemotaxis and its regulatory mechanisms. Eosinophils were derived by treating HL-60 clone 15 (HC15) cells with butyric acid (BA) in an alkaline condition or through direct isolation from human peripheral blood. The expressions of CC chemokine receptor 3 (CCR3) and interleukin (IL)-5 receptors (IL5Rα and β) were analyzed using RT/real-time PCR. The granular proteins were stained using fast green. Eotaxin-induced chemotaxis was measured using a transwell migration assay. CCR3 protein expression was revealed by immunocytochemistry. An animal model of allergic rhinitis was established by challenging Sprague-Dawley® rats repeatedly with ovalbumin. Butyric acid significantly increased the expression of IL5Rα and IL5Rβ, CCR3 and granular proteins in HC15 cells, indicating the maturation of eosinophils (BA-E cells). IL-5 further enhanced the CCR3 expression at both the mRNA and protein levels and the eotaxin-induced chemotaxis of BA-E cells. Simvastatin inhibited the effects of IL-5 on BA-E cells, but not in the presence of mevalonate. Similar results were also exhibited in human primary eosinophils. In vivo animal studies further confirmed that oral simvastatin could significantly suppress the infiltration of eosinophils into turbinate tissues of allergic rats. Therefore, simvastatin was demonstrated to inhibit IL-5-induced CCR3 expression and chemotaxis of eosinophils mediated via the mevalonate pathway. We confirmed that simvastatin also reduced eosinophilic infiltration in allergic rhinitis.
Bile acid-induced necrosis in primary human hepatocytes and in patients with obstructive cholestasis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Woolbright, Benjamin L.; Dorko, Kenneth; Antoine, Daniel J.
Accumulation of bile acids is a major mediator of cholestatic liver injury. Recent studies indicate bile acid composition between humans and rodents is dramatically different, as humans have a higher percent of glycine conjugated bile acids and increased chenodeoxycholate content, which increases the hydrophobicity index of bile acids. This increase may lead to direct toxicity that kills hepatocytes, and promotes inflammation. To address this issue, this study assessed how pathophysiological concentrations of bile acids measured in cholestatic patients affected primary human hepatocytes. Individual bile acid levels were determined in serum and bile by UPLC/QTOFMS in patients with extrahepatic cholestasis with,more » or without, concurrent increases in serum transaminases. Bile acid levels increased in serum of patients with liver injury, while biliary levels decreased, implicating infarction of the biliary tracts. To assess bile acid-induced toxicity in man, primary human hepatocytes were treated with relevant concentrations, derived from patient data, of the model bile acid glycochenodeoxycholic acid (GCDC). Treatment with GCDC resulted in necrosis with no increase in apoptotic parameters. This was recapitulated by treatment with biliary bile acid concentrations, but not serum concentrations. Marked elevations in serum full-length cytokeratin-18, high mobility group box 1 protein (HMGB1), and acetylated HMGB1 confirmed inflammatory necrosis in injured patients; only modest elevations in caspase-cleaved cytokeratin-18 were observed. These data suggest human hepatocytes are more resistant to human-relevant bile acids than rodent hepatocytes, and die through necrosis when exposed to bile acids. These mechanisms of cholestasis in humans are fundamentally different to mechanisms observed in rodent models. - Highlights: • Cholestatic liver injury is due to cytoplasmic bile acid accumulation in hepatocytes. • Primary human hepatocytes are resistant to BA
Computational Approach to Explore the B/A Junction Free Energy in DNA.
Kulkarni, Mandar; Mukherjee, Arnab
2016-01-04
Protein-DNA interactions induce conformational changes in DNA such as B- to A-form transitions at a local level. Such transitions are associated with a junction free energy cost at the boundary of two different conformations in a DNA molecule. In this study, we performed umbrella sampling simulations to find the free energy values of the B-A transition at the dinucleotide and trinucleotide level of DNA. Using a combination of dinucleotide and trinucleotide free energy costs obtained from simulations, we calculated the B/A junction free energy. Our study shows that the B/A junction free energy is 0.52 kcal mol(-1) for the A-philic GG step and 1.59 kcal mol(-1) for the B-philic AA step. This observation is in agreement with experimentally derived values. After excluding junction effects, we obtained an absolute free energy cost for the B- to A-form conversion for all the dinucleotide steps. These absolute free energies may be used for predicting the propensity of structural transitions in DNA. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
NASA Astrophysics Data System (ADS)
Zeng, Min
2011-05-01
Well-crystallized cubic phase BaTiO 3 particles were prepared by heating the mixture of barium hydroxide aqueous solution and titania derived from the hydrolysis of titanium isopropoxide (TTIP) at 328 K, 348 K or 368 K for 24 h. The morphology and size of obtained particles depended on the reaction temperature and the Ba(OH) 2/TTIP molar ratio. By the direct hydrolytic reaction of titanium tetraisopropoxide, the high surface area titania (TiO 2) was obtained. The surface adsorption characteristics of the titania particles had been studied with different electric charges OH - ions or H + ions. The formation mechanism and kinetics of BaTiO 3 were examined by measuring the concentration of [Ba 2+] ions in the solution during the heating process. The experimental results showed that the heterogeneous nucleation of BaTiO 3 occurred on the titania surface, according to the Avrami's equation.
Zígolo, M Antonela; Salinas, Maximiliano; Alché, Laura; Baldessari, Alicia; Liñares, Guadalupe García
2018-08-01
We present an efficient approach to the synthesis of a series of glycyrrhetinic acid derivatives. Six derivatives, five of them new compounds, were obtained through chemoenzymatic reactions in very good to excellent yield. In order to find the optimal reaction conditions, the influence of various parameters such as enzyme source, nucleophile:substrate ratio, enzyme:substrate ratio, solvent and temperature was studied. The excellent results obtained by lipase catalysis made the procedure very efficient considering their advantages such as mild reaction conditions and low environmental impact. Moreover, in order to explain the reactivity of glycyrrhetinic acid and the acetylated derivative to different nucleophiles in the enzymatic reactions, molecular docking studies were carried out. In addition, one of the synthesized compounds exhibited remarkable antiviral activity against TK + and TK- strains of Herpes simplex virus type 1 (HSV-1), sensitive and resistant to acyclovir (ACV) treatment. Copyright © 2018 Elsevier Inc. All rights reserved.
Lozano-Mena, Glòria; Sánchez-González, Marta; Parra, Andrés; Juan, M Emília; Planas, Joana M
2016-09-01
Maslinic acid has been described to exert a chemopreventive activity in colon cancer. Hereby, we determined maslinic acid and its metabolites in the rat intestine previous oral administration as a first step in elucidating whether this triterpene might be used as a nutraceutical. Maslinic acid was orally administered at 1, 2, and 5 mg/kg to male Sprague-Dawley for 2 days. At 24 h after the last administration, the content of the duodenum and jejunum, ileum, cecum, and colon was collected and extracted with methanol 80% prior to LC-APCI-MS analysis. The developed method was validated providing suitable sensitivity (LOQ of 5 nM), good recovery (97.8 ± 3.6%), linear correlation, and appropriate precision (< 9%). Maslinic acid was detected in all the segments with higher concentrations in the distal part of the intestine. LC-APCI-LTQ-ORBITRAP-MS allowed the identification of 11 gut-derived metabolites that were formed by mono-, dihydroxylation, and dehydrogenation reactions. Maslinic acid undergoes phase I reactions resulting in a majority of monohydroxylated metabolites without the presence of phase II derivatives. The high concentration of maslinic acid achieved in the intestine suggests that it could exert a beneficial effect in the prevention of colon cancer. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Novel boronic acid derivatives of bis(indolyl) methane as anti-MRSA agents.
Mandal, Santi M; Pegu, Rupa; Porto, William F; Franco, Octavio L; Pratihar, Sanjay
2017-05-15
Towards the search for a new generation of antibiotics to control methicillin-resistant Staphylococcus aureus (MRSA), the design and synthesis of various bis indolyl methane (BIM) derivatives based on their different electron donor and acceptor properties of the substituents have been made, in which boronic acid derivatives of BIM are found to be active against MRSA. The observed evidence with the lead compound reveals their strong anti-MRSA activity, which paves the way of design and further development of a new generation antibiotics. Copyright © 2017 Elsevier Ltd. All rights reserved.
Effect of various antibiotics on modulation of intestinal microbiota and bile acid profile in mice
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Youcai; Limaye, Pallavi B.; Renaud, Helen J.
Antibiotic treatments have been used to modulate intestinal bacteria and investigate the role of intestinal bacteria on bile acid (BA) homeostasis. However, knowledge on which intestinal bacteria and bile acids are modified by antibiotics is limited. In the present study, mice were administered various antibiotics, 47 of the most abundant bacterial species in intestine, as well as individual BAs in plasma, liver, and intestine were quantified. Compared to the two antibiotic combinations (vancomycin + imipenem and cephalothin + neomycin), the three single antibiotics (metronidazole, ciprofloxacin and aztreonam) have less effect on intestinal bacterial profiles, and thus on host BA profilesmore » and mRNA expression of genes that are important for BA homeostasis. The two antibiotic combinations decreased the ratio of Firmicutes to Bacteroidetes in intestine, as well as most secondary BAs in serum, liver and intestine. Additionally, the two antibiotic combinations significantly increased mRNA of the hepatic BA uptake transporters (Ntcp and Oatp1b2) and canalicular BA efflux transporters (Bsep and Mrp2), but decreased mRNA of the hepatic BA synthetic enzyme Cyp8b1, suggesting an elevated enterohepatic circulation of BAs. Interestingly, the two antibiotic combinations tended to have opposite effect on the mRNAs of most intestinal genes, which tended to be inhibited by vancomycin + imipenem but stimulated by cephalothin + neomycin. To conclude, the present study clearly shows that various antibiotics have distinct effects on modulating intestinal bacteria and host BA metabolism. - Highlights: • Various antibiotics have different effects on intestinal bacteria. • Antibiotics alter bile acid composition in mouse liver and intestine. • Antibiotics influence genes involved in bile acid homeostasis. • Clostridia appear to be important for secondary bile acid formation.« less
Siemoneit, U; Koeberle, A; Rossi, A; Dehm, F; Verhoff, M; Reckel, S; Maier, TJ; Jauch, J; Northoff, H; Bernhard, F; Doetsch, V; Sautebin, L; Werz, O
2011-01-01
BACKGROUND AND PURPOSE Frankincense, the gum resin derived from Boswellia species, showed anti-inflammatory efficacy in animal models and in pilot clinical studies. Boswellic acids (BAs) are assumed to be responsible for these effects but their anti-inflammatory efficacy in vivo and their molecular modes of action are incompletely understood. EXPERIMENTAL APPROACH A protein fishing approach using immobilized BA and surface plasmon resonance (SPR) spectroscopy were used to reveal microsomal prostaglandin E2 synthase-1 (mPGES1) as a BA-interacting protein. Cell-free and cell-based assays were applied to confirm the functional interference of BAs with mPGES1. Carrageenan-induced mouse paw oedema and rat pleurisy models were utilized to demonstrate the efficacy of defined BAs in vivo. KEY RESULTS Human mPGES1 from A549 cells or in vitro-translated human enzyme selectively bound to BA affinity matrices and SPR spectroscopy confirmed these interactions. BAs reversibly suppressed the transformation of prostaglandin (PG)H2 to PGE2 mediated by mPGES1 (IC50 = 3–10 µM). Also, in intact A549 cells, BAs selectively inhibited PGE2 generation and, in human whole blood, β-BA reduced lipopolysaccharide-induced PGE2 biosynthesis without affecting formation of the COX-derived metabolites 6-keto PGF1α and thromboxane B2. Intraperitoneal or oral administration of β-BA (1 mg·kg−1) suppressed rat pleurisy, accompanied by impaired levels of PGE2 and β-BA (1 mg·kg−1, given i.p.) also reduced mouse paw oedema, both induced by carrageenan. CONCLUSIONS AND IMPLICATIONS Suppression of PGE2 formation by BAs via interference with mPGES1 contribute to the anti-inflammatory effectiveness of BAs and of frankincense, and may constitute a biochemical basis for their anti-inflammatory properties. PMID:20840544
Siemoneit, U; Koeberle, A; Rossi, A; Dehm, F; Verhoff, M; Reckel, S; Maier, T J; Jauch, J; Northoff, H; Bernhard, F; Doetsch, V; Sautebin, L; Werz, O
2011-01-01
Frankincense, the gum resin derived from Boswellia species, showed anti-inflammatory efficacy in animal models and in pilot clinical studies. Boswellic acids (BAs) are assumed to be responsible for these effects but their anti-inflammatory efficacy in vivo and their molecular modes of action are incompletely understood. A protein fishing approach using immobilized BA and surface plasmon resonance (SPR) spectroscopy were used to reveal microsomal prostaglandin E(2) synthase-1 (mPGES1) as a BA-interacting protein. Cell-free and cell-based assays were applied to confirm the functional interference of BAs with mPGES1. Carrageenan-induced mouse paw oedema and rat pleurisy models were utilized to demonstrate the efficacy of defined BAs in vivo. Human mPGES1 from A549 cells or in vitro-translated human enzyme selectively bound to BA affinity matrices and SPR spectroscopy confirmed these interactions. BAs reversibly suppressed the transformation of prostaglandin (PG)H(2) to PGE(2) mediated by mPGES1 (IC(50) = 3-10 µM). Also, in intact A549 cells, BAs selectively inhibited PGE(2) generation and, in human whole blood, β-BA reduced lipopolysaccharide-induced PGE(2) biosynthesis without affecting formation of the COX-derived metabolites 6-keto PGF(1α) and thromboxane B(2) . Intraperitoneal or oral administration of β-BA (1 mg·kg(-1) ) suppressed rat pleurisy, accompanied by impaired levels of PGE(2) and β-BA (1 mg·kg(-1) , given i.p.) also reduced mouse paw oedema, both induced by carrageenan. Suppression of PGE(2) formation by BAs via interference with mPGES1 contribute to the anti-inflammatory effectiveness of BAs and of frankincense, and may constitute a biochemical basis for their anti-inflammatory properties. © 2010 The Authors. British Journal of Pharmacology © 2010 The British Pharmacological Society.
Nash, Aaron; Soheili, Arash; Tambar, Uttam K
2013-09-20
Unnatural cyclic amino acids are valuable tools in biomedical research and drug discovery. A two-step stereoselective strategy for converting simple glycine-derived aminoesters into unnatural cyclic amino acid derivatives has been developed. The process includes a palladium-catalyzed tandem allylic amination/[2,3]-Stevens rearrangement followed by a ruthenium-catalyzed ring-closing metathesis. The [2,3]-rearrangement proceeds with high diastereoselectivity through an exo transition state. Oppolzer's chiral auxiliary was utilized to access an enantiopure cyclic amino acid by this approach, which will enable future biological applications.
ASSOCIATION BETWEEN MATERNAL USE OF FOLIC ACID SUPPLEMENTS AND RISK OF AUTISM IN CHILDREN
Surén, Pål; Roth, Christine; Bresnahan, Michaeline; Haugen, Margaretha; Hornig, Mady; Hirtz, Deborah; Lie, Kari Kveim; Lipkin, W. Ian; Magnus, Per; Reichborn-Kjennerud, Ted; Schjølberg, Synnve; Smith, George Davey; Øyen, Anne-Siri; Susser, Ezra; Stoltenberg, Camilla
2014-01-01
Context Prenatal folic acid supplements reduce the risk of neural tube defects in children, but it has not been determined whether they protect against other neurodevelopmental disorders. Objective To examine the association between maternal use of prenatal folic acid supplements and the subsequent risk of autistic disorder in children. Design, Setting, and Patients The study sample of 85,176 was derived from the population-based, prospective Norwegian Mother and Child Cohort Study (MoBa). The children were born in 2002–08. By the end of follow-up on March 31st, 2012, the age range was 3.3–10.2 years and the mean age 6.4 years. The exposure of primary interest was use of folic acid from 4 weeks before to 8 weeks after the start of pregnancy. The start of pregnancy was defined as the first day of the last menstrual period before conception. Relative risks of ASD were estimated by odds ratios (ORs) with 95% confidence intervals (CIs) in a logistic regression analysis. Analyses were adjusted for maternal education level, year of birth, and parity. Main Outcome Measure Specialist-confirmed diagnosis of autistic disorder. Results To date, 114 children in the study sample have been diagnosed with autistic disorder. In children whose mothers took folic acid, 0.10% (64/61,042) had autistic disorder, compared with 0.21% (50/24,134) in those unexposed to folic acid. The adjusted OR for autistic disorder in children of folic acid users was 0.61 (95% CI, 0.41–0.90). Similar analyses for prenatal fish oil supplements showed no such association with autistic disorder, even though fish oil use was associated with the same maternal characteristics as folic acid use. Conclusion Prenatal folic acid supplements around the time of conception were associated with a lower risk of autistic disorder in the MoBa cohort. PMID:23403681
Development of piperic acid derivatives from Piper nigrum as UV protection agents.
Choochana, Piyapong; Moungjaroen, Jirapan; Jongkon, Nathjanan; Gritsanapan, Wandee; Tangyuenyongwatana, Prasan
2015-04-01
There is a need for the discovery of novel natural and semi-synthetic sunscreen that is safe and effective. Piperine has a UV absorption band of 230-400 nm with high molar absorptivity. This compound has a high potential to be developed to sunscreen. This study develops new UV protection compounds from piperine by using chemical synthesis. Piperine was isolated from Piper nigrum L. (Piperaceae) fruits, converted to piperic acid by alkaline hydrolysis, and prepared as ester derivatives by chemical synthesis. The piperate derivatives were prepared as 5% o/w emulsion, and the SPF values were evaluated. The best compound was submitted to cytotoxicity test using MTT assay. Piperic acid was prepared in 86.96% yield. Next, piperic acid was reacted with alcohols using Steglich reaction to obtain methyl piperate, ethyl piperate, propyl piperate, isopropyl piperate, and isobutyl piperate in 62.39-92.79% yield. All compounds were prepared as 5% oil in water emulsion and measured its SPF and UVA/UVB values using an SPF-290S analyzer. The SPF values (n = 6) of the piperate derivatives were 2.68 ± 0.17, 8.89 ± 0.46, 6.86 ± 0.91, 16.37 ± 1.8, and 9.68 ± 1.71. The UVA/UVB ratios of all compounds ranged from 0.860 to 0.967. Cytotoxicity of isopropyl piperate was evaluated using human skin fibroblast cells and the IC50 was equal to 120.2 μM. From the results, isopropyl piperate is an outstanding compound that can be developed into a UV protection agent.
Compost-derived humic acids as regulators for reductive degradation of nitrobenzene.
Yuan, Ying; Xi, Beidou; He, Xiaosong; Tan, Wenbing; Gao, Rutai; Zhang, Hui; Yang, Chao; Zhao, Xinyu; Huang, Caihong; Li, Dan
2017-10-05
Nitrobenzene (NB) is a major class of contaminants in soil and groundwater. The current methods involved in the reductive degradation of NB suffer either cost-ineffective or slow conversion rate. Here, we investigated the mechanisms regarding compost-derived humic acids (HAs) as cost-effective regulators to enhance the reduction of NB to aniline (AN). Our results show that the compost-derived HAs, which have been reduced by a Pd-H 2 catalytic system, were able to reduce NB to AN, and their redox properties were the main factors governing the reduction of NB to AN. The decreasing reduction of NB was mainly caused by the decreasing phenol content of compost-derived HAs during composting. In addition, the results reveal that the increase in the generation content of AN was mainly attributed to the increase in the quinones, aromaticity and humic-like components of compost-derived HAs. The findings demonstrate that the HAs derived from compost are effective regulators to enhance the reduction of NB to AN, and that they exert a bright application prospect for the remediation of the NB-contaminated soil. Copyright © 2017 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Qureshi, N.; Díaz, M. T. Fernández; Chapon, L. C.; Senyshyn, A.; Schweika, W.; Valldor, M.
2018-02-01
We present a study that combines polarized and unpolarized neutrons to derive the magnetic structure of the swedenborgite compound CaBa (Co3Fe ) O7. Integrated intensities from a standard neutron diffraction experiment and polarization matrices from spherical neutron polarimetry have been simultaneously analyzed revealing a complex order, which differs from the usual spin configurations on a kagome lattice. We find that the magnetic structure is well described by a combination of two one-dimensional representations corresponding to the magnetic superspace symmetry P 21' , and it consists of spins rotating around an axis close to the [110] direction. Due to the propagation vector q =(1/3 00 ) , this modulation has cycloidal and helicoidal character rendering this system a potential multiferroic. The resulting spin configuration can be mapped onto the classical √{3 }×√{3 } structure of a kagome lattice, and it indicates an important interplay between the kagome and the triangular layers of the crystal structure.
Genotoxic effects of boric acid and borax in zebrafish, Danio rerio using alkaline comet assay
Gülsoy, Nagihan; Yavas, Cüneyd; Mutlu, Özal
2015-01-01
The present study is conducted to determine the potential mechanisms of Boron compounds, boric acid (BA) and borax (BX), on genotoxicity of zebrafish Danio rerio for 24, 48, 72 and 96-hours acute exposure (level:1, 4, 16, 64 mg/l BA and BX) in semi-static bioassay experiment. For that purpose, peripheral erythrocytes were drawn from caudal vein and Comet assay was applied to assess genotoxicity. Acute (96 hours) exposure and high concentrations of boric acid and borax increases % tail DNA and Olive tail moment. Genotoxicity was found for BA as concentration-dependent and BX as concentration and time dependent manner. In general, significant effects (P < 0,05) on both concentrations and exposure times were observed in experimental groups. DNA damage was highest at 96 h and 24 h for all BX and BA concentrations, respectively in peripheral blood of D. rerio. For the first time, our study demonstrates the effect of waterborne BA and BX exposure on genotoxicity at the molecular level, which may contribute to understanding the mechanism of boric acid and borax-induced genotoxicity in fish. PMID:26862320
Genotoxic effects of boric acid and borax in zebrafish, Danio rerio using alkaline comet assay.
Gülsoy, Nagihan; Yavas, Cüneyd; Mutlu, Özal
2015-01-01
The present study is conducted to determine the potential mechanisms of Boron compounds, boric acid (BA) and borax (BX), on genotoxicity of zebrafish Danio rerio for 24, 48, 72 and 96-hours acute exposure (level:1, 4, 16, 64 mg/l BA and BX) in semi-static bioassay experiment. For that purpose, peripheral erythrocytes were drawn from caudal vein and Comet assay was applied to assess genotoxicity. Acute (96 hours) exposure and high concentrations of boric acid and borax increases % tail DNA and Olive tail moment. Genotoxicity was found for BA as concentration-dependent and BX as concentration and time dependent manner. In general, significant effects (P < 0,05) on both concentrations and exposure times were observed in experimental groups. DNA damage was highest at 96 h and 24 h for all BX and BA concentrations, respectively in peripheral blood of D. rerio. For the first time, our study demonstrates the effect of waterborne BA and BX exposure on genotoxicity at the molecular level, which may contribute to understanding the mechanism of boric acid and borax-induced genotoxicity in fish.
Gao, Ruiling; Li, Zifu; Zhou, Xiaoqin; Cheng, Shikun; Zheng, Lei
2017-01-01
The sustainability of microbial lipids production from traditional carbon sources, such as glucose or glycerol, is problematic given the high price of raw materials. Considerable efforts have been directed to minimize the cost and find new alternative carbon sources. Volatile fatty acids (VFAs) are especially attractive raw materials, because they can be produced from a variety of organic wastes fermentation. Therefore, the use of volatile fatty acids as carbon sources seems to be a feasible strategy for cost-effective microbial lipid production. Lipid accumulation in Y. lipolytica using synthetic and food waste-derived VFAs as substrates was systematically compared and evaluated in batch cultures. The highest lipid content obtained with acetic, butyric, and propionic acids reached 31.62 ± 0.91, 28.36 ± 0.74, and 28.91 ± 0.66%, respectively. High concentrations of VFA inhibited cell growth in the following order: butyric acid > propionic acid > acetic acid. Within a 30-day experimental period, Y. lipolytica could adapt up to 20 g/L acetic acid, whereas the corresponding concentration of propionic acid and butyric acid were 10 and 5 g/L, respectively. Cultures on a VFA mixture showed that the utilization of different types of VFA by Y. lipolytica was not synchronized but rather performed in a step-wise manner. Although yeast fermentation is an exothermic process, and the addition of VFA will directly affect the pH of the system by increasing environmental acidity, cultures at a cultivation temperature of 38 °C and uncontrolled pH demonstrated that Y. lipolytica had high tolerance in the high temperature and acidic environment when a low concentration (2.5 g/L) of either synthetic or food waste-derived VFA was used. However, batch cultures fed with food fermentate yielded lower lipid content (18.23 ± 1.12%) and lipid productivity (0.12 ± 0.02 g/L/day). The lipid composition obtained with synthetic and food waste-derived VFA was similar to
Todua, Nino G; Mikaia, Anzor I
2016-01-01
Derivatives requiring either anhydrous or aqueous reaction conditions were prepared for robust and reliable gas chromatography/mass spectrometry (GC/MS) characterization of hydroxyl, mercapto, and amino benzoic acids Methylation and trialkylsilytation are employed for blocking the acidic function. Alkyl, trimethylsilyl, acetyl, perfluoroacyl and alkoxycarbonyl derivatization groups are introduced to hydroxyl, mercapto and amino functions. The electron ionization induced fragmentation characteristics of corresponding derivatives are explained by comparing the MS 1 spectra of unlabeled compounds to their 2 H and 13 C labeled analogs, and analysis of collision-induced dissociation data from MS 2 spectra. Competing fragmentation alternatives are identified and specific decomposition processes are detailed that characterize (a) ortho isomers due to interaction or vicinal functional substituents and (b) para isomers prone to forming para quinoid type structures. Skeletal and hydrogen rearrangements typical for methyl benzoates and the blocking groups are considered when discussing diagnostically important ions. Characteristic ions produced as a result of rearrangements in ortho isomers are classified, and skeletal rearrangements required to produce para quinoid type ions specific for para isomers are noted. Key ions for structure elucidation and differentiation of isomers for derivatives of substituted benzoic acids by GC/MS are suggested.
Nobmann, Patricia; Smith, Aoife; Dunne, Julie; Henehan, Gary; Bourke, Paula
2009-01-15
Novel mono-substituted carbohydrate fatty acid (CFA) esters and ethers were investigated for their antibacterial activity against a range of pathogenic and spoilage bacteria focussing on Listeria monocytogenes. Carbohydrate derivatives with structural differences enable comparative studies on the structure/activity relationship for antimicrobial efficacy and mechanism of action. The antimicrobial efficacy of the synthesized compounds was compared with commercially available compounds such as monolaurin and monocaprylin, as well as the pure free fatty acids, lauric acid and caprylic acid, which have proven antimicrobial activity. Compound efficacy was compared using an absorbance based broth microdilution assay to determine the minimum inhibitory concentration (MIC), increase in lag phase and decrease in maximum growth rate. Among the carbohydrate derivatives synthesized, lauric ether of methyl alpha-d-glucopyranoside and lauric ester of methyl alpha-d-mannopyranoside showed the highest growth-inhibitory effect with MIC values of 0.04 mM, comparable to monolaurin. CFA derivatives were generally more active against Gram positive bacteria than Gram negative bacteria. The analysis of both ester and ether fatty acid derivatives of the same carbohydrate, in tandem with alpha and beta configuration of the carbohydrate moiety suggest that the carbohydrate moiety is involved in the antimicrobial activity of the fatty acid derivatives and that the nature of the bond also has a significant effect on efficacy, which requires further investigation. This class of CFA derivatives has great potential for developing antibacterial agents relevant to the food industry, particularly for control of Listeria or other Gram-positive pathogens.
Pramanik, Subhamay; Bhalla, Vandana; Kumar, Manoj
2013-09-02
Aggregates of hexaphenylbenzene derivatives 3, having pyrene groups form network of fluorescent nanofibres in presence of mercury ions. Further, fluorescent nanofibres of 3-Hg(2+) supramolecular ensemble exhibit sensitive and pronounced response towards the picric acid. In addition, the solution coated paper strips of 3-Hg(2+) supramolecular ensemble can detect picric acid in the range of 2.29 fg/cm(2), thus, providing a simple, portable and low cost method for detection of picric acid in solution and in contact mode. Copyright © 2013 Elsevier B.V. All rights reserved.
Optical properties of BaO added bioactive Na2O-CaO-P2O5 glasses
NASA Astrophysics Data System (ADS)
Edathazhe, Akhila B.; Shashikala, H. D.
2018-04-01
This paper deals with the effect of BaO addition on the optical properties of bioactive Na2O-CaO-P2O5 glasses for biomedical optics applications. The phosphate glasses with composition (26-x)Na2O-xBaO-29CaO-45P2O5 (x = 0, 5, 10, 15 mol%) have been prepared by melt-quenching technique at 1100°C. The refractive index of glasses increased with BaO content. The optical band gap and Urbach energy of synthesized glasses were derived from the optical absorption spectra by using UV-Visible spectrometer. The addition of 5 mol% of BaO increased the band gap energy of glasses due to the formation of ionic cross-links in the glass structure. The defect and interstitial bonds formation in theglasses decreased with BaO additions as indicated by reductions in the Urbach energy values. No such variations in the band gap and Urbach energy values of glasses were observed with BaO content from 5 to 15 mol%. The molar and oxide ion polarizability values were calculated from the band gap and molar volume of glasses. The increase in the calculated optical basicity and metallization criteria of glasses supported the rise in band gap energy values with BaO additions. As the melting temperature of glasses decreased from 1200 to 1100°C, the refractive index increased as supported by the measured density values. The band gap energy is not changed with melting temperature. The Urbach energy decreased with decrease in melting temperature in case of BaO-free Na2O-CaO-P2O5 glasses, whereas it increased in case of BaO added glasses due to the role of BaO as modifying oxide.
Nelson, Robert S.; Peterson, Darren J.; Karp, Eric M.; ...
2017-03-01
Here, volatile fatty acids (VFAs) can be readily produced from many anaerobic microbes and subsequently utilized as precursors to renewable biofuels and biochemicals. Megasphaera elsdenii represents a promising host for production of VFAs, butyric acid (BA) and hexanoic acid (HA). However, due to the toxicity of these acids, product removal via an extractive fermentation system is required to achieve high titers and productivities. Here, we examine multiple aspects of extractive separations to produce BA and HA from glucose and lignocellulosic hydrolysate with M. elsdenii. A mixture of oleyl alcohol and 10% (v/v) trioctylamine was selected as an extraction solvent duemore » to its insignificant inhibitory effect on the bacteria. Batch extractive fermentations were conducted in the pH range of 5.0 to 6.5 to select the best cell growth rate and extraction efficiency combination. Subsequently, fed-batch pertractive fermentations were run over 230 h, demonstrating high BA and HA concentrations in the extracted fraction (57.2 g/L from ~190 g/L glucose) and productivity (0.26 g/L/h). To our knowledge, these are the highest combined acid titers and productivity values reported for M. elsdenii and bacterial mono-cultures from sugars. Lastly, the production of BA and HA (up to 17 g/L) from lignocellulosic sugars was demonstrated.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nelson, Robert S.; Peterson, Darren J.; Karp, Eric M.
Here, volatile fatty acids (VFAs) can be readily produced from many anaerobic microbes and subsequently utilized as precursors to renewable biofuels and biochemicals. Megasphaera elsdenii represents a promising host for production of VFAs, butyric acid (BA) and hexanoic acid (HA). However, due to the toxicity of these acids, product removal via an extractive fermentation system is required to achieve high titers and productivities. Here, we examine multiple aspects of extractive separations to produce BA and HA from glucose and lignocellulosic hydrolysate with M. elsdenii. A mixture of oleyl alcohol and 10% (v/v) trioctylamine was selected as an extraction solvent duemore » to its insignificant inhibitory effect on the bacteria. Batch extractive fermentations were conducted in the pH range of 5.0 to 6.5 to select the best cell growth rate and extraction efficiency combination. Subsequently, fed-batch pertractive fermentations were run over 230 h, demonstrating high BA and HA concentrations in the extracted fraction (57.2 g/L from ~190 g/L glucose) and productivity (0.26 g/L/h). To our knowledge, these are the highest combined acid titers and productivity values reported for M. elsdenii and bacterial mono-cultures from sugars. Lastly, the production of BA and HA (up to 17 g/L) from lignocellulosic sugars was demonstrated.« less
USDA-ARS?s Scientific Manuscript database
Humic acid (MFG) and fat protected butyric acid (BA) has been shown to modulate energy metabolism and inflammation. Therefore, the objectives of this study were to determine the effects of MFG and BA, alone and in combination, on growth performance and response to lipopolysaccharide (LPS) induced in...
NASA Astrophysics Data System (ADS)
Fehrenbacher, J. S.; Russell, A. D.; Davis, C. V.; Spero, H. J.; Chu, E.
2015-12-01
The Ba/Ca ratio in several spinose planktic foraminifer species varies as a function of the Ba/Ca concentration of seawater and is not affected by other parameters such as the seawater salinity, temperature and pH (Honisch et al., 2011). Since seawater Ba concentration is linearly related to Ba in nearshore environments, Ba/Ca ratios in spinose species shows promise as an indicator of past changes in monsoon strength and river runoff (e. g. Weldeab et al. 2007). In contrast, the non-spinose foraminifers often have intrashell variability in Ba/Ca, with Ba/Ca ratios much higher than expected for the range of Ba concentrations observed in the ocean. Furthermore, the Ba/Ca ratio can vary by over a factor of 10 within a single specimen. This suggests either 1) the partition coefficient for Ba in non-spinose species differs from that determined for spinose species, or 2) non-spinose species calcify in a micro-environment that is enriched in Ba. We conducted experiments on live specimens to determine the partition coefficient for Ba in the non-spinose foraminifer N. dutertrei. Specimens were collected via plankton net from the Southern California Bight and cultured at the Wrigley Marine Science Center, Santa Catalina Island during the summer of 2013-2015. We use isotopically labeled seawater (87Sr) to identify discrete portions of calcite that grew in culture. We use laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS) for trace element analyses and to identify ocean grown vs. culture grown calcite. We show that the partition coefficient is similar to the spinose species: N. dutertrei incorporates Ba as a function of seawater chemistry. We conclude from these observations that N. dutertrei forms its calcite from fluids enriched in Ba, and hypothesize that this process occurs via attachment to organic-rich particles such as marine snow.
Chemoselective amide formation using O-(4-nitrophenyl)hydroxylamines and pyruvic acid derivatives.
Kumar, Sonali; Sharma, Rashi; Garcia, Megan; Kamel, Joseph; McCarthy, Caroline; Muth, Aaron; Phanstiel, Otto
2012-12-07
A series of O-(4-nitrophenyl)hydroxylamines were synthesized from their respective oximes using a pulsed addition of excess NaBH(3)CN at pH 3 in 65-75% yield. Steric hindrance near the oxime functional group played a key role in both the ease by which the oxime could be reduced and the subsequent reactivity of the respective hydroxylamine. Reaction of the respective hydroxylamines with pyruvic acid derivatives generated the desired amides in good yields. A comparison of phenethylamine systems bearing different leaving groups revealed significant differences in the rates of these systems and suggested that the leaving group ability of the N-OR substituent plays an important role in determining their reactivity with pyruvic acid. Competition experiments (in 68% DMSO/phosphate buffered saline) using 1 equiv of N-phenethyl-O-(4-nitrophenyl)hydroxylamine and 2 equiv of pyruvic acid in the presence of other nucleophiles such as glycine, cysteine, phenol, hexanoic acid, and lysine demonstrated that significant chemoselectivity is present in this reaction. The results suggest that this chemoselective reaction can occur in the presence of excess α-amino acids, phenols, acids, thiols, and amines.
Figueroa, Mario; Raja, Huzefa; Falkinham, Joseph O; Adcock, Audrey F; Kroll, David J; Wani, Mansukh C; Pearce, Cedric J; Oberlies, Nicholas H
2013-06-28
An extract of the filamentous fungus Bionectria sp. (MSX 47401) showed both promising cytotoxic activity (>90% inhibition of H460 cell growth at 20 μg/mL) and antibacterial activity against methicillin-resistant Staphylococcus aureus (MRSA). A bioactivity-directed fractionation study yielded one new peptaibol (1) and one new tetramic acid derivative (2), and the fungus biosynthesized diverse secondary metabolites with mannose-derived units. Five known compounds were also isolated: clonostachin (3), virgineone (4), virgineone aglycone (5), AGI-7 (6), and 5,6-dihydroxybisabolol (7). Compounds 5 and 7 have not been described previously from natural sources. Compound 1 represents the second member of the peptaibol structural class that contains an ester-linked sugar alcohol (mannitol) instead of an amide-linked amino alcohol, and peptaibols and tetramic acid derivatives have not been isolated previously from the same fungus. The structures of the new compounds were elucidated primarily by high-field NMR (950 and 700 MHz), HRESIMS/MS, and chemical degradations (Marfey's analysis). All compounds (except 6) were examined for antibacterial and antifungal activities. Compounds 2, 4, and 5 showed antimicrobial activity against S. aureus and several MRSA isolates.
BaBar Experiment Public Web Site
spotlights BaBar time-reversal measurement. December 14, 2012 PhysicsWorld.com has selected the BaBar time . BaBar Makes First Direct Observation of Time-Reversal Violation August 30, 2012 Fundamental interactions among particles are oblivious to the direction of time (a movie of a rock thrown up and falling back
Kijewska, Monika; Kuc, Adam; Kluczyk, Alicja; Waliczek, Mateusz; Man-Kupisinska, Aleksandra; Lukasiewicz, Jolanta; Stefanowicz, Piotr; Szewczuk, Zbigniew
2014-06-01
We present new tags based on the derivatives of phenylboronic acid and apply them for the selective detection of sugars and peptide-sugar conjugates in mass spectrometry. We investigated the binding of phenylboronic acid and its quaternary ammonium salt (QAS) derivatives to carbohydrates and peptide-derived Amadori products by HR-MS and MS/MS experiments. The formation of complexes between sugar or sugar-peptide conjugates and synthetic tags was confirmed on the basis of the unique isotopic distribution resulting from the presence of boron atom. Moreover, incorporation of a quaternary ammonium salt dramatically improved the efficiency of ionization in mass spectrometry. It was found that the formation of a complex with phenylboronic acid stabilizes the sugar moiety in glycated peptides, resulting in simplification of the fragmentation pattern of peptide-derived Amadori products. The obtained results suggest that derivatization of phenylboronic acid as QAS is a promising method for sensitive ESI-MS detection of carbohydrates and their conjugates formed by non-enzymatic glycation or glycosylation.
NASA Astrophysics Data System (ADS)
Kijewska, Monika; Kuc, Adam; Kluczyk, Alicja; Waliczek, Mateusz; Man-Kupisinska, Aleksandra; Lukasiewicz, Jolanta; Stefanowicz, Piotr; Szewczuk, Zbigniew
2014-06-01
We present new tags based on the derivatives of phenylboronic acid and apply them for the selective detection of sugars and peptide-sugar conjugates in mass spectrometry. We investigated the binding of phenylboronic acid and its quaternary ammonium salt (QAS) derivatives to carbohydrates and peptide-derived Amadori products by HR-MS and MS/MS experiments. The formation of complexes between sugar or sugar-peptide conjugates and synthetic tags was confirmed on the basis of the unique isotopic distribution resulting from the presence of boron atom. Moreover, incorporation of a quaternary ammonium salt dramatically improved the efficiency of ionization in mass spectrometry. It was found that the formation of a complex with phenylboronic acid stabilizes the sugar moiety in glycated peptides, resulting in simplification of the fragmentation pattern of peptide-derived Amadori products. The obtained results suggest that derivatization of phenylboronic acid as QAS is a promising method for sensitive ESI-MS detection of carbohydrates and their conjugates formed by non-enzymatic glycation or glycosylation.
Adsorption of Benzoic Acid in Aqueous Solution by Bagasse Fly Ash
NASA Astrophysics Data System (ADS)
Suresh, S.
2012-09-01
This paper reports the studies on the benzoic acid (BA) onto bagasse fly ash (BFA) was studied in aqueous solution in a batch system. Physico-chemical properties including surface area, surface texture of the GAC before and after BA adsorption onto BFA were analysed using X-ray diffractometer (XRD), scanning electron microscopy (SEM) and energy dispersive X-ray spectroscopy (EDX). The optimum initial pH for the adsorption of BA was found to be 5.56. The adsorbent dose was 10 g/l for BFA and the equilibrium time 8 h of reaction. Pseudo first and second order models were used to find the adsorption kinetics. It was found that intraparticle diffusion played important role in the adsorption mechanisms of BA and the adsorption kinetics followed pseudo-second order kinetic model rather than the pseudo first order kinetic model. Isotherm data were generated for BA solution having initial concentrations of BA in the range of 10-200 mg/l for the BFA dosage of 10 g/l at temperatures of 288, 303, and 318 K. The adsorption of BA onto BFA was favorably influenced by an increase in temperature. Equilibrium data were well represented by the Redlich-Peterson isotherm model. Values of the change in entropy ( ΔS 0), heat of adsorption ( ΔH 0) for adsorption of BA on BFA was found to be 120.10 and 19.61 kJ/mol respectively. The adsorption of BA onto BFA was an endothermic reaction. Desorption of BA from BFA was studied by various solvents method. Acetic acid was found to be a better eluant for desorption of BA with a maximum desorption efficiency of 55.2 %. Owing to its heating value, spent BFA can be used as a co-fuel for the production of heat in boiler furnaces.
NASA Astrophysics Data System (ADS)
Rauch, T.; Werner, K.; Quinet, P.; Kruk, J. W.
2014-06-01
Context. For the spectral analysis of high-resolution and high-signal-to-noise (S/N) spectra of hot stars, state-of-the-art non-local thermodynamic equilibrium (NLTE) model atmospheres are mandatory. These are strongly dependent on the reliability of the atomic data that is used for their calculation. Aims: Reliable Ba v-vii oscillator strengths are used to identify Ba lines in the spectra of the DA-type white dwarf G191-B2B and the DO-type white dwarf RE 0503-289 and to determine their photospheric Ba abundances. Methods: We newly calculated Ba v-vii oscillator strengths to consider their radiative and collisional bound-bound transitions in detail in our NLTE stellar-atmosphere models for the analysis of Ba lines exhibited in high-resolution and high-S/N UV observations of G191-B2B and RE 0503-289. Results: For the first time, we identified highly ionized Ba in the spectra of hot white dwarfs. We detected Ba vi and Ba vii lines in the Far Ultraviolet Spectroscopic Explorer (FUSE) spectrum of RE 0503-289. The Ba vi/Ba vii ionization equilibrium is well reproduced with the previously determined effective temperature of 70 000 K and surface gravity of log g = 7.5. The Ba abundance is 3.5 ± 0.5 × 10-4 (mass fraction, about 23 000 times the solar value). In the FUSE spectrum of G191-B2B, we identified the strongest Ba vii line (at 993.41 Å) only, and determined a Ba abundance of 4.0 ± 0.5 × 10-6 (about 265 times solar). Conclusions: Reliable measurements and calculations of atomic data are a pre-requisite for stellar-atmosphere modeling. Observed Ba vi-vii line profiles in two white dwarfs' (G191-B2B and RE 0503-289) far-ultraviolet spectra were well reproduced with our newly calculated oscillator strengths. This allowed to determine the photospheric Ba abundance of these two stars precisely. Based on observations with the NASA/ESA Hubble Space Telescope, obtained at the Space Telescope Science Institute, which is operated by the Association of Universities for
Derivatives of xanthic acid are novel antioxidants: application to synaptosomes.
Lauderback, Christopher M; Drake, Jennifer; Zhou, Daohong; Hackett, Janna M; Castegna, Alessandra; Kanski, Jaroslaw; Tsoras, Maria; Varadarajan, Sridhar; Butterfield, D Allan
2003-04-01
Xanthic acids have long been known to act as reducing agents. Recently, D609, a tricyclodecanol derivative of xanthic acid, has been reported to have anti-apoptotic and anti-inflammatory properties that are attributed to specific inhibition of phosphatidyl choline phospholipase C (PC-PLC). However, because oxidative stress is involved in both of these cellular responses, the possibility that xanthates may act as antioxidants was investigated in the current study. Finding that xanthates efficiently scavenge hydroxyl radicals, the mechanism by which D609 and other xanthate derivatives may protect against oxidative damage was further examined. The xanthates studied, especially D609, mimic glutathione (GSH). Xanthates scavenge hydroxyl radicals and hydrogen peroxide, form disulfide bonds (dixanthogens), and react with electrophilic products of lipid oxidation (acrolein) in a manner similar to GSH. Further, upon disulfide formation, dixanthogens are reduced by glutathione reductase to a redox active xanthate. Supporting its role as an antioxidant, D609 significantly (p < 0.01) reduces free radical-induced changes in synaptosomal lipid peroxidation (TBARs), protein oxidation (protein carbonyls), and protein conformation. Thus, in addition to inhibitory effects on PC-PLC, D609 may prevent cellular apoptotic and inflammatory cascades by acting as antioxidants and novel GSH mimics. These results are discussed with reference to potential therapeutic application of D609 in oxidative stress conditions.
White HDPE bottles as source of serious contamination of water samples with Ba and Zn.
Reimann, Clemens; Grimstvedt, Andreas; Frengstad, Bjørn; Finne, Tor Erik
2007-03-15
During a recent study of surface water quality factory new white high-density polyethylene (HDPE) bottles were used for collecting the water samples. According to the established field protocol of the Geological Survey of Norway the bottles were twice carefully rinsed with water in the field prior to sampling. Several blank samples using milli-Q (ELGA) water (>18.2 MOmega) were also prepared. On checking the analytical results the blanks returned values of Ag, Ba, Sr, V, Zn and Zr. For Ba and Zn the values (c. 300 microg/l and 95 microg/l) were about 10 times above the concentrations that can be expected in natural waters. A laboratory test of the bottles demonstrated that the bottles contaminate the samples with significant amounts of Ba and Zn and some Sr. Simple acid washing of the bottles prior to use did not solve the contamination problem for Ba and Zn. The results suggest that there may exist "clean" and "dirty" HDPE bottles depending on manufacturer/production process. When collecting water samples it is mandatory to check bottles regularly as a possible source of contamination.
Erythrolic acids A-E, Meroterpenoids from a Marine-Derived Erythrobacter sp
Hu, Youcai; Legako, Aaron G.; Espindola, Ana Paula D.M.; MacMillan, John B.
2012-01-01
Erythrolic acids A-E (1–5) are five unusual meroterpenoids isolated from the bacterium Erythrobacter sp. derived from a marine sediment sample collected in Galveston, TX. The structures were elucidated by means of detailed spectroscopic analysis and chemical derivatization. The erythrolic acids contain a 4-hydroxybenzoic acid appended with a modified terpene side chain. The side chain modifications include oxidation of a terminal methyl substituent and in the case of 1–4 addition of a 2-carbon unit to give terpene side chains of unusual length; C22 for 1 and 2, C17 for 3 and C12 for 4. The relative and absolute configurations of the meroterpenoids were determined by coupling constant, NOE and Mosher’s analysis. In vitro cytotoxicity towards a number of non-small cell lung cancer (NSCLC) cell lines revealed only modest activity for erythrolic acid D (4) (2.5 μM against HCC44). The discovery of these unusual diterpenes, along with the previously reported erythrazoles, demonstrate the natural product potential of a previously unstudied group of bacteria for drug discovery. The unusual nature of the terpene side chain, we believe, involves an oxidation of a terminal methyl group to a carboxylic acid and subsequent Claisen condensation with acetyl-CoA. PMID:22384985
Detoxification of sugarcane-derived hemicellulosic hydrolysate using a lactic acid producing strain.
Alves de Oliveira, Regiane; Vaz Rossell, Carlos Eduardo; Venus, Joachim; Cândida Rabelo, Sarita; Maciel Filho, Rubens
2018-07-20
Furfural and HMF are known for a negative impact in different bioprocesses, including lactic acid fermentation. There are already some methods described to remove these inhibitory compounds from the hydrolysates. However, these methods also reduce the yield of sugars from the hydrolysis and increase the process costs. In this work, the detoxification of sugarcane-derived hemicellulosic hydrolysate was performed by Lactobacillus plantarum during the fermentation time. At the end of the fermentation, a decrease of 98% of furfural and 86% of HMF and was observed, with a final lactic acid titer of 34.5 g/L. The simultaneous fermentation and bio-detoxification simplify the process and reduce operational costs, leading to economic competitiveness of second-generation feedstock for lactic acid production. Copyright © 2018 Elsevier B.V. All rights reserved.
Severson, Paul L.; Vrba, Lukas; Stampfer, Martha R.; Futscher, Bernard W.
2014-01-01
Genetic mutations are known to drive cancer progression and certain tumors have mutation signatures that reflect exposures to environmental carcinogens. Benzo[a]pyrene (BaP) has a known mutation signature and has proven capable of inducing changes to DNA sequence that drives normal pre-stasis human mammary epithelial cells (HMEC) past a first tumor suppressor barrier (stasis) and towards immortality. We analyzed normal, pre-stasis HMEC, three independent BaP-derived post-stasis HMEC strains (184Aa, 184Be, 184Ce) and two of their immortal derivatives(184A1 and 184BE1) by whole exome sequencing. The independent post-stasis strains exhibited between 93 and 233 BaP-induced mutations in exons. Seventy percent of the mutations were C:G>A:T transversions, consistent with the known mutation spectrum of BaP. Mutations predicted to impact protein function occurred in several known and putative cancer drivers including p16, PLCG1, MED12, TAF1 in 184Aa; PIK3CG, HSP90AB1, WHSC1L1, LCP1 in 184Be and FANCA, LPP in 184Ce. Biological processes that typically harbor cancer driver mutations such as cell cycle, regulation of cell death and proliferation, RNA processing, chromatin modification and DNA repair were found to have mutations predicted to impact function in each of the post-stasis strains. Spontaneously immortalized HMEC lines derived from two of the BaP-derived post-stasis strains shared greater than 95% of their BaP-induced mutations with their precursor cells. These immortal HMEC had 10 or fewer additional point mutations relative to their post-stasis precursors, but acquired chromosomal anomalies during immortalization that arose independent of BaP. The results of this study indicate that acute exposures of HMEC to high dose BaP recapitulate mutation patterns of human tumors and can induce mutations in a number of cancer driver genes. PMID:25435355
Severson, Paul L; Vrba, Lukas; Stampfer, Martha R; Futscher, Bernard W
2014-12-01
Genetic mutations are known to drive cancer progression and certain tumors have mutation signatures that reflect exposures to environmental carcinogens. Benzo[a]pyrene (BaP) has a known mutation signature and has proven capable of inducing changes to DNA sequence that drives normal pre-stasis human mammary epithelial cells (HMEC) past a first tumor suppressor barrier (stasis) and toward immortality. We analyzed normal, pre-stasis HMEC, three independent BaP-derived post-stasis HMEC strains (184Aa, 184Be, 184Ce) and two of their immortal derivatives(184A1 and 184BE1) by whole exome sequencing. The independent post-stasis strains exhibited between 93 and 233 BaP-induced mutations in exons. Seventy percent of the mutations were C:G>A:T transversions, consistent with the known mutation spectrum of BaP. Mutations predicted to impact protein function occurred in several known and putative cancer drivers including p16, PLCG1, MED12, TAF1 in 184Aa; PIK3CG, HSP90AB1, WHSC1L1, LCP1 in 184Be and FANCA, LPP in 184Ce. Biological processes that typically harbor cancer driver mutations such as cell cycle, regulation of cell death and proliferation, RNA processing, chromatin modification and DNA repair were found to have mutations predicted to impact function in each of the post-stasis strains. Spontaneously immortalized HMEC lines derived from two of the BaP-derived post-stasis strains shared greater than 95% of their BaP-induced mutations with their precursor cells. These immortal HMEC had 10 or fewer additional point mutations relative to their post-stasis precursors, but acquired chromosomal anomalies during immortalization that arose independent of BaP. The results of this study indicate that acute exposures of HMEC to high dose BaP recapitulate mutation patterns of human tumors and can induce mutations in a number of cancer driver genes. Copyright © 2014 Elsevier B.V. All rights reserved.
Severson, Paul L.; Vrba, Lukas; Stampfer, Martha R.; ...
2014-11-04
Genetic mutations are known to drive cancer progression and certain tumors have mutation signatures that reflect exposures to environmental carcinogens. Benzo[a]pyrene (BaP) has a known mutation signature and has proven capable of inducing changes to DNA sequence that drives normal pre-stasis human mammary epithelial cells (HMEC) past a first tumor suppressor barrier (stasis) and toward immortality. We analyzed normal, pre-stasis HMEC, three independent BaP-derived post-stasis HMEC strains (184Aa, 184Be, 184Ce) and two of their immortal derivatives(184A1 and 184BE1) by whole exome sequencing. The independent post-stasis strains exhibited between 93 and 233 BaP-induced mutations in exons. Seventy percent of the mutationsmore » were C:G>A:T transversions, consistent with the known mutation spectrum of BaP. Mutations predicted to impact protein function occurred in several known and putative cancer drivers including p16, PLCG1, MED12, TAF1 in 184Aa; PIK3CG, HSP90AB1, WHSC1L1, LCP1 in 184Be and FANCA, LPP in 184Ce. Biological processes that typically harbor cancer driver mutations such as cell cycle, regulation of cell death and proliferation, RNA processing, chromatin modification and DNA repair were found to have mutations predicted to impact function in each of the post-stasis strains. Spontaneously immortalized HMEC lines derived from two of the BaP-derived post-stasis strains shared greater than 95% of their BaP-induced mutations with their precursor cells. These immortal HMEC had 10 or fewer additional point mutations relative to their post-stasis precursors, but acquired chromosomal anomalies during immortalization that arose independent of BaP. In conclusion, the results of this study indicate that acute exposures of HMEC to high dose BaP recapitulate mutation patterns of human tumors and can induce mutations in a number of cancer driver genes.« less
Nasser Al-Shorgani, Najeeb Kaid; Kalil, Mohd Sahaid; Wan Yusoff, Wan Mohtar; Shukor, Hafiza; Hamid, Aidil Abdul
2015-12-01
Improvement in the butanol production selectivity or enhanced butanol:acetone ratio (B:A) is desirable in acetone-butanol-ethanol (ABE) fermentation by Clostridium strains. In this study, artificial electron carriers were added to the fermentation medium of a new isolate of Clostridium acetobutylicum YM1 in order to improve the butanol yield and B:A ratio. The results revealed that medium supplementation with electron carriers changed the metabolism flux of electron and carbon in ABE fermentation by YM1. A decrease in acetone production, which subsequently improved the B:A ratio, was observed. Further improvement in the butanol production and B:A ratios were obtained when the fermentation medium was supplemented with butyric acid. The maximum butanol production (18.20 ± 1.38 g/L) was gained when a combination of methyl red and butyric acid was added. Although the addition of benzyl viologen (0.1 mM) and butyric acid resulted in high a B:A ratio of 16:1 (800% increment compared with the conventional 2:1 ratio), the addition of benzyl viologen to the culture after 4 h resulted in the production of 18.05 g/L butanol. Manipulating the metabolic flux to butanol through the addition of electron carriers could become an alternative strategy to achieve higher butanol productivity and improve the B:A ratio. Copyright © 2015 Elsevier Ltd. All rights reserved.
Continuous Structural Transition in Glass-Forming Molten Titanate BaTi 2 O 5
Alderman, O. L. G.; Benmore, C. J.; Tamalonis, A.; ...
2016-12-01
The structure of the model titanate glass former BaTi2O5 has been studied over a wide temperature (T) range in the molten, supercooled, and glassy states under conditions of aerodynamic levitation. Both high-energy X-ray diffraction and Ti K-edge X-ray absorption spectroscopy reveal a continuous structural transition involving reduction of the cation-oxygen (and oxygen-cation) average coordination numbers and bond lengths with increasing T. Ti-0 coordination in the moderately supercooled and equilibrium melt follows a linear trend n(Tio) = 5.4(1)- [3.5(7) x 10(-4)]T [K] (1300 <= T <= 1830 K, T-g = 960 K, T-m = 1660 K). Comparison to the melt-quenched glassmore » implies an increase in partial derivative n(Tio)/partial derivative T at lower T, as T-g is approached from above. Both Ba-0 coordination and bond length also decrease at higher T, and the role of Ba addition is to reduce n(Tio) below its value in pure molten TiO2, which is related to the presence of density maxima in molten BaO-TiO2. Density measurements made by imaging of the levitated melt yielded rho(T) = 4.82(55)- 0.0004(3)T in units of K and g cm(-3). While BaTi2O5 glass likely consists of a fully connected Ti-0 network, free of nonbridging oxygen (NBO) [OTi1 and with at least 13(4)% [OTi3] triclusters, the 1835(40) K equilibrium melt contains at least 10(4)% NBO along with 90(4)% bridging oxygen [OTi2]. The results highlight the fact that glasses can be considered as structural analogues of melts only for those melts deeply supercooled into the glass transition region. The results imply possible fictive T dependence of titanate glass structure, suggesting applications as, e.g., laser written waveguides with large refractive indices and refractive index contrasts. The temperature-dependent structure further implies a super-Arrhenian melt viscosity with consequences for glass manufacture, titanate-rich slags produced in iron smelting, TiO2-bearing magmas, and by analogy silicate melts at high
Winston, Jenessa A; Theriot, Casey M
2016-10-01
Clostridium difficile is an anaerobic, Gram positive, spore-forming bacillus that is the leading cause of nosocomial gastroenteritis. Clostridium difficile infection (CDI) is associated with increasing morbidity and mortality, consequently posing an urgent threat to public health. Recurrence of CDI after successful treatment with antibiotics is high, thus necessitating discovery of novel therapeutics against this pathogen. Susceptibility to CDI is associated with alterations in the gut microbiota composition and bile acid metabolome, specifically a loss of microbial derived secondary bile acids. This review aims to summarize in vitro, ex vivo, and in vivo studies done by our group and others that demonstrate how secondary bile acids affect the different stages of the C. difficile life cycle. Understanding the dynamic interplay of C. difficile and microbial derived secondary bile acids within the gastrointestinal tract will shed light on how bile acids play a role in colonization resistance against C. difficile. Rational manipulation of secondary bile acids may prove beneficial as a treatment for patients with CDI. Published by Elsevier Ltd.
Heintz, Ron A.; Wipfli, Mark S.; Hudson, John P.
2010-01-01
The energetic benefits enjoyed by consumers in streams with salmon runs depend on how those benefits are accrued. Adult Pacific salmon Oncorhynchus spp. deliver significant amounts of nutrients (i.e., nitrogen and phosphorus) and carbon to streams when they spawn and die; these nutrient additions can have demonstrable effects on primary production in streams. Consumption of carcass tissues or eggs provides for direct energy subsidies to consumers and may have significant effects on their condition. In this study, comparisons of juvenile coho salmon O. kisutch and aquatic insects exposed to terrestrial and marine energy sources demonstrated that direct consumption of marine-derived lipids had a significant effect on the lipid reserves of consumers. Direct consumption of marine-derived tissues was verified through fatty acid analysis. Selected aquatic insects and juvenile coho salmon were reared for 6 weeks in experimental streams supplied with terrestrial or marine energy sources. Chironomid midges, nemourid stoneflies, and juvenile coho salmon exposed to the marine energy source altered their fatty acid compositions by incorporating the long-chain polyunsaturated fatty acids that are characteristic of marine fish. The fatty acid composition of baetid mayflies was unaffected. The direct movement of specific fatty markers indicated that direct consumption of marine-derived tissues led to increased energy reserves (triacylglycerols) in consumers. Similar results were obtained for juvenile coho salmon sampled from natural streams before and after the arrival of adult salmon runs. These data indicate that marine-derived lipids from anadromous fish runs are an important source of reserve lipids for consumers that overwinter in streams.
Shanmugam, Muthu K.; Dai, Xiaoyun; Kumar, Alan Prem; Tan, Benny KH; Sethi, Gautam; Bishayee, Anupam
2014-01-01
Oleanolic acid (OA, 3β-hydroxyolean-12-en-28-oic acid) is a ubiquitous pentacyclic multifunctional triterpenoid, widely found in several dietary and medicinal plants. Natural and synthetic OA derivatives can modulate multiple signaling pathways including nuclear factor-κB, AKT, signal transducer and activator of transcription 3, mammalian target of rapamycin, caspases, intercellular adhesion molecule 1, vascular endothelial growth factor, and poly (ADP-ribose) polymerase in a variety of tumor cells. Importantly, synthetic derivative of OA, 2-cyano-3,12-dioxoolean-1,9-dien-28-oic acid (CDDO), and its C-28 methyl ester (CDDO-Me) and C28 imidazole (CDDO-Im) have demonstrated potent antiangiogenic and antitumor activities in rodent cancer models. These agents are presently under evaluation in phase I studies in cancer patients. This review summarizes the diverse molecular targets of OA and its derivatives and also provides clear evidence on their promising potential in preclinical and clinical situations. PMID:24486850
Spectroellipsometric studies of sol-gel derived Sr0.6Ba0.4Nb2O6 films
NASA Astrophysics Data System (ADS)
Ho, Melanie M. T.; Tang, T. B.; Mak, C. L.; Pang, G. K. H.; Chan, K. Y.; Wong, K. H.
2006-10-01
Sr0.6Ba0.4Nb2O6 (SBN) films have been fabricated on (001)Si substrates by a sol-gel technique. The annealing process was carried out in air at various temperatures ranging from 200to700°C. Studies using x-ray diffractometry, high resolution transmission electron microscopy, and scanning electron microscopy showed that polycrystalline films, with a grain size of about 100nm, were obtained only for annealing temperatures ⩾600°C. The optical properties of these sol-gel derived SBN films were studied by spectroscopic ellipsometry (SE). In the analysis of the measured SE spectra, a triple-layer Lorentz model has been developed and used to deduce the optical properties of the SBN films. Our systematic SE measurements revealed that the refractive indices of the SBN films increase with the annealing temperature. This increase is more pronounced at around the crystallization temperature, i.e., between 500 and 600°C. The extinction coefficients of the films also exhibit a similar trend, showing a zero value for amorphous films and larger values for films annealed at above 600°C. Our results demonstrate that while crystallization helps to raise the refractive index of the film due to film densification, it also promotes scattering by grain boundary, resulting in a larger extinction coefficient.
NASA Astrophysics Data System (ADS)
Pradal, Nathalie; Potdevin, Audrey; Chadeyron, Geneviève; Bonville, Pierre; Caillier, Bruno; Mahiou, Rachid
2017-02-01
Blue-emitting BaMgAl10O17:Eu2+ (BAM:Eu), suitable for applications in a next generation of Hg-free lamps based on UV LEDs, was prepared by a microwave induced solution combustion synthesis, using urea as combustion fuel and nitrates as oxidizers. Purity control of the as-synthesized blue phosphor was undertaken by a washing step followed by a reduction one. Structural and morphological properties of the outcoming phosphors have been considered. Synthesis process allows producing a well-crystallized and nanostructured BAM phase within only few minutes. The influence of reduction treatment on the relative amounts of Eu2+/Eu3+ in our samples has been investigated through an original study by magnetization and Mössbauer spectroscopy. Furthermore, a complete optical study has been carried out and allowed us to determine the europium localization in the three possible sites in BAM matrix. The percentage of Eu2+ increased twofold after the reduction treatment, entailing an increase in the luminescence efficiency upon UV excitation. Finally, temperature-dependent luminescence of combustion-derived powders has been studied till 170 °C and compared to that of commercial BAM:Eu. MISCS-derived phosphors present a higher thermal stability than commercial one: whereas the emission efficiency of this last was reduced by 64%, the one of combustion-derived BAM:Eu experienced an only 12% decline. Furthermore, while commercial BAM suffered from a severe blue-shift with increasing temperature, our phosphors keep its color quality with a good stability of the photometric parameters.
Butyric acid stimulates bone sialoprotein gene transcription.
Yang, Li; Li, Zhengyang; Li, Xinyue; Wang, Zhitao; Wang, Shuang; Sasaki, Yoko; Takai, Hideki; Ogata, Yorimasa
2010-06-01
Butyric acid (sodium butyrate; BA) is an extracellular metabolite secreted from periodontopathic bacteria present in subgingival plaque. BA induces apoptosis of T and B cells, and acts as a potent inhibitor of histone deacetylases. Bone sialoprotein (BSP) is thought to function in the initial mineralization of bone, and may be crucial for osteoblast differentiation, bone matrix mineralization and tumor metastasis. In the present study we investigated the regulation of BSP transcription by BA in rat osteoblast-like ROS17/2.8 cells. At 12 h, BA (10(-4) M) increased the level of BSP mRNA, and enhanced the luciferase activity of the construct pLUC3, which includes the promoter sequence between nucleotides -116 and +60. Transcriptional stimulation by BA was abrogated in the pLUC3 construct which containing a 2-bp mutation in the fibroblast growth factor 2 response element (FRE). Gel shift analyses showed that BA increased the binding of nuclear protein to FRE. These data suggest that BA increases the transcription of the BSP gene mediated through FRE in the rat BSP gene promoter, and induces osteoblast activity in the early stage of bone formation.
Ouchi, Kazuki; Colyer, Christa L; Sebaiy, Mahmoud; Zhou, Jin; Maeda, Takeshi; Nakazumi, Hiroyuki; Shibukawa, Masami; Saito, Shingo
2015-02-03
We designed a new series of boronic acid-functionalized squarylium cyanine dyes (SQ-BA) with different lengths of alkyl chain residues, suitable for multiple discriminant analysis (MDA) of sialic acid (Neu5Ac) in biological samples. The SQ-BA dyes form aggregates based on hydrophobic interactions, which result in quenched fluorescence in aqueous solutions. When the boronic acid binds with saccharides, the fluorescence intensity increases as a result of dissociation to the emissive monomeric complex. We inferred that different dye aggregate structures (H-aggregates and J-aggregates) were induced depending on the alkyl chain length, so that monosaccharides would be recognized in different ways (especially, multipoint interaction with J-aggregates). A distinctive emission enhancement of SQ-BA dyes with shorter-alkyl-chains in the presence of Neu5Ac was observed (2.4-fold fluorescence enhancement; with formation constant 10(1.7) M(-1)), with no such enhancement for SQ-BA dyes with longer-alkyl-chain. In addition, various enhancement factors for other monosaccharides were observed depending on the alkyl chain length. Detailed thermodynamic and NMR studies of the SQ-BA complexes revealed the unique recognition mechanism: the dye aggregate with a shorter-alkyl-chain causes the slipped parallel structure and forms a stable 2:1 complex with Neu5Ac, as distinct from longer-alkyl-chain dyes, which form a 1:1 monomeric complex. MDA using the four SQ-BA dyes was performed for human urine samples, resulting in the successful discrimination between normal and abnormal Neu5Ac levels characteristic of disease. Thus, we successfully controlled various responses to similar monosaccharides with a novel approach that chemically modified not the boronic acid moiety itself but the length of the alkyl chain residue attached to the dye in order to generate specificity.
Analysis and Correction of Diffraction Effect on the B/A Measurement at High Frequencies
NASA Astrophysics Data System (ADS)
Zhang, Dong; Gong, Xiu-Fen; Liu, Xiao-Zhou; Kushibiki, Jun-ichi; Nishino, Hideo
2004-01-01
A numerical method is developed to analyse and to correct the diffraction effect in the measurement of acoustic nonlinearity parameter B/A at high frequencies. By using the KZK nonlinear equation and the superposition approach of Gaussian beams, an analytical model is derived to describe the second harmonic generation through multi-layer medium SiO2/liquid specimen/SiO2. Frequency dependence of the nonlinear characterization curve for water in 110-155 MHz is numerically and experimentally investigated. With the measured dip position and the new model, values of B/A for water are evaluated. The results show that the present method can effectively correct the diffraction effect in the measurement.
D-Lactic acid biosynthesis from biomass-derived sugars via Lactobacillus delbrueckii fermentation.
Zhang, Yixing; Vadlani, Praveen V
2013-12-01
Poly-lactic acid (PLA) derived from renewable resources is considered to be a good substitute for petroleum-based plastics. The number of poly L-lactic acid applications is increased by the introduction of a stereocomplex PLA, which consists of both poly-L and D-lactic acid and has a higher melting temperature. To date, several studies have explored the production of L-lactic acid, but information on biosynthesis of D-lactic acid is limited. Pulp and corn stover are abundant, renewable lignocellulosic materials that can be hydrolyzed to sugars and used in biosynthesis of D-lactic acid. In our study, saccharification of pulp and corn stover was done by cellulase CTec2 and sugars generated from hydrolysis were converted to D-lactic acid by a homofermentative strain, L. delbrueckii, through a sequential hydrolysis and fermentation process (SHF) and a simultaneous saccharification and fermentation process (SSF). 36.3 g L(-1) of D-lactic acid with 99.8 % optical purity was obtained in the batch fermentation of pulp and attained highest yield and productivity of 0.83 g g(-1) and 1.01 g L(-1) h(-1), respectively. Luedeking-Piret model described the mixed growth-associated production of D-lactic acid with a maximum specific growth rate 0.2 h(-1) and product formation rate 0.026 h(-1), obtained for this strain. The efficient synthesis of D-lactic acid having high optical purity and melting point will lead to unique stereocomplex PLA with innovative applications in polymer industry.
Yao, Ruimiao; Hou, Weiliang; Bao, Jie
2017-11-01
Non-glucose sugars derived from lignocellulose cover approximately 40% of the total carbohydrates of lignocellulose biomass. The conversion of the non-glucose sugars to the target products is an important task of lignocellulose biorefining research. Here we report a fast and complete conversion of the total non-glucose sugars from corn stover into the corresponding sugar acids by whole cell catalysis and aerobic fermentation of Gluconobacter oxydans. The conversions include xylose to xylonate, arabinose to arabonate, mannose to mannonate, and galactose to galactonate, as well as with glucose into gluconate. These cellulosic non-glucose sugar acids showed the excellent cement retard setting property. The mixed cellulosic sugar acids could be used as cement retard additives without separation. The conversion of the non-glucose sugars not only makes full use of lignocellulose derived sugars, but also effectively reduces the wastewater treatment burden by removal of residual sugars. Copyright © 2017 Elsevier Ltd. All rights reserved.
Epoxides Derived from Dietary Dihomo-Gamma-Linolenic Acid Induce Germ Cell Death in C. elegans.
Deline, Marshall; Keller, Julia; Rothe, Michael; Schunck, Wolf-Hagen; Menzel, Ralph; Watts, Jennifer L
2015-10-21
Dietary fats are not created equally, slight differences in structure lead to crucial differences in function. Muticellular organisms use polyunsaturated fatty acid as substrates to produce potent signaling molecules crucial for many physiological processes, including reproduction. Here we explored the mechanism responsible for germ cell loss induced by dietary supplementation of dihomo-gamma-linolenic acid (DGLA, 20:3n-6) in the roundworm Caenorhabditis elegans. In this study we found that C. elegans CYP-33E2 activity produces a range of epoxy and hydroxy metabolites from dietary DGLA. Knockdown of cyp-33E2 suppressed the DGLA-induced sterility phenotype. Additionally, direct exposure of two specific DGLA-derived epoxy products, 8,9- and 14,15-epoxyeicosadienoic acids, produced germ cell abnormalities in the C. elegans gonad. We propose that sterility is mediated by the production of toxic DGLA-derived epoxides that trigger germ cell destruction. These studies are the first to establish a biological activity for a CYP-produced metabolite of DGLA.
Dai, Jing-Cao; Gupta, Shalabh; Corbett, John D
2011-01-03
The synthesis, structure, and bonding of BaTl(4) are described [C2/m, Z = 4, a = 12.408(3), b = 5.351(1), c = 10.383(2) Å, β = 116.00(3)°]. Pairs of edge-sharing Tl pentagons are condensed to generate a network of pentagonal biprisms along b that encapsulate Ba atoms. Alternating levels of prisms along c afford six more bifunctional Tl atoms about the waists of the biprisms, giving Ba a coordination number of 16. Each Tl atom is bonded to five to seven other Tl atoms and to three to five Ba atoms. There is also strong evidence that Hg substitutes preferentially in the shared edges of the Tl biprisms in BaHg(0.80)Tl(3.20) to generate more strongly bound Hg(2) dimers. Cations that are too small relative to the dimensions of the surrounding polyanionic network make this BaTl(4) structure (and for SrIn(4) and perhaps EuIn(4) as well) one stable alternative to tetragonal BaAl(4)-type structures in which cations are bound in larger hexagon-faced nets, as for BaIn(4) and SrGa(4). Characteristic condensation and augmentation of cation-centered prismatic units is common among many relatively cation- and electron-poor, polar derivatives of Zintl phases gain stability. At the other extreme, the large family of Frank-Kasper phases in which the elements exhibit larger numbers of bonded neighbors are sometimes referred to as orbitally rich.
Acerbo, Alvin S; Miller, Lisa M
2009-08-01
Boron is found in everyday foods and drinking water in trace quantities. Boron exists as boric acid (BA) within plants and animals, where low levels have been linked to cancer incidence. However, this correlation is not well characterized. In this study, we examined the chemical and morphological effects of BA on human skin melanoma cells (SK-MEL28) using Fourier Transform InfraRed Imaging (FTIRI) with a Focal Plane Array (FPA) detector. Cells were grown under concentrations of BA ranging from 0 to 50 mM. Cell viability was determined after 1, 2, 3, 5, 7 and 10 days using trypan blue staining. With FTIRI, images of approximately twenty cells per time point per condition were collected. Principal components analysis (PCA) was used to evaluate changes in cell composition, with particular focus on the lipid, protein, and nucleic acid spectral components. Results from trypan blue staining revealed decreased cell viability as BA concentration increased. FTIRI data indicated that the protein and lipid contents (as indicated by the lipid/protein ratio) did not undergo substantial changes due to BA treatment. In contrast, the nucleic acid/protein ratio significantly decreased with BA treatment. PCA results showed an increase in beta-sheet protein at higher concentrations of BA (12.5, 25, and 50 mM). Together, these results suggest that high concentrations of BA have an anti-proliferative effect and show signs consistent with apoptosis.
Mesomorphic properties of multi-arm chenodeoxycholic acid-derived liquid crystals
NASA Astrophysics Data System (ADS)
Dong, Liang; Yao, Miao; Wu, Shuang-jie; Yao, Dan-Shu; Hu, Jian-She; He, Xiao-zhi; Tian, Mei
2017-12-01
Four multi-arm liquid crystals (LCs) based on chenodeoxycholic acid, termed as 2G-PD, 2G-IB, 2G-BD and 5G-GC, respectively, have been synthesised by convergent method, which nematic LC, 6-(4-((4-ethoxybenzoyl)oxy)phenoxy)-6-oxohexanoic acid, was used as side arm, and chenodeoxycholic acid (CDCA) was used as the first core, 1,2-propanediol (PD), isosorbide (IB), 4,4‧-biphenyldiol (BD) and glucose (GC) were used as the second core, respectively. The first generation product, CDCA2EA, displayed cholesteric phase. The second generation products 2G-BD and 5G-GC displayed cholesteric phase, while 2G-PD and 2G-IB exhibited nematic phase. The multi-arm LC, 2G-IB, did not display cholesteric phase although the two cores were all chiral ones. The result indicated that chirality of the second core sometimes made the multi-arm LCs display nematic phase when cholesteric CDCA-derivative were introduced into the second core. Some attention should be paid on molecular conformation besides the introduction of chiral cores for multi-chiral-core LCs to obtain cholesteric phase.
Boric Acid Reduces the Formation of DNA Double Strand Breaks and Accelerates Wound Healing Process.
Tepedelen, Burcu Erbaykent; Soya, Elif; Korkmaz, Mehmet
2016-12-01
Boron is absorbed by the digestive and respiratory system, and it was considered that it is converted to boric acid (BA), which was distributed to all tissues above 90 %. The biochemical essentiality of boron element is caused by boric acid because it affects the activity of several enzymes involved in the metabolism. DNA damage repair mechanisms and oxidative stress regulation is quite important in the transition stage from normal to cancerous cells; thus, this study was conducted to investigate the protective effect of boric acid on DNA damage and wound healing in human epithelial cell line. For this purpose, the amount of DNA damage occurred with irinotecan (CPT-11), etoposide (ETP), doxorubicin (Doxo), and H 2 O 2 was determined by immunofluorescence through phosphorylation of H2AX (Ser139) and pATM (Ser1981) in the absence and presence of BA. Moreover, the effect of BA on wound healing has been investigated in epithelial cells treated with these agents. Our results demonstrated that H2AX (Ser139) foci numbers were significantly decreased in the presence of BA while wound healing was accelerated by BA compared to that in the control and only drug-treated cells. Eventually, the results indicate that BA reduced the formation of DNA double strand breaks caused by agents as well as improving the wound healing process. Therefore, we suggest that boric acid has important therapeutical effectiveness and may be used in the treatment of inflammatory diseases where oxidative stress and wound healing process plays an important role.
Isomer-sensitive deboronation in reductive aminations of aryl boronic acids
Jones, Brad Howard; Wheeler, David R.; Wheeler, Jill S.; ...
2015-09-05
Deboronation is observed during the reductive amination of formylphenylboronic acid (FPBA) to the amine termini and side chains of peptides. This deboronation is sensitive to the isomerism of the boronic acid (BA), with ortho-FPBA yielding complete deboronation in the preparation of an N-terminally-modified dipeptide. The observed behavior is also clearly mediated by the chemical identity of the amine substrate. These results reveal a previously undocumented subtlety of BA functionalization and highlight the importance of thorough spectroscopic characterization in the preparation of peptide and small molecule BAs.
A novel acidic pH fluorescent probe based on a benzothiazole derivative
NASA Astrophysics Data System (ADS)
Ma, Qiujuan; Li, Xian; Feng, Suxiang; Liang, Beibei; Zhou, Tiqiang; Xu, Min; Ma, Zhuoyi
2017-04-01
A novel acidic pH fluorescent probe 1 based on a benzothiazole derivative has been designed, synthesized and developed. The linear response range covers the acidic pH range from 3.44 to 6.46, which is valuable for pH researches in acidic environment. The evaluated pKa value of the probe 1 is 4.23. The fluorescence enhancement of the studied probe 1 with an increase in hydrogen ions concentration is based on the hindering of enhanced photo-induced electron transfer (PET) process. Moreover, the pH sensor possesses a highly selective response to H+ in the presence of metal ions, anions and other bioactive small molecules which would be interfere with its fluorescent pH response. Furthermore, the probe 1 responds to acidic pH with short response time that was less than 1 min. The probe 1 has been successfully applied to confocal fluorescence imaging in live HeLa cells and can selectively stain lysosomes. All of such good properties prove it can be used to monitoring pH fluctuations in acidic environment with high sensitivity, pH dependence and short response time.
Metformin impacts cecal bile acid profiles in mice.
Sillner, Nina; Walker, Alesia; Koch, Wendelin; Witting, Michael; Schmitt-Kopplin, Philippe
2018-04-15
Bile acids (BAs) are major components of bile synthesized from cholesterol and take part in the digestion of dietary lipids, as well as having signaling functions. They undergo extensive microbial metabolism inside the gastrointestinal tract. Here, we present a method of ultra-high pressure liquid chromatography coupled to ion trap mass spectrometry for quantification of 45 BAs in mouse cecum. The system was validated in regard to sensitivity with limits of detection and quantification (0.6-24.9 nM), interday accuracy (102.4%), interday precision (15.2%), recovery rate (74.7%), matrix effect (98.2%) and carry-over effect (<1.1%). Afterwards, we applied our method to investigate the effect of metformin on BA profiles. Diabetic mice were treated with metformin for 1 day or 14 days. One day of treatment resulted in a significant increase of total BA concentration (2.7-fold increase; db/db metformin 5.32 μmol/g, db/db control mice 1.95 μmol/g), most notable in levels of 7-oxodeoxycholic, 3-dehydrocholic and cholic acid. We observed only minor impact on BA metabolism after 14 days of metformin treatment, compared to the single treatment. Furthermore, healthy wild type mice had elevated concentrations of allocholic and ω-muricholic acid compared to diabetic mice. Our method proved the applicability of profiling BAs in cecum to investigate intestinal BA metabolism in diabetes and pharmacological applications. Copyright © 2018 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Zhang, Suyue; Wang, Yunlong; Wang, Cuiping; Zhang, Hui; Shen, Yuhua; Xie, Anjian
2016-02-01
Core/porous-shell olive-like crystalline BaWO4 is synthesized by a combined simple hydrothermal method and soft template approach. The prepared product shows an olive-like shape with diameter of ˜2 μm, length of ˜4 μm, and the thickness of the shell of about 65 nm, which are orderly assembled by many nanoparticles. A possible formation mechanism of olive-like BaWO4 microstructure involving interfacial recognization of ions, nucleation, aggregation, in situ growth and Ostwald ripening process is proposed. Polyacrylic acid sodium (PAAS) as a template plays an important role in inducing the nucleation and growth of olive-like BaWO4 microcrystalline. Other shapes of BaWO4 microcrystalline are also fabricated by varying the concentration of PAAS and Ba2+. The olive-like product with a core-shell structure which exists a large number of pores on crystal surface shows excellent photoluminescence property, which have potentially applied prospects in fields such as light display systems etc.
Bhalla, Vandana; Kaur, Sharanjeet; Vij, Varun; Kumar, Manoj
2013-05-06
Spherical aggregates of hexaphenylbenzene derivative 5 undergo metal-induced modulation to form nanorods in the presence of Hg(2+) ions, which exhibit selective and sensitive response toward picric acid (PA) with a detection limit of 6.87 ppb.
Xing, Rongrong; Hu, Shuang; Chen, Xuan; Bai, Xiaohong
2014-09-01
A novel graphene-sensitized microporous membrane/solvent microextraction method named microporous membrane/graphene/solvent synergistic microextraction, coupled with high-performance liquid chromatography and UV detection, was developed and introduced for the extraction and determination of three cinnamic acid derivatives in Rhizoma Typhonii. Several factors affecting performance were investigated and optimized, including the types of graphene and extraction solvent, concentration of graphene dispersed in octanol, sample phase pH, ionic strength, stirring rate, extraction time, extraction temperature, and sample volume. Under optimized conditions, the enrichment factors of cinnamic acid derivatives ranged from 75 to 269. Good linearities were obtained from 0.01 to 10 μg/mL for all analytes with regression coefficients between 0.9927 and 0.9994. The limits of quantification were <1 ng/mL, and satisfactory recoveries (99-104%) and precision (1.1-10.8%) were also achieved. The synergistic microextraction mechanism based on graphene sensitization was analyzed and described. The experimental results showed that the method was simple, sensitive, practical, and effective for the preconcentration and determination of cinnamic acid derivatives in Rhizoma Typhonii. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Stadler, M; Anke, T; Dasenbrock, J; Steglich, W
1993-01-01
A new hirsutane derivative, phellodonic acid (1), has been isolated from fermentations of Phellodon melaleucus strain 87113. Its structure was elucidated by spectroscopic methods. The compound exhibits antibiotic activities towards bacteria and fungi. 1 is the first bioactive metabolite from cultures of a species belonging to the family Thelephoraceae.
Piazzon, A; Vrhovsek, U; Masuero, D; Mattivi, F; Mandoj, F; Nardini, M
2012-12-19
The main metabolites of caffeic and ferulic acids (ferulic acid-4'-O-sulfate, caffeic acid-4'-O-sulfate, and caffeic acid-3'-O-sulfate), the most representative phenolic acids in fruits and vegetables, and the acyl glucuronide of ferulic acid were synthesized, purified, and tested for their antioxidant activity in comparison with those of their parent compounds and other related phenolics. Both the ferric reducing antioxidant power (FRAP) assay and the 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) radical scavenging method were used. Ferulic acid-4'-O-sulfate and ferulic acid-4'-O-glucuronide exhibited very low antioxidant activity, while the monosulfate derivatives of caffeic acid were 4-fold less efficient as the antioxidant than caffeic acid. The acyl glucuronide of ferulic acid showed strong antioxidant action. The antioxidant activity of caffeic acid-3'-O-glucuronide and caffeic acid-4'-O-glucuronide was also studied. Our results demonstrate that some of the products of phenolic acid metabolism still retain strong antioxidant properties. Moreover, we first demonstrate the ex vivo synthesis of the acyl glucuronide of ferulic acid by mouse liver microsomes, in addition to the phenyl glucuronide.
Ross, T S; Gilliland, D G
1999-08-06
We have previously reported that the Huntingtin interacting protein 1 (HIP1) gene is fused to the platelet-derived growth factor beta receptor (PDGFbetaR) gene in a patient with chronic myelomonocytic leukemia. We now show that HIP1/PDGFbetaR oligomerizes, is constitutively tyrosine-phosphorylated, and transforms the murine hematopoietic cell line, Ba/F3, to interleukin-3-independent growth. A kinase-inactive mutant is neither tyrosine-phosphorylated nor able to transform Ba/F3 cells. Oligomerization and kinase activation required the 55-amino acid carboxyl-terminal TALIN homology region but not the leucine zipper domain. Tyrosine phosphorylation of a 130-kDa protein and STAT5 correlates with transformation in cells expressing HIP1/PDGFbetaR and related mutants. A deletion mutant fusion protein that contains only the TALIN homology region of HIP1 fused to PDGFbetaR is incapable of transforming Ba/F3 cells and does not tyrosine-phosphorylate p130 or STAT5, although it is itself constitutively tyrosine-phosphorylated. We have also analyzed cells expressing Tyr --> Phe mutants of HIP1/PDGFbetaR in the known PDGFbetaR SH2 docking sites and report that none of these sites are necessary for STAT5 activation, p130 phosphorylation, or Ba/F3 transformation. The correlation of factor-independent growth of hematopoietic cells with p130 and STAT5 phosphorylation/activation in both the HIP1/PDGFbetaR Tyr --> Phe and deletion mutational variants suggests that both STAT5 and p130 are important for transformation mediated by HIP1/PDGFbetaR.
Arachidonic-acid-derived eicosanoids: roles in biology and immunopathology.
Harizi, Hedi; Corcuff, Jean-Benoît; Gualde, Norbert
2008-10-01
Arachidonic acid (AA)-derived eicosanoids belong to a complex family of lipid mediators that regulate a wide variety of physiological responses and pathological processes. They are produced by various cell types through distinct enzymatic pathways and act on target cells via specific G-protein-coupled receptors. Although originally recognized for their capacity to elicit biological responses such as vascular homeostasis, protection of the gastric mucosa and platelet aggregation, eicosanoids are now understood to regulate immunopathological processes ranging from inflammatory responses to chronic tissue remodelling, cancer, asthma, rheumatoid arthritis and autoimmune disorders. Here, we review the major properties of eicosanoids and their expanding roles in biology and medicine.
Hop bitter acids exhibit anti-fibrogenic effects on hepatic stellate cells in vitro.
Saugspier, Michael; Dorn, Christoph; Thasler, Wolfgang E; Gehrig, Manfred; Heilmann, Jörg; Hellerbrand, Claus
2012-04-01
Female inflorescences of the hop plant Humulus lupulus L. contain a variety of secondary metabolites with bitter acids (BA) as quantitatively dominating secondary metabolites. The use of hops in beer brewing has a long history due to the antibacterial effects of the BA and their typical bitter taste. Furthermore, hop cones are used in traditional medicine and for pharmaceutical purposes. Recent studies indicate that BA may affect activity of the transcription factor NFκB. NFκB plays a key role in the activation process of hepatic stellate cells (HSC), which is the key event of hepatic fibrosis. The aim of this study was to investigate the effect of BA on HSC (activation) and their potential to inhibit molecular processes involved in the pathogenesis of hepatic fibrosis. HSC were isolated from murine and human liver tissue and incubated with a characterized fraction of bitter acids purified from a CO(2) hop extract. At a concentration of 25μg/ml BA started to induce LDH leakage. Already at lower concentrations BA lead to a dose dependent inhibition of HSC proliferation and inhibited IκB-α-phosphorylation, nuclear p65 translocation and binding activity in a dose dependent way (up to 10μg/ml). Accordingly, the same BA-doses inhibited the expression of pro-inflammatory and NFκB regulated genes as MCP-1 and RANTES, but did not affect expression of genes not related to NFκB signaling. In addition to the effect on activated HSC, BA inhibited the in vitro activation process of freshly isolated HSC as evidenced by delayed expression of collagen I and α-SMA mRNA and protein. Together, these findings indicate that BA inhibit NFκB activation, and herewith the activation and development of profibrogenic phenotype of HSC. Thus, bitter acids appear as potential functional nutrients for the prevention or treatment hepatic fibrosis in chronic liver disease. Copyright © 2011 Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Lin, Weizhen; Navaratnam, Suppiah; Yao, Side; Lin, Nianyun
1998-10-01
Spectral and redox properties of the phenoxyl radicals from hydroxycinnamic acid derivatives and one selected component of phenylpropanoid glycosides, verbascoside, were studied using pulse radiolysis techniques. On the basis of the pH dependence of phenoxyl radical absorptions, the p Ka values for deprotonation of sinapic acid radical and ferulic acid radical are 4.9 and 5.2. The rate constants of one electron oxidation of those antioxidants by azide radical and bromide radical ion were determined at pH 7. The redox potentials of those antioxidants were determined as 0.59-0.71 V vs NHE at pH 7 with reference standard 4-methoxyphenol and resorcinol.
NASA Astrophysics Data System (ADS)
Ružić, Igor; Marović, Ivan; Benac, Čedomir; Ilić, Suzana
2014-12-01
The aim of this study was to examine the capability of structure-from-motion photogrammetry in defining the geometry of cliffs and undercuts in rocks of complex geomorphology. A case site was chosen along pocket beaches near the village of Stara Ba\\vska on the Adriatic Sea island of Krk, Gulf of Kvarner, Croatia, where cliff erosion of 5 m in breccias was identified by comparison of aerial photographs from 1960 and 2004. The 3D point cloud was derived from approx. 800 photos taken on 9 January 2014 by a single camera from various elevations and angles, and processed using the online software ReCap (Autodesk). Data acquisition was found to be quick and the method easy to implement. The difference between the georeferenced 3D cloud points and an RTK-GPS survey was 7 cm, i.e. within the limits of RTK-GPS precision. Quantifying the spatial variation in undercut geometries revealed that the deepest and largest (17 m3) undercut was in the south-eastern sector of the beach. Reconstructing the detailed geomorphology of this 3.8-m-deep undercut convincingly demonstrates the high efficiency of the method. Such assessments of spatiotemporal changes in undercut and overhang volumes can prove useful for evaluations of cliff erosion risk. Coupled with the low cost and relatively simple application, this is evidently an attractive technique for meaningful geotechnical and coastal engineering monitoring in the future on the island of Krk and, for that matter, also on other Adriatic islands and in similar settings worldwide.
Commensal Gut-Derived Anaerobes as Novel Therapy for Inflammatory Autoimmune Diseases
2012-05-01
Luckey D, Marietta EV, Miller ME, Murray JA, White BA and Taneja V. 2012. HLA-DR polymorphism, gut microbiome and sex may predict susceptibility or...Gomez A, Yoeman C, Luckey D, Marietta EV, Miller ME, Murray JA, White BA and Taneja V. 2012. HLA-DR polymorphism, gut microbiome and sex may... Gut -Derived Anaerobes as Novel Therapy for Inflammatory Autoimmune Diseases Veena Taneja Mayo Clinic Rochester, MN 55905
Tang, Khanh G; Kent, Greggory T; Erden, Ihsan; Wu, Weiming
2017-10-04
cis -β-Bromostyrene derivatives were synthesized stereospecifically from cinnamic acids through β-lactone intermediates. The synthetic sequence did not require the purification of the β-lactone intermediates although they were found to be stable and readily purified in most cases.
Bhalla, Vandana; Gupta, Ankush; Kumar, Manoj
2012-06-15
Novel pentacenequinone derivative 3 has been synthesized using the Suzuki-Miyaura coupling protocol which forms fluorescent nanoaggregates in aqueous media due to its aggregation-induced emission enhancement attributes and selectively senses picric acid with a detection limit of 500 ppb.
Comparison of inhibition effects of some benzoic acid derivatives on sheep heart carbonic anhydrase
NASA Astrophysics Data System (ADS)
Kiliç, Deryanur; Yildiz, Melike; Şentürk, Murat; Erdoǧan, Orhan; Küfrevioǧlu, Ömer Irfan
2016-04-01
Carbonic anhydrase (CA) is a family of metalloenzymes that requires Zn as a cofactor and catalyze the quick conversion of CO2 to HCO3- and H+. Inhibitors of the carbonic anhydrases (CAs) have medical usage of significant diseases such as glaucoma, epilepsy, gastroduodenal ulcers, acid-base disequilibria and neurological disorders. In the present study, inhibition of CA with some benzoic derivatives (1-6) were investigated. Sheep heart CA (shCA) enzyme was isolated by means of designed affinity chromatography gel (cellulose-benzyl-sulfanylamide) 42.45-fold in a yield of 44 % with 564.65 EU/mg. Purified shCA enzyme was used in vitro studies. In the studies, IC50 values were calculated for 3-aminobenzoic acid (1), 4-aminobenzoic acid (2), 2-hydroxybenzoic acid (3), 2-benzoylbenzoic acid (4), 2,3-dimethoxybenzoic acid (5), and 3,4,5-trimethoxybenzoic acid (6), showing the inhibition effects on the purified enzyme. Such molecules can be used as pioneer for discovery of novel effective CA inhibitors for medicinal chemistry applications.
Curiel, Jose Antonio; Betancor, Lorena; de las Rivas, Blanca; Muñoz, Rosario; Guisan, Jose M; Fernández-Lorente, Gloria
2010-05-26
A recombinant tannase from Lactobacillus plantarum , overexpressed in Escherichia coli , was purified in a single step by metal chelate affinity chromatography on poorly activated nickel supports. It was possible to obtain 0.9 g of a pure enzyme by using only 20 mL of chromatographic support. The pure enzyme was immobilized and stabilized by multipoint covalent immobilization on highly activated glyoxyl agarose. Derivatives obtained by multipoint and multisubunit immobilization were 500- and 1000-fold more stable than both the soluble enzyme and the one-point-immobilized enzyme in experiments of thermal and cosolvent inactivation, respectively. In addition, up to 70 mg of pure enzyme was immobilized on 1 g of wet support. The hydrolysis of tannic acid was optimized by using the new immobilized tannase derivative. The optimal reaction conditions were 30% diglyme at pH 5.0 and 4 degrees C. Under these conditions, it was possible to obtain 47.5 mM gallic acid from 5 mM tannic acid as substrate. The product was pure as proved by HPLC. On the other hand, the immobilized biocatalyst preserved >95% of its initial activity after 1 month of incubation under the optimal reaction conditions.
NASA Astrophysics Data System (ADS)
Momeni, Shima; Nematollahi, Davood
2017-02-01
Electrochemical behavior of acid orange 7 has been exhaustively studied in aqueous solutions with different pH values, using cyclic voltammetry and constant current coulometry. This study has provided new insights into the mechanistic details, pH dependence and intermediate structure of both electrochemical oxidation and reduction of acid orange 7. Surprisingly, the results indicate that a same redox couple (1-iminonaphthalen-2(1H)-one/1-aminonaphthalen-2-ol) is formed from both oxidation and reduction of acid orange 7. Also, an additional purpose of this work is electrochemical synthesis of three new derivatives of 1-amino-4-(phenylsulfonyl)naphthalen-2-ol (3a-3c) under constant current electrolysis via electrochemical oxidation (and reduction) of acid orange 7 in the presence of arylsulfinic acids as nucleophiles. The results indicate that the electrogenerated 1-iminonaphthalen-2(1 H)-one participates in Michael addition reaction with arylsulfinic acids to form the 1-amino-3-(phenylsulfonyl)naphthalen-2-ol derivatives. The synthesis was carried out in an undivided cell equipped with carbon rods as an anode and cathode.
Zhang, Ting-Jian; Li, Song-Ye; Yuan, Wei-Yan; Zhang, Yi; Meng, Fan-Hao
2018-04-01
A series of N-(9,10-anthraquinone-2-carbonyl)amino acid derivatives (1a-j) was designed and synthesized as novel xanthine oxidase inhibitors. Among them, the L/D-phenylalanine derivatives (1d and 1i) and the L/D-tryptophan derivatives (1e and 1j) were effective with micromolar level potency. In particular, the L-phenylalanine derivative 1d (IC 50 = 3.0 μm) and the D-phenylalanine derivative 1i (IC 50 = 2.9 μm) presented the highest potency and were both more potent than the positive control allopurinol (IC 50 = 8.1 μm). Preliminary SAR analysis pointed that an aromatic amino acid fragment, for example, phenylalanine or tryptophan, was essential for the inhibition; the D-amino acid derivative presented equal or greater potency compared to its L-enantiomer; and the 9,10-anthraquinone moiety was welcome for the inhibition. Molecular simulations provided rational binding models for compounds 1d and 1i in the xanthine oxidase active pocket. As a result, compounds 1d and 1i could be promising lead compounds for further investigation. © 2017 John Wiley & Sons A/S.
Orjala, J; Erdelmeier, C A; Wright, A D; Rali, T; Sticher, O
1993-12-01
Five new prenylated benzoic acid derivatives, methyl 3-(3,7-dimethyl-2,6-octadienyl)-4-methoxybenzoate (1), 1-(1-methylethyl)-4-methyl-3-cyclohexenyl 3,5-bis(3-methyl-2-butenyl)-4-hydroxybenzoate (2), 1-(1-methylethyl)-4-methyl-3-cyclohexenyl 3,5-bis(3-methyl-2-butenyl)-4-methoxybenzoate (3), methyl 3,5-bis(3-methyl-2-butenyl)-4-methoxybenzoate (4), and 4-hydroxy-3-(3-methyl-2-butenyl)-5-(3-methyl-2-butenyl)-benzoic acid (5) were isolated from the dried leaves of Piper aduncum L. (Piperaceae). Together with the new metabolites, four known prenylated benzoic acid derivatives, 3,5-bis(3-methyl-2-butenyl)-4-methoxybenzoic acid (6), 4-hydroxy-3,5-bis(3-methyl-2-butenyl)-benzoic acid (nervogenic acid, 7), methyl 4-hydroxy-3,5-bis(3-methyl-2-butenyl)-benzoate (8), and methyl 4-hydroxy-3-(3-methyl-2-butenyl)-benzoate (9) as well as, dillapiol (10), myristicin, and the three sesquiterpenes humulene, caryophyllene epoxide, and humulene epoxide were isolated. Compounds 7, 8, and 9 are reported as natural products for the first time. The structures of the isolates were elucidated by spectroscopic methods, mainly 1D-and 2D-NMR spectroscopy. Isolates 4-7, 9, and 10 were molluscicidal while 2, 5-7, and 9 displayed significant antibacterial activities.
Giuffrida, A; Contino, A; Maccarrone, G; Messina, M; Cucinotta, V
2009-04-24
The enantioseparation of the enantiomeric pairs of 10 Dns derivatives of alpha-amino acids was successfully carried out by using for the first time the 3-amino derivative of the gamma-cyclodextrin. The effects of pH and selector concentration on the migration times and the resolutions of analytes were studied in detail. 3-Deoxy-3-amino-2(S),3(R)-gamma-cyclodextrin (GCD3AM) shows very good chiral recognition ability even at very low concentrations at all the three investigated values of pH, as shown by the very large values of selectivity and resolution towards several pairs of amino acids. The role played by the cavity, the substitution site and the protonation equilibria on the observed properties of chiral selectivity, on varying the specific amino acid involved, is discussed.
meso-Dihydroguaiaretic acid derivatives with antibacterial and antimycobacterial activity.
Reyes-Melo, Karen; García, Abraham; Romo-Mancillas, Antonio; Garza-González, Elvira; Rivas-Galindo, Verónica M; Miranda, Luis D; Vargas-Villarreal, Javier; Favela-Hernández, Juan Manuel J; Camacho-Corona, María Del Rayo
2017-10-15
Thirty-three meso-dihydroguaiaretic acid (meso-DGA) derivatives bearing esters, ethers, and amino-ethers were synthesized. All derivatives were tested against twelve drug-resistant clinical isolates of Gram-positive and Gram-negative bacteria, including sensitive (H37Rv) and multidrug-resistant Mycobacterium tuberculosis strains. Among the tested compounds, four esters (7, 11, 13, and 17), one ether (23), and three amino-ethers (30, 31, and 33) exhibited moderate activity against methicillin-resistant Staphylococcus aureus, whereas 30 and 31 showed better results than levofloxacin against vancomycin-resistant Enterococcus faecium. Additionally, nineteen meso-DGA derivatives displayed moderate to potent activity against M. tuberculosis H37Rv with minimum inhibitory concentration (MIC) values ranging from 3.125 to 50µg/mL. Seven meso-DGA derivatives bearing amino-ethers (26-31 and 33) exhibited the lowest MICs against M. tuberculosis H37Rv and G122 strains, with 31 being as potent as ethambutol (MICs of 3.125 and 6.25µg/mL). The presence of positively charged group precursors possessing steric and hydrophobic features (e.g. N-ethylpiperidine moieties in meso-31) resulted essential to significantly increase the antimycobacterial properties of parent meso-DGA as supported by the R-group pharmacophoric and field-based QSAR analyses. To investigate the safety profile of the antimycobacterial compounds, cytotoxicity on Vero cells was determined. The amino-ether 31 exhibited a selectivity index value of 23, which indicate it was more toxic to M. tuberculosis than to mammalian cells. Therefore, 31 can be considered as a promising antitubercular agent for further studies. Copyright © 2017 Elsevier Ltd. All rights reserved.
Docking analysis of gallic acid derivatives as HIV-1 protease inhibitors.
Singh, Anjali; Pal, Tapan Kumar
2015-01-01
HIV-1 Protease (HIV-1 PR) enzymes are essential for accurate assembly and maturation of infectious HIV retroviruses. The significant role of HIV-1 protease in viral replication has made it a potential drug target. In the recent past, phytochemical Gallic Acid (GA) derivatives have been screened for protease inhibitor activity. The present work aims to design and evaluate potential GA-based HIV-1 PR phytoinhibitors by docking approach. The ligands were prepared by ChemDraw and docking was performed in HEX software. In this present study, one of the GA analogues (GA4) emerged as a potent drug candidate for HIV-1 PR inhibition, and docking results showed it to be comparable with anti-HIV drugs, darunavir and amprenavir. The GA4 derivative provided a lead for designing more effective HIV-1 PR inhibitors.
Jang, Yu-Sin; Im, Jung Ae; Choi, So Young; Lee, Jung Im; Lee, Sang Yup
2014-05-01
A typical characteristic of the butyric acid-producing Clostridium is coproduction of both butyric and acetic acids. Increasing the butyric acid selectivity important for economical butyric acid production has been rather difficult in clostridia due to their complex metabolic pathways. In this work, Clostridium acetobutylicum was metabolically engineered for highly selective butyric acid production. For this purpose, the second butyrate kinase of C. acetobutylicum encoded by the bukII gene instead of butyrate kinase I encoded by the buk gene was employed. Furthermore, metabolic pathways were engineered to further enhance the NADH-driving force. Batch fermentation of the metabolically engineered C. acetobutylicum strain HCBEKW (pta(-), buk(-), ctfB(-) and adhE1(-)) at pH 6.0 resulted in the production of 32.5g/L of butyric acid with a butyric-to-acetic acid ratio (BA/AA ratio) of 31.3g/g from 83.3g/L of glucose. By further knocking out the hydA gene (encoding hydrogenase) in the HCBEKW strain, the butyric acid titer was not further improved in batch fermentation. However, the BA/AA ratio (28.5g/g) obtained with the HYCBEKW strain (pta(-), buk(-), ctfB(-), adhE1(-) and hydA(-)) was 1.6 times higher than that (18.2g/g) obtained with the HCBEKW strain at pH 5.0, while no improvement was observed at pH 6.0. These results suggested that the buk gene knockout was essential to get a high butyric acid selectivity to acetic acid in C. acetobutylicum. Copyright © 2014 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
He, Hua; Stoyko, Stanislav; Bobev, Svilen, E-mail: bobev@udel.edu
Crystals of three new ternary pnictides—Ba{sub 7}Al{sub 4}Sb{sub 9}, Ba{sub 7}Ga{sub 4}P{sub 9}, and Ba{sub 7}Ga{sub 4}As{sub 9} have been prepared by reactions of the respective elements in molten Al or Pb fluxes. Single-crystal X-ray diffraction studies reveal that the three phases are isotypic, crystallizing in the orthorhombic Ba{sub 7}Ga{sub 4}Sb{sub 9}-type structure (space group Pmmn, Pearson symbol oP40, Z=2), for which only the prototype is known. The structure is based on TrPn{sub 4} tetrahedra (Tr=Al, Ga; Pn=P, As, Sb), connected in an intricate scheme into 1D-ribbons. Long interchain Pn–Pn bonds (d{sub P–P}>3.0 Å; d{sub As–As}>3.1 Å; d{sub Sb–Sb}>3.3 Å)more » account for the realization of 2D-layers, separated by Ba{sup 2+} cations. Applying the classic valance rules to rationalize the bonding apparently fails, and Ba{sub 7}Ga{sub 4}Sb{sub 9} has long been known as a metallic Zintl phase. Earlier theoretical calculations, both empirical and ab-initio, suggest that the possible metallic properties originate from filled anti-bonding Pn–Pn states, and the special roles of the “cations” in this crystal structure. To experimentally probe this hypothesis, we sought to synthesize the ordered quaternary phases Ba{sub 6}CaTr{sub 4}Sb{sub 9} (Tr=Al, Ga). Single-crystal X-ray diffraction work confirms Ba{sub 6.145(3)}Ca{sub 0.855}Al{sub 4}Sb{sub 9} and Ba{sub 6.235(3)}Ca{sub 0.765}Ga{sub 4}Sb{sub 9}, with Ca atoms preferably substituting Ba on one of the three available sites. The nuances of the five crystal structures are discussed, and the chemical bonding in Ba{sub 7}Ga{sub 4}As{sub 9} is interrogated by tight-binding linear muffin-tin orbital calculations. - Graphical abstract: The new Zintl phases—Ba{sub 7}Al{sub 4}Sb{sub 9}, Ba{sub 7}Ga{sub 4}P{sub 9}, and Ba{sub 7}Ga{sub 4}As{sub 9}, and their quaternary variants Ba{sub 6}CaTr{sub 4}Sb{sub 9} (Tr=Al, Ga)—crystallize in the Ba{sub 7}Ga{sub 4}Sb{sub 9} structure type. The structures
Barriet, David; Yam, Chi Ming; Shmakova, Olga E; Jamison, Andrew C; Lee, T Randall
2007-08-14
We report the formation and characterization of self-assembled monolayers (SAMs) derived from the adsorption of 4-mercaptophenylboronic acid (MPBA) on gold. For comparison, SAMs derived from the adsorption of thiophenol (TP), 4-mercaptophenol (MP), and 4-mercaptobenzoic acid (MBA) were also examined. The structure and properties of the SAMs were evaluated by ellipsometry, contact-angle goniometry, polarization-modulation infrared reflection-absorption spectroscopy (PM-IRRAS), and X-ray photoelectron spectroscopy (XPS). Specifically, ellipsometry was used to assess the formation of monolayer films, and contact angle measurements were used to determine the surface hydrophilicity and homogeneity. Separately, PM-IRRAS was used to evaluate the molecular composition and orientation as well as the intermolecular hydrogen bonding within the SAMs. Finally, XPS was used to evaluate the film composition and surface coverage (i.e., packing density), which was observed to increase in the following order: TP < MP < MPBA < MBA. A rationalization for the observed packing differences is presented. The XPS data indicate further that ultrahigh vacuum conditions induce the partial dehydration of MPBA SAMs with the concomitant formation of surface boronic anhydride species. Overall, the analytical data collectively show that the MPBA moieties in the SAMs exist in the acid form rather than the anhydride form under ambient laboratory conditions. Furthermore, stability studies find that MPBA SAMs are surprisingly labile in basic solution, where the terminal B-C bonds are cleaved by the attack of hydroxide ion and strongly basic amine nucleophiles. The unanticipated lability observed here should be considered by those wishing to use MPBA moieties in carbohydrate-sensing applications.
The role of bile acids in metabolic regulation.
Vítek, Libor; Haluzík, Martin
2016-03-01
Bile acids (BA), long believed to only have lipid-digestive functions, have emerged as novel metabolic modulators. They have important endocrine effects through multiple cytoplasmic as well as nuclear receptors in various organs and tissues. BA affect multiple functions to control energy homeostasis, as well as glucose and lipid metabolism, predominantly by activating the nuclear farnesoid X receptor and the cytoplasmic G protein-coupled BA receptor TGR5 in a variety of tissues. However, BA also are aimed at many other cellular targets in a wide array of organs and cell compartments. Their role in the pathogenesis of diabetes, obesity and other 'diseases of civilization' becomes even more clear. They also interact with the gut microbiome, with important clinical implications, further extending the complexity of their biological functions. Therefore, it is not surprising that BA metabolism is substantially modulated by bariatric surgery, a phenomenon contributing favorably to the therapeutic effects of these surgical procedures. Based on these data, several therapeutic approaches to ameliorate obesity and diabetes have been proposed to affect the cellular targets of BA. © 2016 Society for Endocrinology.
Wang, Xue; Wang, Fangyu; Zhang, Yidan; Xiong, Hui; Zhang, Yanjun; Zhuang, Pengwei; Zhang, Youcai
2018-05-01
Impaired regulation of bile acid (BA) homeostasis has been suggested to be associated with adverse metabolic consequences. However, whether BA homeostasis is altered in diabetes-induced cognitive dysfunction (DCD) remains unknown. In the present study, mice were divided into four groups, namely normal control (NC) group, high-fat diet (HFD) group, diabetes without cognitive dysfunction (unDCD) group, and DCD group. Compared to HFD mice, the concentration of total BAs in liver was higher in unDCD and DCD mice, due to increased intestinal BA absorption. DCD mice tended to have higher BA concentrations in both liver and ileum than unDCD mice. Consequently, DCD mice had increased basolateral BA efflux (Ostα, Ostβ, and Mrp4) and decreased BA synthesis (Cyp7a1, Cyp8b1, and Cyp7b1) in the liver as well as activated Fxr-Fgf15 signaling in the ileum. DCD mice also had increased BA hydroxylation (Cyp3a11) and BA sulfation (Sult2a1) in the liver compared to HFD mice. Furthermore, the bacterial community composition was altered in the cecum of DCD mice, characterized with a marked increase in Defferribacteres and Candidatus Saccharibacteria. In summary, the present study provides the first comprehensive analysis of BA homeostasis in DCD mice, and revealed a potential role of BAs in DCD development. Copyright © 2018 Elsevier B.V. All rights reserved.
Lee, Jong-Min; Upare, Pravin P; Chang, Jong-San; Hwang, Young Kyu; Lee, Jeong Ho; Hwang, Dong Won; Hong, Do-Young; Lee, Seung Hwan; Jeong, Myung-Geun; Kim, Young Dok; Kwon, Young-Uk
2014-11-01
Catalytic hydrogenation of organic carboxylic acids and their esters, for example, cellulosic ethanol from fermentation of acetic acid and hydrogenation of ethyl acetate is a promising possibility for future biorefinery concepts. A hybrid conversion process based on selective hydrogenation of butyric acid combined with fermentation of glucose has been developed for producing biobutanol. ZnO-supported Ru-Sn bimetallic catalysts exhibits unprecedentedly superior performance in the vapor-phase hydrogenation of biomass-derived butyric acid to n-butanol (>98% yield) for 3500 h without deactivation. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
NASA Astrophysics Data System (ADS)
Rontani, Jean-François; Aubert, Claude; Belt, Simon T.
2015-09-01
EI mass fragmentation pathways of TMS derivatives οf 7α/β-hydroxy-dehydroabietic acids resulting from NaBH4-reduction of oxidation products of dehydroabietic acid (a component of conifers) were investigated and deduced by a combination of (1) low energy CID-GC-MS/MS, (2) deuterium labeling, (3) different derivatization methods, and (4) GC-QTOF accurate mass measurements. Having identified the main fragmentation pathways, the TMS-derivatized 7α/β-hydroxy-dehydroabietic acids could be quantified in multiple reaction monitoring (MRM) mode in sea ice and sediment samples collected from the Arctic. These newly characterized transformation products of dehydroabietic acid constitute potential tracers of biotic and abiotic degradation of terrestrial higher plants in the environment.
Lee, Ha Young; Jee, Hye Won; Seo, Sung Mi; Kwak, Byung Kook; Khang, Gilson; Cho, Sun Hang
2006-01-01
Biocompatible polysuccinimide (PSI) derivatives conjugated with diethylenetriaminepentaacetic acid gadolinium (DTPA-Gd) were prepared as magnetic resonance imaging (MRI) contrast agents. In this study, we synthesized PSI derivatives incorporating methoxy-poly(ethylene glycol) (mPEG) as hydrophilic ligand, hexadecylamine as hydrophobic ligand, and DTPA-Gd as contrast agent. PSI was synthesized by the polycondensation polymerization of aspartic acid. All the synthesized materials were characterized by proton nuclear magnetic resonance (1H NMR). Critical micellization concentrations were determined using fluorescent probes (pyrene). Micelle size and shape were measured by electro-photometer light scattering (ELS) and atomic force microscopy (AFM). The formed micelle size ranged from 100 to 300 nm. The T1-weighted MR images of the phantom prepared with PSI-mPEG-C16-(DTPA-Gd) were obtained in a 3.0 T clinical MR imager, and the conjugates showed a great potential as MRI contrast agents.
Electronic structure of BaO/W cathode surfaces
NASA Technical Reports Server (NTRS)
Muller, Wolfgang
1989-01-01
The local electronic structure of the emissive layer of barium dispenser thermionic cathodes is investigated theoretically using the relativistic scattered-wave approach. The interaction of Ba and O with W, Os, and W-Os alloy surfaces is studied with atomic clusters modeling different absorption environments representative of B- and M-type cathodes. Ba is found to be strongly oxidized, while O and the metal substrate are in a reduced chemical state. The presence of O enhances the surface dipole and Ba binding energy relative to Ba on W. Model results for W-Os alloy substrates show only relatively small changes in Ba and O for identical geometries, but very large charge redistributions inside the substrate, which are attributed to the electronegativity difference between Os and W. If Os is present in the surface layer, the charge transfer from Ba to the substrate and the Ba binding energy increase relative to W. Explanations are offered for the improved electron emission from alloy surfaces and the different emission enhancement for different alloy substrates.
Boric acid reduces axonal and myelin damage in experimental sciatic nerve injury
Kızılay, Zahir; Erken, Haydar Ali; Çetin, Nesibe Kahraman; Aktaş, Serdar; Abas, Burçin İrem; Yılmaz, Ali
2016-01-01
The aim of this study was to investigate the effects of boric acid in experimental acute sciatic nerve injury. Twenty-eight adult male rats were randomly divided into four equal groups (n = 7): control (C), boric acid (BA), sciatic nerve injury (I), and sciatic nerve injury + boric acid treatment (BAI). Sciatic nerve injury was generated using a Yasargil aneurysm clip in the groups I and BAI. Boric acid was given four times at 100 mg/kg to rats in the groups BA and BAI after injury (by gavage at 0, 24, 48 and 72 hours) but no injury was made in the group BA. In vivo electrophysiological tests were performed at the end of the day 4 and sciatic nerve tissue samples were taken for histopathological examination. The amplitude of compound action potential, the nerve conduction velocity and the number of axons were significantly lower and the myelin structure was found to be broken in group I compared with those in groups C and BA. However, the amplitude of the compound action potential, the nerve conduction velocity and the number of axons were significantly greater in group BAI than in group I. Moreover, myelin injury was significantly milder and the intensity of nuclear factor kappa B immunostaining was significantly weaker in group BAI than in group I. The results of this study show that administration of boric acid at 100 mg/kg after sciatic nerve injury in rats markedly reduces myelin and axonal injury and improves the electrophysiological function of injured sciatic nerve possibly through alleviating oxidative stress reactions. PMID:27904499
Boric acid reduces axonal and myelin damage in experimental sciatic nerve injury.
Kızılay, Zahir; Erken, Haydar Ali; Çetin, Nesibe Kahraman; Aktaş, Serdar; Abas, Burçin İrem; Yılmaz, Ali
2016-10-01
The aim of this study was to investigate the effects of boric acid in experimental acute sciatic nerve injury. Twenty-eight adult male rats were randomly divided into four equal groups ( n = 7): control (C), boric acid (BA), sciatic nerve injury (I), and sciatic nerve injury + boric acid treatment (BAI). Sciatic nerve injury was generated using a Yasargil aneurysm clip in the groups I and BAI. Boric acid was given four times at 100 mg/kg to rats in the groups BA and BAI after injury (by gavage at 0, 24, 48 and 72 hours) but no injury was made in the group BA. In vivo electrophysiological tests were performed at the end of the day 4 and sciatic nerve tissue samples were taken for histopathological examination. The amplitude of compound action potential, the nerve conduction velocity and the number of axons were significantly lower and the myelin structure was found to be broken in group I compared with those in groups C and BA. However, the amplitude of the compound action potential, the nerve conduction velocity and the number of axons were significantly greater in group BAI than in group I. Moreover, myelin injury was significantly milder and the intensity of nuclear factor kappa B immunostaining was significantly weaker in group BAI than in group I. The results of this study show that administration of boric acid at 100 mg/kg after sciatic nerve injury in rats markedly reduces myelin and axonal injury and improves the electrophysiological function of injured sciatic nerve possibly through alleviating oxidative stress reactions.
Kawasoko, Cristiane Y; Foletto, Patricia; Rodrigues, Oscar E D; Dornelles, Luciano; Schwab, Ricardo S; Braga, Antonio L
2013-08-21
The synthesis of new chiral seleno-, telluro-, and thio-N-Boc-γ-amino acids is described herein. These new compounds were prepared through a simple and short synthetic route, from the inexpensive and commercially-available amino acid L-glutamic acid. The products, with a highly modular character, were obtained in good to excellent yields, via hydrolysis of chalcogen pyroglutamic derivatives with overall retention of the L-glutamic acid stereochemistry. Also, an L-diselenide-N-Boc-γ-amino acid was prepared in good yield. This new synthetic route represents an efficient method for preparing new L-chalcogen- and L-diselenide-γ-amino acids with biological potential.
Amano, Ryota; Yamashita, Atsuya; Kasai, Hirotake; Hori, Tomoka; Miyasato, Sayoko; Saito, Setsu; Yokoe, Hiromasa; Takahashi, Kazunori; Tanaka, Tomohisa; Otoguro, Teruhime; Maekawa, Shinya; Enomoto, Nobuyuki; Tsubuki, Masayoshi; Moriishi, Kohji
2017-09-01
Several cinnamic acid derivatives have been reported to exhibit antiviral activity. In this study, we prepared 17 synthetic cinnamic acid derivatives and screened them to identify an effective antiviral compound against hepatitis C virus (HCV). Compound 6, one of two hit compounds, suppressed the viral replications of genotypes 1b, 2a, 3a, and 4a with EC 50 values of 1.5-8.1 μM and SI values of 16.2-94.2. The effect of compound 6 on the phosphorylation of Tyr 705 in signal transducer and activator of transcription 3 (STAT3) was investigated because a cinnamic acid derivative AG490 was reported to suppress HCV replication and the activity of Janus kinase (JAK) 2. Compound 6 potently suppressed HCV replication, but it did not inhibit the JAK1/2-dependent phosphorylation of STAT3 Tyr 705 at the same concentration. Furthermore, a pan-JAK inhibitor tofacitinib potently impaired phosphorylation of STAT3 Tyr 705 , but it did not inhibit HCV replication in the replicon cells and HCV-infected cells at the same concentration, supporting the notion that the phosphorylated state of STAT3 Tyr 705 is not necessarily correlated with HCV replication. The production of reactive oxygen species (ROS) was induced by treatment with compound 6, whereas N-acetyl-cysteine restored HCV replication and impaired ROS production in the replicon cells treated with compound 6. These data suggest that compound 6 inhibits HCV replication via the induction of oxidative stress. Copyright © 2017 Elsevier B.V. All rights reserved.
Anantharaju, Preethi G.; Reddy, Deepa B.; Padukudru, Mahesh A.; Chitturi, CH. M. Kumari; Vimalambike, Manjunath G.
2017-01-01
Recent studies from our group and many others have shown the ability of histone deacetylase (HDAC) inhibitors for retarding the growth of carcinomas of cervix, colon and rectum in vitro. A search for naturally occurring HDAC inhibitors continues due to the adverse effects associated with known HDAC inhibitors like SAHA and TSA. Therefore in the current study, naturally occurring cinnamic acids derivatives were screened for HDAC inhibitory effect using in silico docking method which identified cinnamic acids as potential candidates. Cinnamic acids (CA) are naturally occurring phenolic compounds known to exhibit anticancer properties. However, it is not clearly known whether the anticancer properties of CA derivatives are due to the inhibition of oncogenic HDACs, if so how the efficacy varies among various CA derivatives. Hence, the HDAC inhibitory potential of CA derivatives containing increasing number of hydroxylic groups or methoxy moieties was determined using Discovery Studio software and the most potent CA derivatives tested ex vivo (biochemical assay) as well as in vitro (using cell based assay). Among CA derivatives tested, dihydroxy cinnamic acid (DHCA, commonly known as caffeic acid) exhibited better interactions with HDAC2 (compared to other isoforms) in silico and inhibited its activity ex vivo as well as in vitro. Targeted reduction of HDAC activity using DHCA induced death of cancer cells by (a) generating reactive oxygen species, (b) arresting cells in S and G2/M phases; and (c) induction of caspase-3 mediated apoptosis. In conclusion, we demonstrated that DHCA inhibited cancer cell growth by binding to HDAC followed by the induction of apoptosis. PMID:29190639
Anantharaju, Preethi G; Reddy, Deepa B; Padukudru, Mahesh A; Chitturi, Ch M Kumari; Vimalambike, Manjunath G; Madhunapantula, SubbaRao V
2017-01-01
Recent studies from our group and many others have shown the ability of histone deacetylase (HDAC) inhibitors for retarding the growth of carcinomas of cervix, colon and rectum in vitro. A search for naturally occurring HDAC inhibitors continues due to the adverse effects associated with known HDAC inhibitors like SAHA and TSA. Therefore in the current study, naturally occurring cinnamic acids derivatives were screened for HDAC inhibitory effect using in silico docking method which identified cinnamic acids as potential candidates. Cinnamic acids (CA) are naturally occurring phenolic compounds known to exhibit anticancer properties. However, it is not clearly known whether the anticancer properties of CA derivatives are due to the inhibition of oncogenic HDACs, if so how the efficacy varies among various CA derivatives. Hence, the HDAC inhibitory potential of CA derivatives containing increasing number of hydroxylic groups or methoxy moieties was determined using Discovery Studio software and the most potent CA derivatives tested ex vivo (biochemical assay) as well as in vitro (using cell based assay). Among CA derivatives tested, dihydroxy cinnamic acid (DHCA, commonly known as caffeic acid) exhibited better interactions with HDAC2 (compared to other isoforms) in silico and inhibited its activity ex vivo as well as in vitro. Targeted reduction of HDAC activity using DHCA induced death of cancer cells by (a) generating reactive oxygen species, (b) arresting cells in S and G2/M phases; and (c) induction of caspase-3 mediated apoptosis. In conclusion, we demonstrated that DHCA inhibited cancer cell growth by binding to HDAC followed by the induction of apoptosis.
Neves, Nathália de Andrade; Stringheta, Paulo César; Gómez-Alonso, Sergio; Hermosín-Gutiérrez, Isidro
2018-06-30
Extracts of jabuticaba peels show complex chromatographic profiles at 360 nm, with some peaks presenting UV-Vis spectra resembling those of flavonol glycosides and others resembling that of ellagic acid. The presence and tentative identification of these phenolic compounds were comprehensively studied in four species of Brazilian jabuticaba fruit - Plinia trunciflora, variety 'jabuticaba de cabinho'; P. caulifora, varieties 'jabuticaba paulista' and 'jabuticaba canaã-açu'; P. jaboticaba, variety 'jabuticaba sabará'; and P. phitrantha, variety 'jabuticaba branca-vinho' - using HPLC-DAD-ESI-MS n . Seventeen flavonols derived from quercetin and three from myricetin and eighteen derivatives of ellagic acid and eleven of methyl ellagic acid were detected. Most of them were newly described and mainly occurred in glycosylated and acylglycosylated forms. Some compounds were missing in one variety, such as the absence of methyl ellagic acid derivatives in 'jabuticaba branca-vinho', and others only appeared in one variety, thus suggesting potential capacity for varietal differentiation. Copyright © 2018 Elsevier Ltd. All rights reserved.
Hussein, O; Utton, C; Ojovan, M; Kinoshita, H
2013-10-15
The BaSO4 scales obtained from piping decontamination from oil and gas industries are most often classified as low level radioactive waste. These wastes could be immobilised by stable cement matrix to provide higher safety of handling, transportation, storage and disposal. However, the information available for the effects of the basic formulation such as waste loading on the fundamental properties is still limited. The present study investigated the effect of BaSO4 loading and water content on the properties of OPC-BaSO4 systems containing fine BaSO4 powder and coarse granules. The BaSO4 with different particle size had a marked effect on the compressive strength due to their different effects on hydration products formed. Introduction of fine BaSO4 powder resulted in an increased formation of CaCO3 in the system, which significantly contributed to the compressive strength of the products. Amount of water was important to control the CaCO3 formation, and water to cement ratio of 0.53 was found to be a good level to maintain a low porosity of the products both for fine BaSO4 powder and coarse BaSO4 granule. BaSO4 loading of up to 60 wt% has been achieved satisfying the minimum compressive strength of 5 MPa required for the radioactive wasteforms. Copyright © 2013 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Christensen, Justin; Hucul, David; Campbell, Wesley; Hudson, Eric
2017-04-01
133 Ba+ combines many of the advantages of commonly used trapped ion qubits. 133Ba+ has a nuclear spin 1/2, allowing for a robust hyperfine qubit with simple state preparation and readout. The existence of long-lived metastable D-states and a lack of low-lying F-states simplifies shelving, which will allow high fidelity state detection. The visible wavelength optical transitions enable the use of high-power lasers, low-loss fibers, high quantum efficiency detectors, and other optical technologies developed for visible wavelength light. Furthermore, background-free qubit readout, where the readout is insensitive to laser scatter, is possible in 133Ba+, and simplifies its use in small ion traps and the study of ions near surfaces. We report progress on realizing this qubit. We load barium ions into an ion trap using thermal ionization from a platinum ribbon. We experimentally demonstrate the isotopic purification of large numbers of barium ions using laser heating and cooling along with mass filtering to produce isotopically pure chains of any naturally-occurring barium isotope. This purification process has allowed us to laser cool rare, naturally-occurring barium isotopes 132Ba+and130Ba+, and we report the isotope shifts from 138Ba+ of the P1/2 to D3/2 transitions near 650 nm for the first time. In addition, we have developed an ion gun to produce high luminosity ion beams with adjustable mean kinetic energy by combining a surface ionization source and ion optics.
Lickteig, Andrew J.; Csanaky, Iván L.; Pratt-Hyatt, Matthew
2016-01-01
Activation of Constitutive Androstane Receptor (CAR) protects against bile acid (BA)-induced liver injury. This study was performed to determine the effect of CAR activation on bile flow, BA profile, as well as expression of BA synthesis and transport genes. Synthetic CAR ligand 1,4-bis-[2-(3,5-dichloropyridyloxy)]benzene (TCPOBOP) was administered to mice for 4 days. BAs were quantified by UPLC-MS/MS (ultraperformance liquid chromatography-tandem mass spectrometry). CAR activation decreases total BAs in livers of male (49%) and female mice (26%), largely attributable to decreases of the 12α-hydroxylated BA taurocholic acid (T-CA) (males (M) 65%, females (F) 45%). Bile flow in both sexes was increased by CAR activation, and the increases were BA-independent. CAR activation did not alter biliary excretion of total BAs, but overall BA composition changed. Excretion of muricholic (6-hydroxylated) BAs was increased in males (101%), and the 12α-OH proportion of biliary BAs was decreased in both males (37%) and females (28%). The decrease of T-CA in livers of males and females correlates with the decreased mRNA of the sterol 12α-hydroxylase Cyp8b1 in males (71%) and females (54%). As a response to restore BAs to physiologic concentrations in liver, mRNA of Cyp7a1 is upregulated following TCPOBOP (males 185%, females 132%). In ilea, mRNA of the negative feedback regulator Fgf15 was unaltered by CAR activation, indicating biliary BA excretion was sufficient to maintain concentrations of total BAs in the small intestine. In summary, the effects of CAR activation on BAs in male and female mice are quite similar, with a marked decrease in the major BA T-CA in the liver. PMID:26984780
Specification of hepatopancreas progenitors in zebrafish by hnf1ba and wnt2bb
Lancman, Joseph J.; Zvenigorodsky, Natasha; Gates, Keith P.; Zhang, Danhua; Solomon, Keely; Humphrey, Rohan K.; Kuo, Taiyi; Setiawan, Linda; Verkade, Heather; Chi, Young-In; Jhala, Ulupi S.; Wright, Christopher V. E.; Stainier, Didier Y. R.; Dong, P. Duc Si
2013-01-01
Although the liver and ventral pancreas are thought to arise from a common multipotent progenitor pool, it is unclear whether these progenitors of the hepatopancreas system are specified by a common genetic mechanism. Efforts to determine the role of Hnf1b and Wnt signaling in this crucial process have been confounded by a combination of factors, including a narrow time frame for hepatopancreas specification, functional redundancy among Wnt ligands, and pleiotropic defects caused by either severe loss of Wnt signaling or Hnf1b function. Using a novel hypomorphic hnf1ba zebrafish mutant that exhibits pancreas hypoplasia, as observed in HNF1B monogenic diabetes, we show that hnf1ba plays essential roles in regulating β-cell number and pancreas specification, distinct from its function in regulating pancreas size and liver specification, respectively. By combining Hnf1ba partial loss of function with conditional loss of Wnt signaling, we uncover a crucial developmental window when these pathways synergize to specify the entire ventrally derived hepatopancreas progenitor population. Furthermore, our in vivo genetic studies demonstrate that hnf1ba generates a permissive domain for Wnt signaling activity in the foregut endoderm. Collectively, our findings provide a new model for HNF1B function, yield insight into pancreas and β-cell development, and suggest a new mechanism for hepatopancreatic specification. PMID:23720049
Skała, Ewa; Kicel, Agnieszka; Olszewska, Monika A.; Kiss, Anna K.
2015-01-01
The aim of the study was to obtain transformed roots of Rhaponticum carthamoides and evaluate their phytochemical profile. Hairy roots were induced from leaf explants by the transformation of Agrobacterium rhizogenes strains A4 and ATCC 15834. The best response (43%) was achieved by infection with A4 strain. The effects of different liquid media (WPM, B5, SH) with full and half-strength concentrations of macro- and micronutrients on biomass accumulation of the best grown hairy root line (RC3) at two different lighting conditions (light or dark) were investigated. The highest biomass (93 g L−1 of the fresh weight after 35 days) was obtained in WPM medium under periodic light. UPLC-PDA-ESI-MS3 and HPLC-PDA analyses of 80% aqueous methanol extracts from the obtained hairy roots revealed the presence of eleven caffeoylquinic acids and their derivatives and five flavonoid glycosides. The production of caffeoylquinic acids and their derivatives was elevated in hairy roots grown in the light. Only light-grown hairy roots demonstrated the capability for the biosynthesis of such flavonoid glycosides as quercetagetin, quercetin, luteolin, and patuletin hexosides. Chlorogenic acid, 3,5-di-O-caffeoylquinic acid and a tentatively identified tricaffeoylquinic acid derivative were detected as the major compounds present in the transformed roots. PMID:25811023
Vibrational spectroscopic study of dehydroacetic acid and its cinnamoyl pyrone derivatives
NASA Astrophysics Data System (ADS)
Billes, Ferenc; Elečková, Lenka; Mikosch, Hans; Andruch, Vasil
2015-07-01
The infrared and Raman spectra of dehydroacetic acid and some of its derivatives were measured. The assignments of the vibrational bands were based on quantum chemical calculations and normal coordinate analysis. The optimized structures, atomic net charges and dipole moments of the investigated molecules were also results of our quantum chemical calculations. The analysis of the last properties made possible a deeper insight into the structure and substituent effect on the investigated molecules. One of them is presented in the graphical abstract.
Nishida, Haruyuki; Fujimori, Ikuo; Arikawa, Yasuyoshi; Hirase, Keizo; Ono, Koji; Nakai, Kazuo; Inatomi, Nobuhiro; Hori, Yasunobu; Matsukawa, Jun; Fujioka, Yasushi; Imanishi, Akio; Fukui, Hideo; Itoh, Fumio
2017-07-01
With the aim to discover a novel excellent potassium-competitive acid blocker (P-CAB) that could perfectly overcome the limitations of proton pump inhibitors (PPIs), we tested various approaches based on pyrrole derivative 1 as a lead compound. As part of a comprehensive approach to identify a new effective drug, we tried to optimize the duration of action of the pyrrole derivative. Among the compounds synthesized, fluoropyrrole derivative 20j, which has a 2-F-3-Py group at position 5, fluorine atom at position 4, and a 4-Me-2-Py sulfonyl group at the first position of the pyrrole ring, showed potent gastric acid-suppressive action and moderate duration of action in animal models. On the basis of structural properties including a slightly larger ClogP value (1.95), larger logD value (0.48) at pH 7.4, and fairly similar pKa value (8.73) compared to those of the previously optimized compound 2a, compound 20j was assumed to undergo rapid transfer to the stomach and have a moderate retention time there after single administration. Therefore, compound 20j was selected as a new promising P-CAB with moderately long duration of action. Copyright © 2017 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Gupta, Stuti; Khare, Naveen K.
2017-01-01
The thio-barbituric acid is convenient starting compound for the preparation of fused heterocycles and its 5-substituted derivatives which are pharmacologically one of the most important classes of compounds. The fused compounds of thio-barbituric acid, 4-(1R,2S,3S,4S)-1,2,3,4,5-tetrahydroxy pentyl-10-phenyl-1,3,6,8,9,10 hexahydro-2,7-dithiooxopyrido [2,3-d; 6,5'] dipyrimidine-4,5 diones (1), 4-(1S,2S,3S,4S)-1,2,3,4,5-tetrahydroxy pentyl-10-phenyl-1,3,6,8,9,10 hexahydro-2,7-dithiooxopyrido [2,3-d; 6,5'] dipyrimidine-4,5 diones (2), 3-(1R,2S,3S)-1,2,3,4-tetrahydroxy butyl-10-phenyl-1,3,6,8,9,10 hexahydro-2,7-dithiooxopyrido [2,3-d; 6,5'] dipyrimidine-4,5 diones (3) have been synthesized in single step by the condensation of thio-barbituric acid with sugars (L-rhamnose, L-fucose and L-arabinose) & aniline using para-toluene sulfonic acid (p-TSA) as an effective acid catalyst under refluxing conditions. The molecular structure and detailed spectroscopic analysis of all three novel synthesized thiones derivatives have been performed using experimental techniques like 1H, 13C NMR, 2D (COSY, HSQC, DEPT-135 and DEPT-90) as well as theoretical calculations by density functional theory (DFT) using B3LYP and 6-311G + (d, p) basis set. The strength and nature of weak intramolecular interactions have been studied by atom in molecule (AIM) approach. Global reactivity descriptors have been computed to predict reactivity and reactive sites in the molecule.
Petti, L M; Reddy, V; Smith, S O; DiMaio, D
1997-10-01
The bovine papillomavirus E5 protein forms a stable complex with the cellular platelet-derived growth factor (PDGF) beta receptor, resulting in receptor activation and cell transformation. Amino acids in both the putative transmembrane domain and extracytoplasmic carboxyl-terminal domain of the E5 protein appear important for PDGF receptor binding and activation. Previous analysis indicated that the transmembrane domain of the receptor was also required for complex formation and receptor activation. Here we analyzed receptor chimeras and point mutants to identify specific amino acids in the PDGF beta receptor required for productive interaction with the E5 protein. These receptor mutants were analyzed in murine Ba/F3 cells, which do not express endogenous receptor. Our results confirmed the importance of the transmembrane domain of the receptor for complex formation, receptor tyrosine phosphorylation, and mitogenic signaling in response to the E5 protein and established that the threonine residue in this domain is required for these activities. In addition, a positive charge in the extracellular juxtamembrane domain of the receptor was required for E5 interaction and signaling, whereas replacement of the wild-type lysine with either a neutral or acidic amino acid inhibited E5-induced receptor activation and transformation. All of the receptor mutants defective for activation by the E5 protein responded to acute treatment with PDGF and to stable expression of v-Sis, a form of PDGF. The required juxtamembrane lysine and transmembrane threonine are predicted to align precisely on the same face of an alpha helix packed in a left-handed coiled-coil geometry. These results establish that the E5 protein and v-Sis recognize distinct binding sites on the PDGF beta receptor and further clarify the nature of the interaction between the viral transforming protein and its cellular target.
NASA Astrophysics Data System (ADS)
Nakajima, Daiki; Kikuchi, Tatsuya; Natsui, Shungo; Suzuki, Ryosuke O.
2014-12-01
The growth behavior of anodic oxide films formed via anodizing in glutaric and its derivative acid solutions was investigated based on the acid dissociation constants of electrolytes. High-purity aluminum foils were anodized in glutaric, ketoglutaric, and acetonedicarboxylic acid solutions under various electrochemical conditions. A thin barrier anodic oxide film grew uniformly on the aluminum substrate by glutaric acid anodizing, and further anodizing caused the film to breakdown due to a high electric field. In contrast, an anodic porous alumina film with a submicrometer-scale cell diameter was successfully formed by ketoglutaric acid anodizing at 293 K. However, the increase and decrease in the temperature of the ketoglutaric acid resulted in non-uniform oxide growth and localized pitting corrosion of the aluminum substrate. An anodic porous alumina film could also be fabricated by acetonedicarboxylic acid anodizing due to the relatively low dissociation constants associated with the acid. Acid dissociation constants are an important factor for the fabrication of anodic porous alumina films.
Todua, Nino G.; Mikaia, Anzor I.
2016-01-01
Derivatives requiring either anhydrous or aqueous reaction conditions were prepared for robust and reliable gas chromatography/mass spectrometry (GC/MS) characterization of hydroxyl, mercapto, and amino benzoic acids Methylation and trialkylsilytation are employed for blocking the acidic function. Alkyl, trimethylsilyl, acetyl, perfluoroacyl and alkoxycarbonyl derivatization groups are introduced to hydroxyl, mercapto and amino functions. The electron ionization induced fragmentation characteristics of corresponding derivatives are explained by comparing the MS1 spectra of unlabeled compounds to their 2H and 13C labeled analogs, and analysis of collision-induced dissociation data from MS2 spectra. Competing fragmentation alternatives are identified and specific decomposition processes are detailed that characterize (a) ortho isomers due to interaction or vicinal functional substituents and (b) para isomers prone to forming para quinoid type structures. Skeletal and hydrogen rearrangements typical for methyl benzoates and the blocking groups are considered when discussing diagnostically important ions. Characteristic ions produced as a result of rearrangements in ortho isomers are classified, and skeletal rearrangements required to produce para quinoid type ions specific for para isomers are noted. Key ions for structure elucidation and differentiation of isomers for derivatives of substituted benzoic acids by GC/MS are suggested. PMID:27891187
Bjedov, Srđan; Jakimov, Dimitar; Pilipović, Ana; Poša, Mihalj; Sakač, Marija
2017-04-01
Bile acid derivatives with modifications in side chain and modifications on steroid skeleton were synthetized and their antitumor activity against five human cancer cell lines was investigated. Modifications in side chain include amid group, formed in reaction with 2-amino-2-methylpropanol, and 4,4-dimethyloxazoline group, obtained after cyclization of amides. In the steroid skeleton oxo groups were introduced in position 7 (2, 2a, 2b) and 7,12 (3, 3a, 3b). Ethylidene groups were introduced regio- and stereoselectively on C-7, and/or without stereoselectivity on C-3 by Wittig reaction. By combination of these modifications, a series of 19 bile acid derivatives were synthesized. Compounds containing both C-7 ethylidene and C-12 carbonyl groups (6, 6a, 6b) shown very good antitumor activity with IC 50 <5µM. Altering carboxylic group to amide or oxazoline group has positive effect on cytotoxicity. Different molecular descriptors were determined in silico and after principal component analysis was found that molecular descriptor BLTF96 can be used for fast assessment of experimental cytotoxicity of bile acid derivatives. Copyright © 2017 Elsevier Inc. All rights reserved.
Anti-Inflammatory Effects of Cajaninstilbene Acid and Its Derivatives.
Huang, Mei-Yan; Lin, Jing; Lu, Kuo; Xu, Hong-Gui; Geng, Zhi-Zhong; Sun, Ping-Hua; Chen, Wei-Min
2016-04-13
Cajaninstilbene acid (CSA) is one of the active components isolated from pigeon pea leaves. In this study, anti-inflammatory effects of CSA and its synthesized derivatives were fully valued with regard to their activities on the production of nitric oxide (NO) and pro-inflammatory cytokines tumor necrosis factor-alpha (TNF-α) and interleukin-6 (IL-6) in vitro cell model, as well as their impacts on the migration of neutrophils and macrophages in fluorescent protein labeled zebrafish larvae model by live image analysis. Furthermore, the anti-inflammatory mechanism of this type of compounds was clarified by western-blot and reverse transcription-polymerase chain reaction (RT-PCR). The results showed that CSA, as well as its synthesized derivatives 5c, 5e and 5h, exhibited strong inhibition activity on the release of NO and inflammatory factor TNF-α and IL-6 in lipopolysaccharides (LPS)-stimulated murine macrophages. CSA and 5c greatly inhibited the migration of neutrophils and macrophages in injury zebrafish larvae. CSA and 5c treatment greatly inhibited the phosphorylation of proteins involved in nuclear factor kappa B (NF-κB) and mitogen-activated protein kinase (MAPK) pathways. Moreover, we found that peroxisome proliferator-activated receptor gamma (PPARγ) inhibitor GW9662 could reverse partly the roles of CSA and 5c, and CSA and 5c treatment greatly resist the decrease of PPARγ mRNA and protein induced by LPS stimulation. Our results identified the promising anti-inflammatory effects of CSA and its derivatives, which may serve as valuable anti-inflammatory lead compound. Additionally, the mechanism studies demonstrated that the anti-inflammatory activity of CSA and its derivative is associated with the inhibition of NF-κB and MAPK pathways, relying partly on resisting the LPS-induced decrease of PPARγ through improving its expression.
Xu, Qianqian; Zang, Ying; Zhou, Jie; Liu, Peng; Li, Xin; Yong, Qiang; Ouyang, Jia
2016-11-01
Inulin is a readily available feedstock for cost-effective production of biochemicals. To date, several studies have explored the production of bioethanol, high-fructose syrup and fructooligosaccharide, but there are no studies regarding the production of D-lactic acid using inulin as a carbon source. In the present study, chicory-derived inulin was used for D-lactic acid biosynthesis by Lactobacillus bulgaricus CGMCC 1.6970. Compared with separate hydrolysis and fermentation processes, simultaneous saccharification and fermentation (SSF) has demonstrated the best performance of D-lactic acid production. Because it prevents fructose inhibition and promotes the complete hydrolysis of inulin, the highest D-lactic acid concentration (123.6 ± 0.9 g/L) with a yield of 97.9 % was obtained from 120 g/L inulin by SSF. Moreover, SSF by L. bulgaricus CGMCC 1.6970 offered another distinct advantage with respect to the higher optical purity of D-lactic acid (>99.9 %) and reduced number of residual sugars. The excellent performance of D-lactic acid production from inulin by SSF represents a high-yield method for D-lactic acid production from non-food grains.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rao, Ling; Lu, Wei; Wang, Haibo
2015-04-15
Highlights: • Sub-10 nm cubic phase BaLuF{sub 5} nanocrystals were synthesized by a hydrothermal method for the first time. • Tunable multicolor from yellow to yellow-green was achieved by controlling Gd{sup 3+} content in BaLuF{sub 5}:Yb/Er system. • Intense near-infrared upconversion luminescence in BaLuF{sub 5}:Gd/Yb/Tm nanocrystal. • The enhancement near-infrared luminescence can be realized by adjusting the content of Gd{sup 3+} in BaLuF{sub 5}:Gd/Yb/Tm system. - Abstract: In this study, sub-10 nm BaLuF{sub 5} nanocrystals with cubic phase structure were synthesized by a solvothermal method using oleic acid as the stabilizing agent. The as-prepared BaLuF{sub 5} nanocrystals were characterized bymore » transmission electron microscopy (TEM), X-ray diffraction (XRD), and analyzed by the upconversion (UC) spectra. The TEM results reveal that these samples present high uniformity. Compared with Gd-free samples, the size of BaLuF{sub 5}:Yb/Er doped with 10% Gd{sup 3+} decreased to 5.6 nm. In addition, BaLuF{sub 5}:Yb/Tm/Gd upconversion nanoparticles (UCNPs) presented efficient near-infrared (NIR)-NIR UC luminescence. Therefore, it is expected that these ultra-small BaLuF{sub 5} nanocrystals with well-controlled shape, size, and UC emission have potential applications in biomedical imaging fields.« less
Influence diagnostics for count data under AB-BA crossover trials.
Hao, Chengcheng; von Rosen, Dietrich; von Rosen, Tatjana
2017-12-01
This paper aims to develop diagnostic measures to assess the influence of data perturbations on estimates in AB-BA crossover studies with a Poisson distributed response. Generalised mixed linear models with normally distributed random effects are utilised. We show that in this special case, the model can be decomposed into two independent sub-models which allow to derive closed-form expressions to evaluate the changes in the maximum likelihood estimates under several perturbation schemes. The performance of the new influence measures is illustrated by simulation studies and the analysis of a real dataset.
Pai, Sandeep R; Upadhya, Vinayak; Hegde, Harsha V; Joshi, Rajesh K; Kholkute, Sanjiva D
2016-03-01
Achyranthes aspera L. is a well known herb commonly used in traditional system of Indian medicine to treat various disorders, such as cough, dysentery, gonorrhea, piles, kidney stone, pneumonia, renal dropsy, skin eruptions, snake bite, etc. Here, we used RP-UFLC-DAD method for determining triterpenoids betulinic acid (BA), oleanolic acid (OA) and ursolic acid (UA) from A. aspera. Optimum yield of these compounds were studied and evaluated using parameters viz., method of extraction, time of extraction, age of plant and plant parts (leaves, stem and roots). Linear relationships in RP-UFLC-DAD analysis were obtained in the range 0.05-100 µg/mL with 0.035, 0.042 and 0.033 µg/mL LOD for BA, OA and UA, respectively. Of the variables tested, extraction method and parts used significantly affected content yield. Continuous shaking extraction (CSE) at ambient temperature gave better extraction efficiency than exposure to ultra sonic extraction (USE) or microwave assisted extraction (MAE) methods. The highest content of BA, OA and UA were determined individually in leaf, stem and root extracts with CSE. Collective yield of these triterpenoids were higher in leaf part exposed to 15 min USE method. To best of our knowledge, the study newly reports UA from A. aspera and the same was confirmed using ATR-FT-IR studies. This study explains the distribution pattern of these major triterpenoids and optimum extraction parameters in detail.
Karabay, Arzu Zeynep; Koc, Aslı; Gurkan-Alp, A Selen; Buyukbingol, Zeliha; Buyukbingol, Erdem
2015-04-01
Alpha-lipoic acid (α-lipoic acid) is a potent antioxidant compound that has been shown to possess anti-inflammatory effects. RAW 264.7 macrophages produce various inflammatory mediators such as nitric oxide, IL-1β, IL-6 and TNF-alpha upon activation with LPS (Lipopolysaccharide) and IFNγ (interferon gamma). In this study, the effect of 12 synthetic indole α-lipoic acid derivatives on nitric oxide production and iNOS (inducible nitric oxide synthase) protein expression in LPS/IFNγ activated RAW 264.7 macrophages was determined. Cell proliferation, nitric oxide levels and iNOS protein expression were examined with thiazolyl blue tetrazolium blue test, griess assay and western blot, respectively. Our results showed that all of the indole α-lipoic acid derivatives showed significant inhibitory effects on nitric oxide production and iNOS protein levels (p < 0.05). The most active compounds were identified as compound I-4b, I-4e and II-3b. In conclusion, these indole α-lipoic acid derivatives may have the potential for treatment of inflammatory conditions related with high nitric oxide production. Copyright © 2015 John Wiley & Sons, Ltd.
Dynamics of photoexcited Ba+ cations in 4He nanodroplets
NASA Astrophysics Data System (ADS)
Leal, Antonio; Zhang, Xiaohang; Barranco, Manuel; Cargnoni, Fausto; Hernando, Alberto; Mateo, David; Mella, Massimo; Drabbels, Marcel; Pi, Martí
2016-03-01
We present a joint experimental and theoretical study on the desolvation of Ba+ cations in 4He nanodroplets excited via the 6p ← 6s transition. The experiments reveal an efficient desolvation process yielding mainly bare Ba+ cations and Ba+Hen exciplexes with n = 1 and 2. The speed distributions of the ions are well described by Maxwell-Boltzmann distributions with temperatures ranging from 60 to 178 K depending on the excitation frequency and Ba+ Hen exciplex size. These results have been analyzed by calculations based on a time-dependent density functional description for the helium droplet combined with classical dynamics for the Ba+. In agreement with experiment, the calculations reveal the dynamical formation of exciplexes following excitation of the Ba+ cation. In contrast to experimental observation, the calculations do not reveal desolvation of excited Ba+ cations or exciplexes, even when relaxation pathways to lower lying states are included.
Johnson, Christopher W.; Salvachua, Davinia; Khanna, Payal; ...
2016-04-22
The conversion of biomass-derived sugars and aromatic molecules to cis,cis-muconic acid (referred to hereafter as muconic acid or muconate) has been of recent interest owing to its facile conversion to adipic acid, an important commodity chemical. Metabolic routes to produce muconate from both sugars and many lignin-derived aromatic compounds require the use of a decarboxylase to convert protocatechuate (PCA, 3,4-dihydroxybenzoate) to catechol (1,2-dihydroxybenzene), two central aromatic intermediates in this pathway. Several studies have identified the PCA decarboxylase as a metabolic bottleneck, causing an accumulation of PCA that subsequently reduces muconate production. A recent study showed that activity of the PCAmore » decarboxylase is enhanced by co-expression of two genetically associated proteins, one of which likely produces a flavin-derived cofactor utilized by the decarboxylase. Using entirely genome-integrated gene expression, we have engineered Pseudomonas putida KT2440-derived strains to produce muconate from either aromatic molecules or sugars and demonstrate in both cases that co-expression of these decarboxylase associated proteins reduces PCA accumulation and enhances muconate production relative to strains expressing the PCA decarboxylase alone. In bioreactor experiments, co-expression increased the specific productivity (mg/g cells/h) of muconate from the aromatic lignin monomer p-coumarate by 50% and resulted in a titer of >15 g/L. In strains engineered to produce muconate from glucose, co-expression more than tripled the titer, yield, productivity, and specific productivity, with the best strain producing 4.92+/-0.48 g/L muconate. Furthermore, this study demonstrates that overcoming the PCA decarboxylase bottleneck can increase muconate yields from biomass-derived sugars and aromatic molecules in industrially relevant strains and cultivation conditions.« less
Microbial Incorporation of Fatty Acids Derived From n-Alkanes Into Glycerides and Waxes
Davis, J. B.
1964-01-01
When n-alkanes with 13 to 20 carbon atoms were fed to a Nocardia closely related to N. salmonicolor, the produced cellular triglycerides and aliphatic waxes invariably contained fatty acids with an even or an odd number of carbon atoms subject to this feature of the n-alkane substrate. Beta-oxidation and C2 addition are both operative, as evidenced by the spectra of fatty acids incorporated into the cellular lipid components. There is no distinction in the rate of microbial incorporation of the odd-or even-numbered carbon chains. The fatty acids are apparently directly derived from the long chain n-alkanes, rather than synthesized via the classic C2-condensation route. The alcohol component of waxes produced by the Nocardia is invariably of the same chain length as the n-alkane substrate. PMID:14170957
Revisiting the BaO2/BaO redox cycle for solar thermochemical energy storage.
Carrillo, A J; Sastre, D; Serrano, D P; Pizarro, P; Coronado, J M
2016-03-21
The barium peroxide-based redox cycle was proposed in the late 1970s as a thermochemical energy storage system. Since then, very little attention has been paid to such redox couples. In this paper, we have revisited the use of reduction-oxidation reactions of the BaO2/BaO system for thermochemical heat storage at high temperatures. Using thermogravimetric analysis, reduction and oxidation reactions were studied in order to find the main limitations associated with each process. Furthermore, the system was evaluated through several charge-discharge stages in order to analyse its possible degradation after repeated cycling. Through differential scanning calorimetry the heat stored and released were also determined. Oxidation reaction, which was found to be slower than reduction, was studied in more detail using isothermal tests. It was observed that the rate-controlling step of BaO oxidation follows zero-order kinetics, although at high temperatures a deviation from Arrhenius behaviour was observed probably due to hindrances to anionic oxygen diffusion caused by the formation of an external layer of BaO2. This redox couple was able to withstand several redox cycles without deactivation, showing reaction conversions close to 100% provided that impurities are previously eliminated through thermal pre-treatment, demonstrating the feasibility of this system for solar thermochemical heat storage.
Chen, Wen-Cheng; Ju, Chien-Ping; Wang, Jen-Chyan; Hung, Chun-Cheng; Chern Lin, Jiin-Huey
2008-12-01
Bone filler has been used over the years in dental and biomedical applications. The present work is to characterize a non-dispersive, fast setting, modulus adjustable, high bioresorbable composite bone cement derived from calcium phosphate-based cement combined with polymer and binding agents. This cement, we hope, will not swell in simulated body fluid and keep the osteogenetic properties of the dry bone and avoid its disadvantages of being brittle. We developed a calcium phosphate cement (CPC) of tetracalcium phosphate/dicalcium phosphate anhydrous (TTCP/DCPA)-polyacrylic acid with tartaric acid, calcium fluoride additives and phosphate hardening solution. The results show that while composite, the hard-brittle properties of 25wt% polyacrylic acid are proportional to CPC and mixing with additives is the same as those of the CPC without polyacrylic acid added. With an increase of polyacrylic acid/CPC ratio, the 67wt% samples revealed ductile-tough properties and 100wt% samples kept ductile or elastic properties after 24h of immersion. The modulus range of this development was from 200 to 2600MPa after getting immersed in simulated body fluid for 24h. The TTCP/DCPA-polyacrylic acid based CPC demonstrates adjustable brittle/ductile strength during setting and after immersion, and the final reaction products consist of high bioresorbable monetite/brushite/calcium fluoride composite with polyacrylic acid.
NASA Astrophysics Data System (ADS)
Zhang, Xiaoming; Quan, Zewei; Yang, Jun; Yang, Piaoping; Lian, Hongzhou; Lin, Jun
2008-02-01
MF2 (M = Ca,Sr,Ba) nanocrystals (NCs) were synthesized via a solvothermal process in the presence of oleic acid and characterized by x-ray diffraction (XRD), transmission electron microscopy (TEM), Fourier transform infrared (FT-IR) spectra, UV/vis absorption spectra, photoluminescence (PL) excitation and emission spectra, and lifetimes, respectively. In the synthetic process, oleic acid as a surfactant played a crucial role in confining the growth and solubility of the MF2 NCs. The as-prepared CaF2, SrF2 and BaF2 NCs present morphologies of truncated octahedron, cube and sheet in a narrow distribution, respectively. Possible growth mechanisms were proposed to explain these results. The as-prepared NCs are highly crystalline and can be well dispersed in cyclohexane to form stable and clear colloidal solutions, which demonstrate strong emission bands centred at 400 nm in photoluminescence (PL) spectra compared with the cyclohexane solvent. The PL properties of the colloidal solutions of the as-prepared NCs can be ascribed to the trap states of surface defects.
Cueno, Marni E; Kamio, Noriaki; Seki, Keisuke; Kurita-Ochiai, Tomoko; Ochiai, Kuniyasu
2015-07-01
Butyric acid (BA) is a common secondary metabolite by-product produced by oral pathogenic bacteria and is detected in high amounts in the gingival tissue of patients with periodontal disease. Previous works have demonstrated that BA can cause oxidative stress in various cell types; however, this was never explored using neuronal cells. Here, we exposed nerve growth factor (NGF)-treated PC1(2) cells to varying BA concentrations (0.5, 1.0, 5.0 mM). We measured total heme, H(2)O(2), catalase, and calcium levels through biochemical assays and visualized the neurite outgrowth after BA treatment. Similarly, we determined the effects of other common periodontal short-chain fatty acids (SCFAs) on neurite outgrowth for comparison. We found that high (1.0 and 5.0 mM) BA concentrations induced oxidative stress and altered calcium homeostasis, whereas low (0.5 mM) BA concentration had no significant effect. Moreover, compared to other SCFAs, we established that only BA was able to induce neurite retraction.
Boric Acid Inhibition of Trichophyton rubrum Growth and Conidia Formation.
Schmidt, Martin
2017-12-01
Trichophyton rubrum is a common human dermatophyte that is the causative agent of 80-93% of fungal infections of the skin and nails. While dermatophyte infections in healthy people are easily treatable with over-the-counter medications, such infections pose a higher risk for patients with compromised immune function and impaired regenerative potential. The efficacy of boric acid (BA) for the treatment of vaginal yeast infections prompted an investigation of the effect of BA on growth and morphology of T. rubrum. This is of particular interest since BA facilitates wound healing, raising the possibility that treating athlete's foot with BA, either alone or in combination with other antifungal drugs, would combine the benefits of antimicrobial activity and tissue regeneration to accelerate healing of infected skin. The data presented here show that BA represses T. rubrum growth at a concentration reported to be beneficial for host tissue regeneration. Oxygen exposure increases BA toxicity, and mycelia growing under BA stress avoid colonizing the surface of the growth surface, which leads to a suppression of aerial mycelium growth and surface conidia formation. BA penetrates into solid agar matrices, but the relative lack of oxygen below the substrate surface limits the effectiveness of BA in suppressing growth of embedded T. rubrum cells.
A multi-stimuli responive, self-assembling, boronic acid dipeptide
Jones, Brad Howard; Martinez, Alina Marissa; Wheeler, Jill S.; ...
2015-08-11
Modification of the dipeptide of phenylalanine, FF, with a boronic acid (BA) functionality imparts unique aqueous self-assembly behavior that responds to multiple stimuli. Changes in pH and ionic strength are used to trigger hydrogelation via the formation of nanoribbon networks. Thus, we show for the first time that the binding of polyols to the BA functionality can modulate a peptide between its assembled and disassembled states.
Alammar, Tarek; Slowing, Igor I.; Anderegg, Jim; ...
2017-06-06
Nanocrystalline Sr 1–xBa xSnO 3 (x = 0, 0.2, 0.4, 0.8, 1) perovskite photocatalysts were prepared by microwave synthesis in an ionic liquid (IL) and subsequent heat-treatment. The influence of the Sr/Ba substitution on the structure, crystallization, morphology, and photocatalytic efficiency was investigated and the samples were fully characterized. On the basis of X-ray diffraction results, as the Ba content in the SrSnO 3 lattice increases, a symmetry increase was observed from the orthorhombic perovskite structure for SrSnO 3 to the cubic BaSnO 3 structure. The analysis of the sample morphology by SEM reveals that the Sr 1–xBa xSnO 3more » samples favor the formation of nanorods (500 nm–5 μm in diameter and several micrometers long). The photophysical properties were examined by UV/Vis diffuse reflectance spectroscopy. The band gap decreases from 3.85 to 3.19 eV with increasing Ba 2+ content. Furthermore, the photocatalytic properties were evaluated for the hydroxylation of terephthalic acid (TA). The order of the activities for TA hydroxylation was Sr 0.8Ba 0.2SnO 3 > SrSnO 3 > BaSnO 3 > Sr 0.6Ba 0.4SnO 3 > Sr 0.2Ba 0.8SnO 3. Here, the highest photocatalytic activity was observed for Sr 0.8Ba 0.2SnO 3, and this can be attributed to the synergistic impacts of the modification of the crystal structure and morphology, the relatively large surface area associated with the small crystallite size, and the suitable band gap and band-edge position.« less
Cheel, José; Theoduloz, Cristina; Rodríguez, Jaime; Saud, Guillermo; Caligari, Peter D S; Schmeda-Hirschmann, Guillermo
2005-11-02
Three E-cinnamic acid glycosides, tryptophan, and cyanidin-3-O-beta-D-glucopyranoside were isolated from ripe fruits of the Chilean strawberry Fragaria chiloensis ssp. chiloensis. 1-O-E-Cinnamoyl-beta-D-xylopyranoside, 1-O-E-cinnamoyl-beta-D-rhamnopyranoside, and 1-O-E-cinnamoyl-alpha-xylofuranosyl-(1-->6)-beta-D-glucopyranose are reported for the first time. The cinnamic acid glycosides and aromatic compound patterns in F. chiloensis fruits were determined by high-performance liquid chromatography (HPLC). HPLC analyses of extracts showed that cyanidin-3-O-beta-D-glucopyranoside and free ellagic acid are present in achenes while the E-cinnamoyl derivatives and tryptophan were identified only in the thalamus. The free radical scavenging effect of the fruit extract can be associated with the anthocyanin content.
Effect of pH on fecal recovery of energy derived from volatile fatty acids.
Kien, C L; Liechty, E A
1987-01-01
We assessed the effect of pH on volatilization of short-chain fatty acids during lyophilization. Acetic, propionic, valeric, and butyric acids were added to a fecal homogenate in amounts sufficient to raise the energy density by 18-27%. Fecal homogenate samples were either acidified (pH 2.8-3.2), alkalinized (pH 7.9-8.7), or left unchanged (4.0-4.8) prior to lyophilization and subsequent bomb calorimetry. Alkalinizing the fecal samples prevented the 20% loss of energy derived from each of these volatile fatty acids observed in samples either acidified or without pH adjustment. These data suggest that in energy balance studies involving subjects with active colonic fermentation, fecal samples should be alkalinized prior to lyophilization and bomb calorimetry.
Hamazaki, Kei; Maekawa, Motoko; Toyota, Tomoko; Dean, Brian; Hamazaki, Tomohito; Yoshikawa, Takeo
2015-06-30
Postmortem brain studies have shown abnormal levels of n-3 polyunsaturated fatty acids (PUFAs), especially docosahexaenoic acid, in the frontal cortex (particularly the orbitofrontal cortex) of patients with depression, schizophrenia, or bipolar disorder. However, the results from regions in the frontal cortex other than the orbitofrontal cortex are inconsistent. In this study we investigated whether patients with schizophrenia, bipolar disorder, or major depressive disorder have abnormalities in PUFA levels in the prefrontal cortex [Brodmann area (BA) 8]. In postmortem studies, fatty acids in the phospholipids of the prefrontal cortex (BA8) were evaluated by thin layer chromatography and gas chromatography. Specimens were evaluated for patients with schizophrenia (n=15), bipolar disorder (n=15), or major depressive disorder (n=15) and compared with unaffected controls (n=15). In contrast to previous studies, we found no significant differences in the levels of PUFAs or other fatty acids in the prefrontal cortex (BA8) between patients and controls. Subanalysis by sex also showed no significant differences. No significant differences were found in any individual fatty acids between suicide and non-suicide cases. These psychiatric disorders might be characterized by very specific fatty acid compositions in certain areas of the brain, and BA8 might not be involved in abnormalities of PUFA metabolism. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Synthesis and in vitro antitumor evaluation of dihydroartemisinin-cinnamic acid ester derivatives.
Xu, Cang-Cang; Deng, Ting; Fan, Meng-Lin; Lv, Wen-Bo; Liu, Ji-Hua; Yu, Bo-Yang
2016-01-01
To explore novel high efficiency and low toxicity antitumor agents, a series of dihydroartemisinin-cinnamic acid ester derivatives modified on C-12 and/or C-9 position (s) were synthesized and the in vitro antitumor activities against PC-3, SGC-7901, A549 and MDA-MB-435s cancer cell lines were assessed. The hybrids (3-36) were prepared by esterification of 9α-hydroxyl-dihydroartemisinin (9α-OH DHA), the biotransformation product of dihydroartemisinin (DHA), and cinnamic acid derivatives. Compound 17 (IC50 = 0.20 μM) was the most potent anti-proliferative agent against the human lung carcinoma A549 cells, although it displayed low cytotoxicity on normal hepatic L-02 cells. The mechanism of action of compound 17 was further investigated by analysis of cell apoptosis and intracellular ROS generation. The results indicated that both ROS and ferrous ion contributed to the compound 17-induced cell death. Meanwhile, high intracellular ferrous ion and endogenous oxidative stress in A549 cells made them easier to suffer to compound 17-induced apoptosis. Our promising findings indicated the compound 17 could stand as drug candidate against lung cancer for further investigation. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Solecka, Jolanta; Guśpiel, Adam; Postek, Magdalena; Ziemska, Joanna; Kawęcki, Robert; Lęczycka, Katarzyna; Osior, Agnieszka; Pietrzak, Bartłomiej; Pypowski, Krzysztof; Wyrzykowska, Agata
2014-09-30
A series of 3,4-dihydroisoquinoline-3-carboxylic acid derivatives were synthesised and tested for their free-radical scavenging activity using 2,2-diphenyl-1-picrylhydrazyl radical (DPPH·), 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) radical (ABTS·+), superoxide anion radical (O2·-) and nitric oxide radical (·NO) assays. We also studied d-amino acid oxidase (DAAO), acetylcholinesterase (AChE) and butyrylcholinesterase (BuChE) inhibitory activity. Almost each of newly synthesised compounds exhibited radical scavenging capabilities. Moreover, several compounds showed moderate inhibitory activities against DAAO, AChE and BuChE. Compounds with significant free-radical scavenging activity may be potential candidates for therapeutics used in oxidative-stress-related diseases.
Chen, Yougui; Thiyam-Hollander, Usha; Barthet, Veronique J; Aachary, Ayyappan A
2014-10-08
Valuable phenolic antioxidants are lost during oil refining, but evaluation of their occurrence in refining byproducts is lacking. Rapeseed and canola oil are both rich sources of sinapic acid derivatives and tocopherols. The retention and loss of sinapic acid derivatives and tocopherols in commercially produced expeller-pressed canola oils subjected to various refining steps and the respective byproducts were investigated. Loss of canolol (3) and tocopherols were observed during bleaching (84.9%) and deodorization (37.6%), respectively. Sinapic acid (2) (42.9 μg/g), sinapine (1) (199 μg/g), and canolol (344 μg/g) were found in the refining byproducts, namely, soap stock, spent bleaching clay, and wash water, for the first time. Tocopherols (3.75 mg/g) and other nonidentified phenolic compounds (2.7 mg sinapic acid equivalent/g) were found in deodistillates, a byproduct of deodorization. DPPH radical scavenging confirmed the antioxidant potential of the byproducts. This study confirms the value-added potential of byproducts of refining as sources of endogenous phenolics.
Asahi, Takashi; Wu, Xiaohong; Shimoda, Hiroshi; Hisaka, Shinsuke; Harada, Etsuko; Kanno, Tomomi; Nakamura, Yoshimasa; Kato, Yoji; Osawa, Toshihiko
2016-01-01
Myeloperoxidase (MPO)-generated halogenating molecules, such as hypochlorous acid and hypobromous acid (HOBr), in inflammatory regions are postulated to contribute to disease progression. In this study, we showed that ergothioneine (EGT), derived from an edible mushroom, inhibited MPO activity as well as the formation of 8-bromo-2'-deoxyguanosine in vitro. The HOBr scavenging effect of EGT is higher than those of ascorbic acid and glutathione. We initially observed that the administration of Coprinus comatus, an edible mushroom containing a high amount of EGT, inhibited the UV-B-induced inflammatory responses and DNA halogenation, suggesting that EGT is a promising anti-inflammatory agent from mushrooms.
Structural properties of ultrafine Ba-hexaferrite nanoparticles
DOE Office of Scientific and Technical Information (OSTI.GOV)
Makovec, Darko, E-mail: Darko.Makovec@ijs.si; Primc, Darinka; Sturm, Saso
2012-12-15
Crystal structure of ultrafine Ba-hexaferrite (BaFe{sub 12}O{sub 19}) nanoparticles was studied using X-ray diffractometry (XRD), high-resolution transmission electron microscopy (HRTEM), energy-dispersive X-ray spectroscopy (EDXS), X-ray absorption fine structure (XAFS), and Moessbauer spectroscopy (MS), to be compared to the structure of larger nanoparticles and the bulk. The nanoparticles were synthesized with hydrothermal treatment of an appropriate suspension of Ba and Fe hydroxides in the presence of a large excess of OH{sup -}. The ultrafine nanoparticles were formed in a discoid shape, {approx}10 nm wide and only {approx}3 nm thick, comparable to the size of the hexagonal unit cell in the c-direction.more » The HRTEM image analysis confirmed the hexaferrite structure, whereas EDXS showed the composition matching the BaFe{sub 12}O{sub 19} formula. XAFS and MS analyses showed considerable disorder of the structure, most probably responsible for the low magnetization. - Graphical abstract: Left: HREM image of an ultrafine Ba-hexaferrite nanoparticle (inset: TEM image of the nanoparticles); Right: the experimental HRTEM image is compared with calculated image and corresponding atomic model. Highlights: Black-Right-Pointing-Pointer Crystal structure of ultrafine Ba-hexaferrite (BaFe{sub 12}O{sub 19}) nanoparticles was compared to the structure of the bulk. Black-Right-Pointing-Pointer Thickness the discoid nanoparticles was comparable to the size of the hexagonal unit cell in the c-direction. Black-Right-Pointing-Pointer Considerable disorder of the nanoparticles' structure is most probably responsible for their low magnetization.« less
NASA Astrophysics Data System (ADS)
Yamamichi, Shintaro; Yabuta, Hisato; Sakuma, Toshiyuki; Miyasaka, Yoichi
1994-03-01
(Ba0.5Sr0.5)TiO3 thin films were prepared by ion beam sputtering from powder targets with (Ba+Sr)/Ti ratios ranging from 0.80 to 1.50. All of the perovskite (Ba,Sr)TiO3 films were single phase except for the film with a (Ba+Sr)/Ti ratio of 1.41. The dielectric constant values notably depended on the (Ba+Sr)/Ti ratio for films thicker than 70 nm. The highest dielectric constant of 580 was achieved for the 5% (Ba+Sr) rich film. This (Ba+Sr)/Ti ratio dependence was diminished by the thickness dependence for thinner films. The grain sizes for the 9% (Ba+Sr) rich film and for the 6% (Ba+Sr) poor film ranged from 70 to 100 nm and from 30 to 60 nm, respectively. This grain size difference could explain why slightly A-site rich (Ba,Sr)TiO3 films have a larger dielectric constant than A-site poor films.
Synthesis and electrical characterization of BaZr0.9Ho0.1O3-δ electrolyte ceramic for IT - SOFCs
NASA Astrophysics Data System (ADS)
Saini, Deepash S.; Singh, Lalit K.; Bhattacharya, D.
2018-04-01
A cost-effective modified combustion method using citric acid and glycine has recently been developed to synthesize high quality, and nanosized BaZr0.9Ho0.1O3 ceramic powder. BaZr0.9Ho0.1O3-δ ceramic powder was characterized by X-ray diffraction (XRD), high-resolution transmission electron microscopy (HRTEM) and field emission scanning electron microscopy (FESEM). XRD pattern of BaZr0.9Ho0.1O3-δ ceramic sintered at 1600 °C has shown that pure phase of BaZr0.9Ho0.1O3-δ with cubic Pm3¯m space group symmetry. The transmission electron microscopic investigation has shown that the particle size of the powder calcined at 1100 °C was in the range 30-80 nm. The FESEM image of sintered pellet at 1600 °C for 4 h reveals porous nature of BaZr0.9Ho0.1O3-δ with 83.7 relative density. Impedance analysis reveal three type relaxations in the temperature range 250 °C to 500 °C as studied at different frequencies over 100 Hz to 1 MHz in air. The grain boundary conductivity of BaZr0.9Ho0.1O3-δ ceramic is found lower then grain (bulk) conductivity due to core-space charge layer behavior in grain boundary.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bodeux, Romain; Univ. Bordeaux, ICMCB, UPR 9048, F-33600 Pessac; Michau, Dominique, E-mail: dominique.michau@icmcb.cnrs.fr
2016-09-15
Highlights: • Synthesis of Ba{sub 2}NdFeNb{sub 4}O{sub 15}/BaFe{sub 12}O{sub 19} (BaM) heterostructures by RF magnetron sputtering. • Growth of TTB layer were retained regardless of the underlayer (Pt bottom electrode or BaM). • Dielectric and magnetic properties were obtained from the Pt/TTB/BaM/Pt stacks. - Abstract: Ba{sub 2}NdFeNb{sub 4}O{sub 15} tetragonal tungsten bronze (TTB)/BaFe{sub 12}O{sub 19} (BaM) hexaferrite bilayers have been grown by RF magnetron sputtering on Pt/TiO{sub 2}/SiO{sub 2}/Si (PtS) substrates. The BaM layer is textured along (0 0 1) while the TTB layer is multioriented regardless of the PtS or BaM/PtS substrate. Dielectric properties of TTB films are similarmore » to those of bulk, i.e., ε ∼ 150 and a magnetic hysteresis loop is obtained from TTB/BaM bilayers, thanks to the BaM component. This demonstrates the possibility of transferring to 2 dimensional structures the composite multiferroic system TTB/BaM previously identified in 3 dimensional bulk ceramics.« less
Beta-gamma spectroscopy of the neutron-rich 150Ba
NASA Astrophysics Data System (ADS)
Yokoyama, R.; Ideguchi, E.; Simpson, G. S.; Tanaka, Mn; Nishimura, S.; Doornenbal, P.; Lorusso, G.; Söderström, P.-A.; Sumikama, T.; Wu, J.; Xu, Z. Y.; Aoi, N.; Baba, H.; Bello Garrote, F. L.; Benzoni, G.; Browne, F.; Daido, R.; Fang, Y.; Fukuda, N.; Gottardo, A.; Gey, G.; Go, S.; Inabe, N.; Isobe, T.; Kameda, D.; Kobayashi, K.; Kobayashi, M.; Kojouharov, I.; Komatsubara, T.; Kubo, T.; Kurz, N.; Kuti, I.; Li, Z.; Matsushita, M.; Michimasa, S.; Moon, C. B.; Nishibata, H.; Nishizuka, I.; Odahara, A.; Patel, Z.; Rice, S.; Sahin, E.; Sakurai, H.; Schaffner, H.; Sinclair, L.; Suzuki, H.; Takeda, H.; Taprogge, J.; Vajta, Zs; Watanabe, H.; Yagi, A.; Inakura, T.
2018-04-01
Excited states in the neutron-rich nucleus ^{150}Ba have been observed via β-γ spectroscopy at the Radioactive Isotope Beam Factory, RIKEN Nishina Center. The ^{150}Ba ions were produced by the in-flight fission of a ^{238}U beam with an energy of 345 MeV/nucleon. The E(2+) energy of ^{150}Ba was identified at 100 keV, which is the lowest known in the neutron-rich Ba isotopes. A γ-ray peak was also observed at 597 keV. A mean-field calculation with a fully 3D real space was performed and a static octupole deformation was obtained for the Ba isotopes. K^{π}=0- and 1- excited states with significant octupole collectivity were newly predicted at around or lower than 1 MeV on the ground state of ^{150}Ba by a random-phase approximation calculation. The 597 keV γ ray can be interpreted as a negative-parity state, showing that ^{150}Ba may possess octupole collectivity.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pan, Ming-Yan; Xia, Sheng-Qing, E-mail: shqxia@sdu.edu.cn; Liu, Xiao-Cun
2014-11-15
Two new barium chalcogenides, Ba{sub 3}GeS{sub 5} and Ba{sub 3}InS{sub 4}Cl, were synthesized by using high temperature solid-state reactions and their structures were determined by single-crystal X-ray diffraction technique. Despite the similar chemical formula, the structures of Ba{sub 3}GeS{sub 5} and Ba{sub 3}InS{sub 4}Cl are subtly different due to the size effects originated from the tetrahedral anions. Ba{sub 3}GeS{sub 5} crystallizes in the orthorhombic space group Pnma (no. 62) with cell parameters of a=12.0528(9) Å, b=9.5497(7) Å and c=8.5979(6) Å, while Ba{sub 3}InS{sub 4}Cl adopts a different tetragonal system (space group: I4/mcm, no. 140, a=b=8.3613(6) Å, c=14.3806(18) Å). The measuredmore » optical band gap of Ba{sub 3}GeS{sub 5} is 3.0 eV, a little smaller than the value of 3.42 eV in Ba{sub 3}InS{sub 4}Cl. Theoretical calculations by Wien2k are provided as well in order to better understand these results. - Graphical abstract: The polyhedral structure view for Ba{sub 3}GeS{sub 5} and Ba{sub 3}InS{sub 4}Cl in which Ba, S and Cl atoms are plotted in purple, red and green spheres. - Highlights: • Two new barium chalcogenides, Ba{sub 3}GeS{sub 5} and Ba{sub 3}InS{sub 4}Cl, were synthesized from the BaCl{sub 2}-flux reactions. • Their crystal structures feature discrete [MS{sub 4}] tetrahedra which embody interesting size effects. • Both compounds exhibit a band gap around 3.0 eV. • They are thermally stable up to 1073 K.« less
Wianowska, Dorota; Typek, Rafał; Dawidowicz, Andrzej L
2015-09-01
The analytical procedures for determining plant constituents involve the application of sample preparation methods to fully isolate and/or pre-concentrate the analyzed substances. High-temperature liquid extraction is still applied most frequently for this purpose. The present paper shows that high-temperature extraction cannot be applied for the analysis of chlorogenic acids (CQAs) and their derivatives in plants as it causes the CQAs transformation leading to erroneous quantitative estimations of these compounds. Experiments performed on different plants (black elder, hawthorn, nettle, yerba maté, St John's wort and green coffee) demonstrate that the most appropriate method for the estimation of CQAs/CQAs derivatives is sea sand disruption method (SSDM) because it does not induce any transformation and/or degradation processes in the analyzed substances. Owing to the SSDM method application we found that the investigated plants, besides four main CQAs, contain sixteen CQAs derivatives, among them three quinic acids. The application of SSDM in plant analysis not only allows to establish a true concentration of individual CQAs in the examined plants but also to determine which chlorogenic acids derivatives are native plant components and what is their concentration level. What is even more important, the application of SSDM in plant analysis allows to eliminate errors that may arise or might have arisen in the study of chlorogenic acids and their derivatives in plant metabolism. Copyright © 2015 Elsevier Ltd. All rights reserved.
Trostchansky, Andrés; Mastrogiovanni, Mauricio; Miquel, Ernesto; Rodríguez-Bottero, Sebastián; Martínez-Palma, Laura; Cassina, Patricia; Rubbo, Homero
2018-01-01
The lack of current treatments for amyotrophic lateral sclerosis (ALS) highlights the need of a comprehensive understanding of the biological mechanisms of the disease. A consistent neuropathological feature of ALS is the extensive inflammation around motor neurons and axonal degeneration, evidenced by accumulation of reactive astrocytes and activated microglia. Final products of inflammatory processes may be detected as a screening tool to identify treatment response. Herein, we focus on (a) detection of arachidonic acid (AA) metabolization products by lipoxygenase (LOX) and prostaglandin endoperoxide H synthase in SOD1G93A mice and (b) evaluate its response to the electrophilic nitro-oleic acid (NO2-OA). Regarding LOX-derived products, a significant increase in 12-hydroxyeicosatetraenoic acid (12-HETE) levels was detected in SOD1G93A mice both in plasma and brain whereas no changes were observed in age-matched non-Tg mice at the onset of motor symptoms (90 days-old). In addition, 15-hydroxyeicosatetraenoic acid (15-HETE) levels were greater in SOD1G93A brains compared to non-Tg. Prostaglandin levels were also increased at day 90 in plasma from SOD1G93A compared to non-Tg being similar in both types of animals at later stages of the disease. Administration of NO2-OA 16 mg/kg, subcutaneously (s/c) three times a week to SOD1G93A female mice, lowered the observed increase in brain 12-HETE levels compared to the non-nitrated fatty acid condition, and modified many others inflammatory markers. In addition, NO2-OA significantly improved grip strength and rotarod performance compared to vehicle or OA treated animals. These beneficial effects were associated with increased hemeoxygenase 1 (HO-1) expression in the spinal cord of treated mice co-localized with reactive astrocytes. Furthermore, significant levels of NO2-OA were detected in brain and spinal cord from NO2-OA -treated mice indicating that nitro-fatty acids (NFA) cross brain–blood barrier and reach the central
Diagnostic Methods for Bile Acid Malabsorption in Clinical Practice
Vijayvargiya, Priya; Camilleri, Michael; Shin, Andrea; Saenger, Amy
2013-01-01
Altered bile acid (BA) concentrations in the colon may cause diarrhea or constipation. BA malabsorption (BAM) accounts for >25% of patients with irritable bowel syndrome (IBS) with diarrhea and chronic diarrhea in Western countries. As BAM is increasingly recognized, proper diagnostic methods are desired in clinical practice to help direct the most effective treatment course for the chronic bowel dysfunction. This review appraises the methodology, advantages and disadvantages of 4 tools that directly measure BAM: 14C-glycocholate breath and stool test, 75Selenium HomotauroCholic Acid Test (SeHCAT), 7 α-hydroxy-4-cholesten-3-one (C4) and fecal BAs. 14C-glycocholate is a laborious test no longer widely utilized. 75SeHCAT is validated, but not available in the United States. Serum C4 is a simple, accurate method that is applicable to a majority of patients, but requires further clinical validation. Fecal measurements to quantify total and individual fecal BAs are technically cumbersome and not widely available. Regrettably, none of these tests are routinely available in the U.S., and a therapeutic trial with a BA binder is used as a surrogate for diagnosis of BAM. Recent data suggest there is an advantage to studying fecal excretion of the individual BAs and their role in BAM; this may constitute a significant advantage of the fecal BA method over the other tests. Fecal BA test could become a routine addition to fecal fat measurement in patients with unexplained diarrhea. In summary, availability determines the choice of test among C4, SeHCAT and fecal BA; more widespread availability of such tests would enhance clinical management of these patients. PMID:23644387
Liu, Benguo; Zeng, Jie; Chen, Chen; Liu, Yonglan; Ma, Hanjun; Mo, Haizhen; Liang, Guizhao
2016-03-01
Cyclodextrins (CDs) can be used to improve the solubility and stability of cinnamic acid derivatives (CAs). However, there was no detailed report about understanding the effects of the substituent groups in the benzene ring on the inclusion behavior between CAs and CDs in aqueous solution. Here, the interaction of β-CD with CAs, including caffeic acid, ferulic acid, and p-coumaric acid, in water was investigated by phase-solubility method, UV, fluorescence, and (1)H NMR spectroscopy, together with ONIOM (our Own N-layer Integrated Orbital molecular Mechanics)-based QM/MM (Quantum Mechanics/Molecular Mechanics) calculations. Experimental results demonstrated that CAs could form 1:1 stoichiometric inclusion complex with β-CD by non-covalent bonds, and that the maximum apparent stability constants were found in caffeic acid (176M(-1)) followed by p-coumaric acid (160M(-1)) and ferulic acid (133M(-1)). Moreover, our calculations reasonably illustrated the binding orientations of β-CD with CAs determined by experimental observations. Copyright © 2015. Published by Elsevier Ltd.
NASA Astrophysics Data System (ADS)
Takabe, Ryota; Yachi, Suguru; Tsukahara, Daichi; Toko, Kaoru; Suemasu, Takashi
2017-05-01
We grew BaSi2 films on Ge(111) substrates by various growth methods based on molecular beam epitaxy (MBE). First, we attempted to form BaSi2 films directly on Ge(111) by MBE without templates. We next formed BaSi2 films using BaGe2 templates as commonly used for MBE growth of BaSi2 on Si substrates. Contrary to our prediction, the lateral growth of BaSi2 was not promoted by these two methods; BaSi2 formed not into a continuous film but into islands. Although streaky patterns of reflection high-energy electron diffraction were observed inside the growth chamber, no X-ray diffraction lines of BaSi2 were observed in samples taken out from the growth chamber. Such BaSi2 islands were easily to get oxidized. We finally attempted to form a continuous BaSi2 template layer on Ge(111) by solid phase epitaxy, that is, the deposition of amorphous Ba-Si layers onto MBE-grown BaSi2 epitaxial islands, followed by post annealing. We achieved the formation of an approximately 5-nm-thick BaSi2 continuous layer by this method. Using this BaSi2 layer as a template, we succeeded in forming a-axis-oriented 520-nm-thick BaSi2 epitaxial films on Ge substrates, although (111)-oriented Si grains were included in the grown layer. We next formed a B-doped p-BaSi2(20 nm)/n-Ge(111) heterojunction solar cell. A wide-spectrum response from 400 to 2000 nm was achieved. At an external bias voltage of 1 V, the external quantum efficiency reached as high as 60%, demonstrating the great potential of BaSi2/Ge combination. However, the efficiency of a solar cell under AM1.5 illumination was quite low (0.1%). The origin of such a low efficiency was examined.
Effects of boric acid on experimental periodontitis and alveolar bone loss in rats.
Demirer, Serhat; Kara, M Isa; Erciyas, Kamile; Ozdemir, Hakan; Ozer, Hatice; Ay, Sinan
2012-01-01
The goal of the present study was to evaluate the histopathologic and morphometric effects of systemic boric acid in a rat periodontitis model. Twenty-four Wistar rats were divided into three groups of eight animals each: non-ligated (NL), ligature only (LO), and ligature and treated with boric acid (BA) (3mg/kg per day for 11 days). A 4/0 silk suture was placed in a subgingival position around the mandibular first molars; after 11 days the rats were sacrificed, and changes in alveolar bone levels were measured clinically and tissues were histopathologically examined to assess the differences amongst the study groups. The ratio of presence of inflammatory cell infiltration (ICI) and osteoclast number in the LO group was significantly higher than that of the NL and BA groups (p<0.05). The ratio of presence of osteoblastic activity in the LO group was significantly lower than that of the NL and BA groups (p<0.05). Alveolar bone loss was also significantly higher in the LO group compared to the BA and NL groups (p<005). This study has demonstrated that systemic administration of boric acid reduced periodontal inflammation and alveolar bone loss in periodontal disease in rats. Copyright © 2011 Elsevier Ltd. All rights reserved.
Amino derivatives of glycyrrhetinic acid as potential inhibitors of cholinesterases.
Schwarz, Stefan; Lucas, Susana Dias; Sommerwerk, Sven; Csuk, René
2014-07-01
The development of remedies against the Alzheimer's disease (AD) is one of the biggest challenges in medicinal chemistry nowadays. Although not completely understood, there are several strategies fighting this disease or at least bringing some relief. During the progress of AD, the level of acetylcholine (ACh) decreases; hence, a therapy using inhibitors should be of some benefit to the patients. Drugs presently used for the treatment of AD inhibit the two ACh controlling enzymes, acetylcholinesterase as well as butyrylcholinesterase; hence, the design of selective inhibitors is called for. Glycyrrhetinic acid seems to be an interesting starting point for the development of selective inhibitors. Although its glycon, glycyrrhetinic acid is known for being an AChE activator, several derivatives, altered in position C-3 and C-30, exhibited remarkable inhibition constants in micro-molar range. Furthermore, five representative compounds were subjected to three more enzyme assays (on carbonic anhydrase II, papain and the lipase from Candida antarctica) to gain information about the selectivity of the compounds in comparison to other enzymes. In addition, photometric sulforhodamine B assays using murine embryonic fibroblasts (NiH 3T3) were performed to study the cytotoxicity of these compounds. Two derivatives, bearing either a 1,3-diaminopropyl or a 1H-benzotriazolyl residue, showed a BChE selective inhibition in the single-digit micro-molar range without being cytotoxic up to 30μM. In silico molecular docking studies on the active sites of AChE and BChE were performed to gain a molecular insight into the mode of action of these compounds and to explain the pronounced selectivity for BChE. Copyright © 2014 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hummel, Jessica M.; Madeen, Erin P.; Siddens, Lisbeth K.
Benzo[a]pyrene (BaP), a polycyclic aromatic hydrocarbon (PAH), is a known human carcinogen. In non-smoking adults greater than 95% of BaP exposure is through diet. The carcinogenicity of BaP is utilized by the U.S. EPA to assess relative potency of complex PAH mixtures. PAH relative potency factors (RPFs, BaP=1) are determined from high dose animal data. Here we employed accelerator mass spectrometry (AMS) to determine pharmacokinetics of [ 14C]-BaP in humans following dosing with 46 ng (an order of magnitude lower than human dietary daily exposure and million-fold lower than animal cancer models). To assess the impact of co-administration of foodmore » with a complex PAH mixture, humans were dosed with 46 ng of [ 14C]-BaP with or without smoked salmon. Subjects were asked to avoid high BaP-containing diets and a 3-day dietary questionnaire given to assess dietary exposure prior to dosing and three days post-dosing with [ 14C]-BaP. Co-administration of smoked salmon, containing a complex mixture of PAHs with an RPF of 460 ng BaP eq, reduced and delayed absorption. Administration of canned commercial salmon, containing very low amounts of PAHs, showed the impacts on pharmacokinetics were not due to high amounts of PAHs but rather a food matrix effect.« less
Hummel, Jessica M.; Madeen, Erin P.; Siddens, Lisbeth K.; ...
2018-03-01
Benzo[a]pyrene (BaP), a polycyclic aromatic hydrocarbon (PAH), is a known human carcinogen. In non-smoking adults greater than 95% of BaP exposure is through diet. The carcinogenicity of BaP is utilized by the U.S. EPA to assess relative potency of complex PAH mixtures. PAH relative potency factors (RPFs, BaP=1) are determined from high dose animal data. Here we employed accelerator mass spectrometry (AMS) to determine pharmacokinetics of [ 14C]-BaP in humans following dosing with 46 ng (an order of magnitude lower than human dietary daily exposure and million-fold lower than animal cancer models). To assess the impact of co-administration of foodmore » with a complex PAH mixture, humans were dosed with 46 ng of [ 14C]-BaP with or without smoked salmon. Subjects were asked to avoid high BaP-containing diets and a 3-day dietary questionnaire given to assess dietary exposure prior to dosing and three days post-dosing with [ 14C]-BaP. Co-administration of smoked salmon, containing a complex mixture of PAHs with an RPF of 460 ng BaP eq, reduced and delayed absorption. Administration of canned commercial salmon, containing very low amounts of PAHs, showed the impacts on pharmacokinetics were not due to high amounts of PAHs but rather a food matrix effect.« less
Mhlongo, M I; Tugizimana, F; Piater, L A; Steenkamp, P A; Madala, N E; Dubery, I A
2017-01-22
To counteract biotic stress factors, plants employ multilayered defense mechanisms responsive to pathogen-derived elicitor molecules, and regulated by different phytohormones and signaling molecules. Here, lipopolysaccharide (LPS), a microbe-associated molecular pattern (MAMP) molecule, was used to induce defense responses in Nicotiana tabacum cell suspensions. Intracellular metabolites were extracted with methanol and analyzed using a liquid chromatography-mass spectrometry (UHPLC-qTOF-MS/MS) platform. The generated data were processed and examined with multivariate and univariate statistical tools. The results show time-dependent dynamic changes and accumulation of glycosylated signaling molecules, specifically those of azelaic acid, salicylic acid and methyl-salicylate as contributors to the altered metabolomic state in LPS-treated cells. Copyright © 2016 Elsevier Inc. All rights reserved.
Brunswick, Pamela; Hewitt, L Mark; Frank, Richard A; Kim, Marcus; van Aggelen, Graham; Shang, Dayue
2017-02-23
The advantage of using naphthenic acid (NA) mixtures for the determination of total NA lies in their chemical characteristics and identification of retention times distinct from isobaric interferences. However, the differing homolog profiles and unknown chemical structures of NA mixtures do not allow them to be considered a traceable reference material. The current study provides a new tool for the comparative assessment of different NA mixtures by direct reference to a single, well-defined and traceable compound, decanoic-d 19 acid. The method employed an established liquid chromatography time-of-flight mass spectrometry (LC/QToF) procedure that was applicable both to the classic O2 NA species dominating commercial mixtures and additionally to the O4 species known to be present in acid extractable organics (AEOs) derived from oil sands process water (OSPW). Four different commercial NA mixtures and one OSPW-derived AEOs mixture were comparatively assessed. Results showed significant difference among Merichem Technical, Aldrich, Acros, and Kodak commercial NA mixtures with respect to "equivalent to decanoic-d 19 acid" concentration ratios to nominal. Furthermore, different lot numbers of single commercial NA mixtures were found to be inconsistent with respect to their homolog content by percent response. Differences in the observed homolog content varied significantly, particularly at the lower (n = 9-14) and higher (n = 20-23) carbon number ranges. Results highlighted the problem between using NA mixtures from different sources and different lot numbers but offered a solution to the problem from a concentration perspective. It is anticipated that this tool may be utilized in review of historical data in addition to future studies, such as the study of OSPW derived acid extractable organics (AEOs) and fractions employed during toxicological studies.
Dobson, Tresha E; Maxwell, Anderson R; Ramsubhag, Adesh
2018-07-01
Six cholic acid derivatives (1-6) were isolated from broth cultures of Bacillus amyloliquefaciens UWI-W23, an isolate from the Trinidad Pitch Lake. The compounds were extracted via solvent extraction and/or XAD resin adsorption and purified using silica gel column chromatography. Their structures were elucidated using 1D, 2D NMR and ESI-MS spectrometry and FT-IR spectrophotometry. One of the compounds, taurodeoxycholate (2) is for the first time being reported from a bacterial source while deoxycholate (4) is for the first time being reported from a Gram-positive bacterium. The other compounds have not been previously isolated from Bacillus spp. viz. cholate (1), taurocholic acid (3); glycodeoxycholic acid (5) and glycocholic acid (6). All six compounds exhibited antimicrobial activity against P. aeruginosa and B. cereus with MICs ranging from 7 to 250 µg/mL. Cholate (1) also showed activity against MRSA (MICs = 125 µg/mL) and glycocholic acid (6) against S. cerevisiae (MICs = 15.6 µg/mL). Copyright © 2018 Elsevier Inc. All rights reserved.
Teratologic Evaluation of a Model Perfluorinated Acid, NDFDA
1981-01-01
perfluorocarboxylic and perfluorosulfonic acids. I & G Product Research and Development. Vol. 1, No. 3, 165-169. Olson, C. T. and K. C. Back 1978...AFAMRL-TR-81 -14 TERATOLOGIC EVALUATION OF A MODEL PERFLUORINATED ACID, NDFDA INEZ R. BA CON UNIVERSITY OF THE DISTRICT OF COLUMBIA DEPARTMENT OF...TYPE OF REPORT & PERIOD COVERED TERATOLOGIC EVALUATION OF A MODEL PERFLUORINATED ACID, NDFDA 6. PERFORMING ORG. REPORT NUMBER 7. AUTHOR(s) S. CONTRACT
Posa, Mihalj; Pilipović, Ana; Lalić, Mladena; Popović, Jovan
2011-02-15
Linear dependence between temperature (t) and retention coefficient (k, reversed phase HPLC) of bile acids is obtained. Parameters (a, intercept and b, slope) of the linear function k=f(t) highly correlate with bile acids' structures. Investigated bile acids form linear congeneric groups on a principal component (calculated from k=f(t)) score plot that are in accordance with conformations of the hydroxyl and oxo groups in a bile acid steroid skeleton. Partition coefficient (K(p)) of nitrazepam in bile acids' micelles is investigated. Nitrazepam molecules incorporated in micelles show modified bioavailability (depo effect, higher permeability, etc.). Using multiple linear regression method QSAR models of nitrazepams' partition coefficient, K(p) are derived on the temperatures of 25°C and 37°C. For deriving linear regression models on both temperatures experimentally obtained lipophilicity parameters are included (PC1 from data k=f(t)) and in silico descriptors of the shape of a molecule while on the higher temperature molecular polarisation is introduced. This indicates the fact that the incorporation mechanism of nitrazepam in BA micelles changes on the higher temperatures. QSAR models are derived using partial least squares method as well. Experimental parameters k=f(t) are shown to be significant predictive variables. Both QSAR models are validated using cross validation and internal validation method. PLS models have slightly higher predictive capability than MLR models. Copyright © 2010 Elsevier B.V. All rights reserved.
Methods for diagnosis of bile acid malabsorption in clinical practice.
Vijayvargiya, Priya; Camilleri, Michael; Shin, Andrea; Saenger, Amy
2013-10-01
Altered concentrations of bile acid (BA) in the colon can cause diarrhea or constipation. More than 25% of patients with irritable bowel syndrome with diarrhea or chronic diarrhea in Western countries have BA malabsorption (BAM). As BAM is increasingly recognized, proper diagnostic methods are needed to help direct the most effective course of treatment for the chronic bowel dysfunction. We review the methodologies, advantages, and disadvantages of tools that directly measure BAM: the (14)C-glycocholate breath and stool test, the (75)selenium homotaurocholic acid test (SeHCAT), and measurements of 7 α-hydroxy-4-cholesten-3-one (C4) and fecal BAs. The (14)C-glycocholate test is laborious and no longer widely used. The (75)SeHCAT has been validated but is not available in the United States. Measurement of serum C4 is a simple and accurate method that can be used for most patients but requires further clinical validation. Assays to quantify fecal BA (total and individual levels) are technically cumbersome and not widely available. Regrettably, none of these tests are routinely available in the United States; assessment of the therapeutic effects of a BA binder is used as a surrogate for diagnosis of BAM. Recent data indicate the advantages to studying fecal excretion of individual BAs and their role in BAM; these could support the use of the fecal BA assay, compared with other tests. Measurement of fecal BA levels could become a routine addition to the measurement of fecal fat in patients with unexplained diarrhea. Availability ultimately determines whether the C4, SeHCAT, or fecal BA test is used; more widespread availability of such tests would enhance clinical management of these patients. Copyright © 2013 AGA Institute. Published by Elsevier Inc. All rights reserved.
Hirakawa, A; Shimizu, K; Fukumitsu, H; Soumiya, H; Iinuma, M; Furukawa, S
2010-12-29
There is increasing evidence that omega-3 polyunsaturated fatty acids (PUFAs) have therapeutic potential in various animal models of neuronal injury. However, very few studies have examined the effect of medium-chain fatty acids (MCFAs) on neuronal injury. So in the present study we synthesized various MCFAs and their derivatives, and found that exposure to trans-2-decenoic acid ethyl ester (DAEE) markedly activated extracellular signal-regulated protein kinases 1 and 2 (ERK1/2) in cultured cortical neurons. Therefore, we examined the effect of DAEE treatment on a rat model of spinal cord injury. DAEE (150 μg/kg body weight) administered after hemisection of the spinal cord resulted in improved functional recovery, decreased the lesion size, increased the activation of ERK1/2, and enhanced the expression of bcl-2 and brain-derived neurotrophic factor (BDNF) mRNA in the injury site of the spinal cord. Furthermore, it also increased neuronal survival after spinal cord injury. These results indicate that the possibility that DAEE will become a promising tool for reducing the secondary damage observed following primary physical injury to the spinal cord. Copyright © 2010 IBRO. Published by Elsevier Ltd. All rights reserved.
Cai, Enbo; Guo, Shijie; Yang, Limin; Han, Mei; Xia, Jing; Zhao, Yan; Gao, Xiaorui; Wang, Yu
2018-02-01
Arctigenin (ARG) is famous in its abundant pharmacological activity. However, many researches in it entered the bottleneck period because of its poor water solubility. The derivatives of ARG have been synthesised with five amino acids which have t-Butyloxy carbonyl (BOC) as a protective group. We examined the effects of removing BOC. The results showed that the amino acid derivatives without protective group have better water solubility and nitrite-clearing ability than ARG. Based on these results, ARG6' and ARG9' were selected at a dosage of 40 mg/kg to evaluate their antitumour activity. The percentage inhibition rate of ARG6' and ARG9' were 55.87 and 51.40, respectively, which was twice as much as ARG. Furthermore, they could increase liver and kidney indexes and produce less damage in these organs. In brief, this study provides a basis for new drug development.
Phase relationships in the BaO-Ga2O3-Ta2O5 system and the structure of Ba6Ga21TaO40.
Cao, Jiang; Yu, Xiaodi; Kuang, Xiaojun; Su, Qiang
2012-07-16
Phase relationships in the BaO-Ga(2)O(3)-Ta(2)O(5) ternary system at 1200 °C were determined. The A(6)B(10)O(30) tetragonal tungsten bronze (TTB) related solution in the BaO-Ta(2)O(5) subsystem dissolved up to ~11 mol % Ga(2)O(3), forming a ternary trapezoid-shaped TTB-related solid solution region defined by the BaTa(2)O(6), Ba(1.1)Ta(5)O(13.6), Ba(1.58)Ga(0.92)Ta(4.08)O(13.16), and Ba(6)GaTa(9)O(30) compositions in the BaO-Ga(2)O(3)-Ta(2)O(5) system. Two ternary phases Ba(6)Ga(21)TaO(40) and eight-layer twinned hexagonal perovskite solid solution Ba(8)Ga(4-x)Ta(4+0.6x)O(24) were confirmed in the BaO-Ga(2)O(3)-Ta(2)O(5) system. Ba(6)Ga(21)TaO(40) crystallized in a monoclinic cell of a = 15.9130(2) Å, b = 11.7309(1) Å, c = 5.13593(6) Å, β = 107.7893(9)°, and Z = 1 in space group C2/m. The structure of Ba(6)Ga(21)TaO(40) was solved by the charge flipping method, and it represents a three-dimensional (3D) mixed GaO(4) tetrahedral and GaO(6)/TaO(6) octahedral framework, forming mixed 1D 5/6-fold tunnels that accommodate the Ba cations along the c axis. The electrical property of Ba(6)Ga(21)TaO(40) was characterized by using ac impedance spectroscopy.
Hu, Shuang; Yang, Xiao; Xue, Jiao; Chen, Xuan; Bai, Xiao-Hong; Yu, Zhi-Hui
2017-07-01
A novel graphene/dodecanol floating solidification microextraction followed by HPLC with diode-array detection has been developed to extract trace levels of four cinnamic acid derivatives in traditional Chinese medicines. Several parameters affecting the performance were investigated and optimized. Also, possible microextraction mechanism was analyzed and discussed. Under the optimum conditions (amount of graphene in dodecanol: 0.25 mg/mL; volume of extraction phase: 70 μL; pH of sample phase: 3; extraction time: 30 min; stirring rate: 1000 rpm; salt amount: 26.5% NaCl; volume of sample phase: 10 mL, and without dispersant addition), the enrichment factors of four cinnamic acid derivatives ranged from 26 to 112, the linear ranges were 1.0 × 10 -2 -10.0 μg/mL for caffeic acid, 1.3 × 10 -3 -1.9 μg/mL for p-hydroxycinnamic acid, 2.8 × 10 -3 -4.1 μg/mL for ferulic acid, and 2.7 × 10 -3 -4.1 μg/mL for cinnamic acid, with r 2 ≥ 0.9993. The detection limits were found to be in the range of 0.1-1.0 ng/mL, and satisfactory recoveries (92.5-111.2%) and precisions (RSDs 1.1-9.5%) were also achieved. The results showed that the approach is simple, effective and sensitive for the preconcentration and determination of trace levels of cinnamic acid derivatives in Chinese medicines. The proposed method was compared with conventional dodecanol floating solidification microextraction and other extraction methods. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Dysregulated hepatic bile acids collaboratively promote liver carcinogenesis
Xie, Guoxiang; Wang, Xiaoning; Huang, Fengjie; Zhao, Aihua; Chen, Wenlian; Yan, Jingyu; Zhang, Yunjing; Lei, Sha; Ge, Kun; Zheng, Xiaojiao; Liu, Jiajian; Su, Mingming; Liu, Ping; Jia, Wei
2017-01-01
Dysregulated bile acids (BAs) are closely associated with liver diseases and attributed to altered gut microbiota. Here, we show that the intrahepatic retention of hydrophobic BAs including deoxycholate (DCA), taurocholate (TCA), taurochenodeoxycholate (TCDCA), and taurolithocholate (TLCA) were substantially increased in a streptozotocin and high fat diet (HFD) induced nonalcoholic steatohepatitis-hepatocellular carcinoma (NASH-HCC) mouse model. Additionally chronic HFD-fed mice spontaneously developed liver tumors with significantly increased hepatic BA levels. Enhancing intestinal excretion of hydrophobic BAs in the NASH-HCC model mice by a 2% cholestyramine feeding significantly prevented HCC development. The gut microbiota alterations were closely correlated with altered BA levels in liver and feces. HFD-induced inflammation inhibited key BA transporters, resulting in sustained increases in intrahepatic BA concentrations. Our study also showed a significantly increased cell proliferation in BA treated normal human hepatic cell lines and a down-regulated expression of tumor suppressor gene CEBPα in TCDCA treated HepG2 cell line, suggesting that several hydrophobic BAs may collaboratively promote liver carcinogenesis. PMID:27273788
Dang, Zhao; Qian, Keduo; Ho, Phong; Zhu, Lei; Lee, Kuo-Hsiung; Huang, Li; Chen, Chin-Ho
2012-08-15
Betulinic acid derivatives modified at the C28 position are HIV-1entry inhibitors such as compound A43D; however, modified at the C3 position instead of C28 give HIV-1 maturation inhibitor such as bevirimat. Bevirimat exhibited promising pharmacokinetic profiles in clinical trials, but its effectiveness was compromised by the high baseline drug resistance of HIV-1 variants with polymorphism in the putative drug binding site. In an effort to determine whether the viruses with bevirimat resistant polymorphism also altered their sensitivities to the betulinic acid derivatives that inhibit HIV-1 entry, a series of new betulinic acid entry inhibitors were synthesized and tested for their activities against HIV-1 NL4-3 and NL4-3 variants resistant to bevirimat. The results show that the bevirimat resistant viruses were approximately 5- to10-fold more sensitive to three new glutamine ester derivatives (13, 15 and 38) and A43D in an HIV-1 multi-cycle replication assay. In contrast, the wild type NL4-3 and the bevirimat resistant variants were equally sensitive to the HIV-1 RT inhibitor AZT. In addition, these three new compounds markedly improved microsomal stability compared to A43D. Copyright © 2012 Elsevier Ltd. All rights reserved.
Growth and characterization of BaZnGa
Jo, Na Hyun; Lin, Qisheng; Nguyen, Manh Cuong; ...
2017-10-20
In this paper, we report the growth, structure and characterization of BaZnGa, identifying it as the sole known ternary compound in the Ba–Zn–Ga system. Single crystals of BaZnGa can be grown out of excess Ba–Zn and adopt a tI36 structure type. There are three unique Ba sites and three M = Zn/Ga sites. Using DFT calculations we can argue that whereas one of these three M sites is probably solely occupied by Ga, the other two M sites, most likely, have mixed Zn/Ga occupancy. Finally, temperature-dependent resistivity and magnetization measurements suggest that BaZnGa is a poor metal with no electronicmore » or magnetic phase transitions between 1.8 and 300 K.« less
Farnesylthiosalicylic acid sensitizes hepatocarcinoma cells to artemisinin derivatives
Wu, Liping; Pang, Yilin; Qin, Guiqi; Xi, Gaina; Wu, Shengnan; Wang, Xiaoping; Chen, Tongsheng
2017-01-01
Dihydroartemisinin (DHA) and artesunate (ARS), two artemisinin derivatives, have efficacious anticancer activities against human hepatocarcinoma (HCC) cells. This study aims to study the anticancer action of the combination treatment of DHA/ARS and farnesylthiosalicylic acid (FTS), a Ras inhibitor, in HCC cells (Huh-7 and HepG2 cell lines). FTS pretreatment significantly enhanced DHA/ARS-induced phosphatidylserine (PS) externalization, Bak/Bax activation, mitochondrial membrane depolarization, cytochrome c release, and caspase-8 and -9 activations, characteristics of the extrinsic and intrinsic apoptosis. Pretreatment with Z-IETD-FMK (caspase-8 inhibitor) potently prevented the cytotoxicity of the combination treatment of DHA/ARS and FTS, and pretreatment with Z-VAD-FMK (pan-caspase inhibitor) significantly inhibited the loss of ΔΨm induced by DHA/ARS treatment or the combination treatment of DHA/ARS and FTS in HCC cells. Furthermore, silencing Bak/Bax modestly but significantly inhibited the cytotoxicity of the combination treatment of DHA/ARS and FTS. Interestingly, pretreatment with an antioxidant N-Acetyle-Cysteine (NAC) significantly prevented the cytotoxicity of the combination treatment of DHA and FTS instead of the combination treatment of ARS and FTS, suggesting that reactive oxygen species (ROS) played a key role in the anticancer action of the combination treatment of DHA and FTS. Similar to FTS, DHA/ARS also significantly prevented Ras activation. Collectively, our data demonstrate that FTS potently sensitizes Huh-7 and HepG2 cells to artemisinin derivatives via accelerating the extrinsic and intrinsic apoptotic pathways. PMID:28182780
A new p-hydroxybenzoic acid derivative from an endophytic fungus Penicillium sp. of Nerium indicum.
Ma, Yang-Min; Qiao, Ke; Kong, Yang; Guo, Lin-Xin; Li, Meng-Yun; Fan, Chao
2017-12-01
A new p-hydroxybenzoic acid derivative named 4-(2'R, 4'-dihydroxybutoxy) benzoic acid (1) was isolated from the fermentation of Penicillium sp. R22 in Nerium indicum. The structure was elucidated by means of spectroscopic (HR-ESI-MS, NMR, IR, UV) and X-ray crystallographic methods. The antibacterial and antifungal activity of compound 1 was tested, and the results showed that compound 1 revealed potent antifungal activity against Colletotrichum gloeosporioides, Alternaria alternata, and Alteranria brassicae with MIC value of 31.2 μg/ml.
Boric acid inhibits alveolar bone loss in rats by affecting RANKL and osteoprotegerin expression.
Sağlam, M; Hatipoğlu, M; Köseoğlu, S; Esen, H H; Kelebek, S
2014-08-01
The goal of the present study was to evaluate the effects of systemic boric acid on the levels of expression of RANKL and osteoprotegerin (OPG) and on histopathologic and histometric changes in a rat periodontitis model. Twenty-four Wistar rats were divided into three groups of eight animals each: nonligated (NL); ligature only (LO); and ligature plus treatment with boric acid (BA) (3 mg/kg per day for 11 d). A 4/0 silk suture was placed in a subgingival position around the mandibular right first molars; after 11 d the rats were killed, and alveolar bone loss in the first molars was histometrically determined. Periodontal tissues were examined histopathologically to assess the differences among the study groups. RANKL and OPG were detected immunohistochemically. Alveolar bone loss was significantly higher in the LO group than in the BA and NL groups (p < 0.05). The number of inflammatory infiltrate and osteoclasts in the LO group was significantly higher than that in the NL and BA groups (p < 0.05). The numbers of osteoblasts in LO and BA groups were significantly higher compared with NL group (p < 0.05). There were significantly more RANKL-positive cells in the LO group than in the BA and NL groups (p < 0.05). There was a higher number of OPG-positive cells in the BA group than in the LO and NL groups (p < 0.05). The present study shows that systemic administration of boric acid may reduce alveolar bone loss by affecting the RANKL/OPG balance in periodontal disease in rats. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
40 CFR 721.1675 - Disulfonic acid rosin amine salt of a benzidine derivative (generic name).
Code of Federal Regulations, 2010 CFR
2010-07-01
... PROTECTION AGENCY (CONTINUED) TOXIC SUBSTANCES CONTROL ACT SIGNIFICANT NEW USES OF CHEMICAL SUBSTANCES Significant New Uses for Specific Chemical Substances § 721.1675 Disulfonic acid rosin amine salt of a benzidine derivative (generic name). (a) Chemical substance and significant new uses subject to reporting...
Antibacterial Effects of Glycyrrhetinic Acid and Its Derivatives on Staphylococcus aureus
Oyama, Kentaro; Kawada-Matsuo, Miki; Oogai, Yuichi; Hayashi, Tetsuya; Nakamura, Norifumi; Komatsuzawa, Hitoshi
2016-01-01
Staphylococcus aureus is a major pathogen in humans and causes serious problems due to antibiotic resistance. We investigated the antimicrobial effect of glycyrrhetinic acid (GRA) and its derivatives against 50 clinical S. aureus strains, including 18 methicillin-resistant strains. The minimum inhibitory concentrations (MICs) of GRA, dipotassium glycyrrhizate, disodium succinoyl glycyrrhetinate (GR-SU), stearyl glycyrrhetinate and glycyrrhetinyl stearate were evaluated against various S. aureus strains. Additionally, we investigated the bactericidal effects of GRA and GR-SU against two specific S. aureus strains. DNA microarray analysis was also performed to clarify the mechanism underlying the antibacterial activity of GR-SU. We detected the antimicrobial activities of five agents against S. aureus strains. GRA and GR-SU showed strong antibacterial activities compared to the other three agents tested. At a higher concentration (above 2x MIC), GRA and GR-SU showed bactericidal activity, whereas at a concentration of 1x MIC, they showed a bacteriostatic effect. Additionally, GRA and GR-SU exhibited a synergistic effect with gentamicin. The expression of a large number of genes (including transporters) and metabolic factors (carbohydrates and amino acids) was altered by the addition of GR-SU, suggesting that the inhibition of these metabolic processes may influence the degree of the requirement for carbohydrates or amino acids. In fact, the requirement for carbohydrates or amino acids was increased in the presence of either GRA or GR-SU. GRA and GR-SU exhibited strong antibacterial activity against several S. aureus strains, including MRSA. This activity may be partly due to the inhibition of several pathways involved in carbohydrate and amino acid metabolism. PMID:27820854
The interaction of NO2 with BaO: from cooperative adsorption to Ba(NO3)2 formation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yi, Cheol-Woo W.; Kwak, Ja Hun; Szanyi, Janos
2007-10-25
The effect of water on the morphology of BaO/Al2O3-based NOx storage materials was investigated using Fourier transform infrared spectroscopy, temperature programmed desorption, and time-resolved synchrotron X-ray diffraction techniques. The results of this multi-spectroscopy study reveal that, in the presence of water, surface Ba-nitrates convert to bulk nitrates, and water facilitates the formation of large Ba(NO3)2 particles. The conversion of surface to bulk Ba-nitrates is completely reversible, i.e. after the removal of water from the storage material a significant fraction of the bulk nitrates re-convert to surface nitrates. NO2 exposure of a H2O-containing (wet) BaO/Al2O3 sample results in the formation ofmore » nitrites and bulk nitrates exclusively, i.e. no surface nitrates form. After further exposure to NO2, the nitrites completely convert to bulk nitrates. The amount of NOx taken up by the storage material is, however, essentially unaffected by the presence of water, regardless of whether the water was dosed prior to or after NO2 exposure. Based on the results of this study we are now able to explain most of the observations reported in the literature on the effect of water on NOx uptake on similar storage materials.« less
Raghi, K R; Sherin, D R; Saumya, M J; Arun, P S; Sobha, V N; Manojkumar, T K
2018-04-05
Chronic myeloid leukemia (CML), a hematological malignancy arises due to the spontaneous fusion of the BCR and ABL gene, resulting in a constitutively active tyrosine kinase (BCR-ABL). Pharmacological activity of Gallic acid and 1,3,4-Oxadiazole as potential inhibitors of ABL kinase has already been reported. Objective of this study is to evaluate the ABL kinase inhibitory activity of derivatives of Gallic acid fused with 1,3,4-Oxadiazole moieties. Attempts have been made to identify the key structural features responsible for drug likeness of the Gallic acid and the 1,3,4-Oxadiazole ring using molecular electrostatic potential maps (MESP). To investigate the inhibitory activity of Gallic acid derivatives towards the ABL receptor, we have applied molecular docking and molecular dynamics (MD) simulation approaches. A comparative study was performed using Bosutinib as the standard which is an approved CML drug acting on the same receptor. Furthermore, the novel compounds designed and reported here in were evaluated for ADME properties and the results indicate that they show acceptable pharmacokinetic properties. Accordingly these compounds are predicted to be drug like with low toxicity potential. Copyright © 2018 Elsevier Ltd. All rights reserved.
Amić, Ana; Marković, Zoran; Klein, Erik; Dimitrić Marković, Jasmina M; Milenković, Dejan
2018-04-25
The role of antiradical moieties (catechol, guaiacyl and carboxyl group) and molecular conformation in antioxidative potency of dihydrocaffeic acid (DHCA) and dihydroferulic acid (DHFA) was investigated by density functional theory (DFT) method. The thermodynamic preference of different reaction paths of double (2H + /2e - ) free radical scavenging mechanisms was estimated. Antiradical potency of DHCA and DHFA was compared with that exerted by their unsaturated analogs - caffeic acid (CA) and ferulic acid (FA). Cis/trans and anti-isomers of studied cinnamic acid derivatives may scavenge free radicals via double processes by involvement of catechol or guaiacyl moiety. Carboxyl group of syn-isomers may also participate in the inactivation of free radicals. Gibbs free energies of reactions with various free radicals indicate that syn-DHCA and syn-DHFA, colon catabolites that could be present in systemic circulation in low μM concentrations, have a potential to contribute to health benefits by direct free radical scavenging. Copyright © 2017 Elsevier Ltd. All rights reserved.
Self-Assembled Structures of Benzoic Acid on Au(111) Surface
NASA Astrophysics Data System (ADS)
Vu, Thu-Hien; Wandlowski, Thomas
2017-06-01
Electrochemical scanning tunneling microscopy combined with cyclic voltammetry were employed to explore the self-assembly of benzoic acid (BA) on a Au(111) substrate surface in a 0.1-M HClO4 solution. At the negatively charged surface, BA molecules form two highly ordered physisorbed adlayers with their phenyl rings parallel to the substrate surface. High-resolution scanning tunneling microscopy images reveal the packing arrangement and internal molecular structures. The striped pattern and zigzag structure of the BA adlayers are composed of parallel rows of dimers, in which two BA molecules are bound through a pair of O-H···O hydrogen bonds. Increasing the electrode potential further to positive charge densities of Au(111) leads to the desorption of the physisorbed hydrogen-bonded networks and the formation of a chemisorbed adlayer. BA molecules change their orientation from planar to upright fashion, which is accompanied by the deprotonation of the carboxyl group. Furthermore, potential-induced formation and dissolution of BA adlayers were also investigated. Structural transitions between the various types of ordered adlayers occur according to a nucleation and growth mechanism.
Khattab, Sherine Nabil; Haiba, Nesreen Saied; Asal, Ahmed Mosaad; Bekhit, Adnan A; Guemei, Aida A; Amer, Adel; El-Faham, Ayman
2017-02-15
A new small library of 2-aminobenzoyl amino acid hydrazide derivatives and quinazolinones derivatives was synthesized and fully characterized by IR, NMR, and elemental analysis. The activity of the prepared compounds on the growth of Leishmania aethiopica promastigotes was evaluated. 2-Benzoyl amino acid hydrazide showed higher inhibitory effect than the quinazoline counterpart. The in vitro antipromastigote activity demonstrated that compounds 2a, 2b, 2f and 4a had IC 50 better than standard drug miltefosine and comparable activity to amphotericin B deoxycholate, which indicates their high antileishmanial activity against Leishmania. aethiopica. Among the prepared compounds; 2-amino-N-(6-hydrazinyl-6-oxohexyl)benzamide 2f (IC 50 =0.051μM) has the best activity, 154 folds more active than reference standard drug miltefosine (IC 50 =7.832μM), and half fold the activity of amphotericin B (IC 50 =0.035μM). In addition, this compound was safe and well tolerated by experimental animals orally up to 250mg/kg and parenterally up to 100mg/kg. Copyright © 2017 Elsevier Ltd. All rights reserved.
Xu, Haining; Zhang, Xiaoming; Karangwa, Eric; Xia, Shuqin
2017-09-01
Up to now, only limited research on enzymatic browning inhibition capacity (BIC) of Maillard reaction products (MRPs) has been reported and there are still no overall and systematic researches on MRPs derived from different amino acids. In the present study, BIC and antioxidant capacity, including 2,2-diphenyl-1-picrylhydrazyl radical scavenging activity and Fe 2+ reducing power activity, of the MRPs derived from 12 different amino acids and three reducing sugars were investigated. The MRPs of cysteine (Cys), cystine, arginine (Arg) and histidine (His) showed higher BIC compared to other amino acids. Lysine (Lys)-MRPs showed the highest absorbance value at 420 nm (A 420 ) but very limited BIC, whereas Cys-MRPs, showed the highest BIC and the lowest A 420 . The A 420 can roughly reflect the trend of BIC of MRPs from different amino acids, except Cys and Lys. MRPs from tyrosine (Tyr) showed the most potent antioxidant capacity but very limited BIC, whereas Cys-MRPs showed both higher antioxidant capacity and BIC compared to other amino acids. Partial least squares regression analysis showed positive and significant correlation between BIC and Fe 2+ reducing power of MRPs from 12 amino acids with glucose or fructose, except Lys, Cys and Tyr. The suitable pH for generating efficient browning inhibition compounds varies depending on different amino acids: acidic pH was favorable for Cys, whereas neutral and alkaline pH were suitable for His and Arg, respectively. Increasing both heating temperature and time over a certain range could improve the BIC of MRPs of Cys, His and Arg, whereas any further increase deteriorates their browning inhibition efficiencies. The types of amino acid, initial pH, temperature and time of the Maillard reaction were found to greatly influence the BIC and antioxidant capacity of the resulting MRPs. There is no clear relationship between BIC and the antioxidant capacity of MRPs when reactant type and processing parameters of the Maillard
Evolution in Medicinal Chemistry of Ursolic Acid Derivatives as Anticancer Agents
Chen, Haijun; Gao, Yu; Wang, Ailan; Zhou, Xiaobin; Zheng, Yunquan; Zhou, Jia
2015-01-01
Currently, there is a renewed interest in common dietaries and plant-based traditional medicines for the prevention and treatment of cancer. In the search for potential anticancer agents from natural sources, ursolic acid (UA), a pentacyclic triterpenoid widely found in various medicinal herbs and fruits, exhibits powerful biological effects including its attractive anticancer activity against various types of cancer cells. However, the limited solubility, rapid metabolism and poor bioavailability of UA restricted its further clinical applications. In the past decade, with substantial progress toward the development of new chemical entities for the treatment of cancer, numerous UA derivatives have been designed and prepared to overcome its disadvantages. Despite extensive effort, discovery of effective UA derivatives has so far met with only limited success. This review summarizes the current status of the structural diversity and evolution in medicinal chemistry of UA analogues and provides a detailed discussion of future direction for further research in the chemical modifications of UA. PMID:25617694
Lickteig, Andrew J; Csanaky, Iván L; Pratt-Hyatt, Matthew; Klaassen, Curtis D
2016-06-01
Activation of Constitutive Androstane Receptor (CAR) protects against bile acid (BA)-induced liver injury. This study was performed to determine the effect of CAR activation on bile flow, BA profile, as well as expression of BA synthesis and transport genes. Synthetic CAR ligand 1,4-bis-[2-(3,5-dichloropyridyloxy)]benzene (TCPOBOP) was administered to mice for 4 days. BAs were quantified by UPLC-MS/MS (ultraperformance liquid chromatography-tandem mass spectrometry). CAR activation decreases total BAs in livers of male (49%) and female mice (26%), largely attributable to decreases of the 12α-hydroxylated BA taurocholic acid (T-CA) (males (M) 65%, females (F) 45%). Bile flow in both sexes was increased by CAR activation, and the increases were BA-independent. CAR activation did not alter biliary excretion of total BAs, but overall BA composition changed. Excretion of muricholic (6-hydroxylated) BAs was increased in males (101%), and the 12α-OH proportion of biliary BAs was decreased in both males (37%) and females (28%). The decrease of T-CA in livers of males and females correlates with the decreased mRNA of the sterol 12α-hydroxylase Cyp8b1 in males (71%) and females (54%). As a response to restore BAs to physiologic concentrations in liver, mRNA of Cyp7a1 is upregulated following TCPOBOP (males 185%, females 132%). In ilea, mRNA of the negative feedback regulator Fgf15 was unaltered by CAR activation, indicating biliary BA excretion was sufficient to maintain concentrations of total BAs in the small intestine. In summary, the effects of CAR activation on BAs in male and female mice are quite similar, with a marked decrease in the major BA T-CA in the liver. © The Author 2016. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Armentrout, P B; Yang, Bo; Rodgers, M T
2014-04-24
Metal cation-amino acid interactions are key components controlling the secondary structure and biological function of proteins, enzymes, and macromolecular complexes comprising these species. Determination of pairwise interactions of alkali metal cations with amino acids provides a thermodynamic vocabulary that begins to quantify these fundamental processes. In the present work, we expand a systematic study of such interactions by examining rubidium and cesium cations binding with the acidic amino acids (AA), aspartic acid (Asp) and glutamic acid (Glu), and their amide derivatives, asparagine (Asn) and glutamine (Gln). These eight complexes are formed using electrospray ionization and their bond dissociation energies (BDEs) are determined experimentally using threshold collision-induced dissociation with xenon in a guided ion beam tandem mass spectrometer. Analyses of the energy-dependent cross sections include consideration of unimolecular decay rates, internal energy of the reactant ions, and multiple ion-neutral collisions. Quantum chemical calculations are conducted at the B3LYP, MP2(full), and M06 levels of theory using def2-TZVPPD basis sets, with results showing reasonable agreement with experiment. At 0 and 298 K, most levels of theory predict that the ground-state conformers for M(+)(Asp) and M(+)(Asn) involve tridentate binding of the metal cation to the backbone carbonyl, amino, and side-chain carbonyl groups, although tridentate binding to the carboxylic acid group and side-chain carbonyl is competitive for M(+)(Asn). For the two longer side-chain amino acids, Glu and Gln, multiple structures are competitive. A comparison of these results to those for the smaller alkali cations, Na(+) and K(+), provides insight into the trends in binding energies associated with the molecular polarizability and dipole moment of the side chain. For all four metal cations, the BDEs are inversely correlated with the size of the metal cation and follow the order Asp < Glu
Delekta, Phillip C; Shook, John C; Lydic, Todd A; Mulks, Martha H; Hammer, Neal D
2018-03-26
Methicillin-resistant Staphylococcus aureus (MRSA) is a threat to global health. Consequently, much effort has focused on the development of new antimicrobials that target novel aspects of S. aureus physiology. Fatty acids are required to maintain cell viability, and bacteria synthesize fatty acids using the type II fatty acid synthesis pathway (FASII). FASII is significantly different from human fatty acid synthesis, underscoring the therapeutic potential of inhibiting this pathway. However, many Gram-positive pathogens incorporate exogenous fatty acids, bypassing FASII inhibition and leaving the clinical potential of FASII inhibitors uncertain. Importantly, the source(s) of fatty acids available to pathogens within the host environment remains unclear. Fatty acids are transported throughout the body by lipoprotein particles in the form of triglycerides and esterified cholesterol. Thus, lipoproteins, such as low-density lipoprotein (LDL) represent a potentially rich source of exogenous fatty acids for S. aureus during infection. We sought to test the ability of LDLs to serve as a fatty acid source for S. aureus and show that cells cultured in the presence of human LDLs demonstrate increased tolerance to the FASII inhibitor, triclosan. Using mass spectrometry, we observed that host-derived fatty acids present in the LDLs are incorporated into the staphylococcal membrane and that tolerance to triclosan is facilitated by the fatty acid kinase A, FakA, and Geh, a triacylglycerol lipase. Finally, we demonstrate that human LDLs support the growth of S. aureus fatty acid auxotrophs. Together, these results suggest that human lipoprotein particles are a viable source of exogenous fatty acids for S. aureus during infection. IMPORTANCE Inhibition of bacterial fatty acid synthesis is a promising approach to combating infections caused by S. aureus and other human pathogens. However, S. aureus incorporates exogenous fatty acids into its phospholipid bilayer. Therefore, the
De novo biosynthesis of trans-cinnamic acid derivatives in Saccharomyces cerevisiae.
Gottardi, Manuela; Knudsen, Jan Dines; Prado, Lydie; Oreb, Mislav; Branduardi, Paola; Boles, Eckhard
2017-06-01
The production of natural aroma compounds is an expanding field within the branch of white biotechnology. Three aromatic compounds of interest are cinnamaldehyde, the typical cinnamon aroma that has applications in agriculture and medical sciences, as well as cinnamyl alcohol and hydrocinnamyl alcohol, which have applications in the cosmetic industry. Current production methods, which rely on extraction from plant materials or chemical synthesis, are associated with drawbacks regarding scalability, production time, and environmental impact. These considerations make the development of a sustainable microbial-based production highly desirable. Through steps of rational metabolic engineering, we engineered the yeast Saccharomyces cerevisiae as a microbial host to produce trans-cinnamic acid derivatives cinnamaldehyde, cinnamyl alcohol, and hydrocinnamyl alcohol, from externally added trans-cinnamic acid or de novo from glucose as a carbon source. We show that the desired products can be de novo synthesized in S. cerevisiae via the heterologous overexpression of the genes encoding phenylalanine ammonia lyase 2 from Arabidopsis thaliana (AtPAL2), aryl carboxylic acid reductase (acar) from Nocardia sp., and phosphopantetheinyl transferase (entD) from Escherichia coli, together with endogenous alcohol dehydrogenases. This study provides a proof of concept and a strain that can be further optimized for production of high-value aromatic compounds.
Májer, Ferenc; Salomon, Johanna J; Sharma, Ruchika; Etzbach, Simona V; Najib, Mohd Nadzri Mohd; Keaveny, Ray; Long, Aideen; Wang, Jun; Ehrhardt, Carsten; Gilmer, John F
2012-03-01
Deoxycholic acid (DCA), a secondary bile acid (BA), and ursodeoxycholic acid (UDCA), a tertiary BA, cause opposing effects in vivo and in cell suspensions. Fluorescent analogues of DCA and UDCA could help investigate important questions about their cellular interactions and distribution. We have prepared a set of isomeric 3α- and 3β-amino analogues of UDCA and DCA and derivatised these with the discrete fluorophore, 4-nitrobenzo-2-oxa-1,3-diazol (NBD), forming the corresponding four fluorescent adducts. These absorb in the range 465-470 nm and fluoresce at approx. 535 nm. In order to determine the ability of the new fluorescent bile acids to mimic the parents, their uptake was studied using monolayers of Caco-2 cells, which are known to express multiple proteins of the organic anion-transporting peptide (OATP) subfamily of transporters. Cellular uptake was monitored over time at 4 and 37°C to distinguish between passive and active transport. All four BA analogues were taken up but in a strikingly stereo- and structure-specific manner, suggesting highly discriminatory interactions with transporter protein(s). The α-analogues of DCA and to a lesser extent UDCA were actively transported, whereas the β-analogues were not. The active transport process was saturable, with Michaelis-Menten constants for 3α-NBD DCA (5) being K(m)=42.27±12.98 μM and V(max)=2.8 ± 0.4 nmol/(mg protein*min) and for 3α-NBD UDCA (3) K(m)=28.20 ± 7.45 μM and V(max)=1.8 ± 0.2 nmol/(mg protein*min). These fluorescent bile acids are promising agents for investigating questions of bile acid biology and for detection of bile acids and related organic anion transport processes. Copyright © 2012 Elsevier Ltd. All rights reserved.
USDA-ARS?s Scientific Manuscript database
A blueberry (BB) supplemented diet previously has been shown to significantly stimulate bone formation in rapidly growing male and female rodents. Phenolic acids (PAs) are metabolites derived from polyphenols found in fruits and vegetables as a result of the actions of gut bacteria, and they were fo...
El-Shattory, Y; Abo-Elwafa, Ghada A; Aly, Saadia M; Nashy, El-Shahat H A
2012-01-01
Natural fatty derivatives (oleochemicals) have been used as intermediate materials in several industries replacing the harmful and expensive petrochemicals. Fatty ethoxylates are one of these natural fatty derivatives. In the present work Jatropha fatty acids were derived from the non edible Jatropha oil and used as the fat source precursor. The ethoxylation process was carried out on the derived fatty acids using a conventional cheap catalyst (K₂CO₃) in order to obtain economically and naturally valuable non-ionic surfactants. Ethoxylation reaction was proceeded using ethylene oxide gas in the presence of 1 or 2% K₂CO₃ catalyst at 120 and 145°C for 5, 8 and 12 hours. The prepared products were evaluated for their chemical and physical properties as well as its application as non- ionic fat-liquoring agents in leather industry. The obtained results showed that the number of ethylene oxide groups introduced in the fatty acids as well as their EO% increased as the temperature and time of the reaction increased. The highest ethoxylation number was obtained at 145°C for 8 hr. Also, the prepared ethoxylated products were found to be effective fat-liquors with high HLB values giving stable oil in water emulsions. The fat-liquored leather led to an improvement in its mechanical properties such as tensile strength and elongation at break. In addition, a significant enhancement in the texture of the treated leather by the prepared fat-liquors as indicated from the scanning electron microscope (SEM) images was observed.
Tuning the giant magnetoelastic transition in Ba3BiIr2O9 and Ba3BiRu2O9
NASA Astrophysics Data System (ADS)
Huang, Zixin; Avdeev, Maxim; Kennedy, Brendan J.; Knight, Kevin S.; Zhou, Qingdi; Ling, Chris D.
2014-07-01
We have experimentally investigated the effects of pressure on the magnetoelastic transitions associated with the opening of spin-gaps in Ba3BiIr2O9 and Ba3BiRu2O9. For both compounds, reducing the unit cell volume by either external physical and internal chemical pressure was found to reduce the temperature T* of the transition and, to a lesser extent, the magnitude of the associated negative thermal volume expansion. The results yield the latent heat associated with the transitions, -3.34(3) × 102 J mol-1 for Ba3BiIr2O9 and -7.1(5) × 102 J mol-1 for Ba3BiRu2O9. The transition in Ba3BiRu2O9 is significantly more robust than in Ba3BiIr2O9, requiring an order of magnitude higher pressures to achieve the same reduction in T*. The differing responses of the two compounds points to differences between the 4d and 5d metals and hence to the importance of spin-orbit coupling, which is expected to be much stronger in the Ir compound.
Effects of Boric Acid on Fracture Healing: An Experimental Study.
Gölge, Umut Hatay; Kaymaz, Burak; Arpaci, Rabia; Kömürcü, Erkam; Göksel, Ferdi; Güven, Mustafa; Güzel, Yunus; Cevizci, Sibel
2015-10-01
Boric acid (BA) has positive effects on bone tissue. In this study, the effects of BA on fracture healing were evaluated in an animal model. Standard closed femoral shaft fractures were created in 40 male Sprague-Dawley rats under general anesthesia. The rats were allocated into five groups (n = 8 each): group 1, control with no BA; groups 2 and 3, oral BA at doses of 4 and 8 mg/kg/day, respectively; group 4, local BA (8 mg/kg); and group 5, both oral and local BA (8 mg/kg/day orally and 8 mg/kg locally). After closed fracture creation, the fracture line was opened with a mini-incision, and BA was locally administered to the fracture area in groups 4 and 5. In groups 2, 3, and 5, BA was administered by gastric gavage daily until sacrifice. The rats were evaluated by clinical, radiological, and histological examinations. The control group (group 1) significantly differed from the local BA-exposed groups (groups 4 and 5) in the clinical evaluation. Front-rear and lateral radiographs revealed significant differences between the local BA-exposed groups and the control and other groups (p < 0.05). Clinical and radiological evaluations demonstrated adequate agreement between observers. The average histological scores significantly differed across groups (p = 0.007) and were significantly higher in groups 4 and 5 which were the local BA (8 mg/kg) and both oral and local BA (8 mg/kg/day orally and 8 mg/kg locally), respectively, compared to the controls. This study suggests that BA may be useful in fracture healing. Further research is required to demonstrate the most effective local dosage and possible use of BA-coated implants.